WorldWideScience

Sample records for nitajana noorsportlaste 9-16

  1. 46 CFR 9.16 - Billing for services.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 1 2010-10-01 2010-10-01 false Billing for services. 9.16 Section 9.16 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY PROCEDURES APPLICABLE TO THE PUBLIC EXTRA COMPENSATION FOR OVERTIME SERVICES § 9.16 Billing for services. Overtime services shall be billed to the steamship companies...

  2. Maternal protein intake in pregnancy and offspring metabolic health at age 9-16 y

    DEFF Research Database (Denmark)

    Maslova, Ekaterina; Hansen, Susanne; Grunnet, Louise Groth

    2017-01-01

    in free-living populations remains limited. Objective: We examined the association of protein intake in pregnancy with offspring metabolic health at age 9-16 y in a longitudinal cohort that oversampled pregnancies with gestational diabetes mellitus (GDM). Design: Six hundred eight women with an index...... provide little support for an association of maternal protein intake in pregnancy with measures of offspring metabolic health. Further studies in larger cohorts are needed to determine whether low maternal protein intake in pregnancy may improve glucose homeostasis in GDM-exposed and male offspring....... pregnancy affected by gestational diabetes mellitus and 626 controls enrolled in the Danish National Birth Cohort were used for the analysis. Protein (total, animal, vegetable) intake was assessed by using a foodfrequency questionnaire in gestational week 25. The offspring underwent a clinical examination...

  3. Reliability and construct validity of Yo-Yo tests in untrained and soccer-trained school-girls aged 9-16

    DEFF Research Database (Denmark)

    Póvoas, Susana C A; Castagna, Carlo; Soares, José Manuel da Costa

    2016-01-01

    Purpose: The reliability and construct validity of three age-adapted-intensity Yo-Yo tests were evaluated in untrained (n=67) vs. soccer-trained (n=65) 9-16-year-old school-girls. Methods: Tests were performed 7 days apart for reliability (9-11-year-old: Yo-Yo intermittent recovery level 1 children...... during test and retest. Conclusion: The Yo-Yo tests are reliable for determining intermittent-exercise capacity and %HRpeak for soccer players and untrained 9-16-year-old girls. They also possess construct validity with better performances for soccer players compared to untrained age-matched girls...

  4. The Sky This Week, 2016 February 9 - 16 - Naval Oceanography Portal

    Science.gov (United States)

    formation with two moons on either side of the planet. On the following night the planet's famous Great Red Aldebaran slip behind the Moon's dark limb shortly before moonset that night. We are now at that time of the nearly three minutes per day. Nevertheless, you still have plenty of darkness to enjoy the bright stars

  5. Proceedings of the 21st DOE/NRC nuclear air cleaning conference; Volume 2, Sessions 9--16

    Energy Technology Data Exchange (ETDEWEB)

    First, M.W. [ed.] [Harvard Univ., Boston, MA (United States). Harvard Air Cleaning Lab.

    1991-02-01

    The 21st meeting of the Department of Energy/Nuclear Regulatory Commission (DOE/NRC) Nuclear Air Cleaning Conference was held in San Diego, CA on August 13--16, 1990. The proceedings have been published as a two volume set. Volume 2 contains sessions covering adsorbents, nuclear codes and standards, modelling, filters, safety, containment venting and a review of nuclear air cleaning programs around the world. Also included is the list of attendees and an index of authors and speakers. (MHB)

  6. Report of the IMFIT Advisory Committee from the Meeting of 9/16/08 at General Atomics

    Energy Technology Data Exchange (ETDEWEB)

    Cohen, R; Cary, J; Houlberg, W; McCune, D

    2008-10-22

    The Committee commends and thanks the presenters and GA for providing clear and informative presentations. We present our responses to 5 questions raised in the Charge, as well as additional comments that may be useful for the project. (Question 1) The IMFIT framework is based on PYTHON and CCA; can IMFIT meet its long-term goals with this choice of language for framework? Our first recommendation is to change the terminology; it appears that the project is not really utilizing CCA (Common Component Architecture). The project is really about using Python to organize workflow among components that are spawned as processes via pipes from Python. We suggest that in describing the project, the team drop the designation 'CCA' and simply state that the IMFIT framework is based on using Python to control workflow among components. Concerning the specific question: we understand the principal goal of the project to be the development of an easy-to-use tool that efficiently integrates different physics modules to support experimental data analysis and modeling. Yes, Python and the workflow-based framework are appropriate choices for meeting this objective. The Committee, in examining the goal, discussed whether the IMFIT project was duplicative of other projects; there are several others in the U.S. and elsewhere with integrated modeling goals. In particular in the U.S., SWIM, PTRANSP, and the proto-FSP's. However this project occupies a reasonably unique niche through its emphases on integrating experimental data, use of existing components, its near-term focus, and the extent to which is targeted at experimentalist users. (Question 2) Will IMFIT benefit from the additional use of an interoperability language for framework such as BABEL? No, IMFIT is not really doing inter-language communication. In particular this will be the case as long as inter-component communication is via files--and that's OK so long as you aren't doing lots of short steps with communication at each step. (Question 3) IMFIT GUI is based on the public PyGTK toolkit; will IMFIT benefit from the additional use of other public Python graphic toolkits such as wxPython that is a cross-platform wrapper, or PyQt, or a commercial package such as IDL? PyGTK seems adequate for now. The team needs to decide if it needs more capability. Avoid licensed software that interferes with portability and the open-source goal (and thus in particular avoid IDL). (Question 4) Will IMFIT benefit from using a XML-RPC as alternative to sending files thru sockets? IMFIT could benefit by adopting some kind of self-describing format, such as XML or HDF5, but data can still be sent over sockets. This is part of a broader question: 'Should IMFIT adopt some kind of standard for communicating data between components?' To do anything other than what is done now requires modification of individual components (or convertors/wrappers). But moving to a self-describing standard is a good idea, which should be considered. You don't need to impose a standard, but you could decide on one and move toward it gradually, as the architecture doesn't impose a standard. But whether you adopt a standard and the pace of moving toward it is up to you. (Question 5) Will IMFIT benefit from any other available computational tool? (a) IMFIT would benefit from fuller use of an already incorporated tool--python language in the task execution specification, to enable desired features like branching; (b) If there is a high degree of data hierarchy, IMFIT should explore HDF5 as well as NETCDF and compare; (c) IMFIT would benefit from moving toward common data standards; (d) It would be useful for the IMFIT team to monitor developments in related projects such as the proto-FSP's and PTRANSP to ascertain if there are potentially useful tools.

  7. Report of the IMFIT Advisory Committee from the Meeting of 9/16/08 at General Atomics

    International Nuclear Information System (INIS)

    Cohen, R.; Cary, J.; Houlberg, W.; McCune, D.

    2008-01-01

    The Committee commends and thanks the presenters and GA for providing clear and informative presentations. We present our responses to 5 questions raised in the Charge, as well as additional comments that may be useful for the project. (Question 1) The IMFIT framework is based on PYTHON and CCA; can IMFIT meet its long-term goals with this choice of language for framework? Our first recommendation is to change the terminology; it appears that the project is not really utilizing CCA (Common Component Architecture). The project is really about using Python to organize workflow among components that are spawned as processes via pipes from Python. We suggest that in describing the project, the team drop the designation 'CCA' and simply state that the IMFIT framework is based on using Python to control workflow among components. Concerning the specific question: we understand the principal goal of the project to be the development of an easy-to-use tool that efficiently integrates different physics modules to support experimental data analysis and modeling. Yes, Python and the workflow-based framework are appropriate choices for meeting this objective. The Committee, in examining the goal, discussed whether the IMFIT project was duplicative of other projects; there are several others in the U.S. and elsewhere with integrated modeling goals. In particular in the U.S., SWIM, PTRANSP, and the proto-FSP's. However this project occupies a reasonably unique niche through its emphases on integrating experimental data, use of existing components, its near-term focus, and the extent to which is targeted at experimentalist users. (Question 2) Will IMFIT benefit from the additional use of an interoperability language for framework such as BABEL? No, IMFIT is not really doing inter-language communication. In particular this will be the case as long as inter-component communication is via files--and that's OK so long as you aren't doing lots of short steps with communication at each step. (Question 3) IMFIT GUI is based on the public PyGTK toolkit; will IMFIT benefit from the additional use of other public Python graphic toolkits such as wxPython that is a cross-platform wrapper, or PyQt, or a commercial package such as IDL? PyGTK seems adequate for now. The team needs to decide if it needs more capability. Avoid licensed software that interferes with portability and the open-source goal (and thus in particular avoid IDL). (Question 4) Will IMFIT benefit from using a XML-RPC as alternative to sending files thru sockets? IMFIT could benefit by adopting some kind of self-describing format, such as XML or HDF5, but data can still be sent over sockets. This is part of a broader question: 'Should IMFIT adopt some kind of standard for communicating data between components?' To do anything other than what is done now requires modification of individual components (or convertors/wrappers). But moving to a self-describing standard is a good idea, which should be considered. You don't need to impose a standard, but you could decide on one and move toward it gradually, as the architecture doesn't impose a standard. But whether you adopt a standard and the pace of moving toward it is up to you. (Question 5) Will IMFIT benefit from any other available computational tool? (a) IMFIT would benefit from fuller use of an already incorporated tool--python language in the task execution specification, to enable desired features like branching; (b) If there is a high degree of data hierarchy, IMFIT should explore HDF5 as well as NETCDF and compare; (c) IMFIT would benefit from moving toward common data standards; (d) It would be useful for the IMFIT team to monitor developments in related projects such as the proto-FSP's and PTRANSP to ascertain if there are potentially useful tools

  8. Maternal protein intake in pregnancy and offspring metabolic health at age 9-16 y: results from a Danish cohort of gestational diabetes mellitus pregnancies and controls

    DEFF Research Database (Denmark)

    Maslova, Ekaterina; Hansen, Susanne; Grunnet, Louise Groth

    2017-01-01

    % +/- 3% of energy) in GDM-exposed women and 90 +/- 14 g/d (16% +/- 2% of energy) in control women. There were overall no associations between maternal protein intake and offspring fasting insulin and homeostasis model assessment of insulin resistance (HOMA-IR). We found that maternal total protein intake.......04) and a tendency toward lower HOMA-IR (ratio of geometric means: 0.82; 95% CI: 0.66, 1.02; P = 0.07), but there was no evidence of associations with body composition. Male offspring seemed to derive a similar benefit from a maternal low protein intake as did GDM-exposed offspring.Conclusions: Overall, our results...

  9. Supplement Analysis for the Transmission System Vegetation Management Program FEIS (DOE/EIS-0285/SA-124 (Echo Lake-Maple Valley #1 [Mile 9-16], Adno 8258)

    Energy Technology Data Exchange (ETDEWEB)

    Shurtliff, Aaron [Bonneville Power Administration (BPA), Portland, OR (United States)

    2003-02-18

    Vegetation Management for portion of the Echo Lake – Maple Valley #1 500 kV transmission line located from tower structure 9/2 to 16/5. BPA proposes to clear targeted vegetation within the Right-of-Ways along access roads and around towers that may impede the operation and maintenance of the subject transmission lines. See Section 1.4 of the attached checklists for a complete description of the proposed action.

  10. 3,6,9,16,19,22-Hexaazatricyclo[22.2.2.211,14]triaconta-1(27,11 (30,12,14(29,24(28,25-hexaene hexakis(p-toluenesulfonate dihydrate

    Directory of Open Access Journals (Sweden)

    Musabbir A. Saeed

    2009-10-01

    Full Text Available In the title compound, C24H44N66+·6C7H7O3S−·2H2O, the macrocycle crystallizes in its hexaprotonated form, accompanied by six p-toluenesulfonate ions and two water molecules, and lies on an inversion center. The three independent p-toluenesulfonate anions and their inversion equivalents at (1 − x, 1 − y, 1 − z are linked to the macrocyclic cation through N—H...O hydrogen bonds. Of these, two p-toluenesulfonate ions are located on opposite sides of the macrocyclic plane and are linked to bridgehead N atoms via N—H...O hydrogen bonds. The remaining four p-toluenesulfonate ions bridge two adjacent macrocyclic cationic units through N—H...O hydrogen bonding involving other N atoms, forming a chain along the a axis. The water molecules, which could not be located and may be disordered, do not interact with the macrocycle; however, they form hydrogen bonds with anions.

  11. Report from the Rockefellar Foundation Sponsored International Workshop on reducing mortality and improving quality of life in long-term survivors of Hodgkin's disease: July 9-16, 2003, Bellagio, Italy

    DEFF Research Database (Denmark)

    Mauch, Peter; Ng, Andrea; Aleman, Berthe

    2005-01-01

    A workshop, sponsored by the Rockefellar Foundation, was held between 9 to 16 July, 2003 to devise strategies to reduce mortality and improve quality of life of long-term survivors of Hodgkin's disease. Participants were selected for their clinical and research background on late effects after Ho...

  12. 4,5,7,8,17-Pentahydroxy-14,18-dimethyl-6-methylene-3,10-dioxapentacyclo[9.8.0.01,7.04,19.013,18]nonadec-14-ene-9,16-dione methanol solvate dihydrate

    Directory of Open Access Journals (Sweden)

    Chin Hoe Teh

    2009-04-01

    Full Text Available The title quassinoid compound, C20H24O9·CH3OH·2H2O, is a natural eurycomanone isolated from the roots of Eurycoma longifolia. The molecules contain a fused five-ring system, with one tetrahydrofuran ring adopting an envelope conformation, one tetrahydropyran-2-one ring in a screw boat conformation, one cyclohexenone ring in a half-chair conformation and two cyclohexane rings in chair conformations. Intramolecular C—H...O interactions generate S(5 ring motifs and an O—H...O interaction generates an S(7 ring motif. In the crystal, molecules are linked via intermolecular O—H...O interactions along the b axis and further stacked along a axis. The absolute configuration of the title compound was inferred from previously solved structures of its analogues.

  13. Physical activity attenuates the mid-adolescent peak in insulin resistance but by late adolescence the effect is lost: a longitudinal study with annual measures from 9-16 years (EarlyBird 66).

    Science.gov (United States)

    Metcalf, Brad S; Hosking, Joanne; Henley, William E; Jeffery, Alison N; Mostazir, Mohammod; Voss, Linda D; Wilkin, Terence J

    2015-12-01

    The aim of this work was to test whether the mid-adolescent peak in insulin resistance (IR) and trends in other metabolic markers are influenced by long-term exposure to physical activity. Physical activity (7 day ActiGraph accelerometry), HOMA-IR and other metabolic markers (glucose, fasting insulin, HbA1c, lipids and BP) were measured annually from age 9 years to 16 years in 300 children (151 boys) from the EarlyBird study in Plymouth, UK. The activity level of each child was characterised, with 95% reliability, by averaging their eight annual physical activity measures. Age-related trends in IR and metabolic health were analysed by multi-level modelling, with physical activity as the exposure measure (categorical and continuous) and body fat percentage (assessed by dual-energy X-ray absorptiometry) and pubertal status (according to age at peak height velocity and Tanner stage) as covariates. The peak in IR at age 12-13 years was 17% lower (p adolescents independently of body fat percentage and pubertal status. However, this difference diminished progressively over the next 3 years and had disappeared completely by the age of 16 years (e.g. difference was -14% at 14 years, -8% at 15 years and +1% at 16 years; 'physical activity × age(2), interaction, p adolescence in the more active group. Our finding that physical activity attenuates IR during mid-adolescence may be clinically important. It remains to be established whether the temporary attenuation in IR during this period has implications for the development of diabetes in adolescence and for future metabolic health generally.

  14. CCDC 875408: Experimental Crystal Structure Determination : [(1,9-dimethyl-1,3a,9,16c-tetrahydrodibenzo[de,op]pentacene-7,15-diyl)diethyne-2,1-diyl]bis[tri(propan-2-yl)silane

    KAUST Repository

    Li, Yuan; Heng, Wee-Kuan; Lee, Byung Sun; Aratani, N.; Zafra, J.L.; Bao, N.; Lee, R.; Sung, Young Mo; Sun, Zhe; Huang, Kuo-Wei; Webster, R.D.; Navarrete, J.T.L.; Kim, Dongho; Osuka, A.; Casado, J.; Ding, Jun; Wu, Jishan

    2013-01-01

    An entry from the Cambridge Structural Database, the world’s repository for small molecule crystal structures. The entry contains experimental data from a crystal diffraction study. The deposited dataset for this entry is freely available from the CCDC and typically includes 3D coordinates, cell parameters, space group, experimental conditions and quality measures.

  15. Tools Related to the Federal Tobacco Products Regulations: What Retailers Need to Know PSA (:30)

    Centers for Disease Control (CDC) Podcasts

    2010-09-16

    PSA to announce a new mobile text message program that will help raise retailers' awareness of the new federal tobacco regulations.  Created: 9/16/2010 by The CDC Division of News and Electronic Media and the FDA Center for Tobacco Products.   Date Released: 9/16/2010.

  16. Recognizing and Preventing Whooping Cough 2 (Pertussis)

    Centers for Disease Control (CDC) Podcasts

    2010-09-16

    This podcast encourages everyone to get vaccinated against whooping cough (pertussis), especially those who will have close contact with an infant.  Created: 9/16/2010 by National Center for Immunization and Respiratory Diseases (NCIRD).   Date Released: 9/16/2010.

  17. Epidermis structure and blood parameter differences between sculpin Cottus gobio and Siberian sculpin Cottus poecilopus from the Morava watershed

    Czech Academy of Sciences Publication Activity Database

    Halačka, Karel; Vítek, T.; Vetešník, Lukáš; Spurný, P.

    2012-01-01

    Roč. 61, č. 1 (2012), s. 9-16 ISSN 0139-7893 Institutional support: RVO:68081766 Keywords : goblet cell * sacciform cell * erythrocyte * leucocyte Subject RIV: EG - Zoology Impact factor: 0.494, year: 2012

  18. President Ilves kohtus Ameerika Ühendriikide presidendi Barack Obamaga

    Index Scriptorium Estoniae

    2009-01-01

    President Toomas Hendrik Ilves kohtus 15. juunil 2009 Washingtonis USA presidendi Barack Obama ja tema julgeolekunõuniku James Jonesiga. Vabariigi President töövisiidil Ameerika Ühendriikides 9.-16.06.2009

  19. Eesti õpetajate roll laste internetikasutuse sotsiaalses vahendamises / Kadri Soo, Veronika Kalmus, Mare Ainsaar

    Index Scriptorium Estoniae

    Soo, Kadri

    2015-01-01

    Artiklis käsitletakse õpetajate rolli laste ettevalmistamisel internetimaailma ohtudega toimetulekuks ning analüüsitakse Eesti õpetajate tegevust 9-16aastaste laste internetikasutuse sotsiaalses vahendamises

  20. Rok klasiků a neskutečných událostí

    Czech Academy of Sciences Publication Activity Database

    Janáček, Pavel; Král, P.; Jareš, Michal; Kanda, Roman; Fialová, Alena; Segi, Stefan (ed.); Chrobák, J.; Chuchma, J.

    2014-01-01

    Roč. 30, č. 1 (2014), s. 9-16 ISSN 1211-9938 Institutional support: RVO:68378068 Keywords : Czech literature * Czech prose * Czech poetry * discussions Subject RIV: AJ - Letters, Mass-media, Audiovision

  1. Minut maksab! : 1.- 40 : [humoreskid] / Lembit Sibul

    Index Scriptorium Estoniae

    Sibul, Lembit

    1997-01-01

    Järg: 14., 21. ja 28. nov. ; 5., 12. ja 19. dets. 1998. a.: 1., 9., 16., 23. ja 30. jaan. ; 6. ja 20. veebr. ; 6. ja 20. märts ; 9., 24. ja 30. apr.; 29. mai ; 12. juuni ; 10. ja 17. juuli; 14., 21. ja 28. aug.; 11., 18. ja 25. sept. ; 9., 16., 23. ja 30. okt. ; 6., 13., 20. ja 27. nov.; 11. ja 24. dets

  2. Bioinformatic Tools for Metagenomic Analysis of Pathogen Backgrounds and Human Microbial Communities

    Science.gov (United States)

    2010-05-01

    CCAAAGCCGGTGGCCTAACCTTCGGGGAGGAGCCGTCTAAGGCAGGACAGATGACTGGGGTGAAGTCGTA ACAAG >gi|219857564|ref|NR_025152.1| Nocardiopsis composta strain KS9 16S...Fructobacillus ficulneus strain FS-1 16S ribosomal RNA, partial sequence 2250718 2252192 gi|219857564|ref|NR_025152.1| Nocardiopsis composta strain...Bacteria_16S 2253094 2253187 1 94 gi|219857564|ref|NR_025152.1| Nocardiopsis composta strain KS9 16S ribosomal RNA, partial sequence 2252243 2253696

  3. Ümbreilma reisikirä / Kaido Kama

    Index Scriptorium Estoniae

    Kama, Kaido, 1957-

    1999-01-01

    Jahtlaeva "Lennuk" ümbermaailmareisist. Järgneb 9.,16. nov., 2.,14.,30. dets. ; 2000, 13. jaan., 3.,10. veebr., 9.,16.. märts, 13.,27. apr., 25. mai, 22.,29. juuni, 6. juuli, 24. aug., 1.,28. sept., 12.,26. okt., 2.,23. nov., 7. dets ; 2001, 4.,9.,25. jaan., 15. veebr., 6.,13.,22., märts

  4. 76 FR 59676 - Combined Notice of Filings #1

    Science.gov (United States)

    2011-09-27

    ... MBR Tariff to be effective 10/1/2011. Filed Date: 09/16/2011. Accession Number: 20110916-5146. Comment... 35.1: ONEOK Energy Services Company Baseline MBR Filing to be effective 9/16/2011. Filed Date: 09/16... Services Order No. 697 Compliance Filing of MBR Tariff to be effective 9/16/2011. Filed Date: 09/16/2011...

  5. Tundmatu Venemaa kosmonautika / Jüri Liim

    Index Scriptorium Estoniae

    Liim, Jüri

    2001-01-01

    Järgneb 7.,14. aug., 4.,18.,25. sept., 2.,23.,30. okt., 6.,13.,20. nov., 4.,11.,18. dets. ; 2002, 22.,29. jaan., 5.,12.,19.,26. veeb., 12.,19. märts ; 2.,9.,16.,23. aprill ; 7.,14.,21.,28. mai ; 4.,11.,18. juuni ; 2.,9.,16.,23.,30. juuli ; 6.,13.,27. aug., 3.,10.,17.,24. sept., 1.,8.,15.,22.,29. okt., 5.,12.,19.,26. nov., 3.,10.,17. dets. ; 2003, 7.14.,21.,28. jaan., 4.,11. veebr., 4.,11.,18. märts, 1.,8.,22.,30. apr., 6.,13.,20.,27. mai, 3.,10.,17. juuni, 1.,15.,22.,29. juuli, 5.,12.,26. aug., 2.,9.,16. sept.

  6. Kilde Hiiumaa maleajaloost / Volli Mäeumbaed

    Index Scriptorium Estoniae

    Mäeumbaed, Volli

    1999-01-01

    Järgneb 19.,26. nov., 3.,10.,17.,24.,31. dets. ; 2000, 7.,14.,21.,28. jaan, 4.,11.,18.,26. veebr., 3.,10.,17.,24.,31. märts, 7.,14.,20.,28. apr., 5.,12.,19.,26. mai, 2.,9.,16.,22. juuni, 28. juuli, 4.,11.,25. aug., 1.,8.,15.,22. sept., 20.,27. okt.,3., 10.,17.,24. nov., 1.,8.,15.,22.,29.dets. ; 2001, 19.,26. jaan., 2.,9.,16.,23. veebr., 2.,9.,16.,23.,30. märts, 6.,12.,20.,27. apr., 4.,11. mai

  7. Eesti Vabariigi ametiühingud : ajalooline ülevaade (1918-1940) / Lembit Kiik

    Index Scriptorium Estoniae

    Kiik, Lembit

    1995-01-01

    Järgneb 11.,26. jaan., 9.,16.,23. veebr., 9.,23.,30. märts, 13. apr., 4. mai, 1.,8.,15.,22.,29. juuni, 3.,10.,17.,24.,31. aug., 7.,21.,28. sept., 5.,12.,19.,26. okt., 9.,16.,23.,30. nov., 7. dets. ; 1996, 18.,25. jaan., 1.,8.,22.,29. veebr., 14.,21..,28. märts, 4.,11.,18. apr., 30. mai, 13. juuni, 15.,22.,29. aug., 5.,12.,19.,26. sept., 4.,10.,31. okt., 7.,14.,2. nov.

  8. Akibat Hukum Bagi Bank Bila Kewajiban Modal Inti Minimum Tidak Terpenuhi

    Directory of Open Access Journals (Sweden)

    Indira Retno Aryatie

    2012-02-01

    Full Text Available As an implementation of the Indonesian Banking Architecture policy, the government issues Bank Indonesia Regulation No. 9/16/ PBI/2007 on Minimum Tier One Capital that increases the minimum capital to 100 billion rupiah. This writing discusses the legal complication that a bank will face should it fail to fulfil the minimum ratio. Sebagai tindak lanjut dari kebijakan Arsitektur Perbankan Indonesia, pemerintah mengeluarkan Peraturan Bank Indonesia 9/16/PBI/2007 tentang Kewajiban Modal Inti Minimum Bank yang menaikkan modal inti minimum bank umum menjadi 100 miliar rupiah. Tulisan ini membahas akibat hukum yang akan dialami bank bila kewajiban modal minimum tersebut gagal dipenuhi.

  9. Age-dependent differences in cytokine and antibody responses after experimental RSV infection in a bovine model

    DEFF Research Database (Denmark)

    Grell, S.N.; Riber, Ulla; Tjørnehøj, Kirsten

    2005-01-01

    Respiratory syncytial virus (RSV) causes severe respiratory disease in both infants and calves. As in humans, bovine RSV (BRSV) infections are most severe in the first 6 months of life. In this study, experimental infection with BRSV was performed in calves aged 1-5, 9-16 or 32-37 weeks. Compared...

  10. Nigerian Journal of Gastroenterology and Hepatology - Vol 4, No 1 ...

    African Journals Online (AJOL)

    Management of Liver Metastasis from Colo-Rectal Carcinoma with Laparoscopy: A Literature Review · EMAIL FULL TEXT EMAIL FULL TEXT DOWNLOAD FULL TEXT DOWNLOAD FULL TEXT. E Ray-Offor, EF Alufohai, AB Allison, 9-16. Helicobacter Pylori: Serological Testing and Treatment in Uninvestigated Dyspepsia: ...

  11. Summertime blues

    Index Scriptorium Estoniae

    2009-01-01

    USA presidendi Barack Obama plaaniväline kohtumine president Toomas Hendrik Ilvesega 15. juunil 2009 Washingtonis oli kodeeritud sõnum Moskvale, et Ameerika toetus NATO idapiiril olevatele riikidele on vankumatu. Eesti riigipead nimetatakse artiklis Ameerika lemmikuks Ida-Euroopa poliitikute seas. Vabariigi President töövisiidil Ameerika Ühendriikides 9.-16.06.2009

  12. Degradation of organophosphorus pesticide parathion methyl on nanostructured titania-iron mixed oxides

    Czech Academy of Sciences Publication Activity Database

    Henych, Jiří; Štengl, Václav; Slušná, Michaela; Matys Grygar, Tomáš; Janoš, P.; Kuráň, P.; Šťastný, M.

    2015-01-01

    Roč. 344, JUL (2015), s. 9-16 ISSN 0169-4332 R&D Projects: GA ČR(CZ) GAP106/12/1116 Institutional support: RVO:61388980 Keywords : Titania-iron oxides * Homogeneous hydrolysis * Degradation of organophosphates * Parathion methyl Subject RIV: CA - Inorganic Chemistry Impact factor: 3.150, year: 2015

  13. 78 FR 72931 - Sunshine Act Meeting Notice

    Science.gov (United States)

    2013-12-04

    ... 2, 9, 16, 23, 30, 2013, January 6, 2014. PLACE: Commissioners' Conference Room, 11555 Rockville Pike, Rockville, Maryland. STATUS: Public and Closed. Week of December 2, 2013 There are no meetings scheduled for... Dry Casks (Public Meeting) (Contact: Kevin Witt, 301-415-2145). This meeting will be webcast live at...

  14. 77 FR 18271 - Notice of Sunshine Act Meeting

    Science.gov (United States)

    2012-03-27

    ... 26, April 2, 9, 16, 23, 30, 2012. PLACE: Commissioners' Conference Room, 11555 Rockville Pike, Rockville, Maryland. STATUS: Public and Closed. Week of March 26, 2012 Tuesday, March 27, 2012 8:55 a.m... meeting will be webcast live at the Web address--www.nrc.gov. 9 a.m. Briefing on License Renewal for...

  15. Assessment of the stability of a surface crack in laminates

    Czech Academy of Sciences Publication Activity Database

    Hutař, Pavel; Ševčík, Martin; Náhlík, Luboš; Zouhar, Michal; Knésl, Zdeněk

    2014-01-01

    Roč. 50, č. 1 (2014), s. 9-16 ISSN 0191-5665 R&D Projects: GA ČR(CZ) GAP108/12/1560 Institutional support: RVO:68081723 Keywords : periodically layered composite * interface crack * generalized stress intensity factor * fracture mechanics of interface Subject RIV: JL - Materials Fatigue, Friction Mechanics Impact factor: 0.473, year: 2014

  16. Ecological observations of major Salicornia beds from highly saline coastal wetlands of India

    Digital Repository Service at National Institute of Oceanography (India)

    Jagtap, T.G.; Bhosale, S.H.; Nagle, V.L.

    along the Tamilnadu coast due to greater (0.83-7.2 m) tidal amplitude and flat topography. The sediments from beds of the Gulf of Kutchchh were rich (4.9-16.9% dry weight) in organic matter. The salt content in the sediments from Tamilnadu was relatively...

  17. 76 FR 57982 - Building Energy Codes Cost Analysis

    Science.gov (United States)

    2011-09-19

    ... DEPARTMENT OF ENERGY Office of Energy Efficiency and Renewable Energy [Docket No. EERE-2011-BT-BC-0046] Building Energy Codes Cost Analysis Correction In notice document 2011-23236 beginning on page...-23236 Filed 9-16-11; 8:45 am] BILLING CODE 1505-01-P ...

  18. Eluviisi mõjust haigusele / Lilian Hankewitz

    Index Scriptorium Estoniae

    Hankewitz, Lilian

    2004-01-01

    Raamatu "Vähi vastu aitab see, kui me ei anna talle võimalust tekkidagi" autorid meditsiinidoktor Hari Sharma, ayurveda arst Rama Mishra ja dr. James Meade'i annavad nõu haigusvaenuliku pinnase loomises ja inimese organismi tugevdamises. Järgneb 19.,26. okt., 2., 9.,16.,23.,30. nov., 7.,14.,21. dets.

  19. Single-flavor color superconductivity with color-sextet pairing

    Czech Academy of Sciences Publication Activity Database

    Brauner, Tomáš

    2005-01-01

    Roč. 55, č. 1 (2005), s. 9-16 ISSN 0011-4626 R&D Projects: GA ČR(CZ) GA202/02/0847 Keywords : color superconductivity * spontaneous symmetry breaking Subject RIV: BE - Theoretical Physics Impact factor: 0.360, year: 2005

  20. 77 FR 59554 - Approval and Promulgation of Implementation Plans; Georgia; Control Techniques Guidelines and...

    Science.gov (United States)

    2012-09-28

    ... Emissions from 9/16/1992 9/28/2012 [Insert citation of Wire Coating. publication]. * * * * * * * 391-3-1-.02... [Insert citation of Fuel Burning publication]. Equipment. * * * * * * * 391-3-1-.02(2)(rrr) NOX Emissions from 4/12/2009 9/28/2012 [Insert citation of Small Fuel-Burning publication]. Equipment...

  1. 75 FR 57027 - National Toxicology Program (NTP); NTP Interagency Center for the Evaluation of Alternative...

    Science.gov (United States)

    2010-09-17

    ... DEPARTMENT OF HEALTH AND HUMAN SERVICES National Toxicology Program (NTP); NTP Interagency Center for the Evaluation of Alternative Toxicological Methods (NICEATM); Availability of Interagency..., Associate Director, National Toxicology Program. [FR Doc. 2010-23262 Filed 9-16-10; 8:45 am] BILLING CODE...

  2. A Pilot Study: The Effect of Singing and Non-Singing--Instructional Strategies on Harmonic Listening Skills

    Science.gov (United States)

    Gonzales, Cynthia I.; Brinckmeyer, Lynn; Beckman, Amy A.

    2012-01-01

    The purpose of this investigation is to examine the effects of singing and non-singing experiences when students develop harmonic listening skills. Participants were children and adolescents who participate in a community youth choir (N = 21). Ages ranged from 9-16 years. The subjects were organized into four separate groups. All subjects attended…

  3. Low-Cost In-Fill Installation for High-Energy-Saving, Dynamic Windows

    Science.gov (United States)

    2017-07-01

    increase 2% annually. This is consistent with national recognized energy prediction models. Electrical Labor costs: Electrical labor cost for wiring...Technology Description: ................................................................................................ 3 2.1.2 Energy Consumption ...22 Figure 15. Energy Consumption for the Calibration Period of 9/2/2015 - 9/16/2015

  4. Místní klimatické zóny a jejich význam ve městech České republiky

    Czech Academy of Sciences Publication Activity Database

    Lehnert, M.; Geletič, Jan

    2017-01-01

    Roč. 20, č. 2 (2017), s. 9-16 ISSN 1212-0855 Institutional support: RVO:86652079 Keywords : local climate zones * air temperature * urban heat island Subject RIV: DG - Athmosphere Sciences, Meteorology OBOR OECD: Climatic research http://www.uur.cz/images/5-publikacni-cinnost-a-knihovna/casopis/2017/2017-02/04-mistni.pdf

  5. Estonia President, Obama Discuss Cybersecurity / Eric Chabrow

    Index Scriptorium Estoniae

    Chabrow, Eric

    2009-01-01

    President Toomas Hendrik Ilves kohtus 15. juunil 2009 Washingtonis USA presidendi Barack Obamaga. Riigipead arutasid küberkaitse küsimusi. Eesti president avaldas Ühendriikidele tänu abi eest küberkaitsekeskuse loomisel Tallinnasse. Vabariigi President töövisiidil Ameerika Ühendriikides 9.-16.06.2009

  6. The effects of tree species and substrate on carbon sequestration and chemical and biological properties in reforested post-mining soils

    Czech Academy of Sciences Publication Activity Database

    Józefowska, A.; Pietrzykowski, M.; Woś, B.; Cajthaml, T.; Frouz, Jan

    2017-01-01

    Roč. 292, April (2017), s. 9-16 ISSN 0016-7061 Institutional support: RVO:60077344 Keywords : post mining soil * PLFA * bioturbation * C:N ratio * carbon stock * nitrogen stock Subject RIV: DF - Soil Science OBOR OECD: Soil science Impact factor: 4.036, year: 2016

  7. Air Force Health Study Summary of Findings in the Ranch Hand Group

    Science.gov (United States)

    2007-09-01

    16-9 16.9.7. Somatization ...neurasthenia, hypochondriasis , other neurotic disorders, and unspecified neurotic disorders Personality disorders Sexual deviations and disorders... somatic correlates of anxiety also were included as dimensional components. The symptoms comprising the anxiety dimension were experiencing

  8. Experiments on rocks under high pressure conditions in GTA 20-32 triaxial press

    Czech Academy of Sciences Publication Activity Database

    Poláček, J.; Kožušníková, Alena

    2012-01-01

    Roč. 58, č. 1 (2012), s. 9-16 ISSN 1802-5420 Institutional support: RVO:68145535 Keywords : triaxial stress * deformation * rocks Subject RIV: DH - Mining, incl. Coal Mining http://gse.vsb.cz/2012/LVIII-2012-1-09-16.pdf

  9. Selective activation around the left occipito-temporal sulcus for words relative to pictures: Individual variability or false positives?

    NARCIS (Netherlands)

    Wright, Nicholas D.; Mechelli, Andrea; Noppeney, Uta; Veltman, Dick J.; Rombouts, Serge A. R. B.; Glensman, Janice; Haynes, John-Dylan; Price, Cathy J.

    2008-01-01

    We used high-resolution fMRI to investigate claims that learning to read r !sults in greater left occipito-temporal (OT) activation for written words relative to pictures of objects. In tl e first experiment, 9/16 subjects performing a one-back task showed activation in >= 1 left OT voxel for word:

  10. 76 FR 69723 - Certain New Chemicals; Receipt and Status Information

    Science.gov (United States)

    2011-11-09

    ... marketing exemption (TME), and to publish in the Federal Register periodic status reports on the new... marketing'' purposes, which is referred to as a test marketing exemption, or TME. For more information about...-11-0640 9/16/2011 12/14/2011 CBI (G) Adhesive and (G) Short fusion cleaning partner protein...

  11. Precipitation conditions at the mountain study site of Bílý Kříž (the Beskids Mts.) during the past 20 years

    Czech Academy of Sciences Publication Activity Database

    Marková, I.; Janouš, Dalibor; Holata, Filip

    2017-01-01

    Roč. 10, 1-2 (2017), s. 9-16 ISSN 1803-2451 R&D Projects: GA MŠk(CZ) LO1415 Institutional support: RVO:86652079 Keywords : annual precipitation sum * precipitation intensity * drought period * Lang’s rain factor * standardized precipitation index Subject RIV: EH - Ecology, Behaviour OBOR OECD: Environmental sciences (social aspects to be 5.7)

  12. Armastuse feng shui / Peeter Rüberg

    Index Scriptorium Estoniae

    Rüberg, Peeter

    2000-01-01

    Järg Jan/13;20;27/Feb/3;10;17;23/Mar/2;9;16 ;30/Apr/13/May/4;11 lk. 22;38;56;70;87;102;118;134;150;166;198;230;278 ;296Vanal hiina kodu- ja elukunstil on igaks armuelu juhtumiks varuks praktilisi nõuandeid ja võtteid

  13. Application of Markovian model to school enrolment projection ...

    African Journals Online (AJOL)

    Application of Markovian model to school enrolment projection process. VU Ekhosuehi, AA Osagiede. Abstract. No Abstract. Global Journal of Mathematical Sciences Vol. 5(1) 2006: 9-16. Full Text: EMAIL FREE FULL TEXT EMAIL FREE FULL TEXT · DOWNLOAD FULL TEXT DOWNLOAD FULL TEXT.

  14. Dolores Hoffmann pani Türi kiriku aknad särama / Marge Laagemann

    Index Scriptorium Estoniae

    Laagemann, Marge

    2005-01-01

    vitraažikunstnik räägib Türi kiriku vitraažidest, oma teekonnast vitraažide juurde, vitraažide valmistamisest, nende tekkest, ajaloost ning mõjust. Järgneb 2005. 9. dets., lk. 9, 16. dets., lk. 7, 23. dets., lk. 11 ja 30. dets., lk. 7

  15. Effects of Cognitive-Behavioral Therapy on Anxiety in Children with Autism Spectrum Disorders: A Randomized Controlled Trial

    Science.gov (United States)

    Sung, Min; Ooi, Yoon Phaik; Goh, Tze Jui; Pathy, Pavarthy; Fung, Daniel S. S.; Ang, Rebecca P.; Chua, Alina; Lam, Chee Meng

    2011-01-01

    We compared the effects of a 16-week Cognitive-Behavioral Therapy (CBT) program and a Social Recreational (SR) program on anxiety in children with Autism Spectrum Disorders (ASD). Seventy children (9-16 years old) were randomly assigned to either of the programs (n CBT = 36; n SR = 34). Measures on child's anxiety using the Spence Child Anxiety…

  16. Light Use Efficiency of Aboveground Biomass Production of Norway Spruce Stands

    Czech Academy of Sciences Publication Activity Database

    Bellan, Michal; Marková, I.; Zaika, A.; Krejza, Jan

    2017-01-01

    Roč. 65, č. 1 (2017), s. 9-16 ISSN 1211-8516 R&D Projects: GA TA ČR TA02010945 Institutional support: RVO:67179843 Keywords : absorbed photosynthetically active radiation * aboveground biomass increment * allometric relation Subject RIV: GC - Agronomy OBOR OECD: Agronomy, plant breeding and plant protection

  17. Detection of Energetic Materials by Laser Photofragmentation/Fragment Detection and Pyrolysis/Laser-Induced Fluorescence

    Science.gov (United States)

    2001-02-01

    Nitrate Esters at Various Pressures." Combustion and Flame, vol. 66, no. 9, pp. 9-16, 1986. 25. Ng, W. L., J. E. Field, and H. M. Hauser . "Study of...DARPA B KASPAR 3701 N FAIRFAX DR ARLINGTON VA 22203-1714 US MILITARY ACADEMY MATH SCI CTR OF EXCELLENCE MADN MATH MAJ HUBER THAYER HALL WEST POINT NY

  18. 3D Analysis of Coupled Quasi-Stationary Electromagnetic and Non-Stationary Temperature Fields in Non-Magnetic Inductively Heated Charge

    Czech Academy of Sciences Publication Activity Database

    Barglik, J.; Doležel, Ivo; Šolín, Pavel; Ulrych, B.

    2001-01-01

    Roč. 97, č. 885 (2001), s. 9-16 ISSN 0072-4688 R&D Projects: GA ČR GA102/01/0184; GA MŠk ME 448 Grant - others:-(PL) 7T08603716 Keywords : induction heating * numerical analysis * integral model Subject RIV: JA - Electronics ; Optoelectronics, Electrical Engineering

  19. Two-dimensional zeolites: Adsorption of carbon dioxide on pristine materials and on materials modified by magnesium oxide

    Czech Academy of Sciences Publication Activity Database

    Zukal, Arnošt; Kubů, Martin; Pastva, Jakub

    2017-01-01

    Roč. 21, OCT 2017 (2017), s. 9-16 ISSN 2212-9820 R&D Projects: GA ČR(CZ) GAP106/12/0189 Institutional support: RVO:61388955 Keywords : Carbon dioxide adsorption * Two-dimensional zeolites * Magnesium oxide incorporation Subject RIV: CF - Physical ; Theoretical Chemistry OBOR OECD: Physical chemistry Impact factor: 4.292, year: 2016

  20. 76 FR 39963 - Order Pursuant to Section 36 of the Securities Exchange Act of 1934 Granting Temporary Exemptions...

    Science.gov (United States)

    2011-07-07

    ... Exchange Act Release No. 64017, supra note 9. \\16\\ The Commission stresses that the functions highlighted... SECURITIES AND EXCHANGE COMMISSION [Release No. 34-64796; File No. S7-28-11] Order Pursuant to...- counter (``OTC'') market are centrally cleared.\\4\\ One of the key ways in which the Dodd-Frank Act seeks...

  1. Polyvalent horse F(Ab`)2 snake antivenom: Development of process ...

    African Journals Online (AJOL)

    USER

    2010-04-19

    Apr 19, 2010 ... African Journal of Biotechnology Vol. 9 (16), pp. ... filtered through a 30 kDa ultrafiltration membrane. F(ab´)2 .... was added to the plasma pool obtained from the horses immunized with whole ..... revision of the manuscript.

  2. 30 CFR 931.15 - Approval of New Mexico regulatory program amendments.

    Science.gov (United States)

    2010-07-01

    ..., 1990 CSMC 80-1-1-5, definitions of “affected area,” “self-bond”; 80-1-8-20; 80-1-9-16; 80-1-14-23(d)(2..., and C, concerning verification of ownership or control application information; NMAC, sections 19.8.11...

  3. Euroopa perekonna laienemine / Tommaso Padoa-Shioppa

    Index Scriptorium Estoniae

    Padoa-Shioppa, Tommaso

    2004-01-01

    Ilmunud ka: Kroon & Economy, 2004, nr. 2, lk. 9-16. Autor arutleb Eesti väljavaadete üle EL-i ning tulevikus Euroopa Rahaliidu liikmesriigina. Euroopa Keskpanga juhatuse liikme Tommaso Padoa-Schioppa kõne Eesti Panga eurokonverentsil 3. mail 2004

  4. Mooste näitemängu lugu läbi aastate 1. - 28. / Karl Pilvistu

    Index Scriptorium Estoniae

    Pilvistu, Karl

    1998-01-01

    Alates 24. sept. pealkiri 'Mooste külateatri lugu läbi aastate'. Järg: 30. apr. ; 7., 14., 21. ja 28. mai ; 6., 11., 18. ja 27. juuni ; 2., 9., 16. ja 25. juuli ; 6. ja 15. aug. ; 10., 24. ja 26. sept. ; 10., 15., 17. ja 29. okt. ; 5., 12. nov. ; 3., 10., 12. dets.

  5. President Ilves töövisiidil USAs

    Index Scriptorium Estoniae

    2009-01-01

    President Toomas Hendrik Ilves alustas töövisiiti USA läänerannikul, teadus- ja kõrgtehnoloogia keskuses Silicon Valley's. Riigipea kohtus ka San Francisco linnapea Gavin Newsom'iga ja Stanfordi Ülikooli rektori John L. Hennessy'ga. Vabariigi President töövisiidil Ameerika Ühendriikides 9.-16.06.2009

  6. President Ilves : Eesti ja maailma kõrgtehnoloogia firmade koostööl on tulevikku / Kaidi Aher

    Index Scriptorium Estoniae

    Aher, Kaidi

    2009-01-01

    President Toomas Hendrik Ilvese külaskäigust teadus- ja kõrgtehnoloogia keskusesse Silicon Valley'sse ning kohtumisest Stanfordi Ülikooli rektori John L. Hennessy'ga. Vabariigi President töövisiidil Ameerika Ühendriikides 9.-16.06.2009

  7. Water SA - Vol 31, No 1 (2005)

    African Journals Online (AJOL)

    Water value, resource rent recovery and economic welfare cost of environmental protection: A water-sector model for the Steelpoort sub-basin in South Africa · EMAIL FREE FULL TEXT EMAIL FREE FULL TEXT DOWNLOAD FULL TEXT DOWNLOAD FULL TEXT. RM Hassan, S Farolfi, 9-16.

  8. 75 FR 60371 - Alabama Regulatory Program

    Science.gov (United States)

    2010-09-30

    ..., excluding holidays. You may receive one free copy of the amendment by contacting OSM's Birmingham Field... continuing education of certified blaster applicants. D. Alabama Code Sec. 9-16-77(b) Amends existing... public hearing will continue on the specified date until everyone scheduled to speak has been given an...

  9. Covalent Functionalization of Carbon Nanotube by Tetrasubtituted Amino Manganese Phthalocyanine

    Institute of Scientific and Technical Information of China (English)

    Zheng Long YANG; Hong Zheng CHEN; Lei CAO; Han Yin LI; Mang WANG

    2004-01-01

    The multiwall carbon nanotube (MWCNT) bonded to 2, 9, 16, 23-tetraamino manganese phthalocyanine (TAMnPc) was obtained by covalent functionalization, and its chemical structure was characterized by TEM. The photoconductivity of single-layered photoreceptors, where MWCNT bonded by TAMnPc (MWCNT-b-TAMnPc) served as the charge generation material (CGM), was also studied.

  10. PER 2009(1)

    African Journals Online (AJOL)

    Dr Tanya du Plessis

    7 Cloete Introduction of Sports Law 72. 8 Cloete (n 6) 121. 9 Wet op Arbeidsverhoudinge 66 van ... 15 Du Plessis en Fouché Practical guide to Labour Law 9. 16 Grogan Workplace Law 18. ..... Maintaining a football team was in fact an important aspect of the university's overall business or profession of educating students, ...

  11. Age effects and normative data on a Dutch test battery for auditory processing disorders.

    NARCIS (Netherlands)

    Neijenhuis, C.A.M.; Snik, A.F.M.; Priester, G.; Kordenoordt, S. van; Broek, P. van den

    2002-01-01

    A test battery compiled to diagnose auditory processing disorders (APDs) in an adult population was used on a population of 9-16-year-old children. The battery consisted of eight tests (words -in noise, filtered speech, binaural fusion, dichotic digits, frequency and duration patterns, backward

  12. 76 FR 57985 - Information Collection Being Reviewed by the Federal Communications Commission Under Delegated...

    Science.gov (United States)

    2011-09-19

    ... certain changes in the licensed facilities of these stations. Additionally, when changes are made to an AM station that alter the resistance of the antenna system, a licensee must initiate a determination of the... Secretary, Office of Managing Director. [FR Doc. 2011-23942 Filed 9-16-11; 8:45 am] BILLING CODE 6712-01-P ...

  13. 76 FR 19989 - New York State Prohibition of Discharges of Vessel Sewage; Receipt of Petition and Tentative...

    Science.gov (United States)

    2011-04-11

    ...: Pumpout Station and Dump Station Technical Guidelines (Federal Register, Vol. 59, No. 47, March 10, 1994.... The New London to Orient Point Ferry does not discharge to LIS waters. It pumps waste from its ferries... Harbor, Port VHF 9 & 16. Mon-Sun; 24 Washington Dock Washington. hours. Pump Replacement. 33...

  14. 76 FR 55668 - New York State Prohibition of Discharges of Vessel Sewage; Final Affirmative Determination

    Science.gov (United States)

    2011-09-08

    ... site visit, that a pumpout truck could drive close to the ferry and access the holding tank to pump it...: Pumpout Station and Dump Station Technical Guidelines (Federal Register, Vol. 59, No. 47, March 10, 1994... Free. Hempstead--Port Port Washington. 9 & 16. Sun; 24 hours. Washington Dock Pump Replacement. 33 Town...

  15. Numerical analysis of twin thickening process in magnesium alloys

    Czech Academy of Sciences Publication Activity Database

    Šiška, Filip; Stratil, Luděk; Čížek, J.; Ghaderi, A.; Barnett, M.

    2017-01-01

    Roč. 124, FEB (2017), s. 9-16 ISSN 1359-6454 R&D Projects: GA ČR GJ15-21292Y Institutional support: RVO:68081723 Keywords : Magnesium alloy * Twinning * Crystal plastic ity * FEM Subject RIV: JG - Metallurgy OBOR OECD: Materials engineering Impact factor: 5.301, year: 2016

  16. Tallinn 1991. aastast alates / Kristjan Mändmaa

    Index Scriptorium Estoniae

    Mändmaa, Kristjan, 1973-

    2006-01-01

    9.-16. I Eesti Kunstiakadeemia graafilise disaini osakonnas Kaisa Lassinaro (Soome) ja Bart de Baetsi (Holland) juhendamisel toimunud workshop'ist. Tuli luua esikaas ajalehele The Tallinn'91 Onwards. Valminud esikaaned pandi kokku üheks ajaleheks ja trükiti ära

  17. 76 FR 58005 - Meeting Notice; Depository Library Council to the Public Printer

    Science.gov (United States)

    2011-09-19

    ... GOVERNMENT PRINTING OFFICE Meeting Notice; Depository Library Council to the Public Printer The Depository Library Council to the Public Printer (DLC) will meet on Monday, October 17, through Thursday..., Public Printer of the United States. [FR Doc. 2011-23948 Filed 9-16-11; 8:45 am] BILLING CODE 1520-01-P ...

  18. Factors Influencing Health Beliefs Among People in South West ...

    African Journals Online (AJOL)

    Administrator

    Items 9 - 16 ... Similarly, a natural phenomenon, e.g., ... disasters, crop failures and theft, or loss) in which ill-health is ... are blamed on conflicts with spouses, children, family, friends, ..... cohort effects and influence of western education on their.

  19. Children and the risks of using the Internet

    NARCIS (Netherlands)

    Nathalie Sonck; Jos de Haan

    2011-01-01

    Original title: Kinderen en internetrisico's As well as benefits, Internet use carries risks. This report looks at the online risks to which 9-16 year-olds in the Netherlands expose themselves. How often do they come into contact with online risks and how often do they themselves find this

  20. Digital literacy and safety skills

    NARCIS (Netherlands)

    Sonck, N.; Livingstone, S.; Kuiper, E.; de Haan, J.

    2011-01-01

    Children’s digital skills were assessed by asking 25,000 European 9-16 year old internet users about their online activities, skills and self-efficacy. The range of digital skills and online activities are linked. But many younger (11-13 year old) children lack key critical and safety skills. Also,

  1. Download this PDF file

    African Journals Online (AJOL)

    The mean age (months) of study population in the AL and AA arms were 38.9. 16.90 and 37.7 16.76 respectively, ..... leucopenia after long time use as a prophylactic. 21 agent. ... differences did not reach statistical significant levels. The total ...

  2. Analysis of forest product trade relationships between Turkey and ...

    African Journals Online (AJOL)

    USER

    2010-04-19

    Apr 19, 2010 ... African Journal of Biotechnology Vol. 9(16), pp. ... Full Length Research Paper. Analysis of ... academic attention in the economics literature. The .... In this study, the forest products industry in Turkey and the EU countries have ...

  3. Journal of Genetics | Indian Academy of Sciences

    Indian Academy of Sciences (India)

    Home; Journals; Journal of Genetics. K. Kosalai. Articles written in Journal of Genetics. Volume 80 Issue 1 April 2001 pp 9-16. An automated annotation tool for genomic DNA sequences using GeneScan and BLAST · Andrew M. Lynn Chakresh Kumar Jain K. Kosalai Pranjan Barman Nupur Thakur Harish Batra Alok ...

  4. Research Article Special Issue

    African Journals Online (AJOL)

    Items 9 - 16 ... Published online: 15 January 2018 ... using formal, content, and construct validity as well as internal consistency reliability and stability. ... reproductive age and the importance of men's role has been neglected. .... three meetings and integration of overlapping items and removing inappropriate items, the number ...

  5. EEG transients in the sigma range during non-REM sleep predict learning in dogs

    NARCIS (Netherlands)

    Iotchev, I.B.; Kis, A.; Bodizs, R.; Luijtelaar, E.L.J.M. van; Kubinyi, E.

    2017-01-01

    Sleep spindles are phasic bursts of thalamo-cortical activity, visible in the cortex as transient oscillations in the sigma range (usually defined in humans as 12-14 or 9-16 Hz). They have been associated with sleep-dependent memory consolidation and sleep stability in humans and rodents.

  6. President Ilves : There Is A Future In Co-Operation Between Estonia's State-Of-The Art Companies And The World

    Index Scriptorium Estoniae

    2009-01-01

    President Toomas Hendrik Ilvese külaskäigust teadus- ja kõrgtehnoloogia keskusesse Silicon Valley'sse ning kohtumisest Stanfordi Ülikooli rektori John L. Hennessy'ga. Vabariigi President töövisiidil Ameerika Ühendriikides 9.-16.06.2009

  7. Bone density assessment for evaluation of gender differences in cervical vertebral maturation: A computed tomography study

    Directory of Open Access Journals (Sweden)

    K Usha

    2016-01-01

    Full Text Available Introduction: The cervical vertebral maturation (CVM method is a vital tool for assessing the biological maturation of the orthodontic patient to evaluate the amount of mandibular bone growth left. Aim: To assess and visualize the cervical vertebral morphology (bone density of orthodontic patients of the age group 9,16,27 years. Material and Methods: Twenty four subjects with age group of 9,16,27 who were randomly selected and subjected to 3d tomographic study to estimate the biological age of the orthodontic patients by analyzing c1 c2 and c3 vertebrae. Result: The results showed that bone density of males is lesser than females in 9 and 16 years, whereas they have more bone density than females in 27 years. Conclusion: The study provides qualitative method of assessing the biological age of the patient by using images of cervical vertebrae by three dimensional approach. Hence it can be useful for orthodontic diagnosis and treatment plan.

  8. "Estonia" müsteerium / Jüri Liim

    Index Scriptorium Estoniae

    Liim, Jüri

    2001-01-01

    Järgneb 26. okt., 2.,9.,16.,23.,30. nov., 7.,14. dets. ; 2002, 4.,11.,18.,25. jaan., 1.,8.,15.,22. veebr., 1.,8.,15.,22. märts, 5.,12.,26. aprill, 3.,10.,17.,24.,31. mai, 7.,14.,28. juuni, 5.,12.,19.,26. juuli, 2.,9.,16.,23. aug., 6.,13.,20.,27. sept., 4.,11.,25. okt., 1.,8.,15.,22.,29. nov., 13.,20. dets. ; 10.,17.,24., 31. jaan., 2003, 14. veebr., 7.,28. märts, 4.,11.,25. apr., 16.,23. mai, 6.,27. juuni, 11.,18. juuli. Reisilaev "Estonia" mõistatuslikust hukust

  9. Bone density assessment for evaluation of gender differences in cervical vertebral maturation: A computed tomography study.

    Science.gov (United States)

    Usha, K; Baskaranarayanan, Balashanmugam; Nagarajan, D; Selvarani, R; Vijjaykanth, M

    2016-10-01

    The cervical vertebral maturation (CVM) method is a vital tool for assessing the biological maturation of the orthodontic patient to evaluate the amount of mandibular bone growth left. To assess and visualize the cervical vertebral morphology (bone density) of orthodontic patients of the age group 9,16,27 years. Twenty four subjects with age group of 9,16,27 who were randomly selected and subjected to 3d tomographic study to estimate the biological age of the orthodontic patients by analyzing c1 c2 and c3 vertebrae. The results showed that bone density of males is lesser than females in 9 and 16 years, whereas they have more bone density than females in 27 years. The study provides qualitative method of assessing the biological age of the patient by using images of cervical vertebrae by three dimensional approach. Hence it can be useful for orthodontic diagnosis and treatment plan.

  10. Who is Distressed Applying the Diabetes Related Distress Scale in a Diabetes Clinic

    Science.gov (United States)

    2017-06-09

    59 MDW /SGVU SUBJECT: Professional Presentation Approval 7APR 2017 1. Your paper, entitled Who is Distressed? Applying the Diabetes -Related Distress...Scale in A Diabetes Clinic presented at/published to American Diabetes Association 2017 Meeting, San Francisco, CA (National Conference), 9-16 June...as a publication/presentation, a new 59 MOW Form 3039 must be submitted for review and approval.) Using the Diabetes -Related Distress Scale in

  11. e-criminals are rearing their heads: who owns your computer? / Toivo Tänavsuu

    Index Scriptorium Estoniae

    Tänavsuu, Toivo

    2009-01-01

    Küberkuritegevusest. Rahvusvahelise arvutiturbefirma Trend Micro andmetel juhib Tartu firma Rove Digital üleilmset küberkuritegevuse võrgustikku. Küberrünnakutest Eesti vastu 2007. aasta kevadel. Tabelid. Diagrammid. President Toomas Hendrik Ilvese külaskäigust teadus- ja kõrgtehnoloogia keskusesse Silicon Valley'sse. Vabariigi President töövisiidil Ameerika Ühendriikides 9.-16.06.2009

  12. Effectiveness of an Intervention for Children with Externalizing Behavior and Mild to Borderline Intellectual Disabilities: A Randomized Trial

    OpenAIRE

    Schuiringa, Hilde; Van Nieuwenhuijzen, Maroesjka; Orobio De Castro, Bram; Lochman, John E.; Matthys, Walter

    2017-01-01

    This study evaluated the effectiveness of Standing Strong Together (SST), a combined group based parent and child intervention for externalizing behavior in 9?16?year-old children with mild to borderline intellectual disabilities (MBID). Children with externalizing behavior and MBID (IQ from 55 to 85) (N?=?169) were cluster randomly assigned to SST combined with care as usual or to care as usual only. SST led to a significant benefit on teacher reported but not on parent reported externalizin...

  13. Subscriptions

    African Journals Online (AJOL)

    ₤36.30 less 10% to Subscription Agent (₤32.67 + ₤9.33 Forex charges = ₤42.00 to ISEA, Rhodes University). $57.48 less 10% to Subscription Agent ($51.73 + $18.27 Forex charges = $70.00 to ISEA, Rhodes University). Airmail: Please add a further £9/$16. Africa: Individuals: R230.00 less 10% to Agent - (R 207.00 incl.

  14. The Importance of Ethics in Counterinsurgency Operations

    Science.gov (United States)

    2006-05-25

    4 Niccolo Machiavelli , “The Prince”, in Steven M. Cahn, Classics of Political and Moral Philosophy, (New York: Oxford University Press 2002) 339 5...favored form of government within Western Society is that broadly 9 16 John Rawls , “The Law of Peoples” (Cambridge: Harvard University Press, 2003) 138...Western Society generally follows what John Rawls would call “a well ordered constitutional democracy”16. America is an excellent example of a

  15. Environmental Assessment for Developing Renewable Energy Enhanced Use Lease Facilities at Robins Air Force Base

    Science.gov (United States)

    2013-12-15

    geothermal sources were eliminated because of insufficient sources of energy. Wind power using turbines was eliminated because the average wind speed in...Warner Robins, Georgia is 8 kph (5 mph), and wind turbines are typically not cost-effective in areas with average wind speeds below 12.9-16.1 kph (8...20  Table 3-2. Bird Species of Pine and Pine/Mixed Hardwood Habitats ...................... 31  Table 3-3. Archaeological Sites

  16. Study of Cetane Properties of ATJ Blends Based on World Survey of Jet Fuels

    Science.gov (United States)

    2016-01-28

    FAME Fatty Acid Methyl Ester JP-8 Jet Propellant-8 max. Maximum OCONUS Outside the Contiguous United States PADD Petroleum Administration for...47.4 47.9 13 Jet A - FAME Sensitive 42.34 39.79 41.3 41 14 Jet A - PADD 1 49.39 48.48 48.5 45.7 15 Jet A - PADD 2 41.48 40.37 39.4 39.9 16 Jet A

  17. Determination of the antiproton-to-electron mass ratio by precision laser spectroscopy of $\\overline{p}He^{+}$

    CERN Document Server

    Hori, M; Eades, John; Gomikawa, K; Hayano, R S; Ono, N; Pirkl, Werner; Widmann, E; Torii, H A; Juhász, B; Barna, D; Horváth, D

    2006-01-01

    A femtosecond optical frequency comb and continuous-wave pulse- amplified laser were used to measure 12 transition frequencies of antiprotonic helium to fractional precisions of (9-16) 10/sup -9lifetimes hitherto unaccessible to our precision laser spectroscopy method. Comparisons with three-body QED calculations yielded an antiproton-to-electron mass ratio of M/sub pmacron//m/sub e/=1836.152 674(5).

  18. Aspects epidémiologiques des accidents domestiques de l'enfant à ...

    African Journals Online (AJOL)

    2. Clinics in Mother and Child Health. Tableau 1: Types d'accidents domestiques retrouvés. Type d'accident. Nombre. Pourcentage. Chute. 26. 46,4. Intoxication au pétrole. 9. 16,1. Brûlure. 5. 8,9. Coupure. 5. 8,9. Corps étranger. 4. 7,1. Collusion avec un objet contondant. 4. 7,1. Morsure. 2. 3,7. Suffocation. 1. 1,8. Total. 56.

  19. Advanced Environmental Monitoring Technologies

    Science.gov (United States)

    Jan, Darrell

    2004-01-01

    Viewgraphs on Advanced Environmental Monitoring Technologies are presented. The topics include: 1) Monitoring & Controlling the Environment; 2) Illustrative Example: Canary 3) Ground-based Commercial Technology; 4) High Capability & Low Mass/Power + Autonomy = Key to Future SpaceFlight; 5) Current Practice: in Flight; 6) Current Practice: Post Flight; 7) Miniature Mass Spectrometer for Planetary Exploration and Long Duration Human Flight; 8) Hardware and Data Acquisition System; 9) 16S rDNA Phylogenetic Tree; and 10) Preview of Porter.

  20. Externalizing Behaviors of Ukrainian Children: The Role of Parenting

    OpenAIRE

    Burlaka, Viktor

    2016-01-01

    The purpose of this study was to assess the association of positive and negative parenting with child externalizing problems. Quantitative data were collected during face-to-face interviews with 320 parents of children 9?16 years of age (50% males) in 11 communities in Eastern, Southern and Central Ukraine. The study estimated the relationship between parenting practices and child externalizing behaviors, such as aggression, delinquency and attention problems. Results revealed that positive p...

  1. Nädal Riigikogus / Ramon Loik

    Index Scriptorium Estoniae

    Loik, Ramon

    2003-01-01

    Järg 7.,14.,21. mai, 4.,11.,18. juuni, 24.september, 1.,15.,22.,29. oktoober, 12.,19.,26. november, 10.,17.,24. detsember, 5.,21.,28. jaanuar 2004. a., 4.,18., 25. veebruar, 3.,17.,24. märts, 21., 28. aprill, 12., 19., 26. mai, 9.,16. juuni, 22.,29. sept. lk. 5. Riigikogu töö tutvustus

  2. Women in the Military: A Selected Bibliography

    Science.gov (United States)

    2009-08-01

    Military: Where They Stand, 5th ed. Washington, DC: WREI [Women’s Research and Education Institute], April 2005. 37pp. (UB418 .W65M14 2005) Oliver...34Women in War: Operational Issues of Menstruation and Unintended Pregnancy." Military Medicine 172 (January 2007): 9-16. Ingenta Dove, Mary Baker, and...Publishing Group, 2004. 112pp. (D790 .D66 2004) Fort Des Moines Museum & Education Center. Fort Des Moines Museum & Education Center Home Page. http

  3. 78 FR 52787 - Kevin Dennis, M.D., Decision and Order

    Science.gov (United States)

    2013-08-26

    ... phentermine to family members, including his sister, wife and mother-in-law. Id. at 41. However, the ALJ also... May 23, 2008. GX 15, at 9-16. Each of the prescriptions included Respondent's cell-phone number, id... phentermine 37.5mg, to family members including his wife, sister, and mother-in-law. See GX 19, at 12-13, 17...

  4. Design of personal positioning for coal mine based on mesh

    Energy Technology Data Exchange (ETDEWEB)

    Gao, W.H.; Ma, J.; Kang, L. [Taiyuan University of Science and Technology, Taiyuan (China). College of Electronic Information and Engineering

    2008-07-01

    This paper puts forward a method for a location system for colliery workers based on wireless mesh network combined with zigbee technology which supports IEEE 802.15.4 wireless communication standard, with low power dissipation. Data receipt and transmission by wireless communication is realized by RF chip MC13192 produced by the Freescale company. Data procession and analysis is achieved by an S3C2410A chip manufactured by Sumsung which belongs to the ARM9 16/32 RISC processor.

  5. Characterization of Chromatin Structure-associated Histone Modifications in Breast Cancer Cells

    Directory of Open Access Journals (Sweden)

    Chang Pyo Hong

    2012-09-01

    Full Text Available Chromatin structure and dynamics that are influenced by epigenetic marks, such as histone modification and DNA methylation, play a crucial role in modulating gene transcription. To understand the relationship between histone modifications and regulatory elements in breast cancer cells, we compared our chromatin immunoprecipitation sequencing (ChIP-Seq histone modification patterns for histone H3K4me1, H3K4me3, H3K9/16ac, and H3K27me3 in MCF-7 cells with publicly available formaldehyde-assisted isolation of regulatory elements (FAIRE-chip signals in human chromosomes 8, 11, and 12, identified by a method called FAIRE. Active regulatory elements defined by FAIRE were highly associated with active histone modifications, like H3K4me3 and H3K9/16ac, especially near transcription start sites. The H3K9/16ac-enriched genes that overlapped with FAIRE signals (FAIRE-H3K9/14ac were moderately correlated with gene expression levels. We also identified functional sequence motifs at H3K4me1-enriched FAIRE sites upstream of putative promoters, suggesting that regulatory elements could be associated with H3K4me1 to be regarded as distal regulatory elements. Our results might provide an insight into epigenetic regulatory mechanisms explaining the association of histone modifications with open chromatin structure in breast cancer cells.

  6. Tyrosinase inhibitors from the wood of Artocarpus heterophyllus.

    Science.gov (United States)

    Nguyen, Nhan Trung; Nguyen, Mai Ha Khoa; Nguyen, Hai Xuan; Bui, Ngan Kim Nguyen; Nguyen, Mai Thanh Thi

    2012-11-26

    From the methanolic-soluble extract of the wood of Artocarpus heterophyllus, four new flavones, artocarmins A-D (1-4), and three new chalcones, artocarmitins A-C (5-7), have been isolated together with 13 known compounds. Their structures were determined on the basis of the spectroscopic data. Compounds 1-4, 6, 7, 9-16, and 20 displayed significant tyrosinase inhibitory activity. The most active compound, morachalcone A (12) (IC50, 0.013 μM), was 3000 times more active as a tyrosinase inhibitor than a positive control, kojic acid (IC50, 44.6 μM).

  7. New Erwinia-Like Organism Causing Cervical Lymphadenitis▿

    Science.gov (United States)

    Shin, Sang Yop; Lee, Mi Young; Song, Jae-Hoon; Ko, Kwan Soo

    2008-01-01

    The first case of cervical lymphadenitis due to infection by a new Erwinia-like organism is reported. The organism was identified initially as Pantoea sp. by a Vitek 2-based assessment but was finally identified as a member of the genus Erwinia by 16S rRNA gene sequence analysis. The isolate displayed 98.9% 16S rRNA gene sequence similarity to that of E. tasmaniensis and showed phenotypic characteristics that were different from other Erwinia species. PMID:18614665

  8. Social Networks and Cyber-bullying among Teenagers

    OpenAIRE

    RIZZA CAROLINE; MARTINHO GUIMARAES PIRES PEREIRA Angela

    2013-01-01

    In the digital society, even if ICT offers new opportunities and benefits to teenagers, it also poses significant challenges to them. More and more teenagers are becoming victims of aggression via ICT. In Europe, among the 9-16 year-old participants in the EU Kids Online survey (2011): 33 % were bothered or upset by inappropriate material online, 12 % were bothered or upset meeting online contacts offline, and 80 % were fairly or very upset by cyber-bullying. Cyber-bullying does not respect b...

  9. Dokumente küüditajatelt

    Index Scriptorium Estoniae

    2008-01-01

    Ajakirjas on avaldatud küüditajate raportid 1941. aasta küüditamisel valitsenud meeleolude kohta: "[EK(b)P Valgamaa Komitee] aruanne EK(b)P KK sekretär sms. Särele" (16. juuni 1941.a) ; "Väljavõte EK(b)P Valgamaa Komitee informatsioonist EK(b)P Keskomiteele ajavahemikust 8.-14. juunini 1941. a." (17. juuni 1941. a) ; "Väljavõte EK(b)P Tartumaa Komitee nädalainformatsioonist EK(b)P Keskkomiteele 9.-16. juunini 1941. a." (17. juuni 1941. a.)

  10. Reliability and validity of Yo-Yo tests in 9- to 16-year-old football players and matched non-sports active schoolboys

    DEFF Research Database (Denmark)

    Póvoas, Susana C A; Castagna, Carlo; Soares, José M C

    2016-01-01

    The purpose of this study was to examine the test-retest reliability and construct validity of three age-adapted Yo-Yo intermittent tests in football players aged 9-16 years (n = 70) and in age-matched non-sports active boys (n = 72). Within 7 days, each participant performed two repetitions...... performances and HRpeak are reliable for 9- to 16-year-old footballers and non-sports active boys. Additionally, performances of the three Yo-Yo tests were seemingly better for football-trained than for non-sports active boys, providing evidence of construct validity....

  11. Interpretation and mathematical modeling of temporal changes of temperature observed in borehole Yaxcopoil-1 within the Chicxulub impact structure, Mexico

    Czech Academy of Sciences Publication Activity Database

    Šafanda, Jan; Wilhelm, H.; Heidinger, P.; Čermák, Vladimír

    2009-01-01

    Roč. 372, č. 1-4 (2009), s. 9-16 ISSN 0022-1694 R&D Projects: GA ČR(CZ) GA205/06/1181 Grant - others:Deutsche Forschungsgemeinschaft(DE) W1 687/17-1,2,3 Institutional research plan: CEZ:AV0Z30120515 Keywords : repeated borehole temperature logging * karstic environment * Yucatan * groundwater convection * heat transport numerical simulation * fluid dynamics Subject RIV: DC - Siesmology, Volcanology, Earth Structure Impact factor: 2.433, year: 2009

  12. Incumbency in Multi-level Political Systems and Recruitment Advantage: The Case of the Czech Regional Assemblies

    Czech Academy of Sciences Publication Activity Database

    Bernard, Josef; Šafr, Jiří

    2016-01-01

    Roč. 52, č. 3 (2016), s. 267-291 ISSN 0038-0288 R&D Projects: GA ČR GAP404/12/0714 Institutional support: RVO:68378025 Keywords : incumbency * legislative recruitment * multi-level political system Subject RIV: AD - Politology ; Political Sciences Impact factor: 0.143, year: 2016 http://sreview.soc.cas.cz/uploads/6184b97b7357aa4e289089fff7852b7d898290d9_16-3-02Bernard15.indd.pdf

  13. Saaremaa XX sajandil

    Index Scriptorium Estoniae

    2001-01-01

    Algus: 6. jaanuar 2000. Järg Jan/12;16;26;30/Feb/9;13;22/Mar/6;13;16;27Apr/6;20;27/May/15;31/Jun/12;22/Jul/6;13;27Aug/1;3 Sep/11/Oct/9;16/Nov/6;9/Dec/11. Artiklite autorid: Külli Rikas, Helju Pärt, Garel Püüa, Endel Prooses, Raul Salumäe, Sirje Azarov, Endel Püüa, Maret Soorsk, Aare Laine

  14. Saaremaa XX sajandil

    Index Scriptorium Estoniae

    2000-01-01

    Järg Jan/8;11;15;20;27 Feb/1;10;12;17;19;29 Mar/4;7;11;14;21;25;29;30 Apr/1;8;12;27 May/3;6;11;19;26;30 Jun/3;6;16;21;22 Jul/25 Aug/4;11;18;26 Sep/9;16;22;29 Oct/6;10;21;27 Nov/7;11;17;22 Dec/12 Sündmustest Saaremaal. Artiklite autorid: Raul Salumäe, Marko Püüa, Endel Püüa, Külli Rikas, Maret Soorsk, Olavi Pesti, Bruno Pao, Sirje Azarov, Tõnu Talvi

  15. Molecular Dynamics Simulations of Water Nanodroplets on Silica Surfaces

    DEFF Research Database (Denmark)

    Zambrano, Harvey A; Walther, Jens Honore; Jaffe, Richard L.

    2009-01-01

    and DNA microarrays technologies.4,5,6,7,8 Although extensive experimental, theoretical and computational work has been devoted to study the nature of the interaction between silica and water,2,9-16 at the molecular level a complete understanding of silica-water systems has not been reached. Contact angle...... computations of water droplets on silica surfaces offers a useful fundamental and quantitative measurement in order to study chemical and physical properties of water-silica systems.3,16,17,18 For hydrophobic systems the static and dynamic properties of the fluid-solid interface are influenced by the presence...

  16. Orbit Determination Using Vinti’s Solution

    Science.gov (United States)

    2016-09-15

    crew capsule orbited the earth twice and then experienced re-entry as part of an experimental test flight (Orion EFT -1). With a flight duration of almost...utility greatly outweighs these initial difficulties. A summary of efforts required to tap into these benefits follows. • The current research developed...and Lear, D., “Orion EFT -1 Postflight MMOD Inspection,” Orbital Debris Quarterly News, Vol. 19, April 2015, pp. 6–9. [16] European Space Agency, “Space

  17. Stress-life relation of the rolling-contact fatigue spin rig

    Science.gov (United States)

    Butler, Robert H; Carter, Thomas L

    1957-01-01

    The rolling-contact fatigue spin rig was used to test groups of SAE 52100 9.16-inch-diameter balls lubricated with a mineral oil at 600,000-, 675,000-, and 750,000-psi maximum Hertz stress. Cylinders of AISI M-1 vacuum and commercial melts and MV-1 (AISI M-50) were used as race specimens. Stress-life exponents produced agree closely with values accepted in industry. The type of failure obtained in the spin rig was similar to the subsurface fatigue spells found in bearings.

  18. Marine-derived fungi as a source of proteases

    Digital Repository Service at National Institute of Oceanography (India)

    Kamat, T.; Rodrigues, C.; Naik, C.G.

    , of marine-derived fungi in order to identify the potential sources. Sponge and corals were collected by SCUBA diving, from a depth of 8 to 10 m from the coastal waters of Mandapam, Tamil Nadu (9"16' N; 79"liE). The samples comprised of a soft coral Sinularia... pieces of approximately 2x2 cm were cut out aseptically. These fourteen pieces of each organism were subjected to two different treatments 23 • In the first case seven pieces were vortexed four times, for 20 seconds each, with sterile seawater while...

  19. Selective Activation Around the Left Occipito-Temporal Sulcus for Words Relative to Pictures: Individual Variability or False Positives?

    OpenAIRE

    Wright, Nicholas D; Mechelli, Andrea; Noppeney, Uta; Veltman, Dick J; Rombouts, Serge ARB; Glensman, Janice; Haynes, John-Dylan; Price, Cathy J

    2007-01-01

    We used high-resolution fMRI to investigate claims that learning to read results in greater left occipito-temporal (OT) activation for written words relative to pictures of objects. In the first experiment, 9/16 subjects performing a one-back task showed activation in ?1 left OT voxel for words relative to pictures (P < 0.05 uncorrected). In a second experiment, another 9/15 subjects performing a semantic decision task activated ?1 left OT voxel for words relative to pictures. However, at thi...

  20. 1st February 2011-CERN Cultural Board for Engaging with the Arts, visiting CMS experimental area and LHC Tunnel at Point 5

    CERN Multimedia

    Michael Hoch

    2011-01-01

    Photo 1-4: Visit to CMS Control Room with G. Tonelli,CMS Collaboration Spokesperson Photo 5-9,16-20:CMS experimental area Photo 10-15:LHC Tunnel at Point 5 Photo 21:F. Madlener,Director of IRCAM Paris+S. Dorny,Director-General Lyon Opera House+C. Bollman,Art by Genève+M. Doser,AEgIS Collaboration Spokesperson,Former Physics Department Deputy Head+A. Koek,International Arts Development+G. Tonelli+M. Monje Cano,Arts Development Assistant (part-time work experience)+B. Ruf,Director of Kunsthalle Zürich

  1. Hiiumaa kiviajast tänapäevani / Endel Saar

    Index Scriptorium Estoniae

    Saar, Endel

    2001-01-01

    Järg Feb/10;17 Mar/3;10;17;24;31 Apr/7;21;28 May/5;26 Jun/2;9;16;30 Jul/7;14;21;28 Aug/4;11;18;25 Sep/8 ;15;22;29 Oct/6;13;20;27 Nov/3;10;24 Dec/1;8;15;22;29. Biosfääri Kaitseala Keskuse poolt koostatud atlas "Administratiivsete muutuste ülevaatekaart", kus antakse ülevaade Hiiumaa arenguloost kiviajast tänapäevani

  2. Taasiseseisvumiseelne Rapla / Tõnis Tõnisson

    Index Scriptorium Estoniae

    Tõnisson, Tõnis, 1945-

    2002-01-01

    Järg 8.,10.,15.,17.,22.,24.,29.,31. jaanuar ; 5.,7.,12.,14.,21.,26.,28. veebruar ; 5.,7.,12.,14.,19.,21.,26. märts ; 2.,4.,9.,16.,18.,23.,25. aprill ; 7.,9.,14.,16.,21.,23.,28.,30. mai ; 4.,6.,11.,13.,18.,20.,27. juuni ; 2.,4.,9.,11.,16.,18.,23.,25.,30. juuli ; 1.,6.,8.,13.,15., 22.,24.,27.,29. august ; 3.,10.,12.,17. september. Algus: 26. juuli 2001. Sündmustest Raplamaal aastatel 1988-1991

  3. JOS JOURNAL MAY-AUGUST

    African Journals Online (AJOL)

    FOBUR

    Juu·t.,mml qf On hope die. A.ddressas.· ctnd Tramm• . . los Univf!rsU)' TeachirtR Ho.'t.pilaf, Jos. "WI.- Divij,'J()rt o('!r.aumn. --'J,,.~ery T>e.pwtmenJ. los. U:niver.~ity ...... 161 mi"'~ ~ ~"'~ ~l\\. Nt,tdK1'1\\ Irclood 1. ~7o-84: tht'! HMtile Aa;oo. C;;b!tt.al.ly Sy~cm . .Or J Surg, 19&9;16: Hl-06-. lO. 17) Hull JB. (]()per GJ. Pattern and.

  4. Characterization and Targeting of the Aldehyde Dehydrogenase Subpopulation in Ovarian Cancer

    Science.gov (United States)

    2016-10-01

    Grizzle W, Landen C, Partridge EE, Rice VM, Reddy ES, Rao VN. Epithelial ovarian cancer: An overview. World J Transl Med. 2014 Apr 12;3(1):1-8. PMID...malignant human colonic stem cells (SC) and tracks SC overpopulation during colon tumorigenesis. Cancer Res 2009;69:3382–9. 16. Carpentino JE, HynesMJ...the TGF-b coreceptor endoglin in cancer. Sci World J 2010;10:2367–84. 40. Henriksen R, Gobl A, Wilander E, Oberg K, Miyazono K, Funa K. Expression and

  5. The Temperament Types of Nursing Administrators in Hospital Nursing Service.

    Science.gov (United States)

    1984-05-01

    ENFJ 2 3 1 1 1 ENTP 1 1 2 1 ISFJ 1 2 2 2 ESTP 1 ISFP 1 INTP ESFP INFP ISTP Undetermined 14 7 12 5 3 1 1 1 Total 67 38 48 9 16 3 6 5 *Stated Position 1...interdependent on one another, as well as the relationship of the organization to other organizations in the same business. Each skill is 5 necessary at...combinations of these types allows for a method of dividing individuals into basic groups which are descriptive of the interpersonal relationships , the

  6. A study of full width at half maximum (FWHM) according to the filter's cut off level in SPECT camera

    International Nuclear Information System (INIS)

    Park, Soung Ock; Kwon, Soo Il

    2003-01-01

    Filtering is necessary to reduce statistical noise and to increase image quality in SPECT images. Noises controlled by low-pass filter designed to suppress high spatial frequency in SPECT image. Most SPECT filter function control the degree of high frequency suppression by choosing a cut off frequency. The location of cut off frequency determines the affect image noise and spatial resolution. If select the low cut off frequency, its provide good noise suppression but insufficient image quantity and high cut off frequencies increase the image resolution but insufficient noise suppression. The purpose of this study was to determines the optimum cut off level with comparison of FWHM according to cut off level in each filters-Band-limited, Sheep-logan, Sheep-logan Hanning, Generalized Hamming, Low pass cosine, Parazen and Butterworth filter in SPECT camera. We recorded image along the X, Y, Z-axis with 99m TcO 4 point source and measured FWHM by use profile curve. We find averaged length is 9.16 mm ∼ 18.14 mm of FWHM in X, Y, and Z-axis, and Band-limited and Generalized Hamming filters measures 9.16 mm at 0.7 cycle/pixel cut off frequency

  7. Understanding NaI(Tl) crystal background for dark matter searches

    Energy Technology Data Exchange (ETDEWEB)

    Adhikari, G.; Adhikari, P.; Kong, S.Y.; Oh, S.Y. [Sejong University, Department of Physics and Astronomy, Seoul (Korea, Republic of); Ha, C.; Jeon, E.J.; Kim, N.Y.; Lee, H.S.; Park, J.S.; Park, K.S. [Institute for Basic Science (IBS), Center for Underground Physics, Daejeon (Korea, Republic of); Kim, Y.D. [Institute for Basic Science (IBS), Center for Underground Physics, Daejeon (Korea, Republic of); Sejong University, Department of Physics and Astronomy, Seoul (Korea, Republic of)

    2017-07-15

    We have developed ultra-low-background NaI(Tl) crystals to reproduce the DAMA results with the ultimate goal of achieving purity levels that are comparable to or better than those of the DAMA/LIBRA crystals. Even though the achieved background level does not approach that of DAMA/LIBRA, it is crucial to have a quantitative understanding of the backgrounds. We have studied background simulations toward a deeper understanding of the backgrounds and developed background models for a 9.16-kg NaI(Tl) crystal used in the test arrangement. In this paper we describe the contributions of background sources quantitatively by performing Geant4 Monte Carlo simulations that are fitted to the measured data to quantify the unknown fractions of the background compositions. In the fitted results, the overall simulated background spectrum well describes the measured data with a 9.16-kg NaI(Tl) crystal and shows that the background sources are dominated by surface {sup 210}Pb and internal {sup 40}K in the 2-6-keV energy interval, which produce 2.4 counts/day/keV/kg (dru) and 0.5 dru, respectively. (orig.)

  8. Reduction in inappropriate prevention of urinary tract infections in long-term care facilities.

    Science.gov (United States)

    Rummukainen, Maija-Liisa; Jakobsson, Aino; Matsinen, Maire; Järvenpää, Salme; Nissinen, Antti; Karppi, Pertti; Lyytikäinen, Outi

    2012-10-01

    Urinary tract infection (UTI) is the most common diagnosis made in prescribing antimicrobials in long-term care facilities (LTCF). The diagnostic criteria for UTI vary among institutions and prescribers. Our aim was to reduce the inappropriate use of antimicrobials in LTCFs. A team comprising infectious disease consultant, infection control nurse, and geriatrician visited all LTCFs for older persons (2,321 patients in 25 primary care hospitals and 39 nursing homes and dementia units) in the Central Finland Healthcare District (population 267,000) during 2004-2005. The site visits consisted of a structured interview concerning patients, ongoing systematic antimicrobials, and diagnostic practices for UTI. Following the visits, regional guidelines for prudent use of antimicrobials in LTCFs were published, and the use of antimicrobials was followed up by an annual questionnaire. The proportions of patients receiving antimicrobials in 2005, 2006, 2007, and 2008 were 19.9%, 16.9%, 16.2%, and 15.4%, respectively. Most of the antibiotics were used for UTI (range by year, 66.6%-81.1%). From 2005 through 2008, the proportion of patients on antibiotic prophylaxis for UTI decreased from 13% to 6%. The decrease was statistically significant in both types of settings. The visits and guidelines were associated with a reduction in the usage of antimicrobials. To sustain this, UTI surveillance and close collaboration between infection control experts and LTCFs are crucial. Copyright © 2012 Association for Professionals in Infection Control and Epidemiology, Inc. Published by Mosby, Inc. All rights reserved.

  9. Distal tibial fracture treated by minimally invasive plate osteosynthesis after external fixation Retrospective clinical and radiographic assessment

    Directory of Open Access Journals (Sweden)

    Al. Șerban

    2014-02-01

    Full Text Available Fractures of the horizontal surface of the distal tibia are known commonly as pylon or plafond fractures, and represent 1-5% of lower extremity fractures, 7-10% of all tibial fractures. The protocol consisted of immediate (within eight to 24 hours open reduction and internal fixation of the fibula, using a fibular plate or one third tubular plate and application of an external fixator spanning the ankle joint. In the second stage, the treatment of proximal and distal tibial fractures with close reduction and MIPPO technique can preserve soft tissue, simplify operative procedure and decrease wound, obtain rigid internal fixation and guarantee early function exercises of ankle joint. In this study we evaluated 22 patients treated in Clinical Emergency Hospital Constanta between April 2012 - July 2013 diagnosed with multifragmentary fractures of the distal tibia. This study evaluates the treatment of complex fractures of distal tibia with locked plate after external fixation. There were 17 males and 5 females of mean age 51,7 years (31-68. The mean follow-up period was 14 weeks. (Ranging from 9-16 weeks. All patients were fully weight bearing at 16 weeks (ranging 9-16 weeks showing radiological union. There were no cases of failures of fixation, or rotational misalignment. No significant complication was observed in our patients. MIPO is an effective method of treatment for distal tibial fractures, reduce surgical trauma and maintain a more biologically favorable environment for fracture healing, reducing risks of infection and nonunion.

  10. Lennart Meri armid ja sidemed : lähimineviku vähetuntud lehekülgi / Peeter Rahnel

    Index Scriptorium Estoniae

    Rahnel, Peeter, 1957-

    2002-01-01

    Järg 11.,18., 25. sept., 2. ,9.,16., 23., 30. okt., 6., 13. nov., lk. 9. Ilmunud ka: Hiiumaa 7., 12., 19., 26. sept. lk. 5, 6; 3., 10., 17., 24., 31. okt., 7., 14. november, lk. 6; Kesknädal, 4.,11., 18.,25 sept.;2., 9., 16. okt., lk. 9. Aruandest ENSV Riikliku Julgeoleku Komitee 2. vastuluure osakonna tööst ajavahemikul 1. aprill 1954 - 1. aprill 1955. Lennart Meri isast Georg Merist kui väidetavast NKVD agendist. Georg Meri Moskvas Butõrka vanglas. Eesti Vabariigi riigitegelastest, kelle NKVD Severurallagis surma mõistis. Perekond Meri käekäigust peale II maailmasõda. Lennart Meri õpingud Tartu Ülikoolis, tegevus VEKSA liinis. Lennart Meri väidetavad kahtlused Ülemnõukogu esimehe Arnold Rüütli suhtes 1990. a. Boriss Jeltsini visiit Eestisse 1990. a. Lennart Meri visiit Moskvasse 1994. a. Lepingule allakirjutamine

  11. A study of full width at half maximum (FWHM) according to the filter's cut off level in SPECT camera

    Energy Technology Data Exchange (ETDEWEB)

    Park, Soung Ock [Dongnam Health College, Suwon (Korea, Republic of); Kwon, Soo Il [Kyonggi University, Suwon (Korea, Republic of)

    2003-06-15

    Filtering is necessary to reduce statistical noise and to increase image quality in SPECT images. Noises controlled by low-pass filter designed to suppress high spatial frequency in SPECT image. Most SPECT filter function control the degree of high frequency suppression by choosing a cut off frequency. The location of cut off frequency determines the affect image noise and spatial resolution. If select the low cut off frequency, its provide good noise suppression but insufficient image quantity and high cut off frequencies increase the image resolution but insufficient noise suppression. The purpose of this study was to determines the optimum cut off level with comparison of FWHM according to cut off level in each filters-Band-limited, Sheep-logan, Sheep-logan Hanning, Generalized Hamming, Low pass cosine, Parazen and Butterworth filter in SPECT camera. We recorded image along the X, Y, Z-axis with {sup 99m}TcO{sub 4} point source and measured FWHM by use profile curve. We find averaged length is 9.16 mm {approx} 18.14 mm of FWHM in X, Y, and Z-axis, and Band-limited and Generalized Hamming filters measures 9.16 mm at 0.7 cycle/pixel cut off frequency.

  12. Acute appendicitis in children: ultrasound and CT findings in negative appendectomy cases

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Seong Ho; Choi, Young Hun; Kim, Woo Sun; Cheon, Jung-Eun; Kim, In-One [Seoul National University Hospital, Department of Radiology, Seoul National University College of Medicine, Seoul (Korea, Republic of)

    2014-10-15

    To decrease the negative appendectomy rate in children, knowledge of the misleading imaging findings on US and CT in negative appendicitis cases is important. To evaluate the negative appendectomy rate and describe the imaging findings of US and CT that lead radiologists to misdiagnose acute appendicitis in children. From 2007 to 2013, 374 children operated for suspected appendicitis were proved to either have acute appendicitis (n = 348) or to be negative for appendicitis (n = 26) on pathological reports. Negative appendectomy rates were compared among imaging modalities, age groups and genders. We retrospectively reviewed US and CT findings from negative appendectomy cases. The overall negative appendectomy rate was 7.0% (26/374). There were no statistically significant differences among the subgroups. The most common misleading presentations on US were sonographic tenderness (9/16, 56%) and non-compressibility (9/16, 56%). The most common misleading finding on CT were the presence of an appendicolith or hyperdense feces (5/12, 42%). Periappendiceal fat inflammation was observed in only one case of negative appendicitis on US and on CT. Radiologists can misdiagnose children with equivocal diameters of appendices as having acute appendicitis when sonographic tenderness or non-compressibility is present on US and when an appendicolith or hyperdense feces is noted on CT. The possibility of negative appendicitis should be borne in mind when periappendiceal fat inflammation is absent or minimal in indeterminate cases. (orig.)

  13. Muertes por homicidio, consecuencia fatal de la violencia: el caso de Mexico, 1979-1992 Mortality by homicide, the fatal consequences of violence: the case of Mexico, 1979-1992

    Directory of Open Access Journals (Sweden)

    María Victoria López

    1996-02-01

    Full Text Available Se analizaron las muertes registradas como homicidio en México de 1979-1992. El estudio se basó en fuente secundaria, siendo las variables analizadas: año, edad, sexo y causa externa de traumatismos y envenenamientos según CIE IX Rev.(E960-E969. Se utilizó un modelo de regresión Poisson para las causas más frecuentes, obteniendo riesgos relativos según edad y sexo. El grupo de referencia fue el de 10-14 años y el sexo femenino. Se registraron 198,485 muertes por Homicidio, con un promedio anual de 14,177 y diario de 39. La principal causa fue ataque con arma de fuego y explosivos(56%. El riesgo relativo más alto fue para el grupo de 35-39 años, con RR 15,4 IC(95% 14,9-16,0, en comparación al de referencia. El sexo masculino presentó un riesgo relativo 10,1 veces mayor que el femenino, ajustado por edad IC10.0-10.3. Los resultados llaman la atención sobre la necesidad de profundizar y analizar el problema de los homicidios bajo una perspectiva multidisciplinaria.A study of homicide in the population of Mexico, was undertaken for the purpose of discovering the mortality panorama by this cause during 1979-1992. Homicide mortality trends were analized, as well as the main causes by age and sex. Rate by cause and sex were also analized using a Poisson Regression model. The variables were: age, sex, year, external cause of intentional injuries ICD 9th. E960-E969. Results: The total number of deaths due to homicide was 198,485. Each day 35 persons die in Mexico as a result of homicide. Men were more affected than women with a RR of 10.1 and CI (95%14.9-16.0, adjusted for age. The main cause 56% was homicide by firearms and explosives.The high relative risk was for those aged from 35 to 39 with an RR of 15.4 CI 14.9-16.0. To the cause assault by other and unspecified means, the elderly population has a RR of 21.2 IC 19.7-22.9. Further research in the area and prevention should make use of a multidisciplinary approach in considering the

  14. Proton pickup from /sup 27/Al via the (n,d) reaction at 56. 3 MeV

    Energy Technology Data Exchange (ETDEWEB)

    Brady, F P; Shepard, J R; King, N S.P.; McNaughton, M W; Wang, J C [California Univ., Davis (USA)

    1977-09-26

    Energy spectra of deuterons from the /sup 27/Al(n,d)/sup 26/Mg reaction due to 56.3 MeV neutrons incident have been measured for 10/sup 0/ <= thetasub(c.m.) <= 55 /sup 0/. The angular distributions for the excitations observed at 0.0, 1.81, and 4.33 MeV are quite well described by DWBA calculations and yield spectroscopic factors in agreement with shell model calculations; but with calculations based on the rotational model, the agreement is less satisfactory particularly for the 4.33 MeV level. For the states at 7.86 and 9.16 MeV the fits, assuming p-shell pick-up, are only fair. Comparison with /sup 27/Al(d,/sup 3/He)/sup 26/Mg measurements shows that the deduced spectroscopic factors for the two reactions agree quite well.

  15. Evaluation of an IPCC climate report. An analysis of conclusions on the possible regional consequences of climate change

    International Nuclear Information System (INIS)

    2010-01-01

    This report contains the results of a study of the reliability of the regional chapters (H9-16) of the contribution of Working Group II to the Fourth Climate Report of the IPCC (the sub report on consequences, adaptation and vulnerability). Moreover an assessment was made of the possible consequences of errors for the conclusions in the high level summaries of that report. The Netherlands Environmental Assessment Agency did not detect any errors that may undermine the main conclusions of the scientific UN Climate Panel IPCC of 2007 on the possible future consequences of climate change. However, some of the substantiations of the conclusions lack clarity. To prevent lack of clarity and inaccuracies the IPCC needs to invest more in quality checks. [nl

  16. Rapid sea level rise in the aftermath of a Neoproterozoic snowball Earth.

    Science.gov (United States)

    Myrow, P M; Lamb, M P; Ewing, R C

    2018-04-19

    Earth's most severe climate changes occurred during global-scale snowball-Earth glaciations, which profoundly altered Earth's atmosphere, oceans, and biosphere. Extreme rates of glacio-eustatic sea-level rise are a fundamental prediction of the snowball Earth hypothesis, but supporting geologic evidence is lacking. We use paleohydraulic analysis of wave ripples and tidal laminae of the Elatina Formation, Australia - deposited following the Marinoan glaciation ca. 635Ma - to show that water depths of 9-16m remained nearly constant for ~100yrs throughout 27m of sediment accumulation. This accumulation rate was too great to have been accommodated by subsidence, and instead indicates an extraordinarily rapid rate of sea-level rise (0.2-0.27m/yr). Our results substantiate a fundamental prediction of snowball Earth models of rapid deglaciation during the early transition to a super-greenhouse climate. Copyright © 2018, American Association for the Advancement of Science.

  17. Optical fiber design with orbital angular momentum light purity higher than 99.9.

    Science.gov (United States)

    Zhang, Zhishen; Gan, Jiulin; Heng, Xiaobo; Wu, Yuqing; Li, Qingyu; Qian, Qi; Chen, Dongdan; Yang, Zhongmin

    2015-11-16

    The purity of the synthesized orbital-angular-momentum (OAM) light in the fiber is inversely proportional to channel crosstalk level in the OAM optical fiber communication system. Here the relationship between the fiber structure and the purity is firstly demonstrated in theory. The graded-index optical fiber is proposed and designed for the OAM light propagation with the purity higher than 99.9%. 16 fiber modes (10 OAM modes) have been supported by a specific designed graded-index optical fiber with dispersion less than 35 ps/(km∙nm). Such fiber design has suppressed the intrinsic crosstalk to be lower than -30 dB, and can be potentially used for the long distance OAM optical communication system.

  18. Adverse life events as risk factors for behavioural and emotional problems in a 7-year follow-up of a population-based child cohort

    DEFF Research Database (Denmark)

    Rasmussen, Cathrine Skovmand; Nielsen, Louise Gramstrup; Petersen, Dorthe Janne

    2014-01-01

    on emotional and behavioural problems was obtained from parents filling in the Child Behavior Checklist (CBCL) when the child was 8-9 and again when 15 years old. Data on risk factors was drawn from Danish registers. Analysis used was logistic regression for crude and adjusted change. Results: Parental divorce......Background and aim: The aim of the study was to identify risk factors for significant changes in emotional and behavioural problem load in a community-based cohort of Danish children aged 9-16 years, the risk factors being seven parental and two child-related adverse life events. Methods: Data...... significantly raised the odds ratio of an increase in emotional and behavioural problems; furthermore, the risk of deterioration in problem behaviour rose significantly with increasing number of adverse life events. By dividing the children into four groups based on the pathway in problem load (increasers...

  19. Association of Genetic Loci With Glucose Levels in Childhood and Adolescence A Meta-Analysis of Over 6,000 Children

    DEFF Research Database (Denmark)

    Barker, A.; Sharp, S. J.; Timpson, N. J.

    2011-01-01

    with fasting glucose were genotyped in six studies of children and adolescents of European origin, including over 6,000 boys and girls aged 9-16 years. We performed meta-analyses to test associations of individual SNPs and a weighted risk score of the 16 loci with fasting glucose. RESULTS-Nine loci were...... glucose loci. Children and adolescents carrying glucose-raising alleles of G6PC2, MTNR1B, GCK, and GLIS3 also showed reduced p-cell function, as indicated by homeostasis model assessment of beta-cell function. Analysis using a weighted risk score showed an increase [beta (95% CI)] in fasting glucose level....... In nondiabetic adults, fasting glucose changes little over time, and our results suggest that age-independent effects of fasting glucose loci contribute to long-term interindividual differences in glucose levels from childhood onwards. Diabetes 60:1805-1812, 2011...

  20. Movement of 59Fe in Egyptian soils as affected by chelated agents

    International Nuclear Information System (INIS)

    Massoud, M.A.; Omar, M.A.; Abd-El-Sapour, M.F.

    1983-01-01

    An investigation was undertaken to study the mobility of Fe from different Fe carries; i.e. Fe 2 (So 4 ) 3 , Fe-EDDHA and Fe-DTPA, the results revealed that almost the total mobilization of Fe 2 (So 4 ) 3 beyond the top layer (1-2 cm) ranged from 35.3, 10.4 and 1.9% of added 59Fe to three investigated soils, i.e. Anshas, Sakha and Burg El-Arab. The corresponding values for Fe-EDDHA ranged from 29.9, 20.4 and 14.9%, while for Fe-DTPA it ranged from 46.9, 16.5 and 11.1 when Fe was added as EDDHA and DTPA. It was noticed that the immobilization of Fe was higher in the calcareous than in the alluvial and sandy soils

  1. Movement of /sup 59/Fe in Egyptian soils as affected by chelated agents

    Energy Technology Data Exchange (ETDEWEB)

    Massoud, M.A.; Omar, M.A.; Abd-El-Sapour, M.F. (Agriculture Department for Soil and Water, Nuclear Research Centre, A.E.A., Cairo (Egypt))

    1983-01-01

    An investigation was undertaken to study the mobility of Fe from different Fe carries; i.e. Fe/sub 2/(So/sub 4/)/sub 3/, Fe-EDDHA and Fe-DTPA, the results revealed that almost the total mobilization of Fe/sub 2/(So/sub 4/)/sub 3/ beyond the top layer (1-2 cm) ranged from 35.3, 10.4 and 1.9% of added 59Fe to three investigated soils, i.e. Anshas, Sakha and Burg El-Arab. The corresponding values for Fe-EDDHA ranged from 29.9, 20.4 and 14.9%, while for Fe-DTPA it ranged from 46.9, 16.5 and 11.1 when Fe was added as EDDHA and DTPA. It was noticed that the immobilization of Fe was higher in the calcareous than in the alluvial and sandy soils.

  2. Clinical application of percutaneous needling lung abscess drairnage under CT guidance

    International Nuclear Information System (INIS)

    Hu Xiaokun; Wang Mingyou; Li Chenjun; Lv Dongfang; Li Xiaodong; Yu Zhaocun

    2004-01-01

    Objective: To discuss the clinical application of drainage for lung abscess by needle puncture under CT guidance. Methods: 18 cases of lung abscess were drainaged by needle puncture under CT guidance, including direct aspiration by puncture needle 1-3 times (n=8) and retaining drainage tube continuously (n=10). Results: 17 cases with this procedure were succeeded possessing success rate of 94.7%(17/18). The patients were followed up for 11-35 days with symptom relieving better obviously and the focus shrinkage or disappeared (n=16), the curative rate reached 88.9%(16/18). The main complication was pneumothorax with capacities of 30%(n=1). Conclusions: The curative course of lung abscess can be shortened greatly by percutaneous needling drainage under CT guidance with mild trauma. The procedure is simple with high successful rate and less complication. (authors)

  3. Conceptual thermal design and analysis of a far-infrared/mid-infrared remote sensing instrument

    Science.gov (United States)

    Roettker, William A.

    1992-07-01

    This paper presents the conceptual thermal design and analysis results for the Spectroscopy of the Atmosphere using Far-Infrared Emission (SAFIRE) instrument. SAFIRE has been proposed for Mission to Planet Earth to study ozone chemistry in the middle atmosphere using remote sensing of the atmosphere in the far-infrared (21-87 microns) and mid-infrared (9-16 microns) spectra. SAFIRE requires that far-IR detectors be cooled to 3-4 K and mid-IR detectors to 80 K for the expected mission lifetime of five years. A superfluid helium dewar and Stirling-cycle cryocoolers provide the cryogenic temperatures required by the infrared detectors. The proposed instrument thermal design uses passive thermal control techniques to reject 465 watts of waste heat from the instrument.

  4. Chemical constituents of the essential oil and organic acids from longkong (Aglaia dookkoo Griff. fruits

    Directory of Open Access Journals (Sweden)

    Abdulhakim Hamad

    2006-03-01

    Full Text Available The pulp of longkong fruits (Aglaia dookkoo Griff., collected from Narathiwat province, was dried and extracted by steam distillation to obtain the essential oil in 0.48% yield. The GC-MS data showed oleic acid (14.80%, α-copaene (11.15%, germacrene-D (9.16%, δ- cadinene (6.74%, τ -muurolol (6.34%, (+ spathulenol (5.72% and palmitic acid (5.49% as the major constituents. Organic acids were also extracted from dried pulp with methanol using a Soxhlet apparatus to give the crude extract in 36.26% yield. Four organic acids: glycolic, maleic, malic and citric acids were determined by HPLC. Maleic acid (1.23% was the major acid and the others were citric (0.22%, malic (0.15% and glycolic acids (0.14%.

  5. Phase II Interim Report - Assessment of Hydrocarbon Seepage Detection Methods on the Fort Peck Reservation, Northeast Montana; SEMIANNUAL

    International Nuclear Information System (INIS)

    Monson, Lawrence M.

    2002-01-01

    The following work was performed: (1) collected reconnaissance micro-magnetic data and background field data for Area 1, (2) identified and collected soil sample data in three anomalous regions of Area 1, (3) sampled soils in Northwest Poplar Oil Field, (4) graphed, mapped, and interpreted all data areas listed above, (5) registered for the AAPG Penrose Conference on Hydrocarbon Seepage Mechanisms and Migration (postponed from 9/16/01 until 4/7/02 in Vancouver, B.C.). Results include the identification and confirmation of an oil and gas prospect in the northwest part of Area 1 and the verification of a potential shallow gas prospect in the West Poplar Area. Correlation of hydrocarbon micro-seepage to TM tonal anomalies needs further data analysis

  6. Lactobacillus apodemi sp. nov., a tannase-producing species isolated from wild mouse faeces.

    Science.gov (United States)

    Osawa, Ro; Fujisawa, Tomohiko; Pukall, Rüdiger

    2006-07-01

    A Gram-positive, rod-shaped, non-endospore-forming bacterium, strain ASB1(T), able to degrade tannin, was isolated from faeces of the Japanese large wood mouse, Apodemus speciosus. Comparative analysis of the 16S rRNA gene sequence revealed that the strain could be assigned as a member of the genus Lactobacillus. The nearest phylogenetic neighbours were determined as Lactobacillus animalis DSM 20602(T) (98.9 % 16S rRNA gene sequence similarity) and Lactobacillus murinus ASF 361 (98.9 %). Subsequent polyphasic analysis, including automated ribotyping and DNA-DNA hybridization experiments, confirmed that the isolate represents a novel species, for which the name Lactobacillus apodemi sp. nov. is proposed. The DNA G+C content of the novel strain is 38.5 mol%. The cell-wall peptidoglycan is of type A4alpha L-lys-D-asp. The type strain is ASB1(T) (=DSM 16634(T)=CIP 108913(T)).

  7. Genetic diversity of plasmodium vivax merozoite surface protein-3alpha (Pvmsp-3alpha) gene in Jhapa District of Nepal

    DEFF Research Database (Denmark)

    Adhikari, Madhav; Ranjitkar, Samir; Schousboe, Mette Leth

    2012-01-01

    In Nepal, Plasmodium vivax accounts for approximately 80-90% of the malaria cases, but limited studies have been conducted on the genetic diversity of this parasite population. This study was carried out to determine the genetic diversity of P. vivax population sampled from subjects living...... in an endemic area of Jhapa District by analyzing the polymorphic merozoite surface protein-3alpha (Pvmsp-3alpha) gene by using PCR-restriction fragment length polymorphism. Three distinct genotypes were obtained from 96 samples; type A: 40 (71%), type B: 7 (13%), and type C: 9 (16%) which could be categorized...... into 13 allelic patterns: A1-A9, B1, B2, C1 and C2. These results indicated a high genetic diversity within the studied P. vivax population. As the transmission rate of malaria is low in Nepal, the diversity is most likely due to migration of people between the malaria endemic regions, either within...

  8. Phase II Interim Report -- Assessment of Hydrocarbon Seepage Detection Methods on the Fort Peck Reservation, Northeast Montana

    Energy Technology Data Exchange (ETDEWEB)

    Monson, Lawrence M.

    2002-04-24

    The following work was performed: (1) collected reconnaissance micro-magnetic data and background field data for Area 1, (2) identified and collected soil sample data in three anomalous regions of Area 1, (3) sampled soils in Northwest Poplar Oil Field, (4) graphed, mapped, and interpreted all data areas listed above, (5) registered for the AAPG Penrose Conference on Hydrocarbon Seepage Mechanisms and Migration (postponed from 9/16/01 until 4/7/02 in Vancouver, B.C.). Results include the identification and confirmation of an oil and gas prospect in the northwest part of Area 1 and the verification of a potential shallow gas prospect in the West Poplar Area. Correlation of hydrocarbon micro-seepage to TM tonal anomalies needs further data analysis.

  9. Complications of cochlear implant surgery: A ten-year experience in a referral hospital in Peru, 2006-2015.

    Science.gov (United States)

    Alcas, Olenka; Salazar, Miguel A

    2016-09-01

    To describe the frequency and characteristics of complications of cochlear implant (CI) surgery at Edgardo Rebagliati Martins Hospital of social security in Lima-Peru between 2006 and 2015. A retrospective descriptive study of patients that underwent CI surgery between August 2006 and December 2015. Among the 107 patients with CIs, the overall proportion of complications was 18.7% (20/107): 14.9% (16/107) of minor complications, and 3.7% (4/107) of major complications. Regarding the time of onset of complications, 2.8% (3/107) were intraoperative and 14% (15/107) postoperative. CI surgery in Peru is a safe procedure with a low frequency of major complications, representing an effective therapy for patients with sensorineural hearing loss who do not respond to hearing aids.

  10. Global Epidemiology and Burden of Schizophrenia

    DEFF Research Database (Denmark)

    Charlson, Fiona J; Ferrari, Alize J; Santomauro, Damian F

    2018-01-01

    countries. Method: We conducted a systematic review to identify studies reporting the prevalence, incidence, remission, and/or excess mortality associated with schizophrenia. Reported estimates which met our inclusion criteria were entered into a Bayesian meta-regression tool used in GBD 2016 to derive...... prevalence for 20 age groups, 7 super-regions, 21 regions, and 195 countries and territories. Burden of disease estimates were derived for acute and residual states of schizophrenia by multiplying the age-, sex-, year-, and location-specific prevalence by 2 disability weights representative of the disability......-standardized point prevalence rates did not vary widely across countries or regions. Globally, prevalent cases rose from 13.1 (95% UI: 11.6-14.8) million in 1990 to 20.9 (95% UI: 18.5-23.4) million cases in 2016. Schizophrenia contributes 13.4 (95% UI: 9.9-16.7) million years of life lived with disability to burden...

  11. Properties of aerogels in glazings

    DEFF Research Database (Denmark)

    Schultz, Jørgen Munthe

    1998-01-01

    This report describes the final tests carried out on an advanced apparatus for measurement of thermal conductivity of materials at atmospheric pressure and different levels of evacuation. The apparatus was designed and constructed in the phase 1 of the project. Difficulties with the control system...... have been solved and measurements have been carried out on common polystyrene foam insulation at atmospheric pressure. The measurements have been compared with results from reference measurements and a difference of only 0.3% was found in measured thermal conductivity. Measurements on monolithic silica...... aerogel were performed at 5 different pressure levels in the range 0.2 - 1000 hPa. The measured equivalent thermal conductivity is in the range 8.9 - 16.4 mW/(m K) which corresponds very well with results obtained by institutes in Germany and France....

  12. Early parenting, represented family relationships, and externalizing behavior problems in children born preterm.

    Science.gov (United States)

    Poehlmann, Julie; Burnson, Cynthia; Weymouth, Lindsay A

    2014-01-01

    Through assessment of 173 preterm infants and their mothers at hospital discharge and at 9, 16, 24, 36, and 72 months, the study examined early parenting, attachment security, effortful control, and children's representations of family relationships in relation to subsequent externalizing behavior problems. Less intrusive early parenting predicted more secure attachment, better effortful control skills, and fewer early behavior problems, although it did not directly relate to the structural or content characteristics of children's represented family relationships. Children with higher effortful control scores at 24 months had more coherent family representations at 36 months. Moreover, children who exhibited less avoidance in their family representations at 36 months had fewer mother-reported externalizing behavior problems at 72 months. The study suggests that early parenting quality and avoidance in children's represented relationships are important for the development of externalizing behavior problems in children born preterm.

  13. President Ilves sõitis USAsse poega õnnitlema / Jaan Väljaots

    Index Scriptorium Estoniae

    Väljaots, Jaan, 1968-

    2009-01-01

    President Toomas Hendrik Ilves on koos proua Evelin Ilvese ja kümneliikmelise IT-ettevõtjate äridelegatsiooniga 9.-16.06.2009 töövisiidil USA läänerannikul California osariigis, et tutvustada Eestit ja Eesti tehnoloogiaettevõtjaid ning edendada teadus- ja kõrgtehnoloogia arenduse piirkonnas Silicon Valleys koostööd kohalike ettevõtjatega. Visiidi sisse mahub presidendi poja Luukas Kristjan Ilvese lõpuaktus Stanfordi ülikoolis. Selgitab presidendi pressinõunik Toomas Sildam. Vt. samas: Evelin Ilves: rasvumisega tuleb võidelda kõikjal. Presidendi abikaasa tutvus San Franciscos sotsiaalprojektiga "Glide" ning kohtus Standfordi meditsiinikoolis toitumisspetsialistide ja pediaatritega. Vt. ka juhtkiri lk. 6: Kaks ühe hinnaga

  14. Biodiversity, threats and conservation challenges in the Cerrado of Amapá, an Amazonian savanna

    Directory of Open Access Journals (Sweden)

    Karen Mustin

    2017-10-01

    Full Text Available An Amazonian savanna in northern Brazil known as the Cerrado of Amapá is under imminent threat from poor land-use planning, the expansion of large-scale agriculture and other anthropogenic pressures. These savannas house a rich and unique flora and fauna, including endemic plants and animals. However, the area remains under-sampled for most taxa, and better sampling may uncover new species. We estimate that only ~9.16% of these habitats have any kind of protection, and legislative changes threaten to further weaken or remove this protection. Here we present the status of knowledge concerning the biodiversity of the Cerrado of Amapá, its conservation status, and the main threats to the conservation of this Amazonian savanna. To secure the future of these unique and imperilled habitats, we suggest urgent expansion of protected areas, as well as measures that would promote less-damaging land uses to support the local population.

  15. Reliability of the detailed assessment of speed of handwriting on Flemish children.

    Science.gov (United States)

    Simons, Johan; Probst, Michel

    2014-01-01

    This study evaluates the reliability of the Detailed Assessment of Speed of Handwriting (DASH) in a Dutch-speaking sample of children. The sample included 650 boys and 513 girls (age range = 9-16 years). Handwriting speed measurements were obtained using the DASH. Interrater agreement, test-retest reliability, and internal consistency were calculated; gender and age effects were analyzed. Interrater agreement shows excellent reliability with intraclass correlation coefficients of at least 0.94. Test-retest correlations ranged from r = 0.65 to r = 0.81. The internal consistency measures, calculated with Cronbach's alpha, were between 0.88 and 0.94. Both gender and age have a significant effect on handwriting speed, with F (7.1144) = 17.43 (P handwriting speed of Dutch-speaking children. There is a tendency of girls to write faster than boys.

  16. The effect of self-directed virtual reality simulation on dissection training performance in mastoidectomy

    DEFF Research Database (Denmark)

    Andersen, Steven Arild Wuyts; Foghsgaard, Søren; Konge, Lars

    2016-01-01

    OBJECTIVES/HYPOTHESIS: To establish the effect of self-directed virtual reality (VR) simulation training on cadaveric dissection training performance in mastoidectomy and the transferability of skills acquired in VR simulation training to the cadaveric dissection training setting. STUDY DESIGN......: Prospective study. METHODS: Two cohorts of 20 novice otorhinolaryngology residents received either self-directed VR simulation training before cadaveric dissection training or vice versa. Cadaveric and VR simulation performances were assessed using final-product analysis with three blinded expert raters....... RESULTS: The group receiving VR simulation training before cadaveric dissection had a mean final-product score of 14.9 (95 % confidence interval [CI] [12.9-16.9]) compared with 9.8 (95% CI [8.4-11.1]) in the group not receiving VR simulation training before cadaveric dissection. This 52% increase...

  17. Chemical composition and evaluation of the antimicrobial activity of the essential oil from leaves of Eugenia platysema.

    Science.gov (United States)

    Tenfen, Adrielli; Siebert, Diogo Alexandre; Yamanaka, Celina Noriko; Mendes de Córdova, Caio Maurício; Scharf, Dilamara Riva; Simionatto, Edésio Luiz; Alberton, Michele Debiasi

    2016-09-01

    This study describes the qualitative and quantitative chemical composition and evaluates the antibacterial activity of essential oil from Eugenia platysema leaves. Analysis by GC-FID and GC-MS allowed the identification of 22 compounds. Different from the other species of the Eugenia genus, the major compound found in the essential oil was the diterpene phytol (66.05%), being this the first report of the presence of this compound in the essential oils from Eugenia genus. The sesquiterpene elixene was the second most concentrated compound in the studied essential oil (9.16%). The essential oil from E. platysema was tested for its antibacterial activity against cell-walled bacteria and mollicute strains of clinical interest using the microdilution broth assay. The results showed that the essential oil of E. platysema was inactive until 1000 μg mL(-1) against tested bacteria.

  18. Effect of diets containing whole cottonseed on the quality of sheep semen - doi: 10.4025/actascianimsci.v34i3.12963

    Directory of Open Access Journals (Sweden)

    Adriana Trindade Soares

    2012-05-01

    Full Text Available This study evaluated the semen quality of Santa Ines sheep fed diets containing different levels of whole cottonseed (WCS. Twenty sheep were distributed into four groups that were given diets with 0; 20; 30; 40% of WCS. For this study the semen was collected by electroejaculation, and a monthly andrological examination was performed during nine months. The analyzed variables were: scrotal circumference (SC, appearance and color of the ejaculate, progressive motility (PM, vigor, mass movement (MM, total sperm concentration (spzX109, sperm morphology (SM and blood hematocrit. The SC had no difference among diets, with mean 31.83 cm. The animals fed diets with WCS, presented mean intake of 9.16 mg gossypol kg BW, and were prone to present greenish semen, and appearance ranging from thin creamy to watery. The PM decreased linearly (p

  19. Field Assessment of Gopher Tortoise Habitat at Camp Shelby, MS. Phase II: Overstory and Combined Assessments

    Science.gov (United States)

    2010-10-17

    Magnolia virginiana 0 4.5 0 3.3 0 8.4 Nyssa sylvatica 0 6.7 0 8.8 0 2.5 Pinus echinata 0 0.2 1.8 0.7 0 0 Pinus elliotii 0 0 0.9 0 0.7 0 Pinus...palustris 93.0 53.4 71.9 38.2 88.1 73.6 Pinus taeda 0.5 5.3 0.9 8.8 0.7 1.9 Prunus serotina 0 6.7 1.4 1.1 0 0 Quercus spp. (red) 4.9 16.7 16.1 10.6

  20. Effect of communication style and physician-family relationships on satisfaction with pediatric chronic disease care.

    Science.gov (United States)

    Swedlund, Matthew P; Schumacher, Jayna B; Young, Henry N; Cox, Elizabeth D

    2012-01-01

    Over 8% of children have a chronic disease and many are unable to adhere to treatment. Satisfaction with chronic disease care can impact adherence. We examine how visit satisfaction is associated with physician communication style and ongoing physician-family relationships. We collected surveys and visit videos for 75 children ages 9-16 years visiting for asthma, diabetes, or sickle cell disease management. Raters assessed physician communication style (friendliness, interest, responsiveness, and dominance) from visit videos. Quality of the ongoing relationship was measured with four survey items (parent-physician relationship, child-physician relationship, comfort asking questions, and trust in the physician), while a single item assessed satisfaction. Correlations and chi square were used to assess association of satisfaction with communication style or quality of the ongoing relationship. Satisfaction was positively associated with physician to parent (p relationships (p communication style and the quality of the ongoing relationship contribute to pediatric chronic disease visit satisfaction.

  1. Pichicuco 6: Gulf of California CTD Data Report. R/V New Horizon,

    Science.gov (United States)

    1984-11-01

    cSient ists at Cent ro dj( Oceariografia Fisica eit re ivestilgadores, del Cell - . Inivestilgaciin CieriTica N Ldiucaciori Suiperior de’ t ro de...1 16 STAMIN PC6092 28 37.0 N 112 55.8 W 23/11/84 2054Z 896/1260mn Temperature a2.9 4.93 6.9 8.9 19.9 12.9 14.9 16.9 18.2 22.9 22.9 24.9 26.2 28.2 622...50.0 14.258 34.933 26.101 140.0 9.619 34.694 26.800 60.0 14.132 34.915 26.114 4 1 . . .. 1 󈧪 STAMIN PC6114 28 37.6 N 112 38.6 W 24/11/84 245Z 486/ 365m

  2. Radiation therapy in aged lung cancer patients

    International Nuclear Information System (INIS)

    Ohtake, Eiji; Tobari, Chitose; Matsui, Kengo; Iio, Masahiro.

    1982-01-01

    The results and problems of radiotherapy were analyzed in 57 lung cancer patients more than 65 years of age (average age: 74.8 years). Of these, 45 (79%) were irradiated with a total dose exceeding 40 Gy. In these patients, the median survival was 13 months for Stages I and II, 6.5 months for Stage III, and 5 months for Stage IV. The results of combined radiotherapy and chemotherapy were better than those of radiotherapy alone. Also, slightly better results were obtained in patients treated with split-course than continuous-course irradiation. In aged lung cancer patients the prognosis was highly influenced by their respiratory function. Double cancers were present in 9 (16%) of the 57 patients. (author)

  3. Source of sulphur in the Ebro Basin (Northern Spain). Tertiary nonmarine evaporite deposits as evidenced by sulphur isotopes

    International Nuclear Information System (INIS)

    Birnbaum, S.J.; Coleman, D.

    1979-01-01

    The Ebro Basin is an intermontane basin, located in northern Spain, filled with Tertiary (largely Oligocene and Miocene) elastic and chemical deposits. Sulphur isotopes are utilized to determine the source of sulphur in the sulphate deposits (predominantly gypsum with accessory thenardite, mirabolite and epsomite). Data obtained from Tertiary gypsum rocks produce a range of delta 34 S values from +9.16% to + 14.02% with a mean of +13.61%. Data obtained from Triassic gypsum rocks (in source area) produce a range from +13.73% to +15.14%, with a mean of +14.66%. Values for Tertiary marine water range from +18% to +24%. These data indicate a nonmarine origin for sulpur within the Tertiary sulphate rocks. The contribution of Triassic sulphur to the groundwater system, plus varying degrees of dilution by isotopically lighter (atmospheric and sulphide) sulphur, best explains the isotopic ratios observed in the Tertiary Basin deposits. (Auth.)

  4. Fabry disease in children

    DEFF Research Database (Denmark)

    Borgwardt, Line Gutte; Feldt-Rasmussen, U; Rasmussen, Aase Krogh

    2013-01-01

    retrospective cohort study of 10 children (9-16 years at baseline), who underwent regular systematic investigations for 1-8 years after initiation of ERT with agalsidase-beta (Fabryzyme®, Genzyme). Ophthalmological, echocardiographic abnormalities and hypohidrosis were found at baseline and during the follow......Fabry disease is a rare, multiorgan disease. The most serious complications involve the kidney, brain and heart. This study aims to assess the effect of enzyme replacement therapy (ERT) using agalsidase-beta in children with Fabry disease. We carried out a nationwide, descriptive and observational......-up period. Serious kidney, heart or brain involvement had not developed at the last follow-up examination. For the majority of the patients improvements were found concerning headache, acroparaesthesias and gastrointestinal pain during the follow-up period. The level of energy and physical activity also...

  5. Cosmic expansion and growth histories in Galileon scalar-tensor models of dark energy

    International Nuclear Information System (INIS)

    Kobayashi, Tsutomu

    2010-01-01

    We study models of late-time cosmic acceleration in terms of scalar-tensor theories generalized to include a certain class of nonlinear derivative interaction of the scalar field. The nonlinear effect suppresses the scalar-mediated force at short distances to pass solar-system tests of gravity. It is found that the expansion history until today is almost indistinguishable from that of the ΛCDM model or some (phantom) dark energy models, but the fate of the universe depends clearly on the model parameter. The growth index of matter density perturbations is computed to show that its past asymptotic value is given by 9/16, while the value today is as small as 0.4.

  6. Differences in essential fatty acid requirements by enteral and parenteral routes of administration in patients with fat malabsorption

    DEFF Research Database (Denmark)

    Jeppesen, Palle B; Høy, Carl-Erik; Mortensen, Per B

    1999-01-01

    Background: Essential fatty acid (EFA) requirements of patients receiving home parenteral nutrition (HPN) are uncertain. Objective: The objective was to evaluate the influence of the route of administration (enteral compared with parenteral) on plasma phospholipid EFA concentrations. Design......: Intestinal absorption, parenteral supplement of EFAs, and plasma phospholipid EFA concentrations were investigated in balance studies in 4 groups (A, B, C, and D) of 10 patients with short-bowel syndrome and a fecal loss of >2000 kJ/d. Groups A (fat malabsorption 50%) did...... absorption was negligible in groups C and D. Thus, intestinal absorption of EFAs in group A. corresponded to parenteral EFA supplements in group C, whereas group D was almost totally deprived of EFAs. The median plasma phospholipid concentration of linoleic acid decreased by 21.9%, > 16.3%, >13.8%, 11...

  7. Anaerostipes caccae gen. nov., sp. nov., a new saccharolytic, acetate-utilising, butyrate-producing bacterium from human faeces.

    Science.gov (United States)

    Schwiertz, Andreas; Hold, Georgina L; Duncan, Sylvia H; Gruhl, Barbel; Collins, Matthew D; Lawson, Paul A; Flint, Harry J; Blaut, Michael

    2002-04-01

    Two strains of a previously undescribed Eubacterium-like bacterium were isolated from human faeces. The strains are Gram-variable, obligately anaerobic, catalase negative, asporogenous rod-shaped cells which produced acetate, butyrate and lactate as the end products of glucose metabolism. The two isolates displayed 99.9% 16S rRNA gene sequence similarity to each other and treeing analysis demonstrated the faecal isolates are far removed from Eubacterium sensu stricto and that they represent a new subline within the Clostridium coccoides group of organisms. Based on phenotypic and phylogenetic criteria, it is proposed that the two strains from faeces be classified as a new genus and species, Anaerostipes caccae. The type strain of Anaerostipes caccae is NCIMB 13811T (= DSM 14662T).

  8. Mobility and Distribution of 14C-Endosulfan in Soils

    International Nuclear Information System (INIS)

    Anurakponsatorn, P.; Pakkong, P.; Parkpian, P.

    1998-01-01

    Chromatographic packed-soil Column was used to study the relative mobility and distribution of endosulfan in soil. With water saturated flow and gravity, Phrabat soil (PakChong Series) showed much more relative mobility and distribution than Rangsit soil (Rangsit Series). This was agreed with soil permeability of the two soils with were 0.34 and 9.16 mm/hr for Rangsit soil and Phrabat soil, respectively. This result was in agreeable with the adsorption coefficient (k d ) of the two soils which was higher in Rangsit soil compared to Phrabat soil. The distribution of endosulfan was found mostly in the top 10 cm of soil. As expected distribution to deeper extend was observed in Phrabat soil

  9. Hiedelberg AAF, Germany Revised Uniform Summary of Surface Weather Observations (RUSSWO) Parts A-F.

    Science.gov (United States)

    1981-10-05

    P’EE’i 10 Z6 -5 -4 Z - -2v -->2 - . I -l ’A --. 1. 5/16 0 NO CELIN -- 14.9 16.6 17.1 19.8 20*0 21.1 21.3 21.7 22.5 22.5 22.5 22.6 22.7 22.7 22.8 >_000...99.7100.0 00.0100.0100.0 00.000.0 cOo 0o. TOTAL NUMBER OF OBSERVATIONS 9 USAF "TAC ,W 64 0-14-5 (OL A) P.e .OU.. DION OF VNI FON ANN.. ...... . -r4 -A V

  10. Home Environmental and Behavioral Risk Indices for Reading Achievement.

    Science.gov (United States)

    Taylor, Jeanette; Ennis, Chelsea R; Hart, Sara A; Mikolajewski, Amy J; Schatschneider, Christopher

    2017-07-01

    The goal of this study was to identify home environmental and temperament/behavior variables that best predict standardized reading comprehension scores among school-aged children. Data from 269 children aged 9-16 ( M = 12.08; SD = 1.62) were used in discriminant function analyses to create the Home and Behavior indices. Family income was controlled in each index. The final Home and Behavior models each classified around 75% of cases correctly (reading comprehension at grade level vs. not). Each index was then used to predict other outcomes related to reading. Results showed that Home and/or Behavior accounted for 4-7% of the variance in reading fluency and spelling and 20-35% of the variance in parent-rated problems in math, social anxiety, and other dimensions. These metrics show promise as environmental and temperament/behavior risk scores that could be used to predict and potentially screen for further assessment of reading related problems.

  11. Seasonal variation of daily physical activity in individuals with heart failure

    Directory of Open Access Journals (Sweden)

    Michael J. Shoemaker

    2016-09-01

    Full Text Available BackgroundPrevious studies indicate that seasonal variation affects daily physical activity (PA, but none have investigated this relationship in individuals with heart failure (HF who also have implanted cardioverter defibrillators and cardiac resynchronization therapy (ICD/CRT devices. The purpose of the present study was to determine if seasonal variation in temperature affects daily PA in patients with HF and ICD/CRTs.Patients and methodsSecondary analysis of data from 16 subjects with HF and Medtronic® ICD/CRT devices enrolled in a randomized trial investigating interventions to improve daily PA. Due to the rolling study enrollment, daily PA data for all subjects were not available for the entire time frame and were divided into two groups. Determination of seasonal variation of daily PA was determined using visual analysis of daily PA plotted with average temperature, autocorrelation, visual analysis of seasonal subseries plots and boxplot analysis, as well as Wilcoxon signed-rank tests.ResultsSubjects 1-8 demonstrated the greatest differences in daily PA during periods of seasonal transition whereas subjects 9-16 demonstrated the greatest variation in daily PA with greatest seasonal temperature difference. Wilcoxon signed-rank testing of the lowest and highest months for daily PA revealed median differences of 0.30 (p = 0.050 and 0.36 hours (p = 0.036 for subjects 1-8 and 9-16, with effect sizes of 0.69 and 0.74, respectively.ConclusionsSeasonal variation in mean temperature appears to affect daily PA in individuals with HF and ICD/CRT devices by a magnitude of 0.30-0.36 hours, which may need to be accounted for in future research investigating interventions to improve daily PA.

  12. New Metacentric Populations and Phylogenetic Hypotheses Involving Whole-Arm Reciprocal Translocation in Mus musculus domesticus from Sicily, Southern Italy.

    Science.gov (United States)

    Castiglia, Riccardo; Capanna, Ernesto; Bezerra, Alexandra M R; Bizzoco, Domenico; Zambigli, Emanuela; Solano, Emanuela

    2015-01-01

    The house mouse Mus musculus domesticus is characterized by more than 100 metacentric populations, due to the occurrence of Robertsonian (Rb) fusions, together with the standard all-telocentric karyotype (2n = 40). We examined G-banded karyotypes of 18 mice from 10 localities in Sicily and describe 3 new metacentric populations: 'Ragusa Ibla' (IRAG), 2n = 33-36, Rb(2.4), Rb(5.6), Rb(9.16), Rb(13.17); 'Piana degli Albanesi' (IPIA), 2n = 23, Rb(1.18), Rb(2.15), Rb(3.5), Rb(4.12), Rb(6.11), Rb(7.8), Rb(9.16), Rb(10.14), Rb(13.17); 'Trapani' (ITRA), 2n = 22, Rb(1.18), Rb(2.15), Rb(3.7), Rb(4.12), Rb(5.9), Rb(6.11), Rb(8.16), Rb(10.14), Rb(13.17). Three mice belonged to the previously reported 'Castelbuono' race (ICAS), 2n = 24, which is very similar to the nearby 'Palermo' (IPAL) race, 2n = 26. Three Rb fusions not yet observed in wild mouse populations were identified: Rb(3.5), Rb(3.7) and Rb(5.9). Rb fusions shared among 4 races (IPIA, IRAG, ICAS, and IPAL) allowed us to describe their potential phylogenetic relationships. We obtained 2 alternative phylogenetic trees. The differences between them are mainly due to various modes of formation of IPIA and ITRA. In the first hypothesis, the specific Rb fusions occurred independently. In the second, those of IRAG originated from those of IPIA via whole-arm reciprocal translocations. © 2015 S. Karger AG, Basel.

  13. Successful endoscopic third ventriculostomy in children depends on age and etiology of hydrocephalus: outcome analysis in 51 pediatric patients.

    Science.gov (United States)

    Duru, Soner; Peiro, Jose L; Oria, Marc; Aydin, Emrah; Subasi, Canan; Tuncer, Cengiz; Rekate, Harold L

    2018-04-25

    Endoscopic third ventriculostomy (ETV) has become the method of choice in the treatment of hydrocephalus. Age and etiology could determine success rates (SR) of ETV. The purpose of this study is to assess these factors in pediatric population. Retrospective study on 51 children with obstructive hydrocephalus that underwent ETV was performed. The patients were divided into three groups per their age at the time of the treatment:  24 months of age. All ETV procedures were performed by the same neurosurgeon. Overall SR of ETV was 80% (40/51) for all etiologies and ages. In patients age SR was 56.2% (9/16), while 6-24 months of age was 88.9% (16/18) and > 24 months was 94.1% (16/17) (p = 0.012). The highest SR was obtained on aqueductal stenosis. SR of posthemorrhagic, postinfectious, and spina bifida related hydrocephalus was 60% (3/5), 50% (1/2), and 14.3% (1/7), respectively. While SR rate at the first ETV attempt was 85.3%, it was 76.9% in patients with V-P shunt performed previously (p = 0.000). Factors indicating a potential failure of ETV were young age and etiology such as spina bifida, other than isolated aqueductal stenosis. ETV is the method of choice even in patients with former shunting. Fast healing, distensible skulls, and lower pressure gradient in younger children, all can play a role in ETV failure. Based on our experience, ETV could be the first method of choice for hydrocephalus even in children younger than 6 months of age.

  14. Seleção de Fungicidas para Controle de Oídio em Eucalipto Selection of Fungicides for Control of Eucalypt Powdery Mildew

    Directory of Open Access Journals (Sweden)

    Rafaela Mazur Bizi

    2011-03-01

    Full Text Available

    O objetivo deste estudo foi encontrar fungicidas eficientes contra o oídio do eucalipto. Foram testados os fungicidas chlorothalonil (2 g/l, fenarimol (0,5 ml/l, enxofre (3 g/l, tebuconazole (1 ml/l, propiconazol 12,5% + trifloxistrobina 12,5% (0,6 ml/l, benzothiadiazol (1g/l, piraclostrobina 13,3% + epoxiconazol 5% (1ml/l e triadimenol (1 ml/l. Os fungicidas foram pulverizados em 30 mudas por tratamento de Eucalyptus benthamii, naturalmente infectadas. A doença foi avaliada aos 9, 16, 23, 30 e 37 dias após serem colocadas em um ambiente infectado, onde os sintomas foram classificados em uma escala de notas que variam de 0 (ausência de sintomas a 4 (sintoma muito forte. Os melhores tratamentos foram piraclostrobina + epoxiconazol, propiconazol + trifloxistrobina e triadimenol, apresentando um índice médio de infecção de 0,39 e 0,63 e 1,01, respectivamente.  
    The objective of this study was to find effective fungicides against eucalypt powdery mildew. Fungicides tested were chlorothalonil, fenarimol, sulfur, tebuconazole, propiconazole, benzothiazole, pyraclostrobin + epoxiconazole and triadimenol. These fungicides were sprayed on Eucalyptus benthamii seedlings in a greenhouse infested with powdery mildew. Severity was evaluated at 9, 16, 23, 30 and 37 days after spraying, classifying symptoms observed with a scale 0 (symptoms absent to 4 (strong symptoms. Best treatments were obtained with pyraclostrobin + epoxiconazole, propiconazole + trifloxystrobin and triadimenol, with an infection index average of 0.39, 0.63 and 1.01, respectively.

  15. Composition, functional properties and sensory characteristics of Mozzarella cheese manufactured from different somatic cell counts in milk

    Directory of Open Access Journals (Sweden)

    Evelise Andreatta

    2009-10-01

    Full Text Available In the present study, composition, functional properties and sensory characteristics of Mozzarella cheese produced from milk with somatic cell counts (SCC at low (800,000 cells/mL levels were investigated. Three batches of cheese were produced for each SCC category. The cheeses were vacuum packed in plastic bags and analysed after 2, 9, 16, 23 and 30 days of storage at 4ºC. SCC level did not affect the moisture, fat, total protein and ash content, mesophilic and psychrotrophic bacteria, and sensory parameters of Mozzarella cheese. However, meltability increased in cheese manufactured from high SCC milk. Results indicated that raw milk used to produce Mozzarella cheese should not contain high SCC (>800,000 cells/mL in order to avoid changes in the functional properties of the Mozzarella cheese.No presente estudo foram investigadas a composição, as propriedades funcionais e as características sensoriais do queijo Mussarela produzido a partir de leite com contagens de células somáticas (CCS em níveis baixos (800.000 CS/mL. Foram produzidos 3 lotes de queijo para cada CCS. Os queijos foram embalados a vácuo e analisados após 2, 9, 16, 23 e 30 dias de armazenamento a 4ºC. O nível de CS não afetou a umidade, os teores de gordura, proteína total e cinzas, os níveis de bactérias mesófilas e psicrotróficas, e os parâmetros sensoriais do queijo Mussarela. Entretanto, houve aumento da capacidade de derretimento no queijo fabricado com leite de alta CCS. Os resultados indicam que o leite cru utilizado para a produção de queijo Mussarela não deve conter níveis de CS acima de 800.000/mL, para evitar alterações nas propriedades funcionais do queijo Mussarela.

  16. The study of diagnosis status and, transfer time of stroke patients transferred by pre-hospital emergency medical system (EMS to Vali-Asr hospital in Arak City

    Directory of Open Access Journals (Sweden)

    Saiedeh Bahrampouri

    2013-08-01

    Full Text Available Introduction: Stroke is main cause of death and disability in worldwide and emergency care can decrease complications. Emergency Medical System transferred half of stroke patients to hospital, so improve accuracy of diagnosis may accelerated treatment. This study aimed to determine diagnosis status and, transfer time of stroke patients transferred by prehospital Emergency Medical System to hospital in Arak City. Methods: This study was descriptive -analytic study and all 43 patient’s records with a diagnosis of stroke that transferred by Emergency Medical System to hospital in Arak City was selected. The study Checklist was contained information about age, sex, type of accident prehospital, response time, scene time, transfer time and total time from inpatients records and Emergency Center statistics .Regarding data analysis,SPSS19 software and descriptive statistical tests were used. Results: Mean (SD of age all patients were 73/7±3/8 and 51/2% were women. Ambulance paramedics' stroke diagnosis was correct in 15 (34/9%,20(46/5%of false and 8(18/6% not diagnosed for stroke patients who initially presented to them. The most common non stroke conditions were confusion. Mean response time and scene time, transfer time and total time were 6/9,16/9,9/1 and 35/3 minutes, respectively. In patients with correct diagnose stroke, mean response, scene, transfer and total time were 7,17/1,3/9 and 35/7 minutes. The people with the wrong diagnosis or no diagnosis of stroke by emergency medical personnel were taken to hospital, Mean response, scene, transfer and total time were 6/9, 16/8,9/7 and 33/5 minutes. Conclusions: The results of this study showed that, the correct diagnosis by EMS personnel could be resulted faster transferring patient to definite treatment center.It is recommended to develop prehospital diagnosis tool of stroke, which is contextually adapted and appropriate to facilitate diagnose of strokes and improve the quality of care.

  17. Phenotypic and genetic relationships of residual feed intake measures and their component traits with fatty acid composition in subcutaneous adipose of beef cattle.

    Science.gov (United States)

    Zhang, F; Ekine-Dzivenu, C; Vinsky, M; Basarab, J A; Aalhus, J L; Dugan, M E R; Li, C

    2017-07-01

    Feed efficiency is of particular interest to the beef industry because feed is the largest variable cost in production and fatty acid composition is emerging as an important trait, both economically and socially, due to the potential implications of dietary fatty acids on human health. Quantifying correlations between feed efficiency and fatty acid composition will contribute to construction of optimal multiple-trait selection indexes to maximize beef production profitability. In the present study, we estimated phenotypic and genetic correlations of feed efficiency measures including residual feed intake (RFI), RFI adjusted for final ultrasound backfat thickness (RFIf); their component traits ADG, DMI, and metabolic BW; and final ultrasound backfat thickness measured at the end of feedlot test with 25 major fatty acids in the subcutaneous adipose tissues of 1,366 finishing steers and heifers using bivariate animal models. The phenotypic correlations of RFI and RFIf with the 25 individual and grouped fatty acid traits were generally low (ratio (0.52 ± 0.29 and 0.45 ± 0.31, respectively), 18:2-6 (0.45 ± 0.18 and 0.40 ± 0.19, respectively), -6 (0.43 ± 0.18 and 0.38 ± 0.19, respectively), PUFA (0.42 ± 0.18 and 0.36 ± 0.20, respectively), and 9-16:1 (-0.43 ± 0.20 and -0.33 ± 0.22, respectively) were observed. Hence, selection for low-RFI or more efficient beef cattle will improve fatty acid profiles by lowering the content of -6 PUFA, thus reducing the ratio of -6 to -3 along with increasing the amount of 9-16:1. Moderate to moderately high genetic correlations were also observed for DMI with 9-14:1 (-0.32 ± 0.17) and the sum of CLA analyzed (SumCLA; -0.45 ± 0.21), suggesting that selection of beef cattle with lower DMI will lead to an increase amount of 9-14:1 and SumCLA in the subcutaneous adipose tissue. However, unfavorable genetic correlations were detected for ADG with 11-18:1 (-0.38 ± 0.23) and SumCLA (-0.73 ± 0.26), implying that selection of beef

  18. Maternal perception of their child's nutritional status at less than three years old.

    Science.gov (United States)

    Duarte, Luciane Simões; Fujimori, Elizabeth; Toriyama, Áurea Tamami Minagawa; Palombo, Claudia Nery Teixeira; Miranda, Patrícia Pereira Lima; Borges, Ana Luiza Vilela

    2016-01-01

    Assessing maternal perception of their children's nutritional status and identifying associated factors. A cross-sectional study conducted in a small municipality with 342 children less than 3 years of age treated in Basic Health Units of São Paulo. Nutritional status was classified in percentiles of body mass index for age and maternal perception was assessed using the scale of verbal descriptors (very thin, thin, healthy weight, fat, very fat). Logistic regression was used to identify the associatedfactors. 44.7% of maternal perception was found to beinadequate. Mothers of overweight (OR = 11.8, 95% CI: 6.4-21.7) and underweight (OR = 5.5; 95% CI: 1.9-16.2) children had a higher chance of having inadequate perception, similar to mothers of children over 24 months of age (OR = 2.9; 95% CI: 1.4-6.0). For effective child care in primary care, healthcare professionals should consider maternal perception and helpmothers to identify the nutritional status of children in childcare consultations and growth monitoring. Avaliar a percepção materna do estado nutricional do filho e identificar os fatores associados. Estudo transversal realizado em município de pequeno porte com 342 crianças menores de 3anos atendidas em Unidades Básicas de Saúde do Estado de São Paulo. O estado nutricional foi classificado em percentis do Índice de Massa Corporalpara Idade e a percepção materna foi avaliada com escala de descritores verbais (muito magro, magro, peso adequado, gordo, muito gordo). Utilizou-se de regressão logística para identificar os fatores associados. Constatou-se 44,7% de percepção materna inadequada. Mães de crianças com excesso de peso (OR=11,8; IC95%:6,4-21,7) e com baixo peso (OR=5,5; IC95%:1,9-16,2) apresentaram mais chance de percepção inadequada, da mesma forma que mães de crianças com mais de 24 meses de idade (OR=2,9; IC95%:1,4-6,0). Para uma efetiva assistência à criança na atenção básica, profissionais de saúde devem considerar a

  19. Precisão do conhecimento de resultados no processo adaptativo em crianças Precision of knowledge of results in the adaptative process in children

    Directory of Open Access Journals (Sweden)

    Rafael dos Santos Henrique

    2010-09-01

    Full Text Available O objetivo deste estudo foi analisar os efeitos da precisão de Conhecimento de Resultados (CR na aquisição de uma habilidade motora. Quarenta e oito crianças com idade entre oito e 10 anos (♂ = 9,33 ± 0,70 anos e ♀= 9,16 ± 0,81 anos praticaram uma tarefa de acertar um alvo sobre uma mesa, mediante o lançamento de discos metálicos. Foram formados três grupos experimentais de acordo com o nível de precisão do CR: pouco preciso (GPP, preciso (GP e muito preciso (GMP, além do grupo controle (GC, sem CR. A medida de desempenho foi o erro absoluto (EA. Os resultados indicaram diferença estatística a favor do GMP em comparação aos demais grupos, indicando que a maior precisão do CR favoreceu a estabilização da estrutura e a adaptabilidade do sistema, numa tarefa com meta de precisão espacial, em crianças.This study aimed to analyze the effects of Knowledge of Results (KR precision on acquisition of a motor ability. Forty eight children aged between eight and 10 years old (♂ = 9.33 ± 0.70 years old; ♀ = 9.16 ± 0.81 years old practiced a manipulative task of reaching a target on a table, by the thrown of metallic discs. Three experimental groups were formed according to the KR precision level: less precise group (LPG, precise group (PG and very precise group (VPG, and also the control group (CG, without KR. The performance measure was the absolute error. The results indicated statistic differences in favor of VPG when compared to the other groups, indicating that higher KR precision benefited the system's stabilization and adaptability for task with accuracy goal, for children.

  20. Composição bromatológica e produtividade do capim-andropógon em diferentes idades de rebrota em sistema silvipastoril - DOI: 10.4025/actascianimsci.v31i2. Bromatological composition and productivity of Andropogon grass at different ages of resprout in silvopastoral system - DOI: 10.4025/actascianimsci.v31i2.4549

    Directory of Open Access Journals (Sweden)

    Teodoreto Barbosa Carvalho

    2009-08-01

    Full Text Available Avaliou-se a composição e produtividade do capim-andropógon (Andropogon gayanus Kunth. em diferentes idades de rebrota, associado às espécies arbóreas pau-d’arco (Tabebuia serratifolia e jatobá (Hymenaea courbaril no período chuvoso, em Teresina, Piauí. Adotou-se o delineamento de blocos ao acaso, em esquema fatorial 3 x 2, com parcelas subdivididas, sendo as parcelas os ambientes (sombreamento com jatobá e pau-d’arco e área aberta e posições (nascente e poente, e as subparcelas as idades (35, 49 e 63 dias, com cinco repetições. Houve interação ambiente x idade para MS na planta, FDN e FDA na planta e nas folhas e NIDN nas folhas. A PB nas folhas à sombra foi superior (9,65 ± 0,94% em relação à área aberta (9,16 ± 1,41%. Houve efeito linear decrescente (p The study evaluated composition and productivity of Andropogon grass at different ages of resprout, associated with the species Tabebuia serratifolia and Hymenaea courbaril, during the rainy period, in Teresina, Piauí. A random blocks design was adopted, in a 3 x 2 factorial scheme, with subdivided parcels, being the parcels the environments (shading with Tabebuia serratifolia, Hymenaea courbaril and open area and position (rising and setting, and subparcels the ages (35, 49 and 63 days, with five repetitions. There was interaction between the environment and age for DM in the plant, NDF and ADF in the plant and leaves, and NDIN in leaves. The CP in leaves in the shade was higher (9.65 ± 0.94% compared to the open area (9.16 ± 1.41%. There was a linear effect (p Andropogon grass under T. serratifolia and H. courbaril, respectively. The culture of the grass in silvopastoral systems is viable, due to the stability in the composition of DM and ADF in the ratios of NDIN and ADIN in the plant and leaves, as well as for CP in plant and NDF in leaves, with higher CP levels in leaves of the grass. There was no difference in the levels of NDF in the grass in function of

  1. Composição bromatológica e produtividade do capim-andropógon em diferentes idades de rebrota em sistema silvipastoril = Bromatological composition and productivity of Andropogon grass at different ages of resprout in silvopastoral system

    Directory of Open Access Journals (Sweden)

    Marlúcia da Silva Bezerra Lacerda

    2009-04-01

    Full Text Available Avaliou-se a composição e produtividade do capim-andropógon (Andropogon gayanus Kunth. em diferentes idades de rebrota, associado às espécies arbóreas pau-d’arco (Tabebuia serratifolia e jatobá (Hymenaea courbaril no período chuvoso, em Teresina, Piauí.Adotou-se o delineamento de blocos ao acaso, em esquema fatorial 3 x 2, com parcelas subdivididas, sendo as parcelas os ambientes (sombreamento com jatobá e pau-d’arco e área aberta e posições (nascente e poente, e as subparcelas as idades (35, 49 e 63 dias, com cinco repetições. Houve interação ambiente x idade para MS na planta, FDN e FDA na planta e nas folhas e NIDN nas folhas. A PB nas folhas à sombra foi superior (9,65 ± 0,94% em relação à área aberta (9,16 ± 1,41%. Houve efeito linear decrescente (p The study evaluated composition and productivity of Andropogon grass at different ages of resprout, associated with the species Tabebuiaserratifolia and Hymenaea courbaril, during the rainy period, in Teresina, Piauí. A random blocks design was adopted, in a 3 x 2 factorial scheme, with subdivided parcels, being the parcels theenvironments (shading with Tabebuia serratifolia, Hymenaea courbaril and open area and position (rising and setting, and subparcels the ages (35, 49 and 63 days, with five repetitions. There wasinteraction between the environment and age for DM in the plant, NDF and ADF in the plant and leaves, and NDIN in leaves. The CP in leaves in the shade was higher (9.65 ± 0.94% compared to the open area (9.16 ± 1.41%. There was a linear effect (p < 0.01 of the age on CPin the plant and leaves. From days 47.7 and 48.8 there was a reduction in the leaf/steam ratio of Andropogon grass under T. serratifolia and H. courbaril, respectively. The culture of the grass in silvopastoral systems is viable, due to the stability in the composition of DM and ADF in the ratios of NDIN and ADIN in the plant and leaves, as well as for CP in plant and NDF in leaves, with

  2. Identifying palliative care issues in inpatients dying following stroke.

    Science.gov (United States)

    Ntlholang, O; Walsh, S; Bradley, D; Harbison, J

    2016-08-01

    Stroke leads to high mortality and morbidity but often there is a conflict between need for palliative care and avoidance of 'therapeutic nihilism'. We aimed to elicit the palliative care needs of stroke patients at the end of their lives in our unit with a low overall mortality rate (1 month: 8.8 %, inpatient: 12.9 %). We identified consecutive stroke patients who died over 2 years. Their clinical records were used for data collection. Of 54 deaths, 33 (61.1 %) were females, mean (SD) age at death was 79.3 ± 12.9 years. 41 (75.9 %) died after first stroke, 9 (16.7 %) were inpatient strokes, 7 (13.0 %) thrombolysed and 7 (13.0 %) had strokes as treatment complication. There were clear statements recorded in 26 (48.1 %) that patients were dying and death was thought to be due primarily to extent of brain injury in 24 (44.4 %). Palliative needs identified included dyspnoea 21 (38.9 %), pain 17 (31.5 %), respiratory secretions 17 (31.5 %), agitation 14 (25.9 %) and psychological distress 1 (1.9 %). Symptoms were due to premorbid diseases in 6 (11.1 %). Palliative care expertise were sought in 13 (24.1 %) and continuous subcutaneous infusion was used in 18 (33.3 %) to control symptoms. 4 (7.4 %) subjects underwent cardiac arrest calls and 9 (16.7 %) deaths occurred in ICU/HDU. The median Stroke-Death interval was 20 days (range 0-389). Do Not Attempt Resuscitation (DNAR) orders were in place in 86.8 % of patients. The median DNAR-Death interval was 7 days (range 0-311) with 7-day DNAR-Death rate of 53.2 % and 30-day of 78.7 % of the total deaths. Dyspnoea, pain and respiratory secretions were identified as the main palliative care needs.

  3. The development and refinement of models of less established and more established high school environmental service-learning programs in Florida

    Science.gov (United States)

    Malikova, Yuliya

    2005-07-01

    Environmental Service-Learning (Env. S-L) appears to show great promise and practitioners tout its benefits, although there have been fewer than ten studies in this emerging area of environmental education. The overall study purpose was to describe the nature, status, and effects of Grade 9--16 Env. S-L programs in Florida, and develop descriptive models of those programs. The purpose of Phase I was to describe these programs and associated partnerships. Based on Phase I results, the purpose of Phase II was to develop, compare, and refine models for less and more established high school programs. This study involved: (1) defining the population of Florida 9--16 Env. S-L programs (Phase I); (2) developing and administering program surveys (Phase I, quantitative); (3) analyzing Phase I survey data and identifications of options for Phase II (Intermediate stage); (4) designing and implementing methodology for further data collection (Phase II, qualitative); (5) refining and finalizing program models (Phase II, descriptive); and (6) summarizing program data, changes, and comparisons. This study revealed that Env. S-L has been practiced in a variety of ways at the high school and college levels in Florida. There, the number of high school programs, and participating teachers and students has been growing. Among others, major program features include block scheduling, indirect S-L activities, external funding sources, and formal and ongoing community partnerships. Findings based on self-reported program assessment results indicate that S-L has had positive effects on students across Furco's S-L outcome domains (i.e., academic achievement/success, school participation/behavior, carrier development, personal development, interpersonal development, ethical/moral development, and development of civic responsibility). Differences existed between less established and more established Env. S-L programs. Less established programs had relatively few participating teachers

  4. Statistical analysis of wind speed using two-parameter Weibull distribution in Alaçatı region

    International Nuclear Information System (INIS)

    Ozay, Can; Celiktas, Melih Soner

    2016-01-01

    Highlights: • Wind speed & direction data from September 2008 to March 2014 has been analyzed. • Mean wind speed for the whole data set has been found to be 8.11 m/s. • Highest wind speed is observed in July with a monthly mean value of 9.10 m/s. • Wind speed with the most energy has been calculated as 12.77 m/s. • Observed data has been fit to a Weibull distribution and k &c parameters have been calculated as 2.05 and 9.16. - Abstract: Weibull Statistical Distribution is a common method for analyzing wind speed measurements and determining wind energy potential. Weibull probability density function can be used to forecast wind speed, wind density and wind energy potential. In this study a two-parameter Weibull statistical distribution is used to analyze the wind characteristics of Alaçatı region, located in Çeşme, İzmir. The data used in the density function are acquired from a wind measurement station in Alaçatı. Measurements were gathered on three different heights respectively 70, 50 and 30 m between 10 min intervals for five and half years. As a result of this study; wind speed frequency distribution, wind direction trends, mean wind speed, and the shape and the scale (k&c) Weibull parameters have been calculated for the region. Mean wind speed for the entirety of the data set is found to be 8.11 m/s. k&c parameters are found as 2.05 and 9.16 in relative order. Wind direction analysis along with a wind rose graph for the region is also provided with the study. Analysis suggests that higher wind speeds which range from 6–12 m/s are prevalent between the sectors 340–360°. Lower wind speeds, from 3 to 6 m/s occur between sectors 10–29°. Results of this study contribute to the general knowledge about the regions wind energy potential and can be used as a source for investors and academics.

  5. STIMULASI PERTUMBUHAN JUVENIL ABALON, Haliotis squamata DENGAN PEMBERIAN HORMON REKOMBINAN IKAN rElGH

    Directory of Open Access Journals (Sweden)

    Fitriyah Husnul Khotimah

    2017-01-01

    Full Text Available Masalah yang paling utama dalam budidaya abalon tropis adalah pertumbuhan yang lambat. Penggunaan rElGH (recombinant giant grouper, Epinephelus lanceolatus growth hormone untuk menstimulasi pertumbuhan beberapa spesies ikan sudah dilakukan. Penelitian ini bertujuan untuk menguji akselerasi pertumbuhan juvenil abalon tropis, Haliotis squamata setelah diberi perlakuan perendaman hormon rekombinan ikan kerapu kertang, Epinephelus lanceolatus pada frekuensi yang berbeda. Ada empat perlakuan frekuensi perendaman rElGH yaitu 4, 9, 16 kali, dan tanpa perendaman (kontrol. Masing-masing perlakuan diulang tiga kali. Perendaman dilakukan selama tiga jam, dengan interval waktu empat hari. Kepadatan abalon tropis 100 ekor/L air laut yang mengandung 30 mg rElGH. Wadah untuk perendaman berupa beaker glass yang dilengkapi dengan aerasi. Penelitian dilakukan selama tujuh bulan. Hasil penelitian menunjukkan bahwa abalon tropis yang direndam rElGH dengan frekuensi empat kali menghasilkan pertumbuhan bobot tubuh dan panjang cangkang tertinggi dan berbeda nyata dengan perlakuan lainnya (P<0,05. Sintasan abalon tropis yang diberi perlakuan perendaman hormon rElGH lebih tinggi dibandingkan perlakuan kontrol. The most crucial problem in tropical abalone aquaculture is the slow growth of the species. Studies investigating the use of rElGH (recombinant giant grouper, Epinephelus lanceolatus growth hormone for promoting growth have been performed in various species. This research aimed to examine the growth acceleration of tropical abalone, Haliotis squamata juvenile after being treated in different immersion frequencies of recombinant giant grouper, Epinephelus lanceolatus growth hormone (rElGH. There were four treatments of rElGH immersion frequency: 4, 9, 16 times and without rElGH immersion (control. Each treatment was performed in triplicates. Immersion was performed for 3 hours, at 4-day intervals and a density of 100 tropical abalones in 1 L seawater containing 30

  6. Effects of dietary amylose/amylopectin ratio on growth performance, feed utilization, digestive enzymes, and postprandial metabolic responses in juvenile obscure puffer Takifugu obscurus.

    Science.gov (United States)

    Liu, Xiang-he; Ye, Chao-xia; Ye, Ji-dan; Shen, Bi-duan; Wang, Chun-yan; Wang, An-li

    2014-10-01

    The effect of dietary amylose/amylopectin (AM/AP) ratio on growth, feed utilization, digestive enzyme activities, plasma parameters, and postprandial blood glucose responses was evaluated in juvenile obscure puffer, Takifugu obscurus. Five isonitrogenous (430 g kg(-1) crude protein) and isolipidic (90 g kg(-1) crude lipid) diets containing an equal starch level (250 g kg(-1) starch) with different AM/AP ratio diets of 0/25, 3/22, 6/19, 9/16 and 12/13 were formulated. Each experimental diet was fed to triplicate groups (25 fish per tank), twice daily during a period of 60 days. After the growth trial, a postprandial blood response test was carried out. Fish fed diet 6/19 showed best growth, feed efficiency and protein efficiency ratio. Hepatosomatic index, plasma total cholesterol concentration, liver glycogen and lipid content, and gluconokinase, pyruvate kinase and fructose-1,6-bisphosphatase activities were lower in fish fed highest AM/AP diet (12/13) than in fish fed the low-amylose diets. Activities of liver and intestinal trypsin in fish fed diet 3/22 and diet 6/19 were higher than in fish fed diet 9/16 and diet 12/13. Activities of liver and intestinal amylase and intestinal lipase, and starch digestibility were negatively correlated with dietary AM/AP ratio. Fish fed diet 3/22 and diet 6/19 showed higher plasma total amino acid concentration than fish fed the other diets, while plasma urea nitrogen concentration and activities of alanine aminotransferase and aspartate aminotransferase showed the opposite trend. Equal values were found for viscerosomatic index and condition factor, whole body and muscle composition, plasma high-density and low-density lipoprotein cholesterol concentrations, and activities of lipase and hexokinase and glucose-6-phosphatase in liver. Postprandial plasma glucose and triglyceride peak value of fish fed diet 12/13 were lower than in fish fed the low-amylose diets, and the peak time of plasma glucose was later than in fish fed the

  7. Structural and functional annotation of citrate synthase from Aspergillus niger ANJ-120.

    Science.gov (United States)

    Mustafa, Ghulam; Arif, Rawaba; Bukhari, Shazia Anwer; Ali, Muhammad; Sharif, Sumaira; Atta, Asia

    2018-03-01

    Citrate synthase (CS) is involved in citric acid biosynthesis which is a well-established metabolic pathway. The condensation of acetyl-CoA with oxaloacetate is catalyzed by CS. Citric acid (CA) has a number of applications in pharmaceutical industry. CA in combination with bicarbonates is used as an effervescent in the preparations of tablets and powders. It has also been used as an anticoagulant and acidulant to form mild astringent. In current study, detailed structural and functional analyses of CS protein were carried out using various bioinformatics tools. Structural modeling was also done by building 3D model of CS from Aspergillus niger ANJ-120 using Modeller 9.16 software. The 3D Model was then evaluated using different online approaches. Furthermore, superimposition of query and template structures, Root Mean Squared Deviation and visualization of generated model were done through UCSF Chimera 1.5.3. Even though various roles of CS protein were already known and verified experimentally, here we presented a structural analysis of CS protein. The structural investigation of CS protein will be helpful for protein engineering strategies and understanding the interactions among proteins. Due to large number of applications, the production of citric acid by A. niger and its bioinformatics studies will offer substantial improvement in commercial scale intensification of this useful product.

  8. 2.43 kW narrow linewidth linearly polarized all-fiber amplifier based on mode instability suppression

    Science.gov (United States)

    Su, Rongtao; Tao, Rumao; Wang, Xiaolin; Zhang, Hanwei; Ma, Pengfei; Zhou, Pu; Xu, Xiaojun

    2017-08-01

    We demonstrate an experimental study on scaling mode instability (MI) threshold in fiber amplifiers based on fiber coiling. The experimental results show that coiling the active fiber in the cylindrical spiral shape is superior to the coiling in the plane spiral shape. When the polarization maintained Yb-doped fiber (PM YDF: with a core/inner-cladding diameter of 20/400 µm) is coiled on an aluminous plate with a bend diameter of 9-16 cm, the MI threshold is ~1.55 kW. When such a PM YDF is coiled on an aluminous cylinder with diameter of 9 cm, no MI is observed at the output power of 2.43 kW, which is limited by the available pump power. The spectral width and polarization extinction ratio is 0.255 nm and 18.3 dB, respectively, at 2.43 kW. To the best of our knowledge, this is the highest output power from a linear polarized narrow linewidth all-fiberized amplifier. By using a theoretical model, the potential MI-free scaling capability in such an amplifier is estimated to be 3.5 kW.

  9. Development and preliminary evaluation of a pediatric Spanish-English speech perception task.

    Science.gov (United States)

    Calandruccio, Lauren; Gomez, Bianca; Buss, Emily; Leibold, Lori J

    2014-06-01

    The purpose of this study was to develop a task to evaluate children's English and Spanish speech perception abilities in either noise or competing speech maskers. Eight bilingual Spanish-English and 8 age-matched monolingual English children (ages 4.9-16.4 years) were tested. A forced-choice, picture-pointing paradigm was selected for adaptively estimating masked speech reception thresholds. Speech stimuli were spoken by simultaneous bilingual Spanish-English talkers. The target stimuli were 30 disyllabic English and Spanish words, familiar to 5-year-olds and easily illustrated. Competing stimuli included either 2-talker English or 2-talker Spanish speech (corresponding to target language) and spectrally matched noise. For both groups of children, regardless of test language, performance was significantly worse for the 2-talker than for the noise masker condition. No difference in performance was found between bilingual and monolingual children. Bilingual children performed significantly better in English than in Spanish in competing speech. For all listening conditions, performance improved with increasing age. Results indicated that the stimuli and task were appropriate for speech recognition testing in both languages, providing a more conventional measure of speech-in-noise perception as well as a measure of complex listening. Further research is needed to determine performance for Spanish-dominant listeners and to evaluate the feasibility of implementation into routine clinical use.

  10. Quantitative analysis of velopharyngeal movement using a stereoendoscope: accuracy and reliability of range images.

    Science.gov (United States)

    Nakano, Asuka; Mishima, Katsuaki; Shiraishi, Ruriko; Ueyama, Yoshiya

    2015-01-01

    We developed a novel method of producing accurate range images of the velopharynx using a three-dimensional (3D) endoscope to obtain detailed measurements of velopharyngeal movements. The purpose of the present study was to determine the relationship between the distance from the endoscope to an object, elucidate the measurement accuracy along the temporal axes, and determine the degree of blurring when using a jig to fix the endoscope. An endoscopic measuring system was developed in which a pattern projection system was incorporated into a commercially available 3D endoscope. After correcting the distortion of the camera images, range images were produced using pattern projection to achieve stereo matching. Graph paper was used to measure the appropriate distance from the camera to an object, the mesial buccal cusp of the right maxillary first molar was measured to clarify the range image stability, and an electric actuator was used to evaluate the measurement accuracy along the temporal axes. The measurement error was substantial when the distance from the camera to the subject was >6.5 cm. The standard error of the 3D coordinate value produced from 30 frames was within 0.1 mm (range, 0.01-0.08 mm). The measurement error of the temporal axes was 9.16% in the horizontal direction and 9.27% in the vertical direction. The optimal distance from the camera to an object is movements.

  11. Adverse life events as risk factors for behavioural and emotional problems in a 7-year follow-up of a population-based child cohort.

    Science.gov (United States)

    Rasmussen, Cathrine Skovmand; Nielsen, Louise Gramstrup; Petersen, Dorthe Janne; Christiansen, Erik; Bilenberg, Niels

    2014-04-01

    The aim of the study was to identify risk factors for significant changes in emotional and behavioural problem load in a community-based cohort of Danish children aged 9-16 years, the risk factors being seven parental and two child-related adverse life events. Data on emotional and behavioural problems was obtained from parents filling in the Child Behavior Checklist (CBCL) when the child was 8-9 and again when 15 years old. Data on risk factors was drawn from Danish registers. Analysis used was logistic regression for crude and adjusted change. Parental divorce significantly raised the odds ratio of an increase in emotional and behavioural problems; furthermore, the risk of deterioration in problem behaviour rose significantly with increasing number of adverse life events. By dividing the children into four groups based on the pathway in problem load (increasers, decreasers, high persisters and low persisters), we found that children with a consistently high level of behavioural problems also had the highest number of adverse life events compared with any other group. Family break-up was found to be a significant risk factor. This supports findings in previous studies. The fact that no other risk factor proved to be of significance might be due to lack of power in the study. Children experiencing high levels of adverse life events are at high risk of chronic problem behaviour. Thus these risk factors should be assessed in daily clinical practice.

  12. Highly Stable and Flexible Pressure Sensors with Modified Multi-Walled Carbon Nanotube/Polymer Composites for Human Monitoring.

    Science.gov (United States)

    He, Yin; Ming, Yue; Li, Wei; Li, Yafang; Wu, Maoqi; Song, Jinzhong; Li, Xiaojiu; Liu, Hao

    2018-04-26

    A facile method for preparing an easy processing, repeatable and flexible pressure sensor was presented via the synthesis of modified multi-walled carbon nanotubes (m-MWNTs) and polyurethane (PU) films. The surface modification of multi-walled carbon nanotubes (MWNTs) simultaneously used a silane coupling agent (KH550) and sodium dodecyl benzene sulfonate (SDBS) to improve the dispersibility and compatibility of the MWNTs in a polymer matrix. The electrical property and piezoresistive behavior of the m-MWNT/PU composites were compared with raw multi-walled carbon nanotube (raw MWNT)/PU composites. Under linear uniaxial pressure, the m-MWNT/PU composite exhibited 4.282%kPa −1 sensitivity within the pressure of 1 kPa. The nonlinear error, hysteresis error and repeatability error of the piezoresistivity of m-MWNT/PU decreased 9%, 16.72% and 54.95% relative to raw MWNT/PU respectively. Therefore, the piezoresistive response of m-MWNT/PU had better stability than that of raw MWNT/PU composites. The m-MWNT/PU sensors could be utilized in wearable devices for body movement detection, monitoring of respiration and pressure detection in garments.

  13. Preoperative combination of progressive pneumoperitoneum and botulinum toxin type A in patients with loss of domain hernia.

    Science.gov (United States)

    Bueno-Lledó, José; Torregrosa, Antonio; Jiménez, Raquel; Pastor, Providencia García

    2018-02-15

    Preoperative progressive pneumoperitoneum (PPP) and botulinum toxin type A (BT) are tools in the surgical preparation of patients with loss of domain hernias (LODH). The aim of this paper is to report our experience with these preoperative techniques in 70 patients with LODH. Observational study of 70 consecutive patients with LODH was conducted between May 2010 and May 2016. Diameters of the hernia sac, incisional hernia (VIH), and abdominal cavity (VAC) volumes, and VIH/VAC ratio were measured before and after PPP and BT, using abdominal CT scan data. Combination of both techniques was performed when the VIH/VAC ratio was > 20%. Median insufflated volume of air for PPP was 8450 ± 3400 cc (4500-13,450), over a period of 11.3 ± 2.3 days (9-16). BT administration time was 38.1 ± 3.7 days (35-44). An average reduction of 16.6% of the VIH/VAC ratio after PPP and BT was obtained (p VIH/VAC ratio and hernia defect diameters, which constitutes a key factor in the treatment of LODH.

  14. Anterior maxillary segmental distraction for correction of maxillary hypoplasia and dental crowding in cleft palate patients: a preliminary report.

    Science.gov (United States)

    Wang, X-X; Wang, X; Li, Z-L; Yi, B; Liang, C; Jia, Y-L; Zou, B-S

    2009-12-01

    To evaluate the feasibility of anterior maxillary segmental distraction (AMSD) to correct maxillary hypoplasia and severe dental crowding in cleft lip and palate (CLP) patients, 7 patients (average age 16.4 years) with maxillary hypoplasia, shortened maxillary dental arch length and severe anterior dental crowding secondary to CLP were selected for this study. After anterior maxillary segmental osteotomy, 3 patients were treated using bilateral internal distraction devices, and 4 patients were treated using rigid external distraction devices. Photographs and radiographs were taken to review the improvement in facial profile and occlusion after distraction. An average 10.25 mm anterior maxillary advancement was obtained in all patients after 10-23 days of distraction and 9-16 weeks of consolidation. The sella-nasion-point A (SNA) angle increased from 69.5 degrees to 79.6 degrees. Midface convexity was greatly improved and velopharyngeal competence was preserved. The maxillary dental arch length was greatly increased by 10.1 mm (P<0.01). Dental crowding and malocclusion were corrected by orthodontic treatment. These results show that AMSD can effectively correct the hypoplastic maxilla and severe dental crowding associated with CLP by increasing the midface convexity and dental arch length while preserving velopharyngeal function, and dental crowding can be corrected without requiring tooth extraction.

  15. Levels of depression and anxiety among parents of autistic children

    Directory of Open Access Journals (Sweden)

    Sunay Firat

    2016-09-01

    Results: Participants in the study were parents of 26 male (65% and 14 female (35% autistic children. The average age of the children was 62.9+/-16.6 months. .Mothers had higher levels of depression and anxiety scores. Mothers of autistic children who participated in the study received higher scores on depression, state anxiety and trait anxiety compared to fathers. Among mothers, a significant relationship was found between level of education and level of state anxiety. Conclusion: The findings of this study show that mothers have higher levels of depression and anxiety compared to fathers. This finding might be explained with reference to customs and traditions of the Turkish society in which the study was conducted, which require women to take more responsiblity for family matters. It is recommended that special education and rehabilitation centers provide counseling to parents about the effects of having an autistic children on their lives, and advise them on seeking psychological help if necessary. [Cukurova Med J 2016; 41(3.000: 539-547

  16. Ultrastructural characteristics of spermatogenesis in Pallas's mastiff bat, Molossus molossus (Chiroptera: Molossidae).

    Science.gov (United States)

    Beguelini, Mateus R; Taboga, Sebastião R; Morielle-Versute, Eliana

    2012-07-01

    Despite the large number of species, their wide distribution, and unique reproductive characteristics, Neotropical bats have been poorly studied, and important aspects of the reproduction of these animals have not been elucidated. We made an ultrastructural analysis of spermatogenesis in Molossus molossus (Molossidae). The process of spermatogonial differentiation is similar to that found in other bats and is also relatively similar to that of Primates, with three main spermatogonia types: A(d), A(p), and B. Meiotic divisions proceed similarly to those of most mammals, and spermiogenesis is clearly divided into 12 steps, in the middle of the range known for bats (9-16 steps). Formation of the acrosome is similar to that known from other mammals; however, the ultrastructure of spermatozoa was found to have unique characteristics, including many wavy acrosomal projections on its surface, which seems to be specific for the family Molossidae. Comparing the ultrastructure of the spermatozoon of M. molossus with other bats already study, we observed that three characters vary: morphology of the outer dense fibers, of the perforatorium, and of the spermatozoon head. The great similarity of morphological characters between M. molossus and Platyrrhinus lineatus suggests that M. molossus is more closely related to the Phyllostomidae than to the Rhinolophidae and the Vespertilionidae. Copyright © 2012 Wiley Periodicals, Inc.

  17. Role of Chromosome Changes in Evolution and Diversity

    Directory of Open Access Journals (Sweden)

    Kornsorn Srikulnath

    2015-12-01

    Full Text Available The karyotypes of most species of crocodilians were studied using conventional and molecular cytogenetics. These provided an important contribution of chromosomal rearrangements for the evolutionary processes of Crocodylia and Sauropsida (birds and reptiles. The karyotypic features of crocodilians contain small diploid chromosome numbers (30~42, with little interspecific variation of the chromosome arm number (fundamental number among crocodiles (56~60. This suggested that centric fusion and/or fission events occurred in the lineage, leading to crocodilian evolution and diversity. The chromosome numbers of Alligator, Caiman, Melanosuchus, Paleosuchus, Gavialis, Tomistoma, Mecistops, and Osteolaemus were stable within each genus, whereas those of Crocodylus (crocodylians varied within the taxa. This agreed with molecular phylogeny that suggested a highly recent radiation of Crocodylus species. Karyotype analysis also suggests the direction of molecular phylogenetic placement among Crocodylus species and their migration from the Indo-Pacific to Africa and The New World. Crocodylus species originated from an ancestor in the Indo-Pacific around 9~16 million years ago (MYA in the mid-Miocene, with a rapid radiation and dispersion into Africa 8~12 MYA. This was followed by a trans-Atlantic dispersion to the New World between 4~8 MYA in the Pliocene. The chromosomes provided a better understanding of crocodilian evolution and diversity, which will be useful for further study of the genome evolution in Crocodylia.

  18. Analysis of previous screening examinations for patients with breast cancer

    International Nuclear Information System (INIS)

    Lee, Eun Hye; Cha, Joo Hee; Han, Dae Hee; Choi, Young Ho; Hwang, Ki Tae; Ryu, Dae Sik; Kwak, Jin Ho; Moon, Woo Kyung

    2007-01-01

    We wanted to improve the quality of subsequent screening by reviewing the previous screening of breast cancer patients. Twenty-four breast cancer patients who underwent previous screening were enrolled. All 24 took mammograms and 15 patients also took sonograms. We reviewed the screening retrospectively according to the BI-RADS criteria and we categorized the results into false negative, true negative, true positive and occult cancers. We also categorized the causes of false negative cancers into misperception, misinterpretation and technical factors and then we analyzed the attributing factors. Review of the previous screening revealed 66.7% (16/24) false negative, 25.0% (6/24) true negative, and 8.3% (2/24) true positive cancers. False negative cancers were caused by the mammogram in 56.3% (9/16) and by the sonogram in 43.7% (7/16). For the false negative cases, all of misperception were related with mammograms and this was attributed to dense breast, a lesion located at the edge of glandular tissue or the image, and findings seen on one view only. Almost all misinterpretations were related with sonograms and attributed to loose application of the final assessment. To improve the quality of breast screening, it is essential to overcome the main causes of false negative examinations, including misperception and misinterpretation. We need systematic education and strict application of final assessment categories of BI-RADS. For effective communication among physicians, it is also necessary to properly educate them about BI-RADS

  19. Comparison of MODIS and SWAT evapotranspiration over a complex terrain at different spatial scales

    Science.gov (United States)

    Abiodun, Olanrewaju O.; Guan, Huade; Post, Vincent E. A.; Batelaan, Okke

    2018-05-01

    In most hydrological systems, evapotranspiration (ET) and precipitation are the largest components of the water balance, which are difficult to estimate, particularly over complex terrain. In recent decades, the advent of remotely sensed data based ET algorithms and distributed hydrological models has provided improved spatially upscaled ET estimates. However, information on the performance of these methods at various spatial scales is limited. This study compares the ET from the MODIS remotely sensed ET dataset (MOD16) with the ET estimates from a SWAT hydrological model on graduated spatial scales for the complex terrain of the Sixth Creek Catchment of the Western Mount Lofty Ranges, South Australia. ET from both models was further compared with the coarser-resolution AWRA-L model at catchment scale. The SWAT model analyses are performed on daily timescales with a 6-year calibration period (2000-2005) and 7-year validation period (2007-2013). Differences in ET estimation between the SWAT and MOD16 methods of up to 31, 19, 15, 11 and 9 % were observed at respectively 1, 4, 9, 16 and 25 km2 spatial resolutions. Based on the results of the study, a spatial scale of confidence of 4 km2 for catchment-scale evapotranspiration is suggested in complex terrain. Land cover differences, HRU parameterisation in AWRA-L and catchment-scale averaging of input climate data in the SWAT semi-distributed model were identified as the principal sources of weaker correlations at higher spatial resolution.

  20. The Manitoba Hydro-Electric Board, 43nd annual report for the year ended March 31, 1994

    International Nuclear Information System (INIS)

    1994-01-01

    Manitoba Hydro is a provincially owned corporation that produces electricity for distribution to 380,270 customers throughout all of Manitoba except for central Winnipeg. The utility operates 12 hydraulic generating stations, 2 thermal generating stations and 12 diesel sites. In the year ending March 31, 1994, total combined generation and imports were 27.6 billion kWh, of which 95.2% was produced from hydraulic stations. Power sales to Manitoba customers totalled 15 billion kWh and extraprovincial sales totalled 9.16 billion kWh. Gross revenues were $924.8 million and total expenses were $855.3 million, for a net income of $69.5 million. Total out-of-province sales reached a record high of $231.6 million, or 62.3% more than in 1992/93. That increase was mainly due to a 500-MW firm power sale to Northern States Power. The various sections of the report present information on customer services; employee relations; environmental management; resource planning; electricity generated, purchased, and exported; system development, including construction of new transmission lines and stations; research and development; and safety. Financial statements are included. 25 figs., 5 tabs

  1. Response time scores on a reflexive attention task predict a child's inattention score from a parent report.

    Science.gov (United States)

    Lundwall, Rebecca A; Sgro, Jordan F; Fanger, Julia

    2018-01-01

    Compared to sustained attention, only a small proportion of studies examine reflexive attention as a component of everyday attention. Understanding the significance of reflexive attention to everyday attention may inform better treatments for attentional disorders. Children from a general population (recruited when they were from 9-16 years old) completed an exogenously-cued task measuring the extent to which attention is captured by peripheral cue-target conditions. Parents completed a questionnaire reporting their child's day-to-day attention. A general linear model indicated that parent-rated inattention predicted the increase in response time over baseline when a bright cue preceded the target (whether it was valid or invalid) but not when a dim cue preceded the target. More attentive children had more pronounced response time increases from baseline. Our findings suggest a link between a basic measure of cognition (response time difference scores) and parent observations. The findings have implications for increased understanding of the role of reflexive attention in the everyday attention of children.

  2. Sexual function following radical radiotherapy for bladder cancer

    International Nuclear Information System (INIS)

    Little, F.A.; Howard, G.C.W.

    1998-01-01

    Background and purpose: The effect of radical radiotherapy (RT) for bladder cancer on sexual function has not been previously investigated. The current study was designed as a pilot to assess sexual function in males pre- and post-radiotherapy. Materials and methods: An anonymous questionnaire was devised to examine the following sexual domains: libido, frequency of sexual function, erectile capacity, orgasm and ejaculation in the 6 months prior to radiotherapy and following treatment. Serum testosterone, FSH and LH were measured in 10 patients. Results: Eighteen patients completed the questionnaire from 10 to 56 months following irradiation, 13 of whom were able to achieve an erection prior to RT. Over half of these patients noted a decline in the quality of erections after RT, with a similar proportion noting decreased libido and frequency of sexual activity. Three patients lost the ability to have any erections whatsoever. Of the 10 patients retaining erectile capacity, three noted reduced frequency of early morning erections suggesting a physical aetiology, five had decreased frequency of ejaculation and four had reduced intensity of orgasms. Seventy-one percent (12/17) felt their sex life was worse following RT but only 56% (9/16) were concerned about the deterioration. Testosterone levels were normal in all but one patient. Conclusions: Radical RT to the bladder can cause a decrease in sexual function in males. (Copyright (c) 1998 Elsevier Science B.V., Amsterdam. All rights reserved.)

  3. LINEAR RELATION FOR WIND-BLOWN BUBBLE SIZES OF MAIN-SEQUENCE OB STARS IN A MOLECULAR ENVIRONMENT AND IMPLICATION FOR SUPERNOVA PROGENITORS

    Energy Technology Data Exchange (ETDEWEB)

    Chen Yang; Zhou Ping [Department of Astronomy, Nanjing University, Nanjing 210093 (China); Chu Youhua [Department of Astronomy, University of Illinois at Urbana-Champaign, 1002 West Green Street, Urbana, IL 61801 (United States)

    2013-05-20

    We find a linear relationship between the size of a massive star's main-sequence bubble in a molecular environment and the star's initial mass: R{sub b} Almost-Equal-To 1.22 M/M{sub Sun} - 9.16 pc, assuming a constant interclump pressure. Since stars in the mass range of 8 to 25-30 M{sub Sun} will end their evolution in the red supergiant phase without launching a Wolf-Rayet wind, the main-sequence wind-blown bubbles are mainly responsible for the extent of molecular gas cavities, while the effect of the photoionization is comparatively small. This linear relation can thus be used to infer the masses of the massive star progenitors of supernova remnants (SNRs) that are discovered to evolve in molecular cavities, while few other means are available for inferring the properties of SNR progenitors. We have used this method to estimate the initial masses of the progenitors of eight SNRs: Kes 69, Kes 75, Kes 78, 3C 396, 3C 397, HC 40, Vela, and RX J1713-3946.

  4. The Impact of Pollution Prevention on Toxic Environmental Releases from U.S. Manufacturing Facilities.

    Science.gov (United States)

    Ranson, Matthew; Cox, Brendan; Keenan, Cheryl; Teitelbaum, Daniel

    2015-11-03

    Between 1991 and 2012, the facilities that reported to the U.S. Environmental Protection Agency's Toxic Release Inventory (TRI) Program conducted 370,000 source reduction projects. We use this data set to conduct the first quasi-experimental retrospective evaluation of how implementing a source reduction (pollution prevention) project affects the quantity of toxic chemicals released to the environment by an average industrial facility. We use a differences-in-differences methodology, which measures how implementing a source reduction project affects a facility's releases of targeted chemicals, relative to releases of (a) other untargeted chemicals from the same facility, or (b) the same chemical from other facilities in the same industry. We find that the average source reduction project causes a 9-16% decrease in releases of targeted chemicals in the year of implementation. Source reduction techniques vary in effectiveness: for example, raw material modification causes a large decrease in releases, while inventory control has no detectable effect. Our analysis suggests that in aggregate, the source reduction projects carried out in the U.S. since 1991 have prevented between 5 and 14 billion pounds of toxic releases.

  5. On classification of finite groups with four generators, three of which having orders p,p,q (p

    International Nuclear Information System (INIS)

    Yacoub, K.R.

    1984-03-01

    Finite groups with two independent generators attracted the attention of authors for several years. The author, having started on such groups in his PhD Thesis in 1953, discussed later on the existence and the structure of finite groups with three generators, one being of arbitrary order and the other two having given orders [Pub. Math. Debrecen, 11, 32-38(1964), 13, 9-16(1966)] and others. Recently, the author started the problem of finite groups with four generators a,b,c and d when b,c and d have the same odd prime order p. It is the object of the present paper to deal with a similar problem when the given orders are p, p and q with p q together with the particular case when m is an element of set containing p,q will be kept to a further discussion. The present paper consists actually of two main parts, the first deals with the case p does not divide q-1 while the second deals with the case p divides q-1. (author)

  6. Antiproliferative effects of lanreotide autogel in patients with progressive, well-differentiated neuroendocrine tumours: a Spanish, multicentre, open-label, single arm phase II study

    International Nuclear Information System (INIS)

    Martín-Richard, Marta; Sala, Maria Angeles; Pericay, Carlos; Rivera, Fernando; Sastre, Javier; Segura, Ángel; Quindós, Maria; Maisonobe, Pascal; Massutí, Bartomeu; Pineda, Eva; Alonso, Vicente; Marmol, Maribel; Castellano, Daniel; Fonseca, Emilio; Galán, Antonio; Llanos, Marta

    2013-01-01

    Somatostatin analogues (SSAs) are indicated to relieve carcinoid syndrome but seem to have antiproliferative effects on neuroendocrine tumours (NETs). This is the first prospective study investigating tumour stabilisation with the long-acting SSA lanreotide Autogel in patients with progressive NETs. This was a multicentre, open-label, phase II trial conducted in 17 Spanish specialist centres. Patients with well-differentiated NETs and radiologically confirmed progression within the previous 6 months received lanreotide Autogel, 120 mg every 28 days over ≤92 weeks. The primary endpoint was progression-free survival (PFS). Secondary endpoints were response rate, tumour biomarkers, symptom control, quality of life (QoL), and safety. Radiographic imaging was assessed by a blinded central radiologist. Of 30 patients included in the efficacy and safety analyses, 40% had midgut tumours and 27% pancreatic tumours; 63% of tumours were functioning. Median PFS time was 12.9 (95% CI: 7.9, 16.5) months, and most patients achieved disease stabilisation (89%) or partial response (4%). No deterioration in QoL was observed. Nineteen patients (63%) experienced treatment-related adverse events, most frequently diarrhoea and asthenia; only one treatment-related adverse event (aerophagia) was severe. Lanreotide Autogel provided effective tumour stabilisation and PFS >12 months in patients with progressive NETs ineligible for surgery or chemotherapy, with a safety profile consistent with the pharmacology of the class. ClinicalTrials.gov Identifier http://clinicaltrials.gov/show/NCT00326469; EU Clinical Trial Register EudraCT no 2004-002871-18

  7. Failure to detect variant (CRM+) plasma thromboplastin antecedent (factor XI) molecules in hereditary plasma thromboplastin antecedent deficiency: a study of 125 patients of several ethnic backgrounds.

    Science.gov (United States)

    Saito, H; Ratnoff, O D; Bouma, B N; Seligsohn, U

    1985-12-01

    Plasma samples of 125 patients from 80 kindreds with hereditary plasma thromboplastin antecedent (PTA, factor XI) deficiency were tested by factor XI radioimmunoassay (RIA) and electroimmunoassay (EIA) in an attempt to detect variant molecules. Ninety-six patients (70 kindreds) were Jewish, and 29 (10 kindreds) were of other ethnic backgrounds, namely, Japanese, black American, Korean, Arab, Indian, and English. Seventy-eight patients were homozygotes, and 47 were heterozygotes. Both non-Jewish homozygotes and heterozygotes had lower factor XI activity than respective Jewish subjects. Twenty-eight homozygotes whose factor XI clotting activities (XI:C) were 1.5% to 13% had factor XI-related antigen (XI:RAG) levels less than 10% by EIA. In 72 homozygotes, including 22 patients who were also tested with EIA, XI:C was 2.9% +/- 3.0% (mean +/- SD) and XI:RAG tested by RIA, 2.9% +/- 3.0%. In 47 heterozygotes, XI:C and XI:RAG tested by RIA were 51.9% +/- 16.6% and 51.0% +/- 16.2%, respectively. Similar results were obtained when only unrelated patients (62 homozygotes and 27 heterozygotes) were analyzed. There was a highly significant correlation between XI:C and XI:RAG (RIA) in 38 homozygotes and 47 heterozygotes (r = 0.94, n = 85, P less than 0.001). Thus, we failed to identify functionally abnormal factor XI molecules (CRM+ variant) in these patients with hereditary factor XI deficiency.

  8. Electrodeposition of quaternary alloys in the presence of magnetic field

    Science.gov (United States)

    2010-01-01

    Electrodeposition of Ni-Co-Fe-Zn alloys was done in a chloride ion solution with the presence and absence of a Permanent Parallel Magnetic Field (PPMF). The PPMF was applied parallel to the cathode surface. The deposition profile was monitored chronoamperometrically. It was found that the electrodeposition current was enhanced in the presence of PPMF (9 T) compared to without PPMF. The percentage of current enhancement (Γ%) was increased in the presence of PPMF, with results of Γ% = 11.9%, 16.7% and 18.5% at -1.1, -1.2 and -1.3 V respectively for a 2400 sec duration. In chronoamperometry, the Composition Reference Line (CRL) for Ni was around 57%, although the nobler metals (i.e. Ni, Co) showed anomalous behaviour in the presence of Zn and Fe. The anomalous behaviour of the Ni-Co-Fe-Zn electrodeposition was shown by the Energy Dispersive X-Ray (EDX) results. From Atomic Force Microscopy (AFM) measurements, it was found that the surface roughness of the Ni-Co-Fe-Zn alloy films decreased in the presence of a PPMF. PMID:20604934

  9. Opportunity's View After Drive on Sol 1806

    Science.gov (United States)

    2009-01-01

    NASA's Mars Exploration Rover Opportunity used its navigation camera to take the images combined into this full-circle view of the rover's surroundings just after driving 60.86 meters (200 feet) on the 1,806th Martian day, or sol, of Opportunity's surface mission (Feb. 21, 2009). North is at the center; south at both ends. Tracks from the drive extend northward across dark-toned sand ripples and light-toned patches of exposed bedrock in the Meridiani Planum region of Mars. For scale, the distance between the parallel wheel tracks is about 1 meter (about 40 inches). Engineers designed the Sol 1806 drive to be driven backwards as a strategy to redistribute lubricant in the rovers wheels. The right-front wheel had been showing signs of increased friction. The rover's position after the Sol 1806 drive was about 2 kilometer (1.2 miles) south southwest of Victoria Crater. Cumulative odometry was 14.74 kilometers (9.16 miles) since landing in January 2004, including 2.96 kilometers (1.84 miles) since climbing out of Victoria Crater on the west side of the crater on Sol 1634 (August 28, 2008). This view is presented as a cylindrical projection with geometric seam correction.

  10. Opportunity's View After Drive on Sol 1806 (Polar)

    Science.gov (United States)

    2009-01-01

    NASA's Mars Exploration Rover Opportunity used its navigation camera to take the images combined into this full-circle view of the rover's surroundings just after driving 60.86 meters (200 feet) on the 1,806th Martian day, or sol, of Opportunity's surface mission (Feb. 21, 2009). North is at the center; south at both ends. Tracks from the drive extend northward across dark-toned sand ripples and light-toned patches of exposed bedrock in the Meridiani Planum region of Mars. For scale, the distance between the parallel wheel tracks is about 1 meter (about 40 inches). Engineers designed the Sol 1806 drive to be driven backwards as a strategy to redistribute lubricant in the rovers wheels. The right-front wheel had been showing signs of increased friction. The rover's position after the Sol 1806 drive was about 2 kilometer (1.2 miles) south southwest of Victoria Crater. Cumulative odometry was 14.74 kilometers (9.16 miles) since landing in January 2004, including 2.96 kilometers (1.84 miles) since climbing out of Victoria Crater on the west side of the crater on Sol 1634 (August 28, 2008). This view is presented as a polar projection with geometric seam correction.

  11. Opportunity's View After Drive on Sol 1806 (Vertical)

    Science.gov (United States)

    2009-01-01

    NASA's Mars Exploration Rover Opportunity used its navigation camera to take the images combined into this full-circle view of the rover's surroundings just after driving 60.86 meters (200 feet) on the 1,806th Martian day, or sol, of Opportunity's surface mission (Feb. 21, 2009). North is at the center; south at both ends. Tracks from the drive extend northward across dark-toned sand ripples and light-toned patches of exposed bedrock in the Meridiani Planum region of Mars. For scale, the distance between the parallel wheel tracks is about 1 meter (about 40 inches). Engineers designed the Sol 1806 drive to be driven backwards as a strategy to redistribute lubricant in the rovers wheels. The right-front wheel had been showing signs of increased friction. The rover's position after the Sol 1806 drive was about 2 kilometer (1.2 miles) south southwest of Victoria Crater. Cumulative odometry was 14.74 kilometers (9.16 miles) since landing in January 2004, including 2.96 kilometers (1.84 miles) since climbing out of Victoria Crater on the west side of the crater on Sol 1634 (August 28, 2008). This view is presented as a vertical projection with geometric seam correction.

  12. Asymptomatic carotid artery stenosis in patients with severe peripheral vascular diseases

    Directory of Open Access Journals (Sweden)

    Rasoul Mirsharifi

    2009-04-01

    Full Text Available

    • BACKGROUND: The prevalence of carotid artery stenosis (CAS in the  eneral population is not high enough to justify screening programs. This study was done to determine the prevalence of asymptomatic carotid artery stenosis (ACAS among patients with severe peripheral vascular disease (PVD.
    • METHODS: Between March 2005 and February 2006, 54 consecutive  atients with severe PVD admitted at a vascular surgery unit and underwent carotid duplex scanning in a prospective study. A  uestionnaire was used to collect data concerning known risk factors. Significant CAS was defined as a stenosis of 70% or greater.
    • RESULTS: The mean age was 62.5 years (51-72. Out of 54 patients, 2 (3.7% had an occluded internal carotid artery. Significant CAS was found in 9 (16.7% and its presence was correlated with diabetes, hypertension, hypercholesterolemia, hypertriglyceridemia, coronary artery disease, severity of symptoms, ankle-brachial index, and carotid bruit. On multivariate analysis, only hypercholesterolemia and carotid bruit seemed to have independent influence.
    • CONCLUSION: The prevalence of significant ACAS is higher among  atients with severe PVD. This patient population may indicate a  uitable subgroup for screening of ACAS, especially when hypercholesterolemia and carotid bruit are present.
    • KEYWORDS: Carotid artery stenosis, duplex ultrasound scanning, peripheral vascular disease, carotid endarterectomy,
    • cerebrovascular accident.

  13. Bipolar Radiofrequency Ablation Using Dual Internally Cooled Wet Electrodes: Experimental Study in Ex Vivo Bovine Liver

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Young Joon; Byun, Jae Young [Dept. of Radiology, Seoul St. Mary' s Hospital, The Catholic University of Korea, College of Medicine, Seoul (Korea, Republic of)

    2012-11-15

    To determine the optimized protocol for bipolar radiofrequency ablation (RFA), using dual internally cooled wet (ICW) electrodes in the ex vivo bovine liver. RFA was applied to the explanted bovine liver, using two 3 cm active tip electrodes with 3.5 cm spacing. A total of 25 ablation zones were created by five groups; group A: 70 W-20 minute (min), group B: 70 W-25 min, group C: 90 W-15 min, group D: 90 W-20 min, and group E: 90 W-25 min. We measured the total energy and size of ablation zones with a color of grey or pink. Statistical analysis was done using Kruskal Wallis test and Mann Whitney U-test. The mean energy, mean volume of ablation zone with grey and pink color of groups A to E were 16.7, 23.9, 16.7, 21.8, 29.2 kcal, 25.7, 34.3, 29.5, 36.2, 45.2 cm{sup 3}, and 60.0, 88.0, 71.5, 87.4, 104.5 cm{sup 3}, respectively. Those were significantly different (p < 0.05). The volume of ablation zone of group E with grey color was larger than groups A, B and C (p < 0.05). Bipolar RFA, using dual ICW electrodes, can produce a large ablation zone with the protocol of 90 W-25 min.

  14. Bipolar Radiofrequency Ablation Using Dual Internally Cooled Wet Electrodes: Experimental Study in Ex Vivo Bovine Liver

    International Nuclear Information System (INIS)

    Lee, Young Joon; Byun, Jae Young

    2012-01-01

    To determine the optimized protocol for bipolar radiofrequency ablation (RFA), using dual internally cooled wet (ICW) electrodes in the ex vivo bovine liver. RFA was applied to the explanted bovine liver, using two 3 cm active tip electrodes with 3.5 cm spacing. A total of 25 ablation zones were created by five groups; group A: 70 W-20 minute (min), group B: 70 W-25 min, group C: 90 W-15 min, group D: 90 W-20 min, and group E: 90 W-25 min. We measured the total energy and size of ablation zones with a color of grey or pink. Statistical analysis was done using Kruskal Wallis test and Mann Whitney U-test. The mean energy, mean volume of ablation zone with grey and pink color of groups A to E were 16.7, 23.9, 16.7, 21.8, 29.2 kcal, 25.7, 34.3, 29.5, 36.2, 45.2 cm 3 , and 60.0, 88.0, 71.5, 87.4, 104.5 cm 3 , respectively. Those were significantly different (p < 0.05). The volume of ablation zone of group E with grey color was larger than groups A, B and C (p < 0.05). Bipolar RFA, using dual ICW electrodes, can produce a large ablation zone with the protocol of 90 W-25 min.

  15. Personal characteristics and contextual factors that determine "helping," "joining in," and "doing nothing" when witnessing cyberbullying.

    Science.gov (United States)

    Van Cleemput, Katrien; Vandebosch, Heidi; Pabian, Sara

    2014-01-01

    In this article, we investigated several determinants of bystanders' reactive behaviors when confronted with cyberbullying using self-reported data from 2,333 Flemish 9-16 year olds. Structural equation modeling showed that adolescents that had joined in on the cyberbullying were older, had lower levels of empathy and were more likely to have been involved in cyberbullying or traditional bullying as perpetrators. Adolescents who had helped the victim were younger, had higher levels of empathy and were more likely to have been a victim of cyberbullying or traditional bullying in the past months. Adolescents that did nothing when they witnessed cyberbullying, were also older, showed lower levels of empathy and were less likely to have been a victim of traditional bullying. Social anxiety was not related to joining in, helping and remaining passive. In the second part of the analysis, we found that bystanders' passive behavior could be explained in more detail by moral disengagement theory and other contextual factors. In the discussion, the implications of the findings for research on cyberbullying are addressed. © 2014 Wiley Periodicals, Inc.

  16. Analysis of some components of resistance in the hybrids of banana FHIA-23 and plantain FHIA-21 to black (Mycosphaerella fijiensis Morelet) and yellow (M. musicola Leach) sigatokas

    International Nuclear Information System (INIS)

    Guzman Piedrahita, Oscar Adrian; Castano Zapata, Jairo

    2009-01-01

    It was determined the performance of FHIA-20 and FHIA-23 to both Mycosphaerella fijiensis and M. musicola. The study was conducted in a screen house at the Montelindos farm of the University of Caldas, at 1010 most, average temperature 22.8 Celsius degrade, annual precipitation 2200 mm, and relative humidity 76%. Conidia of Paracercospora fijiensis and Pseudocercospora musae, and mixture of both, were inoculated to seedlings having between 4 and 6 leaves. It was evaluated incubation period (IP) of both pathogens, times of evolution of symptoms (TES) and disease development (TDD), also, lesions per leaf (NLL). In FHIA-20, P. musae, P. fijiensis and P. musae+P. fijiensis, had a longer IP than in Dominico Harton, being 3, 20 and 10 days longer, respectively; in addition, the TES of yellow and black sigatokas and the combination of both diseases, was more prolonged in FHIA-20, in 5, 49 and 26 days, respectively, than in local material. In FHIA-23, P. musae, P. fijiensis and P. musae + P. fijiensis, had 2, 6 and 3 more days of IP, respectively, than in Gros Michel; furthermore, FHIA-23 had a TES of yellow and black sigatokas and the combination of both, higher than in Gros Michel, in 9, 16 and 11 days, respectively. In general, FHIA-23 behaved as highly resistant and tolerant to black and yellow sigatokas, respectively, and FHIA-23, resistant.

  17. Lexical tonal discrimination in Zapotec children. A study of the theta rhythm.

    Science.gov (United States)

    Poblano, Adrián; Castro-Sierra, Eduardo; Arteaga, Carmina; Pérez-Ruiz, Santiago J

    Zapotec is a language used mainly in the state of Oaxaca in Mexico of tonal characteristic; homophone words with difference in fundamental frequency with different meanings. Our objective was to analyze changes in the electroencephalographic (EEG) theta rhythm during word discrimination of lexical tonal bi-syllabic homophone word samples of Zapotec. We employed electroencephalography analysis during lexical tonal discrimination in 12 healthy subjects 9-16 years of age. We observed an increase in theta relative power between lexical discrimination and at rest eyes-open state in right temporal site. We also observed several significant intra- and inter-hemispheric correlations in several scalp sites, mainly in left fronto-temporal and right temporal areas when subjects were performing lexical discrimination. Our data suggest more engagement of neural networks of the right hemisphere are involved in Zapotec language discrimination. Copyright © 2015 Hospital Infantil de México Federico Gómez. Publicado por Masson Doyma México S.A. All rights reserved.

  18. Three-dimensional cine MRI in free-breathing infants and children with congenital heart disease

    Energy Technology Data Exchange (ETDEWEB)

    Seeger, Achim; Fenchel, Michael C.; Kramer, Ulrich; Bretschneider, Christiane; Doering, Joerg; Claussen, Claus D.; Miller, Stephan [University of Tuebingen (Germany). Department of Diagnostic and Interventional Radiology; Greil, Gerald F. [St. Thomas Hospital, Division of Imaging Sciences, King' s College London (United Kingdom); Martirosian, Petros [University of Tuebingen, Section of Experimental Radiology, Tuebingen (Germany); Sieverding, Ludger [University of Tuebingen, Department of Pediatric Cardiology, Tuebingen (Germany)

    2009-12-15

    Patients with congenital heart disease frequently have complex cardiac and vascular malformations requiring detailed non-invasive diagnostic evaluation including functional parameters. To evaluate the morphological and functional information provided by a novel 3-D cine steady-state free-precession (SSFP) sequence. Twenty consecutive children (mean age 2.2 years, nine boys) were examined using a 1.5-T MR system including 2-D cine gradient-recalled-echo sequences, static 3-D SSFP and 3-D cine SSFP sequences. Measurement of ventricular structures and volumes showed close agreement between the 3-D cine SSFP sequence and the 2-D cine gradient-recalled-echo and static 3-D SSFP sequences (left ventricular volumes mean difference 1.0-1.9 ml and 8.8-11.4%, respectively; right ventricular volumes 1.7-2.1 ml and 9.9-16.9%, respectively). No systematic bias was observed. 3-D cine MRI provides anatomic as well as functional information with sufficient spatial and temporal resolution in free-breathing infants with congenital heart disease. (orig.)

  19. Three-dimensional cine MRI in free-breathing infants and children with congenital heart disease

    International Nuclear Information System (INIS)

    Seeger, Achim; Fenchel, Michael C.; Kramer, Ulrich; Bretschneider, Christiane; Doering, Joerg; Claussen, Claus D.; Miller, Stephan; Martirosian, Petros; Sieverding, Ludger

    2009-01-01

    Patients with congenital heart disease frequently have complex cardiac and vascular malformations requiring detailed non-invasive diagnostic evaluation including functional parameters. To evaluate the morphological and functional information provided by a novel 3-D cine steady-state free-precession (SSFP) sequence. Twenty consecutive children (mean age 2.2 years, nine boys) were examined using a 1.5-T MR system including 2-D cine gradient-recalled-echo sequences, static 3-D SSFP and 3-D cine SSFP sequences. Measurement of ventricular structures and volumes showed close agreement between the 3-D cine SSFP sequence and the 2-D cine gradient-recalled-echo and static 3-D SSFP sequences (left ventricular volumes mean difference 1.0-1.9 ml and 8.8-11.4%, respectively; right ventricular volumes 1.7-2.1 ml and 9.9-16.9%, respectively). No systematic bias was observed. 3-D cine MRI provides anatomic as well as functional information with sufficient spatial and temporal resolution in free-breathing infants with congenital heart disease. (orig.)

  20. The stigmatization of obesity among Gypsy and Hungarian children.

    Science.gov (United States)

    Papp, Ildikó; Túry, Ferenc

    2013-06-01

    Prejudice against obese people has been widely confirmed in scientific papers. Therefore, recent studies have increasingly focused on investigating the individual and cultural factors related to attitudes towards obesity. Since there have been no comparative studies involving Gypsy people, our present research aimed at exploring the possible discrepancies in children's attitudes towards obese children between Gypsy and Hungarian cultures. Our survey included 247 children aged 9-16 (108 boys and 139 girls), of which 136 considered themselves Hungarian (55.1 %), while 111 children (44.9 %) claimed themselves as Gypsy. The subjects were asked to rank six male and six female figure drawings according to their preference. Each sequence of figure drawings included a healthy child, an obese child, and four drawings depicted children with disabilities. According to our results, the drawings portraying the healthy child figure were rated most preferable and those portraying the obese child figure the least preferable amongst the subjects regardless of gender and origin. However, the obese girl figures and boy figures were rated significantly more positively by Gypsy children than Hungarian children. Our results suggest that there is a difference in attitude towards obesity among Gypsy and Hungarian children. Therefore, it is worthwhile to further explore this phenomenon.

  1. Comparison of spring-loaded, loss of resistance and hanging drop techniques in lumbar epidural blocks.

    Science.gov (United States)

    Gülen, Güven; Akkaya, Taylan; Ozkan, Derya; Kaydul, Mehmet; Gözaydin, Orhan; Gümüş, Haluk

    2012-01-01

    The spring-loaded syringe is a loss of resistance syringe that provide a more objective sign that the epidural space has been entered compared with the traditional techniques. The aim of this study was to compare the time required to locate the epidural space and the backache incidence with the spring-loaded (SL), loss of resistance (LOR) and the hanging drop (HD) techniques for epidural blocks in patients undergoing transurethral resection procedure. Sixty patients undergoing transurethral resections were enrolled in the study. The patients were randomly assigned to one of three groups. Epidural block was performed in the first group with a spring-loaded syringe (n=20), in the second group with loss-of-resistance syringe (n=20), and in the third group with the hanging drop technique (n=20). The required time to locate the epidural space, the number of attempts, the incidence of dural puncture and the backache incidence were assessed during the procedure and for four weeks after the procedure in all patients. The required time to locate the epidural space was 29.1 ± 9.16 seconds in Group 1; 45.25 ± 19.58 seconds in Group 2, and 47.35 ± 11.42 seconds in Group 3 (p0.05). The use of SL syringe was found to have a shorter time period to locate the epidural space when compared with the LOR syringe and hanging drop technique.

  2. IMPORTANT NOTICE: Cancellation of shuttle Circuit 3

    CERN Multimedia

    2013-01-01

    Circuit 3 of the CERN Shuttle Service (Point 5), which has served CMS since the start of LS1, will be cancelled with effect from Tuesday 16 April. This decision has been taken in consultation with CMS, as the circuit was seldom used.   In response to increasing demand for Circuit 1 - Meyrin and feedback from passengers, the two Circuit 3 journeys will be switched to Circuit 1 – Meyrin (see new timetable below): Mornings: Four journeys instead of three. Circuit 1 now starts at 8:10 (instead of 8:19 a.m.) and runs until 9:27 a.m. (instead of 9:16 a.m.). Lunchtimes: Five journeys in place between 12:10 p.m. and 1:47 p.m. Evenings: Circuit starts at 5:23 p.m. (instead of 5:03 p.m.) and ends at 6:20 p.m. at Building 33. Please note that the circuit will depart from Building 13 instead of Building 33.  

  3. What motivates individuals with ADHD? A qualitative analysis from the adolescent's point of view.

    Science.gov (United States)

    Morsink, Sarah; Sonuga-Barke, Edmund; Mies, Gabry; Glorie, Nathalie; Lemiere, Jurgen; Van der Oord, Saskia; Danckaerts, Marina

    2017-08-01

    Individuals with ADHD appear to respond differently to incentives than their peers. This could be due to a general altered sensitivity to reinforcers. However, apart from differences in the degree of motivation, individuals with ADHD might also be motivated by qualitatively different factors. This study aimed to harvest a range of motivational factors and identify ADHD-related qualitative differences in motivation, from the adolescent's point of view. Semi-structured interviews allowing participants to describe what motivates them in daily life were conducted with young adolescents (9-16 years) with and without ADHD. Thematic analysis was undertaken using NVivo software. Major themes relating to motivation were identified from the interview data. These were: (1) achieving a sense of togetherness; (2) feeling competent; (3) fulfilling a need for variation; (4) gaining pleasure from applying effort to achieve a goal; (5) valuing social reinforcement; (6) desiring to be absorbed/forget problems; (7) feeling free and independent, (8) attaining material reinforcement; and (9) an enjoyment of bodily stimulation. The theme structure was very similar for both groups. However, individuals with ADHD differed in some specifics: their focus on the passing of time, the absence of preference for predictable and familiar tasks, and their less elaborate description of the togetherness theme. A broad range of motivational themes was identified, stretching beyond the current focus of ADHD research and motivational theories. Similarities and differences in motivational values of individuals with and without ADHD should be taken into account in reward sensitivity research, and in psychological treatment.

  4. Combined effect of organic manure and potassium on growth and yield of onion cv. BARI piaz-I

    Directory of Open Access Journals (Sweden)

    H.K. Barman

    2013-06-01

    Full Text Available An experiment was conducted to find out the combined effect of cowdung and potassium on the growth and yield of onion cv. BARI piaz-I at Horticulture Farm, Bangladesh Agricultural University, Mymensingh during the period from December 2010 to March 2011. The experiment was laid out in a randomized complete block design with three replications. The two factors experiment had four levels of cowdung, viz., 0, 5, 10 and 20 tons ha-1 and four levels of potassium, viz. 0, 50, 150 and 250 kg K ha-1. Doses of cowdung and potassium showed significant variation in respect of all the parameters studied. The combination of 10 tons cowdung and 250 kg K ha-1 gave the tallest plant (46.60 cm, the highest number of leaves plant-1 (6.40, the highest length of bulb (3.27 cm, the highest diameter of bulb (4.83 cm, individual weight of bulb (51.23 g, dry matter content (12.66% and yield of bulb ha-1 (12.83 tons; whereas the control treatment gave the shortest plant (38.15 cm, lowest number of leaves plant-1 (5.68, diameter of bulb (3.41, individual weight of bulb (35.65g and gave lowest bulb yield ha-1 (9.16 tons.

  5. Disposal rate in different age groups of Karan Fries (Crossbred) males in organized herd.

    Science.gov (United States)

    Panmei, Achun; Gupta, A K; Shivahre, P R; Bhakat, M; Singh, K Mahesh

    2015-02-01

    The present study was carried out to analyze the disposal rate in different age groups of Karan Fries (KF) males in National Dairy Research Institute herd. Records on 1740 KF crossbred bulls born during the period 1997-2012 were collected with an objective to ascertain the effect of genetic and non-genetic (Period of birth and season of birth) factors on the disposal pattern of KF males. The percent of animals disposed from the herd due to mortality and culling was calculated by proportion using descriptive statistics. The data were subjected to Chi-square test to test the difference due to different factors. Overall disposal rate for the different age groups of 0-1 m, 1-2 m, 2-3 m, 3-6 m, 6-18 m, 18 m-3 year and 3-5 year were calculated as 17.9, 16.3, 14.2, 25.8, 49.0, 37.6 and 51.65%, respectively. In the age groups, 3-6 m, 6-18 m and 3-5 year, effect of periods of birth were found to be statistically significant (page group except in 3-5 year age group. Differences in overall disposal rate due to genetic group were statistically significant (page groups. Overview of the results indicated that higher overall disposal rate in age group of 1 month was due to mortality while, in the age groups of >1 month, culling was the primary cause.

  6. Parental emotional competence and parenting in low-income families with adolescents.

    Science.gov (United States)

    Kliewer, Wendy; Borre, Alicia; Wright, Anna W; Jäggi, Lena; Drazdowski, Tess; Zaharakis, Nikola

    2016-02-01

    Ample research has demonstrated that alexithymia, which is characterized by difficulty processing emotions, is associated with disruptions in parenting infants and toddlers. Individuals suffering from alexithymia have among other negative outcomes difficulty building and maintaining interpersonal relationships. Research on emotional expression and recognition has documented the importance of these competencies for the quality of the parent-child relationship and for skills critical for parents of adolescents, such as effective monitoring. However, literature linking parental alexithymia to parenting behaviors and related constructs during adolescents is lacking. The present study closes this gap by examining how mothers' (M age = 39.42 years, SD = 7.62; Range = 23-67) alexithymia affects parent-reported behaviors of solicitation and control, as well as youths' (53.6% female; M age = 12.13 years, SD = 1.62; Range = 9-16) reported disclosure and felt acceptance by their mothers among a sample of 358 primarily urban, African American families. Structural equation models (SEM) revealed that mothers' alexithymia was prospectively related to less parental solicitation 2 years later for both males and females, and to lower levels of felt acceptance for males. Multiple group analyses revealed that these models fits equally well for younger and older youth. Contrary to hypotheses, alexithymia was not related to control or to disclosure. Taken together, these findings indicate that parents' difficulty in processing emotions contributes to parenting beyond early childhood. (c) 2016 APA, all rights reserved).

  7. Association between metabolic syndrome and 10-year risk of developing cardiovascular disease in a Nigerian population

    DEFF Research Database (Denmark)

    Oguoma, Victor M.; Nwose, Ezekiel U.; Skinner, Timothy C.

    2016-01-01

    Background: Prevalence of metabolic syndrome (MetS) and consequential cardiovascular disease (CVD) events are on the increase in Nigeria. The study aimed to identify the prevalence of 10-year CVD risk in a Nigerian population and assess its relationship with different indices of MetS. Method....... MetS was defined based on the Joint Scientific Statement on Harmonizing the MetS. Result: Of the 211 subjects, mean age was 51.3±17.3 years. Average risk of developing CVD in the next 10 years was 3.7±5.3%. Prevalence of low, moderate and high risk of developing CVD among study participants was 86.......3% (95% CI 82.0-91.3%), 11.8% (95% CI 6.9-16.1%) and 1.9% (95% CI 0.0-3.8%), respectively. Prevalence of MetS was 26.7% (95% CI 21.0-33.3%). There was poor agreement between MetS and the CVD risk scores (kappa=0.209, p=0.001) Conclusions: The results showed that complementary use of MetS and CVD risk...

  8. Association between trichodiniasis in eel ( Anguilla anguilla ) and water quality in recirculation systems

    DEFF Research Database (Denmark)

    Madsen, H.C.K.; Buchmann, K.; Mellergaard, Stig

    2000-01-01

    Association between various water quality parameters and the infection level of Trichodina jadranica in cultured eels were examined in nine recirculation farms in Denmark. Production units suffering from trichodiniasis (n = 4) had relatively high contents of organic dry matter (13-65 mg l(-1)), low...... concentrations of nitrate (150-500 mg NO3 l(-1)) and high pH (6.2-7.4) in the process water compared to farms without Trichodina problems (n = 5), which had a relatively low load of organic dry matter (9-16 mg l(-1)), high nitrate concentration (250-900 mg NO3 l(-1)) and a low pH (5.3-6.9). More detailed studies...... of the effect of water parameters on the infection level were conducted in two production units suffering from frequent outbreaks of trichodiniasis. In one production unit, the high and highly varying content of organic dry matter (21- 83 mg l(-1)) was significantly and positively correlated (r = 0.37, p

  9. Novel Bartonella Species in Insectivorous Bats, Northern China.

    Directory of Open Access Journals (Sweden)

    Hui-Ju Han

    Full Text Available Bartonella species are emerging human pathogens. Bats are known to carry diverse Bartonella species, some of which are capable of infecting humans. However, as the second largest mammalian group by a number of species, the role of bats as the reservoirs of Bartonella species is not fully explored, in term of their species diversity and worldwide distribution. China, especially Northern China, harbors a number of endemic insectivorous bat species; however, to our knowledge, there are not yet studies about Bartonella in bats in China. The aim of the study was to investigate the prevalence and genetic diversity of Bartonella species in bats in Northern China. Bartonella species were detected by PCR amplification of gltA gene in 25.2% (27/107 bats in Mengyin County, Shandong Province of China, including 1/3 Rhinolophus ferrumequinum, 2/10 Rhinolophus pusillus, 9/16 Myotis fimbriatus, 1/5 Myotis ricketti, 14/58 Myotis pequinius. Phylogenetic analysis showed that Bartonella species detected in bats in this study clustered into ten groups, and some might be novel Bartonella species. An association between Bartonella species and bat species was demonstrated and co-infection with different Bartonella species in a single bat was also observed. Our findings expanded our knowledge on the genetic diversity of Bartonella in bats, and shed light on the ecology of bat-borne Bartonella species.

  10. Concentrações bioquímicas séricas de jacaré-açú (Melanosuchus niger machos, adultos de vida livre

    Directory of Open Access Journals (Sweden)

    Bruno Tolentino Caixeta

    2015-12-01

    Full Text Available Resumo: O jacaré-açu (Melanosuchus niger, pertencendo à família Aligatoridae, é considerado o maior predador aquático da América Continental. Como todos os répteis, possui particularidades para o uso de energia, controlando sua temperatura corporal nas variações climáticas. Essas variações podem revelar a situação metabólica atual desse animal, justificando o estudo de tais parâmetros. A importância desse trabalho se justifica pela escassez de estudos disponíveis na literatura. Nesse sentido, determinamos o perfil bioquímico de compostos sanguíneos de 12 jacarés açu, com peso de 77,66±8,92 kg, os quais foram: uréia (3,41±0,66, albumina (24,85±0,63, proteína total (63,83±16,97, ácido úrico (0,25±0,09, glicose (6,99±0,77, colesterol total (2,20±0,27, triglicérides (0,58±0,07, TGO (138,83±9,16 e TGP (12,47±2,82.

  11. Synthesis of anatase TiO2 nanoparticles with beta-cyclodextrin as a supramolecular shell.

    Science.gov (United States)

    Li, Landong; Sun, Xiaohong; Yang, Yali; Guan, Naijia; Zhang, Fuxiang

    2006-11-20

    We report a novel, green hydrothermal-synthesis route to well-dispersed anatase TiO2 nanoparticles with particle sizes of 9-16 nm in the presence of beta-CD (beta-cyclodextrin). During the synthesis process, the CD-containing synthesis mixture assembled in both longitudinal and latitudinal directions. Driven by the interaction between molecules, the beta-CDs assembled in the longitudinal direction to form long-chain compounds, whereas in the latitudinal direction, they tended to form regular aggregates through coordination with the Ti species from the hydrolysis of tetrabutyl titanate. In view of the effect of the coordination and the steric hindrance of beta-CDs as a supramolecular shell, homogeneous nuclei and slow growth of TiO2 crystals during the synthesis process was observed, which was responsible for the formation of uniform TiO2 nanoparticles. The low beta-CD dosage and the high product yield (>90%) demonstrated well the potential of this synthesis route in the large-scale industrial production of anatase nanoparticles.

  12. Simulation exercise to improve retention of cardiopulmonary resuscitation priorities for in-hospital cardiac arrests: A randomized controlled trial.

    Science.gov (United States)

    Sullivan, Nancy J; Duval-Arnould, Jordan; Twilley, Marida; Smith, Sarah P; Aksamit, Deborah; Boone-Guercio, Pam; Jeffries, Pamela R; Hunt, Elizabeth A

    2015-01-01

    Traditional American Heart Association (AHA) cardiopulmonary resuscitation (CPR) curriculum focuses on teams of two performing quality chest compressions with rescuers on their knees but does not include training specific to In-Hospital Cardiac Arrests (IHCA), i.e. patient in hospital bed with large resuscitation teams and sophisticated technology available. A randomized controlled trial was conducted with the primary goal of evaluating the effectiveness and ideal frequency of in-situ training on time elapsed from call for help to; (1) initiation of chest compressions and (2) successful defibrillation in IHCA. Non-intensive care unit nurses were randomized into four groups: standard AHA training (C) and three groups that participated in 15 min in-situ IHCA training sessions every two (2M), three (3M) or six months (6M). Curriculum included specific choreography for teams to achieve immediate chest compressions, high chest compression fractions and rapid defibrillation while incorporating use of a backboard, stepstool. More frequent training was associated with decreased median (IQR) seconds to: starting compressions: [C: 33(25-40) vs. 6M: 21(15-26) vs. 3M: 14(10-20) vs. 2M: 13(9-20); p training sessions: [C:5%(1/18) vs. 6M: 23%(4/17) vs. 3M: 56%(9/16) vs. 2M: 73%(11/15); p training sessions conducted every 3 months are effective in improving timely initiation of chest compressions and defibrillation in IHCA. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  13. Fibronectin non-amyloid glomerulopathy.

    Science.gov (United States)

    Yong, Jim L; Killingsworth, Murray C; Spicer, S Timothy; Wu, Xiao-Juan

    2009-11-20

    A 41-year-old Burmese man presented with nephrotic syndrome, a creatinine level of 150 micromol/L and limited clinical history. His renal biopsy demonstrated glomerulopathy with large eosinophilic deposits in the mesangium and capillary loops that were negative for Congo red, slightly positive for periodic acid-Schiff and blue with Masson trichrome stain. Immunofluorescence microscopy with a routine antibody panel was unhelpful. Electron microscopy demonstrated extensive, moderately electron-dense deposits in the subendothelial space, subepithelial space and mesangium that could be differentiated from adjacent basement membrane by their increased electron density. The deposits contained finely granular material and occasional filaments with variable diameter ranging from 9-16 nm. Fibronectin glomerulopathy was suspected from anti-fibronectin immunohistochemistry that showed positive staining of thickened capillary loops. This staining was subsequently confirmed by immunoelectron microscopy demonstrating the presence of cellular fibronectin (cFN) in deposits. Significantly, deposition of fibronectin appeared to have occurred in the absence of thickening or folding of the adjacent basement membrane. The prominent mesangial location of deposits containing a cFN isotype may indicate that retention of local fibronectin produced in the mesangium has contributed to this pathology.

  14. Canine diabetes mellitus risk factors: A matched case-control study.

    Science.gov (United States)

    Pöppl, Alan Gomes; de Carvalho, Guilherme Luiz Carvalho; Vivian, Itatiele Farias; Corbellini, Luis Gustavo; González, Félix Hilário Díaz

    2017-10-01

    Different subtypes of canine diabetes mellitus (CDM) have been described based on their aetiopathogenesis. Therefore, manifold risk factors may be involved in CDM development. This study aims to investigate canine diabetes mellitus risk factors. Owners of 110 diabetic dogs and 136 healthy controls matched by breed, sex, and age were interviewed concerning aspects related to diet, weight, physical activity, oral health, reproductive history, pancreatitis, and exposure to exogenous glucocorticoids. Two multivariate multivariable statistical models were created: The UMod included males and females without variables related to oestrous cycle, while the FMod included only females with all analysed variables. In the UMod, "Not exclusively commercial diet" (OR 4.86, 95%CI 2.2-10.7, Pdiet" (OR 4.14, 95%CI 1.3-12.7, P=0.01), "Table scraps abuse" (OR 3.62, 95%CI 1.1-12.2, P=0.03), "Overweight" (OR 3.91, 95%CI 1.2-12.6, P=0.02), and "Dioestrus" (OR 5.53, 95%CI 1.9-16.3, P=0.002) were statistically significant. The findings in this study support feeding not exclusively balanced commercial dog food, overweight, treats abuse, and diestrus, as main CDM risk factors. Moreover, those results give subside for preventive care studies against CDM development. Copyright © 2017 Elsevier Ltd. All rights reserved.

  15. Out with the old, in with the new: a novel approach to treating pain associated with rib fractures.

    Science.gov (United States)

    Truitt, Michael S; Mooty, R Clark; Amos, Joseph; Lorenzo, Manuel; Mangram, Alicia; Dunn, Ernest

    2010-10-01

    Rib fractures continue to be a challenging problem from both a pulmonary and analgesia standpoint. As a result, numerous modalities have been used to treat this condition, but none has proven universally available and efficacious. The objective of this pilot study was to assess the efficacy of a novel technique for placing an elastomeric infusion pump (EIP) catheter (On-Q; Lake Forest, CA, USA) in the extrathoracic paraspinous space to create a continuous intercostal nerve block. This was a prospective, nonrandomized study conducted in the surgical intensive care unit (SICU) of an urban level II trauma center. We developed a novel technique for placing EIP catheters in the extrathoracic paraspinous space to provide continuous intercostal nerve blockade. We subsequently evaluated 30 consecutive blunt trauma patients with three or more unilateral rib fractures. The catheters were infused with local anesthetic, and the dose was titrated to achieve adequate analgesia. For each patient, preplacement numeric pain scale scores (NPSs) and sustained maximum inspiration (SMI) lung volumes were determined. Sixty minutes following placement of the catheters, the NPS and SMI were repeated. The patients were monitored for any procedural or drug-related complications. The mean age of the patients was 65 years (22-92 years); the mean ISS was 14 (9-16); and the mean number of rib fractures was 4.4 (3-8). Overall, the mean NPS significantly improved (preplacement NPS 9.03, postplacement NPS 3.06; p pain secondary to rib fractures.

  16. Continuous intercostal nerve blockade for rib fractures: ready for primetime?

    Science.gov (United States)

    Truitt, Michael S; Murry, Jason; Amos, Joseph; Lorenzo, Manuel; Mangram, Alicia; Dunn, Ernest; Moore, Ernest E

    2011-12-01

    Providing analgesia for patients with rib fractures continues to be a management challenge. The objective of this study was to examine our experience with the use of a continuous intercostal nerve block (CINB). Although this technique is being used, little data have been published documenting its use and efficacy. We hypothesized that a CINB would provide excellent analgesia, improve pulmonary function, and decrease length of stay (LOS). Consecutive adult blunt trauma patients with three or more unilateral rib fractures were prospectively studied over 24 months. The catheters were placed at the bedside in the extrathoracic, paravertebral location, and 0.2% ropivacaine was infused. Respiratory rate, preplacement (PRE) numeric pain scale (NPS) scores, and sustained maximal inspiration (SMI) lung volumes were determined at rest and after coughing. Parameters were repeated 60 minutes after catheter placement (POST). Hospital LOS comparison was made with historical controls using epidural analgesia. Over the study period, 102 patients met inclusion criteria. Mean age was 69 (21-96) years, mean injury severity score was 14 (9-16), and the mean number of rib fractures was 5.8 (3-10). Mean NPS improved significantly (PRE NPS at rest = 7.5 vs. POST NPS at rest = 2.6, p pain control, and shortens LOS in patients with rib fractures.

  17. Leaching studies on SYNROC at 950C and 2000C

    International Nuclear Information System (INIS)

    Oversby, V.M.; Ringwood, A.E.

    1982-01-01

    Crushed samples of SYNROC containing 9%, 16% and 20% of simulated high-level nuclear waste were tested for leaching behavior in distilled water at 95 0 C and 200 0 . Leach solutions were analyzed for Cs, Ca, Ba, Sr, Ti, Zr, Nd and U. Results showed that leach rates based on these elements did not change significantly as the waste loading was increased from 9 to 20%. At both temperatures, leach rates showed a decrease as leaching progressed until a plateau level was reached. Plateau leach rates, which were between 10 and 100 times lower than initial leach rates, reflect the expected long term leaching behaviour of the samples. Plateau values of leach rates for SYNROC depend on the element being leached. Highest values are found for Cs and Ba (1 to 2 x 10 -7 g/cm 2 d at 95 0 C) and lowest values for U (5 x 10 -10 g/cm 2 d at 95 0 C). Increasing leaching temperature to 200 0 C produces higher leach rates for all elements except Nd. Comparison of SYNROC leach rate data with that for PNL 76-68 glass shows that at 200 0 C the leach rate for U from SYNROC is 3000 times less than that from glass. (Auth.)

  18. Comparison of APR1400 safety between brake site and shin-Kori site Due to the difference in the climate conditions

    International Nuclear Information System (INIS)

    Yoon, Ho Joon; Lee, Jeong Ik; Lee, Jeong Ik

    2012-01-01

    Brake Nuclear Power Plant (BNPP) is now under the construction based on APR1400 designed by Korean Electric Power Corporation (KEPCO). APR1400 is a two loop pressurized water reactor, the nuclear steam supply system (NSSS) US designed for about put of 4,000 MWt, with a corresponding electrical output of approximately 1,390 MWe. The first APR1400 (SKN 3 and 4) constructed in Shin-Kori, Korea has been modified according to the surrounding environment of the United Arab Emirates. In this paper, authors would like to compare safety issues between B NPP and Skin due to the changes of surroundings, since the site characteristics are very different. For instance, the mean annual air temperature in the UAE is 28 .deg. C and the peak air temperature was recorded as 48.8 .deg. C. Sea temperatures are varying from 17. deg. C in January to 35. deg. C in August, while that of Korea is in 9-16. deg. C range. Hot climate of UAE and the malfunction of HVAC system can lead the increasing of the water temperature in safety injection system (SIS). The heated water in SIS may affect the safety margin of the peak cladding temperature (PCT). The change of PCT and response time according to design basis accident scenarios such as large break LOCA are analyzed in detail. To evaluate such effect, Mars code was utilized to evaluate assumed condition by KAIST and the analyses of the results were carried out by Khalifa Univ.

  19. Reliability and reference values of two clinical measurements of dynamic and static knee position in healthy children

    DEFF Research Database (Denmark)

    Ortqvist, Maria; Moström, Eva B; Roos, Ewa M.

    2011-01-01

    PURPOSE: The purposes of this study were to evaluate reliability of the Single-limb mini squat test (a dynamic measure of medio-lateral knee position) and the Quadriceps-angle (Q-angle) (a static measure of medio-lateral knee position), present paediatric reference values of the Q......-angle measurements was found. Reference values for the Q-angle (mean 13.5° (1.9)-15.3° (2.8)) varies with age and gender. No associations were found between dynamic and static measures. CONCLUSIONS: The Single-limb mini squat test showed a moderate reliability and the Q-angle showed a fair to moderate reliability......-angle, and evaluate the association between the tests. METHODS: Two hundred and forty-six healthy children (9-16 years) were included (intra/inter-rater reliability for Q-angle (n = 37/85) and for Single-limb mini squat test (n = 33/28)). Dynamic medio-lateral knee position was assessed by the Single-limb mini squat...

  20. Impact of pulmonary rehabilitation on postoperative complications in patients with lung cancer and chronic obstructive pulmonary disease.

    Science.gov (United States)

    Saito, Hajime; Hatakeyama, Kazutoshi; Konno, Hayato; Matsunaga, Toshiki; Shimada, Yoichi; Minamiya, Yoshihiro

    2017-09-01

    Given the extent of the surgical indications for pulmonary lobectomy in breathless patients, preoperative care and evaluation of pulmonary function are increasingly necessary. The aim of this study was to assess the contribution of preoperative pulmonary rehabilitation (PR) for reducing the incidence of postoperative pulmonary complications in non-small cell lung cancer (NSCLC) patients with chronic obstructive pulmonary disease (COPD). The records of 116 patients with COPD, including 51 patients who received PR, were retrospectively analyzed. Pulmonary function testing, including slow vital capacity (VC) and forced expiratory volume in one second (FEV 1 ), was obtained preoperatively, after PR, and at one and six months postoperatively. The recovery rate of postoperative pulmonary function was standardized for functional loss associated with the different resected lung volumes. Propensity score analysis generated matched pairs of 31 patients divided into PR and non-PR groups. The PR period was 18.7 ± 12.7 days in COPD patients. Preoperative pulmonary function was significantly improved after PR (VC 5.3%, FEV 1 5.5%; P pulmonary complications after pulmonary lobectomy (odds ratio 18.9, 16.1, and 13.9, respectively; P pulmonary function after lobectomy in the early period, and may decrease postoperative pulmonary complications. © 2017 The Authors. Thoracic Cancer published by China Lung Oncology Group and John Wiley & Sons Australia, Ltd.

  1. Fractionated stereotactic radiotherapy of glomus jugulare tumors. Local control, toxicity, symptomatology, and quality of life

    International Nuclear Information System (INIS)

    Henzel, M.; Gross, M.W.; Failing, T.; Strassmann, G.; Engenhart-Cabillic, R.; Hamm, K.; Surber, G.; Kleinert, G.; Sitter, H.

    2007-01-01

    Background and Purpose: For glomus jugulare tumors, the goal of treatment is microsurgical excision. To minimize postoperative neurologic deficits, stereotactic radiosurgery (SRS) was performed as an alternative treatment option. Stereotactic fractionated radiotherapy (SRT) could be a further alternative. This study aims at the assessment of local control, side effects, and quality of life (QoL). Patients and Methods: Between 1999-2005, 17 patients were treated with SRT. 11/17 underwent previous operations. 6/17 received primary SRT. Treatment was delivered by a linear accelerator with 6-MV photons. Median cumulative dose was 57.0 Gy. Local control, radiologic regression, toxicity, and symptomatology were evaluated half-yearly by clinical examination and MRI scans. QoL was assessed by Short Form-36 (SF-36). Results: Median follow-up was 40 months. Freedom from progression and overall survival for 5 years were 100% and 93.8%. Radiologic regression was seen in 5/16 cases, 11/16 patients were stable. Median tumor shrinkage was 17.9% (p = 0.14). Severe acute toxicity (grade 3-4) or any late toxicity was never seen. Main symptoms improved in 9/16 patients, 7/16 were stable. QoL was not affected in patients receiving primary SRT. Conclusion: SRT offers an additional treatment option of high efficacy with less side effects, especially in cases of large tumors, morbidity, or recurrences after incomplete resections. (orig.)

  2. Isolation and characterization of biosurfactant-producing Alcanivorax strains: hydrocarbon accession strategies and alkane hydroxylase gene analysis.

    Science.gov (United States)

    Olivera, Nelda L; Nievas, Marina L; Lozada, Mariana; Del Prado, Guillermo; Dionisi, Hebe M; Siñeriz, Faustino

    2009-01-01

    Biosurfactant-producing bacteria belonging to the genera Alcanivorax, Cobetia and Halomonas were isolated from marine sediments with a history of hydrocarbon exposure (Aristizábal and Gravina Peninsulas, Argentina). Two Alcanivorax isolates were found to form naturally occurring consortia with strains closely related to Pseudomonas putida and Microbacterium esteraromaticum. Alkane hydroxylase gene analysis in these two Alcanivorax strains resulted in the identification of two novel alkB genes, showing 86% and 60% deduced amino acid sequence identity with those of Alcanivorax sp. A-11-3 and Alcanivorax dieselolei P40, respectively. In addition, a gene homologous to alkB2 from Alcanivorax borkumensis was present in one of the strains. The consortium formed by this strain, Alcanivorax sp. PA2 (98.9% 16S rRNA gene sequence identity with A. borkumensis SK2(T)) and P. putida PA1 was characterized in detail. These strains form cell aggregates when growing as mixed culture, though only PA2 was responsible for biosurfactant activity. During exponential growth phase of PA2, cells showed high hydrophobicity and adherence to hydrocarbon droplets. Biosurfactant production was only detectable at late growth and stationary phases, suggesting that it is not involved in initiating oil degradation and that direct interfacial adhesion is the main hydrocarbon accession mode of PA2. This strain could be useful for biotechnological applications due to its biosurfactant production, catabolic and aggregation properties.

  3. Southwest Atlantic Ocean Marathon Expedition, Leg 8.

    Science.gov (United States)

    1986-07-01

    WEST 36.0OS 530 52* 51* 500 490 46* 470 460 450 440 43v 420 w X~ 400- w~ 600-~ 5 5 27-29 OCT 1984 35.50S LONGITUDE WEST 3%50 53’ 52’ 51’ 50* 490 48...b.8 K0$b.8 OKj/h.8 N../Kc JAC fta /s..2 N/S 10.41/5.4 1.0 1.0164111 16.416 36.711 26. 190 26 196 is.1 £611.6 016 10 1522.6 0 310 10.9 16.46 1641 28707...0.0 2.0 4.0 6.0 8.0 10.0 12.0 14.0 16.0 18.0 20.0 o 24.0 25.0 26.0 27.0 28.0 20- i8 16 A6 14 - /- hi 12 / . o 6 0 4 - 2 0 Nile -2 . 32.0 33.0 340 350

  4. Pengaruh Konsentrasi Minyak Kelapa Murni (Virgin Coconut Oil dan Minyak Jarak (Castor Oil terhadap Sifat Fisikokimia dan Organoleptik Sabun Mandi Cair

    Directory of Open Access Journals (Sweden)

    Asri Widyasanti

    2017-04-01

    Full Text Available VCO contains of lauric acid that perform to smooth and to moisturize the skin. Castor oil has ricinoleic acid that serves to protect the skin. Therefore, both of the oil are suitable to be the raw material for liquid soap making. This study aimed were to produce a liquid soap, to determine the exact concentration of VCO and castor oil for liquid soap and to find out the effect of VCO and Castor Oil concentrations to the characteristics of liquid soap. The method used was laboratory experimental method with descriptive analysis. The treatments in this study were A =concentrations of VCO 100 %, B = concentrations of VCO 80 % and castor oil 20 %, C = concentrations of VCO 50 % and castor oil 50 %, D = concentrations of VCO 20 % and castor oil 80 %, and E = concentrations of castor oil 100 %,  from 200 gram soap base. The parameter observed for liquid soap included chemical properties, physical properties of soap, and organoleptic test. The result shows that all treatments complies the requirement SNI 06-4085-1996. The formula of liquid soap with treatment B was revealed as the best product with 0.01 % of total alkali content, pH value of 9.16 , specific gravity 1.06, and total plate count 5colonies/g. This technology process of natural liquid soap production with the VCO and castor oil could be develop and apply in industrial scale.

  5. Comparison of lipid lowering effect of extra virgin olive oil and atorvastatin in dyslipidemia in type 2 diabetes mellitus

    International Nuclear Information System (INIS)

    Khan, T.M.

    2017-01-01

    Extra virgin olive oil (EVOO) is fruit oil with rich source of monounsaturated fats and powerful antioxidants. It acts as hypolipidemic agent and significant decrease of plasma lipids levelwas observed with EVOO use. Atorvastatin is hypolipidemic drug commonly used for treatment of hyperlipidaemia. The purpose of this study was to determine and compare the lipid lowering effect of EVOO with atorvastatin in type 2 diabetic dyslipidaemia which is leading cause of microvascular diseases. Methods: This cross-sectional study was conducted on 60 already diagnosed cases of type 2 diabetes mellitus with dyslipidaemia. All sixty subjects were divided into 2 groups. Atorvastatin 40mg was given to Group One and two tablespoons of extra virgin olive oil orally per day was given to Group Two. Blood was collected for estimation of plasma lipids level at base line, 4th week, and 6th weeks in two groups and was compared statistically. Results: The present study demonstrated 20-40% lipid lowering effect of atorvastatin on plasma lipids level with 9-16% increase in HDL while extra virgin olive oil showed 14 to 25% reduction in plasma lipids with 8-12% increase in HDL-cholesterol level. Conclusion: This study concludes that both atorvastatin and extra virgin olive oil are effective in reducing plasma lipids level in type 2 diabetic dyslipidaemia with more prominent effect of atorvastatin than EVOO. (author)

  6. Introducing random safety audits (RSA) in a neonatal intensive care unit (NICU).

    LENUS (Irish Health Repository)

    Szymanska, M

    2012-01-31

    Random safety audits (RSA) have been shown to be effective in improving standards of clinical practice. 19 data collection audits were performed relating to hygiene, safe prescribing, oxygen pulse oximetry monitoring and documentation in keeping with the requirements of the new Medical Practitioners Act (MPA) 2007. Hygiene audits (range from 20\\/25 to 21\\/21 80%-100%) and safe prescribing audits (range from 23\\/25 to 25\\/25 86%-100%) achieved n=25 100% compliance with unit guidelines over a 3 month period. Compliance with oxygen pulse oximetry monitoring guideline limits improved from 4\\/27 (15%) to 9\\/16 (56%). Compliance with requirement and use of Physician IMC registration number in documentation was only 10\\/18 (56%). RSA\\'s led to improvements in hygiene and prescribing. Compliance with oxygen monitoring guideline limits highlighted the need for greater education. Awareness of legal requirements relating to documentation improved but this has not translated into a change in practice. RSA\\'s can facilitate real time quality improvement in daily clinical practice.

  7. Working memory arrest in children with high-functioning autism compared to children with attention-deficit/hyperactivity disorder: results from a 2-year longitudinal study.

    Science.gov (United States)

    Andersen, Per N; Skogli, Erik W; Hovik, Kjell T; Geurts, Hilde; Egeland, Jens; Øie, Merete

    2015-05-01

    The aim of this study was to analyse the development of verbal working memory in children with high-functioning autism compared to children with attention-deficit/hyperactivity disorder and typically developing children. A total of 34 children with high-functioning autism, 72 children with attention-deficit/hyperactivity disorder and 45 typically developing children (age 9-16 years) were included at baseline and followed up approximately 25 months later. The children were given a letter/number sequencing task to assess verbal working memory. The performance of children with high-functioning autism on verbal working memory did not improve after 2 years, while improvement was observed in children with attention-deficit/hyperactivity disorder and typically developing children. The results indicate a different developmental trajectory for verbal working memory in children with high-functioning autism compared to children with attention-deficit/hyperactivity disorder and typically developing children. More research is needed to construct a developmental framework more suitable for children with autism spectrum disorder. © The Author(s) 2014.

  8. RESOLUTE PET/MRI Attenuation Correction for O-(2-F-fluoroethyl)-L-tyrosine (FET) in Brain Tumor Patients with Metal Implants

    DEFF Research Database (Denmark)

    Ladefoged, Claes N; Andersen, Flemming L; Kjær, Andreas

    2017-01-01

    of agreement for TMAX/B was for RESOLUTE (-3%; 4%), Dixon (-9%; 16%), and UTE (-7%; 10%). The absolute error when measuring BTV was 0.7 ± 1.9 mL (N.S) with RESOLUTE, 5.3 ± 10 mL using Dixon, and 1.7 ± 3.7 mL using UTE. RESOLUTE performed best in the identification of the location of peak activity and in brain...... to be quantitatively correct in order to be used clinically, which require accurate attenuation correction (AC) in PET/MRI. The aim of this study was to evaluate the use of the subject-specific MR-derived AC method RESOLUTE in post-operative brain tumor patients.Methods:We analyzed 51 post-operative brain tumor...... patients (68 examinations, 200 MBq [18F]-FET) investigated in a PET/MRI scanner. MR-AC maps were acquired using: (1) the Dixon water fat separation sequence, (2) the ultra short echo time (UTE) sequences, (3) calculated using our new RESOLUTE methodology, and (4) a same day low-dose CT used as reference...

  9. Effect aquadest-extracted Gloriosa superba seed as mutagen on morphology of Artemisia annua

    Science.gov (United States)

    Rahmawati, S. I.; Susilowati, A.; Yunus, A.; Widyastuti, Y.

    2018-03-01

    Gloriosa superba is a plant that contains colchicine in all parts of organs, especially in the seeds. Its extract is as a mutagen to produce plants with polyploid cells. Artemisia annua is a plant that produces active ingredients artemisinin as malarial drugs, hemorrhoids therapy, aromatherapy, antiviral, anticancer, and anti-bacterial. The aims of this research was to determine the effect aquadest-extracted Gloriosa superba seed as a mutagen to Artemisia annua morphology. Extraction of Gloriosa superba seeds obtained from Sukoharjo using maceration method with aquadest solvent (1: 1). The extracts were diluted (0, 25, 50, 75 and 100%) for Artemisia annua sprinkling with different times (0, 30, 60 and 90 minutes). Observations of morphology Artemisia annua included height, stem circumference, number of branches, number of leaves, leaf width and leaf length. The treatments did not affect plant morphology observation included height, stem circumference, number of branches, number of leaves, leaf width, and leaf length. The EB treatment (100%, 30 minutes) was higher (120 cm) than other. In all treatments stem circumference about 2.5 cm, number of branches ranged between 40-50, leaves width ranged 9-16c m, and leaf length ranged 8-15 cm.

  10. Comparison of preoperative computerized tomography scan imaging of temporal bone with the intra-operative findings in patients undergoing mastiodectomy

    International Nuclear Information System (INIS)

    Gerami, H.; Naghavi, E.; Wahabi-Moghadam, M.; Forghanparast, K.; Akbar, Manzar H.

    2009-01-01

    Objective was to compare the consistency rates of pre- and intra-operative radiological findings in patients with chronic suppurative otitis media (CSOM). In a cross-sectional study, 80 patients with CSOM underwent pre-operative CT scanning and we compared the results with intra-operative clinical findings during mastiodectomy from 2000-2004 in the Otology Department, Amiralmomenin Hospital of Guilan Medical University, Rasht, Iran. Sensitivity, specificity, positive and negative predictive value of CT scan in tympanic and mastoid cholesteatoma, ossicular chain erosion, tegmentympani erosion, dehiscence of facial canal, lateral semicircular canal (LSCC) fistula were assessed. Then, correlation between radiological findings and intra-operative findings were calculated. The mean age of patients was 27.9+-16.3 years. Mostly were males (n=57 [71.3%]). Correlation of preoperative radiological images with intra-operative clinical findings were moderate to good on tympanic cholesteatoma, mastoid cholesteatoma and ossicular chain erosion, but weak and insignificant in cases of tegmen erosion, facial canal dehiscene and LSCC fistulae. Preoperative CT scan may be helpful in decision-making for surgery in cases of cholesteatoma and ossicular erosion. Despite of limitations radiological scanning is a useful adjunct to management of CSOM. (author)

  11. Equilibrium curve determination of HF adsorption by activated carbon

    International Nuclear Information System (INIS)

    Bahrami, H.; Safdari, S. J.; Mousavian, S. M. A.

    2010-01-01

    One of the byproducts of uranium enrichment industry is hydrogen fluoride gas. Due to the toxicity and corrosivity of the molecule, it has adverse effects on the environment and the process. Therefore, it must be removed by adsorption towers. The activated carbon is one of the proposed sorbent for the adsorption. Hydrogen fluoride adsorption equilibrium curve gives important information for designing the adsorption towers. In this article, the hydrogen fluoride adsorption and adsorption factors were determined experimentally, and four different types of carbon have been used. The operating pressure in all tests was less than 30 mbar. Comparison between the obtained experimental equilibrium curves shows that the first, second and fourth types of activated carbon are suitable for the adsorption of hydrogen fluoride. The experimental data were fitted using mathematical models of Langmuir, Freundlich, Toth and Henry. The results show that Toth mathematical model is more suitable than other models. Also, the absolute error were predicted by the model of Toth for the first, second and fourth types of the activated carbon were 12.9, 16.5 and 34 percent, respectively.

  12. Study of a ternary blend system for bulk heterojunction thin film solar cells

    Science.gov (United States)

    Ahmad, Zubair; Touati, Farid; Shakoor, R. A.; Al-Thani, N. J.

    2016-08-01

    In this research, we report a bulk heterojunction (BHJ) solar cell consisting of a ternary blend system. Poly(3-hexylthiophene) P3HT is used as a donor and [6,6]-phenyl C61-butyric acid methylester (PCBM) plays the role of acceptor whereas vanadyl 2,9,16,23-tetraphenoxy-29H, 31H-phthalocyanine (VOPcPhO) is selected as an ambipolar transport material. The materials are selected and assembled in such a fashion that the generated charge carriers could efficiently be transported rightwards within the blend. The organic BHJ solar cells consist of ITO/PEDOT:PSS/ternary BHJ blend/Al structure. The power conversion efficiencies of the ITO/ PEDOT:PSS/P3HT:PCBM/Al and ITO/PEDOT:PSS/ P3HT:PCBM:VOPcPhO/Al solar cells are found to be 2.3% and 3.4%, respectively. This publication was made possible by PDRA (Grant No. PDRA1-0117-14109) from the Qatar National Research Fund (a member of Qatar Foundation). The findings achieved herein are solely the responsibility of the authors.

  13. Am I normal? A systematic review and construction of nomograms for flaccid and erect penis length and circumference in up to 15,521 men.

    Science.gov (United States)

    Veale, David; Miles, Sarah; Bramley, Sally; Muir, Gordon; Hodsoll, John

    2015-06-01

    To systematically review and create nomograms of flaccid and erect penile size measurements. Study key eligibility criteria: measurement of penis size by a health professional using a standard procedure; a minimum of 50 participants per sample. samples with a congenital or acquired penile abnormality, previous surgery, complaint of small penis size or erectile dysfunction. Synthesis methods: calculation of a weighted mean and pooled standard deviation (SD) and simulation of 20,000 observations from the normal distribution to generate nomograms of penis size. Nomograms for flaccid pendulous [n = 10,704, mean (SD) 9.16 (1.57) cm] and stretched length [n = 14,160, mean (SD) 13.24 (1.89) cm], erect length [n = 692, mean (SD) 13.12 (1.66) cm], flaccid circumference [n = 9407, mean (SD) 9.31 (0.90) cm], and erect circumference [n = 381, mean (SD) 11.66 (1.10) cm] were constructed. Consistent and strongest significant correlation was between flaccid stretched or erect length and height, which ranged from r = 0.2 to 0.6. relatively few erect measurements were conducted in a clinical setting and the greatest variability between studies was seen with flaccid stretched length. Penis size nomograms may be useful in clinical and therapeutic settings to counsel men and for academic research. © 2014 The Authors. BJU International © 2014 BJU International.

  14. Microencapsulation by spray drying of lemon essential oil: Evaluation of mixtures of mesquite gum-nopal mucilage as new wall materials.

    Science.gov (United States)

    Cortés-Camargo, Stefani; Cruz-Olivares, Julian; Barragán-Huerta, Blanca E; Dublán-García, Octavio; Román-Guerrero, Angélica; Pérez-Alonso, César

    2017-06-01

    Mesquite gum (MG) and nopal mucilage (NM) mixtures were used for microencapsulation of lemon essential oil (LEO) by spray drying. Emulsions of MG, NM and MG-NM mixtures (25-75, 50-50, 75-25) were evaluated according to the droplet size (1.49-9.16 μm), viscosity and zeta potential (-16.07 to -20.13 mV), and microcapsules were characterised in particle size (11.9-44.4 μm), morphology, volatile oil retention (VOR) (45.9-74.4%), encapsulation efficiency (EE) (70.9-90.6%), oxidative stability and thermal analysis. The higher concentration of MG led to smaller droplet sizes and lower viscosity in the emulsions, and smaller particle sizes with the highest VOR in microcapsules. The higher concentration of NM induced to higher viscosity in the emulsions, and larger particle sizes with the highest values of EE and oxidative stability in microcapsules. This work shows evidence that MG-NM mixtures can have synergic effect in desirable characteristics such as retention and shelf life extension of LEO in microcapsules.

  15. Experience of the posterior lip augmentation device in a regional hip arthroplasty unit as a treatment for recurrent dislocation.

    Science.gov (United States)

    Hoggett, L; Cross, C; Helm, T

    2017-12-01

    Dislocation after total hip arthroplasty (THA) remains a significant complication of the procedure and is the third leading cause for revision THA. One technique for treatment of this complication is the use of the posterior lip augmentation device (PLAD). We describe our experience using the PLAD including complication rates. A retrospective review of 55 PLADs (54 patients) was carried out following identification from electronic theatre records. Basic patient demographics, operative records and radiographs were collected and reviewed and data was analysed using Microsoft Excel. Failure of the PLAD was defined as further operative intervention after PLAD insertion and included: dislocation, implant breakage, infection and revision of the THA for loosening of either component. 55 PLADs were implanted in 54 patients with an average age of 77 years. There was a significant preponderance of females and a variety of surgical approaches had been used for the original hip replacement, including trochanteric osteotomy, posterior and antero-lateral. 9 (16%) patients had recurrent dislocations,1 (2%) failed secondary to screw breakage, 3 (5%) had and infection requiring intervention and 2 (4%) underwent further revision for aseptic loosening of the femoral component. The overall failure rate was 25% with 14 patients requiring intervention post PLAD. Our results are inferior to other published results and indicate that the PLAD should be used with caution for recurrent dislocations of the Charnley hip replacement.

  16. Elastic properties of woven bone: effect of mineral content and collagen fibrils orientation.

    Science.gov (United States)

    García-Rodríguez, J; Martínez-Reina, J

    2017-02-01

    Woven bone is a type of tissue that forms mainly during fracture healing or fetal bone development. Its microstructure can be modeled as a composite with a matrix of mineral (hydroxyapatite) and inclusions of collagen fibrils with a more or less random orientation. In the present study, its elastic properties were estimated as a function of composition (degree of mineralization) and fibril orientation. A self-consistent homogenization scheme considering randomness of inclusions' orientation was used for this purpose. Lacuno-canalicular porosity in the form of periodically distributed void inclusions was also considered. Assuming collagen fibrils to be uniformly oriented in all directions led to an isotropic tissue with a Young's modulus [Formula: see text] GPa, which is of the same order of magnitude as that of woven bone in fracture calluses. By contrast, assuming fibrils to have a preferential orientation resulted in a Young's modulus in the preferential direction of 9-16 GPa depending on the mineral content of the tissue. These results are consistent with experimental evidence for woven bone in foetuses, where collagen fibrils are aligned to a certain extent.

  17. MRI findings of neurilemmoma of the extremities: Pathologic correlation

    Energy Technology Data Exchange (ETDEWEB)

    Choi, Choong Gon; Kang, Heung Sik; Kim, Joo Wan; Kim, Ho Chul [Seoul National University College of Medicine, Seoul (Korea, Republic of); Suh, Kyung Jin [Kyungpook Natioanl University College of Medicine, Daegu (Korea, Republic of); Song, Chi Sung [Seoul City Boramae Hospital, Seoul (Korea, Republic of)

    1993-07-15

    Neurilemmomas of the extremities are nerve sheath tumors involving peripheral nerves of the extremities. We analyzed MR images of 16 surgically proved tumors in 12 patients and compared the MR images with gross pathologic specimens in two tumors (2/16). Spin echo T1-weighted images were obtained in all the patients but T2-weighted images were obtained in six patients with a gradient echo technique. Gadolinium dimeglumine enhanced T1-weighted images were obtained in 11 patients (15/16). Signal on T1-weighted images was iso or slightly higher than that of the adjacent muscles. Signal on T2-weighted images ranged from homogeneous high to heterogeneous. After Gadolinium injection, all the 15 tumors showed enhancement. Small sized tumors were enhanced homogeneously but there was a tendency to be enhanced heterogeneously to the central portion with peripheral rim enhancement as the size of the tumors increased. Pathologically, the enhanced portion was correlated the with solid portion of the tumors. Also encapsulation of the mass (12/16), suspended nerve strings (9/16) and bony erosion(1/16) were detected. MR characteristics of neurilemmoma include heterogeneity on enhanced T1 and T2 weighted images, encapsulation, and suspended nerve strings. Signal heterogeneity on enhanced T1 and T2 weighted images may be attributed to the variable cellularity, cystic changes, vascularity and focal hemorrhage of the tumors.

  18. Social and individual determinants of adolescents' acceptance of novel healthy and cool snack products.

    Science.gov (United States)

    Nørgaard, Maria Kümpel; Sørensen, Bjarne Taulo; Grunert, Klaus G

    2014-12-01

    Four new, healthy snack products, consisting of fruit, vegetables, bread, dip and topping, were tested with 600 Danish adolescents aged 9-16. Participants could view, handle, and test the products in a school setting. Acceptance was measured by overall buying intention, as well as buying intention contingent on specific substitutes and on the social situation. Price consciousness, health consciousness, snack neophobia, peer influence, social activities and word-of-mouth were measured as potential determinants of acceptance of the novel products. An exploratory analysis in TETRAD suggested that the measured constructs form three layers, with overall buying intention as the terminal causal effect, health consciousness, word of mouth, snack neophobia and peer influence as endogenous determinants, and social activities and the contingent buying intentions as mediators. Estimation of the causal relationships was conducted in LISREL. Findings show a predominance of social factors as determinants of novel snack acceptance, whereas health consciousness had only a weak and indirect effect on buying intentions and the effect of snack neophobia was partly mediated by social factors. Copyright © 2014 Elsevier Ltd. All rights reserved.

  19. Prevalence of Eimeria spp. in Broilers by Multiplex PCR in the Southern Region of Brazil on Two Hundred and Fifty Farms.

    Science.gov (United States)

    Moraes, Julio Cesar; França, Marciél; Sartor, Amélia Aparecida; Bellato, Valdomiro; de Moura, Anderson Barbosa; de Lourdes Borba Magalhães, Maria; de Souza, Antonio Pereira; Miletti, Luiz Claudio

    2015-06-01

    Parasitic infections caused by Eimeria species are responsible for most economic losses in poultry production. Prevalence studies can adequately assist the design of prophylaxis strategies for disease control. Therefore, stool samples from 251 flocks of broilers from 28 to 48 days old were collected in 21 municipalities in the state of Santa Catarina, Brazil, to detect and examine the prevalence of Eimeria acervulina, Eimeria maxima, Eimeria tenella, Eimeria mitis, Eimeria praecox, Eimeria necatrix, and Eimeria brunetti. The oocysts were recovered and quantified, and the species were identified by a multiplex PCR technique. Amplicons of seven Eimeria species originating from the PCR-positive samples were cloned. Microscopy studies demonstrated that 96% of the farms were positive for the Eimeria. Seven species were identified, as follows: E. maxima (63.7%) and E. acervulina (63.3%) were the most prevalent species, followed by E. tenella (54.6%), E. mitis (38.6%), E. praecox (25.1%), E. necatrix (24.3%), and E. brunetti (13.1%). The average number of species detected per farm was 2.96, and the most common were E. acervulina, E. maxima, and E. tenella (9.16%). The sequencing of the clones confirmed the specificity and effectiveness of multiplex PCR for the identification of seven species of Eimeria, so this tool can be useful in studying circulating species in poultry farms, thereby assisting prophylactic measures against coccidiosis.

  20. Risk analysis and technology assessment in support of technology development: Putting responsible innovation in practice in a case study for nanotechnology.

    Science.gov (United States)

    van Wezel, Annemarie P; van Lente, Harro; van de Sandt, Johannes Jm; Bouwmeester, Hans; Vandeberg, Rens Lj; Sips, Adrienne Jam

    2018-01-01

    Governments invest in "key enabling technologies," such as nanotechnology, to solve societal challenges and boost the economy. At the same time, governmental agencies demand risk reduction to prohibit any often unknown adverse effects, and industrial parties demand smart approaches to reduce uncertainties. Responsible research and innovation (RRI) is therefore a central theme in policy making. Risk analysis and technology assessment, together referred to as "RATA," can provide a basis to assess human, environmental, and societal risks of new technological developments during the various stages of technological development. This assessment can help both governmental authorities and innovative industry to move forward in a sustainable manner. Here we describe the developed procedures and products and our experiences to bring RATA in practice within a large Dutch nanotechnology consortium. This is an example of how to put responsible innovation in practice as an integrated part of a research program, how to increase awareness of RATA, and how to help technology developers perform and use RATA. Integr Environ Assess Manag 2018;14:9-16. © 2017 The Authors. Integrated Environmental Assessment and Management published by Wiley Periodicals, Inc. on behalf of Society of Environmental Toxicology & Chemistry (SETAC). © 2017 The Authors. Integrated Environmental Assessment and Management published by Wiley Periodicals, Inc. on behalf of Society of Environmental Toxicology & Chemistry (SETAC).

  1. Reduction of Nicardipine-Related Phlebitis in Patients with Acute Stroke by Diluting Its Concentration.

    Science.gov (United States)

    Kawada, Kei; Ohta, Tsuyoshi; Tanaka, Koudai; Miyamoto, Norifumi

    2018-03-05

    Nicardipine is frequently used in the treatment of hypertension for patients with acute stroke; however, its dosing is complicated by a high risk of phlebitis. In the present study, we examined whether restricting nicardipine concentration under a specific value could reduce the incidence of nicardipine-related phlebitis in patients with acute stroke. Intravenous nicardipine-related phlebitis was retrospectively analyzed. From July 2015, a simple proposition was made to dilute maximum intravenous nicardipine concentration to lower than 130 µg/mL. The maximum intravenous nicardipine concentration and the incidence of phlebitis were compared between patients treated from July 2014 to June 2015 (preproposition group) and patients treated from July 2015 to June 2016 (postproposition group). A total of 300 patients (preproposition group, 138; postproposition group, 162) were included. The postproposition group demonstrated significantly lower maximum intravenous nicardipine concentration (in µg/mL, 76.9, 47.6-104.5 versus 130.4, 69.8-230.8; P phlebitis (9.9%, 16/162 vs. 30%, 42/138; P phlebitis, which indicated the usefulness of the proposition to dilute maximum intravenous nicardipine concentration to lower than 130 µg/mL. The simple and appropriate proposition about nicardipine administration lowered maximum nicardipine concentration and reduced the incidence of nicardipine-related phlebitis in patients with acute stroke. Copyright © 2018 National Stroke Association. Published by Elsevier Inc. All rights reserved.

  2. HPA-axis stress reactivity in youth depression: evidence of impaired regulatory processes in depressed boys.

    Science.gov (United States)

    Lopez-Duran, Nestor L; McGinnis, Ellen; Kuhlman, Kate; Geiss, Elisa; Vargas, Ivan; Mayer, Stefanie

    2015-01-01

    Given the link between youth depression and stress exposure, efforts to identify related biomarkers have involved examinations of stress regulation systems, including the hypothalamic-pituitary-adrenal (HPA) axis. Despite these vast efforts, the underlying mechanisms at play, as well as factors that may explain heterogeneity of past findings, are not well understood. In this study, we simultaneously examined separate components of the HPA-axis response (e.g. activation intensity, peak levels, recovery) to the Socially Evaluated Cold-Pressor Test in a targeted sample of 115 youth (age 9-16), recruited to overrepresent youth with elevated symptoms of depression. Among youth who displayed a cortisol response to the task, depression symptoms were associated with higher peak responses but not greater rate of activation or recovery in boys only. Among those who did not respond to the task, depression symptoms were associated with greater cortisol levels throughout the visit in boys and girls. Results suggest that depression symptoms are associated with a more prolonged activation of the axis and impaired recovery to psychosocial stressors primarily in boys. We discussed two potential mechanistic explanations of the link between depression symptoms and the duration of activation: (1) inhibitory shift (i.e. point at which the ratio of inhibitory and excitatory input into the axis shifts from greater excitatory to greater inhibitory input) or (2) inhibitory threshold (i.e. level of cortisol exposure required to activate the axis' feedback inhibition system).

  3. What's parenting got to do with it: emotional autonomy and brain and behavioral responses to emotional conflict in children and adolescents.

    Science.gov (United States)

    Marusak, Hilary A; Thomason, Moriah E; Sala-Hamrick, Kelsey; Crespo, Laura; Rabinak, Christine A

    2017-09-15

    Healthy parenting may be protective against the development of emotional psychopathology, particularly for children reared in stressful environments. Little is known, however, about the brain and behavioral mechanisms underlying this association, particularly during childhood and adolescence, when emotional disorders frequently emerge. Here, we demonstrate that psychological control, a parenting strategy known to limit socioemotional development in children, is associated with altered brain and behavioral responses to emotional conflict in 27 at-risk (urban, lower income) youth, ages 9-16. In particular, youth reporting higher parental psychological control demonstrated lower activity in the left anterior insula, a brain area involved in emotion conflict processing, and submitted faster but less accurate behavioral responses-possibly reflecting an avoidant pattern. Effects were not replicated for parental care, and did not generalize to an analogous nonemotional conflict task. We also find evidence that behavioral responses to emotional conflict bridge the previously reported link between parental overcontrol and anxiety in children. Effects of psychological control may reflect a parenting style that limits opportunities to practice self-regulation when faced with emotionally charged situations. Results support the notion that parenting strategies that facilitate appropriate amounts of socioemotional competence and autonomy in children may be protective against social and emotional difficulties. © 2017 John Wiley & Sons Ltd.

  4. Binding affinity and adhesion force of organophosphate hydrolase enzyme with soil particles related to the isoelectric point of the enzyme.

    Science.gov (United States)

    Islam, Shah Md Asraful; Yeasmin, Shabina; Islam, Md Saiful; Islam, Md Shariful

    2017-07-01

    The binding affinity of organophosphate hydrolase enzyme (OphB) with soil particles in relation to the isoelectric point (pI) was studied. Immobilization of OphB with soil particles was observed by confocal microscopy, Fourier transform infrared spectroscopy (FT-IR), and Atomic force microscopy (AFM). The calculated pI of OphB enzyme was increased from 8.69 to 8.89, 9.04 and 9.16 by the single, double and triple mutant of OphB enzyme, respectively through the replacement of negatively charged aspartate with positively charged histidine. Practically, the binding affinity was increased to 5.30%, 11.50%, and 16.80% for single, double and triple mutants, respectively. In contrast, enzyme activity of OphB did not change by the mutation of the enzyme. On the other hand, adhesion forces were gradually increased for wild type OphB enzyme (90 pN) to 96, 100 and 104 pN for single, double and triple mutants of OphB enzyme, respectively. There was an increasing trend of binding affinity and adhesion force by the increase of isoelectric point (pI) of OphB enzyme. Copyright © 2017 Elsevier Inc. All rights reserved.

  5. Nonurban aerosol composition near Beijing, China

    International Nuclear Information System (INIS)

    Winchester, J.W.; Darzi, M.; Leslie, A.C.D.; Wang, M.; Ren, L.; Lue, W.; Hansson, H.C.; Lannefors, H.

    1981-01-01

    The urban aerosol plume of Beijing has been sampled as a function of particle size and time at a site 110 km NE of the city, 9-16 March 1980, during the season for space heating by coal combustion. A fine particle mode, contained mostly in the 0.5-2 μm aerodynamic diameter range, could be distinguished from a coarse mode of dust having terrestrial composition by reference to the size distribution of Ca. Elemental composition determined by PIXE analysis for 17 elements, including S and heavy metals, indicates fine mode concentrations higher than background aerosol but with a similarity to cleaner air with respect to both relative elemental abundances and elemental particle size distributions. The results indicate that elements contained in aged coal combustion aerosol occur mainly in 0.5-2 μMAD particles, not smaller, and the aerosol is not substantially different from background aerosol except in overall concentrations. This result may simplify the prediction of the impact of coal combustion on air quality. The results also hint that the background aerosol in more remote continental areas may also be combustion derived. (orig.)

  6. Predictor variables for a half marathon race time in recreational male runners.

    Science.gov (United States)

    Rüst, Christoph Alexander; Knechtle, Beat; Knechtle, Patrizia; Barandun, Ursula; Lepers, Romuald; Rosemann, Thomas

    2011-01-01

    The aim of this study was to investigate predictor variables of anthropometry, training, and previous experience in order to predict a half marathon race time for future novice recreational male half marathoners. Eighty-four male finishers in the 'Half Marathon Basel' completed the race distance within (mean and standard deviation, SD) 103.9 (16.5) min, running at a speed of 12.7 (1.9) km/h. After multivariate analysis of the anthropometric characteristics, body mass index (r = 0.56), suprailiacal (r = 0.36) and medial calf skin fold (r = 0.53) were related to race time. For the variables of training and previous experience, speed in running of the training sessions (r = -0.54) were associated with race time. After multivariate analysis of both the significant anthropometric and training variables, body mass index (P = 0.0150) and speed in running during training (P = 0.0045) were related to race time. Race time in a half marathon might be partially predicted by the following equation (r(2) = 0.44): Race time (min) = 72.91 + 3.045 * (body mass index, kg/m(2)) -3.884 * (speed in running during training, km/h) for recreational male runners. To conclude, variables of both anthropometry and training were related to half marathon race time in recreational male half marathoners and cannot be reduced to one single predictor variable.

  7. Cytotoxicity of cardenolides and cardenolide glycosides from Asclepias curassavica.

    Science.gov (United States)

    Li, Jun-Zhu; Qing, Chen; Chen, Chang-Xiang; Hao, Xiao-Jiang; Liu, Hai-Yang

    2009-04-01

    A new cardenolide, 12beta,14beta-dihydroxy-3beta,19-epoxy-3alpha-methoxy-5alpha-card-20(22)-enolide (6), and a new doubly linked cardenolide glycoside, 12beta-hydroxycalotropin (13), together with eleven known compounds, coroglaucigenin (1), 12beta-hydroxycoroglaucigenin (2), calotropagenin (3), desglucouzarin (4), 6'-O-feruloyl-desglucouzarin (5), calotropin (7), uscharidin (8), asclepin (9), 16alpha-hydroxyasclepin (10), 16alpha-acetoxycalotropin (11), and 16alpha-acetoxyasclepin (12), were isolated from the aerial part of ornamental milkweed, Asclepias curassavica and chemically elucidated through spectral analyses. All the isolates were evaluated for their cytotoxic activity against HepG2 and Raji cell lines. The results showed that asclepin (9) had the strongest cytotoxic activity with an IC(50) value of 0.02 microM against the two cancer cell lines and the new compound 13 had significant cytotoxic activity with IC(50) values of 0.69 and 1.46 microM, respectively.

  8. Resistance of extremely halophilic archaea to zinc and zinc oxide nanoparticles

    Science.gov (United States)

    Salgaonkar, Bhakti B.; Das, Deepthi; Bragança, Judith Maria

    2016-02-01

    Industrialization as well as other anthropogenic activities have resulted in addition of high loads of metal and/or metal nanoparticles to the environment. In this study, the effect of one of the widely used heavy metal, zinc (Zn) and zinc oxide nanoparticles (ZnO NPs) on extremely halophilic archaea was evaluated. One representative member from four genera namely Halococcus, Haloferax, Halorubrum and Haloarcula of the family Halobacteriaceae was taken as the model organism. All the haloarchaeal genera investigated were resistant to both ZnCl2 and ZnO NPs at varying concentrations. Halococcus strain BK6 and Haloferax strain BBK2 showed the highest resistance in complex/minimal medium of up to 2.0/1.0 mM ZnCl2 and 2.0/1.0-0.5 mM ZnO NP. Accumulation of ZnCl2/ZnO NPs was seen as Haloferax strain BBK2 (287.2/549.6 mg g-1) > Halococcus strain BK6 (165.9/388.5 mg g-1) > Haloarcula strain BS2 (93.2/28.5 mg g-1) > Halorubrum strain BS17 (29.9/16.2 mg g-1). Scanning electron microscopy and energy dispersive X-ray spectroscopy (SEM-EDX) analysis revealed that bulk ZnCl2 was sorbed at a higher concentration (21.77 %) on the cell surface of Haloferax strain BBK2 as compared to the ZnO NPs (14.89 %).

  9. Clinical and economic consequences of treating patients with peripheral neuropathic pain with brand name or generic drugs in routine clinical practice: The effects of age and sex.

    Science.gov (United States)

    Navarro-Artieda, R; Rejas-Gutiérrez, J; Pérez-Paramo, M; Sicras-Mainar, A

    2018-04-01

    We aimed to analyse the effects of age and sex on pain and cost for patients with chronic peripheral neuropathic pain (PNP) who have started treatment with brand name gabapentin versus generic gabapentin (EFG). We conducted a retrospective multicentre study using electronic medical records (EMR) for patients of both sexes, older than 18, who began treatment with brand name or generic gabapentin. Adherence (medication possession ratio [MPR]), persistence, use of healthcare resources, cost, and pain reduction were measured for one year. We analysed 1369 EMRs [61.1% women; mean age 64.6 (15.9), 52.4%≥65 years]; 400 used brand name drugs while 969 used generic gabapentin. Persistence and adherence were higher in patients using brand name gabapentin (7.3 vs 6.3 months, Pbrand-name gabapentin in both age groups (brand treatment showed greater pain relief: 13.5% (10.9-16.2) and 10.8% (8.2-13.5) in brand name medication showed greater persistence and adherence to treatment than those taking generic drugs. Brand name treatment also involved lower healthcare costs, and greater pain relief. Copyright © 2016 Sociedad Española de Neurología. Publicado por Elsevier España, S.L.U. All rights reserved.

  10. Formulation, characterization and pharmacokinetics of praziquantel-loaded hydrogenated castor oil solid lipid nanoparticles.

    Science.gov (United States)

    Xie, Shuyu; Pan, Baoliang; Wang, Ming; Zhu, Luyan; Wang, Fenghua; Dong, Zhao; Wang, Xiaofang; Zhou, WenZhong

    2010-07-01

    The purpose of this study was to formulate praziquantel (PZQ)-loaded hydrogenated castor oil (HCO) solid lipid nanoparticles (SLN) to enhance the bioavailability and prolong the systemic circulation of the drug. PZQ was encapsulated into HCO nanoparticles by a hot homogenization and ultrasonication method. The physicochemical characteristics of SLN were investigated by optical microscope, scanning electron microscopy and photon correlation spectroscopy. Pharmacokinetics were studied after oral, subcutaneous and intramuscular administration in mice. The diameter, polydispersivity index, zeta potential, encapsulation efficiency and loading capacity of the nanoparticles were 344.0 +/- 15.1 nm, 0.31 +/- 0.08, -16.7 +/- 0.5 mV, 62.17 +/- 6.53% and 12.43 +/- 1.31%, respectively. In vitro release of PZQ-loaded HCO-SLN exhibited an initial burst release followed by a sustained release. SLN increased the bioavailability of PZQ by 14.9-, 16.1- and 2.6-fold, and extended the mean residence time of the drug from 7.6, 6.6 and 8.2 to 95.9, 151.6 and 48.2 h after oral, subcutaneous and intramuscular administration, respectively. The PZQ-loaded HCO-SLN could be a promising formulation to enhance the pharmacological activity of PZQ.

  11. Effects of metal ions on the catalytic degradation of dicofol by cellulase.

    Science.gov (United States)

    Zhai, Zihan; Yang, Ting; Zhang, Boya; Zhang, Jianbo

    2015-07-01

    A new technique whereby cellulase immobilized on aminated silica was applied to catalyze the degradation of dicofol, an organochlorine pesticide. In order to evaluate the performance of free and immobilized cellulase, experiments were carried out to measure the degradation efficiency. The Michaelis constant, Km, of the reaction catalyzed by immobilized cellulase was 9.16 mg/L, and the maximum reaction rate, Vmax, was 0.40 mg/L/min, while that of free cellulase was Km=8.18 mg/L, and Vmax=0.79 mg/L/min, respectively. The kinetic constants of catalytic degradation were calculated to estimate substrate affinity. Considering that metal ions may affect enzyme activity, the effects of different metal ions on the catalytic degradation efficiency were explored. The results showed that the substrate affinity decreased after immobilization. Monovalent metal ions had no effect on the reaction, while divalent metal ions had either positive or inhibitory effects, including activation by Mn2+, reversible competition with Cd2+, and irreversible inhibition by Pb2+. Ca2+ promoted the catalytic degradation of dicofol at low concentrations, but inhibited it at high concentrations. Compared with free cellulase, immobilized cellulase was affected less by metal ions. This work provided a basis for further studies on the co-occurrence of endocrine-disrupting chemicals and heavy metal ions in the environment. Copyright © 2015. Published by Elsevier B.V.

  12. Rosettes in actinic keratosis and squamous cell carcinoma: distribution, association to other dermoscopic signs and description of the rosette pattern.

    Science.gov (United States)

    Lozano-Masdemont, B; Polimón-Olabarrieta, I; Marinero-Escobedo, S; Gutiérrez-Pecharromán, A; Rodríguez-Lomba, E

    2018-01-01

    Rosettes, a dermoscopic structure characterized by four white points arranged as a 4-leaf clover, supports the dermoscopic diagnosis of actinic keratosis (AK) or squamous cell carcinoma (SCC). The association of rosettes with other dermoscopic structures in AK or SCC and their distribution has not been analysed yet. We conducted a prospective study of patients with histologically proven AK or SCC who presented dermoscopic rosettes at initial evaluation. A total of 56 tumours were collected (94.6% AK and 5.4% SCC). Thirty-seven (66.1%) lesions were non-pigmented and 19 (33.9%) pigmented. The most common dermoscopic findings were erythema (53; 94.6%) and scale (42; 75%). White circles were present in 21 lesions (37.5%); pigmented pseudonetwork in 18 (32.1%) and multiple grey to brown dots and globules in 14 (25%). Rosettes were distributed focally in 9 (16.1%) and generalized in 47 (83.9%). The rosette pattern (rosettes as the main structure) was observed only in AK (19; 35.8%). The analysis was not blinded. The distinction between focal distribution (up to 3 rosettes) or generalized could be considered arbitrary. The rosette pattern identified in AK may be a specific pattern for AK. © 2017 European Academy of Dermatology and Venereology.

  13. PERSONAL AND ENVIRONMENTAL RISK FACTORS SIGNIFICANTLY ASSOCIATED WITH ELEVATED BLOOD LEAD LEVELS IN RURAL THAI CHILDREN.

    Science.gov (United States)

    Swaddiwudhipong, Witaya; Kavinum, Suporn; Papwijitsil, Ratchadaporn; Tontiwattanasap, Worawit; Khunyotying, Wanlee; Umpan, Jiraporn; BoonthuM, Ratchaneekorn; Kaewnate, Yingyot; Boonmee, Sasis; Thongchub, Winai; Rodsung, Thassanee

    2014-11-01

    A community-based study was conducted to determine personal risk factors and environmental sources of lead exposure for elevated blood lead levels (≥ 10 µg/dl, EBLLs) among rural children living at the Thailand-Myanmar border in Tak Province, northwestern Thailand. Six hundred ninety-five children aged 1-14 years old were screened for BLLs. Environmental specimens for lead measurements included samples of water from the streams, taps, and household containers, house floor dust, and foods. Possible lead release from the cooking ware was determined using the leaching method with acetic acid. The overall prevalence of EBLLs was 47.1% and the geometric mean level of blood lead was 9.16 µg/dl. Personal risk factors significantly associated with EBLLs included being male, younger age, anemia, and low weight-for-age. Significant environmental risk factors were exposure to a lead-acid battery of solar energy system and use of a non-certified metal cooking pot. Some families whose children had high BLLs reported production of lead bullets from the used batteries at home. About one-third of the house dust samples taken near batteries contained lead content above the recommended value, compared with none of those taken from other areas and from the houses with no batteries. The metal pots were safe for cooking rice but might be unsafe for acidic food preparation. Both nutritional intervention and lead exposure prevention programs are essential to reduce EBLLs in this population.

  14. Stillbirth history and Toxoplasma gondii infection in women attending public health centers in a northern Mexican City

    Science.gov (United States)

    Alvarado-Esquivel, C.; Pacheco-Vega, S. J.; Salcedo-Jaquez, M.; Sánchez-Anguiano, L. F.; Hernández-Tinoco, J.; Rábago-Sánchez, E.; Centeno-Tinoco, M. M.; Flores-Garcia, I. D.; Ramos-Nevarez, A.; Cerrillo-Soto, S. M.; Guido-Arreola, C. A.; Beristain-García, I.; Liesenfeld, O.; Berumen-Segovia, L. O.; Saenz-Soto, L.; Sifuentes-Álvarez, A.

    2015-01-01

    Through a cross-sectional study design, 150 women attending public health centers with a history of stillbirths were examined for anti-Toxoplasma gondii IgG and IgM antibodies in Durango City, Mexico. Bivariate and multivariate analyses were used to assess the association of T. gondii seropositivity with the characteristics of the women with stillbirth history. Of the 150 women (mean age: 32.09 ± 9.16 years) studied, 14 (9.3%) had anti-T. gondii IgG antibodies and six (42.9%) of them were also positive for anti-T. gondii IgM antibodies. Multivariate analysis showed that T. gondii seropositivity was associated with high frequency (4–7 days a week) of eating meat (OR = 5.52; 95% CI: 1.48–20.59; P = 0.01), history of lymphadenopathy (OR = 4.52; 95% CI: 1.14–17.82; P = 0.03), and history of surgery (OR = 8.68; 95% CI: 1.04–72.15; P = 0.04). This is the first study on the seroepidemiology of T. gondii infection in women with a history of stillbirths in Mexico. The association of T. gondii exposure with a history of surgery warrants for further research. Risk factors for T. gondii infection found in the present survey may help to design optimal educational programs to avoid T. gondii infection. PMID:26185685

  15. Functional specificity of sex pheromone receptors in the cotton bollworm Helicoverpa armigera.

    Directory of Open Access Journals (Sweden)

    Yang Liu

    Full Text Available Male moths can accurately perceive the sex pheromone emitted from conspecific females by their highly accurate and specific olfactory sensory system. Pheromone receptors are of special importance in moth pheromone reception because of their central role in chemosensory signal transduction processes that occur in olfactory receptor neurons in the male antennae. There are a number of pheromone receptor genes have been cloned, however, only a few have been functionally characterized. Here we cloned six full-length pheromone receptor genes from Helicoverpa armigera male antennae. Real-time PCR showing all genes exhibited male-biased expression in adult antennae. Functional analyses of the six pheromone receptor genes were then conducted in the heterologous expression system of Xenopus oocytes. HarmOR13 was found to be a specific receptor for the major sex pheromone component Z11-16:Ald. HarmOR6 was equally tuned to both of Z9-16: Ald and Z9-14: Ald. HarmOR16 was sensitively tuned to Z11-16: OH. HarmOR11, HarmOR14 and HarmOR15 failed to respond to the tested candidate pheromone compounds. Our experiments elucidated the functions of some pheromone receptor genes of H. armigera. These advances may provide remarkable evidence for intraspecific mating choice and speciation extension in moths at molecular level.

  16. Optimization of Acid Black 172 decolorization by electrocoagulation using response surface methodology

    Science.gov (United States)

    2012-01-01

    This paper utilizes a statistical approach, the response surface optimization methodology, to determine the optimum conditions for the Acid Black 172 dye removal efficiency from aqueous solution by electrocoagulation. The experimental parameters investigated were initial pH: 4–10; initial dye concentration: 0–600 mg/L; applied current: 0.5-3.5 A and reaction time: 3–15 min. These parameters were changed at five levels according to the central composite design to evaluate their effects on decolorization through analysis of variance. High R2 value of 94.48% shows a high correlation between the experimental and predicted values and expresses that the second-order regression model is acceptable for Acid Black 172 dye removal efficiency. It was also found that some interactions and squares influenced the electrocoagulation performance as well as the selected parameters. Optimum dye removal efficiency of 90.4% was observed experimentally at initial pH of 7, initial dye concentration of 300 mg/L, applied current of 2 A and reaction time of 9.16 min, which is close to model predicted (90%) result. PMID:23369574

  17. Radioimmunoassay of plasma 18-hydroxy-11-deoxycorticosterone and its response to ACTH

    International Nuclear Information System (INIS)

    May, C.N.; Lewis, P.S.; Horth, C.E.

    1979-01-01

    A radioimmunoassay for 18-OH-DOC in plasma was developed using an antiserum raised against the γ-lactone derivative. The steroids with the greatest degree of cross reaction were 18-OH-corticosterone-γ-lactone and aldosterone-γ-lactone which showed cross-reactivities of 1.96% and 0.47% respectively. These and other interfering steroids were eliminated by chromatography of the extracts on columns of Sephadex LH-20. The lowest limit of detection of 18-OH-DOC in 1 ml of plasma corresponded to 33 pmol -1 . The intra-assay precision was 9.7, 4.8 and 2.6% at 102.0, 316.1 and 1144.0 pmol l -1 respectively and the interassay precision was 15.3 and 5.4% at 71.3 and 404.7 pmol l -1 respectively. The concentration of 18-OH-DOC in ten normal subjects was 172.1 +- 39.1 pmol l -1 at 09.00 h, 100.9 +- 16.9 pmol l -1 at 12.00 h and 95.8 +-33.3 pmol l -1 at 16.30 h. Plasma 18-OH-DOC and cortisol levels were measured after various intravenous doses of ACTH in three patients with essential hypertension. Lower doses of ACTH caused considerably greater increases in 18-OH-DOC. These results confirm the ACTH dependency of 18-OH-DOC secretion. (author)

  18. Using the Analytical Hierarchy Process (AHP) to evaluate target signatures

    CSIR Research Space (South Africa)

    Baumbach, J

    2009-10-01

    Full Text Available .6 12 10.0 0.60 Slide 11 © CSIR 2006 www.csir.co.za G H T S Pattern3 13 9 16 8 9 8 11 3.3 11 4.0 10 2.9 0.92 Pattern4 20 29 26 5 26 29 21 9.2 27 1.7 16 12.1 0.64 CR 38 19 8 31 4 29 4 5 3 λmax 5.00 4.50 4.13 4.83 4.11 4...- ver5 Obser- ver6 Rank Std Dev Rank Std Dev Rank Std Dev 6 Obser- vers W E I Pattern1 63 50 51 62 56 49 58 6.2 53 3.2 62 7.8 -2.27 Pattern2 4 12 7 24 8 14 10 7.1 9 2.6 12 10.0 0.60 Slide 12 © CSIR 2006 www...

  19. A study on total phenolics and vitamin c contents of kalecik karasi (vitis vinifera l.) clones

    International Nuclear Information System (INIS)

    Keskin, N.; Keskin, S.

    2014-01-01

    In this study total phenolic and vitamin C contents of the fully ripe berries of 23 clones of Kalecik Karasi which is one of the leading Turkish local red-wine grape cultivar originally grown in Kizilirmak valley near Kalecik/Ankara region were examined under the clone selection project supported by TUBTAK (Project Nr: 107 O 731). High-pressure liquid chromatography (HPLC) was used for vitamin C and spectrophotometer for total phenolics estimation. One way ANOVA was used to compare means of clone for their total phenolic and vitamin C contents. In addition to this univariate method, hierarchical cluster analysis was performed to identify similarity levels among the clones by considering total phenolics and vitamin C content together. Differences among the clones were found statistically significant for both characteristics. Total phenolic contents of the clones varied from 3.310 mg (clone 21) to 3.389 mg (clone 6) as GAE g fw. Vitamin C content ranged from 14.010 mg (clone 6) to 16.500 mg (clone 19) in 100g fw. Furthermore, similarity level for all clones was 83.1% that means variation rate is about 17% among the clones. As a summary of whole data, the first three performing clones are 6 (3.389 mg), 10 (3.374 mg) and 1 (3.365 mg) for total phenolics, and 19 (16.500 mg), 9 (16.020 mg), and 21 (16.015 mg) for vitamin C contents of the berries. (author)

  20. Genetic diversity of plasmodium vivax merozoite surface protein-3alpha (Pvmsp-3alpha) gene in Jhapa District of Nepal.

    Science.gov (United States)

    Adhikari, Madhav; Ranjitkar, Samir; Schousboe, Mette Leth; Alifrangis, Michael; Imwong, Mallika; Bhatta, Dwij Raj; Banjara, Megha Raj

    2012-03-01

    In Nepal, Plasmodium vivax accounts for approximately 80-90% of the malaria cases, but limited studies have been conducted on the genetic diversity of this parasite population. This study was carried out to determine the genetic diversity of P. vivax population sampled from subjects living in an endemic area of Jhapa District by analyzing the polymorphic merozoite surface protein-3alpha (Pvmsp-3alpha) gene by using PCR-restriction fragment length polymorphism. Three distinct genotypes were obtained from 96 samples; type A: 40 (71%), type B: 7 (13%), and type C: 9 (16%) which could be categorized into 13 allelic patterns: A1-A9, B1, B2, C1 and C2. These results indicated a high genetic diversity within the studied P. vivax population. As the transmission rate of malaria is low in Nepal, the diversity is most likely due to migration of people between the malaria endemic regions, either within the country or between Nepal and India. Similar prevalence of the three genotypes of Pvmsp-3alpha between the two countries likely supports the latter explanation.

  1. Factors Predictive of 90-Day Morbidity, Readmission, and Costs in Patients Undergoing Pelvic Exenteration.

    Science.gov (United States)

    Bogani, Giorgio; Signorelli, Mauro; Ditto, Antonino; Martinelli, Fabio; Casarin, Jvan; Mosca, Lavinia; Leone Roberti Maggiore, Umberto; Chiappa, Valentina; Lorusso, Domenica; Raspagliesi, Francesco

    2018-06-01

    Pelvic exenteration for recurrent gynecological malignancies is characterized by a high rate of severe complications. Factors predictive of morbidity, readmission, and cost were analyzed. Data of consecutive patients undergoing pelvic exenteration between January 2007 and December 2016 were prospectively evaluated. Fifty-eight patients were included in the analysis. Anterior, posterior, and total exenterations were executed in 39 (67%), 9 (16%), and 10 (17%) patients, respectively. Ten (15.5%) severe complications occurred: 8 (20.5%), 0 (0%), and 1 (10%) after anterior, posterior, and total exenterations, respectively. Radiotherapy dosage, time between radiotherapy and surgery, and previous administration of chemotherapy did not influence 90-day complications and readmission. At multivariable analysis, albumin levels less than 3.5 g/dL (odds ratio, 16.2 [95% confidence interval, 2.85-92.8]; P = 0.002) and history of deep vein thrombosis (odds ratio, 9.6 [95% confidence interval, 0.93-98.2]; P = 0.057) were associated with 90-day morbidity. Low albumin levels independently correlated with readmission (P = 0.011). The occurrence of 90-day postoperative complications and readmission increased costs of a median of +12,500 and +6000 euros, respectively (P < 0.05). Preoperative patient selection is a key point for the reduction of postoperative complications after pelvic exenteration. Further prospective studies are warranted to improve patient selection.

  2. Spectrum of pediatric neuromyelitis optica.

    Science.gov (United States)

    Lotze, Timothy E; Northrop, Jennifer L; Hutton, George J; Ross, Benjamin; Schiffman, Jade S; Hunter, Jill V

    2008-11-01

    Our goal was to describe the spectrum of clinical phenotypes, laboratory and imaging features, and treatment in pediatric patients with neuromyelitis optica. The study consisted of a retrospective chart review of patients followed in a pediatric multiple sclerosis center with a diagnosis of neuromyelitis optica spectrum disorder. Nine patients with neuromyelitis optica spectrum disorders were included, all of whom were female. There were 4 black children, 2 Latin American children, 2 white children, and 1 child of mixed Latin American/white heritage. Median age at initial attack was 14 years (range: 1.9-16 years). Median disease duration was 4 years (range: 0.6-9 years). Tests for neuromyelitis optica immunoglobulin G were positive for 7 patients. Eight patients had transverse myelitis and optic neuritis, and 1 patient had longitudinally extensive transverse myelitis without optic neuritis but had a positive neuromyelitis optica immunoglobulin G antibody titer. Cerebral involvement on MRI was found in all subjects, 5 of whom were symptomatic with encephalopathy, seizures, hemiparesis, aphasia, vomiting, or hiccups. Immunosuppressive therapy reduced attack frequency and progression of disability. Pediatric neuromyelitis optica has a diverse clinical presentation and may be difficult to distinguish from multiple sclerosis in the early stages of the disease. The recognition of the broad spectrum of this disease to include signs and symptoms of brain involvement is aided by the availability of a serum biomarker: neuromyelitis optica immunoglobulin G. Early diagnosis and immunosuppresive treatment may help to slow the accumulation of severe disability.

  3. Muertes por homicidio, consecuencia fatal de la violencia: el caso de Mexico, 1979-1992

    Directory of Open Access Journals (Sweden)

    López María Victoria

    1996-01-01

    Full Text Available Se analizaron las muertes registradas como homicidio en México de 1979-1992. El estudio se basó en fuente secundaria, siendo las variables analizadas: año, edad, sexo y causa externa de traumatismos y envenenamientos según CIE IX Rev.(E960-E969. Se utilizó un modelo de regresión Poisson para las causas más frecuentes, obteniendo riesgos relativos según edad y sexo. El grupo de referencia fue el de 10-14 años y el sexo femenino. Se registraron 198,485 muertes por Homicidio, con un promedio anual de 14,177 y diario de 39. La principal causa fue ataque con arma de fuego y explosivos(56%. El riesgo relativo más alto fue para el grupo de 35-39 años, con RR 15,4 IC(95% 14,9-16,0, en comparación al de referencia. El sexo masculino presentó un riesgo relativo 10,1 veces mayor que el femenino, ajustado por edad IC10.0-10.3. Los resultados llaman la atención sobre la necesidad de profundizar y analizar el problema de los homicidios bajo una perspectiva multidisciplinaria.

  4. Radiofrequency ablation of chondroblastoma: procedure technique, clinical and MR imaging follow up of four cases

    Energy Technology Data Exchange (ETDEWEB)

    Christie-Large, M.; Evans, N.; Davies, A.M.; James, S.L.J. [Royal Orthopaedic Hospital Foundation Trust, Department of Radiology, Birmingham (United Kingdom)

    2008-11-15

    The aim of this study is to describe the procedure technique, clinical and imaging outcomes of patients treated with radiofrequency ablation for chondroblastoma. Four patients (female/male, 3:1; mean age, 13 years; age range; 9-16 years) underwent the procedure. All had pre-operative magnetic resonance imaging (MRI) and symptomatic, biopsy-proven chondroblastomas (two proximal femur, two proximal tibia). The lesion size ranged from 1.5 to 2.5 cm in maximal dimension (mean size, 1.8 cm). Bone access was gained with a Bonopty biopsy needle system (mean number of radiofrequency needle placements, 5; mean ablation time, 31 min). Clinical and MRI follow-up was available in all cases (mean, 12.25 months; range, 5-18 months). All patients reported resolution of symptoms at 2-6 weeks post ablation. At their most recent clinical follow-up, three patients remained completely asymptomatic with full return to normal activities and one patient had minor local discomfort (different pain pattern) that was not limiting activity. All four patients' follow-up MRI studies demonstrated resolution of the oedema pattern around the lesion and temporal evolution of the internal signal characteristics with fatty replacement. Radiofrequency ablation for chondroblastoma provides an alternative to surgical curettage, and we have demonstrated both a clinical improvement in symptoms and the follow-up MRI appearances. (orig.)

  5. Bacterial Communities in the Groundwater of Xikuangshan Antimony Mine, China

    Science.gov (United States)

    Wu, M.; Wang, H.; Wang, N.; Wang, M.

    2017-12-01

    Xikuangshan (XKS) is the biggest antimony (Sb) mine around the word, which causes serious environmental contamination due to the mining actives. To fully understand the bacterial compositions in the groundwater around the mining area in XKS and their correlation with environmental factors, groundwater samples were collected and subject to 16S rDNA high throughput sequencing. Results indicated that Proteobacteria (especially Gamma-Proteobacteria) dominated bacterial communities in high-Sb groundwater samples, whereas Bacteroidetes predominated in low-Sb groundwater. Furthermore, antimony concentration was found to be the most significant factor shaping bacterial communities (P=0.002) with an explanation of 9.16% of the variation. Other factors such as pH, contents of Mg, Ca and orthophosphate were also observed to significantly correlate with bacterial communities. This was the first report to show the important impact of Sb concentration on bacterial community structure in the groundwater in the mining area. Our results will enhance the understanding of subsurface biogeochemical processes mediated by microbes.

  6. VOPcPhO:P3HT composite micro-structures with nano-porous surface morphology

    Energy Technology Data Exchange (ETDEWEB)

    Azmer, Mohamad Izzat [Low Dimensional Materials Research Centre (LDMRC), Department of Physics, Faculty of Science, University of Malaya, 50603 Kuala Lumpur (Malaysia); Ahmad, Zubair, E-mail: zubairtarar@qu.edu.qa [Center for Advanced Materials (CAM), Qatar University, P. O. Box 2713, Doha (Qatar); Sulaiman, Khaulah, E-mail: khaulah@um.edu.my [Low Dimensional Materials Research Centre (LDMRC), Department of Physics, Faculty of Science, University of Malaya, 50603 Kuala Lumpur (Malaysia); Touati, Farid [Department of Electrical Engineering, College of Engineering, Qatar University, P. O. Box 2713, Doha (Qatar); Bawazeer, Tahani M. [Department of Chemistry, Faculty of Applied Science, Umm Al-Qura University, Makkah (Saudi Arabia); Alsoufi, Mohammad S. [Mechanical Engineering Department, College of Engineering and Islamic Architecture, Umm Al-Qura University, Makkah (Saudi Arabia)

    2017-03-31

    Highlights: • VOPcPhO:P3HT micro-structures with nano-porous surface morphology have been formed. • Multidimensional structures have been formed by electro-spraying technique. • The electro-sprayed films are very promising for the humidity sensors. - Abstract: In this paper, composite micro-structures of Vanadyl 2,9,16,23-tetraphenoxy-29H,31H-phthalocyanine) (VOPcPhO) and Poly (3-hexylthiophene-2,5-diyl) (P3HT) complex with nano-porous surface morphology have been developed by electro-spraying technique. The structural and morphological characteristics of the VOPcPhO:P3HT composite films have been studied by field emission scanning electron microscopy (FESEM) and atomic force microscopy (AFM). The multidimensional VOPcPhO:P3HT micro-structures formed by electro-spraying with nano-porous surface morphology are very promising for the humidity sensors due to the pore sizes in the range of micro to nano-meters scale. The performance of the VOPcPhO:P3HT electro-sprayed sensor is superior in term of sensitivity, hysteresis and response/recovery times as compared to the spin-coated one. The electro-sprayed humidity sensor exhibits ∼3 times and 0.19 times lower hysteresis in capacitive and resistive mode, respectively, as compared to the spin-coated humidity sensor.

  7. Magnetic resonance imaging (MRI) of liver and brain in haematologic-organic patients with fever of unknown origin

    International Nuclear Information System (INIS)

    Heussel, C.P.; Kauczor, H.U.; Poguntke, M.; Schadmand-Fischer, S.; Mildenberger, P.; Thelen, M.; Heussel, G.

    1998-01-01

    To examine the advantage of liver and brain MRI in clinically anomalous haematological patients with fever of unknown origin. Material and Methods: Twenty liver MRI (T 2 -TSE, T 2 -HASTE, T 1 -FLASH±Gd dynamic) and 16 brain MRI (T 2 -TSE, FLAIR, T 1 -TSE±Gd) were performed searching for a focus of fever with a suspected organ system. Comparison with clinical follow-up. Results: suspected organ system. Comparison with clinical follow-up. Results: A focus was detected in 11/20 liver MRI. Candidiasis (n=3), mycobacteriosis (n=2), relapse of haematological disease (n=3), graft versus host disease (n=1), non-clarified (n=2). The remaining 9 cases with normal MRI were not suspicious of infectious hepatic disease during follo-wup. In brain MRI, 3/16 showed a focus (toxoplasmosis, aspergillosis, mastoiditis). Clinical indication for an infectious involvement of the brain was found in 4/16 cases 2--5 months after initially normal brain MRI. No suspicion of an infectious involvement of brain was present in the remaining 9/16 cases. Conclusion: In case of fever of unknown origin and suspicion of liver involvement, MRI of the liver should be performed due to data given in literature and its sensitivity of 100%. Because of the delayed detectability of cerebral manifestations, in cases of persisting suspicion even a previously normal MRI of the brain should be repeated. (orig.) [de

  8. Monte Carlo evaluation of scattering correction methods in 131I studies using pinhole collimator

    International Nuclear Information System (INIS)

    López Díaz, Adlin; San Pedro, Aley Palau; Martín Escuela, Juan Miguel; Rodríguez Pérez, Sunay; Díaz García, Angelina

    2017-01-01

    Scattering is quite important for image activity quantification. In order to study the scattering factors and the efficacy of 3 multiple window energy scatter correction methods during 131 I thyroid studies with a pinhole collimator (5 mm hole) a Monte Carlo simulation (MC) was developed. The GAMOS MC code was used to model the gamma camera and the thyroid source geometry. First, to validate the MC gamma camera pinhole-source model, sensibility in air and water of the simulated and measured thyroid phantom geometries were compared. Next, simulations to investigate scattering and the result of triple energy (TEW), Double energy (DW) and Reduced double (RDW) energy windows correction methods were performed for different thyroid sizes and depth thicknesses. The relative discrepancies to MC real event were evaluated. Results: The accuracy of the GAMOS MC model was verified and validated. The image’s scattering contribution was significant, between 27-40 %. The discrepancies between 3 multiple window energy correction method results were significant (between 9-86 %). The Reduce Double Window methods (15%) provide discrepancies of 9-16 %. Conclusions: For the simulated thyroid geometry with pinhole, the RDW (15 %) was the most effective. (author)

  9. Cultivation-dependent and cultivation-independent characterisation of hydrocarbon-degrading bacteria in Guaymas Basin sediments

    Directory of Open Access Journals (Sweden)

    Tony eGutierrez

    2015-07-01

    Full Text Available Marine hydrocarbon-degrading bacteria perform a fundamental role in the biodegradation of crude oil and its petrochemical derivatives in coastal and open ocean environments. However, there is a paucity of knowledge on the diversity and function of these organisms in deep-sea sediment. Here we used stable-isotope probing (SIP, a valuable tool to link the phylogeny and function of targeted microbial groups, to investigate polycyclic aromatic hydrocarbon (PAH-degrading bacteria under aerobic conditions in sediments from Guaymas Basin with uniformly labeled [13C]phenanthrene. The dominant sequences in clone libraries constructed from 13C-enriched bacterial DNA (from phenanthrene enrichments were identified to belong to the genus Cycloclasticus. We used quantitative PCR primers targeting the 16S rRNA gene of the SIP-identified Cycloclasticus to determine their abundance in sediment incubations amended with unlabeled phenanthrene and showed substantial increases in gene abundance during the experiments. We also isolated a strain, BG-2, representing the SIP-identified Cycloclasticus sequence (99.9% 16S rRNA gene sequence identity, and used this strain to provide direct evidence of phenanthrene degradation and mineralization. In addition, we isolated Halomonas, Thalassospira and Lutibacterium spp. with demonstrable phenanthrene-degrading capacity from Guaymas Basin sediment. This study demonstrates the value of coupling SIP with cultivation methods to identify and expand on the known diversity of PAH-degrading bacteria in the deep-sea.

  10. Risk Factors for Pneumonia in Ventilated Trauma Patients with Multiple Rib Fractures

    Directory of Open Access Journals (Sweden)

    Hyun Oh Park

    2017-10-01

    Full Text Available Background: Ventilator-associated pneumonia (VAP is a common disease that may contribute to morbidity and mortality among trauma patients in the intensive care unit (ICU. This study evaluated the associations between trauma factors and the development of VAP in ventilated patients with multiple rib fractures. Methods: We retrospectively and consecutively evaluated 101 patients with multiple rib fractures who were ventilated and managed at our hospital between January 2010 and December 2015, analyzing the associations between VAP and trauma factors in these patients. Trauma factors included sternal fracture, flail chest, diaphragm injury, traumatic aortic dissection, combined cardiac injury, pulmonary contusion, pneumothorax, hemothorax, hemopneumothorax, abbreviated injury scale score, thoracic trauma severity score, and injury severity score. Results: Forty-six patients (45.5% had at least 1 episode of VAP, 10 (21.7% of whom died in the ICU. Of the 55 (54.5% patients who did not have pneumonia, 9 (16.4% died in the ICU. Using logistic regression analysis, we found that VAP was associated with severe lung contusion (odds ratio, 3.07; 95% confidence interval, 1.12 to 8.39; p=0.029. Conclusion: Severe pulmonary contusion (pulmonary lung contusion score 6–12 is an independent risk factor for VAP in ventilated trauma patients with multiple rib fractures.

  11. Long-term follow-up of children with high-risk neuroblastoma: the ENSG5 trial experience.

    Science.gov (United States)

    Moreno, Lucas; Vaidya, Sucheta J; Pinkerton, C Ross; Lewis, Ian J; Imeson, John; Machin, David; Pearson, Andrew D J

    2013-07-01

    Therapy for high-risk neuroblastoma is intensive and multimodal, and significant long-term adverse effects have been described. The aim of this study was to identify the nature and severity of late complications of metastatic neuroblastoma survivors included in the ENSG5 clinical trial. The trial protocol included induction chemotherapy (randomized "Standard" OPEC/OJEC vs. "Rapid" COJEC), surgery of primary tumor and high-dose melphalan with stem cell rescue. Two hundred and sixty-two children were randomized, 69 survived >5 years, and 57 were analyzed. Data were obtained from the ENSG5 trial database and verified with questionnaires sent to participating centers. Median follow-up was 12.9 (6.9-16.5) years. No differences were found in late toxicities between treatment arms. Twenty-eight children (49.1%) developed hearing loss. Nine patients (15.8%) developed glomerular filtration rate <80 ml/min/1.73 m(2), but no cases of chronic renal failure were documented. Endocrine complications (28.1% of children) included mainly hypogonadism and delayed growth. Four children developed second malignancies, three of them 5 years after diagnosis: one osteosarcoma, one carcinoma of the parotid gland and one ependymoma. There were no hematological malignancies or deaths in remission. This study analyzed a wide cohort of high-risk neuroblastoma survivors from a multi-institutional randomized trial and established the profile of long-term toxicity within the setting of an international clinical trial. Copyright © 2012 Wiley Periodicals, Inc.

  12. On catalysis of the initial period of methylcyclohexane oxidation by salts of nontransition metals

    International Nuclear Information System (INIS)

    Smirnov, P.A.; Syroezhko, A.M.; Potekhin, V.M.

    1976-01-01

    The purpose of the present work was to study the influence of salts formed by alkali and alkaline-earth metals with aliphatic acids on chain initiation during the initial period of methylcyclohexane oxidation by air. The oxidation was carried out in an autoclave under 10 kg/cm 2 pressure in the temperature range 120-150 0 C, at catalyst concentrations in the range 0.0-2.36.10 -2 M. The inhibitor concentration was varied in the range 0.0-9.5.10 -4 M. Sodium, cesium, barium lithium and calcium stearates and sodium pelargonate (Pe) were used as catalysts. It was found that salts formed by nontransition metals with aliphatic acids having acid radicals with 9-16 carbon atoms are active catalysts of chain initiation. The catalytic activity of the salts increases with the ionic radius of the cation in the series LiSt 2 2 < CsSt. Radical formation is a first-order process with respect to the catalyst and is due to the polar group of the salt

  13. The Relationship Between Family, Parent, and Child Characteristics and Intimate-Partner Violence (IPV) Among Ukrainian Mothers.

    Science.gov (United States)

    Burlaka, Viktor; Grogan-Kaylor, Andrew; Savchuk, Olena; Graham-Bermann, Sandra A

    2017-07-01

    To assess the prevalence of intimate partner violence (IPV) in a sample of Ukrainian mothers of schoolchildren, and to examine the relationship between IPV and family, parent, and child characteristics utilizing multilevel models. Mothers of children aged 9-16 (n = 278, 93.5% Ukrainians) answered the Revised Conflict Tactics Scale (CTS2) assessing IPV. We also examined the relationship between IPV and maternal age, education, employment and marital status, family income, and rural or urban residence. Eighty-one percent of women reported psychological violence and 58% reported physical assault. On average, women reported 66 instances of IPV during the last year. Multilevel modeling revealed that lower maternal education, unemployment, not living with the husband or partner, and urban residency were associated with higher IPV victimization. Younger age and family income were not significantly related to IPV. IPV was a significant social problem in the present sample of Ukrainian mothers of school age children. Future policy and violence prevention programming should focus on supporting academic and employment opportunities for women, particularly for those living in urban areas.

  14. Treatment of HBV and HDV co-infection using lamivudine

    International Nuclear Information System (INIS)

    Qureshi, H.; Arif, A.; Alam, E.

    2009-01-01

    To see effect of Lamivudine on sero conversion of HBeAg positive cases co infected with Delta hepatitis. Hepatitis B positive patients with deranged liver functions for 6 months were tested for HBeAg, HBV DNA and anti-Delta virus (HDV), using ELISA. Patients were divided into 2 groups, group 1: HBeAg, HBV DNA positive (wild type) but delta negative and group 2: HBeAg, HBV DNA positive (wild type) with delta positive. Lamivudine (100 mg) was advised to both groups till sero-conversion. Of 124 cases in year 1999-2005, 69 were in (Group 1), and 55 were in (Group 2). Eighty percent were males in both groups. ALT normalisation occurred in 75%, 24% cases within 6 months respectively. At the start of therapy mean HBeAg was 289+-189 in group 1 and 142+-160 in group 2. With treatment, the values did not change much till 12 months of therapy. The fall was significantly slow in delta positive cases. At 36 months 26 (38%) cases in group 1 and 9 (16.4%) cases in group 2 sero-converted. Nine cases in each group remained non-responders while 2 in each group relapsed. Wild type of HBV/HDV co-infected cases have a 16% chance of seroconversion which negates the concept that once infected with delta virus there is not much that can be done. (author)

  15. Anxiety, depression and self-esteem levels in obese children: a case-control study.

    Science.gov (United States)

    Topçu, Seda; Orhon, Filiz Şimşek; Tayfun, Meltem; Uçaktürk, Seyit Ahmet; Demirel, Fatma

    2016-03-01

    Obesity is a global health problem affecting all age groups. Childhood obesity, which may cause chronic diseases including diabetes mellitus, cardiovascular disease and cancer, etc., deserves more attention. However, few studies highlight the association between childhood obesity and psychological diseases. In the present study, we aimed to evaluate the psychological condition in obese children. One hundred and sixty-seven obese (body mass index (BMI) >95th percentile) and 200 normal weight children (BMI between 5th and 85th percentile) aged 9-16 years were enrolled into this case-control study. In order to assess the self-concept, anxiety and depression levels: the Piers-Harris Children's Self-Concept Scale (PHCSCS), state and trait anxiety inventory for children (STAI-C) and the children depression inventory (CDI) were administered both obese and control groups. There were significant differences among obese and control groups in terms of the total score of PHCSCS [55 (22-69) versus 65 (57-74)], STAI-C [37 (20-55) versus 28 (20-42)], and CDI [12 (4-39)] versus [8 (3-19)]; respectively (p<0.001, p<0.001, p<0.001). We also found statistically significant differences among groups in all of the subscales parameters of PHCSCS (p<0.001). Our results indicate that obese children may experience psychiatric disorders more than normal-weight peers.

  16. Sun protection counseling by pediatricians has little effect on parent and child sun protection behavior.

    Science.gov (United States)

    Cohen, Liza; Brown, Judith; Haukness, Heather; Walsh, Lori; Robinson, June K

    2013-02-01

    To compare counseling concerning sun protection and outdoor exercise with the parent's report of the behavior of a child aged 9-16 years old. Structured interviews of medical personnel in 3 Chicago area practices elicited information about counseling methods and recommendations. In each practice, a convenience sample of parents completed a self-reported survey of their and their child's behavior. Sun protection counseling occurred more frequently than exercise counseling in all practices (P = .014). Sun protection counseling was associated with parental prompting (P = .004), performing a summer camp physical (P = .002), and the child having a sunburn (P = .003). After controlling for the child's age, sex, and skin tone, sun protection counseling was not associated with the child's use of sun protection. In multivariate analysis of the child's sun protection behavior, parental sunburns, indoor tanning in the last 12 months, perception of skin cancer risk, and sun protection self-efficacy were significant (P = .02). Children who pursued outdoor sports were twice as likely to use inadequate sun protection and sustain sunburns (CI 1.3-1.7). The child's sun protection behavior was influenced by parental sun protection, parental perception of skin cancer risk, and parental sun protection self-efficacy; therefore, sun protection for children needs to be aimed at parents as well as children. Communication with parents in a way that incorporates the principles of motivational interviewing may be more effective in promoting behavioral change than admonitions to use sunscreen. Copyright © 2013 Mosby, Inc. All rights reserved.

  17. Externalizing behaviors of Ukrainian children: The role of parenting.

    Science.gov (United States)

    Burlaka, Viktor

    2016-04-01

    The purpose of this study was to assess the association of positive and negative parenting with child externalizing problems. Quantitative data were collected during face-to-face interviews with 320 parents of children 9-16 years of age (50% males) in 11 communities in Eastern, Southern, and Central Ukraine. The study estimated the relationship between parenting practices and child externalizing behaviors such as aggression, delinquency, and attention problems. Results revealed that positive parenting, child monitoring, and avoidance of corporal punishment were associated with fewer child externalizing symptoms. Results also indicated that child male gender and single parenting had significant and positive association with child externalizing behaviors. This study extends international psychosocial knowledge on children and families. These findings can be used to design programs and foster dialogs about the role of family and social environments in the development of externalizing disorder among researchers, representatives of governmental and nongovernmental organizations, and mass media that work with child abuse prevention in Ukraine. Copyright © 2016 Elsevier Ltd. All rights reserved.

  18. Reclassification of Lactobacillus kimchii and Lactobacillus bobalius as later subjective synonyms of Lactobacillus paralimentarius.

    Science.gov (United States)

    Pang, Huili; Kitahara, Maki; Tan, Zhongfang; Wang, Yanping; Qin, Guangyong; Ohkuma, Moriya; Cai, Yimin

    2012-10-01

    Characterization and identification of strain CW 1 ( = JCM 17161) isolated from corn silage were performed. Strain CW 1 was a Gram-positive, catalase-negative and homofermentative rod that produced the DL-form of lactic acid. This strain exhibited more than 99.6% 16S rRNA gene sequence similarity and greater than 82% DNA-DNA reassociation with type strains of Lactobacillus kimchii, L. bobalius and L. paralimentarius. To clarify the taxonomic positions of these type strains, phenotypic characterization, 16S rRNA gene sequencing, ribotyping and DNA-DNA relatedness were examined. The three type strains displayed different L-arabinose, lactose, melibiose, melezitose, raffinose and N-acetyl-β-glucosaminidase fermentation patterns. Phylogenetic analysis showed that L. paralimentarius is a closer neighbour of L. kimchii and L. bobalius, sharing 99.5-99.9% 16S rRNA gene sequence similarity, which was confirmed by the high DNA-DNA relatedness (≥82%) between L. paralimentarius JCM 10415(T), L. bobalius JCM 16180(T) and L. kimchii JCM 10707(T). Therefore, it is proposed that L. kimchii and L. bobalius should be reclassified as later synonyms of L. paralimentarius.

  19. The role of smartphones in increasing digital and social inequalities among Romanian children

    Directory of Open Access Journals (Sweden)

    Bianca Balea

    2016-12-01

    Full Text Available he emergence of new mobile devices such as Smartphones and tablets in children’s everyday life has facilitated the rise of Internet private use among them, making it possible for them to go online at anytime and anywhere. As studies show, ownership and private use of a Smartphone shape the quality of children’s online experience in a meaningful way (Mascheroni & Cuman, 2014. Accordingly, a broader range of access locations and devices relates to more unsupervised access and thus more independent use of the Internet, which are likely to be related to higher skill levels. This paper aims to investigate, using linear and multilinear regressions, whether owning or having access to Smartphones leads to increasing digital inequalities among children. Results show that demographic variables are significant predictors for the level of Smartphone related skills. However, when variables related with children’s Smartphone and Internet use are introduced in the model, the influence of demographic variables is reduced, showing evidence for second-level of digital divide among children. The present study reports on the Net Children Go Mobile dataset. The project collected data in 2013 from random stratified survey samples of around 500 children aged 9-16, who are Internet users, in seven European country, including Romania. For the purpose of this paper, only responses from Romanian children were taken into account (N=522.

  20. Simultaneous determination of glucose, fructose, sucrose and sorbitol in the leaf and fruit peel of different apple cultivars by the HPLC-RI optimized method.

    Science.gov (United States)

    Filip, Miuţa; Vlassa, Mihaela; Coman, Virginia; Halmagyi, Adela

    2016-05-15

    A high performance liquid chromatography method with refractive index detection (HPLC-RI), for simultaneous determination of glucose, fructose, sucrose and sorbitol in leaf and/or apple peel samples from nine apple (Malus domestica Borkh.) cultivars and rootstocks, originating from a germplasm collection, has been developed and validated. Box-Behnken design of response surface methodology was applied for the method optimization. The Carbosep Coregel 87H3 column was used under the optimum conditions predicted: mobile phase of H2SO4 0.005 mol L(-1) solution, flow rate of 0.3 mL min(-1) and column temperature of 35°C. The method was validated for linearity (R(2)>0.99), limits of detection (2.67-4.83 μg mL(-1)) and quantification (8.9-16.1 μg mL(-1)), precision (%RSD<5.05) and recovery (93.94-103.06%) and satisfactory results obtained. The sugars content varied across micropropagated plants in vitro, plants regenerated after cryostorage, growing trees in vivo, and fruit peel. Copyright © 2015 Elsevier Ltd. All rights reserved.

  1. Abundancia y diversidad larval de gasterópodos en el Caribe Mexicano en relación con la temperatura, la salinidad y el oxígeno disuelto

    Directory of Open Access Journals (Sweden)

    José Francisco Chávez Villegas

    2014-09-01

    Full Text Available Quintana Roo tiene mas de 500 especies de gasterópodos pero muy poco se conoce de los estadios larvales. Muestreamos cuatro sitios mensualmente de enero a diciembre de 2008 con arrastres de plancton por triplicado y con una red cónica con malla de 300μm. Puerto Morelos tuvo los mayores registros (41.26±63.23 larvas•10m-3, seguido por Mahahual (14.78±28.21 larvas•10m-3, Sian Ka’an y Xel-Há presentaron las densidades menores (9.16±16.73 y 3.35±4.33 larvas•10m-3, respectivamente. Mayo y agosto presentaron los mayores registros (33.66±67.39 y 31.78±25.92 larvas•10m-3, respectivamente, marzo y diciembre los menores (1.70±1.88 y 3.18±5.27 larvas•10 m-3 respectivamente. Se registraron diferencias significativas en la densidad media espacial (p:<0.0001 y temporal (p: 0.0275. Identificamos un total de 33 especies de gasterópodos de los géneros Strombus, Natica, Cerithium, Nassarius, Neritidae, Cerithiopsis, Nannodiela, Rissoina, Bulla, Bittium, Modulus y Prunum, de las cuales 28 especies se registraron en Puerto Morelos. Natica, Epithonium y Cerithium fueron los géneros con mayor incidencia en las cuatro localidades.

  2. [Molecular structure and luminescent property of bis(2-(4-methyl-2-hydroxyphenyl)benzothiazolate) zinc].

    Science.gov (United States)

    Xu, Hui-Xia; Chen, Liu-Qing; Wang, Hua; Hao, Yu-Ying; Xu, Bing-She

    2011-02-01

    Bis(2-(4-methyl-2-hydroxyphenyl)benzothiazolate) zinc(Zn(4-MeBTZ)2) was synthesized. Its molecular structure was confirmed by single-crystal x-ray diffraction. Single-crystal data are as follows: space group triclinic, P-1; a = 8.989 9(11) angstroms, b =12.161 7 (15) angstroms, c = 12.871 9 (16) angstroms, alpha = 63.492 (2) degrees, beta = 84.825 (2) degrees, gamma =71.187 (2) degrees. The steric hindrance provided by introduction methyl groups on phenoxide ring prohibited effectively the formation of pentacoordinate complex. There is distinct intermolecular pi-pi interaction between molecules. The dihedral angle between the phenol and benzothiazolate rings of Zn(4-MeBTZ)2 is 2.166 degrees. The HOMO energy, LUMO energy and optical gap are -5.84, -3.46 and 2.37 eV, respectively. The maximum wavelength peak of PL spectra located at 470 nm. The double-layer devices were employed using Zn(4-MeBTZ)2 as emitter and NPB as hole-transport material. The EL spectra split into two peaks located at 501 and 544 nm respectively. The broadened EL spectra were demonstrated to be originated from the exciplexes formed at the interface between NPB and Zn(4-MeBTZ)2.

  3. Macrosomic Neonates Carry Increased Risk of Dental Caries in Early Childhood: Findings from a Cohort Study, the Okinawa Child Health Study, Japan.

    Directory of Open Access Journals (Sweden)

    Hiroshi Yokomichi

    Full Text Available Although many studies have discussed health risks in neonates with a low birth weight, few studies have focused on the risks in neonates with a high birth weight. The objective of this study was to determine whether differences in the incidence of dental caries in early childhood are associated with birth weight status.A total of 117,175 children born in Okinawa Prefecture, Japan from 1997 to 2007 were included in this study. Medical professionals collected information about birth records, growth and development, parental child-rearing practices and dental health at 3 months, 18 months and 3 years of age. The risk of dental caries among neonates with macrosomia (birth weight ≥4000 g was compared with that among neonates with normal weight (2500-3999 g. Sensitivity analyses included 'large for gestational age' (LGA, birth weight above the 90th percentile for gestational age, which was relative to 'appropriate for gestational age' (birth weight between 10th and 90th percentiles. Relative risks and relative risk increases were estimated by multivariate Poisson regression.At 3 years of age, the relative risk increases for dental caries after adjusting for confounding factors were 19% [95% confidence interval (CI, 11%-28%, P < 0.001] for macrosomic neonates and 12% (95% CI, 9%-16%, P < 0.001 for LGA neonates.Macrosomia and LGA were associated with an increased risk of dental caries in early childhood. Particular attention should be paid to abnormally large neonates.

  4. Kodumaa linnud / Reet Rea

    Index Scriptorium Estoniae

    Rea, Reet

    2002-01-01

    Järgneb 18.,25. juuli ; 1.,8.,15.,22.,29. august ; 5.,19.,26. september ; 17.,24.,31. oktoober ; 7.,14.,21,28. november ; 5.,12.,19. detsember ; 2003, 9.,16.,23. jaan., 6.,13. veebr., 6., 20. märts, 3.,10.,24. apr., 22.,29. mai, 5. juuni, 17.,24.,31. juuli, 7.,14.,21.,28. aug., 11. sept.Harakas, linavästrik, hall-kärbsenäpp, lepalind, musträstas, punarind, leevike, hakk, pöialpoiss, käblik, võsaraat, ööbik, pasknäär, räästapääsuke, suitsupääsuke, rasvatihane, sinitihane, musttihane, sabatihane, põhjatihane, sootihane, valgeselg-kirjurähn, roherähn, suur-kirjurähn, puukoristaja, porr, jäälind, ohakalind, laulurästas, koduvarblane, hiireviu, tuuletallaja, kanakull, roo-loorkull, piiritaja, rohevint, kodukakk, pruunselg-põõsalind, kaelustuvi, merisk, peoleo

  5. High-frequency profile in adolescents and its relationship with the use of personal stereo devices.

    Science.gov (United States)

    Silvestre, Renata Almeida Araújo; Ribas, Ângela; Hammerschmidt, Rogério; de Lacerda, Adriana Bender Moreira

    2016-01-01

    To analyze and correlate the audiometric findings of high frequencies (9-16 kHz) in adolescents with their hearing habits and attitudes, in order to prevent noise-induced hearing loss. This was a descriptive cross-sectional study, which included 125 adolescents in a sample of normal-hearing students, at a state school. The subjects performed high-frequency audiometry testing and answered a self-administered questionnaire addressing information on sound habits concerning the use of personal stereo devices. The sample was divided according to the exposure characteristics (time, duration, intensity, etc.) and the results were compared with the observed thresholds, through the difference in proportions test, chi-squared, Student's t-test, and ANOVA, all at a significance level of 0.05. Average high-frequency thresholds were registered below 15 dB HL and no significant correlation was found between high frequency audiometric findings and the degree of exposure. The prevalence of harmful sound habits due to the use of personal stereo devices is high in the adolescent population, but there was no correlation between exposure to high sound pressure levels through personal stereos and the high-frequency thresholds in this population. Copyright © 2016 Sociedade Brasileira de Pediatria. Published by Elsevier Editora Ltda. All rights reserved.

  6. Yoga Practice Increases Minimum Muscular Fitness in Children with Visual Impairment

    Directory of Open Access Journals (Sweden)

    Soubhagyalaxmi Mohanty

    2015-12-01

    Full Text Available Introduction: Muscle strength, a component for balance, gait and functional mobility is vital for children with visual impairment. Yoga has frequently been demonstrated to improve physical and mental fitness in children. This study aimed to assess the effect of 16 weeks yoga training on muscular fitness in children with visual impairment.Methods: This was a wait-listed two-armed-matched case–control study. Eighty (41 yoga, 39control visual impairment students of both genders aged 9-16 years matched on age, gender and degree of blindness were assessed at pre, mid (after 8 weeks and post (after 16 weeks yoga intervention using the Kraus-Weber test. Results: The percentage of students passed in yoga group were 12.2%, 43.9% and 68.3% whereas percentages in the control group were 23.1%, 30.8% and 30.8% in pre, mid, and post tests respectively. McNemar test showed significant differences between pre and mid, mid and post in the yoga group while those parameters were not significantly different in the control group. Yoga therapy seemed to have considerable benefits for the children’s muscular fitness. Conclusion: The study suggests that yoga have considerable benefits for improvement of fitness level in children with visual impairment and may be recommended as and effective, alternative, inexpensive low risk training activity option for them.

  7. Infertility and Weight Reduction: Influence and Outcome

    International Nuclear Information System (INIS)

    Khaskheli, M. N.; Baloch, S.; Baloch, A. S.

    2013-01-01

    Objective: To assess the effect of weight reduction in obese infertile women on conception rate spontaneously as well as with ovulation induction and pregnancy outcome. Study Design: Observational experimental study. Place and Duration of Study: Different private clinics at Mirpurkhas, Thana Bola Khan and Hyderabad, Sindh, Pakistan, from March 2008 to February 2011. Methodology: Infertile women who were obese with the body mass index (BMI) > 30 kg/ m2 and failed to conceive within 2-5 years after taking treatment of infertility for many cycles were inducted. These women underwent life style change program related to exercise and diet for 6 months and in the next 6 months they were observed for spontaneous conception. Those women who failed to conceive were prescribed ovulation induction (clomifene citrate) for the next 6 months and were observed for conception. After conception, they visited regularly during antenatal period till delivery. The data was collected and analyzed on SPSS version 17. Results: The mean decrease in the body index observed was 9.6 +- 1.23 kg/m2, spontaneous conception rate was (n = 35, 41.17%) and miscarriage rate was (n = 9, 16.66%). Conclusion: Weight reduction leads to high spontaneous conception rate as well as with ovulation induction therapy and improves the pregnancy outcome. (author)

  8. Muertes por homicidio, consecuencia fatal de la violencia: el caso de Mexico, 1979-1992

    Directory of Open Access Journals (Sweden)

    María Victoria López

    1996-02-01

    Full Text Available Se analizaron las muertes registradas como homicidio en México de 1979-1992. El estudio se basó en fuente secundaria, siendo las variables analizadas: año, edad, sexo y causa externa de traumatismos y envenenamientos según CIE IX Rev.(E960-E969. Se utilizó un modelo de regresión Poisson para las causas más frecuentes, obteniendo riesgos relativos según edad y sexo. El grupo de referencia fue el de 10-14 años y el sexo femenino. Se registraron 198,485 muertes por Homicidio, con un promedio anual de 14,177 y diario de 39. La principal causa fue ataque con arma de fuego y explosivos(56%. El riesgo relativo más alto fue para el grupo de 35-39 años, con RR 15,4 IC(95% 14,9-16,0, en comparación al de referencia. El sexo masculino presentó un riesgo relativo 10,1 veces mayor que el femenino, ajustado por edad IC10.0-10.3. Los resultados llaman la atención sobre la necesidad de profundizar y analizar el problema de los homicidios bajo una perspectiva multidisciplinaria.

  9. Incidence, management and outcome of women requiring massive transfusion after childbirth in the Netherlands: secondary analysis of a nationwide cohort study between 2004 and 2006.

    Science.gov (United States)

    Ramler, Paul I; van den Akker, Thomas; Henriquez, Dacia D C A; Zwart, Joost J; van Roosmalen, Jos

    2017-06-19

    Postpartum hemorrhage remains the leading cause of maternal morbidity and mortality worldwide. Few population-based studies have examined the epidemiology of massive transfusion for postpartum hemorrhage. The aim of this study was to determine the incidence, management, and outcomes of women with postpartum hemorrhage who required massive transfusion in the Netherlands between 2004 and 2006. Data for all women from a gestational age of 20 weeks onwards who had postpartum hemorrhage requiring eight or more red blood cell concentrates were obtained from a nationwide population-based cohort study including all 98 hospitals with a maternity unit in the Netherlands. Three hundred twenty-seven women who had postpartum hemorrhage requiring massive transfusion were identified (massive transfusion rate 91 per 100,000 deliveries (95% confidence interval: 81-101)). The median blood loss was 4500 mL (interquartile range 3250-6000 mL) and the median number of red blood cell concentrates transfused was 11 units (interquartile range 9-16 units). Among women receiving massive transfusion, the most common cause of hemorrhage was uterine atony. Eighty-three women (25%) underwent hysterectomy, 227 (69%) were admitted to an intensive care unit, and three women died (case fatality rate 0,9%). The number of women in the Netherlands who had postpartum hemorrhage treated with massive transfusion was relatively high compared to other comparable settings. Evidence-based uniform management guidelines are necessary.

  10. DETERMINING MONOFILAMENT GILLNET OPTIMUM MESH SIZE TO MITIGATE Amphilophus citrinellus POPULATION OUTBREAKS IN IR.H.DJUANDA RESERVOIR

    Directory of Open Access Journals (Sweden)

    Prawira A.R.P. Tampubolon

    2015-12-01

    Full Text Available Gillnet is the most common fishing gear used by fishers in Ir. H. Djuanda Reservoir. Currently, gillnet catches are dominated by midas cichlid (Amphilophus citrinellus which is not the main target catch. To some extent, their presence is even considered intrusive by the fishers. The aim of this study is to reveal the optimum gillnet mesh size in catching this alien species, which in turn can be useful to control the fish population in Ir. H. Djuanda Reservoir. The study was conducted from August 2011 to January 2012. The mesh size of the gillnets were 1, 1.5, 2, 2.5, 3, and 3.5 inches. The total midas cichlid caught were 628 fish which were mostly caught in 1.5 inches sized gillnet. Length first mature fish is 13.31 cm. The optimum size of fish caught in the mesh of 1.5, 2, 2.5, 3, and 3.5 inches are 9.7, 12.9, 16.2, 19.4, and 22.6 cm, respectively.

  11. Is autoimmune thyroid dysfunction a risk factor for gestational diabetes?

    Science.gov (United States)

    Pascual Corrales, Eider; Andrada, Patricia; Aubá, María; Ruiz Zambrana, Alvaro; Guillén Grima, Francisco; Salvador, Javier; Escalada, Javier; Galofré, Juan C

    2014-01-01

    Some recent studies have related autoimmune thyroid dysfunction and gestational diabetes (GD). The common factor for both conditions could be the existence of pro-inflammatory homeostasis. The study objective was therefore to assess whether the presence of antithyroid antibodies is related to the occurrence of GD. Fifty-six pregnant women with serum TSH levels ≥ 2.5 mU/mL during the first trimester were retrospectively studied. Antithyroid antibodies were measured, and an O'Sullivan test was performed. GD was diagnosed based on the criteria of the Spanish Group on Diabetes and Pregnancy. Positive antithyroid antibodies were found in 21 (37.50%) women. GD was diagnosed in 15 patients, 6 of whom (10.71%) had positive antibodies, while 9 (16.07%) had negative antibodies. Data were analyzed using exact logistic regression by LogXact-8 Cytel; no statistically significant differences were found between GD patients with positive and negative autoimmunity (OR = 1.15 [95%CI = 0.28-4.51]; P=1.00). The presence of thyroid autoimmunity in women with TSH above the recommended values at the beginning of pregnancy is not associated to development of GD. However, GD prevalence was higher in these patients as compared to the Spanish general population, suggesting the need for closer monitoring in pregnant women with TSH levels ≥ 2.5 mU/mL. Copyright © 2013 SEEN. Published by Elsevier Espana. All rights reserved.

  12. Biosynthesis and metabolic engineering of palmitoleate production, an important contributor to human health and sustainable industry.

    Science.gov (United States)

    Wu, Yongmei; Li, Runzhi; Hildebrand, David F

    2012-10-01

    Palmitoleate (cis-Δ9-16:1) shows numerous health benefits such as increased cell membrane fluidity, reduced inflammation, protection of the cardiovascular system, and inhibition of oncogenesis. Plant oils containing this unusual fatty acid can also be sustainable feedstocks for producing industrially important and high-demand 1-octene. Vegetable oils rich in palmitoleate are the ideal candidates for biodiesel production. Several wild plants are known that can synthesize high levels of palmitoleate in seeds. However, low yields and poor agronomic characteristics of these plants limit their commercialization. Metabolic engineering has been developed to create oilseed crops that accumulate high levels of palmitoleate or other unusual fatty acids, and significant advances have been made recently in this field, particularly using the model plant Arabidopsis as the host. The engineered targets for enhancing palmitoleate synthesis include overexpression of Δ9 desaturase from mammals, yeast, fungi, and plants, down-regulating KASII, coexpression of an ACP-Δ9 desaturase in plastids and CoA-Δ9 desaturase in endoplasmic reticulum (ER), and optimizing the metabolic flux into triacylglycerols (TAGs). This review will mainly describe the recent progress towards producing palmitoleate in transgenic plants by metabolic engineering along with our current understanding of palmitoleate biosynthesis and its regulation, as well as highlighting the bottlenecks that require additional investigation by combining lipidomics, transgenics and other "-omics" tools. A brief review of reported health benefits and non-food uses of palmitoleate will also be covered. Copyright © 2012. Published by Elsevier Ltd.

  13. Evaluation of cardiac functions in patients with thalassemia major

    International Nuclear Information System (INIS)

    Kucuk, N.O.; Aras, G.; Sipahi, T.; Ibis, E.; Akar, N.; Soylu, A.; Erbay, G.

    1999-01-01

    It is known that a blood transfusion is necessary for survival in patients with thalassemia, but it may cause myocardial dysfunction due to myocardial siderosis as in other organs. The aim of this study was to evaluate myocardial perfusion by means of stress thallium scanning (MPS) and left ventricular functions by rest radionuclide ventriculography (RNV). Twenty-one patients at ages 9-16 (mean 12.1±3.2) who have been diagnosed with thalassemia for 4-15 years mean 12.7±4.8) were included in the study. They had blood transfusion 78-318 times (mean 162.1±71). MPS and RNV was performed within two days after the any transfusion. MPS showed ischemia in 3 patients and normal perfusion in 18 patients. RNV revealed normal systolic parameters (wall motion, EF, PER, TPE) but diminished diastolic parameters (TPF, PFR) compared with normal values (p<0.05). We conclude that ischemia or fixed defects may be seen in stress MPS as results of cardiac involvement in patients with thalassemia. But, RNV is an important and preferable test for the early detection of subclinic cardiomyopathy. RNV may therefore show diastolic abnormalities before the systolic abnormalities show up. (author)

  14. Evaluation of cardiac functions in patients with thalassemia major

    Energy Technology Data Exchange (ETDEWEB)

    Kucuk, N.O.; Aras, G.; Sipahi, T.; Ibis, E.; Akar, N.; Soylu, A.; Erbay, G. [Ankara Univ. (Turkey). Medical School

    1999-06-01

    It is known that a blood transfusion is necessary for survival in patients with thalassemia, but it may cause myocardial dysfunction due to myocardial siderosis as in other organs. The aim of this study was to evaluate myocardial perfusion by means of stress thallium scanning (MPS) and left ventricular functions by rest radionuclide ventriculography (RNV). Twenty-one patients at ages 9-16 (mean 12.1{+-}3.2) who have been diagnosed with thalassemia for 4-15 years mean 12.7{+-}4.8) were included in the study. They had blood transfusion 78-318 times (mean 162.1{+-}71). MPS and RNV was performed within two days after the any transfusion. MPS showed ischemia in 3 patients and normal perfusion in 18 patients. RNV revealed normal systolic parameters (wall motion, EF, PER, TPE) but diminished diastolic parameters (TPF, PFR) compared with normal values (p<0.05). We conclude that ischemia or fixed defects may be seen in stress MPS as results of cardiac involvement in patients with thalassemia. But, RNV is an important and preferable test for the early detection of subclinic cardiomyopathy. RNV may therefore show diastolic abnormalities before the systolic abnormalities show up. (author)

  15. Reducing errors benefits the field-based learning of a fundamental movement skill in children.

    Science.gov (United States)

    Capio, C M; Poolton, J M; Sit, C H P; Holmstrom, M; Masters, R S W

    2013-03-01

    Proficient fundamental movement skills (FMS) are believed to form the basis of more complex movement patterns in sports. This study examined the development of the FMS of overhand throwing in children through either an error-reduced (ER) or error-strewn (ES) training program. Students (n = 216), aged 8-12 years (M = 9.16, SD = 0.96), practiced overhand throwing in either a program that reduced errors during practice (ER) or one that was ES. ER program reduced errors by incrementally raising the task difficulty, while the ES program had an incremental lowering of task difficulty. Process-oriented assessment of throwing movement form (Test of Gross Motor Development-2) and product-oriented assessment of throwing accuracy (absolute error) were performed. Changes in performance were examined among children in the upper and lower quartiles of the pretest throwing accuracy scores. ER training participants showed greater gains in movement form and accuracy, and performed throwing more effectively with a concurrent secondary cognitive task. Movement form improved among girls, while throwing accuracy improved among children with low ability. Reduced performance errors in FMS training resulted in greater learning than a program that did not restrict errors. Reduced cognitive processing costs (effective dual-task performance) associated with such approach suggest its potential benefits for children with developmental conditions. © 2011 John Wiley & Sons A/S.

  16. Assessment of Psychopathology and Quality of Life in Children and Adolescents With Migraine.

    Science.gov (United States)

    Öztop, Didem Behice; Taşdelen, Bedia İnce; PoyrazoğLu, Hatıce Gamze; Ozsoy, Saliha; Yilmaz, Rabia; Şahın, Nilfer; Per, Hüseyin; Bozkurt, Selma

    2016-06-01

    The aims of this study were to investigate comorbid psychiatric disorders and to identify anxiety and depression levels and quality of life in children and adolescents with migraine; and to assess their relationship with migraine. 35 patients aged 9-16 years were followed in our neurology clinic and their parents were included into the study. 35 age- and sex-matched patients were employed as the control group. In the subjects included, psychiatric disorders were assessed by using the Schedule for Affective Disorders and Schizophrenia for School Age Children-Present and Lifetime Version. All children and adolescents were assessed by using the Children's Depression Inventory, the State-Trait Anxiety Inventory and the Pediatric Quality of Life Inventory. In addition, the Pediatric Migraine Disability Assessment Tool and visual analog scale were used to identify the degree of disability and pain severity in patients with migraine. In the psychiatric assessment of children and adolescents with migraine, it was found that a psychiatric diagnosis was made in 40% of patients; and depression scale scores were significantly higher than those of controls. Quality of life was found to be poorer in patients with migraine compared to controls. It was found that quality of life was negatively correlated with pain severity and degree of disability; while it was positively correlated with depression scores. In children and adolescents with migraine, treatment of psychiatric disorders in addition to migraine therapy can facilitate migraine management and may decrease the need for prophylactic therapy. © The Author(s) 2016.

  17. Predicting Arrest in a Sample of Youth Perinatally Exposed to HIV: The Intersection of HIV and Key Contextual Factors.

    Science.gov (United States)

    Elkington, Katherine S; Peters, Zachary; Choi, C Jean; Bucek, Amelia; Leu, Cheng-Shiun; Abrams, Elaine J; Mellins, Claude A

    2017-11-22

    We examined the role of youth HIV status and other key factors on past-year arrest in perinatally HIV-exposed but uninfected (PHIV-) and perinatally HIV-infected (PHIV+) youth using data from a multi-site study of psychosocial behaviors in PHIV-exposed urban youth (N = 340; 61% PHIV+; 51% female; ages 9-16 at baseline). Youth and caregivers were administered 5 interviews, spanning approximately 7.5 years. Using longitudinal logistic mixed-effect models, we explored the association between past year arrest, internal [e.g., substance use disorder (SUD)] and external (e.g., neighborhood arrest rates) contextual factors, and social-regulation processes (e.g., in-school/work). Arrest rates increased from 2.6 to 19.7% across follow-ups; there were no differences in arrest over time by HIV status. In the final model, odds of arrest were greater for youth who were male, with SUD, ≥ 18 years old, with high levels of city stress, and neither in school nor employed. PHIV-exposed, urban youth have much higher rates of arrest than national samples. Lack of differences in arrest by HIV status suggests key contextual factors are more important in promoting arrest.

  18. Factors influencing the virological testing of cornea donors.

    Science.gov (United States)

    Röck, Tobias; Beck, Robert; Jürgens, Stefan; Bartz-Schmidt, Karl Ulrich; Bramkamp, Matthias; Thaler, Sebastian; Röck, Daniel

    2017-11-01

    To assess the influence of donor, environment, and logistical factors on the results of virological testing of blood samples from cornea donors.Data from 670 consecutive cornea donors were analyzed retrospectively. Logistic regression analysis was used to assess the influence of different factors on the results of virological testing of blood samples from cornea donors.The mean annual rate of donors with serology-reactive or not evaluable result was 14.8% (99 of 670) (range 11.9%-16.9%). The cause of donor death by cancer increased the risk of serology-reactive or not evaluable result (P = .0300). Prolonged time between death and post mortem blood removal was associated with a higher rate of serology-reactive or not evaluable result (P donors, sex, and donor age had no significant impact on the results of virological testing of blood samples from cornea donors.The cause of donor death by cancer and a prolonged time between death and post mortem blood removal seem to be mainly responsible for serology-reactive or not evaluable result of blood samples from cornea donors. The percentage of discarded corneas caused by serology-reactive or not evaluable result may be reduced by shortening the period of time between death and post mortem blood removal. Copyright © 2017 The Authors. Published by Wolters Kluwer Health, Inc. All rights reserved.

  19. Characterisation of clotting factors, anticoagulant protein activities and viscoelastic analysis in healthy donkeys.

    Science.gov (United States)

    Perez-Ecija, A; Mendoza, F J

    2017-11-01

    Studies have demonstrated differences in commonly measured haemostatic parameters between donkeys and horses. Whether clotting factors, anticoagulant protein activities and thromboelastography parameters also differ between species is still unknown. To characterise haemostatic parameters in healthy donkeys and to compare these with those in horses. Cross-sectional study. Clotting factors (V, VII, VIII, IX, X, XI and XII), and antithrombin III, Protein C and Protein S activities were measured in 80 healthy Andalusian and crossbred donkeys and 40 healthy Andalusian crossbred horses with assays based on human deficient plasmas. Thromboelastography was performed in 34 donkeys using a coagulation and platelet function analyser. Donkeys had shorter activated partial thromboplastin time (mean ± s.d. 33.4 ± 5.2 s vs. 38.8 ± 4.2 s; P0.05) and XII (96 ± 21 vs. 108 ± 15; Pdonkeys. Activated clot time (175 [159-189]), time to peak (6.5 [5.8-7.8]) and clot formation rate (26.9 [16.9-36.4]) in donkeys were shorter than reported values in horses. Haemostatic pathways could not be fully evaluated in donkeys because some tests are unavailable. Certain fibrinolytic parameters (plasmin, plasminogen, etc.) have not been characterised in donkeys and this may have affected our results. The haemostatic system in donkeys differs from that in horses and extrapolation of reference values between these species is not appropriate. © 2017 EVJ Ltd.

  20. MRI findings of neurilemmoma of the extremities: Pathologic correlation

    International Nuclear Information System (INIS)

    Choi, Choong Gon; Kang, Heung Sik; Kim, Joo Wan; Kim, Ho Chul; Suh, Kyung Jin; Song, Chi Sung

    1993-01-01

    Neurilemmomas of the extremities are nerve sheath tumors involving peripheral nerves of the extremities. We analyzed MR images of 16 surgically proved tumors in 12 patients and compared the MR images with gross pathologic specimens in two tumors (2/16). Spin echo T1-weighted images were obtained in all the patients but T2-weighted images were obtained in six patients with a gradient echo technique. Gadolinium dimeglumine enhanced T1-weighted images were obtained in 11 patients (15/16). Signal on T1-weighted images was iso or slightly higher than that of the adjacent muscles. Signal on T2-weighted images ranged from homogeneous high to heterogeneous. After Gadolinium injection, all the 15 tumors showed enhancement. Small sized tumors were enhanced homogeneously but there was a tendency to be enhanced heterogeneously to the central portion with peripheral rim enhancement as the size of the tumors increased. Pathologically, the enhanced portion was correlated the with solid portion of the tumors. Also encapsulation of the mass (12/16), suspended nerve strings (9/16) and bony erosion(1/16) were detected. MR characteristics of neurilemmoma include heterogeneity on enhanced T1 and T2 weighted images, encapsulation, and suspended nerve strings. Signal heterogeneity on enhanced T1 and T2 weighted images may be attributed to the variable cellularity, cystic changes, vascularity and focal hemorrhage of the tumors

  1. Análisis de la condición física en jóvenes jugadores de fútbol en función de la categoría de formación y del puesto específico

    Directory of Open Access Journals (Sweden)

    Fernando Calahorro Cañada

    2012-09-01

    Full Text Available El objetivo principal de este trabajo es valorar el nivel de condición física en jugadores de 13 a 18 años, determinando posibles diferencias respecto a la categoría de formación (infantil, cadete y juvenil y el puesto específico (porteros, defensas, centrocampistas, delanteros. Se seleccionaron 66 jugadores (con una edad de 15,46 ± 1,83 años, una masa de 63,33 ± 9,51 kg, una estatura de 171,44 ± 8,38 cm y una experiencia previa competitiva de 9,16 ± 1,93 años. Se determinó la composición corporal (INBODY 720, flexibilidad isquiosural (test sit and reach, salto con contramovimiento y abalakov (plataforma nusclelab 4000, y consumo máximo de oxígeno (test de course navette. Se observan diferencias por puesto específico y categoría de formación en la composición corporal y condición física (infantiles respecto cadetes y juveniles, y se observan diferencias fundamentalmente entre los puestos específicos de defensas cadetes respecto a los juveniles, y entre el puesto especifico de categoría infantil respecto al resto.

  2. Characteristics of the Triassic Source Rocks of the Aitutu Formation in the (West Timor Basin

    Directory of Open Access Journals (Sweden)

    Asep Kurnia Permana

    2014-12-01

    Full Text Available DOI:10.17014/ijog.v1i3.192The Triassic rocks of the (West Timor Basin have been identified that was mainly deposited in the  marine environment. The fine grained clastics and carbonate  rocks of this Triassic marine  facies are considered to be the most promising source rocks potential in this basin. In this paper we present geochemical and petrographic data from outcrop samples of the Triassic carbonate Aitutu Formation, due to emphasized the organic maturation, kerogen type of the organic matter and the origin of the organic matter.  A representative of selected sample were subjected to the Rock-Eval Pyrolisis, vitrinite reflectance and thermal alteration index, bitumen extraction, were analyzed on the GC-MS. The samples were collected from marine deposit of the Triassic Sequence. The TOC values of the analyzed sample range between rich and rich organic richness (0.51% - 9.16%, wt.%, TOC, which consists mainly of type II and III kerogen and the organic matter consider to be predominantly oil/gas prone and gas prone potential. The thermal maturity assessed from Tmax, TAI, and vitrinite reflectance shows an immature to early peak mature stage of the organic matter. The GC-MS analyses of the biomarkers indicate mainly the organic matter derived from mixed source rocks facies containing alga debris and higher plant terrestrial origin.

  3. Comparison Of Lipid Lowering Effect Of Extra Virgin Olive Oil And Atorvastatin In Dyslipidaemia In Type 2 Diabetes Mellitus.

    Science.gov (United States)

    Khan, Tariq Mahmood; Iqbal, Sohail; Rashid, Muhammad Adnan

    2017-01-01

    Extra virgin olive oil (EVOO) is fruit oil with rich source of monounsaturated fats and powerful antioxidants. It acts as hypolipidemic agent and significant decrease of plasma lipids level was observed with EVOO use. Atorvastatin is hypolipidemic drug commonly used for treatment of hyperlipidaemia. The purpose of this study was to determine & compare the lipid lowering effect of EVOO with atorvastatin in type 2 diabetic dyslipidaemia which is leading cause of microvascular diseases. This randomised controlled trial was conducted on 60 already diagnosed cases of type 2 diabetes mellitus with dyslipidaemia. All sixty subjects were divided randomly into 2 groups. Atorvastatin 40 mg was given to Group One and two tablespoons of extra virgin olive oil orally per day was given to Group Two. Blood was collected for estimation of plasma lipids level at base line, 4th week, and 6th weeks in two groups and was compared statistically. The present study demonstrated 20-40% lipid lowering effect of atorvastatin on plasma lipids level with 9-16% increase in HDL while extra virgin olive oil showed 14-25% reduction in plasma lipids with 8-12% increase in HDL-cholesterol level. This study concludes that both atorvastatin and extra virgin olive oil are effective in reducing plasma lipids level in type 2 diabetic dyslipidaemia with more prominent effect of atorvastatin than EVOO.

  4. Variability in Glycemic Control with Temperature Transitions during Therapeutic Hypothermia

    Directory of Open Access Journals (Sweden)

    Krystal K. Haase

    2017-01-01

    Full Text Available Purpose. Patients treated with therapeutic hypothermia (TH and continuous insulin may be at increased risk of hyperglycemia or hypoglycemia, particularly during temperature transitions. This study aimed to evaluate frequency of glucose excursions during each phase of TH and to characterize glycemic control patterns in relation to survival. Methods. Patients admitted to a tertiary care hospital for circulatory arrest and treated with both therapeutic hypothermia and protocol-based continuous insulin between January 2010 and June 2013 were included. Glucose measures, insulin, and temperatures were collected through 24 hours after rewarming. Results. 24 of 26 patients experienced glycemic excursions. Hyperglycemic excursions were more frequent during initiation versus remaining phases (36.3%, 4.3%, 2.5%, and 4.0%, p=0.002. Hypoglycemia occurred most often during rewarming (0%, 7.7%, 23.1%, and 3.8%, p=0.02. Patients who experienced hypoglycemia had higher insulin doses prior to rewarming (16.2 versus 2.1 units/hr, p=0.03. Glucose variation was highest during hypothermia and trended higher in nonsurvivors compared to survivors (13.38 versus 9.16, p=0.09. Frequency of excursions was also higher in nonsurvivors (32.3% versus 19.8%, p=0.045. Conclusions. Glycemic excursions are common and occur more often in nonsurvivors. Excursions differ by phase but risk of hypoglycemia is increased during rewarming.

  5. Effect of Cooking Method on the Proximate, Amino Acid and Fatty Acid Compositions of Clarias gariepinus and Oreochromis niloticus

    Directory of Open Access Journals (Sweden)

    Omolara Olusola Oluwaniyi

    2016-10-01

    Full Text Available The proximate, amino acid and fatty acid compositions of the fillet and oil from Clarias gariepinus (Catfish and Oreochromis niloticus (Tilapia were determined. The moisture content ranged from 76.27 % for catfish to 79.97 % for tilapia while the oil content ranged from 7.80 % for tilapia and 11.00 % for catfish. Ash content was in the range 8.03 – 9.16 % and the protein content was 15.83 - 18.48 %. Cooking – boiling, roasting or frying – resulted in a variation in the nutrient composition but with no significant effect on the amino acid composition except for the samples fried with palm oil which resulted in significantly reduced essential amino acids contents. All the fish samples – both fresh and processed – have amino acid scores less than 100, with lysine, threonine and the sulphur-containing amino acids being among the limiting amino acids. Both fish samples contain more unsaturated than saturated fatty acids.

  6. Comparison of the effects of model-based iterative reconstruction and filtered back projection algorithms on software measurements in pulmonary subsolid nodules

    Energy Technology Data Exchange (ETDEWEB)

    Cohen, Julien G. [Seoul National University College of Medicine, Department of Radiology, Seoul (Korea, Republic of); Seoul National University Medical Research Center, Institute of Radiation Medicine, Seoul (Korea, Republic of); Centre Hospitalier Universitaire de Grenoble, Clinique Universitaire de Radiologie et Imagerie Medicale (CURIM), Universite Grenoble Alpes, Grenoble Cedex 9 (France); Kim, Hyungjin; Park, Su Bin [Seoul National University College of Medicine, Department of Radiology, Seoul (Korea, Republic of); Seoul National University Medical Research Center, Institute of Radiation Medicine, Seoul (Korea, Republic of); Ginneken, Bram van [Radboud University Nijmegen Medical Center, Department of Radiology and Nuclear Medicine, Nijmegen (Netherlands); Ferretti, Gilbert R. [Centre Hospitalier Universitaire de Grenoble, Clinique Universitaire de Radiologie et Imagerie Medicale (CURIM), Universite Grenoble Alpes, Grenoble Cedex 9 (France); Institut A Bonniot, INSERM U 823, La Tronche (France); Lee, Chang Hyun [Seoul National University College of Medicine, Department of Radiology, Seoul (Korea, Republic of); Goo, Jin Mo; Park, Chang Min [Seoul National University College of Medicine, Department of Radiology, Seoul (Korea, Republic of); Seoul National University Medical Research Center, Institute of Radiation Medicine, Seoul (Korea, Republic of); Seoul National University College of Medicine, Cancer Research Institute, Seoul (Korea, Republic of)

    2017-08-15

    To evaluate the differences between filtered back projection (FBP) and model-based iterative reconstruction (MBIR) algorithms on semi-automatic measurements in subsolid nodules (SSNs). Unenhanced CT scans of 73 SSNs obtained using the same protocol and reconstructed with both FBP and MBIR algorithms were evaluated by two radiologists. Diameter, mean attenuation, mass and volume of whole nodules and their solid components were measured. Intra- and interobserver variability and differences between FBP and MBIR were then evaluated using Bland-Altman method and Wilcoxon tests. Longest diameter, volume and mass of nodules and those of their solid components were significantly higher using MBIR (p < 0.05) with mean differences of 1.1% (limits of agreement, -6.4 to 8.5%), 3.2% (-20.9 to 27.3%) and 2.9% (-16.9 to 22.7%) and 3.2% (-20.5 to 27%), 6.3% (-51.9 to 64.6%), 6.6% (-50.1 to 63.3%), respectively. The limits of agreement between FBP and MBIR were within the range of intra- and interobserver variability for both algorithms with respect to the diameter, volume and mass of nodules and their solid components. There were no significant differences in intra- or interobserver variability between FBP and MBIR (p > 0.05). Semi-automatic measurements of SSNs significantly differed between FBP and MBIR; however, the differences were within the range of measurement variability. (orig.)

  7. Gibberellins in shoots and developing capsules of Populus species.

    Science.gov (United States)

    Pearce, David W; Hutt, Oliver E; Rood, Stewart B; Mander, Lewis N

    2002-03-01

    Extracts of stems of growing shoots of Populus deltoides and P. trichocarpa, and developing capsules of P. deltoides were analysed for gibberellins (GAs) by gas chromatography-mass spectrometry. The following known GAs were identified by comparison of their Kovats retention indices (KRIs) and mass spectra with those of standards: GA1, GA8, GA9, GA19, GA20, 16 beta,17-dihydro-17-hydroxy GA20, GA23, GA28, GA29, GA34, GA44, and GA97. Several of these have not been previously reported from Populus. In addition, two new GAs were identified as 12 beta-hydroxy GA53 (GA127) and 16 beta,17-dihydro-17-hydroxy GA53 and their structures were confirmed by partial synthesis. Evidence was found of 16,17-dihydro-16,17-dihydroxy GA9, 16,17-dihydro-16,17-dihydroxy GA12, 12-hydroxy GA14, and GA34-catabolite by comparison of mass spectra and KRIs with published data. Several putative GAs (hydroxy- and dihydroxy-GA12-like) were also found. The catabolites of active GAs or of key precursors, hydroxylated at C-2 in stems and either C-2, C-12, C-17, or C-16,17 in capsules, were the major proportion of the GAs.

  8. Outcomes of Pulmonary Valve Replacement for Correction Pulmonary Insufficiency after Primary Repair of Tetralogy of Fallot (TOF

    Directory of Open Access Journals (Sweden)

    Mohammad Abbassi Teshnisi

    2016-09-01

    Full Text Available Background Total correction of Tetralogy of Fallot (TOF anomaly in early childhood has been practiced in many centers with good results, but in some of patients after few years sever Pulmonary valve insufficiency occurred. Materials and Methods At a cross- sectional study from January 2015 to January 2016, 10 patients who had history of primary repair of TOF with free pulmonary insufficiency (PI that underwent of pulmonary valve replacement (PVR with bioprosthetic valves were evaluated. Results Themean age of patients was 6.5 + 0.753 years old (ranged 8-12 years old and male to female ratio was 6/4. The mean of Intensive care unit (ICU stay and Hospital stay was 4.5+ 0.712 days (ranged 3-8 and 11.5+ 0.357 days (ranged 9- 16. Mean of cardiopulmonary bypass time and operation time was 45 + 0.684 min (ranged 32-60 and 83 + 0.317 min (ranged 65-112. In this study we did not find any mortality and ventricular arrhythmia and Heart block. There was only one case (10% with superficial wound infection that was controlled. At 6 months follow up, all of patients were alive, but Echocardiography sign of Right Ventricular (RV failure was present in 2 patients (20% recently. Conclusion Although for Pulmonary insufficiency after primary TOF repair there is controversial in studies, but we had good results of PVR with Bioprosthesis in TOF patients.

  9. Release of non-methane organic compounds during simulated landfilling of aerobically pretreated municipal solid waste.

    Science.gov (United States)

    Zhang, Yuanyuan; Yue, Dongbei; Liu, Jianguo; Lu, Peng; Wang, Ying; Liu, Jing; Nie, Yongfeng

    2012-06-30

    Characteristics of non-methane organic compounds (NMOCs) emissions during the anaerobic decomposition of untreated (APD-0) and four aerobically pretreated (APD-20, APD-39, APD-49, and APD-63) samples of municipal solid waste (MSW) were investigated in laboratory. The cumulative mass of the NMOCs of APD-20, APD-39, APD-49, and APD-63 accounted for 15%, 9%, 16%, and 15% of that of APD-0, respectively. The intensities of the NMOC emissions calculated by dividing the cumulative NMOC emissions by the quantities of organic matter removed (Q(VS)) decreased from 4.1 mg/kg Q(VS) for APD-0 to 0.8-3.4 mg/kg Q(VS) for aerobically pretreated MSW. The lipid and starch contents might have significant impact on the intensity of the NMOC emissions. Alkanes dominated the NMOCs released from the aerobically pretreated MSW, while oxygenated compounds were the chief component of the NMOCs generated from untreated MSW. Aerobic pretreatment of MSW prior to landfilling reduces the organic content of the waste and the intensity of the NMOC emissions, and increases the odor threshold, thereby reducing the environmental impact of landfills. Copyright © 2012 Elsevier Ltd. All rights reserved.

  10. Myocardial infarction increases progressive visual field defects in well treated early primary open angle glaucoma--a prospective case control study.

    Science.gov (United States)

    Mondal, Lakshmikanta; Baidya, Krishnapada; Choudhury, Himadri; Roy, Rupam

    2013-06-01

    The purpose of the study was to evaluate the progression of glaucomatous field damage in patients with stable primary open angle glaucoma after an attack of myocardial infarction. In this case control study, 62 open angle glaucoma patients were selected and regularly followed up. Among 62 patients, 9 had an attack of myocardial infarction. The intra-ocular pressure and visual field progression of both the groups (myocardial infarction versus no myocardial infarction) were analysed. Three (33.3%) out of 9 patients who had suffered from myocardial infarction showed progressive visual field loss whereas only 9 (16.9%) out of 53 patients who did not suffer from myocardial infarction, showed progressive field changes. Both the groups had stable target intra-ocular pressure between 14 and 16 mm Hg. Myocardial infarction may adversely influence the progression of primary open angle glaucoma which is suspected to result from ischaemia induced neuronal loss and only control of intraocular pressure is not the only solution. We have to look for other drugs that prevents ischaemia induced neuronal damage.

  11. Evaluation of the causes of the exams repetition in a mammography service

    International Nuclear Information System (INIS)

    Padilha Filho, L.G.; Pereira, W.W.; Montone Junior, V.; Beskow, R.LK.; Berquo, F.R.; Chernicharo, C.C.; Lins, R.P.N.; Petrelli, A. dos S.C.; Santos, R.P.

    2001-01-01

    The objective of this work is to evaluate and become clear the causes of repetitions of the mammography centre of the Santa Casa da Misericordia do Rio de Janeiro (CDM/SCMRJ). This will become possible to make the necessary modifications to a better learning to the residents of CDM/SCMRJ and also to the students of medical physics of Fundacao Tecnico Educacional Souza Marques. During the period of 2001 April to 2001 July, 131 rejections from a total of 3936 mammography's exams over patients from CDM/SCMRJ, taking in consideration, the mistakes over confection of mammography. The obtained results show in a preliminary evaluation that from 131 utilized films, the more frequent mistakes were 29% from the positioning; 16.79% from radiographic artifacts; 9.16% from sub-exposition; 8.39% from inadequate techniques; 8.39% from overcast. The majority of rejected films happened during a clinical phase of radiographic confection, this shows that the efforts that have been done in the teaching and training from technicians and residents must be accentuated yet more to diminished these wrongs. The conditions of functioning are in the domain of preconization rules for a good radiographic analysis. (author)

  12. Histopathological Diagnostic Value of the IgG4+/IgG+ Ratio of Plasmacytic Infiltration for IgG4-Related Diseases

    Science.gov (United States)

    Deng, Chuiwen; Li, Wenli; Chen, Si; Zhang, Wen; Li, Jing; Hu, Chaojun; Wen, Xiaoting; Zhang, Fengchun; Li, Yongzhe

    2015-01-01

    Abstract This article aims to perform a meta-analysis to evaluate the diagnostic value of the immunoglobulin G (IgG)4+/IgG+ ratio of plasmacytic infiltration for IgG4-related diseases. Four databases—EMBASE, ISI Web of Knowledge, PubMed, and the Cochrane Library—were systematically searched. Approximately 200 participants from several studies were included in this research. STATA 11.2 software (Stata Corporation, College Station, TX) and Meta-DiSc 1.4 (Unit of Clinical Biostatistics, Ramon y Cajal Hospital, Madrid, Spain) were used to perform the meta-analysis. Nine studies were included in the meta-analysis. The pooled diagnostic odds ratio was 18.94 [95% confidence interval (CI), 2.89–124.30]. The sensitivity was 58.80% (95% CI, 50.90–66.30) and the specificity was 90.20% (95% CI, 81.20–95.80). The positive and negative likelihood ratios were 3.12 (95% CI, 1.07–9.16) and 0.26 (95% CI, 0.09–0.70), respectively. The area under the curve of the summary receiver-operating characteristic was 0.88. To conclude, the IgG4+/IgG+ ratio of plasmacytic infiltration is modestly effective in diagnosing IgG-related disease. PMID:25738476

  13. Quality of registration for clinical trials published in emergency medicine journals.

    Science.gov (United States)

    Jones, Christopher W; Platts-Mills, Timothy F

    2012-10-01

    In 2005, the International Committee of Medical Journal Editors established clinical trial registration as a requirement for articles submitted to member journals, with the goal of improving the transparency of clinical research. The objective of this study is to characterize the registration of clinical trials published in emergency medicine journals. Randomized trials involving human subjects and published between June 1, 2008, and May 31, 2011 in the 5 emergency medicine journals with the highest impact factors were included. We assessed the clarity of registered primary outcomes, timing of registration relative to patient enrollment, and consistency between registered and published outcomes. Of the 123 trials included, registry entries were identified for 57 (46%). Of the 57 registered studies, 45 (79%) were registered after the initiation of subject enrollment, 9 (16%) had registered outcomes that were unclear, and 26 (46%) had discrepancies between registered and published outcomes. Only 5 studies were registered before patient enrollment with a clear primary outcome that was consistent with the published primary outcome. Annals of Emergency Medicine was the only journal in which the majority of trials were registered. Current compliance with clinical trial registration guidelines is poor among trials published in emergency medicine journals. Copyright © 2012. Published by Mosby, Inc.

  14. Effectiveness of a national cardiovascular disease risk assessment program (NHS Health Check): results after one year.

    Science.gov (United States)

    Artac, Macide; Dalton, Andrew R H; Majeed, Azeem; Car, Josip; Millett, Christopher

    2013-08-01

    We aimed to assess whether the National Health Service (NHS) Health Check, a systematic cardiovascular disease (CVD) risk assessment and management program, was associated with reduction in CVD risk in attendees after one year. We extracted data from patients aged 40-74 years, with high estimated CVD risk, who were registered with general practices in a deprived, culturally diverse setting in England. We included 4748 patients at baseline (July 2008-November 2009), with 3712 at follow-up (December 2009-March 2011). We used a pre-post study design to assess changes in global CVD risk, individual CVD risk factors and statin prescription in patients with a complete and partial Health Check. There were significant reductions in mean CVD risk score (28.2%; 95% confidence interval (CI)=27.3-29.1 to 26.2%; 95% CI, 25.4-27.1), diastolic blood pressure, total cholesterol levels and lipid ratios after one year in patients with a complete Health Check. Statin prescription increased from 14.0% (95% CI=11.9-16.0) to 60.6% (95% CI=57.7-63.5). The introduction of NHS Health Check was associated with significant but modest reductions in CVD risk among screened high-risk individuals. Further cost-effectiveness analysis and work accounting for uptake is required to assess whether the program can make significant changes to population health. Copyright © 2013 Elsevier Inc. All rights reserved.

  15. Effect of the New Plant Growth Biostimulants Based on Amino Acids on Yield and Grain Quality of Winter Wheat.

    Science.gov (United States)

    Popko, Małgorzata; Michalak, Izabela; Wilk, Radosław; Gramza, Mateusz; Chojnacka, Katarzyna; Górecki, Henryk

    2018-02-21

    Field and laboratory experiments were carried out in 2012-2013, aimed at evaluating the influence of new products stimulating plant growth based on amino acids on crop yield, characteristics of grain and content of macro- and micronutrients in winter wheat ( Triticum aestivum L.). The tests included two formulations produced in cooperation with INTERMAG Co. (Olkusz, Poland)-AminoPrim and AminoHort, containing 15% and 20% amino acids, respectively, and 0.27% and 2.1% microelements, respectively. Field experiments showed that the application of products based on amino acids influenced the increase of grain yield of winter wheat (5.4% and 11%, respectively, for the application of AminoPrim at a dose 1.0 L/ha and AminoHort at dose 1.25 L/ha) when compared to the control group without biostimulant. Laboratory tests showed an increase of technological characteristics of grain such as ash content, Zeleny sedimentation index and content of protein. The use of the tested preparations at different doses also contributed to the increase of the nutrients content in grains, in particular copper (ranging 31-50%), as well as sodium (35-43%), calcium (4.3-7.9%) and molybdenum (3.9-16%). Biostimulants based on amino acids, tested in the present study, can be recommended for an efficient agricultural production.

  16. Online on the mobile: internet use on the smartphone and associated risks among youth in Europe

    DEFF Research Database (Denmark)

    Stald, Gitte Bang; Green, Leila; Barbowski, Monica

    2014-01-01

    1. This report analyses how children aged 9-16 changed their internet use between 2010, when most children used fixed computers and laptops, and 2013, with over one-quarter (c. 28%) of 9-12 year olds, and three-fifths (c. 60%) of 13-16 year olds, accessing the internet via a smartphone. 2. Children...... experience slightly increased risk when accessing the internet via a smartphone or tablet. Historically, such children came from richer, more privileged backgrounds, and spent more time online: all linked with risk exposure. Now that most 13-16 year olds have smartphones, they are no longer an elite. Along...... with extra risk, children with smartphones access the internet more often, engage in a greater range of activities, and have a higher number of skills. 3. The likelihood of children experiencing three or more risks has not changed greatly between 2010 and 2013, except for a rise in the 9-10 age group (from 1...

  17. SU-E-T-335: Transit Dosimetry for Verification of Dose Delivery Using Electronic Portal Imaging Device (EPID)

    Energy Technology Data Exchange (ETDEWEB)

    Baek, T [Korea University, Seoul (Korea, Republic of); National Health Insurance Co.Ilsan Hospital, Ilsan (Korea, Republic of); Chung, E [National Health Insurance Co.Ilsan Hospital, Ilsan (Korea, Republic of); Lee, S [Cheil General Hospital and Women Healthcare Center, Kwandong University, Seoul (Korea, Republic of); Yoon, M [Korea University, Seoul (Korea, Republic of)

    2014-06-01

    Purpose: To evaluate the effectiveness of transit dose, measured with an electronic portal imaging device (EPID), in verifying actual dose delivery to patients. Methods: Plans of 5 patients with lung cancer, who received IMRT treatment, were examined using homogeneous solid water phantom and inhomogeneous anthropomorphic phantom. To simulate error in patient positioning, the anthropomorphic phantom was displaced from 5 mm to 10 mm in the inferior to superior (IS), superior to inferior (SI), left to right (LR), and right to left (RL) directions. The transit dose distribution was measured with EPID and was compared to the planed dose using gamma index. Results: Although the average passing rate based on gamma index (GI) with a 3% dose and a 3 mm distance-to-dose agreement tolerance limit was 94.34 % for the transit dose with homogeneous phantom, it was reduced to 84.63 % for the transit dose with inhomogeneous anthropomorphic phantom. The Result also shows that the setup error of 5mm (10mm) in IS, SI, LR and SI direction can Result in the decrease in values of GI passing rates by 1.3% (3.0%), 2.2% (4.3%), 5.9% (10.9%), and 8.9% (16.3%), respectively. Conclusion: Our feasibility study suggests that the transit dose-based quality assurance may provide information regarding accuracy of dose delivery as well as patient positioning.

  18. High resolution pituitary gland MRI at 7.0 tesla: a clinical evaluation in Cushing's disease

    Energy Technology Data Exchange (ETDEWEB)

    Rotte, Alexandra A.J. de; Groenewegen, Amy; Rutgers, Dik R.; Witkamp, Theo; Luijten, Peter R.; Hendrikse, Jeroen [University Medical Center Utrecht, Department of Radiology, Utrecht (Netherlands); Zelissen, Pierre M.J. [University Medical Center Utrecht, Department of Internal Medicine (Section of Endocrinology), Utrecht (Netherlands); Meijer, F.J.A. [Radboud University Medical Center, Department of Radiology and Nuclear Medicine, Nijmegen (Netherlands); Lindert, Erik J. van [Radboud University Medical Center, Department of Neurosurgery, Nijmegen (Netherlands); Hermus, Ad [Radboud University Medical Center, Department of Internal Medicine (Section of Endocrinology), Nijmegen (Netherlands)

    2016-01-15

    To evaluate the detection of pituitary lesions at 7.0 T compared to 1.5 T MRI in 16 patients with clinically and biochemically proven Cushing's disease. In seven patients, no lesion was detected on the initial 1.5 T MRI, and in nine patients it was uncertain whether there was a lesion. Firstly, two readers assessed both 1.5 T and 7.0 T MRI examinations unpaired in a random order for the presence of lesions. Consensus reading with a third neuroradiologist was used to define final lesions in all MRIs. Secondly, surgical outcome was evaluated. A comparison was made between the lesions visualized with MRI and the lesions found during surgery in 9/16 patients. The interobserver agreement for lesion detection was good at 1.5 T MRI (κ = 0.69) and 7.0 T MRI (κ = 0.62). In five patients, both the 1.5 T and 7.0 T MRI enabled visualization of a lesion on the correct side of the pituitary gland. In three patients, 7.0 T MRI detected a lesion on the correct side of the pituitary gland, while no lesion was visible at 1.5 T MRI. The interobserver agreement of image assessment for 7.0 T MRI in patients with Cushing's disease was good, and lesions were detected more accurately with 7.0 T MRI. (orig.)

  19. Soda-anthraquinone, kraft and organosolv pulping of holm oak trimmings.

    Science.gov (United States)

    Alaejos, J; López, F; Eugenio, M E; Tapias, R

    2006-11-01

    The operating conditions for an organosolv (ethyleneglycol) and two alkaline (soda-anthraquinone and kraft) processes for obtaining cellulose pulp and paper from holm oak (Quercus ilex) wood trimmings were optimized. A range of variation for each process variable (viz. temperature, cooking time and soda or ethyleneglycol concentration) was established and a central composite experimental design involving three independent variables at three different variation levels was applied. The results obtained with the three cooking processes used were compared and those provided by the kraft process were found to be the best. Thus, the tensile index values it provided (5.9-16.3 N m/g) were 23.7% and 41.5% better than those obtained with the soda-AQ and ethyleneglycol processes, respectively. Also, the kraft process provided the best burst index, brightness and kappa number values. Based on the optimum working ranges, the temperature and cooking time were the variables resulting in the most and least marked changes, respectively, in pulp properties.

  20. Descriptive epidemiology of screen and non-screen sedentary time in adolescents: a cross sectional study

    Directory of Open Access Journals (Sweden)

    Ridley Kate

    2010-12-01

    Full Text Available Abstract Background Much attention has been paid to adolescents' screen time, however very few studies have examined non-screen sedentary time (NSST. This study aimed to (1 describe the magnitude and composition of screen sedentary time (SST and NSST in Australian adolescents, (2 describe the socio-demographic correlates of SST and NSST, and (3 determine whether screen time is an adequate surrogate for total sedentary behaviour in this population. Methods 2200 9-16 year old Australians provided detailed use of time data for four days. Non-screen sedentary time (NSST included time spent participating in activities expected to elicit Results Adolescents spent a mean (SD of 345 (105 minutes/day in NSST, which constituted 60% of total sedentary time. School activities contributed 42% of NSST, socialising 19%, self-care (mainly eating 16%, and passive transport 15%. Screen time and NSST showed opposite patterns in relation to key socio-demographic characteristics, including sex, age, weight status, household income, parental education and day type. Because screen time was negatively correlated with NSST (r = -0.58, and exhibited a moderate correlation (r = 0.53 with total sedentary time, screen time was only a moderately effective surrogate for total sedentary time. Conclusions To capture a complete picture of young people's sedentary time, studies should endeavour to measure both screen time and NSST.

  1. Mass loss and chemical structures of wheat and maize straws in response to ultraviolet-B radiation and soil contact.

    Science.gov (United States)

    Zhou, Guixiang; Zhang, Jiabao; Mao, Jingdong; Zhang, Congzhi; Chen, Lin; Xin, Xiuli; Zhao, Bingzi

    2015-10-01

    The role of photodegradation, an abiotic process, has been largely overlooked during straw decomposition in mesic ecosystems. We investigated the mass loss and chemical structures of straw decomposition in response to elevated UV-B radiation with or without soil contact over a 12-month litterbag experiment. Wheat and maize straw samples with and without soil contact were exposed to three radiation levels: a no-sunlight control, ambient solar UV-B, and artificially elevated UV-B radiation. A block control with soil contact was not included. Compared with the no-sunlight control, UV-B radiation increased the mass loss by 14-19% and the ambient radiation by 9-16% for wheat and maize straws without soil contact after 12 months. Elevated UV-B exposure decreased the decomposition rates of both wheat and maize straws when in contact with soil. Light exposure resulted in decreased O-alkyl carbons and increased alkyl carbons for both the wheat and maize straws compared with no-sunlight control. The difference in soil contact may influence the contribution of photodegradation to the overall straw decomposition process. These results indicate that we must take into account the effects of photodegradation when explaining the mechanisms of straw decomposition in mesic ecosystems.

  2. Treatment outcomes of patients co-infected with tuberculosis and HIV at Chiang Mai University Hospital, Thailand.

    Science.gov (United States)

    Limmahakhun, S; Chaiwarith, R; Nuntachit, N; Sirisanthana, T; Supparatpinyo, K

    2012-06-01

    Thailand has been greatly affected by the tuberculosis (TB) and HIV syndemic. This study aimed to determine treatment outcomes among HIV/TB co-infected patients. A retrospective cohort study was conducted at Chiang Mai University Hospital from 1 January 2000 to 31 December 2009. Of 171 patients, 100 patients were male (58.5%) and the mean age was 36.8 ± 8.0 years. Seventy-two patients (42.1%) had pulmonary tuberculosis. Median CD4+ count before TB treatment was 69 cells/mm(3) (interquartile range [IQR] 33, 151). The overall mortality was 3.5% (6 patients). Immune reconstitution inflammatory syndrome (IRIS) occurred in eight patients (6.0%). Disseminated TB infections increased risk of death (odds ratio [OR] = 2.55, 95% confidence interval [CI] 1.25, 5.18) and IRIS (OR = 9.16, 95% CI 1.67, 50.07). Initiating combination antiretroviral therapy (cART) within two months after TB treatment increased risk of IRIS (OR = 6.57, 95% CI 1.61-26.86) and physicians caring for HIV/TB co-infected patients should be aware of this condition.

  3. An interpretation of core and wireline logs for the Petrophysical evaluation of Upper Shallow Marine sandstone reservoirs of the Bredasdorp Basin, offshore South Africa

    Science.gov (United States)

    Magoba, Moses; Opuwari, Mimonitu

    2017-04-01

    This paper embodies a study carried out to assess the Petrophysical evaluation of upper shallow marine sandstone reservoir of 10 selected wells in the Bredasdorp basin, offshore, South Africa. The studied wells were selected randomly across the upper shallow marine formation with the purpose of conducting a regional study to assess the difference in reservoir properties across the formation. The data sets used in this study were geophysical wireline logs, Conventional core analysis and geological well completion report. The physical rock properties, for example, lithology, fluid type, and hydrocarbon bearing zone were qualitatively characterized while different parameters such as volume of clay, porosity, permeability, water saturation ,hydrocarbon saturation, storage and flow capacity were quantitatively estimated. The quantitative results were calibrated with the core data. The upper shallow marine reservoirs were penetrated at different depth ranging from shallow depth of about 2442m to 3715m. The average volume of clay, average effective porosity, average water saturation, hydrocarbon saturation and permeability range from 8.6%- 43%, 9%- 16%, 12%- 68% , 32%- 87.8% and 0.093mD -151.8mD respectively. The estimated rock properties indicate a good reservoir quality. Storage and flow capacity results presented a fair to good distribution of hydrocarbon flow.

  4. A novel PSB-EDI system for high ammonia wastewater treatment, biomass production and nitrogen resource recovery: PSB system.

    Science.gov (United States)

    Wang, Hangyao; Zhou, Qin; Zhang, Guangming; Yan, Guokai; Lu, Haifeng; Sun, Liyan

    A novel process coupling photosynthetic bacteria (PSB) with electrodeionization (EDI) treatment was proposed to treat high ammonia wastewater and recover bio-resources and nitrogen. The first stage (PSB treatment) was used to degrade organic pollutants and accumulate biomass, while the second stage (EDI) was for nitrogen removal and recovery. The first stage was the focus in this study. The results showed that using PSB to transform organic pollutants in wastewater into biomass was practical. PSB could acclimatize to wastewater with a chemical oxygen demand (COD) of 2,300 mg/L and an ammonia nitrogen (NH4(+)-N) concentration of 288-4,600 mg/L. The suitable pH was 6.0-9.0, the average COD removal reached 80%, and the biomass increased by an average of 9.16 times. The wastewater COD removal was independent of the NH4(+)-N concentration. Moreover, the PSB functioned effectively when the inoculum size was only 10 mg/L. The PSB-treated wastewater was then further handled in an EDI system. More than 90% of the NH4(+)-N was removed from the wastewater and condensed in the concentrate, which could be used to produce nitrogen fertilizer. In the whole system, the average NH4(+)-N removal was 94%, and the average NH4(+)-N condensing ratio was 10.0.

  5. Plasma 25-Hydroxyvitamin D and Risk of Non-Melanoma and Melanoma Skin Cancer

    DEFF Research Database (Denmark)

    Afzal, Shoaib; Nordestgaard, Børge G; Bojesen, Stig E

    2013-01-01

    Sun exposure is a major risk factor for skin cancer and is also an important source of vitamin D. We tested the hypothesis that elevated plasma 25-hydroxyvitamin D (25-OH-vitD) associates with increased risk of non-melanoma and melanoma skin cancer in the general population. We measured plasma 25......-OH-vitD in 10,060 white individuals from the Danish general population. During 28 years of follow-up, 590 individuals developed non-melanoma skin cancer and 78 developed melanoma skin cancer. Increasing 25-OH-vitD levels, by clinical categories or by seasonally adjusted tertiles, were associated...... with increasing cumulative incidence of non-melanoma skin cancer (trend P=2 × 10(-15) and P=3 × 10(-17)) and melanoma skin cancer (P=0.003 and P=0.001). Multivariable adjusted hazard ratios of non-melanoma skin cancer were 5.04 (95% confidence interval (CI): 2.78-9.16) for 25-OH-vitD 50 vs. 60 years, 25-OH...

  6. On the complexity of a combined homotopy interior method for convex programming

    Science.gov (United States)

    Yu, Bo; Xu, Qing; Feng, Guochen

    2007-03-01

    In [G.C. Feng, Z.H. Lin, B. Yu, Existence of an interior pathway to a Karush-Kuhn-Tucker point of a nonconvex programming problem, Nonlinear Anal. 32 (1998) 761-768; G.C. Feng, B. Yu, Combined homotopy interior point method for nonlinear programming problems, in: H. Fujita, M. Yamaguti (Eds.), Advances in Numerical Mathematics, Proceedings of the Second Japan-China Seminar on Numerical Mathematics, Lecture Notes in Numerical and Applied Analysis, vol. 14, Kinokuniya, Tokyo, 1995, pp. 9-16; Z.H. Lin, B. Yu, G.C. Feng, A combined homotopy interior point method for convex programming problem, Appl. Math. Comput. 84 (1997) 193-211.], a combined homotopy was constructed for solving non-convex programming and convex programming with weaker conditions, without assuming the logarithmic barrier function to be strictly convex and the solution set to be bounded. It was proven that a smooth interior path from an interior point of the feasible set to a K-K-T point of the problem exists. This shows that combined homotopy interior point methods can solve the problem that commonly used interior point methods cannot solveE However, so far, there is no result on its complexity, even for linear programming. The main difficulty is that the objective function is not monotonically decreasing on the combined homotopy path. In this paper, by taking a piecewise technique, under commonly used conditions, polynomiality of a combined homotopy interior point method is given for convex nonlinear programming.

  7. The clinical role of "1"8F-FDG PET/CT in diagnosis of the peritoneal carcinomatosis

    International Nuclear Information System (INIS)

    Wang Xiaoyan; Zhang Xiangsong; Chen Zhifeng; Li Ziping; Li Fang; Rao Guohui; Shi Xinchong; Hu Ping

    2010-01-01

    Objective: To evaluate the clinical role of "1"8F-fluorodeoxyglucose (FDG) PET/CT in diagnosis of the peritoneal carcinomatosis. Methods: The "1"8F-FDG PET/CT scan was performed in 22 patients. All had documented malignancy and had ascites. Histopathology. or clinical follow-up was 'gold standard' for diagnostic accuracy in PET/CT scan. Results: Of these 22 patients, 18 had positive "1"8F- FDG PET/CT findings. Sixteen were peritoneal carcinomatosis and 2 were peritoneal tuberculosis. Four patients had negative "1"8F-FDG PET/CT findings. Three were peritonitis and 1 was peritoneal carcinomatosis. The sensitivity, specificity, positive predictive value, negative predictive value, and accuracy of "1"8F-FDG PET/CT in diagnosing peritoneal carcinomatosis were 94.1% (16/17), 3/5, 88.9% (16/18), 3/4, and 86.4% (19/22). Conclusions: "1"8F-FDG PET/CT had high sensitivity in detecting peritoneal carcinomatosis. The most common false positive for "1"8F-FDG PET/CT in ascites was peritoneal tuberculosis. (authors)

  8. Effects of Diets Enriched in Omega-9 or Omega-6 Fatty Acids on Reproductive Process

    Directory of Open Access Journals (Sweden)

    Seyedeh Neda Mousavi

    2016-08-01

    Full Text Available Objective: Maternal type and amounts of dietary fatty acids affect on reproductive process in the mice. The present study investigated the effects of maternal supplementation with different amounts of omega-6 or omega-9 during pregnancy on the number of offspring, sex-ratio and duration of gestation.Materials and methods: Eight-week-old female C57BL/6 mice were randomly assigned into four dietary groups including low omega-6 (16%; LO6, low omega-9 (16%; LO9, high omega-6 (45%; HO6 and high omega-9 (45%; HO9 during gestation. Number of offspring, sex-ratio and duration of pregnancy were compared among four dietary groups.Results: There was significant difference between LO6 and HO6 (p < 0.0001, LO9 and HO9 (p < 0.0001 groups in total number of pups. The number of female and male offspring were significantly different between LO6 and LO9 (p = 0.009 and p = 0.001, respectively, LO9 and HO9 (p = 0.01 and p = 0.025 groups. Duration of pregnancy was significantly higher in low fat diet than high fat diet groups (< 0.001.Conclusion: High fat diet reduced number of pups, gestation duration and lead to early labor. Omega-9 fatty acids shifted sex of offspring to females.

  9. The Academic Book of the Future

    Directory of Open Access Journals (Sweden)

    Marilyn Deegan

    2015-11-01

    Full Text Available The Academic Book of the Future is a research project funded by the Arts and Humanities Research Council (AHRC in collaboration with The British Library (BL and is concerned with how scholarly work in the arts and humanities will be produced, read and preserved in coming years. The project is run by a team from University College London (UCL and King’s College London (King’s, with support from the Research Information Network (RIN. The project has built a Community Coalition of more than 100 organizations and individuals.  The project and the Coalition are holding a whole range of events and carrying out research projects on a variety of relevant topics. The key event for 2015 is Academic Book Week, 9-16 November 2015, which has been taken up enthusiastically by the Publishers Association (PA and the Booksellers Association (BA, as well as the Association of Learned and Professional Society Publishers (ALPSP, and was launched in July 2015 with a large announcement in 'The Bookseller. 'Events celebrating the diversity, innovation and influence of academic books will be held across the UK, with participation from institutions elsewhere in Europe and also in the USA, Canada, Japan and Australia.

  10. Electronic control of different generation regimes in mode-locked all-fibre F8 laser

    Science.gov (United States)

    Kobtsev, Sergey; Ivanenko, Aleksey; Kokhanovskiy, Alexey; Smirnov, Sergey

    2018-04-01

    We demonstrate for the first time an electronically controlled realisation of markedly different generation regimes in a mode-locked all-fibre figure-eight (F8) Yb-doped laser. Electronic adjustment of the ratio of pumping powers of two amplification stages in a nonlinear amplifying loop mirror enables the establishment of stable pulse generation regimes with different degrees of coherence and control over their parameters within relatively broad limits, with the pulse duration range exceeding a factor of two in the picosecond domain for coherent and incoherent pulses, the energy range exceeding an order of magnitude for incoherent pulses (2.2-24.8 nJ) and over a factor of 8 for coherent pulses (1.9-16.2 nJ). Adjustment of the pumping powers allows one to maintain the duration of the coherent pulses and to set their peak power in the range of 32.5-292.5 W. The proposed configuration of electronic control over the radiation parameters of a mode-locked all-fibre F8 laser enables reproducible generation of pulses of different types with specified parameters within a broad range of values.

  11. Subsurface Endospore-Forming Bacteria Possess Bio-Sealant Properties.

    Science.gov (United States)

    Basha, Sreenivasulu; Lingamgunta, Lakshman Kumar; Kannali, Jayakumar; Gajula, Swarna Kumari; Bandikari, Ramesh; Dasari, Sreenivasulu; Dalavai, Veena; Chinthala, Paramageetham; Gundala, Prasada Babu; Kutagolla, Peera; Balaji, Vinodh Kumar

    2018-04-24

    Concrete is a strong and fairly inexpensive building substance, but has several disadvantages like cracking that allows corrosion, thus reducing its lifespan. To mitigate these complications, long-lasting microbial self-healing cement is an alternative that is eco-friendly and also actively repairs cracks. The present paper describes the detailed experimental investigation on compressive strength of cement mortars, mixed with six alkaliphilic bacteria, isolated from subsurface mica mines of high alkalinity. The experiments showed that the addition of alkaliphilic isolates at different cell concentrations (10 4 and 10 6 cells/ml) enhanced the compressive strength of cement mortar, because the rapid growth of bacteria at high alkalinity precipitates calcite crystals that lead to filling of pores and densifying the concrete mix. Thus, Bacillus subtilis (SVUNM4) showed the highest compressive strength (28.61%) of cement mortar at 10 4 cells/ml compared to those of other five alkaliphilic isolates (Brevibacillus sp., SVUNM15-22.1%; P. dendritiformis, SVUNM11-19.9%; B. methylotrophicus, SVUNM9-16%; B. licheniformis, SVUNM14-12.7% and S. maltophilia, SVUNM13-9.6%) and controlled cement mortar as well. This method resulted in the filling of cracks in concrete with calcite (CaCO 3 ), which was observed by scanning electron microscopy (SEM). Our results showed that the alkaliphilic bacterial isolates used in the study are effective in self-healing and repair of concrete cracks.

  12. Evaluation of the comparative growth and reproductive performance of West African dwarf goats in the western highlands of Cameroon[(AFRA - African Regional Co-operative Agreement for Research, Development and Training related to Nuclear Science and Technology)

    Energy Technology Data Exchange (ETDEWEB)

    Tedonkeng Pamo, E; Tendonkeng, F; Kadjio, J T.T.; Kwami, H N; Taboum, R K; Kana, J R; Tegodjeu, A [University of Dschang, FASA, Department of Animal Sciences, Dschang (Cameroon)

    2002-06-01

    On-farm and on-station evaluations of the comparative growth performance of West African Dwarf Goats supplemented at an iso-nitrogenous level (6 g/animal/day) with leguminous browse Calliandra calothyrsus, Leucaena leucocephala, or Gliricidia sepium, or with cotton seed cake, were conducted around Dschang in the Western Highlands of Cameroon and at the University Experimental Farm. The animals were weighed every 21 days during the rainy season and every 14 days during the dry season for three months to evaluate their response to supplementation. Cotton seed cake, L. leucocephala, C. calothyrsus were the most accepted supplements. The weight gain of the animals fed with these supplements was significantly higher compared to that of the control animals. Mean weight of animals supplemented with G. sepium was not significantly different (P>0.05) from that of the control group during the rainy season. The average daily weight gains during the rainy period were 20.6, 19.1, 13.8, 4.5, and 3.1 g for L. leucocephala, cotton seed cake, C. calothyrsus, G. sepium and the control animals respectively, during the rainy season and 19.9, 16.1 and 1.7 g for cotton seed cake, L. leucocephala and the control animal respectively, during the dry season. Progesterone profiles were low and were unaffected by supplementation during the dry season. (author)

  13. Evaluation of the comparative growth and reproductive performance of West African dwarf goats in the western highlands of Cameroon

    International Nuclear Information System (INIS)

    Tedonkeng Pamo, E.; Tendonkeng, F.; Kadjio, J.T.T.; Kwami, H.N.; Taboum, R.K.; Kana, J.R.; Tegodjeu, A.

    2002-01-01

    On-farm and on-station evaluations of the comparative growth performance of West African Dwarf Goats supplemented at an iso-nitrogenous level (6 g/animal/day) with leguminous browse Calliandra calothyrsus, Leucaena leucocephala, or Gliricidia sepium, or with cotton seed cake, were conducted around Dschang in the Western Highlands of Cameroon and at the University Experimental Farm. The animals were weighed every 21 days during the rainy season and every 14 days during the dry season for three months to evaluate their response to supplementation. Cotton seed cake, L. leucocephala, C. calothyrsus were the most accepted supplements. The weight gain of the animals fed with these supplements was significantly higher compared to that of the control animals. Mean weight of animals supplemented with G. sepium was not significantly different (P>0.05) from that of the control group during the rainy season. The average daily weight gains during the rainy period were 20.6, 19.1, 13.8, 4.5, and 3.1 g for L. leucocephala, cotton seed cake, C. calothyrsus, G. sepium and the control animals respectively, during the rainy season and 19.9, 16.1 and 1.7 g for cotton seed cake, L. leucocephala and the control animal respectively, during the dry season. Progesterone profiles were low and were unaffected by supplementation during the dry season. (author)

  14. Assessment of the quality of medication information for patients in Spain.

    Science.gov (United States)

    Mira, José Joaquín; Lorenzo, Susana; Pérez-Jover, Virtudes; Navarro, Isabel; Martín de Rosales, Ana María; Lara, Catalina

    2013-01-01

    To analyze the extent to which Spanish leaflets and drug information on the Net met quality criteria. A descriptive study was conducted comparing readability (REA) and comprehensibility (COM) criteria of a random sample of 77 marketed products of the 12 active ingredients most frequently sold in 2010 in Spain. Leaflets were approved by the Spanish Agency for Medication (AEMPS). Flesch index, DISCERN, ELF, MIDAS and CIRF scales were used to evaluate quality criteria. COM assessment yielded between 63 and 77% of the maximum possible scores on the scales. None of the websites or leaflets met all the quality criteria of the DISCERN, CIRF or MIDAS scales. Four (3%) leaflets met all the 22 quality criteria of ELF. The leaflets showed shortcomings regarding: medication benefits (17 required substantial improvements, 31.5%), correct forms of storage (13, 24.1%), contraindications (12, 22.2%), side effects (11, 20.4%) and precautions to be taken (9, 16.7%). The quality of the information approved by the AEMPS is superior to that which can be found by surfing the Net. More specific information on precautions, complications and how to avoid common patient errors would allow patients the best chance to contribute to their own clinical safety.

  15. Biocompatible high performance hyperbranched epoxy/clay nanocomposite as an implantable material.

    Science.gov (United States)

    Barua, Shaswat; Dutta, Nipu; Karmakar, Sanjeev; Chattopadhyay, Pronobesh; Aidew, Lipika; Buragohain, Alak K; Karak, Niranjan

    2014-04-01

    Polymeric biomaterials are in extensive use in the domain of tissue engineering and regenerative medicine. High performance hyperbranched epoxy is projected here as a potential biomaterial for tissue regeneration. Thermosetting hyperbranched epoxy nanocomposites were prepared with Homalomena aromatica rhizome oil-modified bentonite as well as organically modified montmorillonite clay. Fourier transformed infrared spectroscopy, x-ray diffraction and scanning and transmission electron microscopic techniques confirmed the strong interfacial interaction of clay layers with the epoxy matrix. The poly(amido amine)-cured thermosetting nanocomposites exhibited high mechanical properties like impact resistance (>100 cm), scratch hardness (>10 kg), tensile strength (48-58 MPa) and elongation at break (11.9-16.6%). Cytocompatibility of the thermosets was found to be excellent as evident by MTT and red blood cell hemolytic assays. The nanocomposites exhibited antimicrobial activity against Staphylococcus aureus (ATCC 11632), Escherichia coli (ATCC 10536), Mycobacterium smegmatis (ATCC14468) and Candida albicans (ATCC 10231) strains. In vivo biocompatibility of the best performing nanocomposite was ascertained by histopathological study of the brain, heart, liver and skin after subcutaneous implantation in Wistar rats. The material supported the proliferation of dermatocytes without induction of any sign of toxicity to the above organs. The adherence and proliferation of cells endorse the nanocomposite as a non-toxic biomaterial for tissue regeneration.

  16. Preliminary study of interventional treatment for tubal pregnancy

    International Nuclear Information System (INIS)

    Tang Yukuan; Chen Hanwei; Li Kaifang; Jiang Zaibo; Ma Zhuang; Liu Huanling

    2000-01-01

    Objective: To study the clinical value and methods of interventional treatment for tubal pregnancy. Methods: Two different methods were used in the interventional treatment of 18 patients with tubal pregnancy, which were transvaginal tubal intra-gestational methotrexate (MTX) injection and intra-utero-arterial MTX infusion. The former was selected for the treatment of 8 patients and the latter for 10 patients. Cook-fallopian tube catheterization set and the general angiographic catheters of 4.1 Fr Cobra were used. After the treatment, conditions of the patients, β-HCG level and ultrasound changes of the pregnant bladder were the main indexes for monitoring the therapeutic effect in this study. Results: The successful rate, cure rate, embryo killing rate reached 100%, 88.9%(16/18) and 94.4% (17/18) respectively. Two cases of intra-utero-arterial MTX infusion treatment failed, β-HCG was reduced to normal level with an average of 11.2 +- 11.6 d (3-28 d). In 10 cases, the ultrasound showed that the pregnancy bladder disappeared in 2-3 weeks, accounting for 76.9% (10/13). The longest time was 60 days. The range of menstruation recovery was 37 +- 9 d (21-50 d). Conclusions: Interventional treatment of tubal pregnancy is effective, reliable and easy for operation. It will be especially effective by arterial procedure. Interventional treatment will be a important method for terminating tubal pregnancy

  17. Transcutaneous electrical nerve stimulation reduces acute low back pain during emergency transport.

    Science.gov (United States)

    Bertalanffy, Alexander; Kober, Alexander; Bertalanffy, Petra; Gustorff, Burkhard; Gore, Odette; Adel, Sharam; Hoerauf, Klaus

    2005-07-01

    Patients with acute low back pain may require emergency transport because of pain and immobilization. Transcutaneous electrical nerve stimulation (TENS) is a nonpharmaceutical therapy for patients with low back pain. To evaluate the efficacy of paramedic-administered TENS in patients with acute low back pain during emergency transport. This was a prospective, randomized study involving 74 patients transported to hospital. The patients were randomly assigned to two groups: group 1 (n = 36) was treated with true TENS, while group 2 (n = 36) was treated with sham TENS. The authors recorded pain and anxiety as the main outcome variables using a visual analog scale (VAS). The authors recorded a significant (p pain reduction (mean +/- standard deviation) during transport in group 1 (79.2 +/- 6.5 mm VAS to 48.9 +/- 8.2 mm VAS), whereas pain scores remained unchanged in group 2 (75.9 +/- 16.4 mm VAS and 77.1 +/- 11.2 mm VAS). Similarly, the scores for anxiety were significantly reduced (p TENS was found to be effective and rapid in reducing pain during emergency transport of patients with acute low back pain and should be considered due to its ease of use and lack of side effects in the study population.

  18. Novel method of determination of D9-tetrahydrocannabinol(THC) in human serum by high-performance liquid chromatography with electrochemical detection.

    Science.gov (United States)

    Kokubun, Hideya; Uezono, Yasuhito; Matoba, Motohiro

    2014-04-01

    In Europe and the United States, D9-tetrahydrocannabinol(THC, dronabinol), one of the psychoactive constituents of cannabis, has been used for both its anti-emetic and orexigenic effects in cancer patient receiving chemotherapy.However, dronabinol has not yet been launched in the market in Japan.In the future, it is necessary to ascertain the pharmacokinetics of dronabinol in cancer paitient.Therefore, we developed an HPLC procedure using electrochemical detection(ECD)for quan- titation of the concentrations of dronabinol in blood.An eluent of 50mM KH2PO4/CH3CN(9:16)was used as the mobile phase.The column was used the XTerra®RP18, and the voltage of the electrochemical detector in dronabinol was set at 400 mV.As a result, the calibration curve was linear in the range of 10 ng/mL to 100 ng/mL(y=964.85x -3,419, r=0.997).The lower limit of quantification was 0.5 ng/mL(S/N=3).The relative within-runs and between-runs standard deviations for the assay dronabinol were less than 4.7%. The method reported here is superior to previously reported methods in cancer patient.

  19. The entity-to-algorithm allocation problem: Extending the analysis

    CSIR Research Space (South Africa)

    Grobler, J

    2014-12-01

    Full Text Available . HYPOTHESES ANALYSIS OF ALTERNATIVE MULTI-METHOD ALGORITHMS. HMHH EIHH EEA-SLPS HMHH NA 4− 19− 5 11− 8− 9 EIHH 5− 19− 4 NA 6− 16− 6 EEA-SLPS 9− 8− 11 6− 16− 6 NA Multi-EA 3− 4− 21 3− 1− 24 2− 3− 23 Multi-EA TOTAL HMHH 21− 4− 3 36− 3− 17 EIHH 24− 1− 3 35− 36... ANALYSIS OF THE VARIOUS ALGORITHMS VERSUS THEIR CONSTITUENT ALGORITHMS. Algorithm HMHH EIHH EEA-SLPS Multi-EA CMAES 0-3-25 4-2-22 4-2-22 2-2-24 SaNSDE 17-2-9 16-8-4 12-12-4 5-0-23 GA 22-3-3 23-2-3 23-4-1 4-5-19 GCPSO 20-1-7 20-3-5 19-3-6 8-3-17 TOTAL 55...

  20. Comparison of the effects of 665 nm low level diode Laser Hat versus and a combination of 665 nm and 808nm low level diode Laser Scanner of hair growth in androgenic alopecia.

    Science.gov (United States)

    Barikbin, Behrooz; Khodamrdi, Zeinab; Kholoosi, Leila; Akhgri, Mohammad Reza; Haj Abbasi, Majid; Hajabbasi, Mojgan; Razzaghi, Zahra; Akbarpour, Samaneh

    2017-05-17

    This study aimed to evaluate the effectiveness of a combined set of low level diode laser scanner (665 nm and 808nm) on hair growth, and assessment of safety and effectiveness of a new laser scanner on hair growth treatment procedure in androgenic alopecia. 90 patients (18 to 70 years) with androgenic alopecia were randomized into three groups. The first group (n=30) received 655 nm red light using laser hat, the second group (n=30) received 655 nm red laser plus 808 nm infrared laser using a laser scanner of hair growth device (with the patent number: 77733) and the third group (n=30) received no laser as the control group. Patients in laser scanner group had better results and showed a higher increase in terminal hair density compared with laser hat group (mean of 9.61 versus 9.16 per cm 2 ). We found significant decrease in terminal hair density from baseline in control group (mean -1.8 per cm 2 , plaser scanner of the hair growth group compared with laser hat and the control group. The study showed that treatment with new laser devise had a promising result without any observable adverse effects.

  1. Analysis of risk factor and clinical characteristics of angiodysplasia presenting as upper gastrointestinal bleeding.

    Science.gov (United States)

    Kim, Dae Bum; Chung, Woo Chul; Lee, Seok Jong; Sung, Hea Jung; Woo, Seokyung; Kim, Hyo Suk; Jeong, Yeon Oh; Lee, Hyewon; Kim, Yeon-Ji

    2016-07-01

    Angiodysplasia is important in the differential diagnosis of upper gastrointestinal bleeding (UGIB), but the clinical features and outcomes associated with UGIB from angiodysplasia have not been characterized. We aimed to analyze the clinical characteristics and outcomes of angiodysplasia presented as UGIB. Between January 2004 and December 2013, a consecutive series of patients admitted with UGIB were retrospectively analyzed. Thirty-five patients with bleeding from angiodysplasia were enrolled. We compared them with an asymptomatic control group (incidental finding of angiodysplasia in health screening, n = 58) and bleeding control group (simultaneous finding of angiodysplasia and peptic ulcer bleeding, n = 28). When patients with UGIB from angiodysplasia were compared with the asymptomatic control group, more frequent rates of nonantral location and large sized lesion (≥ 1 cm) were evident in multivariate analysis. When these patients were compared with the bleeding control group, they were older (mean age: 67.94 ± 9.16 years vs.55.07 ± 13.29 years, p = 0.03) and received less transfusions (p = 0.03). They also had more frequent rate of recurrence (40.0% vs. 20.7%, p = 0.02). Non-antral location and large lesions (≥ 1 cm) could be risk factors of UGIB of angiodysplasia. UGIB due to angiodysplasia was more common in older patients. Transfusion requirement would be less and a tendency of clinical recurrence might be apparent.

  2. Discovery of ectosymbiotic Endomicrobium lineages associated with protists in the gut of stolotermitid termites.

    Science.gov (United States)

    Izawa, Kazuki; Kuwahara, Hirokazu; Sugaya, Kaito; Lo, Nathan; Ohkuma, Moriya; Hongoh, Yuichi

    2017-08-01

    The genus Endomicrobium is a dominant bacterial group in the gut of lower termites, and most phylotypes are intracellular symbionts of gut protists. Here we report the discovery of Endomicrobium ectosymbionts of termite gut protists. We found that bristle-like Endomicrobium cells attached to the surface of spirotrichosomid protist cells inhabiting the termite Stolotermes victoriensis. Transmission electron microscopy revealed that a putative Endomicrobium cell likely attached to the protist surface via a protrusion from the tip of the bacterium. A phylotype, sharing 98.9% 16S rRNA sequence identity with the Endomicrobium ectosymbionts of the spirotrichosomid protists, was also found on the cell surface of the protist Trichonympha magna in the gut of the termite Porotermes adamsoni. We propose the novel species 'Candidatus Endomicrobium superficiale' for these bacteria. T. magna simultaneously harboured another Endomicrobium ectosymbiont that shared 93.5-94.2% 16S rRNA sequence identities with 'Ca. Endomicrobium superficiale'. Furthermore, Spirotrichonympha-like protists in P. adamsoni guts were associated with an Endomicrobium phylotype that possibly attached to the host flagella. A phylogenetic analysis suggested that these ectosymbiotic lineages have evolved multiple times from free-living Endomicrobium lineages and are relatively distant from the endosymbionts. Our results provide novel insights into the ecology and evolution of the Endomicrobium. © 2017 Society for Applied Microbiology and John Wiley & Sons Ltd.

  3. High resolution pituitary gland MRI at 7.0 tesla: a clinical evaluation in Cushing's disease

    International Nuclear Information System (INIS)

    Rotte, Alexandra A.J. de; Groenewegen, Amy; Rutgers, Dik R.; Witkamp, Theo; Luijten, Peter R.; Hendrikse, Jeroen; Zelissen, Pierre M.J.; Meijer, F.J.A.; Lindert, Erik J. van; Hermus, Ad

    2016-01-01

    To evaluate the detection of pituitary lesions at 7.0 T compared to 1.5 T MRI in 16 patients with clinically and biochemically proven Cushing's disease. In seven patients, no lesion was detected on the initial 1.5 T MRI, and in nine patients it was uncertain whether there was a lesion. Firstly, two readers assessed both 1.5 T and 7.0 T MRI examinations unpaired in a random order for the presence of lesions. Consensus reading with a third neuroradiologist was used to define final lesions in all MRIs. Secondly, surgical outcome was evaluated. A comparison was made between the lesions visualized with MRI and the lesions found during surgery in 9/16 patients. The interobserver agreement for lesion detection was good at 1.5 T MRI (κ = 0.69) and 7.0 T MRI (κ = 0.62). In five patients, both the 1.5 T and 7.0 T MRI enabled visualization of a lesion on the correct side of the pituitary gland. In three patients, 7.0 T MRI detected a lesion on the correct side of the pituitary gland, while no lesion was visible at 1.5 T MRI. The interobserver agreement of image assessment for 7.0 T MRI in patients with Cushing's disease was good, and lesions were detected more accurately with 7.0 T MRI. (orig.)

  4. The efficiency of sonography in diagnosing volvulus in neonates with suspected intestinal malrotation.

    Science.gov (United States)

    Zhang, Wenhua; Sun, Hongjun; Luo, Fangqiong

    2017-10-01

    This study is to prospectively evaluate the efficiency of sonography for volvulus diagnosis in neonates with clinically suspected intestinal malrotation.A total of 83 patients with suspected intestinal malrotation who underwent detailed abdominal sonography and upper gastrointestinal contrast study were included. Malrotation was characterized by inversion of the superior mesenteric artery (SMA) and superior mesenteric vein (SMV) in sonographic examination. The "whirlpool sign" of Color Doppler Sonography was recognized as a characteristic for malrotation with volvulus. The degrees of rotation of the SMV winding around SMA were also detected by sonography. Surgery was performed in patients with sonography diagnosed malrotation.A total of 39 patients were sonographically diagnosed as malrotation which was subsequently confirmed by surgery. The sensitivity and positive predictive value of the sonographic diagnosis were both 100% (39/39). The sensitivity, specificity and accuracy of "whirlpool sign" for the detection of midgut volvulus were 95.2% (20/21), 88.9% (16/18), and 92.3% (36/39), respectively. Greater degrees of rotation (equal or greater than 720°) showed higher risk (odds ratio, 5.0; P volvulus may be used as a potential indicator for intestinal necrosis. In addition, sonography can exclude malrotation and may help the diagnosis of other diseases, such as annular pancreas and duodenal atresia.

  5. Increasing Risk of Disturbed Root Development in Permanent Teeth in Childhood Cancer Survivors Undergoing Cancer Treatment at Older Age.

    Science.gov (United States)

    Tanaka, Miyuki; Kamata, Takahiro; Yanagisawa, Ryu; Morita, Daisuke; Saito, Shoji; Sakashita, Kazuo; Shiohara, Masaaki; Kurita, Hiroshi; Koike, Kenichi; Nakazawa, Yozo

    2017-04-01

    Structural anomalies of teeth are observed at high rates in childhood cancer survivors (CCS). Several therapeutic exposures have been shown to be associated with dental developmental disturbances. This study was conducted to analyze the risk factors for dental developmental abnormality (DDA) and investigate the association between age at the time of cancer treatment and DDA in CCS. Fifty-six CCS were enrolled. Orthopantomography and dental examination were performed in all the patients. We evaluated the prevalence of DDA and analyzed the risk factors for each type of DDA. DDAs were observed in 46.4% of CCS, including hypodontia in 9 (16.1%), abnormal roots in nine (16.1%), enamel defects/hypoplasia in 6 (10.7%), and microdontia in 12 (21.4%) patients. The number of patients with abnormal roots was significantly higher in the group treated with stem cell transplantation or at an age older than 4 years. We observed that the formation period of abnormal teeth coincided with the treatment period in the majority of CCS with DDA. Particularly regarding the root abnormality, treatment at elder age may be a risk factor for root developmental disturbances. Risk evaluation, appropriate follow-up, and early detection of dental issues are required for all CCS.

  6. RAPD analysis of the genetic diversity of mango (Mangifera indica) germplasm in Brazil.

    Science.gov (United States)

    Souza, I G B; Valente, S E S; Britto, F B; de Souza, V A B; Lima, P S C

    2011-12-14

    We evaluated genetic variability of mango (Mangifera indica) accessions maintained in the Active Germplasm Bank of Embrapa Meio-Norte in Teresina, Piauí, Brazil, using RAPDs. Among these accessions, 35 originated from plantings in Brazil, six from the USA and one from India. Genomic DNA, extracted from leaf material using a commercial purification kit, was subjected to PCR with the primers A01, A09, G03, G10, N05, and M16. Fifty-five polymorphic loci were identified, with mean of 9.16 ± 3.31 bands per primer and 100% polymorphism. Application of unweighted pair group method using arithmetic average cluster analysis demonstrated five genotypic groups among the accessions examined. The genotypes Rosa 41, Rosa 48 and Rosa 49 were highly similar (94% similarity), whereas genotypes Sensation and Rosa 18 were the most divergent (only 7% similarity). The mango accessions were found to have considerable genetic variability, demonstrating the importance of analyzing each genotype in a collection in order to efficiently maintain the germplasm collection.

  7. Neurogenic bowel dysfunction (NBD) translation and linguistic validation to classical Arabic.

    Science.gov (United States)

    Mallek, A; Elleuch, M H; Ghroubi, S

    2016-09-01

    To translate and linguistically validate in classical Arabic; the French version of the neurogenic bowel dysfunction (NBD). Arabic translation of the NBD score was obtained by the "forward translation/backword translation" method. Patients with multiple sclerosis (MS) and spinal cord injury were included. Evaluation of intestinal and anorectal disorders was conducted by the self-administered questionnaire NBD, which was filled twice two weeks apart. An item-by-item analysis was made. The feasibility, acceptability, internal consistency using Cronbach's alpha, and test-retest repeatability by non-parametric Spearman correlation were studied. Twenty-three patients with colorectal disorders secondary to neurological disease were included, the average age was 40.79±9.16years and the sex-ratio was 1.85. The questionnaire was feasible and acceptable, no items were excluded. The spearman correlation was of 0.842. Internal consistency was judged good through the Cronbach's alpha was of 0.896. The Arabic version of NBD was reproducible and construct validity was satisfactory. The study of its responsiveness to change with a larger number of patients will be the subject of further work. 4. Copyright © 2016 Elsevier Masson SAS. All rights reserved.

  8. The Influence of Team Functioning and Workload on Sustainability of Trauma-Focused Evidence-Based Psychotherapies.

    Science.gov (United States)

    Mohr, David C; Rosen, Craig S; Schnurr, Paula P; Orazem, Robert J; Noorbaloochi, Siamak; Clothier, Barbara A; Eftekhari, Afsoon; Bernardy, Nancy C; Chard, Kathleen M; Crowley, Jill J; Cook, Joan M; Kehle-Forbes, Shannon M; Ruzek, Josef I; Sayer, Nina A

    2018-05-25

    It has been over a decade since the U.S. Department of Veterans Affairs (VA) began formal dissemination and implementation of two trauma-focused evidence-based psychotherapies (TF-EBPs). The objective of this study was to examine the sustainability of the TF-EBPs and determine whether team functioning and workload were associated with TF-EBP sustainability. This observational study used VA administrative data for 6,251 patients with posttraumatic stress disorder (PTSD) and surveys from 78 providers from 10 purposefully selected PTSD clinical teams located in nine VA medical centers. The outcome was sustainability of TF-EBPs, which was based on British National Health System Sustainability Index scores (possible scores range from 0 to 100.90). Primary predictors included team functioning, workload, and TB-EBP reach to patients with PTSD. Multiple linear regression models were used to examine the influence of team functioning and workload on TF-EBP sustainability after adjustment for covariates that were significantly associated with sustainability. Sustainability Index scores ranged from 53.15 to 100.90 across the 10 teams. Regression models showed that after adjustment for patient and facility characteristics, team functioning was positively associated (B=9.16, psustainability. There was considerable variation across teams in TF-EBP sustainability. The contribution of team functioning and workload to the sustainability of evidence-based mental health care warrants further study.

  9. Effect of Non-fullerene Acceptors' Side Chains on the Morphology and Photovoltaic Performance of Organic Solar Cells.

    Science.gov (United States)

    Zhang, Cai'e; Feng, Shiyu; Liu, Yahui; Hou, Ran; Zhang, Zhe; Xu, Xinjun; Wu, Youzhi; Bo, Zhishan

    2017-10-04

    Three indacenodithieno[3,2-b]thiophene (IT) cored small molecular acceptors (ITIC-SC6, ITIC-SC8, and ITIC-SC2C6) were synthesized, and the influence of side chains on their performances in solar cells was systematically probed. Our investigations have demonstrated the variation of side chains greatly affects the charge dissociation, charge mobility, and morphology of the donor:acceptor blend films. ITIC-SC2C6 with four branched side chains showed improved solubility, which can ensure the polymer donor to form favorable fibrous nanostructure during the drying of the blend film. Consequently, devices based on PBDB-ST:ITIC-SC2C6 demonstrated higher charge mobility, more effective exciton dissociation, and the optimal power conversion efficiency up to 9.16% with an FF of 0.63, a J sc of 15.81 mA cm -2 , and a V oc of 0.92 V. These results reveal that the side chain engineering is a valid way of tuning the morphology of blend films and further improving PCE in polymer solar cells.

  10. [Features of Bordetella pertussis, Bordetella spp. infection and whopping cough in Córdoba province, Argentina].

    Science.gov (United States)

    Giayetto, Víctor O; Blanco, Sebastián; Mangeaud, Arnaldo; Barbás, María G; Cudolá, Analía; Gallego, Sandra V

    2017-04-01

    Whooping cough is a re-emerging infection in the world and Latin America. It was considered relevant to investigate the clinical and epidemiological profile of Bordetella spp. and Bordetella pertussis infection in Córdoba province, Argentina; evaluating, at the same time, the co-infection with virus producing respiratory infections that may be confused with whooping cough. All whooping cough suspected cases were studied by Polimerase Chain Reaction, amplifying the repeated insertion sequence (IS) 481 and the promoter gene encoding pertussis toxin, between 2011 and 2013. The data were obtained from the clinical and epidemiological records. From 2,588 whooping cough suspected cases, 11.59% was infected by Bordetella spp. and 9.16% was confirmed as Bordetella pertussis infection. The rate of infection was 7.22 and 1.84 per 100,000 for 2011 and 2012, respectively. The infection presented a seasonal tendency and it was mainly found on the group of children between 13 and 24 months old. The co-infection with virus producing respiratory infections, were uncommon. Paroxysmal cough, cyanosis and/or vomiting were predictors of the infection for Bordetella pertussis. To deal with the re-emergence of whooping cough is important the knowledge of the regional epidemiological situation. This paper shows the situation of these infections in the regional clinical and epidemiological context, and makes the information available for health decision-making.

  11. Prediction of single versus multivessel disease following myocardial infarction using 201-thallium scintigraphy and electrocardiographic stress testing

    International Nuclear Information System (INIS)

    Weiss, R.J.; Morise, A.P.; Raabe, D.S. Jr.; Sbarbaro, J.A.

    1983-01-01

    Fifty patients were evaluated who suffered a single myocardial infarction with graded electrocardiographic stress testing, 201-thallium myocardial perfusion imaging and coronary angiography to assess the role of noninvasive indices as predictors of single versus multivessel coronary artery disease. Multivessel involvement was defined angiographically as the presence of two or more major coronary arteries with at least a 70% intraluminal diameter narrowing. Multivessel disease was defined scintigraphically as the presence of stress and/or redistribution perfusion defects in the distribution of more than one coronary artery. The results of stress electrocardiography were not useful in differentiating patients with single (9/16 positive) versus multivessel (22/34 positive) disease. The degree of exercise-induced ST-segment depression was also not helpful. Stress 201-thallium imaging did offer limited additional information with correct predictions of multivessel disease in 21 of 26 patients. Predictions of single-vessel disease were accurate in 11 of 24 patients. Eleven of these 13 incorrect predictions of single-vessel disease were due to the relative insensitivity of the thallium stress image to perceive defect in the anterior wall when the left anterior descending artery had significant obstruction at catheterization. Further refinements of stress perfusion imaging are needed before this method can be used to reliably separate patients with single and multivessel disease after myocardial infarction

  12. Genetic Influence on Slope Variability in a Childhood Reflexive Attention Task.

    Directory of Open Access Journals (Sweden)

    Rebecca A Lundwall

    Full Text Available Individuals are not perfectly consistent, and interindividual variability is a common feature in all varieties of human behavior. Some individuals respond more variably than others, however, and this difference may be important to understanding how the brain works. In this paper, we explore genetic contributions to response time (RT slope variability on a reflexive attention task. We are interested in such variability because we believe it is an important part of the overall picture of attention that, if understood, has the potential to improve intervention for those with attentional deficits. Genetic association studies are valuable in discovering biological pathways of variability and several studies have found such associations with a sustained attention task. Here, we expand our knowledge to include a reflexive attention task. We ask whether specific candidate genes are associated with interindividual variability on a childhood reflexive attention task in 9-16 year olds. The genetic makers considered are on 11 genes: APOE, BDNF, CHRNA4, COMT, DRD4, HTR4, IGF2, MAOA, SLC5A7, SLC6A3, and SNAP25. We find significant associations with variability with markers on nine and we discuss the results in terms of neurotransmitters associated with each gene and the characteristics of the associated measures from the reflexive attention task.

  13. A reconfigurable frequency-selective surface for dual-mode multi-band filtering applications

    Science.gov (United States)

    Majidzadeh, Maryam; Ghobadi, Changiz; Nourinia, Javad

    2017-03-01

    A reconfigurable single-layer frequency-selective surface (FSS) with dual-mode multi-band modes of operation is presented. The proposed structure is printed on a compact 10 × 10 mm2 FR4 substrate with the thickness of 1.6 mm. A simple square loop is printed on the front side while another one along with two defected vertical arms is deployed on the backside. To realise the reconfiguration, two pin diodes are embedded on the backside square loop. Suitable insertion of conductive elements along with pin diodes yields in dual-mode multi-band rejection of applicable in service frequency ranges. The first operating mode due to diodes' 'ON' state provides rejection of 2.4 GHz WLAN in 2-3 GHz, 5.2/5.8 GHz WLAN and X band in 5-12 GHz, and a part of Ku band in 13.9-16 GHz. In diodes 'OFF' state, the FSS blocks WLAN in 4-7.3 GHz, X band in 8-12.7 GHz as well as part of Ku band in 13.7-16.7 GHz. As well, high attenuation of incident waves is observed by a high shielding effectiveness (SE) in the blocked frequency bands. Also, a stable behaviour against different polarisations and angles of incidence is obtained. Comprehensive studies are conducted on a fabricated prototype to assess its performance from which encouraging results are obtained.

  14. Small nonnative fishes as predators of larval razorback suckers

    Science.gov (United States)

    Carpenter, J.; Mueller, G.A.

    2008-01-01

    The razorback sucker (Xyrauchen texanus), an endangered big-river fish of the Colorado River basin, has demonstrated no sustainable recruitment in 4 decades, despite presence of spawning adults and larvae. Lack of adequate recruitment has been attributed to several factors, including predation by nonnative fishes. Substantial funding and effort has been expended on mechanically removing nonnative game fishes, typically targeting large predators. As a result, abundance of larger predators has declined, but the abundance of small nonnative fishes has increased in some areas. We conducted laboratory experiments to determine if small nonnative fishes would consume larval razorback suckers. We tested adults of three small species (threadfin shad, Dorosoma petenense; red shiner, Cyprinella lutrensis; fathead minnow, Pimephales promelas) and juveniles of six larger species (common carp, Cyprinus carpio; yellow bullhead, Ameiurus natalis; channel catfish, Ictalurus punctatus; rainbow trout, Oncorhynchus mykiss; green sunfish, Lepomis cyanellus; bluegill, L. macrochirus). These nonnative fishes span a broad ecological range and are abundant within the historical range of the razorback sucker. All nine species fed on larval razorback suckers (total length, 9-16 mm). Our results suggest that predation by small nonnative fishes could be responsible for limiting recovery of this endangered species.

  15. Effects of bisphenol A treatment during pregnancy on kidney development in mice: a stereological and histopathological study.

    Science.gov (United States)

    Nuñez, P; Fernandez, T; García-Arévalo, M; Alonso-Magdalena, P; Nadal, A; Perillan, C; Arguelles, J

    2018-04-01

    Bisphenol A (BPA) is a chemical found in plastics that resembles oestrogen in organisms. Developmental exposure to endocrine-disrupting chemicals, such as BPA, increases the susceptibility to type 2 diabetes (T2DM) and cardiovascular diseases. Animal studies have reported a nephron deficit in offspring exposed to maternal diabetes. The aim of this study was to investigate the prenatal BPA exposure effects on nephrogenesis in a mouse model that was predisposed to T2DM. This study quantitatively evaluated the renal structural changes using stereology and histomorphometry methods. The OF1 pregnant mice were treated with a vehicle or BPA (10 or 100 μg/kg/day) during days 9-16 of gestation (early nephrogenesis). The 30-day-old offspring were sacrificed, and tissue samples were collected and prepared for histopathological and stereology studies. Glomerular abnormalities and reduced glomerular formation were observed in the BPA offspring. The kidneys of the BPA10 and BPA100 female offspring had a significantly lower glomerular number and density than those of the CONTROL female offspring. The glomerular histomorphometry revealed a significant difference between the female and male CONTROL offspring for the analysed glomerular parameters that disappeared in the BPA10 and BPA100 offspring. In addition, the kidney histopathological examination showed typical male cuboidal epithelial cells of the Bowman capsule in the female BPA offspring. Exposure to environmentally relevant doses of BPA during embryonic development altered nephrogenesis. These structural changes could be associated with an increased risk of developing cardiometabolic diseases later in life.

  16. Yoga Practice Increases Minimum Muscular Fitness in Children with Visual Impairment.

    Science.gov (United States)

    Mohanty, Soubhagyalaxmi; Venkata Ramana Murty, Peri; Pradhan, Balaram; Hankey, Alex

    2015-12-01

    Muscle strength, a component for balance, gait and functional mobility is vital for children with visual impairment. Yoga has frequently been demonstrated to improve physical and mental fitness in children. This study aimed to assess the effect of 16 weeks yoga training on muscular fitness in children with visual impairment. This was a wait-listed two-armed-matched case-control study. Eighty (41 yoga, 39 control) visual impairment students of both genders aged 9-16 years matched on age, gender and degree of blindness were assessed at pre, mid (after 8 weeks) and post (after 16 weeks) yoga intervention using the Kraus-Weber test. The percentage of students passed in yoga group were 12.2%, 43.9% and 68.3% whereas percentages in the control group were 23.1%, 30.8% and 30.8% in pre, mid, and post tests respectively. McNemar test showed significant differences between pre and mid, mid and post in the yoga group while those parameters were not significantly different in the control group. Yoga therapy seemed to have considerable benefits for the children's muscular fitness. The study suggests that yoga have considerable benefits for improvement of fitness level in children with visual impairment and may be recommended as and effective, alternative, inexpensive low risk training activity option for them.

  17. Survey and molecular detection of Melissococcus plutonius, the causative agent of European Foulbrood in honeybees in Saudi Arabia

    Directory of Open Access Journals (Sweden)

    Mohammad Javed Ansari

    2017-09-01

    Full Text Available A large-scale field survey was conducted to screen major Saudi Arabian beekeeping locations for infection by Melissococcus plutonius. M. plutonius is one of the major bacterial pathogens of honeybee broods and is the causative agent of European Foulbrood disease (EFB. Larvae from samples suspected of infection were collected from different apiaries and homogenized in phosphate buffered saline (PBS. Bacteria were isolated on MYPGP agar medium. Two bacterial isolates, ksuMP7 and ksuMP9 (16S rRNA GenBank accession numbers, KX417565 and KX417566, respectively, were subjected to molecular identification using M. plutonius -specific primers, a BLAST sequence analysis revealed that the two isolates were M. plutonius with more than 98% sequence identity. The molecular detection of M. plutonius from honeybee is the first recorded incidence of this pathogen in Saudi Arabia. This study emphasizes the need for official authorities to take immediate steps toward treating and limiting the spread of this disease throughout the country.

  18. Fatty acid composition of bacteria associated with the toxic dinoflagellate Ostreopsis lenticularis and with Caribbean Palythoa species.

    Science.gov (United States)

    Carballeira, N M; Emiliano, A; Sostre, A; Restituyo, J A; González, I M; Colón, G M; Tosteson, C G; Tosteson, T R

    1998-06-01

    The fatty acid composition of a Pseudomonas sp. (Alteromonas) and its host, the dinoflagellate Ostreopsis lenticularis, vectors in ciguatera fish poisoning, has been studied. The major fatty acids in O. lenticularis were 16:0, 20:5n-3, and 22:6n-3, but 18:2n-6, 18:3n-3, and 18:n-3 were also identified. In contrast to other dinoflagellates, 1 8:5n-3 was not detected in O. lenticularis. Even-chain fatty acids such as 9-16:1, 11-18:1, and 13-20:1 predominated in the Pseudomonas sp. from O. lenticularis, but 1 6-20% of (E)-11-methyl-12-octadecenoic acid was also identified. The chirality of the latter was confirmed by total synthesis (28% overall yield) starting from oxacyclotridecan-2-one. The fatty acid compositions of two other Pseudomonas species, from the palytoxin-producing zoanthids Palythoa mamillosa and P. caribdea, were also studied and were similar to that of the Pseudomonas sp. from O. lenticularis. The possibility of using some of these fatty acids as chemotaxonomic lipids in identifying marine animals that consume toxic dinoflagellates or zoanthids is discussed.

  19. Comparison of dorsal and dorsomedial displacement in evaluation of first ray hypermobility in feet with and without hallux valgus.

    Science.gov (United States)

    Singh, Dishan; Biz, Carlo; Corradin, Marco; Favero, Laura

    2016-06-01

    Hypermobility of the first ray, a probable primary cause of hallux valgus, has traditionally been evaluated in the dorsal direction only although the first tarso-metatarsal joint allows movement in a dorso-medial direction. 600 feet, divided according to the presence or absence of hallux valgus, were evaluated for both dorsal and dorso-medial displacement using a Klaue device. In the control group, the mean first ray displacement was 7.2mm (4.2-11.3) in the dorsal direction (sagittal plane) and 8.3mm (4.0-12.6) in the 45° dorso-medial direction. In the hallux valgus group, the mean first ray mobility was 9.8mm (5.2-14.1) in the dorsal direction compared to a mean of 11.0mm (5.9-16.2) in the 45° dorso-medial direction. It is a paradox that hypermobility of the first ray is measured in only a dorsal (vertical) direction whereas a hallux valgus angle and an intermetatarsal angle are only measured in a transverse plane. Furthermore, the weightbearing foot pronates during gait and the first metatarsal is displaced in a dorsomedial direction rather than a pure dorsal direction. It is suggested that measurement hypermobility of the first ray at a 45° dorso-medial direction is more appropriate. Copyright © 2015 European Foot and Ankle Society. Published by Elsevier Ltd. All rights reserved.

  20. A new species of Cystoisospora Frenkel, 1977 (Apicomplexa: Sarcocystidae) from Oecomys mamorae Thomas (Rodentia: Cricetidae) in the Brazilian Pantanal.

    Science.gov (United States)

    Barreto, Wanessa Teixeira Gomes; de Andrade, Gisele Braziliano; Viana, Lúcio André; de Oliveira Porfírio, Grasiela Edith; Santos, Filipe Martins; Perdomo, Alessandra Cabral; do Carmo, Jéssica Soares; da Silva, Alanderson Rodrigues; Maltezo, Taynara Rocha; Herrera, Heitor Miraglia

    2018-05-01

    Despite the great diversity of coccidians, to our knowledge, no coccidian infections have been described in Oecomys spp. In this context, we examined Oecomys mamorae Thomas (Rodentia: Cricetidae) from the Brazilian Pantanal for infections with enteric coccidia. Nine individuals were sampled, and one was found to be infected. The oöcysts were recovered through centrifugal flotation in sugar solution. Using morphological and morphometric features, we described a new species of Cystoisospora Frenkel, 1977. Sporulated oöcysts were ovoidal 20.0-29.1 × 16.4-23.2 (26.7 × 21.2) µm and contained two sporocysts, 12.9-19.1 × 9.4-13.9 (16.4 × 12.4) µm, each with four banana-shaped sporozoites. Polar granule and oöcyst residuum were both absent. We documented the developmental forms in the small intestine and described the histopathological lesions in the enteric tract. Our results indicate that the prevalence of Cystoisospora mamorae n. sp. in O. mamorae is low, and tissue damage in the enteric tract is mild, even in the presence of coccidian developmental stages.

  1. Streptococcus pharyngis sp. nov., a novel streptococcal species isolated from the respiratory tract of wild rabbits.

    Science.gov (United States)

    Vela, Ana I; Casas-Díaz, Encarna; Lavín, Santiago; Domínguez, Lucas; Fernández-Garayzábal, Jose F

    2015-09-01

    Four isolates of an unknown Gram-stain-positive, catalase-negative coccus-shaped organism, isolated from the pharynx of four wild rabbits, were characterized by phenotypic and molecular genetic methods. The micro-organisms were tentatively assigned to the genus Streptococcus based on cellular morphological and biochemical criteria, although the organisms did not appear to correspond to any species with a validly published name. Comparative 16S rRNA gene sequencing confirmed their identification as members of the genus Streptococcus, being most closely related phylogenetically to Streptococcus porcorum 682-03(T) (96.9% 16S rRNA gene sequence similarity). Analysis of rpoB and sodA gene sequences showed divergence values between the novel species and S. porcorum 682-03(T) (the closest phylogenetic relative determined from 16S rRNA gene sequences) of 18.1 and 23.9%, respectively. The novel bacterial isolate could be distinguished from the type strain of S. porcorum by several biochemical characteristics, such as the production of glycyl-tryptophan arylamidase and α-chymotrypsin, and the non-acidification of different sugars. Based on both phenotypic and phylogenetic findings, it is proposed that the unknown bacterium be assigned to a novel species of the genus Streptococcus, and named Streptococcus pharyngis sp. nov. The type strain is DICM10-00796B(T) ( = CECT 8754(T) = CCUG 66496(T)).

  2. Mixed acinar-endocrine carcinoma of the pancreas: new clinical and pathological features in a contemporary series.

    Science.gov (United States)

    Yu, Run; Jih, Lily; Zhai, Jing; Nissen, Nicholas N; Colquhoun, Steven; Wolin, Edward; Dhall, Deepti

    2013-04-01

    The objective of this study was to characterize the novel clinical and pathological features of mixed acinar-endocrine carcinoma of the pancreas. This was a retrospective review of medical records and surgical pathology specimens of patients with a diagnosis of mixed acinar-endocrine carcinoma of the pancreas at Cedars-Sinai Medical Center between 2005 and 2011. Additional immunohistochemistry was performed on the specimens of some patients. Five patients were identified. The median age at presentation was 74 years (range, 59-89 years), and all patients were male. The presenting symptoms were all related to tumor mass effects. The median size of the tumor was 10 cm (range, 3.9-16 cm). Preoperative clinical diagnosis aided by fine-needle aspiration biopsy was incorrect in all 5 cases. Most tumors (3/5) exhibited predominantly endocrine differentiation without hormonal production. Only 10% to 30% of cells were truly amphicrine, whereas most were differentiated into either endocrine or acinar phenotype. The clinical behavior ranged from moderate to aggressive with postoperative survival from 2.5 months to more than 3 years. Four patients received neoadjuvant or adjuvant chemotherapy with variable responses. Mixed acinar-endocrine carcinoma of the pancreas appears to be not uncommon in men, may harbor predominantly endocrine component, is often misdiagnosed by cytology, and exhibits variable clinical behavior. Mixed acinar-endocrine carcinoma of the pancreas should be considered in older patients with sizable pancreatic mass and may warrant aggressive surgical resection and chemotherapy.

  3. Portal Annular Pancreas

    Science.gov (United States)

    Harnoss, Jonathan M.; Harnoss, Julian C.; Diener, Markus K.; Contin, Pietro; Ulrich, Alexis B.; Büchler, Markus W.; Schmitz-Winnenthal, Friedrich H.

    2014-01-01

    Abstract Portal annular pancreas (PAP) is an asymptomatic congenital pancreas anomaly, in which portal and/or mesenteric veins are encased by pancreas tissue. The aim of the study was to determine the role of PAP in pancreatic surgery as well as its management and potential complication, specifically, postoperative pancreatic fistula (POPF). On the basis of a case report, the MEDLINE and ISI Web of Science databases were systematically reviewed up to September 2012. All articles describing a case of PAP were considered. In summary, 21 studies with 59 cases were included. The overall prevalence of PAP was 2.4% and the patients' mean (SD) age was 55.9 (16.2) years. The POPF rate in patients with PAP (12 pancreaticoduodenectomies and 3 distal pancreatectomies) was 46.7% (in accordance with the definition of the International Study Group of Pancreatic Surgery). Portal annular pancreas is a quite unattended pancreatic variant with high prevalence and therefore still remains a clinical challenge to avoid postoperative complications. To decrease the risk for POPF, attentive preoperative diagnostics should also focus on PAP. In pancreaticoduodenectomy, a shift of the resection plane to the pancreas tail should be considered; in extensive pancreatectomy, coverage of the pancreatic remnant by the falciform ligament could be a treatment option. PMID:25207658

  4. Portal annular pancreas: a systematic review of a clinical challenge.

    Science.gov (United States)

    Harnoss, Jonathan M; Harnoss, Julian C; Diener, Markus K; Contin, Pietro; Ulrich, Alexis B; Büchler, Markus W; Schmitz-Winnenthal, Friedrich H

    2014-10-01

    Portal annular pancreas (PAP) is an asymptomatic congenital pancreas anomaly, in which portal and/or mesenteric veins are encased by pancreas tissue. The aim of the study was to determine the role of PAP in pancreatic surgery as well as its management and potential complication, specifically, postoperative pancreatic fistula (POPF).On the basis of a case report, the MEDLINE and ISI Web of Science databases were systematically reviewed up to September 2012. All articles describing a case of PAP were considered.In summary, 21 studies with 59 cases were included. The overall prevalence of PAP was 2.4% and the patients' mean (SD) age was 55.9 (16.2) years. The POPF rate in patients with PAP (12 pancreaticoduodenectomies and 3 distal pancreatectomies) was 46.7% (in accordance with the definition of the International Study Group of Pancreatic Surgery).Portal annular pancreas is a quite unattended pancreatic variant with high prevalence and therefore still remains a clinical challenge to avoid postoperative complications. To decrease the risk for POPF, attentive preoperative diagnostics should also focus on PAP. In pancreaticoduodenectomy, a shift of the resection plane to the pancreas tail should be considered; in extensive pancreatectomy, coverage of the pancreatic remnant by the falciform ligament could be a treatment option.

  5. Qualidade de queijo minas frescal preparado com leite com diferentes quantidades de células somáticas Quality of minas frescal cheese prepared from milk with different somatic cell counts

    Directory of Open Access Journals (Sweden)

    Evelise Andreatta

    2009-03-01

    Full Text Available The objective of this work was to evaluate the effects of using bulk milk with different somatic cell counts (SCC on the quality of minas frescal cheese. A randomized complete block design was used, with 3x5 factorial treatments, with three SCC levels (low, 125,000 cells mL-1; intermediate, 437,000 cells mL-1; and high, 1,053,000 cells mL-1 and five storage durations. Cheese was vacuum-packed in plastic bags and analyzed after 2, 9, 16, 23 and 30 days of storage at 4ºC. Somatic cell counts did not affect dry matter, fat, ash content, pH, free fatty acid concentrations and sensory parameters of minas frescal cheese. However, SCC in milk increased losses of protein in whey and decreased the cheese protein content. These changes did not affect the moisture-adjusted cheese yield and proteolysis during 30 days of storage. An interaction effect between SCC and time of storage was observed for firmness and sensory grades of cheeses. Results indicated that raw milk used to produce minas frescal cheese should not contain high SCC, in order to avoid lower acceptance of the product after 30 days of storage.O objetivo deste trabalho foi avaliar o efeito do uso de leite com diferentes contagens de células somáticas (CCS, na qualidade do queijo minas frescal. Utilizou-se delineamento de blocos ao acaso, em esquema fatorial 3x5, com três níveis de CCS (baixa, 125.000 células mL-1; intermediária, 437.000 células mL-1; e alta, 1.053.000 células·mL-1 e cinco tempos de armazenamento. Os queijos foram embalados a vácuo, em embalagens de plástico, e analisados após 2, 9, 16, 23 e 30 dias de armazenamento a 4ºC. A contagem de células somáticas não afetou a matéria seca, a gordura, as cinzas, o pH, a concentração de ácidos graxos livres e os parâmetros sensoriais do minas frescal. A CCS no leite aumentou as perdas de proteína no soro e diminuiu o teor de proteína no queijo. Essas alterações não afetaram o rendimento com umidade ajustada e a

  6. Does mean heart dose sufficiently reflect coronary artery exposure in left-sided breast cancer radiotherapy. Influence of respiratory gating

    Energy Technology Data Exchange (ETDEWEB)

    Becker-Schiebe, Martina [Klinikum Braunschweig, Department of Radiotherapy and Radio-Oncology, Braunschweig (Germany); Hannover Medical School, Radiation Oncology, Hannover (Germany); Stockhammer, Maxi; Franz, Heiko [Klinikum Braunschweig, Department of Gynecology and Obstetrics, Braunschweig (Germany); Hoffmann, Wolfgang; Wetzel, Fabian [Klinikum Braunschweig, Department of Radiotherapy and Radio-Oncology, Braunschweig (Germany)

    2016-09-15

    With extensive use of systemic treatment, the issue of cardiac mortality after breast cancer radiation (RT) is still important. The aim of our analysis was to clarify whether the dose to one surrogate parameter (e. g., mean heart dose, as used in most studies) reflects the dose to the other cardiovascular structures especially the left anterior descending artery depending on breathing-adapted RT. A total of 130 patients who underwent adjuvant RT (50.4 Gy plus boost 9-16 Gy) were evaluated. In all, 71 patients were treated with free-breathing and 59 patients using respiratory monitoring (gated RT). Dosimetric associations were calculated. The mean dose to the heart (Dmean heart) was reduced from 2.7 (0.8-5.2) Gy to 2.4 (1.1-4.6) Gy, the Dmean LAD (left anterior descending artery) decreased from 11.1 (1.3-28.6) Gy to 9.3 (2.2-19.9) Gy with gated RT (p = 0.04). A significant relationship was shown for Dmean{sub heart}-Dmean LAD, V25heart-Dmean LAD and Dmax heart-Dmax LAD for gated patients only (p < 0.01). For every 1 Gy increase in Dmean heart, mean LAD doses rose by 3.6 Gy, without gating V25 ≤5 % did not assure a benefit and resulted in Dmean LAD between 1.3 and 28.6 Gy. A significant reduction and association of heart and coronary artery (LAD) doses using inspiratory gating was shown. However, in free-breathing plans commonly measured dose constraints do not allow precise estimation of the dose to the coronary arteries. (orig.) [German] Das Risiko kardialer Spaetfolgen nach Bestrahlung (RT) eines Mammakarzinoms spielt insbesondere auch aufgrund der zunehmenden systemischen Begleittherapien eine wichtige Rolle. Unklar ist, welche koronaren und/oder myokardialen Mechanismen hier entscheidend sind. Der Einfluss der Atemtriggerung und der daraus resultierenden geometrischen Lagevariabilitaet der Risikoorgane auf die Dosisverteilung am Herzen/Koronarien sollte geprueft werden, um zu klaeren, inwieweit die mittlere Herzdosis ein ausreichender Surrogatparameter fuer

  7. Analysis of the symmetric configuration of the circle of Willis in a series of autopsied corpses.

    Science.gov (United States)

    Stojanović, Nebojga; Stefanović, Ivica; Kostić, Aleksandar; Radisavejević, Misa; Stojanov, Dragan; Petrović, Sladjana

    2015-04-01

    The forming of the blood vessels network configuration at the base of the brain and interconnecting of blood vessels during the embryogenesis is directly related to the phylogenetic development of the brain and brain structures. A blood vessel configuration at the brain base, in the form of a ring or a hexagon, stands in direct relation to the perfusion needs of certain parts of the brain during its primary differentiation. The aim of this paper was to determine the incidence of certain blood vessel configurations at the base of the brain and understanding their symmetry or asymmetry. Analysis of the blood vessels at the base of the brain was performed on the autopsied subjects. The object of observation was the anterior segment of the circle of Willis consisting of C1- a. carotis interna (ICA), above a. communicaus posterior (PcoA), the segment A1 a. cerebri anterior (ACA) from a. carotis interna bifurcation to the a. communicans anterior (AcoA) and a communicans anterior itself, as well as the posterior segment consisting of PcoA and the segment P1--a. cerebri posterior (PCA) from the a. basilaris bifurcation to the PcoA. For the purpose of grouping the findings, the four basic configuration types of the circle of Willis were identified based on its symmetry or asymmetry. Type-A (symmetric circle of Willis), type-B (asymmetric circle of Willis' due to the unilateral hypoplastic A1-ACA); type-C (symmetric circle of Willis with bilateral symmetric changes on PcoA) and type-D (asymmetric circle of Willis due to the asymmetric changes on PcoA). Autosy was performed on 56 corpses. A total of 41 (73.2%) subjects were recorded with a symmetric configuration of the circle of Willis', of which 27 (48.2%) subjects had type A and 14 (25%) type C. The asymmetric configuration was present in 15 (26.8%) subjects, of whom 9 (16%) had type B and 6 (10.8%) subjects, of whom 9 (16%) had type B and 6 (10.8%) type D. The symmetric Willis group (73.2%) did not have a homogeneous

  8. Risk factors for avascular osteonecrosis in children with malignant tumors after thermochemotherapy

    International Nuclear Information System (INIS)

    Balzer, S.; Wessalowski, R.; Mils, O.; Schneider, D.; Bernbeck, B.; Goebel, U.; Jaeger, M.; Krauspe, R.

    2005-01-01

    following groups: 1-8 sessions (32 pts), 9-16 sessions (34 pts), > 16 sessions (3 pts). Power supply per body weight was classified into four distinct groups: 1-10 W/kg (6 pts), 10 to 100 min (3 pts), 50-100 min (2 pts), 20-50 min (6 pts), 10-20 min (18 pts), ≤10 min (41 pts). Severity of ON was defined: slight, moderate and severe. Seven out of 72 patients treated with RHT and chemotherapy ± radiotherapy developed ON, 1/7 double-sided. Appearance of aseptic ON is related to young age (5/7 pts 15 years), high power supply per body weight (2/7 pts 10-20 W/kg, 5/7 pts 20-30 W/kg) and high number of heat sessions (6/7 pts 9-16 sessions, 1/7 pts > 16 sessions). The present analysis showed that aseptic On can be a complication of RHT treatment in children and adolescents, which is not observed in adults. Pain or other skeletal symptoms after power supply of >20 W/kg body weight disclose a risk of osteochondrosis in young patients. We speculate that heat-induced reduction of blood perfusion and chondral injuries of the hip may be relevant for this specific complication in the pediatric age group. In the future 3D temperature measurement by MRI may be helpful to avoid dangerous temperatures in normal tissues. (author)

  9. Teores de colesterol, lipídios totais e ácidos graxos em cortes de carne suína Cholesterol, total lipds and fatty acids in cuts of pork

    Directory of Open Access Journals (Sweden)

    Neura Bragagnolo

    2002-01-01

    Full Text Available A carne suína é um alimento considerado rico em colesterol, lipídios e ácidos graxos saturados. De acordo com a AMERICAN HEART ASSOCIATION, para manter baixos níveis de colesterol sangüíneo, a alimentação deve ser pobre em colesterol e lipídios, principalmente gordura saturada. No presente trabalho foram determinados os teores de colesterol, lipídios totais e ácidos graxos em lombo, pernil, paleta e toucinho, comercializados em açougues da cidade de Campinas, São Paulo. Foi verificado também o efeito da inclusão da gordura externa nos níveis destes componentes. O teor médio de lipídios totais foi de 3 a 5g/100g nos cortes de carne e 83g/100g no toucinho. O colesterol variou, em média, de 42 a 53mg/100g, sendo menor no lombo e maior no toucinho. Não houve diferença significativa (p³0,05 no nível de colesterol entre lombo com e sem gordura externa. Em todos os cortes e no toucinho, foram identificados trinta e seis (36 ácidos graxos, os principais dos quais foram: 18:1ômega9, 16:0, 18:2ômega6, 18:0, 16:1ômega7 e 18:1ômega7. O total de ácidos graxos saturados, monoinsaturados e poliinsaturados variou de 33 a 41%, 42 a 48% e 11 a 25%, respectivamente.Pork is a food considered to be rich in cholesterol, lipids and saturated fatty acids. According to the American Heart Association, the diet must be low in cholesterol and lipids, especially saturated fat. In the present work, total lipids, cholesterol and fatty acids were determined in pork loin, fresh ham, pork shoulder and backfat, commercialized in butchery of Campinas City, São Paulo State, Brazil. The mean total lipids was 3 to 5g/100g in the meat cuts and 83g/100g in backfat. Cholesterol varied, on the average, from 42 to 53mg/100g, being lower in pork loin and higher in backfat. No significant difference (p³0,05 in cholesterol content was seen in pork loin with or without external fat. Thirty-six fatty acids were identified in all cuts and the backfat, with

  10. Dental caries and treatment needs among indigenous people of the Potiguara Indian reservation in Brazil Caries dental y necesidades de tratamiento en los indígenas de la reserva india Potiguara de Brasil

    Directory of Open Access Journals (Sweden)

    Fábio Correia Sampaio

    2010-04-01

    Full Text Available OBJETIVE: The aim of this study was to assess the caries prevalence and treatment needs of Brazilian indigenous residents on an Indian reservation. METHODS: This cross-sectional study comprised 1 461 individuals of ages 18-36 months and 5, 12, 15-19, 35-44, and 65-74 years living in the Potiguara Indian villages of Brazil. Decayed, missing, or filled permanent teeth (DMFT and deciduous teeth (dmft were determined by calibrated examiners using the methodology recommended by the World Health Organization. Treatment needs were assessed with the guidelines of the 2003 Brazilian Oral Health Survey. RESULTS: Means ± standard deviations (SD for dmft of 18- to 36-month-old and 5-year-old children were 2.5 ± 3.7 and 5.8 ± 4.3, respectively. For the age groups 12, 15-19, 35-44, and 65-74 years, mean ± SD values of DMFT were 3.6 ± 3.1, 7.1 ± 4.9, 16.4 ± 7.5, and 22.8 ± 8.6. The mean ± SD number of deciduous teeth requiring treatment varied from 2.4 ± 3.5 to 5.0 ± 4.0 in the 18- to 36-month and 5-year-old age groups, respectively. Among adolescents and adults, it was observed that on average at least three permanent teeth required dental treatment such as fillings, crowns, endodontic treatment, and extractions. CONCLUSIONS: High prevalence of caries and many teeth needing treatment were observed in all age groups of the Potiguara Indians.OBJETIVO: El objetivo de este estudio fue evaluar la prevalencia de caries y las necesidades de tratamiento en los residentes indígenas brasileños de una reserva india. MÉTODOS: En este estudio transversal se incluyó a 1 461 personas de 18 a 36 meses de edad, y de 5, 12, 15-19, 35-44, y 65-74 años, que vivían en aldeas indias Potiguara de Brasil. Se determinaron los dientes permanentes cariados, perdidos y obturados (CPO y los dientes deciduos mediante examinadores calibrados, con ayuda del método recomendado por la Organización Mundial de la Salud. Las necesidades de tratamiento se evaluaron con las

  11. Atividade residual in vitro do pelo de cobertura de cães tratados com dinotefuran sobre larvas e adultos de Ctenocephalides felis felis (Bouché, 1835 (Siphonaptera: pulicidae Residual activity in vitro of treated dog's hair coat with dinotefuran on larvae and adults of Ctenocephalides felis felis (Bouché, 1835 (Siphonaptera: Pulicidae

    Directory of Open Access Journals (Sweden)

    Thaís R. Correia

    2008-12-01

    Full Text Available O objetivo deste trabalho foi avaliar a atividade in vitro do resíduo em pelo de cobertura de cães tratados com dinotefuran sobre larvas e adultos de Ctenocephalides felis felis. Foram utilizadas três cadelas da Raça Beagle: a nº 1 foi tratada com uma formulação spray de dinotefuran a 0,834%, a nº 2 com uma formulação "strip-on" de dinotefuran a 30% e a nº 3 foi mantida sem tratamento. Pequenas áreas foram tricotomizadas nos dias 2, 9, 16, 23, 30, 37 e 44 após o tratamento. Para avaliação adulticida e larvicida, foram utilizados pulgas de uma colônia mantida em laboratório. Seis repetições com cada uma contendo 10 exemplares de C. f. felis, acondicionados em tubos de ensaio, da etapa correspondente foram utilizados por dia de desafio. Em cada repetição foi adicionado 0,02 gramas de pelo de cada área tricotomizada e dieta na etapa de larvas. O material da etapa adulto foi avaliado num período de 24 horas, o da etapa larvas foi avaliado após 20 dias de cada desafio. O resíduo no pêlo de cães tratados com ambas as formulações de dinotefuran foi eficaz no controle de larvas por um período de 44 dias, e no controle de adultos as formulações spray e a "strip-on" foram eficazes por um período de 16 e 23 dias, respectivamente.The aim of this study was to evaluate the residual activity of treated dog's hair coat with dinotefuran on larvae and adults of Ctenocephalides felis felis. Three female Beagle dogs were used. One female dog was treated with 0.834% dinotefuran spray, the second was treated with 30% dinotefuran strip-on and the third was not treated. Some areas of dog's hair were clipped on days 2, 9, 16, 23, 30, 37 and 44 after treatment. For the evaluation of adulticidal and larvicidal activities, flea adults and larvae from the laboratory colony were used. Six repetitions were used with 10 samples of each flea stage per day, placed in assay tubes. In each repetition we added 0.02 g of treated or untreated dog

  12. KARAKTERISASI BIODIESEL DARI MINYAK JELANTAH MENGGUNAKAN PEREAKSI BIOETANOL TETES TEBU

    Directory of Open Access Journals (Sweden)

    Sagung Ngurah Mayuni

    2015-10-01

    Full Text Available ABSTRAK: Biodiesel merupakan bahan bakar alternatif yang dapat disintesis dari minyak jelantah dan alkohol melalui proses esterifikasi. Penelitian ini menggunakan bahan dasar minyak jelantah dengan kadar asam lemak bebas sebesar 9,16 %, dimana alkohol yang digunakan adalah bioetanol tetes tebu. Tujuan penelitian ini adalah untuk mengkarakterisasi biodiesel hasil esterifikasi dan transesterifikasi minyak jelantah dengan hasil destilasi bioetanol tetes tebu. Metode penelitian yang dilakukan adalah menggunakan perbandingan bervariasi antara minyak jelantah dan etanol yaitu 1 : 1 (B1, 3:1 (B2, 5:1 (B3. Hasil karakterisasi biodiesel diperoleh sesuai dengan SNI berturut-turut untuk densitas B1 = 860,3, B2 = 865,3 , B3 = 866,3 (kg/m3, Viskositas B1 = 19,138 , B2 = 24,881 , B3 = 25,359(mm2/s, Titik NyalaB1 = 138,5, B2 = 93,5, B3 = 212,5 (0C. Titik tuang B1 = 6, B2 = 93,5, B3 = 212,5. Titik Tuang B1 = 6, B2 = 6, dan B3 = 9 (0C. Korosi B1 = 1a, B2 = 1a dan B3 =1a. Untuk kadar air dengan hasil B1 = 0,05, B2 = trace (tidak terdeteksi dan B3 = 0,2 (% v/v.Biodiesel minyak jelantah dan etanol tetes tebu dapat terbentuk, setelah dianalisis dengan kromatografi gas menunjukkan adanya senyawa ester (etil palmitat, etil linoleat, etil laurat dengan waktu retensi masing-masing adalah 17,0, 18,6 , 18,7 menit. Berdasarkan hasil penelitian disimpulkan bioetanol tetes tebu dapat digunakan dalam sintesis biodiesel. Penggunaan bioetanol tetes tebu dalam sintesis biodiesel diperoleh karakteristik sesuai dengan Standar Nasional Indonesia (SNI -04-7182-2006 kecuali viskositas. ABSTRACT: Biodiesel is an alternative energy for fossil fuel. It can be synthesized by esterification of waste cooking oil with alcohol. In this research, the used waste cooking oil contains 9.16 % FFA, while the alcohol used was bioethanol fermented from molase. The aim of this research was to characterize biodiesel produced from esterification and transesterification of used cooking oil with

  13. Caracterização da estrutura anatômica, densidade básica e morfologia de cavacos da madeira de Eucalyptus grandis para a produção de painéis MDF Characterization of wood anatomy, basic density, and morphology of Eucalyptus grandis chips for MDF production

    Directory of Open Access Journals (Sweden)

    Ugo Leandro Belini

    2008-08-01

    Full Text Available O aumento na produção dos painéis "Medium Density Fiberboard" (MDF confeccionados com madeira de espécies de Eucalyptus spp de rápido crescimento evidencia a necessidade da caracterização dos seus componentes celulares, da densidade básica e da morfologia de cavacos. Com esse objetivo, foram coletadas três amostras de cavacos de madeira de árvores de Eucalyptus grandis, na linha de produção de indústria de painel. Em laboratório, os cavacos foram dissociados por maceração, para a avaliação das dimensões das fibras e dos vasos; determinou-se a densidade básica dos cavacos, bem como se caracterizaram a sua espessura e morfologia. Os resultados indicaram valores médios de 1005-19,7-11,8-3,9 µm para o comprimento, largura, diâmetro do lume e espessura média da parede das fibras, respectivamente. A densidade básica da madeira foi de 0,432 g/cm³ e a espessura dos cavacos, de 4,36 mm. Os valores médios de retenção dos cavacos foram de 0,9-16,9-44,5-30,7-6,1-0,9% nas peneiras 40, 25, 16, 8, 3,35 mm e fundo, respectivamente, sendo 75,2% retidos nas peneiras de 16-8 mm de abertura. Os resultados das análises anatômicas e morfológicas dos cavacos de madeira foram discutidos e comparados com informações da literatura especializada e correlacionados com o processo produtivo de chapas MDF.The increase of the MDF panels (Medium Density Fiberboard production by the use of the fast growing eucalypt wood species it evidences the need of the characterization of the cellular components, basic density and the chips morphology. With this aim 3 samples of wood chips of Eucalyptus grandis trees were collected, in the production line of panel industry. In laboratory, the wood chips were dissociated by maceration for the evaluation of the fiber and vessels dimensions; the wood basic density was determined and the thickness and morphology were characterized. The results indicated mean values of 1005-19,7-11,8-3,9 µm for the fiber length

  14. Effect of feeding lambs with a tanniferous shrub (rockrose) and a vegetable oil blend on fatty acid composition of meat lipids.

    Science.gov (United States)

    Francisco, A; Alves, S P; Portugal, P V; Pires, V M R; Dentinho, M T; Alfaia, C M; Jerónimo, E; Prates, J A M; Santos-Silva, J; Bessa, R J B

    2016-12-01

    The effects of feeding Cistus ladanifer (Cistus) and a blend of soybean and linseed oil (1 : 2 vol/vol) on fatty acid (FA) composition of lamb meat lipids and messenger RNA (mRNA) expression of desaturase enzymes was assessed. In total, 54 male lambs were randomly assigned to 18 pens and to nine diets, resulting from the combination of three inclusion levels of Cistus (50 v. 100 v. 200 g/kg of dry matter (DM)) and three inclusion levels of oil (0 v. 40 v. 80 g/kg of DM). The forage-to-concentrate ratio of the diets was 1 : 1. Longissimus muscle lipids were extracted, fractionated into neutral (NL) and polar lipid (PL) and FA methyl esters obtained and analyzed by GLC. The expression of genes encoding Δ5, Δ6 and Δ9 desaturases (fatty acid desaturase 1 (FADS1), fatty acid desaturase 2 (FADS2) and stearoyl CoA desaturase (SCD)) was determined. Intramuscular fat, NL and PL contents were not affected by oil or Cistus. Oil supplementation reduced (P<0.05) 16:0, c9-16:1, 17:0, c9-17:1 and c9-18:1 FA and increased (P<0.05) 18:2n-6, 18:3n-3 and the majority of biohydrogenation intermediates in NL. Cistus alone had few effects on FA of NL but interacted with oil (P<0.05) by increasing t10-18:1,t10,t12-18:2,t10,c12-18:2 and t7,c9-18:2. The t10-/t11-18:1 ratio increased with both Cistus and oil levels. The c9, t11-18:2 did not increase (P<0.05) with both oil and Cistus dietary inclusion. Oil reduced c9-16:1, 17:0, c9-17:1,c9-18:1, 20:4n-6, 22:4n-6 and 20:3n-9 proportions in PL, and increased 18:2n-6, 18:3n-3, 20:3n-3 and of most of the biohydrogenation intermediates. The Cistus had only minor effects on FA composition of PL. Cistus resulted in a reduction (P<0.05) of 20:5n-3 and 22:6n-3 in the meat PL. The expression level of SCD mRNA increased (P=0.015) with Cistus level, although a linear relationship with condensed tannins intake (P=0.11) could not be established. FADS1 mRNA expressed levels increased linearly (P=0.019) with condensed tannins intake. In summary, the

  15. Niveles sanguíneos de plomo en neonatos hijos de madres consumidoras de "basuco": estudio comparativo

    Directory of Open Access Journals (Sweden)

    Martha Piedad Restrepo

    1988-02-01

    Full Text Available

    Obtention of cocaine clorhydrate from coca leaves requires the use of gasoline; therefore residues such as lead may remain in the base paste (basuca; the latter is smoked, under the name basuco, mixed with tobacco or marijuana; It is conceivable that the smoker takes up lead residues that Increase lead blood levels; we wanted to determine whether the use of basuco during pregnancy could produce such effect In the newborn infant. Serum lead concentrations were measured In 19 newborn children and In 18 of their mothers. The latter were basuco consumers. They were compared to those of 20 non consuming delivering women along with 19 of their newborn Infants. Measurements were performed on a Perkin-Palmer model 2380 atomic absorption

    spectrophotometer. Women were divided in four groups according to the degree of consumption, as follows: mild, moderate, Intense or non existent. Mean levels and SDs in the children were respectively: 13.5 ± 9.4; 15.8 ± 6.5; 16.6 ± 7.8; 6.9 ± 5.0 ug/dl; and In their mothers: 13.3 ± 4.6; 13.5 ± 6.9; 16.2 ± 4.9; 8.4 ± 4.6 ug/dl Statistic analysis revealed highly significant differences between mothers and children exposed to basuco and those that were not exposed. No difference was observed ac. cording to the degree of consumption. In conclusion: newborn from basuco consuming mothers have Increased lead blood levels; the long term effects of such alteration should be the subject of further studies.

    La obtención del clorhidrato de cocaína a partir de la hoja de coca requiere el uso de gasolina; residuos de ésta pueden permanecer en la pasta base (basuca; al fumar ésta, mezclada con cigarrillo o marihuana (basuco el consumidor puede captar residuos de plomo e Incrementar sus concentraciones sanguíneas del mismo; quisimos saber si el uso del basuco

  16. 成都市综合医院门诊患者抑郁焦虑障碍诊治状况研究%Prevalence of Depression and (or) Anxiety Disorders among Outpatients in General Hospitals in Chengdu

    Institute of Scientific and Technical Information of China (English)

    李晓靖; 张岚; 李斌

    2011-01-01

    Objective To investigate the prevalence of depressive disorders and (or) anxiety disorders and physicians' detection rate of these disorders in general hospitals in Chengdu. Methods From April to May, 2007, a hospital-based cross-sectional survey was conducted in neurology, gastrointestinal, gynecology and vasculocardiology departments in West China Hospital and West China Second Hospital. Outpatients were screened by using Hospital Anxiety and Depression Scale (HADS) and Patient Health Questionnaire 15-Item (PHQ-15). Psychiatrists interviewed subjects whose score of HADS were 8 and above and made diagnoses by using Mini International Neuropsychiatric Interview (MINI) according to the criteria of Diagnostic and Statistical Manual of Mental Health Disorders 4th Edition (DSM-IV). Results The adjusted current and lifetime prevalence of depressive disorders were 19. 26% and 22. 32%, respectively, and those of anxiety disorders were 9. 16% and 9. 63%, respectively. The prevalence of depressive disorders and/or anxiety disorders among four departments had statistically significant difference. The detection rate of these disorders by outpatient physicians was 10. 57%. Conclusion Prevalence of depressive disorders and anxiety disorders among outpatients in West China Hospital and West China Women and Children Hospital is high, and the rate of physicians' detection needs to be improved.%目的 了解成都市综合医院门诊患者抑郁障碍和焦虑障碍的患病率及门诊医生的识别率.方法 2007年4-5月应用医院焦虑抑郁量表(Hospital Anxiety and Depression Scale,HADS)、患者健康问卷(PatientHealth Questionnaire 15-Item,PHQ-15)对在四川大学华两医院和华两第二医院神经内科、消化内科、妇科和心血管内科门诊就诊的685例患者进行筛杳.HADS≥8分者进入精神科访谈,南精神科医牛使朋国际神经精神科简式访谈问卷进行诊断.结果 综合医院门诊患者抑郁障碍校正后的现

  17. Fundus fluorescein angiography in the early diagnosis of diabetic retinopathy significance%眼底荧光血管造影对早期诊断糖尿病性视网膜病变的意义

    Institute of Scientific and Technical Information of China (English)

    王霞; 裴承华; 丁爱东

    2014-01-01

    ObjectiveTo explore the Fundus fluorescein angiography in the early diagnosis of diabetic retinopathy significance.Methods300 cases (273 eyes) diabetic patients clinical data were collectes from 2010 December to 2012 December,and all patients were checked with ophthalmoscope and fundus fluorescein angiography two checking methods.Results153 cases were checked by the ophthalmoscopic lesions number,lesions was 56.05%;251 cases were detected by FFA lesions,which followed by fundus fluorescein angiography,lesions was 91.94%.The diagnosis of fundus fluorescein angiography of the correct rate had a higher Correct rate,the difference was statistically significant between the two groups (P<0.05).Non proliferative diabetic retinopathy had 55 cases by FFA lesions,accounting for 21.91% disease variables;preproliferative diabetic retinopathy had 73 cases,accounting for 29.08%;proliferative diabetic retinopathy had 65 cases,accounting for 25.91%;diabetic macularlesions had 35 cases,accounting for 13.94%;diabetic papillopathy had 23 cases,accounting for 9.16%.Conclusion Early diabetic retinopathy fluorescein angiography can be found on thelens cannot make diagnosis.%目的:探讨眼底荧光血管造影对早期诊断糖尿病性视网膜病变的意义。方法选取2010年12月~2012年12月300例(273只眼)糖尿病患者的临床资料,所有患者皆用检眼镜和荧光素眼底血管造影两种检查方法。结果采用检眼镜检出病变数153例,病变率为56.05%;后经荧光素眼底血管造影检查,发现FFA检出病变数251例,病变率为91.94%,荧光素眼底血管造影的诊断正确率较高,两组比较,差异具有统计学意义(P<0.05)。FFA检查病变种类主要包括非增生性糖尿病性视网膜病变55例,占病变数的21.91%;增生前糖尿病性视网膜病变73例,占29.08%;增生型糖尿病性视网膜病变;65例,占25.91%;糖尿病性黄斑病变35例,占13.94%;糖

  18. Avaliação de poluentes aéreos em instalações de creche e terminação de suínos Evaluation of aerial pollutants in nursery and finishing swine housing

    Directory of Open Access Journals (Sweden)

    Carlos Augusto de Paiva Sampaio

    2007-04-01

    Full Text Available Esta pesquisa foi desenvolvida em duas instalações para suínos nas fases de creche e terminação, em duas salas cada, em granjas localizadas no município de Salto, SP, com os objetivos de avaliar a concentração de amônia e poeira e a presença de fungos, além de estimar os riscos de exposição ocupacional a esses agentes ambientais. As avaliações foram realizadas conforme preceituam as normas NR-15, NIOSH e ACGIH. Os resultados indicaram diferença significativa nas concentrações de amônia em relação aos horários, às instalações e aos períodos do dia. Estes também indicam negligência para a questão da ventilação sanitária nas instalações de creche, com conseqüentes teores mais altos de amônia, e que estes estão vinculados à circulação de ar no interior das instalações, ao manejo dos dejetos e da cortina, à tipologia da construção e às condições de clima local, além da lotação e da densidade de suínos. A concentração de poeira total foi mais alta nos prédios de creche (0,84-9,16mg m-3 do que nos de terminação (0,84-3,34mg m-3, enquanto que a poeira respirável foi mais alta na creche, ficando inferior a 3,67mg m-3 e dentro dos limites de insalubridade para o trabalhador. Foram encontrados fungos do gênero Aspergillus, Penicillium e Neurospora em suspensão no ambiente interno das instalações estudadas.This research was developed in two swine housings in the phases of nursery and finishing: in two pens each, in two farms located at Salto County, SP, with the objective to evaluate ammonia and concentrations, and fungi presence besides estimating the occupational risk of exposure to these environmental agents. The evaluations were done according to recommended by the norms NR-15, NIOSH e ACGIH. Results indicated significant difference in ammonia concentration in relation to the hour, the housing and to the day period. They also indicate negligence to sanitary ventilation matter in nursery

  19. Prevalencia del intento de interrumpir el embarazo y factores asociados en una comunidad urbano marginal de Lima-Perú, 2006 Prevalence of the attempts to stop pregnancy and associated factors in a marginal suburban comunnity in Lima-Peru, 2006

    Directory of Open Access Journals (Sweden)

    Carolina Tarqui-Mamani

    2010-03-01

    Full Text Available Objetivos. Estimar la prevalencia y determinar los factores asociados al intento de interrumpir el embarazo en mujeres con antecedente de embarazo. Material y métodos. Se realizó un estudio transversal durante el año 2006. La muestra incluyó a 1057 mujeres con antecedente de embarazo que habitaban en Pamplona Alta, seleccionadas a través del muestreo probabilístico sistemático. Se realizó análisis estadístico descriptivo e inferencial, incluyendo un modelo de regresión logística. Resultados. La prevalencia de la intención de interrumpir su embarazo fue 13,9% (IC99%: 11,1- 16,7. Al efectuarse un análisis multivariado, se encontró que los factores asociados fueron: embarazo no deseado (OR=5,7; IC: 1,9-16,7, la falta de atención prenatal (OR=4,7; IC: 1,8-12,2, la prostitución (OR=11,4; IC: 1,5-87,9, tener menos de 20 años (OR=2,9; IC: 1,1-7,9 y tener más de dos parejas (OR=3,3; IC: 1,1-10,2. Conclusiones. La prevalencia estimada del intento de interrumpir el embarazo en mujeres con antecedente de embarazo en una zona urbano marginal de Lima es baja si se compara al estimado nacional de abortos. Los factores asociados al intento de interrumpir el embarazo son: el embarazo no deseado, prostitución, tener menos de 20 años, tener más de dos parejas y la falta de atención prenatal.Objectives. To estimate the prevalence for the attempts to stop pregnancy among women with history of previous pregnancies, and to determine the factors associated. Material and methods. A cross-sectional study was performed during 2006. Samples included 1057 women with background of pregnancy, living in Pamplona Alta, selected by a systematic random sampling. We applied descriptive and inferential statistics, including a logistic regression model. Results. The prevalence for the attempt to stop pregnancy was 13.9% (99% CI: 11.1-16.7. The factors associated identified by multivariate analysis were: Unwanted pregnancy (OR=5.7; CI: 1.9-16.7, lack of pre

  20. Avaliação de modelos de predição da energia metabolizável do milho para suínos Evaluating models to predict the metabolizable energy of maize for swine

    Directory of Open Access Journals (Sweden)

    R.N. Pelizzeri

    2013-04-01

    Full Text Available Os objetivos propostos no presente trabalho foram a validação da predição de modelos de regressão linear de 1º grau, dos valores estimados de energia metabolizável (EM em função dos valores observados de EM do milho, obtidos em ensaios biológicos com suínos. Setenta e quatro registros de composição química e energética do milho foram obtidos na literatura e utilizados para estimar a EM de 41 modelos de predição em função da composição química. A significância dos parâmetros (β0 e β1 da regressão foi avaliada pelo teste t parcial, e a validação da predição dos modelos de 1º grau foi obtida pela aceitação da hipótese de nulidade conjunta β0=0 e β1=1. Os modelos EM7 = 1,099 + 0,740EB - 5,5MM - 3,7FDN; EM9 = 16,13 - 9,5FDN + 16EE + 23PB*FDN - 138MM*FDN e EM13 = 5,42 - 17,2FDN - 19,4MM + 0,709EB são os mais adequados para estimar os valores de EM do milho e podem ser utilizados como ferramenta para formulação de rações para suínos.The proposed objective of this study was to validate the prediction of linear regression models of the first degree, the estimated values of metabolizable energy (ME regarding the observed ME values of maize obtained in biological assays with swine. Seventy four records of chemical and energetic composition of maize were obtained from literature and used to estimate the ME of 41 prediction models depending on the chemical composition. The significance of the regression parameters (β0and β1was evaluated by partial t test and the prediction validation of first degree models was obtained by accepting the null hypothesis β0=0 and β1=1. The ME7= 1.099 + 0.740GE - 5.5MM - 3.7NDF; ME9= 16.13 - 9.5NDF + 16EE + 23CP*NDF - 138MM* NDF and ME13= 5.42 - 17.2 NDF - 19.4MM + 0.709GE models are the most adequate to estimate the metabolizable energy of maize and can be used as a tool to formulate diets for swine.

  1. Função sexual de homens submetidos a transplante hepático Sexual function of males subjected to liver transplantation

    Directory of Open Access Journals (Sweden)

    Júlio Cezar Uili Coelho

    2003-01-01

    Full Text Available OBJETIVO: Avaliar a qualidade de vida sexual masculina antes e depois do transplante hepático. MÉTODOS: Foi enviado questionário de avaliação para 56 doentes masculinos, que tinham idade superior a 18 anos e que sobreviveram mais de seis meses após o transplante hepático. O questionário continha 15 perguntas com cinco ou seis alternativas de resposta para mensurar a função sexual masculina segmentada por cinco componentes: função erétil, função orgástica, desejo sexual, satisfação com a relação sexual e satisfação com a vida sexual como um todo. As respostas geraram valores numéricos, os quais foram agrupados dentro de cada domínio e comparados antes e depois do transplante hepático. RESULTADOS: Vinte e cinco doentes responderam completamente o questionário. Todas os cinco componentes da função sexual melhoraram após o transplante hepático, sendo que o escore da função erétil aumentou de 21,12±8,07 para 26,52±5,22 (p=0,004, da função orgástica de 7,28±3,05 para 9,36±1,47 (p=0,008, da função desejo sexual de 6,64±2,58 para 8,68±1,35 (p=0,005, da satisfação com relação sexual de 9,16±3,83 para 12,52±2,65 (pBACKGROUND: Sexual dysfunction is very common in liver transplantation candidates. Our objective is to determine the sexual life quality of males before and after liver transplantation. METHODS: Questionnaire was sent to 56 males over 18 years of age with at least six-month survival after orthotopic liver transplantation. The self-administered questionnaire contained 15 questions with 5 or 6 alternatives to determine the male sexual function which may be divided into 5 domains: 1 erectile function; 2 orgasmic function; 3 sexual desire; 4 intercourse satisfaction; and 5 overall satisfaction with sexual life. Each answer received a score. Domains scores were computed by summing the scores for individual answers and they were compared before and after the liver transplantation. RESULTS: Twenty

  2. Conteúdo e exportação de micronutrientes em acácia-negra (Acacia Mearnsii De Wild. procedência batemans bay (Austrália Content and exportation of micronutrients in black wattle (Acacia Mearnsii de wild. of Australian batemans bay provenance

    Directory of Open Access Journals (Sweden)

    Marcos Vinicius Winckler Caldeira

    2003-02-01

    Full Text Available O objetivo do presente trabalho foi estimar o conteúdo e a exportação de micronutrientes (Mn, B, Cu, Zn e Fe e o Na nos diferentes componentes de árvores de um povoamento de acácia-negra (Acacia mearnsii De Wild., procedência australiana Batemans Bay, com 2,4 anos de idade, em Butiá-RS (Brasil. A biomassa total estimada foi de 36.155 kg/ha, apresentando distribuição de 46,0, 20,0, 19,5, 12,0 e 3,0%, na madeira do lenho, nas folhas, nos galhos vivos, na casca e nos galhos mortos, respectivamente. A proporção de micronutrientes acumulados na biomassa dos componentes da árvore foram 43,76% nas folhas, 26,94% na madeira do tronco, 19,56% nos galhos vivos, 7,21% na casca e 2,54% nos galhos mortos. A quantidade estimada de micronutrientes contidos na biomassa acima do solo foi 10,4 kg/ha, acumulados da seguinte forma: Na (58,84%, Fe (21,79%, Zn (9,16%, B (4,09%, Mn (4,59% e Cu (1,54%. A casca e a madeira do lenho acumulou Na (21,47%, Fe (6,71%, Mn (2,11%, Zn (1,66%, B (1,58% e Cu (0,63%. A copa (folhas e galhos vivos e mortos acumularam Na (37,36%, Fe (15,07%, Zn (7,49%, B (2,53%, Mn (2,48% e Cu (0,91%. A exploração intensiva de áreas com a procedência Batemans Bay gera suspeitas de possíveis ocorrências de deficiências nutricionais de Na nas rotações futuras, tornando necessário o emprego de fertilizantes para manter a produtividade do sítio.This study aimed to estimate the content and exportation of micronutrients (Mn, B, Cu, Zn e Fe and Na in different tree components of black wattle (Acacia mearnsii De Wild. forest of Batemans Bay Australian provenance, 2.4 years old in Butiá, RS, Brazil. The total biomass found was 36,155 kg/ha, thus distributed: 46.0%; 20.0%; 19.5%; 12.0% and 3.0%, spread in the wood of the stem, leaves, live branches, bark and dead branches, respectively. The proportion of the micronutrients accumulated in the biomass of the components were: leaves (43.76%, wood of the stem (26.94%, live branches (19

  3. Clinical evaluation of multisurface ART restorations Avaliação clínica de restaurações compostas ou complexas com a técnica do ART

    Directory of Open Access Journals (Sweden)

    Daniela Francisca Gigo Cefaly

    2005-03-01

    Full Text Available The aim of this study was to evaluate the performance of two different glass-ionomer cements: a high-density (Ketac Molar - ESPE and a resin-modified cement (Fuji VIII - GC using the Atraumatic Restorative Treatment technique to restore multisurface cavities in permanent teeth. A total of 60 ART restorations (30 with each material were placed in schoolchildren (9-16 years of age by two operators. After a period of 6 months, two independent examiners evaluated 59 restorations according to the criteria used in previous ART studies. Data were submitted to McNemar and Fischer tests. The success rate of the treatment was 98.3%. One restoration (Ketac Molar was replaced by another material and was recorded as failure. The success rates of the restorations were 100% and 96.6% for Fuji VIII and Ketac Molar, respectively. There was no statistically significant difference in the restorations success between baseline and 6 months (p>0.05. In the same way, no significant differences were found between materials, cavity types or operators (p>0.05. The ART approach was highly appropriate and effective in restorations involving two or more tooth surfaces, after 6 months. The results showed a promising performance of the ART technique with both materials.O objetivo deste estudo foi avaliar o comportamento de dois cimentos de ionômero de vidro: um de alta viscosidade (Ketac Molar - ESPE e um modificado por resina (Fuji VIII - GC em restaurações envolvendo duas ou mais superfícies dentárias, confeccionadas pela técnica do Tratamento Restaurador Atraumático. Sessenta restaurações (30 com cada material foram inseridas em estudantes (9-16 anos por dois operadores. Após 6 meses, dois examinadores independentes avaliaram as restaurações de acordo com os critérios utilizados em trabalhos prévios semelhantes. Os dados foram analisados pelos testes de McNemar e Fischer. A porcentagem de sucesso do tratamento foi de 98,3%. Uma restauração (Ketac Molar foi

  4. Desenvolvimento gonadal do jundiá, Rhamdia quelen (Teleostei, Siluriformes, em viveiros de terra, na região sul do Brasil = Gonadal development of jundiá, Rhamdia quelen (Teleostei, Siluriformes, in earthen ponds in southern Brazil

    Directory of Open Access Journals (Sweden)

    Luciana Ghiraldelli

    2007-10-01

    Full Text Available O presente estudo caracterizou o desenvolvimento gonadal de jundiá até a maturação sexual, quando cultivados em viveiros de terra, visando subsidiar o desenvolvimento de tecnologia de cultivo para esta espécie na região sul do Brasil. Alevinos de jundiá (peso médio 8 ± 3,73 g foram estocados em três viveiros, na densidade de 0,6indivíduos m-2. Catorze indivíduos foram amostrados mensalmente, de setembro de 2001 a outubro de 2002. Os estádios de maturação gonadal foram caracterizados macroscopicamente, e fragmentos de ovários e testículos de alguns exemplares foram fixados em formalina 4% para análise histológica. Foram analisados 118 exemplares: 60 machos e 58 fêmeas. Os machos apresentaram atividade reprodutiva precoce, quandocomparados às fêmeas. Testículos e ovários apresentaram morfologia similar a de outras espécies de Siluriformes. De acordo com a análise microscópica, as gônadas foram classificadas em quatro estádios de desenvolvimento: imaturo, em maturação inicial, em maturação final e maduro. A relação gonadossomática variou de 0,29 a 9,16 para os machose de 0,11 a 13,03 para as fêmeas. Indivíduos maduros foram observados nos meses de verão (dezembro/2001 e janeiro/2002, outono (abril e maio/2002 e primavera (setembro e outubro/2002, acompanhando o aumento de temperatura.The study characterized the gonadal development of jundiá from approximately 8 g until gonadal maturation, to provide further knowledge for farming jundiá in Southern Brazil. Jundiá fingerlings(average weight 8.00 ± 3.73 g were stocked in three ponds at 0.6 fish m-2. Fourteen fish were sampled each month from September 2001 to October 2002. Gonadal maturation stages were characterized macroscopically, and samples of ovaries and testicles were fixedin 4-%-buffered formalin for histological examination. One hundred and eighteen fish were analyzed: 60 males e 58 females. Jundiá males matured earlier than females. Testicles and

  5. Comparison of the hypothetical (57)Co brachytherapy source with the (192)Ir source.

    Science.gov (United States)

    Toossi, Mohammad Taghi Bahreyni; Ghorbani, Mahdi; Rostami, Atefeh; Khosroabadi, Mohsen; Khademi, Sara; Knaup, Courtney

    2016-01-01

    The (57)Co radioisotope has recently been proposed as a hypothetical brachytherapy source due to its high specific activity, appropriate half-life (272 days) and medium energy photons (114.17 keV on average). In this study, Task Group No. 43 dosimetric parameters were calculated and reported for a hypothetical (57)Co source. A hypothetical (57)Co source was simulated in MCNPX, consisting of an active cylinder with 3.5 mm length and 0.6 mm radius encapsulated in a stainless steel capsule. Three photon energies were utilized (136 keV [10.68%], 122 keV [85.60%], 14 keV [9.16%]) for the (57)Co source. Air kerma strength, dose rate constant, radial dose function, anisotropy function, and isodose curves for the source were calculated and compared to the corresponding data for a (192)Ir source. The results are presented as tables and figures. Air kerma strength per 1 mCi activity for the (57)Co source was 0.46 cGyh(-1) cm 2 mCi(-1). The dose rate constant for the (57)Co source was determined to be 1.215 cGyh(-1)U(-1). The radial dose function for the (57)Co source has an increasing trend due to multiple scattering of low energy photons. The anisotropy function for the (57)Co source at various distances from the source is more isotropic than the (192)Ir source. The (57)Co source has advantages over (192)Ir due to its lower energy photons, longer half-life, higher dose rate constant and more isotropic anisotropic function. However, the (192)Ir source has a higher initial air kerma strength and more uniform radial dose function. These properties make (57)Co a suitable source for use in brachytherapy applications.

  6. Cellulose synthase complex organization and cellulose microfibril structure.

    Science.gov (United States)

    Turner, Simon; Kumar, Manoj

    2018-02-13

    Cellulose consists of linear chains of β-1,4-linked glucose units, which are synthesized by the cellulose synthase complex (CSC). In plants, these chains associate in an ordered manner to form the cellulose microfibrils. Both the CSC and the local environment in which the individual chains coalesce to form the cellulose microfibril determine the structure and the unique physical properties of the microfibril. There are several recent reviews that cover many aspects of cellulose biosynthesis, which include trafficking of the complex to the plasma membrane and the relationship between the movement of the CSC and the underlying cortical microtubules (Bringmann et al. 2012 Trends Plant Sci. 17 , 666-674 (doi:10.1016/j.tplants.2012.06.003); Kumar & Turner 2015 Phytochemistry 112 , 91-99 (doi:10.1016/j.phytochem.2014.07.009); Schneider et al. 2016 Curr. Opin. Plant Biol. 34 , 9-16 (doi:10.1016/j.pbi.2016.07.007)). In this review, we will focus on recent advances in cellulose biosynthesis in plants, with an emphasis on our current understanding of the structure of individual catalytic subunits together with the local membrane environment where cellulose synthesis occurs. We will attempt to relate this information to our current knowledge of the structure of the cellulose microfibril and propose a model in which variations in the structure of the CSC have important implications for the structure of the cellulose microfibril produced.This article is part of a discussion meeting issue 'New horizons for cellulose nanotechnology'. © 2017 The Author(s).

  7. [Acute meningitis in Córdoba, Colombia (2002-2004)].

    Science.gov (United States)

    Tique, Vaneza; Alvis, Nelson; Parodi, Renata; Bustos, Alvaro; Mattar, Salim

    2006-05-01

    Establishing characteristic epidemiologic and microbiologic features of acute meningitis in the Córdoba department. A descriptive epidemiological study was carried out between June 2002 and June 2004 at the Hospital San Jerónimo in Montería. All suspicious cases of meningitis were included; laboratory tests included cytological smear, biochemistry, latex, Gram stain and culture. 57 (11.3%) and 85 (16.8%) of the 503 samples of cerebrum spinal fluid (CSF) were confirmed by culture as being probable cases. There were 6 cases of polymicrobial infection, making a total of 63 isolates: 17 non-fermenting Gram-negative bacilli (26.9%), 16 Streptococcus pneumoniae (25.4%), 7 Enterobacteriaceae (11%), 5 Criptococcus neoformans (8%) 4 Neisseria meningitidis serotype B (6.3%), 3 S. viridans (4.8%), 2 Streptococcus group B (3.2%), 2 Haemophilus influenzae type B (3.2%), 2 Staphylococcus negative coagulase (3.2%), 2 S. aureus (3.2%), 2 Enterococcus (3.2%) and 1 Candida albicans (1.6%). The S. Pneumoniae serotypes found were: 5 (n=4), 23F (n=3), 14 (n=2), 18C (n=2), 18A (n=l1, 17F (n=l1, 1 (n=1). The study led to determining epidemiological and microbiological aspects of acute meningitis in the Códoba department which had been unknown up to now. Streptococcus pneumoniae (25.4% was the main aetiological agent of meningitis; the epidemiologic aspects so established confirmed the need for strengthening and implementing measures for controlling meningitis in C6ódoba and its surveillance there.

  8. Nurses exposure to workplace violence in a large teaching hospital in Iran.

    Science.gov (United States)

    Teymourzadeh, Ehsan; Rashidian, Arash; Arab, Mohammad; Akbari-Sari, Ali; Hakimzadeh, Seyyed Mostafa

    2014-11-01

    Workplace violence is one of the factors which can strongly reduce job satisfaction and the quality of working life of nurses. The aim of this study was to measure nurses' exposure to workplace violence in one of the major teaching hospitals in Tehran in 2010. We surveyed the nurses in a cross-sectional design in 2010. The questionnaire was adapted from a standardized questionnaire designed collaboratively by the International Labor Office (ILO), the International Health Organization (IHO), the International Council of Nurses (ICN), and the Public Services International (PSI). Finally, in order to analyze the relationships among different variables in the study, T-test and Chi-Square test were used. Three hundred and one nurses responded to the questionnaire (a response rate of 73%). Over 70% of the nurses felt worried about workplace violence. The participants reported exposure to verbal abuse (64% CI: 59-70%), bullying-mobbing (29% CI: 24-34%) and physical violence (12% CI: 9-16%) at least once during the previous year. Relatives of hospital patients were responsible for most of the violence. Nurses working in the emergency department and outpatient clinics were more likely to report having experienced violence. Nurses were unlikely to report violence to hospital managers, and 40% of nurses were unaware of any existing policies within the hospital for reducing violence. We observed a considerable level of nurse exposure to workplace violence. The high rate of reported workplace violence demonstrates that the existing safeguards that aim to protect the staff from abusive patients and relatives are inadequate.

  9. Nanodefects of membranes cause destruction of packed red blood cells during long-term storage

    International Nuclear Information System (INIS)

    Kozlova, Elena; Chernysh, Aleksandr; Moroz, Victor; Sergunova, Victoria; Gudkova, Olga; Kuzovlev, Artem

    2015-01-01

    Packed red blood cells (PRBC) are used for blood transfusion. PRBC were stored for 30 days under 4 °C in hermetic blood bags with CPD anticoagulant-preservative solution. Hematocrit was 50–55%. The distortions of PRBC membranes nanostructure and cells morphology during storage were studied by atomic force microscopy. Basic measurements were performed at the day 2, 6, 9, 16, 23 and 30 of storage and additionally 2–3 days after it. Topological defects occurred on RBC membranes by day 9. They appeared as domains with grain-like structures (“grains”) sized up to 200 nm. These domains were appeared in almost all cells. Later these domains merged and formed large defects on cells. It was the formation of domains with the “grains” which was onset process leading eventually to destruction of PRBC. Possible mechanisms of transformation of PRBC and their membrane are related to the alterations of spectrin cytoskeleton. During this storage period potassium ions and lactat concentrations increased, pH decreased, intracellular concentration of reduced glutathione diminished in the preservative solution. Changes of PRBC morphology were detected within the entire period of PRBC storage. Discocytes predominated at the days 1 and 2. By day 30 PRBC transformed into irreversible echinocytes and spheroechinocytes. Study of defects of membranes nanostructure may form the basis of assessing the quality of the stored PRBC. This method may allow to work out the best recommendations for blood transfusion. - Highlights: • Domains with “grains” are formed on membranes surface on 9–16 days of PRBC storage. • The development of domains is the reason of irreversible changes of PRBC structure. • The origin of domains is the consequence of alterations of spectrin cytoskeleton. • Study of nanostructure may form basis of assessing the quality of the stored PRBC

  10. Uterine contractions evaluated on cine MR imaging in patients with uterine leiomyomas

    International Nuclear Information System (INIS)

    Nishino, Mizuki; Togashi, Kaori; Nakai, Asako; Hayakawa, Katsumi; Kanao, Shotarou; Iwasaku, Kazuhiro; Fujii, Shingo

    2005-01-01

    Purpose: Submucosal leiomyoma is one of the most recognized causes of infertility and habitual abortion. The purpose of this study is to evaluate uterine peristalsis, a cycle-related inherent contractility of uterus probably responsible for sperm transport and conservation of pregnancy, in patients with uterine leiomyomas using cine magnetic resonance (MR) imaging. Materials and methods: Study population consisted of 26 female patients (age range: 19-51 years, mean: 41 years), in which 16 patients had submucosal leiomyomas and 10 patients had intramural or subserosal leiomyomas. We prospectively performed MR imaging of the midsagittal plane of uterus using 1.5 T magnet (Symphony, Siemens Medical Systems) with a body array coil, and obtained 60 half-Fourier acquisition single shot turbo spin echo (HASTE) images (Echo time=80 ms, FOV=300 mm, slice thickness 5 mm, matrix 256x256) within 2 min, and displayed them on cine mode at 12x faster than real speed. Evaluated were peristaltic movements at the endometral-myometrial junction and focal myometrial movements, adjacent to leiomyomas, regarding presence, direction, frequency, and conduction. Results: The peristaltic movements were identified in 12/16 patients with submucosal lesions and 10/10 with other leiomyomas. The frequency and direction were cycle-related. Loss of peristalsis was noted adjacent to submucosal myomas in 4/12 patients, but was not in others. Focal myometrial movements were noted in 9/16 patients with submucosal myomas, but not in others. Conclusions: Uterine peristaltic movements were partly interrupted by submucosal leiomoymas, but not by myometrial or subserosal leiomyomas. Loss of peristalsis and focal myometrial movements was noted only adjacent to submucosal leiomyomas. These findings are considered to represent dysfunctional contractility, and may be related with pregnancy loss

  11. Optimising diffusion-weighted MR imaging for demonstrating pancreatic cancer: a comparison of respiratory-triggered, free-breathing and breath-hold techniques

    Energy Technology Data Exchange (ETDEWEB)

    Kartalis, Nikolaos; Loizou, Louiza; Edsborg, Nick; Albiin, Nils [Karolinska University Hospital, Division of Medical Imaging and Technology, Department of Clinical Science, Intervention and Technology (CLINTEC), Karolinska Institutet, Stockholm (Sweden); Segersvaerd, Ralf [Karolinska University Hospital, Division of Surgery, Department of Clinical Science, Intervention and Technology (CLINTEC), Karolinska Institutet, Stockholm (Sweden)

    2012-10-15

    To compare respiratory-triggered, free-breathing, and breath-hold DWI techniques regarding (1) image quality, and (2) signal intensity (SI) and ADC measurements in pancreatic ductal adenocarcinoma (PDAC). Fifteen patients with histopathologically proven PDAC underwent DWI prospectively at 1.5 T (b = 0, 50, 300, 600 and 1,000 s/mm{sup 2}) with the three techniques. Two radiologists, independently and blindly, assigned total image quality scores [sum of rating diffusion images (lesion detection, anatomy, presence of artefacts) and ADC maps (lesion characterisation, overall image quality)] per technique and ranked them. The lesion SI, signal-to-noise ratio, mean ADC and coefficient of variation (CV) were compared. Total image quality scores for respiratory-triggered, free-breathing and breath-hold techniques were 17.9, 16.5 and 17.1 respectively (respiratory-triggered was significantly higher than free-breathing but not breath-hold). The respiratory-triggered technique had a significantly higher ranking. Lesion SI on all b-values and signal-to-noise ratio on b300 and b600 were significantly higher for the respiratory-triggered technique. For respiratory-triggered, free-breathing and breath-hold techniques the mean ADCs were 1.201, 1.132 and 1.253 x 10{sup -3} mm{sup 2}/s, and mean CVs were 8.9, 10.8 and 14.1 % respectively (respiratory-triggered and free-breathing techniques had a significantly lower mean CV than the breath-hold technique). In both analyses, respiratory-triggered DWI showed superiority and seems the optimal DWI technique for demonstrating PDAC. (orig.)

  12. Aortic root replacement after previous surgical intervention on the aortic valve, aortic root, or ascending aorta.

    Science.gov (United States)

    Kirsch, E W Matthias; Radu, N Costin; Mekontso-Dessap, Armand; Hillion, Marie-Line; Loisance, Daniel

    2006-03-01

    Aortic root replacement after a previous operation on the aortic valve, aortic root, or ascending aorta remains a major challenge. Records of 56 consecutive patients (44 men; mean age, 56.4 +/- 13.6 years) undergoing reoperative aortic root replacement between June 1994 and June 2005 were reviewed retrospectively. Reoperation was performed 9.4 +/- 6.7 years after the last cardiac operation. Indications for reoperation were true aneurysm (n = 14 [25%]), false aneurysm (n = 10 [18%]), dissection or redissection (n = 9 [16%]), structural or nonstructural valve dysfunction (n = 10 [18%]), prosthetic valve-graft infection (n = 12 [21%]), and miscellaneous (n = 1 [2%]). Procedures performed were aortic root replacement (n = 47 [84%]), aortic root replacement plus mitral valve procedure (n = 5 [9%]), and aortic root replacement plus arch replacement (n = 4 [7%]). In 14 (25%) patients coronary artery bypass grafting had to be performed unexpectedly during the same procedure or immediately after the procedure to re-establish coronary perfusion. Hospital mortality reached 17.9% (n = 10). Multivariate logistic regression analysis revealed the need for unplanned perioperative coronary artery bypass grafting as the sole independent risk factor for hospital death (P = .005). Actuarial survival was 83.8% +/- 4.9% at 1 month, 73.0% +/- 6.3% at 1 year, and 65.7% +/- 9.0% at 5 years after the operation. One patient had recurrence of endocarditis 6.7 months after the operation and required repeated homograft aortic root replacement. Reoperative aortic root replacement remains associated with a high postoperative mortality. The need to perform unplanned coronary artery bypass grafting during reoperative aortic root replacement is a major risk factor for hospital death. The optimal technique for coronary reconstruction in this setting remains to be debated.

  13. Reliability and convergent validity of the five-step test in people with chronic stroke.

    Science.gov (United States)

    Ng, Shamay S M; Tse, Mimi M Y; Tam, Eric W C; Lai, Cynthia Y Y

    2018-01-10

    (i) To estimate the intra-rater, inter-rater and test-retest reliabilities of the Five-Step Test (FST), as well as the minimum detectable change in FST completion times in people with stroke. (ii) To estimate the convergent validity of the FST with other measures of stroke-specific impairments. (iii) To identify the best cut-off times for distinguishing FST performance in people with stroke from that of healthy older adults. A cross-sectional study. University-based rehabilitation centre. Forty-eight people with stroke and 39 healthy controls. None. The FST, along with (for the stroke survivors only) scores on the Fugl-Meyer Lower Extremity Assessment (FMA-LE), the Berg Balance Scale (BBS), Limits of Stability (LOS) tests, and Activities-specific Balance Confidence (ABC) scale were tested. The FST showed excellent intra-rater (intra-class correlation coefficient; ICC = 0.866-0.905), inter-rater (ICC = 0.998), and test-retest (ICC = 0.838-0.842) reliabilities. A minimum detectable change of 9.16 s was found for the FST in people with stroke. The FST correlated significantly with the FMA-LE, BBS, and LOS results in the forward and sideways directions (r = -0.411 to -0.716, p people with stroke and healthy older adults. The FST is a reliable, easy-to-administer clinical test for assessing stroke survivors' ability to negotiate steps and stairs.

  14. Synthetic Cu 0.507(5)Pb 8.73(9)Sb 8.15(8)I 1.6S 20.0(2) nanowires

    Science.gov (United States)

    Kryukova, Galina N.; Heuer, Matthias; Wagner, Gerald; Doering, Thomas; Bente, Klaus

    2005-01-01

    Nanowires of an iodine containing Pb-Sb-sulfosalt have been synthesized by chemical vapor transport. Their structure was studied using high-resolution transmission electron microscopy and X-ray powder diffraction. The lattice parameters show values equal to a=4.9801(4) nm, b=0.41132(8) nm (with two-fold superstructure), c=2.1989(1) nm and β=99.918(6)°. These parameters and the results of a multislice simulation are in good agreement with the mineral pillaite, Cu 0.10Pb 9.16Sb 9.84S 22.94Cl 1.06O 0.5 (space group C2/m, a=4.949(1) nm, b=0.41259(8) nm, c=2.1828(4) nm, and β=99.62(3)°). Microprobe and EDX analyses yielded a chemical composition of Cu 0.507(5)Pb 8.73(9)Sb 8.15(8)I 1.6S 20.0(2) which is close to natural pillaite but contains no oxygen and iodine instead of chlorine. The structure of the investigated material is based on chains of M-S polyhedra ( M=Pb or Sb) typical for the architecture of sulfosalts implying iodine atoms in trigonal prismatic coordination with Pb atoms from the M-S polyhedra of neighboring chains. The [010] superstructure of the specimen was found to be unstable under electron beam irradiation with a rapid decrease of the b lattice parameter from 0.8 to 0.4 nm within 5 min.

  15. Synthetic Cu0.507(5)Pb8.73(9)Sb8.15(8)I1.6S20.0(2) nanowires

    International Nuclear Information System (INIS)

    Kryukova, Galina N.; Heuer, Matthias; Wagner, Gerald; Doering, Thomas; Bente, Klaus

    2005-01-01

    Nanowires of an iodine containing Pb-Sb-sulfosalt have been synthesized by chemical vapor transport. Their structure was studied using high-resolution transmission electron microscopy and X-ray powder diffraction. The lattice parameters show values equal to a=4.9801(4)nm, b=0.41132(8)nm (with two-fold superstructure), c=2.1989(1)nm and β=99.918(6) o . These parameters and the results of a multislice simulation are in good agreement with the mineral pillaite, Cu 0.10 Pb 9.16 Sb 9.84 S 22.94 Cl 1.06 O 0.5 (space group C2/m, a=4.949(1)nm, b=0.41259(8)nm, c=2.1828(4)nm, and β=99.62(3) o ). Microprobe and EDX analyses yielded a chemical composition of Cu 0.507(5) Pb 8.73(9) Sb 8.15(8) I 1.6 S 20.0(2) which is close to natural pillaite but contains no oxygen and iodine instead of chlorine. The structure of the investigated material is based on chains of M-S polyhedra (M=Pb or Sb) typical for the architecture of sulfosalts implying iodine atoms in trigonal prismatic coordination with Pb atoms from the M-S polyhedra of neighboring chains. The [010] superstructure of the specimen was found to be unstable under electron beam irradiation with a rapid decrease of the b lattice parameter from 0.8 to 0.4nm within 5min

  16. High-antibacterial activity of Urtica spp. seed extracts on food and plant pathogenic bacteria.

    Science.gov (United States)

    Körpe, Didem Aksoy; İşerı, Özlem Darcansoy; Sahin, Feride Iffet; Cabi, Evren; Haberal, Mehmet

    2013-05-01

    The aim of this study was to comparatively evaluate antibacterial activities of methanol (MetOH) and aqueous (dw) leaf (L), root (R) and seed (S) extracts of Urtica dioica L. (Ud; stinging nettle) and Urtica pilulifera L. (Up; Roman nettle) on both food- and plant-borne pathogens, with total phenolic contents and DPPH radical scavenging activities (DRSA). MetOH extracts of leaves and roots of U. dioica had the highest DRSA. Extracts with high antibacterial activity were in the order Up-LMetOH (13/16) > Ud-SMetOH (11/16) > Up-SMetOH (9/16). Results obtained with Up-SMetOH against food spoiling Bacillus pumilus, Shigella spp. and Enterococcus gallinarum with minimum inhibitory concentrations (MICs) in 128-1024 μg/ml range seem to be promising. Up-SMetOH also exerted strong inhibition against Clavibacter michiganensis with a considerably low MIC (32 μg/ml). Ud-SMetOH and Up-LMetOH were also effective against C. michiganensis (MIC = 256 and 1024 μg/ml, respectively). Ud-SMetOH and Ud-RMetOH had also antimicrobial activity against Xanthomonas vesicatoria (MIC = 512 and 1024 μg/ml, respectively). Results presented here demonstrate high-antibacterial activity of U. pilulifera extracts and U. dioica seed extract against phytopathogens for the first time, and provide the most comprehensive data on the antibacterial activity screening of U. pilulifera against food-borne pathogens. Considering limitations in plant disease control, antibacterial activities of these extracts would be of agricultural importance.

  17. Prenatal vitamin C and E supplementation in smokers is associated with reduced placental abruption and preterm birth: a secondary analysis.

    Science.gov (United States)

    Abramovici, A; Gandley, R E; Clifton, R G; Leveno, K J; Myatt, L; Wapner, R J; Thorp, J M; Mercer, B M; Peaceman, A M; Samuels, P; Sciscione, A; Harper, M; Saade, G; Sorokin, Y

    2015-12-01

    Smoking and pre-eclampsia (PE) are associated with increases in preterm birth, placental abruption and low birthweight. We evaluated the relationship between prenatal vitamin C and E (C/E) supplementation and perinatal outcomes by maternal self-reported smoking status focusing on outcomes known to be impacted by maternal smoking. A secondary analysis of a multi-centre trial of vitamin C/E supplementation starting at 9-16 weeks in low-risk nulliparous women with singleton gestations. We examined the effect of vitamin C/E by smoking status at randomisation using the Breslow-Day test for interaction. The trial's primary outcomes were PE and a composite outcome of pregnancy-associated hypertension (PAH) with serious adverse outcomes. Perinatal outcomes included preterm birth and abruption. There were no differences in baseline characteristics within subgroups (smokers versus nonsmokers) by vitamin supplementation status. The effect of prenatal vitamin C/E on the risk of PE (P = 0.66) or PAH composite outcome (P = 0.86) did not differ by smoking status. Vitamin C/E was protective for placental abruption in smokers (relative risk [RR] 0.09; 95% CI 0.00-0.87], but not in nonsmokers (RR 0.92; 95% CI 0.52-1.62) (P = 0.01), and for preterm birth in smokers (RR 0.76; 95% CI 0.58-0.99) but not in nonsmokers (RR 1.03; 95% CI 0.90-1.17) (P = 0.046). In this cohort of women, smoking was not associated with a reduction in PE or the composite outcome of PAH. Vitamin C/E supplementation appears to be associated with a reduction in placental abruption and preterm birth among smokers. © 2014 Royal College of Obstetricians and Gynaecologists.

  18. CHANGES OF SUCROSE CONTENT AND INVERTASE ACTIVITY DURING SUGARCANE STEM STORAGE

    Directory of Open Access Journals (Sweden)

    Tri Agus Siswoyo

    2016-10-01

    Full Text Available Invertases (beta-D-fructofuranosidase, E.C. 3.2.1.26 are the key enzymes involved in sucrose metabolism in sugarcane plants. They are highly correlated with sucrose and reducing sugar contents during plant growth. The sugarcane plants have two kinds of invertases, namely neutral invertase (NI and acid invertase (AI. They have different function in sucrose accumulation. The research aimed to study the role of AI and NI in accumulation of reducing sugar during storage of sugarcane stems. Plant materials of 18-month-old field grown sugarcane of the commercial variety R-579 (wet-land and M 442-51 (dry-land were used. Three internodes were sampled to represent immature (internode 1-8/F1, maturing (internode 9-16/F2, and mature (internode 17-24/F3 stem tissues. All tissues were stored for 0-9 days at room temperature (28-32oC and each day, the samplewas extracted to determine invertase activity, total soluble protein, and sugar contents. This observation was valid for invertase activity expressed on a protein basis. At the initiateharvested (0-3 days, NI had a higher specific activity than AI in the sucrose-accumulating region of the sugarcane stems. Negative significant correlation was found between NI specific activity and sucrose accumulation (r2 = 0.41, P < 0.05. AI showed a higher specific activity after 4 days harvested and had negative correlation with sucrose accumulation (r2 = 0.40, P < 0.05. These results showed that NI could be more  responsible in sucrose hydrolisis than AI at early storage of sugarcane stems.

  19. Costs and Outcomes of Increasing Access to Bariatric Surgery: Cohort Study and Cost-Effectiveness Analysis Using Electronic Health Records.

    Science.gov (United States)

    Gulliford, Martin C; Charlton, Judith; Prevost, Toby; Booth, Helen; Fildes, Alison; Ashworth, Mark; Littlejohns, Peter; Reddy, Marcus; Khan, Omar; Rudisill, Caroline

    2017-01-01

    To estimate costs and outcomes of increasing access to bariatric surgery in obese adults and in population subgroups of age, sex, deprivation, comorbidity, and obesity category. A cohort study was conducted using primary care electronic health records, with linked hospital utilization data, for 3,045 participants who underwent bariatric surgery and 247,537 participants who did not undergo bariatric surgery. Epidemiological analyses informed a probabilistic Markov model to compare bariatric surgery, including equal proportions with adjustable gastric banding, gastric bypass, and sleeve gastrectomy, with standard nonsurgical management of obesity. Outcomes were quality-adjusted life-years (QALYs) and net monetary benefits at a threshold of £30,000 per QALY. In a UK population of 250,000 adults, there may be 7,163 people with morbid obesity including 1,406 with diabetes. The immediate cost of 1,000 bariatric surgical procedures is £9.16 million, with incremental discounted lifetime health care costs of £15.26 million (95% confidence interval £15.18-£15.36 million). Patient-years with diabetes mellitus will decrease by 8,320 (range 8,123-8,502). Incremental QALYs will increase by 2,142 (range 2,032-2,256). The estimated cost per QALY gained is £7,129 (range £6,775-£7,506). Net monetary benefits will be £49.02 million (range £45.72-£52.41 million). Estimates are similar for subgroups of age, sex, and deprivation. Bariatric surgery remains cost-effective if the procedure is twice as costly, or if intervention effect declines over time. Diverse obese individuals may benefit from bariatric surgery at acceptable cost. Bariatric surgery is not cost-saving, but increased health care costs are exceeded by health benefits to obese individuals. Copyright © 2017 International Society for Pharmacoeconomics and Outcomes Research (ISPOR). Published by Elsevier Inc. All rights reserved.

  20. Does Increasing the Dose of Abobotulinumtoxina Impact the Duration of Effectiveness for the Treatment of Moderate to Severe Glabellar Lines?

    Science.gov (United States)

    Joseph, John H; Eaton, Laura L; Robinson, James; Pontius, Allison; Williams, Edwin F

    2016-12-01

    To evaluate the duration of effect of a single dose of 120 units of abobotulinumtoxinA for the treatment of moderate to severe glabellar lines. Investigator-initiated, prospective, multi-center, open-label study. This open-label trial of thirty subjects with moderate to severe glabellar lines at maximum frown was per- formed at 2 private plastic surgery clinics. 120 units of abobotulinumtoxinA was injected in 5 equal aliquots (24 units each) into each of 5 injection sites in the glabellar complex. Investigator and subject assessments of wrinkle severity at maximum frown and repose using 4-point scales and adverse events were conducted. Follow-up was monthly for up to 11 months. The median duration of response for all subjects, as assessed by the investigator, was 150 days (95% CI: 120, 180). The median duration of response was 165 days (95% CI: 90, 180) for subjects with Grade 2 (Moderate) wrinkles at baseline and 75 days (95% CI: 30, 120) for subjects with Grade 3 (Severe) wrinkles at baseline. Overall, 76.7% of subjects had a duration of ≥ 120 days. At the end of study (day 300) 9/16 (53%) of subjects who were Grade 3 at baseline still rated themselves as not returning to Grade 3, demonstrating ongoing improvement. Adverse events were mild and transient. There were no events of lid or brow ptosis. The 120 units of abobotulinumtoxinA were significantly effective in reducing glabellar lines in subjects with Grade 2 (Moderate) wrinkles at baseline for a longer duration than the reported 85 days in the FDA Phase III randomized, placebo-controlled clinical studies using a standard 50 unit dose. Subject satisfaction was high. There was no increase in the incidence of adverse events with this higher dose. J Drugs Dermatol. 2016;15(12):1544-1549.

  1. Relative equilibrium plot improves graphical analysis and allows bias correction of standardized uptake value ratio in quantitative 11C-PiB PET studies.

    Science.gov (United States)

    Zhou, Yun; Sojkova, Jitka; Resnick, Susan M; Wong, Dean F

    2012-04-01

    Both the standardized uptake value ratio (SUVR) and the Logan plot result in biased distribution volume ratios (DVRs) in ligand-receptor dynamic PET studies. The objective of this study was to use a recently developed relative equilibrium-based graphical (RE) plot method to improve and simplify the 2 commonly used methods for quantification of (11)C-Pittsburgh compound B ((11)C-PiB) PET. The overestimation of DVR in SUVR was analyzed theoretically using the Logan and the RE plots. A bias-corrected SUVR (bcSUVR) was derived from the RE plot. Seventy-eight (11)C-PiB dynamic PET scans (66 from controls and 12 from participants with mild cognitive impaired [MCI] from the Baltimore Longitudinal Study of Aging) were acquired over 90 min. Regions of interest (ROIs) were defined on coregistered MR images. Both the ROI and the pixelwise time-activity curves were used to evaluate the estimates of DVR. DVRs obtained using the Logan plot applied to ROI time-activity curves were used as a reference for comparison of DVR estimates. Results from the theoretic analysis were confirmed by human studies. ROI estimates from the RE plot and the bcSUVR were nearly identical to those from the Logan plot with ROI time-activity curves. In contrast, ROI estimates from DVR images in frontal, temporal, parietal, and cingulate regions and the striatum were underestimated by the Logan plot (controls, 4%-12%; MCI, 9%-16%) and overestimated by the SUVR (controls, 8%-16%; MCI, 16%-24%). This bias was higher in the MCI group than in controls (P bias and higher consistency of DVR estimates than of SUVR. The RE plot and the bcSUVR are practical quantitative approaches that improve the analysis of (11)C-PiB studies.

  2. Evaluation of the Roche LightMix Gastro parasites multiplex PCR assay detecting Giardia duodenalis, Entamoeba histolytica, cryptosporidia, Dientamoeba fragilis, and Blastocystis hominis.

    Science.gov (United States)

    Friesen, J; Fuhrmann, J; Kietzmann, H; Tannich, E; Müller, M; Ignatius, R

    2018-03-23

    Multiplex PCR assays offer highly sensitive and specific tools for the detection of enteric pathogens. This prospective study aimed at comparing the novel Roche LightMix Modular Assay Gastro Parasites (LMAGP) detecting Giardia duodenalis, Entamoeba histolytica, Cryptosporidium spp., Blastocystishominis, and Dientamoebafragilis with routine laboratory procedures. Stool specimens (n = 1062 from 1009 patients) were consecutively examined by LMAGP, R-Biopharm Ridascreen enzyme immunoassays (EIAs) detecting G. duodenalis or E. histolytica/dispar, and microscopy of wet mounts. Discrepant results were analysed by in-house PCR. D. fragilis or B. hominis were detected by LMAGP in 131 (14.4%) and 179 (19.9%; 16 samples positive by microscopy; p PCR). G. duodenalis was detected by LMAGP, EIA, or microscopy in 20, 16, or 9 of 1039 stool samples, respectively; all four samples missed by EIA were confirmed by in-house PCR. In total, 938 stool samples were analysed for E. histolytica/dispar. Nine of ten EIA-positive samples were negative by LMAGP but positive by in-house PCR for E. dispar. One E. histolytica infection (positive by both LMAGP and in-house PCR) was missed by EIA and microscopy. Parasites only detected by microscopy included Enterobius vermicularis eggs (n = 3) and apathogenic amoebae (n = 27). The data call for routine use of multiplex PCR assays for the detection of enteric protozoan parasites in laboratory diagnostics. Copyright © 2018 European Society of Clinical Microbiology and Infectious Diseases. Published by Elsevier Ltd. All rights reserved.

  3. Review: Diagnostic accuracy of PCR-based detection tests for Helicobacter Pylori in stool samples.

    Science.gov (United States)

    Khadangi, Fatemeh; Yassi, Maryam; Kerachian, Mohammad Amin

    2017-12-01

    Although different methods have been established to detect Helicobacter pylori (H. pylori) infection, identifying infected patients is an ongoing challenge. The aim of this meta-analysis was to provide pooled diagnostic accuracy measures for stool PCR test in the diagnosis of H. pylori infection. In this study, a systematic review and meta-analysis were carried out on various sources, including MEDLINE, Web of Sciences, and the Cochrane Library from April 1, 1999, to May 1, 2016. This meta-analysis adheres to the guidelines provided by the Preferred Reporting Items for Systematic Reviews and Meta-Analyses report (PRISMA Statement). The clinical value of DNA stool PCR test was based on the pooled false positive, false negative, true positive, and true negative of different genes. Twenty-six of 328 studies identified met the eligibility criteria. Stool PCR test had a performance of 71% (95% CI: 68-73) sensitivity, 96% (95% CI: 94-97) specificity, and 65.6 (95% CI: 30.2-142.5) diagnostic odds ratio (DOR) in diagnosis of H. pylori. The DOR of genes which showed the highest performance of stool PCR tests was as follows: 23S rRNA 152.5 (95% CI: 55.5-418.9), 16S rRNA 67.9 (95%CI: 6.4-714.3), and glmM 68.1 (95%CI: 20.1-231.7). The sensitivity and specificity of stool PCR test are relatively in the same spectrum of other diagnostic methods for the detection of H. pylori infection. In descending order of significance, the most diagnostic candidate genes using PCR detection were 23S rRNA, 16S rRNA, and glmM. PCR for 23S rRNA gene which has the highest performance could be applicable to detect H. pylori infection. © 2017 John Wiley & Sons Ltd.

  4. Evaluating the effect of rectal distension and rectal movement on prostate gland position using cine MRI

    International Nuclear Information System (INIS)

    Padhani, Anwar R.; Khoo, Vincent S.; Suckling, John; Husband, Janet E.; Leach, Martin O.; Dearnaley, David P.

    1999-01-01

    Purpose: To evaluate the dynamic interrelationship between rectal distension and rectal movements, and to determine the effect of rectal movement on the position of the prostatic gland using cine magnetic resonance imaging (MRI). Methods and Materials: Fifty-five patients with biopsy-proven or suspected prostate cancer were examined in the axial plane using repeated spoiled gradient-echo sequences every 10 seconds for 7 minutes. Twenty-four patients received bowel relaxants before imaging. Images were analyzed for the degree of rectal distension, for the incidence, magnitude, and number of rectal and prostate movements. Results: Rectal movements were seen in 28 (51%) patients overall, in 10 (42%) of those receiving bowel relaxants and in 18 (58%) not receiving bowel relaxants. The incidence of rectal movements correlated with the degree of rectal distension (p = 0.0005), but the magnitude of rectal movements did not correlate with the degree of rectal distension. Eighty-six rectal movements resulting in 33 anterior-posterior (AP) prostate movements were seen. The magnitude of rectal movements correlated well with degree of prostate movements (p < 0.001). Prostate movements in the AP direction were seen in 16 (29%) patients, and in 9 (16%) patients the movement was greater than 5 mm. The median prostate AP displacement was anterior by 4.2 (-5 to +14 mm). Conclusions: Cine MRI is able to demonstrate near real time rectal and associated prostate movements. Rectal movements are related to rectal distension and result in significant displacements of the prostate gland over a time period similar to that used for daily fractionated radiotherapy treatments. Delivery of radiotherapy needs to take into account these organ movements

  5. The dynamic role of parental influences in preventing adolescent smoking initiation.

    Science.gov (United States)

    Mahabee-Gittens, E Melinda; Xiao, Yang; Gordon, Judith S; Khoury, Jane C

    2013-04-01

    As adolescents grow, protective parental influences become less important and peer influences take precedence in adolescent's initiation of smoking. It is unknown how and when this occurs. We sought to: prospectively estimate incidence rates of smoking initiation from late childhood through mid-adolescence, identify important risk and protective parental influences on smoking initiation, and examine their dynamic nature in order to identify key ages. Longitudinal data from the National Survey of Parents and Youth of 8 nationally representative age cohorts (9-16 years) of never smokers in the U.S. were used (N=5705 dyads at baseline). Analysis involved a series of lagged logistic regression models using a cohort-sequential design. The mean sample cumulative incidence rates of tobacco use increased from 1.8% to 22.5% between the 9 and 16 years old age cohorts. Among risk factors, peer smoking was the most important across all ages; 11-15 year-olds who spent time with peers who smoked had 2 to 6.5 times higher odds of initiating smoking. Parent-youth connectedness significantly decreased the odds of smoking initiation by 14-37% in 11-14 year-olds; parental monitoring and punishment for smoking decreased the odds of smoking initiation risk by 36-59% in 10-15 year-olds, and by 15-28% in 12-14 year-olds, respectively. Parental influences are important in protecting against smoking initiation across adolescence. At the same time, association with peers who smoke is a very strong risk factor. Our findings provide empirical evidence to suggest that in order to prevent youth from initiating smoking, parents should be actively involved in their adolescents' lives and guard them against association with peers who smoke. Copyright © 2013 Elsevier Ltd. All rights reserved.

  6. Obesity and overweight prevalence and its association with undiagnosed hypertension in Shanghai population, China: a cross-sectional population-based survey.

    Science.gov (United States)

    Li, Xinjian; Xu, Jiying; Yao, Haihong; Guo, Yanfei; Chen, Minna; Lu, Wei

    2012-09-01

    The aim of this study was to determine the prevalence of overweight and obese subjects in the Shanghai population of China and its association with undiagnosed hypertension, by taking age, gender and place of residence (urban or suburban) into account. A cross-sectional population-based survey was conducted in 2007. The sample included 13,359 participants aged 15-69 years.Weight, height, and blood pressure were recorded, and information about gender, age and place of residence was obtained. Overweight and obesity prevalence were calculated by the body mass index (BMI) definition recommended by Working Group on Obesity in China (normal weight, 18.5-23.9 kg/m(2); overweight, 24-27.9 kg/m(2); obesity, ≥ 28 kg/m(2)). Undiagnosed hypertension was defined by China criteria in accord with that of WHO-ISH (subjects with systolic pressure ≥ 140 mmHg, and/or diastolic pressure ≥ 90 mmHg). Multiple logistic regression analyses were used to assess the association of overweight or obesity with undiagnosed hypertension by adjusting for age, gender and place of residence. The overall overweight, obesity, and undiagnosed hypertension prevalence were 27.6% (95% CI: 26.8-28.4), 6.6% (95% CI: 6.2-7.0), and 15.5% (95% CI: 14.9-16.1), respectively. Compared to normal weight subjects, the odds ratios (OR) for subjects who were overweight and had hypertension was 2.33 (95% CI: 2.10-2.59); that for obesity and hypertension was 4.27 (95% CI: 3.66-4.99). These data suggest that overweight and obesity prevalence and their association with undiagnosed hypertension are high in our study population.

  7. [Cinnamon rolls are not associated with admission for toxic or alcoholic hepatitis in a Danish liver referral centre].

    Science.gov (United States)

    Gr Ønbæk, Henning; Borre, Mette

    2014-12-08

    Cinnamon contains cumarin, which may be toxic to the liver. EU-regulations standardardize the amount of cinnamon in pastry including cinnamon rolls. The aim of the study was to investigate if cinnamon intake from pastry was associated with toxic or alcoholic hepatitis. We registered 58 patients with toxic hepatitis, 38 (66%) women and 20 (34%) men with a median age of 51 (range: 32-80) and 53 (range: 18-78) years, respectively. A total of 22 patients had primarily cholestasis and 36 had hepatitis biochemically. The duration of toxic liver disease from admission to normalization of liver enzymes was similar in the two groups (3.5 ± 3.5 vs 3.6 ± 3.5 months). Toxic hepatitis was most often caused by drugs e.g. NSAID (n = 15; 26%), antibiotics (n = 9; 16%), alternative medicine (n = 7; 12%) and Antabuse (n = 5; 9%). We registered eight patients admitted with severe alcoholic hepatitis, five men and three women, median age of 60 (range: 34-67) years. Alcoholic hepatitis was associated with high alcohol intake. None of the patients with toxic or alcoholic hepatitis reported of excessive intake of cinnamon rolls and there was no evidence of cinnamon added to alcohol of alternative medicine products. Intake of cinnamon from cinnamon rolls is not associated with admission for toxic or alcoholic hepatitis. However, for the diagnosis of toxic liver diseases including alcohol it is very important to have patient information regarding any new drugs, alternative medicine and alcohol intake. Further, other causes of liver diseases should be excluded. not relevant. not relevant.

  8. Disentangling the change-alliance relationship: Observational assessment of the therapeutic alliance during change and stuck episodes.

    Science.gov (United States)

    Mellado, Augusto; Suárez, Nicolás; Altimir, Carolina; Martínez, Claudio; Pérez, Janet; Krause, Mariane; Horvath, Adam

    2017-09-01

    The therapeutic alliance is considered the most robust process variable associated with positive therapeutic outcome in a variety of psychotherapeutic models [Alexander, L. B., & Luborsky, L. (1986). The Penn Helping Alliance Scales. In L. S. Greenberg & W. M. Pinsoff (Eds.), The psychotherapeutic process: A research handbook (pp. 325-356). New York: Guilford Press; Horvath, A. O., Gaston, L., & Luborsky, L. (1993). The alliance as predictor of benefits of counseling and therapy. In N. Miller, L. Luborsky, J. Barber, & J. P. Docherty (Eds.), Psychodynamic treatment research: A handbook for clinical practice (pp. 247-274). New York, NY: Basic Books; Horvath, A. O., Del Re, A. C., Flückiger, C., & Symonds, D. (2011). Alliance in individual psychotherapy. Psychotherapy, 48, 9-16; Orlinky, D., Grawe, K., & Parks, B. (1994). Process and outcome in psychotherapy: Noch einmal. In A. Bergin & J. S. Garfield (Eds.), Handbook of psychotherapy and behaviour change (4th ed., pp. 270-378). New York, NY: Wiley and Sons]. The relationship between alliance and outcome has traditionally been studied based on measures that assess these therapy factors at a global level. However, the specific variations of the alliance process and their association with therapy segments that are relevant for change have not yet been fully examined. The present study examines the variations in the therapeutic alliance in 73 significant in-session events: 35 change and 38 stuck episodes identified through the observation of 14 short-term therapies of different theoretical orientations. Variations in the alliance were assessed using the VTAS-SF [Shelef, K., & Diamond, G. (2008). Short form of the revised Vanderbilt Therapeutic Alliance Scale: Development, reliability, and validity. Psychotherapy Research, 18, 433-443]. Nested analyses (HLM) indicate a statistically significant better quality of the alliance during change episodes.

  9. Review of management and morbidity of pediatric craniopharyngioma patients in a low-middle-income country: a 12-year experience.

    Science.gov (United States)

    Amayiri, Nisreen; Swaidan, Maisa; Yousef, Yocoub; Halalsheh, Hadeel; Abu-Hijlih, Ramiz; Kalaldeh, Sima; Barbar, Maha; Elayyan, Maher; Faqih, Nesreen; Al-Hussaini, Maysa; Mehyar, Mustafa; Bartels, Ute; Drake, James; Musharbash, Awni; Bouffet, Eric

    2017-06-01

    Management of craniopharyngioma in children is challenging, and their quality of life can be significantly affected. Series describing this from low-middle income countries (LMIC) are few. The study provides a retrospective chart review of pediatric patients craniopharyngioma between 2003 and 2014, and treated at King Hussein Cancer Center, Jordan. Twenty-four patients (12 males) were identified. Median age at diagnosis was 7.4 years (0.9-16.4 years). Commonest symptoms were visual impairment and headache (71%). Review of seventeen preoperative MRIs showed hypothalamic involvement in 88% and hydrocephalus in 76%. Thirteen patients (54%) had multiple surgical interventions. Five patients (21%) had initial gross total resection. Eleven patients (46%) received radiotherapy and six (25%) intra-cystic interferon. Five years' survival was 87 ± 7% with a median follow-up of 4.5 years (0.3-12.3 years). Four patients (17%) died; one after post-operative cerebral infarction and three secondary to hypothalamic damage. At their last evaluation, all but one patient required multiple hormonal supplements. Ten patients (42%) had best eye visual acuity (VA) >20/40, and four (16%) were legally blind. Eleven patients (46%) were overweight/obese; one had gastric bypass surgery. Seven patients had hyperlipidemia, and eight developed fatty liver infiltration. Eleven patients (65%) were attending schools and one at college. Nine of the living patients (53%) expressed difficulty to engage in the community. Management of pediatric craniopharyngioma is particularly complex and demanding in LMIC. Multidisciplinary care is integral to optimize the care and minimize the morbidities. A management outline for LMIC is proposed.

  10. Opportunity's View After Drive on Sol 1806 (Stereo)

    Science.gov (United States)

    2009-01-01

    [figure removed for brevity, see original site] Left-eye view of a color stereo pair for PIA11816 [figure removed for brevity, see original site] Right-eye view of a color stereo pair for PIA11816 NASA's Mars Exploration Rover Opportunity used its navigation camera to take the images combined into this stereo, full-circle view of the rover's surroundings just after driving 60.86 meters (200 feet) on the 1,806th Martian day, or sol, of Opportunity's surface mission (Feb. 21, 2009). North is at the center; south at both ends. This view combines images from the left-eye and right-eye sides of the navigation camera. It appears three-dimensional when viewed through red-blue glasses with the red lens on the left. Tracks from the drive extend northward across dark-toned sand ripples and light-toned patches of exposed bedrock in the Meridiani Planum region of Mars. For scale, the distance between the parallel wheel tracks is about 1 meter (about 40 inches). Engineers designed the Sol 1806 drive to be driven backwards as a strategy to redistribute lubricant in the rovers wheels. The right-front wheel had been showing signs of increased friction. The rover's position after the Sol 1806 drive was about 2 kilometer (1.2 miles) south southwest of Victoria Crater. Cumulative odometry was 14.74 kilometers (9.16 miles) since landing in January 2004, including 2.96 kilometers (1.84 miles) since climbing out of Victoria Crater on the west side of the crater on Sol 1634 (August 28, 2008). This view is presented as a cylindrical-perspective projection with geometric seam correction.

  11. Spindle-like thalamocortical synchronization in a rat brain slice preparation.

    Science.gov (United States)

    Tancredi, V; Biagini, G; D'Antuono, M; Louvel, J; Pumain, R; Avoli, M

    2000-08-01

    We obtained rat brain slices (550-650 microm) that contained part of the frontoparietal cortex along with a portion of the thalamic ventrobasal complex (VB) and of the reticular nucleus (RTN). Maintained reciprocal thalamocortical connectivity was demonstrated by VB stimulation, which elicited orthodromic and antidromic responses in the cortex, along with re-entry of thalamocortical firing originating in VB neurons excited by cortical output activity. In addition, orthodromic responses were recorded in VB and RTN following stimuli delivered in the cortex. Spontaneous and stimulus-induced coherent rhythmic oscillations (duration = 0.4-3.5 s; frequency = 9-16 Hz) occurred in cortex, VB, and RTN during application of medium containing low concentrations of the K(+) channel blocker 4-aminopyridine (0.5-1 microM). This activity, which resembled electroencephalograph (EEG) spindles recorded in vivo, disappeared in both cortex and thalamus during application of the excitatory amino acid receptor antagonist kynurenic acid in VB (n = 6). By contrast, cortical application of kynurenic acid (n = 4) abolished spindle-like oscillations at this site, but not those recorded in VB, where their frequency was higher than under control conditions. Our findings demonstrate the preservation of reciprocally interconnected cortical and thalamic neuron networks that generate thalamocortical spindle-like oscillations in an in vitro rat brain slice. As shown in intact animals, these oscillations originate in the thalamus where they are presumably caused by interactions between RTN and VB neurons. We propose that this preparation may help to analyze thalamocortical synchronization and to understand the physiopathogenesis of absence attacks.

  12. Nutritional risk factors and status of serum 25(OH)D levels in patients with breast cancer: A case control study in India.

    Science.gov (United States)

    Sofi, Nighat Y; Jain, Monika; Kapil, Umesh; Seenu, Vuthaluru; Kamal, Vineet Kumar; Pandey, Ravinder Mohan

    2018-01-01

    To study the nutritional risk factors and status of serum 25(OH)D levels in patients with breast cancer. A total of 100 women (cases) with confirmed breast cancer (BC) matched with equal number of healthy females (controls) of similar age and socioeconomic status (SES) were included in study. Controls included were nonbreast cancer patients who accompanied the patients to a tertiary care hospital. All the subjects (cases and controls) were administered a questionnaires to collect data on socioeconomic status, dietary pattern and the frequency of food consumption using a validated food frequency questionnaire. Anthropometric assessment was done for waist and hip circumference to calculate waist to hip ratio (WHR). Non fasting blood samples were collected for serum 25-hydroxyvitamin D [25(OH)D] levels estimation using chemiluminescent immunoassay technique and total serum calcium levels by colorimetric assay technique. Serum 25(OH)D and total calcium levels were expressed in ng/ml and mg/dl. Vitamin D deficiency was defined as per the guidelines set by United States Endocrine Society. The mean age of cases and controls was 45±9 and 46±10 years respectively. On multivariate analysis, an inverse association with BC was found for less frequency of fruits consumption with an adjusted (ORs, 95% CI) (2.7, 0.5-15.7) respectively. Mushroom intake was inversely associated with risk of BC (ORs, 95% CI) (5.6, 1.9-16.6). Saturated fat intake and high WHR were significantly associated with high risk of BC with adjusted ORs, 95% CI of (3.4, 1.4-8.1) and (5, 1.4-17). A significant association (pnutritional risk factors determined by higher WHR was found to be significantly associated with the risk of BC. Copyright © 2016 Elsevier Ltd. All rights reserved.

  13. Determinants of psychoactive substances use among Woldia University students in Northeastern Ethiopia.

    Science.gov (United States)

    Adere, Ashete; Yimer, Nigus Bililign; Kumsa, Henok; Liben, Misgan Legesse

    2017-09-05

    Psychoactive substance use has become a major public health problem among students in Ethiopian universities. Hence, this study aimed to investigate the magnitude and determinants of psychoactive substances use (khat chewing, alcohol drinking and cigarette smoking) among undergraduate students of Woldia University, Ethiopia. Institution based quantitative cross-sectional study was employed on Woldia University students in April 2015. 730 students were included in the study. Data were collected using self-administered questionnaires. EpiData version 3.02 was used to enter data. Then, data were exported to SPSS version 20 for analysis. The lifetime prevalence of alcohol drinking, khat chewing and cigarette smoking among the study students were 33.1, 13 and 7.9%, respectively. Likewise, the current prevalence of alcohol drinking, khat chewing and cigarette smoking was 27.9, 10.4 and 6.4%, respectively. More than half of the surveyed students (59.1%) were introduced to psychoactive substance use by peer pressure. About 66% of the study participants believed that psychoactive substances are important for relaxation, and 19% to relief from stress. Students who were Muslims [adjusted odds ratio (AOR) 3.74, 95% CI (1.57, 8.91)], Oromo ethnic group [AOR 2.63, 95% CI (1.19, 5.81)], ever drunk alcohol [AOR 6.32, 95% CI (2.96, 13.48)] and ever smoked cigarette [AOR: 9.16, 95% CI (4.33, 19.38)] were positively associated with khat chewing. Furthermore, pocket money and ever khat chewing were associated with alcohol drinking and cigarette smoking. This study showed that psychoactive substances use is somewhat prevalent among students in Woldia University. Hence, support of religious institutions in providing education aimed at preventing substance use, establishing and strengthening peer educators in the university are important interventions to tackle psychoactive substances use.

  14. Patient-targeted Googling and social media: a cross-sectional study of senior medical students.

    Science.gov (United States)

    Chester, Aaron N; Walthert, Susan E; Gallagher, Stephen J; Anderson, Lynley C; Stitely, Michael L

    2017-12-04

    Social media and Internet technologies present several emerging and ill-explored issues for a modern healthcare workforce. One issue is patient-targeted Googling (PTG), which involves a healthcare professional using a social networking site (SNS) or publicly available search engine to find patient information online. The study's aim was to address a deficit in data and knowledge regarding PTG, and to investigate medical student use of SNSs due to a close association with PTG. The authors surveyed final year medical students at the Otago Medical School, University of Otago in January 2016. A subset completed focus groups that were analysed using thematic analysis to identify key themes relating to students' attitudes towards PTG, and reasons why they might engage in PTG. Fifty-four students completed the survey (response rate = 65.1%), which showed that PTG was uncommon (n = 9, 16.7%). Attitudes were varied and context dependent. Most participants saw problems with PTG and favoured more explicit guidance on the issue (n = 29, 53.7%). SNS usage was high (n = 51, 94.4%); participants were concerned by the content of their SNS profiles and who they were connecting with online. Participants showing high SNS use were 1.83 times more likely to have conducted PTG than lower use groups. The diverse attitudes uncovered in this study indicated that teaching or guidelines could be useful to healthcare professionals considering PTG. Though ethically problematic, PTG may be important to patient care and safety. The decision to conduct PTG should be made with consideration of ethical principles and the intended use of the information.

  15. People and things. CERN Courier, March 1982, v. 22(2)

    International Nuclear Information System (INIS)

    Anon.

    1982-01-01

    The article reports on achievements of various people, staff changes and position opportunities within the CERN organization and contains news updates on upcoming or past events. From 3-6 May, a 'Workshop on Accelerator Orbit and Particle Tracking Programs' will be held at Brookhaven. The focus will be primarily on computer simulation of non-linear magnetic effects as they influence beam lifetime in storage rings.The 1982 CERN School of Computing will be held from 29 August to 11 September in Zinal, Valais, Switzerland. This will be the seventh such school and will cover topics of current interest in computing which are relevant to data processing needs in high energy physics. This year marks the fiftieth anniversary of the discovery of the neutron by Sir James Chadwick. To commemorate the event, the UK Institute of Physics, in collaboration with the UK Atomic Energy Research Establishment at Harwell, is organizing an international conference at Cambridge from 13-17 September. The layout of the proposed Stanford Linear Collider SLC has been changed for environmental reasons. A workshop on physics with low energy cooled antiprotons at the new LEAR ring, currently under construction at CERN, will be held at Erice, Sicily, from 9-16 May. To stimulate interest in the problems of particle acceleration to the multi-TeV range, ECFA is organizing a meeting to review the limitations and prospects of both conventional and novel particle acceleration techniques. The 1982 CERN School of Physics will take place in Cambridge, UK, from 5-18 September

  16. Clinical patterns associated with the concurrent detection of anti-HBs and HBV DNA.

    Science.gov (United States)

    Anastasiou, Olympia E; Widera, Marek; Korth, Johannes; Kefalakes, Helenie; Katsounas, Antonios; Hilgard, Gudrun; Gerken, Guido; Canbay, Ali; Ciesek, Sandra; Verheyen, Jens

    2018-02-01

    Simultaneous detection of anti-HBs and HBV DNA is a rare serological combination and has been described in acute and chronic HBV infection. To scrutinize viral and clinical patterns associated with concurrent detection of anti-HBs and HBV DNA. Simultaneous detection of anti-HBs and HBV DNA was observed in 64/1444 (4.4%) patients treated for HBV infection at the University Hospital of Essen from 2006 to 2016 (8 with acute, 20 with reactivated, and 36 chronic HBV infection). Clinical data and laboratory parameters were analyzed. Regions of the small hepatitis B surface antigen (SHB) and the reverse transcriptase (RT) were sequenced using next generation sequencing (NGS). Among the 64 patients with detectable HBV DNA and anti-HBs, 17 were HBsAg negative (HBsAg[-]), and two had acute liver failure. Patients with acute HBV infection had fewer genotype specific amino acid substitutions in the SHB region than patients with reactivated HBV infection (4 [4.5] vs 9 [16.25], P = 0.043). However, we could observe a significantly higher number of mutations in the a-determinant region when comparing chronically infected patients to patients with acute infection (0 [1] vs 1 [1], P = 0.044). The ratio of nonsynonymous to synonymous mutations (Ka/Ks) was on average >1 for the SHB region and 1) in the SHB region indicates that anti-HBs might have exerted selection pressure on the HBsAg. In three cases the diagnosis of acute HBV infection would have been at least delayed by only focusing on HBsAg testing. © 2017 Wiley Periodicals, Inc.

  17. A Bayesian approach to assessing the uncertainty in estimating bioconcentration factors in earthworms--the example of quinoxyfen.

    Science.gov (United States)

    Fragoulis, George; Merli, Annalisa; Reeves, Graham; Meregalli, Giovanna; Stenberg, Kristofer; Tanaka, Taku; Capri, Ettore

    2011-06-01

    Quinoxyfen is a fungicide of the phenoxyquinoline class used to control powdery mildew, Uncinula necator (Schw.) Burr. Owing to its high persistence and strong sorption in soil, it could represent a risk for soil organisms if they are exposed at ecologically relevant concentrations. The objective of this paper is to predict the bioconcentration factors (BCFs) of quinoxyfen in earthworms, selected as a representative soil organism, and to assess the uncertainty in the estimation of this parameter. Three fields in each of four vineyards in southern and northern Italy were sampled over two successive years. The measured BCFs varied over time, possibly owing to seasonal changes and the consequent changes in behaviour and ecology of earthworms. Quinoxyfen did not accumulate in soil, as the mean soil concentrations at the end of the 2 year monitoring period ranged from 9.16 to 16.0 µg kg⁻¹ dw for the Verona province and from 23.9 to 37.5 µg kg⁻¹ dw for the Taranto province, with up to eight applications per season. To assess the uncertainty of the BCF in earthworms, a probabilistic approach was used, firstly by building with weighted bootstrapping techniques a generic probabilistic density function (PDF) accounting for variability and incompleteness of knowledge. The generic PDF was then used to derive prior distribution functions, which, by application of Bayes' theorem, were updated with the new measurements and a posterior distribution was finally created. The study is a good example of probabilistic risk assessment. The means of mean and SD posterior estimates of log BCFworm (2.06, 0.91) are the 'best estimate values'. Further risk assessment of quinoxyfen and other phenoxyquinoline fungicides and realistic representative scenarios for modelling exercises required for future authorization and post-authorization requirements can now use this value as input. Copyright © 2011 Society of Chemical Industry.

  18. The impact of duration on effectiveness of exercise, the implication for periodization of training and goal setting for individuals who are overfat, a meta-analysis.

    Science.gov (United States)

    Clark, J E

    2016-12-01

    Given the assumption that all methods of exercise, e.g., endurance (ET), resistance (RT), or combination of both (E+R), can induce a beneficial effect size (ES) for changes in body composition and health status of individuals who are overfat. Thus the aim and purpose of this study is to evaluate the current body of knowledge to address the question as to the impact that the duration of exercise has on its relative effectiveness for inducing health and body compositional changes in individuals who are overfat to assist with developing periodized exercise protocols and establishing short and long term goals. A tiered meta-analysis of 92-studies and 200-exercise groupings were used for establishing pooled ES within and between groupings based on the increments of 4-week of duration and study designs of ≤8, 9-16, 17-23, 24-36, and ≥36 weeks. Analysis based on random-effect of response indicates a continuum of effectiveness within and between ET, RT and E+R based on duration. Where beneficial effectiveness is not indicated for any measures until after 8-weeks of continuous training with progressive effectiveness being noted in changes to cardiorespiratory fitness, inflammatory cytokines, and alteration of metabolic status from 12-weeks through 32-weeks of continuous training. Results indicate a greater ES for RT and E+R versus ET early in intervention that equalizes with longer durations. Supporting the use of RT and E+R within a periodized program. And secondarily, goals should be established first on performance gains and second body composition or health status modifications for the individual who is overfat.

  19. Numbers, biomass and cultivable diversity of microbial populations relate to depth and borehole-specific conditions in groundwater from depths of 4-450 m in Olkiluoto, Finland.

    Science.gov (United States)

    Pedersen, Karsten; Arlinger, Johanna; Eriksson, Sara; Hallbeck, Anna; Hallbeck, Lotta; Johansson, Jessica

    2008-07-01

    Microbiology, chemistry and dissolved gas in groundwater from Olkiluoto, Finland, were analysed over 3 years; samples came from 16 shallow observation tubes and boreholes from depths of 3.9-16.2 m and 14 deep boreholes from depths of 35-742 m. The average total number of cells (TNC) was 3.9 x 10(5) cells per ml in the shallow groundwater and 5.7 x 10(4) cells per ml in the deep groundwater. There was a significant correlation between the amount of biomass, analysed as ATP concentration, and TNC. ATP concentration also correlated with the stacked output of anaerobic most probable number cultivations of nitrate-, iron-, manganese- and sulphate-reducing bacteria, and acetogenic bacteria and methanogens. The numbers and biomass varied at most by approximately three orders of magnitude between boreholes, and TNC and ATP were positively related to the concentration of dissolved organic carbon. Two depth zones were found where the numbers, biomass and diversity of the microbial populations peaked. Shallow groundwater down to a depth of 16.2 m on average contained more biomass and cultivable microorganisms than did deep groundwater, except in a zone at a depth of approximately 300 m where the average biomass and number of cultivable microorganisms approached those of shallow groundwater. Starting at a depth of approximately 300 m, there were steep gradients of decreasing sulphate and increasing methane concentrations with depth; together with the peaks in biomass and sulphide concentration at this depth, these suggest that anaerobic methane oxidation may be a significant process at depth in Olkiluoto.

  20. Characterization of monoclonal antibodies that specifically recognize the palm subdomain of hepatitis C virus nonstructural protein 5B polymerase.

    Science.gov (United States)

    Ingravallo, P; Lahser, F; Xia, E; Sodowich, B; Lai, V C; Hong, Z; Zhong, W

    2001-06-01

    The nonstructural protein 5B (NS5B) of hepatitis C virus (HCV) is an RNA-dependent RNA polymerase (RdRp) which plays an essential role in viral RNA replication. Antibodies that specifically recognize NS5B will have utilities in monitoring NS5B production and subcellular localization, as well as in structure-function studies. In this report, three mouse monoclonal antibodies (mAbs), 16A9C9, 16D9A4 and 20A12C7, against a recombinant NS5B protein (genotype 1a, H-77 strain) were produced. These mAbs specifically recognize HCV NS5B, but not RdRps of polivirus (PV), bovine viral diarrhea virus (BVDV) or GB virus B (GBV-B). The mAbs can readily detect NS5B in cellular lysates of human osteosarcoma Saos2 cells constitutively expressing the nonstructural region of HCV (NS3-NS4A-NS4B-NS5A-NS5B). NS5B proteins of different HCV genotypes/subtypes (1a, 1b, 2a, 2c, 5a) showed varied affinity for these mAbs. Interestingly, the epitopes for the mAbs were mapped to the palm subdomain (amino acid 188-370) of the HCV RdRp as determined by immunoblotting analysis of a panel of HCV/GBV-B chimeric NS5B proteins. The binding site was mapped between amino acid 231 and 267 of NS5B for 16A9C9, and between 282 and 372 for 16D9A4 and 20A12C7. Furthermore, these mAbs showed no inhibitory effect on the NS5B polymerase activity in vitro.

  1. Prospective evaluation of MRI, 11C-acetate PET/CT and contrast-enhanced CT for staging of bladder cancer

    International Nuclear Information System (INIS)

    Vargas, H.A.; Akin, O.; Schöder, H.; Olgac, S.; Dalbagni, G.; Hricak, H.; Bochner, B.H.

    2012-01-01

    Purpose: To prospectively evaluate the diagnostic performance of magnetic resonance imaging (MRI), 11 C-acetate positron emission tomography/computed tomography (PET/CT) and contrast-enhanced CT for bladder cancer staging, using whole-mount pathologic review of radical cystectomy and pelvic lymph node specimens as the reference standard. Materials and methods: The institutional review board approved this prospective study, which was compliant with the Health Insurance Portability and Accountability Act. Written informed consent was obtained from 16 patients with histologically confirmed bladder cancer who underwent MRI, 11 C-acetate PET/CT and contrast-enhanced CT before radical cystectomy and pelvic lymph node dissection. Before imaging 4/16 patients had received intravesical Bacillus Calmette-Guérin treatment, 6 had received systemic chemotherapy, 3 had received both and 3 had received neither. Measures of diagnostic performance including accuracy, sensitivity and specificity were estimated separately for each imaging modality. Results: MRI correctly staged 56% of patients (9/16), overstaged 38% (6/16) and understaged 6% (1/16). CT correctly staged 50% of patients (8/16), overstaged 44% (7/16) and understaged 6% (1/16). In 9 patients, 11 C-acetate PET/CT showed uptake within the bladder wall; the uptake was true-positive in 7 patients and false-positive in 2 patients. Of the remaining 7 patients, 5 had true-negative and 2 had false-negative PET/CT results for cancer in the bladder wall. For all modalities, staging accuracy was reduced in patients with a history of prior intravesical and/or systemic chemotherapy. Conclusion: In staging bladder cancer, MRI, 11 C-acetate PET/CT and CT displayed similar levels of accuracy. For all modalities, a history of intravesical and/or systemic chemotherapy affected staging accuracy.

  2. Post-Stroke Longitudinal Alterations of Inter-Hemispheric Correlation and Hemispheric Dominance in Mouse Pre-Motor Cortex.

    Science.gov (United States)

    Vallone, Fabio; Lai, Stefano; Spalletti, Cristina; Panarese, Alessandro; Alia, Claudia; Micera, Silvestro; Caleo, Matteo; Di Garbo, Angelo

    2016-01-01

    Limited restoration of function is known to occur spontaneously after an ischemic injury to the primary motor cortex. Evidence suggests that Pre-Motor Areas (PMAs) may "take over" control of the disrupted functions. However, little is known about functional reorganizations in PMAs. Forelimb movements in mice can be driven by two cortical regions, Caudal and Rostral Forelimb Areas (CFA and RFA), generally accepted as primary motor and pre-motor cortex, respectively. Here, we examined longitudinal changes in functional coupling between the two RFAs following unilateral photothrombotic stroke in CFA (mm from Bregma: +0.5 anterior, +1.25 lateral). Local field potentials (LFPs) were recorded from the RFAs of both hemispheres in freely moving injured and naïve mice. Neural signals were acquired at 9, 16 and 23 days after surgery (sub-acute period in stroke animals) through one bipolar electrode per hemisphere placed in the center of RFA, with a ground screw over the occipital bone. LFPs were pre-processed through an efficient method of artifact removal and analysed through: spectral,cross-correlation, mutual information and Granger causality analysis. Spectral analysis demonstrated an early decrease (day 9) in the alpha band power in both the RFAs. In the late sub-acute period (days 16 and 23), inter-hemispheric functional coupling was reduced in ischemic animals, as shown by a decrease in the cross-correlation and mutual information measures. Within the gamma and delta bands, correlation measures were already reduced at day 9. Granger analysis, used as a measure of the symmetry of the inter-hemispheric causal connectivity, showed a less balanced activity in the two RFAs after stroke, with more frequent oscillations of hemispheric dominance. These results indicate robust electrophysiological changes in PMAs after stroke. Specifically, we found alterations in transcallosal connectivity, with reduced inter-hemispheric functional coupling and a fluctuating dominance

  3. Post-Stroke Longitudinal Alterations of Inter-Hemispheric Correlation and Hemispheric Dominance in Mouse Pre-Motor Cortex.

    Directory of Open Access Journals (Sweden)

    Fabio Vallone

    Full Text Available Limited restoration of function is known to occur spontaneously after an ischemic injury to the primary motor cortex. Evidence suggests that Pre-Motor Areas (PMAs may "take over" control of the disrupted functions. However, little is known about functional reorganizations in PMAs. Forelimb movements in mice can be driven by two cortical regions, Caudal and Rostral Forelimb Areas (CFA and RFA, generally accepted as primary motor and pre-motor cortex, respectively. Here, we examined longitudinal changes in functional coupling between the two RFAs following unilateral photothrombotic stroke in CFA (mm from Bregma: +0.5 anterior, +1.25 lateral.Local field potentials (LFPs were recorded from the RFAs of both hemispheres in freely moving injured and naïve mice. Neural signals were acquired at 9, 16 and 23 days after surgery (sub-acute period in stroke animals through one bipolar electrode per hemisphere placed in the center of RFA, with a ground screw over the occipital bone. LFPs were pre-processed through an efficient method of artifact removal and analysed through: spectral,cross-correlation, mutual information and Granger causality analysis.Spectral analysis demonstrated an early decrease (day 9 in the alpha band power in both the RFAs. In the late sub-acute period (days 16 and 23, inter-hemispheric functional coupling was reduced in ischemic animals, as shown by a decrease in the cross-correlation and mutual information measures. Within the gamma and delta bands, correlation measures were already reduced at day 9. Granger analysis, used as a measure of the symmetry of the inter-hemispheric causal connectivity, showed a less balanced activity in the two RFAs after stroke, with more frequent oscillations of hemispheric dominance.These results indicate robust electrophysiological changes in PMAs after stroke. Specifically, we found alterations in transcallosal connectivity, with reduced inter-hemispheric functional coupling and a fluctuating

  4. Community quarantine to interrupt Ebola virus transmission - Mawah Village, Bong County, Liberia, August-October, 2014.

    Science.gov (United States)

    Nyenswah, Tolbert; Blackley, David J; Freeman, Tabeh; Lindblade, Kim A; Arzoaquoi, Samson K; Mott, Joshua A; Williams, Justin N; Halldin, Cara N; Kollie, Francis; Laney, A Scott

    2015-02-27

    On September 30, 2014, the Bong County health officer notified the county Ebola task force of a growing outbreak of Ebola virus disease (Ebola) in Mawah, a village of approximately 800 residents. During September 9-16, household quarantine had been used by the community in response to a new Ebola infection. Because the infection led to a local outbreak that grew during September 17-20, county authorities suggested community quarantine be considered, and beginning on approximately September 20, the Fuamah District Ebola Task Force (Task Force) engaged Mawah leaders to provide education about Ebola and to secure cooperation for the proposed measures. On September 30, Bong County requested technical assistance to develop strategies to limit transmission in the village and to prevent spread to other areas. The county health team, with support from the Task Force and CDC, traveled to Mawah on October 1 and identified approximately two dozen residents reporting symptoms consistent with Ebola. Because of an ambulance shortage, 2 days were required, beginning October 1, to transport the patients to an Ebola treatment unit in Monrovia. Community quarantine measures, consisting of restrictions on entering or leaving Mawah, regulated river crossings, and market closures, were implemented on October 1. Local leaders raised concerns about availability of medical care and food. The local clinic was reopened on October 11, and food was distributed on October 12. The Task Force reported a total of 22 cases of Ebola in Mawah during September 9-October 2, of which 19 were fatal. During October 3-November 21, no new cases were reported in the village. Involving community members during planning and implementation helped support a safe and effective community quarantine in Mawah.

  5. Extended high dose letrozole regimen versus short low dose letrozole regimen as an adjuvant to gonadotropin releasing hormone antagonist protocol in poor responders undergoing IVF-ET.

    Science.gov (United States)

    Fouda, Usama M; Sayed, Ahmed M

    2011-12-01

    To compare the efficacy and cost-effectiveness of extended high dose letrozole regimen/HPuFSH-gonadotropin releasing hormone antagonist (GnRHant) protocol with short low dose letrozole regimen/HPuFSH-GnRHant protocol in poor responders undergoing IVF-ET. In this randomized controlled trial, 136 women who responded poorly to GnRH agonist long protocol in their first IVF cycle were randomized into two equal groups using computer generated list and were treated in the second IVF cycle by either extended letrozole regimen (5 mg/day during the first 5 days of cycle and 2.5 mg/day during the subsequent 3 days) combined with HPuFSH-GnRHant protocol or short letrozole regimen (2.5 mg/day from cycle day 3-7) combined with HPuFSH-GnRHant protocol. There were no significant differences between both groups with regard to number of oocytes retrieved and clinical pregnancy rate (5.39 ± 2.08 vs. 5.20 ± 1.88 and 22.06% vs. 16.18%, respectively).The total gonadotropins dose and medications cost per cycle were significantly lower in extended letrozole group (44.87 ± 9.16 vs. 59.97 ± 14.91 ampoules and 616.52 ± 94.97 vs. 746.84 ± 149.21 US Dollars ($), respectively).The cost-effectiveness ratio was 2794 $ in extended letrozole group and 4616 $ in short letrozole group. Extended letrozole regimen/HPuFSH-GnRHant protocol was more cost-effective than short letrozole regimen/HPuFSH-GnRHant protocol in poor responders undergoing IVF-ET.

  6. Arachidonic acid-and docosahexaenoic acid-enriched formulas modulate antigen-specific T cell responses to influenza virus in neonatal piglets.

    Science.gov (United States)

    Bassaganya-Riera, Josep; Guri, Amir J; Noble, Alexis M; Reynolds, Kathryn A; King, Jennifer; Wood, Cynthia M; Ashby, Michael; Rai, Deshanie; Hontecillas, Raquel

    2007-03-01

    Whereas the immunomodulatory effects of feeding either arachidonic acid (AA) or docosahexaenoic acid (DHA) separately have been previously investigated, little is known about the immunomodulatory efficacy of AA or DHA when they are fed in combination as infant formula ingredients. The objective of this study was to investigate the ability of AA- and DHA(AA/DHA)-enriched infant formula to modulate immune responses in the neonate in response to an inactivated influenza virus vaccine. Neonatal piglets (n = 48) were weaned on day 2 of age and distributed into 16 blocks of 3 littermate piglets each. Within each block, piglets were randomly assigned to a control formula, AA/DHA-enriched formula (0.63% AA and 0.34% DHA), or sow milk for 30 d. On day 9, 8 blocks of piglets were immunized with an inactivated influenza virus vaccine. On days 0, 9, 16, 23, and 30 after weaning, we measured influenza virus-specific T cell proliferation and phenotype of T subsets in peripheral blood. A delayed-type hypersensitivity reaction test was administered on day 28. Cytokine messenger RNA expression was determined by quantitative real time reverse transcriptase-polymerase chain reaction on day 30. The influenza virus-specific CD4(+) and CD8(+) T cell ex vivo lymphoproliferative responses were significantly lower on day 23 after immunization in piglets receiving dietary AA/DHA supplementation and sow milk than in those receiving the unsupplemented control formula. The immunomodulatory effects of AA/DHA-enriched formulas were consistent with up-regulation of interleukin 10 in peripheral blood mononuclear cells. Overall, it appears that the AA/DHA-enriched formula modulated antigen-specific T cell responses in part through an interleukin 10-dependent mechanism.

  7. Mirtazapine, a sedating antidepressant, and improved driving safety in patients with major depressive disorder: a prospective, randomized trial of 28 patients.

    Science.gov (United States)

    Shen, Jianhua; Moller, Henry J; Wang, Xuehua; Chung, Sharon A; Shapiro, Gilla K; Li, Xiuying; Shapiro, Colin M

    2009-03-01

    The objectives of the study were to investigate the effects of mirtazapine, a sedating antidepressant, on driving safety in major depressive disorder (MDD) patients and to observe the effect of mirtazapine on daytime alertness. Twenty-eight patients who met the DSM-IV criteria for MDD completed the study in a university teaching hospital. Half of these patients took mirtazapine 30 mg at bedtime for 30 days. A computerized driving simulator test (DST) and the Maintenance of Wakefulness Test (MWT) were conducted at baseline and on days 2, 9, 16, and 30 after commencement of antidepressant use. Fourteen untreated depressed patients performed a DST and MWT at baseline and on days 2 and 9 to evaluate the possibility of a learning effect. Data collection was from June 2005 through January 2006. There were significant linear effects of the treatment on road position at All Trials (p = .018) and on the morning sessions at 10:00 a.m. (p < .001) and 12:00 p.m. (p = .022) and on the number of crashes at All Trials (p = .034) and the 4:00 p.m. session (p = .050) for the group on active treatment. Compared with the values at baseline, those of road position at 10:00 a.m. significantly improved on days 2 (p < .05), 9 (p < .01), 16 (p < .01) and 30 (p < .01) and road position at 12:00 p.m. significantly improved on days 16 (p < .05) and 30 (p < .05). The number of crashes significantly decreased on day 30 (p < .05). The untreated patients showed no improvement in performance in any of the measures, suggesting that the results are not due to a learning effect. A sedating antidepressant can increase driving safety in MDD patients. clinicaltrials.gov Identifier: NCT00385437. ©Copyright 2009 Physicians Postgraduate Press, Inc.

  8. The electric vehicles as a mean to reduce CO2 emissions and energy costs in isolated regions. The São Miguel (Azores) case study

    International Nuclear Information System (INIS)

    Camus, Cristina; Farias, Tiago

    2012-01-01

    Most of small islands around the world today, are dependent on imported fossil fuels for the majority of their energy needs especially for transport activities and electricity production. The use of locally renewable energy resources and the implementation of energy efficiency measures could make a significant contribution to their economic development by reducing fossil fuel imports. An electrification of vehicles has been suggested as a way to both reduce pollutant emissions and increase security of supply of the transportation sector by reducing the dependence on oil products imports and facilitate the accommodation of renewable electricity generation, such as wind and, in the case of volcanic islands like São Miguel (Azores) of the geothermal energy whose penetration has been limited by the valley electricity consumption level. In this research, three scenarios of EV penetration were studied and it was verified that, for a 15% LD fleet replacement by EVs with 90% of all energy needs occurring during the night, the accommodation of 10 MW of new geothermal capacity becomes viable. Under this scenario, reductions of 8% in electricity costs, 14% in energy, 23% in fossil fuels use and CO 2 emissions for the transportation and electricity production sectors could be expected. - Highlights: ► EVs impacts on the electric system in energy and power profiles, costs and emissions. ► At least an EV penetration of 15% is needed to allow new geothermal power production. ► Reductions in energy, fossil fuels use and CO 2 emissions of 9%, 16% and 17% respectively. ► Electricity production with more % of renewable technologies reduces unit costs.

  9. Temporomandibular disorders, sleep bruxism, and primary headaches are mutually associated.

    Science.gov (United States)

    Fernandes, Giovana; Franco, Ana Lúcia; Gonçalves, Daniela Aparecida; Speciali, José Geraldo; Bigal, Marcelo Eduardo; Camparis, Cinara Maria

    2013-01-01

    To investigate the association among temporomandibular disorders (TMD), sleep bruxism, and primary headaches, assessing the risk of occurrence of primary headaches in patients with or without painful TMD and sleep bruxism. The sample consisted of 301 individuals (253 women and 48 men) with ages varying from 18 to 76 years old (average age of 37.5 years). The Research Diagnostic Criteria for Temporomandibular Disorders were used to classify TMD. Sleep bruxism was diagnosed by clinical criteria proposed by the American Academy of Sleep Medicine, and primary headaches were diagnosed according to the International Classification of Headache Disorders-II. Data were analyzed by chi-square and odds ratio tests with a 95% confidence interval, and the significance level adopted was .05. An association was found among painful TMD, migraine, and tension-type headache (P headache (3.7; 1.59-8.75). With regard to sleep bruxism, the association was significant only for chronic migraine (3.8; 1.83-7.84). When the sample was stratified by the presence of sleep bruxism and painful TMD, only the presence of sleep bruxism did not increase the risk for any type of headache. The presence of painful TMD without sleep bruxism significantly increased the risk in particular for chronic migraine (30.1; 3.58-252.81), followed by episodic migraine (3.7; 1.46-9.16). The association between painful TMD and sleep bruxism significantly increased the risk for chronic migraine (87.1; 10.79-702.18), followed by episodic migraine (6.7; 2.79-15.98) and episodic tension-type headache (3.8; 1.38-10.69). The association of sleep bruxism and painful TMD greatly increased the risk for episodic migraine, episodic tension-type headache, and especially for chronic migraine.

  10. [Extracorporeal circulation and hypothermy surgery in tumors with vena cava extension: 20 years experience at the University Clinic of Navarra].

    Science.gov (United States)

    Rioja Zuazu, J; Rodríguez-Rubio Cortadillas, F; Zudaire Bergera, J J; Saiz Sansi, A; Rosell Costa, D; Robles García, J E; Rábago, G; Berián Polo, J M

    2008-04-01

    We present our 20 years experience treating patients with vena cava extension in whom an extracorporeal circulation, hypothermia, cardio circulatory arrest (ECC-H-CCA) in order to perform, together with a tumoral resection, a thrombus resection. From 1985 to 2005 a total of 28 retroperitoneal tumor were treated: 25 renal cancers, a Wilms tumor, a paratesticular rabdomiosarcoma, and a pheocromocitoma. All of them had an extension by means of thrombus above the suprahepatics veins. All of them were treated by means of ECC-H-CCA for thrombus extraction. A descriptive study of the serie is performed as well as a Kaplan Meyer survival study. Surgical complications were present within 10 patients (35%), with a surgical mortality of two patients (7%): one intra-operatively because a massive embolism of the lungs and the other because of a lung embolism on the 4th post-operative day. Global actuarial survival was 29.1+/-10% at three years and 17.5+/-8% at five years. Analyzing only who do not have metastatic lesions, nor lymph nodes at diagnosis their three year survival was 50.9+/-16.3% and 32.2+/-16% at five years. Mean while those who have any metastatic lesion at diagnosis their three and five years survival was 20.8+/-12% and 10.4+/-9% respectively. The employ of surgical techniques with ECC-H-CCA with in oncological pathology associated with vena cava thrombus is justified and its employment does not worsen the survival; it is indicated because its results, allowing a complete tumoral resection in a safe and reproducible fashion.

  11. Prevalent lightning sferics at 600 megahertz near Jupiter's poles

    Science.gov (United States)

    Brown, Shannon; Janssen, Michael; Adumitroaie, Virgil; Atreya, Sushil; Bolton, Scott; Gulkis, Samuel; Ingersoll, Andrew; Levin, Steven; Li, Cheng; Li, Liming; Lunine, Jonathan; Misra, Sidharth; Orton, Glenn; Steffes, Paul; Tabataba-Vakili, Fachreddin; Kolmašová, Ivana; Imai, Masafumi; Santolík, Ondřej; Kurth, William; Hospodarsky, George; Gurnett, Donald; Connerney, John

    2018-06-01

    Lightning has been detected on Jupiter by all visiting spacecraft through night-side optical imaging and whistler (lightning-generated radio waves) signatures1-6. Jovian lightning is thought to be generated in the mixed-phase (liquid-ice) region of convective water clouds through a charge-separation process between condensed liquid water and water-ice particles, similar to that of terrestrial (cloud-to-cloud) lightning7-9. Unlike terrestrial lightning, which emits broadly over the radio spectrum up to gigahertz frequencies10,11, lightning on Jupiter has been detected only at kilohertz frequencies, despite a search for signals in the megahertz range12. Strong ionospheric attenuation or a lightning discharge much slower than that on Earth have been suggested as possible explanations for this discrepancy13,14. Here we report observations of Jovian lightning sferics (broadband electromagnetic impulses) at 600 megahertz from the Microwave Radiometer15 onboard the Juno spacecraft. These detections imply that Jovian lightning discharges are not distinct from terrestrial lightning, as previously thought. In the first eight orbits of Juno, we detected 377 lightning sferics from pole to pole. We found lightning to be prevalent in the polar regions, absent near the equator, and most frequent in the northern hemisphere, at latitudes higher than 40 degrees north. Because the distribution of lightning is a proxy for moist convective activity, which is thought to be an important source of outward energy transport from the interior of the planet16,17, increased convection towards the poles could indicate an outward internal heat flux that is preferentially weighted towards the poles9,16,18. The distribution of moist convection is important for understanding the composition, general circulation and energy transport on Jupiter.

  12. Clinical value of 18F-FDG PET/CT in detecting viable tumor, recurrence and metastases of hepato-cellular carcinoma after transcatheter arterial chemoembolization

    International Nuclear Information System (INIS)

    Hu Silong; Zhang Yingjian; Zhu Beiling; Shi Wei; Men Zhiqiang; Li Peilen; Jiang Guoliang

    2009-01-01

    Objective: Accurate evaluation of treatment result of transcatheter arterial chemoembolization (TACE) in patients with hepatocellular carcinoma (HCC) by conventional imaging is difficult. The objective of this study was to investigate the clinical value of 18 F-fluorodeoxyglucose (FDG) PET/CT for detecting residual viable tumor, recurrence and metastases in patients with HCC after TACE. Methods: Twenty-two patients with HCC after TACE were investigated with 18 F-FDG PET/CT. The accuracy of FDG PET/CT was determined by the histopathological results or evidences of clinical follow-up. Results: Of all 22 HCC patients after TACE, 18 had intra- and (or) extrahepatic lesions, detected by FDG PET/CT. Six-teen patients had intrahepatic FDG-avid lesion(s). Of the 16 patients, five had intrahepatic FDG-avid lesions located at both lipiodol-rich and -deprive regions, 13 had associated extrahepatic metastases. Of the two HCC patients who had no intrahepatic FDG-avid lesion, there were extrahepatic FDG-avid lesions at the retroperitoneal lymph nodes. In all, 15 HCC had extrahepatic lesions identified by FDG PET/CT. There were lung and lymph nodes (n = 9), bone (n = 2), tumor thrombus at portal vein (n - 1) and diaphragm crus (n = 1). Two patients were false negative. The sensitivity, specificity, accuracy of FDG PET/CT in detecting intra- and (or) extrahepatic lesions after TACE were 88.9% (16/18) vs 94.7 % (18/19), 4/4 vs 3/3, and 90.9% (20/22) vs 95.5% (21/22), respectively. Conclusion: 18 F-FDG PET/CT is potential useful for detection both intra- and (or) extrahepatic lesions in HCC patients after TACE. (authors)

  13. Trimester- and Assay-Specific Thyroid Reference Intervals for Pregnant Women in China

    Directory of Open Access Journals (Sweden)

    Jinfang Xing

    2016-01-01

    Full Text Available Objective. The guidelines of the American Thyroid Association (ATA recommend an upper limit reference interval (RI of thyroid stimulating hormone (TSH of 2.5 mIU/L in the first trimester of pregnancy and 3.0 mIU/L in subsequent trimesters, but some reported ranges in China are significantly higher. Our study aimed to establish trimester- and assay-specific RIs for thyroid hormones in normal pregnant Chinese women. Methods. In this cross-sectional study, 2540 women with normal pregnancies (first trimester, n=398; second trimester, n=797; third trimester, n=1345 and 237 healthy nonpregnant control subjects were recruited. Serum TSH, free thyroxin (FT4, thyroid peroxidase antibody (TPOAb, and thyroglobulin antibody (TgAb levels were determined by automated chemiluminescence with an Immulite 2000 system (Siemens, Erlangen, Germany. After outliers were excluded, the 2.5–97.5th percentiles were used to define the RIs. Results. The RIs of thyroid function in the first, second, and third trimesters of pregnancy and in nonpregnant controls were 0.07–3.96, 0.27–4.53, 0.48–5.40, and 0.69–5.78 mIU/L for TSH and 9.16–18.12, 8.67–16.21, 7.80–13.90, and 8.24–16.61 pmol/L for FT4, respectively. Conclusion. The trimester- and assay-specific RIs of thyroid function during pregnancy differed between trimesters, which suggests that it is advisable to detect and avoid misclassification of thyroid dysfunction during pregnancy for women in Henan, China.

  14. Social class-related gradient in the association of skeletal growth with blood pressure among adolescent boys in India.

    Science.gov (United States)

    Rao, Shobha; Apte, Priti

    2009-12-01

    In view of the fact that height differences between socio-economic groups are apparent early in childhood, it is of interest to examine whether skeletal growth is reflective of the social class gradient in CVD risk. The present study examined blood pressure levels, adiposity and growth of adolescent boys from high and low social classes. In a cross-sectional study, skeletal growth (height and sitting height), adiposity (weight, BMI and body fat) and blood pressure levels of the adolescents were measured. Pune, India. Adolescent schoolboys (9-16 years) from high socio-economic (HSE; n 1146) and low socio-economic (LSE; n 932) class. LSE boys were thin, short and undernourished (mean BMI: 15.5 kg/m2 v. 19.3 kg/m2 in HSE boys, P = 0.00). Social gradient was revealed in differing health risks. The prevalence of high systolic blood pressure (HSBP) was high in HSE class (10.5 % v. 2.7 % in LSE class, P = 0.00) and was associated with adiposity, while the prevalence of high diastolic blood pressure (HDBP) was high in LSE class (9.8 % v. 7.0 % in HSE class, P = 0.00) and had only a weak association with adiposity. Despite this, lower ratio of leg length to height was associated with significantly higher respective health risks, i.e. for HDBP in LSE class (OR = 1.99, 95 % CI 1.14, 3.47) and for HSBP in HSE class (OR = 1.69, 95 % CI 1.02, 2.77). As stunting in childhood is a major problem in India and Asia, the leg length to height indicator needs to be validated in different populations to understand CVD risks.

  15. Changes in anxiety following a randomized control trial of a theatre-based intervention for youth with autism spectrum disorder.

    Science.gov (United States)

    Corbett, Blythe A; Blain, Scott D; Ioannou, Sara; Balser, Maddie

    2017-04-01

    Increased anxiety and stress are frequently found in children with autism spectrum disorder and are associated with social challenges. Recently, we reported changes in social competence following peer-mediated, theatre-based intervention. The purpose of this study was to examine the impact of the intervention on reducing anxiety and stress. Participants included 30 youth with autism spectrum disorder (8-14 years old) randomly assigned to the experimental (17) or waitlist control (13) group. Pretest adjusted, between-group differences were analyzed for state-anxiety, trait-anxiety, play-based cortisol, and diurnal cortisol. Pearson correlations were conducted between anxiety, cortisol, and group play. Significant pretest-adjusted between-group differences at posttest were observed on trait-anxiety (F(1, 27) = 9.16, p = 0.005) but not state-anxiety (F(1, 27) = 0.03, p = 0.86), showing lower trait-anxiety in the experimental group. There were no between-group differences on cortisol. There was a significant negative correlation between group play and trait-anxiety (r = -0.362, p = 0.05). Playground cortisol correlated with group play, for the experimental group (r = 0.55, p = 0.03). The theatre-based, peer-mediated intervention not only contributes to improvement in social competence in youth with autism spectrum disorder but also contributes to reductions in trait-anxiety associated with more social interaction with peers. Results suggest that some degree of physiological arousal is essential for social interaction.

  16. Progranulin haploinsufficiency causes biphasic social dominance abnormalities in the tube test.

    Science.gov (United States)

    Arrant, A E; Filiano, A J; Warmus, B A; Hall, A M; Roberson, E D

    2016-07-01

    Loss-of-function mutations in progranulin (GRN) are a major autosomal dominant cause of frontotemporal dementia (FTD), a neurodegenerative disorder in which social behavior is disrupted. Progranulin-insufficient mice, both Grn(+/-) and Grn(-/-) , are used as models of FTD due to GRN mutations, with Grn(+/-) mice mimicking the progranulin haploinsufficiency of FTD patients with GRN mutations. Grn(+/-) mice have increased social dominance in the tube test at 6 months of age, although this phenotype has not been reported in Grn(-/-) mice. In this study, we investigated how the tube test phenotype of progranulin-insufficient mice changes with age, determined its robustness under several testing conditions, and explored the associated cellular mechanisms. We observed biphasic social dominance abnormalities in Grn(+/-) mice: at 6-8 months, Grn(+/-) mice were more dominant than wild-type littermates, while after 9 months of age, Grn(+/-) mice were less dominant. In contrast, Grn(-/-) mice did not exhibit abnormal social dominance, suggesting that progranulin haploinsufficiency has distinct effects from complete progranulin deficiency. The biphasic tube test phenotype of Grn(+/-) mice was associated with abnormal cellular signaling and neuronal morphology in the amygdala and prefrontal cortex. At 6-9 months, Grn(+/-) mice exhibited increased mTORC2/Akt signaling in the amygdala and enhanced dendritic arbors in the basomedial amygdala, and at 9-16 months Grn(+/-) mice exhibited diminished basal dendritic arbors in the prelimbic cortex. These data show a progressive change in tube test dominance in Grn(+/-) mice and highlight potential underlying mechanisms by which progranulin insufficiency may disrupt social behavior. © 2016 John Wiley & Sons Ltd and International Behavioural and Neural Genetics Society.

  17. Cancer-related symptoms predict psychological wellbeing among prostate cancer survivors: results from the PiCTure study.

    Science.gov (United States)

    Sharp, Linda; O'Leary, Eamonn; Kinnear, Heather; Gavin, Anna; Drummond, Frances J

    2016-03-01

    Prostate cancer treatments are associated with a range of symptoms and physical side-effects. Cancer can also adversely impact on psychological wellbeing. Because many prostate cancer-related symptoms and side-effects are potentially modifiable, we investigated associations between symptoms and psychological wellbeing among prostate cancer survivors. Postal questionnaires were distributed to men diagnosed with prostate cancer 2-18 years previously identified through cancer registries. General and prostate cancer-specific symptoms were assessed using the EORTC QLQ-C30 and QLQ-PR25, with higher symptom scores indicating more/worse symptomatology. Psychological wellbeing was assessed by the DASS-21. Associations between symptoms and each outcome were investigated using multivariate logistic regression, controlling for socio-demographic and clinical factors. A total 3348 men participated (response rate = 54%). Seventeen percent (95%CI 15.2%-17.9%), 16% (95%CI 15.1%-17.8%) and 11% (95%CI 9.5%-11.8%) of survivors scored in the range for depression, anxiety and distress on the DASS scales, respectively. In multivariate models, risk of depression on the DASS scale was significantly higher in men with higher urinary and androgen deprivation therapy (ADT)-related symptoms, and higher scores for fatigue, insomnia and financial difficulties. Risk of anxiety on the DASS scale was higher in men with higher scores for urinary, bowel and ADT-related symptoms and fatigue, dyspnoea and financial difficulties. Risk of distress on the DASS scale was positively associated with urinary, bowel and ADT-related symptoms, fatigue, insomnia and financial difficulties. Cancer-related symptoms significantly predict psychological wellbeing among prostate cancer survivors. Greater use of interventions and medications and to alleviate symptoms might improve psychological wellbeing of prostate cancer survivors. Copyright © 2015 John Wiley & Sons, Ltd.

  18. Reduced Number of CD8+ Cells in Tonsillar Germinal Centres in Children with the Periodic Fever, Aphthous Stomatitis, Pharyngitis and Cervical Adenitis Syndrome.

    Science.gov (United States)

    Førsvoll, J; Janssen, E A M; Møller, I; Wathne, N; Skaland, I; Klos, J; Kristoffersen, E K; Øymar, K

    2015-07-01

    The syndrome of periodic fever, aphthous stomatitis, pharyngitis and cervical adenitis (PFAPA) is an autoinflammatory disorder of unknown aetiology. Tonsillectomy may cause a prompt resolution of the syndrome. The aim was to study the histologic and immunological aspects of the palatine tonsils in PFAPA, to help understand the pathophysiology of the syndrome. Tonsils from children with PFAPA (n = 11) and children with tonsillar hypertrophy (n = 16) were evaluated histologically after haematoxylin and eosin staining. The number of different cell types was identified immunohistochemically by cluster of differentiation (CD) markers: CD3 (T cells), CD4 (T helper cells), CD8 (cytotoxic T cells), CD15 (neutrophils), CD20 (B cells), CD45 (all leucocytes), CD57 (NK cells) and CD163 (monocytes and macrophages). Tonsils from children with PFAPA showed reactive lymphoid hyperplasia dominated by well-developed germinal centres with many tingible body macrophages. The histologic findings were unspecific, and a similar morphologic appearance was also found in the tonsils from controls. The number of CD8+ cells in germinal centres differed between children with PFAPA [median 9 cells (quartiles: 5, 15)] and controls [18 cells (12, 33) (P = 0.001)] and between children with PFAPA with (median 14 cells; 9, 16) and without (4 cells; 3, 8) aphthous stomatitis (P = 0.015). For the other cell types, no differences in germinal centres were found between children with PFAPA and controls. In conclusion, a lower number of CD8+ cells were found in germinal centres of tonsils in children with PFAPA compared to controls, which may be a feature linked to the aetiology of the syndrome. © 2015 John Wiley & Sons Ltd.

  19. [Improving inpatient pharmacoterapeutic process by Lean Six Sigma methodology].

    Science.gov (United States)

    Font Noguera, I; Fernández Megía, M J; Ferrer Riquelme, A J; Balasch I Parisi, S; Edo Solsona, M D; Poveda Andres, J L

    2013-01-01

    Lean Six Sigma methodology has been used to improve care processes, eliminate waste, reduce costs, and increase patient satisfaction. To analyse the results obtained with Lean Six Sigma methodology in the diagnosis and improvement of the inpatient pharmacotherapy process during structural and organisational changes in a tertiary hospital. 1.000 beds tertiary hospital. prospective observational study. The define, measure, analyse, improve and control (DMAIC), were deployed from March to September 2011. An Initial Project Charter was updated as results were obtained. 131 patients with treatments prescribed within 24h after admission and with 4 drugs. safety indicators (medication errors), and efficiency indicators (complaints and time delays). Proportion of patients with a medication error was reduced from 61.0% (25/41 patients) to 55.7% (39/70 patients) in four months. Percentage of errors (regarding the opportunities for error) decreased in the different phases of the process: Prescription: from 5.1% (19/372 opportunities) to 3.3% (19/572 opportunities); Preparation: from 2.7% (14/525 opportunities) to 1.3% (11/847 opportunities); and administration: from 4.9% (16/329 opportunities) to 3.0% (13/433 opportunities). Nursing complaints decreased from 10.0% (2119/21038 patients) to 5.7% (1779/31097 patients). The estimated economic impact was 76,800 euros saved. An improvement in the pharmacotherapeutic process and a positive economic impact was observed, as well as enhancing patient safety and efficiency of the organization. Standardisation and professional training are future Lean Six Sigma candidate projects. Copyright © 2012 SECA. Published by Elsevier Espana. All rights reserved.

  20. Inter- and Intrafraction Patient Positioning Uncertainties for Intracranial Radiotherapy: A Study of Four Frameless, Thermoplastic Mask-Based Immobilization Strategies Using Daily Cone-Beam CT

    International Nuclear Information System (INIS)

    Tryggestad, Erik; Christian, Matthew; Ford, Eric; Kut, Carmen; Le Yi; Sanguineti, Giuseppe; Song, Danny Y.; Kleinberg, Lawrence

    2011-01-01

    Purpose: To determine whether frameless thermoplastic mask-based immobilization is adequate for image-guided cranial radiosurgery. Methods and Materials: Cone-beam CT localization data from patients with intracranial tumors were studied using daily pre- and posttreatment scans. The systems studied were (1) Type-S IMRT (head only) mask (Civco) with head cushion; (2) Uni-Frame mask (Civco) with head cushion, coupled with a BlueBag body immobilizer (Medical Intelligence); (3) Type-S head and shoulder mask with head and shoulder cushion (Civco); (4) same as previous, coupled with a mouthpiece. The comparative metrics were translational shift magnitude and average rotation angle; systematic inter-, random inter-, and random intrafraction positioning error was computed. For strategies 1-4, respectively, the analysis for interfraction variability included data from 20, 9, 81, and 11 patients, whereas that for intrafraction variability included a subset of 7, 9, 16, and 8 patients. The results were compared for statistical significance using an analysis of variance test. Results: Immobilization system 4 provided the best overall accuracy and stability. The mean interfraction translational shifts (± SD) were 2.3 (± 1.4), 2.2 (± 1.1), 2.7 (± 1.5), and 2.1 (± 1.0) mm whereas intrafraction motion was 1.1 (± 1.2), 1.1 (± 1.1), 0.7 (± 0.9), and 0.7 (± 0.8) mm for devices 1-4, respectively. No significant correlation between intrafraction motion and treatment time was evident, although intrafraction motion was not purely random. Conclusions: We find that all frameless thermoplastic mask systems studied are viable solutions for image-guided intracranial radiosurgery. With daily pretreatment corrections, symmetric PTV margins of 1 mm would likely be adequate if ideal radiation planning and targeting systems were available.

  1. Using motivational interviewing for weight feedback to parents of young children.

    Science.gov (United States)

    Dawson, Anna M; Brown, Deirdre A; Cox, Adell; Williams, Sheila M; Treacy, Lee; Haszard, Jill; Meredith-Jones, Kim; Hargreaves, Elaine; Taylor, Barry J; Ross, Jim; Taylor, Rachael W

    2014-06-01

    To determine whether a single session of motivational interviewing (MI) for feedback of a child's overweight status promotes engagement in treatment following screening. One thousand ninety-three children aged 4-8 years were recruited through primary and secondary care to attend health screening, including assessment of parenting practices and motivation (questionnaire). Families with normal-weight children were informed about their child's weight but had no further involvement. Parents of overweight (body mass index ≥ 85th percentile) children (n = 271) were randomised to receive weight feedback via MI or best practice care (BPC) using a traffic light concept to indicate degree of health risk. Follow-up interviews were held 2 weeks later to examine intervention uptake, changes to motivation and behaviour, and parental response to feedback. Recruitment into the intervention was high (76%) and not altered by feedback condition (percentage difference 6.6 (95% confidence interval -2.9, 16.0). High scores on the Health Care Climate Questionnaire (rating of the interviewer) indicated satisfaction with how the information was provided to parents. No differences were observed in multiple indicators of harm. However, self-determined motivation for healthy life-styles was significantly higher in the MI condition at follow-up (0.18: 0.00, 0.35), after only a single session of MI. MI and BPC were both successful in encouraging parents to participate in a family-based intervention, with MI offering little significant benefit over BPC. A traffic light approach to weight feedback is a suitable way of providing sensitive information to parents not expecting such news. © 2014 The Authors. Journal of Paediatrics and Child Health © 2014 Paediatrics and Child Health Division (Royal Australasian College of Physicians).

  2. Assessment of Volatile Chemical Composition of the Essential Oil of Jatropha ribifolia (Pohl Baill by HS-SPME-GC-MS Using Different Fibers

    Directory of Open Access Journals (Sweden)

    Celia Eliane de Lara da Silva

    2013-01-01

    Full Text Available The chemical composition of essential oil and volatile obtained from the roots of Jatropha ribifolia (Pohl Baill was performed in this work. The Clevenger extractor was utilized in hydrodistillation of oil and chemical composition determined by gas chromatography coupled with mass spectrometry detector (GC-MS. The identification of compounds was confirmed by retention index (Kovats index obtained from a series of straight chain alkanes (C7–C30 and by comparison with NIST and ADAMS library. A total of 61 compounds were identified in essential oil by GC-MS. The extraction of volatile was performed also by the use of the solid phase microextraction (SPME with four different fibers. The essential oil extraction was extremely rapid (15 s to avoid saturation of the fiber and the MS detector. The majority of the composition of essential oil is the terpenes: β-pinene (major compound 9.16%, β-vatirene (8.34%, α-gurjunene (6.98%, α-pinene (6.35%, camphene (4.34%, tricyclene (3.79% and dehydro aromadendrene (3.52% it and aldehydes and alcohols. Through the SPME it was possible to determine the nine volatile compounds not identified in oil 2,3,4-trimethyl-2-cyclopenten-1-one, α-phellandrene, 3-carene, trans-p-mentha-2,8-dienol, pinocamphone, D-verbenon, 1,3,3-trimethyl-2-(2-methyl-cyclopropyl-cyclohexene, 2,4-diisocyanato-1-methylbenzene, and (6-hydroxymethyl-2,3-dimethylehenyl methanol.

  3. Perturbations to the lower ionosphere by tropical cyclone Evan in the South Pacific Region

    Science.gov (United States)

    Kumar, Sushil; NaitAmor, Samir; Chanrion, Olivier; Neubert, Torsten

    2017-08-01

    Very low frequency (VLF) electromagnetic signals from navigational transmitters propagate worldwide in the Earth-ionosphere waveguide formed by the Earth and the electrically conducting lower ionosphere. Changes in the signal properties are signatures of variations in the conductivity of the reflecting boundary of the lower ionosphere which is located in the mesosphere and lower thermosphere, and their analysis is, therefore, a way to study processes in these remote regions. Here we present a study on amplitude perturbations of local origin on the VLF transmitter signals (NPM, NLK, NAA, and JJI) observed during tropical cyclone (TC) Evan, 9-16 December 2012 when TC was in the proximity of the transmitter-receiver links. We observed a maximum amplitude perturbation of 5.7 dB on JJI transmitter during 16 December event. From Long Wave Propagation Capability model applied to three selected events we estimate a maximum decrease in the nighttime D region reference height (H') by 5.2 km (13 December, NPM) and maximum increase in the daytime D region H' by 6.1 km and 7.5 km (14 and 16 December, JJI). The results suggest that the TC caused the neutral densities of the mesosphere and lower thermosphere to lift and sink (bringing the lower ionosphere with it), an effect that may be mediated by gravity waves generated by the TC. The perturbations were observed before the storm was classified as a TC, at a time when it was a tropical depression, suggesting the broader conclusion that severe convective storms, in general, perturb the mesosphere and the stratosphere through which the perturbations propagate.

  4. First liver transplant in Qatar: an evolving program facing many challenges.

    Science.gov (United States)

    Khalaf, Hatem; Derballa, Moataz; Elmasry, Mohammed; Khalil, Ahmed; Yakoob, Rafie; Almohannadi, Muneera; Almaslamani, Muna; Fadhil, Riadh; Al-Kaabi, Saad; Al-Ansari, Abdulla; Almaslamani, Yousuf

    2013-10-01

    Beginning to do liver transplants in a developing country is challenging. We report on the first few liver transplants performed in Qatar and discuss future exceptions and challenges facing our program. The first liver transplant was performed in Qatar on December 6, 2011. Since starting the program, 4 deceased-donor liver transplants have been performed in Qatar. All recipients underwent a standard deceased-donor liver transplant procedure, which included a duct-to-duct biliary anastomosis without a veno-venous bypass. All liver transplants were performed at the Hamad Medical Corporation by a local team of surgeons without external assistance. The 4 patients were all men, with a median age of 56 years (age range, 46-63 y). Indications for liver transplant included hepatitis C cirrhosis in 2 patients, and 1 patient with hepatitis B cirrhosis with hepatocellular carcinoma, and the other patient with cryptogenic liver cirrhosis. Median amount of blood transfused was 6 units (range, 0-10 U); median time spent in the intensive care unit was 2 days (range, 2-5 d); median amount of time spent in the hospital was 10 days (range, 9-16 d). All 4 recipients have survived after a median follow-up of 438 days (range, 33-602 d) and are enjoying a healthy life, with no significant posttransplant complications. A deceased-donor liver transplant can be performed in Qatar with no external assistance. However, a severe organ shortage remains the biggest obstacle facing us. Efforts should be directed toward improving the number and quality of available deceased donors in Qatar. Meanwhile, live-donor liver transplant may be the only way for us, going forward, to prevent deaths on the waiting list.

  5. CNS germinoma: disease control and long-term functional outcome for 12 children treated with craniospinal irradiation

    International Nuclear Information System (INIS)

    Merchant, Thomas E.; Sherwood, Scot H.; Mulhern, Raymond K.; Rose, Susan R.; Thompson, Stephen J.; Sanford, Robert A.; Kun, Larry E.

    2000-01-01

    Purpose: To provide evidence that radiation therapy alone in the form of craniospinal irradiation (CSI) and a boost to the primary site of disease provides effective disease control and limited additional morbidity for patients with CNS germinoma. Methods and Materials: Twelve patients with a median age of 12 years (range 9-16 years) with CNS germinoma were treated with CSI (median 25.6 Gy, range 23.4-32 Gy) and a boost to the primary site of disease (50.4 Gy, range 45-54 Gy) between January 1987 and June 1998. All patients were biopsied prior to radiation therapy and none received chemotherapy. No patients were lost to follow-up and the majority had long-term (> 45 month) pre- and postirradiation endocrine and psychology assessment. Results: All 12 patients are alive and no failures have occurred with a median follow-up of 69 months (range 14-143 months). Preirradiation endocrine deficiencies were present in 6 of 6 suprasellar tumors and 1 of 6 pineal tumors; with follow-up there was no substantial difference between age and gender adjusted pre- and postirradiation stature and weight. With long-term follow-up, there were no significant differences between pre- and postirradiation full-scale, verbal, and performance IQ scores. Conclusions: This study confirms the ability of radiation therapy alone to achieve disease control with a high rate of success in pediatric patients and demonstrates that the treatment toxicity faced by these patients may be less than anticipated. Because these patients present with substantial preexisting morbidity at diagnosis and may be of an age where the potential for radiation-related side effects is relatively small, the superiority of treatment alternatives may be difficult to prove

  6. Role of arginine-292 in the substrate specificity of aspartate aminotransferase as examined by site-directed mutagenesis

    International Nuclear Information System (INIS)

    Cronin, C.N.; Kirsch, J.F.

    1988-01-01

    X-ray crystallographic data have implicated Arg-292 as the residue responsible for the preferred side-chain substrate specificity of asparate aminotransferase. It forms a salt bridge with the β or γ carboxylate group of the substrate. In order to test this proposal and, in addition, to attempt to reverse the substrate charge specificity of this enzyme, Arg-292 has been converted to Asp-292 by site-directed mutagenesis. The activity k/sub cat//K/sub M/) of the mutant enzyme, R292D, toward the natural anionic substrates L-aspartate, L-glutamate, and α-ketoglutarate is depressed by over 5 orders of magnitude, whereas the activity toward the keto acid pyruvate and a number of aromatic and other neutral amino acids is reduced by only 2-9-fold. These results confirm the proposal that Arg-292 is critical for the rapid turnover of substrates bearing anionic side chains and show further that, apart from the desired alteration no major perturbations of the remainder of the molecule have been made. The activity of R292D toward the cationic amino acids L-arginine, L-lysine, and L-ornithine is increased by 9-16-fold over that of wild type and the ratio (k/sub cat//K/sub M/)/sub cationic//(k/sub cat//K/sub M/)/sub anionic/ is in the range 2-40-fold for R292D, whereas this ratio has a range of [(0.3-6) x 10 -6 ]-fold for wild type. Thus, the mutation has produced an inversion of the substrate charge specificity. Possible explanations for the less-than-expected reactivity of R292D with arginine are discussed

  7. Comparison of the usefulness of the CACO-2 cell line with standard substrates for isolation of swine influenza A viruses.

    Science.gov (United States)

    Chiapponi, Chiara; Zanni, Irene; Garbarino, Chiara; Barigazzi, Giuseppe; Foni, Emanuela

    2010-01-01

    Influenza A virus isolation is undertaken routinely in embryonated chicken eggs, but to improve virus detection various cell lines can be used. The CACO-2 cell line was compared to the MDCK cell line and embryonated chicken eggs for the isolation of H1N1, H1N2, H3N2 swine influenza A virus subtypes from clinical specimens. From 2006 to 2008, 104 influenza A samples found positive by PCR from 42 respiratory outbreaks in Italian swine farms were examined by virus isolation. Sixty swine influenza A viruses were isolated (16 H1N1, 28 H1N2 and 16 H3N2) and their growth behaviour on the different substrates was examined. 16/16 H1N1, 28/28 H1N2 and 8/16 of H3N2 viruses were isolated from the CACO-2 cell line, while 7/16 H1N1, 3/28 H1N2 and 16/16 H3N2 viruses were isolated using embryonated chicken eggs. Only 9/16 H1N1, 1/28 H1N2 and 6/16 H3N2 viruses replicated in MDCK cells. A link was found between viral hemagglutinin and the isolation rate on the various substrates. The CACO-2 line was statistically more sensitive (Fisher's exact test, pH1N2 subtypes. In contrast influenza A H3N2 virus was isolated more readily in embryonated chicken eggs than in cultured cells (Fisher's exact test, p<0.01).

  8. Soleus muscle injury: sensitivity of ultrasound patterns

    Energy Technology Data Exchange (ETDEWEB)

    Balius, Ramon [Sport Catalan Council, Generalitat de Catalunya, Barcelona (Spain); Clinica CMI Diagonal, Barcelona (Spain); Rodas, Gil [F.C. Barcelona Medical Services, Barcelona (Spain); Pedret, Carles [Clinica CMI Diagonal, Barcelona (Spain); Clinica Mapfre de Medicina del Tenis, Sports Medicine and Imaging Department, Barcelona (Spain); Centre de Diagnostic per Imatge de Tarragona, Tarragona (Spain); Capdevila, Lluis [Universitat Autonoma de Barcelona, Laboratory of Sport Psychology, Barcelona (Spain); Alomar, Xavier [Clinica Creu Blanca, Barcelona (Spain); Bong, David A. [Instituto Poal de Reumatologia, Barcelona (Spain)

    2014-06-15

    To assess the sensitivity of ultrasound in detecting soleus muscle lesions diagnosed on magnetic resonance imaging (MRI) and to characterize their location, ultrasound pattern, and evolution. Ultrasound and MRI studies were performed between May 2009 and February 2013 on all patients who presented to the Medical Services Clinic of the Catalan Sport Council with the initial onset of sharp pain in the calf compatible with injury of the soleus muscle. An inter-observer ultrasound reliability study was also performed. A total of 55 cases of soleus injury were studied prospectively (22 with right leg involvement, 33 left) by ultrasound and MRI, which was utilized as the ''gold standard.'' In MRI studies, 24 cases (43.7 %) had myofascial injuries that were localized in the posterior aponeurosis (PMF) in 15 cases (27.3 %) and in the anterior aponeurosis (AMF) in 9 (16.4 %). Thirty-one cases (56.3 %) were musculotendinous injuries, with 9 cases (16.4 %) in the medial aponeurosis (MMT), 11 cases (20 %) in the lateral aponeurosis (LMT), and 11 cases (20 %) in the central tendon (CMT). In comparison to MRI, ultrasound was able to detect injury to the soleus in 27.2 % of cases. No injuries were detected by ultrasound alone. Posterior myofascial injuries were more likely to be detected by ultrasound than anterior myofascial injuries or all types of musculotendinous injuries. Ultrasound patterns for each type of injury were described. Ultrasound is not a sensitive technique for detecting and assessing soleus traumatic tears compared with MRI, although the sensitivity is enhanced by a thorough anatomically based ultrasound examination. Timing of the ultrasound examination may be of importance. Each type of soleus injury appears to have a characteristic ultrasound pattern based on a defect of connective expansions, the existence of small myofascial filiform collections, and the rarefaction of the fibrillar area. (orig.)

  9. Therapeutic potential and adverse events of everolimus for treatment of hepatocellular carcinoma – systematic review and meta-analysis

    International Nuclear Information System (INIS)

    Yamanaka, Kenya; Petrulionis, Marius; Lin, Shibo; Gao, Chao; Galli, Uwe; Richter, Susanne; Winkler, Susanne; Houben, Philipp; Schultze, Daniel; Hatano, Etsuro; Schemmer, Peter

    2013-01-01

    Everolimus is an orally administrated mammalian target of rapamycin (mTOR) inhibitor. Several large-scale randomized controlled trials (RCTs) have demonstrated the survival benefits of everolimus at the dose of 10 mg/day for solid cancers. Furthermore, mTOR-inhibitor-based immunosuppression is associated with survival benefits for patients with hepatocellular carcinoma (HCC) who have received liver transplantation. However, a low rate of tumor reduction and some adverse events have been pointed out. This review summarizes the antitumor effects and adverse events of everolimus and evaluates its possible application in advanced HCC. For the meta-analysis of adverse events, we used the RCTs for solid cancers. The odds ratios of adverse events were calculated using the Peto method. Manypreclinical studies demonstrated that everolimus had antitumor effects such as antiproliferation and antiangiogenesis. However, some differences in the effects were observed among in vivo animal studies for HCC treatment. Meanwhile, clinical studies demonstrated that the response rate of single-agent everolimus was low, though survival benefits could be expected. The meta-analysis revealed the odds ratios (95% confidence interval [CI]) of stomatitis: 5.42 [4.31–6.73], hyperglycemia: 3.22 [2.37–4.39], anemia: 3.34 [2.37–4.67], pneumonitis: 6.02 [3.95–9.16], aspartate aminotransferase levels: 2.22 [1.37–3.62], and serum alanine aminotransferase levels: 2.94 [1.72–5.02], respectively. Everolimus at the dose of 10 mg/day significantly increased the risk of the adverse events. In order to enable its application to the standard conventional therapies of HCC, further studies are required to enhance the antitumor effects and manage the adverse events of everolimus

  10. The Impact of the Newly Licensed Dengue Vaccine in Endemic Countries.

    Science.gov (United States)

    Aguiar, Maíra; Stollenwerk, Nico; Halstead, Scott B

    2016-12-01

    With approximately 3 billion people at risk of acquiring the infection, dengue fever is now considered the most important mosquito-borne viral disease in the world, with 390 million dengue infections occurring every year, of which 96 million manifest symptoms with any level of disease severity. Treatment of uncomplicated dengue cases is only supportive and severe dengue cases require hospital intensive care. A vaccine now licensed in several countries and developed by Sanofi Pasteur (CYD-TDV, named Dengvaxia), was able to protect, in the first 25 months of the two Phase III, 66% of a subset of 9-16 year old participants. However, a significantly lower efficacy (including negative vaccine efficacy) was noted for children younger than 9 years of age. Analysis of year 3 results of phase III trials of Dengvaxia suggest high rates of protection of vaccinated partial dengue immunes but high rates of hospitalizations during breakthrough dengue infections of persons who were vaccinated when seronegative, with vaccine appearing to induce enhancing antibodies (ADE). An age structured model was developed based on Sanofi's recommendation to vaccinate persons age 945 years in dengue endemic countries. The model was used to explore the clinical burden of two vaccination strategies: 1) Vaccinate 4 or 20% of individuals, ages 9-45 years, seropositives and seronegatives, and 2) vaccinate 4 or 20% of individuals, ages 9-45 years, who are dengue immune only. Our results show that vaccinating dengue monotypic immune individuals prevents dengue hospitalizations, but at the same time dengue infections of vaccine-sensitized persons increases hospitalizations. When the vaccine is given only to partial immune individuals, after immunological screening of the population, disease burden decreases considerably.

  11. Cardiovascular Research Publications from Latin America between 1999 and 2008. A Bibliometric Study

    Directory of Open Access Journals (Sweden)

    Lisandro D. Colantonio

    2015-01-01

    Full Text Available Background: Cardiovascular research publications seem to be increasing in Latin America overall. Objective: To analyze trends in cardiovascular publications and their citations from countries in Latin America between 1999 and 2008, and to compare them with those from the rest of the countries. Methods: We retrieved references of cardiovascular publications between 1999 and 2008 and their five-year post-publication citations from the Web of Knowledge database. For countries in Latin America, we calculated the total number of publications and their citation indices (total citations divided by number of publications by year. We analyzed trends on publications and citation indices over time using Poisson regression models. The analysis was repeated for Latin America as a region, and compared with that for the rest of the countries grouped according to economic development. Results: Brazil (n = 6,132 had the highest number of publications in1999-2008, followed by Argentina (n = 1,686, Mexico (n = 1,368 and Chile (n = 874. Most countries showed an increase in publications over time, leaded by Guatemala (36.5% annually [95%CI: 16.7%-59.7%], Colombia (22.1% [16.3%-28.2%], Costa Rica (18.1% [8.1%-28.9%] and Brazil (17.9% [16.9%-19.1%]. However, trends on citation indices varied widely (from -33.8% to 28.4%. From 1999 to 2008, cardiovascular publications of Latin America increased by 12.9% (12.1%-13.5% annually. However, the citation indices of Latin America increased 1.5% (1.3%-1.7% annually, a lower increase than those of all other country groups analyzed. Conclusions: Although the number of cardiovascular publications of Latin America increased from 1999 to 2008, trends on citation indices suggest they may have had a relatively low impact on the research field, stressing the importance of considering quality and dissemination on local research policies.

  12. Intake fractions of industrial air pollutants in China. Estimation and application

    International Nuclear Information System (INIS)

    Wang, Shuxiao; Hao, Jiming; Li, Ji; Lu, Yongqi; Ho, Mun S.

    2006-01-01

    Intake fractions, an emissions-intake relationship for primary pollutants, are defined and are estimated in order to make simple estimates of health damages from air pollution. The sulfur dioxide (SO 2 ) and total suspended particles (TSP) intake fractions for five cities of China are estimated for the four main polluting industries-electric power generation, mineral (mostly cement) products industry, chemical process industry and metallurgical industry (mainly iron and steel smelting). The Industrial Source Complex Long Term (ISTLT3) model is used to simulate the spatial distribution of incremental ambient concentrations due to emissions from a large sample of site-specific sources. Detailed population distribution information is used for each city. The average intake fractions within 50 km of these sources are 4.4x10 -6 for TSP, and 4.2x10 -6 for SO 2 , with standard deviations of 8.15x10 -6 and 9.16x10 -6 , respectively. They vary over a wide range, from 10 -7 to 10 -5 . Although the electric power generation has been the focus of much of the air pollution research in China, our results show that it has the lowest average intake fraction for a local range among the four industries, which highlights the importance of pollutant emissions from other industrial sources. Sensitivity analyses show how the intake fractions are affected by the source and pollutant characteristics, the most important parameter being the size of the domain. However, the intake fraction estimates are robust enough to be useful for evaluating the local impacts on human health of primary SO 2 and TSP emissions. An application of intake fractions is given to demonstrate how this approach provides a rapid population risk estimate if the dose-response function is linear without threshold, and hence can help in prioritizing pollution control efforts. (author)

  13. Prognostic value of exercise echocardiography in diabetic patients

    Science.gov (United States)

    Oliveira, Joselina LM; Barreto-Filho, José AS; Oliveira, Carla RP; Santana, Thaiana A; Anjos-Andrade, Fernando D; Alves, Érica O; Nascimento-Junior, Adão C; Góes, Thiago JS; Santana, Nathalie O; Vasconcelos, Francis L; Barreto, Martha A; D'Oliveira Junior, Argemiro; Salvatori, Roberto; Aguiar-Oliveira, Manuel H; Sousa, Antônio CS

    2009-01-01

    Background Coronary artery disease (CAD) is the leading cause of death in diabetic patients. Although exercise echocardiography (EE) is established as a useful method for diagnosis and stratification of risk for CAD in the general population, there are few studies on its value as a prognostic tool in diabetic patients. The purpose of this investigation was to evaluate the value of EE in predicting cardiac events in diabetics. Methods 193 diabetic patients, 97 males, 59.8 ± 9.3 yrs (mean ± SD) were submitted to EE between 2001 and 2006 and followed from 7 to 65 months with median of 29 months by phone calls and personal interviews with patients and their primary physician, and reviewing medical records and death certificates. The end points were cardiac events, defined as non-fatal myocardial infarction, late myocardial revascularization and cardiac death. Sudden death without another explanation was considered cardiac death. Survival free of end points was estimated by the Kaplan-Meier method. Results Twenty-six cardiac events were registered in 24 individuals during the follow-up. The rates of cardiac events were 20.6 and 7% in patients with positive and negative EE, respectively (p < 0.001). Predictors of cardiac events included sedentary lifestyle, with RR of 2.57 95%CI [1.09 to 6.02] (P = 0.03) and positive EE, with RR 3.63, 95%CI [1.44 to 9.16] (P = 0.01). Patients with positive EE presented higher rates of cardiac events at 12 months (6.8% vs. 2.2%), p = 0.004. Conclusion EE is a useful method to predict cardiac events in diabetic patients with suspected or known CAD. PMID:19480653

  14. Bacteriophage lytic to Desulfovibrio aespoeensis isolated from deep groundwater.

    Science.gov (United States)

    Eydal, Hallgerd S C; Jägevall, Sara; Hermansson, Malte; Pedersen, Karsten

    2009-10-01

    Viruses were earlier found to be 10-fold more abundant than prokaryotes in deep granitic groundwater at the Aspö Hard Rock Laboratory (HRL). Using a most probable number (MPN) method, 8-30 000 cells of sulphate-reducing bacteria per ml were found in groundwater from seven boreholes at the Aspö HRL. The content of lytic phages infecting the indigenous bacterium Desulfovibrio aespoeensis in Aspö groundwater was analysed using the MPN technique for phages. In four of 10 boreholes, 0.2-80 phages per ml were found at depths of 342-450 m. Isolates of lytic phages were made from five cultures. Using transmission electron microscopy, these were characterized and found to be in the Podoviridae morphology group. The isolated phages were further analysed regarding host range and were found not to infect five other species of Desulfovibrio or 10 Desulfovibrio isolates with up to 99.9% 16S rRNA gene sequence identity to D. aespoeensis. To further analyse phage-host interactions, using a direct count method, growth of the phages and their host was followed in batch cultures, and the viral burst size was calculated to be approximately 170 phages per lytic event, after a latent period of approximately 70 h. When surviving cells from infected D. aespoeensis batch cultures were inoculated into new cultures and reinfected, immunity to the phages was found. The parasite-prey system found implies that viruses are important for microbial ecosystem diversity and activity, and for microbial numbers in deep subsurface groundwater.

  15. Prevalence of Cleft Lip/Palate in the Fangshan District of Beijing, 2006-2012.

    Science.gov (United States)

    Yang, Yanfen; Liu, Hui; Ma, Ruixin; Jin, Lei

    2018-01-01

    To estimate the cleft lip with or without cleft palate (CL/P) prevalence among births between 2006 and 2012 in Fangshan district of Beijing, China. Surveillance data analysis. All hospitals that provide obstetric services in the district. The CL/P cases presented for this report were from 13 weeks' gestation to 7 days postpartum. The CL/P prevalence was defined as the number of cases per 10 000 births, including live births and stillbirths at 28 weeks' gestation or beyond. The overall CL/P prevalence was 18.9 (95% confidence interval [CI]: 15.1-22.7) per 10 000 births. From 2006 to 2012, the CL/P prevalence was 19.3, 20.2, 10.9, 16.1, 17.5, 25.4, and 22.3 per 10 000 births; annually, no significant change was noted ( P for trend = .311). The prevalence of cleft palate, cleft lip, and cleft lip and palate were 3.4 (95% CI: 2.0-5.4), 6.2 (95% CI: 4.2-8.8), and 9.4 (95% CI: 6.9-12.4) per 10 000 births, respectively. The CL/P prevalence among the nonpermanent residents (31.4 per 10 000 births) was 2.31 times that of permanent residents (13.6 per 10 000 births). Among nonpermanent residents, the CL/P prevalence showed an upward trend over the study period ( P for trend = .036), that increased from 38.8 (95% CI: 16.5-76.6) per 10 000 births in 2006 to 54.6 (95% CI: 25.7-100.4) per 10 000 births in 2012. The overall CL/P prevalence was stable in the Fangshan district. However, the CL/P prevalence of the nonpermanent residents increased significantly.

  16. The Archaen volcanic facies in the Migori segment, Nyanza greenstone belt, Kenya: stratigraphy, geochemistry and mineralisation

    Science.gov (United States)

    Ichang'l, D. W.; MacLean, W. H.

    The Migori segment is an 80 by 20 km portion of the Nyanza greenstone belt which forms the northern part of the Archean Tanzanian Craton in western Kenya, northern Tanzania and southeastern Uganda. It consists of two volcanic centres, each with central, proximal and distal volcanic facies, comprising the Migori Group, the Macalder and Lolgorien Subgroups, and eleven volcano-sedimentary formations. The centres are separated by a basin of tuffs and greywacke turbidites. The volcanics are bimodal mafic basalt and dolerite ( Zr/Y = 3.8 - 6.5, La N/Yb N = 1.0 - 2.4) , and felsic calc-alkaline dacite-rhyolite ( Zr/Y = 10 - 21, La N/Yb N = 19 - 42 ) and high-K dacite ( Zr/Y = 9 - 16, La N/Yb N = 21 - 22 ). Felsic units form approximately three-fourths of the volcanic stratigraphy. Basalts, calc-alkaline dacites and rhyolites were deposited in a submarine environment, but the voluminous high-K dacites were erupted subaerially. The turbidites contain units of iron-formations. Granitic intrusions are chemically continuous with the high-K dacites. The felsic volcanics are anologous to those found at modern volcanic arc subduction settings involving continental crust. The Macalder ZnCuAuAg volcanogenic massive sulphide deposits is in central facies basalts-greywacke-rhyolite. Gold mineralisation occurs in proximal facies tuffs and iron formation, and in oblique and semi-conformable quartz veins. Greenstones in the Nyanza belt are dominated by calc-alkaline felsic volcanics in constrast to the komatiite-tholeiitic basalt volcanism in the Kaapvaal Craton of South Africa, and a mixture of the two types in the Zimbabwe Craton.

  17. Cardiovascular Research Publications from Latin America between 1999 and 2008. A Bibliometric Study

    Energy Technology Data Exchange (ETDEWEB)

    Colantonio, Lisandro D., E-mail: Lisandro.Colantonio@fulbrightmail.org [Department of Epidemiology - University of Alabama at Birmingham School of Public Health, Birmingham (United States); Department of Public Health, School of Medicine, University of Buenos Aires, Buenos Aires (Argentina); Baldridge, Abigail S.; Huffman, Mark D. [Northwestern University Feinberg School of Medicine, Chicago (United States); Bloomfield, Gerald S. [Duke University Medical Center - Duke Clinical Research Institute and Duke Global Health Institute, Durham (United States); Prabhakaran, Dorairaj [Centre for Chronic Disease Control, New Delhi (India)

    2015-01-15

    Cardiovascular research publications seem to be increasing in Latin America overall. To analyze trends in cardiovascular publications and their citations from countries in Latin America between 1999 and 2008, and to compare them with those from the rest of the countries. We retrieved references of cardiovascular publications between 1999 and 2008 and their five-year post-publication citations from the Web of Knowledge database. For countries in Latin America, we calculated the total number of publications and their citation indices (total citations divided by number of publications) by year. We analyzed trends on publications and citation indices over time using Poisson regression models. The analysis was repeated for Latin America as a region, and compared with that for the rest of the countries grouped according to economic development. Brazil (n = 6,132) had the highest number of publications in1999-2008, followed by Argentina (n = 1,686), Mexico (n = 1,368) and Chile (n = 874). Most countries showed an increase in publications over time, leaded by Guatemala (36.5% annually [95%CI: 16.7%-59.7%]), Colombia (22.1% [16.3%-28.2%]), Costa Rica (18.1% [8.1%-28.9%]) and Brazil (17.9% [16.9%-19.1%]). However, trends on citation indices varied widely (from -33.8% to 28.4%). From 1999 to 2008, cardiovascular publications of Latin America increased by 12.9% (12.1%-13.5%) annually. However, the citation indices of Latin America increased 1.5% (1.3%-1.7%) annually, a lower increase than those of all other country groups analyzed. Although the number of cardiovascular publications of Latin America increased from 1999 to 2008, trends on citation indices suggest they may have had a relatively low impact on the research field, stressing the importance of considering quality and dissemination on local research policies.

  18. Prospective evaluation of MRI, {sup 11}C-acetate PET/CT and contrast-enhanced CT for staging of bladder cancer

    Energy Technology Data Exchange (ETDEWEB)

    Vargas, H.A., E-mail: vargasah@mskcc.org [Department of Radiology, Memorial Sloan-Kettering Cancer Center, New York, NY (United States); Akin, O.; Schöder, H. [Department of Radiology, Memorial Sloan-Kettering Cancer Center, New York, NY (United States); Olgac, S. [Department of Pathology, Memorial Sloan-Kettering Cancer Center, New York, NY (United States); Dalbagni, G. [Department of Surgery, Urology Service, Memorial Sloan-Kettering Cancer Center, New York, NY (United States); Hricak, H. [Department of Radiology, Memorial Sloan-Kettering Cancer Center, New York, NY (United States); Bochner, B.H. [Department of Surgery, Urology Service, Memorial Sloan-Kettering Cancer Center, New York, NY (United States)

    2012-12-15

    Purpose: To prospectively evaluate the diagnostic performance of magnetic resonance imaging (MRI), {sup 11}C-acetate positron emission tomography/computed tomography (PET/CT) and contrast-enhanced CT for bladder cancer staging, using whole-mount pathologic review of radical cystectomy and pelvic lymph node specimens as the reference standard. Materials and methods: The institutional review board approved this prospective study, which was compliant with the Health Insurance Portability and Accountability Act. Written informed consent was obtained from 16 patients with histologically confirmed bladder cancer who underwent MRI, {sup 11}C-acetate PET/CT and contrast-enhanced CT before radical cystectomy and pelvic lymph node dissection. Before imaging 4/16 patients had received intravesical Bacillus Calmette-Guérin treatment, 6 had received systemic chemotherapy, 3 had received both and 3 had received neither. Measures of diagnostic performance including accuracy, sensitivity and specificity were estimated separately for each imaging modality. Results: MRI correctly staged 56% of patients (9/16), overstaged 38% (6/16) and understaged 6% (1/16). CT correctly staged 50% of patients (8/16), overstaged 44% (7/16) and understaged 6% (1/16). In 9 patients, {sup 11}C-acetate PET/CT showed uptake within the bladder wall; the uptake was true-positive in 7 patients and false-positive in 2 patients. Of the remaining 7 patients, 5 had true-negative and 2 had false-negative PET/CT results for cancer in the bladder wall. For all modalities, staging accuracy was reduced in patients with a history of prior intravesical and/or systemic chemotherapy. Conclusion: In staging bladder cancer, MRI, {sup 11}C-acetate PET/CT and CT displayed similar levels of accuracy. For all modalities, a history of intravesical and/or systemic chemotherapy affected staging accuracy.

  19. Immunological Effect of aGV Rabies Vaccine Administered Using the Essen and Zagreb Regimens: A Double-Blind, Randomized Clinical Trial.

    Science.gov (United States)

    Miao, Li; Shi, Liwei; Yang, Yi; Yan, Kunming; Sun, Hongliang; Mo, Zhaojun; Li, Li

    2018-04-01

    This study evaluated the immunological effect of an aGV rabies virus strain using the Essen and Zagreb immunization programs. A total of 1,944 subjects were enrolled and divided into three groups: the Essen test group, Essen control group, and Zagreb test group. Neutralizing antibody levels and antibody seroconversion rates were determined at 7 and 14 days after the initial inoculations and then 14 days after the final inoculation in all of the subjects. The seroconversion rates for the Essen test group, Essen control group, and Zagreb test group, which were assessed 7 days after the first dosing in a susceptible population, were 35.74%, 26.92%, and 45.49%, respectively, and at 14 days, the seroconversion rates in this population were 100%, 100%, and 99.63%, respectively. At 14 days after the final dosing, the seroconversion rates were 100% in all three of the groups. The neutralizing serum antibody levels of the Essen test group, Essen control group, and Zagreb test group at 7 days after the first dosing in the susceptible population were 0.37, 0.26, and 0.56 IU/mL, respectively, and at 14 days after the initial dosing, these levels were 16.71, 13.85, and 16.80 IU/mL. At 14 days after the final dosing, the neutralizing antibody levels were 22.9, 16.3, and 18.62 IU/mL, respectively. The results of this study suggested that the aGV rabies vaccine using the Essen program resulted in a good serum immune response, and the seroconversion rates and the neutralizing antibody levels generated with the Zagreb regimen were higher than those with the Essen regimen when measured 7 days after the first dose.

  20. Selective activation around the left occipito-temporal sulcus for words relative to pictures: individual variability or false positives?

    Science.gov (United States)

    Wright, Nicholas D; Mechelli, Andrea; Noppeney, Uta; Veltman, Dick J; Rombouts, Serge A R B; Glensman, Janice; Haynes, John-Dylan; Price, Cathy J

    2008-08-01

    We used high-resolution fMRI to investigate claims that learning to read results in greater left occipito-temporal (OT) activation for written words relative to pictures of objects. In the first experiment, 9/16 subjects performing a one-back task showed activation in > or =1 left OT voxel for words relative to pictures (P or =1 left OT voxel for words relative to pictures. However, at this low statistical threshold false positives need to be excluded. The semantic decision paradigm was therefore repeated, within subject, in two different scanners (1.5 and 3 T). Both scanners consistently localised left OT activation for words relative to fixation and pictures relative to words, but there were no consistent effects for words relative to pictures. Finally, in a third experiment, we minimised the voxel size (1.5 x 1.5 x 1.5 mm(3)) and demonstrated a striking concordance between the voxels activated for words and pictures, irrespective of task (naming vs. one-back) or script (English vs. Hebrew). In summary, although we detected differential activation for words relative to pictures, these effects: (i) do not withstand statistical rigour; (ii) do not replicate within or between subjects; and (iii) are observed in voxels that also respond to pictures of objects. Our findings have implications for the role of left OT activation during reading. More generally, they show that studies using low statistical thresholds in single subject analyses should correct the statistical threshold for the number of comparisons made or replicate effects within subject. (c) 2007 Wiley-Liss, Inc.

  1. Predictor variables for a half marathon race time in recreational male runners

    Directory of Open Access Journals (Sweden)

    Rüst CA

    2011-08-01

    Full Text Available Christoph Alexander Rüst1, Beat Knechtle1,2, Patrizia Knechtle2, Ursula Barandun1, Romuald Lepers3, Thomas Rosemann11Institute of General Practice and Health Services Research, University of Zurich, Zurich, Switzerland; 2Gesundheitszentrum St Gallen, St Gallen, Switzerland; 3INSERM U887, University of Burgundy, Faculty of Sport Sciences, Dijon, FranceAbstract: The aim of this study was to investigate predictor variables of anthropometry, training, and previous experience in order to predict a half marathon race time for future novice recreational male half marathoners. Eighty-four male finishers in the ‘Half Marathon Basel’ completed the race distance within (mean and standard deviation, SD 103.9 (16.5 min, running at a speed of 12.7 (1.9 km/h. After multivariate analysis of the anthropometric characteristics, body mass index (r = 0.56, suprailiacal (r = 0.36 and medial calf skin fold (r = 0.53 were related to race time. For the variables of training and previous experience, speed in running of the training sessions (r = –0.54 were associated with race time. After multivariate analysis of both the significant anthropometric and training variables, body mass index (P = 0.0150 and speed in running during training (P = 0.0045 were related to race time. Race time in a half marathon might be partially predicted by the following equation (r2 = 0.44: Race time (min = 72.91 + 3.045 * (body mass index, kg/m2 –3.884 * (speed in running during training, km/h for recreational male runners. To conclude, variables of both anthropometry and training were related to half marathon race time in recreational male half marathoners and cannot be reduced to one single predictor variable.Keywords: anthropometry, body fat, skin-folds, training, endurance

  2. Ionizing radiation in the disinfection of water contaminated with potentially pathogenic mycobacteria

    International Nuclear Information System (INIS)

    Kubin, M.; Sedlackova, J.; Vacek, K.

    1982-01-01

    Sterile drinking water samples were artificially colonized with M. kansasii, M. gardonae and M. fortuitum suspensions (the numbers of viable units in 1 ml were 1.2x10 3 , 48.5 and 3.2x10 3 , respectively) prepared from mycobacterial strains replicated in Tween 80-free liquid Dubos medium STO. The contaminated water samples were irradiated from a rotary cobalt 60 source (gamma radiation, E=1.17 and 1.33 MeV, dose rate 1 kJ/kg.h at room temperature) with doses 0.7, 1.5, 2.2, 3, 9, 16 and 27 kJ/kg. The disinfecting effectiveness was assessed by direct cultivation tests (0.5 ml volumes of water inoculated on egg medium) and by cultivation on membrane filtres after filtering the whole amount of the water examined (about 500 ml). Total disinfection was recorded for M. kansasii and M. fortuitum irradiated with 9 kJ/kg and for M. gordonae after irradiation with 1.5 kJ/kg. The calculated value of D 10 =0.4 kJ/kg (i.e., the radiation dose that reduces the number of viable mycobacteria by an order of magnitude) is suggestive of a strong disinfecting effect of ionizing radiation on the tested strains of potentially pathogenic mycobacteria. The results indicate that ionizing radiation could be applxcable in disinfecting supply and potable water contaminated with mycobacteria difficult to remove by other methods which, as a rule, cannot ensure permanent disinfection. (author)

  3. Ionizing radiation in the disinfection of water contaminated with potentially pathogenic mycobacteria

    Energy Technology Data Exchange (ETDEWEB)

    Kubin, M [Institut Hygieny a Epidemiologie, Prague (Czechoslovakia); Sedlackova, J; Vacek, K [Ustav Jaderneho Vyzkumu CSKAE, Rez (Czechoslovakia)

    1982-01-01

    Sterile drinking water samples were artificially colonized with M. kansasii, M. gardonae and M. fortuitum suspensions (the numbers of viable units in 1 ml were 1.2x10/sup 3/, 48.5 and 3.2x10/sup 3/, respectively) prepared from mycobacterial strains replicated in Tween 80-free liquid Dubos medium STO. The contaminated water samples were irradiated from a rotary cobalt 60 source (gamma radiation, E=1.17 and 1.33 MeV, dose rate 1 kJ/kg.h at room temperature) with doses 0.7, 1.5, 2.2, 3, 9, 16 and 27 kJ/kg. The disinfecting effectiveness was assessed by direct cultivation tests (0.5 ml volumes of water inoculated on egg medium) and by cultivation on membrane filtres after filtering the whole amount of the water examined (about 500 ml). Total disinfection was recorded for M. kansasii and M. fortuitum irradiated with 9 kJ/kg and for M. gordonae after irradiation with 1.5 kJ/kg. The calculated value of D/sub 10/=0.4 kJ/kg (i.e., the radiation dose that reduces the number of viable mycobacteria by an order of magnitude) is suggestive of a strong disinfecting effect of ionizing radiation on the tested strains of potentially pathogenic mycobacteria. The results indicate that ionizing radiation could be applicable in disinfecting supply and potable water contaminated with mycobacteria difficult to remove by other methods which, as a rule, cannot ensure permanent disinfection.

  4. Genesis Solar Wind Collector Cleaning Assessment: Update on 60336 Sample Case Study

    Science.gov (United States)

    Goreva, Y. S.; Allums, K. K.; Gonzalez, C. P.; Jurewicz, A. J.; Burnett, D. S.; Allton, J. H.; Kuhlman, K. R.; Woolum, D.

    2015-01-01

    To maximize the scientific return of Genesis Solar Wind return mission it is necessary to characterize and remove a crash-derived particle and thin film surface contamination. A small subset of Genesis mission collector fragments are being subjected to extensive study via various techniques. Here we present an update on the sample 60336, a Czochralski silicon (Si-CZ) based wafer from the bulk array (B/C). This sample has undergone multiple cleaning steps (see the table below): UPW spin wash, aggressive chemical cleanings (including aqua regia, hot xylene and RCA1), as well as optical and chemical (EDS, ToF-SIMS) imaging. Contamination appeared on the surface of 60336 after the initial 2007 UPW cleaning. Aqua regia and hot xylene treatment (8/13/2013) did little to remove contaminants. The sample was UPW cleaned for the third time and imaged (9/16/13). The UPW removed the dark stains that were visible on the sample. However, some features, like "the Flounder" (a large, 100 micron feature in Fig. 1b) appeared largely intact, resisting all previous cleaning efforts. These features were likely from mobilized adhesive, derived from the Post-It notes used to stabilize samples for transport from Utah after the hard landing. To remove this contamination, an RCA step 1 organic cleaning (RCA1) was employed. Although we are still uncertain on the nature of the Flounder and why it is resistant to UPW and aqua regia/hot xylene treatment, we have found RCA1 to be suitable for its removal. It is likely that the glue from sticky pads used during collector recovery may have been a source for resistant organic contamination [9]; however [8] shows that UPW reaction with crash-derived organic contamination does not make particle removal more difficult.

  5. Cost-effectiveness analysis of weekday and weeknight or weekend shifts for assessment of appendicitis

    International Nuclear Information System (INIS)

    Doria, Andrea S.; Babyn, Paul; Chait, Peter; Amernic, Heidi; Coyte, Peter C.; Dick, Paul; Langer, Jacob; Ungar, Wendy J.

    2005-01-01

    Assessment of appendicitis during a weeknight or weekend shift (after-hours period, AHP) might be more costly and less effective than its assessment on a weekday shift (standard hours period, SHP) because of increased costs (staff premium fees) and perforation risk (longer delays and less experience of fellows). Objectives: The objectives were to compare the costs and effectiveness of assessing children with suspected appendicitis who required a laparotomy and had US or CT after-hours with those of assessing children during standard hours, and to evaluate the importance of diagnostic imaging (DI) within the overall costs. We retrospectively microcosted resource use within six areas of a tertiary hospital (emergency [ED], diagnostic imaging (DI), surgery, wards, transport, and pathology) in a tertiary hospital. About 41 children (1.8-17 years) in the AHP and 35 (2.9-16 years) in the SHP were evaluated. Work shift effectiveness was measured with a histological score that assessed the severity of appendicitis (non-perforated appendicitis: scores 1-3; perforated appendicitis: score 4). The SHP was less costly and more effective regardless of whether the calculation included US or CT costs only. For a salary-based fee schedule, US$733 were saved per case of perforated appendicitis averted in the SHP. For a fee-for-service payment schedule, $847 were saved. Within the overall budget, the highest costs were those incurred on the ward for both shifts. The average cost per patient in DI ranged from 2 to 5% of the total costs in both shifts. Most perforation cases were found in the AHP (31.7%, AHP vs. 17.1%, SHP), which resulted in higher ward costs for patients in the AHP. (orig.)

  6. Most probable mixing state of aerosols in Delhi NCR, northern India

    Science.gov (United States)

    Srivastava, Parul; Dey, Sagnik; Srivastava, Atul Kumar; Singh, Sachchidanand; Tiwari, Suresh

    2018-02-01

    Unknown mixing state is one of the major sources of uncertainty in estimating aerosol direct radiative forcing (DRF). Aerosol DRF in India is usually reported for external mixing and any deviation from this would lead to high bias and error. Limited information on aerosol composition hinders in resolving this issue in India. Here we use two years of aerosol chemical composition data measured at megacity Delhi to examine the most probable aerosol mixing state by comparing the simulated clear-sky downward surface flux with the measured flux. We consider external, internal, and four combinations of core-shell (black carbon, BC over dust; water-soluble, WS over dust; WS over water-insoluble, WINS and BC over WINS) mixing. Our analysis reveals that choice of external mixing (usually considered in satellite retrievals and climate models) seems reasonable in Delhi only in the pre-monsoon (Mar-Jun) season. During the winter (Dec-Feb) and monsoon (Jul-Sep) seasons, 'WS coating over dust' externally mixed with BC and WINS appears to be the most probable mixing state; while 'WS coating over WINS' externally mixed with BC and dust seems to be the most probable mixing state in the post-monsoon (Oct-Nov) season. Mean seasonal TOA (surface) aerosol DRF for the most probable mixing states are 4.4 ± 3.9 (- 25.9 ± 3.9), - 16.3 ± 5.7 (- 42.4 ± 10.5), 13.6 ± 11.4 (- 76.6 ± 16.6) and - 5.4 ± 7.7 (- 80.0 ± 7.2) W m- 2 respectively in the pre-monsoon, monsoon, post-monsoon and winter seasons. Our results highlight the importance of realistic mixing state treatment in estimating aerosol DRF to aid in policy making to combat climate change.

  7. Energy- and time-resolved detection of prompt gamma-rays for proton range verification.

    Science.gov (United States)

    Verburg, Joost M; Riley, Kent; Bortfeld, Thomas; Seco, Joao

    2013-10-21

    In this work, we present experimental results of a novel prompt gamma-ray detector for proton beam range verification. The detection system features an actively shielded cerium-doped lanthanum(III) bromide scintillator, coupled to a digital data acquisition system. The acquisition was synchronized to the cyclotron radio frequency to separate the prompt gamma-ray signals from the later-arriving neutron-induced background. We designed the detector to provide a high energy resolution and an effective reduction of background events, enabling discrete proton-induced prompt gamma lines to be resolved. Measuring discrete prompt gamma lines has several benefits for range verification. As the discrete energies correspond to specific nuclear transitions, the magnitudes of the different gamma lines have unique correlations with the proton energy and can be directly related to nuclear reaction cross sections. The quantification of discrete gamma lines also enables elemental analysis of tissue in the beam path, providing a better prediction of prompt gamma-ray yields. We present the results of experiments in which a water phantom was irradiated with proton pencil-beams in a clinical proton therapy gantry. A slit collimator was used to collimate the prompt gamma-rays, and measurements were performed at 27 positions along the path of proton beams with ranges of 9, 16 and 23 g cm(-2) in water. The magnitudes of discrete gamma lines at 4.44, 5.2 and 6.13 MeV were quantified. The prompt gamma lines were found to be clearly resolved in dimensions of energy and time, and had a reproducible correlation with the proton depth-dose curve. We conclude that the measurement of discrete prompt gamma-rays for in vivo range verification of clinical proton beams is feasible, and plan to further study methods and detector designs for clinical use.

  8. Temperature-dependent elimination efficiency on Phaeocystis globosa by different initial population sizes of rotifer Brachionus plicatilis.

    Science.gov (United States)

    Sun, Yunfei; Wang, Yuanyuan; Lei, Jin; Qian, Chenchen; Zhu, Xuexia; Akbar, Siddiq; Huang, Yuan; Yang, Zhou

    2018-07-01

    Due to sea water eutrophication and global warming, the harmful Phaeocystis blooms outbreak frequently in coastal waters, which cause a serious threat to marine ecosystem. The application of rotifer to control the harmful alga is a promising way. To investigate the influence of initial rotifer density and temperature on the ability of rotifer Brachionus plicatilis to eliminate Phaeocystis globosa population, we cultured P. globosa with different initial rotifer densities (1, 3, 5 inds mL -1 ) at 19, 22, 25, 28, and 31 °C for 9-16 d. Results showed that the population of rotifer feeding on Phaeocystis increased rapidly and higher temperatures favored the growth of P. globosa and B. plicatilis. With increased initial rotifer density and temperature, both the clearance rate of rotifer and the reduction rate of P. globosa increased, and thus P. globosa were eliminated earlier. Both temperature and initial rotifer density had significant effects on clearance rate of rotifer and the time to Phaeocystis extinction, and there was a significant interaction between the two factors on the two parameters, i.e., the effect of initial rotifer density on eliminating Phaeocystis decreased with increasing temperature. The rotifer in 5 inds mL -1 at 28 °C eliminated P. globosa in 4 d, whereas the rotifer in 1 ind mL -1 at 19 °C spent about 16 d on eliminating P. globosa. In conclusion, higher temperature and bigger initial rotifer density promote rotifer to eliminate the harmful P. globosa, and the optimal temperature for rotifer to clear P. globosa is 28 °C. Copyright © 2018 Elsevier Ltd. All rights reserved.

  9. Particle Sizes in the Coma of Comet 45P/Honda-Mrkos-Pajdušáková from Arecibo Radar Observations

    Science.gov (United States)

    Springmann, Alessondra; Howell, Ellen S.; Harmon, John K.; Lejoly, Cassandra; Rivera-Valentin, Edgard G.; Virkki, Anne; Zambrano-Marin, Luisa F.; Taylor, Patrick A.; Harris, Walter M.; Mueller, Beatrice E. A.; Samarasinha, Nalin H.; Rodriguez Sanchez-Vahamonde, Carolina

    2017-10-01

    Radar observations of cometary comae can provide information about not only the cross-section of the coma, but also constraints on the particle sizes comprising the coma. Harmon et al. (2011) described analysis of radar observations of comet 103P/Hartley 2 to constrain the sizes of its coma particles, as well as modeling to analyze the particle velocity distribution in the coma and orientation with respect to the sun. Arecibo Observatory planetary radar system observations of comet 45P/Honda-Mrkos-Pajdušáková were obtained 9-16 February 2017 by transmitting a continuous wave of polarized radio waves at the comet. By examining the polarization ratios of the returned signal (whether it has the same sense or opposite sense of the transmitted signal), we can look for non-zero same sense polarization signal. Detectable same sense signal indicates the presence of particles with sizes larger than the Rayleigh transition size criteria, a = λ/2π ≈ 2 cm (for the Arecibo wavelength of 12.6 cm).The observations show strong opposite sense signal return from the comet nucleus, as well as a larger ‘skirt’ of surrounding grains in the coma. Preliminary analysis of this data indicates at least a weak same sense polarized signal, implying a population of grains larger than 2 cm in the coma. The sizes of particles in the coma, compared with the area of the coma, can help us constrain the minimum mass for particles at the Rayleigh size limit in the 45P coma. Further, a detectable grain halo of large particles around 45P would imply significant lofting of grains from the comet nucleus.ReferencesHarmon, John K., et al. "Radar observations of comet 103P/Hartley 2." The Astrophysical Journal Letters 734.1 (2011): L2.

  10. Validity of a Minimally Invasive Autopsy for Cause of Death Determination in Adults in Mozambique: An Observational Study

    Science.gov (United States)

    Castillo, Paola; Martínez, Miguel J.; Ussene, Esperança; Jordao, Dercio; Lovane, Lucilia; Ismail, Mamudo R.; Carrilho, Carla; Lorenzoni, Cesaltina; Ferreira, Luiz; Lacerda, Marcus; Mandomando, Inacio; Vila, Jordi; Munguambe, Khátia; Maixenchs, Maria; Quintó, Llorenç; Macete, Eusebio; Alonso, Pedro; Bassat, Quique; Menéndez, Clara; Ordi, Jaume

    2016-01-01

    Background There is an urgent need to identify tools able to provide reliable information on the cause of death in low-income regions, since current methods (verbal autopsy, clinical records, and complete autopsies) are either inaccurate, not feasible, or poorly accepted. We aimed to compare the performance of a standardized minimally invasive autopsy (MIA) approach with that of the gold standard, the complete diagnostic autopsy (CDA), in a series of adults who died at Maputo Central Hospital in Mozambique. Methods and Findings In this observational study, coupled MIAs and CDAs were performed in 112 deceased patients. The MIA analyses were done blindly, without knowledge of the clinical data or the results of the CDA. We compared the MIA diagnosis with the CDA diagnosis of cause of death. CDA diagnoses comprised infectious diseases (80; 71.4%), malignant tumors (16; 14.3%), and other diseases, including non-infectious cardiovascular, gastrointestinal, kidney, and lung diseases (16; 14.3%). A MIA diagnosis was obtained in 100/112 (89.2%) cases. The overall concordance between the MIA diagnosis and CDA diagnosis was 75.9% (85/112). The concordance was higher for infectious diseases and malignant tumors (63/80 [78.8%] and 13/16 [81.3%], respectively) than for other diseases (9/16; 56.2%). The specific microorganisms causing death were identified in the MIA in 62/74 (83.8%) of the infectious disease deaths with a recognized cause. The main limitation of the analysis is that both the MIA and the CDA include some degree of expert subjective interpretation. Conclusions A simple MIA procedure can identify the cause of death in many adult deaths in Mozambique. This tool could have a major role in improving the understanding and surveillance of causes of death in areas where infectious diseases are a common cause of mortality. PMID:27875530

  11. Association between stricter alcohol advertising regulations and lower hazardous drinking across European countries.

    Science.gov (United States)

    Bosque-Prous, Marina; Espelt, Albert; Guitart, Anna M; Bartroli, Montserrat; Villalbí, Joan R; Brugal, M Teresa

    2014-10-01

    To analyse the association between alcohol advertising restrictions and the prevalence of hazardous drinking among people aged 50-64 years in 16 European countries, taking into account both individual and contextual-level factors (alcohol taxation, availability, etc.). Cross-sectional study based on SHARE project surveys. A total of 27 773 subjects, aged 50-64 years, from 16 European countries who participated in wave 4 of the SHARE (Survey of Health, Ageing and Retirement in Europe) project. We estimated the prevalence of hazardous drinking (through adaptation of the SHARE questions to the scheme used by the Alcohol Use Disorders Identification Test Consumption (AUDIT-C) for each country. To determine whether the degree of advertising restrictions was associated with prevalence of hazardous drinking, we fitted robust variance multi-level Poisson models, adjusting for various individual and contextual variables. Prevalence ratios (PR) and their 95% confidence intervals (95% CI) were obtained. The observed prevalence of hazardous drinking was 24.1%, varying by sex and country. Countries with greater advertising restrictions had lower prevalence of hazardous drinking: 30.6% (95% CI = 29.3-31.8) in countries with no restrictions, 20.3% (95% CI = 19.3-21.2) in countries with some restrictions and 14.4% (95% CI = 11.9-16.8) in those with greatest restrictions. The PR found (with respect to countries with greatest restrictions) were 1.36 (95% CI = 0.90-2.06) for countries with some restrictions and 1.95 (95% CI = 1.31-2.91) for those with no advertising restrictions. The extent of advertising restrictions in European countries is associated inversely with prevalence of hazardous drinking in people aged 50-64 years. © 2014 Society for the Study of Addiction.

  12. Relation between fasting glucose and retinopathy for diagnosis of diabetes: three population-based cross-sectional studies.

    Science.gov (United States)

    Wong, Tien Y; Liew, Gerald; Tapp, Robyn J; Schmidt, Maria Inês; Wang, Jie Jin; Mitchell, Paul; Klein, Ronald; Klein, Barbara E K; Zimmet, Paul; Shaw, Jonathan

    2008-03-01

    The WHO and American Diabetes Association criteria for diagnosing diabetes mellitus assume the presence of a glycaemic threshold with high sensitivity for identifying retinopathy. However, this assumption is based on data from three previous studies that had important limitations in detecting retinopathy. We aimed to provide updated data for the relation between fasting plasma glucose (FPG) and retinopathy, and to assess the diagnostic accuracy of current FPG thresholds in identifying both prevalent and incident retinopathy. We examined the data from three cross-sectional adult populations: those in the Blue Mountains Eye Study (BMES, Australia, n=3162), the Australian Diabetes, Obesity and Lifestyle Study (AusDiab, Australia, n=2182), and the Multi-Ethnic Study of Atherosclerosis (MESA, USA, n=6079). Retinopathy was diagnosed from multiple retinal photographs of each eye, and graded according to the modified Airlie House Classification system. Plasma glucose concentrations were measured from fasting venous blood samples. The overall prevalence of retinopathy was 11.5% in BMES (95% CI 10.4-12.6%), 9.6% in AusDiab (8.4-10.9), and 15.8% in MESA (14.9-16.7). However, we found inconsistent evidence of a uniform glycaemic threshold for prevalent and incident retinopathy, with analyses suggesting a continuous relation. The widely used diabetes FPG cutoff of 7.0 mmol/L or higher had sensitivity less than 40% (range 14.8-39.1) for detecting retinopathy, with specificity between 80.8% and 95.8%. The area under receiver operating characteristic curves for FPG and retinopathy was low and ranged from 0.56 to 0.61. We saw no evidence of a clear and consistent glycaemic threshold for the presence or incidence of retinopathy across different populations. The current FPG cutoff of 7.0 mmol/L used to diagnose diabetes did not accurately identify people with and without retinopathy. These findings suggest that the criteria for diagnosing diabetes could need reassessment.

  13. The prevalence of impaired fasting glucose and undiagnosed diabetes mellitus and associated risk factors among adults living in a rural Koladiba town, northwest Ethiopia.

    Science.gov (United States)

    Worede, Abebaw; Alemu, Shitaye; Gelaw, Yalemzewod Assefa; Abebe, Molla

    2017-07-06

    Diabetes mellitus is becoming a big public health challenge, particularly in developing countries like Ethiopia. It is a manageable disease if early screening and follow up is made. However, as studies in Ethiopia are limited and unorganized, determining the magnitude of prediabetes and diabetes and identifying associated risk factors is quite essential. A community-based, cross-sectional study was conducted from February to April 2015 among adults (aged ≥20 years) in a rural Koladiba town. A multistage sampling technique was used to select a total of 392 study participants. Data were collected after a fully informed written consent was obtained from each participant. Demographic, behavioral, and clinical data were collected using a well-structured questionnaire. Multivariable logistic regression models were fitted to control the effect of confounders. Adjusted odds ratios (AOR) with their 95% confidence intervals (95% CI) were computed to measure associations. A p value of fasting glucose and undiagnosed diabetes mellitus were 12% (95% CI 9-16) and 2.3% (95% CI 1.1-4), respectively, in Koladiba. Overweight (AOR: 4.257, 95% CI 1.345-13.476), obesity (AOR: 5.26, 95% CI 1.138-24.316), hypertriglyceridemia (AOR: 2.83, 95% CI 1.451-5.521), and systolic hypertension (AOR: 3.858, 95% CI 1.62-9.189) were found to be independently associated with impaired fasting glucose. Positive family history of diabetes also showed a marginal association with impaired fasting glucose (p = 0.057). Male sex (p = 0.012) and hypertriglyceridemia (p = 0.030) were associated with undiagnosed diabetes mellitus. The prevalence of impaired fasting glucose and undiagnosed diabetes mellitus are found to be significant. Obesity, hypertriglyceridemia, and systolic hypertension are independently associated with impaired fasting glucose among adults. We recommend that the community be aware of healthy life style, early screening, and maintain continuous follow up.

  14. Optimising diffusion-weighted MR imaging for demonstrating pancreatic cancer: a comparison of respiratory-triggered, free-breathing and breath-hold techniques

    International Nuclear Information System (INIS)

    Kartalis, Nikolaos; Loizou, Louiza; Edsborg, Nick; Albiin, Nils; Segersvaerd, Ralf

    2012-01-01

    To compare respiratory-triggered, free-breathing, and breath-hold DWI techniques regarding (1) image quality, and (2) signal intensity (SI) and ADC measurements in pancreatic ductal adenocarcinoma (PDAC). Fifteen patients with histopathologically proven PDAC underwent DWI prospectively at 1.5 T (b = 0, 50, 300, 600 and 1,000 s/mm 2 ) with the three techniques. Two radiologists, independently and blindly, assigned total image quality scores [sum of rating diffusion images (lesion detection, anatomy, presence of artefacts) and ADC maps (lesion characterisation, overall image quality)] per technique and ranked them. The lesion SI, signal-to-noise ratio, mean ADC and coefficient of variation (CV) were compared. Total image quality scores for respiratory-triggered, free-breathing and breath-hold techniques were 17.9, 16.5 and 17.1 respectively (respiratory-triggered was significantly higher than free-breathing but not breath-hold). The respiratory-triggered technique had a significantly higher ranking. Lesion SI on all b-values and signal-to-noise ratio on b300 and b600 were significantly higher for the respiratory-triggered technique. For respiratory-triggered, free-breathing and breath-hold techniques the mean ADCs were 1.201, 1.132 and 1.253 x 10 -3 mm 2 /s, and mean CVs were 8.9, 10.8 and 14.1 % respectively (respiratory-triggered and free-breathing techniques had a significantly lower mean CV than the breath-hold technique). In both analyses, respiratory-triggered DWI showed superiority and seems the optimal DWI technique for demonstrating PDAC. (orig.)

  15. Transcardiac conducted electrical weapon (TASER) probe deployments: incidence and outcomes.

    Science.gov (United States)

    Bozeman, William P; Teacher, Eric; Winslow, James E

    2012-12-01

    TASER (TASER International, Scottsdale, AZ) conducted electrical weapons (CEWs) are commonly used by law enforcement officers. Although animal studies have suggested that transcardiac CEW discharges may produce direct cardiac effects, this has not been demonstrated in human studies. This study sought to determine the incidence and outcomes of transcardiac CEW probe impact locations in a large series of actual CEW deployments. A multi-center database of consecutive CEW uses by law enforcement officers was retrospectively reviewed. Case report forms were independently reviewed by three investigators to identify cases with paired probe configurations potentially producing a transcardiac discharge vector. Descriptive analysis was performed and inter-rater reliability was assessed. Among 1201 total CEW uses, 813 included probe deployments and 178 cases had paired anterior probe impacts potentially capable of producing a transcardiac discharge vector. This represents 14.8% of all CEW uses (95% confidence interval [CI] 12.9-16.9%) and 21.9% of CEW uses in probe mode (95% CI 19.1-24.9%). Inter-rater agreement was very good, with kappa = 0.82. There were no immediate deaths in any cases (97.5% CI 0.0-0.3%) to suggest a cardiac dysrhythmia, including those with transcardiac discharge vector. CEW deployments with probe impact configurations capable of producing a transcardiac discharge occur in a minority of cases in field use conditions. None of these cases, transcardiac or otherwise, produced immediately fatal dysrhythmias. These data support the overall safety of CEWs and provide a benchmark estimate of the likelihood of transcardiac discharge vectors occurring in field use of CEWs. Copyright © 2012 Elsevier Inc. All rights reserved.

  16. Hydrodynamic delivery of plasmid DNA encoding human FcγR-Ig dimers blocks immune-complex mediated inflammation in mice.

    Science.gov (United States)

    Shashidharamurthy, R; Machiah, D; Bozeman, E N; Srivatsan, S; Patel, J; Cho, A; Jacob, J; Selvaraj, P

    2012-09-01

    Therapeutic use and function of recombinant molecules can be studied by the expression of foreign genes in mice. In this study, we have expressed human Fcγ receptor-Ig fusion molecules (FcγR-Igs) in mice by administering FcγR-Ig plasmid DNAs hydrodynamically and compared their effectiveness with purified molecules in blocking immune-complex (IC)-mediated inflammation in mice. The concentration of hydrodynamically expressed FcγR-Igs (CD16A(F)-Ig, CD32A(R)-Ig and CD32A(H)-Ig) reached a maximum of 130 μg ml(-1) of blood within 24 h after plasmid DNA administration. The in vivo half-life of FcγR-Igs was found to be 9-16 days and western blot analysis showed that the FcγR-Igs were expressed as a homodimer. The hydrodynamically expressed FcγR-Igs blocked 50-80% of IC-mediated inflammation up to 3 days in a reverse passive Arthus reaction model. Comparative analysis with purified molecules showed that hydrodynamically expressed FcγR-Igs are more efficient than purified molecules in blocking IC-mediated inflammation and had a higher half-life. In summary, these results suggest that the administration of a plasmid vector with the FcγR-Ig gene can be used to study the consequences of blocking IC binding to FcγRs during the development of inflammatory diseases. This approach may have potential therapeutic value in treating IC-mediated inflammatory autoimmune diseases such as lupus, arthritis and autoimmune vasculitis.

  17. Topical use of a silymarin-based preparation to prevent radiodermatitis. Results of a prospective study in breast cancer patients

    Energy Technology Data Exchange (ETDEWEB)

    Becker-Schiebe, Martina; Hoffmann, Wolfgang [Klinikum Braunschweig (Germany). Klinik fuer Radioonkologie und Strahlentherapie; Mengs, Ulrich; Schaefer, Margitta [Rottapharm/Madaus, Koeln (Germany). Research and Development; Bulitta, Michael [CRM Biometrics GmbH, Rheinbach (Germany)

    2011-08-15

    More than 80% of patients with breast cancer undergoing postsurgical radiotherapy (RT) will develop radiodermatitis and approximately 10% of these patients show grade 3 lesions. Side effects may reduce the patient's compliance and can be limiting factors to follow RT protocols. Therefore, there is a high need for more effective prophylactic treatments. In this study, a silymarin-based cream (Leviaderm {sup registered}) was tested in comparison to our standard of care (SOC) at the involved site. A total of 101 patients were evaluated after breast-conserving surgery followed by RT with 50.4 Gy plus boost 9-16 Gy. Of these, 51 patients were treated with the silymarin-based cream. In addition, 50 patients were documented receiving a panthenol-containing cream interventionally, if local skin lesions occurred. The acute skin reactions were classified according to the RTOG and VAS (Visual Analogue Scale) scores. The median time to toxicity was prolonged significantly with silymarin-based cream (45 vs. 29 days (SOC), p < 0.0001). Only 9.8% of patients using silymarin-based cream showed grade 2 toxicity in week 5 of RT in comparison to 52% with SOC. At the end of RT, 23.5% of patients in the silymarin-based study group developed no skin reactions vs. 2% with SOC, while grade 3 toxicity occurred only in 2% in the silymarin-based arm compared to 28% (SOC). Silymarin-based cream Leviaderm {sup registered} may be a promising and effective treatment for the prevention of acute skin lesions caused by RT of breast cancer patients. To confirm the results of this nonrandomized, observational trial, this component should be tested in larger multicenter studies in this setting. (orig.)

  18. Combining biochar, zeolite and wood vinegar for composting of pig manure: The effect on greenhouse gas emission and nitrogen conservation.

    Science.gov (United States)

    Wang, Quan; Awasthi, Mukesh Kumar; Ren, Xiuna; Zhao, Junchao; Li, Ronghua; Wang, Zhen; Wang, Meijing; Chen, Hongyu; Zhang, Zengqiang

    2018-04-01

    The effect of enhancing wood vinegar (WV) with a mixture of biochar (B) and zeolite (Z) to compost pig manure (PM) in a 130 L reactor was evaluated to determine the levels of greenhouse gas (GHG) and ammonia emissions. Six treatments were prepared in a 2:1 ratio of PM mixed with wheat straw (WS; dry weight basis): PM + WS (control), PM + WS + 10%B, PM + WS + 10%B + 10%Z, and PM + WS with 0.5%, 1.0% and 2.0%WV combined with 10%B + 10%Z. These were composted for 50 days, and the results indicated that the combined use of B, Z, and WV could shorten the thermophilic phase and improve the maturity of compost compared to the control treatment. In addition, WV mixed with B and Z could reduce ammonia loss by 64.45-74.32% and decrease CO 2 , CH 4 , and N 2 O emissions by 33.90-46.98%, 50.39-61.15%, and 79.51-81.10%, respectively. Furthermore, compared to treatments in which B and B + Z were added, adding WV was more efficient to reduce the nitrogen and carbon loss, and the 10%B + 10%Z + 2%WV treatment presented the lowest loss of carbon (9.16%) and nitrogen (0.75%). Based on the maturity indexes used, nitrogen conservation, and efficiency of GHG emissions reduction, the treatment 10%B + 10%Z + 2%WV is suggested for efficient PM composting. Copyright © 2018 Elsevier Ltd. All rights reserved.

  19. Adult bone strength of children from single-parent families: the Midlife in the United States Study.

    Science.gov (United States)

    Crandall, C J; Karlamangla, A S; Merkin, S S; Binkley, N; Carr, D; Greendale, G A; Seeman, T E

    2015-03-01

    Bone health may be negatively impacted by childhood socio-environmental circumstances. We examined the independent associations of single-parent childhood and parental death or divorce in childhood with adult bone strength indices. Longer exposure to a single-parent household in childhood was associated with lower bone strength in adulthood. Because peak bone mass is acquired during childhood, bone health may be negatively impacted by childhood socio-environmental disadvantage. The goal of this study was to determine whether being raised in a single-parent household is associated with lower bone strength in adulthood. Using dual-energy X-ray absorptiometry data from 708 participants (mean age 57 years) in the Midlife in the United States Biomarker Project, we examined the independent associations of composite indices of femoral neck bone strength relative to load (in three failure modes: compression, bending, and impact) in adulthood with the experience of single-parent childhood and parental death or divorce in childhood. After adjustment for gender, race, menopause transition stage, age, and body mass index, each additional year of single-parent childhood was associated with 0.02 to 0.03 SD lower indices of adult femoral neck strength. In those with 9-16 years of single-parent childhood, the compression strength index was 0.41 SD lower, bending strength index was 0.31 SD lower, and impact strength index was 0.25 SD lower (all p values divorce during childhood was not by itself independently associated with adult bone strength indices. The magnitudes of these associations were unaltered by additional adjustment for lifestyle factors and socioeconomic status in childhood and adulthood. Independent of parental death or divorce, growing up in a single-parent household is associated with lower femoral neck bone strength in adulthood, and this association is not entirely explained by childhood or adult socioeconomic conditions or lifestyle choices.

  20. Capacidad entomocida de cepas nativas de Beauveria sp. sobre Schistocerca piceifrons peruviana (Lynch Arribalzaga, 1903

    Directory of Open Access Journals (Sweden)

    Nicolaza Pariona

    2013-04-01

    Full Text Available Cuatro cepas de Beauveria sp. (ABvPr11, ABvPr8, ABvPr3 y ABvSr4, fueron aisladas y caracterizadas de ejemplares de la langosta Schistocerca piceifrons peruviana procedentes de la Provincia de Huamanga del Departamento de Ayacucho. La capacidad entomocida de las 4 cepas fue evaluada en la langosta Schistocerca piceifrons peruviana. Los resultados muestran que todas las cepas, en soluciones de 108 conidias/mL, producen un 100% de mortalidad. El tiempo que se necesitó para eliminar el 100% de las langostas, para las cepas ABvPr11, ABvPr8, ABvSr4 y ABvPr3 fue de 12, 14 y 16 días respectivamente. Al décimo día se observó diferencias significativas respecto a la mortalidad, entre la cepa ABvPr11(90% y la cepas ABvSr4(74%, ABvPr8(72% y ABvPr3(64.6%. Posteriormente se determinó el tiempo de letalidad al 50% (TL50 de la población de langostas, con un intervalo de 8,38 a 9,16 días y el tiempo de letalidad al 80% (TL80 fue de 9,6 a 11,5 días. La cepa ABvPr11 presentó la mayor actividad entomocida para el control de Schistocerca piceifrons peruviana L.A.