ISS Expeditions 16 through 20: Chemical Analysis Results for Potable Water

Science.gov (United States)

Straub, John E., II; Plumlee, Debrah K.; Schultz, John R.

2010-01-01

During the 2-year span from Expedition 16 through Expedition 20, the chemical quality of the potable water onboard the International Space Station (ISS) was verified safe for crew consumption through the return and chemical analysis of archival water samples by the Water and Food Analytical Laboratory (WAFAL) at Johnson Space Center (JSC). Reclaimed cabin humidity condensate and Russian ground-supplied water were the principal sources of potable water for Expeditions 16 through 18. During Expedition 18 the U.S. water processor assembly was delivered, installed, and tested during a 90-day checkout period. Beginning with Expedition 19, U.S. potable water recovered from a combined waste stream of humidity condensate and pretreated urine was also available for ISS crew use. A total of 74 potable water samples were collected using U.S. sampling hardware during Expeditions 16 through 20 and returned on both Shuttle and Soyuz vehicles. The results of JSC chemical analyses of these ISS potable water samples are presented in this paper. Eight potable water samples collected in flight with Russian hardware were also received for analysis, as well as 5 preflight samples of Rodnik potable water delivered to ISS on Russian Progress vehicles 28 to 34. Analytical results for these additional potable water samples are also reported and discussed.

ISS Potable Water Quality for Expeditions 26 through 30

Science.gov (United States)

Straub, John E., II; Plumlee, Debrah K.; Schultz, John R.; McCoy, J. Torin

2012-01-01

International Space Station (ISS) Expeditions 26-30 spanned a 16-month period beginning in November of 2010 wherein the final 3 flights of the Space Shuttle program finished ISS construction and delivered supplies to support the post-shuttle era of station operations. Expedition crews relied on several sources of potable water during this period, including water recovered from urine distillate and humidity condensate by the U.S. water processor, water regenerated from humidity condensate by the Russian water recovery system, and Russian ground-supplied potable water. Potable water samples collected during Expeditions 26-30 were returned on Shuttle flights STS-133 (ULF5), STS-134 (ULF6), and STS-135 (ULF7), as well as Soyuz flights 24-27. The chemical quality of the ISS potable water supplies continued to be verified by the Johnson Space Center s Water and Food Analytical Laboratory (WAFAL) via analyses of returned water samples. This paper presents the chemical analysis results for water samples returned from Expeditions 26-30 and discusses their compliance with ISS potable water standards. The presence or absence of dimethylsilanediol (DMSD) is specifically addressed, since DMSD was identified as the primary cause of the temporary rise and fall in total organic carbon of the U.S. product water that occurred in the summer of 2010.

Trihalomethanes in potable water

International Nuclear Information System (INIS)

Ahmad, M.; Bajahalan, A.S.

2005-01-01

These experiments were conducted to evaluate the quality of potable water in Yanbu AI-Sinaiyah, one of the leading industrial city in the Kingdom of Saudi Arabia. The major source of water is Redsea. Desalinated water is distributed in the whole city for domestic uses. At the treatment plant chlorine is being used as disinfectant in pre and post desalination. The present study was conducted to determine the presence of disinfection by-products in potable water. Trihalomethanes are the major disinfection by-products found in the chlorinated water. Trihalomethanes identified in these experiments are chloroform, dichlorobromomethane, dibromochloromethane and tribromomethane. Thichloromethanes are considered to be carcinogenic, hence it is very important to investigate the presence of these compounds in potable water. Samples were collected from consumers tap and preserved at the site for analysis. In the laboratory samples were extracted by Tekmar Velocity XPT purge and trap unit. High purity nitrogen was purged through a sparger in the samples and purged volatiles were trapped in a carbo trap at room temperature. Then trapped components were desorbed with high purity helium and transferred to gas chromatograph injector and analysed by Varian Saturn 2200 GC-MS using 30 m long factor four capillary column. The effect of temperature and seasonal variation (winter and summer) was also monitored. Mean trihalomethane level was higher in summer (8.617 micro g/L) than in winter (5.173 micro g/L). Mean concentration of all the four THMs was 6.9 micro g/L, much less than prescribed EPA limits (80 micro g/L). About 13 brands of bottled water were also analysed for THMs. Only tribromomethane and dibromochloromethane were detected in few brands. Experiments were also conducted to remove THMs from chlorinated water and found that passing through activated charcoal and boiling the water for couple of minutes were sufficient to remove all the THMs from chlorinated water. (author)

Legionella pneumophila: From potable water to treated greywater; quantification and removal during treatment.

Science.gov (United States)

Blanky, Marina; Rodríguez-Martínez, Sara; Halpern, Malka; Friedler, Eran

2015-11-15

Greywater is an alternative water source that can help alleviate stress on depleted water resources. The main options for greywater reuse are toilet flushing and garden irrigation, both producing aerosols. For that reason transmission of inhalable pathogens like Legionella present a potential risk. To improve the understanding about Legionella in greywater, we traced the pathogen seasonally from the potable water system to the final steps of the greywater treatment in four houses in northern Israel. Physicochemical and microbiological parameters were analyzed in order to assess background greywater quality and to establish possible associations with Legionella. The mean concentrations of Legionella pneumophila isolated from the potable water system were 6.4×10(2) and 5.9×10(3) cfu/l in cold and hot water respectively. By amending the ISO protocol for Legionella isolation from drinking water, we succeeded in quantifying Legionella in greywater. The mean Legionella concentrations that were found in raw, treated and treated chlorinated greywater were 1.2×10(5), 2.4×10(4) and 5.7×10(3) cfu/l respectively. While Legionella counts in potable water presented a seasonal pattern with high concentrations in summer, its counts in greywater presented an almost inversed pattern. Greywater treatment resulted in 95% decrease in Legionella counts. No significant difference was found between Legionella concentrations in potable water and the treated chlorinated greywater. These findings indicate that regarding Legionella, reusing treated chlorinated greywater would exhibit a risk that is very similar to the risk associated with using potable water for the same non-potable uses. Copyright © 2015 Elsevier B.V. All rights reserved.

Field-analysis of potable water quality and ozone efficiency in ozone-assisted biological filtration systems for surface water treatment.

Science.gov (United States)

Zanacic, Enisa; Stavrinides, John; McMartin, Dena W

2016-11-01

Potable water treatment in small communities is challenging due to a complexity of factors starting with generally poor raw water sources, a smaller tax and consumption base that limit capital and operating funds, and culminating in what is typically a less sophisticated and robust water treatment plant for production and delivery of safe, high quality potable water. The design and optimization of modular ozone-assisted biological filtration systems can address some of these challenges. In surface water treatment, the removal of organic matter (e.g., dissolved organic carbon - DOC), inorganic nutrients and other exposure-related contaminants (e.g., turbidity and dissolved solids) from the raw water source is essential. Thus, a combination of chemical and biological oxidation processes can produce an effective and efficient water treatment plant design that is also affordable and robust. To that end, the ozone-assisted biological filtration water treatment plants in two communities were evaluated to determine the efficacy of oxidation and contaminant removal processes. The results of testing for in-field system performance indicate that plant performance is particularly negatively impacted by high alkalinity, high organics loading, and turbidity. Both bicarbonate and carbonate alkalinity were observed to impede ozone contact and interaction with DOC, resulting in lower than anticipated DOC oxidation efficiency and bioavailability. The ozone dosage at both water treatment plants must be calculated on a more routine basis to better reflect both the raw water DOC concentration and presence of alkalinities to ensure maximized organics oxidation and minimization of trihalomethanes production. Copyright © 2016 The Authors. Published by Elsevier Ltd.. All rights reserved.

Governing Non-Potable Water-Reuse to Alleviate Water Stress: The Case of Sabadell, Spain

Directory of Open Access Journals (Sweden)

Marketa Šteflová

2018-06-01

Full Text Available The world will experience an estimated 40% freshwater supply shortage by 2030, converting water scarcity into one of the principal global challenges that modern society faces. Urban water reuse is recognized as a promising and necessary measure to alleviate the growing water stress in many regions. The transformation to widespread application of water-reuse systems requires major changes in the way water is governed, and countries such as Spain already find themselves involved in this process. Through the systematic assessment of the city of Sabadell (Spain, we aim to identify the main barriers, opportunities and transferable lessons that can enhance governance capacity to implement systems for non-potable reuse of treated wastewater in cities. It was found that continuous learning, the availability and quality of information, the level of knowledge, and strong agents of change are the main capacity-building priorities. On the other hand, awareness, multilevel network potential and implementing capacity are already well-established. It is concluded that in order to undertake a widespread application of water-reuse practices, criteria examining water quality according to its use need to be developed independently of the water’s origin. The development and implementation of such a legislative frame should be based on the experience of local water-reuse practices and continuous evaluation. Finally, the need for public engagement and adequate pricing mechanisms are emphasized.

Ultraviolet disinfection of potable water

Energy Technology Data Exchange (ETDEWEB)

Wolfe, R. L. [Metropolitan Water District of Southern California, Los Angeles, CA (United States)

1990-06-15

Because of upcoming surface and groundwater regulations regarding the control of microbiological and chemical contaminants, there is a need to evaluate the feasibility and effectiveness of ultraviolet (UV) radiation for primary disinfection of potable water supplies. Data is presented on microbicidal wavelengths of UV and distribution of energy output for low and medium-pressure arc lamps. Both systems were found to perform equally well for inactivating microorganisms, but each had distinct advantages in different applications. Approximate dosages for 90% inactivation of selected microorganisms by UV is presented in a table. Cost analysis for disinfection is presented in two tables as well as the advantages and disadvantages of UV disinfection.

Ultraviolet disinfection of potable water

International Nuclear Information System (INIS)

Wolfe, R.L.

1990-01-01

Because of upcoming surface and groundwater regulations regarding the control of microbiological and chemical contaminants, there is a need to evaluate the feasibility and effectiveness of ultraviolet (UV) radiation for primary disinfection of potable water supplies. Data is presented on microbicidal wavelengths of UV and distribution of energy output for low and medium-pressure arc lamps. Both systems were found to perform equally well for inactivating microorganisms, but each had distinct advantages in different applications. Approximate dosages for 90% inactivation of selected microorganisms by UV is presented in a table. Cost analysis for disinfection is presented in two tables as well as the advantages and disadvantages of UV disinfection

Beyond User Acceptance: A Legitimacy Framework for Potable Water Reuse in California.

Science.gov (United States)

Harris-Lovett, Sasha R; Binz, Christian; Sedlak, David L; Kiparsky, Michael; Truffer, Bernhard

2015-07-07

Water resource managers often tout the potential of potable water reuse to provide a reliable, local source of drinking water in water-scarce regions. Despite data documenting the ability of advanced treatment technologies to treat municipal wastewater effluent to meet existing drinking water quality standards, many utilities face skepticism from the public about potable water reuse. Prior research on this topic has mainly focused on marketing strategies for garnering public acceptance of the process. This study takes a broader perspective on the adoption of potable water reuse based on concepts of societal legitimacy, which is the generalized perception or assumption that a technology is desirable or appropriate within its social context. To assess why some potable reuse projects were successfully implemented while others faced fierce public opposition, we performed a series of 20 expert interviews and reviewed in-depth case studies from potable reuse projects in California. Results show that proponents of a legitimated potable water reuse project in Orange County, California engaged in a portfolio of strategies that addressed three main dimensions of legitimacy. In contrast, other proposed projects that faced extensive public opposition relied on a smaller set of legitimation strategies that focused near-exclusively on the development of robust water treatment technology. Widespread legitimation of potable water reuse projects, including direct potable water reuse, may require the establishment of a portfolio of standards, procedures, and possibly new institutions.

Disinfection of Spacecraft Potable Water Systems by Passivation with Ionic Silver

Science.gov (United States)

Birmele, Michele N.; McCoy, LaShelle e.; Roberts, Michael S.

2011-01-01

Microbial growth is common on wetted surfaces in spacecraft environmental control and life support systems despite the use of chemical and physical disinfection methods. Advanced control technologies are needed to limit microorganisms and increase the reliability of life support systems required for long-duration human missions. Silver ions and compounds are widely used as antimicrobial agents for medical applications and continue to be used as a residual biocide in some spacecraft water systems. The National Aeronautics and Space Administration (NASA) has identified silver fluoride for use in the potable water system on the next generation spacecraft. Due to ionic interactions between silver fluoride in solution and wetted metallic surfaces, ionic silver is rapidly depleted from solution and loses its antimicrobial efficacy over time. This report describes research to prolong the antimicrobial efficacy of ionic silver by maintaining its solubility. Three types of metal coupons (lnconel 718, Stainless Steel 316, and Titanium 6AI-4V) used in spacecraft potable water systems were exposed to either a continuous flow of water amended with 0.4 mg/L ionic silver fluoride or to a static, pre-treatment passivation in 50 mg/L ionic silver fluoride with or without a surface oxidation pre-treatment. Coupons were then challenged in a high-shear, CDC bioreactor (BioSurface Technologies) by exposure to six bacteria previously isolated from spacecraft potable water systems. Continuous exposure to 0.4 mg/L ionic silver over the course of 24 hours during the flow phase resulted in a >7-log reduction. The residual effect of a 24-hour passivation treatment in 50 mg/L of ionic silver resulted in a >3-log reduction, whereas a two-week treatment resulted in a >4-log reduction. Results indicate that 0.4 mg/L ionic silver is an effective biocide against many bacteria and that a prepassivation of metal surfaces with silver can provide additional microbial control.

Prototype solar heating and cooling systems including potable hot water

Science.gov (United States)

1978-01-01

Progress is reviewed in the development, delivery, and support of two prototype solar heating and cooling systems including potable hot water. The system consisted of the following subsystems: collector, auxiliary heating, potable hot water, storage, control, transport, and government-furnished site data acquisition.

[Incidence of non-communicable diseases and health risks due to potable water quality].

Science.gov (United States)

Skudarnov, S E; Kurkatov, S V

2011-01-01

Iron and fluorine concentrations and water mineralization and hardness, which exceeded the maximum allowable concentrations, were found to cause an increase in overall morbidity and morbidity from skeletal-and-muscular, urogenital, and digestive system involvement in the population of the Krasnoyarsk Region. A quantitative relationship were found between the concentrations of iron, the hardness and dry residue of water and the incidence rates of urogenital, skeletal-and-muscular and digestive diseases. The consumption of potable water contaminated with chloroform and methane tetrachloride presents unacceptable carcinogenic risks to the population of the Krasnoyarsk Region.

Quality characteristics of potable water from different sources of district Bannu (Pakistan) and their possible health impacts

International Nuclear Information System (INIS)

Khan, A.R.; Hussain, F.; Khan, M.; Riaz, M.; Hussain, F.

1999-01-01

The quality of potable water samples collected from 8 tube wells, 8 hand pumps, 15 wells and 4 surface water sources in Bannu District were investigated and compared with international standards. It was observed that water form with and hand pumps seemed to be more polluted than those from other sources due to high nitrite levels. Similarly the oxygen demanding content was higher in 88% hand pumps, 60% wells and 25% surface water, whereas the magnesium level was higher in almost all the samples. The synergetic effect of magnesium and sulphate concentrations has suggested that all hand pumps. 73% well water and the stream water were unfit for drinking due to their laxative nature. It concludes that all hand pump water and 73% of all well water were not potable. The stream water was found to be laxative in nature due to higher concentration of both magnesium and sulphate. Na/sup +/, K/sup +/ and chloride concentrations in all the samples were found to be within the permissible limits. The tube well water appeared to be comparatively safer, compared to other sources, due to lower COD and NO/sub 2//sup -/ concentrations. Due to the presence of NO/sub 2//sup -/, 88% samples of well waters, 50% surface waters, 38% hand pump waters and only 13% tube well water were not potable. Overall, the water of Bannu District has been found to be unsuitable for drinking purposes and are considered to be harmful to humans which may adversely affect the overall health of the people on prolonged usage of these substandard waters. (author)

Selective intake of down-pit water and separating potable water from water-bearing seams at the Rydultowy mine

Energy Technology Data Exchange (ETDEWEB)

Musiolik, H; Sikora, A; Murek, R

1987-06-01

Discusses problems of pit water selection. Describes the method of water intake, down-pit transport, pumping the separated potable water and its treatment at the Rydultowy mine. Stresses the usefulness of pit water selection in view of the existing shortage of potable water. Geologic and mining conditions at the mine are described along with the amount of water influx into the mine. Advantages arising from mine water utilization are outlined.

Mycobacterium avium complex--the role of potable water in disease transmission.

Science.gov (United States)

Whiley, H; Keegan, A; Giglio, S; Bentham, R

2012-08-01

Mycobacterium avium complex (MAC) is a group of opportunistic pathogens of major public health concern. It is responsible for a wide spectrum of disease dependent on subspecies, route of infection and patients pre-existing conditions. Presently, there is limited research on the incidence of MAC infection that considers both pulmonary and other clinical manifestations. MAC has been isolated from various terrestrial and aquatic environments including natural waters, engineered water systems and soils. Identifying the specific environmental sources responsible for human infection is essential in minimizing disease prevalence. This paper reviews current literature and case studies regarding the wide spectrum of disease caused by MAC and the role of potable water in disease transmission. Potable water was recognized as a putative pathway for MAC infection. Contaminated potable water sources associated with human infection included warm water distribution systems, showers, faucets, household drinking water, swimming pools and hot tub spas. MAC can maintain long-term contamination of potable water sources through its high resistance to disinfectants, association with biofilms and intracellular parasitism of free-living protozoa. Further research is required to investigate the efficiency of water treatment processes against MAC and into construction and maintenance of warm water distribution systems and the role they play in MAC proliferation. No claim to Australian Government works Journal of Applied Microbiology © 2012 The Society for Applied Microbiology.

Indirect Potable Reuse: A Sustainable Water Supply Alternative

Directory of Open Access Journals (Sweden)

Clemencia Rodriguez

2009-03-01

Full Text Available The growing scarcity of potable water supplies is among the most important issues facing many cities, in particular those using single sources of water that are climate dependent. Consequently, urban centers are looking to alternative sources of water supply that can supplement variable rainfall and meet the demands of population growth. A diversified portfolio of water sources is required to ensure public health, as well as social, economical and environmental sustainability. One of the options considered is the augmentation of drinking water supplies with advanced treated recycled water. This paper aims to provide a state of the art review of water recycling for drinking purposes with emphasis on membrane treatment processes. An overview of significant indirect potable reuse projects is presented followed by a description of the epidemiological and toxicological studies evaluating any potential human health impacts. Finally, a summary of key operational measures to protect human health and the areas that require further research are discussed.

Indirect Potable Reuse: A Sustainable Water Supply Alternative

Science.gov (United States)

Rodriguez, Clemencia; Van Buynder, Paul; Lugg, Richard; Blair, Palenque; Devine, Brian; Cook, Angus; Weinstein, Philip

2009-01-01

The growing scarcity of potable water supplies is among the most important issues facing many cities, in particular those using single sources of water that are climate dependent. Consequently, urban centers are looking to alternative sources of water supply that can supplement variable rainfall and meet the demands of population growth. A diversified portfolio of water sources is required to ensure public health, as well as social, economical and environmental sustainability. One of the options considered is the augmentation of drinking water supplies with advanced treated recycled water. This paper aims to provide a state of the art review of water recycling for drinking purposes with emphasis on membrane treatment processes. An overview of significant indirect potable reuse projects is presented followed by a description of the epidemiological and toxicological studies evaluating any potential human health impacts. Finally, a summary of key operational measures to protect human health and the areas that require further research are discussed. PMID:19440440

Potable water as a source of airborne 222Rn in US dwellings: a review and assessment

International Nuclear Information System (INIS)

Nazaroff, W.W.; Doyle, S.M.; Nero, A.V.; Sextro, R.G.

1987-01-01

Using a long-term-average, single-cell model and available data for U.S. housing, the concentration of 222 Rn in indoor air due to the use of potable water is assessed. The ratio of the airborne 222 Rn concentration to the concentration in water is represented by a lognormal distribution with geometric mean and geometric standard deviation of 0.65 X 10(-4) and 2.88, respectively, in fair agreement with the previously reported results of direct measurements of the ratio in 13 houses. By combining this result with data on 222 Rn concentrations in U.S. water supplies, potable water is estimated to contribute an average of 24, 1.3, and 0.1 Bq m-3 to the airborne 222 Rn concentration in residences served by private wells, public ground water, and surface water supplies, respectively

Sensitivity of Hollow Fiber Spacesuit Water Membrane Evaporator Systems to Potable Water Constituents, Contaminants and Air Bubbles

Science.gov (United States)

Bue, Grant C.; Trevino, Luis A.; Fritts, Sharon; Tsioulos, Gus

2008-01-01

The Spacesuit Water Membrane Evaporator (SWME) is the baseline heat rejection technology selected for development for the Constellation lunar suit. The first SWME prototype, designed, built, and tested at Johnson Space Center in 1999 used a Teflon hydrophobic porous membrane sheet shaped into an annulus to provide cooling to the coolant loop through water evaporation to the vacuum of space. This present study describes the test methodology and planning and compares the test performance of three commercially available hollow fiber materials as alternatives to the sheet membrane prototype for SWME, in particular, a porous hydrophobic polypropylene, and two variants that employ ion exchange through non-porous hydrophilic modified Nafion. Contamination tests will be performed to probe for sensitivities of the candidate SWME elements to ordinary constituents that are expected to be found in the potable water provided by the vehicle, the target feedwater source. Some of the impurities in potable water are volatile, such as the organics, while others, such as the metals and inorganic ions are nonvolatile. The non-volatile constituents will concentrate in the SWME as evaporated water from the loop is replaced by the feedwater. At some point in the SWME mission lifecycle as the concentrations of the non-volatiles increase, the solubility limits of one or more of the constituents may be reached. The resulting presence of precipitate in the coolant water may begin to plug pores and tube channels and affect the SWME performance. Sensitivity to macroparticles, lunar dust simulant, and air bubbles will also be investigated.

Cross-connection control of the potable water lines at Oak Ridge National Laboratory

Energy Technology Data Exchange (ETDEWEB)

Moore, R.M.

1996-04-01

A 1991 independent U.S. Department of Energy (DOE) audit of Oak Ridge National Laboratory (ORNL) identified the need for establishing a cross-connection control program for the potable and nonpotable water systems at the facility. An informal cross-connection policy had been in place for some time, but the formal implementation of a cross-connection program brought together individuals from the Quality Engineering and Inspection Section of the Office of Quality Programs and Inspection, Industrial Hygiene, Health Physics, Plant and Equipment Division, and the Atomic Trade and Labor Council. In January 1994 a Cross-Connection Control Committee was established at ORNL to identify potential and actual cross connections between potable and nonpotable water systems. Potable water is safe to drink, and nonpotable or process water (e.g., sewage, laboratory wastewater, cooling water, and tower water) is not intended for human consumption, washing of the body, or food preparation. The program is intended to conform with the Federal Safe Drinking Water Act Amendment of 1986 and with state and local regulations. Although the Occupational Safety and Health Administration addresses cross-connection functions, it does not define specific program requirements. The program at ORNL is designed to ensure that necessary recommendations are implemented to safeguard all internal and external potable water distribution lines. Program responsibilities include a thorough engineering assessment to (1) identify the potable water lines, (2) identify any existing or potential cross connections, and (3) inspect the integrity of the water lines. If any cross-connection deficiencies are found, corrective actions are initiated according to industry standards.

Detection of Cyanotoxins During Potable Water Treatment

Science.gov (United States)

In 2007, the U.S. EPA listed three cyanobacterial toxins on the CCL3 containment priority list for potable drinking waters. This paper describes all methodologies used for detection of these toxins, and assesses each on a cost/benefit basis. Methodologies for microcystin, cylindrospermopsin, and a...

Nanotechnology for potable water and general consumption in developing countries

CSIR Research Space (South Africa)

Hillie, T

2012-08-01

Full Text Available that affect people in developing and developed countries. The challenges outlined are; poor governance, water scarcity, sanitation and climate change. Nanotechnology is sufficiently advanced to help provide potable water and water for general assumption...

42 CFR 71.45 - Food, potable water, and waste: U.S. seaports and airports.

Science.gov (United States)

2010-10-01

... 42 Public Health 1 2010-10-01 2010-10-01 false Food, potable water, and waste: U.S. seaports and... Inspection § 71.45 Food, potable water, and waste: U.S. seaports and airports. (a) Every seaport and airport..., or waste water or other polluting materials. Arriving aircraft shall discharge such matter only at...

Reclamation of grey water for non-potable purposes using pilot-scale solar photocatalytic tubular reactors.

Science.gov (United States)

Saran, Sarangapany; Arunkumar, Patchaiyappan; Manjari, Gangarapu; Devipriya, Suja P

2018-05-05

Application of pilot-scale slurry-type tubular photocatalytic reactor was tested for the decentralized treatment of actual grey water. The reactors were fabricated by reusing the locally available materials at low cost, operated in batch recycle mode with 25 L of grey water. The influence of operational parameters such as catalysts' concentration, initial slurry pH and addition of H 2 O 2 on COD abatement were optimized. The results show that Ag-decorated TiO 2 showed a two-fold increase in COD abatement than did pure TiO 2 . Better COD abatement was observed under acidic conditions, and addition of H 2 O 2 significantly increases the rate of COD abatement. Within 2 h, 99% COD abatement was observed when the reactor was operated with optimum operational conditions. Silver ion lixiviate was also monitored during the experiment and is five times less than the permissible limits. The catalyst shows good stability even after five cycles without much loss in its photocatalytic activity. The results clearly reveal that pilot-scale slurry tubular solar photocatalytic reactors could be used as a cost-effective method to treat grey water and the resulting clean water could be reused for various non-potable purposes, thus conserving precious water resource. This study favours decentralized grey water treatment and possible scaling up of solar photocatalytic reactor using locally available materials for the potential reuse of treated water.

Uncertainty analysis of daily potable water demand on the performance evaluation of rainwater harvesting systems in residential buildings.

Science.gov (United States)

Silva, Arthur Santos; Ghisi, Enedir

2016-09-15

The objective of this paper is to perform a sensitivity analysis of design variables and an uncertainty analysis of daily potable water demand to evaluate the performance of rainwater harvesting systems in residential buildings. Eight cities in Brazil with different rainfall patterns were analysed. A numeric experiment was performed by means of computer simulation of rainwater harvesting. A sensitivity analysis was performed using variance-based indices for identifying the most important design parameters for rainwater harvesting systems when assessing the potential for potable water savings and underground tank capacity sizing. The uncertainty analysis was performed for different scenarios of potable water demand with stochastic variations in a normal distribution with different coefficients of variation throughout the simulated period. The results have shown that different design variables, such as potable water demand, number of occupants, rainwater demand, and roof area are important for obtaining the ideal underground tank capacity and estimating the potential for potable water savings. The stochastic variations on the potable water demand caused amplitudes of up to 4.8% on the potential for potable water savings and 9.4% on the ideal underground tank capacity. Average amplitudes were quite low for all cities. However, some combinations of parameters resulted in large amplitude of uncertainty and difference from uniform distribution for tank capacities and potential for potable water savings. Stochastic potable water demand generated low uncertainties in the performance evaluation of rainwater harvesting systems; therefore, uniform distribution could be used in computer simulation. Copyright © 2016 Elsevier Ltd. All rights reserved.

Waste Feed Delivery Raw Water and Potable Water and Compressed Air Capacity Evaluation

International Nuclear Information System (INIS)

MAY, T.H.

2000-01-01

This study evaluated the ability of the Raw Water, Potable Water, and Compressed Air systems to support safe storage as well as the first phase of the Waste Feed Delivery. Several recommendations are made to improve the system

Experimental Study on the Palatability Impacts of Potable Water as a Hydronic Medium

Directory of Open Access Journals (Sweden)

Robert Prybysh

2018-02-01

Full Text Available Hydronic systems installed in buildings utilize water to transport thermal energy within the building for heating and cooling purposes. These systems can be closed loop, where the water is chemically treated and circulated indefinitely, or they can be open loop, where the water is not treated and is effluxed as a result of occupant activities, such as bathing or cooking. Water in an open loop system may circulate within the system for a limited time before it is extracted from the system by occupant activities and replaced with new water from the local water supply. The implementation of open loop hydronic systems is becoming more common in multi-unit residential buildings, even though a number of questions regarding the use of such systems remain unanswered. One concern regarding the use of circulated potable water for heating purposes is the potential effects on the occupant perceptions of the palatability of the service water being delivered to their suites. In an open-loop HVAC system (Heating Ventilating, Air Conditioning System, heating water is subject to repeated thermal cycles and continuous recirculation, which creates the potential for chemical alterations of the materials present in the water or leaching of materials from the equipment and piping. Through the use of Flavor Profile Analysis (FPA established by the American Water Works Association, and a multi-unit HVAC system constructed in a controlled environment, the palatability effects of the operational system were evaluated for a number of scenarios. The collected feedback from the study participants was then tabulated to quantify the impacts of using potable water as a recirculating heating medium on the perceptions of the occupants. The resulting observations led us to conclude that utilizing potable water as a heating medium has a negligible effect on the palatability of water in the system for average retention times under one day, and a non-objectionable, but noticeable

Drivers of Microbial Risk for Direct Potable Reuse and de Facto Reuse Treatment Schemes: The Impacts of Source Water Quality and Blending

Science.gov (United States)

Chaudhry, Rabia M.; Hamilton, Kerry A.; Haas, Charles N.; Nelson, Kara L.

2017-01-01

Although reclaimed water for potable applications has many potential benefits, it poses concerns for chemical and microbial risks to consumers. We present a quantitative microbial risk assessment (QMRA) Monte Carlo framework to compare a de facto water reuse scenario (treated wastewater-impacted surface water) with four hypothetical Direct Potable Reuse (DPR) scenarios for Norovirus, Cryptosporidium, and Salmonella. Consumer microbial risks of surface source water quality (impacted by 0–100% treated wastewater effluent) were assessed. Additionally, we assessed risks for different blending ratios (0–100% surface water blended into advanced-treated DPR water) when source surface water consisted of 50% wastewater effluent. De facto reuse risks exceeded the yearly 10−4 infections risk benchmark while all modeled DPR risks were significantly lower. Contamination with 1% or more wastewater effluent in the source water, and blending 1% or more wastewater-impacted surface water into the advanced-treated DPR water drove the risk closer to the 10−4 benchmark. We demonstrate that de facto reuse by itself, or as an input into DPR, drives microbial risks more so than the advanced-treated DPR water. When applied using location-specific inputs, this framework can contribute to project design and public awareness campaigns to build legitimacy for DPR. PMID:28608808

Drivers of Microbial Risk for Direct Potable Reuse and de Facto Reuse Treatment Schemes: The Impacts of Source Water Quality and Blending

Directory of Open Access Journals (Sweden)

Rabia M. Chaudhry

2017-06-01

Full Text Available Although reclaimed water for potable applications has many potential benefits, it poses concerns for chemical and microbial risks to consumers. We present a quantitative microbial risk assessment (QMRA Monte Carlo framework to compare a de facto water reuse scenario (treated wastewater-impacted surface water with four hypothetical Direct Potable Reuse (DPR scenarios for Norovirus, Cryptosporidium, and Salmonella. Consumer microbial risks of surface source water quality (impacted by 0–100% treated wastewater effluent were assessed. Additionally, we assessed risks for different blending ratios (0–100% surface water blended into advanced-treated DPR water when source surface water consisted of 50% wastewater effluent. De facto reuse risks exceeded the yearly 10−4 infections risk benchmark while all modeled DPR risks were significantly lower. Contamination with 1% or more wastewater effluent in the source water, and blending 1% or more wastewater-impacted surface water into the advanced-treated DPR water drove the risk closer to the 10−4 benchmark. We demonstrate that de facto reuse by itself, or as an input into DPR, drives microbial risks more so than the advanced-treated DPR water. When applied using location-specific inputs, this framework can contribute to project design and public awareness campaigns to build legitimacy for DPR.

Drivers of Microbial Risk for Direct Potable Reuse and de Facto Reuse Treatment Schemes: The Impacts of Source Water Quality and Blending.

Science.gov (United States)

Chaudhry, Rabia M; Hamilton, Kerry A; Haas, Charles N; Nelson, Kara L

2017-06-13

Although reclaimed water for potable applications has many potential benefits, it poses concerns for chemical and microbial risks to consumers. We present a quantitative microbial risk assessment (QMRA) Monte Carlo framework to compare a de facto water reuse scenario (treated wastewater-impacted surface water) with four hypothetical Direct Potable Reuse (DPR) scenarios for Norovirus, Cryptosporidium , and Salmonella . Consumer microbial risks of surface source water quality (impacted by 0-100% treated wastewater effluent) were assessed. Additionally, we assessed risks for different blending ratios (0-100% surface water blended into advanced-treated DPR water) when source surface water consisted of 50% wastewater effluent. De facto reuse risks exceeded the yearly 10 -4 infections risk benchmark while all modeled DPR risks were significantly lower. Contamination with 1% or more wastewater effluent in the source water, and blending 1% or more wastewater-impacted surface water into the advanced-treated DPR water drove the risk closer to the 10 -4 benchmark. We demonstrate that de facto reuse by itself, or as an input into DPR, drives microbial risks more so than the advanced-treated DPR water. When applied using location-specific inputs, this framework can contribute to project design and public awareness campaigns to build legitimacy for DPR.

Feasibility study of an aeration treatment system in a raw water storage reservoir used as a potable water source

OpenAIRE

Fronk, Robert Charles

1996-01-01

The systems engineering process has been utilized to determine the feasibility of an aeration treatment system for a raw water storage reservoir used as a potable water source. This system will be used to ensure a consistently high quality of raw water by the addition of dissolved oxygen into the reservoir. A needs analysis establishes the importance and requirements for a consistently high quality of raw water used as a source for a potable water treatment facility. This s...

Conceptual design report, TWRS Privatization phase I, raw and potable water, subproject W-504

International Nuclear Information System (INIS)

Singh, G.

1997-01-01

This document includes Conceptual Design Report (CDR) for extension of existing Raw and Potable systems from 200-East Area systems to two new private contractor facilities for immobilization and disposal of low-activity waste (LAW). The work will include design and installation of almost 3400 m (11,200 ft) of raw water pipe and 2200 in (7,300 ft) of potable water pipe

Radioactivity in surface waters and its effects

International Nuclear Information System (INIS)

Stoeber, I.

1987-01-01

In consequence of the reactor accident in Chernobyl, the State Office for Water and Waste Disposal of North-Rhine Westphalia implemented immediate programmes for monitoring radioactivity in surface waters, including their sediments and organisms. Of the initially-measured radionuclides, only cesium-137, with its long half-life of 30 years, is of interest. Only trace amounts of the almost equally long-lived strontium 90 (half-life 28 years) were present in rainfall. Cs-137 is a non-natural-radionuclide, occurring solely as a by-product of nuclear installations and atomic bomb tests. Following the ban on surface testing of nuclear weapons, the Cs-137 content of surface waters had fallen significantly up to April 1986. The load due to the reactor disaster is of the same order of magnitude as that produced by atomic testing at the end of the nineteen-sixties. The paper surveys radioactive pollution of surface waters in North-Rhine Westphalia and its effects on water use, especially in regard to potable water supplies and the fish population. (orig./HSCH) [de

Radium in potable waters from Central Victoria, Australia - an application of the Australian drinking water guidelines

International Nuclear Information System (INIS)

Tinker, R.A.; Smith, J.D.

1998-01-01

Determinations of 226 Ra and 228 Ra in potable mineral waters from springs located in the Daylesford-Hepburn region of Victoria, Australia are presented. Concentrations ranged from 230-810 mBq L -1 for 226 Ra and 200-800 mBq L -1 for 226 Ra. These levels approach or exceed the guideline limits recommended in the Australian Drinking Water Guidelines. The annual committed effective dose and health risks from radium in potable water is discussed. Assuming consumption of 2 L per day the average annual committed effective dose received from 226 Ra was 0.087 mSv y -1 and from 226 Ra was 0.10 mSv y -1

Beyond User Acceptance : A Legitimacy Framework for Potable Water Reuse in California

NARCIS (Netherlands)

Harris-Lovett, S.R.; Binz, C.; Sedlak, D.L.; Kiparsky, M.; Truffer, B.

2015-01-01

Water resource managers often tout the potential of potable water reuse to provide a reliable, local source of drinking water in water-scarce regions. Despite data documenting the ability of advanced treatment technologies to treat municipal wastewater effluent to meet existing drinking water

Removal of arsenic from potable water by adsorptive media treatment techniques

International Nuclear Information System (INIS)

Yousuf, S.; Khan, S.; Aslam, M.T.; Khan, A.R.

2012-01-01

Summary: This study was conducted to investigate the arsenic removal efficiency of different adsorptive media from water. Different naturally occurring materials such as bauxite, plastic clay, plaster of Paris, lime, alum, and alumina etc. were used for the development of media to remove arsenic As/sup +5/ present in the artificially contaminated water. Different ratios of the selected materials were combined and ignited at 9000 C to enhance its arsenic removing efficiency. It was found that the media bauxite, plastic clay, lime (1:1:1) has a maximum removal (99%) of As +5 species from aqueous media and can be used on- site to reduce the arsenic contamination of potable water. Furthermore, the materials used in this experiment were cheaply and abundantly available within the country. The method is very simple and economically viable, for removal of arsenic from potable water. (author)

RARE OCCURRENCE OF HETEROTROPHIC BACTERIA WITH PATHOGENIC POTENTIAL IN POTABLE WATER

Science.gov (United States)

Since the discovery of Legionella pneumophila, an opportunistic pathogen that is indigenous to water, microbiologists have speculated that there may be other opportunistic pathogens among the numerous heterotrophic bacteria found in potable water. The USEPA developed a series of...

Experimental Study on Feasibility of Non Potable Water with Lime on Properties of Ppc

Science.gov (United States)

Reddy Babu, G.; Madhusudana Reddy, B.; Ramana, N. V.; Sudharshan Reddy, B.

2017-08-01

This research aimed to investigate feasibility of outlet water of water treatment plant and limewater on properties of Portland pozzolana cement (PPC). Twenty water treatment plants were found out in the Bhimavaram municipality region in West Godavari district, Andhra Pradesh, India. Approximately, each plant supplying potable water about 4000 to 5000 L/day. All plants are extracting ground water and treating through Reverse Osmosis (RO) process. At outlet, huge quantity of wasted water is being discharged into side drains in Bhimavaram municipality. One typical treatment plant was selected, and water at outlet was collected and Physical and chemical analysis was carried out as per producer described in APHA. The effect of plant outlet water(POW), lime water(LM), and plant outlet water with lime (POWL) on physical properties i.e., setting times, compressive strength, and flexural strength of Portland pozzolana Cement (PPC) were studied in laboratory and compared same with reference specimens i.e., made with Distilled Water (DW) as mixing water. No significant change was observed in initial and finial setting time in POW, LW, and (POWL) as compared with reference specimens made with distilled water (DW). Compressive strength was significantly increased with LW and (POWL) specimens compared to that of reference specimens. XRD technique was employed to study the mineralogical analysis.

Hospital Impact After a Chemical Spill That Compromised the Potable Water Supply: West Virginia, January 2014.

Science.gov (United States)

Hsu, Joy; Del Rosario, Maria C; Thomasson, Erica; Bixler, Danae; Haddy, Loretta; Duncan, Mary Anne

2017-10-01

In January 2014, a chemical spill of 4-methylcyclohexanemethanol and propylene glycol phenyl ethers contaminated the potable water supply of approximately 300,000 West Virginia residents. To understand the spill's impact on hospital operations, we surveyed representatives from 10 hospitals in the affected area during January 2014. We found that the spill-related loss of potable water affected many aspects of hospital patient care (eg, surgery, endoscopy, hemodialysis, and infection control of Clostridium difficile). Hospital emergency preparedness planning could be enhanced by specifying alternative sources of potable water sufficient for hemodialysis, C. difficile infection control, and hospital processing and cleaning needs (in addition to drinking water). (Disaster Med Public Health Preparedness. 2017;11:621-624).

Disinfection of Spacecraft Potable Water Systems by Photocatalytic Oxidation Using UV-A Light Emitting Diodes

Science.gov (United States)

Birmele, Michele N.; O'Neal, Jeremy A.; Roberts, Michael S.

2011-01-01

Ultraviolet (UV) light has long been used in terrestrial water treatment systems for photodisinfection and the removal of organic compounds by several processes including photoadsorption, photolysis, and photocatalytic oxidation/reduction. Despite its effectiveness for water treatment, UV has not been explored for spacecraft applications because of concerns about the safety and reliability of mercury-containing UV lamps. However, recent advances in ultraviolet light emitting diodes (UV LEDs) have enabled the utilization of nanomaterials that possess the appropriate optical properties for the manufacture of LEDs capable of producing monochromatic light at germicidal wavelengths. This report describes the testing of a commercial-off-the-shelf, high power Nichia UV-A LED (250mW A365nnJ for the excitation of titanium dioxide as a point-of-use (POD) disinfection device in a potable water system. The combination of an immobilized, high surface area photocatalyst with a UV-A LED is promising for potable water system disinfection since toxic chemicals and resupply requirements are reduced. No additional consumables like chemical biocides, absorption columns, or filters are required to disinfect and/or remove potentially toxic disinfectants from the potable water prior to use. Experiments were conducted in a static test stand consisting of a polypropylene microtiter plate containing 3mm glass balls coated with titanium dioxide. Wells filled with water were exposed to ultraviolet light from an actively-cooled UV-A LED positioned above each well and inoculated with six individual challenge microorganisms recovered from the International Space Station (ISS): Burkholderia cepacia, Cupriavidus metallidurans, Methylobacterium fujisawaense, Pseudomonas aeruginosa, Sphingomonas paucimobilis and Wautersia basilensis. Exposure to the Nichia UV-A LED with photocatalytic oxidation resulted in a complete (>7-log) reduction of each challenge bacteria population in UV-A LEDs and semi

Environmental benefit analysis of strategies for potable water savings in residential buildings.

Science.gov (United States)

Marinoski, Ana Kelly; Rupp, Ricardo Forgiarini; Ghisi, Enedir

2018-01-15

The objective of this study is to assess the environmental benefit of using rainwater, greywater, water-efficient appliances and their combinations in low-income houses. The study was conducted surveying twenty households located in southern Brazil, which resulted in water end-uses estimation. Then, embodied energy, potential for potable water savings and sewage reduction when using the different strategies were estimated. The environmental benefit analysis of these strategies was performed using an indicator that includes embodied energy, potable water savings, reduction of sewage and energy consumption in the water utility, and sewage production during the life cycle of the system. The results indicated that the strategy with the greatest environmental benefit is the use of water-efficient appliances, which resulted in substantial water savings and reduction of sewage, causing low environmental impact due to lower embodied energy over the life cycle. Copyright © 2017 Elsevier Ltd. All rights reserved.

Preprototype vapor compression distillation subsystem. [recovering potable water from wastewater

Science.gov (United States)

Ellis, G. S.; Wynveen, R. A.; Schubert, F. H.

1979-01-01

A three-person capacity preprototype vapor compression distillation subsystem for recovering potable water from wastewater aboard spacecraft was designed, assembled, and tested. The major components of the subsystem are: (1) a distillation unit which includes a compressor, centrifuge, central shaft, and outer shell; (2) a purge pump; (3) a liquids pump; (4) a post-treat cartridge; (5) a recycle/filter tank; (6) an evaporator high liquid level sensor; and (7) the product water conductivity monitor. A computer based control monitor instrumentation carries out operating mode change sequences, monitors and displays subsystem parameters, maintains intramode controls, and stores and displays fault detection information. The mechanical hardware occupies 0.467 m3, requires 171 W of electrical power, and has a dry weight of 143 kg. The subsystem recovers potable water at a rate of 1.59 kg/hr, which is equivalent to a duty cycle of approximately 30% for a crew of three. The product water has no foul taste or odor. Continued development of the subsystem is recommended for reclaiming water for human consumption as well as for flash evaporator heat rejection, urinal flushing, washing, and other on-board water requirements.

Evaluation of Electrochemically Generated Potable Water Disinfectants for Use on the International Space Station

Science.gov (United States)

Rodriquez, Branelle; Anderson, Molly; Adams, Niklas; Vega, Leticia; Botkin, Douglas

2013-01-01

Microbial contamination and subsequent growth in spacecraft water systems are constant concerns for missions involving human crews. The current potable water disinfectant for the International Space Station (ISS) is iodine; however, with the end of the Space Shuttle Program, there is a need to develop redundant biocide systems that do not require regular up-mass dependencies. Throughout the course of a year, four different electrochemical systems were investigated as a possible biocide for potable water on the ISS. Research has indicated that a wide variability exists with regards to efficacy in both concentration and exposure time of these disinfectants; therefore, baseline efficacy values were established. This paper describes a series of tests performed to establish optimal concentrations and exposure times for four disinfectants against single and mixed species planktonic and biofilm bacteria. Results of the testing determined whether these electrochemical disinfection systems are able to produce a sufficient amount of chemical in both concentration and volume to act as a biocide for potable water on the ISS.

Strategic Siting of Contingency Bases: Assessing Options for Potable Water

Science.gov (United States)

2017-02-01

of water. Thus the use of water can be viewed as taking place within a socio-ecological system, which is interlinked in its social, political, eco ...evaluation of how that infrastructure meets societal needs culturally, socially, politically, economically, and technologically . Their an- alytical... technological relationships be- tween Army and host-nation users of potable water when siting a CB. The questions focus on consideration of the reciprocal

Atmospheric Water Harvesting: Role of Surface Wettability and Edge Effect

KAUST Repository

Jin, Yong; Zhang, Lianbin; Wang, Peng

2017-01-01

Atmospheric water is emerging as an important potable water source. The present work experimentally and theoretically investigates water condensation and collection on flat surfaces with contrasting contact angles and contact angle hysteresis (CAH

Atmospheric Water Harvesting: Role of Surface Wettability and Edge Effect

KAUST Repository

Jin, Yong

2017-06-23

Atmospheric water is emerging as an important potable water source. The present work experimentally and theoretically investigates water condensation and collection on flat surfaces with contrasting contact angles and contact angle hysteresis (CAH) to elucidate their roles on water mass collection efficiency. The experimental results indicate that a hydrophilic surface promotes nucleation and individual droplets growth, and a surface with a low CAH tends to let a smaller droplet to slide down, but the overall water mass collection efficiency is independent of both surface contact angle and CAH. The experimental results agree well with our theoretical calculations. During water condensation, a balance has to be struck between single droplet growth and droplet density on a surface so as to maintain a constant water droplet surface coverage ratio, which renders the role of both surface wettability and hysteresis insignificant to the ultimate water mass collection. Moreover, water droplets on the edges of a surface grow much faster than those on the non-edge areas and thus dominate the contribution to the water mass collection by the entire surface, directly pointing out the very important role of edge effect on water condensation and collection.

Correlates of potable water demand among farming households in ...

African Journals Online (AJOL)

This study estimated the correlates of potable water demand among farming households through the use of cross-sectional data collected from 100 households in Abak, Nigeria. Based on the fact that heterogeneity and homogeneity exist within and among the clans and also to ensure equal representation of people from all ...

Absorption heat pump for a potable water supply in a solar house

Energy Technology Data Exchange (ETDEWEB)

Elshamarka, S [Military Technical Coll., Cairo (EG)

1991-01-01

Solar houses usually have good potential in arid areas. These areas often suffer from not only a shortage of conventional energy sources, but also of potable water supplies. In this study, a solar air-conditioning system including an absorption heat pump, already in production since the early 1980s, is described for potable water production while performing its air-conditioning duty in a solar house. Compiled weather-conditions of the Hurgada area, on the Red Sea coast of Egypt, were employed for the prediction of the system's productivity, if it were installed in such a locality. An evaluation of the system's feasibility has been conducted. (author).

Accessibility levels to potable Water Supply in Rural Areas of Akwa ...

African Journals Online (AJOL)

`123456789jkl''''#

1987-09-23

Sep 23, 1987 ... number of water boreholes in the communities were collected and analyzed. The population of the communities provided a basis for evolving an index that measured the levels of access to potable water supply in the study area. The use of GIS was subsequently employed to map out the study area on the ...

Potable water supply in U.S. manned space missions

Science.gov (United States)

Sauer, Richard L.; Straub, John E., II

1992-01-01

A historical review of potable water supply systems used in the U.S. manned flight program is presented. This review provides a general understanding of the unusual challenges these systems have presented to the designers and operators of the related flight hardware. The presentation concludes with the projection of how water supply should be provided in future space missions - extended duration earth-orbital and interplanetary missions and lunar and Mars habitation bases - and the challenges to the biomedical community that providing these systems can present.

An assessment of the potability of some sachet water brands sold in ...

African Journals Online (AJOL)

Analysis of the microbial and physico-chemical qualities of 14 sachet water ... their potability based on World Health Organization (WHO) recommendations. ... that about 85 % of the brands tested were microbially unsuitable for consumption.

Biosensor for detection of dissolved chromium in potable water: A review.

Science.gov (United States)

Biswas, Puja; Karn, Abhinav Kumar; Balasubramanian, P; Kale, Paresh G

2017-08-15

The unprecedented deterioration rate of the environmental quality due to rapid urbanization and industrialization causes a severe global health concern to both ecosystem and humanity. Heavy metals are ubiquitous in nature and being used extensively in industrial processes, the exposure to excessive levels could alter the biochemical cycles of living systems. Hence the environmental monitoring through rapid and specific detection of heavy metal contamination in potable water is of paramount importance. Various standard analytical techniques and sensors are used for the detection of heavy metals include spectroscopy and chromatographic methods along with electrochemical, optical waveguide and polymer based sensors. However, the mentioned techniques lack the point of care application as it demands huge capital cost as well as the attention of expert personnel for sample preparation and operation. Recent advancements in the synergetic interaction among biotechnology and microelectronics have advocated the biosensor technology for a wide array of applications due to its characteristic features of sensitivity and selectivity. This review paper has outlined the overview of chromium toxicity, conventional analytical techniques along with a particular emphasis on electrochemical based biosensors for chromium detection in potable water. This article emphasized porous silicon as a host material for enzyme immobilization and elaborated the working principle, mechanism, kinetics of an enzyme-based biosensor for chromium detection. The significant characteristics such as pore size, thickness, and porosity make the porous silicon suitable for enzyme entrapment. Further, several schemes on porous silicon-based immobilized enzyme biosensors for the detection of chromium in potable water are proposed. Copyright © 2017 Elsevier B.V. All rights reserved.

Autogenous Metallic Pipe Leak Repair in Potable Water Systems.

Science.gov (United States)

Tang, Min; Triantafyllidou, Simoni; Edwards, Marc A

2015-07-21

Copper and iron pipes have a remarkable capability for autogenous repair (self-repair) of leaks in potable water systems. Field studies revealed exemplars that metallic pipe leaks caused by nails, rocks, and erosion corrosion autogenously repaired, as confirmed in the laboratory experiments. This work demonstrated that 100% (N = 26) of 150 μm leaks contacting representative bulk potable water in copper pipes sealed autogenously via formation of corrosion precipitates at 20-40 psi, pH 3.0-11.0, and with upward and downward leak orientations. Similar leaks in carbon steel pipes at 20 psi self-repaired at pH 5.5 and 8.5, but two leaks did not self-repair permanently at pH 11.0 suggesting that water chemistry may control the durability of materials that seal the leaks and therefore the permanence of repair. Larger 400 μm holes in copper pipes had much lower (0-33%) success of self-repair at pH 3.0-11.0, whereas all 400 μm holes in carbon steel pipes at 20 psi self-repaired at pH 4.0-11.0. Pressure tests indicated that some of the repairs created at 20-40 psi ambient pressure could withstand more than 100 psi without failure. Autogenous repair has implications for understanding patterns of pipe failures, extending the lifetime of decaying infrastructure, and developing new plumbing materials.

Basic aspects of the use of reverse osmosis in indirect potable reuse; Aspectos basicos de la aplicacion de la osmosis inversa a la reutilizacion potable indirecta

Energy Technology Data Exchange (ETDEWEB)

Lopez Ramirez, J. A.; Sales Marquez, D.; Quiroga Alonso, J. M.; Asano, T.

2003-07-01

Wastewater reclamation and reuse is an increasing activity in those countries who are facing water restrictions both in quality and quantity, and it has become an integral part of water resources management. Among several applications of reclaimed wastewater, one of the most interesting and innovative is indirect potable reuse. This consists in the purposeful augmentation of surface or groundwater resources with highly treated reclaimed water which will ultimately serve as a source of drinking water. There are world-wide experiences confirming that this kind of application is safe. The use of reverse osmosis for wastewater reclamation is very interesting and the use of this in indirect potable reuse started more that thirty years ago, mainly in USA. However the extension of this kind of applications is in someway low, not for economic issues or technology faults,but the ignorance, distrust or public opinion rejection. In this paper, the most important challenges, from a technical and scientific point of view, of indirect potable reuse are discussed to allow it to be used as a safe, reliable and additional water source: with all its implications and, of course, with all its benefits. (Author) 16 refs.

Developing effective messages about potable recycled water: The importance of message structure and content

Science.gov (United States)

Price, J.; Fielding, K. S.; Gardner, J.; Leviston, Z.; Green, M.

2015-04-01

Community opposition is a barrier to potable recycled water schemes. Effective communication strategies about such schemes are needed. Drawing on social psychological literature, two experimental studies are presented, which explore messages that improve public perceptions of potable recycled water. The Elaboration-Likelihood Model of information processing and attitude change is tested and supported. Study 1 (N = 415) premeasured support for recycled water, and trust in government information at Time 1. Messages varied in complexity and sidedness were presented at Time 2 (3 weeks later), and support and trust were remeasured. Support increased after receiving information, provided that participants received complex rather than simple information. Trust in government was also higher after receiving information. There was tentative evidence of this in response to two-sided messages rather than one-sided messages. Initial attitudes to recycled water moderated responses to information. Those initially neutral or ambivalent responded differently to simple and one-sided messages, compared to participants with positive or negative attitudes. Study 2 (N = 957) tested the effectiveness of information about the low relative risks, and/or benefits of potable recycled water, compared to control groups. Messages about the low risks resulted in higher support when the issue of recycled water was relevant. Messages about benefits resulted in higher perceived issue relevance, but did not translate into greater support. The results highlight the importance of understanding people's motivation to process information, and need to tailor communication to match attitudes and stage of recycled water schemes' development.

Potability of drinking water in an oil impacted community in Southern ...

African Journals Online (AJOL)

Some physicochemical parameters like iron and mercury in some boreholes did not meet World Health Organization (WHO) standard for potable water. High counts of indicator bacteria also constitute a threat to public health. Journal of Applied Sciences and Environmental Management Vol. 9(1) 2005: 135-141.

Diversification des ressources du réseau d’eau non potable parisien : contribution à une gestion durable des ressources en eau

OpenAIRE

Trinh , Bich-Thuy

2017-01-01

At the scale of a city, a sustainable water management raises questions about the links between uses and resources: what water quality is needed for what purpose? The Parisian context is a favourable ground for conducting such type of reflection thanks to the existence of a non-potable water network (RENP) dating from the late nineteenth century. The network is currently supplied by summarily filtrated water from the Seine river (20%) and the canal de l’Ourcql (80%). It is mainly used for mun...

Efficacy of Various Chemical Disinfectants on Biofilms Formed in Spacecraft Potable Water System Component

Science.gov (United States)

Wong, Willy; Garcia, Veronica; Castro, Victoria; Ott, Mark; Duane

2009-01-01

As the provision of potable water is critical for successful habitation of the International Space Station (ISS), life support systems were installed in December 2008 to recycle both humidity from the atmosphere and urine to conserve available water in the vehicle. Pre-consumption testing from the dispensing needle at the Potable Water Dispenser (PWD) indicated that bacterial concentrations exceeded the current ISS specifications of 50 colony forming units (CFU) per ml. Subsequent investigations revealed that a corrugated stainless steel flex hose upstream of the dispensing needle in the PWD was filled with non-sterile water and left at room temperature for over one month before launch. To simulate biofilm formation that was suspected in the flight system, sterile flex hoses were seeded with a consortium of bacterial isolates previously recovered from other ISS water systems, which included Ralstonia pickettii, Burkholderia multivorans, Caulobacter vibrioides., and Cupriavidus pauculus. After 5 days of incubation, these hoses were challenged with various chemical disinfectants including hydrogen peroxide, colloidal silver, and buffered pH solutions to determine the ability of the disinfectants to decrease and maintain bacterial concentrations below ISS specifications. Disinfection efficacy over time was measured by collecting daily heterotrophic plate counts following exposure to the disinfectants. A single flush with either 6% hydrogen peroxide solution or a mixture of 3% hydrogen peroxide and 400 ppb colloidal silver effectively reduced the bacterial concentrations to less than 1 CFU/ml for a period of up to 2 months. Testing results indicated that hydrogen peroxide and mixtures of hydrogen peroxide and colloidal silver have tremendous potential as alternative disinfectants for ISS water systems.

UV-decontamination of potable and sewage water in the city with population over one million

Directory of Open Access Journals (Sweden)

Smirnov Aleksandr

2016-01-01

Full Text Available The waterworks system in a modern city is a complex challenge. From the one hand, it is necessary to provide high-quality potable water to the residents with observance of all sanitary and hygienic requirements; from the other hand, the sewage water discharged from the city should not affect the environment. Meanwhile, the microbiological safety is the top-priority and crucial parameter for evaluation of any work and any project. In Novosibirsk, solutions have been found for both of them by using the cutting-edge approaches in the decontamination technologies. The UV-decontamination enabled to create a multi-barrier efficient protection when dealing with the potable water treatment and ensure environmentally-friendly decontamination of the sewage water.

Analysis of radon, uranium 238 and thorium 232 in potable waters: Dose to adult members of the Moroccan urban population

International Nuclear Information System (INIS)

Misdaq, M.A.; Ouabi, H.; Merzouki, A.

2007-01-01

Uranium ( 238 U) and thorium ( 232 Th) concentrations as well as radon ( 222 Rn) and thoron ( 220 Rn) alpha-activities per unit volume have been measured inside various potable water samples collected from nineteen cities in Morocco by using CR-39 and LR-115 type II solid state nuclear track detectors (SSNTDs). Measured radon alpha-activities ranged from (0.37 ± 0.02) Bq l -1 to (13.6 ± 1.10) Bq l -1 for the potable water samples studied. Alpha-activities due to radon from the ingestion of the studied potable water samples were determined in different compartments of the gastrointestinal system by using the ICRP compartmental model for radon. Annual committed equivalent doses due to radon were evaluated in the gastrointestinal compartments from the ingestion of the potable water samples studied. The influence of the target tissue mass, radon intake and alpha-activity integral due to radon on the annual committed equivalent doses in the gastrointestinal compartments was investigated

Detection of Legionella, L. pneumophila and Mycobacterium avium complex (MAC) along potable water distribution pipelines.

Science.gov (United States)

Whiley, Harriet; Keegan, Alexandra; Fallowfield, Howard; Bentham, Richard

2014-07-18

Inhalation of potable water presents a potential route of exposure to opportunistic pathogens and hence warrants significant public health concern. This study used qPCR to detect opportunistic pathogens Legionella spp., L. pneumophila and MAC at multiple points along two potable water distribution pipelines. One used chlorine disinfection and the other chloramine disinfection. Samples were collected four times over the year to provide seasonal variation and the chlorine or chloramine residual was measured during collection. Legionella spp., L. pneumophila and MAC were detected in both distribution systems throughout the year and were all detected at a maximum concentration of 103 copies/mL in the chlorine disinfected system and 106, 103 and 104 copies/mL respectively in the chloramine disinfected system. The concentrations of these opportunistic pathogens were primarily controlled throughout the distribution network through the maintenance of disinfection residuals. At a dead-end and when the disinfection residual was not maintained significant (p pipeline and sampling period. Total coliforms were not present in any water sample collected. This study demonstrates the ability of Legionella spp., L. pneumophila and MAC to survive the potable water disinfection process and highlights the need for greater measures to control these organisms along the distribution pipeline and at point of use.

Municipal management and geo-hydrological aspects of importance in the potable water supply of Lindley

Directory of Open Access Journals (Sweden)

Eric Nealer

2014-07-01

Full Text Available When the South African Government in 1998 re-demarcated its 283 municipalities so that they completely cover the country in a “wall-to-wall” manner, their main focus was on growing local economies and maintaining the provision of an increased number of diverse and more complex basic municipal services to new geographical areas consisting of millions of citizens who might previously had been neglected. In most of the instances the newly established and merged municipalities were demarcated according to geographical aspects inherited from the previous political dispensation, historical municipal areas and magisterial district farm names. The fact that these municipal government jurisdictions for the purpose of improving co-operative municipal- and integrated water resources management (IWRM, in most instances do not correspond with environmental and physical land features such as the demarcated surface water (rivers drainage regions’ boundaries, could lead to the ineffective, inefficient and non-economic municipal management of water, sanitation and environmental services. The aforementioned is a case with reference to water services management in the Free State Province town of Lindley located in the Vals River catchment and the Nketoana Local Municipality’s area of jurisdiction. An extensive literature review, the use and study of geographic tools such as maps, ortho- photos and information data bases, as well as two field visits to the area, enabled the researchers to identify the essential geographical, geo-hydrological and municipal management aspects of importance for the potable water service providers and managers in the Lindley municipal area. The researchers argue that effective trans-boundary municipal management through simunye-type co-operative governance and IWRM must be facilitated in the Vals River surface water catchment between the respective local- and district municipalities for the benefit of the Lindley, Arlington

Risk assessment of aquifer storage transfer and recovery with urban stormwater for producing water of a potable quality.

Science.gov (United States)

Page, Declan; Dillon, Peter; Vanderzalm, Joanne; Toze, Simon; Sidhu, Jatinder; Barry, Karen; Levett, Kerry; Kremer, Sarah; Regel, Rudi

2010-01-01

The objective of the Parafield Aquifer Storage Transfer and Recovery research project in South Australia is to determine whether stormwater from an urban catchment that is treated in a constructed wetland and stored in an initially brackish aquifer before recovery can meet potable water standards. The water produced by the stormwater harvesting system, which included a constructed wetland, was found to be near potable quality. Parameters exceeding the drinking water guidelines before recharge included small numbers of fecal indicator bacteria and elevated iron concentrations and associated color. This is the first reported study of a managed aquifer recharge (MAR) scheme to be assessed following the Australian guidelines for MAR. A comprehensive staged approach to assess the risks to human health and the environment of this project has been undertaken, with 12 hazards being assessed. A quantitative microbial risk assessment undertaken on the water recovered from the aquifer indicated that the residual risks posed by the pathogenic hazards were acceptable if further supplementary treatment was included. Residual risks from organic chemicals were also assessed to be low based on an intensive monitoring program. Elevated iron concentrations in the recovered water exceeded the potable water guidelines. Iron concentrations increased after underground storage but would be acceptable after postrecovery aeration treatment. Arsenic concentrations in the recovered water continuously met the guideline concentrations acceptable for potable water supplies. However, the elevated concentration of arsenic in native groundwater and its presence in aquifer minerals suggest that the continuing acceptable residual risk from arsenic requires further evaluation.

Detection of Legionella, L. pneumophila and Mycobacterium Avium Complex (MAC) along Potable Water Distribution Pipelines

Science.gov (United States)

Whiley, Harriet; Keegan, Alexandra; Fallowfield, Howard; Bentham, Richard

2014-01-01

Inhalation of potable water presents a potential route of exposure to opportunistic pathogens and hence warrants significant public health concern. This study used qPCR to detect opportunistic pathogens Legionella spp., L. pneumophila and MAC at multiple points along two potable water distribution pipelines. One used chlorine disinfection and the other chloramine disinfection. Samples were collected four times over the year to provide seasonal variation and the chlorine or chloramine residual was measured during collection. Legionella spp., L. pneumophila and MAC were detected in both distribution systems throughout the year and were all detected at a maximum concentration of 103 copies/mL in the chlorine disinfected system and 106, 103 and 104 copies/mL respectively in the chloramine disinfected system. The concentrations of these opportunistic pathogens were primarily controlled throughout the distribution network through the maintenance of disinfection residuals. At a dead-end and when the disinfection residual was not maintained significant (p < 0.05) increases in concentration were observed when compared to the concentration measured closest to the processing plant in the same pipeline and sampling period. Total coliforms were not present in any water sample collected. This study demonstrates the ability of Legionella spp., L. pneumophila and MAC to survive the potable water disinfection process and highlights the need for greater measures to control these organisms along the distribution pipeline and at point of use. PMID:25046636

Potable water recovery for spacecraft application by electrolytic pretreatment/air evaporation

Science.gov (United States)

Wells, G. W.

1975-01-01

A process for the recovery of potable water from urine using electrolytic pretreatment followed by distillation in a closed-cycle air evaporator has been developed and tested. Both the electrolytic pretreatment unit and the air evaporation unit are six-person, flight-concept prototype, automated units. Significantly extended wick lifetimes have been achieved in the air evaporation unit using electrolytically pretreated, as opposed to chemically pretreated, urine feed. Parametric test data are presented on product water quality, wick life, process power, maintenance requirements, and expendable requirements.

Quantifying pathogen risks associated with potable reuse: A risk assessment case study for Cryptosporidium.

Science.gov (United States)

Amoueyan, Erfaneh; Ahmad, Sajjad; Eisenberg, Joseph N S; Pecson, Brian; Gerrity, Daniel

2017-08-01

This study evaluated the reliability and equivalency of three different potable reuse paradigms: (1) surface water augmentation via de facto reuse with conventional wastewater treatment; (2) surface water augmentation via planned indirect potable reuse (IPR) with ultrafiltration, pre-ozone, biological activated carbon (BAC), and post-ozone; and (3) direct potable reuse (DPR) with ultrafiltration, ozone, BAC, and UV disinfection. A quantitative microbial risk assessment (QMRA) was performed to (1) quantify the risk of infection from Cryptosporidium oocysts; (2) compare the risks associated with different potable reuse systems under optimal and sub-optimal conditions; and (3) identify critical model/operational parameters based on sensitivity analyses. The annual risks of infection associated with the de facto and planned IPR systems were generally consistent with those of conventional drinking water systems [mean of (9.4 ± 0.3) × 10 -5 to (4.5 ± 0.1) × 10 -4 ], while DPR was clearly superior [mean of (6.1 ± 67) × 10 -9 during sub-optimal operation]. Because the advanced treatment train in the planned IPR system was highly effective in reducing Cryptosporidium concentrations, the associated risks were generally dominated by the pathogen loading already present in the surface water. As a result, risks generally decreased with higher recycled water contributions (RWCs). Advanced treatment failures were generally inconsequential either due to the robustness of the advanced treatment train (i.e., DPR) or resiliency provided by the environmental buffer (i.e., planned IPR). Storage time in the environmental buffer was important for the de facto reuse system, and the model indicated a critical storage time of approximately 105 days. Storage times shorter than the critical value resulted in significant increases in risk. The conclusions from this study can be used to inform regulatory decision making and aid in the development of design or operational

Assessing efficiency and economic viability of rainwater harvesting systems for meeting non-potable water demands in four climatic zones of China

Science.gov (United States)

Zhang, S.; Jing, X.

2017-12-01

Rainwater harvesting is now increasingly used to manage urban flood and alleviate water scarcity crisis. In this study, a computational tool based on water balance equation is developed to assess stormwater capture and water saving efficiency and economic viability of rainwater harvesting systems (RHS) in eight cities across four climatic zones of China. It requires daily rainfall, contributing area, runoff losses, first flush volume, storage capacity, daily water demand and economic parameters as inputs. Three non-potable water demand scenarios (i.e., toilet flushing, lawn irrigation, and combination of them) are considered. The water demand for lawn irrigation is estimated using the Cropwat 8.0 and Climwat 2.0. Results indicate that higher water saving efficiency and water supply time reliability can be achieved for RHS with larger storage capacities, for lower water demand scenarios and located in more humid regions, while higher stormwater capture efficiency is associated with larger storage capacity, higher water demand scenarios and less rainfall. For instance, a 40 m3 RHS in Shanghai (humid climate) for lawn irrigation can capture 17% of stormwater, while its water saving efficiency and time reliability can reach 96 % and 98%, respectively. The water saving efficiency and time reliability of a 20 m3 RHS in Xining (semi-arid climate) for toilet flushing are 19% and 16%, respectively, but it can capture 63% of stormwater. With the current values of economic parameters, economic viability of RHS can be achieved in humid and semi-humid regions for reasonably designed RHS; however, it is not financially viable to install RHS in arid regions as the benefit-cost ratio is much smaller than 1.0.

A Study of Failure Events in Drinking Water Systems As a Basis for Comparison and Evaluation of the Efficacy of Potable Reuse Schemes.

Science.gov (United States)

Onyango, Laura A; Quinn, Chloe; Tng, Keng H; Wood, James G; Leslie, Greg

2015-01-01

Potable reuse is implemented in several countries around the world to augment strained water supplies. This article presents a public health perspective on potable reuse by comparing the critical infrastructure and institutional capacity characteristics of two well-established potable reuse schemes with conventional drinking water schemes in developed nations that have experienced waterborne outbreaks. Analysis of failure events in conventional water systems between 2003 and 2013 showed that despite advances in water treatment technologies, drinking water outbreaks caused by microbial contamination were still frequent in developed countries and can be attributed to failures in infrastructure or institutional practices. Numerous institutional failures linked to ineffective treatment protocols, poor operational practices, and negligence were detected. In contrast, potable reuse schemes that use multiple barriers, online instrumentation, and operational measures were found to address the events that have resulted in waterborne outbreaks in conventional systems in the past decade. Syndromic surveillance has emerged as a tool in outbreak detection and was useful in detecting some outbreaks; increases in emergency department visits and GP consultations being the most common data source, suggesting potential for an increasing role in public health surveillance of waterborne outbreaks. These results highlight desirable characteristics of potable reuse schemes from a public health perspective with potential for guiding policy on surveillance activities.

Siting study for Test Area North potable water deep well project

International Nuclear Information System (INIS)

Hubbell, J.M.; Wylie, A.H.

1993-05-01

This study was conducted to evaluate the suitability of various locations for a new potable ground water well at Test Area North (TAN). The new well is proposed to replace two existing wells located within a trichloroethylene (TCE) plume. Several locations were evaluated using computer simulations based on the hydrogeology of the site. The modeling effort involved: (1) producing a water table map, (2) superimposing the effects of pumping the proposed new production well on the water table map using the model CAPZONE, and (3) calculating the capture zone for these wells using the GWPATH model. A three dimensional contaminant transport model was used to evaluate siting a well in a deeper horizon of the aquifer. The following scenarios were investigated: (1) placing a new well 500 ft north of the existing wells; (2) locating a well 3,000 ft northwest of the existing wells; (3) deepening one of the existing wells 100 to 150 ft to produce water from beneath an interbed that acts as a hydraulic barrier; and (4) drilling a new well about 500 ft northwest of the existing wells to produce water from beneath the interbed. The recommended new well site (fourth scenario) is northwest of the existing wells, with the well completed from 500 to 600 ft below land surface to produce water from beneath the Q-R interbed. Locating the well northwest of the existing wells places the new well out of the TCE plume and reduces the possibility of transporting contaminated water across the interbed

Centralised urban stormwater harvesting for potable reuse.

Science.gov (United States)

McArdle, P; Gleeson, J; Hammond, T; Heslop, E; Holden, R; Kuczera, G

2011-01-01

Urban impervious areas provide a guaranteed source of runoff, especially in cities with high rainfall - this represents a source of water with low sensitivity to unfavourable climate change. Whilst the potential to reuse stormwater has long been recognised, its quality has largely limited usage to non-potable applications requiring the use of a third-pipe network, a prohibitively expensive option in established urban areas. Given recent advances in membrane filtration, this study investigates the potential of harvesting and treating stormwater to a potable standard to enable use of the potable distribution network. A case study based on the Throsby Creek catchment in Newcastle explores the issue. The high seasonally uniform rainfall provides insight into the maximum potential of such an option. Multicriterion optimisation was used to identify Pareto optimal solutions for harvesting, storing and treating stormwater. It is shown that harvesting and treating stormwater from a 13 km² catchment can produce yields ranging from 8.5 to 14.2 ML/day at costs ranging from AU$2.60/kL to AU$2.89/kL, which may become viable as the cost of traditional supply continues to grow. However, there are significant social impacts to deal with including alienation of public land for storage and community acceptance of treated stormwater.

Q-PCR Based Culture-Independent Enumeration and Detection of Enterobacter: An Emerging Environmental Human Pathogen in Riverine Systems and Potable Water

Science.gov (United States)

Patel, Chandra B.; Shanker, Rishi; Gupta, Vijai K.; Upadhyay, Ram S.

2016-01-01

The availability of safe and pristine water is a global challenge when large numbers of natural and anthropogenic water resources are being depleted with faster rate. The remaining water resources are severely contaminated with various kinds of contaminants including microorganisms. Enterobacter is one of the fecal coliform bacteria of family Enterobacteriaceae. Enterobacter was earlier used as an indicator bacterium along with other fecal Coliforms namely Escherichia coli, Citrobacter, and Klebsiella, but it is now known to cause various diseases in human beings. In this study, we have collected 55 samples from potable water and riverine system and proved their presence using their conserved sequences of 16S rRNA and 23S rRNA genes with the help of SYBR green real-time PCR, which showed very high specificity for the detection of Enterobacter. The Enterobacter counts in potable water were found to 1290 ± 32.89 to 1460 ± 39.42 cfu/100 ml. The Enterobacter levels in surface water were 1.76 × 104 ± 492, 1.33 × 104 ± 334, 1.15 × 104 ± 308, 2.56 × 104 ± 802, 2.89 × 104 ± 962, 8.16 × 104 ± 3443 cfu/100 ml; the levels of Enterobacter contamination associated with hydrophytes were 4.80 × 104 ± 1804, 3.48 × 104 ± 856, 8.50 × 104 ± 2074, 8.09 × 104 ± 1724, 6.30 × 104 ± 1738, 3.68 × 104 ± 949 cfu/10 g and the Enterobacter counts in sediments of the river, were 2.36 × 104 ± 703, 1.98 × 104 ± 530, 9.92 × 104 ± 3839, 6.80 × 104 ± 2230, 8.76 × 104 ± 3066 and 2.34 × 104 ± 732 cfu/10 g at the sampling Site #1, Site #2, Site #3, Site #4, Site #5, and Site #6, respectively. The assay could be used for the regular monitoring of potable water and other water reservoirs to check waterborne outbreaks. PMID:26925044

System Dynamics Approach for Critical Infrastructure and Decision Support. A Model for a Potable Water System.

Science.gov (United States)

Pasqualini, D.; Witkowski, M.

2005-12-01

The Critical Infrastructure Protection / Decision Support System (CIP/DSS) project, supported by the Science and Technology Office, has been developing a risk-informed Decision Support System that provides insights for making critical infrastructure protection decisions. The system considers seventeen different Department of Homeland Security defined Critical Infrastructures (potable water system, telecommunications, public health, economics, etc.) and their primary interdependencies. These infrastructures have been modeling in one model called CIP/DSS Metropolitan Model. The modeling approach used is a system dynamics modeling approach. System dynamics modeling combines control theory and the nonlinear dynamics theory, which is defined by a set of coupled differential equations, which seeks to explain how the structure of a given system determines its behavior. In this poster we present a system dynamics model for one of the seventeen critical infrastructures, a generic metropolitan potable water system (MPWS). Three are the goals: 1) to gain a better understanding of the MPWS infrastructure; 2) to identify improvements that would help protect MPWS; and 3) to understand the consequences, interdependencies, and impacts, when perturbations occur to the system. The model represents raw water sources, the metropolitan water treatment process, storage of treated water, damage and repair to the MPWS, distribution of water, and end user demand, but does not explicitly represent the detailed network topology of an actual MPWS. The MPWS model is dependent upon inputs from the metropolitan population, energy, telecommunication, public health, and transportation models as well as the national water and transportation models. We present modeling results and sensitivity analysis indicating critical choke points, negative and positive feedback loops in the system. A general scenario is also analyzed where the potable water system responds to a generic disruption.

[Health risk induced by estrogens during unplanned indirect potable reuse of reclaimed water from domestic wastewater].

Science.gov (United States)

Wu, Qian-Yuan; Shao, Yi-Ru; Wang, Chao; Sun, Yan; Hu, Hong-Ying

2014-03-01

The estrogenic endocrine disruptors in reclaimed water from domestic wastewater may induce health risks to human being, when reclaimed water is used for augmentation of drinking water unplannedly and indirectly. This study investigated changes in concentrations of estrone, estradiol, 17alpha-ethinyl estradiol, bisphenol A, nonylphenol and octylphenol in reclaimed water during the reuse of reclaimed water for augmentation to water source such as lakes and reservoir via river. Thereafter, health risk induced by estrogens during the resue of reclaimed water was evaluated. The concentration of estrogen in secondary effluent ranged 0.1-100 ng x L(-1). The highest concentrations of bisphenol A and nonylphenol reached up to 1-10 microg x L(-1). During the indirect reuse of reclaimed water as potable water, the dilution and degradation in river and lake, and the removal by drinking water treatment process could change the concentrations of estrogen. The non-carcinogenic risks of estrone, estradiol, bisphenol A, nonylphenol and octylphenol were lower than 1. When the hydraulic retention time of 17alpha-ethinyl estradiol (EE2) in lakes and reservoir was higher than 30 days, the non-carcinogenic risk of EE2 was lower than 1 in most cases. When the hydraulic retention time of EE2 in lakes and reservoir was less than 30 days and the percentages of reclaimed water in drinking water were higher than 50%, the non-carcinogenic risk induced by EE2 was higher than 1 in 20%-50% samples. This indicated that the risks of EE2 should be concerned.

Potable water quality monitoring of primary schools in Magura district, Bangladesh: children's health risk assessment.

Science.gov (United States)

Rahman, Aminur; Hashem, Abul; Nur-A-Tomal, Shahruk

2016-12-01

Safe potable water is essential for good health. Worldwide, school-aged children especially in the developing countries are suffering from various water-borne diseases. In the study, drinking water supplies for primary school children were monitored at Magura district, Bangladesh, to ensure safe potable water. APHA standard analytical methods were applied for determining the physicochemical parameters of the water samples. For determination of the essential physicochemical parameters, the samples were collected from 20 randomly selected tube wells of primary schools at Magura. The metal contents, especially arsenic (As), iron (Fe), and manganese (Mn), in the water samples were analyzed by atomic absorption spectroscopy. The range of physicochemical parameters found in water samples were as follows: pH 7.05-9.03, electrical conductivity 400-2340 μS/cm, chloride 10-640 mg/L, hardness 200-535 mg/L as CaCO 3 , and total dissolved solids 208-1216 mg/L. The level of metals in the tube well water samples were as follows: As 1 to 55 μg/L, Fe 40 to 9890 μg/L, and Mn 10 to 370 μg/L. Drinking water parameters of Magura district did not meet the requirement of the World Health Organization drinking water quality guideline, or the Drinking Water Quality Standards of Bangladesh.

Comparative LCA of decentralized wastewater treatment alternatives for non-potable urban reuse.

Science.gov (United States)

Opher, Tamar; Friedler, Eran

2016-11-01

Municipal wastewater (WW) effluent represents a reliable and significant source for reclaimed water, very much needed nowadays. Water reclamation and reuse has become an attractive option for conserving and extending available water sources. The decentralized approach to domestic WW treatment benefits from the advantages of source separation, which makes available simple small-scale systems and on-site reuse, which can be constructed on a short time schedule and occasionally upgraded with new technological developments. In this study we perform a Life Cycle Assessment to compare between the environmental impacts of four alternatives for a hypothetical city's water-wastewater service system. The baseline alternative is the most common, centralized approach for WW treatment, in which WW is conveyed to and treated in a large wastewater treatment plant (WWTP) and is then discharged to a stream. The three alternatives represent different scales of distribution of the WW treatment phase, along with urban irrigation and domestic non-potable water reuse (toilet flushing). The first alternative includes centralized treatment at a WWTP, with part of the reclaimed WW (RWW) supplied back to the urban consumers. The second and third alternatives implement de-centralized greywater (GW) treatment with local reuse, one at cluster level (320 households) and one at building level (40 households). Life cycle impact assessment results show a consistent disadvantage of the prevailing centralized approach under local conditions in Israel, where seawater desalination is the marginal source of water supply. The alternative of source separation and GW reuse at cluster level seems to be the most preferable one, though its environmental performance is only slightly better than GW reuse at building level. Centralized WW treatment with urban reuse of WWTP effluents is not advantageous over decentralized treatment of GW because the supply of RWW back to consumers is very costly in materials and

Real Time Assessment of Potable Water Quality in Distribution Network based on Low Cost Multi-Sensor Array

Science.gov (United States)

Bhardwaj, Jyotirmoy; Gupta, Karunesh K.; Khatri, Punit

2018-03-01

New concepts and techniques are replacing traditional methods of water quality parameters measurement systems. This paper proposed a new way of potable water quality assessment in distribution network using Multi Sensor Array (MSA). Extensive research suggests that following parameters i.e. pH, Dissolved Oxygen (D.O.), Conductivity, Oxygen Reduction Potential (ORP), Temperature and Salinity are most suitable to detect overall quality of potable water. Commonly MSA is not an integrated sensor array on some substrate, but rather comprises a set of individual sensors measuring simultaneously different water parameters all together. Based on research, a MSA has been developed followed by signal conditioning unit and finally, an algorithm for easy user interfacing. A dedicated part of this paper also discusses the platform design and significant results. The Objective of this proposed research is to provide simple, efficient, cost effective and socially acceptable means to detect and analyse water bodies regularly and automatically.

Legionella Risk Management and Control in Potable Water Systems: Argument for the Abolishment of Routine Testing.

Science.gov (United States)

Whiley, Harriet

2016-12-24

Legionella is an opportunistic pathogen of public health significance. One of the main sources of Legionella is potable water systems. As a consequence of aging populations there is an increasing demographic considered at high risk for Legionellosis and, as such, a review of the guidelines is required. Worldwide, Legionella has been detected from many potable water sources, suggesting it is ubiquitous in this environment. Previous studies have identified the limitations of the current standard method for Legionella detection and the high possibility of it returning both false negative and false positive results. There is also huge variability in Legionella test results for the same water sample when conducted at different laboratories. However, many guidelines still recommend the testing of water systems. This commentary argues for the removal of routine Legionella monitoring from all water distribution guidelines. This procedure is financially consuming and false negatives may result in managers being over-confident with a system or a control mechanism. Instead, the presence of the pathogen should be assumed and focus spent on managing appropriate control measures and protecting high-risk population groups.

Administrative limits for tritium concentrations found in non-potable groundwater at nuclear power facilities

International Nuclear Information System (INIS)

Parker, R.; Hart, D.; WIllert, C.

2012-01-01

Currently, there is a regulatory limit available for tritium in drinking water, but no such limit for non-potable groundwater. Voluntary administrative limits for site groundwater may be established at nuclear power facilities to ensure minimal risk to human health and the environment, and provide guidance for investigation or other actions intended to prevent exceedances of future regulatory or guideline limits. This work presents a streamlined approach for nuclear power facilities to develop three tiers of administrative limits for tritium in groundwater so that facilities can identify abnormal/uncontrolled releases of tritium at an early stage, and take appropriate actions to investigate, control, and protect groundwater. Tier 1 represents an upper limit of background, Tier 2 represents a level between background and Tier 3, and Tier 3 represents a risk-based concentration protective of down-gradient receptors. (author)

Feasibility of Rainwater Harvesting to fulfill potable water demand using quantitative water management in low-lying delta regions of Asia

Science.gov (United States)

Mahmood, A.; Hossain, F.

2016-12-01

Low-lying deltas of Asian region are usually densely populated and located in developing countries situated at the downstream end of major rivers. Extensive dam construction by the upstream countries has now caused water scarcity in large portions of low-lying deltas. Most inhabitants depend on shallow tube well for safe drinking water that tend to suffer from water quality issues (e.g. Arsenic contamination). In addition, people also get infected from water borne diseases like Cholera and Typhoid due to lack of safe drinking water. Developing a centralized piped network based water supply system is often not a feasible option in rural regions. Due to social acceptability, environment friendliness, lower capital and maintenance cost, rainwater harvesting can be the most sustainable option to supply safe drinking water in rural areas. In this study, first we estimate the monthly rainfall variability using long precipitation climatology from satellite precipitation data. The upper and lower bounds of monthly harvestable rainwater were estimated for each satellite precipitation grid. Taking this lower bound of monthly harvestable rainwater as input, we use quantitative water management concept to determine the percent of the time of the year potable water demand can be fulfilled. Analysis indicates that a 6 m³ reservoir tank can fulfill the potable water demand of a 6 person family throughout a year in almost all parts of this region.

Availability of uranium present in the sludge generated at two stations of potable water treatment

International Nuclear Information System (INIS)

Munoz-Serrano, A.; Baeza, A.; Salas, A.; Guillen, J.

2013-01-01

During the treatment is carried out in a Station Potable Water Treatment Plant sludge enriched are produced in components that have been removed from the water. The concentration and availability of radionuclides accumulated in a sludge during coagulation-flocculation will condition possible later use, so it is essential to carry out the characterization of sludge and its chemical speciation. (Author)

Nuclear Heat Application: Desalination as an Alternative Process for Potable Water Production in Indonesia (part 2)

International Nuclear Information System (INIS)

Amir-Rusli

2000-01-01

A survey of water supply and demand system and identification of desalination process need for Indonesia has been carried out. Even Indonesia is located in tropical zone of equator; it is still reported lack of water resources, especially during 6 months dry season. Due to miss-water management and bad attitude of the people itself occurred in the past; most of conventional water resources of river, lake and reservoir were damaged during development period of industrial and agriculture sectors. A half of 200 millions peoples of Indonesian population are still scarce of potable drinking water during the year of 1997. Jakarta as the capital has a population of 10 millions people which is the worse water availability in capita per year in the world at present. Seawater intrusion problem to about more than 11 km away is also detected in big cities of the main islands of Indonesia, and these same conditions are faced to other thousands of small islands. Therefore it is an urgent situation to develop a total integrated water management system in order to improve the performance of water resources. Desalination system of seawater/brackish water is considered and showed a good alternative for potable water production for domestic or industrial purposes. But in the long-term, water management system of the effectiveness cycle use of water should be implemented at sites. (author)

ANALISIS PERAN SERTA MASYARAKAT DALAM PENGELOLAAN AIR BERSIH (The Analysis of Community Roles in Potable Water Management

Directory of Open Access Journals (Sweden)

Syahrani Syahrani

2004-07-01

Full Text Available ABSTRAK Kondisi air sungai yang terpolusi karena penebangan hutan, penambangan, dan limbah domestik menyebabkan rendahnya kualitas air yang dikonsumsi masyarakat. Pada tahun l996 telah dibentuk Unit Pengelola Air (UPS-AB oleh komunitas di Kumpai Batu untuk membantu pengadaan air bagi masyarakat. Studi ini dilakukan untuk mengkaji kinerja UPS-AB melalui survai lapangan terhadap 160 rumah tangga. Variabel yang dikaji meliputi aktivitas UPS-AB. cara pengelolaannya dan keterlibatan masyarakat dalam pengelolaan air. Data ini kemudian diproses dengan analisa deskriptif dan analisis regresi. Hasil analisis menunjukkan bahwa tingkat partisipasi masyarakat cukup tinggi. Tingginya tingkat partisipasi ini disebabkan karena kebutuhan komunitas yang tinggi akan pelayanan air. Meskipun demikian masyarakat merasakan pentingnya peningkatan pengelolaaut air oleh UPS-AB khususnya dalam hal: peningkatan kualitas air. kontinuitas suplai. sistim pembayaran dan sistim pencatatan.   ABSTRACT Polluted river water due to destructed forest, mining and population settlement have created lower quality of up-stream water that households generally consume. Considering the scarcity of water, in 1996, Potable Water Management Unit (UPS-AB of Kumpai Batu was founded as community association to participate in the potable water preparation, development and maintenance. This study was conducted through a field survey on 160 households selected using random sampling method. The variable studied were the availability of UPS-AB, involvement indecision making, involvement in activity, involvement in evaluation and social economic condition of village community. Data were processed using descriptive an regression analysis. The result showed that availability of UPS-AB involvement in decision making, involvement in activities, involvement in evaluation and social-economic condition of village community positively affected community participation in potable water management.

Evaluation of available analytical techniques for monitoring the quality of space station potable water

Science.gov (United States)

Geer, Richard D.

1989-01-01

To assure the quality of potable water (PW) on the Space Station (SS) a number of chemical and physical tests must be conducted routinely. After reviewing the requirements for potable water, both direct and indirect analytical methods are evaluated that could make the required tests and improvements compatible with the Space Station operation. A variety of suggestions are made to improve the analytical techniques for SS operation. The most important recommendations are: (1) the silver/silver chloride electrode (SB) method of removing I sub 2/I (-) biocide from the water, since it may interfere with analytical procedures for PW and also its end uses; (2) the orbital reactor (OR) method of carrying out chemistry and electrochemistry in microgravity by using a disk shaped reactor on an orbital table to impart artificial G force to the contents, allowing solution mixing and separation of gases and liquids; and (3) a simple ultra low volume highly sensitive electrochemical/conductivity detector for use with a capillary zone electrophoresis apparatus. It is also recommended, since several different conductivity and resistance measurements are made during the analysis of PW, that the bipolar pulse measuring circuit be used in all these applications for maximum compatibility and redundancy of equipment.

Distribution of sequence-based types of legionella pneumophila serogroup 1 strains isolated from cooling towers, hot springs, and potable water systems in China.

Science.gov (United States)

Qin, Tian; Zhou, Haijian; Ren, Hongyu; Guan, Hong; Li, Machao; Zhu, Bingqing; Shao, Zhujun

2014-04-01

Legionella pneumophila serogroup 1 causes Legionnaires' disease. Water systems contaminated with Legionella are the implicated sources of Legionnaires' disease. This study analyzed L. pneumophila serogroup 1 strains in China using sequence-based typing. Strains were isolated from cooling towers (n = 96), hot springs (n = 42), and potable water systems (n = 26). Isolates from cooling towers, hot springs, and potable water systems were divided into 25 sequence types (STs; index of discrimination [IOD], 0.711), 19 STs (IOD, 0.934), and 3 STs (IOD, 0.151), respectively. The genetic variation among the potable water isolates was lower than that among cooling tower and hot spring isolates. ST1 was the predominant type, accounting for 49.4% of analyzed strains (n = 81), followed by ST154. With the exception of two strains, all potable water isolates (92.3%) belonged to ST1. In contrast, 53.1% (51/96) and only 14.3% (6/42) of cooling tower and hot spring, respectively, isolates belonged to ST1. There were differences in the distributions of clone groups among the water sources. The comparisons among L. pneumophila strains isolated in China, Japan, and South Korea revealed that similar clones (ST1 complex and ST154 complex) exist in these countries. In conclusion, in China, STs had several unique allelic profiles, and ST1 was the most prevalent sequence type of environmental L. pneumophila serogroup 1 isolates, similar to its prevalence in Japan and South Korea.

Development and Optimum Composition of Locally Developed Potable Water Treatment Tablets

Directory of Open Access Journals (Sweden)

Josiah Oladele BABATOLA

2009-07-01

Full Text Available Current high level of energy cost and operational cost of membrane technologies and couple with difficulties in obtaining chemicals for potable water treatment give rooms for development of local substance and low cost adsorbents for water treatment. This paper presents a follow-up study on an earlier work in which some water treatment Tablets were produced and tested. The current work was directed at establishing the optimum composition of the tablets. Alum, calcium hypochlorite and lime were combined in proportion and made into pastes and tablets. Residual chlorine contents of the tablets were determined. The quality of stream water samples treated with the tablets was measured by chlorine content, pH and turbidity removal. It is concluded that the best composition is one part alum, two parts hypochlorite and three parts lime and this produced treated water pH of 7.8, chlorine residual of 5.0 mg/l and settled water turbidity 3.0 NTU. The product is aimed for use in rural communities to reduce rampaging death from water borne diseases.

Energy saving in the pumping of drinking water, Municipality of San Felipe, Guanajuato; Ahorro de energia electrica en bombeo de agua potable, en el municipio de San Felipe, Gto.

Energy Technology Data Exchange (ETDEWEB)

Gamiz Sanchez, Lorenzo [Applied Technology Center de Mexico, S.A. de C.V. (Mexico)

2006-01-15

This paper shows the results attained in energy saving through a project of potable water pumping, which took an investment of $433,043.00 and an internal rate of return of 126%. This project puts into evidence that it is possible to reduce between 15 and 30% of the total invoicing for energy consumption in potable water pumping if an equipment of poor efficiency is replaced by another of high efficiency. The project was requested by the Guanajuato's State Water Comision and the Municipal Bureau of Sewage and Potable Water, with the double intention of reducing the energy consumption along with the corresponding invoicing and incrementing the output of the wells in order to improve the potable water supply. In the site two high efficiency submersible motor-pumps were installed previously to the energy diagnosis that triggered profitable operation results and a convenient invoicing. [Spanish] Se documentan los resultados obtenidos en un proyecto de ahorro de energia en el bombeo de agua potable realizado con una inversion de $433,043.00 y con una tasa interna de retorno de 126%. Este proyecto pone en evidencia que es posible reducir entre el 15 y 30% de la facturacion total por consumo de energia electrica en el bombeo de agua potable si se sustituye un equipo poco eficiente por otro de alta eficiencia. El proyecto fue solicitado por la Comision Estatal del Agua de Guanajuato y la Junta Municipal de Agua Potable y Alcantarillado del municipio, con un doble proposito, reducir el consumo de energia junto con la facturacion correspondiente e incrementar la capacidad de produccion de los pozos con la intencion de mejorar el abasto de agua potable. En el lugar se instalaron dos motobombas sumergibles de alta eficiencia previo diagnostico energetico que desencadenaron rentables resultados operativos y de facturacion.

Remediation of ultra low level of transuranics from potable water using hybrid materials

International Nuclear Information System (INIS)

Singhal, R.K.; Basu, H.; Reddy, A.V.R.

2015-01-01

In case of nuclear accidents like Daiichi Nuclear Power Plant (NPP) Fukushima, Japan (11 March, 2011) and nuclear accidents like Chernobyl, USSR (March, 1986), where large amount of activity spread in public domain necessitate the need of development of new material which can efficiently remove transuranic from potable water without disturbing its water quality. Three different types of natural sorbents were developed using natural siliceous material, sodium alginate and impregnation of goethite in alginate matrix. Experiments were carried out for decontamination of americium and plutonium by using Calcium Alginate (Cal-Alg) and Goethite impregnated Cal-Alg (Geo-Cal-Alg) respectively

Incidental potable water reuse in a Catalonian basin: living downstream

Directory of Open Access Journals (Sweden)

R. Mujeriego

2017-09-01

Full Text Available A preliminary assessment of incidental potable water reuse (IPR in the Llobregat River basin has been conducted by estimating the dilution factor of treated effluent discharges upstream of six river flow measurement sections. IPR in the Llobregat River basin is an everyday occurrence, because of the systematic discharge of treated effluents upstream of river sections used as drinking water sources. Average river flows at the Sant Joan Despí measurement section increased from 400,000 m3/d (2007 to 864,000 m3/d (2008 and to 931,000 m3/d (2013, while treated effluent discharges upstream of that section ranged from 109,000 m3/d to 114,000 m3/d in those years. The highest degree of IPR occurs downstream of the Abrera and Sant Joan Despí flow measurement sections, from where about half of the drinking water supplied to the Barcelona Metropolitan Area is abstracted. Based on average annual flows, the likelihood that drinking water produced from that river stretch contained treated effluent varied from 25% (2007 to 13% (2008 and to 12% (2013. Water agencies and drinking water production utilities have strived for decades to ensure that drinking water production satisfies applicable quality requirements and provides the required public health protection.

International Space Station (ISS) Potable Water Dispenser (PWD) Beverage Adapter (BA) Redesign

Science.gov (United States)

Edgerly, Rachel; Benoit, Jace; Shindo, David

2012-01-01

The Potable Water Dispenser used on the International Space Station (ISS) interfaces with food and drink packages using the Beverage Adapter and Needle. Unexpected leakage has been seen in this interface. The Beverage Adapter used on ]orbit was returned to the ground for Test, Teardown, and Evaluation. The results of that investigation prompted a redesign of the Beverage Adapter and Needle. The Beverage Adapter materials were changed to be more corrosion resistant, and the Needle was redesigned to preclude leakage. The redesigns have been tested and proven.

Efficacy of various chemical disinfectants on biofilms formed in spacecraft potable water system components.

Science.gov (United States)

Wong, Wing C; Dudinsky, Lynn A; Garcia, Veronica M; Ott, Charlie M; Castro, Victoria A

2010-07-01

As the provision of potable water is critical for successful habitation of the International Space Station (ISS), life support systems were installed in December 2008 to recycle both humidity from the atmosphere and urine to conserve available water in the Station. In-flight pre-consumption testing from the dispensing needle at the Potable Water Dispenser (PWD) indicated that bacterial concentrations exceeded the current ISS specifications of 50 colony-forming units (CFU) ml(-1). Subsequent investigations revealed that a corrugated stainless steel flex hose upstream of the dispensing needle in the PWD was filled with nonsterile water and left at room temperature for more than 1 month before launch. To simulate biofilm formation that was suspected in the flight system, sterile flex hoses were seeded with a consortium of bacterial isolates previously recovered from other ISS water systems, including Ralstonia pickettii, Burkholderia multivorans, Caulobacter vibrioides, and Cupriavidus pauculus. After incubation for 5 days, the hoses were challenged with various chemical disinfectants including hydrogen peroxide (H2O2), colloidal silver, and buffered pH solutions to determine the ability of the disinfectants to decrease and maintain bacterial concentrations below ISS specifications. The disinfection efficacy over time was measured by collecting daily heterotrophic plate counts after exposure to the disinfectants. A single flush with either 6% H2O2 solution or a mixture of 3% H2O2 and 400 ppb colloidal silver effectively reduced the bacterial concentrations to <1 CFU ml(-1) for a period of up to 3 months.

Potential for nuclear desalination as a source of low cost potable water in North Africa

International Nuclear Information System (INIS)

1996-11-01

Based on the limited regional water resources and in recognizing the possible role of nuclear energy in seawater desalination, the five North African Countries (NACs): Algeria, Egypt, Libya, Morocco and Tunisia submitted a request to the IAEA in 1990 for assistance in carrying out a feasibility study on the use of nuclear energy for seawater desalination in some pre-selected sites in these countries to cover their medium- and long-term needs for economical potable water. The present report has been prepared and is presented to the NACs in response to their request. It contains an assessment of the regional specific aspects, the available technical options with respect to desalination processes and energy sources, the cost evaluation of various technical options for the production of desalinated water, as well as the financial constraints and options, and finally the necessary steps needed to ensure the successful implementation of a nuclear desalination programme. The report also complements other work of the IAEA in the field of nuclear desalination, carried out in response to various resolutions of the IAEA General Conferences since 1989, namely: ''Use of Nuclear Reactors for Seawater Desalination'', IAEA-TECDOC-574 (1990) and ''Technical and Economic Evaluation of Potable Water Production through Desalination of Seawater by using Nuclear Energy and Other Means'', IAEA-TECDOC-666 (1992). 105 refs, 39 figs, tabs

Potential for nuclear desalination as a source of low cost potable water in North Africa

Energy Technology Data Exchange (ETDEWEB)

NONE

1996-11-01

Based on the limited regional water resources and in recognizing the possible role of nuclear energy in seawater desalination, the five North African Countries (NACs): Algeria, Egypt, Libya, Morocco and Tunisia submitted a request to the IAEA in 1990 for assistance in carrying out a feasibility study on the use of nuclear energy for seawater desalination in some pre-selected sites in these countries to cover their medium- and long-term needs for economical potable water. The present report has been prepared and is presented to the NACs in response to their request. It contains an assessment of the regional specific aspects, the available technical options with respect to desalination processes and energy sources, the cost evaluation of various technical options for the production of desalinated water, as well as the financial constraints and options, and finally the necessary steps needed to ensure the successful implementation of a nuclear desalination programme. The report also complements other work of the IAEA in the field of nuclear desalination, carried out in response to various resolutions of the IAEA General Conferences since 1989, namely: ``Use of Nuclear Reactors for Seawater Desalination``, IAEA-TECDOC-574 (1990) and ``Technical and Economic Evaluation of Potable Water Production through Desalination of Seawater by using Nuclear Energy and Other Means``, IAEA-TECDOC-666 (1992). 105 refs, 39 figs, tabs.

Availability of uranium present in the sludge generated at two stations of potable water treatment; Disponibilidad del uranio presente en el fango generado en dos estaciones de tratamiento de agua potable

Energy Technology Data Exchange (ETDEWEB)

Munoz-Serrano, A.; Baeza, A.; Salas, A.; Guillen, J.

2013-07-01

During the treatment is carried out in a Station Potable Water Treatment Plant sludge enriched are produced in components that have been removed from the water. The concentration and availability of radionuclides accumulated in a sludge during coagulation-flocculation will condition possible later use, so it is essential to carry out the characterization of sludge and its chemical speciation. (Author)

Inhibition of Copper Pitting Corrosion in Aggressive Potable Waters

Directory of Open Access Journals (Sweden)

Emily Sarver

2012-01-01

Full Text Available Copper pitting corrosion can lead to premature plumbing failures, and can be caused by aggressive potable waters characterized by high pH, free chlorine residual and low alkalinity. In such waters and under continuous flow, certain inhibitors including phosphate, silica or natural organic matter may greatly reduce pitting occurrence. In the current work, 1 mg/L phosphate (as P completely prevented initiation of pits, and 5 mg/L silica (as Si significantly decelerated pitting. However, much lower doses of these inhibitors had little benefit and actually accelerated the rate of attack in some cases. Effects of organic matter were dependent on both the type (e.g., natural versus ozonated humic substances and dosage. Dose-response effects of free chlorine and alkalinity were also investigated. Based on electrochemical data, pits initiated more rapidly with increased free chlorine, but even moderate levels of chlorine (~0.4 mg/L eventually caused severe pitting. High alkalinity decreased pit propagation rates but did not prevent pit formation.

The provision of potable water in eradication of Guinea worm infection in Ezza North, Southeastern, Nigeria.

Science.gov (United States)

Ede, Alison Okorie; Nwaokoro, Joakin Chidozie; Iwuala, C C; Amadi, A N; Akpelu, Ugochinyere Alvana

2014-10-01

Guinea worm is a parasite found in unprotected drinking water sources, causes considerable morbidity and loss of agricultural production among rural people. The study was to determine the current status of Guinea worm infection in Ezza North and to evaluate the impact of control measures on guinea worm infection. A total of 200 individuals in Ezza North Southeastern, Nigeria were examined for guinea worm infection. A standardized questionnaire was used to determine the effect of potable water on guinea worm eradication/control, the source of drinking water, information on the knowledge, attitude, symptom management practices, availability of health facilities and boreholes installation status. The instrument for data collection was well constructed, validated and reliable tested questionnaire by an expert. Data obtained was analyzed using Epi-Info model 3.4 versions. Results of a study indicated majority of the respondents 195 (97.5 %) have access to safe drinking water supply which indicated no case of Guinea worm infection. The active use of potable water supply was found among the age group of 20-30 years 71 (35.5 %) and higher in male (57.5 %) than females (42.5 %). The drastic reduction of Guinea worm infection to zero (0) level in Ezza North were due to multiple factors as health education, availability of functional boreholes, presence of health centers for immediate treatment if any case discovered.

The role of pesticide fate modelling in a prevention-led approach to potable water quality management

Science.gov (United States)

Dolan, Tom; Pullan, Stephanie; Whelan, Mick; Parsons, David

2013-04-01

Diffuse inputs from agriculture are commonly the main source of pesticide contamination in surface water and may have implications for the quality of treated drinking water. After privatisation in 1991, UK water companies primarily focused on the provision of sufficient water treatment to reduce the risk of non-compliance with the European Drinking Water Directive (DWD), under which all pesticide concentrations must be below 0.1µg/l and UK Water Supply Regulations for the potable water they supply. Since 2000, Article 7 of the Water Framework Directive (WFD) has begun to drive a prevention-led approach to compliance with the DWD. As a consequence water companies are now more interested in the quality of 'raw' (untreated) water at the point of abstraction. Modelling (based upon best available estimates of cropping, pesticide use, weather conditions, pesticide characteristics, and catchment characteristics) and monitoring of raw water quality can both help to determine the compliance risks associated with the quality of this 'raw' water resource. This knowledge allows water companies to prioritise active substances for action in their catchments, and is currently used in many cases to support the design of monitoring programmes for pesticide active substances. Additional value can be provided if models are able to help to identify the type and scale of catchment management interventions required to achieve DWD compliance for pesticide active substances through pollution prevention at source or along transport pathways. These questions were explored using a simple catchment-scale pesticide fate and transport model. The model employs a daily time-step and is semi-lumped with calculations performed for soil type and crop combinations, weighted by their proportions within the catchment. Soil properties are derived from the national soil database and the model can, therefore, be applied to any catchment in England and Wales. Various realistic catchment management

TECHNIQUES FOR POTABLE WATER TREATMENT USING APPROPRIATE LOW COST NATURAL MATERIALS IN THE TROPICS

Directory of Open Access Journals (Sweden)

Sila Onesmus Nzung’a

2013-04-01

Full Text Available The effectiveness of mechanical filtration and solar irradiation in water treatment was evaluated. Selected metals and non-metals ions before and after treatment were determined colorimetrically while turbidity was measured using a turbidimeter. pH, electrical conductivity, dissolved oxygen (DO and temperature were measured using a portable universal multiline P4 WTW meter while total alkalinity was determined titrimetrically. The load of coliform bacteria contamination before and after treatment was determined by Millipore filtration method. Screening for the presence of pathogenic bacteria was carried out using standard methods. The levels of the properties before and after treatment were each compared with the recommended drinking water standards according to Kenya Bureau of Standards (KEBS and World Health Organization (WHO. The water was treated by being subjected to mechanical filtration and solar irradiation and changes in their physico-chemical properties and bacteriological load determined. The results obtained after treatment revealed that solar irradiation killed most of the pathogenic bacteria after exposure for eight hours but had no impact on the physico-chemical properties except nitrates (from 24.5 to 8.0 mg.L-1. Mechanical filtration reduced total coliforms and E. coli by 30 %. It also reduced the loads of Zn, Cu, Mn, Pb, Fe, nitrate nitrogen and turbidity of the water treated to an almost potable state. Water treatment using a combination of mechanical filtration system and solar disinfection was found to be very effective in reducing the bacterial load.

Hydrogeochemical evolution and potability evaluation of saline ...

Indian Academy of Sciences (India)

the coastal aquifer system of Rajnagar block, Kendrapara district, Odisha, India. The research ... as well as policy making decisions. As a part of ... alluvial aquifers of Rajnagar block from a water potability .... Materials and methodology.

Removal of trace metal contaminants from potable water by electrocoagulation

Science.gov (United States)

Heffron, Joe; Marhefke, Matt; Mayer, Brooke K.

2016-06-01

This study investigated the effects of four operational and environmental variables on the removal of trace metal contaminants from drinking water by electrocoagulation (EC). Removal efficiencies for five metals (arsenic, cadmium, chromium, lead and nickel) were compared under varying combinations of electrode material, post-treatment, water composition and pH. Iron electrodes out-performed aluminum electrodes in removing chromium and arsenic. At pH 6.5, aluminum electrodes were slightly more effective at removing nickel and cadmium, while at pH 8.5, iron electrodes were more effective for these metals. Regardless of electrode, cadmium and nickel removal efficiencies were higher at pH 8.5 than at pH 6.5. Post-EC treatment using membrane filtration (0.45 μm) enhanced contaminant removal for all metals but nickel. With the exception of lead, all metals exhibited poorer removal efficiencies as the ionic strength of the background electrolyte increased, particularly in the very high-solids synthetic groundwaters. Residual aluminum concentrations were lowest at pH 6.5, while iron residuals were lowest in low ionic strength waters. Both aluminum and iron residuals required post-treatment filtration to meet drinking water standards. EC with post-treatment filtration appears to effectively remove trace metal contaminants to potable water standards, but both reactor and source water parameters critically impact removal efficiency.

Dioxins, Furans and PCBs in Recycled Water for Indirect Potable Reuse

Directory of Open Access Journals (Sweden)

Clemencia Rodriguez

2008-12-01

Full Text Available An assessment of potential health impacts of dioxin and dioxin-like compounds in recycled water for indirect potable reuse was conducted. Toxic equivalency factors (TEFs for 2,3,7,8-substituted polychlorinated dibenzo-p-dioxins (PCDD and dibenzofurans (PCDFs and dioxin-like polychlorinated biphenyls (PCBs congeners have been developed by the World Health Organization to simplify the risk assessment of complex mixtures. Samples of secondary treated wastewater in Perth, Australia were examined pre-and post-tertiary treatment in one full-scale and one pilot water reclamation plant. Risk quotients (RQs were estimated by expressing the middle-bound toxic equivalent (TEQ and the upper-bound TEQ concentration in each sampling point as a function of the estimated health target value. The results indicate that reverse osmosis (RO is able to reduce the concentration of PCDD, PCDF and dioxin-like PCBs and produce water of high quality (RQ after RO=0.15. No increased human health risk from dioxin and dioxin-like compounds is anticipated if highly treated recycled water is used to augment drinking water supplies in Perth. Recommendations for a verification monitoring program are offered.

Dioxins, Furans and PCBs in Recycled Water for Indirect Potable Reuse

Science.gov (United States)

Rodriguez, Clemencia; Cook, Angus; Devine, Brian; Van Buynder, Paul; Lugg, Richard; Linge, Kathryn; Weinstein, Philip

2008-01-01

An assessment of potential health impacts of dioxin and dioxin-like compounds in recycled water for indirect potable reuse was conducted. Toxic equivalency factors (TEFs) for 2,3,7,8-substituted polychlorinated dibenzo-p-dioxins (PCDD) and dibenzofurans (PCDFs) and dioxin-like polychlorinated biphenyls (PCBs) congeners have been developed by the World Health Organization to simplify the risk assessment of complex mixtures. Samples of secondary treated wastewater in Perth, Australia were examined pre-and post-tertiary treatment in one full-scale and one pilot water reclamation plant. Risk quotients (RQs) were estimated by expressing the middle-bound toxic equivalent (TEQ) and the upper-bound TEQ concentration in each sampling point as a function of the estimated health target value. The results indicate that reverse osmosis (RO) is able to reduce the concentration of PCDD, PCDF and dioxin-like PCBs and produce water of high quality (RQ after RO=0.15). No increased human health risk from dioxin and dioxin-like compounds is anticipated if highly treated recycled water is used to augment drinking water supplies in Perth. Recommendations for a verification monitoring program are offered. PMID:19151430

Preliminary studies on membrane filtration for the production of potable water: a case of Tshaanda rural village in South Africa.

Science.gov (United States)

Molelekwa, Gomotsegang F; Mukhola, Murembiwa S; Van der Bruggen, Bart; Luis, Patricia

2014-01-01

Ultrafiltration (UF) systems have been used globally for treating water from resources including rivers, reservoirs, and lakes for the production of potable water in the past decade. UF membranes with a pore size of between 0.1 and 0.01 micrometres provide an effective barrier for bacteria, viruses, suspended particles, and colloids. The use of UF membrane technology in treating groundwater for the supply of potable water in the impoverished and rural village, Tshaanda (i.e., the study area) is demonstrated. The technical and administrative processes that are critical for the successful installation of the pilot plant were developed. Given the rural nature of Tshaanda, the cultural and traditional protocols were observed. Preliminary results of the water quality of untreated water and the permeate are presented. Escherichia coli in the untreated water during the dry season (i.e., June and July) was 2 cfu/100 ml and was 2419.2 cfu/100 ml) before UF. Following UF, it dramatically reduced to acceptable level (7 cfu/100 ml) which is within the WHO recommended level of water for suspended particles and colloids. Considering these data, it can be concluded that the water is suitable for human consumption, following UF.

Determination of total inorganic arsenic in potable water through spectroscopy of atomic absorption with generation of hydride

International Nuclear Information System (INIS)

Rodriguez Roman, S.

1997-01-01

This study developed a method for the cuantitative analysis of arsenic in potable water , through the spectrophotometric technique of atomic absorption. It used an automatic system of injection of flux for the generation of hydrides. It studied the effect produced by reducer agents, in the prereduction of arsenic in water, obtaining the best result with the use of potasium iodide 1.5% and ascorbic acid 0.25% in hydrochloric acid 3.7%, for the direct determination of total inorganic arsenic. It observed the effect produced by cadmium and selenium to the half of the concentration of arsenic, chromium, lead and silver at the same concentration, and barium at a ten times higher concentration, in the recuperation of total inorganic arsenic. It also used sodium borohydride 0.3% in sodium hydroxide 0.05% (5mL/min), for the formation of the volatile hydrides. It used hydrochloric acid 3.7% (12 mL/min) as disolution of transport; argon as inert gas, and a flame air-acetylene, for the atomization of the hydrides. This method was applied to 19 samples of potable water, and the result was no detectable for all of them. (S. Grainger)

Radon concentration measurements in waters in Greece and Cyprus

International Nuclear Information System (INIS)

Louizi, A.; Nikolopoulos, D.; Tzortzi, A.; Thanassas, D.; Serefoglou, A.; Georgiou, E.; Vogiannis, E.; Koukouliou, V.

2004-01-01

A total of 35 measurements in Greece and 15 in Cyprus were performed. Radon concentrations in drinking water in Greece were from (1.1±0.5) to (410±50) Bq/L. The corresponding concentrations in underground potable waters in Cyprus ranged between (0.4±0.3) Bq/L and (15±4) Bq/L. High concentrations, viz. (120±20), (320±40) and (410±50) Bq/L, were observed in three samples collected from the city of Arnea Chalkidekis in northern Greece. One water sample from Lesvos Island (north-eastern part of Greece) exhibited a radon concentration of (140±20) Bq/L. Six samples of hot spring water from the city of Loutraki (Attica prefecture), characterized as 'medicinal drinking water', contained concentrations of radon between (220±10) and (340±20) Bq/L. Radon concentrations in potable and non-potable underground water in Greece and Cyprus ranged between (0.4±0.3) and (15±4) Bq/L, whereas in surface water the range was from (2.7±0.8) to (24±6) Bq/L. (P.A.)

Chemical Characterization and Identification of Organosilicon Contaminants in ISS Potable Water

Science.gov (United States)

Straub, John E., II; Plumlee, Debrah K.; Gazda, Daniel B.

2016-01-01

2015 marked the 15th anniversary of continuous human presence on board the International Space Station. During the past year crew members from Expeditions 42-46, including two participating in a one-year mission, continued to rely on reclaimed water as their primary source of potable water. This paper presents and discusses results from chemical analyses performed on ISS water samples returned in 2015. Since the U.S. water processor assembly (WPA) became operational in 2008, there have been 5 instances of organic contaminants breaking through the treatment process. On each occasion, the breakthrough was signaled by an increase in the total organic carbon (TOC) concentration in the product water measured by the onboard TOC analyzer (TOCA). Although the most recent TOC rise in 2015 was not unexpected, it was the first time where dimethylsilanediol (DMSD) was not the primary compound responsible for the increase. Results from ground analysis of a product water sample collected in June of 2015 and returned on Soyuz 41 showed that DMSD only accounted for 10% of the measured TOC. After considerable laboratory investigation, the compound responsible for the majority of the TOC was identified as monomethysilanetriol (MMST). MMST is a low-toxicity compound that is structurally similar to DMSD.

Bacteriological Quality and Antibiogram of Isolates from Potable ...

African Journals Online (AJOL)

ADOWIE PERE

Bacteriological Quality and Antibiogram of Isolates from Potable Water Sources in ... microbial analysis revealed a faecal contamination of the groundwater, making it unfit for drinking ... Recent studies shows the proliferation of emerging.

Quorum Sensing Activity of Mesorhizobium sp. F7 Isolated from Potable Water

Directory of Open Access Journals (Sweden)

Pei-Ling Yong

2014-01-01

Full Text Available We isolated a bacterial isolate (F7 from potable water. The strain was identified as Mesorhizobium sp. by 16S rDNA gene phylogenetic analysis and screened for N-acyl homoserine lactone (AHL production by an AHL biosensor. The AHL profile of the isolate was further analyzed using high resolution triple quadrupole liquid chromatography mass spectrometry (LC/MS which confirmed the production of multiple AHLs, namely, N-3-oxo-octanoyl-L-homoserine lactone (3-oxo-C8-HSL and N-3-oxo-decanoyl-L-homoserine lactone (3-oxo-C10-HSL. These findings will open the perspective to study the function of these AHLs in plant-microbe interactions.

Point-of-care controls for nosocomial legionellosis combined with chlorine dioxide potable water decontamination: a two-year survey at a Welsh teaching hospital.

Science.gov (United States)

Hosein, I K; Hill, D W; Tan, T Y; Butchart, E G; Wilson, K; Finlay, G; Burge, S; Ribeiro, C D

2005-10-01

This study reports a two-year programme of attempted eradication of Legionella colonization in the potable water supply of a 1000-bed tertiary care teaching hospital in Wales. There was a simultaneous, point-of-care, sterile-water-only policy for all intensive care units (ICU) and bone marrow and renal transplant units in order to prevent acquisition of nosocomial Legionnaires' disease. The programme was initiated following a case of nosocomial pneumonia caused by Legionella pneumophila serogroup 1-Bellingham-like genotype A on the cardiac ICU. The case occurred 14 days after mitral and aortic valve replacement surgery. Clinical and epidemiological investigations implicated aspiration of hospital potable water as the mechanism of infection. Despite interventions with chlorine dioxide costing over 25000 UK pounds per annum, Legionella has remained persistently present in significant numbers (up to 20000 colony forming units/L) and with little reduction in the number of positive sites. Two further cases of nosocomial disease occurred over the following two-year period; in one case, aspiration of tap water was implicated again, and in the other case, instillation of contaminated water into the right main bronchus via a misplaced nasogastric tube was implicated. These cases arose because of inadvertent non-compliance with the sterile-water-only policy in high-risk locations. Enhanced clinical surveillance over the same two-year period detected no other cases of nosocomial disease. This study suggests that attempts at eradication of Legionella spp. from complex water systems may not be a cost-effective measure for prevention of nosocomial infections, and to the best of our knowledge is the first study from the UK to suggest that the introduction of a sterile-water-only policy for ICUs and other high-risk units may be a more cost-effective approach.

Variations in uranium and radioactivity levels in surface and ground water at selected sites in British Columbia, April 1980 - March 1981

International Nuclear Information System (INIS)

1981-07-01

This report summarizes field and analytical work carried out between April, 1980 and March, 1981 on a program to investigate uranium and radioactivity levels in potable surface and ground water in selected regions throughout British Columbia

Development of a separate tank with an electrolysis-dependent bacteria controlling system for the long term storage of potable water.

Science.gov (United States)

Ishizuka, Akinori; Tanji, Masataka; Hayashi, Nobuatsu; Wakabayashi, Akihiro; Tatsumoto, Hideki; Hotta, Kunimoto

2006-12-01

For the long term storage of tap water, we developed a separate type of tank (5 m3) equipped with an electrolysis system to control bacterial growth. The electrolysis conditions using 20A direct current and a water flow rate of 10 L/min were capable of producing available chlorine (AC) at the rate of 5-8mg/min and raising the AC level of the stored tap water by about 0.2 mg/kg within 20-30 min The electrolyzed tap water with 0.2 mg/kg AC showed a capability per ml of killing 10(5)-10(6) cfu of bacteria such as Escherichia coli and Pseudomonas aeruginosa within 15 sec. A 6-month trial operation of the storage system with an automatic electrolysis control to keep AC level ranging 0.2-0.4 mg/kg demonstrated that the system worked well for the stored tap water in suppressing bacterial growth as well as in keeping good potable quality with reference to the 46 parameters specified for Japanese tap water. Actually, the electrolysis treatment was administered intermittently with an interval of about two weeks. Thus we believe the developed system has good potential to secure a potable water supply not only in the occasion of emergencies but also in countries having problems in the supply of safe drinking water.

Environmental transport and fate of endocrine disruptors from non-potable reuse of municipal wastewater

Energy Technology Data Exchange (ETDEWEB)

Hudson, B; Beller, H; Bartel, C M; Kane, S; Campbell, C; Grayson, A; Liu, N; Burastero, S

2005-11-16

This project was designed to investigate the important but virtually unstudied topic of the subsurface transport and fate of Endocrine Disrupting Compounds (EDCs) when treated wastewater is used for landscape irrigation (non-potable water reuse). Although potable water reuse was outside the scope of this project, the investigation clearly has relevance to such water recycling practices. The target compounds, which are discussed in the following section and include EDCs such as 4-nonylphenol (NP) and 17{beta}-estradiol, were studied not only because of their potential estrogenic effects on receptors but also because they can be useful as tracers of wastewater residue in groundwater. Since the compounds were expected to occur at very low (part per trillion) concentrations in groundwater, highly selective and sensitive analytical techniques had to be developed for their analysis. This project assessed the distributions of these compounds in wastewater effluents and groundwater, and examined their fate in laboratory soil columns simulating the infiltration of treated wastewater into an aquifer (e.g., as could occur during irrigation of a golf course or park with nonpotable treated water). Bioassays were used to determine the estrogenic activity present in effluents and groundwater, and the results were correlated with those from chemical analysis. In vitro assays for estrogenic activity were employed to provide an integrated measure of estrogenic potency of environmental samples without requiring knowledge or measurement of all bioactive compounds in the samples. For this project, the Las Positas Golf Course (LPGC) in the City of Livermore provided an ideal setting. Since 1978, irrigation of this area with treated wastewater has dominated the overall water budget. For a variety of reasons, a group of 10 monitoring wells were installed to evaluate wastewater impacts on the local groundwater. Additionally, these wells were regularly monitored for tritium ({sup 3}H

Monitoring of Hazardous Inorganic Pollutants and Heavy Metals in Potable Water at the Source of Supply and Consumers end of a Tropical Urban Municipality

International Nuclear Information System (INIS)

Shah, A. B.; Singh, R. P.

2016-01-01

River water is not only an indispensable source for irrigation but also plays a vital role for drinking water supply for most of the urban municipalities. Water from rivers is pumped at specific sites and after treatment at municipal water treatment plants supplied as domestic potable water supply. The present study was undertaken to assess the suitability of Gomti river water at Gaughat being used as the source of water supply for Lucknow city and to evaluate post-treatment potable water quality at the consumer end by monitoring the levels of inorganic pollutants (nitrate, nitrite, ammonium and phosphate) and heavy metals. Municipal water supply at Gaughat showed marked variations in the levels of p H (7.13-8.63) and electrical conductivity (375.66-571.67μS/cm). The amount of nitrate, nitrite, ammonium and phosphate was observed 26.25, 0.082, 6.9 and 1.82 mg/l respectively at Gaughat. Also, the levels of heavy metals in the municipal water source at Gaughat varied significantly for Fe (0.33-1.65 mg/l), Cu (0.077-0.108 mg/l), Cd (0.03-0.052 mg/l), Pb (0.68-0.96 mg/l) and Cr (0.036-0.065 mg/l). Water at the user end was also contaminated as the concentration of analysed inorganic pollutants and heavy metals were correspondingly higher than observed at the source. While comparing potable water at the user end of Lucknow municipality with the BIS (Drinking Water Specifications) and WHO standards for drinking water, the concentration of all studied heavy metals and other inorganic contaminants were much above the permissible levels, thus posing a serious threat to the public health.

Minimal climate change impacts on natural organic matter forecasted for a potable water supply in Ireland.

Science.gov (United States)

O'Driscoll, Connie; Ledesma, José L J; Coll, John; Murnane, John G; Nolan, Paul; Mockler, Eva M; Futter, Martyn N; Xiao, Liwen W

2018-07-15

Natural organic matter poses an increasing challenge to water managers because of its potential adverse impacts on water treatment and distribution, and subsequently human health. Projections were made of impacts of climate change on dissolved organic carbon (DOC) in the primarily agricultural Boyne catchment which is used as a potable water supply in Ireland. The results indicated that excluding a potential rise in extreme precipitation, future projected loads are not dissimilar to those observed under current conditions. This is because projected increases in DOC concentrations are offset by corresponding decreases in precipitation and hence river flow. However, the results presented assume no changes in land use and highlight the predicted increase in DOC loads from abstracted waters at water treatment plants. Copyright © 2018. Published by Elsevier B.V.

Polygeneration microgrids: A viable solution in remote areas for supplying power, potable water and hydrogen as transportation fuel

International Nuclear Information System (INIS)

Kyriakarakos, George; Dounis, Anastasios I.; Rozakis, Stelios; Arvanitis, Konstantinos G.; Papadakis, George

2011-01-01

Highlights: → Polygeneration of power, hydrogen and potable water through desalination in remote areas. → Particle Swarm Optimization for the design of Polygeneration microgrid design with TRNSYS, GenOpt and TRNOPT. → Economic evaluation with Monte Carlo simulation for the calculation of NPV distribution. → Polygeneration microgrids are technically feasible and most likely financially profitable. -- Abstract: This paper presents the concept and the design of a hybrid renewable energy polygeneration microgrid along with its technical and economical evaluation. The energy of the sun and the wind is harvested by photovoltaics and a wind turbine. Besides that, the components of the microgrid include a battery bank, a Proton Exchange Membrane (PEM) fuel cell, a PEM electrolyzer, a metal hydride tank, a reverse osmosis desalination unit using energy recovery and a control system. The microgrid covers the electricity, transport and water needs and thus its products are power, hydrogen as transportation fuel and potable water through desalination. Hydrogen and the desalinated water also act as medium to long term seasonal storage. A design tool based on TRNSYS 16, GenOpt 2.0 and TRNOPT was developed using Particle Swarm Optimization method. The economic evaluation of the concept was based on the discounting cash flow approach. The Monte Carlo Simulation method was used in order to take uncertainty into account. A technically feasible polygeneration microgrid adapted to a small island is financially profitable with a probability of 90% for the present and 100% at the medium term.

Heat transmission systems for heating and potable water. New requirements and problem solutions for hygiene, safety and improved heat utilization. Waermeuebertragungssysteme fuer Heizung und Trinkwasser. Neue Anforderungen und Problemloesungen bezueglich Hygiene, Sicherheit und besserer Waermenutzung

Energy Technology Data Exchange (ETDEWEB)

Kremer, R

1989-10-01

In the past, additional demands were made on heat transmission systems regarding hygienic requirements in potable water heating plant for hospitals, hotels, sanatoriums and old-age homes, safety requirements to protect the potable water from the penetration of hazardous substances and requirements for improved heat utilization through return flow cooling and condensate cooling in the district heating. Where potable water heaters are concerned, safety radiators for heat transfer which comply with the requirements of DIN 1988 Part 2 and Part 4, as well as water heaters with permanent disinfection which are legionnaires' disease-proof, are now available for use in hospitals, old age homes and sanatoriums. For the district heating sector, improved range systems with low concentration in the hot water sector as well as condensate heat utilizing systems have been further developed in the steam heating sector. (orig.).

Nano-Pervaporation Membrane with Heat Exchanger Generates Medical-Grade Water

Science.gov (United States)

Tsai, Chung-Yi; Alexander, Jerry

2009-01-01

A nanoporous membrane is used for the pervaporation process in which potable water is maintained, at atmospheric pressure, on the feed side of the membrane. The water enters the non-pervaporation (NPV) membrane device where it is separated into two streams -- retentate water and permeated water. The permeated pure water is removed by applying low vapor pressure on the permeate side to create water vapor before condensation. This permeated water vapor is subsequently condensed by coming in contact with the cool surface of a heat exchanger with heat being recovered through transfer to the feed water stream.

Measuring water ingestion from spray exposures.

Science.gov (United States)

Sinclair, Martha; Roddick, Felicity; Nguyen, Thang; O'Toole, Joanne; Leder, Karin

2016-08-01

Characterisation of exposure levels is an essential requirement of health risk assessment; however for water exposures other than drinking, few quantitative exposure data exist. Thus, regulatory agencies must use estimates to formulate policy on treatment requirements for non-potable recycled water. We adapted the use of the swimming pool chemical cyanuric acid as a tracer of recreational water ingestion to permit detection of small water volumes inadvertently ingested from spray exposures. By using solutions of 700-1000 mg/L cyanuric acid in an experimental spray exposure scenario, we were able to quantify inadvertent water ingestion in almost 70% of participants undertaking a 10 min car wash activity using a high pressure spray device. Skin absorption was demonstrated to be negligible under the experimental conditions, and the measured ingestion volumes ranged from 0.06 to 3.79 mL. This method could be applied to a range of non-potable water use activities to generate exposure data for risk assessment processes. The availability of such empirical measurements will provide greater assurance to regulatory agencies and industry that potential health risks from exposure to non-potable water supplies are well understood and adequately managed to protect public health. Copyright © 2016 Elsevier Ltd. All rights reserved.

Heavy Metal Levels and Physico-Chemical Quality of Potable Water Supply in Warri, Nigeria

International Nuclear Information System (INIS)

Nduka, K.C.; Orisakwe, E.O.

2007-01-01

The interaction between man's activities and the environment is gaining world wide attention. Warri an oil producing community in Delta State of Nigeria is faced with environmental oil pollution. Since open and underground water bodies are regarded as final recipients of most environmental pollutants, this study sought to provide data on the levels of the physico-chemical parameters and contaminants in Warri metropolitan water supply. This study investigated the cadmium, lead and chromium using Atomic Absorption Spectrophotometer, physico - chemical properties such as pH, temperature, total suspended solid TSS, total dissolved solid TDS, electrical conductivity EC, biological oxygen demand BOD, dissolved oxygen DO, chemical oxygen demand COD, and total coliform count of potable water sources in Warri. Ekpan River was found to have 1.2 mg/L of cadmium, 1.0mg/L of chromium, 1.20 mg/L of lead and 2.0 mg/L of manganese. The heavy metals levels and the pollution parameters were lowest in the borehole water samples, except pH which is more acidic in borehole water samples and conductivity which is more in well water samples in all the sampling stations. Some of the parameters were above WHO standards

Evaluating exposure of pedestrians to airborne contaminants associated with non-potable water use for pavement cleaning.

Science.gov (United States)

Seidl, M; Da, G; Ausset, P; Haenn, S; Géhin, E; Moulin, L

2016-04-01

Climate change and increasing demography press local authorities to look after affordable water resources and replacement of drinking water for city necessities like street and pavement cleaning by more available raw water. Though, the substitution of drinking by non-drinking resources demands the evaluation of sanitary hazards. This article aims therefore to evaluate the contribution of cleaning water to the overall exposure of city dwellers in case of wet pavement cleaning using crossed physical, chemical and biological approaches. The result of tracer experiments with fluorescein show that liquid water content of the cleaning aerosol produced is about 0.24 g m(-3), rending possible a fast estimation of exposure levels. In situ analysis of the aerosol particles indicates a significant increase in particle number concentration and particle diameter, though without change in particle composition. The conventional bacterial analysis using total coliforms as tracer suggests that an important part of the contamination is issued from the pavement. The qPCR results show a more than 20-fold increase of background genome concentration for Escherichia coli and 10-fold increase for Enterococcus but a negligible contribution of the cleaning water. The fluorescence analysis of the cleaning aerosol confirms the above findings identifying pavement surface as the major contributor to aerosol organic load. The physical, chemical and microbiological approaches used make it possible to describe accurately the cleaning bioaerosol and to identify the existence of significantly higher levels of all parameters studied during the wet pavement cleaning. Though, the low level of contamination and the very short time of passage of pedestrian in the zone do not suggest a significant risk for the city dwellers. As the cleaning workers remain much longer in the impacted area, more attention should be paid to their chronic exposure.

Water security-National and global issues

Science.gov (United States)

Tindall, James A.; Campbell, Andrew A.

2010-01-01

Potable or clean freshwater availability is crucial to life and economic, environmental, and social systems. The amount of freshwater is finite and makes up approximately 2.5 percent of all water on the Earth. Freshwater supplies are small and randomly distributed, so water resources can become points of conflict. Freshwater availability depends upon precipitation patterns, changing climate, and whether the source of consumed water comes directly from desalination, precipitation, or surface and (or) groundwater. At local to national levels, difficulties in securing potable water sources increase with growing populations and economies. Available water improves living standards and drives urbanization, which increases average water consumption per capita. Commonly, disruptions in sustainable supplies and distribution of potable water and conflicts over water resources become major security issues for Government officials. Disruptions are often influenced by land use, human population, use patterns, technological advances, environmental impacts, management processes and decisions, transnational boundaries, and so forth.

Risk of post-fire metal mobilization into surface water resources: A review.

Science.gov (United States)

Abraham, Joji; Dowling, Kim; Florentine, Singarayer

2017-12-01

One of the significant economic benefits to communities around the world of having pristine forest catchments is the supply of substantial quantities of high quality potable water. This supports a saving of around US$ 4.1 trillion per year globally by limiting the cost of expensive drinking water treatments and provision of unnecessary infrastructure. Even low levels of contaminants specifically organics and metals in catchments when in a mobile state can reduce these economic benefits by seriously affecting the water quality. Contamination and contaminant mobility can occur through natural and anthropogenic activities including forest fires. Moderate to high intensity forest fires are able to alter soil properties and release sequestered metals from sediments, soil organic matter and fragments of vegetation. In addition, the increase in post-fire erosion rate by rainfall runoff and strong winds facilitates the rapid transport of these metals downslope and downstream. The subsequent metal deposition in distal soil and water bodies can influence surface water quality with potential impacts to the larger ecosystems inclusive of negative effects on humans. This is of substantial concern as 4 billion hectares of forest catchments provide high quality water to global communities. Redressing this problem requires quantification of the potential effects on water resources and instituting rigorous fire and environmental management plans to mitigate deleterious effects on catchment areas. This paper is a review of the current state of the art literature dealing with the risk of post-fire mobilization of the metals into surface water resources. It is intended to inform discussion on the preparation of suitable management plans and policies during and after fire events in order to maintain potable water quality in a cost-effective manner. In these times of climate fluctuation and increased incidence of fires, the need for development of new policies and management frameworks

Quality of Mount Etna groundwaters utilized for the potable supply

International Nuclear Information System (INIS)

Giammanco, G.; Giammanco, S.; Valenza, M.

1995-01-01

The groundwaters of many aquifers of Mt. Etna are naturally enriched in a number of elements that are present in the rocks making up the volcanic edifice. The concentrations of magnesium, iron and manganese in the waters from many wells and springs utilized for the potable supply of Catania and various other villages exceed the maximum admissible concentrations (CMA) fixed by the law n. 236 enacted in 1988. The literal observance of the law in force has led to the prohibition from drinking such waters, although the above-mentioned substances are not prejudicial to the health at the found concentrations. Further problems have arised from the presence of vanadium, even though no CMA has been fixed for this element. All this has provoked serious hardships to the population and risks to the health due to the reduced water delivery. In order to avoid such inconveniences, the revision of the law in force is necessary in all those geographical areas where are naturally rich in non toxic elements. For these elements is opportune that indicative and non prescriptive levels of acceptability were established instead of the CMA

Hydraulic Model for Drinking Water Networks, Including Household Connections; Modelo hidraulico para redes de agua potable con tomas domiciliarias

Energy Technology Data Exchange (ETDEWEB)

Guerrero Angulo, Jose Oscar [Universidad Autonoma de Sinaloa (Mexico); Arreguin Cortes, Felipe [Instituto Mexicano de Tecnologia del Agua, Jiutepec, Morelos (Mexico)

2002-03-01

This paper presents a hydraulic simulation model for drinking water networks, including elements that are currently not considered household connections, spatially variable flowrate distribution pipelines, and tee secondary network. This model is determined by solving the equations needed for a conventional model following an indirect procedure for the solution of large equations systems. Household connection performance is considered as dependent of water pressure and the way in which users operate the taps of such intakes. This approach allows a better a acquaintance with the drinking water supply networks performance as well as solving problems that demand a more precise hydraulic simulation, such as water quality variations, leaks in networks, and the influence of home water tanks as regulating devices. [Spanish] Se presenta un modelo de simulacion hidraulica para redes de agua potable en el cual se incluyen elementos que no se toman en cuenta actualmente, como las tomas domiciliarias, los tubos de distribucion con gastos espacialmente variado y la red secundaria, resolviendo el numero de ecuaciones que seria necesario plantear en un modelo convencional mediante un procedimiento indirecto para la solucion de grandes sistemas de ecuaciones. En las tomas domiciliarias se considera que su funcionamiento depende de las presiones y la forma en que los usuarios operan las llaves de las mismas. Este planteamiento permite conocer mejor el funcionamiento de las redes de abastecimiento de agua potable y solucionar problemas que requieren de una simulacion hidraulica mas precisa, como el comportamiento de la calidad del agua, las fugas en las redes y la influencia reguladora de los tinacos de las casas.

Potencial da economia de água potável pelo uso de água pluvial: análise de 40 cidades da Amazônia Potential for potable water savings by using rainwater: an analysis over 40 cities in Amazon

Directory of Open Access Journals (Sweden)

Jeferson Alberto de Lima

2011-09-01

Full Text Available A escassez de água é um problema cada vez mais severo em todo o mundo devido a fatores como o consumo excessivo de água bruta, as mudanas climáticas, a poluição da água e o consumo insustentável dos recursos hídricos. Sob essas condições, formas tradicionais ou alternativas de recursos hídricos, tais como a água pluvial, estão sendo consideradas como opções atrativas para reduzir o consumo de água potável. Neste contexto, este artigo descreve o cenário de disponibilidade de água na região Amazõnica, Noroeste do Brasil, e avalia o potencial da economia de água potável para o setor residencial em 40 cidades da região. Os resultados indicam que o potencial da economia de água potável varia entre 21 e 100%, dependendo da demanda de água potável verificada nas 40 cidades, com potencial médio de 76%. A prisncipal conclusão desta pesquisa é que, se houvesse um programa do governo para promover a economia de água potável por meio da utilização da água pluvial, haveria significativa economia de água potável e, consequentemente, a preservação dos recursos hídricos na Amazõnia.Water scarcity is an increasingly severe problem worldwide due to some factors, such as the excessive consumption of raw water, climate changes, water pollution, and unsustainable water resource consumption. Under these conditions, traditional or alternative forms of water resource, such as rainwater, are being considered as attractive options to reduce potable water consumption. In this context, this paper describes the water availability scenario in the Amazon region, Brazilian Northeast, and it evaluates the potential for potable water savings estimated for the residential sector of 40 cities in the region. Results indicate that the potential for potable water savings range from 21 to 100% depending on the potable water demand verified in the 40 cities, with an average potential for potable water savings of 76%. The main conclusion is

Water quality indexing for predicting variation of water quality over time

African Journals Online (AJOL)

PPoonoosamy

water, and expressing them to non-technical people may not always be easy. ... parameters for a case study; dissolved oxygen, pH, total coliforms, ... Several national agencies responsible for water supply and water pollution, have strongly .... good quality and required proper treatment if it were to be consumed as potable.

Retrofitting the potable water supply in Vira Gambarogno, Switzerland - Feasibility study of a small hydro power plant in the Muntin water reservoir; Risanamento dell'acquedotto Monti di Vira. Studio di fattibilita di recupero energetico al serbatoio Muntin

Energy Technology Data Exchange (ETDEWEB)

Mutti, M.

2008-07-01

This final report for the Swiss Federal Office of Energy describes the retrofitting project for the potable water supply in the municipality of Vira Gambarogno, Southern Switzerland. The current status of the scheme and three possible variants are presented, including the technical and financial aspects. In a second part of the report a feasibility study is reported on for the energetic use of the potable water falling down from the springs, located at 1040 m over sea level, and the Muntin water reservoir, located at 460 m about sea level. A small hydroelectric plant can be created at the entry of the reservoir, with an electric power of about 20 kW, depending on the variant considered. Estimated energy yield and cost figures are given.

Why chlorate occurs in potable water and processed foods: a critical assessment and challenges faced by the food industry.

Science.gov (United States)

Kettlitz, Beate; Kemendi, Gabriella; Thorgrimsson, Nigel; Cattoor, Nele; Verzegnassi, Ludovica; Le Bail-Collet, Yves; Maphosa, Farai; Perrichet, Aurélie; Christall, Birgit; Stadler, Richard H

2016-06-01

Recently, reports have been published on the occurrence of chlorate mainly in fruits and vegetables. Chlorate is a by-product of chlorinating agents used to disinfect water, and can be expected to be found in varying concentrations in drinking water. Data on potable water taken at 39 sampling points across Europe showed chlorate to range from foods of 0.01 mg kg(-1). This default MRL has now led to significant problems in the EU, where routinely disinfected water, used in the preparation of food products such as vegetables or fruits, leaves chlorate residues in excess of the default MRL, and in strict legal terms renders the food unmarketable. Due to the paucity of data on the chlorate content of prepared foods in general, we collated chlorate data on more than 3400 samples of mainly prepared foods, including dairy products, meats, fruits, vegetables and different food ingredients/additives. In total, 50.5% of the food samples contained chlorate above 0.01 mg kg(-1), albeit not due to the use of chlorate as a pesticide but mainly due to the occurrence of chlorate as an unavoidable disinfectant by-product. A further entry point of chlorate into foods may be via additives/ingredients that may contain chlorate as a by-product of the manufacturing process (e.g. electrolysis). Of the positive samples in this study, 22.4% revealed chlorate above 0.1 mg kg(-1). In the absence of EU levels for chlorate in water, any future EU regulations must consider the already available WHO guideline value of 0.7 mg l(-1) in potable water, and the continued importance of the usage of oxyhalides for disinfection purposes.

The effect of influent temperature variations in a sedimentation tank for potable water treatment--a computational fluid dynamics study.

Science.gov (United States)

Goula, Athanasia M; Kostoglou, Margaritis; Karapantsios, Thodoris D; Zouboulis, Anastasios I

2008-07-01

A computational fluid dynamics (CFD) model is used to assess the effect of influent temperature variation on solids settling in a sedimentation tank for potable water treatment. The model is based on the CFD code Fluent and exploits several specific aspects of the potable water application to derive a computational tool much more efficient than the corresponding tools employed to simulate primary and secondary wastewater settling tanks. The linearity of the particle conservation equations allows separate calculations for each particle size class, leading to the uncoupling of the CFD problem from a particular inlet particle size distribution. The usually unknown and difficult to be measured particle density is determined by matching the theoretical to the easily measured experimental total settling efficiency. The present model is adjusted against data from a real sedimentation tank and then it is used to assess the significance of influent temperature variation. It is found that a temperature difference of only 1 degrees C between influent and tank content is enough to induce a density current. When the influent temperature rises, the tank exhibits a rising buoyant plume that changes the direction of the main circular current. This process keeps the particles in suspension and leads to a higher effluent suspended solids concentration, thus, worse settling. As the warmer water keeps coming in, the temperature differential decreases, the current starts going back to its original position, and, thus, the suspended solids concentration decreases.

Preliminary studies on membrane filtration for the production of potable water: a case of Tshaanda rural village in South Africa.

Directory of Open Access Journals (Sweden)

Gomotsegang F Molelekwa

Full Text Available Ultrafiltration (UF systems have been used globally for treating water from resources including rivers, reservoirs, and lakes for the production of potable water in the past decade. UF membranes with a pore size of between 0.1 and 0.01 micrometres provide an effective barrier for bacteria, viruses, suspended particles, and colloids. The use of UF membrane technology in treating groundwater for the supply of potable water in the impoverished and rural village, Tshaanda (i.e., the study area is demonstrated. The technical and administrative processes that are critical for the successful installation of the pilot plant were developed. Given the rural nature of Tshaanda, the cultural and traditional protocols were observed. Preliminary results of the water quality of untreated water and the permeate are presented. Escherichia coli in the untreated water during the dry season (i.e., June and July was 2 cfu/100 ml and was 2419.2 cfu/100 ml before UF. Following UF, it dramatically reduced to acceptable level (7 cfu/100 ml which is within the WHO recommended level of <10 cfu/100 ml. Additionally, during the wet/rainy season E. coli and enterococci were unacceptably high (40.4 cfu/100 ml and 73.3 cfu/100 ml, respectively before UF but were completely removed following UF, which are within the WHO and SANS recommended limit. The values for electrical conductivity (EC and turbidity were constantly within the WHO recommended limits of 300 µS/cm corrected at 25°C and <5 NTU, respectively, before and after UF, during dry season and wet season. This suggests that there is no need for pre-treatment of the water for suspended particles and colloids. Considering these data, it can be concluded that the water is suitable for human consumption, following UF.

Finding New Water: Development of On-Site Non-Potable Water Reuse Systems

Science.gov (United States)

By designing our buildings to collect and treat water generated on-site, can be and reused for flushing our toilets and irrigating our landscaping. Several water sources are generated with-in a building including: rainwater, stormwater, graywater, blackwater and foundation drain...

Prague’s Water Supply Station in Podolí — a Solution for the Problems of Clean Water in the 1930s

Directory of Open Access Journals (Sweden)

K. Drnek

2011-01-01

Full Text Available In the 1920s Prague was seeking a solution to the problem of supplying its inhabitants with drinkable water. The water plant in Káraný was not able to provide enough water, and the bold plan to bring water from a reservoir and to provide a dual system of potable and non-potable water faced an uncertain future. In order to stave off the crisis and make time to complete its plans, the city council decided to construct a new water supply plant inside the city next to the Vltava river in the city district of Podolí.

Vertical and temporal dynamics of cyanobacteria in the Carpina potable water reservoir in northeastern Brazil.

Science.gov (United States)

Moura, A N; Dantas, E W; Oliveira, H S B; Bittencourt-Oliveira, M C

2011-05-01

This study analysed vertical and temporal variations of cyanobacteria in a potable water supply in northeastern Brazil. Samples were collected from four reservoir depths in the four months; September and December 2007; and March and June 2008. The water samples for the determination of nutrients and cyanobacteria were collected using a horizontal van Dorn bottle. The samples were preserved in 4% formaldehyde for taxonomic analysis using an optical microscope, and water aliquots were preserved in acetic Lugol solution for determination of density using an inverted microscope. High water temperatures, alkaline pH, low transparency, high phosphorous content and limited nitrogen content were found throughout the study. Dissolved oxygen stratification occurred throughout the study period whereas temperature stratification occurred in all sampling months, with the exception of June. No significant vertical differences were recorded for turbidity or total and dissolved forms of nutrients. There were high levels of biomass arising from Planktothrix agardhii, Cylindrospermopsis raciborskii, Geitlerinema amphibium and Pseudanabaena catenata. The study demonstrates that, in a tropical eutrophic environment with high temperatures throughout the water column, perennial multi-species cyanobacterial blooms, formed by species capable of regulating their position in the water column (those that have gas vesicles for buoyancy), are dominant in the photic and aphotic strata.

Vertical and temporal dynamics of cyanobacteria in the Carpina potable water reservoir in northeastern Brazil

Directory of Open Access Journals (Sweden)

AN Moura

Full Text Available This study analysed vertical and temporal variations of cyanobacteria in a potable water supply in northeastern Brazil. Samples were collected from four reservoir depths in the four months; September and December 2007; and March and June 2008. The water samples for the determination of nutrients and cyanobacteria were collected using a horizontal van Dorn bottle. The samples were preserved in 4% formaldehyde for taxonomic analysis using an optical microscope, and water aliquots were preserved in acetic Lugol solution for determination of density using an inverted microscope. High water temperatures, alkaline pH, low transparency, high phosphorous content and limited nitrogen content were found throughout the study. Dissolved oxygen stratification occurred throughout the study period whereas temperature stratification occurred in all sampling months, with the exception of June. No significant vertical differences were recorded for turbidity or total and dissolved forms of nutrients. There were high levels of biomass arising from Planktothrix agardhii, Cylindrospermopsis raciborskii, Geitlerinema amphibium and Pseudanabaena catenata. The study demonstrates that, in a tropical eutrophic environment with high temperatures throughout the water column, perennial multi-species cyanobacterial blooms, formed by species capable of regulating their position in the water column (those that have gas vesicles for buoyancy, are dominant in the photic and aphotic strata.

A Water-Service Challenge

Science.gov (United States)

Roman, Harry T.

2011-01-01

It is important to let students see the value of mathematics in design--and how mathematics lends perspective to problem solving. In this article, the author describes a water-service challenge which enables students to design a water utility system that uses surface runoff into an open reservoir as the potable water source. This challenge…

Life cycle assessment of four potable water treatment plants in northeastern Colombia

Directory of Open Access Journals (Sweden)

Oscar Orlando Ortiz Rodriguez

2016-04-01

Full Text Available There is currently great concern about the processes that directly or indirectly contribute to the potential for global warming, such as stratospheric ozone depletion or acidification. In this context, and provided that treated water is a basic public utility in urban centers around the world as well as in some rural areas, its impact on the environment is of great interest. Therefore, this study applied the environmental methodology of Life Cycle Assessment (LCA to evaluate the environmental loads of four potable water treatment plants (PWTPs located in northeastern Colombia following the international guidelines delineated in ISO 14040. The different stages of the drinking water process were thoroughly assessed, from the catchment point through pumping to the distribution network. The functional unit was defined as 1 m3 of drinking water produced at the plant. The data were analyzed through the database Ecoinvent v.3.01, and modeled and processed in the software LCA-Data Manager. The results showed that in plants PLA-CA and PLA-PO, the flocculation process has the highest environmental load, which is mostly attributable to the coagulant agent, with a range between 47-73% of the total impact. In plants PLA-TON and PLA-BOS, electricity consumption was identified as the greatest impact source, with percentages ranging from 67 to 85%. Treatment processes and techniques, bioclimatic conditions and culturally driven consumption behavior varied from region to region. Furthermore, changes in treatment processes and techniques are likely to affect the environment during all stages of a plant’s operational cycle.

LCA of Drinking Water Supply

DEFF Research Database (Denmark)

Godskesen, Berit; Meron, Noa; Rygaard, Martin

2018-01-01

Water supplies around the globe are growing complex and include more intense treatment methods than just decades ago. Now, desalination of seawater and wastewater reuse for both non-potable and potable water supply have become common practice in many places. LCA has been used to assess...... the potentials and reveal hotspots among the possible technologies and scenarios for water supplies of the future. LCA studies have been used to support decisions in the planning of urban water systems and some important findings include documentation of reduced environmental impact from desalination of brackish...... water over sea water, the significant impacts from changed drinking water quality and reduced environmental burden from wastewater reuse instead of desalination. Some of the main challenges in conducting LCAs of water supply systems are their complexity and diversity, requiring very large data...

Use of multiple water surface flow constructed wetlands for non-point source water pollution control.

Science.gov (United States)

Li, Dan; Zheng, Binghui; Liu, Yan; Chu, Zhaosheng; He, Yan; Huang, Minsheng

2018-05-02

Multiple free water surface flow constructed wetlands (multi-FWS CWs) are a variety of conventional water treatment plants for the interception of pollutants. This review encapsulated the characteristics and applications in the field of ecological non-point source water pollution control technology. The roles of in-series design and operation parameters (hydraulic residence time, hydraulic load rate, water depth and aspect ratio, composition of influent, and plant species) for performance intensification were also analyzed, which were crucial to achieve sustainable and effective contaminants removal, especially the retention of nutrient. The mechanism study of design and operation parameters for the removal of nitrogen and phosphorus was also highlighted. Conducive perspectives for further research on optimizing its design/operation parameters and advanced technologies of ecological restoration were illustrated to possibly interpret the functions of multi-FWS CWs.

A Fuzzy Linear Programming Model for Improving Productivity of Electrical Energy in Potable Water Supply Facilities (Case study: Sistan Water Supply Project

Directory of Open Access Journals (Sweden)

Vahid Baradaran

2018-03-01

Full Text Available One of the most important operational issues in urban drinking water production and distribution systems is to assign a plan for running hours of water supplying electric pumps. The cost of consuming electricity in these pumps allocates most of water and wastewater companies operational costs to itself which is dependent to their running hours. In this paper, meanwhile having a field study in Sistan rural water and wastewater company, the constraints for specifying electric pumps operational time in water supplying resources such as restrictions in fulfilling demand, supply potable water with suitable quality and uselessness of electric pumps have been identified. Due to uncertainty and fuzziness of the constraints, a linear programming model with fuzzy restrictions for determining electric pumps running hours per day is submitted with the aim to minimize electricity consumption and cost. After collecting and using required data for model, it proved that using the proposed model could reduce the costs of electrical energy and increase productivity up to 23 percent per month. The proposed mathematical fuzzy programming is able to specify electric pumps scheduling plan for water supply resources with the aim to reduce the costs of consuming energy.

Bacterial community diversity and variation in spray water sources and the tomato fruit surface.

Science.gov (United States)

Telias, Adriana; White, James R; Pahl, Donna M; Ottesen, Andrea R; Walsh, Christopher S

2011-04-21

Tomato (Solanum lycopersicum) consumption has been one of the most common causes of produce-associated salmonellosis in the United States. Contamination may originate from animal waste, insects, soil or water. Current guidelines for fresh tomato production recommend the use of potable water for applications coming in direct contact with the fruit, but due to high demand, water from other sources is frequently used. We sought to describe the overall bacterial diversity on the surface of tomato fruit and the effect of two different water sources (ground and surface water) when used for direct crop applications by generating a 454-pyrosequencing 16S rRNA dataset of these different environments. This study represents the first in depth characterization of bacterial communities in the tomato fruit surface and the water sources commonly used in commercial vegetable production. The two water sources tested had a significantly different bacterial composition. Proteobacteria was predominant in groundwater samples, whereas in the significantly more diverse surface water, abundant phyla also included Firmicutes, Actinobacteria and Verrucomicrobia. The fruit surface bacterial communities on tomatoes sprayed with both water sources could not be differentiated using various statistical methods. Both fruit surface environments had a high representation of Gammaproteobacteria, and within this class the genera Pantoea and Enterobacter were the most abundant. Despite the major differences observed in the bacterial composition of ground and surface water, the season long use of these very different water sources did not have a significant impact on the bacterial composition of the tomato fruit surface. This study has provided the first next-generation sequencing database describing the bacterial communities living in the fruit surface of a tomato crop under two different spray water regimes, and therefore represents an important step forward towards the development of science

Bacterial community diversity and variation in spray water sources and the tomato fruit surface

Directory of Open Access Journals (Sweden)

Ottesen Andrea R

2011-04-01

Full Text Available Abstract Background Tomato (Solanum lycopersicum consumption has been one of the most common causes of produce-associated salmonellosis in the United States. Contamination may originate from animal waste, insects, soil or water. Current guidelines for fresh tomato production recommend the use of potable water for applications coming in direct contact with the fruit, but due to high demand, water from other sources is frequently used. We sought to describe the overall bacterial diversity on the surface of tomato fruit and the effect of two different water sources (ground and surface water when used for direct crop applications by generating a 454-pyrosequencing 16S rRNA dataset of these different environments. This study represents the first in depth characterization of bacterial communities in the tomato fruit surface and the water sources commonly used in commercial vegetable production. Results The two water sources tested had a significantly different bacterial composition. Proteobacteria was predominant in groundwater samples, whereas in the significantly more diverse surface water, abundant phyla also included Firmicutes, Actinobacteria and Verrucomicrobia. The fruit surface bacterial communities on tomatoes sprayed with both water sources could not be differentiated using various statistical methods. Both fruit surface environments had a high representation of Gammaproteobacteria, and within this class the genera Pantoea and Enterobacter were the most abundant. Conclusions Despite the major differences observed in the bacterial composition of ground and surface water, the season long use of these very different water sources did not have a significant impact on the bacterial composition of the tomato fruit surface. This study has provided the first next-generation sequencing database describing the bacterial communities living in the fruit surface of a tomato crop under two different spray water regimes, and therefore represents an

Principles for scaling of distributed direct potable water reuse systems: a modeling study.

Science.gov (United States)

Guo, Tianjiao; Englehardt, James D

2015-05-15

Scaling of direct potable water reuse (DPR) systems involves tradeoffs of treatment facility economy-of-scale, versus cost and energy of conveyance including energy for upgradient distribution of treated water, and retention of wastewater thermal energy. In this study, a generalized model of the cost of DPR as a function of treatment plant scale, assuming futuristic, optimized conveyance networks, was constructed for purposes of developing design principles. Fractal landscapes representing flat, hilly, and mountainous topographies were simulated, with urban, suburban, and rural housing distributions placed by modified preferential growth algorithm. Treatment plants were allocated by agglomerative hierarchical clustering, networked to buildings by minimum spanning tree. Simulations assume advanced oxidation-based DPR system design, with 20-year design life and capability to mineralize chemical oxygen demand below normal detection limits, allowing implementation in regions where disposal of concentrate containing hormones and antiscalants is not practical. Results indicate that total DPR capital and O&M costs in rural areas, where systems that return nutrients to the land may be more appropriate, are high. However, costs in urban/suburban areas are competitive with current water/wastewater service costs at scales of ca. one plant per 10,000 residences. This size is relatively small, and costs do not increase significantly until plant service areas fall below 100 to 1000 homes. Based on these results, distributed DPR systems are recommended for consideration for urban/suburban water and wastewater system capacity expansion projects. Copyright © 2015 Elsevier Ltd. All rights reserved.

Effects of selected water chemistry variables on copper pitting propagation in potable water

International Nuclear Information System (INIS)

Ha Hung; Taxen, Claes; Williams, Keith; Scully, John

2011-01-01

. Malachite, bronchantite, cuprite, nantokite and atacamite corrosion products were both observed in experiment and predicted by the model. Stifling and/or repassivation occurred when the resistance of the corrosion product layer became high enough to lower the pit bottom potential and pit current density such as 10 -5 A/cm 2 could be attained with thick and dense layer. The ramifications of these findings towards pit propagation characteristics in potable waters will be discussed with improved insight into the roles of Cl - and SO 4 2- ions.

Nitrogenase gene amplicons from global marine surface waters are dominated by genes of non-cyanobacteria.

Directory of Open Access Journals (Sweden)

Hanna Farnelid

Full Text Available Cyanobacteria are thought to be the main N(2-fixing organisms (diazotrophs in marine pelagic waters, but recent molecular analyses indicate that non-cyanobacterial diazotrophs are also present and active. Existing data are, however, restricted geographically and by limited sequencing depths. Our analysis of 79,090 nitrogenase (nifH PCR amplicons encoding 7,468 unique proteins from surface samples (ten DNA samples and two RNA samples collected at ten marine locations world-wide provides the first in-depth survey of a functional bacterial gene and yield insights into the composition and diversity of the nifH gene pool in marine waters. Great divergence in nifH composition was observed between sites. Cyanobacteria-like genes were most frequent among amplicons from the warmest waters, but overall the data set was dominated by nifH sequences most closely related to non-cyanobacteria. Clusters related to Alpha-, Beta-, Gamma-, and Delta-Proteobacteria were most common and showed distinct geographic distributions. Sequences related to anaerobic bacteria (nifH Cluster III were generally rare, but preponderant in cold waters, especially in the Arctic. Although the two transcript samples were dominated by unicellular cyanobacteria, 42% of the identified non-cyanobacterial nifH clusters from the corresponding DNA samples were also detected in cDNA. The study indicates that non-cyanobacteria account for a substantial part of the nifH gene pool in marine surface waters and that these genes are at least occasionally expressed. The contribution of non-cyanobacterial diazotrophs to the global N(2 fixation budget cannot be inferred from sequence data alone, but the prevalence of non-cyanobacterial nifH genes and transcripts suggest that these bacteria are ecologically significant.

Microbial water quality of treated water and raw water sources in the ...

African Journals Online (AJOL)

Microbial water quality is an essential aspect in the provision of potable water for domestic use. The provision of adequate amounts of safe water for domestic purposes has become difficult for most municipalities mandated to do so in Zimbabwe. Morton-Jaffray Treatment Plant supplies potable water to Harare City and ...

Effect of non-Legionellaceae bacteria on the multiplication of Legionella pneumophila in potable water.

Science.gov (United States)

Wadowsky, R M; Yee, R B

1985-05-01

A naturally occurring suspension of Legionella pneumophila and associated microbiota contained three unidentified non-Legionellaceae bacteria which supported satellite growth of a subculture of L. pneumophila on an L-cysteine-deficient medium and another bacterium which did not support growth of the subculture. Washed suspensions containing 10(3), 10(5), 10(7), or 10(8) CFU of a mixture of isolates of these non-Legionellaceae bacteria failed to support the multiplication of an isolate of agar-grown L. pneumophila which had been washed and seeded into the suspensions. The suspensions which contained 10(3), 10(5), or 10(7) CFU of the non-Legionellaceae bacteria per ml appeared to enhance survival or cryptic growth of agar-grown L. pneumophila. A decline of 1.3 log CFU of L. pneumophila per ml occurred within the first week of incubation in the sample which contained 10(8) CFU of the non-Legionellaceae bacteria per ml. In contrast to these results, naturally occurring L. pneumophila multiplied in the presence of associated microbiota. The necessity to subculture L. pneumophila and the non-Legionellaceae bacteria on artificial medium to obtain pure cultures may have affected the multiplication of L. pneumophila in tap water. Alternatively, other microorganisms may be present in the naturally occurring suspension which support the growth of this bacterium.

A nested observation and model approach to non linear groundwater surface water interactions.

Science.gov (United States)

van der Velde, Y.; Rozemeijer, J. C.; de Rooij, G. H.

2009-04-01

Surface water quality measurements in The Netherlands are scattered in time and space. Therefore, water quality status and its variations and trends are difficult to determine. In order to reach the water quality goals according to the European Water Framework Directive, we need to improve our understanding of the dynamics of surface water quality and the processes that affect it. In heavily drained lowland catchment groundwater influences the discharge towards the surface water network in many complex ways. Especially a strong seasonal contracting and expanding system of discharging ditches and streams affects discharge and solute transport. At a tube drained field site the tube drain flux and the combined flux of all other flow routes toward a stretch of 45 m of surface water have been measured for a year. Also the groundwater levels at various locations in the field and the discharge at two nested catchment scales have been monitored. The unique reaction of individual flow routes on rainfall events at the field site allowed us to separate the discharge at a 4 ha catchment and at a 6 km2 into flow route contributions. The results of this nested experimental setup combined with the results of a distributed hydrological model has lead to the formulation of a process model approach that focuses on the spatial variability of discharge generation driven by temporal and spatial variations in groundwater levels. The main idea of this approach is that discharge is not generated by catchment average storages or groundwater heads, but is mainly generated by points scale extremes i.e. extreme low permeability, extreme high groundwater heads or extreme low surface elevations, all leading to catchment discharge. We focused on describing the spatial extremes in point scale storages and this led to a simple and measurable expression that governs the non-linear groundwater surface water interaction. We will present the analysis of the field site data to demonstrate the potential

Algorithmic Optimal Management of a Potable Water Distribution System: Application to the Primary Network of Bonaberi (Douala, Cameroon

Directory of Open Access Journals (Sweden)

Zineb Simeu-Abazi

2009-11-01

Full Text Available The optimal management of a potable water distribution system requires the control of the reference (standard data, the control points, control of the drainage parameters (pressure, flow, etc. and maintenance parameters. The control of the mentioned data defines the network learning process [1]. Besides classic IT functions of acquisition, storage and data processing, a geographical information system (GIS can be used as the basis for an alarm system, allowing one to identify and to localize the presence of water leaks in the network [2]. In this article we propose an algorithm coupling the various drainage parameters for the management of the network. The algorithm leads to an optimal management of leaks. An application is in progress on the primary network in the region of Bonaberi in Douala, the largest city of Cameroon.

Surface composition and surface properties of water hyacinth ...

African Journals Online (AJOL)

Surface composition and surface properties of water hyacinth ( Eichhornia ... (2/1, v/v) followed by ethanol, using Fourier Transform Infra-red (FT-IR) spectroscopy, ... polar organic solvents and non-polar n-alkane hydrocarbons is discussed.

Water quality - Measurement of gross alpha activity in non-saline water - Thick source method. 2. ed.

International Nuclear Information System (INIS)

2007-01-01

This International Standard specifies a method for the determination of gross alpha activity in non-saline waters for alpha-emitting radionuclides which are not volatile at 350 degree Centigrade. It is possible to determine supported volatile radionuclides measured to an extent determined by half-life, matrix retention (of the volatile species) and the duration of measurement (counting time). The method is applicable to raw and potable waters. The range of application depends on the amount of suspended matter in the water and on the performance characteristics (background count rate and counting efficiency) of the counter. Gross alpha radioactivity is determined by using proportional counting or solid scintillation counting on water residue deposited on a planchet. Due to the strong absorption of the residue deposit, it is considered that the alpha emission from the surface is proportional to the alpha activity of the deposit. Gross alpha determination is not an absolute determination of the sample alpha radioactive content, but a relative determination referring to a specific alpha emitter which constitutes the standard calibration source. This type of determination is also known as alpha index. The sample is acidified to stabilize it, evaporated almost to dryness, converted to the sulfate form and then ignited at 350 degree Centigrade. A portion of the residue is transferred to a planchet and the alpha activity measured by counting in an alpha-particle detector or counting system previously calibrated against an alpha-emitting standard and the alpha activity concentration calculated. The paper provides information about scope, normative references, symbols, definitions and units, principle, reagents and equipment, procedure, contamination check, expression of results and test report

Soil and surface layer type affect non-rainfall water inputs

Science.gov (United States)

Agam, Nurit; Berliner, Pedro; Jiang, Anxia

2017-04-01

Non-rainfall water inputs (NRWIs), which include fog deposition, dew formation, and direct water vapor adsorption by the soil, play a vital role in arid and semiarid regions. Environmental conditions, namely radiation, air temperature, air humidity, and wind speed, largely affect the water cycle driven by NRWIs. The substrate type (soil type and the existence/absence of a crust layer) may as well play a major role. Our objective was to quantify the effects of soil type (loess vs. sand) and surface layer (bare vs. crusted) on the gain and posterior evaporation of NRWIs in the Negev Highlands throughout the dry summer season. Four undisturbed soil samples (20 cm diameter and 50 cm depth) were excavated and simultaneously introduced into a PVC tube. Two samples were obtained in the Negev's Boker plain (loess soil) and two in the Nizzana sand dunes in the Western Negev. On one sample from each site the crust was removed while on the remaining one the natural crust was left in place. The samples were brought to the research site at the Jacob Bluestein Institutes for Desert Research, Ben-Gurion University of the Negev, Israel (31˚08' N, 34˚53' E, 400 meter above the sea level) where they were exposed to the same environmental conditions. The four samples in their PVC tubes were placed on top of scales and the samples mass was continuously monitored. Soil temperatures were monitored at depths of 1, 2, 3, 5 and10 cm in each microlysimeter (ML) using Copper-Constantan thermocouples. The results of particle size distribution indicated that the crust of the loess soil is probably a physical crust, i.e., a crust that forms due to raindroplets impact; while the crust on the sand soil is biological. On most days, the loess soils adsorbed more water than their corresponding sand soil samples. For both soils, the samples for which the crust was removed adsorbed more water than the samples for which it was intact. The difference in daily water adsorption amount between crusted

Fifty Years of Water Sensitive Urban Design, Salisbury, South Australia

Institute of Scientific and Technical Information of China (English)

John C.Radcliffe; Declan Page; Bruce Naumann; Peter Dillon

2017-01-01

Australia has developed extensive policies and guidelines for the management of its water.The City of Salisbury,located within metropolitan Adelaide,South Australia,developed rapidly through urbanisation from the 1970s.Water sensitive urban design principles were adopted to maximise the use of the increased run-off generated by urbanisation and ameliorate flood risk.Managed aquifer recharge was introduced for storing remediated low-salinity stormwater by aquifer storage and recovery (ASR) in a brackish aquifer for subsequent irrigation.This paper outlines how a municipal government has progressively adopted principles of Water Sensitive Urban Design during its development within a framework of evolving national water policies.Salisbury's success with stormwater harvesting led to the formation of a pioneering water business that includes linking projects from nine sites to provide a non-potable supply of 5 × 106 m3 ·year-1.These installations hosted a number of applied research projects addressing well configuration,water quality,reliability and economics and facilitated the evaluation of its system as a potential potable water source.The evaluation showed that while untreated stormwater contained contaminants,subsurface storage and end-use controls were sufficient to make recovered water safe for public open space irrigation,and with chlorination,acceptable for third pipe supplies.Drinking water quality could be achieved by adding microfiltration,disinfection with UV and chlorination.The costs that would need to be expended to achieve drinking water safety standards were found to be considerably less than the cost of establishing dual pipe distribution systems.The full cost of supply was determined to be AUD$1.57 m-3 for non-potable water for public open space irrigation,much cheaper than mains water,AUD $3.45 m-3 at that time.Producing and storing potable water was found to cost AUD$1.96 to $2.24 m-3.

Burned forests impact water supplies

Science.gov (United States)

Dennis W. Hallema; Ge Sun; Peter V. Caldwell; Steven P. Norman; Erika C. Cohen; Yongqiang Liu; Kevin D. Bladon; Steven G. McNulty

2018-01-01

Wildland fire impacts on surface freshwater resources have not previously been measured, nor factored into regional water management strategies. But, large wildland fires are increasing and raise concerns about fire impacts on potable water. Here we synthesize longterm records of wildland fire, climate, and river flow for 168 locations across the United States. We show...

Water on a Hydrophobic surface

Science.gov (United States)

Scruggs, Ryan; Zhu, Mengjue; Poynor, Adele

2012-02-01

Hydrophobicity, meaning literally fear of water, is exhibited on the surfaces of non-stick cooking pans and water resistant clothing, on the leaves of the lotus plan, or even during the protein folding process in our bodies. Hydrophobicity is directly measured by determining a contact angle between water and an objects surface. Associated with a hydrophobic surface is the depletion layer, a low density region approximately 0.2 nm thick. We study this region by comparing data found in lab using surface plasmon resonance techniques to theoretical calculations. Experiments use gold slides coated in ODT and Mercapto solutions to model both hydrophobic and hydrophilic surfaces respectively.

Real-time dynamic hydraulic model for potable water loss reduction

CSIR Research Space (South Africa)

Abu-Mahfouz, Adnan M

2016-08-01

Full Text Available South Africa is a water scarce country with limited water resources and steadily growing water demand. Unacceptably high water losses and non-revenue water threaten our water resource security as well as the financial viability of municipal water...

Discovery and Identification of Dimethylsilanediol as a Contaminant in ISS Potable Water

Science.gov (United States)

Rutz, Jeffrey A.; Schultz, John R.; Kuo, C. Mike; Curtis, Matthew; Jones, Patrick R.; Sparkman, O. David; McCoy, J. Torin

2011-01-01

In September 2010, analysis of ISS potable water samples was undertaken to determine the contaminant(s) responsible for a rise of total organic carbon (TOC) in the Water Processor Assembly (WPA) product water. As analysis of the routine target list of organic compounds did not reveal the contaminant, efforts to look for unknown compounds were initiated, resulting in discovery of an unknown peak in the gas chromatography/mass spectrometry (GC/MS) analysis for glycols. A mass spectrum of the contaminant was then generated by concentrating one of the samples and analyzing it by GC/MS in full-scan mode. Although a computer match of the compound identity could not be obtained with the instrument database, a search with a more up-to-date mass spectral library yielded a good match with dimethylsilanediol (DMSD). Inductively coupled plasma/mass spectrometry (ICP/MS) analyses showed abnormally high silicon levels in the samples, confirming that the unknown compound(s) contained silicon. DMSD was then synthesized to confirm the identification and provide a standard to develop a calibration curve. Further confirmation was provided by external direct analysis in real time time of flight (DART TOF) mass spectrometry. To routinely test for DMSD in the future, a quantitative method was needed. A preliminary GC/MS method was developed and archived samples from various locations on ISS were analyzed to determine the extent of the contamination and provide data for troubleshooting. This paper describes these events in more detail as well as problems encountered in routine GC/MS analyses and the subsequent development of high performance liquid chromatography and LC/MS/MS methods for measuring DMSD.

CONCRETE SUPPORT DESIGN FOR MISCELLANEOUS ESF UTILITIES

International Nuclear Information System (INIS)

Misiak, T.A.

1999-01-01

The purpose and objective of this analysis is to design concrete supports for the miscellaneous utility equipment used at the Exploratory Studies Facility (ESF). Two utility systems are analyzed: (1) the surface collection tanks of the Waste Water System, and (2) the chemical tracer mixing and storage tanks of the Non-Potable Water System. This analysis satisfies design recommended in the Title III Evaluation Reports for the Subsurface Fire Water System and Subsurface Portion of the Non-Potable Water System (CRWMS M andO 1998a) and Waste Water Systems (CRWMS M andO 1998b)

The study of potable water treatment process in Algeria (boudouaou station) -by the application of life cycle assessment (LCA).

Science.gov (United States)

Mohamed-Zine, Messaoud-Boureghda; Hamouche, Aksas; Krim, Louhab

2013-12-19

Environmental impact assessment will soon become a compulsory phase in future potable water production projects, in algeria, especially, when alternative treatment processes such sedimentation ,coagulation sand filtration and Desinfection are considered. An impact assessment tool is therefore developed for the environmental evaluation of potable water production. in our study The evaluation method used is the life cycle assessment (LCA) for the determination and evaluation of potential impact of a drink water station ,near algiers (SEAL-Boudouaoua).LCA requires both the identification and quantification of materials and energy used in all stages of the product's life, when the inventory information is acquired, it will then be interpreted into the form of potential impact " eco-indicators 99" towards study areas covered by LCA, using the simapro6 soft ware for water treatment process is necessary to discover the weaknesses in the water treatment process in order for it to be further improved ensuring quality life. The main source shown that for the studied water treatment process, the highest environmental burdens are coagulant preparation (30% for all impacts), mineral resource and ozone layer depletion the repartition of the impacts among the different processes varies in comparison with the other impacts. Mineral resources are mainly consumed during alumine sulfate solution preparation; Ozone layer depletion originates mostly from tetrachloromethane emissions during alumine sulfate production. It should also be noted that, despite the small doses needed, ozone and active Carbone treatment generate significant impacts with a contribution of 10% for most of the impacts.Moreover impacts of energy are used in producing pumps (20-25 GHC) for plant operation and the unitary processes (coagulation, sand filtration decantation) and the most important impacts are localized in the same equipment (40-75 GHC) and we can conclude that:- Pre-treatment, pumping and EDR (EDR: 0

Future Water-Supply Scenarios, Cape May County, New Jersey, 2003-2050

Science.gov (United States)

Lacombe, Pierre J.; Carleton, Glen B.; Pope, Daryll A.; Rice, Donald E.

2009-01-01

Stewards of the water supply in New Jersey are interested in developing a plan to supply potable and non-potable water to residents and businesses of Cape May County until at least 2050. The ideal plan would meet projected demands and minimize adverse effects on currently used sources of potable, non-potable, and ecological water supplies. This report documents past and projected potable, non-potable, and ecological water-supply demands. Past and ongoing adverse effects to production and domestic wells caused by withdrawals include saltwater intrusion and water-level declines in the freshwater aquifers. Adverse effects on the ecological water supplies caused by groundwater withdrawals include premature drying of seasonal wetlands, delayed recovery of water levels in the water-table aquifer, and reduced streamflow. To predict the effects of future actions on the water supplies, three baseline and six future scenarios were created and simulated. Baseline Scenarios 1, 2, and 3 represent withdrawals using existing wells projected until 2050. Baseline Scenario 1 represents average 1998-2003 withdrawals, and Scenario 2 represents New Jersey Department of Environmental Protection (NJDEP) full allocation withdrawals. These withdrawals do not meet projected future water demands. Baseline Scenario 3 represents the estimated full build-out water demands. Results of simulations of the three baseline scenarios indicate that saltwater would intrude into the Cohansey aquifer as much as 7,100 feet (ft) to adversely affect production wells used by Lower Township and the Wildwoods, as well as some other near-shore domestic wells; water-level altitudes in the Atlantic City 800-foot sand would decline to -156 ft; base flow in streams would be depleted by 0 to 26 percent; and water levels in the water-table aquifer would decline as much as 0.7ft. [Specific water-level altitudes, land-surface altitudes, and present sea level when used in this report are referenced to the North American

Performance analysis of solar cogeneration system with different integration strategies for potable water and domestic hot water production

International Nuclear Information System (INIS)

Uday Kumar, N.T.; Mohan, Gowtham; Martin, Andrew

2016-01-01

Highlights: • Solar driven cogeneration system integrating membrane distillation technology is developed. • System utilizes solar thermal energy for the operations without auxiliary heaters. • Three different system integrations are experimentally investigated in UAE. • Economical benefits of solar cogeneration system is also reported. - Abstract: A novel solar thermal cogeneration system featuring the provision of potable water with membrane distillation in combination with domestic hot water supply has been developed and experimentally analyzed. The system integrates evacuated tube collectors, thermal storage, membrane distillation unit, and heat exchangers with the overall goals of maximizing the two outputs while minimizing costs for the given design conditions. Experiments were conducted during one month’s operation at AURAK’s facility in UAE, with average peak global irradiation levels of 650 W/m"2. System performance was determined for three integration strategies, all utilizing brackish water (typical conductivity of 20,000 μs/cm) as a feedstock: Thermal store integration (TSI), which resembles a conventional indirect solar domestic hot water system; Direct solar integration (DSI) connecting collectors directly to the membrane distillation unit without thermal storage; and Direct solar with thermal store integration (DSTSI), a combination of these two approaches. The DSTSI strategy offered the best performance given its operational flexibility. Here the maximum distillate productivity was 43 L/day for a total gross solar collector area of 96 m"2. In terms of simultaneous hot water production, 277 kWh/day was achieved with this configuration. An economic analysis shows that the DSTSI strategy has a payback period of 3.9 years with net cumulative savings of $325,000 during the 20 year system lifetime.

Nitrogenase gene amplicons from global marine surface waters are dominated by genes of non-cyanobacteria

DEFF Research Database (Denmark)

Farnelid, Hanna; Andersson, Anders F.; Bertilsson, Stefan

2011-01-01

analysis of 79,090 nitrogenase (nifH) PCR amplicons encoding 7,468 unique proteins from surface samples (ten DNA samples and two RNA samples) collected at ten marine locations world-wide provides the first in-depth survey of a functional bacterial gene and yield insights into the composition and diversity...... by unicellular cyanobacteria, 42% of the identified non-cyanobacterial nifH clusters from the corresponding DNA samples were also detected in cDNA. The study indicates that non-cyanobacteria account for a substantial part of the nifH gene pool in marine surface waters and that these genes are at least...

Biomass in pre potable groundwater; Biomasa en aguas prepotables de origen subterraneo

Energy Technology Data Exchange (ETDEWEB)

Perez Monteverde, M. P.; Ayala Diaz, J. H.; Afonso Perea, A. M.; Gonzalez Diaz, V.

2004-07-01

This study assessed the quality of available pre potable water in the south of Tenerife (Spain) taken from various canal and storage ponds. This was done by continuous determination, between May 2000 and July 2002, of microorganisms indicating pollution by sewage or animal waste and of chlorophyll a, parameter indicating microalgae biomass. (Author)

Thermodynamic and economic evaluation of co-production plants for electricity and potable water

International Nuclear Information System (INIS)

1997-05-01

Within the framework of the IAEA's activities related to seawater desalination using nuclear energy, a need was identified for developing criteria and methodologies in order to facilitate comparative economic evaluations of nuclear and fossil fuelled energy sources for desalination and generation of electricity. The aspect of costing of electricity and potable water from co-production plants is of particular interest. In response to these needs, the IAEA carried out a study to establish methodologies for allocating costs to the two final products of co-production plants based on thermodynamic criteria and to enable economic ranking of co-production plant alternatives. This publication describes the methodologies and presents the results obtained from analyzing a reference case, taken as an example. This publication has been discussed and reviewed at a consultants meeting convened by the IAEA in September 1996 in Vienna. The methodologies have been incorporated in an EXCEL spreadsheet routine which is available upon request from the IAEA. The IAEA staff member responsible for this publication is L. Breidenbach of the Division of Nuclear Power and the Fuel Cycle. 30 refs, figs, tabs

N-nitrosodimethylamine (NDMA) formation at an indirect potable reuse facility.

Science.gov (United States)

Sgroi, Massimiliano; Roccaro, Paolo; Oelker, Gregg L; Snyder, Shane A

2015-03-01

Full-scale experiments to evaluate N-nitrosodimethylamine (NDMA) formation and attenuation were performed within an advanced indirect potable reuse (IPR) treatment system, which includes, sequentially: chloramination for membrane fouling control, microfiltration (MF), reverse osmosis (RO), ultraviolet irradiation with hydrogen peroxide (UV/H₂O₂), final chloramination, and pH stabilization. Results of the study demonstrate that while RO does effectively remove the vast majority of NDMA precursors, RO permeate can still contain significant concentrations of NDMA precursors resulting in additional NDMA formation during chloramination. Thus, it is possible for this advanced treatment system to produce water with NDMA levels higher than regional requirements for potable applications (10 ng/L). The presence of H2O2 during UV oxidation reduced NDMA photolysis efficiency and increased NDMA formation (∼22 ng/L) during the secondary chloramination and lime stabilization. This is likely due to formation of UV/H₂O₂ degradation by-products with higher NDMA formation rate than the parent compounds. However, this effect was diminished with higher UV doses. Bench-scale experiments confirmed an enhanced NDMA formation during chloramination after UV/H2O2 treatment of dimethylformamide, a compound detected in RO permeate and used as model precursor in this study. The effect of pre-ozonation for membrane fouling control on NDMA formation was also evaluated at pilot- (ozone-MF-RO) and bench-scale. Relatively large NDMA formation (117-227 ng/L) occurred through ozone application that was dose dependent, whereas chloramination under typical dosages and contact times of IPR systems resulted in only a relatively small increase of NDMA (∼20 ng/L). Thus, this research shows that NDMA formation within a potable water reuse facility can be challenging and must be carefully evaluated and controlled. Copyright © 2014 Elsevier Ltd. All rights reserved.

Impact of volcanic plume emissions on rain water chemistry during the January 2010 Nyamuragira eruptive event: implications for essential potable water resources.

Science.gov (United States)

Cuoco, Emilio; Tedesco, Dario; Poreda, Robert J; Williams, Jeremy C; De Francesco, Stefano; Balagizi, Charles; Darrah, Thomas H

2013-01-15

On January 2, 2010 the Nyamuragira volcano erupted lava fountains extending up to 300 m vertically along an ~1.5 km segment of its southern flank cascading ash and gas on nearby villages and cities along the western side of the rift valley. Because rain water is the only available potable water resource within this region, volcanic impacts on drinking water constitutes a major potential hazard to public health within the region. During the 2010 eruption, concerns were expressed by local inhabitants about water quality and feelings of physical discomfort (e.g. nausea, bloating, indigestion, etc.) after consuming rain water collected after the eruption began. We present the elemental and ionic chemistry of drinking water samples collected within the region on the third day of the eruption (January 5, 2010). We identify a significant impact on water quality associated with the eruption including lower pH (i.e. acidification) and increases in acidic halogens (e.g. F(-) and Cl(-)), major ions (e.g. SO(4)(2-), NH(4)(+), Na(+), Ca(2+)), potentially toxic metals (e.g. Al(3+), Mn(2+), Cd(2+), Pb(2+), Hf(4+)), and particulate load. In many cases, the water's composition significantly exceeds World Health Organization (WHO) drinking water standards. The degree of pollution depends upon: (1) ash plume direction and (2) ash plume density. The potential negative health impacts are a function of the water's pH, which regulates the elements and their chemical form that are released into drinking water. Copyright © 2012 Elsevier B.V. All rights reserved.

Development of latent fingerprints on non-porous surfaces recovered from fresh and sea water.

Science.gov (United States)

Madkour, Somaya; Abeer Sheta; El Dine, Fatma Badr; Elwakeel, Yasser; AbdAllah, Nermine

2017-01-01

Criminal offenders have a fundamental goal not to leave any traces at the crime scene. Some may suppose that items recovered underwater will have no forensic value, therefore, they try to destroy the traces by throwing items in water. These traces are subjected to the destructive environmental effects. This can represent a challenge for forensic experts investigating fingerprints. The present study was conducted to determine the optimal method for latent fingerprints development on dry non-porous surfaces submerged in aquatic environments at different time interval. The quality of the developed fingerprints depending on the used method was assessed. In addition, two factors were analyzed in this study; the effects of the nature of aquatic environment and the length of submerged time. Therefore, latent fingerprints were deposited on metallic, plastic and glass objects and submerged in fresh and sea water for 1, 2, and 10 days. After recovery, the items were processed by black powder, small particle reagent and cyanoacrylate fuming and the prints were examined. Each print was evaluated according to fingerprint quality assessment scale. Cyanoacrylate developed latent prints found to have the highest mean visibility score after submersion in fresh and sea water for 1, 2 and 10 days. Mean visibility score of prints developed showed significant decline after 10 days of submersion. Prints submerged in fresh water showed significantly higher mean visibility score than those submerged in sea water using various methods of development and in all time intervals. The study demonstrated that it is possible to recover latent prints submerged in water on different studied dry non porous surfaces with the best visualization method using cyanoacrylate either in fresh or sea water. The duration of submersion affects the quality of fingerprints developed; the longer the duration, the worse the quality is. In addition, this study has revealed that the exposure to high salinity i

Flight Testing of the Forward Osmosis Bag for Water Recovery on STS-135

Science.gov (United States)

Roberts, Michael S.; Soler, Monica; Mortenson, Todd; McCoy, LaShelle; Woodward, Spencer; Levine, Howard G.

2011-01-01

The Forward Osmosis Bag (FOB) is a personal water purification device for recovery of potable liquid from almost any non-potable water source. The FOB experiment was flown as a sortie mission on STS-135/ULF7 using flight-certified materials and a design based on the X-Pack(TradeMark) from Hydration Technology Innovations (Albany, OR). The primary objective was to validate the technology for use under microgravity conditions. The FOB utilizes a difference in solute concentration across a selectively permeable membrane to draw water molecules from the non-potable water while rejecting most chemical and all microbial contaminants contained within. Six FOB devices were tested on STS-135 for their ability to produce a potable liquid permeate from a feed solution containing 500 mL potassium chloride (15 g/L) amended with 0.1% methyl blue dye (w:v) tracer against an osmotic gradient created by addition of 60 mL of concentrate containing the osmolytes fructose and glucose, and 0.01% sodium fluorescein (w:v) tracer. Three FOB devices were physically mixed by hand for 2 minutes by a crewmember after loading to augment membrane wetting for comparison with three unmixed FOB devices. Hydraulic flux rate and rejection of salt and dye in microgravity were determined from a 60-mL sample collected by the crew on orbit after 6 hours. Post-flight analysis of samples collected on orbit demonstrated that the Forward Osmosis Bag achieved expected design specifications in microgravity. The hydraulic flux rate of water across the membrane was reduced approximately 50% in microgravity relative to ground controls that generated an average of 50 mL per hour using the same water and osmolyte solutions. The membrane rejected both potassium and chloride at >92% and methyl blue dye at >99.9%. Physical mixing of the FOB during water recovery did not have any significant effect on either flux rate or rejection of solutes from the water solution. The absence of buoyancy-driven convection in

Organic matter and heavy metals in grey-water sludge | Eriksson ...

African Journals Online (AJOL)

Grey-water intended for non-potable reuse is being intensively studied, but little attention has been given to the associated solid fraction, the grey-water sludge. In this study grey-water sludge originating from bathroom grey-water has been screened with respect to organic matter; particles; short-chain fatty alcohols and ...

Assessing rural small community water supply in Limpopo, South Africa: water service benchmarks and reliability.

Science.gov (United States)

Majuru, Batsirai; Jagals, Paul; Hunter, Paul R

2012-10-01

Although a number of studies have reported on water supply improvements, few have simultaneously taken into account the reliability of the water services. The study aimed to assess whether upgrading water supply systems in small rural communities improved access, availability and potability of water by assessing the water services against selected benchmarks from the World Health Organisation and South African Department of Water Affairs, and to determine the impact of unreliability on the services. These benchmarks were applied in three rural communities in Limpopo, South Africa where rudimentary water supply services were being upgraded to basic services. Data were collected through structured interviews, observations and measurement, and multi-level linear regression models were used to assess the impact of water service upgrades on key outcome measures of distance to source, daily per capita water quantity and Escherichia coli count. When the basic system was operational, 72% of households met the minimum benchmarks for distance and water quantity, but only 8% met both enhanced benchmarks. During non-operational periods of the basic service, daily per capita water consumption decreased by 5.19l (pwater sources were 639 m further (p ≤ 0.001, 95% CI 560-718). Although both rudimentary and basic systems delivered water that met potability criteria at the sources, the quality of stored water sampled in the home was still unacceptable throughout the various service levels. These results show that basic water services can make substantial improvements to water access, availability, potability, but only if such services are reliable. Copyright © 2012 Elsevier B.V. All rights reserved.

Novel configurations of solar distillation system for potable water production

Science.gov (United States)

Riahi, A.; Yusof, K. W.; Sapari, N.; Singh, B. S.; Hashim, A. M.

2013-06-01

More and more surface water are polluted with toxic chemicals. Alternatively brackish and saline water are used as feed water to water treatment plants. Expensive desalination process via reverse osmosis or distillation is used in the plants. Thus, this conventional desalination is not suitable for low and medium income countries. A cheaper method is by solar distillation. However the rate of water production by this method is generally considered low. This research attempts to enhance water production of solar distillation by optimizing solar capture, evaporation and condensation processes. Solar radiation data was captured in several days in Perak, Malaysia. Three kinds of experiments were done by fabricating triangular solar distillation systems. First type was conventional solar still, second type was combined with 50 Watt solar photovoltaic panel and 40 Watt Dc heater, while third type was integrated with 12 Volt Solar battery and 40 Watt Dc heater. The present investigation showed that the productivity of second and third systems were 150% and 480% of the conventional still type, respectively. The finding of this research can be expected to have wide application in water supply particularly in areas where fresh surface water is limited.

Novel configurations of solar distillation system for potable water production

International Nuclear Information System (INIS)

Riahi, A; Yusof, K W; Sapari, N; Hashim, A M; Singh, B S

2013-01-01

More and more surface water are polluted with toxic chemicals. Alternatively brackish and saline water are used as feed water to water treatment plants. Expensive desalination process via reverse osmosis or distillation is used in the plants. Thus, this conventional desalination is not suitable for low and medium income countries. A cheaper method is by solar distillation. However the rate of water production by this method is generally considered low. This research attempts to enhance water production of solar distillation by optimizing solar capture, evaporation and condensation processes. Solar radiation data was captured in several days in Perak, Malaysia. Three kinds of experiments were done by fabricating triangular solar distillation systems. First type was conventional solar still, second type was combined with 50 Watt solar photovoltaic panel and 40 Watt Dc heater, while third type was integrated with 12 Volt Solar battery and 40 Watt Dc heater. The present investigation showed that the productivity of second and third systems were 150% and 480% of the conventional still type, respectively. The finding of this research can be expected to have wide application in water supply particularly in areas where fresh surface water is limited.

Reduction of trihalomethane (THM) formation with potassium permanganate in potable water treatment; Aplicacion del permanganato potasico y la formacion de trihalometanos (THM) en los procesos de potabilizacion del agua

Energy Technology Data Exchange (ETDEWEB)

Aguirre Pascual, G.; Monforte de Monleon, L.; Tos Boix, s.

1996-04-01

Replacing prechlorination with a preoxidation with potassium permanganate in potable water treatment has proved to be an effective way to reduce the formation of THM, organochlorinated compounds known to be carcinogenic. It has been proved that the use of potassium permanganate to reduce the formation of THM is a simple and economic treatment process, having the added affect of improving the taste of the treated water. (Author) 21 refs.

First Derivative UV Spectra of Surface Water as a Monitor of Chlorination in Drinking Water Treatment

Directory of Open Access Journals (Sweden)

V. Zitko

2001-01-01

Full Text Available Many countries require the presence of free chlorine at about 0.1 mg/l in their drinking water supplies. For various reasons, such as cast-iron pipes or long residence times in the distribution system, free chlorine may decrease below detection limits. In such cases it is important to know whether or not the water was chlorinated or if nonchlorinated water entered the system by accident. Changes in UV spectra of natural organic matter in lakewater were used to assess qualitatively the degree of chlorination in the treatment to produce drinking water. The changes were more obvious in the first derivative spectra. In lakewater, the derivative spectra have a maximum at about 280 nm. This maximum shifts to longer wavelengths by up to 10 nm, decreases, and eventually disappears with an increasing dose of chlorine. The water treatment system was monitored by this technique for over 1 year and changes in the UV spectra of water samples were compared with experimental samples treated with known amounts of chlorine. The changes of the UV spectra with the concentration of added chlorine are presented. On several occasions, water, which received very little or no chlorination, may have entered the drinking water system. The results show that first derivative spectra are potentially a tool to determine, in the absence of residual chlorine, whether or not surface water was chlorinated during the treatment to produce potable water.

UV Photolysis of Chloramine and Persulfate for 1,4-Dioxane Removal in Reverse-Osmosis Permeate for Potable Water Reuse.

Science.gov (United States)

Li, Wei; Patton, Samuel; Gleason, Jamie M; Mezyk, Stephen P; Ishida, Kenneth P; Liu, Haizhou

2018-06-05

A sequential combination of membrane treatment and UV-based advanced oxidation processes (UV/AOP) has become the industry standard for potable water reuse. Chloramines are used as membrane antifouling agents and therefore carried over into the UV/AOP. In addition, persulfate (S 2 O 8 2- ) is an emerging oxidant that can be added into a UV/AOP, thus creating radicals generated from both chloramines and persulfate for water treatment. This study investigated the simultaneous photolysis of S 2 O 8 2- and monochloramine (NH 2 Cl) on the removal of 1,4-dioxane (1,4-D) for potable-water reuse. The dual oxidant effects of NH 2 Cl and S 2 O 8 2- on 1,4-D degradation were examined at various levels of oxidant dosage, chloride, and solution pH. Results showed that a NH 2 Cl-to-S 2 O 8 2- molar ratio of 0.1 was optimal, beyond which the scavenging by NH 2 Cl of HO • , SO 4 •- , and Cl 2 •- radicals decreased the 1,4-D degradation rate. At the optimal ratio, the degradation rate of 1,4-D increased linearly with the total oxidant dose up to 6 mM. The combined photolysis of NH 2 Cl and S 2 O 8 2- was sensitive to the solution pH due to a disproportionation of NH 2 Cl at pH lower than 6 into less-photoreactive dichloramine (NHCl 2 ) and radical scavenging by NH 4 + . The presence of chloride transformed HO • and SO 4 •- to Cl 2 •- that is less-reactive with 1,4-D, while the presence of dissolved O 2 promoted gaseous nitrogen production. Results from this study suggest that the presence of chloramines can be beneficial to persulfate photolysis in the removal of 1,4-D; however, the treatment efficiency depends on a careful control of an optimal NH 2 Cl dosage and a minimal chloride residue.

Detection of Leaks in Water Mains Using Ground Penetrating Radar

OpenAIRE

Alaa Al Hawari; Mohammad Khader; Tarek Zayed; Osama Moselhi

2016-01-01

Ground Penetrating Radar (GPR) is one of the most effective electromagnetic techniques for non-destructive non-invasive subsurface features investigation. Water leak from pipelines is the most common undesirable reason of potable water losses. Rapid detection of such losses is going to enhance the use of the Water Distribution Networks (WDN) and decrease threatens associated with water mains leaks. In this study, GPR approach was developed to detect leaks by implementing an appropriate imagin...

Biodosimetric analysis of medium pressure UV disinfection reactor treating unfiltered surface water

International Nuclear Information System (INIS)

Leinan, B.E.; Craik, S.A.; Smith, D.W.; Belosevic, M.

2002-01-01

Many small and medium-sized communities use chlorination of surface water as their sole treatment of potable water. Ultraviolet (UV) disinfection may offer these communities a cost effective treatment option for protection against pathogens not readily inactivated by chlorine. The effectiveness of UV reactors for microorganism reduction, however, is sensitive to UV dose delivery, which is in turn influenced by water quality characteristics. The effectiveness of a Calgon Carbon Inc. Sentinel medium-pressure UV reactor for microorganism reduction was determined using biodosimetry with two non-pathogenic indicator organisms - MS2 phage and Bacillus subtilis. Testing was conducted using low turbidity (<0.5 NTU) lake water characterized by relatively high absorbance in the UV range (UVT of approx. 87 to 88% at 254 nm). The efficiency of UV dose delivery in the reactor was determined for various operating conditions by calculating the normalized reductive equivalent irradiance (REI). With a single lamp in operation, the normalized REI measured with B. subtilis increased significantly when the flow rate through the reactor was increased from 380 L/min to 1140 L/min. This increase in reactor efficiency was believed to be due to improved reactor hydrodynamics and axial mixing that accompanied the higher flow rates. In contrast, treatment efficiency based on biodosimetry with MS2 phage was found to decrease with increasing flow rate when a single lamp was in operation. In general, treatment efficiency was greater when more than one adjacent lamp was in operation, suggesting that the influence of flow short-circuiting with single lamp operation. Differences between the outcomes observed with the two indicator microorganisms were not resolved, however, it was concluded that reactor efficiency was sensitive to both water flow rate and the number of adjacent lamps that were in operation. (author)

Coping with drought: the experience of water sensitive urban design ...

African Journals Online (AJOL)

2014-11-14

Nov 14, 2014 ... cled water supply', supplied by local authorities. This system provides recycled water as an alternative source of water, for non-potable use only, via a pipeline with a tap for each user who opts to use it (McAlister, 2007). Stormwater is reused via rainwater harvesting tanks which allows for the re-use of water.

Organized Communities and Potable Water Public Utilities in Colombia: Advocacy for the Third Economic Option Based on the Common-pool Resources Theory

Directory of Open Access Journals (Sweden)

Jhonny Moncada Mesa

2013-11-01

Full Text Available Based on the theory and institutional principles proposed by Elinor Ostrom, this paper explores whether Colombian organized communities are able to provide potable water public utility in a sustainable manner and manage it as a common-pool resource (CPR. For this purpose, a set of Colombian community aqueducts is selected and compared against the eight principles proposed by this theory. The results have shown that, in general it complies with institutional principles but it also highlights difficulties, particularly in regards to the "minimal recognition of organization rights" principle.

Gouvernance de l’eau potable et dynamiques locales en zone rurale au Bénin

Directory of Open Access Journals (Sweden)

Bernard G. Hounmenou

2006-05-01

Full Text Available Dans la fourniture des services de base aux populations, les politiques publiques de plusieurs pays, en particulier celles des Pays en Voie de Développement (PED, ont connu ces dernières années une profonde mutation. Les changements les plus remarquables se rapportent à la remise en cause du service public gratuit. Outre la nécessité fondamentale pour les Etats d’assainir leurs économies, ces réformes visent à favoriser une participation des populations dans la conduite des opérations ayant pour objectif la satisfaction de leurs besoins. La question de la participation constitue actuellement un élément capital pour l’organisation des services au niveau communautaire. En effet, plusieurs expériences ont montré que les projets réalisés sans la participation des populations concernées ont échoué au moment de l’exécution ou, faute d’entretien, n’ont eu que des retombées éphémères (Banque Mondiale, 1994. Au Bénin, certaines opérations de développement, en particulier celles conduites dans le secteur de l’approvisionnement en eau potable des populations rurales, n’ont pas échappé à cette réalité. En effet, jusqu’à la fin des années 1980, plusieurs ouvrages d’approvisionnement en eau potable ont été construits par les pouvoirs publics, sans une réelle participation des communautés bénéficiaires en milieu rural béninois. Cette situation a occasionné un manque d’intérêt des populations, qui s’est exprimé par l’abandon des ouvrages en cas de panne, et le recours à l’utilisation de sources d’eau non potable. Pour y remédier, le Bénin a opté en 1992 pour une nouvelle stratégie nationale d’alimentation en eau potable. La stratégie a pour objectif l’implication des populations du monde rural dans tout le processus d’appropriation de l’alimentation en eau. Les principes fondamentaux de cette stratégie sont notamment, la décentralisation du processus de prise de d

The modular pebble bed nuclear reactor - the preferred new sustainable energy source for electricity, hydrogen and potable water production?

International Nuclear Information System (INIS)

Kemeny, L.G.

2003-01-01

This paper describes a joint project of Massachusetts Institute of technology, Nu-Tec Inc. and Proto Power. The elegant simplicity of graphite moderated pebble bed reactor is the basis for the 'generation four' nuclear power plants. High Temperature Gas Cooled (HTGC) nuclear power plant have the potential to become the preferred base load sustainable energy source for the new millennium. The great attraction of these helium cooled 'Generation Four' nuclear plant can be summarised as follows: Factory assembly line production; Modularity and ease of delivery to site; High temperature Brayton Cycle ideally suited for cogeneration of electricity, potable water and hydrogen; Capital and operating costs competitive with hydrocarbon plant; Design is inherently meltdown proof and proliferation resistant

The control of potential health risks related to drinking water in the UK

Energy Technology Data Exchange (ETDEWEB)

Dick, T A

1981-04-01

In the United Kingdom, potable water put into supply is required to be 'wholesome'. The term 'wholesome' is interpreted as clear, palatable and safe to drink. About 99% of potable supplies are provided by Regional Water Authorities and Water Companies (for England and Wales), Regional Councils and Island Councils (for Scotland) and the Department of the Environment (NI) (for Northern Ireland). These water authorities draw their raw water from upland surface waters, lowland surface waters (including lakes and rivers) and underground waters. Although each source provides approximately one-third of supply, the proportion varies considerably in different parts of the UK. Consequently the control of potential health risks related to drinking water also varies according to the source of supply. The paper describes briefly the treatment practice for the various sources, including disinfection practice. More specifically the paper describes current UK practice or developments in the control or investigation of plumbosolvency, fluoridation, nitrate, trihalomethanes, other organic micropollutants, sodium, asbestos and tar linings in pipes. The possibilities for the surveillance of the 1% of private supplies are also discussed.

Uranium removal from the water supply

International Nuclear Information System (INIS)

Miranzadeh, Mohammad Bagher.

1996-01-01

Uranium can be naturally occurring radionuclides that contaminate some potable water supplies. Uranium is found both in surface water and ground water supplies. The United States Environmental Protection Agency recently proposed a maximum contaminant of 20 micro gram/liter for uranium because of concerns about its association with kidney disease and cancer. uranium can be removed from the supply by strong base anion-resin. Exhausted resin is regenerated by sodium chloride solution. (Author)

Occurrence of Surface Water Contaminations: An Overview

Science.gov (United States)

Shahabudin, M. M.; Musa, S.

2018-04-01

Water is a part of our life and needed by all organisms. As time goes by, the needs by human increased transforming water quality into bad conditions. Surface water contaminated in various ways which is pointed sources and non-pointed sources. Pointed sources means the source are distinguished from the source such from drains or factory but the non-pointed always occurred in mixed of elements of pollutants. This paper is reviewing the occurrence of the contaminations with effects that occurred around us. Pollutant factors from natural or anthropology factors such nutrients, pathogens, and chemical elements contributed to contaminations. Most of the effects from contaminated surface water contributed to the public health effects also to the environments.

Inverse Modeling of Water-Rock-CO2 Batch Experiments: Potential Impacts on Groundwater Resources at Carbon Sequestration Sites.

Science.gov (United States)

Yang, Changbing; Dai, Zhenxue; Romanak, Katherine D; Hovorka, Susan D; Treviño, Ramón H

2014-01-01

This study developed a multicomponent geochemical model to interpret responses of water chemistry to introduction of CO2 into six water-rock batches with sedimentary samples collected from representative potable aquifers in the Gulf Coast area. The model simulated CO2 dissolution in groundwater, aqueous complexation, mineral reactions (dissolution/precipitation), and surface complexation on clay mineral surfaces. An inverse method was used to estimate mineral surface area, the key parameter for describing kinetic mineral reactions. Modeling results suggested that reductions in groundwater pH were more significant in the carbonate-poor aquifers than in the carbonate-rich aquifers, resulting in potential groundwater acidification. Modeled concentrations of major ions showed overall increasing trends, depending on mineralogy of the sediments, especially carbonate content. The geochemical model confirmed that mobilization of trace metals was caused likely by mineral dissolution and surface complexation on clay mineral surfaces. Although dissolved inorganic carbon and pH may be used as indicative parameters in potable aquifers, selection of geochemical parameters for CO2 leakage detection is site-specific and a stepwise procedure may be followed. A combined study of the geochemical models with the laboratory batch experiments improves our understanding of the mechanisms that dominate responses of water chemistry to CO2 leakage and also provides a frame of reference for designing monitoring strategy in potable aquifers.

New non-stick expoxy-silicone water-based coatings part 1: Physical and surface properties

Energy Technology Data Exchange (ETDEWEB)

Garti, N. [Hebrew Univ. of Jerusalem (Israel); Smith, J. [Decora Manufacturing, Fort Edward, NY (United States)

1995-06-01

In search for tomorrow`s technology for water-based coating, Decora Manufacturing and The Hebrew University of Jerusalem, have initiated an intensive research program for designing, developing and manufacturing new coatings based on cross-linked, room temperature-cured silicone-expoxy resins. The new water-borne coatings have most exciting characteristics such as: non-stick properties, effective release, high lubricity, corrosion protection and abrasion resistance. The coatings are environmentally-friendly and easy to use. These coatings are ideal for marine, agricultural, industrial and maintenance applications. This paper brings quantitative measurements related to the dispersion technology (particle size, stability, shelf-life), to the non-stick properties (deicing, low surface energy, easy-release and non-stick), lubricity, adhesion to substrates, viscosity, dynamic and static friction coefficients and environmental impact (low VOC, non-toxicity, low-leaching). The coating was tested in various industrial coating systems and was found to exhibit excellent non-stick and release properties. Special attention was given to Zebra Mussels, Quagga Mussels and other bacterial and algeal bioforms. The coating proved to be efficient as foul-release coating with very low biofouling adhesion. The low adhesion applied to many other substances in which foul-release means easy-clean and low-wear.

Challenges in setting up a potable water supply system in a United Nations peacekeeping mission: the South Sudan experience.

Science.gov (United States)

Hazra, Aniruddha

2013-01-01

A United Nations peacekeeping contingent was deployed in the conflict affected areas of South Sudan with inadequate environmental sanitation, lack of clean drinking water and a heightened risk of water-borne diseases. In the immediate post-deployment phase, the contingent-owned water purification system was pressed into service. However, laboratory analyses of processed water revealed its unsuitability for human consumption. A systematic, sanitary survey was conducted to identify the shortcomings in the water supply system's ability to provide potable water. Under field conditions, the 'H2S method' was used to detect faecal contamination of drinking water. The raw water from the only available source, the White Nile River, was highly turbid and contaminated by intestinal and other pathogens due to an unprotected watershed. Water sterilizing powder was not readily available in the local area to replenish the existing stocks that had deteriorated during the long transit period from the troop contributing country. The water pipelines that had been laid along the ground, under water-logged conditions, were prone to microbial recontamination due to leakages in the network. The critical evaluation of the water supply system and necessary modifications in the purification process, based upon locally available options, yielded safe drinking water. Provision of safe drinking water in the mission area requires an in-depth analysis of prevailing conditions and appropriate planning in the pre-deployment phase. The chemicals for water purification should be procured through UN sources via a 'letter of assist' request from the troop contributor. Copyright © 2012 Elsevier GmbH. All rights reserved.

Cogeneration of Electricity and Potable Water Using The International Reactor Innovative And Secure (IRIS) Design

International Nuclear Information System (INIS)

Ingersoll, D.T.; Binder, J.L.; Kostin, V.I.; Panov, Y.K.; Polunichev, V.; Ricotti, M.E.; Conti, D.; Alonso, G.

2004-01-01

The worldwide demand for potable water has been steadily growing and is projected to accelerate, driven by a continued population growth and industrialization of emerging countries. This growth is reflected in a recent market survey by the World Resources Institute, which shows a doubling in the installed capacity of seawater desalination plants every ten years. The production of desalinated water is energy intensive, requiring approximately 3-6 kWh/m3 of produced desalted water. At current U.S. water use rates, a dedicated 1000 MW power plant for every one million people would be required to meet our water needs with desalted water. Nuclear energy plants are attractive for large scale desalination application. The thermal energy produced in a nuclear plant can provide both electricity and desalted water without the production of greenhouse gases. A particularly attractive option for nuclear desalination is to couple a desalination plant with an advanced, modular, passively safe reactor design. The use of small-to-medium sized nuclear power plants allows for countries with smaller electrical grid needs and infrastructure to add new electrical and water capacity in more appropriate increments and allows countries to consider siting plants at a broader number of distributed locations. To meet these needs, a modified version of the International Reactor Innovative and Secure (IRIS) nuclear power plant design has been developed for the cogeneration of electricity and desalted water. The modular, passively safe features of IRIS make it especially well adapted for this application. Furthermore, several design features of the IRIS reactor will ensure a safe and reliable source of energy and water even for countries with limited nuclear power experience and infrastructure. The IRIS-D design utilizes low-quality steam extracted from the low-pressure turbine to boil seawater in a multi-effect distillation desalination plant. The desalination plant is based on the horizontal

Perceptions of Different Stakeholders on Reclaimed Water Reuse: The Case of Beijing, China

OpenAIRE

Weiping Chen; Yanying Bai; Weiling Zhang; Sidan Lyu; Wentao Jiao

2015-01-01

Public involvement is critical to the successful implementation of reclaimed water reuse programs. Based on the participatory research method, we studied the attitudes of the stakeholders who are involved in reclaimed water reuse in Beijing, China. Results showed that the general public’s knowledge on water resources was poor, while their awareness on reclaimed water reuse was high. The general public showed a strong acceptance of non-contact and non-potable reclaimed water reuse, but their a...

Autotrophic nitrogen removal process in a potable water treatment biofilter that simultaneously removes Mn and NH4(+)-N.

Science.gov (United States)

Cai, Yan'an; Li, Dong; Liang, Yuhai; Zeng, Huiping; Zhang, Jie

2014-11-01

Ammonia (NH4(+)-N) removal pathways were investigated in a potable water treatment biofilter that simultaneously removes manganese (Mn) and NH4(+)-N. The results indicated a significant loss of nitrogen in the biofilter. Both the completely autotrophic nitrogen removal over nitrite (CANON) process and nitrification were more likely to contribute to NH4(+)-N removal. Moreover, the model calculation results demonstrated that the CANON process contributed significantly to the removal of NH4(+)-N. For influent NH4(+)-N levels of 1.030 and 1.749mg/L, the CANON process contribution was about 48.5% and 46.6%, respectively. The most important finding was that anaerobic ammonia oxidation (ANAMMOX) bacteria were detectable in the biofilter. It is interesting that the CANON process was effective even for such low NH4(+)-N concentrations. Copyright © 2014 Elsevier Ltd. All rights reserved.

Drinking water: problems related to water supply in Bahía Blanca, Argentina Agua potable: problemas en el abastecimiento de la ciudad de Bahía Blanca, Argentina

Directory of Open Access Journals (Sweden)

Ricardo Echenique

2006-12-01

Full Text Available In April 2000, alterations in drinking water quality, such as turbidity and odors similar to those of organochloride pesticides, were detected at Bahía Blanca (Argentina. This fact was associated to reports of dermic reactions and respiratory problems in the population. Samples drawn from Paso de las Piedras reservoir, two water treatment plants of at inlet and outlet points and at several particular houses were analyzed. Total phytoplankton in the reservoir varied between 49440 and 84832 cells.ml-1, while dominant species was, Anabaena circinalis. Efficiency to remove microorganisms (ER by the treatment plants considering cell number of total phytoplankton was analyzed. Bacteriological analysis, qualitative and quantitative studies of phytoplankton, pesticides, THM (trihalomethanes and BTEX (benzene, toluene, ethylbenzene and xylene analysis were carried out in samples of domestic supply and in the treatment plants. Even though samples were bacteriological potable, Anabaena circinalis and Microcystis aeruginosa algae were found at high concentrations in some cases. No pesticides were detected. THM and BTEX were below guideline values into recommendations for drinking water. Geosmin was responsible for detected odors. Besides, Copaene, another volatile metabolite, which on account in its structure could be considered a Geosmin precursor, was also detected. In Argentina, this was the first report of Cyanobacteria presence in drinking water.En abril de 2000, en Bahía Blanca (Argentina, se detectaron alteraciones en el agua de bebida, turbidez y olor semejante a "Gamexane". Esto coincidió con la aparición de problemas dérmicos y respiratorios en la población. Para determinar el origen del problema, se analizaron muestras, tomadas en el embalse Paso de las Piedras, en las plantas potabilizadoras y en varios domicilios particulares. En el embalse, la densidad celular del fitoplancton, fluctuó entre 49440 y 84832 cél/ml-1, muy por encima de

Hydro-geochemical characterization of Treated Domestic Waste Water for possible use in homestead irrigation and managed aquifer recharge in the coastal city of Khulna, Bangladesh

Science.gov (United States)

Hamid, T.; Ahmed, K. M.

2016-12-01

Bangladesh is among the most densely populated countries in the world. Rapid and unplanned urbanization in Bangladesh has resulted in heterogeneous land use pattern and larger demands for municipal water. To meet the ever-increasing demand of water for such population, the usage of treated domestic waste water (DWW) has become a viable option that can serve specific purposes, i.e. homestead irrigation, managed aquifer recharge (MAR) in major cities like Khulna, the largest city in the southwest coastal region. It is an attractive solution to minimize the deficit between the demand and supply of water in the study area where, in specific parts, city-dwellers suffer year round shortage of potable water due to high salinity in shallow depths. However, certain degree of treatment is mandatory for DWW in order to ensure the compliance of the output water with a set of standards and regulations for the DWW reuse. At present, the DWW is being treated through Constructed Wetlands but the treated water is not used and discharged into the sewer system. Wastewater that has been treated through a constructed wetland is a resource that can be used for productive uses in homestead garden irrigation, artificial aquifer recharge, and other non-potable uses. The study addresses the effectiveness of constructed wetlands in improving the quality of wastewater through on the hydro-geochemical characterization of both raw and treated DWW as well as baseline water quality analysis of surface and ground water in and around the treatment plant with consideration of seasonal variations. The study aims at sustainable development through conservation of water, satisfaction of demands, reliability of water supply, contribution to urban food supply, sustenance of livelihood and replenishment of the depleting aquifer by assessing the suitability of the treated DWW for various non-potable uses and also to provide guidelines for possible uses of treated DWW without adverse impact on environment

Access to potable water and sanitation in Cameroon within the context of Millennium Development Goals (MDGS).

Science.gov (United States)

Ako, Andrew Ako; Shimada, Jun; Eyong, Gloria Eneke Takem; Fantong, Wilson Yetoh

2010-01-01

Cameroon has been fully engaged with the Millennium Development Goals (MDGs) since their inception in 2000. This paper examines the situation of access to potable water and sanitation in Cameroon within the context of the Millennium Development Goals (MDGs), establishes whether Cameroon is on the track of meeting the MDGs in these domains and proposes actions to be taken to bring it closer to these objectives. Based on analyzed data obtained from national surveys, government ministries, national statistical offices, bibliographic research, reports and interviews, it argues that Cameroon will not reach the water and sanitation MGDs. While Cameroon is not yet on track to meet the targets of the MDGs for water and sanitation, it has made notable progress since 1990, much more needs to be done to improve the situation, especially in rural areas. In 2006, 70% of the population had access to safe drinking water and the coverage in urban centres is 88%, significantly better than the 47% in rural areas. However, rapid urbanization has rendered existing infrastructure inadequate with periurban dwellers also lacking access to safe drinking water. Sanitation coverage is also poor. In urban areas only 58% of the population has access to improved sanitation facilities, and the rate in rural areas is 42%. Women and girls shoulder the largest burden in collecting water, 15% of urban and 18% rural populations use improved drinking water sources over 30 minutes away. Cameroon faces the following challenges in reaching the water and sanitation MDGs: poor management and development of the resources, coupled with inadequate political will and commitment for the long term; rapid urbanization; urban and rural poverty and regulation and legislative lapses. The authors propose that: bridging the gap between national water policies and water services; recognizing the role played by Civil Society Organizations (CSOs) in the attainment of MDGs; developing a Council Water Resource Management

Silver deposition on stainless steel container surfaces in contact with disinfectant silver aqueous solutions

International Nuclear Information System (INIS)

Petala, M.; Tsiridis, V.; Mintsouli, I.; Pliatsikas, N.; Spanos, Th.; Rebeyre, P.; Darakas, E.; Patsalas, P.; Vourlias, G.; Kostoglou, M.; Sotiropoulos, S.; Karapantsios, Th.

2017-01-01

Highlights: • Silver is one of the biocides of water consumed in the International Space Station. • Ionic silver is depleted from potable water when in contact with stainless steel (SS). • SEM and XPS analysis reveal a uniform silver deposition over the SS surface. • Silver deposits in its metallic form, in line with a galvanic deposition mechanism. • Evidence is provided that Cr and/ or Ni oxide builds-up on SS surfaces. - Abstract: Silver is the preservative used on the Russian segment of the International Space Station (ISS) to prevent microbial proliferation within potable water supplies. Yet, in the frame of the European Automated Transfer Vehicle (ATV) missions to ISS, silver depletion from water has been detected during ground transportation of this water to launch site, thereby indicating a degradation of water quality. This study investigates the silver loss from water when in contact with stainless steel surfaces. Experiments are conducted with several types of stainless steel surfaces being exposed to water containing 10 or 0.5 mg/L silver ions. Results show that silver deposits on stainless steel surfaces even when a passivation layer protects the metallic surface. The highest protection to silver deposition is offered by acid passivated and electropolished SS 316L. SEM and XPS experiments were carried out at several locations of the sample area that was in contact with the Ag solution and found similar morphological (SEM) and compositional (sputter-etch XPS) results. The results reveal that silver deposits uniformly across the wetted surface to a thickness larger than 3 nm. Moreover, evidence is provided that silver deposits in its metallic form on all stainless steel surfaces, in line with a galvanic deposition mechanism. Combination of ICP-MS and XPS results suggests a mechanism for Ag deposition/reduction with simultaneous substrate oxidation resulting in oxide growth at the exposed stainless steel surface.

Silver deposition on stainless steel container surfaces in contact with disinfectant silver aqueous solutions

Energy Technology Data Exchange (ETDEWEB)

Petala, M., E-mail: petala@civil.auth.gr [Department of Civil Engineering, Aristotle University of Thessaloniki, Thessaloniki, 54124 (Greece); Tsiridis, V. [Department of Civil Engineering, Aristotle University of Thessaloniki, Thessaloniki, 54124 (Greece); Mintsouli, I. [Department of Chemistry, Aristotle University of Thessaloniki, Thessaloniki, 54124 (Greece); Pliatsikas, N. [Department of Physics, Aristotle University of Thessaloniki, Thessaloniki, 54124 (Greece); Spanos, Th. [Department of Petroleum and Mechanical Engineering Sciences, Eastern Macedonia and Thrace Institute of Technology, Kavala, 65404 (Greece); Rebeyre, P. [ESA/ESTEC, P.O.Box 299, 2200 AG, Noordwijk (Netherlands); Darakas, E. [Department of Civil Engineering, Aristotle University of Thessaloniki, Thessaloniki, 54124 (Greece); Patsalas, P.; Vourlias, G. [Department of Physics, Aristotle University of Thessaloniki, Thessaloniki, 54124 (Greece); Kostoglou, M.; Sotiropoulos, S.; Karapantsios, Th. [Department of Chemistry, Aristotle University of Thessaloniki, Thessaloniki, 54124 (Greece)

2017-02-28

Highlights: • Silver is one of the biocides of water consumed in the International Space Station. • Ionic silver is depleted from potable water when in contact with stainless steel (SS). • SEM and XPS analysis reveal a uniform silver deposition over the SS surface. • Silver deposits in its metallic form, in line with a galvanic deposition mechanism. • Evidence is provided that Cr and/ or Ni oxide builds-up on SS surfaces. - Abstract: Silver is the preservative used on the Russian segment of the International Space Station (ISS) to prevent microbial proliferation within potable water supplies. Yet, in the frame of the European Automated Transfer Vehicle (ATV) missions to ISS, silver depletion from water has been detected during ground transportation of this water to launch site, thereby indicating a degradation of water quality. This study investigates the silver loss from water when in contact with stainless steel surfaces. Experiments are conducted with several types of stainless steel surfaces being exposed to water containing 10 or 0.5 mg/L silver ions. Results show that silver deposits on stainless steel surfaces even when a passivation layer protects the metallic surface. The highest protection to silver deposition is offered by acid passivated and electropolished SS 316L. SEM and XPS experiments were carried out at several locations of the sample area that was in contact with the Ag solution and found similar morphological (SEM) and compositional (sputter-etch XPS) results. The results reveal that silver deposits uniformly across the wetted surface to a thickness larger than 3 nm. Moreover, evidence is provided that silver deposits in its metallic form on all stainless steel surfaces, in line with a galvanic deposition mechanism. Combination of ICP-MS and XPS results suggests a mechanism for Ag deposition/reduction with simultaneous substrate oxidation resulting in oxide growth at the exposed stainless steel surface.

Water Supply and Treatment Equipment. Change Notice 1

Science.gov (United States)

2014-08-05

Coagulation Filtration Total Dissolved Solids Water Quality Conductivity Potable water Turbidity Water Treatment/Purification Disinfection ...microorganisms (pathogenic) found in the raw water . The preferred Army field method of water disinfection is chlorination. Filtration Filtration...senses. It looks, tastes, and smells good and is neither too hot nor too cold. Potable water Water that is safe for drinking . Reverse osmosis

Estimating the potential water reuse based on fuzzy reasoning

OpenAIRE

Almeida, Giovana; Vieira, J. M. Pereira; Marques, Alfeu Sá; Kiperstok, Asher; Cardoso, Alberto

2013-01-01

Studies worldwide suggest that the risk of water shortage in regions affected by climate change is growing. Decision support tools can help governments to identify future water supply problems in order to plan mitigation measures. Treated wastewater is considered a suitable alternative water resource and it is used for non-potable applications in many dry regions around the world. This work describes a decision support system (DSS) that was developed to identify current water reus...

Assembling and testing of laboratory scale grey water treatment system

OpenAIRE

Harju, Vilhelmiina

2010-01-01

Grey water management and reuse is slowly gaining importance in the management of water resources. The benefits of well organized grey water management is that it offers a tool for coping with water scarcity and reduces the amount of pollution to enter the hydrological cycle. Grey water management aims on using treated grey water in applications which do not require drinking water quality. These non-potable reuse applications include industrial processes, irrigation, toilet flushing and lau...

Bulk water freezing dynamics on superhydrophobic surfaces

Science.gov (United States)

Chavan, S.; Carpenter, J.; Nallapaneni, M.; Chen, J. Y.; Miljkovic, N.

2017-01-01

In this study, we elucidate the mechanisms governing the heat-transfer mediated, non-thermodynamic limited, freezing delay on non-wetting surfaces for a variety of characteristic length scales, Lc (volume/surface area, 3 mm commercial superhydrophobic spray coatings, showing a monotonic increase in freezing time with coating thickness. The added thermal resistance of thicker coatings was much larger than that of the nanoscale superhydrophobic features, which reduced the droplet heat transfer and increased the total freezing time. Transient finite element method heat transfer simulations of the water slab freezing process were performed to calculate the overall heat transfer coefficient at the substrate-water/ice interface during freezing, and shown to be in the range of 1-2.5 kW/m2K for these experiments. The results shown here suggest that in order to exploit the heat-transfer mediated freezing delay, thicker superhydrophobic coatings must be deposited on the surface, where the coating resistance is comparable to the bulk water/ice conduction resistance.

Removal of Animal Antibiotics for Potable Water Reclamation: A Review

OpenAIRE

Chang, Rita

2015-01-01

Important classes of antibiotics that are used to treat bacterial infections in humans are also being used in food-producing animals. The overuse of antibiotics for animal food production is becoming an issue of growing concern as it promotes antibacterial resistance, compromising their efficacy and effectiveness. Low concentrations of antibiotics from feedlot runoff and wastewater discharges have been reported in surface waters and groundwaters used as drinking water sources. The presence of...

Radon concentration measurements in waters in Greece and Cyprus

International Nuclear Information System (INIS)

Louizi, A.; Nikolopoulos, D.; Tzortzi, A.; Thanassas, D.; Serefoglou, A.; Georgiou, E.; Vogiannis, E.; Koukouliou, V.

2004-01-01

The radon content of drinking water samples was determined with Alpha Guard Pro equipped with an appropriate unit (Aqua Kit). The samples were collected from water taps in dwellings located at various cities in Greece and Cyprus. In addition, surface water samples from rivers, lakes and seas as well as potable underground and hot spring water samples from Greece and Cyprus were also collected. For a precise determination of radon concentration in water samples, special procedures were followed both for sampling and transportation, as well as for measurement. Intercomparison experiments were designed and implemented before and during the study. Radon concentrations in drinking water samples in Greece ranged between 1.1 ± 0.5 Bq/L and 410±50 Bq/L. The corresponding concentrations in Cyprus ranged between 1.3 ± 0.8 Bq/L and 15±4 Bq/L. Three samples collected from the city of Arnea Chalkidikis (Northern Greece) exhibited high concentrations of 120±20 Bq/L, 320±40 Bq/L and 410±50 Bq/L. This city is identified as a high radon potential area. One water sample located in Lesvos Island (North-East part of Greece) exhibited radon concentration 140±20 Bq/L. Additional six samples displayed high concentrations in potable hot spring water samples. These samples which were collected from the city of Loutraki (Peloponnesus) ranged between 220-230 Bq/L. In addition, two samples characterized as 'medicinal drinking water' gave concentrations between 320 Bq/L and 340 Bq/L. For underground water samples the radon concentrations ranged between 1.2±0.7 Bq/L and 15±4 Bq/L, while for surface water samples the range was 2.7±0.8 Bq/L to 24±6 Bq/L. The observed concentrations of radon gas in potable water samples in Greece were found to be largely low. In Cyprus, they were all well below 15 Bq/L

Radiological quality in drinking water from Granada city; Calidad radiologica del agua potable de la ciudad de Granada

Energy Technology Data Exchange (ETDEWEB)

Lopez Penalver, J. J.; Gonzalez Gomez, C.; Ferro Garcia, M. A.; Prados Joya, G.

2007-07-01

The purpose of this study is to present data on gross alpha and beta activities in the drinking water from Granada city, during six years, 2000 to 2005. The samples were measured using a gas-flow proportional counter Bert hold LB 770-2/5. The results show that the gross alpha and gross beta cavity is lower than the maximum contaminant level based on the World Health Organisation, who which indicates 0.1 Bq.1-1 and 1.0 Bq.l''-1 as maximum contaminant level of gross alpha and gross beta radioactivity in potable water, respectively. Concentration ranging from 4.1.10''-3 to 3.9.10''2 Bq.l''-1 and from 4.9.10''-3 to 5.6.10''-2 Bq.l''-1 were observed from the gross alpha and beta activities, respectively. An average annual effective dose equivalent of 2.909 {mu}Sv-yr''-1 was obtained together with a range of 0.186 to 0.326 {mu}Sv.mo''-1. (Author) 10 refs.

De l'eau potable dans les foyers grâce à un dispositif révolutionnaire ...

International Development Research Centre (IDRC) Digital Library (Canada)

8 déc. 2010 ... Pour en savoir plus. DES EFFETS DURABLES > ACCÈS À L'EAU · Eau potable et meilleure santé grâce au filtre biosable · DESEA Perú · mantzwaterinfo.ca · Centre for Affordable Water and Sanitation Technology · Écosystèmes et santé humaine ...

Unsafe Practice of Extracting Potable Water From Aquifers in the Southwestern Coastal Region of Bangladesh

Science.gov (United States)

Chowdhury, S. H.; Ahmed, A. U.; Iqbal, M. Z.

2009-05-01

The groundwater resource is of paramount importance to the lives and livelihoods of the millions of people in Bangladesh. Unfortunately, high levels of arsenic have been found in groundwater in many parts of Bangladesh. Besides, the salinity in water systems in the coastal areas has increased as a consequence of the flow diversion from the upper reaches of Ganges River by the neighboring country India. Since hand- pumped groundwater (tube) wells are the only viable sources of drinking water, maintaining drinking water security for over 6 million people in the south-west (SW) region has been a major challenge for the Bangladesh Government. Due to rapid exploitation of groundwater resources in excess of recharge capacity, non-saline water sources in the SW region have already been depleted and the hand tube wells have mostly been abandoned. Meanwhile, shrimp farming has resulted in saline water infiltration into the perched aquifer system in many areas. A recent survey covering123 wells out of 184, extending to a depth of 330 m, showed high salinity in water. Combined factors of rapid exploitation of shallow groundwater, depletion of the deep aquifers and the subsequent saline water intrusion into these aquifers have put long-term sustainability of the remaining fresh groundwater resource into jeopardy. Very high concentrations of nitrite are found in this study in many tube wells in the area where samples have been drawn from aquifer systems up to 244 m deep. Nitrite concentrations in 35 wells randomly sampled in this study range from 16.98 to 43.11 mg/L, averaging 27.55 mg/L. This is much higher than the Maximum Contaminant Level (MCL) of 1 mg/L set by the U.S. EPA for human consumption. Simultaneously, dissolved oxygen (DO) is found to be very low (0.1 to 2 mg/L). There are numerous reports and anecdotal evidences of "Blue Baby Syndrome" (methemoglobinemia) in the region, which is generally due to gradual suffocation caused by poor transport of oxygen from the

Water pumping system using solar photovoltaic induction motor; Sistema de bombeamento de agua com energia solar fotovoltaica utilizando motor de inducao trifasico

Energy Technology Data Exchange (ETDEWEB)

Andrade, Eduardo Henrique Pereira de; Bezerra, Luiz Daniel Santos; Antunes, Fernando Luiz Marcelo [Universidade Federal do Ceara (DEE/PPGEE/UFC), Fortaleza, CE (Brazil). Dept. de Engenharia Eletrica. Programa de Pos -Graduacao em Engenharia Eletrica; Borges Neto, Manuel Rangel [Centro Federal de Educacao Tecnologica de Petrolina (CEFET), PE (Brazil)

2008-07-01

One of the main difficulties to people who live in remote areas or isolated community and not grid connected, certainly is to access potable drink water. In the world, more than 6000 children dies everyday by some kind of illnesses associated to non-potable drink water. At state of Ceara, during the dry weather periods, remain water reservoir becomes practically a mud puddle, as a result, people and animals are forced to drink this inappropriate water. To minimize this consequences in this periods some water is distributed by tankers but, sometimes, even this water is not enough potable. Underground water is an alternative to mitigate this problem. The most common technique is the use of direct current (DC) pumps set supplied by solar photovoltaic systems. However, this kind of pump-set is relatively expensive and too hard to maintain. This paper brings an alternative lower expensive and sustainable to water pumping system, it uses a three phase induction machine coupled to an underwater centrifugal pump supplied by solar photovoltaic energy system. (author)

Standardization and estimation of gross alpha and beta activities for potable water samples in presence of TDS using TDCR based LSA (Hidex 300SL)

International Nuclear Information System (INIS)

Gupta, Anil; Lenka, P.; Sahoo, S.K.; Patra, A.C.; Jha, S.K.; Tripathi, R.M.

2018-01-01

Quality of water is important in environmental studies because of its daily use for human consumption and an important route of intake for various elements and radionuclides. Therefore radiological quality of drinking water must be ensured. The screening parameter to evaluate the radiological safety of potable water is by estimating gross alpha and gross beta activities with a limit of 0.5 Bq/l and 1 Bq/l respectively. These have been traditionally being done by radiochemical co-precipitation of alpha and beta emitters followed by counting by ZnS(Ag) counter for alpha and gas flow proportional counter for beta. Gross alpha estimation in water samples with high TDS by ZnS(Ag) is difficult and often leads to underestimation of result due to self-absorption of alpha within the residue. This study was carried out to standardize a method to provide rapid results by simultaneously estimating both gross alpha and gross beta activity in the presence of TDS with adequate sensitivity, minimum sample processing

Liquid Water may Stick on Hydrophobic Surfaces

Indian Academy of Sciences (India)

IAS Admin

Common Perception. A surface can be classified as. > Wetting. > Non-wetting. Depending on the spreading characteristics of a droplet of water that splashes on the surface. The behavior of fluid on a solid surface under static and dynamic ..... color of the number density profile. Ions at the interface tend to form pinning zones ...

Iron oxidation kinetics and phosphorus immobilization at the groundwater-surface water interface

NARCIS (Netherlands)

van der Grift, Bas; Rozemeijer, Joachim; Griffioen, Jasper; van der Velde, Ype

2014-01-01

Eutrophication of freshwater environments following diffuse nutrient loads is a widely recognized water quality problem in catchments. Fluxes of non-point P sources to surface waters originate from surface runoff and flow from soil water and groundwater into surface water. The availability of P in

Reclaimed water as an alternative source of water for the city of Bulawayo, Zimbabwe

Science.gov (United States)

Taigbenu, Akpofure E.; Ncube, Mthokozisi

Perennial water problems, precipitated by increased water demand in Bulawayo, the second largest city in Zimbabwe, has prompted the consideration of a wide array of strategies from demand management and water conservation measures to exploitation of alternative water sources. One of such strategies in the latter category includes recycling of blue water for both potable and non-potable purposes. This paper examines the existing reclaimed water system with a view at revamping the existing infrastructure to maximise reclaimed water use for purposes that are amenable to water of lower quality. It is a generally accepted practice to avoid the use of water of high quality for purposes that can tolerate a lower grade, unless it is in excess in amount [ Okun, D.A., 1973. Planning for water reuse. Journal of AWWA 65(10)]. The reclaimed water is assessed in terms of its quality and quantity vis-à-vis possible uses. Perceptions and expectations of both current and identified prospective consumers are examined and discussed, in addition to the feasibility of accommodating these identified prospective consumers in an expanded network. Apart from enhancement of the existing infrastructure, the paper highlights the need for social marketing and education in order to realise the optimum benefits of this alternative water source. The cost implications of implementing the proposed project are evaluated, including suggestions on suitable tariff structure and an allocation distribution that achieves equity.

Reducing ultrafiltration membrane fouling during potable water reuse using pre-ozonation.

Science.gov (United States)

Wang, Hui; Park, Minkyu; Liang, Heng; Wu, Shimin; Lopez, Israel J; Ji, Weikang; Li, Guibai; Snyder, Shane A

2017-11-15

Wastewater reclamation has increasingly become popular to secure potable water supply. Low-pressure membrane processes such as microfiltration (MF) and ultrafiltration (UF) play imperative roles as a barrier of macromolecules for such purpose, but are often limited by membrane fouling. Effluent organic matter (EfOM), including biopolymers and particulates, in secondary wastewater effluents have been known to be major foulants in low-pressure membrane processes. Hence, the primary aim of this study was to investigate the effects of pre-ozonation as a pre-treatment for UF on the membrane fouling caused by EfOM in secondary wastewater effluents for hydrophilic regenerated cellulose (RC) and hydrophobic polyethersulfone (PES) UF membranes. It was found that greater fouling reduction was achieved by pre-ozonation for the hydrophilic RC membrane than the hydrophobic PES membrane at increasing ozone doses. In addition, the physicochemical property changes of EfOM, including biopolymer fractions, by pre-ozonation were systemically investigated. The classical pore blocking model and the extended Derjaguin-Landau-Verwey-Overbeek (XDLVO) theories were employed to scrutinize the fouling alleviation mechanism by pre-ozonation. As a result, the overarching mechanisms of fouling reduction were attributed to the following key reasons: (1) Ozone degraded macromolecules such as biopolymers like proteins and polysaccharides into smaller fractions, thereby increasing free energy of cohesion of EfOM and rendering them more hydrophilic and stable; (2) pre-ozonation augmented the interfacial free energy of adhesion between foulants and the RC/PES membranes, leading to the increase of repulsions and/or the decrease of attractions; and (3) pre-ozonation prolonged the transition from pore blocking to cake filtration that was a dominant fouling mechanism, thereby reducing fouling. Copyright © 2017 Elsevier Ltd. All rights reserved.

41 CFR 109-27.5008 - Control of drug substances and potable alcohol.

Science.gov (United States)

2010-07-01

..., and Guidelines § 109-27.5008 Control of drug substances and potable alcohol. Effective procedures and... 41 Public Contracts and Property Management 3 2010-07-01 2010-07-01 false Control of drug substances and potable alcohol. 109-27.5008 Section 109-27.5008 Public Contracts and Property Management...

Evaluation of appropriate technologies for grey water treatments and reuses.

Science.gov (United States)

Li, Fangyue; Wichmann, Knut; Otterpohl, Ralf

2009-01-01

As water is becoming a rare resource, the onsite reuse and recycling of grey water is practiced in many countries as a sustainable solution to reduce the overall urban water demand. However, the lack of appropriate water quality standards or guidelines has hampered the appropriate grey water reuses. Based on literature review, a non-potable urban grey water treatment and reuse scheme is proposed and the treatment alternatives for grey water reuse are evaluated according to the grey water characteristics, the proposed standards and economical feasibility.

Sustainable access to safe drinking water: fundamental human right in the international and national scene

Directory of Open Access Journals (Sweden)

Celso Maran de Oliveira

2017-12-01

Full Text Available Access to potable water is absolutely essential to the maintenance of life, as well as to provide regular exercise of other human rights. The lack of access to water in sufficient quantity or access to non-potable water may cause serious and irreparable damage to people. This paper investigates the evolution of international and national recognition of this fundamental human right, whether implicit or explicit. This was accomplished by the study of international human rights treaties, bibliographic information on water resources and their corresponding legal systems, national and international. The results suggest that sustainable access to drinking water is a fundamental human right in the context of international relations and the State. Further, even without explicitly stating this right in the Constitution of 1988, Brazil has incorporated the main international provisions on the subject, but this right must be acknowledged according to the principles of non-typical fundamental rights and the dignity of the human person. This right should be universally guaranteed by the Government in sufficient quantity and quality, regardless of the economic resources of individuals.

Fitting probability distributions to component water quality data from ...

African Journals Online (AJOL)

The treatment of water is carried out to make the available water meet the standards for its intended use. Such use may be for drinking and other household needs, industries,livestock rearing or fisheries etc. poor quality water is commonly treated to ensure potability. Potable water should be free from unpleasant tastes and ...

An Evaluation of the Bacteriological Quality of Water Consumed by ...

African Journals Online (AJOL)

, especially among the poorer urban and rural households because of the uneven distribution of potable water supply. Communities without potable water supply depend on traditional sources which have often been reported to be ...

An Integrated and Optimal Joint Scheduling of Energy Resources to Feed Electrical, Thermal and Potable Water Demands in Remote Area

Directory of Open Access Journals (Sweden)

R. Ghaffarpour

2016-12-01

Full Text Available The continuous spread of distributed energy resources (DERs such as combined heating and power (CHP, diesel generators, boilers and renewable energy sources provide an effective solution to energy related problems to serve the power and heat demands with minimum cost. Moreover, the DERs may play a significant role for supplying power and heat in rural areas, where grid electricity is not available. Also, some dry areas may face water scarcity and salinity problems. So, one important solution is the use of DERs to drive desalination units in order to solve water scarcity and salinity problems. In this study, the optimal scheduling of DERs and reverse osmosis (RO desalination unit that feed the required electric, thermal and potable water demands are determined. The present paper describes the operation constraints and cost function of components of the system in detail. Operation constraints of generation units as well as feasible region of operation CHP in dual dependency characteristic are taken into account. To confirm the performance of the proposed model the approach is tested on a realistic remote area over a 24-h period. The results show that the economical scheduling of DERs and desalination units can be obtained using proposed methodology by implementing the proposed formulation.

Imbalance in Groundwater-Surface Water Interactions and its Relationship to the Coastal Zone Hazards

Science.gov (United States)

Kontar, Y. A.; Ozorovich, Y. R.; Salokhiddinov, A. T.

2011-12-01

We report here some efforts and results in studying the imbalance in groundwater-surface water interactions and processes of groundwater-surface water interactions and groundwater flooding creating hazards in the coastal zones. Hazards, hydrological and geophysical risk analysis related to imbalance in groundwater-surface water interactions and groundwater flooding have been to a large extent under-emphasized for coastal zone applications either due to economical limitations or underestimation of significance of imbalance in groundwater-surface water interactions. This is particularly true for tsunamis creating salt water intrusion to coastal aquifers, even though most tsunami hazard assessments have in the past relied on scenario or deterministic type models, and to increasing mineralization of potable water because of intensive water diversions and also the abundance of highly toxic pollutants (mainly pesticides) in water, air and food, which contribute to the deterioration of the coastal population's health. In the wake of pressing environmental and economic issues, it is of prime importance for the scientific community to shed light onto the great efforts by hydrologists and geophysicists to quantify conceptual uncertainties and to provide quality assurances of potential coastal zone hazard evaluation and prediction under conditions of imbalance in groundwater-surface water interactions. This paper proposes consideration of two case studies which are important and significant for future understanding of a concept of imbalance in groundwater-surface water interactions and development and essential for feasibility studies of hazards in the coastal zone. The territory of the Aral Sea Region in Central Asia is known as an ecological disaster coastal zone. It is now obvious that, in order to provide reasonable living conditions to the coastal zone population, it is first of all necessary to drastically improve the quality of the water dedicated to human needs. Due

Water crisis: the metropolitan Atlanta, Georgia, regional water supply conflict

KAUST Repository

Missimer, Thomas M.

2014-07-01

Many large population centres are currently facing considerable difficulties with planning issues to secure future water supplies, as a result of water allocation and environmental issues, litigation, and political dogma. A classic case occurs in the metropolitan Atlanta area, which is a rapidly growing, large population centre that relies solely on surface water for supply. Lake Lanier currently supplies about 70% of the water demand and has been involved in a protracted legal dispute for more than two decades. Drought and environmental management of the reservoir combined to create a water shortage which nearly caused a disaster to the region in 2007 (only about 35 days of water supply was in reserve). While the region has made progress in controlling water demand by implementing a conservation plan, per capita use projections are still very high (at 511 L/day in 2035). Both non-potable reuse and indirect reuse of treated wastewater are contained in the most current water supply plan with up to 380,000 m3/day of wastewater treated using advanced wastewater treatment (nutrient removal) to be discharged into Lake Lanier. The water supply plan, however, includes no additional or new supply sources and has deleted any reference to the use of seawater desalination or other potential water sources which would provide diversification, thereby relying solely on the Coosa and Chattahoochee river reservoirs for the future. © 2014 IWA Publishing.

MX Siting Investigation. Water Resources Program Industry Activity Inventory, Nevada-Utah.

Science.gov (United States)

1980-09-02

Agua Caliente Existing 150 gpm *One of five sites shown on Plate II may be the site of this project. There are also three additional sites outside the...SOURCE: Wells WATER RECIRCULATED: 80%, hopefully WATER QUALITY: POTABLE : STOCK AGRICULTURE OTHER ? OPERATION - REOPENED: Reopened NEW: WATER...year _________ TYPE OF BENEFICIAL USE: __ * ~~WATER SOURCE: ____-____ WATER RECIRCULATED: ___ _____ WATER QUALITY: POTABLE : STOCK ___AGRICULTURE

The Energy, Greenhouse Gas Emissions, and Cost Implications of Municipal Water Supply & Wastewater Treatment

Science.gov (United States)

Rodriguez-Winter, Thelma

All man-made structures and materials have a design life. Across the United States there is a common theme for our water and wastewater treatment facilities and infrastructure. The design life of many of our mid 20 th century water and wastewater infrastructures in the United States have reached or are reaching life expectancy limits (ASCE, 2010). To compound the financial crisis of keeping up with the degradation, meeting and exceeding quality standards has never been more important in order to protect local fresh water supplies. This thesis analyzes the energy consumption of a municipal water and wastewater treatment system from a Lake Erie intake through potable treatment and back through wastewater treatment then discharge. The system boundary for this thesis includes onsite energy consumed by the treatment system and distribution/reclamation system as well as the energy consumed by the manufacturing of treatment chemicals applied during the study periods. By analyzing energy consumption, subsequent implications from greenhouse gas emissions and financial expenditures were quantified. Through the segregation of treatment and distribution processes from non-process energy consumption, such as heating, lighting, and air handling, this study identified that the potable water treatment system consumed an annual average of 2.42E+08 kBtu, spent 5,812,144 for treatment and distribution, and emitted 28,793 metric tons of CO2 equivalent emissions. Likewise, the wastewater treatment system consumed an annual average of 2.45E+08 kBtu, spent 3,331,961 for reclamation and treatment, and emitted 43,780 metric tons of CO2 equivalent emissions. The area with the highest energy usage, financial expenditure, and greenhouse gas emissions for the potable treatment facility and distribution system was from the manufacturing of the treatment chemicals, 1.10E+08 kBtu, 3.7 million, and 17,844 metric tons of CO2 equivalent, respectively. Of the onsite energy (1.4E-03 kWh per gallon

Water desalination using different capacity reactors options

International Nuclear Information System (INIS)

Alonso, G.; Vargas, S.; Del Valle, E.; Ramirez, R.

2010-01-01

The Northwest region of Mexico has a deficit of potable water, along this necessity is the region growth, which requires of additional energy capacity, cogeneration of potable water production and nuclear electricity is an option to be assessed. In this paper we will perform an economical comparison for cogeneration using a big reactor, the AP1000, and a medium size reactor, the IRIS, both of them are PWR type reactors and will be coupled to the desalination plant using the same method. For this cogeneration case we will assess the best reactor option that can cover both needs using the maximum potable water production for two different desalination methods: Multistage Flash Distillation and Multi-effect Distillation. (authors)

Escape jumping by three age-classes of water striders from smooth, wavy and bubbling water surfaces.

Science.gov (United States)

Ortega-Jimenez, Victor Manuel; von Rabenau, Lisa; Dudley, Robert

2017-08-01

Surface roughness is a ubiquitous phenomenon in both oceanic and terrestrial waters. For insects that live at the air-water interface, such as water striders, non-linear and multi-scale perturbations produce dynamic surface deformations which may impair locomotion. We studied escape jumps of adults, juveniles and first-instar larvae of the water strider Aquarius remigis on smooth, wave-dominated and bubble-dominated water surfaces. Effects of substrate on takeoff jumps were substantial, with significant reductions in takeoff angles, peak translational speeds, attained heights and power expenditure on more perturbed water surfaces. Age effects were similarly pronounced, with the first-instar larvae experiencing the greatest degradation in performance; age-by-treatment effects were also significant for many kinematic variables. Although commonplace in nature, perturbed water surfaces thus have significant and age-dependent effects on water strider locomotion, and on behavior more generally of surface-dwelling insects. © 2017. Published by The Company of Biologists Ltd.

Manufacturing and characterisation of water repellent surfaces

DEFF Research Database (Denmark)

De Grave, Arnaud; Botija, Pablo; Hansen, Hans Nørgaard

2006-01-01

design criteria for such surfaces. The problem of adapting this behaviour to artificially roughened surfaces is addressed by providing design criteria for superhydrophobic, water-repellent and self-cleaning surfaces according to the concrete performance desired for them. Different kind of manufacturing...... techniques are investigated and the production of patterned micro structured surfaces following two different manufacturing techniques is reported. The first is a combination of laser manufacturing and hot embossing on polystyrene. To compare geometry and functionality a non-silicon based lithography...

Corrosive microenvironments at lead solder surfaces arising from galvanic corrosion with copper pipe.

Science.gov (United States)

Nguyen, Caroline K; Stone, Kendall R; Dudi, Abhijeet; Edwards, Marc A

2010-09-15

As stagnant water contacts copper pipe and lead solder (simulated soldered joints), a corrosion cell is formed between the metals in solder (Pb, Sn) and the copper. If the resulting galvanic current exceeds about 2 μA/cm(2), a highly corrosive microenvironment can form at the solder surface, with pH chloride concentrations at least 11 times higher than bulk water levels. Waters with relatively high chloride tend to sustain high galvanic currents, preventing passivation of the solder surface, and contributing to lead contamination of potable water supplies. The total mass of lead corroded was consistent with predictions based on the galvanic current, and lead leaching to water was correlated with galvanic current. If the concentration of sulfate in the water increased relative to chloride, galvanic currents and associated lead contamination could be greatly reduced, and solder surfaces were readily passivated.

Estudio preliminar de tres modelos de destiladores solares para producir sal y agua potable (ING

Directory of Open Access Journals (Sweden)

Shyam S. Nandwani

2016-03-01

Full Text Available We have constructed three solar stills of areas 0.5-1.0 m2 to produce salt and potable water, using local technology and local materials. We have studied the thermal efficiency of these stills as a function of solar intensity, covers, geometrical configuration, quantity of water, salt concentration and artificial cooling of the cover. Some of the important results are: still with glass cover destill more water than still with plastic cover, thermal efficiency vary between 10-30%, amount of water which can be evaporated and condense is 2-4 l/day/m2, exist 25-60% of loss of water in the still and finally artificial cooling of the cover can be accelerate the process of condensation, etc. Finally we have mentioned the chemical analysis of destilled and normal tap water.

Prevalence and distribution of Legionella spp in potable water systems in Germany, risk factors associated with contamination, and effectiveness of thermal disinfection.

Science.gov (United States)

Kruse, Eva-Brigitta; Wehner, Arno; Wisplinghoff, Hilmar

2016-04-01

Worldwide, Legionella spp are a common cause of community-acquired pneumonia. Potable water systems are a main reservoir; however, exposure in the community is unknown. Water samples from 718 buildings in Germany were collected. Possible risk factors were prospectively recorded. All samples were tested for Legionella spp using cultural microbiologic methods. Samples were assigned to 1 of 5 levels of contamination. Statistical analysis was performed to determine the influence of risk factors for contamination and, in a subgroup of buildings, for unsuccessful thermal disinfection. In total, 4,482 water samples from 718 different water supply systems were analyzed. In 233 buildings (32.7%), Legionella spp were identified, 148 (63.5%) of which had a medium or higher level of contamination. The most common species was Legionella pneumophila (94%). Contamination was strongly associated with temperature in the circulation, but not with the size of the building, time of the year, or transport time to the laboratory. Thermal disinfection was successful in fewer than half of the buildings. There is relevant exposure to Legionella spp in the community. Water systems are not always up to current technical standards. Although microbiological risk assessment remains a challenge, there is a case for monitoring for Legionella spp outside of hospitals. Copyright © 2016 Association for Professionals in Infection Control and Epidemiology, Inc. Published by Elsevier Inc. All rights reserved.

Origins of the Non-DLVO Force between Glass Surfaces in Aqueous Solution.

Science.gov (United States)

Adler, Joshua J.; Rabinovich, Yakov I.; Moudgil, Brij M.

2001-05-15

Direct measurement of surface forces has revealed that silica surfaces seem to have a short-range repulsion that is not accounted for in classical DLVO theory. The two leading hypotheses for the origin of the non-DLVO force are (i) structuring of water at the silica interface or (ii) water penetration into the surface resulting in a gel layer. In this article, the interaction of silica surfaces will be reviewed from the perspective of the non-DLVO force origin. In an attempt to more accurately describe the behavior of silica and glass surfaces, alternative models of how surfaces with gel layers should interact are proposed. It is suggested that a lessened van der Waals attraction originating from a thin gel layer may explain both the additional stability and the coagulation behavior of silica. It is important to understand the mechanisms underlying the existence of the non-DLVO force which is likely to have a major influence on the adsorption of polymers and surfactants used to modify the silica surface for practical applications in the ceramic, mineral, and microelectronic industries. Copyright 2001 Academic Press.

Thermo-economic performance of inclined solar water distillation systems

Directory of Open Access Journals (Sweden)

Agboola Phillips O.

2015-01-01

Full Text Available This study investigates the thermo-economic performance of different configurations of inclined solar water desalination for parameters such as daily production, efficiency, system cost and distilled water production cost. The four different configurations considered for this study are as follows; 1. Inclined solar water distillation with bare absorber plate (IISWD with daily production of 5.46 kg/m2 day and daily efficiency of 48.3%. 2. Inclined solar water distillation with wick on absorber plate (IISWDW with daily production of 6.41kg/m2 day and daily efficiency 50.3%. 3. Inclined solar water distillation with wire mesh on absorber plate (IISWDWM with daily production n of 3.03 kg/m2 day and daily efficiency 32.6%. 4. Inclined solar water distillation with bare absorber plate (ISWD. (Control System with daily production of 3.25 kg/m2 day and daily efficiency of 40.1%. The systems potable water cost price ranges from 0.03 $/L for IISWDW to 0.06$/L for IISWDWM System. All the systems are economically and technically feasible as a solar distillation system for potable water in Northern Cyprus. The price of potable water from water vendors/hawkers ranges from 0.11-0.16 $/L. It is more economically viable to have the rooftop inclined solar water desalination system than procuring potable water from vendors.`

Potable Water Quality Management Guidance Document

Science.gov (United States)

2007-09-01

include GAC, microfiltration , ultrafiltration or nanofiltration. Because consecutive systems are buying and distributing treated water, their options for...booster chlorination and breakpoint chlorination. Booster chlorination restores chlorine residuals in the distribution system and minimizes initial...and sediments from the system; and 3) remove stagnant water. Removing stagnant water enables systems to restore disinfectant residuals to distant

Mapping and analysis of the groundwater potability in the Lajeado municipality, Rio Grande do Sul State, Brazil

Directory of Open Access Journals (Sweden)

Eduardo Strohschoen

2009-04-01

Full Text Available The groundwater sources spread in extensive areas and are relatively protected from pollution agents when compared to rivers and artificial reservoirs. These aspects, combined with low exploitation costs, provided a considerable growth in the groundwater use in the last decades. Groundwater became an important alternative source for public water supply in Brazil. This paper shows the georeferenced location of the groundwater exploitation points in the Lajeado, RS municipality and the potability analysis of this water. The groundwater exploitation in the study area is accomplished in the Serra Geral and Guarani aquifers and the exploitation points were identified in field campaigns using a GPS receiver and plotted over satellite imagery using remote sensing and geoprocessing techniques. The groundwater potability assessment was based on 100 samples for microbiological and physico-chemical analyses that included 78 samples of tubular wells and 22 of dug wells. Contour maps were generated for the analyzed parameters in the tubular wells, using geostatistics procedures. In this study, 362 tubular wells and 253 dug wells were studied. The results show that the dug wells are located mainly in rural areas and 77.27% of them aren’t suitable for human consumption due to high levels of contamination. The tubular wells are concentrated in urban areas and results revealed that 76.92% of them have water with suitable quality for the human consumption.

Spatial analysis of Ardabil plain aquifer potable groundwater using fuzzy logic

Directory of Open Access Journals (Sweden)

Mehdi Kord

2014-04-01

Full Text Available The purpose of this study is to evaluate the quality of drinking water and qualitative classification of potable water in Ardabil plain aquifer. To determine the chemical properties 58 water samples were collected from wells and analyzed. Distribution of each quality parameter was estimated using data driven techniques of kriging and fuzzy logic modeling. According to the obtained results, the fuzzy model provides better results compared to kriging. Different water quality standards are used for assessment of drinking water. The quantitative limits specified in these standards and also water quality data are associated with uncertainty. To reduce the uncertainty a fuzzy based decision making approach was applied for interpretation of groundwater quality. Final output was presented in the form of a zoning map with three categories as ‘Desirable’, ‘Acceptable’ and ‘Not acceptable’. This map indicates that most parts of the aquifer have acceptable and desirable water quality for drinking; but the groundwater in the Southwest and North of the plain, being in conformity with Miocene formations, is undesirable (Not acceptable. This spatial distribution map can help a lot for groundwater supply and offers a good insight of groundwater qualitative trend in this study area.

Peroxone mineralization of chemical oxygen demand for direct potable water reuse: Kinetics and process control.

Science.gov (United States)

Wu, Tingting; Englehardt, James D

2015-04-15

Mineralization of organics in secondary effluent by the peroxone process was studied at a direct potable water reuse research treatment system serving an occupied four-bedroom, four bath university residence hall apartment. Organic concentrations were measured as chemical oxygen demand (COD) and kinetic runs were monitored at varying O3/H2O2 dosages and ratios. COD degradation could be accurately described as the parallel pseudo-1st order decay of rapidly and slowly-oxidizable fractions, and effluent COD was reduced to below the detection limit (<0.7 mg/L). At dosages ≥4.6 mg L(-1) h(-1), an O3/H2O2 mass ratio of 3.4-3.8, and initial COD <20 mg/L, a simple first order decay was indicated for both single-passed treated wastewater and recycled mineral water, and a relationship is proposed and demonstrated to estimate the pseudo-first order rate constant for design purposes. At this O3/H2O2 mass ratio, ORP and dissolved ozone were found to be useful process control indicators for monitoring COD mineralization in secondary effluent. Moreover, an average second order rate constant for OH oxidation of secondary effluent organics (measured as MCOD) was found to be 1.24 × 10(7) ± 0.64 × 10(7) M(-1) S(-1). The electric energy demand of the peroxone process is estimated at 1.73-2.49 kW h electric energy for removal of one log COD in 1 m(3) secondary effluent, comparable to the energy required for desalination of medium strength seawater. Advantages/disadvantages of the two processes for municipal wastewater reuse are discussed. Copyright © 2015 Elsevier Ltd. All rights reserved.

Brote de gastroenteritis por agua potable de suministro público Waterborne outbreak of gastroenteritis transmitted through the public water supply

Directory of Open Access Journals (Sweden)

P. Godoy

2003-06-01

Full Text Available Introducción: La potabilidad del agua induce a descartar el posible origen hídrico de los brotes. El objetivo fue investigar un brote de gastroenteritis por agua potable de suministro público. Métodos: Después de la notificación de un brote de gastroenteritis en el municipio de Baqueira (Valle de Arán se diseñó un estudio epidemiológico de cohortes retrospectivo. Mediante un muestreo sistemático se eligió a 87 personas hospedadas en los hoteles y a 62 alojadas en diferentes apartamentos. Se recogió información sobre 4 factores (consumo de agua de la red, bocadillos, agua y alimentos en las pistas de esquí y presencia de síntomas. Se determinó la existencia de cloro, se analizó el agua de la red y se realizó un coprocultivo a 4 enfermos. La implicación de cada factor se determinó con el riesgo relativo (RR y su intervalo de confianza (IC del 95%. Resultados: La incidencia de gastroenteritis fue del 51,0% (76/149. Los porcentajes de los síntomas fueron los siguientes: fiebre, 27,0%; diarrea, 87,5%; náuseas, 50,7%; vómitos, 30,3%, y dolor abdominal, 80,0%. El único factor que presentó un riesgo estadísticamente significativo fue el consumo de agua de la red (RR = 11,0; IC del 95%, 1,6-74,7. La calificación sanitaria del agua fue de potabilidad. Se observó un defecto de situación del clorador en el depósito, que fue corregido. Se recomendó incrementar aún más las concentraciones de cloro, lo cual se acompañó de una disminución de los casos. Los coprocultivos de los 4 enfermos fueron negativos para las enterobacterias investigadas. Conclusiones: El estudio demuestra la posibilidad de presentación de brotes hídricos por agua cualificada como potable y sugiere la necesidad de mejorar la investigación microbiológica (determinación de protozoos y virus en este tipo de brotes.Introduction: The chlorination of public water supplies has led researchers to largely discard drinking water as a potential source of

Removal of phages and viral pathogens in a full-scale MBR: Implications for wastewater reuse and potable water.

Science.gov (United States)

Purnell, Sarah; Ebdon, James; Buck, Austen; Tupper, Martyn; Taylor, Huw

2016-09-01

The aim of this study was to demonstrate how seasonal variability in the removal efficacy of enteric viral pathogens from an MBR-based water recycling system might affect risks to human health if the treated product were to be used for the augmentation of potable water supplies. Samples were taken over a twelve month period (March 2014-February 2015), from nine locations throughout a water recycling plant situated in East London and tested for faecal indicator bacteria (thermotolerant coliforms, intestinal enterococci n = 108), phages (somatic coliphage, F-specific RNA phage and Bacteroides phage (GB-124) n = 108), pathogenic viruses (adenovirus, hepatitis A, norovirus GI/GII n = 48) and a range of physico-chemical parameters (suspended solids, DO, BOD, COD). Thermotolerant coliforms and intestinal enterococci were removed effectively by the water recycling plant throughout the study period. Significant mean log reductions of 3.9-5.6 were also observed for all three phage groups monitored. Concentrations of bacteria and phages did not vary significantly according to season (P < 0.05; Kruskal-Wallis), though recorded levels of norovirus (GI) were significantly higher during autumn/winter months (P = 0.027; Kruskal-Wallis). Log reduction values for norovirus and adenovirus following MBR treatment were 2.3 and 4.4, respectively. However, both adenovirus and norovirus were detected at low levels (2000 and 3240 gene copies/L, respectively) post chlorination in single samples. Whilst phage concentrations did correlate with viral pathogens, the results of this study suggest that phages may not be suitable surrogates, as viral pathogen concentrations varied to a greater degree seasonally than did the phage indicators and were detected on a number of occasions on which phages were not detected (false negative sample results). Copyright © 2016 Elsevier Ltd. All rights reserved.

Macro-invertebrate decline in surface water polluted with imidacloprid

NARCIS (Netherlands)

van Dijk, T.; van Staalduinen, M.A.; van der Sluijs, J.P.|info:eu-repo/dai/nl/073427489

Imidacloprid is one of the most widely used insecticides in the world. Its concentration in surface water exceeds the water quality norms in many parts of the Netherlands. Several studies have demonstrated harmful effects of this neonicotinoid to a wide range of non-target species. Therefore we

Reducing Tri halomethanes in the Aigues de Terrassa Potable Water Treatment Plant Using Potassium Permanganate; Reduccion de trihalometanos en la ETAP de Aigues de Terrassa. Tratamiento con permanganato potasico

Energy Technology Data Exchange (ETDEWEB)

Brull Fontsere, M.; Garcia Espejo, B.; Mellado Ruiz, J.

2003-07-01

Mina Publica de Aguas de Terrassa has changed the treatment in its potable water treatment plant which receivers water captured from the river Llobregat. This was prompted by the need to reduce the concentration of trihalomethanes (THM) in drinking water as provided for in Directive 98/83/EC, incorporated into Spanish law by means of Royal Decree 140/2003/. The company has moved the disinfecting stage to the end of the potabilising treatment process while simultaneously introducing the addition of potassium permanganate as apreoxidant. Given that the water in question in highly saline and also contains bromides, various compounds are generated among which bromoform is the most prominent followed, in decreasing rder of quantity, by dibromochloroethena and chloroform. However, the concentrations are much smallerthan those found prior to these changes so it can be concluded that have improved the supply and comply with current legislation. (Author)

Installation Restoration Program. Phase II, Stage 1. Problem Confirmation Study, Luke Air Force Base, Glendale, Arizona.

Science.gov (United States)

1984-11-01

potable water in LAFB. Surface water from the Central Arizona Project (CAP) is available to the Base, but at a significantly higher cost than that of...available supplies of potable water which currently support the Base mission at LAFB. 1-16 1-16 SECTION 2 ENVIRONMENTAL SETTING 2.1 REGIONAL GEOLOGY Luke Air...the northern portion of the Base discharges toward the nearest natural surface water feature, the Agua Fria River. Figure 2-1 summarizes surface

Étude pilote d'affinage par nanofiltration pour la production d'eau potable

OpenAIRE

Bonnelly, Mathieu

2005-01-01

Un traitement conventionnel suivi d'un affinage par nanofiltration (NF) permet de produire une eau potable de qualité exceptionnelle à partir d'une eau de surface, et ce tout en minimisant le colmatage des membranes de NF et en favorisant l'approche multibarrières. L'objectif principal de la présente étude est d'évaluer l'effet des conditions d'opération de la NF sur la productivité de ce traitement d'affinage. Des essais pilotes ont été réalisés entre octobre 2003 et mai 2004 à l'usine de ...

Surface Water & Surface Drainage

Data.gov (United States)

Earth Data Analysis Center, University of New Mexico — This data set contains boundaries for all surface water and surface drainage for the state of New Mexico. It is in a vector digital data structure digitized from a...

Potable water scarcity: options and issues in the coastal areas of Bangladesh.

Science.gov (United States)

Islam, Atikul; Sakakibara, Hiroyuki; Karim, Rezaul; Sekine, Masahiko

2013-09-01

In the coastal areas of Bangladesh, scarcity of drinking water is acute as freshwater aquifers are not available at suitable depths and surface water is highly saline. Households are mainly dependent on rainwater harvesting, pond sand filters and pond water for drinking purposes. Thus, individuals in these areas often suffer from waterborne diseases. In this paper, water consumption behaviour in two southwestern coastal districts of Bangladesh has been investigated. The data for this study were collected through a survey conducted on 750 rural households in 39 villages of the study area. The sample was selected using a random sampling technique. Households' choice of water source is complex and seasonally dependent. Water sourcing patterns, households' preference of water sourcing options and economic feasibility of options suggest that a combination of household and community-based options could be suitable for year-round water supply. Distance and time required for water collection were found to be difficult for water collection from community-based options. Both household and community-based options need regular maintenance. In addition to installation of water supply facilities, it is necessary to make the residents aware of proper operation and maintenance of the facilities.

Agua potable y saneamiento en la Argentina

OpenAIRE

Auge, Miguel

2007-01-01

Este trabajo fue presentado originalmente en el Foro Regional del Agua, con el título “Problemática del Acceso al Agua Potable y al Saneamiento en Argentina”. Dicho foro, organizado por la Defensoría del Pueblo de la Nación Argentina, se desarrolló en Córdoba, en mayo del 2007.

THE PRECAUTIONARY PROCEDURES IN THE CASE OF NON-COMPLIANCE WITH THE BALLAST WATER MANAGEMENT CON-VENTION’S STANDARDS – POSSIBLE SOLUTIONS FOR POLISH PORTS

Directory of Open Access Journals (Sweden)

Magdalena Klopott

2016-12-01

Full Text Available On September 8, 2017 the International Convention for the Control and Manage-ment of Ships’ Ballast Water and Sediments (BWMC adopted in 2004 will enter into force. It imposes a lot of requirements on shipowners and port states. The aim of this article is to elaborate on the possible solutions that may be adopted in Polish ports as precau-tionary measures in the case of non-compliance with the provisions of BWMC. The article starts with a brief overview of BWMC and ballast water quality stand-ards. Further, it discusses the possible implications of not meeting the ballast water quality standards under BWMC. The elaboration of potential solutions and mitigation measures in the event of non-compliance with the BWMC constitutes the main part of the article. These are crucial to developing a port contingency plan and include, for example, shore-based reception facility for ballast water, mobile ballast water treatment systems, and using potable water. The article ends with a brief analysis of a possible fee systems for reception of ballast water. The research was based on a comprehensive analysis of the Convention and related legal documents, interviews with ports’ representatives as well as e-mail interviews with maritime authorities in the Baltic Sea countries.

Poly(ethylene glycol)-grafted cyclic acetals based polymer networks with non-water-swellable, biodegradable and surface hydrophilic properties

Energy Technology Data Exchange (ETDEWEB)

Yin, Ruixue, E-mail: qdruinyan@hotmail.com [Complex and Intelligent Research Center, School of Mechanical and Power Engineering, East China University of Science and Technology, Shanghai (China); Zhang, Nan; Wu, Wentao [School of Materials Science and Engineering, Changzhou University, Changzhou 213164 (China); Wang, Kemin, E-mail: kemin-wang@hotmail.com [School of Materials Science and Engineering, Changzhou University, Changzhou 213164 (China)

2016-05-01

Cyclic acetals based biomaterial without acidic products during hydrolytic degradation is a promising candidate for tissue engineering applications; however, low hydrophilicity is still one limitation for its biomedical application. In this work, we aim to achieve non-water-swellable cyclic acetal networks with improved hydrophilicity and surface wettability by copolymerization of cyclic acetal units based monomer, 5-ethyl-5-(hydroxymethyl)-β,β-dimethyl-1, 3-dioxane-2-ethanol diacrylate (EHD) and methoxy poly(ethylene glycol) monoacrylate (mPEGA) under UV irradiation, to avoid swelling of conventional hydrogels which could limit their applicability in particular of the mechanical properties and geometry integrity. Various EHD/mPEGA networks were fabricated with different concentrations of mPEGA from 0 to 30%, and the results showed photopolymerization behavior, mechanical property and thermal stability could not be significantly affected by addition of mPEGA, while the surface hydrophilicity was dramatically improved with the increase of mPEGA and could achieve a water contact angle of 37° with 30% mPEGA concentration. The obtained EHD/mPEGA network had comparative degradation rate to the PECA hydrogels reported previously, and MTT assay indicated it was biocompatible to L929 cells. - Highlights: • Cyclic acetals contained EHD/mPEGA networks were fabricated by photopolymerization. • It can be degraded under simulated physiological condition without acidic products. • Surface hydrophilicity was increased without swelling in water.

Plan director red de abastecimiento de agua potable en la localidad de Gestalgar (Valencia)

OpenAIRE

HERRERA AGUILAR, MANUEL JOSÉ

2011-01-01

El objeto de este proyecto es definir las características técnicas necesarias para aumentar la eficiencia de las redes de alta de suministro de agua potable en la localidad de Gestalgar (Valencia) Herrera Aguilar, MJ. (2011). Plan director red de abastecimiento de agua potable en la localidad de Gestalgar (Valencia). http://hdl.handle.net/10251/12468. Archivo delegado

Effect of non-Legionellaceae bacteria on the multiplication of Legionella pneumophila in potable water.

OpenAIRE

Wadowsky, R M; Yee, R B

1985-01-01

A naturally occurring suspension of Legionella pneumophila and associated microbiota contained three unidentified non-Legionellaceae bacteria which supported satellite growth of a subculture of L. pneumophila on an L-cysteine-deficient medium and another bacterium which did not support growth of the subculture. Washed suspensions containing 10(3), 10(5), 10(7), or 10(8) CFU of a mixture of isolates of these non-Legionellaceae bacteria failed to support the multiplication of an isolate of agar...

Optimization of the Use of Selected Non-Phosphate Water Retention Additives in Minced Beef Using Response Surface Methodology

Science.gov (United States)

Shang, Xiaolan; Qiao, Jie; Liu, Yujie

2017-12-01

This study looked to determine what the optimum cooking loss for minced beef was when three different non-phosphate water retention additives (L-Arginine, sodium carbonate, and sodium citrate) were combined; the optimum value was determined using a Box-Behnken response surface design method. The optimum value was found to be 8.26%, and it was obtained when 0.29% L-Arginine, 0.45% sodium carbonate, and 0.24% sodium citrate were added to the beef.

Slowly biodegradable organic compounds impact the biostability of non-chlorinated drinking water produced from surface water.

Science.gov (United States)

Hijnen, W A M; Schurer, R; Bahlman, J A; Ketelaars, H A M; Italiaander, R; van der Wal, A; van der Wielen, P W J J

2018-02-01

It is possible to distribute drinking water without a disinfectant residual when the treated water is biologically stable. The objective of this study was to determine the impact of easily and slowly biodegradable compounds on the biostability of the drinking water at three full-scale production plants which use the same surface water, and on the regrowth conditions in the related distribution systems. Easily biodegradable compounds in the drinking water were determined with AOC-P17/Nox during 2012-2015. Slowly biodegradable organic compounds measured as particulate and/or high-molecular organic carbon (PHMOC), were monitored at the inlet and after the different treatment stages of the three treatments during the same period. The results show that PHMOC (300-470 μg C L -1 ) was approximately 10% of the TOC in the surface water and was removed to 50-100 μg C L -1 . The PHMOC in the water consisted of 40-60% of carbohydrates and 10% of proteins. A significant and strong positive correlation was observed for PHMOC concentrations and two recently introduced bioassay methods for slowly biodegradable compounds (AOC-A3 and biomass production potential, BPC 14 ). Moreover, these three parameters in the biological active carbon effluent (BACF) of the three plants showed a positive correlation with regrowth in the drinking water distribution system, which was assessed with Aeromonas, heterotrophic plate counts, coliforms and large invertebrates. In contrast, the AOC-P17/Nox concentrations did not correlate with these regrowth parameters. We therefore conclude that slowly biodegradable compounds in the treated water from these treatment plants seem to have a greater impact on regrowth in the distribution system than easily biodegradable compounds. Copyright © 2017 Elsevier Ltd. All rights reserved.

Arsenic Content of the Drinking Water Source, for the Guadiana Valley, Mexico; Contenido de arsenico en el agua potable de Valle del Guadiana, Mexico

Energy Technology Data Exchange (ETDEWEB)

Alarcon Herrera, Maria Teresa [Centro de Investigacion en Materiales Avanzados (Mexico); Flores Montenegro, Isela [Sistema Desentralizado de agua Potable y alcantarillado Durango (Mexico); Romero Navar, Pedro [Comision Nacional del Agua (Mexico); Martin Dominguez, Ignacio [Centro de Investigacion en Materiales Avanzados (Mexico); Trejo Vazquez, Rodolfo [Instituto Tecnologico de Aguascalientes (Mexico)

2001-12-01

In recent years, high levels of arsenic concentration have been detected in some drinking water sources of the Guadiana Valley (Durango and surrounding towns) in Mexico. These levels are above the limits recommended bye the world Health Organization (WHO) and the maximum levels allowed by the Mexican standards. due to the well.known toxicity of this element, this study set as its objective to determine in quantitative terms the arsenic content of the drinking water sources for the Guadiana Valley, as the first step in the way to solve environment problems, It was found that 59% of the sources in the south, northeast and Northwest zones of Durango exceed in 40% the maximum level established by Mexican standards for arsenic content. In the Guadiana towns, 48% of the sources surpass such levels even in 46%. If the maximum levels suggested bye the WHO are taken as the reference, then virtually all sources exceed such level. [Spanish] En los ultimos anos, en la region del valle de Gadiana (ciudad de Durango y poblados cercanos) se han detectado niveles de concentracion de arsenico (As) en algunos pozos de abastecimiento de agua potable que superan los limites recomendados por la Organizacion Mundial de la Salud(OMS) y el limite maximo permisible establecido por la legislacion mexicana. Dada la conocida toxicidad de dicho elemento, en el presente estudio se propuso determinar cuantitativamente el contenido de arsenico en los pozos de abastecimiento de agua potable del valle del Guadiana, como un primer paso hacia la solucion de la problematica ambiental. Se encontro que en la zona sureste, noroeste y noreste de la ciudad, en 59% de los pozos se excede hasta en 40% la concentracion de arsenico establecida como limite maximo por la legislacion mexicana. En las poblaciones del valle del Guadiana, 48% de los pozos superan los limites mencionados hasta en un 136%. Si se toma como referencia el limite maximo establecido por la OMS, practicamente todos los pozos exceden el

Surface-water surveillance

Energy Technology Data Exchange (ETDEWEB)

Saldi, K.A.; Dirkes, R.L.; Blanton, M.L.

1995-06-01

This section of the 1994 Hanford Site Environmental Report summarizes the Surface water on and near the Hanford Site is monitored to determine the potential effects of Hanford operations. Surface water at Hanford includes the Columbia River, riverbank springs, ponds located on the Hanford Site, and offsite water systems directly east and across the Columbia River from the Hanford Site, and offsite water systems directly east and across the Columbia River from the Hanford Site. Columbia River sediments are also included in this discussion. Tables 5.3.1 and 5.3.2 summarize the sampling locations, sample types, sampling frequencies, and sample analyses included in surface-water surveillance activities during 1994. Sample locations are also identified in Figure 5.3.1. This section describes the surveillance effort and summarizes the results for these aquatic environments. Detailed analytical results are reported by Bisping (1995).

Surface-water surveillance

International Nuclear Information System (INIS)

Saldi, K.A.; Dirkes, R.L.; Blanton, M.L.

1995-01-01

This section of the 1994 Hanford Site Environmental Report summarizes the Surface water on and near the Hanford Site is monitored to determine the potential effects of Hanford operations. Surface water at Hanford includes the Columbia River, riverbank springs, ponds located on the Hanford Site, and offsite water systems directly east and across the Columbia River from the Hanford Site, and offsite water systems directly east and across the Columbia River from the Hanford Site. Columbia River sediments are also included in this discussion. Tables 5.3.1 and 5.3.2 summarize the sampling locations, sample types, sampling frequencies, and sample analyses included in surface-water surveillance activities during 1994. Sample locations are also identified in Figure 5.3.1. This section describes the surveillance effort and summarizes the results for these aquatic environments. Detailed analytical results are reported by Bisping (1995)

Water at surfaces with tunable surface chemistries

Science.gov (United States)

Sanders, Stephanie E.; Vanselous, Heather; Petersen, Poul B.

2018-03-01

Aqueous interfaces are ubiquitous in natural environments, spanning atmospheric, geological, oceanographic, and biological systems, as well as in technical applications, such as fuel cells and membrane filtration. Where liquid water terminates at a surface, an interfacial region is formed, which exhibits distinct properties from the bulk aqueous phase. The unique properties of water are governed by the hydrogen-bonded network. The chemical and physical properties of the surface dictate the boundary conditions of the bulk hydrogen-bonded network and thus the interfacial properties of the water and any molecules in that region. Understanding the properties of interfacial water requires systematically characterizing the structure and dynamics of interfacial water as a function of the surface chemistry. In this review, we focus on the use of experimental surface-specific spectroscopic methods to understand the properties of interfacial water as a function of surface chemistry. Investigations of the air-water interface, as well as efforts in tuning the properties of the air-water interface by adding solutes or surfactants, are briefly discussed. Buried aqueous interfaces can be accessed with careful selection of spectroscopic technique and sample configuration, further expanding the range of chemical environments that can be probed, including solid inorganic materials, polymers, and water immiscible liquids. Solid substrates can be finely tuned by functionalization with self-assembled monolayers, polymers, or biomolecules. These variables provide a platform for systematically tuning the chemical nature of the interface and examining the resulting water structure. Finally, time-resolved methods to probe the dynamics of interfacial water are briefly summarized before discussing the current status and future directions in studying the structure and dynamics of interfacial water.

Surface freezing of water

OpenAIRE

P?rez-D?az, J. L.; ?lvarez-Valenzuela, M. A.; Rodr?guez-Celis, F.

2016-01-01

Freezing, melting, evaporation and condensation of water are essential ingredients for climate and eventually life on Earth. In the present work, we show how surface freezing of supercooled water in an open container is conditioned and triggered?exclusively?by humidity in air. Additionally, a change of phase is demonstrated to be triggered on the water surface forming surface ice crystals prior to freezing of bulk. The symmetry of the surface crystal, as well as the freezing point, depend on ...

Leaf gas exchange and water status responses of a native and non-native grass to precipitation across contrasting soil surfaces in the Sonoran Desert.

Science.gov (United States)

Ignace, Danielle D; Huxman, Travis E; Weltzin, Jake F; Williams, David G

2007-06-01

Arid and semi-arid ecosystems of the southwestern US are undergoing changes in vegetation composition and are predicted to experience shifts in climate. To understand implications of these current and predicted changes, we conducted a precipitation manipulation experiment on the Santa Rita Experimental Range in southeastern Arizona. The objectives of our study were to determine how soil surface and seasonal timing of rainfall events mediate the dynamics of leaf-level photosynthesis and plant water status of a native and non-native grass species in response to precipitation pulse events. We followed a simulated precipitation event (pulse) that occurred prior to the onset of the North American monsoon (in June) and at the peak of the monsoon (in August) for 2002 and 2003. We measured responses of pre-dawn water potential, photosynthetic rate, and stomatal conductance of native (Heteropogon contortus) and non-native (Eragrostis lehmanniana) C(4) bunchgrasses on sandy and clay-rich soil surfaces. Soil surface did not always amplify differences in plant response to a pulse event. A June pulse event lead to an increase in plant water status and photosynthesis. Whereas the August pulse did not lead to an increase in plant water status and photosynthesis, due to favorable soil moisture conditions facilitating high plant performance during this period. E. lehmanniana did not demonstrate heightened photosynthetic performance over the native species in response to pulses across both soil surfaces. Overall accumulated leaf-level CO(2) response to a pulse event was dependent on antecedent soil moisture during the August pulse event, but not during the June pulse event. This work highlights the need to understand how desert species respond to pulse events across contrasting soil surfaces in water-limited systems that are predicted to experience changes in climate.

Spatial and temporal variation in de facto wastewater reuse in drinking water systems across the U.S.A.

Science.gov (United States)

Rice, Jacelyn; Westerhoff, Paul

2015-01-20

De facto potable reuse occurs when treated wastewater is discharged into surface waters upstream of potable drinking water treatment plant (DWTP) intakes. Wastewater treatment plant (WWTP) discharges may pose water quality risks at the downstream DWTP, but additional flow aids in providing a reliable water supply source. In this work de facto reuse is analyzed for 2056 surface water intakes serving 1210 DWTPs across the U.S.A. that serve greater than 10,000 people, covering approximately 82% of the nation’s population. An ArcGIS model is developed to assess spatial relationships between DWTPs and WWTPs, with a python script designed to perform a network analysis by hydrologic region. A high frequency of de facto reuse occurrence was observed; 50% of the DWTP intakes are potentially impacted by upstream WWTP discharges. However, the magnitude of de facto reuse was seen to be relatively low, where 50% of the impacted intakes contained less than 1% treated municipal wastewater under average streamflow conditions. De facto reuse increased greatly under low streamflow conditions (modeled by Q95), with 32 of the 80 sites yielding at least 50% treated wastewater, this portion of the analysis is limited to sites where stream gauge data was readily available.

Public health risk status of the water supply frame work at Kwame ...

African Journals Online (AJOL)

The aim of the study is to assess the public health risk status of the potable water supply framework at the Kwame Nkurumah Postgraduate Residence (PG) Hall, University of Nigeria, Nsukka, (UNN), Enugu State, Nigeria, and environs. Four potable water supply frame-works at the PG Hall, UNN, and exposed stagnant ...

Water reactivity with mixed oxide (U,Pu)O2 surfaces

International Nuclear Information System (INIS)

Gaillard, Jeremy

2013-01-01

The interaction of water with actinides oxide surfaces remains poorly understood. The adsorption of water on PuO 2 surface and (U,Pu)O 2 surface leads to hydrogen generation through radiolysis but also surface evolution. The study of water interaction with mixed oxide (U,Pu)O 2 and PuO 2 surfaces requires the implementation of non intrusive techniques. The study of the hydration of CeO 2 surface is used to study the effectiveness of different techniques. The results show that the water adsorption leads to the surface evolution through the formation of a hydroxide superficial layer. The reactivity of water on the surface depends on the calcination temperature of the oxide precursor. The thermal treatment of hydrated surfaces can regenerate the surface. The study on CeO 2 hydration emphasizes the relevancies of these techniques in studying the hydration of surfaces. The hydrogen generation through water radiolysis is studied with an experimental methodology based on constant relative humidity in the radiolysis cell. The hydrogen accumulation is linear for the first hours and then tends to a steady state content. A mechanism of hydrogen consumption is proposed to explain the existence of the steady state of hydrogen content. This mechanism enables to explain also the evolution of the oxide surface during hydrogen generation experiments as shown by the evolution of hydrogen accumulation kinetics. The accumulation kinetics depends on the dose rate, specific surface area and the relative humidity but also on the oxide aging. The plutonium percentage appears to be a crucial parameter in hydrogen accumulation kinetics. (author) [fr

Surface freezing of water.

Science.gov (United States)

Pérez-Díaz, J L; Álvarez-Valenzuela, M A; Rodríguez-Celis, F

2016-01-01

Freezing, melting, evaporation and condensation of water are essential ingredients for climate and eventually life on Earth. In the present work, we show how surface freezing of supercooled water in an open container is conditioned and triggered-exclusively-by humidity in air. Additionally, a change of phase is demonstrated to be triggered on the water surface forming surface ice crystals prior to freezing of bulk. The symmetry of the surface crystal, as well as the freezing point, depend on humidity, presenting at least three different types of surface crystals. Humidity triggers surface freezing as soon as it overpasses a defined value for a given temperature, generating a plurality of nucleation nodes. An evidence of simultaneous nucleation of surface ice crystals is also provided.

Solar Energy and Other Appropriate Technologies for Small Potable Water Systems in Puerto Rico

Science.gov (United States)

This Region 2 research demonstration project presentation studied the efficacy of sustainable solar-powered water delivery and monitoring systems to reduce the economic burden of operating and maintaining Non-PRASA drinking water systems and to reduce the impact of climate change...

The potential use of rainwater as alternative source of drinking water by using laterite soil as natural adsorbent

Science.gov (United States)

Omar, Khairunnisa Fakhriah Mohd; Palaniandy, Puganeshwary; Adlan, Mohd Nordin; Aziz, Hamidi Abdul; Subramaniam, Ambarasi

2017-10-01

Generally, the rainwater has low concentration of pollutants, whereby it is applicable for domestic water supply. Due to the low concentration of pollutants, further treatment such as adsorption is necessary to treat the harvested rainwater as an alternative source of drinking water supply. Therefore, this research has been carried out to determine the quality of rainwater from different types of locations, which are; rural residential area, urban residential area, agricultural area, industrial area, and open surface. The rainwater sampling was carried out from September 2014 to December 2015. The parameters that have been analysed during the sampling process are chemical oxygen demand (COD), turbidity, heavy metals, and Escherichia coli (E.coli). The sampling results show that the rainwater provides low concentration of contaminants. Thus, it has high potential to be used as alternative source of potable and non potable water supply with a suitable treatment. Due to that, an experimental work contained of 86 of designated experiments for a batch study has been carried out to determine the performance of laterite soil as an adsorbent to remove pollutants that present in the rainwater (i.e. zinc, manganese, and E.coli). The operating factors involved in the experimental works are pH, mass of adsorbents, contact time, initial concentration of zinc, manganese, and E.coli. In this study, the experimental data of the batch study was analysed by developing regression model equation and analysis of variance. Perturbation plots were analysed to determine the effectiveness of the operating factors by developing response surface model, resulting that the high removals of zinc, manganese, and E.coli are 95.8%, 94.05% and 100%, respectively. Overall, this research works found out that the rainwater has a good quality as alternative source of drinking water by providing a suitable treatment. The application of laterite soil as natural adsorbent shows that it has potential to be

Antimicrobial-Coated Granules for Disinfecting Water

Science.gov (United States)

Akse, James R.; Holtsnider, John T.; Kliestik, Helen

2011-01-01

Methods of preparing antimicrobialcoated granules for disinfecting flowing potable water have been developed. Like the methods reported in the immediately preceding article, these methods involve chemical preparation of substrate surfaces (in this case, the surfaces of granules) to enable attachment of antimicrobial molecules to the surfaces via covalent bonds. A variety of granular materials have been coated with a variety of antimicrobial agents that include antibiotics, bacteriocins, enzymes, bactericides, and fungicides. When employed in packed beds in flowing water, these antimicrobial-coated granules have been proven effective against gram-positive bacteria, gram-negative bacteria, fungi, and viruses. Composite beds, consisting of multiple layers containing different granular antimicrobial media, have proven particularly effective against a broad spectrum of microorganisms. These media have also proven effective in enhancing or potentiating the biocidal effects of in-line iodinated resins and of very low levels of dissolved elemental iodine.

A group decision-making tool for the application of membrane technologies in different water reuse scenarios.

Science.gov (United States)

Sadr, S M K; Saroj, D P; Kouchaki, S; Ilemobade, A A; Ouki, S K

2015-06-01

A global challenge of increasing concern is diminishing fresh water resources. A growing practice in many communities to supplement diminishing fresh water availability has been the reuse of water. Novel methods of treating polluted waters, such as membrane assisted technologies, have recently been developed and successfully implemented in many places. Given the diversity of membrane assisted technologies available, the current challenge is how to select a reliable alternative among numerous technologies for appropriate water reuse. In this research, a fuzzy logic based multi-criteria, group decision making tool has been developed. This tool has been employed in the selection of appropriate membrane treatment technologies for several non-potable and potable reuse scenarios. Robust criteria, covering technical, environmental, economic and socio-cultural aspects, were selected, while 10 different membrane assisted technologies were assessed in the tool. The results show this approach capable of facilitating systematic and rigorous analysis in the comparison and selection of membrane assisted technologies for advanced wastewater treatment and reuse. Copyright © 2015 Elsevier Ltd. All rights reserved.

POTABLE WATER SUPPLY IN OWERRI METROPOLIS: A ...

African Journals Online (AJOL)

address the problems of water supply and management. These include: ..... total replacement of under-laid water pipes has not been done, and there is no modern way .... If the present trend continues, the vast majority of these people will be living ... maintenance and management of water facilities and other logistics.

Comparative Evaluation of Aluminum Sulfate and Ferric Sulfate-Induced Coagulations as Pretreatment of Microfiltration for Treatment of Surface Water

Directory of Open Access Journals (Sweden)

Yali Song

2015-06-01

Full Text Available Two coagulants, aluminum sulfate and ferric chloride, were tested to reduce natural organic matter (NOM as a pretreatment prior to polyvinylidene fluoride (PVDF microfiltration (MF membranes for potable water treatment. The results showed that the two coagulants exhibited different treatment performance in NOM removal. Molecular weight (MW distributions of NOM in the tested surface raw water were concentrated at 3–5 kDa and approximately 0.2 kDa. Regardless of the coagulant species and dosages, the removal of 0.2 kDa NOM molecules was limited. In contrast, NOM at 3–5 kDa were readily removed with increasing coagulant dosages. In particular, aluminum sulfate favorably removed NOM near 5 kDa, whereas ferric chloride tended to reduce 3 kDa organic substances. Although aluminum sulfate and ferric chloride could improve the flux of the ensuing MF treatment, the optimal coagulant dosages to achieve effective pretreatment were different: 2–30 mg/L for aluminum sulfate and >15 mg/L for ferric chloride. The scanning electron microscope (SEM image of the membrane-filtered coagulated raw water showed that coagulation efficiency dramatically affected membrane flux and that good coagulation properties can reduce membrane fouling.

The Virginia Beach shallow ground-water study

Science.gov (United States)

Johnson, Henry M.

1999-01-01

IntroductionVirginia Beach is a rapidly growing city of more than 425,000 people. Sources of fresh water within the city, however, are limited. Prior to 1998, the Virginia Beach Public Utilities Department met the city's water needs by purchasing treated drinking water from the City of Norfolk. Because Norfolk had to meet its own requirements, the amount of water available to Virginia Beach was limited to about 30 million gallons per day (mgd) and even less during droughts. This water supply was supplemented with ground water from city-owned, community, and private wells. In many parts of the city, however, ground water cannot be used because of high concentrations of chloride, iron, and (or) sulfur, which give the water an unpleasant taste.In early 1998, a pipeline came on-line that can carry up to 45 mgd of water from Lake Gaston to Virginia Beach. The Gaston pipeline has alleviated concerns about water supply and quality for most residents living north of the "Green Line." These residents primarily use ground water only for small-scale domestic activities such as watering lawns, filling ponds and pools, and washing cars. City water and sewer services have been extended beyond the Green Line into the "Transition Area." Residents and businesses south of the Transition Area, however, continue to rely on ground water to meet most of their needs for potable and non-potable water. To help assure a continued, reliable supply of ground water, the U.S. Geological Survey (USGS), in cooperation with the City of Virginia Beach Public Utilities Department, has begun an assessment of the shallow ground-water resources underlying the City of Virginia Beach.

Vacuum distillation/vapor filtration water recovery, phases 1 and 2

Science.gov (United States)

Honegger, R. J.; Remus, G. A.; Krug, E. K.

1973-01-01

The research is reported on the development of an evaporator for vacuum distillation/vapor filtration VD/VF water reclamation system for use on manned space flights. The design, fabrication, and tests of a six-man evaporator are described. It is concluded that: (1) A condenser with an internal rotating impeller and coolant surfaces directly opposite the condensing surfaces is an effective condenser. (2) The VD/VF evaporator, catalyst unit and condenser function satisfactorily based on thermal, mechanical and recovery performance during a 145-hour evaluation test. (3) The quality of recovered water, as measured by analyses for total organic carbon, pH, conductivity, turbidity, and viable bacteria density was within established limits for potability.

Removal of cyanotoxins from surface water resources using reusable molecularly imprinted polymer adsorbents.

Science.gov (United States)

Krupadam, Reddithota J; Patel, Govind P; Balasubramanian, Rajasekhar

2012-06-01

Microcystins (MCs; cyclic heptapeptides) are produced by freshwater cyanobacteria and cause public health concern in potable water supplies. There are more than 60 types of MCs identified to date, of which MC-LR is the most common found worldwide. For MC-LR, the WHO has established a threshold value of 1 μg L(-1) for drinking water. The present MCs removal methods such as coagulation, flocculation, adsorption, and filtration showed low efficiency for removing dissolved MC fraction from surface waters to the stipulated limit prescribed by WHO based on MC health impacts. The search for cost-effective and efficient removal method is still warranted for remediation of dissolved MC-LR-contaminated water resources. Molecularly imprinted polymer (MIP) adsorbent has been prepared using non-covalent imprinting approach. Using MC-LR as a template, itaconic acid as a functional monomer, and ethylene glycol dimethacrylate as a cross-linking monomer, a MIP has been synthesized. Computer simulations were used to design effective binding sites for MC-LR binding in aqueous solutions. Batch binding adsorption assay was followed to determine binding capacity of MIP under the influence of environmental parameters such as total dissolved solids and pH. The adsorptive removal of MC-LR from lake water has been investigated using MIPs. The MIP showed excellent adsorption potential toward MC-LR in aqueous solutions with a binding capacity of 3.64 μg mg(-1) which is about 60% and 70% more than the commercially used powdered activated carbon (PAC) and resin XAD, respectively. Environmental parameters such as total organic carbon (represented as chemical oxygen demand (COD)) and total dissolved solids (TDS) showed no significant interference up to 300 mg L(-1) for MC-LR removal from lake water samples. It was found that the binding sites on PAC and XAD have more affinity toward COD and TDS than the MC-LR. Further, the adsorption capacity of the MIP was evaluated rigorously by its repeated

A robust Multi-Band Water Index (MBWI) for automated extraction of surface water from Landsat 8 OLI imagery

Science.gov (United States)

Wang, Xiaobiao; Xie, Shunping; Zhang, Xueliang; Chen, Cheng; Guo, Hao; Du, Jinkang; Duan, Zheng

2018-06-01

Surface water is vital resources for terrestrial life, while the rapid development of urbanization results in diverse changes in sizes, amounts, and quality of surface water. To accurately extract surface water from remote sensing imagery is very important for water environment conservations and water resource management. In this study, a new Multi-Band Water Index (MBWI) for Landsat 8 Operational Land Imager (OLI) images is proposed by maximizing the spectral difference between water and non-water surfaces using pure pixels. Based on the MBWI map, the K-means cluster method is applied to automatically extract surface water. The performance of MBWI is validated and compared with six widely used water indices in 29 sites of China. Results show that our proposed MBWI performs best with the highest accuracy in 26 out of the 29 test sites. Compared with other water indices, the MBWI results in lower mean water total errors by a range of 9.31%-25.99%, and higher mean overall accuracies and kappa coefficients by 0.87%-3.73% and 0.06-0.18, respectively. It is also demonstrated for MBWI in terms of robustly discriminating surface water from confused backgrounds that are usually sources of surface water extraction errors, e.g., mountainous shadows and dark built-up areas. In addition, the new index is validated to be able to mitigate the seasonal and daily influences resulting from the variations of the solar condition. MBWI holds the potential to be a useful surface water extraction technology for water resource studies and applications.

Pathogen reduction requirements for direct potable reuse in Antarctica: evaluating human health risks in small communities.

Science.gov (United States)

Barker, S Fiona; Packer, Michael; Scales, Peter J; Gray, Stephen; Snape, Ian; Hamilton, Andrew J

2013-09-01

Small, remote communities often have limited access to energy and water. Direct potable reuse of treated wastewater has recently gained attention as a potential solution for water-stressed regions, but requires further evaluation specific to small communities. The required pathogen reduction needed for safe implementation of direct potable reuse of treated sewage is an important consideration but these are typically quantified for larger communities and cities. A quantitative microbial risk assessment (QMRA) was conducted, using norovirus, giardia and Campylobacter as reference pathogens, to determine the level of treatment required to meet the tolerable annual disease burden of 10(-6) DALYs per person per year, using Davis Station in Antarctica as an example of a small remote community. Two scenarios were compared: published municipal sewage pathogen loads and estimated pathogen loads during a gastroenteritis outbreak. For the municipal sewage scenario, estimated required log10 reductions were 6.9, 8.0 and 7.4 for norovirus, giardia and Campylobacter respectively, while for the outbreak scenario the values were 12.1, 10.4 and 12.3 (95th percentiles). Pathogen concentrations are higher under outbreak conditions as a function of the relatively greater degree of contact between community members in a small population, compared with interactions in a large city, resulting in a higher proportion of the population being at risk of infection and illness. While the estimates of outbreak conditions may overestimate sewage concentration to some degree, the results suggest that additional treatment barriers would be required to achieve regulatory compliance for safe drinking water in small communities. Copyright © 2013 Elsevier B.V. All rights reserved.

Impacts of Solid Waste Leachate on Groundwater and Surface Water Quality

International Nuclear Information System (INIS)

Karim, S.

2010-01-01

The present investigation was carried out to assess the impacts of solid waste leachate on groundwater and surface water quality at unlined dumping site. Six leachate samples collected from different locations have average values of COD and BOD 2563 mg/L and 442 mg/L, respectively. Surface water samples were collected in two different seasons (rainy and non- rainy). Samples collected during non-rainy season were found to be more contaminated than rainy season. Soil samples collected from the depth of 1.5 m are contaminated with heavy metals (Cd, Cr, Fe and Zn) and E.coli. Presence of E.coli shows that leachate has deteriorated groundwater quality. (author)

Hybrid materials for decontamination of potable water

International Nuclear Information System (INIS)

Basu, H.; Singhal, R.K.; Reddy, A.V.R.

2015-01-01

Water is the most essential component on the earth for vital activities of all living beings. Unfortunately, due to geometrical growth of population, civilization, industrialization, agricultural activities and other geological and environmental changes quality of water from different resources is deteriorating. Water pollution has therefore become a serious issue in the present scenario, affecting all living creatures. In 2008, WHO published a third edition of the Guidelines for Drinking Water Quality. Thousands of inorganic, organic and biological pollutants have been reported as water contaminants. Some of them have serious side effects and toxicities. Even few of them are lethal and carcinogenic. A majority of them are heavy metals and radionuclides. The removal of low levels of heavy metals (As, Pb, Hg, etc.), toxic elements (F) and radionuclides (U, Th, Am, Pu) in various forms from groundwater still remains a problem, both technically and economically. Depending on local geology, groundwater contains these elements in low levels (μg L -1 range), but sometimes in concentrations which are not acceptable for drinking water. Material used for the sorption of heavy metals from waters in commercial applications must be immobilized in order to meet technical demands for onsite use. Generally, packed bed columns, with a stable, porous material that has a specific grain size, are used. Moreover, tailored materials must be stable and resistant to the medium that is investigated so that there is no release of constituent components

White Sands Missile Range 2011 Drinking Water Quality Report

Science.gov (United States)

2012-01-01

acerca de su agua potable . Haga que alguien lo traduzca para usted, o hable con alguien que lo entienda. Main Post White Sands Missile Range 2011...standards. What is This Water Quality Report? Este informe contiene informacion importante acerca de su agua potable . Haga que alguien lo traduzca

Water Quality Evaluation of Spring Waters in Nsukka, Nigeria ...

African Journals Online (AJOL)

Water qualities of springs in their natural state are supposed to be clean and potable. Although, water quality is not a static condition it depends on the local geology and ecosystem, as well as human activities such as sewage dispersion, industrial pollution, use of water bodies as a heat sink, and overuse. The activities on ...

Monitoring for Pesticides in Groundwater and Surface Water in Nevada, 2008

Science.gov (United States)

Thodal, Carl E.; Carpenter, Jon; Moses, Charles W.

2009-01-01

Commercial pesticide applicators, farmers, and homeowners apply about 1 billion pounds of pesticides annually to agricultural land, non-crop land, and urban areas throughout the United States (Gilliom and others, 2006, p. 1). The U.S. Environmental Protection Agency (USEPA) defines a pesticide as any substance used to kill or control insects, weeds, plant diseases, and other pest organisms. Although there are important benefits from the proper use of pesticides, like crop protection and prevention of human disease outbreaks, there are also risks. One risk is the contamination of groundwater and surface-water resources. Data collected during 1992-2001 from 51 major hydrologic systems across the United States indicate that one or more pesticide or pesticide breakdown product was detected in more than 50 percent of 5,057 shallow (less than 20 feet below land surface) wells and in all of the 186 stream sites that were sampled in agricultural and urban areas (Gilliom and others, 2006, p. 2-4). Pesticides can contaminate surface water and groundwater from both point sources and non-point sources. Point sources are from specific locations such as spill sites, disposal sites, pesticide drift during application, and application of pesticides to control aquatic pests. Non-point sources represent the dominant source of surface water and groundwater contamination and may include agricultural and urban runoff, erosion, leaching from application sites, and precipitation that has become contaminated by upwind applications. Pesticides typically enter surface water when rainfall or irrigation exceeds the infiltration capacity of soil and resulting runoff then transports pesticides to streams, rivers, and other surface-water bodies. Contamination of groundwater may result directly from spills near poorly sealed well heads and from pesticide applications through improperly designed or malfunctioning irrigation systems that also are used to apply pesticides (chemigation; Carpenter and

Determination of natural radionuclides in wastes generated in the potable water treatment plants of the Zona da Mata of the State of Pernambuco-Brazil

Energy Technology Data Exchange (ETDEWEB)

Albuquerque, Adriana M. de A.; França, Fernanda Cláudia S. da S.; Silveira, Patrícia B. da; Hazin, Clovis A.; Honorato, Eliane V., E-mail: chazin@elogica.com.br, E-mail: valentim@cnen.gov.br, E-mail: adrianamuniz.a@gmail.com [Centro Regional de Ciências Nucleares do Nordeste (CRCN/CNEN-PE), Recife, PE (Brazil)

2017-07-01

The water purification procedure aims to obtain a product appropriate for human consumption, minimizing the concentration of contaminants and toxic substances present in the water. Among these contaminants, some radionuclides of natural origin, such as uranium, thorium and their descendants, have been identified. Previous studies have shown that the stages of purification are quite effective in removing the radionuclides contained in the water. The removal is due to co-precipitation of the radionuclides with the suspended materials. The precipitated material is accumulated and characterized as a Technologically Enhanced Naturally Occurring Radioactive Materials (TENORM) by the United States Environmental Protection Agency (USEPA). This wastes can present significant levels of radioactivity and, when discarded in the environment without any treatment, can generate a problem of environmental impact and a risk to the health of the population. In this way, some gamma emitters of the series of U and Th, as well as {sup 40}K were determined in the residues generated at the Potable Water Treatment Plants PWTPs in six municipalities of Pernambuco. The results obtained corroborate the classification of the residues generated in the PWTPs as concentrators of the radioactive components contained in the water supplied to the system and reinforce the need for the release to the environment, which is the usual way of disposal of this waste, to be carried out only after considering the radiation protection standards established by CNEN. (author)

Determination of natural radionuclides in wastes generated in the potable water treatment plants of the Zona da Mata of the State of Pernambuco-Brazil

International Nuclear Information System (INIS)

Albuquerque, Adriana M. de A.; França, Fernanda Cláudia S. da S.; Silveira, Patrícia B. da; Hazin, Clovis A.; Honorato, Eliane V.

2017-01-01

The water purification procedure aims to obtain a product appropriate for human consumption, minimizing the concentration of contaminants and toxic substances present in the water. Among these contaminants, some radionuclides of natural origin, such as uranium, thorium and their descendants, have been identified. Previous studies have shown that the stages of purification are quite effective in removing the radionuclides contained in the water. The removal is due to co-precipitation of the radionuclides with the suspended materials. The precipitated material is accumulated and characterized as a Technologically Enhanced Naturally Occurring Radioactive Materials (TENORM) by the United States Environmental Protection Agency (USEPA). This wastes can present significant levels of radioactivity and, when discarded in the environment without any treatment, can generate a problem of environmental impact and a risk to the health of the population. In this way, some gamma emitters of the series of U and Th, as well as 40 K were determined in the residues generated at the Potable Water Treatment Plants PWTPs in six municipalities of Pernambuco. The results obtained corroborate the classification of the residues generated in the PWTPs as concentrators of the radioactive components contained in the water supplied to the system and reinforce the need for the release to the environment, which is the usual way of disposal of this waste, to be carried out only after considering the radiation protection standards established by CNEN. (author)

Effects of Surface Dipole Lengths on Evaporation of Tiny Water Aggregation

International Nuclear Information System (INIS)

Wang Shen; Wan Rongzheng; Fang Haiping; Tu Yusong

2013-01-01

Using molecular dynamics simulation, we compared evaporation behavior of a tiny amount of water molecules adsorbed on solid surfaces with different dipole lengths, including surface dipole lengths of 1 fold, 2 folds, 4 folds, 6 folds and 8 folds of 0.14 nm and different charges from 0.1e to 0.9e. Surfaces with short dipole lengths (1-fold system) can always maintain hydrophobic character and the evaporation speeds are not influenced, whether the surface charges are enhanced or weakened; but when surface dipole lengths get to 8 folds, surfaces become more hydrophilic as the surface charge increases, and the evaporation speeds increase gradually and monotonically. By tuning dipole lengths from 1-fold to 8-fold systems, we confirmed non-monotonic variation of the evaporation flux (first increases, then decreases) in 4 fold system with charges (0.1e–0.7e), reported in our previous paper [S. Wang, et al., J. Phys. Chem. B 116 (2012) 13863], and also show the process from the enhancement of this unexpected non-monotonic variation to its vanishment with surface dipole lengths increasing. Herein, we demonstrated two key factors to influence the evaporation flux of a tiny amount of water molecules adsorbed on solid surfaces: the exposed surficial area of water aggregation from where the water molecules can evaporate directly and the attraction potential from the substrate hindering the evaporation. In addition, more interestingly, we showed extra steric effect of surface dipoles on further increase of evaporation flux for 2-folds, 4-folds, 6-folds and 8-folds systems with charges around larger than 0.7e. (The steric effect is first reported by parts of our authors [C. Wang, et al., Sci. Rep. 2 (2012) 358]). This study presents a complete physical picture of the influence of surface dipole lengths on the evaporation behavior of the adsorbed tiny amount of water. (condensed matter: structural, mechanical, and thermal properties)

Sustaining dry surfaces under water

DEFF Research Database (Denmark)

Jones, Paul R.; Hao, Xiuqing; Cruz-Chu, Eduardo R.

2015-01-01

Rough surfaces immersed under water remain practically dry if the liquid-solid contact is on roughness peaks, while the roughness valleys are filled with gas. Mechanisms that prevent water from invading the valleys are well studied. However, to remain practically dry under water, additional...... mechanisms need consideration. This is because trapped gas (e.g. air) in the roughness valleys can dissolve into the water pool, leading to invasion. Additionally, water vapor can also occupy the roughness valleys of immersed surfaces. If water vapor condenses, that too leads to invasion. These effects have...... not been investigated, and are critically important to maintain surfaces dry under water.In this work, we identify the critical roughness scale, below which it is possible to sustain the vapor phase of water and/or trapped gases in roughness valleys – thus keeping the immersed surface dry. Theoretical...

Modeling and optimization of potable water network

Energy Technology Data Exchange (ETDEWEB)

Djebedjian, B.; Rayan, M.A. [Mansoura Univ., El-Mansoura (Egypt); Herrick, A. [Suez Canal Authority, Ismailia (Egypt)

2000-07-01

Software was developed in order to optimize the design of water distribution systems and pipe networks. While satisfying all the constraints imposed such as pipe diameter and nodal pressure, it was based on a mathematical model treating looped networks. The optimum network configuration and cost are determined considering parameters like pipe diameter, flow rate, corresponding pressure and hydraulic losses. It must be understood that minimum cost is relative to the different objective functions selected. The determination of the proper objective function often depends on the operating policies of a particular company. The solution for the optimization technique was obtained by using a non-linear technique. To solve the optimal design of network, the model was derived using the sequential unconstrained minimization technique (SUMT) of Fiacco and McCormick, which decreased the number of iterations required. The pipe diameters initially assumed were successively adjusted to correspond to the existing commercial pipe diameters. The technique was then applied to a two-loop network without pumps or valves. Fed by gravity, it comprised eight pipes, 1000 m long each. The first evaluation of the method proved satisfactory. As with other methods, it failed to find the global optimum. In the future, research efforts will be directed to the optimization of networks with pumps and reservoirs. 24 refs., 3 tabs., 1 fig.

Determination of the speed of corrosion of aluminum brass in drinking water

International Nuclear Information System (INIS)

Valcarce, M.B; Vasquez, M; Sanchez, S.R de

2004-01-01

Copper alloys are widely used for water conduits. This work defines the speed of corrosion of aluminum brass (Cu76Zn22Al2) in potable water by comparing the results from electrochemical tests and from weight loss tests. The chosen medium is synthetic drinking water (pH 7.6) whose composition is the average for the drinking water in Mar del Plata city. Coupons were prepared for the weight loss test, which were kept in artificial potable water for 90 days. The flow of corrosion was determined based on the resulting weight loss. After the period of immersion, the coupons showed pitting. The resistance to polarization (Rp) was also determined at different immersion times with potential jumps, potentiodynamic sweeps and electrochemical impedance spectroscopy (EIS). The Rp values obtained with the different electrochemical methods are in agreement, and they increase over time. This increase can be attributed to the growth of a layer of oxide over the metallic surface. Based on the record of polarization curves the Tafel slopes were obtained and the corrosion current was estimated after 2 hrs and 192 hrs of immersion. The corrosion current values obtained for the different electrochemical methods match the results obtained from the weight loss test (CW)

Basin scale management of surface and ground water

International Nuclear Information System (INIS)

Tracy, J.C.; Al-Sharif, M.

1993-01-01

An important element in the economic development of many regions of the Great Plains is the availability of a reliable water supply. Due to the highly variable nature of the climate through out much of the Great Plains region, non-controlled stream flow rates tend to be highly variable from year to year. Thus, the primary water supply has tended towards developing ground water aquifers. However, in regions where shallow ground water is extracted for use, there exists the potential for over drafting aquifers to the point of depleting hydraulically connected stream flows, which could adversely affect the water supply of downstream users. To prevent the potential conflict that can arise when a basin's water supply is being developed or to control the water extractions within a developed basin requires the ability to predict the effect that water extractions in one region will have on water extractions from either surface or ground water supplies else where in the basin. This requires the ability to simulate ground water levels and stream flows on a basin scale as affected by changes in water use, land use practices and climatic changes within the basin. The outline for such a basin scale surface water-ground water model has been presented in Tracy (1991) and Tracy and Koelliker (1992), and the outline for the mathematical programming statement to aid in determining the optimal allocation of water on a basin scale has been presented in Tracy and Al-Sharif (1992). This previous work has been combined into a computer based model with graphical output referred to as the LINOSA model and was developed as a decision support system for basin managers. This paper will present the application of the LINOSA surface-ground water management model to the Rattlesnake watershed basin that resides within Ground Water Management District Number 5 in south central Kansas

Perceptions of Nongovernmental Organization (NGO Staff about Water Privatization in Developing Countries

Directory of Open Access Journals (Sweden)

Ellis A. Adams

2014-11-01

Full Text Available Almost a billion people globally lack access to potable water. In the early 1990’s, attempts to improve potable water access in the global south included a massive push for water services privatization, often involving the transfer of public water services to private companies. Critics of water privatization claim it rarely improves access to water, and in most cases, unfairly affect poor people. Proponents on the other hand argue that it is necessary for efficient management and capital investment in the water sector. Although development NGOs play an important role in developing country water provision, hardly any studies have sought to understand their perceptions about the potential role of water privatization towards improving access to potable water in developing countries. We interviewed the key staff among 28 international and national NGO staff about water privatization, its opportunities and constraints. Their perceptions were mixed. While most criticized water privatization as increasing water costs to the poor, some noted that privatization is necessary for improving water access through increased capital investment. We present the findings and discuss larger implications for water policies and reforms in developing countries.

Drinking water insecurity: water quality and access in coastal south-western Bangladesh.

Science.gov (United States)

Benneyworth, Laura; Gilligan, Jonathan; Ayers, John C; Goodbred, Steven; George, Gregory; Carrico, Amanda; Karim, Md Rezaul; Akter, Farjana; Fry, David; Donato, Katherine; Piya, Bhumika

2016-01-01

National drinking water assessments for Bangladesh do not reflect local variability, or temporal differences. This paper reports on the findings of an interdisciplinary investigation of drinking water insecurity in a rural coastal south-western Bangladesh. Drinking water quality is assessed by comparison of locally measured concentrations to national levels and water quality criteria; resident's access to potable water and their perceptions are based on local social surveys. Residents in the study area use groundwater far less than the national average; salinity and local rainwater scarcity necessitates the use of multiple water sources throughout the year. Groundwater concentrations of arsenic and specific conductivity (SpC) were greater than surface water (pond) concentrations; there was no statistically significant seasonal difference in mean concentrations in groundwater, but there was for ponds, with arsenic higher in the dry season. Average arsenic concentrations in local water drinking were 2-4 times times the national average. All of the local groundwater samples exceeded the Bangladesh guidance for SpC, although the majority of residents surveyed did not perceive their water as having a 'bad' or 'salty' taste.

Surface Water in Hawaii

Science.gov (United States)

Oki, Delwyn S.

2003-01-01

Surface water in Hawaii is a valued resource as well as a potential threat to human lives and property. The surface-water resources of Hawaii are of significant economic, ecologic, cultural, and aesthetic importance. Streams supply more than 50 percent of the irrigation water in Hawaii, and although streams supply only a few percent of the drinking water statewide, surface water is the main source of drinking water in some places. Streams also are a source of hydroelectric power, provide important riparian and instream habitats for many unique native species, support traditional and customary Hawaiian gathering rights and the practice of taro cultivation, and possess valued aesthetic qualities. Streams affect the physical, chemical, and aesthetic quality of receiving waters, such as estuaries, bays, and nearshore waters, which are critical to the tourism-based economy of the islands. Streams in Hawaii pose a danger because of their flashy nature; a stream's stage, or water level, can rise several feet in less than an hour during periods of intense rainfall. Streams in Hawaii are flashy because rainfall is intense, drainage basins are small, basins and streams are steep, and channel storage is limited. Streamflow generated during periods of heavy rainfall has led to loss of property and human lives in Hawaii. Most Hawaiian streams originate in the mountainous interiors of the islands and terminate at the coast. Streams are significant sculptors of the Hawaiian landscape because of the erosive power of the water they convey. In geologically young areas, such as much of the southern part of the island of Hawaii, well-defined stream channels have not developed because the permeability of the surface rocks generally is so high that rainfall infiltrates before flowing for significant distances on the surface. In geologically older areas that have received significant rainfall, streams and mass wasting have carved out large valleys.

PHOSPHATE CHEMICALS FOR BUILDING POTABLE WATER TREATMENT

Science.gov (United States)

Buildings can contribute significant quantities of trace metal contamination to drinking water, particularly lead, copper and zinc. Discolored water may also result in corroded galvanized and steel plumbing and after prolonged stagnation times. To protect human health as well as ...

Water-resources and land-surface deformation evaluation studies at Fort Irwin National Training Center, Mojave Desert, California

Science.gov (United States)

Densmore-Judy, Jill; Dishart, Justine E.; Miller, David; Buesch, David C.; Ball, Lyndsay B.; Bedrosian, Paul A.; Woolfenden, Linda R.; Cromwell, Geoffrey; Burgess, Matthew K.; Nawikas, Joseph; O'Leary, David; Kjos, Adam; Sneed, Michelle; Brandt, Justin

2017-01-01

The U.S. Army Fort Irwin National Training Center (NTC), in the Mojave Desert, obtains all of its potable water supply from three groundwater basins (Irwin, Langford, and Bicycle) within the NTC boundaries (fig. 1; California Department of Water Resources, 2003). Because of increasing water demands at the NTC, the U.S. Geological Survey (USGS), in cooperation with the U.S. Army, completed several studies to evaluate water resources in the developed and undeveloped groundwater basins underlying the NTC. In all of the developed basins, groundwater withdrawals exceed natural recharge, resulting in water-level declines. However, artificial recharge of treated wastewater has had some success in offsetting water-level declines in Irwin Basin. Additionally, localized water-quality changes have occurred in some parts of Irwin Basin as a result of human activities (i.e., wastewater disposal practices, landscape irrigation, and/or leaking pipes). As part of the multi-faceted NTC-wide studies, traditional datacollection methods were used and include lithological and geophysical logging at newly drilled boreholes, hydrologic data collection (i.e. water-level, water-quality, aquifer tests, wellbore flow). Because these data cover a small portion of the 1,177 square-mile (mi2 ) NTC, regional mapping, including geologic, gravity, aeromagnetic, and InSAR, also were done. In addition, ground and airborne electromagnetic surveys were completed and analyzed to provide more detailed subsurface information on a regional, base-wide scale. The traditional and regional ground and airborne data are being analyzed and will be used to help develop preliminary hydrogeologic framework and groundwater-flow models in all basins. This report is intended to provide an overview of recent water-resources and land-surface deformation studies at the NTC.

Managed Aquifer Recharge (MAR in Sustainable Urban Water Management

Directory of Open Access Journals (Sweden)

Declan Page

2018-02-01

Full Text Available To meet increasing urban water requirements in a sustainable way, there is a need to diversify future sources of supply and storage. However, to date, there has been a lag in the uptake of managed aquifer recharge (MAR for diversifying water sources in urban areas. This study draws on examples of the use of MAR as an approach to support sustainable urban water management. Recharged water may be sourced from a variety of sources and in urban centers, MAR provides a means to recycle underutilized urban storm water and treated wastewater to maximize their water resource potential and to minimize any detrimental effects associated with their disposal. The number, diversity and scale of urban MAR projects is growing internationally due to water shortages, fewer available dam sites, high evaporative losses from surface storages, and lower costs compared with alternatives where the conditions are favorable, including water treatment. Water quality improvements during aquifer storage are increasingly being documented at demonstration sites and more recently, full-scale operational urban schemes. This growing body of knowledge allows more confidence in understanding the potential role of aquifers in water treatment for regulators. In urban areas, confined aquifers provide better protection for waters recharged via wells to supplement potable water supplies. However, unconfined aquifers may generally be used for nonpotable purposes to substitute for municipal water supplies and, in some cases, provide adequate protection for recovery as potable water. The barriers to MAR adoption as part of sustainable urban water management include lack of awareness of recent developments and a lack of transparency in costs, but most importantly the often fragmented nature of urban water resources and environmental management.

Contamination levels of human pharmaceutical compounds in French surface and drinking water.

Science.gov (United States)

Mompelat, S; Thomas, O; Le Bot, B

2011-10-01

The occurrence of 20 human pharmaceutical compounds and metabolites from 10 representative therapeutic classes was analysed from resource and drinking water in two catchment basins located in north-west France. 98 samples were analysed from 63 stations (surface water and drinking water produced from surface water). Of the 20 human pharmaceutical compounds selected, 16 were quantified in both the surface water and drinking water, with 22% of the values above the limit of quantification for surface water and 14% for drinking water). Psychostimulants, non-steroidal anti-inflammatory drugs, iodinated contrast media and anxiolytic drugs were the main therapeutic classes of human pharmaceutical compounds detected in the surface water and drinking water. The results for surface water were close to results from previous studies in spite of differences in prescription rates of human pharmaceutical compounds in different countries. The removal rate of human pharmaceutical compounds at 11 water treatment units was also determined. Only caffeine proved to be resistant to drinking water treatment processes (with a minimum rate of 5%). Other human pharmaceutical compounds seemed to be removed more efficiently (average elimination rate of over 50%) by adsorption onto activated carbon and oxidation/disinfection with ozone or chlorine (not taking account of the disinfection by-products). These results add to the increasing evidence of the occurrence of human pharmaceutical compounds in drinking water that may represent a threat to human beings exposed to a cocktail of human pharmaceutical compounds and related metabolites and by-products in drinking water.

Water-Energy Correlations: Analysis of Water Technologies, Processes and Systems in Rural and Urban India

Science.gov (United States)

Murumkar, A. R.; Gupta, S.; Kaurwar, A.; Satankar, R. K.; Mounish, N. K.; Pitta, D. S.; Virat, J.; Kumar, G.; Hatte, S.; Tripathi, R. S.; Shedekar, V.; George, K. J.; Plappally, A. K.

2015-12-01

In India, the present value of water, both potable and not potable, bears no relation to the energy of water production. However, electrical energy spent on ground water extraction alone is equivalent to the nation's hydroelectric capacity of 40.1 GWh. Likewise, desalinating 1m3 water of the Bay of Bengal would save three times the energy for potable ground water extraction along the coast of the Bay. It is estimated that every second woman in rural India expends 0.98 kWhe/m3/d for bringing water for household needs. Yet, the water-energy nexus remains to be a topic which is gravely ignored. This is largely caused by factors such as lack of awareness, defective public policies, and intrusive cultural practices. Furthermore, there are instances of unceasing dereliction towards water management and maintenance of the sparsely distributed water and waste water treatment plants across the country. This pollutes the local water across India apart from other geogenic impurities. Additionally, product aesthetics and deceptive advertisements take advantage of the abulia generated by users' ignorance of technical specifications of water technologies and processes in mismanagement of water use. Accordingly, urban residents are tempted to expend on energy intensive water technologies at end use. This worsens the water-energy equation at urban households. Cooking procedures play a significant role in determining the energy expended on water at households. The paper also evaluates total energy expense involved in cultivating some major Kharif and Rabi crops. Manual and traditional agricultural practices are more prominent than mechanized and novel agricultural techniques. The specific energy consumption estimate for different water technologies will help optimize energy expended on water in its life cycles. The implication of the present study of water-energy correlation will help plan and extend water management infrastructure at different locations across India.

Levels of radioactivity in the UK from the accident at Chernobyl, USSR on 26 April 1986. A compilation of the results of environmental measurements in the UK

Energy Technology Data Exchange (ETDEWEB)

1986-01-01

The compilation includes information available to NRPB up to 23 May 1986. The data includes activity concentrations in air, waters (rain, surface, underground, tapwater and non-potable), grass (including forage and general herbage and mosses), outdoor dose/rates for gamma activity, milks, leafy vegetables and other foodstuffs such as fish, eggs, cheese, milk products and meat. (U.K.).

Impact of green roofs on stormwater quality in a South Australian urban environment.

Science.gov (United States)

Razzaghmanesh, M; Beecham, S; Kazemi, F

2014-02-01

Green roofs are an increasingly important component of water sensitive urban design systems and can potentially improve the quality of urban runoff. However, there is evidence that they can occasionally act as a source rather than a sink for pollutants. In this study, the water quality of the outflow from both intensive and extensive green roof systems were studied in the city of Adelaide, South Australia over a period of nine months. The aim was to examine the effects of different green roof configurations on stormwater quality and to compare this with runoff from aluminium and asphalt roofs as control surfaces. The contaminant concentrations in runoff from both intensive and extensive green roofs generally decreased during the study period. A comparison between the two types of green roof showed that except for some events for EC, TDS and chloride, the values of the parameters such as pH, turbidity, nitrate, phosphate and potassium in intensive green roof outflows were higher than in the outflows from the extensive green roofs. These concentrations were compared to local, state, national and international water quality guidelines in order to investigate the potential for outflow runoff from green roofs to be reused for potable and non-potable purposes. The study found that green roof outflow can provide an alternative water source for non-potable purposes such as urban landscape irrigation and toilet flushing. © 2013.

Focus on CSIR research in water resources: ECO2 – sharing benefits from water resources

CSIR Research Space (South Africa)

Claassen, Marius

2007-08-01

Full Text Available benefits from water resources Socio-economic development de- pends on the reliable supply of water for industrial, mining, agricultural, potable and recreational purposes. These activities also generate waste products that are often discharged...

Measuring surface-water loss in Honouliuli Stream near the ‘Ewa Shaft, O‘ahu, Hawai‘i

Science.gov (United States)

Rosa, Sarah N.

2017-05-30

The Honolulu Board of Water Supply is currently concerned with the possibility of bacteria in the pumped water of the ‘Ewa Shaft (State well 3-2202-21). Groundwater from the ‘Ewa Shaft could potentially be used to meet future potable water needs in the ‘Ewa area on the island of O‘ahu. The source of the bacteria in the pumped water is unknown, although previous studies indicate that surface water may be lost to the subsurface near the site. The ‘Ewa Shaft consists of a vertical shaft, started near the south bank of Honouliuli Stream at an altitude of about 161 feet, and two horizontal infiltration tunnels near sea level. The shaft extracts groundwater from near the top of the freshwater lens in the Waipahu-Waiawa aquifer system within the greater Pearl Harbor Aquifer Sector, a designated Water Management Area.The surface-water losses were evaluated with continuous groundwater-level data from the ‘Ewa Shaft and a nearby monitoring well, continuous stream-discharge data from U.S. Geological Survey streamflow-gaging station 16212490 (Honouliuli Stream at H-1 Freeway near Waipahu), and seepage-run measurements in Honouliuli Stream and its tributary. During storms, discharge at the Honouliuli Stream gaging station increases and groundwater levels at ‘Ewa Shaft and a nearby monitoring well also increase. The concurrent increase in water levels at ‘Ewa Shaft and the nearby monitoring well during storms indicates that regional groundwater-level changes related to increased recharge, reduced withdrawals (due to a decrease in demand during periods of rainfall), or both may be occurring; although these data do not preclude the possibility of local recharge from Honouliuli Stream. Discharge measurements from two seepage runs indicate that surface water in the immediate area adjacent to ‘Ewa Shaft infiltrates into the streambed and may later reach the groundwater system developed by the ‘Ewa Shaft. The estimated seepage loss rates in the vicinity of �

Immersed membrane technology for advanced wastewater treatment and water reuse

Energy Technology Data Exchange (ETDEWEB)

Hotchkies, J.W. [Zenon Municipal Systems Inc., Oakville, ON (Canada)

2000-07-01

The use of membrane technology for both municipal water purification and wastewater/sewage treatment was discussed. Membranes are available in a wide range of forms and configurations. Their primary characteristics are pore size and molecular weight separation which classifies then as either microfiltration, ultrafiltration or reverse osmosis membranes. Ultrafiltration can separate soluble organics and insoluble solids such as bacteria, viruses, colloids and suspended particles. Microfiltration can separate most suspended solids including bacteria, many viruses and other suspended solids. It is not, however a complete barrier to viruses and is best used in conjunction with an ultra-violet disinfecting process. Different membrane configurations currently available were described along with their performance and efficiency. The ZenoGem{sup R} process which operates at high organic loadings, meets surface water discharge criteria. This membrane bioreactor makes wastewater reuse an achievable and cost-effective option, particularly when it is combined with carbon filtration and ultra-violet disinfection. The Cycle-Let{sup R} system produces a treated stream that is suitable for re-use in non-potable applications such as toilet flush water or for irrigation. 1 tab., 3 figs.

TESTING OF CARBONACEOUS ADSORBENTS FOR REMOVAL OF POLLUTANTS FROM WATER

Directory of Open Access Journals (Sweden)

RAISA NASTAS

2012-03-01

Full Text Available Testing of carbonaceous adsorbents for removal of pollutants from water. Relevant direction for improving of quality of potable water is application of active carbons at various stages of water treatments. This work includes complex research dealing with testing of a broad spectrum of carbonaceous adsorbents for removal of hydrogen sulfide and nitrite ions from water. The role of the surface functional groups of carbonaceous adsorbents, their acid-basic properties, and the influence of the type of impregnated heteroatom (N, O, or metals (Fe, Cu, Ni, on removal of hydrogen sulfide species and nitrite ions have been researched. The efficiency of the catalyst obtained from peach stones by impregnation with Cu2+ ions of oxidized active carbon was established, being recommended for practical purposes to remove the hydrogen sulfide species from the sulfurous ground waters. Comparative analysis of carbonaceous adsorbents reveals the importance of surface chemistry for oxidation of nitrite ions.

Upgrading and extended testing of the MSC integrated water and waste management hardware

Science.gov (United States)

Bambenek, R. A.; Nuccio, P. P.; Hurley, T. L.; Jasionowski, W. J.

1972-01-01

The results are presented of upgrading and testing an integrated water and waste management system, which uses the compression distillation, reverse osmosis, adsorption filtration and ion-exchange processes to recover potable water from urine, flush water and used wash water. Also included is the development of techniques for extending the useful biological life of biological filters, activated carbon filters and ion-exchange resins to at least 30 days, and presterilizing ion-exchange resins so that sterile water can be recovered from waste water. A wide variety of reverse osmosos materials, surfactants and germicides were experimentally evaluated to determine the best combination for a wash water subsystem. Full-scale module tests with real wash water demonstrated that surface fouling is a major problem.

Tentative reference method for measurement of tritium in environmental waters. Environmental monitoring series

International Nuclear Information System (INIS)

1975-12-01

A tentative reference method for the measurement of tritium in potable and nonpotable environmental water is described. Water samples are treated with sodium hydroxide and potassium permanganate and then a water fraction is separated from interferences by distillation. Two distillation procedures are described, a simple aqueous distillation for samples from potable water sources, and an aqueous-azeotropic-benzene distillation for nonpotable water sources. Alliquots of a designated distillate fraction are measured for tritium activity by liquid scintillation detection. Distillation recovery and counting efficiency factors are determined with tritium standards. Results are reported in picocuries per milliliter

Water Recycling via Aquifers for Sustainable Urban Water Quality Management: Current Status, Challenges and Opportunities

Directory of Open Access Journals (Sweden)

Elise Bekele

2018-04-01

Full Text Available Managed aquifer recharge (MAR is used worldwide in urban environments to replenish groundwater to provide a secure and sustainable supply of potable and non-potable water. It relies on natural treatment processes within aquifers (i.e., filtration, sorption, and degradation, and in some cases involves infiltration through the unsaturated zone to polish the given source water, e.g., treated wastewater, stormwater, or rainwater, to the desired quality prior to reuse. Whilst MAR in its early forms has occurred for millennia, large-scale schemes to replenish groundwater with advanced treated reclaimed water have come to the fore in cities such as Perth, Western Australia, Monterey, California, and Changwon, South Korea, as water managers consider provision for projected population growth in a drying climate. An additional bonus for implementing MAR in coastal aquifers is assisting in the prevention of seawater intrusion. This review begins with the rationale for large-scale MAR schemes in an Australian urban context, reflecting on the current status; describes the unique benefits of several common MAR types; and provides examples from around the world. It then explores several scientific challenges, ranging from quantifying aquifer removal for various groundwater contaminants to assessing risks to human health and the environment, and avoiding adverse outcomes from biogeochemical changes induced by aquifer storage. Scientific developments in the areas of water quality assessments, which include molecular detection methods for microbial pathogens and high resolution analytical chemistry methods for detecting trace chemicals, give unprecedented insight into the “polishing” offered by natural treatment. This provides opportunities for setting of compliance targets for mitigating risks to human health and maintaining high performance MAR schemes.

[The effectiveness of the spa and health resort-based treatment with the application of Essentuki-type drinking mineral waters for the management of non-alcoholic fatty liver disease in the patients presenting with type 2 diabetes mellitus].

Science.gov (United States)

Efimenko, N V; Kaĭsinova, A S; Fedorova, T E; Botvineva, L A

2015-01-01

The objective of the present study was to estimate the effectiveness of the spa and health resort-based treatment of non-alcoholic fatty liver disease in 40 patients at the mean age of 48,8 ± 5.7 years suffering from type 2 diabetes mellitus. All of them received combined therapy including the application of potable Essentuki-Novaya mineral water (20 patients) or Essentuki No 4 water (20 patients). This therapeutic modality resulted in positive dynamics of clinical symptoms of the disease, the functional liver tests, and parameters of intra-hepatic hemodynamics, lipid peroxidation homeostasis, and the hormonal status. It is concluded that the spa and health resort-based treatment with the application of local drinking Essentuki-type mineral waters for the management of non-alcoholic fatty liver disease in the patients presenting with type 2 diabetes mellitus leads to the improvement of the main functions of the liver, stabilizes carbohydrate and lipid metabolism, and prevents progression of the pathological process.

Reducing the Risk of Water Pollution in Vulnerable Coastal ...

International Development Research Centre (IDRC) Digital Library (Canada)

Outcomes to improve water quality The team will recommend ways to minimize exposure to contaminants and to ... for improving access to potable water will prepare a regional strategy for integrated water management. ... Total funding.

Impinging Water Droplets on Inclined Glass Surfaces

Energy Technology Data Exchange (ETDEWEB)

Armijo, Kenneth Miguel [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States); Lance, Blake [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States); Ho, Clifford K. [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States)

2017-09-01

Multiphase computational models and tests of falling water droplets on inclined glass surfaces were developed to investigate the physics of impingement and potential of these droplets to self-clean glass surfaces for photovoltaic modules and heliostats. A multiphase volume-of-fluid model was developed in ANSYS Fluent to simulate the impinging droplets. The simulations considered different droplet sizes (1 mm and 3 mm), tilt angles (0°, 10°, and 45°), droplet velocities (1 m/s and 3 m/s), and wetting characteristics (wetting=47° contact angle and non-wetting = 93° contact angle). Results showed that the spread factor (maximum droplet diameter during impact divided by the initial droplet diameter) decreased with increasing inclination angle due to the reduced normal force on the surface. The hydrophilic surface yielded greater spread factors than the hydrophobic surface in all cases. With regard to impact forces, the greater surface tilt angles yielded lower normal forces, but higher shear forces. Experiments showed that the experimentally observed spread factor (maximum droplet diameter during impact divided by the initial droplet diameter) was significantly larger than the simulated spread factor. Observed spread factors were on the order of 5 - 6 for droplet velocities of ~3 m/s, whereas the simulated spread factors were on the order of 2. Droplets were observed to be mobile following impact only for the cases with 45° tilt angle, which matched the simulations. An interesting phenomenon that was observed was that shortly after being released from the nozzle, the water droplet oscillated (like a trampoline) due to the "snapback" caused by the surface tension of the water droplet being released from the nozzle. This oscillation impacted the velocity immediately after the release. Future work should evaluate the impact of parameters such as tilt angle and surface wettability on the impact of particle/soiling uptake and removal to investigate ways that

Water quality. Pt. 3

International Nuclear Information System (INIS)

1993-01-01

This International Standard specifies a method for the determination of gross alpha activity in non-saline waters for alpha-emitting radionuclides which are not volatile at 350 o C. It is possible to determine supported volatile radionuclides measured to an extent determined by half-life, matrix retention (of the volatile species) and the duration of measurement (counting time). The method is applicable to raw and potable waters and can be extended to saline or mineralized waters, but with a reduced sensitivity. The range of application depends on the amount of inorganic material in the water and on the performance characteristics (background count rate and counting efficiency) of the counter. The sample is acidified to stabilize it, evaporated almost to dryness, converted to the sulfate form and then ignited at 350 o C. A portion of the residue is transferred to a planchette and the alpha activity measured by counting in an alpha-particle detector or counting system previously calibrated against an alpha-emitting standard. (author)

Spatial response surface modelling in the presence of data paucity for the evaluation of potential human health risk due to the contamination of potable water resources.

Science.gov (United States)

Liu, Shen; McGree, James; Hayes, John F; Goonetilleke, Ashantha

2016-10-01

Potential human health risk from waterborne diseases arising from unsatisfactory performance of on-site wastewater treatment systems is driven by landscape factors such as topography, soil characteristics, depth to water table, drainage characteristics and the presence of surface water bodies. These factors are present as random variables which are spatially distributed across a region. A methodological framework is presented that can be applied to model and evaluate the influence of various factors on waterborne disease potential. This framework is informed by spatial data and expert knowledge. For prediction at unsampled sites, interpolation methods were used to derive a spatially smoothed surface of disease potential which takes into account the uncertainty due to spatial variation at any pre-determined level of significance. This surface was constructed by accounting for the influence of multiple variables which appear to contribute to disease potential. The framework developed in this work strengthens the understanding of the characteristics of disease potential and provides predictions of this potential across a region. The study outcomes presented constitutes an innovative approach to environmental monitoring and management in the face of data paucity. Copyright © 2016 Elsevier B.V. All rights reserved.

Microbial quality of reclaimed water for urban reuses: Probabilistic risk-based investigation and recommendations.

Science.gov (United States)

Chhipi-Shrestha, Gyan; Hewage, Kasun; Sadiq, Rehan

2017-01-15

Although Canada has abundant freshwater resources, many cities still experience seasonal water shortage. Supply-side and demand-side management is a core strategy to address this water shortage. Under this strategy, reclaimed water, which the Canadian public is willing to use for non-potable purposes, is an option. However, no universal guidelines exist for reclaimed water use. Despite the federal government's long-term goal to develop guidelines for many water reuse applications, guidelines have only been prescribed for reclaimed water use in toilet and urinal flushing in Canada. At the provincial level, British Columbia (BC) has promulgated guidelines for wide applications of reclaimed water but only at broad class levels. This research has investigated and proposed probabilistic risk-based recommended values for microbial quality of reclaimed water in various non-potable urban reuses. The health risk was estimated by using quantitative microbial risk assessment. Two-dimensional Monte Carlo simulations were used in the analysis to include variability and uncertainty in input data. The proposed recommended values are based on the indicator organism E. coli. The required treatment levels for reuse were also estimated. In addition, the recommended values were successfully applied to three wastewater treatment effluents in the Okanagan Valley, BC, Canada. The health risks associated with other bacterial pathogens (Campylobacter jejuni and Salmonella spp.), virus (adenovirus, norovirus, and rotavirus), and protozoa (Cryptosporidium parvum and Giardia spp.), were also estimated. The estimated risks indicate the effectiveness of the E. coli-based water quality recommended values. Sensitivity analysis shows the pathogenic E. coli ratio and morbidity are the most sensitive input parameters for all water reuses. The proposed recommended values could be further improved by using national or regional data on water exposures, disease burden per case, and the susceptibility

The impact of land use on microbial surface water pollution.

Science.gov (United States)

Schreiber, Christiane; Rechenburg, Andrea; Rind, Esther; Kistemann, Thomas

2015-03-01

Our knowledge relating to water contamination from point and diffuse sources has increased in recent years and there have been many studies undertaken focusing on effluent from sewage plants or combined sewer overflows. However, there is still only a limited amount of microbial data on non-point sources leading to diffuse pollution of surface waters. In this study, the concentrations of several indicator micro-organisms and pathogens in the upper reaches of a river system were examined over a period of 16 months. In addition to bacteria, diffuse pollution caused by Giardia lamblia and Cryptosporidium spp. was analysed. A single land use type predestined to cause high concentrations of all microbial parameters could not be identified. The influence of different land use types varies between microbial species. The microbial concentration in river water cannot be explained by stable non-point effluent concentrations from different land use types. There is variation in the ranking of the potential of different land use types resulting in surface water contamination with regard to minimum, median and maximum effects. These differences between median and maximum impact indicate that small-scale events like spreading manure substantially influence the general contamination potential of a land use type and may cause increasing micro-organism concentrations in the river water by mobilisation during the next rainfall event. Copyright © 2014 Elsevier GmbH. All rights reserved.

9 CFR 354.224 - Water supply.

Science.gov (United States)

2010-01-01

... 9 Animals and Animal Products 2 2010-01-01 2010-01-01 false Water supply. 354.224 Section 354.224....224 Water supply. The water supply shall be ample, clean, and potable with adequate facilities for its distribution in the plant and its protection against contamination and pollution. (a) Hot water at a...

Evolution of water recycling in Australian cities since 2003.

Science.gov (United States)

Radcliffe, J C

2010-01-01

The prolonged Australian drought which commenced in 2002, and the agreement between Australia's Commonwealth and States/Territories governments to progress water reform through the National Water Initiative, has resulted in many new recycling projects in Australia's capital cities. Dual reticulation systems are being advanced in new subdivision developments in Sydney, Melbourne and Adelaide. Brisbane has installed three large Advanced Water Treatment Plants that are designed to send indirect potable recycled water to the Wivenhoe Dam which is Brisbane's principal water reservoir. Numerous water recycling projects are serving industry and agriculture. Experimental managed aquifer recharge is being undertaken with wetland-treated stormwater in Adelaide and reverse osmosis treated wastewater in Perth. New National Water Quality Management Strategy recycled water guidelines have been developed for managing environmental risks, for augmentation of drinking water supplies, for managed aquifer recharge and for stormwater harvesting and reuse. Many recent investments are part-supported through Commonwealth government grants. Desalination plants are being established in Melbourne and Adelaide and a second one in Perth in addition to the newly-operational plants in Perth, South-East Queensland and Sydney. Despite there being numerous examples of unplanned indirect potable recycling, most governments remain reluctant about moving towards planned potable recycling. There is evidence of some policy bans still being maintained by governments but the National Water Commission continues to reinforce the necessity of an even-handed objective consideration of all water supply options.

Reclamation of potable water from mixed gas streams

Science.gov (United States)

Judkins, Roddie R; Bischoff, Brian L; Debusk, Melanie Moses; Narula, Chaitanya

2013-08-20

An apparatus for separating a liquid from a mixed gas stream can include a wall, a mixed gas stream passageway, and a liquid collection assembly. The wall can include a first surface, a second surface, and a plurality of capillary condensation pores. The capillary condensation pores extend through the wall, and have a first opening on the first surface of the wall, and a second opening on the second surface of the wall. The pore size of the pores can be between about 2 nm to about 100 nm. The mixed gas stream passageway can be in fluid communication with the first opening. The liquid collection assembly can collect liquid from the plurality of pores.

Disinfection of grey water

OpenAIRE

Winward, Gideon Paul

2007-01-01

The reuse of grey water, for applications such as toilet flushing and irrigation, represents a potential sustainable solution to water shortages experienced by regions worldwide. Although reused grey water is not intended for potable use, the potential for transmission of waterborne pathogens by aerosol inhalation, topical contact, or indirect ingestion is a key concern for grey water reuse. This thesis explores the pathogen content of grey water and investigates pathogen remov...

Microbial biotechnologies for potable water production

DEFF Research Database (Denmark)

Fowler, S. Jane; Smets, Barth F.

2017-01-01

Sustainable Development Goal 6 requires the provision of safe drinking water to the world. We propose that increased exploitation of biological processes is fundamental to achieving this goal due to their low economic and energetic costs. Biological processes exist for the removal of most common...... contaminants, and biofiltration processes can establish a biologically stable product that retains high quality in distribution networks, minimizing opportunities for pathogen invasion....

Assessment of water supply system and water quality of Lighvan village using water safety plan

Directory of Open Access Journals (Sweden)

Mojtaba Pourakbar

2015-12-01

Full Text Available Background: Continuous expansion of potable water pollution sources is one of the main concerns of water suppliers, therefore measures such as water safety plan (WSP, have been taken into account to control these sources of pollution. The aim of this study was to identify probable risks and threatening hazards to drinking water quality in Lighvan village along with assessment of bank filtration of the village. Methods: In the present study all risks and probable hazards were identified and ranked. For each of these cases, practical suggestions for removing or controlling them were given. To assess potable water quality in Lighvan village, sampling was done from different parts of the village and physicochemical parameters were measured. To assess the efficiency of bank filtration system of the village, independent t test was used to compare average values of parameters in river and treated water. Results: One of the probable sources of pollution in this study was domestic wastewater which threatens water quality. The results of this study show that bank filtration efficiency in water supply of the village is acceptable. Conclusion: Although Bank filtration imposes fewer expenses on governments, it provides suitable water for drinking and other uses. However, it should be noted that application of these systems should be done after a thorough study of water pollution level, types of water pollutants, soil properties of the area, soil percolation and system distance from pollutant sources.

30 CFR 71.601 - Drinking water; quality.

Science.gov (United States)

2010-07-01

... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Drinking water; quality. 71.601 Section 71.601... Water § 71.601 Drinking water; quality. (a) Potable water provided in accordance with the provisions of § 71.600 shall meet the applicable minimum health requirements for drinking water established by the...

Coastal Zone Hazards Related to Groundwater-Surface Water Interactions and Groundwater Flooding

Science.gov (United States)

Kontar, Y. A.; Ozorovich, Y. R.; Salokhiddinov, A. T.

2009-12-01

Worldwide, as many as half a million people have died in natural and man-made disasters since the turn of the 21st century (Wirtz, 2008). Further, natural and man-made hazards can lead to extreme financial losses (Elsner et al, 2009). Hazards, hydrological and geophysical risk analysis related to groundwater-surface water interactions and groundwater flooding have been to a large extent under-emphasized for coastal zone applications either due to economical limitations or underestimation of its significance. This is particularly true for tsunamis creating salt water intrusion to coastal aquifers, even though most tsunami hazard assessments have in the past relied on scenario or deterministic type models (Geist and Parsons, 2006), and to increasing mineralization of potable water because of intensive water diversions and also the abundance of highly toxic pollutants (mainly pesticides) in water, air and food, which contribute to the deterioration of the coastal population's health (Glantz, 2007). In the wake of pressing environmental and economic issues, it is of prime importance for the scientific community to shed light onto the great efforts by hydrologists and geophysicists to quantify conceptual uncertainties and to provide quality assurances of potential coastal zone hazard evaluation and prediction. This paper proposes consideration of two case studies which are important and significant for future development and essential for feasibility studies of hazards in the coastal zone. The territory of the Aral Sea Region in Central Asia is known as an ecological disaster coastal zone (Zavialov, 2005). It is now obvious that, in order to provide reasonable living conditions to the coastal zone population, it is first of all necessary to drastically improve the quality of the water dedicated to human needs. Due to their intensive pollution by industrial wastes and by drainage waters from irrigated fields, the Syr Darya and Amu Darya rivers can no longer be considered

Modelling the impact of Water Sensitive Urban Design technologies on the urban water cycle

DEFF Research Database (Denmark)

Locatelli, Luca

Alternative stormwater management approaches for urban developments, also called Water Sensitive Urban Design (WSUD), are increasingly being adopted with the aims of providing flood control, flow management, water quality improvements and opportunities to harvest stormwater for non-potable uses....... To model the interaction of infiltration based WSUDs with groundwater. 4. To assess a new combination of different WSUD techniques for improved stormwater management. 5. To model the impact of a widespread implementation of multiple soakaway systems at the catchment scale. 6. Test the models by simulating...... the hydrological performance of single devices relevant for urban drainage applications. Moreover, the coupling of soakaway and detention storages is also modeled to analyze the benefits of combining different local stormwater management systems. These models are then integrated into urban drainage network models...

Assessment of Groundwater Quality of Ilorin Metropolis using Water Quality Index Approach

Directory of Open Access Journals (Sweden)

J. A. Olatunji

2015-06-01

Full Text Available Groundwater as a source of potable water is becoming more important in Nigeria. Therefore, the need to ascertain the continuing potability of the sources cannot be over emphasised. This study is aimed at assessing the quality of selected groundwater samples from Ilorin metropolis, Nigeria, using the water quality index (WQI method. Twenty two water samples were collected, 10 samples from boreholes and 12 samples from hand dug wells. All these were analysed for their physico – chemical properties. The parameters used for calculating the water quality index include the following: pH, total hardness, total dissolved solid, calcium, fluoride, iron, potassium, sulphate, nitrate and carbonate. The water quality index for the twenty two samples ranged from 0.66 to 756.02 with an average of 80.77. Two of the samples exceeded 100, which is the upper limit for safe drinking water. The high values of WQI from the sampling locations are observed to be due to higher values of iron and fluoride. This study reveals that the investigated groundwaters are mostly potable and can be consumed without treatment. Nonetheless, the sources identified to be unsafe should be treated before consumption.

BTEX compounds in water - future trends and directions for water treatment

OpenAIRE

Fayemiwo, OM; Daramola, MO; Moothi, K

2017-01-01

BTEX (benzene, toluene, ethylbenzene, and xylene) compounds are common water resource and potable water pollutants that are often left undetected and untreated by municipal treatment systems in spite of the negative repercussions associated with their ingestion. The US EPA has classified these pollutants as priority pollutant, yet they are persistently present in a variety of water resources. In this review paper, we highlight the sources and reported concentrations of BTEX compounds in water...

30 CFR 71.600 - Drinking water; general.

Science.gov (United States)

2010-07-01

... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Drinking water; general. 71.600 Section 71.600 Mineral Resources MINE SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR COAL MINE SAFETY AND HEALTH... Water § 71.600 Drinking water; general. An adequate supply of potable water shall be provided for...

30 CFR 75.1718 - Drinking water.

Science.gov (United States)

2010-07-01

... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Drinking water. 75.1718 Section 75.1718 Mineral... SAFETY STANDARDS-UNDERGROUND COAL MINES Miscellaneous § 75.1718 Drinking water. [Statutory Provisions] An adequate supply of potable water shall be provided for drinking purposes in the active workings of the mine...

Electrólisis de Salmuera para el Suministro de agua potable en poblaciónes marginadas

OpenAIRE

Barranco, Nelson

2012-01-01

En nuestro país el Instituto de Acueductos y Alcantarillados Nacionales (IDAAN) es el responsable de dotar a toda la población panameña de agua potable. Sin embargo las comunidades con menos 1,500 habitantes son atendidas por el MINSA, por los llamados acueductos rurales; los cuales son manejados por las mismas comunidades. La mayoría de estos acueductos rurales operan con muchas deficiencias. Por lo cual, la disponibilidad de agua potable a estas poblaciones rurales es muy insegura.

Southern Dobrogea coastal potable water sources and Upper Quaternary Black Sea level changes

Science.gov (United States)

Caraivan, Glicherie; Stefanescu, Diana

2013-04-01

Southern Dobrogea is a typical geologic platform unit, placed in the south-eastern part of Romania, with a Pre-Cambrian crystalline basement and a Paleozoic - Quaternary sedimentary cover. It is bordered to the north by the Capidava - Ovidiu fault and by the Black Sea to the east. A regional WNW - ESE and NNE - SSW fault system divides the Southern Dobrogea structure in several tectonic blocks. Four drinking water sources have been identified: surface water, phreatic water, medium depth Sarmatian aquifer, and deep Upper Jurassic - Lower Cretaceous aquifer. Surface water sources are represented by several springs emerged from the base of the loess cliff, and a few small rivers, barred by coastal beaches. The phreatic aquifer develops at the base of the loess deposits, on the impervious red clay, overlapping the Sarmatian limestones. The medium depth aquifer is located in the altered and karstified Sarmatian limestones, and discharges into the Black Sea. The Sarmatian aquifer is unconfined where covered by silty loess deposits, and locally confined, where capped by clayey loess deposits. The aquifer is supplied from the Pre-Balkan Plateau. The Deep Upper Jurassic - Lower Cretaceous aquifer, located in the limestone and dolomite deposits, is generally confined and affected by the regional WNW - ESE and NNE - SSW fault system. In the south-eastern Dobrogea, the deep aquifer complex is separated from the Sarmatian aquifer by a Senonian aquitard (chalk and marls). The natural boundary of the Upper Jurassic - Lower Cretaceous aquifer is the Capidava - Ovidiu Fault. The piezometric heads show that the Upper Jurassic - Lower Cretaceous aquifer is supplied from the Bulgarian territory, where the Upper Jurassic deposits crop out. The aquifer discharges into the Black Sea to the east and into Lake Siutghiol to the northeast. The cyclic Upper Quaternary climate changes induced drastic remodeling of the Black Sea level and the corresponding shorelines. During the Last Glacial

availability analysis of chemicals for water treatment

African Journals Online (AJOL)

NIJOTECH

In most countries, chemicals are generally recognized as being vital in the production of potable water and will ... industries and water utility ventures are being started in Nigeria ... are being dumped into rivers thereby polluting them the more.

Analysis of the bacterial community composition in acidic well water used for drinking in Guinea-Bissau, West Africa.

Science.gov (United States)

Machado, Ana; Bordalo, Adriano A

2014-08-01

Potable water is a resource out of reach for millions worldwide, and the available water may be chemically and microbiologically compromised. This is particularly acute in Africa, where water-networks may be non-existent or restricted to a small fraction of the urban population, as in the case of Guinea-Bissau, West Africa. This study was carried out seasonally in Bolama (11°N), where unprotected hand-dug wells with acidic water are the sole source of water for the population. We inspected the free-living bacterial community dynamics by automated rRNA intergenic spacer analyses, quantitative polymerase chain reaction and cloning approaches. The results revealed a clear seasonal shift in bacterial assemblage composition and microbial abundance within the same sampling site. Temperature, pH and turbidity, together with the infiltration and percolation of surface water, which takes place in the wet season, seemed to be the driving factors in the shaping and selection of the bacterial community and deterioration of water quality. Analysis of 16S rDNA sequences revealed several potential pathogenic bacteria and uncultured bacteria associated with water and sediments, corroborating the importance of a culture-independent approach in drinking water monitoring. Copyright © 2014. Published by Elsevier B.V.

Fracture mechanics assessment of surface and sub-surface cracks in the RPV under non-symmetric PTS loading

Energy Technology Data Exchange (ETDEWEB)

Keim, E; Shoepper, A; Fricke, S [Siemens AG Unternehmensbereich KWU, Erlangen (Germany)

1997-09-01

One of the most severe loading conditions of a reactor pressure vessel (rpv) under operation is the loss of coolant accident (LOCA) condition. Cold water is injected through nozzles in the downcomer of the rpv, while the internal pressure may remain at a high level. Complex thermal hydraulic situations occur and the fluid and downcomer temperatures as well as the fluid to wall heat transfer coefficient at the inner surface are highly non-linear. Due to this non-symmetric conditions, the problem is investigated by three-dimensional non-linear finite element analyses, which allow for an accurate assessment of the postulated flaws. Transient heat transfer analyses are carried out to analyze the effect of non-symmetrical cooling of the inner surface of the pressure vessel. In a following uncoupled stress analysis the thermal shock effects for different types of defects, surface flaws and sub-surface flaws are investigated for linear elastic and elastic-plastic material behaviour. The obtained fracture parameters are calculated along the crack fronts. By a fast fracture analysis the fracture parameters at different positions along the crack front are compared to the material resistance. Safety margins are pointed out in an assessment diagram of the fracture parameters and the fracture resistance versus the transient temperature at the crack tip position. (author). 4 refs, 10 figs.

21 CFR 1250.87 - Wash water.

Science.gov (United States)

2010-04-01

... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Wash water. 1250.87 Section 1250.87 Food and Drugs... Sanitation Facilities and Conditions on Vessels § 1250.87 Wash water. Where systems installed on vessels for wash water, as defined in § 1250.3(n), do not comply with the requirements of a potable water system...

Hydrogen isotope separation in hydrophobic catalysts between hydrogen and liquid water

Energy Technology Data Exchange (ETDEWEB)

Ye, Linsen, E-mail: yls2005@mail.ustc.edu.cn [China Academy of Engineering Physics, Mianyang 621900 (China); Luo, Deli [Science and Technology on Surface Physics and Chemistry Laboratory, Jiangyou 621907 (China); Tang, Tao; Yang, Wan; Yang, Yong [China Academy of Engineering Physics, Mianyang 621900 (China)

2015-11-15

Hydrogen isotope catalytic exchange between hydrogen and liquid water is a very effective process for deuterium-depleted potable water production and heavy water detritiation. To improve the characteristics of hydrophobic catalysts for this type of reaction, foamed and cellular structures of hydrophobic carbon-supported platinum catalysts were successfully prepared. Separation of deuterium or tritium from liquid water was carried out by liquid-phase catalytic exchange. At a gas–liquid ratio of 1.53 and exchange temperature of 70 °C, the theoretical plate height of the hydrophobic catalyst (HETP = 34.2 cm) was slightly lower than previously reported values. Changing the concentration of the exchange column outlet water yielded nonlinear changes in the height of the packing layer. Configurations of deuterium-depleted potable water and detritiation of heavy water provide references for practical applications.

Characterisation of some South African water treatment residues ...

African Journals Online (AJOL)

... the production of potable water, is becoming the preferred method of disposal, ... and plant available water) and chemical attributes (pH, electrical conductivity, ... but currently they are regulated by the 'minimum requirements for disposal of ...

Studies on the treatment of surface water using rajma seeds

Directory of Open Access Journals (Sweden)

Merlin S. Babitha

2018-03-01

Full Text Available Indiscriminate disposal of wastewater with suspended solids have led to higher amount of pollution to the natural water bodies. Turbidity removal becomes an essential part in the water treatment when surface water is used for drinking purpose, this can be achieved by means of coagulation process. Coagulation process is the dosing of a coagulant in water, resulting in the destabilization of negatively charged particles. Commercial coagulants which were widely used can synthesize by-products in turn may pollute the environment and deteriorate the ecosystem at a slow rate. So, now-a-days natural coagulants are used as a potential substitute because it’s biodegradable, ecofriendly and non-toxic. In this study, the turbid surface water samples were treated using powdered seeds of Rajma (natural coagulant followed by variations in dosage, settling time and pH were also studied. From the results obtained, it was found that the Rajma seeds powder achieved 48.80% efficiency for 0.5 g/l of optimum dose at pH 6 for 20 min settling time respectively.

Studies on the treatment of surface water using rajma seeds

Science.gov (United States)

Merlin, S. Babitha; Abirami, M.; Kumar, R. Suresh

2018-03-01

Indiscriminate disposal of wastewater with suspended solids have led to higher amount of pollution to the natural water bodies. Turbidity removal becomes an essential part in the water treatment when surface water is used for drinking purpose, this can be achieved by means of coagulation process. Coagulation process is the dosing of a coagulant in water, resulting in the destabilization of negatively charged particles. Commercial coagulants which were widely used can synthesize by-products in turn may pollute the environment and deteriorate the ecosystem at a slow rate. So, now-a-days natural coagulants are used as a potential substitute because it's biodegradable, ecofriendly and non-toxic. In this study, the turbid surface water samples were treated using powdered seeds of Rajma (natural coagulant) followed by variations in dosage, settling time and pH were also studied. From the results obtained, it was found that the Rajma seeds powder achieved 48.80% efficiency for 0.5 g/l of optimum dose at pH 6 for 20 min settling time respectively.

Avisos de salud sobre el PFOA y PFOS en el agua potable

Science.gov (United States)

La EPA estableció avisos de salud sobre el ácido perfluorooctanoico (PFOA) y el sulfonato de perfluorooctano (PFOS) para proporcionar información a los operadores de sistemas de agua potable y funcionarios estatales, tribales y locales sobre los riesgos de

Estudio de factibilidad de mínimo costo del sistema de producción de agua potable de la ciudad de Iquitos

OpenAIRE

Pinchi Valdez, Marco Antonio; Pinchi Valdez, Marco Antonio; Pinchi Valdez, Marco Antonio

1997-01-01

El presente informe técnico recopila el trabajo realizado en la ciudad de Iquitos acerca del Sistema de producción de agua potable de la ciudad de iquitos, por el Concurso internacional de Méritos N“ 001-94- PRES-VMI-PRONAP, que fue convocado por el proyecto especial “Programa Nacional de Agua Potable y Alcantarillado” (PRONAP), del Ministerio de la Presidencia, para la elaboración de los “Estudios de Factibilidad de los Planes de Expansión de Mínimo Costo de los Servicios de Agua Potable y A...

Temporal variability in water quality parameters--a case study of drinking water reservoir in Florida, USA.

Science.gov (United States)

Toor, Gurpal S; Han, Lu; Stanley, Craig D

2013-05-01

Our objective was to evaluate changes in water quality parameters during 1983-2007 in a subtropical drinking water reservoir (area: 7 km(2)) located in Lake Manatee Watershed (area: 338 km(2)) in Florida, USA. Most water quality parameters (color, turbidity, Secchi depth, pH, EC, dissolved oxygen, total alkalinity, cations, anions, and lead) were below the Florida potable water standards. Concentrations of copper exceeded the potable water standard of water quality threshold of 20 μg l(-1). Concentrations of total N showed significant increase from 1983 to 1994 and a decrease from 1997 to 2007. Total P showed significant increase during 1983-2007. Mean concentrations of total N (n = 215; 1.24 mg l(-1)) were lower, and total P (n = 286; 0.26 mg l(-1)) was much higher than the EPA numeric criteria of 1.27 mg total N l(-1) and 0.05 mg total P l(-1) for Florida's colored lakes, respectively. Seasonal trends were observed for many water quality parameters where concentrations were typically elevated during wet months (June-September). Results suggest that reducing transport of organic N may be one potential option to protect water quality in this drinking water reservoir.

In situ detection and characterization of potable water biofilms on materials by microscopic, spectroscopic and electrochemistry methods

Energy Technology Data Exchange (ETDEWEB)

Gamby, Jean [Universite Pierre et Marie Curie - Paris 6, CNRS-UPR 15, Laboratoire Interfaces et Systemes Electrochimiques, 4 Place Jussieu, Case Courrier 133, 75252 Paris Cedex 05 (France)], E-mail: jean.gamby@upmc.fr; Pailleret, Alain [Universite Pierre et Marie Curie - Paris 6, CNRS-UPR 15, Laboratoire Interfaces et Systemes Electrochimiques, 4 Place Jussieu, Case Courrier 133, 75252 Paris Cedex 05 (France); Clodic, Carol Boucher; Pradier, Claire-Marie [Universite Pierre et Marie Curie - Paris 6, CNRS-UMR 7609, Laboratoire de Reactivite de Surface, 4 Place Jussieu, Case Courrier 178, 75252 Paris Cedex 05 (France); Tribollet, Bernard [Universite Pierre et Marie Curie - Paris 6, CNRS-UPR 15, Laboratoire Interfaces et Systemes Electrochimiques, 4 Place Jussieu, Case Courrier 133, 75252 Paris Cedex 05 (France)

2008-12-01

We studied biofilm formation on stainless steel occurring in a drinking water distribution system which operated in parallel at 20 and 37 deg. C, in order to focus on the effect of temperature rather than on other operational and water quality parameters. A surface conditioning step was followed as a function of time on this material until adhesion of bacterial colonies by using microscopic methods: scanning electron microscopy (SEM) and atomic force microscopy (AFM); a spectroscopic method: polarization modulation infrared reflection absorption spectroscopy (PM-IRRAS), and an electrochemical method: rotating disk electrode (RDE). Correlations between surface analysis, the duration of immersion of the sample and the influence of temperature have been identified clearly before bacterial adhesion. In cold water, these results showed an initial conditioning step of surface occurring during the first 8 days, with detection of superficial acidic functions grafted on surface, until adsorption of proteins. After 12 days, formation of independent bacteria microcolonies, reaching 2-3 {mu}m in length was observed. In tepid water, the first step was reduced to 2 days during which carbonates, acidic functions, and proteins were detected. After 90 days, the biofilm entered in a stable population state, which appeared as a bacteria rich film, including possibly Legionella. The spatial variation of the biofilm was limited as deduced from the thickness determination (about 4 {mu}m for 3-month period), using a RDE. The combination of these different techniques confirms successive steps for biofilm formation on stainless steel in a tap water. Then, we scrutinized the external near environment of bacteria including extracellular polymeric substances (EPS) and then further characterize the morphology of dominant bacteria (shape, size, flagellum) on gold substrate by AFM in air.

In situ detection and characterization of potable water biofilms on materials by microscopic, spectroscopic and electrochemistry methods

International Nuclear Information System (INIS)

Gamby, Jean; Pailleret, Alain; Clodic, Carol Boucher; Pradier, Claire-Marie; Tribollet, Bernard

2008-01-01

We studied biofilm formation on stainless steel occurring in a drinking water distribution system which operated in parallel at 20 and 37 deg. C, in order to focus on the effect of temperature rather than on other operational and water quality parameters. A surface conditioning step was followed as a function of time on this material until adhesion of bacterial colonies by using microscopic methods: scanning electron microscopy (SEM) and atomic force microscopy (AFM); a spectroscopic method: polarization modulation infrared reflection absorption spectroscopy (PM-IRRAS), and an electrochemical method: rotating disk electrode (RDE). Correlations between surface analysis, the duration of immersion of the sample and the influence of temperature have been identified clearly before bacterial adhesion. In cold water, these results showed an initial conditioning step of surface occurring during the first 8 days, with detection of superficial acidic functions grafted on surface, until adsorption of proteins. After 12 days, formation of independent bacteria microcolonies, reaching 2-3 μm in length was observed. In tepid water, the first step was reduced to 2 days during which carbonates, acidic functions, and proteins were detected. After 90 days, the biofilm entered in a stable population state, which appeared as a bacteria rich film, including possibly Legionella. The spatial variation of the biofilm was limited as deduced from the thickness determination (about 4 μm for 3-month period), using a RDE. The combination of these different techniques confirms successive steps for biofilm formation on stainless steel in a tap water. Then, we scrutinized the external near environment of bacteria including extracellular polymeric substances (EPS) and then further characterize the morphology of dominant bacteria (shape, size, flagellum) on gold substrate by AFM in air

Contaminants of emerging concern in surface waters in Barbados, West Indies.

Science.gov (United States)

Edwards, Quincy A; Kulikov, Sergei M; Garner-O'Neale, Leah D; Metcalfe, Chris D; Sultana, Tamanna

2017-11-14

Contaminants of emerging concern (CECs), including pharmaceuticals, artificial sweeteners, steroid hormones, and current-use pesticides have been detected in surface waters around the world, but to date, there have been no reports in the peer-reviewed literature on the levels of these classes of contaminants in freshwater resources in the Caribbean region. In the present study, multi-residue solid phase extraction (SPE) and liquid chromatography with tandem mass spectroscopy (LC-MS/MS) were used to analyze grab samples of surface waters collected from five different watersheds in Barbados, West Indies. The artificial sweeteners (AS), acesulfame, cyclamate, saccharin, and sucralose were widely detected in the watersheds, indicating contamination from domestic wastewater, and the concentrations of these chemical tracers in water were correlated with the concentrations of the non-prescription pharmaceutical, ibuprofen (R 2 values of 0.4-0.6). Surprisingly, the concentrations of another chemical tracer of domestic wastewater, caffeine were not correlated with ibuprofen or AS concentrations. Several other prescription pharmaceuticals and the steroid hormones, estrone and androstenedione, were detected in selected watersheds at low ng/L concentrations. The fungicide, chlorothalonil was widely detected in surface waters at low (contamination of water resources by pharmaceuticals.

The current water quality situation at clinics in the Limpopo Province and subsequent management suggestions / Jan Hendrik Stander

OpenAIRE

Stander, Jan Hendrik

2010-01-01

South Africa's water resources are, in global terms, scarce and extremely limited (DWAF, 2004). Groundwater is a valuable source of potable water in South Africa. It was found that most of the health facilities in the Limpopo Province depend on groundwater as sole source of potable water. Groundwater quality is to a great extent influenced by the dominant land use in the vicinity of an aquifer. It is therefore important to carefully manage possible pollution sources of anthropogen...

Capture and Utilization of Water From Rain: The Way for Sustainable School

OpenAIRE

Jamila El Tugoz; Geysler Rogis Flor Bertolini; Loreni Teresinha Brandalise

2017-01-01

Currently, issues related to environmental preservation and responsible use of water, have become a global concern, which has driven the increasing number of public policies aimed at promoting sustainable practices. In this context, it addresses the implementation of a system harnessing rainwater for non-potable purposes in a school unit. This article aimed to evaluate the results obtained from the use of tanks to capture and use of rainwater in a state school of Paraná, in the city of Marec...

Radon in houses due to radon in potable water

International Nuclear Information System (INIS)

Hess, C.T.; Korsah, J.K.; Einloth, C.J.

1987-01-01

Radon concentration in the air of 10 houses has been measured as a function of water use and meterological parameters such as barometric pressure, wind velocity and direction, indoor and outdoor temperature, and rainfall. Results of calibrations and data collected in winter, spring, fall, and summer are given for selected houses. Average values of radon concentration in air are from 0.80 to 77 rhoCi/1. Water use average ranges from 70 to 240 gal/day. Average potential alpha energy concentrations in these houses range from 0.02 to 1.6 working levels. The radon level due to water use ranges from 0 to 36% of the house radon from soil and water combined. The radon level change due to use of a filter on the water supply shows a 60% reduction in radon in the house. Conclusions are that water radon can be a major fraction of the radon in houses. The ratio of airborne radon concentration due to water use to the radon concentration in water is 4.5 x 10/sup -5/ - 13 x 10/sup -5/

Anisotropic and sub-diffusive water motion at the surface of DNA and of an anionic micelle CsPFO

International Nuclear Information System (INIS)

Pal, Subrata; Maiti, Prabal K; Bagchi, Biman

2005-01-01

We use long atomistic molecular dynamics simulations to address certain fundamental issues regarding water dynamics in the hydration layer of a 38 base long (GCCGCGAGGTGTCAGGGATTGCAGCCAGCATCTCGTCG) negatively charged hydrated DNA duplex. The rotational time correlation function of surface water dipoles is found to be markedly non-exponential, with a slow component at long time, whose magnitude depends on the initial (t = 0) residence of the water in the major or minor groove of the DNA. The surface water molecules are also found to exhibit anisotropic diffusion in both the major and minor grooves: diffusion in the direction parallel to the DNA surface exhibits a crossover from higher to lower than that in the direction normal to the surface at short-to-intermediate times. In the same time window, translational motion of water molecules in the minor groove is sub-diffusive, with mean square displacement (MSD) growing as t α with α ∼ 0.43. In general, water molecules in the major group exhibit faster dynamics than those in the minor groove, in agreement with earlier results (Bonvin et al 1998 J. Mol. Biol. 282 859-73). We compare these results with dynamics of water molecules at the surface of an anionic micelle, cesium perfluorooctanoate (CsPFO). Water molecules on the surface of CsPFO also exhibit slow translation and non-exponential orientational dynamics

The effectiveness of conventional water treatment in removing ...

African Journals Online (AJOL)

Algal blooms are a global problem due to various negative effects that can compromise water quality, such as the production of metabolites that are responsible for odour, colour, taste and toxins. In drinking water supplies algae can reduce the aesthetics of potable water when not readily removed by conventional water ...

Controllability of Surface Water Networks

Science.gov (United States)

Riasi, M. Sadegh; Yeghiazarian, Lilit

2017-12-01

To sustainably manage water resources, we must understand how to control complex networked systems. In this paper, we study surface water networks from the perspective of structural controllability, a concept that integrates classical control theory with graph-theoretic formalism. We present structural controllability theory and compute four metrics: full and target controllability, control centrality and control profile (FTCP) that collectively determine the structural boundaries of the system's control space. We use these metrics to answer the following questions: How does the structure of a surface water network affect its controllability? How to efficiently control a preselected subset of the network? Which nodes have the highest control power? What types of topological structures dominate controllability? Finally, we demonstrate the structural controllability theory in the analysis of a wide range of surface water networks, such as tributary, deltaic, and braided river systems.

Repository surface design site layout analysis

International Nuclear Information System (INIS)

Montalvo, H.R.

1998-01-01

The purpose of this analysis is to establish the arrangement of the Yucca Mountain Repository surface facilities and features near the North Portal. The analysis updates and expands the North Portal area site layout concept presented in the ACD, including changes to reflect the resizing of the Waste Handling Building (WHB), Waste Treatment Building (WTB), Carrier Preparation Building (CPB), and site parking areas; the addition of the Carrier Washdown Buildings (CWBs); the elimination of the Cask Maintenance Facility (CMF); and the development of a concept for site grading and flood control. The analysis also establishes the layout of the surface features (e.g., roads and utilities) that connect all the repository surface areas (North Portal Operations Area, South Portal Development Operations Area, Emplacement Shaft Surface Operations Area, and Development Shaft Surface Operations Area) and locates an area for a potential lag storage facility. Details of South Portal and shaft layouts will be covered in separate design analyses. The objective of this analysis is to provide a suitable level of design for the Viability Assessment (VA). The analysis was revised to incorporate additional material developed since the issuance of Revision 01. This material includes safeguards and security input, utility system input (size and location of fire water tanks and pump houses, potable water and sanitary sewage rates, size of wastewater evaporation pond, size and location of the utility building, size of the bulk fuel storage tank, and size and location of other exterior process equipment), main electrical substation information, redundancy of water supply and storage for the fire support system, and additional information on the storm water retention pond

Characterisation of some South African water treatment residues ...

African Journals Online (AJOL)

2005-07-03

Jul 3, 2005 ... Land application of water treatment residue (WTR) the by-product from the production of potable water, is becoming the preferred ... were analysed for some physical (particle size distribution, particle density and plant available water) and chemical attributes ...... for Industrial Wastes – Theory and Practice.

Groundwater–Surface Water Exchange

DEFF Research Database (Denmark)

Karan, Sachin

The exchange of groundwater-surface water has been invetigated in the western part of Denmark. Holtum AA provides the framework for all the performed investigations. Several methods are used, primarily eld based measurements ombined with numerical models to achieve insight to the governing...... processes of interaction between groundwater and surface water. By using heat as a tracer it has been possible to use temperature directly as calibrationtargets in a groundwater and heat transport model. Thus, it is possible to use heat investigate the change in groundwater discharge in dynamic conditions...... by using simple temperature devices along a stream to delineate the areas of interest in regard to GW{SW exchange. Thus, at several locations in a stream a temperature data logger was placed in the water column and right at the streambed-water interface. By looking at the correlation of streambed...

Pollution source control by water utilities – characterisation and implications for water management: research results from England and Wales

NARCIS (Netherlands)

Spiller, M.; McIntosh, B.S.; Seaton, R.A.F.; Jeffrey, P.

2013-01-01

The treatment of agriculturally polluted water to potable standards is costly for water companies. Changes in agricultural practice can reduce these costs while also meeting the objectives of European Union (EU) environmental legislation. In this paper, the uptake of source control interventions

An energy balance model exploration of the impacts of interactions between surface albedo, cloud cover and water vapor on polar amplification

Science.gov (United States)

Södergren, A. Helena; McDonald, Adrian J.; Bodeker, Gregory E.

2017-11-01

We examine the effects of non-linear interactions between surface albedo, water vapor and cloud cover (referred to as climate variables) on amplified warming of the polar regions, using a new energy balance model. Our simulations show that the sum of the contributions to surface temperature changes due to any variable considered in isolation is smaller than the temperature changes from coupled feedback simulations. This non-linearity is strongest when all three climate variables are allowed to interact. Surface albedo appears to be the strongest driver of this non-linear behavior, followed by water vapor and clouds. This is because increases in longwave radiation absorbed by the surface, related to increases in water vapor and clouds, and increases in surface absorbed shortwave radiation caused by a decrease in surface albedo, amplify each other. Furthermore, our results corroborate previous findings that while increases in cloud cover and water vapor, along with the greenhouse effect itself, warm the polar regions, water vapor also significantly warms equatorial regions, which reduces polar amplification. Changes in surface albedo drive large changes in absorption of incoming shortwave radiation, thereby enhancing surface warming. Unlike high latitudes, surface albedo change at low latitudes are more constrained. Interactions between surface albedo, water vapor and clouds drive larger increases in temperatures in the polar regions compared to low latitudes. This is in spite of the fact that, due to a forcing, cloud cover increases at high latitudes and decreases in low latitudes, and that water vapor significantly enhances warming at low latitudes.

agua potable

Directory of Open Access Journals (Sweden)

John Fredy Rios

2008-01-01

Full Text Available Los sistemas de distribución pueden afectar la calidad del agua potable debido a las condiciones de la tubería y a la operación del sistema. Algunos parámetros son sensibles a la variación durante la distribución como: el cloro residual, pH, color y turbiedad, debido a que el material de la tubería puede presentar deterioro en estos sistemas a causa de la corrosividad del agua. Los diversos estudios realizados sobre el tema han empleado tanto sistemas reales como dispositivos de laboratorio para la realización de los ensayos. Entre los dispositivos más empleados actualmente, se reporta el uso del sistema piloto de distribución por las ventajas que ofrece y su flexibilidad en el diseño. Para definir las características de diseño de un sistema piloto de distribución se hizo una revisión de la literatura. El sistema se empleará en el estudio de la interacción entre el líquido y la pared de tubería. Se utilizarán materiales metálicos usados en sistemas de distribución secundarios, con el fin de determinar el ataque a la superficie interna de las tuberías y las causas de formación de depósitos sobre ellas, así como identificar los efectos de esta interacción en la calidad del agua.

Impact of Water Withdrawals from Groundwater and Surface Water on Continental Water Storage Variations

Science.gov (United States)

Doell, Petra; Hoffmann-Dobrev, Heike; Portmann, Felix T.; Siebert, Stefan; Eicker, Annette; Rodell, Matthew; Strassberg, Gil

2011-01-01

Humans have strongly impacted the global water cycle, not only water flows but also water storage. We have performed a first global-scale analysis of the impact of water withdrawals on water storage variations, using the global water resources and use model WaterGAP. This required estimation of fractions of total water withdrawals from groundwater, considering five water use sectors. According to our assessment, the source of 35% of the water withdrawn worldwide (4300 cubic km/yr during 1998-2002) is groundwater. Groundwater contributes 42%, 36% and 27% of water used for irrigation, households and manufacturing, respectively, while we assume that only surface water is used for livestock and for cooling of thermal power plants. Consumptive water use was 1400 cubic km/yr during 1998-2002. It is the sum of the net abstraction of 250 cubic km/yr of groundwater (taking into account evapotranspiration and return flows of withdrawn surface water and groundwater) and the net abstraction of 1150 km3/yr of surface water. Computed net abstractions indicate, for the first time at the global scale, where and when human water withdrawals decrease or increase groundwater or surface water storage. In regions with extensive surface water irrigation, such as Southern China, net abstractions from groundwater are negative, i.e. groundwater is recharged by irrigation. The opposite is true for areas dominated by groundwater irrigation, such as in the High Plains aquifer of the central USA, where net abstraction of surface water is negative because return flow of withdrawn groundwater recharges the surface water compartments. In intensively irrigated areas, the amplitude of seasonal total water storage variations is generally increased due to human water use; however, in some areas, it is decreased. For the High Plains aquifer and the whole Mississippi basin, modeled groundwater and total water storage variations were compared with estimates of groundwater storage variations based on

Assessment of Groundwater Quality of Ilorin Metropolis using Water ...

African Journals Online (AJOL)

Akorede

ABSTRACT: Groundwater as a source of potable water is becoming more important in ... The parameters used for calculating the water quality index include the following: pH, total hardness, total ... Generally, water pollution not only affects water quality ..... regardless of the natural geology and human activities, it has.

Evaluation of ATP measurements to detect microbial ingress by wastewater and surface water in drinking water.

Science.gov (United States)

Vang, Óluva K; Corfitzen, Charlotte B; Smith, Christian; Albrechtsen, Hans-Jørgen

2014-11-01

Fast and reliable methods are required for monitoring of microbial drinking water quality in order to protect public health. Adenosine triphosphate (ATP) was investigated as a potential real-time parameter for detecting microbial ingress in drinking water contaminated with wastewater or surface water. To investigate the ability of the ATP assay in detecting different contamination types, the contaminant was diluted with non-chlorinated drinking water. Wastewater, diluted at 10(4) in drinking water, was detected with the ATP assay, as well as 10(2) to 10(3) times diluted surface water. To improve the performance of the ATP assay in detecting microbial ingress in drinking water, different approaches were investigated, i.e. quantifying microbial ATP or applying reagents of different sensitivities to reduce measurement variations; however, none of these approaches contributed significantly in this respect. Compared to traditional microbiological methods, the ATP assay could detect wastewater and surface water in drinking water to a higher degree than total direct counts (TDCs), while both heterotrophic plate counts (HPC 22 °C and HPC 37 °C) and Colilert-18 (Escherichia coli and coliforms) were more sensitive than the ATP measurements, though with much longer response times. Continuous sampling combined with ATP measurements displays definite monitoring potential for microbial drinking water quality, since microbial ingress in drinking water can be detected in real-time with ATP measurements. The ability of the ATP assay to detect microbial ingress is influenced by both the ATP load from the contaminant itself and the ATP concentration in the specific drinking water. Consequently, a low ATP concentration of the specific drinking water facilitates a better detection of a potential contamination of the water supply with the ATP assay. Copyright © 2014 Elsevier Ltd. All rights reserved.

Infiltration of pesticides in surface water into nearby drinking water supply wells

DEFF Research Database (Denmark)

Malaguerra, Flavio; Albrechtsen, Hans-Jørgen; Binning, Philip John

Drinking water wells are often placed near streams because streams often overly permeable sediments and the water table is near the surface in valleys, and so pumping costs are reduced. The lowering of the water table by pumping wells can reverse the natural flow from the groundwater to the stream......, inducing infiltration of surface water to groundwater and consequently to the drinking water well. Many attenuation processes can take place in the riparian zone, mainly due to mixing, biodegradation and sorption. However, if the water travel time from the surface water to the pumping well is too short......, or if the compounds are poorly degradable, contaminants can reach the drinking water well at high concentrations, jeopardizing drinking water quality. Here we developed a reactive transport model to evaluate the risk of contamination of drinking water wells by surface water pollution. The model was validated using...

Water quality assessment of the Shatt al-Arab River, Southern Iraq

Directory of Open Access Journals (Sweden)

Mohammad Salim Moyel

2015-06-01

Full Text Available Objective: To assess suitability of the water quality of Shatt al-Arab River for protection of aquatic life, potable water supply and irrigation uses. Methods: The Shatt al-Arab River was monitored on a monthly basis from July 2009 to June 2010. A water quality index (WQI was calculated to assess the suitability of water for protection of aquatic life, potable water supply and irrigation uses during the dry season from July to December 2009 and the wet season from January until June 2010. Results: The results of the WQI showed that the lowest water quality values were scored during the dry season for all three uses of the river. Marginal water quality values were recorded for protection of aquatic life and fair (upstream to poor (downstream water quality values were recorded for irrigation uses. Moreover, the river water was not suitable for potable water supply without elaborate treatment. Conclusions: Deterioration of the Shatt al-Arab water quality has been attributed to reduced freshwater discharges from Tigris and Euphrates Rivers, low annual precipitations and an advancing salt wedge from the Arabian Gulf. However, a combination of those factors such as low riverine discharge and advancing salt wedge with a continuous discharge of agriculture, oil industry and urban point effluent has polluted the waters and fostered the decline of the Shatt al-Arab River water quality during the study period. The study indicated that application of WQIs was a useful tool to monitor and assess the overall water quality of the Shatt al-Arab River.

21 CFR 1240.95 - Sanitation of water boats.

Science.gov (United States)

2010-04-01

... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Sanitation of water boats. 1240.95 Section 1240.95... DISEASES Source and Use of Potable Water § 1240.95 Sanitation of water boats. No vessel engaged in interstate traffic shall obtain water for drinking and culinary purposes from any water boat unless the tanks...

An assessment of existing common traditional methods of water ...

African Journals Online (AJOL)

Classical water purification methods include boiling, filtration, irradiation and the use of chemicals while traditional water purification methods in use are boiling, filtration, sedimentation, long storage and solar radiation. Waterborne diseases are m ore common in the rural communities where potable water supply coverage ...

Optimizing conjunctive use of surface water and groundwater resources with stochastic dynamic programming

DEFF Research Database (Denmark)

Davidsen, Claus; Liu, Suxia; Mo, Xinguo

2014-01-01

. A stochastic dynamic programming (SDP) approach is used to minimize the basin-wide total costs arising from water allocations and water curtailments. Dynamic allocation problems with inclusion of groundwater resources proved to be more complex to solve with SDP than pure surface water allocation problems due...... to head-dependent pumping costs. These dynamic pumping costs strongly affect the total costs and can lead to non-convexity of the future cost function. The water user groups (agriculture, industry, domestic) are characterized by inelastic demands and fixed water allocation and water supply curtailment...

Preparación de Membranas para Producción de Agua Potable Preparation of Membranes for the Production of Drinking Water

OpenAIRE

Rosa M Ribeiro; Rosângela Bergamasco; Marcelino L Gimenes; Carmen M. O Müller

2007-01-01

En este trabajo se presenta un estudio sobre la síntesis de membranas poliméricas asimétricas para la producción de agua potable. La filtración usando membranas es un proceso alternativo para el tratamiento de aguas, donde la membrana actúa como una barrera selectiva que bloquea el pasaje de algunos componentes. En este trabajo algunas muestras de agua fueron infectadas con 10(7) a 10(8) unidades formadoras de colonias (UFC) por ml con la bacteria Escherichia coli. El proceso utilizado fue la...

Amoco-US Environmental Protection Agency, pollution prevention project, Yorktown, Virginia: Surface water data

International Nuclear Information System (INIS)

Baloo, S.

1991-08-01

The report summarizes the surface water sampling program at the Amoco Refinery at Yorktown, Virginia. This was undertaken as a part of the joint project between Amoco Corporation and the United States Environmental Protection Agency to review pollution prevention alternatives at a petroleum refinery. The surface water data provides a snapshot of surface water pollutant generation and discharge from the refinery. Different process units contribute to the total wastewater flow of 460 GPM in the refinery. Water in the ditch system, which is non-process water, is free of organic contamination. Oil and grease, phenols, ammonia and sulfides are the significant components measured in the process wastewater. The concentrations of organics in most water streams leaving the individual process units are relatively low, in the 1-5 parts per million (ppm) range. A few individual streams such as the crude desalter brine and tank water draws have high pollutant loadings. Concentrations of metals in the refinery wastewater are very low. The wastewater treatment plant is very effective in reducing the pollutant loading in the water with overall removal efficiencies greater than 99% for most organics and inorganics

The adsorption and dissociation of water molecule on goethite (010) surface: A DFT approach

Energy Technology Data Exchange (ETDEWEB)

Zhou, Long, E-mail: shuweixia@ouc.edu.cn [Key Laboratory of Marine Chemistry Theory and Technology, Ministry of Education, Ocean University of China, College of Chemistry and Chemical Engineering (China); Xiu, Fangyuan [Key Laboratory of Marine Chemistry Theory and Technology, Ministry of Education, Ocean University of China, College of Chemistry and Chemical Engineering (China); Qiu, Meng [Qingdao Institute of Bioenergy and Bioprocess Technology (China); Xia, Shuwei; Yu, Liangmin [Key Laboratory of Marine Chemistry Theory and Technology, Ministry of Education, Ocean University of China, College of Chemistry and Chemical Engineering (China)

2017-01-15

Graphical abstract: The optimized structure of hydrated goethite (010) surface with medium water coverage (water density about 6.7 H{sub 2}O/nm{sup 2}). - Highlights: • Stable adsorption and dissociation structure of H{sub 2}O on goethite (010) surface was investigated by DFT. • Reasonable path for water dissociation was proposed by transitional state analysis. • The mechanism of water adsorption on goethite and binding nature were revealed by PDOS. - Abstract: Using density functional theory (DFT) calculation, we investigate the configuration, stability and electronic properties of fresh cleaved (010) goethite surface (Pnma) and this surface exposed to water monolayer at low, medium and high coverage. Water is predicted to be chemisorbed to the surface, together with the surface reconstruction. The interaction energy of the most stable configuration of both low and medium coverage per water molecule is almost the same (−1.17 eV), while that of high coverage is much lower (less than 1.03 eV). It indicates that highly hydrated surface is less stable. PDOS analysis reveals the adsorption of H{sub 2}O is due to the formation of Fe−O bond, caused by overlapping of Fe's 3d and O's 2p orbitals. Dissociation processes at low and medium water coverage are non-spontaneous; while at high coverage, it can undertake spontaneously both thermodynamically and dynamically. The dissociation paths of all three water coverage are the similar. The proton from one adsorbed water is likely to dissociate to bind to the vicinal surface μ{sub 3}−O as an intermediate product; the proton belonged to μ{sub 3}−O transferred to the neighbor surface μ{sub 2}−O as the dissociative configuration.

Waste water treatment in surface mines

Energy Technology Data Exchange (ETDEWEB)

Navasardyants, M A; Esipov, V Z; Ryzhkov, Yu A

1981-01-01

This paper evaluates problems associated with waste water from coal surface mines of the Kemerovougol' association in the Kuzbass. Waste water treatment in the Kuzbass is of major importance as the region is supplied with water from only one river, the Tom river. Water influx to Kemerovougol' surface mines in a year amounts to 136 million m/sup 3/. The water is used during technological processes, for fire fighting, and spraying to prevent dusting; the rest, about 82.1 million m/sup 3/, is discharged into surface waters. Of this amount, 25.1 million m/sup 3/ is heavily polluted water, 46.6 million m3 are polluted but within limits, and 10.4 million m/sup 3/ are characterized as relatively clean. Waste water is polluted with: suspended matters, oils and oil products, nitrates, nitrides and chlorides. Suspended matter content sometimes reaches 4,000 and 5,000 mg/l, and oil product content in water amounts to 2.17 mg/l. Water treatment in surface mines is two-staged: sumps and sedimentation tanks are used. Water with suspended matter content of 50 to 100 mg/l in winter and summer, and 200 to 250 mg/l in spring and autumn is reduced in sumps to 25 to 30 mg/l in summer and winter and to 40 to 50 mg/l in autumn and spring. During the first stage water treatment efficiency ranges from 50 to 80%. During the second stage water is collected in sedimentation tanks. It is noted that so-called secondary pollution is one of the causes of the relatively high level of suspended matter in discharged water. Water discharged from sedimentation tanks carries clay and loam particles from the bottom and walls of water tanks and channels.

Biofilm Composition and Threshold Concentration for Growth of Legionella pneumophila on Surfaces Exposed to Flowing Warm Tap Water without Disinfectant.

Science.gov (United States)

van der Kooij, Dick; Bakker, Geo L; Italiaander, Ronald; Veenendaal, Harm R; Wullings, Bart A

2017-03-01

Legionella pneumophila in potable water installations poses a potential health risk, but quantitative information about its replication in biofilms in relation to water quality is scarce. Therefore, biofilm formation on the surfaces of glass and chlorinated polyvinyl chloride (CPVC) in contact with tap water at 34 to 39°C was investigated under controlled hydraulic conditions in a model system inoculated with biofilm-grown L. pneumophila The biofilm on glass (average steady-state concentration, 23 ± 9 pg ATP cm -2 ) exposed to treated aerobic groundwater (0.3 mg C liter -1 ; 1 μg assimilable organic carbon [AOC] liter -1 ) did not support growth of the organism, which also disappeared from the biofilm on CPVC (49 ± 9 pg ATP cm -2 ) after initial growth. L. pneumophila attained a level of 4.3 log CFU cm -2 in the biofilms on glass (1,055 ± 225 pg ATP cm -2 ) and CPVC (2,755 ± 460 pg ATP cm -2 ) exposed to treated anaerobic groundwater (7.9 mg C liter -1 ; 10 μg AOC liter -1 ). An elevated biofilm concentration and growth of L. pneumophila were also observed with tap water from the laboratory. The Betaproteobacteria Piscinibacter and Methyloversatilis and amoeba-resisting Alphaproteobacteria predominated in the clones and isolates retrieved from the biofilms. In the biofilms, the Legionella colony count correlated significantly with the total cell count (TCC), heterotrophic plate count, ATP concentration, and presence of Vermamoeba vermiformis This amoeba was rarely detected at biofilm concentrations of water-associated disease outbreaks reported in the United States. The organism proliferates in biofilms on surfaces exposed to warm water in engineered freshwater installations. An investigation with a test system supplied with different types of warm drinking water without disinfectant under controlled hydraulic conditions showed that treated aerobic groundwater (0.3 mg liter -1 of organic carbon) induced a low biofilm concentration that supported no or very

Field-deployable, nano-sensing approach for real-time detection of free mercury, speciation and quantification in surface stream waters and groundwater samples at the U.S. Department of Energy contaminated sites

Energy Technology Data Exchange (ETDEWEB)

Campiglia, Andres D. [Univ. of Central Florida, Orlando, FL (United States); Hernandez, Florencio E. [Univ. of Central Florida, Orlando, FL (United States)

2014-08-28

The detrimental effects on human health caused by long-term exposure to trace contamination of toxic metals have been documented in numerous epidemiological and toxicological studies. The fact that metals are non-biodegradable and accumulate in the food chain poses a severe threat to the environment and human health. Their monitoring in drinking water, aquatic ecosystems, food and biological fluids samples is then essential for global sustainability. While research efforts employing established methodology continue to advance conceptual/computational models of contaminant behavior, the increasing awareness and public concern with environmental and occupational exposure to toxic metals calls for sensing devices capable to handle on-site elemental analysis in short analysis time. Field analysis with potable methodology prevents unnecessary scrutiny of un-contaminated samples via laboratory-bound methods, reduces analysis cost and expedites turnaround time for decision making and remediation purposes. Of particular toxicological interest are mercury and its species. Mercury is recognized as a major environmental pollution issue. The field-portable sensor developed in this project provides a unique and valuable tool for the on-site, real-time determination of inorganic mercury in surface waters. The ability to perform on-site analysis of mercury should prove useful in remote locations with difficult accessibility. It should facilitate data collection from statistically meaningful population sizes for a better understanding of the dose-effect role and the water-soil-plant-animal-human transfer mechanisms. The acquired knowledge should benefit the development of efficient environmental remediation processes, which is extremely relevant for a globally sustainable environment.

30 CFR 75.1718-1 - Drinking water; quality.

Science.gov (United States)

2010-07-01

... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Drinking water; quality. 75.1718-1 Section 75... AND HEALTH MANDATORY SAFETY STANDARDS-UNDERGROUND COAL MINES Miscellaneous § 75.1718-1 Drinking water; quality. (a) Potable water provided in accordance with the provisions of § 75.1718 shall meet the...

Indices of quality surface water bodies in the planning of water resources

Directory of Open Access Journals (Sweden)

Rodríguez-Miranda, Juan Pablo

2016-12-01

Full Text Available This paper considers a review of the literature major and significant methods of quality indices of water applied in surface water bodies, used and proposed for assessing the significance of parameters of water quality in the assessment of surface water currents and they are usually used in making decisions for intervention and strategic prevention measures for those responsible for the conservation and preservation of watersheds where these water bodies belong. An exploratory methodology was applied to realize the conceptualization of each water quality index. As a result, it is observed that there are several important methods for determining the water quality index applied in surface water bodies.

Insight into Chemistry on Cloud/Aerosol Water Surfaces.

Science.gov (United States)

Zhong, Jie; Kumar, Manoj; Francisco, Joseph S; Zeng, Xiao Cheng