WorldWideScience

Sample records for nipah virus matrix

  1. Matrix proteins of Nipah and Hendra viruses interact with beta subunits of AP-3 complexes.

    Science.gov (United States)

    Sun, Weina; McCrory, Thomas S; Khaw, Wei Young; Petzing, Stephanie; Myers, Terrell; Schmitt, Anthony P

    2014-11-01

    Paramyxoviruses and other negative-strand RNA viruses encode matrix proteins that coordinate the virus assembly process. The matrix proteins link the viral glycoproteins and the viral ribonucleoproteins at virus assembly sites and often recruit host machinery that facilitates the budding process. Using a co-affinity purification strategy, we have identified the beta subunit of the AP-3 adapter protein complex, AP3B1, as a binding partner for the M proteins of the zoonotic paramyxoviruses Nipah virus and Hendra virus. Binding function was localized to the serine-rich and acidic Hinge domain of AP3B1, and a 29-amino-acid Hinge-derived polypeptide was sufficient for M protein binding in coimmunoprecipitation assays. Virus-like particle (VLP) production assays were used to assess the relationship between AP3B1 binding and M protein function. We found that for both Nipah virus and Hendra virus, M protein expression in the absence of any other viral proteins led to the efficient production of VLPs in transfected cells, and this VLP production was potently inhibited upon overexpression of short M-binding polypeptides derived from the Hinge region of AP3B1. Both human and bat (Pteropus alecto) AP3B1-derived polypeptides were highly effective at inhibiting the production of VLPs. VLP production was also impaired through small interfering RNA (siRNA)-mediated depletion of AP3B1 from cells. These findings suggest that AP-3-directed trafficking processes are important for henipavirus particle production and identify a new host protein-virus protein binding interface that could become a useful target in future efforts to develop small molecule inhibitors to combat paramyxoviral infections. Henipaviruses cause deadly infections in humans, with a mortality rate of about 40%. Hendra virus outbreaks in Australia, all involving horses and some involving transmission to humans, have been a continuing problem. Nipah virus caused a large outbreak in Malaysia in 1998, killing 109 people

  2. The YPLGVG sequence of the Nipah virus matrix protein is required for budding

    Directory of Open Access Journals (Sweden)

    Yan Lianying

    2008-11-01

    Full Text Available Abstract Background Nipah virus (NiV is a recently emerged paramyxovirus capable of causing fatal disease in a broad range of mammalian hosts, including humans. Together with Hendra virus (HeV, they comprise the genus Henipavirus in the family Paramyxoviridae. Recombinant expression systems have played a crucial role in studying the cell biology of these Biosafety Level-4 restricted viruses. Henipavirus assembly and budding occurs at the plasma membrane, although the details of this process remain poorly understood. Multivesicular body (MVB proteins have been found to play a role in the budding of several enveloped viruses, including some paramyxoviruses, and the recruitment of MVB proteins by viral proteins possessing late budding domains (L-domains has become an important concept in the viral budding process. Previously we developed a system for producing NiV virus-like particles (VLPs and demonstrated that the matrix (M protein possessed an intrinsic budding ability and played a major role in assembly. Here, we have used this system to further explore the budding process by analyzing elements within the M protein that are critical for particle release. Results Using rationally targeted site-directed mutagenesis we show that a NiV M sequence YPLGVG is required for M budding and that mutation or deletion of the sequence abrogates budding ability. Replacement of the native and overlapping Ebola VP40 L-domains with the NiV sequence failed to rescue VP40 budding; however, it did induce the cellular morphology of extensive filamentous projection consistent with wild-type VP40-expressing cells. Cells expressing wild-type NiV M also displayed this morphology, which was dependent on the YPLGVG sequence, and deletion of the sequence also resulted in nuclear localization of M. Dominant-negative VPS4 proteins had no effect on NiV M budding, suggesting that unlike other viruses such as Ebola, NiV M accomplishes budding independent of MVB cellular proteins

  3. Nipah virus transmission in a hamster model.

    Directory of Open Access Journals (Sweden)

    Emmie de Wit

    2011-12-01

    Full Text Available Based on epidemiological data, it is believed that human-to-human transmission plays an important role in Nipah virus outbreaks. No experimental data are currently available on the potential routes of human-to-human transmission of Nipah virus. In a first dose-finding experiment in Syrian hamsters, it was shown that Nipah virus was predominantly shed via the respiratory tract within nasal and oropharyngeal secretions. Although Nipah viral RNA was detected in urogenital and rectal swabs, no infectious virus was recovered from these samples, suggesting no viable virus was shed via these routes. In addition, hamsters inoculated with high doses shed significantly higher amounts of viable Nipah virus particles in comparison with hamsters infected with lower inoculum doses. Using the highest inoculum dose, three potential routes of Nipah virus transmission were investigated in the hamster model: transmission via fomites, transmission via direct contact and transmission via aerosols. It was demonstrated that Nipah virus is transmitted efficiently via direct contact and inefficiently via fomites, but not via aerosols. These findings are in line with epidemiological data which suggest that direct contact with nasal and oropharyngeal secretions of Nipah virus infected individuals resulted in greater risk of Nipah virus infection. The data provide new and much-needed insights into the modes and efficiency of Nipah virus transmission and have important public health implications with regards to the risk assessment and management of future Nipah virus outbreaks.

  4. Nipah Virus Transmission in a Hamster Model

    Science.gov (United States)

    de Wit, Emmie; Bushmaker, Trenton; Scott, Dana; Feldmann, Heinz; Munster, Vincent J.

    2011-01-01

    Based on epidemiological data, it is believed that human-to-human transmission plays an important role in Nipah virus outbreaks. No experimental data are currently available on the potential routes of human-to-human transmission of Nipah virus. In a first dose-finding experiment in Syrian hamsters, it was shown that Nipah virus was predominantly shed via the respiratory tract within nasal and oropharyngeal secretions. Although Nipah viral RNA was detected in urogenital and rectal swabs, no infectious virus was recovered from these samples, suggesting no viable virus was shed via these routes. In addition, hamsters inoculated with high doses shed significantly higher amounts of viable Nipah virus particles in comparison with hamsters infected with lower inoculum doses. Using the highest inoculum dose, three potential routes of Nipah virus transmission were investigated in the hamster model: transmission via fomites, transmission via direct contact and transmission via aerosols. It was demonstrated that Nipah virus is transmitted efficiently via direct contact and inefficiently via fomites, but not via aerosols. These findings are in line with epidemiological data which suggest that direct contact with nasal and oropharyngeal secretions of Nipah virus infected individuals resulted in greater risk of Nipah virus infection. The data provide new and much-needed insights into the modes and efficiency of Nipah virus transmission and have important public health implications with regards to the risk assessment and management of future Nipah virus outbreaks. PMID:22180802

  5. Quantitative analysis of Nipah virus proteins released as virus-like particles reveals central role for the matrix protein

    Directory of Open Access Journals (Sweden)

    Eaton Bryan T

    2007-01-01

    Full Text Available Abstract Background Nipah virus (NiV is an emerging paramyxovirus distinguished by its ability to cause fatal disease in both animal and human hosts. Together with Hendra virus (HeV, they comprise the genus Henipavirus in the Paramyxoviridae family. NiV and HeV are also restricted to Biosafety Level-4 containment and this has hampered progress towards examining details of their replication and morphogenesis. Here, we have established recombinant expression systems to study NiV particle assembly and budding through the formation of virus-like particles (VLPs. Results When expressed by recombinant Modified Vaccinia virus Ankara (rMVA or plasmid transfection, individual NiV matrix (M, fusion (F and attachment (G proteins were all released into culture supernatants in a membrane-associated state as determined by sucrose density gradient flotation and immunoprecipitation. However, co-expression of F and G along with M revealed a shift in their distribution across the gradient, indicating association with M in VLPs. Protein release was also altered depending on the context of viral proteins being expressed, with F, G and nucleocapsid (N protein reducing M release, and N release dependent on the co-expression of M. Immunoelectron microscopy and density analysis revealed VLPs that were similar to authentic virus. Differences in the budding dynamics of NiV proteins were also noted between rMVA and plasmid based strategies, suggesting that over-expression by poxvirus may not be appropriate for studying the details of recombinant virus particle assembly and release. Conclusion Taken together, the results indicate that NiV M, F, and G each possess some ability to bud from expressing cells, and that co-expression of these viral proteins results in a more organized budding process with M playing a central role. These findings will aid our understanding of paramyxovirus particle assembly in general and could help facilitate the development of a novel vaccine

  6. Nipah Virus: A Public Health Concern

    Directory of Open Access Journals (Sweden)

    Abu Bakar Siddique

    2016-05-01

    Full Text Available Nipah virus, a member of the genus Henipavirus, a new class of virus in the Paramyxoviridae family, has drawn attention as an emerging zoonotic virus in South-East and South Asian region. Case fatality rate of Nipah virus infection ranges from 40–70% although it has been as high as 100% in some outbreaks. Many of the outbreaks were attributed to pigs consuming fruits, partially eaten by fruit bats, and transmission of infection to humans. In Bangladesh, Nipah virus infection was associated with contact with a sick cow, consumption of fresh date palm sap (potentially contaminated with pteropid bat saliva, and person-to-person transmission. In 2014, 18 cases of Nipah virus infection have been reported in Bangladesh, of which 9 cases died. In the most recent epidemic at least 6 people died out of nine cases due to Nipah virus infection in the remote northern Bangladesh in 2015. Human infections range from asymptomatic infection to fatal encephalitis. Some people can also experience atypical pneumonia and severe respiratory problems. The virus is detected by ELISA, PCR, immunofluoroscence assay and isolation by cell culture. Treatment is mostly symptomatic and supportive as the effect of antiviral drugs is not satisfactory, and an effective vaccine is yet to be developed. So the very high case fatality addresses the need for adequate and strict control and preventive measures.

  7. Nipah virus infection in bats (order Chiroptera) in peninsular Malaysia.

    Science.gov (United States)

    Yob, J. M.; Field, H.; Rashdi, A. M.; Morrissy, C.; van der Heide, B.; Rota, P.; bin Adzhar, A.; White, J.; Daniels, P.; Jamaluddin, A.; Ksiazek, T.

    2001-01-01

    Nipah virus, family Paramyxoviridae, caused disease in pigs and humans in peninsular Malaysia in 1998-99. Because Nipah virus appears closely related to Hendra virus, wildlife surveillance focused primarily on pteropid bats (suborder Megachiroptera), a natural host of Hendra virus in Australia. We collected 324 bats from 14 species on peninsular Malaysia. Neutralizing antibodies to Nipah virus were demonstrated in five species, suggesting widespread infection in bat populations in peninsular Malaysia. PMID:11384522

  8. Quantitative estimation of Nipah virus replication kinetics in vitro

    Directory of Open Access Journals (Sweden)

    Hassan Sharifah

    2006-06-01

    Full Text Available Abstract Background Nipah virus is a zoonotic virus isolated from an outbreak in Malaysia in 1998. The virus causes infections in humans, pigs, and several other domestic animals. It has also been isolated from fruit bats. The pathogenesis of Nipah virus infection is still not well described. In the present study, Nipah virus replication kinetics were estimated from infection of African green monkey kidney cells (Vero using the one-step SYBR® Green I-based quantitative real-time reverse transcriptase-polymerase chain reaction (qRT-PCR assay. Results The qRT-PCR had a dynamic range of at least seven orders of magnitude and can detect Nipah virus from as low as one PFU/μL. Following initiation of infection, it was estimated that Nipah virus RNA doubles at every ~40 minutes and attained peak intracellular virus RNA level of ~8.4 log PFU/μL at about 32 hours post-infection (PI. Significant extracellular Nipah virus RNA release occurred only after 8 hours PI and the level peaked at ~7.9 log PFU/μL at 64 hours PI. The estimated rate of Nipah virus RNA released into the cell culture medium was ~0.07 log PFU/μL per hour and less than 10% of the released Nipah virus RNA was infectious. Conclusion The SYBR® Green I-based qRT-PCR assay enabled quantitative assessment of Nipah virus RNA synthesis in Vero cells. A low rate of Nipah virus extracellular RNA release and low infectious virus yield together with extensive syncytial formation during the infection support a cell-to-cell spread mechanism for Nipah virus infection.

  9. Evaluation of Nipah Virus as a Human and Animal Biological Terrorism and Warfare Agent

    Science.gov (United States)

    2001-09-01

    Molecular analyses have confirmed that Nipah virus and Hendra virus are closely related, but different viruses . The N, C, P. V, M, F and G genes of Nipah...encephalitis and 106 of them have died. The Nipah virus outbreak also devastated Malaysia’s pig-farming industry. The Nipah virus or so-called Hendra ...Nipah virus belongs to the Paramnyxoviirit strain, which shows similarities to the Hendra virus , which was discovered in Australia in 1994

  10. Hendra virus and Nipah virus animal vaccines.

    Science.gov (United States)

    Broder, Christopher C; Weir, Dawn L; Reid, Peter A

    2016-06-24

    Hendra virus (HeV) and Nipah virus (NiV) are zoonotic viruses that emerged in the mid to late 1990s causing disease outbreaks in livestock and people. HeV appeared in Queensland, Australia in 1994 causing a severe respiratory disease in horses along with a human case fatality. NiV emerged a few years later in Malaysia and Singapore in 1998-1999 causing a large outbreak of encephalitis with high mortality in people and also respiratory disease in pigs which served as amplifying hosts. The key pathological elements of HeV and NiV infection in several species of mammals, and also in people, are a severe systemic and often fatal neurologic and/or respiratory disease. In people, both HeV and NiV are also capable of causing relapsed encephalitis following recovery from an acute infection. The known reservoir hosts of HeV and NiV are several species of pteropid fruit bats. Spillovers of HeV into horses continue to occur in Australia and NiV has caused outbreaks in people in Bangladesh and India nearly annually since 2001, making HeV and NiV important transboundary biological threats. NiV in particular possesses several features that underscore its potential as a pandemic threat, including its ability to infect humans directly from natural reservoirs or indirectly from other susceptible animals, along with a capacity of limited human-to-human transmission. Several HeV and NiV animal challenge models have been developed which have facilitated an understanding of pathogenesis and allowed for the successful development of both active and passive immunization countermeasures. Published by Elsevier Ltd.

  11. The Matrix Protein of Nipah Virus Targets the E3-Ubiquitin Ligase TRIM6 to Inhibit the IKKε Kinase-Mediated Type-I IFN Antiviral Response.

    Directory of Open Access Journals (Sweden)

    Preeti Bharaj

    2016-09-01

    Full Text Available For efficient replication, viruses have developed mechanisms to evade innate immune responses, including the antiviral type-I interferon (IFN-I system. Nipah virus (NiV, a highly pathogenic member of the Paramyxoviridae family (genus Henipavirus, is known to encode for four P gene-derived viral proteins (P/C/W/V with IFN-I antagonist functions. Here we report that NiV matrix protein (NiV-M, which is important for virus assembly and budding, can also inhibit IFN-I responses. IFN-I production requires activation of multiple signaling components including the IκB kinase epsilon (IKKε. We previously showed that the E3-ubiquitin ligase TRIM6 catalyzes the synthesis of unanchored K48-linked polyubiquitin chains, which are not covalently attached to any protein, and activate IKKε for induction of IFN-I mediated antiviral responses. Using co-immunoprecipitation assays and confocal microscopy we show here that the NiV-M protein interacts with TRIM6 and promotes TRIM6 degradation. Consequently, NiV-M expression results in reduced levels of unanchored K48-linked polyubiquitin chains associated with IKKε leading to impaired IKKε oligomerization, IKKε autophosphorylation and reduced IFN-mediated responses. This IFN antagonist function of NiV-M requires a conserved lysine residue (K258 in the bipartite nuclear localization signal that is found in divergent henipaviruses. Consistent with this, the matrix proteins of Ghana, Hendra and Cedar viruses were also able to inhibit IFNβ induction. Live NiV infection, but not a recombinant NiV lacking the M protein, reduced the levels of endogenous TRIM6 protein expression. To our knowledge, matrix proteins of paramyxoviruses have never been reported to be involved in innate immune antagonism. We report here a novel mechanism of viral innate immune evasion by targeting TRIM6, IKKε and unanchored polyubiquitin chains. These findings expand the universe of viral IFN antagonism strategies and provide a new

  12. Passive immunization and active vaccination against Hendra and Nipah viruses.

    Science.gov (United States)

    Broder, C C

    2013-01-01

    Hendra virus and Nipah virus are viral zoonoses first recognized in the mid and late 1990's and are now categorized as the type species of the genus Henipavirus within the family Paramyxoviridae. Their broad species tropism together with their capacity to cause severe and often fatal disease in both humans and animals make Hendra and Nipah "overlap agents" and significant biosecurity threats. The development of effective vaccination strategies to prevent or treat henipavirus infection and disease has been an important area of research. Here, henipavirus active and passive vaccination strategies that have been examined in animal challenge models of Hendra and Nipah virus disease are summarized and discussed.

  13. Nipah virus entry can occur by macropinocytosis

    International Nuclear Information System (INIS)

    Pernet, Olivier; Pohl, Christine; Ainouze, Michelle; Kweder, Hasan; Buckland, Robin

    2009-01-01

    Nipah virus (NiV) is a zoonotic biosafety level 4 paramyxovirus that emerged recently in Asia with high mortality in man. NiV is a member, with Hendra virus (HeV), of the Henipavirus genus in the Paramyxoviridae family. Although NiV entry, like that of other paramyxoviruses, is believed to occur via pH-independent fusion with the host cell's plasma membrane we present evidence that entry can occur by an endocytic pathway. The NiV receptor ephrinB2 has receptor kinase activity and we find that ephrinB2's cytoplasmic domain is required for entry but is dispensable for post-entry viral spread. The mutation of a single tyrosine residue (Y304F) in ephrinB2's cytoplasmic tail abrogates NiV entry. Moreover, our results show that NiV entry is inhibited by constructions and drugs specific for the endocytic pathway of macropinocytosis. Our findings could potentially permit the rapid development of novel low-cost antiviral treatments not only for NiV but also HeV.

  14. Identifying Early Target Cells of Nipah Virus Infection in Syrian Hamsters

    OpenAIRE

    Baseler, Laura; Scott, Dana P.; Saturday, Greg; Horne, Eva; Rosenke, Rebecca; Thomas, Tina; Meade-White, Kimberly; Haddock, Elaine; Feldmann, Heinz; de Wit, Emmie

    2016-01-01

    Background Nipah virus causes respiratory and neurologic disease with case fatality rates up to 100% in individual outbreaks. End stage lesions have been described in the respiratory and nervous systems, vasculature and often lymphoid organs in fatal human cases; however, the initial target organs of Nipah virus infection have not been identified. Here, we detected the initial target tissues and cells of Nipah virus and tracked virus dissemination during the early phase of infection in Syrian...

  15. Antibodies to Nipah-like virus in bats (Pteropus lylei), Cambodia.

    Science.gov (United States)

    Olson, James G; Rupprecht, Charles; Rollin, Pierre E; An, Ung Sam; Niezgoda, Michael; Clemins, Travis; Walston, Joe; Ksiazek, Thomas G

    2002-09-01

    Serum specimens from fruit bats were obtained at restaurants in Cambodia. We detected antibodies cross-reactive to Nipah virus by enzyme immunoassay in 11 (11.5%) of 96 Lyle's flying foxes (Pteropus lylei). Our study suggests that viruses closely related to Nipah or Hendra viruses are more widespread in Southeast Asia than previously documented.

  16. Pathogenesis of Hendra and Nipah virus infection in humans.

    Science.gov (United States)

    Escaffre, Olivier; Borisevich, Viktoriya; Rockx, Barry

    2013-04-17

    Hendra virus (HeV) and Nipah virus (NiV) are emerging zoonotic viruses that cause severe and often lethal respiratory illness and encephalitis in humans. Henipaviruses can infect a wide range of species and human-to-human transmission has been observed for NiV. While the exact route of transmission in humans is not known, experimental infection in different animal species suggests that infection can be efficiently initiated after respiratory challenge. The limited data on histopathological changes in fatal human cases of HeV and NiV suggest that endothelial cells are an important target during the terminal stage of infection; however, it is unknown where these viruses initially establish infection and how the virus disseminates from the respiratory tract to the central nervous system and other organs. Here we review the current concepts in henipavirus pathogenesis in humans.

  17. Hendra and Nipah viruses: why are they so deadly?

    Science.gov (United States)

    Marsh, Glenn A; Wang, Lin-Fa

    2012-06-01

    Henipavirus, including Hendra and Nipah viruses, is a group of emerging bat-borne paramyxoviruses which were responsible for severe disease outbreaks in humans, horses and pigs. The mortality rate of human infection varies between 50 and 100%, making them one of the most deadly viruses known to infect humans. Its use of highly conserved cell surface molecules (ephrin) as entry receptors and its highly effective replication and fusion strategies are believed to be important characteristics responsible for its high pathogenicity. Henipavirus also encodes multiple accessory proteins which play a key role in evasion of host innate immune responses. Our recent study on the mechanism of IFN antagonism by henipaviruses indicated that a better understanding of the virus-host interaction provides great potential to develop new therapeutic strategies against these viruses. Crown Copyright © 2012. Published by Elsevier B.V. All rights reserved.

  18. A treatment for and vaccine against the deadly Hendra and Nipah viruses.

    Science.gov (United States)

    Broder, Christopher C; Xu, Kai; Nikolov, Dimitar B; Zhu, Zhongyu; Dimitrov, Dimiter S; Middleton, Deborah; Pallister, Jackie; Geisbert, Thomas W; Bossart, Katharine N; Wang, Lin-Fa

    2013-10-01

    Hendra virus and Nipah virus are bat-borne paramyxoviruses that are the prototypic members of the genus Henipavirus. The henipaviruses emerged in the 1990s, spilling over from their natural bat hosts and causing serious disease outbreaks in humans and livestock. Hendra virus emerged in Australia and since 1994 there have been 7 human infections with 4 case fatalities. Nipah virus first appeared in Malaysia and subsequent outbreaks have occurred in Bangladesh and India. In total, there have been an estimated 582 human cases of Nipah virus and of these, 54% were fatal. Their broad species tropism and ability to cause fatal respiratory and/or neurologic disease in humans and animals make them important transboundary biological threats. Recent experimental findings in animals have demonstrated that a human monoclonal antibody targeting the viral G glycoprotein is an effective post-exposure treatment against Hendra and Nipah virus infection. In addition, a subunit vaccine based on the G glycoprotein of Hendra virus affords protection against Hendra and Nipah virus challenge. The vaccine has been developed for use in horses in Australia and is the first vaccine against a Biosafety Level-4 (BSL-4) agent to be licensed and commercially deployed. Together, these advances offer viable approaches to address Hendra and Nipah virus infection of livestock and people. Published by Elsevier B.V.

  19. Nipah virus encephalitis: A cause for concern for Indian neurologists?

    Directory of Open Access Journals (Sweden)

    Halder Amit

    2006-01-01

    Full Text Available The first and only recorded outbreak of Nipah virus (NV encephalitis in India occurred in the winter of 2001, although the causative organism could only be identified 5 years down the line in 2006. The first ever-recorded outbreak of NV encephalitis occurred in the Malaysian peninsula in 1998-99; though between 2001 and 2005, at least four outbreaks occurred in our neighboring country of Bangladesh. The threat of further outbreaks of this dangerous disease looms large on the Indian subcontinent, given the natural reservoir of the definitive host, namely, fruit-eating bats of the genus Pteropus. This review would briefly highlight the epidemiology, clinical aspects and diagnosis of NV encephalitis to enlighten the neurological community of the country for early detection and implementation of preventive measures in the event of further outbreaks, especially those which are generally passed of as ′mystery diseases′ in the lay press and even by governmental agencies.

  20. Structural and Functional Studies on the Fusion and Attachment Envelope Glycoproteins of Nipah Virus and Hendra Virus

    National Research Council Canada - National Science Library

    Bossart, Katharine

    2003-01-01

    Nipah virus (NiV) and Hendra (HeV) virus are emerging, biosafety level 4 paramyxoviruses responsible for fatal zoonotic infections of humans from pigs and horses, respectively, and are the prototypic members of a new Paramyxovirinae...

  1. Nipah and hendra virus interactions with the innate immune system.

    Science.gov (United States)

    Basler, Christopher F

    2012-01-01

    Nipah virus and Hendra virus are related, highly pathogenic paramyxoviruses with unusually broad host ranges. Henipaviruses encode several proteins that block innate immune responses, and these are likely to serve as virulence factors. Specfically, four virus-encoded proteins, the phosphoprotein (P), the V protein, the W protein, and the C protein have each been demonstrated to counteract aspects of the interferon (IFN)-α/β response, a key component of the innate immune response to virus infection. The available data indicate that V and W can inhibit the production of IFNα/β in response to various stimuli, while the P, V, and W proteins also block the ability of IFNs to signal and induce an antiviral state in cells. The C protein also inhibits the antiviral effects of IFNα/β by a poorly characterized mechanism. Reverse genetics systems, which allow the generation of recombinant viruses bearing specific mutations, have demonstrated the importance of the viral IFN-antagonists for replication. With these systems in hand, the field is now poised to define how specific viral IFN-antagonist functions influence viral pathogenesis.

  2. Cytoplasmic Motifs in the Nipah Virus Fusion Protein Modulate Virus Particle Assembly and Egress.

    Science.gov (United States)

    Johnston, Gunner P; Contreras, Erik M; Dabundo, Jeffrey; Henderson, Bryce A; Matz, Keesha M; Ortega, Victoria; Ramirez, Alfredo; Park, Arnold; Aguilar, Hector C

    2017-05-15

    Nipah virus (NiV), a paramyxovirus in the genus Henipavirus , has a mortality rate in humans of approximately 75%. While several studies have begun our understanding of NiV particle formation, the mechanism of this process remains to be fully elucidated. For many paramyxoviruses, M proteins drive viral assembly and egress; however, some paramyxoviral glycoproteins have been reported as important or essential in budding. For NiV the matrix protein (M), the fusion glycoprotein (F) and, to a much lesser extent, the attachment glycoprotein (G) autonomously induce the formation of virus-like particles (VLPs). However, functional interactions between these proteins during assembly and egress remain to be fully understood. Moreover, if the F-driven formation of VLPs occurs through interactions with host cell machinery, the cytoplasmic tail (CT) of F is a likely interactive domain. Therefore, we analyzed NiV F CT deletion and alanine mutants and report that several but not all regions of the F CT are necessary for efficient VLP formation. Two of these regions contain YXXØ or dityrosine motifs previously shown to interact with cellular machinery involved in F endocytosis and transport. Importantly, our results showed that F-driven, M-driven, and M/F-driven viral particle formation enhanced the recruitment of G into VLPs. By identifying key motifs, specific residues, and functional viral protein interactions important for VLP formation, we improve our understanding of the viral assembly/egress process and point to potential interactions with host cell machinery. IMPORTANCE Henipaviruses can cause deadly infections of medical, veterinary, and agricultural importance. With recent discoveries of new henipa-like viruses, understanding the mechanisms by which these viruses reproduce is paramount. We have focused this study on identifying the functional interactions of three Nipah virus proteins during viral assembly and particularly on the role of one of these proteins, the

  3. A mature and fusogenic form of the Nipah virus fusion protein requires proteolytic processing by cathepsin L

    International Nuclear Information System (INIS)

    Pager, Cara Theresia; Craft, Willie Warren; Patch, Jared; Dutch, Rebecca Ellis

    2006-01-01

    The Nipah virus fusion (F) protein is proteolytically processed to F 1 + F 2 subunits. We demonstrate here that cathepsin L is involved in this important maturation event. Cathepsin inhibitors ablated cleavage of Nipah F. Proteolytic processing of Nipah F and fusion activity was dramatically reduced in cathepsin L shRNA-expressing Vero cells. Additionally, Nipah virus F-mediated fusion was inhibited in cathepsin L-deficient cells, but coexpression of cathepsin L restored fusion activity. Both purified cathepsin L and B could cleave immunopurified Nipah F protein, but only cathepsin L produced products of the correct size. Our results suggest that endosomal cathepsins can cleave Nipah F, but that cathepsin L specifically converts Nipah F to a mature and fusogenic form

  4. Identifying Early Target Cells of Nipah Virus Infection in Syrian Hamsters.

    Directory of Open Access Journals (Sweden)

    Laura Baseler

    2016-11-01

    Full Text Available Nipah virus causes respiratory and neurologic disease with case fatality rates up to 100% in individual outbreaks. End stage lesions have been described in the respiratory and nervous systems, vasculature and often lymphoid organs in fatal human cases; however, the initial target organs of Nipah virus infection have not been identified. Here, we detected the initial target tissues and cells of Nipah virus and tracked virus dissemination during the early phase of infection in Syrian hamsters inoculated with a Nipah virus isolate from Malaysia (NiV-M or Bangladesh (NiV-B.Syrian hamsters were euthanized between 4 and 48 hours post intranasal inoculation and tissues were collected and analyzed for the presence of viral RNA, viral antigen and infectious virus. Virus replication was first detected at 8 hours post inoculation (hpi. Nipah virus initially targeted type I pneumocytes, bronchiolar respiratory epithelium and alveolar macrophages in the lung and respiratory and olfactory epithelium lining the nasal turbinates. By 16 hpi, virus disseminated to epithelial cells lining the larynx and trachea. Although the pattern of viral dissemination was similar for both virus isolates, the rate of spread was slower for NiV-B. Infectious virus was not detected in the nervous system or blood and widespread vascular infection and lesions within lymphoid organs were not observed, even at 48 hpi.Nipah virus initially targets the respiratory system. Virus replication in the brain and infection of blood vessels in non-respiratory tissues does not occur during the early phase of infection. However, virus replicates early in olfactory epithelium and may serve as the first step towards nervous system dissemination, suggesting that development of vaccines that block virus dissemination or treatments that can access the brain and spinal cord and directly inhibit virus replication may be necessary for preventing central nervous system pathology.

  5. Identifying Early Target Cells of Nipah Virus Infection in Syrian Hamsters.

    Science.gov (United States)

    Baseler, Laura; Scott, Dana P; Saturday, Greg; Horne, Eva; Rosenke, Rebecca; Thomas, Tina; Meade-White, Kimberly; Haddock, Elaine; Feldmann, Heinz; de Wit, Emmie

    2016-11-01

    Nipah virus causes respiratory and neurologic disease with case fatality rates up to 100% in individual outbreaks. End stage lesions have been described in the respiratory and nervous systems, vasculature and often lymphoid organs in fatal human cases; however, the initial target organs of Nipah virus infection have not been identified. Here, we detected the initial target tissues and cells of Nipah virus and tracked virus dissemination during the early phase of infection in Syrian hamsters inoculated with a Nipah virus isolate from Malaysia (NiV-M) or Bangladesh (NiV-B). Syrian hamsters were euthanized between 4 and 48 hours post intranasal inoculation and tissues were collected and analyzed for the presence of viral RNA, viral antigen and infectious virus. Virus replication was first detected at 8 hours post inoculation (hpi). Nipah virus initially targeted type I pneumocytes, bronchiolar respiratory epithelium and alveolar macrophages in the lung and respiratory and olfactory epithelium lining the nasal turbinates. By 16 hpi, virus disseminated to epithelial cells lining the larynx and trachea. Although the pattern of viral dissemination was similar for both virus isolates, the rate of spread was slower for NiV-B. Infectious virus was not detected in the nervous system or blood and widespread vascular infection and lesions within lymphoid organs were not observed, even at 48 hpi. Nipah virus initially targets the respiratory system. Virus replication in the brain and infection of blood vessels in non-respiratory tissues does not occur during the early phase of infection. However, virus replicates early in olfactory epithelium and may serve as the first step towards nervous system dissemination, suggesting that development of vaccines that block virus dissemination or treatments that can access the brain and spinal cord and directly inhibit virus replication may be necessary for preventing central nervous system pathology.

  6. Affinity selection of Nipah and Hendra virus-related vaccine candidates from a complex random peptide library displayed on bacteriophage virus-like particles

    Energy Technology Data Exchange (ETDEWEB)

    Peabody, David S.; Chackerian, Bryce; Ashley, Carlee; Carnes, Eric; Negrete, Oscar

    2017-01-24

    The invention relates to virus-like particles of bacteriophage MS2 (MS2 VLPs) displaying peptide epitopes or peptide mimics of epitopes of Nipah Virus envelope glycoprotein that elicit an immune response against Nipah Virus upon vaccination of humans or animals. Affinity selection on Nipah Virus-neutralizing monoclonal antibodies using random sequence peptide libraries on MS2 VLPs selected peptides with sequence similarity to peptide sequences found within the envelope glycoprotein of Nipah itself, thus identifying the epitopes the antibodies recognize. The selected peptide sequences themselves are not necessarily identical in all respects to a sequence within Nipah Virus glycoprotein, and therefore may be referred to as epitope mimics VLPs displaying these epitope mimics can serve as vaccine. On the other hand, display of the corresponding wild-type sequence derived from Nipah Virus and corresponding to the epitope mapped by affinity selection, may also be used as a vaccine.

  7. A review of Nipah and Hendra viruses with an historical aside.

    Science.gov (United States)

    Ksiazek, Thomas G; Rota, Paul A; Rollin, Pierre E

    2011-12-01

    The emergence of Hendra and Nipah viruses in the 1990s has been followed by the further emergence of these viruses in the tropical Old World. The history and current knowledge of the disease, the viruses and their epidemiology is reviewed in this article. A historical aside summarizes the role that Dr. Brian W.J. Mahy played at critical junctures in the early stories of these viruses. Copyright © 2011 Elsevier B.V. All rights reserved.

  8. Comparison of the pathogenicity of Nipah virus isolates from Bangladesh and Malaysia in the Syrian hamster.

    Directory of Open Access Journals (Sweden)

    Blair L DeBuysscher

    Full Text Available Nipah virus is a zoonotic pathogen that causes severe disease in humans. The mechanisms of pathogenesis are not well described. The first Nipah virus outbreak occurred in Malaysia, where human disease had a strong neurological component. Subsequent outbreaks have occurred in Bangladesh and India and transmission and disease processes in these outbreaks appear to be different from those of the Malaysian outbreak. Until this point, virtually all Nipah virus studies in vitro and in vivo, including vaccine and pathogenesis studies, have utilized a virus isolate from the original Malaysian outbreak (NiV-M. To investigate potential differences between NiV-M and a Nipah virus isolate from Bangladesh (NiV-B, we compared NiV-M and NiV-B infection in vitro and in vivo. In hamster kidney cells, NiV-M-infection resulted in extensive syncytia formation and cytopathic effects, whereas NiV-B-infection resulted in little to no morphological changes. In vivo, NiV-M-infected Syrian hamsters had accelerated virus replication, pathology and death when compared to NiV-B-infected animals. NiV-M infection also resulted in the activation of host immune response genes at an earlier time point. Pathogenicity was not only a result of direct effects of virus replication, but likely also had an immunopathogenic component. The differences observed between NiV-M and NiV-B pathogeneis in hamsters may relate to differences observed in human cases. Characterization of the hamster model for NiV-B infection allows for further research of the strain of Nipah virus responsible for the more recent outbreaks in humans. This model can be used to study NiV-B pathogenesis, transmission, and countermeasures that could be used to control outbreaks.

  9. Antiviral activity of gliotoxin, gentian violet and brilliant green against Nipah and Hendra virus in vitro

    Directory of Open Access Journals (Sweden)

    Meyer Adam G

    2009-11-01

    Full Text Available Abstract Background Using a recently described monolayer assay amenable to high throughput screening format for the identification of potential Nipah virus and Hendra virus antivirals, we have partially screened a low molecular weight compound library (>8,000 compounds directly against live virus infection and identified twenty eight promising lead molecules. Initial single blind screens were conducted with 10 μM compound in triplicate with a minimum efficacy of 90% required for lead selection. Lead compounds were then further characterised to determine the median efficacy (IC50, cytotoxicity (CC50 and the in vitro therapeutic index in live virus and pseudotype assay formats. Results While a number of leads were identified, the current work describes three commercially available compounds: brilliant green, gentian violet and gliotoxin, identified as having potent antiviral activity against Nipah and Hendra virus. Similar efficacy was observed against pseudotyped Nipah and Hendra virus, vesicular stomatitis virus and human parainfluenza virus type 3 while only gliotoxin inhibited an influenza A virus suggesting a non-specific, broad spectrum activity for this compound. Conclusion All three of these compounds have been used previously for various aspects of anti-bacterial and anti-fungal therapy and the current results suggest that while unsuitable for internal administration, they may be amenable to topical antiviral applications, or as disinfectants and provide excellent positive controls for future studies.

  10. A neutralizing human monoclonal antibody protects against lethal disease in a new ferret model of acute nipah virus infection.

    Directory of Open Access Journals (Sweden)

    Katharine N Bossart

    2009-10-01

    Full Text Available Nipah virus is a broadly tropic and highly pathogenic zoonotic paramyxovirus in the genus Henipavirus whose natural reservoirs are several species of Pteropus fruit bats. Nipah virus has repeatedly caused outbreaks over the past decade associated with a severe and often fatal disease in humans and animals. Here, a new ferret model of Nipah virus pathogenesis is described where both respiratory and neurological disease are present in infected animals. Severe disease occurs with viral doses as low as 500 TCID(50 within 6 to 10 days following infection. The underlying pathology seen in the ferret closely resembles that seen in Nipah virus infected humans, characterized as a widespread multisystemic vasculitis, with virus replicating in highly vascular tissues including lung, spleen and brain, with recoverable virus from a variety of tissues. Using this ferret model a cross-reactive neutralizing human monoclonal antibody, m102.4, targeting the henipavirus G glycoprotein was evaluated in vivo as a potential therapeutic agent. All ferrets that received m102.4 ten hours following a high dose oral-nasal Nipah virus challenge were protected from disease while all controls died. This study is the first successful post-exposure passive antibody therapy for Nipah virus using a human monoclonal antibody.

  11. Hendra and Nipah viruses: pathogenesis, animal models and recent breakthroughs in vaccination

    Directory of Open Access Journals (Sweden)

    Weingartl HM

    2015-09-01

    Full Text Available Hana M Weingartl National Centre for Foreign Animal Disease, Canadian Food Inspection Agency, Winnipeg, MB, Canada Abstract: Hendra and Nipah viruses are two highly pathogenic zoonotic members of the genus Henipavirus, family Paramyxoviridae, requiring work under biosafety level 4 conditions due to a lack of effective therapy and human vaccines. Several vaccine candidates were protective in animal models: recombinant vaccinia virus expressing Nipah virus (NiV F and G proteins in hamsters against NiV; recombinant ALVAC–NiV F and G in swine against NiV; recombinant Hendra virus (HeV soluble G protein (sGHeV against HeV and NiV in cats, ferrets, horses, and African green monkeys (AGM; recombinant vesicular stomatitis virus-based vectors expressing NiV F or G against NiV in hamsters and ferrets; measles virus-based NiV G vaccine candidate in hamsters and AGMs against NiV; and adenoassociated virus expressing NiG protein, which protected hamsters against NiV. The sGHeV was licensed for use in horses (Equivac HeV® in 2012. It is the first vaccine candidate licensed against a biosafety level 4 agent. With the development of suitable animal models (ferret, hamster and, importantly, AGM, progress can be made toward development of a human vaccine.Keywords: henipavirus, equine, swine, human infection, animal models, vaccine candidates

  12. Use of monoclonal antibodies against Hendra and Nipah viruses in an antigen capture ELISA

    Directory of Open Access Journals (Sweden)

    Spiropoulou Christina F

    2010-06-01

    Full Text Available Abstract Background Outbreaks of Hendra (HeV and Nipah (NiV viruses have been reported starting in 1994 and 1998, respectively. Both viruses are capable of causing fatal disease in humans and effecting great economical loss in the livestock industry. Results Through screening of hybridomas derived from mice immunized with γ-irradiated Nipah virus, we identified two secreted antibodies; one reactive with the nucleocapsid (N protein and the other, the phosphoprotein (P of henipaviruses. Epitope mapping and protein sequence alignments between NiV and HeV suggest the last 14 amino acids of the carboxyl terminus of the N protein is the target of the anti-N antibody. The anti-P antibody recognizes an epitope in the amino-terminal half of P protein. These monoclonal antibodies were used to develop two antigen capture ELISAs, one for virus detection and the other for differentiation between NiV and HeV. The lower limit of detection of the capture assay with both monoclonal antibodies was 400 pfu. The anti-N antibody was used to successfully detect NiV in a lung tissue suspension from an infected pig. Conclusion The antigen capture ELISA developed is potentially affordable tool to provide rapid detection and differentiation between the henipaviruses.

  13. Use of monoclonal antibodies against Hendra and Nipah viruses in an antigen capture ELISA.

    Science.gov (United States)

    Chiang, Cheng-Feng; Lo, Michael K; Rota, Paul A; Spiropoulou, Christina F; Rollin, Pierre E

    2010-06-03

    Outbreaks of Hendra (HeV) and Nipah (NiV) viruses have been reported starting in 1994 and 1998, respectively. Both viruses are capable of causing fatal disease in humans and effecting great economical loss in the livestock industry. Through screening of hybridomas derived from mice immunized with gamma-irradiated Nipah virus, we identified two secreted antibodies; one reactive with the nucleocapsid (N) protein and the other, the phosphoprotein (P) of henipaviruses. Epitope mapping and protein sequence alignments between NiV and HeV suggest the last 14 amino acids of the carboxyl terminus of the N protein is the target of the anti-N antibody. The anti-P antibody recognizes an epitope in the amino-terminal half of P protein. These monoclonal antibodies were used to develop two antigen capture ELISAs, one for virus detection and the other for differentiation between NiV and HeV. The lower limit of detection of the capture assay with both monoclonal antibodies was 400 pfu. The anti-N antibody was used to successfully detect NiV in a lung tissue suspension from an infected pig. The antigen capture ELISA developed is potentially affordable tool to provide rapid detection and differentiation between the henipaviruses.

  14. Novel Functions of Hendra Virus G N-Glycans and Comparisons to Nipah Virus.

    Science.gov (United States)

    Bradel-Tretheway, Birgit G; Liu, Qian; Stone, Jacquelyn A; McInally, Samantha; Aguilar, Hector C

    2015-07-01

    Hendra virus (HeV) and Nipah virus (NiV) are reportedly the most deadly pathogens within the Paramyxoviridae family. These two viruses bind the cellular entry receptors ephrin B2 and/or ephrin B3 via the viral attachment glycoprotein G, and the concerted efforts of G and the viral fusion glycoprotein F result in membrane fusion. Membrane fusion is essential for viral entry into host cells and for cell-cell fusion, a hallmark of the disease pathobiology. HeV G is heavily N-glycosylated, but the functions of the N-glycans remain unknown. We disrupted eight predicted N-glycosylation sites in HeV G by conservative mutations (Asn to Gln) and found that six out of eight sites were actually glycosylated (G2 to G7); one in the stalk (G2) and five in the globular head domain (G3 to G7). We then tested the roles of individual and combined HeV G N-glycan mutants and found functions in the modulation of shielding against neutralizing antibodies, intracellular transport, G-F interactions, cell-cell fusion, and viral entry. Between the highly conserved HeV and NiV G glycoproteins, similar trends in the effects of N-glycans on protein functions were observed, with differences in the levels at which some N-glycan mutants affected such functions. While the N-glycan in the stalk domain (G2) had roles that were highly conserved between HeV and NiV G, individual N-glycans in the head affected the levels of several protein functions differently. Our findings are discussed in the context of their contributions to our understanding of HeV and NiV pathogenesis and immune responses. Viral envelope glycoproteins are important for viral pathogenicity and immune evasion. N-glycan shielding is one mechanism by which immune evasion can be achieved. In paramyxoviruses, viral attachment and membrane fusion are governed by the close interaction of the attachment proteins H/HN/G and the fusion protein F. In this study, we show that the attachment glycoprotein G of Hendra virus (HeV), a deadly

  15. Microsphere suspension array assays for detection and differentiation of Hendra and Nipah viruses.

    Science.gov (United States)

    Foord, Adam J; White, John R; Colling, Axel; Heine, Hans G

    2013-01-01

    Microsphere suspension array systems enable the simultaneous fluorescent identification of multiple separate nucleotide targets in a single reaction. We have utilized commercially available oligo-tagged microspheres (Luminex MagPlex-TAG) to construct and evaluate multiplexed assays for the detection and differentiation of Hendra virus (HeV) and Nipah virus (NiV). Both these agents are bat-borne zoonotic paramyxoviruses of increasing concern for veterinary and human health. Assays were developed targeting multiple sites within the nucleoprotein (N) and phosphoprotein (P) encoding genes. The relative specificities and sensitivities of the assays were determined using reference isolates of each virus type, samples from experimentally infected horses, and archival veterinary diagnostic submissions. Results were assessed in direct comparison with an established qPCR. The microsphere array assays achieved unequivocal differentiation of HeV and NiV and the sensitivity of HeV detection was comparable to qPCR, indicating high analytical and diagnostic specificity and sensitivity.

  16. Inhibition of Henipavirus fusion and infection by heptad-derived peptides of the Nipah virus fusion glycoprotein

    Science.gov (United States)

    Bossart, Katharine N; Mungall, Bruce A; Crameri, Gary; Wang, Lin-Fa; Eaton, Bryan T; Broder, Christopher C

    2005-01-01

    Background The recent emergence of four new members of the paramyxovirus family has heightened the awareness of and re-energized research on new and emerging diseases. In particular, the high mortality and person to person transmission associated with the most recent Nipah virus outbreaks, as well as the very recent re-emergence of Hendra virus, has confirmed the importance of developing effective therapeutic interventions. We have previously shown that peptides corresponding to the C-terminal heptad repeat (HR-2) of the fusion envelope glycoprotein of Hendra virus and Nipah virus were potent inhibitors of both Hendra virus and Nipah virus-mediated membrane fusion using recombinant expression systems. In the current study, we have developed shorter, second generation HR-2 peptides which include a capped peptide via amidation and acetylation and two poly(ethylene glycol)-linked (PEGylated) peptides, one with the PEG moity at the C-terminus and the other at the N-terminus. Here, we have evaluated these peptides as well as the corresponding scrambled peptide controls in Nipah virus and Hendra virus-mediated membrane fusion and against infection by live virus in vitro. Results Unlike their predecessors, the second generation HR-2 peptides exhibited high solubility and improved synthesis yields. Importantly, both Nipah virus and Hendra virus-mediated fusion as well as live virus infection were potently inhibited by both capped and PEGylated peptides with IC50 concentrations similar to the original HR-2 peptides, whereas the scrambled modified peptides had no inhibitory effect. These data also indicate that these chemical modifications did not alter the functional properties of the peptides as inhibitors. Conclusion Nipah virus and Hendra virus infection in vitro can be potently blocked by specific HR-2 peptides. The improved synthesis and solubility characteristics of the second generation HR-2 peptides will facilitate peptide synthesis for pre-clinical trial

  17. Inhibition of Henipavirus fusion and infection by heptad-derived peptides of the Nipah virus fusion glycoprotein

    Directory of Open Access Journals (Sweden)

    Eaton Bryan T

    2005-07-01

    Full Text Available Abstract Background The recent emergence of four new members of the paramyxovirus family has heightened the awareness of and re-energized research on new and emerging diseases. In particular, the high mortality and person to person transmission associated with the most recent Nipah virus outbreaks, as well as the very recent re-emergence of Hendra virus, has confirmed the importance of developing effective therapeutic interventions. We have previously shown that peptides corresponding to the C-terminal heptad repeat (HR-2 of the fusion envelope glycoprotein of Hendra virus and Nipah virus were potent inhibitors of both Hendra virus and Nipah virus-mediated membrane fusion using recombinant expression systems. In the current study, we have developed shorter, second generation HR-2 peptides which include a capped peptide via amidation and acetylation and two poly(ethylene glycol-linked (PEGylated peptides, one with the PEG moity at the C-terminus and the other at the N-terminus. Here, we have evaluated these peptides as well as the corresponding scrambled peptide controls in Nipah virus and Hendra virus-mediated membrane fusion and against infection by live virus in vitro. Results Unlike their predecessors, the second generation HR-2 peptides exhibited high solubility and improved synthesis yields. Importantly, both Nipah virus and Hendra virus-mediated fusion as well as live virus infection were potently inhibited by both capped and PEGylated peptides with IC50 concentrations similar to the original HR-2 peptides, whereas the scrambled modified peptides had no inhibitory effect. These data also indicate that these chemical modifications did not alter the functional properties of the peptides as inhibitors. Conclusion Nipah virus and Hendra virus infection in vitro can be potently blocked by specific HR-2 peptides. The improved synthesis and solubility characteristics of the second generation HR-2 peptides will facilitate peptide synthesis for pre

  18. Potent Human Monoclonal Antibodies against SARS CoV, Nipah and Hendra Viruses

    Science.gov (United States)

    Prabakaran, Ponraj; Zhongyu, Zhu; Xiao, Xiaodong; Biragyn, Arya; Dimitrov, Antony S.; Broder, Christopher C.; Dimitrov, Dimiter S.

    2009-01-01

    Polyclonal antibodies have a century-old history of being effective against some viruses; recently, monoclonal antibodies (mAbs) have also shown success. The humanized mAb Synagis (palivizumab) remains still the only mAb against respiratory syncytial virus (RSV) infections approved by the U.S. Food and Drug Administration (FDA). Recently, several potent human monoclonal antibodies (hmAbs) targeting the Severe Acute Respiratory Syndrome-Associated coronavirus (SARS CoV) S glycoproteins were developed quickly after the virus was identified in 2003. Among these antibodies, m396 and S230.15 exhibit exceptional potency and cross-reactivity as they neutralize isolates from the first and second outbreaks and from palm civets both in vitroand in mice. Similarly, the first fully hmAbs against two other paramyxoviruses, Hendra virus (HeV) and Nipah virus (NiV), which can cause up to 75% mortality, were recently developed; one of them, m102.4, shows exceptional cross-reactive potency against both NiV and HeV. Three-dimensional molecular structures of envelope glycoproteins from these viruses in complexes with antibodies and/or receptors were recently determined. Structural analyses along with other experiments have provided insights into the molecular mechanisms of receptor recognition and antibody neutralization, and suggested that these antibodies alone or in combination could successfully fight the viruses’ heterogeneity and mutability which is a major problem in the development of effective therapeutic agents against viruses, including therapeutic antibodies. PMID:19216624

  19. The distribution of henipaviruses in Southeast Asia and Australasia: is Wallace's line a barrier to Nipah virus?

    Directory of Open Access Journals (Sweden)

    Andrew C Breed

    Full Text Available Nipah virus (NiV (Genus Henipavirus is a recently emerged zoonotic virus that causes severe disease in humans and has been found in bats of the genus Pteropus. Whilst NiV has not been detected in Australia, evidence for NiV-infection has been found in pteropid bats in some of Australia's closest neighbours. The aim of this study was to determine the occurrence of henipaviruses in fruit bat (Family Pteropodidae populations to the north of Australia. In particular we tested the hypothesis that Nipah virus is restricted to west of Wallace's Line. Fruit bats from Australia, Papua New Guinea, East Timor and Indonesia were tested for the presence of antibodies to Hendra virus (HeV and Nipah virus, and tested for the presence of HeV, NiV or henipavirus RNA by PCR. Evidence was found for the presence of Nipah virus in both Pteropus vampyrus and Rousettus amplexicaudatus populations from East Timor. Serology and PCR also suggested the presence of a henipavirus that was neither HeV nor NiV in Pteropus alecto and Acerodon celebensis. The results demonstrate the presence of NiV in the fruit bat populations on the eastern side of Wallace's Line and within 500 km of Australia. They indicate the presence of non-NiV, non-HeV henipaviruses in fruit bat populations of Sulawesi and Sumba and possibly in Papua New Guinea. It appears that NiV is present where P. vampyrus occurs, such as in the fruit bat populations of Timor, but where this bat species is absent other henipaviruses may be present, as on Sulawesi and Sumba. Evidence was obtained for the presence henipaviruses in the non-Pteropid species R. amplexicaudatus and in A. celebensis. The findings of this work fill some gaps in knowledge in geographical and species distribution of henipaviruses in Australasia which will contribute to planning of risk management and surveillance activities.

  20. The distribution of henipaviruses in Southeast Asia and Australasia: is Wallace's line a barrier to Nipah virus?

    Science.gov (United States)

    Breed, Andrew C; Meers, Joanne; Sendow, Indrawati; Bossart, Katharine N; Barr, Jennifer A; Smith, Ina; Wacharapluesadee, Supaporn; Wang, Linfa; Field, Hume E

    2013-01-01

    Nipah virus (NiV) (Genus Henipavirus) is a recently emerged zoonotic virus that causes severe disease in humans and has been found in bats of the genus Pteropus. Whilst NiV has not been detected in Australia, evidence for NiV-infection has been found in pteropid bats in some of Australia's closest neighbours. The aim of this study was to determine the occurrence of henipaviruses in fruit bat (Family Pteropodidae) populations to the north of Australia. In particular we tested the hypothesis that Nipah virus is restricted to west of Wallace's Line. Fruit bats from Australia, Papua New Guinea, East Timor and Indonesia were tested for the presence of antibodies to Hendra virus (HeV) and Nipah virus, and tested for the presence of HeV, NiV or henipavirus RNA by PCR. Evidence was found for the presence of Nipah virus in both Pteropus vampyrus and Rousettus amplexicaudatus populations from East Timor. Serology and PCR also suggested the presence of a henipavirus that was neither HeV nor NiV in Pteropus alecto and Acerodon celebensis. The results demonstrate the presence of NiV in the fruit bat populations on the eastern side of Wallace's Line and within 500 km of Australia. They indicate the presence of non-NiV, non-HeV henipaviruses in fruit bat populations of Sulawesi and Sumba and possibly in Papua New Guinea. It appears that NiV is present where P. vampyrus occurs, such as in the fruit bat populations of Timor, but where this bat species is absent other henipaviruses may be present, as on Sulawesi and Sumba. Evidence was obtained for the presence henipaviruses in the non-Pteropid species R. amplexicaudatus and in A. celebensis. The findings of this work fill some gaps in knowledge in geographical and species distribution of henipaviruses in Australasia which will contribute to planning of risk management and surveillance activities.

  1. The Nature of Exposure Drives Transmission of Nipah Viruses from Malaysia and Bangladesh in Ferrets.

    Directory of Open Access Journals (Sweden)

    Bronwyn A Clayton

    2016-06-01

    Full Text Available Person-to-person transmission is a key feature of human Nipah virus outbreaks in Bangladesh. In contrast, in an outbreak of Nipah virus in Malaysia, people acquired infections from pigs. It is not known whether this important epidemiological difference is driven primarily by differences between NiV Bangladesh (NiV-BD and Malaysia (NiV-MY at a virus level, or by environmental or host factors. In a time course study, ferrets were oronasally exposed to equivalent doses of NiV-BD or NiV-MY. More rapid onset of productive infection and higher levels of virus replication in respiratory tract tissues were seen for NiV-BD compared to NiV-MY, corroborating our previous report of increased oral shedding of NiV-BD in ferrets and suggesting a contributory mechanism for increased NiV-BD transmission between people compared to NiV-MY. However, we recognize that transmission occurs within a social and environmental framework that may have an important and differentiating role in NiV transmission rates. With this in mind, ferret-to-ferret transmission of NiV-BD and NiV-MY was assessed under differing viral exposure conditions. Transmission was not identified for either virus when naïve ferrets were cohoused with experimentally-infected animals. In contrast, all naïve ferrets developed acute infection following assisted and direct exposure to oronasal fluid from animals that were shedding either NiV-BD or NiV-MY. Our findings for ferrets indicate that, although NiV-BD may be shed at higher levels than NiV-MY, transmission risk may be equivalently low under exposure conditions provided by cohabitation alone. In contrast, active transfer of infected bodily fluids consistently results in transmission, regardless of the virus strain. These observations suggest that the risk of NiV transmission is underpinned by social and environmental factors, and will have practical implications for managing transmission risk during outbreaks of human disease.

  2. Hendra and Nipah Virus Infection in Cultured Human Olfactory Epithelial Cells.

    Science.gov (United States)

    Borisevich, Viktoriya; Ozdener, Mehmet Hakan; Malik, Bilal; Rockx, Barry

    2017-01-01

    Henipaviruses are emerging zoonotic viruses and causative agents of encephalitis in humans. However, the mechanisms of entry into the central nervous system (CNS) in humans are not known. Here, we evaluated the possible role of olfactory epithelium in virus entry into the CNS. We characterized Hendra virus (HeV) and Nipah virus (NiV) infection of primary human olfactory epithelial cultures. We show that henipaviruses can infect mature olfactory sensory neurons. Henipaviruses replicated efficiently, resulting in cytopathic effect and limited induction of host responses. These results show that human olfactory epithelium is susceptible to infection with henipaviruses, suggesting that this could be a pathway for neuroinvasion in humans. IMPORTANCE Henipaviruses are emerging zoonotic pathogens that can cause acute and severe respiratory and neurological disease in humans. The pathways by which henipaviruses enter the central nervous system (CNS) in humans are still unknown. The observation that human olfactory neurons are highly susceptible to infection with henipaviruses demonstrates that the olfactory epithelium can serve as a site of Henipavirus entry into the CNS.

  3. Microsphere Suspension Array Assays for Detection and Differentiation of Hendra and Nipah Viruses

    Directory of Open Access Journals (Sweden)

    Adam J. Foord

    2013-01-01

    Full Text Available Microsphere suspension array systems enable the simultaneous fluorescent identification of multiple separate nucleotide targets in a single reaction. We have utilized commercially available oligo-tagged microspheres (Luminex MagPlex-TAG to construct and evaluate multiplexed assays for the detection and differentiation of Hendra virus (HeV and Nipah virus (NiV. Both these agents are bat-borne zoonotic paramyxoviruses of increasing concern for veterinary and human health. Assays were developed targeting multiple sites within the nucleoprotein (N and phosphoprotein (P encoding genes. The relative specificities and sensitivities of the assays were determined using reference isolates of each virus type, samples from experimentally infected horses, and archival veterinary diagnostic submissions. Results were assessed in direct comparison with an established qPCR. The microsphere array assays achieved unequivocal differentiation of HeV and NiV and the sensitivity of HeV detection was comparable to qPCR, indicating high analytical and diagnostic specificity and sensitivity.

  4. Inhibition of Nipah Virus Infectin In Vivo: Targeting an Early Stage of Paramyxovirus Fusion Activation during Viral Entry

    Energy Technology Data Exchange (ETDEWEB)

    M Porotto; B Rockx; C Yokoyama; A Talekar; I DeVito; l Palermo; J Liu; R Cortese; M Lu; et al.

    2011-12-31

    In the paramyxovirus cell entry process, receptor binding triggers conformational changes in the fusion protein (F) leading to viral and cellular membrane fusion. Peptides derived from C-terminal heptad repeat (HRC) regions in F have been shown to inhibit fusion by preventing formation of the fusogenic six-helix bundle. We recently showed that the addition of a cholesterol group to HRC peptides active against Nipah virus targets these peptides to the membrane where fusion occurs, dramatically increasing their antiviral effect. In this work, we report that unlike the untagged HRC peptides, which bind to the postulated extended intermediate state bridging the viral and cell membranes, the cholesterol tagged HRC-derived peptides interact with F before the fusion peptide inserts into the target cell membrane, thus capturing an earlier stage in the F-activation process. Furthermore, we show that cholesterol tagging renders these peptides active in vivo: the cholesterol-tagged peptides cross the blood brain barrier, and effectively prevent and treat in an established animal model what would otherwise be fatal Nipah virus encephalitis. The in vivo efficacy of cholesterol-tagged peptides, and in particular their ability to penetrate the CNS, suggests that they are promising candidates for the prevention or therapy of infection by Nipah and other lethal paramyxoviruses.

  5. Nipah virus infects specific subsets of porcine peripheral blood mononuclear cells.

    Directory of Open Access Journals (Sweden)

    Beata Stachowiak

    Full Text Available Nipah virus (NiV, a zoonotic paramyxovirus, is highly contagious in swine, and can cause fatal infections in humans following transmission from the swine host. The main viral targets in both species are the respiratory and central nervous systems, with viremia implicated as a mode of dissemination of NiV throughout the host. The presented work focused on the role of peripheral blood mononuclear cells (PBMC in the viremic spread of the virus in the swine host. B lymphocytes, CD4-CD8-, as well as CD4+CD8- T lymphocytes were not permissive to NiV, and expansion of the CD4+CD8- cells early post infection was consistent with functional humoral response to NiV infection observed in swine. In contrast, significant drop in the CD4+CD8- T cell frequency was observed in piglets which succumbed to the experimental infection, supporting the hypothesis that antibody development is the critical component of the protective immune response. Productive viral replication was detected in monocytes, CD6+CD8+ T lymphocytes and NK cells by recovery of infectious virus in the cell supernatants. Virus replication was supported by detection of the structural N and the non-structural C proteins or by detection of genomic RNA increase in the infected cells. Infection of T cells carrying CD6 marker, a strong ligand for the activated leukocyte cell adhesion molecule ALCAM (CD166 highly expressed on the microvascular endothelial cell of the blood-air and the blood-brain barrier may explain NiV preferential tropism for small blood vessels of the lung and brain.

  6. Nipah virus infects specific subsets of porcine peripheral blood mononuclear cells.

    Science.gov (United States)

    Stachowiak, Beata; Weingartl, Hana M

    2012-01-01

    Nipah virus (NiV), a zoonotic paramyxovirus, is highly contagious in swine, and can cause fatal infections in humans following transmission from the swine host. The main viral targets in both species are the respiratory and central nervous systems, with viremia implicated as a mode of dissemination of NiV throughout the host. The presented work focused on the role of peripheral blood mononuclear cells (PBMC) in the viremic spread of the virus in the swine host. B lymphocytes, CD4-CD8-, as well as CD4+CD8- T lymphocytes were not permissive to NiV, and expansion of the CD4+CD8- cells early post infection was consistent with functional humoral response to NiV infection observed in swine. In contrast, significant drop in the CD4+CD8- T cell frequency was observed in piglets which succumbed to the experimental infection, supporting the hypothesis that antibody development is the critical component of the protective immune response. Productive viral replication was detected in monocytes, CD6+CD8+ T lymphocytes and NK cells by recovery of infectious virus in the cell supernatants. Virus replication was supported by detection of the structural N and the non-structural C proteins or by detection of genomic RNA increase in the infected cells. Infection of T cells carrying CD6 marker, a strong ligand for the activated leukocyte cell adhesion molecule ALCAM (CD166) highly expressed on the microvascular endothelial cell of the blood-air and the blood-brain barrier may explain NiV preferential tropism for small blood vessels of the lung and brain.

  7. Induction of neutralizing antibodies to Hendra and Nipah glycoproteins using a Venezuelan equine encephalitis virus in vivo expression system.

    Science.gov (United States)

    Defang, Gabriel N; Khetawat, Dimple; Broder, Christopher C; Quinnan, Gerald V

    2010-12-16

    The emergence of Hendra Virus (HeV) and Nipah Virus (NiV) which can cause fatal infections in both animals and humans has triggered a search for an effective vaccine. Here, we have explored the potential for generating an effective humoral immune response to these zoonotic pathogens using an alphavirus-based vaccine platform. Groups of mice were immunized with Venezuelan equine encephalitis virus replicon particles (VRPs) encoding the attachment or fusion glycoproteins of either HeV or NiV. We demonstrate the induction of highly potent cross-reactive neutralizing antibodies to both viruses using this approach. Preliminary study suggested early enhancement in the antibody response with use of a modified version of VRP. Overall, these data suggest that the use of an alphavirus-derived vaccine platform might serve as a viable approach for the development of an effective vaccine against the henipaviruses. Published by Elsevier Ltd.

  8. Molecular characterization of Nipah virus from Pteropus hypomelanus in Southern Thailand.

    Science.gov (United States)

    Wacharapluesadee, Supaporn; Samseeneam, Panumas; Phermpool, Mana; Kaewpom, Thongchai; Rodpan, Apaporn; Maneeorn, Pattarapol; Srongmongkol, Phimchanok; Kanchanasaka, Budsabong; Hemachudha, Thiravat

    2016-03-25

    Nipah virus (NiV) first emerged in Malaysia in 1998, with two bat species (Pteropus hypomelanus and P. vampyrus) as the putative natural reservoirs. In 2002, NiV IgG antibodies were detected in these species from Thailand, but viral RNA could not be detected for strain characterization. Two strains of NiV (Malaysia and Bangladesh) have been found in P. lylei in central Thailand, although Bangladesh strain, the causative strain for the outbreak in Bangladesh since 2001, was dominant. To understand the diversity of NiV in Thailand, this study identified NiV strain, using molecular characterizations, from P. hypomelanus in southern Thailand. Pooled bat urine specimens were collected from plastic sheet underneath bat roosts in April 2010, and then monthly from December 2010 to May 2011 at an island in southern Thailand. Five in 184 specimens were positive for NiV, using duplex nested RT-PCR assay on partial nucleocapsid fragment (357 bp). Whole sequences of nucleocapsid gene from four bats were characterized. All 5 partial fragments and 4 whole nucleocapsid genes formed a monophyletic with NiV-MY. Our study showed that P. hypomelanus in southern Thailand and from Malaysia, a bordering country, harbored similar NiV. This finding indicates that NiV is not limited to central Thailand or P. lylei species, and it may be a source of inter-species transmission. This indicates a higher potential for a widespread NiV outbreak in Thailand. NiV surveillance in Pteropus bats, the major natural reservoirs, should be conducted continuously in countries or regions with high susceptibility to outbreaks.

  9. Nipah Virus Transmission from Bats to Humans Associated with Drinking Traditional Liquor Made from Date Palm Sap, Bangladesh, 2011–2014

    Centers for Disease Control (CDC) Podcasts

    2016-06-30

    Sarah Gregory reads an abridged version of the article, Nipah Virus Transmission from Bats to Humans Associated with Drinking Traditional Liquor Made from Date Palm Sap, Bangladesh, 2011–2014.  Created: 6/30/2016 by National Center for Emerging and Zoonotic Infectious Diseases (NCEZID).   Date Released: 6/30/2016.

  10. Towards understanding of Nipah virus attachment protein assembly and the role of protein affinity and crowding for membrane curvature events.

    Energy Technology Data Exchange (ETDEWEB)

    Stachowiak, Jeanne C.; Hayden, Carl C.; Negrete, Oscar.; Davis, Ryan Wesley; Sasaki, Darryl Y

    2013-10-01

    Pathogenic viruses are a primary threat to our national security and to the health and economy of our world. Effective defense strategies to combat viral infection and spread require the development of understanding of the mechanisms that these pathogens use to invade the host cell. We present in this report results of our research into viral particle recognition and fusion to cell membranes and the role that protein affinity and confinement in lipid domains plays in membrane curvature in cellular fusion and fission events. Herein, we describe 1) the assembly of the G attachment protein of Nipah virus using point mutation studies to define its role in viral particle fusion to the cell membrane, 2) how lateral pressure of membrane bound proteins induce curvature in model membrane systems, and 3) the role of membrane curvature in the selective partitioning of molecular receptors and specific affinity of associated proteins.

  11. Agricultural intensification, priming for persistence and the emergence of Nipah virus: a lethal bat-borne zoonosis.

    Science.gov (United States)

    Pulliam, Juliet R C; Epstein, Jonathan H; Dushoff, Jonathan; Rahman, Sohayati A; Bunning, Michel; Jamaluddin, Aziz A; Hyatt, Alex D; Field, Hume E; Dobson, Andrew P; Daszak, Peter

    2012-01-07

    Emerging zoonoses threaten global health, yet the processes by which they emerge are complex and poorly understood. Nipah virus (NiV) is an important threat owing to its broad host and geographical range, high case fatality, potential for human-to-human transmission and lack of effective prevention or therapies. Here, we investigate the origin of the first identified outbreak of NiV encephalitis in Malaysia and Singapore. We analyse data on livestock production from the index site (a commercial pig farm in Malaysia) prior to and during the outbreak, on Malaysian agricultural production, and from surveys of NiV's wildlife reservoir (flying foxes). Our analyses suggest that repeated introduction of NiV from wildlife changed infection dynamics in pigs. Initial viral introduction produced an explosive epizootic that drove itself to extinction but primed the population for enzootic persistence upon reintroduction of the virus. The resultant within-farm persistence permitted regional spread and increased the number of human infections. This study refutes an earlier hypothesis that anomalous El Niño Southern Oscillation-related climatic conditions drove emergence and suggests that priming for persistence drove the emergence of a novel zoonotic pathogen. Thus, we provide empirical evidence for a causative mechanism previously proposed as a precursor to widespread infection with H5N1 avian influenza and other emerging pathogens.

  12. Transcriptome Profiling of the Virus-Induced Innate Immune Response in Pteropus vampyrus and Its Attenuation by Nipah Virus Interferon Antagonist Functions.

    Science.gov (United States)

    Glennon, Nicole B; Jabado, Omar; Lo, Michael K; Shaw, Megan L

    2015-08-01

    Bats are important reservoirs for several viruses, many of which cause lethal infections in humans but have reduced pathogenicity in bats. As the innate immune response is critical for controlling viruses, the nature of this response in bats and how it may differ from that in other mammals are of great interest. Using next-generation transcriptome sequencing (mRNA-seq), we profiled the transcriptional response of Pteropus vampyrus bat kidney (PVK) cells to Newcastle disease virus (NDV), an avian paramyxovirus known to elicit a strong innate immune response in mammalian cells. The Pteropus genus is a known reservoir of Nipah virus (NiV) and Hendra virus (HeV). Analysis of the 200 to 300 regulated genes showed that genes for interferon (IFN) and antiviral pathways are highly upregulated in NDV-infected PVK cells, including genes for beta IFN, RIG-I, MDA5, ISG15, and IRF1. NDV-infected cells also upregulated several genes not previously characterized to be antiviral, such as RND1, SERTAD1, CHAC1, and MORC3. In fact, we show that MORC3 is induced by both IFN and NDV infection in PVK cells but is not induced by either stimulus in human A549 cells. In contrast to NDV infection, HeV and NiV infection of PVK cells failed to induce these innate immune response genes. Likewise, an attenuated response was observed in PVK cells infected with recombinant NDVs expressing the NiV IFN antagonist proteins V and W. This study provides the first global profile of a robust virus-induced innate immune response in bats and indicates that henipavirus IFN antagonist mechanisms are likely active in bat cells. Bats are the reservoir host for many highly pathogenic human viruses, including henipaviruses, lyssaviruses, severe acute respiratory syndrome coronavirus, and filoviruses, and many other viruses have also been isolated from bats. Viral infections are reportedly asymptomatic or heavily attenuated in bat populations. Despite their ecological importance to viral maintenance, research

  13. Unraveling a three-step spatiotemporal mechanism of triggering of receptor-induced Nipah virus fusion and cell entry.

    Directory of Open Access Journals (Sweden)

    Qian Liu

    Full Text Available Membrane fusion is essential for entry of the biomedically-important paramyxoviruses into their host cells (viral-cell fusion, and for syncytia formation (cell-cell fusion, often induced by paramyxoviral infections [e.g. those of the deadly Nipah virus (NiV]. For most paramyxoviruses, membrane fusion requires two viral glycoproteins. Upon receptor binding, the attachment glycoprotein (HN/H/G triggers the fusion glycoprotein (F to undergo conformational changes that merge viral and/or cell membranes. However, a significant knowledge gap remains on how HN/H/G couples cell receptor binding to F-triggering. Via interdisciplinary approaches we report the first comprehensive mechanism of NiV membrane fusion triggering, involving three spatiotemporally sequential cell receptor-induced conformational steps in NiV-G: two in the head and one in the stalk. Interestingly, a headless NiV-G mutant was able to trigger NiV-F, and the two head conformational steps were required for the exposure of the stalk domain. Moreover, the headless NiV-G prematurely triggered NiV-F on virions, indicating that the NiV-G head prevents premature triggering of NiV-F on virions by concealing a F-triggering stalk domain until the correct time and place: receptor-binding. Based on these and recent paramyxovirus findings, we present a comprehensive and fundamentally conserved mechanistic model of paramyxovirus membrane fusion triggering and cell entry.

  14. Raw Sap Consumption Habits and Its Association with Knowledge of Nipah Virus in Two Endemic Districts in Bangladesh.

    Science.gov (United States)

    Nahar, Nazmun; Paul, Repon C; Sultana, Rebeca; Gurley, Emily S; Garcia, Fernando; Abedin, Jaynal; Sumon, Shariful Amin; Banik, Kajal Chandra; Asaduzzaman, Mohammad; Rimi, Nadia Ali; Rahman, Mahmudur; Luby, Stephen P

    2015-01-01

    Human Nipah virus (NiV) infection in Bangladesh is a fatal disease that can be transmitted from bats to humans who drink contaminated raw date palm sap collected overnight during the cold season. Our study aimed to understand date palm sap consumption habits of rural residents and factors associated with consumption. In November-December 2012 the field team interviewed adult respondents from randomly selected villages from Rajbari and Kushtia Districts in Bangladesh. We calculated the proportion of people who consumed raw sap and had heard about a disease from raw sap consumption. We assessed the factors associated with raw sap consumption by calculating prevalence ratios (PR) adjusted for village level clustering effects. Among the 1,777 respondents interviewed, half (50%) reported drinking raw sap during the previous sap collection season and 37% consumed raw sap at least once per month. Few respondents (5%) heard about NiV. Thirty-seven percent of respondents reported hearing about a disease transmitted through raw sap consumption, inclusive of a 10% who related it with milder illness like diarrhea, vomiting or indigestion rather than NiV. Respondents who harvested date palm trees in their household were more likely to drink sap than those who did not own date palm trees (79% vs. 65% PR 1.2, 95% CI 1.1-1.3, psap was available, respondents who heard about a disease from raw sap consumption were just as likely to drink it as those who did not hear about a disease (69% vs. 67%, PR 1.0, 95% CI 0.9-1.1, p = 0.512). Respondents' knowledge of NiV was low. They might not have properly understood the risk of NiV, and were likely to drink sap when it was available. Implementing strategies to increase awareness about the risks of NiV and protect sap from bats might reduce the risk of NiV transmission.

  15. Hendra and Nipah virus infection in cultured human olfactory epithelial cells

    NARCIS (Netherlands)

    Borisevich, V. (Viktoriya); Ozdener, M.H. (Mehmet Hakan); Malik, B. (Bilal); B. Rockx (Barry)

    2017-01-01

    textabstractHenipaviruses are emerging zoonotic viruses and causative agents of encephalitis in humans. However, the mechanisms of entry into the central nervous system (CNS) in humans are not known. Here, we evaluated the possible role of olfactory epithelium in virus entry into the CNS. We

  16. Development and validation of a chemiluminescent immunodetection assay amenable to high throughput screening of antiviral drugs for Nipah and Hendra virus.

    Science.gov (United States)

    Aljofan, Mohamad; Porotto, Matteo; Moscona, Anne; Mungall, Bruce A

    2008-04-01

    There are currently no antiviral drugs approved for the highly lethal Biosafety Level 4 pathogens Nipah and Hendra virus. A number of researchers are developing surrogate assays amenable to Biosafety Level 2 biocontainment but ultimately, the development of a high throughput screening method for directly quantifying these viruses in a Biosafety Level 4 environment will be critical for final evaluation of antiviral drugs identified in surrogate assays, in addition to reducing the time required for effective antiviral drug development. By adapting an existing immunoplaque assay and using enzyme linked immunodetection in a microtitre plate format, the current experiments describe a simple two step assay protocol involving an overnight virus inoculation of Vero cell monolayers (with or without antiviral drug treatment) at Biosafety Level 4, followed by cell fixation and virus inactivation enabling removal of plates from the Biosafety Level 4 laboratory and a subsequent immunodetection assay using a chemiluminescent horse radish peroxidase substrate to be performed at Biosafety Level 2. The analytical sensitivity (limit of detection) of this assay is 100 tissue culture infectious dose50/ml of either Nipah or Hendra virus. In addition this assay enables linear quantitation of virus over three orders of magnitude and is unaffected by dimethyl sulfoxide concentrations of 1% or less. Intra-assay coefficients of variation are acceptable (less than 20%) when detecting a minimum of 1000 tissue culture infectious dose50/ml of either virus although inter-assay variation is considerably greater. By an assessment of efficacies of the broad spectrum antiviral Ribavirin and an experimental fusion inhibitory peptide, this assay reveals a good correlation with previously published fluorescent immunodetection assays. The current experiments describe for the first time, a high throughput screening method amenable for direct assessment of live henipavirus antiviral drug activity.

  17. In silico identification and characterization of common epitope-based peptide vaccine for Nipah and Hendra viruses.

    Science.gov (United States)

    Saha, Chayan Kumar; Mahbub Hasan, Md; Saddam Hossain, Md; Asraful Jahan, Md; Azad, Abul Kalam

    2017-06-01

    To explore a common B- and T-cell epitope-based vaccine that can elicit an immune response against encephalitis causing genus Henipaviruses, Hendra virus (HeV) and Nipah virus (NiV). Membrane proteins F, G and M of HeV and NiV were retrieved from the protein database and subjected to different bioinformatics tools to predict antigenic B-cell epitopes. Best B-cell epitopes were then analyzed to predict their T-cell antigenic potentiality. Antigenic B- and T-cell epitopes that shared maximum identity with HeV and NiV were selected. Stability of the selected epitopes was predicted. Finally, the selected epitopes were subjected to molecular docking simulation with HLA-DR to confirm their antigenic potentiality in silico. One epitope from G proteins, one from M proteins and none from F proteins were selected based on their antigenic potentiality. The epitope from the G proteins was stable whereas that from M was unstable. The M-epitope was made stable by adding flanking dipeptides. The 15-mer G-epitope (VDPLRVQWRNNSVIS) showed at least 66% identity with all NiV and HeV G protein sequences, while the 15-mer M-epitope (GKLEFRRNNAIAFKG) with the dipeptide flanking residues showed 73% identity with all NiV and HeV M protein sequences available in the database. Molecular docking simulation with most frequent MHC class-II (MHC II) and class-I (MHC I) molecules showed that these epitopes could bind within HLA binding grooves to elicit an immune response. Data in our present study revealed the notion that the epitopes from G and M proteins might be the target for peptide-based subunit vaccine design against HeV and NiV. However, the biochemical analysis is necessary to experimentally validate the interaction of epitopes individually with the MHC molecules through elucidation of immunity induction. Copyright © 2017 Hainan Medical University. Production and hosting by Elsevier B.V. All rights reserved.

  18. Structural and Functional Studies on the Fusion and Attachment Envelope Glycoproteins of Nipah Virus and Hendra Virus

    Science.gov (United States)

    2003-01-01

    subcloned into the vaccinia virus promoter driven expression vector pMCO2 (90) and recombinant vaccinia viruses were generated using standard...characteristics and properties of these novel viruses , and may provide insights into membrane fusion mechanisms, the virus infection process, and towards...these novel viruses , and may provide insights into membrane fusion mechanisms, the virus infection process, and towards the development of therapeutics

  19. A Randomized Controlled Trial of Interventions to Impede Date Palm Sap Contamination by Bats to Prevent Nipah Virus Transmission in Bangladesh

    Science.gov (United States)

    Khan, Salah Uddin; Gurley, Emily S.; Hossain, M. Jahangir; Nahar, Nazmun; Sharker, M. A. Yushuf; Luby, Stephen P.

    2012-01-01

    Background Drinking raw date palm sap is a risk factor for human Nipah virus (NiV) infection. Fruit bats, the natural reservoir of NiV, commonly contaminate raw sap with saliva by licking date palm’s sap producing surface. We evaluated four types of physical barriers that may prevent bats from contacting sap. Methods During 2009, we used a crossover design and randomly selected 20 date palm sap producing trees and observed each tree for 2 nights: one night with a bamboo skirt intervention applied and one night without the intervention. During 2010, we selected 120 trees and randomly assigned four types of interventions to 15 trees each: bamboo, dhoincha (local plant), jute stick and polythene skirts covering the shaved part, sap stream, tap and collection pot. We enrolled the remaining 60 trees as controls. We used motion sensor activated infrared cameras to examine bat contact with sap. Results During 2009 bats contacted date palm sap in 85% of observation nights when no intervention was used compared with 35% of nights when the intervention was used [psap when the skirt did not entirely cover the sap producing surface. Therefore, in 2010 we requested the sap harvesters to use larger skirts. During 2010 bats contacted date palm sap [2% vs. 83%, psap in trees with bamboo (psap during one night (7%) with the jute stick skirt (psap producing areas of a tree effectively prevented bat-sap contact. Community interventions should promote applying these skirts to prevent occasional Nipah spillovers to human. PMID:22905160

  20. The Role of the Hendra Virus and Nipah Virus Attachment Glycoproteins in Receptor Binding and Antibody Neutralization

    Science.gov (United States)

    2014-01-31

    glycoproteins, such as HIV gp140 and Rabies glycoprotein, its ability to form trimers but not tetramers makes it ineffective for correct oligomerization of...Oldstone MB. 2000. V and C proteins of measles virus function as virulence factors in vivo. Virology 267:80-9.   216 148. Playford EG, McCall B...2005. Stable trimerization of recombinant rabies virus glycoprotein ectodomain is required for interaction with the p75NTR receptor. J Gen Virol 86

  1. Identification of a broad-spectrum antiviral small molecule against severe acute respiratory syndrome coronavirus and Ebola, Hendra, and Nipah viruses by using a novel high-throughput screening assay.

    Science.gov (United States)

    Elshabrawy, Hatem A; Fan, Jilao; Haddad, Christine S; Ratia, Kiira; Broder, Christopher C; Caffrey, Michael; Prabhakar, Bellur S

    2014-04-01

    Severe acute respiratory syndrome coronavirus (SARS-CoV) and Ebola, Hendra, and Nipah viruses are members of different viral families and are known causative agents of fatal viral diseases. These viruses depend on cathepsin L for entry into their target cells. The viral glycoproteins need to be primed by protease cleavage, rendering them active for fusion with the host cell membrane. In this study, we developed a novel high-throughput screening assay based on peptides, derived from the glycoproteins of the aforementioned viruses, which contain the cathepsin L cleavage site. We screened a library of 5,000 small molecules and discovered a small molecule that can inhibit the cathepsin L cleavage of all viral peptides with minimal inhibition of cleavage of a host protein-derived peptide (pro-neuropeptide Y). The small molecule inhibited the entry of all pseudotyped viruses in vitro and the cleavage of SARS-CoV spike glycoprotein in an in vitro cleavage assay. In addition, the Hendra and Nipah virus fusion glycoproteins were not cleaved in the presence of the small molecule in a cell-based cleavage assay. Furthermore, we demonstrate that the small molecule is a mixed inhibitor of cathepsin L. Our broad-spectrum antiviral small molecule appears to be an ideal candidate for future optimization and development into a potent antiviral against SARS-CoV and Ebola, Hendra, and Nipah viruses. We developed a novel high-throughput screening assay to identify small molecules that can prevent cathepsin L cleavage of viral glycoproteins derived from SARS-CoV and Ebola, Hendra, and Nipah viruses that are required for their entry into the host cell. We identified a novel broad-spectrum small molecule that could block cathepsin L-mediated cleavage and thus inhibit the entry of pseudotypes bearing the glycoprotein derived from SARS-CoV or Ebola, Hendra, or Nipah virus. The small molecule can be further optimized and developed into a potent broad-spectrum antiviral drug.

  2. Contribution of Human Lung Parenchyma and Leukocyte Influx to Oxidative Stress and Immune System-Mediated Pathology following Nipah Virus Infection.

    Science.gov (United States)

    Escaffre, Olivier; Saito, Tais B; Juelich, Terry L; Ikegami, Tetsuro; Smith, Jennifer K; Perez, David D; Atkins, Colm; Levine, Corri B; Huante, Matthew B; Nusbaum, Rebecca J; Endsley, Janice J; Freiberg, Alexander N; Rockx, Barry

    2017-08-01

    Nipah virus (NiV) is a zoonotic emerging paramyxovirus that can cause fatal respiratory illness or encephalitis in humans. Despite many efforts, the molecular mechanisms of NiV-induced acute lung injury (ALI) remain unclear. We previously showed that NiV replicates to high titers in human lung grafts in NOD-SCID/γ mice, resulting in a robust inflammatory response. Interestingly, these mice can undergo human immune system reconstitution by the bone marrow, liver, and thymus (BLT) reconstitution method, in addition to lung tissue engraftment, giving altogether a realistic model to study human respiratory viral infections. Here, we characterized NiV Bangladesh strain (NiV-B) infection of human lung grafts from human immune system-reconstituted mice in order to identify the overall effect of immune cells on NiV pathogenesis of the lung. We show that NiV-B replicated to high titers in human lung grafts and caused similar cytopathic effects irrespective of the presence of human leukocytes in mice. However, the human immune system interfered with virus spread across lung grafts, responded to infection by leukocyte migration to small airways and alveoli of the lung grafts, and accelerated oxidative stress in lung grafts. In addition, the presence of human leukocytes increased the expression of cytokines and chemokines that regulate inflammatory influx to sites of infection and tissue damage. These results advance our understanding of how the immune system limits NiV dissemination and contributes to ALI and inform efforts to identify therapeutic targets. IMPORTANCE Nipah virus (NiV) is an emerging paramyxovirus that can cause a lethal respiratory and neurological disease in humans. Only limited data are available on NiV pathogenesis in the human lung, and the relative contribution of the innate immune response and NiV to acute lung injury (ALI) is still unknown. Using human lung grafts in a human immune system-reconstituted mouse model, we showed that the NiV Bangladesh

  3. Efficient reverse genetics reveals genetic determinants of budding and fusogenic differences between Nipah and Hendra viruses and enables real-time monitoring of viral spread in small animal models of henipavirus infection.

    Science.gov (United States)

    Yun, Tatyana; Park, Arnold; Hill, Terence E; Pernet, Olivier; Beaty, Shannon M; Juelich, Terry L; Smith, Jennifer K; Zhang, Lihong; Wang, Yao E; Vigant, Frederic; Gao, Junling; Wu, Ping; Lee, Benhur; Freiberg, Alexander N

    2015-01-15

    Nipah virus (NiV) and Hendra virus (HeV) are closely related henipaviruses of the Paramyxovirinae. Spillover from their fruit bat reservoirs can cause severe disease in humans and livestock. Despite their high sequence similarity, NiV and HeV exhibit apparent differences in receptor and tissue tropism, envelope-mediated fusogenicity, replicative fitness, and other pathophysiologic manifestations. To investigate the molecular basis for these differences, we first established a highly efficient reverse genetics system that increased rescue titers by ≥3 log units, which offset the difficulty of generating multiple recombinants under constraining biosafety level 4 (BSL-4) conditions. We then replaced, singly and in combination, the matrix (M), fusion (F), and attachment glycoprotein (G) genes in mCherry-expressing recombinant NiV (rNiV) with their HeV counterparts. These chimeric but isogenic rNiVs replicated well in primary human endothelial and neuronal cells, indicating efficient heterotypic complementation. The determinants of budding efficiency, fusogenicity, and replicative fitness were dissociable: HeV-M budded more efficiently than NiV-M, accounting for the higher replicative titers of HeV-M-bearing chimeras at early times, while the enhanced fusogenicity of NiV-G-bearing chimeras did not correlate with increased replicative fitness. Furthermore, to facilitate spatiotemporal studies on henipavirus pathogenesis, we generated a firefly luciferase-expressing NiV and monitored virus replication and spread in infected interferon alpha/beta receptor knockout mice via bioluminescence imaging. While intraperitoneal inoculation resulted in neuroinvasion following systemic spread and replication in the respiratory tract, intranasal inoculation resulted in confined spread to regions corresponding to olfactory bulbs and salivary glands before subsequent neuroinvasion. This optimized henipavirus reverse genetics system will facilitate future investigations into the

  4. COMPOSITION OF FOWLPOX VIRUS AND INCLUSION MATRIX.

    Science.gov (United States)

    RANDALL, C C; GAFFORD, L G; DARLINGTON, R W; HYDE, J

    1964-04-01

    Randall, Charles C. (University of Mississippi School of Medicine, Jackson), Lanelle G. Gafford, Robert W. Darlington, and James M. Hyde. Composition of fowlpox virus and inclusion matrix. J. Bacteriol. 87:939-944. 1964.-Inclusion bodies of fowlpox virus infection are especially favorable starting material for the isolation of virus and inclusion matrix. Electron micrographs of viral particles and matrix indicated a high degree of purification. Density-gradient centrifugation of virus in cesium chloride and potassium tartrate was unsatisfactory because of inactivation, and clumping or disintegration. Chemical analyses of virus and matrix revealed significant amounts of lipid, protein, and deoxyribonucleic acid, but no ribonucleic acid or carbohydrate. Approximately 47% of the weight of the virus and 83% of the matrix were extractable in chloroform-methanol. The lipid partitions of the petroleum ether extracts were similar, except that the phospholipid content of the matrix was 2.2 times that of the virus. Viral particles were sensitive to diethyl ether and chloroform.

  5. The Central Role of the Matrix Protein in Nipah Virus Assembly and Morphogenesis

    Science.gov (United States)

    2007-03-23

    attention paid to the cytoplasmic domains of these proteins. Co-localization of M and at least one envelope glycoprotein has been observed for SeV (111...from pCP630 (NiV M gene in pFastBac HTa ) using primers 5’- GTTTAAACCACCATGGAGCCGGACATC (NIVMS) and 5’- GTTTAAACTTAGCCCTTTAGAATTCTC (NIVMAS). The NiV...lipid rafts in assembly has received the most attention for MeV. The measles F and H glycoproteins associate with lipid rafts in the trans-Golgi

  6. Piloting the use of indigenous methods to prevent Nipah virus infection by interrupting bats' access to date palm sap in Bangladesh.

    Science.gov (United States)

    Nahar, Nazmun; Mondal, Utpal Kumar; Sultana, Rebeca; Hossain, M Jahangir; Khan, M Salah Uddin; Gurley, Emily S; Oliveras, Elizabeth; Luby, Stephen P

    2013-09-01

    People in Bangladesh frequently drink fresh date palm sap. Fruit bats (Pteropus giganteus) also drink raw sap and may contaminate the sap by shedding Nipah virus through saliva and urine. In a previous study we identified two indigenous methods to prevent bats accessing the sap, bamboo skirts and lime (calcium carbonate). We conducted a pilot study to assess the acceptability of these two methods among sap harvesters. We used interactive community meetings and group discussions to encourage all the sap harvesters (n = 12) from a village to use either bamboo skirts or lime smear that some of them (n = 4) prepared and applied. We measured the preparation and application time and calculated the cost of bamboo skirts. We conducted interviews after the use of each method. The sap harvesters found skirts effective in preventing bats from accessing sap. They were sceptical that lime would be effective as the lime was washed away by the sap flow. Preparation of the skirt took ∼105 min. The application of each method took ∼1 min. The cost of the bamboo skirt is minimal because bamboo is widely available and they made the skirts with pieces of used bamboo. The bamboo skirt method appeared practical and affordable to the sap harvesters. Further studies should explore its ability to prevent bats from accessing date palm sap and assess if its use produces more or better quality sap, which would provide further incentives to make it more acceptable for its regular use.

  7. Endothelial galectin-1 binds to specific glycans on nipah virus fusion protein and inhibits maturation, mobility, and function to block syncytia formation.

    Directory of Open Access Journals (Sweden)

    Omai B Garner

    2010-07-01

    Full Text Available Nipah virus targets human endothelial cells via NiV-F and NiV-G envelope glycoproteins, resulting in endothelial syncytia formation and vascular compromise. Endothelial cells respond to viral infection by releasing innate immune effectors, including galectins, which are secreted proteins that bind to specific glycan ligands on cell surface glycoproteins. We demonstrate that galectin-1 reduces NiV-F mediated fusion of endothelial cells, and that endogenous galectin-1 in endothelial cells is sufficient to inhibit syncytia formation. Galectin-1 regulates NiV-F mediated cell fusion at three distinct points, including retarding maturation of nascent NiV-F, reducing NiV-F lateral mobility on the plasma membrane, and directly inhibiting the conformational change in NiV-F required for triggering fusion. Characterization of the NiV-F N-glycome showed that the critical site for galectin-1 inhibition is rich in glycan structures known to bind galectin-1. These studies identify a unique set of mechanisms for regulating pathophysiology of NiV infection at the level of the target cell.

  8. Biochemical and structural studies of the oligomerization domain of the Nipah virus phosphoprotein: evidence for an elongated coiled-coil homotrimer.

    Science.gov (United States)

    Blocquel, David; Beltrandi, Matilde; Erales, Jenny; Barbier, Pascale; Longhi, Sonia

    2013-11-01

    Nipah virus (NiV) is a recently emerged severe human pathogen that belongs to the Henipavirus genus within the Paramyxoviridae family. The NiV genome is encapsidated by the nucleoprotein (N) within a helical nucleocapsid that is the substrate used by the polymerase for transcription and replication. The polymerase is recruited onto the nucleocapsid via its cofactor, the phosphoprotein (P). The NiV P protein has a modular organization, with alternating disordered and ordered domains. Among these latter, is the P multimerization domain (PMD) that was predicted to adopt a coiled-coil conformation. Using both biochemical and biophysical approaches, we show that NiV PMD forms a highly stable and elongated coiled-coil trimer, a finding in striking contrast with respect to the PMDs of Paramyxoviridae members investigated so far that were all found to tetramerize. The present results therefore represent the first report of a paramyxoviral P protein forming trimers. © 2013 Elsevier Inc. All rights reserved.

  9. Receptor-Targeted Nipah Virus Glycoproteins Improve Cell-Type Selective Gene Delivery and Reveal a Preference for Membrane-Proximal Cell Attachment.

    Directory of Open Access Journals (Sweden)

    Ruben R Bender

    2016-06-01

    Full Text Available Receptor-targeted lentiviral vectors (LVs can be an effective tool for selective transfer of genes into distinct cell types of choice. Moreover, they can be used to determine the molecular properties that cell surface proteins must fulfill to act as receptors for viral glycoproteins. Here we show that LVs pseudotyped with receptor-targeted Nipah virus (NiV glycoproteins effectively enter into cells when they use cell surface proteins as receptors that bring them closely enough to the cell membrane (less than 100 Å distance. Then, they were flexible in receptor usage as demonstrated by successful targeting of EpCAM, CD20, and CD8, and as selective as LVs pseudotyped with receptor-targeted measles virus (MV glycoproteins, the current standard for cell-type specific gene delivery. Remarkably, NiV-LVs could be produced at up to two orders of magnitude higher titers compared to their MV-based counterparts and were at least 10,000-fold less effectively neutralized than MV glycoprotein pseudotyped LVs by pooled human intravenous immunoglobulin. An important finding for NiV-LVs targeted to Her2/neu was an about 100-fold higher gene transfer activity when particles were targeted to membrane-proximal regions as compared to particles binding to a more membrane-distal epitope. Likewise, the low gene transfer activity mediated by NiV-LV particles bound to the membrane distal domains of CD117 or the glutamate receptor subunit 4 (GluA4 was substantially enhanced by reducing receptor size to below 100 Å. Overall, the data suggest that the NiV glycoproteins are optimally suited for cell-type specific gene delivery with LVs and, in addition, for the first time define which parts of a cell surface protein should be targeted to achieve optimal gene transfer rates with receptor-targeted LVs.

  10. Nipah and Hendra Virus Nucleoproteins Inhibit Nuclear Accumulation of Signal Transducer and Activator of Transcription 1 (STAT1) and STAT2 by Interfering with Their Complex Formation.

    Science.gov (United States)

    Sugai, Akihiro; Sato, Hiroki; Takayama, Ikuyo; Yoneda, Misako; Kai, Chieko

    2017-11-01

    Henipaviruses, such as Nipah (NiV) and Hendra (HeV) viruses, are highly pathogenic zoonotic agents within the Paramyxoviridae family. The phosphoprotein (P) gene products of the paramyxoviruses have been well characterized for their interferon (IFN) antagonist activity and their contribution to viral pathogenicity. In this study, we demonstrated that the nucleoprotein (N) of henipaviruses also prevents the host IFN signaling response. Reporter assays demonstrated that the NiV and HeV N proteins (NiV-N and HeV-N, respectively) dose-dependently suppressed both type I and type II IFN responses and that the inhibitory effect was mediated by their core domains. Additionally, NiV-N prevented the nuclear transport of signal transducer and activator of transcription 1 (STAT1) and STAT2. However, NiV-N did not associate with Impα5, Impβ1, or Ran, which are members of the nuclear transport system for STATs. Although P protein is known as a binding partner of N protein and actively retains N protein in the cytoplasm, the IFN antagonist activity of N protein was not abolished by the coexpression of P protein. This suggests that the IFN inhibition by N protein occurs in the cytoplasm. Furthermore, we demonstrated that the complex formation of STATs was hampered in the N protein-expressing cells. As a result, STAT nuclear accumulation was reduced, causing a subsequent downregulation of interferon-stimulated genes (ISGs) due to low promoter occupancy by STAT complexes. This novel route for preventing host IFN responses by henipavirus N proteins provides new insight into the pathogenesis of these viruses. IMPORTANCE Paramyxoviruses are well known for suppressing interferon (IFN)-mediated innate immunity with their phosphoprotein (P) gene products, and the henipaviruses also possess P, V, W, and C proteins for evading host antiviral responses. There are numerous studies providing evidence for the relationship between viral pathogenicity and antagonistic activities against IFN

  11. Hendra and Nipah infection: emerging paramyxoviruses.

    Science.gov (United States)

    Aljofan, Mohamad

    2013-11-06

    Since their first emergence in mid 1990s henipaviruses continued to re emerge in Australia and South East Asia almost every year. In total there has been more than 12 Nipah and 48 Hendra virus outbreaks reported in South East Asia and Australia, respectively. These outbreaks are associated with significant economic and health damages that most high risks countries (particularly in South East Asia) cannot bear the burden of such economical threats. Up until recently, there were no actual therapeutics available to treat or prevent these lethal infections. However, an international collaborative research has resulted in the identification of a potential equine Hendra vaccine capable of providing antibody protection against Hendra virus infections. Consequently, with the current findings and after nearly 2 decades since their first detection, are we there yet? This review recaps the chronicle of the henipavirus emergence and briefly evaluates potential anti-henipavirus vaccines and antivirals. Copyright © 2013 Elsevier B.V. All rights reserved.

  12. Hendra and Nipah Infection: Pathology, Models and Potential Therapies

    Science.gov (United States)

    Vigant, Frederic; Lee, Benhur

    2011-01-01

    The Paramyxoviridae family comprises of several genera that contain emerging or re-emerging threats for human and animal health with no real specific effective treatment available. Hendra and Nipah virus are members of a newly identified genus of emerging paramyxoviruses, Henipavirus. Since their discovery in the 1990s, henipaviruses outbreaks have been associated with high economic and public health threat potential. When compared to other paramyxoviruses, henipaviruses appear to have unique characteristics. Henipaviruses are zoonotic paramyxoviruses with a broader tropism than most other paramyxoviruses, and can cause severe acute encephalitis with unique features among viral encephalitides. There are currently no approved effective prophylactic or therapeutic treatments for henipavirus infections. Although ribavirin was empirically used and seemed beneficial during the biggest outbreak caused by one of these viruses, the Nipah virus, its efficacy is disputed in light of its lack of efficacy in several animal models of henipavirus infection. Nevertheless, because of its highly pathogenic nature, much effort has been spent in developing anti-henipavirus therapeutics. In this review we describe the unique features of henipavirus infections and the different strategies and animal models that have been developed so far in order to identify and test potential drugs to prevent or treat henipavirus infections. Some of these components have the potential to be broad-spectrum antivirals as they target effectors of viral pathogenecity common to other viruses. We will focus on small molecules or biologics, rather than vaccine strategies, that have been developed as anti-henipaviral therapeutics. PMID:21488828

  13. NMR Structure of the Myristylated Feline Immunodeficiency Virus Matrix Protein

    Directory of Open Access Journals (Sweden)

    Lola A. Brown

    2015-04-01

    Full Text Available Membrane targeting by the Gag proteins of the human immunodeficiency viruses (HIV types-1 and -2 is mediated by Gag’s N-terminally myristylated matrix (MA domain and is dependent on cellular phosphatidylinositol-4,5-bisphosphate [PI(4,5P2]. To determine if other lentiviruses employ a similar membrane targeting mechanism, we initiated studies of the feline immunodeficiency virus (FIV, a widespread feline pathogen with potential utility for development of human therapeutics. Bacterial co-translational myristylation was facilitated by mutation of two amino acids near the amino-terminus of the protein (Q5A/G6S; myrMAQ5A/G6S. These substitutions did not affect virus assembly or release from transfected cells. NMR studies revealed that the myristyl group is buried within a hydrophobic pocket in a manner that is structurally similar to that observed for the myristylated HIV-1 protein. Comparisons with a recent crystal structure of the unmyristylated FIV protein [myr(-MA] indicate that only small changes in helix orientation are required to accommodate the sequestered myr group. Depletion of PI(4,5P2 from the plasma membrane of FIV-infected CRFK cells inhibited production of FIV particles, indicating that, like HIV, FIV hijacks the PI(4,5P2 cellular signaling system to direct intracellular Gag trafficking during virus assembly.

  14. NMR Structure of the Myristylated Feline Immunodeficiency Virus Matrix Protein

    Science.gov (United States)

    Brown, Lola A.; Cox, Cassiah; Baptiste, Janae; Summers, Holly; Button, Ryan; Bahlow, Kennedy; Spurrier, Vaughn; Kyser, Jenna; Luttge, Benjamin G.; Kuo, Lillian; Freed, Eric O.; Summers, Michael F.

    2015-01-01

    Membrane targeting by the Gag proteins of the human immunodeficiency viruses (HIV types-1 and -2) is mediated by Gag’s N-terminally myristylated matrix (MA) domain and is dependent on cellular phosphatidylinositol-4,5-bisphosphate [PI(4,5)P2]. To determine if other lentiviruses employ a similar membrane targeting mechanism, we initiated studies of the feline immunodeficiency virus (FIV), a widespread feline pathogen with potential utility for development of human therapeutics. Bacterial co-translational myristylation was facilitated by mutation of two amino acids near the amino-terminus of the protein (Q5A/G6S; myrMAQ5A/G6S). These substitutions did not affect virus assembly or release from transfected cells. NMR studies revealed that the myristyl group is buried within a hydrophobic pocket in a manner that is structurally similar to that observed for the myristylated HIV-1 protein. Comparisons with a recent crystal structure of the unmyristylated FIV protein [myr(-)MA] indicate that only small changes in helix orientation are required to accommodate the sequestered myr group. Depletion of PI(4,5)P2 from the plasma membrane of FIV-infected CRFK cells inhibited production of FIV particles, indicating that, like HIV, FIV hijacks the PI(4,5)P2 cellular signaling system to direct intracellular Gag trafficking during virus assembly. PMID:25941825

  15. Investigation of the HIV-1 matrix interactome during virus replication.

    Science.gov (United States)

    Li, Yan; Frederick, Kristin M; Haverland, Nicole A; Ciborowski, Pawel; Belshan, Michael

    2016-02-01

    Like all viruses, human immunodeficiency virus type 1 (HIV-1) requires host cellular factors for productive replication. Identification of these factors may lead to the development of novel cell-based inhibitors. A Strep-tag was inserted into the C-terminus of the matrix (MA) region of the HIV-1 gag gene. The resultant virus was replication competent and used to infect Jurkat T-cells. MA complexes were affinity purified with Strep-Tactin agarose. Protein quantification was performed using sequential window acquisition of all theoretical fragment ion spectra (SWATH) MS, data were log2 -transformed, and Student t-tests with Bonferroni correction used to determine statistical significance. Several candidate proteins were validated by immunoblot and investigated for their role in virus infection by siRNA knockdown assays. A total of 17 proteins were found to be statistically different between the infected versus uninfected and untagged control samples. X-ray repair cross-complementing protein 6 (Ku70), X-ray repair cross-complementing protein 5 (Ku80), and Y-box binding protein 1 (YB-1) were confirmed to interact with MA by immunoblot. Knockdown of two candidates, EZRIN and Y-box binding protein 1, enhanced HIV infection in vitro. The Strep-tag allowed for the capture of viral protein complexes in the context of virus replication. Several previously described factors were identified and at least two candidate proteins were found to play a role in HIV-1 infection. These data further increase our understanding of HIV host -cell interactions. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  16. The influenza A virus matrix protein as a marker to monitor initial virus internalisation.

    Science.gov (United States)

    Eierhoff, Thorsten; Ludwig, Stephan; Ehrhardt, Christina

    2009-01-01

    The uptake of influenza A viruses (IAV) into cells represents an attractive antiviral drug target, e.g., by interfering with essential cellular or viral entry factors. So far, this process could only be studied by time-consuming microscopical methods. Thus, there is a lack of rapid and easy assay systems to monitor viral entry. Here, we describe a rapid procedure to analyse internalisation of IAV via Western blot detection of virion-associated matrix protein (M1), the most abundant protein within the viral particle. The assay is broadly applicable and detects different virus strains of various subtypes. As a proof of principle, treatment of cells with various known or presumed entry inhibitors resulted in reduced M1 levels. Removal of sialic acids, the receptors for IAV, led to a complete loss of the M1 signal, indicating that virus internalisation can be monitored already at the stage of attachment. Prevention of endosomal acidification resulted in a delayed degradation of M1 indicative of IAV particles trapped in endosomes. Thus, early detection of the virus-associated M1 protein is a rapid method to monitor different steps of influenza virus internalisation and has potential for application as a screening method for drugs that interfere with the uptake of IAV.

  17. Matrix Metalloproteinase 9 Exerts Antiviral Activity against Respiratory Syncytial Virus.

    Directory of Open Access Journals (Sweden)

    Abdoulaye J Dabo

    Full Text Available Increased lung levels of matrix metalloproteinase 9 (MMP9 are frequently observed during respiratory syncytial virus (RSV infection and elevated MMP9 concentrations are associated with severe disease. However little is known of the functional role of MMP9 during lung infection with RSV. To determine whether MMP9 exerted direct antiviral potential, active MMP9 was incubated with RSV, which showed that MMP9 directly prevented RSV infectivity to airway epithelial cells. Using knockout mice the effect of the loss of Mmp9 expression was examined during RSV infection to demonstrate MMP9's role in viral clearance and disease progression. Seven days following RSV infection, Mmp9-/- mice displayed substantial weight loss, increased RSV-induced airway hyperresponsiveness (AHR and reduced clearance of RSV from the lungs compared to wild type mice. Although total bronchoalveolar lavage fluid (BALF cell counts were similar in both groups, neutrophil recruitment to the lungs during RSV infection was significantly reduced in Mmp9-/- mice. Reduced neutrophil recruitment coincided with diminished RANTES, IL-1β, SCF, G-CSF expression and p38 phosphorylation. Induction of p38 signaling was required for RANTES and G-CSF expression during RSV infection in airway epithelial cells. Therefore, MMP9 in RSV lung infection significantly enhances neutrophil recruitment, cytokine production and viral clearance while reducing AHR.

  18. Matrix protein 2 of influenza A virus blocks autophagosome fusion with lysosomes

    DEFF Research Database (Denmark)

    Gannagé, Monique; Dormann, Dorothee; Albrecht, Randy

    2009-01-01

    demonstrate that influenza A virus inhibits macroautophagy, a cellular process known to be manipulated by diverse pathogens. Influenza A virus infection causes accumulation of autophagosomes by blocking their fusion with lysosomes, and one viral protein, matrix protein 2, is necessary and sufficient...... for this inhibition of autophagosome degradation. Macroautophagy inhibition by matrix protein 2 compromises survival of influenza virus-infected cells but does not influence viral replication. We propose that influenza A virus, which also encodes proapoptotic proteins, is able to determine the death of its host cell...

  19. Association of Ebola Virus Matrix Protein VP40 with Microtubules

    National Research Council Canada - National Science Library

    Ruthel, Gordon; Demmin, Gretchen L; Kallstrom, George; Javid, Melodi P; Badie, Shirin S; Will, Amy B; Nelle, Timothy; Schokman, Rowena; Nguyen, Tam L; Carra, John H; Bavari, Sina; Aman, M. J

    2005-01-01

    Viruses exploit a variety of cellular components to complete their life cycles, and it has become increasingly clear that use of host cell microtubules is a vital part of the infection process for many viruses...

  20. Nipah Encephalitis – A Dangerous Zooanthroponosis Of Indo-Malaysian Region Of South-Еast Asia

    Directory of Open Access Journals (Sweden)

    E. P. Lukin

    2014-01-01

    Full Text Available The review provides information on a new zooanthroponosis – Nipah encephalitis. Characteristics of the pathogen and its ecology and clinic are presented. The purpose of the review is to get Russian specialist acquainted with new dangerous disease unknown in Russia. The research method – analytical. Infection by humans were first described in Malaysia (1999, after in Bangladesh (2004 and India (2006. The causative agent was identified as a new member of paramyxoviruses and then, together with related Hendra virus, separated in a new genus Henipavirus of the family Paramyxoviridae (2000. Reservoir in nature – fruit bats, predominantly carnivorous flying foxes of 8 species of the genus Pteropus, secondary reservoir – domestic pigs. Nipah virus is highly contagious for humans and swine. The last act as amplifying and reservoir host. The disease inhumans is characterized by symptoms and signs of acute encephalitis and pulmonary insufficiency. Rapidly developing coma, lethality – up to 92,0%. Outbreaks with transmission of the virus from person-to-person are known. Specific treatment has not been developed, prevention is nonspecific.

  1. A catalytically and genetically optimized β-lactamase-matrix based assay for sensitive, specific, and higher throughput analysis of native henipavirus entry characteristics

    Directory of Open Access Journals (Sweden)

    Holbrook Michael R

    2009-07-01

    Full Text Available Abstract Nipah virus (NiV and Hendra virus (HeV are the only paramyxoviruses requiring Biosafety Level 4 (BSL-4 containment. Thus, study of henipavirus entry at less than BSL-4 conditions necessitates the use of cell-cell fusion or pseudotyped reporter virus assays. Yet, these surrogate assays may not fully emulate the biological properties unique to the virus being studied. Thus, we developed a henipaviral entry assay based on a β-lactamase-Nipah Matrix (βla-M fusion protein. We first codon-optimized the bacterial βla and the NiV-M genes to ensure efficient expression in mammalian cells. The βla-M construct was able to bud and form virus-like particles (VLPs that morphologically resembled paramyxoviruses. βla-M efficiently incorporated both NiV and HeV fusion and attachment glycoproteins. Entry of these VLPs was detected by cytosolic delivery of βla-M, resulting in enzymatic and fluorescent conversion of the pre-loaded CCF2-AM substrate. Soluble henipavirus receptors (ephrinB2 or antibodies against the F and/or G proteins blocked VLP entry. Additionally, a Y105W mutation engineered into the catalytic site of βla increased the sensitivity of our βla-M based infection assays by 2-fold. In toto, these methods will provide a more biologically relevant assay for studying henipavirus entry at less than BSL-4 conditions.

  2. Deletions in the fifth alpha helix of HIV-1 matrix block virus release

    Energy Technology Data Exchange (ETDEWEB)

    Sanford, Bridget; Li, Yan; Maly, Connor J.; Madson, Christian J. [Department of Medical Microbiology and Immunology, Creighton University, 2500 California Plaza, Omaha, NE 68178 (United States); Chen, Han [Center for Biotechnology, University of Nebraska-Lincoln, Lincoln, NE (United States); Zhou, You [Center for Biotechnology, University of Nebraska-Lincoln, Lincoln, NE (United States); Nebraska Center for Virology, Lincoln, NE (United States); Belshan, Michael, E-mail: michaelbelshan@creighton.edu [Department of Medical Microbiology and Immunology, Creighton University, 2500 California Plaza, Omaha, NE 68178 (United States); Nebraska Center for Virology, Lincoln, NE (United States)

    2014-11-15

    The matrix (MA) protein of HIV-1 is the N-terminal component of the Gag structural protein and is critical for the early and late stages of viral replication. MA contains five α-helices (α1–α5). Deletions in the N-terminus of α5 as small as three amino acids impaired virus release. Electron microscopy of one deletion mutant (MA∆96-120) showed that its particles were tethered to the surface of cells by membranous stalks. Immunoblots indicated all mutants were processed completely, but mutants with large deletions had alternative processing intermediates. Consistent with the EM data, MA∆96-120 retained membrane association and multimerization capability. Co-expression of this mutant inhibited wild type particle release. Alanine scanning mutation in this region did not affect virus release, although the progeny virions were poorly infectious. Combined, these data demonstrate that structural ablation of the α5 of MA inhibits virus release. - Highlights: • Deletions were identified in the C-terminus of matrix that block virus release. • These deletion mutants still multimerized and associated with membranes. • TEM showed the mutant particles were tethered to the cell surface. • Amino acid mutagenesis of the region did not affect release. • The data suggests that disruption of matrix structure blocks virus release.

  3. Deletions in the fifth alpha helix of HIV-1 matrix block virus release

    International Nuclear Information System (INIS)

    Sanford, Bridget; Li, Yan; Maly, Connor J.; Madson, Christian J.; Chen, Han; Zhou, You; Belshan, Michael

    2014-01-01

    The matrix (MA) protein of HIV-1 is the N-terminal component of the Gag structural protein and is critical for the early and late stages of viral replication. MA contains five α-helices (α1–α5). Deletions in the N-terminus of α5 as small as three amino acids impaired virus release. Electron microscopy of one deletion mutant (MA∆96-120) showed that its particles were tethered to the surface of cells by membranous stalks. Immunoblots indicated all mutants were processed completely, but mutants with large deletions had alternative processing intermediates. Consistent with the EM data, MA∆96-120 retained membrane association and multimerization capability. Co-expression of this mutant inhibited wild type particle release. Alanine scanning mutation in this region did not affect virus release, although the progeny virions were poorly infectious. Combined, these data demonstrate that structural ablation of the α5 of MA inhibits virus release. - Highlights: • Deletions were identified in the C-terminus of matrix that block virus release. • These deletion mutants still multimerized and associated with membranes. • TEM showed the mutant particles were tethered to the cell surface. • Amino acid mutagenesis of the region did not affect release. • The data suggests that disruption of matrix structure blocks virus release

  4. KAJIAN ASPEK TEKNIS DAN FINASIAL USAHA RUMAH TANGGA BRIKET BIOMASSA DARI KULIT NIPAH DENGAN TEMPURUNG KELAPA

    Directory of Open Access Journals (Sweden)

    Martanto Martanto

    2016-04-01

    Full Text Available Nipah merupakan salah satu tanaman  didaerah pasang surut. Di Indonesia terdapat Sekitar tujuh juta hektar (7 Ha  tanaman Nipah. Pemanfaatan kulit nipah  sampai saat ini belum maksimal. Penelitian ini mencoba membuat briket arang dengan campuran arang kelapa. Metode pernelitian ini menggunakan eksperimen untuk pembuatan briket kulit nipah dan metode kuantitatif tehadap nilai ekonomisnya Dari hasil penelitian didapat kadar air 9,2 % ,kadar abu 3,51 % dan kadar zat menguap  2,62 %. Hasil penelitian tersebut layak dan kulaitasnya hampir sama dengan batu bara muda. Dari perhitungan analisa finansial perhitungan NPV, IRR, Payback period  B/C ratio adalah masing-masing menghasilkan nilai masing-masing adalah 8.843.001, 41 %, 3 tahun 7 bulan dan  2,04. Sehingga usaha briket arang dari kulit nipah dengan tempurung kelapa sangat layak untuk dijadikan usaha skala rumah tangga

  5. Membrane association and localization dynamics of the Ebola virus matrix protein VP40.

    Science.gov (United States)

    Gc, Jeevan B; Gerstman, Bernard S; Chapagain, Prem P

    2017-10-01

    The Ebola virus matrix protein VP40 is a major structural protein that provides the scaffolding for new Ebola virus particles. For this, VP40 is first trafficked to the lower leaflet of the plasma membrane (PM) in its dimeric form. Once associated with the PM, the VP40 dimers undergo structural rearrangements and oligomerize into hexamers and filaments that make up the virus matrix. Therefore, association of the VP40 dimers and their stabilization at the PM is a crucial step in the Ebola life-cycle. To understand the molecular details of the VP40 dimer-PM interactions, we investigated the dimer association with the inner leaflet of the PM using detailed all-atom molecular dynamics (MD) simulations. The formation of the dimer-PM complex is facilitated by the interactions of the VP40 lysine residues and the anionic lipids POPS, POPI, and PIP 2 in the PM. In contrast, the dimer fails to associate with a membrane without POPS, POPI, or PIP 2 lipids. We explored the mechanisms of the association and identified important residues and lipids involved in localization and stabilization of VP40 dimers at the PM. MD simulations elucidate the role of a C-terminal α-helix alignment parallel to the lipid bilayer surface as well as the creation of membrane defects that allow partial insertion of the hydrophobic residue V276 into the membrane to further stabilize the VP40 dimer-PM complex. Understanding the mechanisms of the VP40 dimer-PM association that facilitate oligomerization can be important for potentially targeting the VP40 for small molecules that can interfere with the virus life-cycle. Copyright © 2017 Elsevier B.V. All rights reserved.

  6. Myristoylation drives dimerization of matrix protein from mouse mammary tumor virus

    Czech Academy of Sciences Publication Activity Database

    Doležal, Michal; Zábranský, Aleš; Dostál, Jiří; Vaněk, O.; Brynda, Jiří; Lepšík, Martin; Hadravová, Romana; Pichová, Iva

    2016-01-01

    Roč. 13, Jan 5 (2016), č. článku 2. ISSN 1742-4690 R&D Projects: GA MŠk LO1302; GA MŠk(CZ) LO1304; GA ČR GBP208/12/G016 Institutional support: RVO:61388963 Keywords : dimerization * matrix protein * MMTV * molecular dynamics * mouse mammary tumor virus * myristoylation Subject RIV: CE - Biochemistry Impact factor: 3.867, year: 2016 http://retrovirology.biomedcentral.com/articles/10.1186/s12977-015-0235-8

  7. Single mutation in the matrix gene of seasonal influenza A viruses critically affects the performance of diagnostic molecular assay.

    Science.gov (United States)

    Duh, Darja; Blažič, Barbara

    2018-01-01

    Reduced intensity of the fluorescence signal in the amplification curve was observed when using a WHO recommended real time RT-PCR for influenza virus detection. A single mutation, G189T, in the conserved region of influenza virus matrix gene was detected by Sanger sequencing. The mutation is located in the probe binding region, hence we speculated it could be the reason for the atypical shape of amplification curve. The mutation was first noted in Slovenia in 2011 and 2013 for seasonal influenza A virus types A(H1N1)pdm09 and A(H3N2), respectively. In the following years, 2014 and 2015, the majority of influenza A(H3N2) viruses alone carried the mutation. The amplification of matrix gene for these influenza A(H3N2) viruses continuously resulted in the atypically shaped amplification curves. The performance of the particular assay was critically affected; therefore, the assay was no longer usable as diagnostic tool for influenza virus detection. Mutations in the conserved region of influenza virus genome are more common than expected and this would need to be considered when targeting matrix gene. Copyright © 2017 Elsevier B.V. All rights reserved.

  8. Annexin A2 Mediates the Localization of Measles Virus Matrix Protein at the Plasma Membrane.

    Science.gov (United States)

    Koga, Ritsuko; Kubota, Marie; Hashiguchi, Takao; Yanagi, Yusuke; Ohno, Shinji

    2018-02-28

    Annexins are a family of structurally related proteins that bind negatively charged membrane phospholipids in a Ca 2+ -dependent manner. Annexin A2 (AnxA2), a member of the family, has been implicated in a variety of cellular functions including the organization of membrane domains, vesicular trafficking and cell-cell adhesion. AnxA2 generally forms the heterotetrameric complex with a small Ca 2+ -binding protein S100A10. Measles virus (MV), a member of the family Paramyxoviridae , is an enveloped virus with a nonsegmented negative strand RNA genome. Knockdown of AnxA2 greatly reduced MV growth in cells, without affecting its entry and viral RNA production. In MV-infected, AnxA2-knockdown cells, the expression level of the matrix (M) protein, but not other viral proteins, was reduced compared with that in control cells, and the distribution of the M protein at the plasma membrane was decreased. The M protein lines the inner surface of the envelope and plays an important role in virus assembly by connecting the nucleocapsid to the envelope proteins. The M protein bound to AnxA2 independently of AnxA2's phosphorylation or its association with S100A10, and was co-localized with AnxA2 within cells. Truncation of the N-terminal 10 amino acid residues, but not the N-terminal 5 residues, compromised the ability of the M protein to interact with AnxA2 and localize at the plasma membrane. These results indicate that AnxA2 mediates the localization of the MV M protein at the plasma membrane by interacting with its N-terminal region (especially residues at positions 6-10), thereby aiding in MV assembly. IMPORTANCE Measles virus (MV) is an important human pathogen, still claiming ∼ 100,000 lives per year despite the presence of effective vaccines, and causes occasional outbreaks even in developed countries. Replication of viruses largely relies on the functions of host cells. Our study revealed that the reduction of the host protein annexin A2 compromises the replication of

  9. UJI FITOKIMIA SENYAWA KIMIA AKTIF AKAR NIPAH (Nyfa Fruticans WURMB SEBAGAI TUMBUHAN OBAT DI KALIMANTAN SELATAN

    Directory of Open Access Journals (Sweden)

    Rosidah R Radam

    2017-02-01

    Full Text Available Nipa (Nypa fruticans WURMB classified in Palma family and grow in riptide area. This Research aims to know active Chemical compounds in Nipa root. We Hope that this Research will provide new information about active Chemical compounds in Nipa root, so that we can improve the benefit value of Nipa as One of the medicinal herb. Nipa root samples is taken in Tanah Bumbu District, samples examined in Laboratory of F-MIPA UNLAM. The observed parameters in thus Chemical Test are the active Chemical compounds: alkaloid, steroid, triterpenoid, flavonoid, and tannin. The Content of active Chemical compound is presented in Table and concluded descriptively. The Result of active Chemical compound consist in Nipa’s root shows that Alkaloid, Steroid, Triterpenoid, Flavonoid , and tannin compound is do contains in Nipa root. This active Chemical compound in Nipa root can be Led as the basic Chemical informative to utilize Nipa root as analgesics Medical for such disease. Nipah (nypa fruticans WURMB merupakan tumbuhan yang termasuk famili Palmae dan   tumbuh di daerah  pasang   surut.  Penelitian ini bertujuan untuk mengetahui  kandungan senyawa-senyawa kimia aktif pada akar nipah. Manfaat dari penelitian ini untuk memberikan informasi baru tentang senyawa aktif yang terdapat pada akar nipah, sehingga dapat meningkatkan nilai guna dan manfaat tumbuhan nipah sebagai salah satu tanaman obat. Pengambilan sample akar nipah dilakukan Kabupaten Tanah Bumbu  sedangkan pengujian sample akar nipah dilakukan di Laboratorium F-MIFA UNLAM. Parameter-parameter yang diamati pada pengujian kimia tersebut adalah senyawa-senyawa kimia aktif yaitu alkaloid, steroid, triterpenoid flavonoid, dan tanin. Data hasil uji kandungan senyawa kimia aktif  ditabulasi dan disimpulkan secara diskriptif. Hasil pengujian terhadap senyawa kimia aktif yang terkandung dalam akar Nifah ini menunjukan bahwa senyawa Alkaloid, Steroid, Triterpenoid, Flavonoid , dan tanin memang dikandung

  10. A spatio-temporal analysis of matrix protein and nucleocapsid trafficking during vesicular stomatitis virus uncoating.

    Directory of Open Access Journals (Sweden)

    Chad E Mire

    2010-07-01

    Full Text Available To study VSV entry and the fate of incoming matrix (M protein during virus uncoating we used recombinant viruses encoding M proteins with a C-terminal tetracysteine tag that could be fluorescently labeled using biarsenical (Lumio compounds. We found that uncoating occurs early in the endocytic pathway and is inhibited by expression of dominant-negative (DN Rab5, but is not inhibited by DN-Rab7 or DN-Rab11. Uncoating, as defined by the separation of nucleocapsids from M protein, occurred between 15 and 20 minutes post-entry and did not require microtubules or an intact actin cytoskeleton. Unexpectedly, the bulk of M protein remained associated with endosomal membranes after uncoating and was eventually trafficked to recycling endosomes. Another small, but significant fraction of M distributed to nuclear pore complexes, which was also not dependent on microtubules or polymerized actin. Quantification of fluorescence from high-resolution confocal micrographs indicated that after membrane fusion, M protein diffuses across the endosomal membrane with a concomitant increase in fluorescence from the Lumio label which occurred soon after the release of RNPs into the cytoplasm. These data support a new model for VSV uncoating in which RNPs are released from M which remains bound to the endosomal membrane rather than the dissociation of M protein from RNPs after release of the complex into the cytoplasm following membrane fusion.

  11. Optical diagnosis of dengue virus infected human blood using Mueller matrix polarimetry

    Science.gov (United States)

    Anwar, Shahzad; Firdous, Shamaraz

    2016-08-01

    Currently dengue fever diagnosis methods include capture ELISAs, immunofluorescence tests, and hemagglutination assays. In this study optical diagnosis of dengue virus infection in the whole blood is presented utilizing Mueller matrix polarimetry. Mueller matrices of about 50 dengue viral infected and 25 non-dengue healthy blood samples were recorded utilizing light source from 500 to 700 nm with scanning step of 10 nm. Polar decomposition of the Mueller matrices for all the blood samples was performed that yielded polarization properties including depolarization, diattenuation, degree of polarization, retardance and optical activity, out of which, depolarization index clusters up the diseased and healthy in to different separate groups. The average depolarized light in the case of dengue infection in the whole blood at 500 nm is 18%, whereas for the healthy blood samples it is 13.5%. This suggests that depolarization index of polarized light at the wavelengths of 500, 510, 520, 530 and 540 nm, we find that in case of depolarization index values are higher for dengue viral infection as compared to normal samples. This technique can effectively be used for the characterization of the dengue virus infected at an early stage of disease.

  12. Biophysical characterization and crystal structure of the Feline Immunodeficiency Virus p15 matrix protein.

    Science.gov (United States)

    Serrière, Jennifer; Robert, Xavier; Perez, Magali; Gouet, Patrice; Guillon, Christophe

    2013-06-24

    Feline Immunodeficiency Virus (FIV) is a viral pathogen that infects domestic cats and wild felids. During the viral replication cycle, the FIV p15 matrix protein oligomerizes to form a closed matrix that underlies the lipidic envelope of the virion. Because of its crucial role in the early and late stages of viral morphogenesis, especially in viral assembly, FIV p15 is an interesting target in the development of potential new therapeutic strategies. Our biochemical study of FIV p15 revealed that it forms a stable dimer in solution under acidic conditions and at high concentration, unlike other retroviral matrix proteins. We determined the crystal structure of full-length FIV p15 to 2 Å resolution and observed a helical organization of the protein, typical for retroviral matrix proteins. A hydrophobic pocket that could accommodate a myristoyl group was identified, and the C-terminal end of FIV p15, which is mainly unstructured, was visible in electron density maps. As FIV p15 crystallizes in acidic conditions but with one monomer in the asymmetric unit, we searched for the presence of a biological dimer in the crystal. No biological assembly was detected by the PISA server, but the three most buried crystallographic interfaces have interesting features: the first one displays a highly conserved tryptophan acting as a binding platform, the second one is located along a 2-fold symmetry axis and the third one resembles the dimeric interface of EIAV p15. Because the C-terminal end of p15 is involved in two of these three interfaces, we investigated the structure and assembly of a C-terminal-truncated form of p15 lacking 14 residues. The truncated FIV p15 dimerizes in solution at a lower concentration and crystallizes with two molecules in the asymmetric unit. The EIAV-like dimeric interface is the only one to be retained in the new crystal form. The dimeric form of FIV p15 in solution and its extended C-terminal end are characteristic among lentiviral matrix proteins

  13. Nuclear localization and secretion competence are conserved among henipavirus matrix proteins.

    Science.gov (United States)

    McLinton, Elisabeth C; Wagstaff, Kylie M; Lee, Alexander; Moseley, Gregory W; Marsh, Glenn A; Wang, Lin-Fa; Jans, David A; Lieu, Kim G; Netter, Hans J

    2017-04-01

    Viruses of the genus Henipavirus of the family Paramyxoviridae are zoonotic pathogens, which have emerged in Southeast Asia, Australia and Africa. Nipah virus (NiV) and Hendra virus are highly virulent pathogens transmitted from bats to animals and humans, while the henipavirus Cedar virus seems to be non-pathogenic in infection studies. The full replication cycle of the Paramyxoviridae occurs in the host cell's cytoplasm, where viral assembly is orchestrated by the matrix (M) protein. Unexpectedly, the NiV-M protein traffics through the nucleus as an essential step to engage the plasma membrane in preparation for viral budding/release. Comparative studies were performed to assess whether M protein nuclear localization is a common feature of the henipaviruses, including the recently sequenced (although not yet isolated) Ghanaian bat henipavirus (Kumasi virus, GH-M74a virus) and Mojiang virus. Live-cell confocal microscopy revealed that nuclear translocation of GFP-fused M protein is conserved between henipaviruses in both human- and bat-derived cell lines. However, the efficiency of M protein nuclear localization and virus-like particle budding competency varied. Additionally, Cedar virus-, Kumasi virus- and Mojiang virus-M proteins were mutated in a bipartite nuclear localization signal, indicating that a key lysine residue is essential for nuclear import, export and induction of budding events, as previously reported for NiV-M. The results of this study suggest that the M proteins of henipaviruses may utilize a similar nucleocytoplasmic trafficking pathway as an essential step during viral replication in both humans and bats.

  14. Matrix Metalloproteinase Activity in Infections by an Encephalitic Virus, Mouse Adenovirus Type 1

    Science.gov (United States)

    Ashley, Shanna L.; Pretto, Carla D.; Stier, Matthew T.; Kadiyala, Padma; Castro-Jorge, Luiza; Hsu, Tien-Huei; Doherty, Robert; Carnahan, Kelly E.; Castro, Maria G.; Lowenstein, Pedro R.

    2017-01-01

    ABSTRACT Mouse adenovirus type 1 (MAV-1) infection causes encephalitis in susceptible strains of mice and alters the permeability of infected brains to small molecules, which indicates disruption of the blood-brain barrier (BBB). Under pathological conditions, matrix metalloproteinases (MMPs) can disrupt the BBB through their proteolytic activity on basement membrane and tight junction proteins. We examined whether MAV-1 infection alters MMP activity in vivo and in vitro. Infected MAV-1-susceptible SJL mice had higher MMP2 and MMP9 activity in brains, measured by gelatin zymography, than mock-infected mice. Infected MAV-1-resistant BALB/c mice had MMP activity levels equivalent to those in mock infection. Primary SJL mouse brain endothelial cells (a target of MAV-1 in vivo) infected ex vivo with MAV-1 had no difference in activities of secreted MMP2 and MMP9 from mock cells. We show for the first time that astrocytes and microglia are also infected in vivo by MAV-1. Infected mixed primary cultures of astrocytes and microglia had higher levels of MMP2 and MMP9 activity than mock-infected cells. These results indicate that increased MMP activity in the brains of MAV-1-infected susceptible mice may be due to MMP activity produced by endothelial cells, astrocytes, and microglia, which in turn may contribute to BBB disruption and encephalitis in susceptible mice. IMPORTANCE RNA and DNA viruses can cause encephalitis; in some cases, this is accompanied by MMP-mediated disruption of the BBB. Activated MMPs degrade extracellular matrix and cleave tight-junction proteins and cytokines, modulating their functions. MAV-1 infection of susceptible mice is a tractable small-animal model for encephalitis, and the virus causes disruption of the BBB. We showed that MAV-1 infection increases enzymatic activity of two key MMPs known to be secreted and activated in neuroinflammation, MMP2 and MMP9, in brains of susceptible mice. MAV-1 infects endothelial cells, astrocytes, and

  15. Dimerization Efficiency of Canine Distemper Virus Matrix Protein Regulates Membrane-Budding Activity.

    Science.gov (United States)

    Bringolf, Fanny; Herren, Michael; Wyss, Marianne; Vidondo, Beatriz; Langedijk, Johannes P; Zurbriggen, Andreas; Plattet, Philippe

    2017-08-15

    Paramyxoviruses rely on the matrix (M) protein to orchestrate viral assembly and budding at the plasma membrane. Although the mechanistic details remain largely unknown, structural data suggested that M dimers and/or higher-order oligomers may facilitate membrane budding. To gain functional insights, we employed a structure-guided mutagenesis approach to investigate the role of canine distemper virus (CDV) M protein self-assembly in membrane-budding activity. Three six-alanine-block (6A-block) mutants with mutations located at strategic oligomeric positions were initially designed. While the first one includes residues potentially residing at the protomer-protomer interface, the other two display amino acids located within two distal surface-exposed α-helices proposed to be involved in dimer-dimer contacts. We further focused on the core of the dimeric interface by mutating asparagine 138 (N138) to several nonconservative amino acids. Cellular localization combined with dimerization and coimmunopurification assays, performed under various denaturing conditions, revealed that all 6A-block mutants were impaired in self-assembly and cell periphery accumulation. These phenotypes correlated with deficiencies in relocating CDV nucleocapsid proteins to the cell periphery and in virus-like particle (VLP) production. Conversely, all M-N138 mutants remained capable of self-assembly, though to various extents, which correlated with proper accumulation and redistribution of nucleocapsid proteins at the plasma membrane. However, membrane deformation and VLP assays indicated that the M-N138 variants exhibiting the most reduced dimerization propensity were also defective in triggering membrane remodeling and budding, despite proper plasma membrane accumulation. Overall, our data provide mechanistic evidence that the efficiency of CDV M dimerization/oligomerization governs both cell periphery localization and membrane-budding activity. IMPORTANCE Despite the availability of

  16. Suppression of matrix protein synthesis in endothelial cells by herpes simplex virus is not dependent on viral protein synthesis

    International Nuclear Information System (INIS)

    Kefalides, N.A.

    1986-01-01

    The synthesis of matrix proteins by human endothelial cells (EC) in vitro was studied before and at various times after infection with Herpes Simplex virus Type 1 (HSV-1) or 2 (HSV-2). Monolayers of EC were either mock-infected or infected with virus for 1 hr at a multiplicity infection (MOI) of 5 to 20 at 37 0 C. Control and infected cultures were pulse-labeled for 1 or 2 hrs with either [ 14 C]proline or [ 35 S]methionine. Synthesis of labeled matrix proteins was determined by SDS-gel electrophoresis. Suppression of synthesis of fibronectin, Type IV collagen and thrombospondin began as early as 2 hrs and became almost complete by 10 hrs post-infection. The degree of suppression varied with the protein and the virus dose. Suppression of Type IV collagen occurred first followed by that of fibronectin and then thrombospondin. Infection of EC with UV irradiated HSV-1 or HSV-2 resulted in suppression of host-cell protein synthesis as well as viral protein synthesis. Infection with intact virus in the presence of actinomycin-D resulted in suppression of both host-cell and viral protein synthesis. The data indicate that infection of EC with HSV leads to suppression of matrix protein synthesis which does not depend on viral protein synthesis

  17. Evidence for ubiquitin-regulated nuclear and subnuclear trafficking among Paramyxovirinae matrix proteins.

    Directory of Open Access Journals (Sweden)

    Mickey Pentecost

    2015-03-01

    Full Text Available The paramyxovirus matrix (M protein is a molecular scaffold required for viral morphogenesis and budding at the plasma membrane. Transient nuclear residence of some M proteins hints at non-structural roles. However, little is known regarding the mechanisms that regulate the nuclear sojourn. Previously, we found that the nuclear-cytoplasmic trafficking of Nipah virus M (NiV-M is a prerequisite for budding, and is regulated by a bipartite nuclear localization signal (NLSbp, a leucine-rich nuclear export signal (NES, and monoubiquitination of the K258 residue within the NLSbp itself (NLSbp-lysine. To define whether the sequence determinants of nuclear trafficking identified in NiV-M are common among other Paramyxovirinae M proteins, we generated the homologous NES and NLSbp-lysine mutations in M proteins from the five major Paramyxovirinae genera. Using quantitative 3D confocal microscopy, we determined that the NES and NLSbp-lysine are required for the efficient nuclear export of the M proteins of Nipah virus, Hendra virus, Sendai virus, and Mumps virus. Pharmacological depletion of free ubiquitin or mutation of the conserved NLSbp-lysine to an arginine, which inhibits M ubiquitination, also results in nuclear and nucleolar retention of these M proteins. Recombinant Sendai virus (rSeV-eGFP bearing the NES or NLSbp-lysine M mutants rescued at similar efficiencies to wild type. However, foci of cells expressing the M mutants displayed marked fusogenicity in contrast to wild type, and infection did not spread. Recombinant Mumps virus (rMuV-eGFP bearing the homologous mutations showed similar defects in viral morphogenesis. Finally, shotgun proteomics experiments indicated that the interactomes of Paramyxovirinae M proteins are significantly enriched for components of the nuclear pore complex, nuclear transport receptors, and nucleolar proteins. We then synthesize our functional and proteomics data to propose a working model for the ubiquitin

  18. Reassortment between Avian H5N1 and human influenza viruses is mainly restricted to the matrix and neuraminidase gene segments.

    Directory of Open Access Journals (Sweden)

    Eefje J A Schrauwen

    Full Text Available Highly pathogenic avian influenza H5N1 viruses have devastated the poultry industry in many countries of the eastern hemisphere. Occasionally H5N1 viruses cross the species barrier and infect humans, sometimes with a severe clinical outcome. When this happens, there is a chance of reassortment between H5N1 and human influenza viruses. To assess the potential of H5N1 viruses to reassort with contemporary human influenza viruses (H1N1, H3N2 and pandemic H1N1, we used an in vitro selection method to generate reassortant viruses, that contained the H5 hemagglutinin gene, and that have a replication advantage in vitro. We found that the neuraminidase and matrix gene segments of human influenza viruses were preferentially selected by H5 viruses. However, these H5 reassortant viruses did not show a marked increase in replication in MDCK cells and human bronchial epithelial cells. In ferrets, inoculation with a mixture of H5N1-pandemic H1N1 reassortant viruses resulted in outgrowth of reassortant H5 viruses that had incorporated the neuraminidase and matrix gene segment of pandemic 2009 H1N1. This virus was not transmitted via aerosols or respiratory droplets to naïve recipient ferrets. Altogether, these data emphasize the potential of avian H5N1 viruses to reassort with contemporary human influenza viruses. The neuraminidase and matrix gene segments of human influenza viruses showed the highest genetic compatibility with HPAI H5N1 virus.

  19. Cloning and characterization of DNA complementary to the canine distemper virus mRNA encoding matrix, phosphoprotein, and nucleocapsid protein

    Energy Technology Data Exchange (ETDEWEB)

    Rozenblatt, S.; Eizenberg, O.; Englund, G.; Bellini, W.J.

    1985-02-01

    Double-stranded cDNA synthesized from total polyadenylate-containing mRNA, extracted from monkey kidney cells infected with canine distemper virus (CDV), has been cloned into the PstI site of Escherichia coli plasmid pBR322. Clones containing canine distemper virus DNA were identified by hybridization to a canine distemper virus-specific, /sup 32/P-labeled cDNA. Four specific clones containing different classes of sequences have been identified. The cloned plasmids contain inserts of 800 (clone 44-80), 960 (clone 74-16), 1700 (clone 364), and 950 (clone 40-9) base pairs. The sizes of the mRNA species complementary to these inserts are 1500, 1850, 1850 and 2500 nucleotides, respectively, as determined by the Northern technique. Three of the cloned DNA fragments were further identified as the reverse transcripts of the mRNA coding for the matrix, phosphoprotein, and nucleocapsid protein of CDV.

  20. Cloning and characterization of DNA complementary to the canine distemper virus mRNA encoding matrix, phosphoprotein, and nucleocapsid protein

    International Nuclear Information System (INIS)

    Rozenblatt, S.; Eizenberg, O.; Englund, G.; Bellini, W.J.

    1985-01-01

    Double-stranded cDNA synthesized from total polyadenylate-containing mRNA, extracted from monkey kidney cells infected with canine distemper virus (CDV), has been cloned into the PstI site of Escherichia coli plasmid pBR322. Clones containing canine distemper virus DNA were identified by hybridization to a canine distemper virus-specific, 32 P-labeled cDNA. Four specific clones containing different classes of sequences have been identified. The cloned plasmids contain inserts of 800 (clone 44-80), 960 (clone 74-16), 1700 (clone 364), and 950 (clone 40-9) base pairs. The sizes of the mRNA species complementary to these inserts are 1500, 1850, 1850 and 2500 nucleotides, respectively, as determined by the Northern technique. Three of the cloned DNA fragments were further identified as the reverse transcripts of the mRNA coding for the matrix, phosphoprotein, and nucleocapsid protein of CDV

  1. Influenza A virus infection engenders a poor antibody response against the ectodomain of matrix protein 2

    Directory of Open Access Journals (Sweden)

    Wunner William

    2006-12-01

    Full Text Available Abstract Background Matrix protein 2 (M2 is an integral tetrameric membrane protein of influenza A virus (IAV. Its ectodomain (M2e shows remarkably little diversity amongst human IAV strains. As M2e-specific antibodies (Abs have been shown to reduce the severity of infection in animals, M2e is being studied for its capability of providing protection against a broad range of IAV strains. Presently, there is little information about the concentration of M2e-specific Abs in humans. Two previous studies made use of ELISA and Western blot against M2e peptides and recombinant M2 protein as immunosorbents, respectively, and reported Ab titers to be low or undetectable. An important caveat is that these assays may not have detected all Abs capable of binding to native tetrameric M2e. Therefore, we developed an assay likely to detect all M2e tetramer-specific Abs. Results We generated a HeLa cell line that expressed full length tetrameric M2 (HeLa-M2 or empty vector (HeLa-C10 under the control of the tetracycline response element. These cell lines were then used in parallel as immunosorbents in ELISA. The assay was standardized and M2e-specific Ab titers quantified by means of purified murine or chimeric (mouse variable regions, human constant regions M2e-specific Abs in the analysis of mouse and human sera, respectively. We found that the cell-based ELISA was substantially more effective than immobilized M2e peptide in detecting M2e-specific Abs in sera of mice that had recovered from repetitive IAV infections. Still, titers remained low ( Conclusion The results provide convincing evidence that M2e-specific Ab-mediated protection is currently lacking or suboptimal in humans.

  2. The Glycoprotein and the Matrix Protein of Rabies Virus Affect Pathogenicity by Regulating Viral Replication and Facilitating Cell-to-Cell Spread▿

    OpenAIRE

    Pulmanausahakul, Rojjanaporn; Li, Jianwei; Schnell, Matthias J.; Dietzschold, Bernhard

    2007-01-01

    While the glycoprotein (G) of rabies virus (RV) is known to play a predominant role in the pathogenesis of rabies, the function of the RV matrix protein (M) in RV pathogenicity is not completely clear. To further investigate the roles of these proteins in viral pathogenicity, we constructed chimeric recombinant viruses by exchanging the G and M genes of the attenuated SN strain with those of the highly pathogenic SB strain. Infection of mice with these chimeric viruses revealed a significant ...

  3. Fitting evolution of matrix protein 1 from influenza A virus using analytical solution of system of differential equations.

    Science.gov (United States)

    Yan, Shaomin; Li, Zhenchong; Wu, Guang

    2010-04-01

    The understanding of evolutionary mechanism is important, and equally important is to describe the evolutionary process. If so, we would know where the biological evolution will go. At species level, we would know whether and when a species will extinct or be prosperous. At protein level, we would know when a protein family will mutate more. In our previous study, we explored the possibility of using the differential equation to describe the evolution of protein family from influenza A virus based on the assumption that the mutation process is the exchange of entropy between protein family and its environment. In this study, we use the analytical solution of system of differential equations to fit the evolution of matrix protein 1 family from influenza A virus. Because the evolutionary process goes along the time course, it can be described by differential equation. The results show that the evolution of a protein family can be fitted by the analytical solution. With the obtained fitted parameters, we may predict the evolution of matrix protein 1 family from influenza A virus. Our model would be the first step towards the systematical modeling of biological evolution and paves the way for further modeling.

  4. Matrix Degradation in Human Immunodeficiency Virus Type 1-Associated Tuberculosis and Tuberculosis Immune Reconstitution Inflammatory Syndrome: A Prospective Observational Study.

    Science.gov (United States)

    Walker, Naomi F; Wilkinson, Katalin A; Meintjes, Graeme; Tezera, Liku B; Goliath, Rene; Peyper, Janique M; Tadokera, Rebecca; Opondo, Charles; Coussens, Anna K; Wilkinson, Robert J; Friedland, Jon S; Elkington, Paul T

    2017-07-01

    Extensive immunopathology occurs in human immunodeficiency virus (HIV)/tuberculosis (TB) coinfection, but the underlying molecular mechanisms are not well-defined. Excessive matrix metalloproteinase (MMP) activity is emerging as a key process but has not been systematically studied in HIV-associated TB. We performed a cross-sectional study of matrix turnover in HIV type 1 (HIV-1)-infected and -uninfected TB patients and controls, and a prospective cohort study of HIV-1-infected TB patients at risk of TB immune reconstitution inflammatory syndrome (TB-IRIS), in Cape Town, South Africa. Sputum and plasma MMP concentrations were quantified by Luminex, plasma procollagen III N-terminal propeptide (PIIINP) by enzyme-linked immunosorbent assay, and urinary lipoarabinomannan (LAM) by Alere Determine TB LAM assay. Peripheral blood mononuclear cells from healthy donors were cultured with Mycobacterium tuberculosis and extracellular matrix in a 3D model of TB granuloma formation. MMP activity differed between HIV-1-infected and -uninfected TB patients and corresponded with specific TB clinical phenotypes. HIV-1-infected TB patients had reduced pulmonary MMP concentrations, associated with reduced cavitation, but increased plasma PIIINP, compared to HIV-1-uninfected TB patients. Elevated extrapulmonary extracellular matrix turnover was associated with TB-IRIS, both before and during TB-IRIS onset. The predominant collagenase was MMP-8, which was likely neutrophil derived and M. tuberculosis-antigen driven. Mycobacterium tuberculosis-induced matrix degradation was suppressed by the MMP inhibitor doxycycline in vitro. MMP activity in TB differs by HIV-1 status and compartment, and releases matrix degradation products. Matrix turnover in HIV-1-infected patients is increased before and during TB-IRIS, informing novel diagnostic strategies. MMP inhibition is a potential host-directed therapy strategy for prevention and treatment of TB-IRIS. © The Author 2017. Published by Oxford

  5. Comparison of in vivo toxicity, antioxidant and immunomodulatory activities of coconut, nipah and pineapple juice vinegars.

    Science.gov (United States)

    Mohamad, Nurul Elyani; Keong Yeap, Swee; Beh, Boon Keen; Romli, Muhammad Firdaus; Yusof, Hamidah Mohd; Kristeen-Teo, Ye Wen; Sharifuddin, Shaiful Adzni; Long, Kamariah; Alitheen, Noorjahan Banu

    2018-01-01

    Vinegar is widely used as a food additive, in food preparation and as a food supplement. This study compared the phenolic acid profiles and in vivo toxicities, and antioxidant and immunomodulatory effects of coconut, nipah and pineapple juice vinegars, which were respectively prepared via a two-step fermentation using Saccharomyces cerevisiae 7013 INRA and Acetobacter aceti vat Europeans. Pineapple juice vinegar, which had the highest total phenolic acid content, also exhibited the greatest in vitro antioxidant capacity compared to coconut juice and nipah juice vinegars. Following acute and sub-chronic in vivo toxicity evaluation, no toxicity and mortality were evident and there were no significant differences in the serum biochemical profiles between mice administered the vinegars versus the control group. In the sub-chronic toxicity evaluation, the highest liver antioxidant levels were found in mice fed with pineapple juice vinegar, followed by coconut juice and nipah juice vinegars. However, compared to the pineapple juice and nipah juice vinegars, the mice fed with coconut juice vinegar, exhibited a higher population of CD4 + and CD8 + T-lymphocytes in the spleen, which was associated with greater levels of serum interleukin-2 and interferon-γ cytokines. Overall, the data suggested that not all vinegar samples cause acute and sub-chronic toxicity in vivo. Moreover, the in vivo immunity and organ antioxidant levels were enhanced, to varying extents, by the phenolic acids present in the vinegars. The results obtained in this study provide appropriate guidelines for further in vivo bioactivity studies and pre-clinical assessments of vinegar consumption. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.

  6. Safety and Serological Response to a Matrix Gene-deleted Rabies Virus-based Vaccine Vector in Dogs

    OpenAIRE

    McGettigan, James P.; David, Frederic; Figueiredo, Monica Dias; Minke, Jules; Mebatsion, Teshome; Schnell, Matthias J.

    2014-01-01

    Dogs account for the majority of human exposures and deaths due to rabies virus (RABV) worldwide. In this report, we show that a replication-deficient RABV-based vaccine in which the matrix gene is deleted (RABV- M) is safe and induces rapid and potent VNA titers after a single inoculation in dogs. Average VNA titers peaked at 3.02 or 5.11 International Units (IU/ml) by 14 days post-immunization with a single dose of 106 or 107 focus forming units (ffu), respectively, of RABV- M. By day 70 po...

  7. A Human Nuclear Shuttling Protein That Interacts with Human Immunodeficiency Virus Type 1 Matrix Is Packaged into Virions

    Science.gov (United States)

    Gupta, Kalpana; Ott, David; Hope, Thomas J.; Siliciano, Robert F.; Boeke, Jef D.

    2000-01-01

    Active nuclear import of the human immunodeficiency virus type 1 (HIV-1) preintegration complex (PIC) is essential for the productive infection of nondividing cells. Nuclear import of the PIC is mediated by the HIV-1 matrix protein, which also plays several critical roles during viral entry and possibly during virion production facilitating the export of Pr55Gag and genomic RNA. Using a yeast two-hybrid screen, we identified a novel human virion-associated matrix-interacting protein (VAN) that is highly conserved in vertebrates and expressed in most human tissues. Its expression is upregulated upon activation of CD4+ T cells. VAN is efficiently incorporated into HIV-1 virions and, like matrix, shuttles between the nucleus and cytoplasm. Furthermore, overexpression of VAN significantly inhibits HIV-1 replication in tissue culture. We propose that VAN regulates matrix nuclear localization and, by extension, both nuclear import of the PIC and export of Pr55Gag and viral genomic RNA during virion production. Our data suggest that this regulatory mechanism reflects a more global process for regulation of nucleocytoplasmic transport. PMID:11090181

  8. Elevated Serum Levels of Matrix Metalloproteinase 9 in Severe Dengue Virus Infection at Sanglah Hospital Denpasar, Bali - Indonesia

    Directory of Open Access Journals (Sweden)

    Dewi Dian Sukmawati

    2016-08-01

    Full Text Available Dengue virus - infected dendritic cells along with cytokines overproduction trigger endothelial barrier dysfunction and plasma leakage through matrix metalloproteinase (MMP-9 over production. The event is responsible for more severe dengue virus infection’s manifestation. The study objective is to measure the association of MMP-9 serum level with disease severity of dengue virus infection. Prospective study of 70 participants hospitalized in Internal Medicine ward of Sanglah Hospital Denpasar, during 1 July 2011 – 31 December 2011 and diagnosed as dengue virus infection were followed during their hospital stay. Baseline demographic were obtained on admission, serum level of MMP-9 was measured once at third – fifth day from fever onset. Independent-samples t test was used to compare the MMP 9 levels among diagnosis groups and exploration of variables were using logistic regression analysis.  There was significant higher level of MMP-9 serum level on DHF (median [range] compared to DF (367.78 ng/mL [81.16 – 797.79] vs. 128.67 ng/mL [41.79 – 327.32]; p < 0.0001. After adjusted with baseline hematocrit, for every 10 ng/mL elevation of MMP-9 serum contributes to 1.159 increased risk of DHF with optimal threshold MMP-9 level is 330 ng/mL (100 % sensitivity, 64% specificity.MMP-9 level is associated with dengue severity. The measurement was able to predict the DHF among those infected with dengue virus infection. This may lead to a novel marker of dengue hemorrhagic fever predictor.

  9. Emerging tropical diseases in Australia. Part 5. Hendra virus.

    Science.gov (United States)

    Tulsiani, S M; Graham, G C; Moore, P R; Jansen, C C; Van Den Hurk, A F; Moore, F A J; Simmons, R J; Craig, S B

    2011-01-01

    Hendra virus (HeV) was first isolated in 1994, from a disease outbreak involving at least 21 horses and two humans in the Brisbane suburb of Hendra, Australia. The affected horses and humans all developed a severe but unidentified respiratory disease that resulted in the deaths of one of the human cases and the deaths or putting down of 14 of the horses. The virus, isolated by culture from a horse and the kidney of the fatal human case, was initially characterised as a new member of the genus Morbillivirus in the family Paramyxoviridae. Comparative sequence analysis of part of the matrix protein gene of the virus and the discovery that the virus had an exceptionally large genome subsequently led to HeV being assigned to a new genus, Henipavirus, along with Nipah virus (a newly emergent virus in pigs). The regular outbreaks of HeV-related disease that have occurred in Australia since 1994 have all been characterised by acute respiratory and neurological manifestations, with high levels of morbidity and mortality in the affected horses and humans. The modes of transmission of HeV remain largely unknown. Although fruit bats have been identified as natural hosts of the virus, direct bat-horse, bat-human or human-human transmission has not been reported. Human infection can occur via exposure to infectious urine, saliva or nasopharyngeal fluid from horses. The treatment options and efficacy are very limited and no vaccine exists. Reports on the outbreaks of HeV in Australia are collated in this review and the available data on the biology, transmission and detection of the pathogen are summarized and discussed.

  10. A novel subnucleocapsid nanoplatform for mucosal vaccination against influenza virus that targets the ectodomain of matrix protein 2.

    Science.gov (United States)

    Hervé, Pierre-Louis; Raliou, Mariam; Bourdieu, Christiane; Dubuquoy, Catherine; Petit-Camurdan, Agnès; Bertho, Nicolas; Eléouët, Jean-François; Chevalier, Christophe; Riffault, Sabine

    2014-01-01

    In this study, subnucleocapsid nanorings formed by the recombinant nucleoprotein (N) of the respiratory syncytial virus were evaluated as a platform to anchor heterologous antigens. The ectodomain of the influenza virus A matrix protein 2 (M2e) is highly conserved and elicits protective antibodies when it is linked to an immunogenic carrier, making it a promising target to develop universal influenza vaccines. In this context, one or three M2e copies were genetically linked to the C terminus of N to produce N-M2e and N-3M2e chimeric recombinant nanorings. Mice were immunized intranasally with N-M2e or N-3M2e or with M2e or 3M2e control peptides. N-3M2e-vaccinated mice showed the strongest mucosal and systemic antibody responses. These mice presented a reduced viral load and minor weight loss, and all survived upon challenge with influenza virus A/PR8/34 (H1N1) (PR8). We compared the intranasal route to the subcutaneous route of N-3M2e immunization. Only the intranasal route induced a strong local IgA response and led to the protection of mice upon challenge. Finally, we demonstrated that the induction of anti-M2e antibodies by N-3M2e is not impaired by preexisting anti-N immunity. Overall, these results show that the N nanoring is a potent carrier for mucosal delivery of vaccinal antigens.

  11. Involvement of nucleoprotein, phosphoprotein, and matrix protein genes of rabies virus in virulence for adult mice.

    Science.gov (United States)

    Shimizu, Kenta; Ito, Naoto; Mita, Tetsuo; Yamada, Kentaro; Hosokawa-Muto, Junji; Sugiyama, Makoto; Minamoto, Nobuyuki

    2007-02-01

    Rabies virus Ni-CE strain causes nonlethal infection in adult mice after intracerebral inoculation, whereas the parental Nishigahara strain kills mice. In this study, to identify viral gene(s) related to the difference in pathogenicity between Ni-CE and Nishigahara strains, we generated chimeric viruses with respective genes of the virulent Nishigahara strain in the background of the avirulent Ni-CE genome. Since chimeric viruses, which had the N, P, or M genes of the Nishigahara strain, respectively, killed adult mice after intracerebral inoculation, it became evident that the N, P, and M genes are related to the difference in pathogenicity between Ni-CE and Nishigahara strains. Previously, we showed that the G gene is a major contributor to the difference in pathogenicity between another avirulent strain, RC-HL, and the parental Nishigahara strain. These results imply that the attenuation mechanism of the Ni-CE strain is different from that of the RC-HL strain, thus suggesting that rabies virus can be attenuated by diverse mechanisms. This is the first report of changes in viral genes other than the G gene of rabies virus causing the reversion of pathogenicity of an avirulent strain.

  12. Emerging Foodborne and Agriculture-Related Viruses.

    Science.gov (United States)

    Kingsley, David H

    2016-08-01

    Viruses rapidly evolve and can emerge in unpredictable ways. Transmission pathways by which foodborne viruses may enter human populations and evolutionary mechanisms by which viruses can become virulent are discussed in this chapter. A majority of viruses emerge from zoonotic animal reservoirs, often by adapting and infecting intermediate hosts, such as domestic animals and livestock. Viruses that are known foodborne threats include hepatitis E virus, tick-borne encephalitis virus, enteroviruses, adenovirus, and astroviruses, among others. Viruses may potentially evolve and emerge as a result of modern agricultural practices which can concentrate livestock and bring them into contact with wild animals. Examples of viruses that have emerged in this manner are influenza, coronaviruses such as severe acute respiratory syndrome and Middle East respiratory syndrome, and the Nipah virus. The role of bats, bush meat, rodents, pigs, cattle, and poultry as reservoirs from which infectious pathogenic viruses emerge are discussed.

  13. Rapid Screening for Entry Inhibitors of Highly Pathogenic Viruses under Low-Level Biocontainment

    Science.gov (United States)

    Talekar, Aparna; Pessi, Antonello; Glickman, Fraser; Sengupta, Uttara; Briese, Thomas; Whitt, Michael A.; Mathieu, Cyrille; Horvat, Branka; Moscona, Anne; Porotto, Matteo

    2012-01-01

    Emerging viruses including Nipah, Hendra, Lujo, and Junin viruses have enormous potential to spread rapidly. Nipah virus, after emerging as a zoonosis, has also evolved the capacity for human-to-human transmission. Most of the diseases caused by these pathogens are untreatable and require high biocontainment conditions. Universal methods for rapidly identifying and screening candidate antivirals are urgently needed. We have developed a modular antiviral platform strategy that relies on simple bioinformatic and genetic information about each pathogen. Central to this platform is the use of envelope glycoprotein cDNAs to establish multi-cycle replication systems under BSL2 conditions for viral pathogens that normally require BSL3 and BSL4 facilities. We generated monoclonal antibodies against Nipah G by cDNA immunization in rats, and we showed that these antibodies neutralize both Nipah and Hendra live viruses. We then used these effective Henipavirus inhibitors to validate our screening strategy. Our proposed strategy should contribute to the response capability for emerging infectious diseases, providing a way to initiate antiviral development immediately upon identifying novel viruses. PMID:22396728

  14. Rapid screening for entry inhibitors of highly pathogenic viruses under low-level biocontainment.

    Directory of Open Access Journals (Sweden)

    Aparna Talekar

    Full Text Available Emerging viruses including Nipah, Hendra, Lujo, and Junin viruses have enormous potential to spread rapidly. Nipah virus, after emerging as a zoonosis, has also evolved the capacity for human-to-human transmission. Most of the diseases caused by these pathogens are untreatable and require high biocontainment conditions. Universal methods for rapidly identifying and screening candidate antivirals are urgently needed. We have developed a modular antiviral platform strategy that relies on simple bioinformatic and genetic information about each pathogen. Central to this platform is the use of envelope glycoprotein cDNAs to establish multi-cycle replication systems under BSL2 conditions for viral pathogens that normally require BSL3 and BSL4 facilities. We generated monoclonal antibodies against Nipah G by cDNA immunization in rats, and we showed that these antibodies neutralize both Nipah and Hendra live viruses. We then used these effective Henipavirus inhibitors to validate our screening strategy. Our proposed strategy should contribute to the response capability for emerging infectious diseases, providing a way to initiate antiviral development immediately upon identifying novel viruses.

  15. Bat flight and zoonotic viruses

    Science.gov (United States)

    O'Shea, Thomas J.; Cryan, Paul M.; Cunningham, Andrew A.; Fooks, Anthony R.; Hayman, David T.S.; Luis, Angela D.; Peel, Alison J.; Plowright, Raina K.; Wood, James L.N.

    2014-01-01

    Bats are sources of high viral diversity and high-profile zoonotic viruses worldwide. Although apparently not pathogenic in their reservoir hosts, some viruses from bats severely affect other mammals, including humans. Examples include severe acute respiratory syndrome coronaviruses, Ebola and Marburg viruses, and Nipah and Hendra viruses. Factors underlying high viral diversity in bats are the subject of speculation. We hypothesize that flight, a factor common to all bats but to no other mammals, provides an intensive selective force for coexistence with viral parasites through a daily cycle that elevates metabolism and body temperature analogous to the febrile response in other mammals. On an evolutionary scale, this host–virus interaction might have resulted in the large diversity of zoonotic viruses in bats, possibly through bat viruses adapting to be more tolerant of the fever response and less virulent to their natural hosts.

  16. Structure and dynamics of Ebola virus matrix protein VP40 by a coarse-grained Monte Carlo simulation

    Science.gov (United States)

    Pandey, Ras; Farmer, Barry

    Ebola virus matrix protein VP40 (consisting of 326 residues) plays a critical role in viral assembly and its functions such as regulation of viral transcription, packaging, and budding of mature virions into the plasma membrane of infected cells. How does the protein VP40 go through structural evolution during the viral life cycle remains an open question? Using a coarse-grained Monte Carlo simulation we investigate the structural evolution of VP40 as a function of temperature with the input of a knowledge-based residue-residue interaction. A number local and global physical quantities (e.g. mobility profile, contact map, radius of gyration, structure factor) are analyzed with our large-scale simulations. Our preliminary data show that the structure of the protein evolves through different state with well-defined morphologies which can be identified and quantified via a detailed analysis of structure factor.

  17. A Novel Subnucleocapsid Nanoplatform for Mucosal Vaccination against Influenza Virus That Targets the Ectodomain of Matrix Protein 2

    Science.gov (United States)

    Hervé, Pierre-Louis; Raliou, Mariam; Bourdieu, Christiane; Dubuquoy, Catherine; Petit-Camurdan, Agnès; Bertho, Nicolas; Eléouët, Jean-François

    2014-01-01

    In this study, subnucleocapsid nanorings formed by the recombinant nucleoprotein (N) of the respiratory syncytial virus were evaluated as a platform to anchor heterologous antigens. The ectodomain of the influenza virus A matrix protein 2 (M2e) is highly conserved and elicits protective antibodies when it is linked to an immunogenic carrier, making it a promising target to develop universal influenza vaccines. In this context, one or three M2e copies were genetically linked to the C terminus of N to produce N-M2e and N-3M2e chimeric recombinant nanorings. Mice were immunized intranasally with N-M2e or N-3M2e or with M2e or 3M2e control peptides. N-3M2e-vaccinated mice showed the strongest mucosal and systemic antibody responses. These mice presented a reduced viral load and minor weight loss, and all survived upon challenge with influenza virus A/PR8/34 (H1N1) (PR8). We compared the intranasal route to the subcutaneous route of N-3M2e immunization. Only the intranasal route induced a strong local IgA response and led to the protection of mice upon challenge. Finally, we demonstrated that the induction of anti-M2e antibodies by N-3M2e is not impaired by preexisting anti-N immunity. Overall, these results show that the N nanoring is a potent carrier for mucosal delivery of vaccinal antigens. PMID:24155388

  18. Virus inactivation by salt (NaCl) and phosphate supplemented salt in a 3D collagen matrix model for natural sausage casings.

    Science.gov (United States)

    Wieringa-Jelsma, Tinka; Wijnker, Joris J; Zijlstra-Willems, Esther M; Dekker, Aldo; Stockhofe-Zurwieden, Norbert; Maas, Riks; Wisselink, Henk J

    2011-08-02

    Due to possible presence and spread of contagious animal viruses via natural sausage casings the international trade in these food products is subject to veterinary and public health requirements. In order to manage these restrictions we determined the effect of casing preservation on four highly contagious viruses for livestock: foot-and-mouth-disease virus (FMDV), classical swine fever virus (CSFV), swine vesicular disease virus (SVDV) and African swine fever virus (ASFV). We used an in vitro 3D collagen matrix model in which cells, infected with the four different viruses were embedded in a bovine collagen type I gel matrix and treated with either saturated salt (NaCl) or phosphate supplemented saturated salt at four different temperatures (4, 12, 20 and 25 °C) during a period of 30 days. The results showed that all viruses were faster inactivated at higher temperatures, but that stability of the various viruses at 4 °C differed. Inactivation of FMDV in the 3D collagen matrix model showed a clear temperature and treatment effect on the reduction of FMDV titres. At 4 and 12 °C phosphate supplemented salt showed a very strong FMDV inactivation during the first hour of incubation. Salt (NaCl) only had a minor effect on FMDV inactivation. Phosphate supplemented salt treatment increased the effect temperature had on inactivation of CSFV. In contrast, the salt (NaCl) treatment only increased CSFV inactivation at the higher temperatures (20 °C and 25 °C). Also SVDV inactivation was increased by phosphate supplemented salt, but salt (NaCl) treatment only resulted in a significant decrease of SVDV titre at a few time points. The ASFV results showed that both salt (NaCl) and phosphate supplemented salt were capable to inactivate ASFV within 48 h. In contrast to the other viruses (FMDV, CSFV and SVDV), ASFV was the most stable virus even at higher temperatures. The results obtained in this in vitro model underline the efficacy of a combined treatment using phosphate

  19. Host cell recognition by the henipaviruses: Crystal structures of the Nipah G attachment glycoprotein and its complex with ephrin-B3

    Energy Technology Data Exchange (ETDEWEB)

    Xu, Kai; Rajashankar, Kanagalaghatta R.; Chan, Yee-Peng; Himanen, Juha P.; Broder, Christopher C.; Nikolov, Dimitar B. (USUHS); (Cornell); (MSKCC)

    2008-07-28

    Nipah virus (NiV) and Hendra virus are the type species of the highly pathogenic paramyxovirus genus Henipavirus, which can cause severe respiratory disease and fatal encephalitis infections in humans, with case fatality rates approaching 75%. NiV contains two envelope glycoproteins, the receptor-binding G glycoprotein (NiV-G) that facilitates attachment to host cells and the fusion (F) glycoprotein that mediates membrane merger. The henipavirus G glycoproteins lack both hemagglutinating and neuraminidase activities and, instead, engage the highly conserved ephrin-B2 and ephrin-B3 cell surface proteins as their entry receptors. Here, we report the crystal structures of the NiV-G both in its receptor-unbound state and in complex with ephrin-B3, providing, to our knowledge, the first view of a paramyxovirus attachment complex in which a cellular protein is used as the virus receptor. Complex formation generates an extensive protein-protein interface around a protruding ephrin loop, which is inserted in the central cavity of the NiV-G {beta}-propeller. Analysis of the structural data reveals the molecular basis for the highly specific interactions of the henipavirus G glycoproteins with only two members (ephrin-B2 and ephrin-B3) of the very large ephrin family and suggests how they mediate in a unique fashion both cell attachment and the initiation of membrane fusion during the virus infection processes. The structures further suggest that the NiV-G/ephrin interactions can be effectively targeted to disrupt viral entry and provide the foundation for structure-based antiviral drug design.

  20. Studies on Nanoparticle Based Avian Influenza Vaccines to Present Immunogenic Epitopes of the Virus with Concentration on Ectodomain of Matrix 2 (M2e) Protein

    Science.gov (United States)

    Babapoor Dighaleh, Sankhiros

    2011-12-01

    Avian influenza is an infectious disease of avian species caused by type A influenza viruses with a significant economic impact on the poultry industry. Vaccination is the main prevention strategy in many countries worldwide. However, available vaccines elicit antibodies against two major surface protein of the virus hemagglutinin (HA) and neuraminidase (NA), where they constantly change by point mutations. Influenza viruses can also easily undergo gene reassortment. Therefore, to protect chickens against new strain of avian influenza virus, as well as control and prevent virus spread among farms, new vaccines needed to be designed which is a tedious, time consuming and expensive. Recently, conserved regions of the influenza genome have been evaluated as possible universal vaccines to eliminate constant vaccine updates based on circulating virus. In this study, peptide nanotechnology was used to generate vaccine nanoparticles that carry the highly conserved external domain of matrix 2 protein (M2e). These nanoparticles presented M2e in monomeric or tetrameric forms, designated as PSC-M2e-CH and BNSC-M2eN-CH. respectively. First, to demonstrate immunogenicity of these nanoparticles, we measured anti-M2e antibody in chickens, particularly when a high dose was applied. Prior to vaccination-challenge study, the challenge dose were determined by oculonasal inoculation of 10 6 EID50 or 107.7 EID50 of low pathogenicity AI virus HSN2 followed by measuring cloacal and tracheal virus shedding. A biphasic virus shedding pattern was observed with two peaks of virus shedding at days 4 and 8 for both tracheal and cloacal swabs. The chickens infected with 107.7 EID50 had significant virus shedding as compared with 106 EID50. Based on results of mentioned studies, a vaccination-challenge study was conducted by using 75mug of each vaccine construct per inoculation (with and without adjuvant) and higher dose of virus for challenge. BN5C-M2e-CH with adjuvant significantly reduced the

  1. Safety and serological response to a matrix gene-deleted rabies virus-based vaccine vector in dogs.

    Science.gov (United States)

    McGettigan, James P; David, Frederic; Figueiredo, Monica Dias; Minke, Jules; Mebatsion, Teshome; Schnell, Matthias J

    2014-03-26

    Dogs account for the majority of human exposures and deaths due to rabies virus (RABV) worldwide. In this report, we show that a replication-deficient RABV-based vaccine in which the matrix gene is deleted (RABV-ΔM) is safe and induces rapid and potent VNA titers after a single inoculation in dogs. Average VNA titers peaked at 3.02 or 5.11 international units (IU/ml) by 14 days post-immunization with a single dose of 10(6) or 10(7) focus forming units (ffu), respectively, of RABV-ΔM. By day 70 post immunization, all dogs immunized with either dose of vaccine showed VNA titers >0.5IU/ml, the level indicative of a satisfactory immunization. Importantly, no systemic or local reactions were noted in any dog immunized with RABV-ΔM. The elimination of dog rabies through mass vaccination is hindered by limited resources, requirement for repeat vaccinations often for the life of a dog, and in some parts of the world, inferior vaccine quality. Our preliminary safety and immunogenicity data in dogs suggest that RABV-ΔM might complement currently used inactivated RABV-based vaccines in vaccination campaigns by helping to obtain 100% response in vaccinated dogs, thereby increasing overall vaccination coverage. Copyright © 2014 Elsevier Ltd. All rights reserved.

  2. Application of green fluorescent protein-labeled assay for the study of subcellular localization of Newcastle disease virus matrix protein.

    Science.gov (United States)

    Duan, Zhiqiang; Li, Qunhui; He, Liang; Zhao, Guo; Chen, Jian; Hu, Shunlin; Liu, Xiufan

    2013-12-01

    Green fluorescent protein (GFP) used as a powerful marker of gene expression in vivo has so far been applied widely in studying the localizations and functions of protein in living cells. In this study, GFP-labeled assay was used to investigate the subcellular localization of matrix (M) protein of different virulence and genotype Newcastle disease virus (NDV) strains. The M protein of ten NDV strains fused with GFP (GFP-M) all showed nuclear-and-nucleolar localization throughout transfection, whereas that of the other two strains were observed in the nucleus and nucleolus early in transfection but in the cytoplasm late in transfection. In addition, mutations to the previously defined nuclear localization signal in the GFP-M fusion protein were studied as well. Single changes at positions 262 and 263 did not affect nuclear localization of M, while changing both of these arginine residues to asparagine caused re-localization of M mainly to the cytoplasm. The GFP-M was validated as a suitable system for studying the subcellular localization of M protein and could be used to assist us in further identifying the signal sequences responsible for the nucleolar localization and cytoplasmic localization of M protein. Copyright © 2013 Elsevier B.V. All rights reserved.

  3. Safety and Serological Response to a Matrix Gene-deleted Rabies Virus-based Vaccine Vector in Dogs

    Science.gov (United States)

    McGettigan, James P.; David, Frederic; Figueiredo, Monica Dias; Minke, Jules; Mebatsion, Teshome; Schnell, Matthias J.

    2014-01-01

    Dogs account for the majority of human exposures and deaths due to rabies virus (RABV) worldwide. In this report, we show that a replication-deficient RABV-based vaccine in which the matrix gene is deleted (RABV- M) is safe and induces rapid and potent VNA titers after a single inoculation in dogs. Average VNA titers peaked at 3.02 or 5.11 International Units (IU/ml) by 14 days post-immunization with a single dose of 106 or 107 focus forming units (ffu), respectively, of RABV- M. By day 70 post immunization, all dogs immunized with either dose of vaccine showed VNA titers >0.5 IU/ml, the level indicative of a satisfactory immunization. Importantly, no systemic or local reactions were noted in any dog immunized with RABV- M. The elimination of dog rabies through mass vaccination is hindered by limited resources, requirement for repeat vaccinations often for the life of a dog, and in some parts of the world, inferior vaccine quality. Our preliminary safety and immunogenicity data in dogs suggest that RABV- M might complement currently used inactivated RABV-based vaccines in vaccination campaigns by helping to obtain 100% response in vaccinated dogs, thereby increasing overall vaccination coverage. PMID:24508037

  4. Matrix protein of vesicular stomatitis virus: a potent inhibitor of vascular endothelial growth factor and malignant ascites formation.

    Science.gov (United States)

    Zhou, Y; Wen, F; Zhang, P; Tang, R; Li, Q

    2013-03-01

    Malignant ascites is common in various types of cancers and is difficult to manage. Vascular endothelial growth factor (VEGF) has a pivotal role in malignant ascites. The matrix protein of vesicular stomatitis virus (VSVMP) has been shown to inhibit host gene expression and induce the apoptosis of cancer cells. The present study was designed to determine whether VSVMP suppresses the formation of ascites in ascites-producing peritoneal carcinomatosis. BALB/c female mice, 6-8 weeks old, bearing peritoneal tumors of H22 or MethA cells received an intraperitoneal administration of 50 μg VSVMP/250 μg liposome complexes, 50 μg empty plasmid/250 μg liposome complexes or 0.9% NaCl solution, respectively, every 2 days for 3 weeks. Administration of VSVMP resulted in a significant inhibition in ascites formation, improvement in health condition and prolonged survival of the treated mice. Decreased peritoneum osmolarity and reduced tumor vascularity coincided with dramatic reductions in the VEGF level in ascites fluid and plasma. Examination of floating tumor cells collected from the peritoneal wash revealed an apparently increased number of apoptotic cells and profound downregulation of VEGF mRNA in the VSVMP-treated mice. Our data indicate for the first time that in BALB/c mice bearing H22 or MethA cell peritoneal tumors, VSVMP may inhibit VEGF production and suppress angiogenesis, consequently abolishing ascites formation.

  5. The glycoprotein and the matrix protein of rabies virus affect pathogenicity by regulating viral replication and facilitating cell-to-cell spread.

    Science.gov (United States)

    Pulmanausahakul, Rojjanaporn; Li, Jianwei; Schnell, Matthias J; Dietzschold, Bernhard

    2008-03-01

    While the glycoprotein (G) of rabies virus (RV) is known to play a predominant role in the pathogenesis of rabies, the function of the RV matrix protein (M) in RV pathogenicity is not completely clear. To further investigate the roles of these proteins in viral pathogenicity, we constructed chimeric recombinant viruses by exchanging the G and M genes of the attenuated SN strain with those of the highly pathogenic SB strain. Infection of mice with these chimeric viruses revealed a significant increase in the pathogenicity of the SN strain bearing the RV G from the pathogenic SB strain. Moreover, the pathogenicity was further increased when both G and M from SB were introduced into SN. Interestingly, the replacement of the G or M gene or both in SN by the corresponding genes of SB was associated with a significant decrease in the rate of viral replication and viral RNA synthesis. In addition, a chimeric SN virus bearing both the M and G genes from SB exhibited more efficient cell-to-cell spread than a chimeric SN virus in which only the G gene was replaced. Together, these data indicate that both G and M play an important role in RV pathogenesis by regulating virus replication and facilitating cell-to-cell spread.

  6. The Glycoprotein and the Matrix Protein of Rabies Virus Affect Pathogenicity by Regulating Viral Replication and Facilitating Cell-to-Cell Spread▿

    Science.gov (United States)

    Pulmanausahakul, Rojjanaporn; Li, Jianwei; Schnell, Matthias J.; Dietzschold, Bernhard

    2008-01-01

    While the glycoprotein (G) of rabies virus (RV) is known to play a predominant role in the pathogenesis of rabies, the function of the RV matrix protein (M) in RV pathogenicity is not completely clear. To further investigate the roles of these proteins in viral pathogenicity, we constructed chimeric recombinant viruses by exchanging the G and M genes of the attenuated SN strain with those of the highly pathogenic SB strain. Infection of mice with these chimeric viruses revealed a significant increase in the pathogenicity of the SN strain bearing the RV G from the pathogenic SB strain. Moreover, the pathogenicity was further increased when both G and M from SB were introduced into SN. Interestingly, the replacement of the G or M gene or both in SN by the corresponding genes of SB was associated with a significant decrease in the rate of viral replication and viral RNA synthesis. In addition, a chimeric SN virus bearing both the M and G genes from SB exhibited more efficient cell-to-cell spread than a chimeric SN virus in which only the G gene was replaced. Together, these data indicate that both G and M play an important role in RV pathogenesis by regulating virus replication and facilitating cell-to-cell spread. PMID:18094173

  7. A nuclear localization signal in the matrix of spleen necrosis virus (SNV) does not allow efficient gene transfer into quiescent cells with SNV-derived vectors.

    Science.gov (United States)

    Caron, Marie-Christine; Caruso, Manuel

    2005-08-01

    A major limitation in gene therapy for vectors derived from Moloney murine leukemia virus (MLV) is that they only deliver genes into dividing cells. In this study, a careful comparison of spleen necrosis virus (SNV)-derived vectors with MLV and human immunodeficiency virus (HIV)-1 retroviral vectors indicated that SNV vectors can deliver genes 4-fold more efficiently than MLV vectors into aphidicolin-arrested cells, although at a 25-fold lower efficiency than HIV-1-derived vectors. Furthermore, the addition of a NLS in the SNV matrix (MA) that mimics the one located in HIV-1 MA did not increase the ability of SNV vectors to transfer genes into arrested cells. Also, we found that the RD114 envelope was able to pseudotype SNV viral particles in a very efficient manner.

  8. Application of Multiplex PCR Coupled with Matrix-Assisted Laser Desorption Ionization-Time of Flight Analysis for Simultaneous Detection of 21 Common Respiratory Viruses.

    Science.gov (United States)

    Zhang, Chi; Xiao, Yan; Du, Jiang; Ren, Lili; Wang, Jianwei; Peng, Junping; Jin, Qi

    2015-08-01

    Respiratory infections continue to pose a significant threat to human health. It is important to accurately and rapidly detect respiratory viruses. To compensate for the limits of current respiratory virus detection methods, we developed a 24-plex analysis (common respiratory virus-mass spectrometry [CRV-MS]) that can simultaneously detect and identify 21 common respiratory viruses based on a matrix-assisted laser desorption ionization-time of flight (MALDI-TOF) mass spectrometry system. To evaluate the efficacy of the CRV-MS method, we used 102 samples that were confirmed positive for these common respiratory viruses. All tests using the CRV-MS method were effective, with no cross-reactivity observed with other common respiratory viruses. To confirm the usefulness of the CRV-MS method, we screened 336 nasal and throat swabs that were collected from adults or children with suspected viral acute respiratory tract infections using the CRV-MS method and consensus PCR/reverse transcription-PCR (RT-PCR) methods. Excluding four RNase P-negative samples, the CRV-MS and consensus PCR/RT-PCR methods detected respiratory viruses in 92.5% (307/332) and 89.5% (297/332) of the samples, respectively. The two methods yielded identical results for 306 (92.2%) samples, including negative results for 25 samples (7.5%) and positive results for 281 samples (84.6%). Differences between the two methods may reflect their different sensitivities. The CRV-MS method proved to be sensitive and robust, and it can be used in large-scale epidemiological studies of common respiratory virus infections. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  9. Complexes of vesicular stomatitis virus matrix protein with host Rae1 and Nup98 involved in inhibition of host transcription.

    Science.gov (United States)

    Rajani, Karishma R; Pettit Kneller, Elizabeth L; McKenzie, Margie O; Horita, David A; Chou, Jeff W; Lyles, Douglas S

    2012-09-01

    Vesicular stomatitis virus (VSV) suppresses antiviral responses in infected cells by inhibiting host gene expression at multiple levels, including transcription, nuclear cytoplasmic transport, and translation. The inhibition of host gene expression is due to the activity of the viral matrix (M) protein. Previous studies have shown that M protein interacts with host proteins Rae1 and Nup98 that have been implicated in regulating nuclear-cytoplasmic transport. However, Rae1 function is not essential for host mRNA transport, raising the question of how interaction of a viral protein with a host protein that is not essential for gene expression causes a global inhibition at multiple levels. We tested the hypothesis that there may be multiple M protein-Rae1 complexes involved in inhibiting host gene expression at multiple levels. Using size exclusion chromatography and sedimentation velocity analysis, it was determined that Rae1 exists in high, intermediate, and low molecular weight complexes. The intermediate molecular weight complexes containing Nup98 interacted most efficiently with M protein. The low molecular weight form also interacted with M protein in cells that overexpress Rae1 or cells in which Nup98 expression was silenced. Silencing Rae1 expression had little if any effect on nuclear accumulation of host mRNA in VSV-infected cells, nor did it affect VSV's ability to inhibit host translation. Instead, silencing Rae1 expression reduced the ability of VSV to inhibit host transcription. M protein interacted efficiently with Rae1-Nup98 complexes associated with the chromatin fraction of host nuclei, consistent with an effect on host transcription. These results support the idea that M protein-Rae1 complexes serve as platforms to promote the interaction of M protein with other factors involved in host transcription. They also support the idea that Rae1-Nup98 complexes play a previously under-appreciated role in regulation of transcription.

  10. Complexes of vesicular stomatitis virus matrix protein with host Rae1 and Nup98 involved in inhibition of host transcription.

    Directory of Open Access Journals (Sweden)

    Karishma R Rajani

    2012-09-01

    Full Text Available Vesicular stomatitis virus (VSV suppresses antiviral responses in infected cells by inhibiting host gene expression at multiple levels, including transcription, nuclear cytoplasmic transport, and translation. The inhibition of host gene expression is due to the activity of the viral matrix (M protein. Previous studies have shown that M protein interacts with host proteins Rae1 and Nup98 that have been implicated in regulating nuclear-cytoplasmic transport. However, Rae1 function is not essential for host mRNA transport, raising the question of how interaction of a viral protein with a host protein that is not essential for gene expression causes a global inhibition at multiple levels. We tested the hypothesis that there may be multiple M protein-Rae1 complexes involved in inhibiting host gene expression at multiple levels. Using size exclusion chromatography and sedimentation velocity analysis, it was determined that Rae1 exists in high, intermediate, and low molecular weight complexes. The intermediate molecular weight complexes containing Nup98 interacted most efficiently with M protein. The low molecular weight form also interacted with M protein in cells that overexpress Rae1 or cells in which Nup98 expression was silenced. Silencing Rae1 expression had little if any effect on nuclear accumulation of host mRNA in VSV-infected cells, nor did it affect VSV's ability to inhibit host translation. Instead, silencing Rae1 expression reduced the ability of VSV to inhibit host transcription. M protein interacted efficiently with Rae1-Nup98 complexes associated with the chromatin fraction of host nuclei, consistent with an effect on host transcription. These results support the idea that M protein-Rae1 complexes serve as platforms to promote the interaction of M protein with other factors involved in host transcription. They also support the idea that Rae1-Nup98 complexes play a previously under-appreciated role in regulation of transcription.

  11. Infectious pancreatic necrosis virus infection of fish cell lines: Preliminary analysis of gene expressions related to extracellular matrix remodeling and immunity.

    Science.gov (United States)

    Villalba, Melina; Pérez, Valeria; Herrera, Laura; Stepke, Cristopher; Maldonado, Nicolas; Fredericksen, Fernanda; Yáñez, Alejandro; Olavarría, Víctor H

    2017-12-01

    The pathogenic infectious pancreatic necrosis virus (IPNV) causes high economic losses in fish farming. This virus can modulate several cellular processes during infection, but little is known about the infection mechanism. To investigate gene activation in response to IPNV, CHSE/F and SHK-1 cell line were infected with a cytopathic Sp field isolate of IPNV, and the expression profiles of proinflammatory, antiviral cytokine, and extracellular matrix markers were analyzed. IPNV induced the production of perlecan, fibulin-1, matrix metalloproteinase-2, 14-3-3β, interleukin-1β, Mx1, and interferon regulatory factors-1, -3, and -9. Interestingly, IPNV-mediated activity was blocked by pharmacological inhibitors of the NF-κB signaling pathway. These results, together with in silico analyses showing the presence of several regulatory consensus-target motifs, suggest that IPNV regulates gene expressions in fish through the activation of several key transcription factors. Collectively, these data indicate that IPNV is a viral regulator of expression for extracellular-matrix and immune markers, even during early infection. Finally, this is the first report in fish to find IPNV modulating the activation of interleukin-1β production primarily through the NF-κB pathway. Copyright © 2017 Elsevier B.V. All rights reserved.

  12. Amphipathic alpha-helices and putative cholesterol binding domains of the influenza virus matrix M1 protein are crucial for virion structure organisation.

    Science.gov (United States)

    Tsfasman, Tatyana; Kost, Vladimir; Markushin, Stanislav; Lotte, Vera; Koptiaeva, Irina; Bogacheva, Elena; Baratova, Ludmila; Radyukhin, Victor

    2015-12-02

    The influenza virus matrix M1 protein is an amphitropic membrane-associated protein, forming the matrix layer immediately beneath the virus raft membrane, thereby ensuring the proper structure of the influenza virion. The objective of this study was to elucidate M1 fine structural characteristics, which determine amphitropic properties and raft membrane activities of the protein, via 3D in silico modelling with subsequent mutational analysis. Computer simulations suggest the amphipathic nature of the M1 α-helices and the existence of putative cholesterol binding (CRAC) motifs on six amphipathic α-helices. Our finding explains for the first time many features of this protein, particularly the amphitropic properties and raft/cholesterol binding potential. To verify these results, we generated mutants of the A/WSN/33 strain via reverse genetics. The M1 mutations included F32Y in the CRAC of α-helix 2, W45Y and W45F in the CRAC of α-helix 3, Y100S in the CRAC of α-helix 6, M128A and M128S in the CRAC of α-helix 8 and a double L103I/L130I mutation in both a putative cholesterol consensus motif and the nuclear localisation signal. All mutations resulted in viruses with unusual filamentous morphology. Previous experimental data regarding the morphology of M1-gene mutant influenza viruses can now be explained in structural terms and are consistent with the pivotal role of the CRAC-domains and amphipathic α-helices in M1-lipid interactions. Copyright © 2015 Elsevier B.V. All rights reserved.

  13. Comparison of Shear Strength Properties for Undisturbed and Reconstituted Parit Nipah Peat, Johor

    Science.gov (United States)

    Azhar, A. T. S.; Norhaliza, W.; Ismail, B.; Abdullah, M. E.; Zakaria, M. N.

    2016-11-01

    Shear strength of soil is required to determine the soil stability and design the foundations. Peat is known as a soil with complex natural formations which also contributes problems to the researchers, developers, engineers and contractors in constructions and infrastructures. Most researchers conducted experiment and investigation of shear strength on peat using shear box test and simple shear test, but only a few had discovered the behavior of peat using triaxial consolidated undrained test. The aim of this paper is to determine the undrained shear strength properties of reconstituted peat and undisturbed peat of Parit Nipah, Johor for comparison purposes. All the reconstituted peat samples were formed with the size that passed opening sieve 3.35 mm and preconsolidation pressure at 100 kPa. The result of undrained shear strength of reconstituted peat was 21kPa for cohesion with the angle of friction, 41° compare to the undisturbed peat with cohesion 10 kPa and angle of friction, 16°. The undrained shear strength properties result obtained shows that the reconstituted peat has higher strength than undisturbed peat. For relationship deviator stress-strain, σd max and excess pore pressure, Δu, it shows that both of undisturbed and reconstituted gradually increased when σ’ increased, but at the end of the test, the values are slightly dropped. The physical properties of undisturbed and reconstituted peat were also investigated to correlate with the undrained shear strength results.

  14. Involvement of an Arginine Triplet in M1 Matrix Protein Interaction with Membranes and in M1 Recruitment into Virus-Like Particles of the Influenza A(H1N1pdm09 Virus.

    Directory of Open Access Journals (Sweden)

    Adeline Kerviel

    Full Text Available The influenza A(H1N1pdm09 virus caused the first influenza pandemic of the 21st century. In this study, we wanted to decipher the role of conserved basic residues of the viral M1 matrix protein in virus assembly and release. M1 plays many roles in the influenza virus replication cycle. Specifically, it participates in viral particle assembly, can associate with the viral ribonucleoprotein complexes and can bind to the cell plasma membrane and/or the cytoplasmic tail of viral transmembrane proteins. M1 contains an N-terminal domain of 164 amino acids with two basic domains: the nuclear localization signal on helix 6 and an arginine triplet (R76/77/78 on helix 5. To investigate the role of these two M1 basic domains in influenza A(H1N1pdm09 virus molecular assembly, we analyzed M1 attachment to membranes, virus-like particle (VLP production and virus infectivity. In vitro, M1 binding to large unilamellar vesicles (LUVs, which contain negatively charged lipids, decreased significantly when the M1 R76/77/78 motif was mutated. In cells, M1 alone was mainly observed in the nucleus (47% and in the cytosol (42%. Conversely, when co-expressed with the viral proteins NS1/NEP and M2, M1 was relocated to the cell membranes (55%, as shown by subcellular fractionation experiments. This minimal system allowed the production of M1 containing-VLPs. However, M1 with mutations in the arginine triplet accumulated in intracellular clusters and its incorporation in VLPs was strongly diminished. M2 over-expression was essential for M1 membrane localization and VLP production, whereas the viral trans-membrane proteins HA and NA seemed dispensable. These results suggest that the M1 arginine triplet participates in M1 interaction with membranes. This R76/77/78 motif is essential for M1 incorporation in virus particles and the importance of this motif was confirmed by reverse genetic demonstrating that its mutation is lethal for the virus. These results highlight the

  15. Human immunodeficiency virus type 1 KK26-27 matrix mutants display impaired infectivity, circularization and integration but not nuclear import

    International Nuclear Information System (INIS)

    Mannioui, Abdelkrim; Nelson, Elisabeth; Schiffer, Cecile

    2005-01-01

    We analyzed the role of human immunodeficiency virus (HIV)-1 matrix protein (MA) during the virus replication afferent phase. Single-round infection of H9 T lymphocytes showed that the combined mutation of MA Lys residues 26-27 in MA reported nuclear localization signal (NLS)-1 [Haffar, O.K., Popov, S., Dubrovsky, L., Agostini, I., Tang, H., Pushkarsky, T., Nadler, S.G., Bukrinsky, M., 2000. Two nuclear localization signals in the HIV-1 matrix protein regulate nuclear import of the HIV-1 pre-integration complex. J. Mol. Biol. 299 (2): 359-368] impaired infectivity, abrogated 2-LTR-circle formation and significantly reduced integration. However, the mutation did not affect viral DNA docking to chromatin in either interphasic or mitotic cells, indicating that MA N-terminal basic domain should not represent a major determinant of HIV-1 nuclear import in T lymphocytes. These data point to a previously unreported role of MA in the late, post-chromatin-binding, afferent phase of HIV-1 replication cycle

  16. Assembly of Ebola virus matrix protein VP40 is regulated by latch-like properties of N and C terminal tails.

    Directory of Open Access Journals (Sweden)

    Leslie P Silva

    Full Text Available The matrix protein VP40 coordinates numerous functions in the viral life cycle of the Ebola virus. These range from the regulation of viral transcription to morphogenesis, packaging and budding of mature virions. Similar to the matrix proteins of other nonsegmented, negative-strand RNA viruses, VP40 proceeds through intermediate states of assembly (e.g. octamers but it remains unclear how these intermediates are coordinated with the various stages of the life cycle. In this study, we investigate the molecular basis of synchronization as governed by VP40. Hydrogen/deuterium exchange mass spectrometry was used to follow induced structural and conformational changes in VP40. Together with computational modeling, we demonstrate that both extreme N and C terminal tail regions stabilize the monomeric state through a direct association. The tails appear to function as a latch, released upon a specific molecular trigger such as RNA ligation. We propose that triggered release of the tails permits the coordination of late-stage events in the viral life cycle, at the inner membrane of the host cell. Specifically, N-tail release exposes the L-domain motifs PTAP/PPEY to the transport and budding complexes, whereas triggered C-tail release could improve association with the site of budding.

  17. Pengaruh Konsentrasi Asam Sitrat dan Suhu Pengempaan terhadap Kualitas Papan Partikel Pelepah Nipah

    Directory of Open Access Journals (Sweden)

    Ragil Widyorini

    2014-01-01

    Full Text Available Papan partikel tanpa perekat sintesis atau binderlessboard merupakan alternatif produk ramah lingkungan yang potensial dikembangkan di Indonesia. Kelemahan produk tersebut diantaranya adalah kestabilan dimensinya yang relatif rendah. Alternatif perbaikan produk bisa dilakukan dengan menambahkan bahan pengaktif komponen kimia. Asam sitrat memiliki tiga gugus karboksil dan diharapkan dapat membentuk ikatan ester dengan gugus hidroksil pada permukaan kayu. Penelitian menggunakan asam sitrat relatif baru dan belum banyak dikembangkan, oleh karena itu penelitian ini ditujukan untuk pengembangan produk biokomposit dengan menggunakan asam sitrat sebagai bahan pengikat. Bahan yang digunakan adalah pelepah nipah dengan ukuran partikel (halus dan kasar, konsentrasi asam sitrat (0% dan 10%, dan suhu pengempaan (180ºC dan 200°C. Pengujian sifat fisika dan mekanika dilakukan berdasarkan Japanese Industrial Standard untuk papan partikel (JIS A 5908. Penambahan asam sitrat memperlihatkan kenaikan sifat fisika (penyerapan air dan mekanika papan partikel. Perbedaan ukuran partikel mempengaruhi sifat mekanika papan partikel dimana ukuran partikel kasar memberikan nilai mekanika yang lebih baik dibandingkan dengan ukuran partikel halus. Kualitas papan partikel optimum diperoleh pada kondisi pengempaan 180ºC, penambahan asam sitrat 10% dari partikel ukuran kasar dengan nilai pengembangan tebal 2,4%, penyerapan air 41%, kekuatan rekat internal 0,2 MPa, modulus patah 5,5 MPa, dan modulus elastisitas 1,6 GPa. Kata kunci: asam sitrat, pelepah nipah, konsentrasi asam sitrat, suhu pengempa   Effect of Citric Acid Concentration and Pressing Temperature on the Quality of Particleboard from Nypa Frond Abstract Binderlessboard is one of the potential eco friendly products that can be developed in Indonesia. However, its boards usually have low in dimensional stability. Addition of the chemical agent, such as citric acid, that can improve the dimensional stability is

  18. Production of H5N1 influenza virus matrix protein 2 ectodomain protein bodies in tobacco plants and in insect cells as a candidate universal influenza vaccine

    Directory of Open Access Journals (Sweden)

    Sandiswa Mbewana

    2015-12-01

    Full Text Available The spread of influenza A viruses is partially controlled and prevented by vaccination. The matrix protein 2 ectodomain (M2e is the most conserved sequence in influenza A viruses, and is therefore a good potential target for a vaccine to protect against multiple virus subtypes. We explored the feasibility of a M2e-based universal influenza A vaccine candidate based on the highly pathogenic avian influenza A virus, H5N1. A synthetic M2e gene was human and plant codon optimised and fused in-frame with a sequence encoding the N-terminal proline-rich domain (Zera® of the γ-zein protein of maize. Zera®M2e was expressed transiently in Nicotiana benthamiana and Sf21 baculovirus / insect cell expression systems, and Zera®M2e protein bodies (PBs were successfully produced in both expression systems. The plant-produced Zera®M2e PBs were purified and injected into Balb/c mice. Western blot analysis using insect cell-produced Zera®M2e PBs and multiple tandem M2e sequences (5xM2e fused with the avian influenza H5N1 transmembrane and cytosolic tail (5xM2e_tHA confirmed the presence of M2e-specific antibodies in immunised mice sera. The immunogenicity of the Zera®M2e indicates that our plant-produced protein has potential as an inexpensive universal influenza A vaccine.

  19. Antioxidant and Atibacterial Activities of Nipah (Nypa fruticans against Vibrio sp. Isolated From Mud Crab (Scylla sp.

    Directory of Open Access Journals (Sweden)

    Imra Imra

    2016-12-01

    Full Text Available Nipah (Nypa fruticans is the potential plant for source of active compound such as antioksidant and antibacterial substances. The plants are dispersed in Sumatera, Kalimantan, Sulawesi, Maluku and Papua Island. The aim of this research were determine the antioxidant and antibacterial activity from of nipah (fruit and leaf that it extraction with methanol, and than determine toxicity and active compound contained in this extract. Diffusion agar and DPPH method were use for antibacterial and antioxsidant assay, respectively. Antioxsidant activity from nipah’s leaf extract was more effective (22,5 µg/mL than nipah’s fruit extract (415 µg/mL. This activity to be classified to the strong antioxidant activity (IC50<50 µg/mL. The antibacterial activity from leaf extract was strong to inhibited Vibrio sp. with inhibition zone 8,75 mm. The crude extract of nipah’s leaf was toxic with toxicity value is 663,598 µg/mL. Flavonoids, steroids, tanin, saponin and phenol hidroquinon were the active compounds contained in the extract of nipah’s leaf.

  20. Antioxidant and Atibacterial Activities of Nipah (Nypa fruticans against Vibrio sp. Isolated From Mud Crab (Scylla sp.

    Directory of Open Access Journals (Sweden)

    Imra Imra

    2017-02-01

    Full Text Available AbstractNipah (Nypa fruticans is the potential plant for source of active compound such as antioksidant and antibacterial substances. The plants are dispersed in Sumatera, Kalimantan, Sulawesi, Maluku and Papua Island. The aim of this research were determine the antioxidant and antibacterial activity from of nipah (fruit and leaf that it extraction with methanol, and than determine toxicity and active compound contained in this extract. Diffusion agar and DPPH method were use for antibacterial and antioxsidant assay, respectively. Antioxsidant activity from nipah’s leaf extract was more effective (22,5 μg/mL than nipah’s fruit extract (415 μg/mL. This activity to be classified to the strong antioxidant activity (IC50<50 μg/mL. The antibacterial activity from leaf extract was strong to inhibited Vibrio sp. with inhibition zone 8,75 mm. The crude extract of nipah’s leaf was toxic with toxicity value is 663,598 μg/mL. Flavonoids, steroids, tanin, saponin and phenol hidroquinon were the active compounds contained in the extract of nipah’s leaf.

  1. Ecological dynamics of emerging bat virus spillover

    Science.gov (United States)

    Plowright, Raina K.; Eby, Peggy; Hudson, Peter J.; Smith, Ina L.; Westcott, David; Bryden, Wayne L.; Middleton, Deborah; Reid, Peter A.; McFarlane, Rosemary A.; Martin, Gerardo; Tabor, Gary M.; Skerratt, Lee F.; Anderson, Dale L.; Crameri, Gary; Quammen, David; Jordan, David; Freeman, Paul; Wang, Lin-Fa; Epstein, Jonathan H.; Marsh, Glenn A.; Kung, Nina Y.; McCallum, Hamish

    2015-01-01

    Viruses that originate in bats may be the most notorious emerging zoonoses that spill over from wildlife into domestic animals and humans. Understanding how these infections filter through ecological systems to cause disease in humans is of profound importance to public health. Transmission of viruses from bats to humans requires a hierarchy of enabling conditions that connect the distribution of reservoir hosts, viral infection within these hosts, and exposure and susceptibility of recipient hosts. For many emerging bat viruses, spillover also requires viral shedding from bats, and survival of the virus in the environment. Focusing on Hendra virus, but also addressing Nipah virus, Ebola virus, Marburg virus and coronaviruses, we delineate this cross-species spillover dynamic from the within-host processes that drive virus excretion to land-use changes that increase interaction among species. We describe how land-use changes may affect co-occurrence and contact between bats and recipient hosts. Two hypotheses may explain temporal and spatial pulses of virus shedding in bat populations: episodic shedding from persistently infected bats or transient epidemics that occur as virus is transmitted among bat populations. Management of livestock also may affect the probability of exposure and disease. Interventions to decrease the probability of virus spillover can be implemented at multiple levels from targeting the reservoir host to managing recipient host exposure and susceptibility. PMID:25392474

  2. Structural defect linked to nonrandom mutations in the matrix gene of Biden strain subacute sclerosing panencephalitis virus defined by cDNA cloning and expression of chimeric genes

    International Nuclear Information System (INIS)

    Ayata, M.; Hirano, A.; Wong, T.C.

    1989-01-01

    Biken strain, a nonproductive measles viruslike agent isolated from a subacute sclerosing panencephalitis (SSPE) patient, contains a posttranscriptional defect affecting matrix (M) protein. A putative M protein was translated in vitro with RNA from Biken strain-infected cells. A similar protein was detected in vivo by an antiserum against a peptide synthesized from the cloned M gene of Edmonston strain measles virus. By using a novel method, full-length cDNAs of the Biken M gene were selectively cloned. The cloned Biken M gene contained an open reading frame which encoded 8 extra carboxy-terminal amino acid residues and 20 amino acid substitutions predicted to affect both the hydrophobicity and secondary structure of the gene product. The cloned gene was expressed in vitro and in vivo into a 37,500 M r protein electrophoretically and antigenically distinct from the M protein of Edmonston strain but identical to the M protein in Biken strain-infected cells. Chimeric M proteins synthesized in vitro and in vivo showed that the mutations in the carboxy-proximal region altered the local antigenicity and those in the amino region affected the overall protein conformation. The protein expressed from the Biken M gene was unstable in vivo. Instability was attributed to multiple mutations. These results offer insights into the basis of the defect in Biken strain and pose intriguing questions about the evolutionary origins of SSPE viruses in general

  3. Mutations in the Transmembrane Domain and Cytoplasmic Tail of Hendra Virus Fusion Protein Disrupt Virus-Like-Particle Assembly.

    Science.gov (United States)

    Cifuentes-Muñoz, Nicolás; Sun, Weina; Ray, Greeshma; Schmitt, Phuong Tieu; Webb, Stacy; Gibson, Kathleen; Dutch, Rebecca Ellis; Schmitt, Anthony P

    2017-07-15

    Hendra virus (HeV) is a zoonotic paramyxovirus that causes deadly illness in horses and humans. An intriguing feature of HeV is the utilization of endosomal protease for activation of the viral fusion protein (F). Here we investigated how endosomal F trafficking affects HeV assembly. We found that the HeV matrix (M) and F proteins each induced particle release when they were expressed alone but that their coexpression led to coordinated assembly of virus-like particles (VLPs) that were morphologically and physically distinct from M-only or F-only VLPs. Mutations to the F protein transmembrane domain or cytoplasmic tail that disrupted endocytic trafficking led to failure of F to function with M for VLP assembly. Wild-type F functioned normally for VLP assembly even when its cleavage was prevented with a cathepsin inhibitor, indicating that it is endocytic F trafficking that is important for VLP assembly, not proteolytic F cleavage. Under specific conditions of reduced M expression, we found that M could no longer induce significant VLP release but retained the ability to be incorporated as a passenger into F-driven VLPs, provided that the F protein was competent for endocytic trafficking. The F and M proteins were both found to traffic through Rab11-positive recycling endosomes (REs), suggesting a model in which F and M trafficking pathways converge at REs, enabling these proteins to preassemble before arriving at plasma membrane budding sites. IMPORTANCE Hendra virus and Nipah virus are zoonotic paramyxoviruses that cause lethal infections in humans. Unlike that for most paramyxoviruses, activation of the henipavirus fusion protein occurs in recycling endosomal compartments. In this study, we demonstrate that the unique endocytic trafficking pathway of Hendra virus F protein is required for proper viral assembly and particle release. These results advance our basic understanding of the henipavirus assembly process and provide a novel model for the interplay between

  4. Molecular and phylogenetic analysis of matrix gene of avian influenza viruses isolated from wild birds and live bird markets in the USA.

    Science.gov (United States)

    Chander, Yogesh; Jindal, Naresh; Sreevatsan, Srinand; Stallknecht, David E; Goyal, Sagar M

    2013-07-01

    Wild birds are the natural hosts for influenza A viruses (IAVs) and provide a niche for the maintenance of this virus. This study was undertaken to analyze nucleotide sequences of the matrix (M) gene of AIVs isolated from wild birds and live bird markets (LBMs) to index the changes occurring in this gene. M-gene of 229 avian influenza virus (AIV) isolates obtained from wild birds and LBMs was amplified and sequenced. Full-length sequences (∼900 nt.) thus obtained were analyzed to identify changes that may be associated with resistance to adamantanes. Phylogenetic analysis of all sequences was performed using clustalw, and evolutionary distances were calculated by maximum composite likelihood method using mega (ver. 5.0) software. Twenty-seven different viral subtypes were represented with H3N8 being the most dominant subtype in wild birds and H7N2 being the predominant subtype among isolates from LBMs. Phylogenetic analysis of the M-gene showed a high degree of nucleotide sequence identity with US isolates of AIVs but not with those of Asian or European lineages. While none of the isolates from wild birds had any antiviral resistance-associated mutations, 17 LBM isolates carried polymorphisms known to cause reduced susceptibility to antiviral drugs (adamantanes). Of these 17 isolates, 16 had S31N change and one isolate had V27A mutation. These results indicate independent evolution of M-gene in the absence of any antiviral drugs leading to mutations causing resistance indicating the need for continued active surveillance of AIVs. © 2012 John Wiley & Sons Ltd.

  5. The non-structural protein 5 and matrix protein are antigenic targets of T cell immunity to genotype 1 porcine reproductive and respiratory syndrome viruses

    Directory of Open Access Journals (Sweden)

    Helen eMokhtar

    2016-02-01

    Full Text Available The porcine reproductive and respiratory syndrome virus (PRRSV is the cause of one of the most economically important diseases affecting swine worldwide. Efforts to develop a next-generation vaccine have largely focussed on envelope glycoproteins to target virus-neutralising antibody responses. However, these approaches have failed to demonstrate the necessary efficacy to progress towards market. T cells are crucial to the control of many viruses through cytolysis and cytokine secretion. Since control of PRRSV infection is not dependent on the development of neutralising antibodies, it has been proposed that T cell mediated immunity plays a key role. We therefore hypothesised that conserved T cell antigens represent prime candidates for the development a novel PRRS vaccine. Antigens were identified by screening a proteome-wide synthetic peptide library with T cells from cohorts of pigs rendered immune by experimental infections with a closely-related (subtype 1 or divergent (subtype 3 PRRSV-1 strain. Dominant T cell IFN-γ responses were directed against the non-structural protein 5 (NSP5, and to a lesser extent, the matrix (M protein. The majority of NSP5-specific CD8 T cells and M-specific CD4 T cells expressed a putative effector memory phenotype and were polyfunctional as assessed by co-expression of TNF-α and mobilisation of the cytotoxic degranulation marker CD107a. Both antigens were generally well conserved amongst strains of both PRRSV genotypes. Thus M and NSP5 represent attractive vaccine candidate T cell antigens which should be evaluated further in the context of PRRSV vaccine development.

  6. Poliomyelitis in MuLV-infected ICR-SCID mice after injection of basement membrane matrix contaminated with lactate dehydrogenase-elevating virus.

    Science.gov (United States)

    Carlson Scholz, Jodi A; Garg, Rohit; Compton, Susan R; Allore, Heather G; Zeiss, Caroline J; Uchio, Edward M

    2011-10-01

    The arterivirus lactate dehydrogenase-elevating virus (LDV) causes life-long viremia in mice. Although LDV infection generally does not cause disease, infected mice that are homozygous for the Fv1(n) allele are prone to develop poliomyelitis when immunosuppressed, a condition known as age-dependent poliomyelitis. The development of age-dependent poliomyelitis requires coinfection with endogenous murine leukemia virus. Even though LDV is a common contaminant of transplantable tumors, clinical signs of poliomyelitis after inadvertent exposure to LDV have not been described in recent literature. In addition, LDV-induced poliomyelitis has not been reported in SCID or ICR mice. Here we describe the occurrence of poliomyelitis in ICR-SCID mice resulting from injection of LDV-contaminated basement membrane matrix. After exposure to LDV, a subset of mice presented with clinical signs including paresis, which was associated with atrophy of the hindlimb musculature, and tachypnea; in addition, some mice died suddenly with or without premonitory signs. Mice presenting within the first 6 mo after infection had regions of spongiosis, neuronal necrosis and astrocytosis of the ventral spinal cord, and less commonly, brainstem. Axonal degeneration of ventral roots prevailed in more chronically infected mice. LDV was identified by RT-PCR in 12 of 15 mice with typical neuropathology; positive antiLDV immunolabeling was identified in all PCR-positive animals (n = 7) tested. Three of 8 mice with neuropathology but no clinical signs were LDV negative by RT-PCR. RT-PCR yielded murine leukemia virus in spinal cords of all mice tested, regardless of clinical presentation or neuropathology.

  7. Mutations in matrix and SP1 repair the packaging specificity of a Human Immunodeficiency Virus Type 1 mutant by reducing the association of Gag with spliced viral RNA

    Directory of Open Access Journals (Sweden)

    Ristic Natalia

    2010-09-01

    Full Text Available Abstract Background The viral genome of HIV-1 contains several secondary structures that are important for regulating viral replication. The stem-loop 1 (SL1 sequence in the 5' untranslated region directs HIV-1 genomic RNA dimerization and packaging into the virion. Without SL1, HIV-1 cannot replicate in human T cell lines. The replication restriction phenotype in the SL1 deletion mutant appears to be multifactorial, with defects in viral RNA dimerization and packaging in producer cells as well as in reverse transcription of the viral RNA in infected cells. In this study, we sought to characterize SL1 mutant replication restrictions and provide insights into the underlying mechanisms of compensation in revertants. Results HIV-1 lacking SL1 (NLΔSL1 did not replicate in PM-1 cells until two independent non-synonymous mutations emerged: G913A in the matrix domain (E42K on day 18 postinfection and C1907T in the SP1 domain (P10L on day 11 postinfection. NLΔSL1 revertants carrying either compensatory mutation showed enhanced infectivity in PM-1 cells. The SL1 revertants produced significantly more infectious particles per nanogram of p24 than did NLΔSL1. The SL1 deletion mutant packaged less HIV-1 genomic RNA and more cellular RNA, particularly signal recognition particle RNA, in the virion than the wild-type. NLΔSL1 also packaged 3- to 4-fold more spliced HIV mRNA into the virion, potentially interfering with infectious virus production. In contrast, both revertants encapsidated 2.5- to 5-fold less of these HIV-1 mRNA species. Quantitative RT-PCR analysis of RNA cross-linked with Gag in formaldehyde-fixed cells demonstrated that the compensatory mutations reduced the association between Gag and spliced HIV-1 RNA, thereby effectively preventing these RNAs from being packaged into the virion. The reduction of spliced viral RNA in the virion may have a major role in facilitating infectious virus production, thus restoring the infectivity of NLΔSL1

  8. Importin α5 negatively regulates importin β1-mediated nuclear import of Newcastle disease virus matrix protein and viral replication and pathogenicity in chicken fibroblasts.

    Science.gov (United States)

    Duan, Zhiqiang; Xu, Haixu; Ji, Xinqin; Zhao, Jiafu; Xu, Houqiang; Hu, Yan; Deng, Shanshan; Hu, Shunlin; Liu, Xiufan

    2018-03-13

    The matrix (M) protein of Newcastle disease virus (NDV) is demonstrated to localize in the nucleus via intrinsic nuclear localization signal (NLS), but cellular proteins involved in the nuclear import of NDV M protein and the role of M's nuclear localization in the replication and pathogenicity of NDV remain unclear. In this study, importin β1 was screened to interact with NDV M protein by yeast two-hybrid screening. This interaction was subsequently confirmed by co-immunoprecipitation and pull-down assays. In vitro binding studies indicated that the NLS region of M protein and the amino acids 336-433 of importin β1 that belonged to the RanGTP binding region were important for binding. Importantly, a recombinant virus with M/NLS mutation resulted in a pathotype change of NDV and attenuated viral replication and pathogenicity in chicken fibroblasts and SPF chickens. In agreement with the binding data, nuclear import of NDV M protein in digitonin-permeabilized HeLa cells required both importin β1 and RanGTP. Interestingly, importin α5 was verified to interact with M protein through binding importin β1. However, importin β1 or importin α5 depletion by siRNA resulted in different results, which showed the obviously cytoplasmic or nuclear accumulation of M protein and the remarkably decreased or increased replication ability and pathogenicity of NDV in chicken fibroblasts, respectively. Our findings therefore demonstrate for the first time the nuclear import mechanism of NDV M protein and the negative regulation role of importin α5 in importin β1-mediated nuclear import of M protein and the replication and pathogenicity of a paramyxovirus.

  9. Immunohistochemical study on the expression of matrix metalloproteinase 2 and high-risk human papilloma virus in the malignant progression of papillomas.

    Science.gov (United States)

    Lee, Ho-Jin; Kim, Jin-Wook

    2013-10-01

    Papilloma frequently develops as a benign tumor of the head and neck area, but its potential for malignant transformation has yet to be studied. This study aims to provide basic information for papillomas using the immunohistochemical staining of matrix metalloproteinase 2 (MMP-2) and human papilloma virus (HPV) 16 and 18. To evaluate the malignant transformation of papillomas, the selected tissue samples were serially diagnosed with pre-cancerous papilloma (with epithelial dysplasia, pseudo-epitheliomatous hyperplasia) or malignant lesion (squamous cell carcinoma, SCC) after the first diagnosis (squamous papilloma, inverted papilloma). The selected tissues were stained with an antibody to MMP-2 and HPV 16-E7, HPV 18-L1. A statistical analysis was performed according to each transformation step. The epithelial layer of papilloma and pre-cancerous papilloma lesions had a similar MMP-2 expression, but that of the malignant lesion had a significantly increased MMP-2 expression. HPV 16 and 18 infection rates were 28.6%, 33.3% and 63.6% in papillomas, pre-cancerous papilloma lesions, and SCC. A relatively high MMP-2 expression and HPV 16 or 18 infection of papillomas may be associated with early events in the multistep processes of malignant transformation of papillomas.

  10. European Bats as Carriers of Viruses with Zoonotic Potential

    Directory of Open Access Journals (Sweden)

    Claudia Kohl

    2014-08-01

    Full Text Available Bats are being increasingly recognized as reservoir hosts of highly pathogenic and zoonotic emerging viruses (Marburg virus, Nipah virus, Hendra virus, Rabies virus, and coronaviruses. While numerous studies have focused on the mentioned highly human-pathogenic bat viruses in tropical regions, little is known on similar human-pathogenic viruses that may be present in European bats. Although novel viruses are being detected, their zoonotic potential remains unclear unless further studies are conducted. At present, it is assumed that the risk posed by bats to the general public is rather low. In this review, selected viruses detected and isolated in Europe are discussed from our point of view in regard to their human-pathogenic potential. All European bat species and their roosts are legally protected and some European species are even endangered. Nevertheless, the increasing public fear of bats and their viruses is an obstacle to their protection. Educating the public regarding bat lyssaviruses might result in reduced threats to both the public and the bats.

  11. European bats as carriers of viruses with zoonotic potential.

    Science.gov (United States)

    Kohl, Claudia; Kurth, Andreas

    2014-08-13

    Bats are being increasingly recognized as reservoir hosts of highly pathogenic and zoonotic emerging viruses (Marburg virus, Nipah virus, Hendra virus, Rabies virus, and coronaviruses). While numerous studies have focused on the mentioned highly human-pathogenic bat viruses in tropical regions, little is known on similar human-pathogenic viruses that may be present in European bats. Although novel viruses are being detected, their zoonotic potential remains unclear unless further studies are conducted. At present, it is assumed that the risk posed by bats to the general public is rather low. In this review, selected viruses detected and isolated in Europe are discussed from our point of view in regard to their human-pathogenic potential. All European bat species and their roosts are legally protected and some European species are even endangered. Nevertheless, the increasing public fear of bats and their viruses is an obstacle to their protection. Educating the public regarding bat lyssaviruses might result in reduced threats to both the public and the bats.

  12. Newly emerging mutations in the matrix genes of the human influenza A(H1N1)pdm09 and A(H3N2) viruses reduce the detection sensitivity of real-time reverse transcription-PCR.

    Science.gov (United States)

    Yang, Ji-Rong; Kuo, Chuan-Yi; Huang, Hsiang-Yi; Wu, Fu-Ting; Huang, Yi-Lung; Cheng, Chieh-Yu; Su, Yu-Ting; Chang, Feng-Yee; Wu, Ho-Sheng; Liu, Ming-Tsan

    2014-01-01

    New variants of the influenza A(H1N1)pdm09 and A(H3N2) viruses were detected in Taiwan between 2012 and 2013. Some of these variants were not detected in clinical specimens using a common real-time reverse transcription-PCR (RT-PCR) assay that targeted the conserved regions of the viral matrix (M) genes. An analysis of the M gene sequences of the new variants revealed that several newly emerging mutations were located in the regions where the primers or probes of the real-time RT-PCR assay bind; these included three mutations (G225A, T228C, and G238A) in the A(H1N1)pdm09 virus, as well as one mutation (C163T) in the A(H3N2) virus. These accumulated mismatch mutations, together with the previously identified C154T mutation of the A(H1N1)pdm09 virus and the C153T and G189T mutations of the A(H3N2) virus, result in a reduced detection sensitivity for the real-time RT-PCR assay. To overcome the loss of assay sensitivity due to mismatch mutations, we established a real-time RT-PCR assay using degenerate nucleotide bases in both the primers and probe and successfully increased the sensitivity of the assay to detect circulating variants of the human influenza A viruses. Our observations highlight the importance of the simultaneous use of different gene-targeting real-time RT-PCR assays for the clinical diagnosis of influenza.

  13. Reassortment between Avian H5N1 and Human Influenza Viruses Is Mainly Restricted to the Matrix and Neuraminidase Gene Segments

    NARCIS (Netherlands)

    E.J.A. Schrauwen (Eefje); T.M. Bestebroer (Theo); G.F. Rimmelzwaan (Guus); A.D.M.E. Osterhaus (Albert); R.A.M. Fouchier (Ron); S. Herfst (Sander)

    2013-01-01

    textabstractHighly pathogenic avian influenza H5N1 viruses have devastated the poultry industry in many countries of the eastern hemisphere. Occasionally H5N1 viruses cross the species barrier and infect humans, sometimes with a severe clinical outcome. When this happens, there is a chance of

  14. The Non-structural Protein 5 and Matrix Protein Are Antigenic Targets of T Cell Immunity to Genotype 1 Porcine Reproductive and Respiratory Syndrome Viruses

    DEFF Research Database (Denmark)

    Mokhtar, Helen; Pedrera, Miriam; Frossard, Jean-Pierre

    2016-01-01

    The porcine reproductive and respiratory syndrome virus (PRRSV) is the cause of one of the most economically important diseases affecting swine worldwide. Efforts to develop a next-generation vaccine have largely focused on envelope glycoproteins to target virus-neutralizing antibody responses....... However, these approaches have failed to demonstrate the necessary efficacy to progress toward market. T cells are crucial to the control of many viruses through cytolysis and cytokine secretion. Since control of PRRSV infection is not dependent on the development of neutralizing antibodies, it has been...

  15. Immunology of Bats and Their Viruses: Challenges and Opportunities

    Science.gov (United States)

    Schountz, Tony

    2014-01-01

    Bats are reservoir hosts of several high-impact viruses that cause significant human diseases, including Nipah virus, Marburg virus and rabies virus. They also harbor many other viruses that are thought to have caused disease in humans after spillover into intermediate hosts, including SARS and MERS coronaviruses. As is usual with reservoir hosts, these viruses apparently cause little or no pathology in bats. Despite the importance of bats as reservoir hosts of zoonotic and potentially zoonotic agents, virtually nothing is known about the host/virus relationships; principally because few colonies of bats are available for experimental infections, a lack of reagents, methods and expertise for studying bat antiviral responses and immunology, and the difficulty of conducting meaningful field work. These challenges can be addressed, in part, with new technologies that are species-independent that can provide insight into the interactions of bats and viruses, which should clarify how the viruses persist in nature, and what risk factors might facilitate transmission to humans and livestock. PMID:25494448

  16. Immunology of Bats and Their Viruses: Challenges and Opportunities

    Directory of Open Access Journals (Sweden)

    Tony Schountz

    2014-12-01

    Full Text Available Bats are reservoir hosts of several high-impact viruses that cause significant human diseases, including Nipah virus, Marburg virus and rabies virus. They also harbor many other viruses that are thought to have caused disease in humans after spillover into intermediate hosts, including SARS and MERS coronaviruses. As is usual with reservoir hosts, these viruses apparently cause little or no pathology in bats. Despite the importance of bats as reservoir hosts of zoonotic and potentially zoonotic agents, virtually nothing is known about the host/virus relationships; principally because few colonies of bats are available for experimental infections, a lack of reagents, methods and expertise for studying bat antiviral responses and immunology, and the difficulty of conducting meaningful field work. These challenges can be addressed, in part, with new technologies that are species-independent that can provide insight into the interactions of bats and viruses, which should clarify how the viruses persist in nature, and what risk factors might facilitate transmission to humans and livestock.

  17. Immunology of bats and their viruses: challenges and opportunities.

    Science.gov (United States)

    Schountz, Tony

    2014-12-01

    Bats are reservoir hosts of several high-impact viruses that cause significant human diseases, including Nipah virus, Marburg virus and rabies virus. They also harbor many other viruses that are thought to have caused disease in humans after spillover into intermediate hosts, including SARS and MERS coronaviruses. As is usual with reservoir hosts, these viruses apparently cause little or no pathology in bats. Despite the importance of bats as reservoir hosts of zoonotic and potentially zoonotic agents, virtually nothing is known about the host/virus relationships; principally because few colonies of bats are available for experimental infections, a lack of reagents, methods and expertise for studying bat antiviral responses and immunology, and the difficulty of conducting meaningful field work. These challenges can be addressed, in part, with new technologies that are species-independent that can provide insight into the interactions of bats and viruses, which should clarify how the viruses persist in nature, and what risk factors might facilitate transmission to humans and livestock.

  18. West Nile virus-induced disruption of the blood-brain barrier in mice is characterized by the degradation of the junctional complex proteins and increase in multiple matrix metalloproteinases.

    Science.gov (United States)

    Roe, Kelsey; Kumar, Mukesh; Lum, Stephanie; Orillo, Beverly; Nerurkar, Vivek R; Verma, Saguna

    2012-06-01

    West Nile virus (WNV) encephalitis is characterized by neuroinflammation, neuronal loss and blood-brain barrier (BBB) disruption. However, the mechanisms associated with the BBB disruption are unclear. Complex interactions between the tight junction proteins (TJP) and the adherens junction proteins (AJP) of the brain microvascular endothelial cells are responsible for maintaining the BBB integrity. Herein, we characterized the relationship between the BBB disruption and expression kinetics of key TJP, AJP and matrix metalloproteinases (MMPs) in the mice brain. A dramatic increase in the BBB permeability and extravasation of IgG was observed at later time points of the central nervous system (CNS) infection and did not precede virus-CNS entry. WNV-infected mice exhibited significant reduction in the protein levels of the TJP ZO-1, claudin-1, occludin and JAM-A, and AJP β-catenin and vascular endothelial cadherin, which correlated with increased levels of MMP-1, -3 and -9 and infiltrated leukocytes in the brain. Further, intracranial inoculation of WNV also demonstrated increased extravasation of IgG in the brain, suggesting the role of virus replication in the CNS in BBB disruption. These data suggest that altered expression of junction proteins is a pathological event associated with WNV infection and may explain the molecular basis of BBB disruption. We propose that WNV initially enters CNS without altering the BBB integrity and later virus replication in the brain initiates BBB disruption, allowing enhanced infiltration of immune cells and contribute to virus neuroinvasion via the 'Trojan-horse' route. These data further implicate roles of multiple MMPs in the BBB disruption and strategies to interrupt this process may influence the WNV disease outcome.

  19. Matrix theory

    CERN Document Server

    Franklin, Joel N

    2003-01-01

    Mathematically rigorous introduction covers vector and matrix norms, the condition-number of a matrix, positive and irreducible matrices, much more. Only elementary algebra and calculus required. Includes problem-solving exercises. 1968 edition.

  20. Synthetic protocells interact with viral nanomachinery and inactivate pathogenic human virus.

    Directory of Open Access Journals (Sweden)

    Matteo Porotto

    Full Text Available We present a new antiviral strategy and research tool that could be applied to a wide range of enveloped viruses that infect human beings via membrane fusion. We test this strategy on two emerging zoonotic henipaviruses that cause fatal encephalitis in humans, Nipah (NiV and Hendra (HeV viruses. In the new approach, artificial cell-like particles (protocells presenting membrane receptors in a biomimetic manner were developed and found to attract and inactivate henipavirus envelope glycoprotein pseudovirus particles, preventing infection. The protocells do not accumulate virus during the inactivation process. The use of protocells that interact with, but do not accumulate, viruses may provide significant advantages over current antiviral drugs, and this general approach may have wide potential for antiviral development.

  1. An "on-matrix" digestion procedure for AP-MS experiments dissects the interplay between complex-conserved and serotype-specific reactivities in Dengue virus-human plasma interactome.

    Science.gov (United States)

    Ramos, Yassel; Huerta, Vivian; Martín, Dayron; Palomares, Sucel; Yero, Alexis; Pupo, Dianne; Gallien, Sebastien; Martín, Alejandro M; Pérez-Riverol, Yasset; Sarría, Mónica; Guirola, Osmany; Chinea, Glay; Domon, Bruno; González, Luis Javier

    2017-07-13

    The interactions between the four Dengue virus (DENV) serotypes and plasma proteins are crucial in the initial steps of viral infection to humans. Affinity purification combined with quantitative mass spectrometry analysis, has become one of the most powerful tools for the investigation on novel protein-protein interactions. Using this approach, we report here that a significant number of bait-interacting proteins do not dissociate under standard elution conditions, i.e. acid pH and chaotropic agents, and that this problem can be circumvented by using the "on-matrix" digestion procedure described here. This procedure enabled the identification of 16 human plasma proteins interacting with domain III from the envelope protein of DENV serotypes 1, 3 and 4 that would have not been detected otherwise and increased the known DIIIE interactors in human plasma to 59 proteins. Selected Reaction Monitoring analysis evidenced DENV interactome in human plasma is rather conserved although significant differences on the reactivity of viral serotypes with specific proteins do exist. A comparison between the serotype-dependent profile of reactivity and the conservation pattern of amino acid residues suggests an evolutionary selection of highly conserved interactions with the host and other interactions mediated for surface regions of higher variability. False negative results on the identification of interacting proteins in pull-down experiments compromise the subsequent interpretation of results and the formulation of a working hypothesis for the derived future work. In this study we demonstrate the presence of bait-interacting proteins reluctant to dissociate under elution conditions of acid pH and presence of chaotropics. We propose the direct proteolytic digestion of proteins while still bound to the affinity matrix ("on-matrix" digestion) and evaluate the impact of this methodology in the comparative study of the interactome of the four serotypes of Dengue virus mediated by

  2. Dimeric architecture of the Hendra virus attachment glycoprotein: evidence for a conserved mode of assembly.

    Science.gov (United States)

    Bowden, Thomas A; Crispin, Max; Harvey, David J; Jones, E Yvonne; Stuart, David I

    2010-06-01

    Hendra virus is a negative-sense single-stranded RNA virus within the Paramyxoviridae family which, together with Nipah virus, forms the Henipavirus genus. Infection with bat-borne Hendra virus leads to a disease with high mortality rates in humans. We determined the crystal structure of the unliganded six-bladed beta-propeller domain and compared it to the previously reported structure of Hendra virus attachment glycoprotein (HeV-G) in complex with its cellular receptor, ephrin-B2. As observed for the related unliganded Nipah virus structure, there is plasticity in the Glu579-Pro590 and Lys236-Ala245 ephrin-binding loops prior to receptor engagement. These data reveal that henipaviral attachment glycoproteins undergo common structural transitions upon receptor binding and further define the structural template for antihenipaviral drug design. Our analysis also provides experimental evidence for a dimeric arrangement of HeV-G that exhibits striking similarity to those observed in crystal structures of related paramyxovirus receptor-binding glycoproteins. The biological relevance of this dimer is further supported by the positional analysis of glycosylation sites from across the paramyxoviruses. In HeV-G, the sites lie away from the putative dimer interface and remain accessible to alpha-mannosidase processing on oligomerization. We therefore propose that the overall mode of dimer assembly is conserved for all paramyxoviruses; however, while the geometry of dimerization is rather closely similar for those viruses that bind flexible glycan receptors, significant (up to 60 degrees ) and different reconfigurations of the subunit packing (associated with a significant decrease in the size of the dimer interface) have accompanied the independent switching to high-affinity protein receptor binding in Hendra and measles viruses.

  3. Virus inactivation by salt (NaCl) and phosphate supplemented salt in a 3D collagen matrix model for natural sausage casings

    NARCIS (Netherlands)

    Wieringa-Jelsma, H.; Wijnker, J.J.; Zijlstra-Willems, E.M.; Dekker, A.; Stockhofe-Zurwieden, N.; Maas, R.; Wisselink, H.J.

    2011-01-01

    Due to possible presence and spread of contagious animal viruses via natural sausage casings the international trade in these food products is subject to veterinary and public health requirements. In order to manage these restrictions we determined the effect of casing preservation on four highly

  4. Extracellular Protein Interactions Mediated by the Neural Cell Adhesion Molecule, NCAM: Heterophilic Interactions Between NCAM and Cell Adhesion Molecules, Extracellular Matrix Proteins, and Viruses

    DEFF Research Database (Denmark)

    Nielsen, Janne; Kulahin, Nikolaj; Walmod, Peter

    2008-01-01

    interactions, thereby modulating a range of biological processes. This review summarizes interactions between NCAM and other CAMs and ECM proteins. Additionally, the role of NCAM as a receptor for rabies virus, and its implications in rabies infections is briefly described. Interactions between NCAM and its...

  5. Amplification of the Matrix Gene of RBOK Vaccine Strain of Rinderpest Virus (RPV) by Polymerase Chain Reaction and Cloning into TOPOR XL Cloning Vector

    OpenAIRE

    AZKUR, Ahmet Kürşat; BOLAT, Yusuf

    2003-01-01

    In this study, the matrix (M) gene of the RBOK vaccine strain of rinderpest (RPV) was amplified by polymerase chain reaction (PCR) and cloned into TOPOR XL cloning vector. For this purpose, Vero cells were infected with the RBOK vaccine strain of RPV and total RNA was obtained from the infected cells. cDNA of the matrix gene was obtained by reverse transcription from the total RNA. Amplification of the cDNA with PCR was achieved by using the M gene specific primer and PCR products of the M ge...

  6. Resonance assignments of the myristoylated Y28F/Y67F mutant of the Mason-Pfizer monkey virus matrix protein

    Czech Academy of Sciences Publication Activity Database

    Doležal, Michal; Hrabal, R.; Ruml, T.; Rumlová, Michaela

    2015-01-01

    Roč. 9, č. 2 (2015), s. 229-233 ISSN 1874-2718 Institutional support: RVO:61388963 Keywords : isotopic labeling * matrix protein * M-PMV * myristoylation * resonance assignment * reverse labeling Subject RIV: CE - Biochemistry Impact factor: 0.687, year: 2015

  7. Severity of Plasma Leakage Is Associated With High Levels of Interferon γ-Inducible Protein 10, Hepatocyte Growth Factor, Matrix Metalloproteinase 2 (MMP-2), and MMP-9 During Dengue Virus Infection.

    Science.gov (United States)

    Her, Zhisheng; Kam, Yiu-Wing; Gan, Victor C; Lee, Bernett; Thein, Tun-Linn; Tan, Jeslin J L; Lee, Linda K; Fink, Katja; Lye, David C; Rénia, Laurent; Leo, Yee-Sin; Ng, Lisa F P

    2017-01-01

     Dengue virus infection typically causes mild dengue fever, but, in severe cases, life-threatening dengue hemorrhagic fever (DHF) and dengue shock syndrome (DSS) occur. The pathophysiological hallmark of DHF and DSS is plasma leakage that leads to enhanced vascular permeability, likely due to a cytokine storm.  Ninety patients with dengue during 2010-2012 in Singapore were prospectively recruited and stratified according to their disease phase, primary and secondary infection status, and disease severity, measured by plasma leakage. Clinical parameters were recorded throughout the disease progression. The levels of various immune mediators were quantified using comprehensive multiplex microbead-based immunoassays for 46 immune mediators.  Associations between clinical parameters and immune mediators were analyzed using various statistical methods. Potential immune markers, including interleukin 1 receptor antagonist, interferon γ-inducible protein 10, hepatocyte growth factor, soluble p75 tumor necrosis factor α receptor, vascular cell adhesion molecule 1, and matrix metalloproteinase 2, were significantly associated with significant plasma leakage. Secondary dengue virus infections were also shown to influence disease outcome in terms of disease severity.  This study identified several key markers for exacerbated dengue pathogenesis, notably plasma leakage. This will allow a better understanding of the molecular mechanisms of DHF and DSS in patients with dengue. © The Author 2016. Published by Oxford University Press for the Infectious Diseases Society of America. All rights reserved. For permissions, e-mail journals.permissions@oup.com.

  8. Matrix calculus

    CERN Document Server

    Bodewig, E

    1959-01-01

    Matrix Calculus, Second Revised and Enlarged Edition focuses on systematic calculation with the building blocks of a matrix and rows and columns, shunning the use of individual elements. The publication first offers information on vectors, matrices, further applications, measures of the magnitude of a matrix, and forms. The text then examines eigenvalues and exact solutions, including the characteristic equation, eigenrows, extremum properties of the eigenvalues, bounds for the eigenvalues, elementary divisors, and bounds for the determinant. The text ponders on approximate solutions, as well

  9. Insights into the coiled-coil organization of the Hendra virus phosphoprotein from combined biochemical and SAXS studies.

    Science.gov (United States)

    Beltrandi, Matilde; Blocquel, David; Erales, Jenny; Barbier, Pascale; Cavalli, Andrea; Longhi, Sonia

    2015-03-01

    Nipah and Hendra viruses are recently emerged paramyxoviruses belonging to the Henipavirus genus. The Henipavirus phosphoprotein (P) consists of a large intrinsically disordered domain and a C-terminal domain (PCT) containing alternating disordered and ordered regions. Among these latter is the P multimerization domain (PMD). Using biochemical, analytical ultracentrifugation and small-angle X-ray scattering (SAXS) studies, we show that Hendra virus (HeV) PMD forms an elongated coiled-coil homotrimer in solution, in agreement with our previous findings on Nipah virus (NiV) PMD. However, the orientation of the N-terminal region differs from that observed in solution for NiV PMD, consistent with the ability of this region to adopt different conformations. SAXS studies provided evidence for a trimeric organization also in the case of PCT, thus extending and strengthening our findings on PMD. The present results are discussed in light of conflicting reports in the literature pointing to a tetrameric organization of paramyxoviral P proteins. Copyright © 2014 Elsevier Inc. All rights reserved.

  10. Matrix superpotentials

    Science.gov (United States)

    Nikitin, Anatoly G.; Karadzhov, Yuri

    2011-07-01

    We present a collection of matrix-valued shape invariant potentials which give rise to new exactly solvable problems of SUSY quantum mechanics. It includes all irreducible matrix superpotentials of the generic form W=kQ+\\frac{1}{k} R+P, where k is a variable parameter, Q is the unit matrix multiplied by a real-valued function of independent variable x, and P and R are the Hermitian matrices depending on x. In particular, we recover the Pron'ko-Stroganov 'matrix Coulomb potential' and all known scalar shape invariant potentials of SUSY quantum mechanics. In addition, five new shape invariant potentials are presented. Three of them admit a dual shape invariance, i.e. the related Hamiltonians can be factorized using two non-equivalent superpotentials. We find discrete spectrum and eigenvectors for the corresponding Schrödinger equations and prove that these eigenvectors are normalizable.

  11. Possibility of using combined treatment of processing and ionizing radiation to eliminate contaminated viruses from non-screened donor of tissue allografts

    International Nuclear Information System (INIS)

    Nazly Hilmy; Paramita Pandansari

    2008-01-01

    Full text: New emerging and re- emerging infectious diseases caused by viruses are outbreak and re- outbreak around the world. Most of the viruses come from animals ( zoonoses) and jump to human beings ( host jumping ) such as corona virus ( SARS), HIV, bird flu/ Avian flu H5N1, hepatitis viruses, Dengue fever virus, West Nile virus/WNV, Hantavirus, Marburg haemorrhagic fever virus, Hendra virus, Nipah virus etc. Transmission of those diseases through transplantation of contaminated tissue allograft to recipient can happened if the donor could not be screened properly. The donor can be well screened from some of those viruses such as HIV, hepatitis viruses and WNV. Processing of tissue allografts by pasteurization, washing and soaking in H 2 O 2 and soap can eliminate contaminated viruses to a certain amount, have been reported by several authors. Viruses are very small microbes, they have DNA/RNA, resistant to radiation but to a certain degree they can be well eliminated by radiation. Their D10 - values vary from 4 to 13 kGy. This paper discribes briefly the possibility of using combined treatment of processing, lyophilization and sterilisation by radiation to overcome problems of non screened donor from some contaminated viruses. (Author)

  12. Generation of virus-free induced pluripotent stem cell clones on a synthetic matrix via a single cell subcloning in the naive state.

    Directory of Open Access Journals (Sweden)

    Naoki Nishishita

    Full Text Available CD34+ cord blood cells can be reprogrammed effectively on dishes coated with a synthetic RGD motif polymer (PronectinF® using a temperature sensitive Sendai virus vector (SeV TS7 carrying reprogramming factors OCT3/4, SOX2, KLF4 and c-MYC. Dish-shaped human ES cell-like colonies emerged in serum-free primate ES cell medium (supplemented with bFGF in 20% O2 culture conditions. The copy numbers of SeV TS7 vectors in the cytoplasm were drastically reduced by a temperature shift at 38°C for three days. Then, single cells from colonies were seeded on PronectinF®-coated 96-well plates and cultured under naïve culture conditions (N2B27-based medium supplemented with LIF, forskolin, a MAPK inhibitor, and a GSK inhibitor in 5% O2 for cloning purpose. Dome-shaped mouse ES cell-like colonies from single cells emerged on PronectinF®-coated dishes. These cells were collected and cultured again in primate ES cell medium supplemented with bFGF in 20% O2 and maintained on PronectinF®-coated dishes. Cells were assessed for reprogramming, including the absence of residual SeV and their potential for three germ layer differentiation. Generation of virus-free induced pluripotent stem cell (iPSC clones from single cells under feeder-free conditions will solve some of the safety concerns related to use of xeno- or allogeneic-material in culture, and contribute to the characterization and the standardization of iPS cells intended for use in a clinical setting.

  13. Generation of virus-free induced pluripotent stem cell clones on a synthetic matrix via a single cell subcloning in the naïve state.

    Science.gov (United States)

    Nishishita, Naoki; Shikamura, Masayuki; Takenaka, Chiemi; Takada, Nozomi; Fusaki, Noemi; Fusak, Noemi; Kawamata, Shin

    2012-01-01

    CD34+ cord blood cells can be reprogrammed effectively on dishes coated with a synthetic RGD motif polymer (PronectinF®) using a temperature sensitive Sendai virus vector (SeV TS7) carrying reprogramming factors OCT3/4, SOX2, KLF4 and c-MYC. Dish-shaped human ES cell-like colonies emerged in serum-free primate ES cell medium (supplemented with bFGF) in 20% O2 culture conditions. The copy numbers of SeV TS7 vectors in the cytoplasm were drastically reduced by a temperature shift at 38°C for three days. Then, single cells from colonies were seeded on PronectinF®-coated 96-well plates and cultured under naïve culture conditions (N2B27-based medium supplemented with LIF, forskolin, a MAPK inhibitor, and a GSK inhibitor in 5% O2) for cloning purpose. Dome-shaped mouse ES cell-like colonies from single cells emerged on PronectinF®-coated dishes. These cells were collected and cultured again in primate ES cell medium supplemented with bFGF in 20% O2 and maintained on PronectinF®-coated dishes. Cells were assessed for reprogramming, including the absence of residual SeV and their potential for three germ layer differentiation. Generation of virus-free induced pluripotent stem cell (iPSC) clones from single cells under feeder-free conditions will solve some of the safety concerns related to use of xeno- or allogeneic-material in culture, and contribute to the characterization and the standardization of iPS cells intended for use in a clinical setting.

  14. Matrix thermalization

    Energy Technology Data Exchange (ETDEWEB)

    Craps, Ben [Theoretische Natuurkunde, Vrije Universiteit Brussel (VUB), and International Solvay Institutes, Pleinlaan 2, B-1050 Brussels (Belgium); Evnin, Oleg [Department of Physics, Faculty of Science, Chulalongkorn University, Thanon Phayathai, Pathumwan, Bangkok 10330 (Thailand); Theoretische Natuurkunde, Vrije Universiteit Brussel (VUB), and International Solvay Institutes, Pleinlaan 2, B-1050 Brussels (Belgium); Nguyen, Kévin [Theoretische Natuurkunde, Vrije Universiteit Brussel (VUB), and International Solvay Institutes, Pleinlaan 2, B-1050 Brussels (Belgium)

    2017-02-08

    Matrix quantum mechanics offers an attractive environment for discussing gravitational holography, in which both sides of the holographic duality are well-defined. Similarly to higher-dimensional implementations of holography, collapsing shell solutions in the gravitational bulk correspond in this setting to thermalization processes in the dual quantum mechanical theory. We construct an explicit, fully nonlinear supergravity solution describing a generic collapsing dilaton shell, specify the holographic renormalization prescriptions necessary for computing the relevant boundary observables, and apply them to evaluating thermalizing two-point correlation functions in the dual matrix theory.

  15. Roles of adjuvant and route of vaccination in antibody response and protection engendered by a synthetic matrix protein 2-based influenza A virus vaccine in the mouse

    Directory of Open Access Journals (Sweden)

    Cudic Mare

    2007-10-01

    Full Text Available Abstract Background The M2 ectodomain (M2e of influenza A virus (IAV strains that have circulated in humans during the past 90 years shows remarkably little structural diversity. Since M2e-specific antibodies (Abs are capable of restricting IAV replication in vivo but are present only at minimal concentration in human sera, efforts are being made to develop a M2e-specific vaccine. We are exploring a synthetic multiple antigenic peptide (MAP vaccine and here report on the role of adjuvants (cholera toxin and immunostimulatory oligodeoxynucleotide and route of immunization on Ab response and strength of protection. Results Independent of adjuvants and immunization route, on average 87% of the M2e-MAP-induced Abs were specific for M2e peptide and a variable fraction of these M2e(pep-specific Abs (average 15% cross-reacted with presumably native M2e expressed by M2-transfected cells. The titer of these cross-reactive M2e(pep-nat-specific Abs in sera of parenterally immunized mice displayed a sigmoidal relation to level of protection, with EC50 of ~20 μg Ab/ml serum, though experiments with passive M2e(pep-nat Abs indicated that serum Abs did not fully account for protection in parenterally vaccinated mice, particularly in upper airways. Intranasal vaccination engendered stronger protection and a higher proportion of G2a Abs than parenteral vaccination, and the strength of protection failed to correlate with M2e(pep-nat-specific serum Ab titers, suggesting a role of airway-associated immunity in protection of intranasally vaccinated mice. Intranasal administration of M2e-MAP without adjuvant engendered no response but coadministration with infectious IAV slightly enhanced the M2e(pep-nat Ab response and protection compared to vaccination with IAV or adjuvanted M2e-MAP alone. Conclusion M2e-MAP is an effective immunogen as ~15% of the total M2e-MAP-induced Ab response is of desired specificity. While M2e(pep-nat-specific serum Abs have an important

  16. Human Hendra virus infection causes acute and relapsing encephalitis.

    Science.gov (United States)

    Wong, K T; Robertson, T; Ong, B B; Chong, J W; Yaiw, K C; Wang, L F; Ansford, A J; Tannenberg, A

    2009-06-01

    To study the pathology of two cases of human Hendra virus infection, one with no clinical encephalitis and one with relapsing encephalitis. Autopsy tissues were investigated by light microscopy, immunohistochemistry and in situ hybridization. In the patient with acute pulmonary syndrome but not clinical acute encephalitis, vasculitis was found in the brain, lung, heart and kidney. Occasionally, viral antigens were demonstrated in vascular walls but multinucleated endothelial syncytia were absent. In the lung, there was severe inflammation, necrosis and viral antigens in type II pneumocytes and macrophages. The rare kidney glomerulus showed inflammation and viral antigens in capillary walls and podocytes. Discrete necrotic/vacuolar plaques in the brain parenchyma were associated with antigens and viral RNA. Brain inflammation was mild although CD68(+) microglia/macrophages were significantly increased. Cytoplasmic viral inclusions and antigens and viral RNA in neurones and ependyma suggested viral replication. In the case of relapsing encephalitis, there was severe widespread meningoencephalitis characterized by neuronal loss, macrophages and other inflammatory cells, reactive blood vessels and perivascular cuffing. Antigens and viral RNA were mainly found in neurones. Vasculitis was absent in all the tissues examined. The case of acute Hendra virus infection demonstrated evidence of systemic infection and acute encephalitis. The case of relapsing Hendra virus encephalitis showed no signs of extraneural infection but in the brain, extensive inflammation and infected neurones were observed. Hendra virus can cause acute and relapsing encephalitis and the findings suggest that the pathology and pathogenesis are similar to Nipah virus infection.

  17. [Summary of research works on viruses in the Vietnam Research Station, Institute of Tropical Medicine, Nagasaki University].

    Science.gov (United States)

    Yamashiro, Tetsu

    2013-01-01

    Institute of Tropical Medicine, Nagasaki University (NEKKEN) and National Institute of Hygiene and Epidemiology, Vietnam (NIHE) jointly conducted a project from 2006 on Emerging and Re-emerging Infectious Diseases (ERID) granted by the Ministry of Education, Science, Culture and Technology (MEXT) of Japan. Fifteen independent researches have been carried out by 7 scientists who stationed in the Vietnam Research Station (VRS), and by approximately 60 visiting scientists. A wide variety of viruses have been studied in the research activities in the VRS, of those, topics of'' Nipah virus infection in bats in Vietnam'', ''Nam Dinh virus, a newly discovered insect nidovirus'', and'' Risk factors of dengue fever in southern Vietnam'' were summarized. It is important to develop a mechanism to facilitate young scientists to use the VRS in their research works, and then a scope to establish the VRS as a gateway to a successful career path for young scientists in the field of the infectious diseases would be realized.

  18. Duration of Maternal Antibodies against Canine Distemper Virus and Hendra Virus in Pteropid Bats

    Science.gov (United States)

    Zambrana-Torrelio, Carlos; Middleton, Deborah; Barr, Jennifer A.; DuBovi, Edward; Boyd, Victoria; Pope, Brian; Todd, Shawn; Crameri, Gary; Walsh, Allyson; Pelican, Katey; Fielder, Mark D.; Davies, Angela J.; Wang, Lin-Fa; Daszak, Peter

    2013-01-01

    Old World frugivorous bats have been identified as natural hosts for emerging zoonotic viruses of significant public health concern, including henipaviruses (Nipah and Hendra virus), Ebola virus, and Marburg virus. Epidemiological studies of these viruses in bats often utilize serology to describe viral dynamics, with particular attention paid to juveniles, whose birth increases the overall susceptibility of the population to a viral outbreak once maternal immunity wanes. However, little is understood about bat immunology, including the duration of maternal antibodies in neonates. Understanding duration of maternally derived immunity is critical for characterizing viral dynamics in bat populations, which may help assess the risk of spillover to humans. We conducted two separate studies of pregnant Pteropus bat species and their offspring to measure the half-life and duration of antibodies to 1) canine distemper virus antigen in vaccinated captive Pteropus hypomelanus; and 2) Hendra virus in wild-caught, naturally infected Pteropus alecto. Both of these pteropid bat species are known reservoirs for henipaviruses. We found that in both species, antibodies were transferred from dam to pup. In P. hypomelanus pups, titers against CDV waned over a mean period of 228.6 days (95% CI: 185.4–271.8) and had a mean terminal phase half-life of 96.0 days (CI 95%: 30.7–299.7). In P. alecto pups, antibodies waned over 255.13 days (95% CI: 221.0–289.3) and had a mean terminal phase half-life of 52.24 days (CI 95%: 33.76–80.83). Each species showed a duration of transferred maternal immunity of between 7.5 and 8.5 months, which was longer than has been previously estimated. These data will allow for more accurate interpretation of age-related Henipavirus serological data collected from wild pteropid bats. PMID:23826322

  19. Duration of Maternal Antibodies against Canine Distemper Virus and Hendra Virus in Pteropid Bats.

    Directory of Open Access Journals (Sweden)

    Jonathan H Epstein

    Full Text Available Old World frugivorous bats have been identified as natural hosts for emerging zoonotic viruses of significant public health concern, including henipaviruses (Nipah and Hendra virus, Ebola virus, and Marburg virus. Epidemiological studies of these viruses in bats often utilize serology to describe viral dynamics, with particular attention paid to juveniles, whose birth increases the overall susceptibility of the population to a viral outbreak once maternal immunity wanes. However, little is understood about bat immunology, including the duration of maternal antibodies in neonates. Understanding duration of maternally derived immunity is critical for characterizing viral dynamics in bat populations, which may help assess the risk of spillover to humans. We conducted two separate studies of pregnant Pteropus bat species and their offspring to measure the half-life and duration of antibodies to 1 canine distemper virus antigen in vaccinated captive Pteropus hypomelanus; and 2 Hendra virus in wild-caught, naturally infected Pteropus alecto. Both of these pteropid bat species are known reservoirs for henipaviruses. We found that in both species, antibodies were transferred from dam to pup. In P. hypomelanus pups, titers against CDV waned over a mean period of 228.6 days (95% CI: 185.4-271.8 and had a mean terminal phase half-life of 96.0 days (CI 95%: 30.7-299.7. In P. alecto pups, antibodies waned over 255.13 days (95% CI: 221.0-289.3 and had a mean terminal phase half-life of 52.24 days (CI 95%: 33.76-80.83. Each species showed a duration of transferred maternal immunity of between 7.5 and 8.5 months, which was longer than has been previously estimated. These data will allow for more accurate interpretation of age-related Henipavirus serological data collected from wild pteropid bats.

  20. Duration of Maternal Antibodies against Canine Distemper Virus and Hendra Virus in Pteropid Bats.

    Science.gov (United States)

    Epstein, Jonathan H; Baker, Michelle L; Zambrana-Torrelio, Carlos; Middleton, Deborah; Barr, Jennifer A; Dubovi, Edward; Boyd, Victoria; Pope, Brian; Todd, Shawn; Crameri, Gary; Walsh, Allyson; Pelican, Katey; Fielder, Mark D; Davies, Angela J; Wang, Lin-Fa; Daszak, Peter

    2013-01-01

    Old World frugivorous bats have been identified as natural hosts for emerging zoonotic viruses of significant public health concern, including henipaviruses (Nipah and Hendra virus), Ebola virus, and Marburg virus. Epidemiological studies of these viruses in bats often utilize serology to describe viral dynamics, with particular attention paid to juveniles, whose birth increases the overall susceptibility of the population to a viral outbreak once maternal immunity wanes. However, little is understood about bat immunology, including the duration of maternal antibodies in neonates. Understanding duration of maternally derived immunity is critical for characterizing viral dynamics in bat populations, which may help assess the risk of spillover to humans. We conducted two separate studies of pregnant Pteropus bat species and their offspring to measure the half-life and duration of antibodies to 1) canine distemper virus antigen in vaccinated captive Pteropus hypomelanus; and 2) Hendra virus in wild-caught, naturally infected Pteropus alecto. Both of these pteropid bat species are known reservoirs for henipaviruses. We found that in both species, antibodies were transferred from dam to pup. In P. hypomelanus pups, titers against CDV waned over a mean period of 228.6 days (95% CI: 185.4-271.8) and had a mean terminal phase half-life of 96.0 days (CI 95%: 30.7-299.7). In P. alecto pups, antibodies waned over 255.13 days (95% CI: 221.0-289.3) and had a mean terminal phase half-life of 52.24 days (CI 95%: 33.76-80.83). Each species showed a duration of transferred maternal immunity of between 7.5 and 8.5 months, which was longer than has been previously estimated. These data will allow for more accurate interpretation of age-related Henipavirus serological data collected from wild pteropid bats.

  1. The nuclear export protein of H5N1 influenza A viruses recruits Matrix 1 (M1) protein to the viral ribonucleoprotein to mediate nuclear export.

    Science.gov (United States)

    Brunotte, Linda; Flies, Joe; Bolte, Hardin; Reuther, Peter; Vreede, Frank; Schwemmle, Martin

    2014-07-18

    In influenza A virus-infected cells, replication and transcription of the viral genome occurs in the nucleus. To be packaged into viral particles at the plasma membrane, encapsidated viral genomes must be exported from the nucleus. Intriguingly, the nuclear export protein (NEP) is involved in both processes. Although NEP stimulates viral RNA synthesis by binding to the viral polymerase, its function during nuclear export implicates interaction with viral ribonucleoprotein (vRNP)-associated M1. The observation that both interactions are mediated by the C-terminal moiety of NEP raised the question whether these two features of NEP are linked functionally. Here we provide evidence that the interaction between M1 and the vRNP depends on the NEP C terminus and its polymerase activity-enhancing property for the nuclear export of vRNPs. This suggests that these features of NEP are linked functionally. Furthermore, our data suggest that the N-terminal domain of NEP interferes with the stability of the vRNP-M1-NEP nuclear export complex, probably mediated by its highly flexible intramolecular interaction with the NEP C terminus. On the basis of our data, we propose a new model for the assembly of the nuclear export complex of Influenza A vRNPs. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

  2. Effects of nutrients on matrix metalloproteinases in human T-lymphotropic virus type 1 positive and negative malignant T-lymphocytes.

    Science.gov (United States)

    Harakeh, Steve; Abou-Khouzam, Raefa; Damanhouri, Ghazi A; Al-Hejin, Ahmed; Kumosani, Taha; Niedzwiecki, Aleksandra; Rath, Mathias; Barbour, Elie; Diab-Assaf, Mona; Azar, Rania

    2014-11-01

    Experimental and clinical studies have revealed the effectiveness of a specific nutrient synergy (SNS) mixture composed of ascorbic acid (AA), lysine, proline, arginine, epigallocatechin gallate (EGCG) and other micronutrients in targeting crucial physiological mechanisms involved in cancer progression and metastasis. HTLV-1 causes adult T-cell leukemia (ATL). The spread and metastases of ATL as well as other tumors has been associated with matrix metalloproteinases, especially the gelatinases MMP-2 and MMP-9. The objective of this study was to investigate whether SNS, AA and EGCG affects the gelatinolytic activity of MMP-2 and its transcriptional and translational levels in HTLV-1-positive and -negative malignant T-cells. The results indicated that SNS and EGCG caused a dose-dependent decline in the activity, transcription and translation of MMP-2 after treatment with SNS and EGCG, while AA was only able to inhibit the activity at maximum doses tested and to some extent, the protein expression levels of MMP-2, without affecting their transcriptional levels. The highest activity was noted in the case of SNS which is likely to be due to a synergistic effect of the different constituents in the formulation. These results point towards the potential integration of SNS in the anti-invasive treatment of ATL and related diseases.

  3. Potential for Introduction of Bat-Borne Zoonotic Viruses into the EU: A Review

    Directory of Open Access Journals (Sweden)

    Robin R. L. Simons

    2014-05-01

    Full Text Available Bat-borne viruses can pose a serious threat to human health, with examples including Nipah virus (NiV in Bangladesh and Malaysia, and Marburg virus (MARV in Africa. To date, significant human outbreaks of such viruses have not been reported in the European Union (EU. However, EU countries have strong historical links with many of the countries where NiV and MARV are present and a corresponding high volume of commercial trade and human travel, which poses a potential risk of introduction of these viruses into the EU. In assessing the risks of introduction of these bat-borne zoonotic viruses to the EU, it is important to consider the location and range of bat species known to be susceptible to infection, together with the virus prevalence, seasonality of viral pulses, duration of infection and titre of virus in different bat tissues. In this paper, we review the current scientific knowledge of all these factors, in relation to the introduction of NiV and MARV into the EU.

  4. The Reciprocal Pascal Matrix

    OpenAIRE

    Richardson, Thomas M.

    2014-01-01

    The reciprocal Pascal matrix is the Hadamard inverse of the symmetric Pascal matrix. We show that the ordinary matrix inverse of the reciprocal Pascal matrix has integer elements. The proof uses two factorizations of the matrix of super Catalan numbers.

  5. Matrix inequalities

    CERN Document Server

    Zhan, Xingzhi

    2002-01-01

    The main purpose of this monograph is to report on recent developments in the field of matrix inequalities, with emphasis on useful techniques and ingenious ideas. Among other results this book contains the affirmative solutions of eight conjectures. Many theorems unify or sharpen previous inequalities. The author's aim is to streamline the ideas in the literature. The book can be read by research workers, graduate students and advanced undergraduates.

  6. Kecernaan In Vitro Fraksi Serat (NDF, ADF dan Selulosa Lima Jenis Rumput Laut Coklat dari Pantai Sungai Nipah Kabupaten Pesisir Selatan Sumatera Barat

    Directory of Open Access Journals (Sweden)

    Y.L. Dewi

    2015-10-01

    Full Text Available Penelitian ini bertujuan untuk mengetahui kecernaan fraksi serat (NDF, ADF dan Selulosa lima jenis rumput laut coklat dari Pantai Sungai Nipah Kabupaten Pesisir Selatan Sumatera Barat secara in vitro. Metode penelitian yang digunakan adalah metode eksperimen dengan Rancangan Acak Kelompok (RAK terdiri dari lima perlakuan rumput laut coklat yang berbeda jenis ( A = Padina australis, B = Turbinaria decurrens, C = Turbinaria murayana, D = Sargassum crassifolium dan E = Sargassum binderi dan masing-masing perlakuan diulang 3 kali sebagai kelompok. Kelompok didasarkan atas tiga kali pengambilan cairan rumen kambing yang berbeda. Parameter yang diamati pada penelitian ini adalah kecernaan NDF, kecernaan ADF dan kecernaan selulosa. Hasil penelitian menunjukkan 5 jenis rumput laut coklat berpengaruh sangat nyata (P<0,01 terhadap kecernaan NDF, kecernaan ADF dan kecernaan selulosa. Hasil penelitian ini dapat disimpulkan bahwa rumput laut Sargassum crassifolium dan Sargassum binderi memiliki kecernaan NDF tertinggi (15,65% dan 20,56% dan ADF tertinggi (15,43% dan 17,80% dibandingkan dengan jenis rumput laut coklat lainnya.

  7. MRI findings in acute Hendra virus meningoencephalitis

    Energy Technology Data Exchange (ETDEWEB)

    Nakka, P.; Amos, G.J. [Department of Diagnostic Radiology, Princess Alexandra Hospital, Woolloongabba, Qld 4102 (Australia); Saad, N., E-mail: nivena100@hotmail.com [Department of Diagnostic Radiology, Princess Alexandra Hospital, Woolloongabba, Qld 4102 (Australia); Jeavons, S. [Department of Diagnostic Radiology, Princess Alexandra Hospital, Woolloongabba, Qld 4102 (Australia)

    2012-05-15

    Aim: To describe serial changes in brain magnetic resonance imaging (MRI) in acute human infection from two outbreaks of Hendra virus (HeV), relate these changes to disease prognosis, and compare HeV encephalitis to reported cases of Nipah virus encephalitis. Materials and methods: The MRI images of three human cases (two of which were fatal) of acute HeV meningoencephalitis were reviewed. Results: Cortical selectivity early in the disease is evident in all three patients, while deep white matter involvement appears to be a late and possibly premorbid finding. This apparent early grey matter selectivity may be related to viral biology or ribavirin pharmacokinetics. Neuronal loss is evident at MRI, and the rate of progression of MRI abnormalities can predict the outcome of the infection. In both fatal cases, the serial changes in the MRI picture mirrored the clinical course. Conclusion: This is the first comprehensive report of serial MRI findings in acute human cerebral HeV infection from two outbreaks. The cortical selectivity appears to be an early finding while deep white matter involvement a late, and possibly premorbid, finding. In both fatal cases, the serial changes in MRI mirrored the clinical course.

  8. The immune evasion function of J and Beilong virus V proteins is distinct from that of other paramyxoviruses, consistent with their inclusion in the proposed genus Jeilongvirus.

    Science.gov (United States)

    Audsley, Michelle D; Marsh, Glenn A; Lieu, Kim G; Tachedjian, Mary; Joubert, D Albert; Wang, Lin-Fa; Jans, David A; Moseley, Gregory W

    2016-03-01

    IFN-antagonist function is a major determinant of pathogenicity and cross-species infection by viruses, but remains poorly defined for many potentially zoonotic viruses resident in animal species. The paramyxovirus family contains several zoonotic viruses, including highly pathogenic viruses such as Nipah virus and Hendra virus, and an increasing number of largely uncharacterized animal viruses. Here, we report the characterization of IFN antagonism by the rodent viruses J virus (JPV) and Beilong virus (BeiPV) of the proposed genus Jeilongvirus of the paramyxoviruses. Infection of cells by JPV and BeiPV was found to inhibit IFN-activated nuclear translocation of signal transducer and activator of transcription 1 (STAT1). However, in contrast to most other paramyxoviruses, the JPV and BeiPV V proteins did not interact with or inhibit signalling by STAT1 or STAT2, suggesting that JPV/BeiPV use an atypical V protein-independent strategy to target STATs, consistent with their inclusion in a separate genus. Nevertheless, the V proteins of both viruses interacted with melanoma differentiation-associated protein 5 (MDA5) and robustly inhibited MDA5-dependent activation of the IFN-β promoter. This supports a growing body of evidence that MDA5 is a universal target of paramyxovirus V proteins, such that the V-MDA5 interaction represents a potential target for broad-spectrum antiviral approaches.

  9. [Bats and Viruses: complex relationships].

    Science.gov (United States)

    Rodhain, F

    2015-10-01

    With more than 1 200 species, bats and flying foxes (Order Chiroptera) constitute the most important and diverse order of Mammals after Rodents. Many species of bats are insectivorous while others are frugivorous and few of them are hematophagous. Some of these animals fly during the night, others are crepuscular or diurnal. Some fly long distances during seasonal migrations. Many species are colonial cave-dwelling, living in a rather small home range while others are relatively solitary. However, in spite of the importance of bats for terrestrial biotic communities and ecosystem ecology, the diversity in their biology and lifestyles remain poorly known and underappreciated. More than sixty viruses have been detected or isolated in bats; these animals are therefore involved in the natural cycles of many of them. This is the case, for instance, of rabies virus and other Lyssavirus (Family Rhabdoviridae), Nipah and Hendra viruses (Paramyxoviridae), Ebola and Marburg viruses (Filoviridae), SARS-CoV and MERS-CoV (Coronaviridae). For these zoonotic viruses, a number of bat species are considered as important reservoir hosts, efficient disseminators or even directly responsible of the transmission. Some of these bat-borne viruses cause highly pathogenic diseases while others are of potential significance for humans and domestic or wild animals; so, bats are an important risk in human and animal public health. Moreover, some groups of viruses developed through different phylogenetic mechanisms of coevolution between viruses and bats. The fact that most of these viral infections are asymptomatic in bats has been observed since a long time but the mechanisms of the viral persistence are not clearly understood. The various bioecology of the different bat populations allows exchange of virus between migrating and non-migrating conspecific species. For a better understanding of the role of bats in the circulation of these viral zoonoses, epidemiologists must pay attention to

  10. Matrix analysis

    CERN Document Server

    Bhatia, Rajendra

    1997-01-01

    A good part of matrix theory is functional analytic in spirit. This statement can be turned around. There are many problems in operator theory, where most of the complexities and subtleties are present in the finite-dimensional case. My purpose in writing this book is to present a systematic treatment of methods that are useful in the study of such problems. This book is intended for use as a text for upper division and gradu­ ate courses. Courses based on parts of the material have been given by me at the Indian Statistical Institute and at the University of Toronto (in collaboration with Chandler Davis). The book should also be useful as a reference for research workers in linear algebra, operator theory, mathe­ matical physics and numerical analysis. A possible subtitle of this book could be Matrix Inequalities. A reader who works through the book should expect to become proficient in the art of deriving such inequalities. Other authors have compared this art to that of cutting diamonds. One first has to...

  11. Matrix pentagons

    Science.gov (United States)

    Belitsky, A. V.

    2017-10-01

    The Operator Product Expansion for null polygonal Wilson loop in planar maximally supersymmetric Yang-Mills theory runs systematically in terms of multi-particle pentagon transitions which encode the physics of excitations propagating on the color flux tube ending on the sides of the four-dimensional contour. Their dynamics was unraveled in the past several years and culminated in a complete description of pentagons as an exact function of the 't Hooft coupling. In this paper we provide a solution for the last building block in this program, the SU(4) matrix structure arising from internal symmetry indices of scalars and fermions. This is achieved by a recursive solution of the Mirror and Watson equations obeyed by the so-called singlet pentagons and fixing the form of the twisted component in their tensor decomposition. The non-singlet, or charged, pentagons are deduced from these by a limiting procedure.

  12. Matrix pentagons

    Directory of Open Access Journals (Sweden)

    A.V. Belitsky

    2017-10-01

    Full Text Available The Operator Product Expansion for null polygonal Wilson loop in planar maximally supersymmetric Yang–Mills theory runs systematically in terms of multi-particle pentagon transitions which encode the physics of excitations propagating on the color flux tube ending on the sides of the four-dimensional contour. Their dynamics was unraveled in the past several years and culminated in a complete description of pentagons as an exact function of the 't Hooft coupling. In this paper we provide a solution for the last building block in this program, the SU(4 matrix structure arising from internal symmetry indices of scalars and fermions. This is achieved by a recursive solution of the Mirror and Watson equations obeyed by the so-called singlet pentagons and fixing the form of the twisted component in their tensor decomposition. The non-singlet, or charged, pentagons are deduced from these by a limiting procedure.

  13. Ebola Virus and Marburg Virus

    Science.gov (United States)

    Ebola virus and Marburg virus Overview Ebola virus and Marburg virus are related viruses that cause hemorrhagic fevers — illnesses marked by severe bleeding (hemorrhage), organ failure and, in many ...

  14. [Emergence of new viruses in Asia: is climate change involved?].

    Science.gov (United States)

    Chastel, C

    2004-11-01

    Tropical Africa is not the only area where deadly viruses have recently emerged. In South-East Asia severe epidemics of dengue hemorrhagic fever started in 1954 and flu pandemics have originated from China such as the Asian flu (H2N2) in 1957, the Hong-Kong flu (H3N2) in 1968, and the Russian flu (H1N1) in 1977. However, it is especially during the last ten years that very dangerous viruses for mankind have repeatedly developed in Asia, with the occurrence of Alkhurma hemorrhagic fever in Saudi Arabia (1995), avian flu (H5N1) in Hong-Kong (1997), Nipah virus encephalitis in Malaysia (1998,) and, above all, the SARS pandemic fever from Southern China (2002). The evolution of these viral diseases was probably not directly affected by climate change. In fact, their emergential success may be better explained by the development of large industry poultry flocks increasing the risks of epizootics, dietary habits, economic and demographic constraints, and negligence in the surveillance and reporting of the first cases.

  15. Kanyawara Virus: A Novel Rhabdovirus Infecting Newly Discovered Nycteribiid Bat Flies Infesting Previously Unknown Pteropodid Bats in Uganda.

    Science.gov (United States)

    Goldberg, Tony L; Bennett, Andrew J; Kityo, Robert; Kuhn, Jens H; Chapman, Colin A

    2017-07-13

    Bats are natural reservoir hosts of highly virulent pathogens such as Marburg virus, Nipah virus, and SARS coronavirus. However, little is known about the role of bat ectoparasites in transmitting and maintaining such viruses. The intricate relationship between bats and their ectoparasites suggests that ectoparasites might serve as viral vectors, but evidence to date is scant. Bat flies, in particular, are highly specialized obligate hematophagous ectoparasites that incidentally bite humans. Using next-generation sequencing, we discovered a novel ledantevirus (mononegaviral family Rhabdoviridae, genus Ledantevirus) in nycteribiid bat flies infesting pteropodid bats in western Uganda. Mitochondrial DNA analyses revealed that both the bat flies and their bat hosts belong to putative new species. The coding-complete genome of the new virus, named Kanyawara virus (KYAV), is only distantly related to that of its closest known relative, Mount Elgon bat virus, and was found at high titers in bat flies but not in blood or on mucosal surfaces of host bats. Viral genome analysis indicates unusually low CpG dinucleotide depletion in KYAV compared to other ledanteviruses and rhabdovirus groups, with KYAV displaying values similar to rhabdoviruses of arthropods. Our findings highlight the possibility of a yet-to-be-discovered diversity of potentially pathogenic viruses in bat ectoparasites.

  16. Protection from Hendra virus infection with Canarypox recombinant vaccine.

    Science.gov (United States)

    Guillaume-Vasselin, Vanessa; Lemaitre, Laurent; Dhondt, Kévin P; Tedeschi, Laurence; Poulard, Amelie; Charreyre, Catherine; Horvat, Branka

    2016-01-01

    Hendra virus (HeV) is an emerging zoonotic pathogen, which causes severe respiratory illness and encephalitis in humans and horses. Since its first appearance in 1994, spillovers of HeV from its natural reservoir fruit bats occur on almost an annual basis. The high mortality rate in both humans and horses and the wide-ranging reservoir distribution are making HeV a serious public health problem, especially for people exposed to sick horses. This study has aimed to develop an efficient low-cost HeV vaccine for horses based on Canarypox recombinant vector expressing HeV glycoproteins, attachment glycoprotein (G) and fusion protein (F). This vaccine was used to immunise hamsters and then challenged intraperitoneally with HeV 3 weeks later. The higher tested dose of the vaccine efficiently prevented oropharyngeal virus shedding and protected animals from clinical disease and virus-induced mortality. Vaccine induced generation of seroneutralising antibodies and prevented virus-induced histopathological changes and a production of viral RNA and antigens in animal tissues. Interestingly, some vaccinated animals, including those immunised at a lower dose, were protected in the absence of detectable specific antibodies, suggesting the induction of an efficient virus-specific cellular immunity. Finally, ponies immunised using the same vaccination protocol as hamsters developed strong seroneutralising titres against both HeV and closely related Nipah virus, indicating that this vaccine may have the ability to induce cross-protection against Henipavirus infection. These data suggest that Canarypox-based vectors encoding for HeV glycoproteins present very promising new vaccine candidate to prevent infection and shedding of the highly lethal HeV.

  17. Cedar virus: a novel Henipavirus isolated from Australian bats.

    Directory of Open Access Journals (Sweden)

    Glenn A Marsh

    Full Text Available The genus Henipavirus in the family Paramyxoviridae contains two viruses, Hendra virus (HeV and Nipah virus (NiV for which pteropid bats act as the main natural reservoir. Each virus also causes serious and commonly lethal infection of people as well as various species of domestic animals, however little is known about the associated mechanisms of pathogenesis. Here, we report the isolation and characterization of a new paramyxovirus from pteropid bats, Cedar virus (CedPV, which shares significant features with the known henipaviruses. The genome size (18,162 nt and organization of CedPV is very similar to that of HeV and NiV; its nucleocapsid protein displays antigenic cross-reactivity with henipaviruses; and it uses the same receptor molecule (ephrin-B2 for entry during infection. Preliminary challenge studies with CedPV in ferrets and guinea pigs, both susceptible to infection and disease with known henipaviruses, confirmed virus replication and production of neutralizing antibodies although clinical disease was not observed. In this context, it is interesting to note that the major genetic difference between CedPV and HeV or NiV lies within the coding strategy of the P gene, which is known to play an important role in evading the host innate immune system. Unlike HeV, NiV, and almost all known paramyxoviruses, the CedPV P gene lacks both RNA editing and also the coding capacity for the highly conserved V protein. Preliminary study indicated that CedPV infection of human cells induces a more robust IFN-β response than HeV.

  18. Development of human monoclonal antibodies against diseases caused by emerging and biodefense-related viruses.

    Science.gov (United States)

    Zhu, Zhongyu; Dimitrov, Antony S; Chakraborti, Samitabh; Dimitrova, Dimana; Xiao, Xiaodong; Broder, Christopher C; Dimitrov, Dimiter S

    2006-02-01

    Polyclonal antibodies have a century-old history of being effective against some viruses; recently, monoclonal antibodies (mAbs) have also shown success. The humanized mAb Synagis (palivizumab), which is still the only mAb against a viral disease approved by the US FDA, has been widely used as a prophylactic measure against respiratory syncytial virus infections in neonates and immunocompromised individuals. The first fully human mAbs against two other paramyxoviruses, Hendra and Nipah virus, which can cause high (up to 75%) mortality, were recently developed; one of them, m101, showed exceptional potency against infectious virus. In an amazing pace of research, several potent human mAbs targeting the severe acute respiratory syndrome coronavirus S glycoprotein that can affect infections in animal models have been developed months after the virus was identified in 2003. A potent humanized mAb with therapeutic potential was recently developed against the West Nile virus. The progress in developing neutralizing human mAbs against Ebola, Crimean-Congo hemorrhagic fever, vaccinia and other emerging and biodefense-related viruses is slow. A major problem in the development of effective therapeutic agents against viruses, including therapeutic antibodies, is the viruses' heterogeneity and mutability. A related problem is the low binding affinity of crossreactive antibodies able to neutralize a variety of primary isolates. Combinations of mAbs or mAbs with other drugs, and/or the identification of potent new mAbs and their derivatives that target highly conserved viral structures, which are critical for virus entry into cells, are some of the possible solutions to these problems, and will continue to be a major focus of antiviral research.

  19. Transmission or Within-Host Dynamics Driving Pulses of Zoonotic Viruses in Reservoir–Host Populations

    Science.gov (United States)

    Plowright, Raina K.; Peel, Alison J.; Streicker, Daniel G.; Gilbert, Amy T.; McCallum, Hamish; Wood, James; Baker, Michelle L.; Restif, Olivier

    2016-01-01

    Progress in combatting zoonoses that emerge from wildlife is often constrained by limited knowledge of the biology of pathogens within reservoir hosts. We focus on the host–pathogen dynamics of four emerging viruses associated with bats: Hendra, Nipah, Ebola, and Marburg viruses. Spillover of bat infections to humans and domestic animals often coincides with pulses of viral excretion within bat populations, but the mechanisms driving such pulses are unclear. Three hypotheses dominate current research on these emerging bat infections. First, pulses of viral excretion could reflect seasonal epidemic cycles driven by natural variations in population densities and contact rates among hosts. If lifelong immunity follows recovery, viruses may disappear locally but persist globally through migration; in either case, new outbreaks occur once births replenish the susceptible pool. Second, epidemic cycles could be the result of waning immunity within bats, allowing local circulation of viruses through oscillating herd immunity. Third, pulses could be generated by episodic shedding from persistently infected bats through a combination of physiological and ecological factors. The three scenarios can yield similar patterns in epidemiological surveys, but strategies to predict or manage spillover risk resulting from each scenario will be different. We outline an agenda for research on viruses emerging from bats that would allow for differentiation among the scenarios and inform development of evidence-based interventions to limit threats to human and animal health. These concepts and methods are applicable to a wide range of pathogens that affect humans, domestic animals, and wildlife. PMID:27489944

  20. Henipavirus Mediated Membrane Fusion, Virus Entry and Targeted Therapeutics

    Directory of Open Access Journals (Sweden)

    Dimitar B. Nikolov

    2012-02-01

    Full Text Available The Paramyxoviridae genus Henipavirus is presently represented by the type species Hendra and Nipah viruses which are both recently emerged zoonotic viral pathogens responsible for repeated outbreaks associated with high morbidity and mortality in Australia, Southeast Asia, India and Bangladesh. These enveloped viruses bind and enter host target cells through the coordinated activities of their attachment (G and class I fusion (F envelope glycoproteins. The henipavirus G glycoprotein interacts with host cellular B class ephrins, triggering conformational alterations in G that lead to the activation of the F glycoprotein, which facilitates the membrane fusion process. Using the recently published structures of HeV-G and NiV-G and other paramyxovirus glycoproteins, we review the features of the henipavirus envelope glycoproteins that appear essential for mediating the viral fusion process, including receptor binding, G-F interaction, F activation, with an emphasis on G and the mutations that disrupt viral infectivity. Finally, recent candidate therapeutics for henipavirus-mediated disease are summarized in light of their ability to inhibit HeV and NiV entry by targeting their G and F glycoproteins.

  1. A recombinant Hendra virus G glycoprotein-based subunit vaccine protects ferrets from lethal Hendra virus challenge.

    Science.gov (United States)

    Pallister, Jackie; Middleton, Deborah; Wang, Lin-Fa; Klein, Reuben; Haining, Jessica; Robinson, Rachel; Yamada, Manabu; White, John; Payne, Jean; Feng, Yan-Ru; Chan, Yee-Peng; Broder, Christopher C

    2011-08-05

    The henipaviruses, Hendra virus (HeV) and Nipah virus (NiV), are two deadly zoonotic viruses for which no vaccines or therapeutics have yet been approved for human or livestock use. In 14 outbreaks since 1994 HeV has been responsible for multiple fatalities in horses and humans, with all known human infections resulting from close contact with infected horses. A vaccine that prevents virus shedding in infected horses could interrupt the chain of transmission to humans and therefore prevent HeV disease in both. Here we characterise HeV infection in a ferret model and show that it closely mirrors the disease seen in humans and horses with induction of systemic vasculitis, including involvement of the pulmonary and central nervous systems. This model of HeV infection in the ferret was used to assess the immunogenicity and protective efficacy of a subunit vaccine based on a recombinant soluble version of the HeV attachment glycoprotein G (HeVsG), adjuvanted with CpG. We report that ferrets vaccinated with a 100 μg, 20 μg or 4 μg dose of HeVsG remained free of clinical signs of HeV infection following a challenge with 5000 TCID₅₀ of HeV. In addition, and of considerable importance, no evidence of virus or viral genome was detected in any tissues or body fluids in any ferret in the 100 and 20 μg groups, while genome was detected in the nasal washes only of one animal in the 4 μg group. Together, our findings indicate that 100 μg or 20 μg doses of HeVsG vaccine can completely prevent a productive HeV infection in the ferret, suggesting that vaccination to prevent the infection and shedding of HeV is possible. Copyright © 2011 Elsevier Ltd. All rights reserved.

  2. Efficiency criterion for teleportation via channel matrix, measurement matrix and collapsed matrix

    Directory of Open Access Journals (Sweden)

    Xin-Wei Zha

    Full Text Available In this paper, three kinds of coefficient matrixes (channel matrix, measurement matrix, collapsed matrix associated with the pure state for teleportation are presented, the general relation among channel matrix, measurement matrix and collapsed matrix is obtained. In addition, a criterion for judging whether a state can be teleported successfully is given, depending on the relation between the number of parameter of an unknown state and the rank of the collapsed matrix. Keywords: Channel matrix, Measurement matrix, Collapsed matrix, Teleportation

  3. Extended biorthogonal matrix polynomials

    Directory of Open Access Journals (Sweden)

    Ayman Shehata

    2017-01-01

    Full Text Available The pair of biorthogonal matrix polynomials for commutative matrices were first introduced by Varma and Tasdelen in [22]. The main aim of this paper is to extend the properties of the pair of biorthogonal matrix polynomials of Varma and Tasdelen and certain generating matrix functions, finite series, some matrix recurrence relations, several important properties of matrix differential recurrence relations, biorthogonality relations and matrix differential equation for the pair of biorthogonal matrix polynomials J(A,B n (x, k and K(A,B n (x, k are discussed. For the matrix polynomials J(A,B n (x, k, various families of bilinear and bilateral generating matrix functions are constructed in the sequel.

  4. A matrix lower bound

    Energy Technology Data Exchange (ETDEWEB)

    Grcar, Joseph F.

    2002-02-04

    A matrix lower bound is defined that generalizes ideas apparently due to S. Banach and J. von Neumann. The matrix lower bound has a natural interpretation in functional analysis, and it satisfies many of the properties that von Neumann stated for it in a restricted case. Applications for the matrix lower bound are demonstrated in several areas. In linear algebra, the matrix lower bound of a full rank matrix equals the distance to the set of rank-deficient matrices. In numerical analysis, the ratio of the matrix norm to the matrix lower bound is a condition number for all consistent systems of linear equations. In optimization theory, the matrix lower bound suggests an identity for a class of min-max problems. In real analysis, a recursive construction that depends on the matrix lower bound shows that the level sets of continuously differential functions lie asymptotically near those of their tangents.

  5. Matrix completion by deep matrix factorization.

    Science.gov (United States)

    Fan, Jicong; Cheng, Jieyu

    2018-02-01

    Conventional methods of matrix completion are linear methods that are not effective in handling data of nonlinear structures. Recently a few researchers attempted to incorporate nonlinear techniques into matrix completion but there still exists considerable limitations. In this paper, a novel method called deep matrix factorization (DMF) is proposed for nonlinear matrix completion. Different from conventional matrix completion methods that are based on linear latent variable models, DMF is on the basis of a nonlinear latent variable model. DMF is formulated as a deep-structure neural network, in which the inputs are the low-dimensional unknown latent variables and the outputs are the partially observed variables. In DMF, the inputs and the parameters of the multilayer neural network are simultaneously optimized to minimize the reconstruction errors for the observed entries. Then the missing entries can be readily recovered by propagating the latent variables to the output layer. DMF is compared with state-of-the-art methods of linear and nonlinear matrix completion in the tasks of toy matrix completion, image inpainting and collaborative filtering. The experimental results verify that DMF is able to provide higher matrix completion accuracy than existing methods do and DMF is applicable to large matrices. Copyright © 2017 Elsevier Ltd. All rights reserved.

  6. ECHO virus

    Science.gov (United States)

    ... page: //medlineplus.gov/ency/article/001340.htm ECHO virus To use the sharing features on this page, please enable JavaScript. Enteric cytopathic human orphan (ECHO) viruses are a group of viruses that can lead ...

  7. New insights into the Hendra virus attachment and entry process from structures of the virus G glycoprotein and its complex with Ephrin-B2.

    Directory of Open Access Journals (Sweden)

    Kai Xu

    Full Text Available Hendra virus and Nipah virus, comprising the genus Henipavirus, are recently emerged, highly pathogenic and often lethal zoonotic agents against which there are no approved therapeutics. Two surface glycoproteins, the attachment (G and fusion (F, mediate host cell entry. The crystal structures of the Hendra G glycoprotein alone and in complex with the ephrin-B2 receptor reveal that henipavirus uses Tryptophan 122 on ephrin-B2/B3 as a "latch" to facilitate the G-receptor association. Structural-based mutagenesis of residues in the Hendra G glycoprotein at the receptor binding interface document their importance for viral attachments and entry, and suggest that the stability of the Hendra-G-ephrin attachment complex does not strongly correlate with the efficiency of viral entry. In addition, our data indicates that conformational rearrangements of the G glycoprotein head domain upon receptor binding may be the trigger leading to the activation of the viral F fusion glycoprotein during virus infection.

  8. Transition Matrix Cluster Algorithms

    OpenAIRE

    Yevick, David; Lee, Yong Hwan

    2018-01-01

    We demonstrate that a series of simple procedures for increasing the efficiency of transition matrix calculations can be realized by integrating the standard single-spin reversal transition matrix method with global cluster inversion techniques.

  9. The Matrix Cookbook

    DEFF Research Database (Denmark)

    Petersen, Kaare Brandt; Pedersen, Michael Syskind

    Matrix identities, relations and approximations. A desktop reference for quick overview of mathematics of matrices.......Matrix identities, relations and approximations. A desktop reference for quick overview of mathematics of matrices....

  10. Stochastic Matrix Factorization

    OpenAIRE

    Adams, Christopher

    2016-01-01

    This paper considers a restriction to non-negative matrix factorization in which at least one matrix factor is stochastic. That is, the elements of the matrix factors are non-negative and the columns of one matrix factor sum to 1. This restriction includes topic models, a popular method for analyzing unstructured data. It also includes a method for storing and finding pictures. The paper presents necessary and sufficient conditions on the observed data such that the factorization is unique. I...

  11. Matrix with Prescribed Eigenvectors

    Science.gov (United States)

    Ahmad, Faiz

    2011-01-01

    It is a routine matter for undergraduates to find eigenvalues and eigenvectors of a given matrix. But the converse problem of finding a matrix with prescribed eigenvalues and eigenvectors is rarely discussed in elementary texts on linear algebra. This problem is related to the "spectral" decomposition of a matrix and has important technical…

  12. Nucleocytoplasmic Shuttling of Influenza A Virus Proteins

    Directory of Open Access Journals (Sweden)

    Jing Li

    2015-05-01

    Full Text Available Influenza viruses transcribe and replicate their genomes in the nuclei of infected host cells. The viral ribonucleoprotein (vRNP complex of influenza virus is the essential genetic unit of the virus. The viral proteins play important roles in multiple processes, including virus structural maintenance, mediating nucleocytoplasmic shuttling of the vRNP complex, virus particle assembly, and budding. Nucleocytoplasmic shuttling of viral proteins occurs throughout the entire virus life cycle. This review mainly focuses on matrix protein (M1, nucleoprotein (NP, nonstructural protein (NS1, and nuclear export protein (NEP, summarizing the mechanisms of their nucleocytoplasmic shuttling and the regulation of virus replication through their phosphorylation to further understand the regulation of nucleocytoplasmic shuttling in host adaptation of the viruses.

  13. Structure and stabilization of the Hendra virus F glycoprotein in its prefusion form.

    Science.gov (United States)

    Wong, Joyce J W; Paterson, Reay G; Lamb, Robert A; Jardetzky, Theodore S

    2016-01-26

    Hendra virus (HeV) is one of the two prototypical members of the Henipavirus genus of paramyxoviruses, which are designated biosafety level 4 (BSL-4) organisms due to the high mortality rate of Nipah virus (NiV) and HeV in humans. Paramyxovirus cell entry is mediated by the fusion protein, F, in response to binding of a host receptor by the attachment protein. During posttranslational processing, the fusion peptide of F is released and, upon receptor-induced triggering, inserts into the host cell membrane. As F undergoes a dramatic refolding from its prefusion to postfusion conformation, the fusion peptide brings the host and viral membranes together, allowing entry of the viral RNA. Here, we present the crystal structure of the prefusion form of the HeV F ectodomain. The structure shows very high similarity to the structure of prefusion parainfluenza virus 5 (PIV5) F, with the main structural differences in the membrane distal apical loops and the fusion peptide cleavage loop. Functional assays of mutants show that the apical loop can tolerate perturbation in length and surface residues without loss of function, except for residues involved in the stability and conservation of the F protein fold. Structure-based disulfide mutants were designed to anchor the fusion peptide to conformationally invariant residues of the F head. Two mutants were identified that inhibit F-mediated fusion by stabilizing F in its prefusion conformation.

  14. Antibodies to henipavirus or henipa-like viruses in domestic pigs in Ghana, West Africa.

    Directory of Open Access Journals (Sweden)

    David T S Hayman

    Full Text Available Henipaviruses, Hendra virus (HeV and Nipah virus (NiV, have Pteropid bats as their known natural reservoirs. Antibodies against henipaviruses have been found in Eidolon helvum, an old world fruit bat species, and henipavirus-like nucleic acid has been detected in faecal samples from E. helvum in Ghana. The initial outbreak of NiV in Malaysia led to over 265 human encephalitis cases, including 105 deaths, with infected pigs acting as amplifier hosts for NiV during the outbreak. We detected non-neutralizing antibodies against viruses of the genus Henipavirus in approximately 5% of pig sera (N = 97 tested in Ghana, but not in a small sample of other domestic species sampled under a E. helvum roost. Although we did not detect neutralizing antibody, our results suggest prior exposure of the Ghana pig population to henipavirus(es. Because a wide diversity of henipavirus-like nucleic acid sequences have been found in Ghanaian E. helvum, we hypothesise that these pigs might have been infected by henipavirus(es sufficiently divergent enough from HeVor NiV to produce cross-reactive, but not cross-neutralizing antibodies to HeV or NiV.

  15. La experiencia de los virus emergentes en el Caribe colombiano

    Directory of Open Access Journals (Sweden)

    Salim Máttar V

    2010-04-01

    Full Text Available Existe una interrelación muy estrecha entre el hombre, su ecología y el mundo microbiano, tanto el ser humano como los agentes infecciosos han coevolucionado durante milenios (1. La historia demuestra que ha existido una confluencia de diferentes enfermedades infecciosas y las principales civilizaciones. En los últimos años las enfermedades zoonoticas emergentes han ido cobrando una importancia creciente en el terreno de la salud humana y animal, surgiendo nuevas enfermedades procedentes siempre de lugares insospechados y causantes de graves problemas para el hombre o los animales (2. La mayoría de patógenos involucrados en las enfermedades infecciosas emergentes (EIE son de origen bacteriano o rickettsial (54.3%. En este grupo están incluidos los patógenos bacterianos resistentes a los antibióticos. Los patógenos de origen viral y los priones, constituyen el 25.4% de eventos de las EIE, los protozoarios representan el 10.7%, seguido de los hongos 6.3% y los helmintos en un 3.3%. El 60.3% de las enfermedades infecciosas emergentes son causadas por patógenos zoonoticos (2. El 71.8% de estas zoonosis son causados por patógenos que se originan de la fauna silvestre, como la emergencia del virus de Nipah en Malasia y el síndrome respiratorio agudo severo (SARS en China (3.

  16. Physiological stress and Hendra virus in flying-foxes (Pteropus spp., Australia.

    Directory of Open Access Journals (Sweden)

    Lee McMichael

    Full Text Available Pteropid bats (flying-foxes are the natural reservoir of Hendra virus, an emergent paramyxovirus responsible for fatal infection in horses and humans in Australia. Pteropus alecto (the Black flying-fox and the paraphyletic P. conspicillatus (the Spectacled flying-fox appear to be the primary reservoir hosts. Previous studies have suggested that physiological and ecological factors may underpin infection dynamics in flying-foxes, and subsequent spillover to horses and in turn humans. We sought to examine temporal trends in urinary cortisol concentration in wild Australian flying-fox populations, to elucidate the putative relationship between Hendra virus infection and physiological stress. Pooled and individual urine samples were non-invasively collected from under roosting flying-foxes at two latitudinally disparate regions in the eastern Australian state of Queensland. Hendra virus detection, and (in individual urine samples sex and species determination were PCR-based. Urinary cortisol measurement used a validated enzyme immunoassay. We found no direct correlation between increased urinary cortisol and Hendra virus excretion, but our findings do suggest a biologically plausible association between low winter temperatures and elevated cortisol levels in P. alecto in the lower latitude Southeast Queensland roosts. We hypothesize an indirect association between low winter temperatures and increased Hendra virus infection and excretion, mediated by the physiological cost of thermoregulation. Our findings and our approach are directly relevant to elaboration of the disease ecology of Nipah virus and other emerging henipaviruses in bats. More broadly, they inform investigation of emerging disease infection dynamics across the wildlife/livestock/human interface.

  17. Henipavirus microsphere immuno-assays for detection of antibodies against Hendra virus.

    Science.gov (United States)

    McNabb, Leanne; Barr, J; Crameri, G; Juzva, S; Riddell, S; Colling, A; Boyd, V; Broder, C; Wang, L-F; Lunt, R

    2014-05-01

    Hendra and Nipah viruses (HeV and NiV) are closely related zoonotic pathogens of the Paramyxoviridae family. Both viruses belong to the Henipavirus genus and cause fatal disease in animals and humans, though only HeV is endemic in Australia. In general and due to the acute nature of the disease, agent detection by PCR and virus isolation are the primary tools for diagnostic investigations. Assays for the detection of antibodies against HeV are fit more readily for the purpose of surveillance testing in disease epidemiology and to meet certification requirements in the international movement of horses. The first generation indirect ELISA has been affected by non-specific reactions which must be resolved using virus neutralisation serology conducted at laboratory bio-safety level 4 containment (PC4). Recent developments have enabled improvements in the available serology assays. The production of an expressed recombinant truncated HeV G protein has been utilised in ELISA and in Luminex-based multiplexed microsphere assays. In the latter format, two Luminex assays have been developed for use in henipavirus serology: a binding assay (designed for antibody detection and differentiation) and a blocking assay (designed as a surrogate for virus neutralisation). Equine and canine field sera were used to evaluate the two Luminex assays relative to ELISA and virus neutralisation serology. Results showed that Luminex assays can be effective as rapid, sensitive and specific tests for the detection of HeV antibody in horse and dog sera. The tests do not require PC4 containment and are appropriate for high throughput applications as might be required for disease investigations and other epidemiological surveillance. Also, the results show that the Luminex assays detect effectively HeV vaccine-induced antibodies. Copyright © 2014 Elsevier B.V. All rights reserved.

  18. Physiological stress and Hendra virus in flying-foxes (Pteropus spp.), Australia.

    Science.gov (United States)

    McMichael, Lee; Edson, Daniel; Smith, Craig; Mayer, David; Smith, Ina; Kopp, Steven; Meers, Joanne; Field, Hume

    2017-01-01

    Pteropid bats (flying-foxes) are the natural reservoir of Hendra virus, an emergent paramyxovirus responsible for fatal infection in horses and humans in Australia. Pteropus alecto (the Black flying-fox) and the paraphyletic P. conspicillatus (the Spectacled flying-fox) appear to be the primary reservoir hosts. Previous studies have suggested that physiological and ecological factors may underpin infection dynamics in flying-foxes, and subsequent spillover to horses and in turn humans. We sought to examine temporal trends in urinary cortisol concentration in wild Australian flying-fox populations, to elucidate the putative relationship between Hendra virus infection and physiological stress. Pooled and individual urine samples were non-invasively collected from under roosting flying-foxes at two latitudinally disparate regions in the eastern Australian state of Queensland. Hendra virus detection, and (in individual urine samples) sex and species determination were PCR-based. Urinary cortisol measurement used a validated enzyme immunoassay. We found no direct correlation between increased urinary cortisol and Hendra virus excretion, but our findings do suggest a biologically plausible association between low winter temperatures and elevated cortisol levels in P. alecto in the lower latitude Southeast Queensland roosts. We hypothesize an indirect association between low winter temperatures and increased Hendra virus infection and excretion, mediated by the physiological cost of thermoregulation. Our findings and our approach are directly relevant to elaboration of the disease ecology of Nipah virus and other emerging henipaviruses in bats. More broadly, they inform investigation of emerging disease infection dynamics across the wildlife/livestock/human interface.

  19. Parallelism in matrix computations

    CERN Document Server

    Gallopoulos, Efstratios; Sameh, Ahmed H

    2016-01-01

    This book is primarily intended as a research monograph that could also be used in graduate courses for the design of parallel algorithms in matrix computations. It assumes general but not extensive knowledge of numerical linear algebra, parallel architectures, and parallel programming paradigms. The book consists of four parts: (I) Basics; (II) Dense and Special Matrix Computations; (III) Sparse Matrix Computations; and (IV) Matrix functions and characteristics. Part I deals with parallel programming paradigms and fundamental kernels, including reordering schemes for sparse matrices. Part II is devoted to dense matrix computations such as parallel algorithms for solving linear systems, linear least squares, the symmetric algebraic eigenvalue problem, and the singular-value decomposition. It also deals with the development of parallel algorithms for special linear systems such as banded ,Vandermonde ,Toeplitz ,and block Toeplitz systems. Part III addresses sparse matrix computations: (a) the development of pa...

  20. Secondary metabolites extracted from marine sponge associated Comamonas testosteroni and Citrobacter freundii as potential antimicrobials against MDR pathogens and hypothetical leads for VP40 matrix protein of Ebola virus: an in vitro and in silico investigation.

    Science.gov (United States)

    Skariyachan, Sinosh; Acharya, Archana B; Subramaniyan, Saumya; Babu, Sumangala; Kulkarni, Shruthi; Narayanappa, Rajeswari

    2016-09-01

    The current study explores therapeutic potential of metabolites extracted from marine sponge (Cliona sp.)-associated bacteria against MDR pathogens and predicts the binding prospective of probable lead molecules against VP40 target of Ebola virus. The metabolite-producing bacteria were characterized by agar overlay assay and as per the protocols in Bergey's manual of determinative bacteriology. The antibacterial activities of extracted metabolites were tested against clinical pathogens by well-diffusion assay. The selected metabolite producers were characterized by 16S rDNA sequencing. Chemical screening and Fourier Transform Infrared (FTIR) analysis for selected compounds were performed. The probable lead molecules present in the metabolites were hypothesized based on proximate analysis, FTIR data, and literature survey. The drug-like properties and binding potential of lead molecules against VP40 target of Ebola virus were hypothesized by computational virtual screening and molecular docking. The current study demonstrated that clear zones around bacterial colonies in agar overlay assay. Antibiotic sensitivity profiling demonstrated that the clinical isolates were multi-drug resistant, however; most of them showed sensitivity to secondary metabolites (MIC-15 μl/well). The proximate and FTIR analysis suggested that probable metabolites belonged to alkaloids with O-H, C-H, C=O, and N-H groups. 16S rDNA characterization of selected metabolite producers demonstrated that 96% and 99% sequence identity to Comamonas testosteroni and Citrobacter freundii, respectively. The docking studies suggested that molecules such as Gymnastatin, Sorbicillactone, Marizomib, and Daryamide can designed as probable lead candidates against VP40 target of Ebola virus.

  1. Crystal Structure of the Marburg Virus VP35 Oligomerization Domain

    Energy Technology Data Exchange (ETDEWEB)

    Bruhn, Jessica F.; Kirchdoerfer, Robert N.; Urata, Sarah M.; Li, Sheng; Tickle, Ian J.; Bricogne, Gérard; Saphire, Erica Ollmann (Scripps); (Globel Phasing); (UCSD)

    2016-11-09

    ABSTRACT

    Marburg virus (MARV) is a highly pathogenic filovirus that is classified in a genus distinct from that of Ebola virus (EBOV) (generaMarburgvirusandEbolavirus, respectively). Both viruses produce a multifunctional protein termed VP35, which acts as a polymerase cofactor, a viral protein chaperone, and an antagonist of the innate immune response. VP35 contains a central oligomerization domain with a predicted coiled-coil motif. This domain has been shown to be essential for RNA polymerase function. Here we present crystal structures of the MARV VP35 oligomerization domain. These structures and accompanying biophysical characterization suggest that MARV VP35 is a trimer. In contrast, EBOV VP35 is likely a tetramer in solution. Differences in the oligomeric state of this protein may explain mechanistic differences in replication and immune evasion observed for MARV and EBOV.

    IMPORTANCEMarburg virus can cause severe disease, with up to 90% human lethality. Its genome is concise, only producing seven proteins. One of the proteins, VP35, is essential for replication of the viral genome and for evasion of host immune responses. VP35 oligomerizes (self-assembles) in order to function, yet the structure by which it assembles has not been visualized. Here we present two crystal structures of this oligomerization domain. In both structures, three copies of VP35 twist about each other to form a coiled coil. This trimeric assembly is in contrast to tetrameric predictions for VP35 of Ebola virus and to known structures of homologous proteins in the measles, mumps, and Nipah viruses. Distinct oligomeric states of the Marburg and Ebola virus VP35 proteins may explain differences between them in polymerase function and immune evasion. These findings may provide a more accurate understanding of the

  2. This could be the start of something big—20 years since the identification of bats as the natural host of Hendra virus

    Directory of Open Access Journals (Sweden)

    Peter Black

    2015-12-01

    Full Text Available Hendra virus was first described in 1994 in Australia, causally associated with a cluster of fatal equine and human cases at a thoroughbred racing stable in the Brisbane suburb of Hendra. This year marks the twentieth anniversary of the identification of pteropid bats (flying-foxes as the natural host of the virus, and it is timely to reflect on a pivotal meeting of an eclectic group of scientists in that process. They included animal and public health experts, environmental scientists, veterinary and horse industry representatives, and wildlife experts. The task was to review and prioritise wildlife surveillance seeking the origin of the previously unknown virus. The group determined that the likely reservoir must occur in disparate locations, and be capable of moving between locations, or exist in continuous, overlapping populations spanning multiple locations. Flying-foxes were considered to be a more probable source of the novel virus than birds. Within weeks, antibodies were detected in several species of flying-fox, and the virus was subsequently isolated. While the identification of the natural host of Hendra virus within 18 months of its description was remarkable in itself, a broader legacy followed. In the subsequent years, a suite of zoonotic viruses including Australian bat lyssavirus, Nipah virus, SARS coronavirus, and Ebola and Marburg viruses have been detected in bats. Bats are now the “go to” taxa for novel viruses. History has repeatedly demonstrated that knowledge begets knowledge. This simple notion of bringing a diverse group of people together in an environment of mutual respect reinforced this principle and proves that the sum is often so much more powerful than the parts.

  3. This could be the start of something big-20 years since the identification of bats as the natural host of Hendra virus.

    Science.gov (United States)

    Black, Peter; Douglas, Ian; Field, Hume

    2015-12-01

    Hendra virus was first described in 1994 in Australia, causally associated with a cluster of fatal equine and human cases at a thoroughbred racing stable in the Brisbane suburb of Hendra. This year marks the twentieth anniversary of the identification of pteropid bats (flying-foxes) as the natural host of the virus, and it is timely to reflect on a pivotal meeting of an eclectic group of scientists in that process. They included animal and public health experts, environmental scientists, veterinary and horse industry representatives, and wildlife experts. The task was to review and prioritise wildlife surveillance seeking the origin of the previously unknown virus. The group determined that the likely reservoir must occur in disparate locations, and be capable of moving between locations, or exist in continuous, overlapping populations spanning multiple locations. Flying-foxes were considered to be a more probable source of the novel virus than birds. Within weeks, antibodies were detected in several species of flying-fox, and the virus was subsequently isolated. While the identification of the natural host of Hendra virus within 18 months of its description was remarkable in itself, a broader legacy followed. In the subsequent years, a suite of zoonotic viruses including Australian bat lyssavirus, Nipah virus, SARS coronavirus, and Ebola and Marburg viruses have been detected in bats. Bats are now the "go to" taxa for novel viruses. History has repeatedly demonstrated that knowledge begets knowledge. This simple notion of bringing a diverse group of people together in an environment of mutual respect reinforced this principle and proves that the sum is often so much more powerful than the parts.

  4. Impact of anti-virus software on computer virus dynamical behavior

    Science.gov (United States)

    Sun, Mei; Li, Dandan; Han, Dun; Jia, Changsheng

    2014-11-01

    The impact of anti-virus software on the spreading of computer virus is investigated via developing a mathematical model in this paper. Considering the anti-virus software may not be effective, as it may be an outdated version, and then the computers may be infected with a reduced incidence rate. According to the method of next generation matrix, the basic reproduction number is derived. By introducing appropriate Lyapunov function and the Routh stability criterion, acquiring the stability conditions of the virus-free equilibrium and virus equilibrium. The effect of anti-virus software and disconnecting rate on the spreading of virus are also analyzed. When combined with the numerical results, a set of suggestions are put forward for eradicating virus effectively.

  5. Patience of matrix games

    DEFF Research Database (Denmark)

    Hansen, Kristoffer Arnsfelt; Ibsen-Jensen, Rasmus; Podolskii, Vladimir V.

    2013-01-01

    For matrix games we study how small nonzero probability must be used in optimal strategies. We show that for image win–lose–draw games (i.e. image matrix games) nonzero probabilities smaller than image are never needed. We also construct an explicit image win–lose game such that the unique optimal...

  6. Unitarity of CKM Matrix

    CERN Document Server

    Saleem, M

    2002-01-01

    The Unitarity of the CKM matrix is examined in the light of the latest available accurate data. The analysis shows that a conclusive result cannot be derived at present. Only more precise data can determine whether the CKM matrix opens new vistas beyond the standard model or not.

  7. Probability matrix decomposition models

    NARCIS (Netherlands)

    Maris, E.; DeBoeck, P.; Mechelen, I. van

    1996-01-01

    In this paper, we consider a class of models for two-way matrices with binary entries of 0 and 1. First, we consider Boolean matrix decomposition, conceptualize it as a latent response model (LRM) and, by making use of this conceptualization, generalize it to a larger class of matrix decomposition

  8. Triangularization of a Matrix

    Indian Academy of Sciences (India)

    ). From this one can see that this equality is als9 true for diagonalizable matrices; just note that eSAs-. 1 = SeAS-I. Finally, the equality car- ries over to all matrices since both sides are continuous functions of a matrix and every matrix is a limit ...

  9. Zika Virus

    Science.gov (United States)

    ... through blood transfusions. There have been outbreaks of Zika virus in the United States, Africa, Southeast Asia, the ... not travel to areas where there is a Zika virus outbreak. If you do decide to travel, first ...

  10. Zika Virus

    Science.gov (United States)

    ... which is responsible for transmitting Zika virus. Photo Courtesy of: James Gathany, Centers for Disease Control and ... National Institute of Allergy and Infectious Diseases. Photo Courtesy of NIH "You could have a Zika virus ...

  11. Chikungunya Virus

    Science.gov (United States)

    ... Gaines, PhD, MPH, MA, CHES Differentiating Chikungunya From Dengue: A Clinical Challenge For Travelers CDC Travelers' Health Chikungunya Virus Home Prevention Transmission Symptoms & Treatment Geographic Distribution Chikungunya virus in the United States ...

  12. Fuzzy vulnerability matrix

    International Nuclear Information System (INIS)

    Baron, Jorge H.; Rivera, S.S.

    2000-01-01

    The so-called vulnerability matrix is used in the evaluation part of the probabilistic safety assessment for a nuclear power plant, during the containment event trees calculations. This matrix is established from what is knows as Numerical Categories for Engineering Judgement. This matrix is usually established with numerical values obtained with traditional arithmetic using the set theory. The representation of this matrix with fuzzy numbers is much more adequate, due to the fact that the Numerical Categories for Engineering Judgement are better represented with linguistic variables, such as 'highly probable', 'probable', 'impossible', etc. In the present paper a methodology to obtain a Fuzzy Vulnerability Matrix is presented, starting from the recommendations on the Numerical Categories for Engineering Judgement. (author)

  13. Matrix comparison, Part 2

    DEFF Research Database (Denmark)

    Schneider, Jesper Wiborg; Borlund, Pia

    2007-01-01

    The present two-part article introduces matrix comparison as a formal means for evaluation purposes in informetric studies such as cocitation analysis. In the first part, the motivation behind introducing matrix comparison to informetric studies, as well as two important issues influencing...... such comparisons, matrix generation, and the composition of proximity measures, are introduced and discussed. In this second part, the authors introduce and thoroughly demonstrate two related matrix comparison techniques the Mantel test and Procrustes analysis, respectively. These techniques can compare...... and evaluate the degree of monotonicity between different proximity measures or their ordination results. In common with these techniques is the application of permutation procedures to test hypotheses about matrix resemblances. The choice of technique is related to the validation at hand. In the case...

  14. Hepadna viruses

    Energy Technology Data Exchange (ETDEWEB)

    Robinson, W.; Koike, K.; Will, H.

    1987-01-01

    This book examines the molecular biology, disease pathogenesis, epidemiology, and clinical features of hepadna and other viruses with hepatic tropism and outlines future directions and approaches for their management. The volume's six sections provide a review of the various features, mechanisms, and functions of these viruses, ranging from hepadna virus replication and regulation of gene expression to the structure and function of hepadna-virus gene products.

  15. C-terminal tyrosine residues modulate the fusion activity of the Hendra virus fusion protein.

    Science.gov (United States)

    Popa, Andreea; Pager, Cara Teresia; Dutch, Rebecca Ellis

    2011-02-15

    The paramyxovirus family includes important human pathogens such as measles, mumps, respiratory syncytial virus, and the recently emerged, highly pathogenic Hendra and Nipah viruses. The viral fusion (F) protein plays critical roles in infection, promoting both the virus-cell membrane fusion events needed for viral entry as well as cell-cell fusion events leading to syncytia formation. We describe the surprising finding that addition of the short epitope HA tag to the cytoplasmic tail (CT) of the Hendra virus F protein leads to a significant increase in the extent of cell-cell membrane fusion. This increase was not due to alterations in surface expression, cleavage state, or association with lipid microdomains. Addition of a Myc tag of similar length did not alter Hendra F protein fusion activity, indicating that the observed stimulation was not solely a result of lengthening the CT. Three tyrosine residues within the HA tag were critical for the increase in the extent of fusion, suggesting C-terminal tyrosines may modulate Hendra fusion activity. The effects of addition of the HA tag varied with other fusion proteins, as parainfluenza virus 5 F-HA showed a decreased level of surface expression and no stimulation of fusion. These results indicate that additions to the C-terminal end of the F protein CT can modulate protein function in a sequence specific manner, reinforcing the need for careful analysis of epitope-tagged glycoproteins. In addition, our results implicate C-terminal tyrosine residues in the modulation of the membrane fusion reaction promoted by these viral glycoproteins.

  16. A comparative analysis of viral matrix proteins using disorder predictors

    Directory of Open Access Journals (Sweden)

    Dunker A Keith

    2008-10-01

    Full Text Available Abstract Background A previous study (Goh G.K.-M., Dunker A.K., Uversky V.N. (2008 Protein intrinsic disorder toolbox for comparative analysis of viral proteins. BMC Genomics. 9 (Suppl. 2, S4 revealed that HIV matrix protein p17 possesses especially high levels of predicted intrinsic disorder (PID. In this study, we analyzed the PID patterns in matrix proteins of viruses related and unrelated to HIV-1. Results Both SIVmac and HIV-1 p17 proteins were predicted by PONDR VLXT to be highly disordered with subtle differences containing 50% and 60% disordered residues, respectively. SIVmac is very closely related to HIV-2. A specific region that is predicted to be disordered in HIV-1 is missing in SIVmac. The distributions of PID patterns seem to differ in SIVmac and HIV-1 p17 proteins. A high level of PID for the matrix does not seem to be mandatory for retroviruses, since Equine Infectious Anemia Virus (EIAV, an HIV cousin, has been predicted to have low PID level for the matrix; i.e. its matrix protein p15 contains only 21% PID residues. Surprisingly, the PID percentage and the pattern of predicted disorder distribution for p15 resemble those of the influenza matrix protein M1 (25%. Conclusion Our data might have important implications in the search for HIV vaccines since disorder in the matrix protein might provide a mechanism for immune evasion.

  17. The nuclear reaction matrix

    International Nuclear Information System (INIS)

    Krenciglowa, E.M.; Kung, C.L.; Kuo, T.T.S.; Osnes, E.; and Department of Physics, State University of New York at Stony Brook, Stony Brook, New York 11794)

    1976-01-01

    Different definitions of the reaction matrix G appropriate to the calculation of nuclear structure are reviewed and discussed. Qualitative physical arguments are presented in support of a two-step calculation of the G-matrix for finite nuclei. In the first step the high-energy excitations are included using orthogonalized plane-wave intermediate states, and in the second step the low-energy excitations are added in, using harmonic oscillator intermediate states. Accurate calculations of G-matrix elements for nuclear structure calculations in the Aapprox. =18 region are performed following this procedure and treating the Pauli exclusion operator Q 2 /sub p/ by the method of Tsai and Kuo. The treatment of Q 2 /sub p/, the effect of the intermediate-state spectrum and the energy dependence of the reaction matrix are investigated in detail. The present matrix elements are compared with various matrix elements given in the literature. In particular, close agreement is obtained with the matrix elements calculated by Kuo and Brown using approximate methods

  18. Nuclear reaction matrix

    International Nuclear Information System (INIS)

    Krenciglowa, E.M.; Kung, C.L.; Kuo, T.T.S.; Osnes, E.

    1975-01-01

    Different definitions of the reaction matrix G appropriate to the calculation of nuclear structure are reviewed and discussed. Qualitative physical arguments are presented in support of a two-step calculation of the G-matrix for finite nuclei. In the first step the high-energy excitations are included using orthogonalized plane-wave intermediate states, and in the second step the low-energy excitations are added in, using harmonic oscillator intermediate states. Accurate calculations of G-matrix elements for nuclear structure calculations in the A approximately 18 region are performed following this procedure and treating the Pauli exclusion operator Q/sub 2p/ by the method of Tsai and Kuo. The treatment of Q/sub 2p/, the effect of the intermediate-state spectrum and the energy dependence of the reaction matrix are investigated in detail. The present matrix elements are compared with various matrix elements given in the literature. In particular, close argument is obtained with the matrix elements calculated by Kuo and Brown using approximate methods

  19. N-matrix completion problem

    OpenAIRE

    Araújo, C. Mendes; Torregrosa, Juan R.; Urbano, Ana M.

    2003-01-01

    An n x n matrix is called an N-matrix if all principal minors are negative. In this paper, we are interested in N-matrix completion problems, that is, when a partial N-matrix hás an N-matrix completion. In general, a combinatorially or non-combinatorially symmetric partial N-matrix does not have an N-matrix completion. Here we prove that a combinatorially symmetric partial N-matrix has an N-matrix completion if the graph of its specified entries is a 1-chordal graph. We also prove that there ...

  20. Elementary matrix theory

    CERN Document Server

    Eves, Howard

    1980-01-01

    The usefulness of matrix theory as a tool in disciplines ranging from quantum mechanics to psychometrics is widely recognized, and courses in matrix theory are increasingly a standard part of the undergraduate curriculum.This outstanding text offers an unusual introduction to matrix theory at the undergraduate level. Unlike most texts dealing with the topic, which tend to remain on an abstract level, Dr. Eves' book employs a concrete elementary approach, avoiding abstraction until the final chapter. This practical method renders the text especially accessible to students of physics, engineeri

  1. Quantifying matrix product state

    Science.gov (United States)

    Bhatia, Amandeep Singh; Kumar, Ajay

    2018-03-01

    Motivated by the concept of quantum finite-state machines, we have investigated their relation with matrix product state of quantum spin systems. Matrix product states play a crucial role in the context of quantum information processing and are considered as a valuable asset for quantum information and communication purpose. It is an effective way to represent states of entangled systems. In this paper, we have designed quantum finite-state machines of one-dimensional matrix product state representations for quantum spin systems.

  2. The biofilm matrix.

    Science.gov (United States)

    Flemming, Hans-Curt; Wingender, Jost

    2010-09-01

    The microorganisms in biofilms live in a self-produced matrix of hydrated extracellular polymeric substances (EPS) that form their immediate environment. EPS are mainly polysaccharides, proteins, nucleic acids and lipids; they provide the mechanical stability of biofilms, mediate their adhesion to surfaces and form a cohesive, three-dimensional polymer network that interconnects and transiently immobilizes biofilm cells. In addition, the biofilm matrix acts as an external digestive system by keeping extracellular enzymes close to the cells, enabling them to metabolize dissolved, colloidal and solid biopolymers. Here we describe the functions, properties and constituents of the EPS matrix that make biofilms the most successful forms of life on earth.

  3. One-step separation of myristoylated and nonmyristoylated retroviral matrix proteins

    Czech Academy of Sciences Publication Activity Database

    Doležal, Michal; Zábranský, Aleš; Hrabal, R.; Ruml, T.; Pichová, Iva; Rumlová, Michaela

    2013-01-01

    Roč. 92, č. 1 (2013), s. 94-99 ISSN 1046-5928 R&D Projects: GA ČR GA204/09/1388 Institutional support: RVO:61388963 Keywords : matrix protein * mouse mammary tumor virus * murine leukemia virus * myristoylation * N-myristoyltransferase * retrovirus Subject RIV: CE - Biochemistry Impact factor: 1.508, year: 2013

  4. Tendon functional extracellular matrix.

    Science.gov (United States)

    Screen, Hazel R C; Berk, David E; Kadler, Karl E; Ramirez, Francesco; Young, Marian F

    2015-06-01

    This article is one of a series, summarizing views expressed at the Orthopaedic Research Society New Frontiers in Tendon Research Conference. This particular article reviews the three workshops held under the "Functional Extracellular Matrix" stream. The workshops focused on the roles of the tendon extracellular matrix, such as performing the mechanical functions of tendon, creating the local cell environment, and providing cellular cues. Tendon is a complex network of matrix and cells, and its biological functions are influenced by widely varying extrinsic and intrinsic factors such as age, nutrition, exercise levels, and biomechanics. Consequently, tendon adapts dynamically during development, aging, and injury. The workshop discussions identified research directions associated with understanding cell-matrix interactions to be of prime importance for developing novel strategies to target tendon healing or repair. © 2015 Orthopaedic Research Society. Published by Wiley Periodicals, Inc.

  5. Universal influenza virus vaccines and therapeutic antibodies.

    Science.gov (United States)

    Nachbagauer, R; Krammer, F

    2017-04-01

    Current influenza virus vaccines are effective when well matched to the circulating strains. Unfortunately, antigenic drift and the high diversity of potential emerging zoonotic and pandemic viruses make it difficult to select the right strains for vaccine production. This problem causes vaccine mismatches, which lead to sharp drops in vaccine effectiveness and long response times to manufacture matched vaccines in case of novel pandemic viruses. To provide an overview of universal influenza virus vaccines and therapeutic antibodies in preclinical and clinical development. PubMed and clinicaltrials.gov were used as sources for this review. Universal influenza virus vaccines that target conserved regions of the influenza virus including the haemagglutinin stalk domain, the ectodomain of the M2 ion channel or the internal matrix and nucleoproteins are in late preclinical and clinical development. These vaccines could confer broad protection against all influenza A and B viruses including drift variants and thereby abolish the need for annual re-formulation and re-administration of influenza virus vaccines. In addition, these novel vaccines would enhance preparedness against emerging influenza virus pandemics. Finally, novel therapeutic antibodies against the same conserved targets are in clinical development and could become valuable tools in the fight against influenza virus infection. Both universal influenza virus vaccines and therapeutic antibodies are potential future options for the control of human influenza infections. Copyright © 2017 European Society of Clinical Microbiology and Infectious Diseases. Published by Elsevier Ltd. All rights reserved.

  6. Hacking the Matrix.

    Science.gov (United States)

    Czerwinski, Michael; Spence, Jason R

    2017-01-05

    Recently in Nature, Gjorevski et al. (2016) describe a fully defined synthetic hydrogel that mimics the extracellular matrix to support in vitro growth of intestinal stem cells and organoids. The hydrogel allows exquisite control over the chemical and physical in vitro niche and enables identification of regulatory properties of the matrix. Copyright © 2017 Elsevier Inc. All rights reserved.

  7. The Matrix Organization Revisited

    DEFF Research Database (Denmark)

    Gattiker, Urs E.; Ulhøi, John Parm

    1999-01-01

    This paper gives a short overview of matrix structure and technology management. It outlines some of the characteristics and also points out that many organizations may actualy be hybrids (i.e. mix several ways of organizing to allocate resorces effectively).......This paper gives a short overview of matrix structure and technology management. It outlines some of the characteristics and also points out that many organizations may actualy be hybrids (i.e. mix several ways of organizing to allocate resorces effectively)....

  8. CHLORELLA VIRUSES

    Science.gov (United States)

    Yamada, Takashi; Onimatsu, Hideki; Van Etten, James L.

    2007-01-01

    Chlorella viruses or chloroviruses are large, icosahedral, plaque‐forming, double‐stranded‐DNA—containing viruses that replicate in certain strains of the unicellular green alga Chlorella. DNA sequence analysis of the 330‐kbp genome of Paramecium bursaria chlorella virus 1 (PBCV‐1), the prototype of this virus family (Phycodnaviridae), predict ∼366 protein‐encoding genes and 11 tRNA genes. The predicted gene products of ∼50% of these genes resemble proteins of known function, including many that are completely unexpected for a virus. In addition, the chlorella viruses have several features and encode many gene products that distinguish them from most viruses. These products include: (1) multiple DNA methyltransferases and DNA site‐specific endonucleases, (2) the enzymes required to glycosylate their proteins and synthesize polysaccharides such as hyaluronan and chitin, (3) a virus‐encoded K+ channel (called Kcv) located in the internal membrane of the virions, (4) a SET domain containing protein (referred to as vSET) that dimethylates Lys27 in histone 3, and (5) PBCV‐1 has three types of introns; a self‐splicing intron, a spliceosomal processed intron, and a small tRNA intron. Accumulating evidence indicates that the chlorella viruses have a very long evolutionary history. This review mainly deals with research on the virion structure, genome rearrangements, gene expression, cell wall degradation, polysaccharide synthesis, and evolution of PBCV‐1 as well as other related viruses. PMID:16877063

  9. Matrix Information Geometry

    CERN Document Server

    Bhatia, Rajendra

    2013-01-01

    This book is an outcome of the Indo-French Workshop on Matrix Information Geometries (MIG): Applications in Sensor and Cognitive Systems Engineering, which was held in Ecole Polytechnique and Thales Research and Technology Center, Palaiseau, France, in February 23-25, 2011. The workshop was generously funded by the Indo-French Centre for the Promotion of Advanced Research (IFCPAR).  During the event, 22 renowned invited french or indian speakers gave lectures on their areas of expertise within the field of matrix analysis or processing. From these talks, a total of 17 original contribution or state-of-the-art chapters have been assembled in this volume. All articles were thoroughly peer-reviewed and improved, according to the suggestions of the international referees. The 17 contributions presented  are organized in three parts: (1) State-of-the-art surveys & original matrix theory work, (2) Advanced matrix theory for radar processing, and (3) Matrix-based signal processing applications.  

  10. Fast methods for resumming matrix polynomials and Chebyshev matrix polynomials

    International Nuclear Information System (INIS)

    Liang Wanzen; Baer, Roi; Saravanan, Chandra; Shao Yihan; Bell, Alexis T.; Head-Gordon, Martin

    2004-01-01

    Fast and effective algorithms are discussed for resumming matrix polynomials and Chebyshev matrix polynomials. These algorithms lead to a significant speed-up in computer time by reducing the number of matrix multiplications required to roughly twice the square root of the degree of the polynomial. A few numerical tests are presented, showing that evaluation of matrix functions via polynomial expansions can be preferable when the matrix is sparse and these fast resummation algorithms are employed

  11. 2016 MATRIX annals

    CERN Document Server

    Praeger, Cheryl; Tao, Terence

    2018-01-01

    MATRIX is Australia’s international, residential mathematical research institute. It facilitates new collaborations and mathematical advances through intensive residential research programs, each lasting 1-4 weeks. This book is a scientific record of the five programs held at MATRIX in its first year, 2016: Higher Structures in Geometry and Physics (Chapters 1-5 and 18-21); Winter of Disconnectedness (Chapter 6 and 22-26); Approximation and Optimisation (Chapters 7-8); Refining C*-Algebraic Invariants for Dynamics using KK-theory (Chapters 9-13); Interactions between Topological Recursion, Modularity, Quantum Invariants and Low-dimensional Topology (Chapters 14-17 and 27). The MATRIX Scientific Committee selected these programs based on their scientific excellence and the participation rate of high-profile international participants. Each program included ample unstructured time to encourage collaborative research; some of the longer programs also included an embedded conference or lecture series. The artic...

  12. Matrix interdiction problem

    Energy Technology Data Exchange (ETDEWEB)

    Pan, Feng [Los Alamos National Laboratory; Kasiviswanathan, Shiva [Los Alamos National Laboratory

    2010-01-01

    In the matrix interdiction problem, a real-valued matrix and an integer k is given. The objective is to remove k columns such that the sum over all rows of the maximum entry in each row is minimized. This combinatorial problem is closely related to bipartite network interdiction problem which can be applied to prioritize the border checkpoints in order to minimize the probability that an adversary can successfully cross the border. After introducing the matrix interdiction problem, we will prove the problem is NP-hard, and even NP-hard to approximate with an additive n{gamma} factor for a fixed constant {gamma}. We also present an algorithm for this problem that achieves a factor of (n-k) mUltiplicative approximation ratio.

  13. Dynamic Matrix Rank

    DEFF Research Database (Denmark)

    Frandsen, Gudmund Skovbjerg; Frandsen, Peter Frands

    2009-01-01

    We consider maintaining information about the rank of a matrix under changes of the entries. For n×n matrices, we show an upper bound of O(n1.575) arithmetic operations and a lower bound of Ω(n) arithmetic operations per element change. The upper bound is valid when changing up to O(n0.575) entries...... in a single column of the matrix. We also give an algorithm that maintains the rank using O(n2) arithmetic operations per rank one update. These bounds appear to be the first nontrivial bounds for the problem. The upper bounds are valid for arbitrary fields, whereas the lower bound is valid for algebraically...... closed fields. The upper bound for element updates uses fast rectangular matrix multiplication, and the lower bound involves further development of an earlier technique for proving lower bounds for dynamic computation of rational functions....

  14. Elementary matrix algebra

    CERN Document Server

    Hohn, Franz E

    2012-01-01

    This complete and coherent exposition, complemented by numerous illustrative examples, offers readers a text that can teach by itself. Fully rigorous in its treatment, it offers a mathematically sound sequencing of topics. The work starts with the most basic laws of matrix algebra and progresses to the sweep-out process for obtaining the complete solution of any given system of linear equations - homogeneous or nonhomogeneous - and the role of matrix algebra in the presentation of useful geometric ideas, techniques, and terminology.Other subjects include the complete treatment of the structur

  15. Complex matrix model duality

    Energy Technology Data Exchange (ETDEWEB)

    Brown, T.W.

    2010-11-15

    The same complex matrix model calculates both tachyon scattering for the c=1 non-critical string at the self-dual radius and certain correlation functions of half-BPS operators in N=4 super- Yang-Mills. It is dual to another complex matrix model where the couplings of the first model are encoded in the Kontsevich-like variables of the second. The duality between the theories is mirrored by the duality of their Feynman diagrams. Analogously to the Hermitian Kontsevich- Penner model, the correlation functions of the second model can be written as sums over discrete points in subspaces of the moduli space of punctured Riemann surfaces. (orig.)

  16. Expression, purification and crystallization of a lyssavirus matrix (M) protein

    Energy Technology Data Exchange (ETDEWEB)

    Assenberg, René [Division of Structural Biology and Oxford Protein Production Facility, The Henry Wellcome Building for Genomic Medicine, Oxford University, Roosevelt Drive, Oxford OX3 7BN (United Kingdom); Delmas, Olivier [UPRE Lyssavirus Dynamics and Host Adaptation, WHO Collaborating Centre for Reference and Research on Rabies, Institut Pasteur, 28 Rue du Docteur Roux, 75724 Paris CEDEX 15 (France); Graham, Stephen C.; Verma, Anil; Berrow, Nick; Stuart, David I.; Owens, Raymond J. [Division of Structural Biology and Oxford Protein Production Facility, The Henry Wellcome Building for Genomic Medicine, Oxford University, Roosevelt Drive, Oxford OX3 7BN (United Kingdom); Bourhy, Hervé [UPRE Lyssavirus Dynamics and Host Adaptation, WHO Collaborating Centre for Reference and Research on Rabies, Institut Pasteur, 28 Rue du Docteur Roux, 75724 Paris CEDEX 15 (France); Grimes, Jonathan M., E-mail: jonathan@strubi.ox.ac.uk [Division of Structural Biology and Oxford Protein Production Facility, The Henry Wellcome Building for Genomic Medicine, Oxford University, Roosevelt Drive, Oxford OX3 7BN (United Kingdom)

    2008-04-01

    The expression, purification and crystallization of the full-length matrix protein from three lyssaviruses is described. The matrix (M) proteins of lyssaviruses (family Rhabdoviridae) are crucial to viral morphogenesis as well as in modulating replication and transcription of the viral genome. To date, no high-resolution structural information has been obtained for full-length rhabdovirus M. Here, the cloning, expression and purification of the matrix proteins from three lyssaviruses, Lagos bat virus (LAG), Mokola virus and Thailand dog virus, are described. Crystals have been obtained for the full-length M protein from Lagos bat virus (LAG M). Successful crystallization depended on a number of factors, in particular the addition of an N-terminal SUMO fusion tag to increase protein solubility. Diffraction data have been recorded from crystals of native and selenomethionine-labelled LAG M to 2.75 and 3.0 Å resolution, respectively. Preliminary analysis indicates that these crystals belong to space group P6{sub 1}22 or P6{sub 5}22, with unit-cell parameters a = b = 56.9–57.2, c = 187.9–188.6 Å, consistent with the presence of one molecule per asymmetric unit, and structure determination is currently in progress.

  17. SARS virus

    Indian Academy of Sciences (India)

    First page Back Continue Last page Overview Graphics. SARS virus. Novel corona virus emerges in the new millenia. Genome sequences invariant- global isolates do not show differences of consequence.Protein spike similar. HE gene absent. 2787 nucleotides. Largest genome. Jumps species by genetic deletion.

  18. CHANDIPURA VIRUS

    Indian Academy of Sciences (India)

    First page Back Continue Last page Overview Graphics. CHANDIPURA VIRUS. First isolated from a village called Chandipura near Nagpur in 1965 in India. Belongs to rhabdoviridae family. Used as a Model System to study RNA virus multiplication in the infected cell at molecular level. Notes:

  19. Schmallenberg Virus

    Indian Academy of Sciences (India)

    IAS Admin

    challenged with emerging and re-emerging infections that pose a constant threat to human and animal health. Indeed, researchers around the globe are still fighting deadly diseases like malaria, trypanosomosis and AIDS. In this article, we focus on a recently identified virus, namely, Schmallenberg virus as an example of a.

  20. Phytophthora viruses.

    Science.gov (United States)

    Cai, Guohong; Hillman, Bradley I

    2013-01-01

    Phytophthora sp. is a genus in the oomycetes, which are similar to filamentous fungi in morphology and habitat, but phylogenetically more closely related to brown algae and diatoms and fall in the kingdom Stramenopila. In the past few years, several viruses have been characterized in Phytophthora species, including four viruses from Phytophthora infestans, the late blight pathogen, and an endornavirus from an unnamed Phytophthora species from Douglas fir. Studies on Phytophthora viruses have revealed several interesting systems. Phytophthora infestans RNA virus 1 (PiRV-1) and PiRV-2 are likely the first members of two new virus families; studies on PiRV-3 support the establishment of a new virus genus that is not affiliated with established virus families; PiRV-4 is a member of Narnaviridae, most likely in the genus Narnavirus; and Phytophthora endornavirus 1 (PEV1) was the first nonplant endornavirus at the time of reporting. Viral capsids have not been found in any of the above-mentioned viruses. PiRV-1 demonstrated a unique genome organization that requires further examination, and PiRV-2 may have played a role in late blight resurgence in 1980s-1990s. Copyright © 2013 Elsevier Inc. All rights reserved.

  1. R-matrix methods

    International Nuclear Information System (INIS)

    Robb, W.D.

    1978-01-01

    The procedures used in the application of R-matrix theory to atomic and molecular collision processes are presented. The computationally advantageous features of these methods are high-lighted, and some applications to electron scattering and photoionization are briefly discussed

  2. A Matrix Isolation Infrared

    Indian Academy of Sciences (India)

    The elusive ≡C-H· · ·O complex in the hydrogen bonded systems of Phenylacetylene: A Matrix Isolation Infrared and Ab Initio Study ... A comparison of the spectral shifts observed in the features of PhAc-MeOH and PhAc-DEE would therefore independently confirm the existence or not of n-σ* complex in both these systems.

  3. Challenging the CSCW matrix

    DEFF Research Database (Denmark)

    Jørnø, Rasmus Leth Vergmann; Gynther, Karsten; Christensen, Ove

    2014-01-01

    useful information, we question whether the axis of time and space comprising the matrix pertains to relevant defining properties of the tools, technology or learning environments to which they are applied. Subsequently we offer an example of an Adobe Connect e-learning session as an illustration...

  4. R-matrix analysis

    International Nuclear Information System (INIS)

    Dodder, D.C.

    1975-01-01

    Scattering and reaction processes involving very few nucleons are studied via the R matrix formalism of Wigner and Eisenbud. As examples, the d + 3 He, p + 4 He, 3 He + 4 He, and p + 6 Li are considered. (3 figures) (SDF)

  5. Combinatorial matrix theory

    CERN Document Server

    Mitjana, Margarida

    2018-01-01

    This book contains the notes of the lectures delivered at an Advanced Course on Combinatorial Matrix Theory held at Centre de Recerca Matemàtica (CRM) in Barcelona. These notes correspond to five series of lectures. The first series is dedicated to the study of several matrix classes defined combinatorially, and was delivered by Richard A. Brualdi. The second one, given by Pauline van den Driessche, is concerned with the study of spectral properties of matrices with a given sign pattern. Dragan Stevanović delivered the third one, devoted to describing the spectral radius of a graph as a tool to provide bounds of parameters related with properties of a graph. The fourth lecture was delivered by Stephen Kirkland and is dedicated to the applications of the Group Inverse of the Laplacian matrix. The last one, given by Ángeles Carmona, focuses on boundary value problems on finite networks with special in-depth on the M-matrix inverse problem.

  6. In silico design of cyclic peptides as influenza virus, a subtype H1N1 ...

    African Journals Online (AJOL)

    Arli Parikesit

    2012-06-28

    Jun 28, 2012 ... basis of its genus, there are three types of influenza viruses: type A, B and C. Influenza A and B viruses have. 8 ribonucleic acid (RNA) segments, while type C has seven RNA segments. Nucleic acid of influenza virus was translated to about 10 proteins, haemaglutinin (HA), neuraminidase (NA), matrix ...

  7. Expression, characterisation and antigenicity of a truncated Hendra virus attachment protein expressed in the protozoan host Leishmania tarentolae.

    Science.gov (United States)

    Fischer, Kerstin; dos Reis, Vinicius Pinho; Finke, Stefan; Sauerhering, Lucie; Stroh, Eileen; Karger, Axel; Maisner, Andrea; Groschup, Martin H; Diederich, Sandra; Balkema-Buschmann, Anne

    2016-02-01

    Hendra virus (HeV) is an emerging zoonotic paramyxovirus within the genus Henipavirus that has caused severe morbidity and mortality in humans and horses in Australia since 1994. HeV infection of host cells is mediated by the membrane bound attachment (G) and fusion (F) glycoproteins, that are essential for receptor binding and fusion of viral and cellular membranes. The eukaryotic unicellular parasite Leishmania tarentolae has recently been established as a powerful tool to express recombinant proteins with mammalian-like glycosylation patterns, but only few viral proteins have been expressed in this system so far. Here, we describe the purification of a truncated, Strep-tag labelled and soluble version of the HeV attachment protein (sHeV G) expressed in stably transfected L. tarentolae cells. After Strep-tag purification the identity of sHeV G was confirmed by immunoblotting and mass spectrometry. The functional binding of sHeV G to the HeV cell entry receptor ephrin-B2 was confirmed in several binding assays. Generated polyclonal rabbit antiserum against sHeV G reacted with both HeV and Nipah virus (NiV) G proteins in immunofluorescence assay and efficiently neutralised NiV infection, thus further supporting the preserved antigenicity of the purified protein. Copyright © 2015 The Authors. Published by Elsevier B.V. All rights reserved.

  8. Strategies of highly pathogenic RNA viruses to block dsRNA detection by RIG-I-like receptors: hide, mask, hit.

    Science.gov (United States)

    Zinzula, Luca; Tramontano, Enzo

    2013-12-01

    Double-stranded RNA (dsRNA) is synthesized during the course of infection by RNA viruses as a byproduct of replication and transcription and acts as a potent trigger of the host innate antiviral response. In the cytoplasm of the infected cell, recognition of the presence of viral dsRNA as a signature of "non-self" nucleic acid is carried out by RIG-I-like receptors (RLRs), a set of dedicated helicases whose activation leads to the production of type I interferon α/β (IFN-α/β). To overcome the innate antiviral response, RNA viruses encode suppressors of IFN-α/β induction, which block RLRs recognition of dsRNA by means of different mechanisms that can be categorized into: (i) dsRNA binding and/or shielding ("hide"), (ii) dsRNA termini processing ("mask") and (iii) direct interaction with components of the RLRs pathway ("hit"). In light of recent functional, biochemical and structural findings, we review the inhibition mechanisms of RLRs recognition of dsRNA displayed by a number of highly pathogenic RNA viruses with different disease phenotypes such as haemorrhagic fever (Ebola, Marburg, Lassa fever, Lujo, Machupo, Junin, Guanarito, Crimean-Congo, Rift Valley fever, dengue), severe respiratory disease (influenza, SARS, Hendra, Hantaan, Sin Nombre, Andes) and encephalitis (Nipah, West Nile). Copyright © 2013 Elsevier B.V. All rights reserved.

  9. Computer viruses

    Science.gov (United States)

    Denning, Peter J.

    1988-01-01

    The worm, Trojan horse, bacterium, and virus are destructive programs that attack information stored in a computer's memory. Virus programs, which propagate by incorporating copies of themselves into other programs, are a growing menace in the late-1980s world of unprotected, networked workstations and personal computers. Limited immunity is offered by memory protection hardware, digitally authenticated object programs,and antibody programs that kill specific viruses. Additional immunity can be gained from the practice of digital hygiene, primarily the refusal to use software from untrusted sources. Full immunity requires attention in a social dimension, the accountability of programmers.

  10. Sparse matrix decompositions for clustering

    OpenAIRE

    Blumensath, Thomas

    2014-01-01

    Clustering can be understood as a matrix decomposition problem, where a feature vector matrix is represented as a product of two matrices, a matrix of cluster centres and a matrix with sparse columns, where each column assigns individual features to one of the cluster centres. This matrix factorisation is the basis of classical clustering methods, such as those based on non-negative matrix factorisation but can also be derived for other methods, such as k-means clustering. In this paper we de...

  11. Paths correlation matrix.

    Science.gov (United States)

    Qian, Weixian; Zhou, Xiaojun; Lu, Yingcheng; Xu, Jiang

    2015-09-15

    Both the Jones and Mueller matrices encounter difficulties when physically modeling mixed materials or rough surfaces due to the complexity of light-matter interactions. To address these issues, we derived a matrix called the paths correlation matrix (PCM), which is a probabilistic mixture of Jones matrices of every light propagation path. Because PCM is related to actual light propagation paths, it is well suited for physical modeling. Experiments were performed, and the reflection PCM of a mixture of polypropylene and graphite was measured. The PCM of the mixed sample was accurately decomposed into pure polypropylene's single reflection, pure graphite's single reflection, and depolarization caused by multiple reflections, which is consistent with the theoretical derivation. Reflection parameters of rough surface can be calculated from PCM decomposition, and the results fit well with the theoretical calculations provided by the Fresnel equations. These theoretical and experimental analyses verify that PCM is an efficient way to physically model light-matter interactions.

  12. Partially separable t matrix

    International Nuclear Information System (INIS)

    Sasakawa, T.; Okuno, H.; Ishikawa, S.; Sawada, T.

    1982-01-01

    The off-shell t matrix is expressed as a sum of one nonseparable and one separable terms so that it is useful for applications to more-than-two body problems. All poles are involved in this one separable term. Both the nonseparable and the separable terms of the kernel G 0 t are regular at the origin. The nonseparable term of this kernel vanishes at large distances, while the separable term behaves asymptotically as the spherical Hankel function. These properties make our expression free from defects inherent in the Jost or the K-matrix expressions, and many applications are anticipated. As the application, a compact expression of the many-level formula is presented. Also the application is suggested to the breakup threebody problem based on the Faddeev equation. It is demonstrated that the breakup amplitude is expressed in a simple and physically interesting form and we can calculate it in coordinate space

  13. A matrix contraction process

    Science.gov (United States)

    Wilkinson, Michael; Grant, John

    2018-03-01

    We consider a stochastic process in which independent identically distributed random matrices are multiplied and where the Lyapunov exponent of the product is positive. We continue multiplying the random matrices as long as the norm, ɛ, of the product is less than unity. If the norm is greater than unity we reset the matrix to a multiple of the identity and then continue the multiplication. We address the problem of determining the probability density function of the norm, \

  14. Holomorphic matrix integrals

    International Nuclear Information System (INIS)

    Felder, Giovanni; Riser, Roman

    2004-01-01

    We study a class of holomorphic matrix models. The integrals are taken over middle-dimensional cycles in the space of complex square matrices. As the size of the matrices tends to infinity, the distribution of eigenvalues is given by a measure with support on a collection of arcs in the complex planes. We show that the arcs are level sets of the imaginary part of a hyperelliptic integral connecting branch points

  15. Matrix groups for undergraduates

    CERN Document Server

    Tapp, Kristopher

    2016-01-01

    Matrix groups touch an enormous spectrum of the mathematical arena. This textbook brings them into the undergraduate curriculum. It makes an excellent one-semester course for students familiar with linear and abstract algebra and prepares them for a graduate course on Lie groups. Matrix Groups for Undergraduates is concrete and example-driven, with geometric motivation and rigorous proofs. The story begins and ends with the rotations of a globe. In between, the author combines rigor and intuition to describe the basic objects of Lie theory: Lie algebras, matrix exponentiation, Lie brackets, maximal tori, homogeneous spaces, and roots. This second edition includes two new chapters that allow for an easier transition to the general theory of Lie groups. From reviews of the First Edition: This book could be used as an excellent textbook for a one semester course at university and it will prepare students for a graduate course on Lie groups, Lie algebras, etc. … The book combines an intuitive style of writing w...

  16. Extracellular matrix structure.

    Science.gov (United States)

    Theocharis, Achilleas D; Skandalis, Spyros S; Gialeli, Chrysostomi; Karamanos, Nikos K

    2016-02-01

    Extracellular matrix (ECM) is a non-cellular three-dimensional macromolecular network composed of collagens, proteoglycans/glycosaminoglycans, elastin, fibronectin, laminins, and several other glycoproteins. Matrix components bind each other as well as cell adhesion receptors forming a complex network into which cells reside in all tissues and organs. Cell surface receptors transduce signals into cells from ECM, which regulate diverse cellular functions, such as survival, growth, migration, and differentiation, and are vital for maintaining normal homeostasis. ECM is a highly dynamic structural network that continuously undergoes remodeling mediated by several matrix-degrading enzymes during normal and pathological conditions. Deregulation of ECM composition and structure is associated with the development and progression of several pathologic conditions. This article emphasizes in the complex ECM structure as to provide a better understanding of its dynamic structural and functional multipotency. Where relevant, the implication of the various families of ECM macromolecules in health and disease is also presented. Copyright © 2015 Elsevier B.V. All rights reserved.

  17. Standard Errors for Matrix Correlations.

    Science.gov (United States)

    Ogasawara, Haruhiko

    1999-01-01

    Derives the asymptotic standard errors and intercorrelations for several matrix correlations assuming multivariate normality for manifest variables and derives the asymptotic standard errors of the matrix correlations for two factor-loading matrices. (SLD)

  18. Virophages or satellite viruses?

    Science.gov (United States)

    Krupovic, Mart; Cvirkaite-Krupovic, Virginija

    2011-11-01

    It has been argued that the smaller viruses associated with giant DNA viruses are a new biological entity. However, Mart Krupovic and Virginija Cvirkaite-Krupovic argue here that these smaller viruses should be classified with the satellite viruses.

  19. The cellulose resource matrix.

    Science.gov (United States)

    Keijsers, Edwin R P; Yılmaz, Gülden; van Dam, Jan E G

    2013-03-01

    The emerging biobased economy is causing shifts from mineral fossil oil based resources towards renewable resources. Because of market mechanisms, current and new industries utilising renewable commodities, will attempt to secure their supply of resources. Cellulose is among these commodities, where large scale competition can be expected and already is observed for the traditional industries such as the paper industry. Cellulose and lignocellulosic raw materials (like wood and non-wood fibre crops) are being utilised in many industrial sectors. Due to the initiated transition towards biobased economy, these raw materials are intensively investigated also for new applications such as 2nd generation biofuels and 'green' chemicals and materials production (Clark, 2007; Lange, 2007; Petrus & Noordermeer, 2006; Ragauskas et al., 2006; Regalbuto, 2009). As lignocellulosic raw materials are available in variable quantities and qualities, unnecessary competition can be avoided via the choice of suitable raw materials for a target application. For example, utilisation of cellulose as carbohydrate source for ethanol production (Kabir Kazi et al., 2010) avoids the discussed competition with easier digestible carbohydrates (sugars, starch) deprived from the food supply chain. Also for cellulose use as a biopolymer several different competing markets can be distinguished. It is clear that these applications and markets will be influenced by large volume shifts. The world will have to reckon with the increase of competition and feedstock shortage (land use/biodiversity) (van Dam, de Klerk-Engels, Struik, & Rabbinge, 2005). It is of interest - in the context of sustainable development of the bioeconomy - to categorize the already available and emerging lignocellulosic resources in a matrix structure. When composing such "cellulose resource matrix" attention should be given to the quality aspects as well as to the available quantities and practical possibilities of processing the

  20. Structural characterization by transmission electron microscopy and immunoreactivity of recombinant Hendra virus nucleocapsid protein expressed and purified from Escherichia coli.

    Science.gov (United States)

    Pearce, Lesley A; Yu, Meng; Waddington, Lynne J; Barr, Jennifer A; Scoble, Judith A; Crameri, Gary S; McKinstry, William J

    2015-12-01

    Hendra virus (family Paramyxoviridae) is a negative sense single-stranded RNA virus (NSRV) which has been found to cause disease in humans, horses, and experimentally in other animals, e.g. pigs and cats. Pteropid bats commonly known as flying foxes have been identified as the natural host reservoir. The Hendra virus nucleocapsid protein (HeV N) represents the most abundant viral protein produced by the host cell, and is highly immunogenic with naturally infected humans and horses producing specific antibodies towards this protein. The purpose of this study was to express and purify soluble, functionally active recombinant HeV N, suitable for use as an immunodiagnostic reagent to detect antibodies against HeV. We expressed both full-length HeV N, (HeV NFL), and a C-terminal truncated form, (HeV NCORE), using a bacterial heterologous expression system. Both HeV N constructs were engineered with an N-terminal Hisx6 tag, and purified using a combination of immobilized metal affinity chromatography (IMAC) and size exclusion chromatography (SEC). Purified recombinant HeV N proteins self-assembled into soluble higher order oligomers as determined by SEC and negative-stain transmission electron microscopy. Both HeV N proteins were highly immuno-reactive with sera from animals and humans infected with either HeV or the closely related Nipah virus (NiV), but displayed no immuno-reactivity towards sera from animals infected with a non-pathogenic paramyxovirus (CedPV), or animals receiving Equivac® (HeV G glycoprotein subunit vaccine), using a Luminex-based multiplexed microsphere assay. Crown Copyright © 2015. Published by Elsevier Inc. All rights reserved.

  1. The V protein of Tioman virus is incapable of blocking type I interferon signaling in human cells.

    Directory of Open Access Journals (Sweden)

    Grégory Caignard

    Full Text Available The capacity of a virus to cross species barriers is determined by the development of bona fide interactions with cellular components of new hosts, and in particular its ability to block IFN-α/β antiviral signaling. Tioman virus (TioV, a close relative of mumps virus (MuV, has been isolated in giant fruit bats in Southeast Asia. Nipah and Hendra viruses, which are present in the same bat colonies, are highly pathogenic in human. Despite serological evidences of close contacts between TioV and human populations, whether TioV is associated to some human pathology remains undetermined. Here we show that in contrast to the V protein of MuV, the V protein of TioV (TioV-V hardly interacts with human STAT2, does not degrade STAT1, and cannot block IFN-α/β signaling in human cells. In contrast, TioV-V properly binds to human STAT3 and MDA5, and thus interferes with IL-6 signaling and IFN-β promoter induction in human cells. Because STAT2 binding was previously identified as a host restriction factor for some Paramyxoviridae, we established STAT2 sequence from giant fruit bats, and binding to TioV-V was tested. Surprisingly, TioV-V interaction with STAT2 from giant fruit bats is also extremely weak and barely detectable. Altogether, our observations question the capacity of TioV to appropriately control IFN-α/β signaling in both human and giant fruit bats that are considered as its natural host.

  2. Matrix Encryption Scheme

    Directory of Open Access Journals (Sweden)

    Abdelhakim Chillali

    2017-05-01

    Full Text Available In classical cryptography, the Hill cipher is a polygraphic substitution cipher based on linear algebra. In this work, we proposed a new problem applicable to the public key cryptography, based on the Matrices, called “Matrix discrete logarithm problem”, it uses certain elements formed by matrices whose coefficients are elements in a finite field. We have constructed an abelian group and, for the cryptographic part in this unreliable group, we then perform the computation corresponding to the algebraic equations, Returning the encrypted result to a receiver. Upon receipt of the result, the receiver can retrieve the sender’s clear message by performing the inverse calculation.

  3. Matrix string partition function

    CERN Document Server

    Kostov, Ivan K; Kostov, Ivan K.; Vanhove, Pierre

    1998-01-01

    We evaluate quasiclassically the Ramond partition function of Euclidean D=10 U(N) super Yang-Mills theory reduced to a two-dimensional torus. The result can be interpreted in terms of free strings wrapping the space-time torus, as expected from the point of view of Matrix string theory. We demonstrate that, when extrapolated to the ultraviolet limit (small area of the torus), the quasiclassical expressions reproduce exactly the recently obtained expression for the partition of the completely reduced SYM theory, including the overall numerical factor. This is an evidence that our quasiclassical calculation might be exact.

  4. Matrix vector analysis

    CERN Document Server

    Eisenman, Richard L

    2005-01-01

    This outstanding text and reference applies matrix ideas to vector methods, using physical ideas to illustrate and motivate mathematical concepts but employing a mathematical continuity of development rather than a physical approach. The author, who taught at the U.S. Air Force Academy, dispenses with the artificial barrier between vectors and matrices--and more generally, between pure and applied mathematics.Motivated examples introduce each idea, with interpretations of physical, algebraic, and geometric contexts, in addition to generalizations to theorems that reflect the essential structur

  5. Matrix algebra for linear models

    CERN Document Server

    Gruber, Marvin H J

    2013-01-01

    Matrix methods have evolved from a tool for expressing statistical problems to an indispensable part of the development, understanding, and use of various types of complex statistical analyses. This evolution has made matrix methods a vital part of statistical education. Traditionally, matrix methods are taught in courses on everything from regression analysis to stochastic processes, thus creating a fractured view of the topic. Matrix Algebra for Linear Models offers readers a unique, unified view of matrix analysis theory (where and when necessary), methods, and their applications. Written f

  6. Computer Viruses. Technology Update.

    Science.gov (United States)

    Ponder, Tim, Comp.; Ropog, Marty, Comp.; Keating, Joseph, Comp.

    This document provides general information on computer viruses, how to help protect a computer network from them, measures to take if a computer becomes infected. Highlights include the origins of computer viruses; virus contraction; a description of some common virus types (File Virus, Boot Sector/Partition Table Viruses, Trojan Horses, and…

  7. Matrix proteins as centralized organizers of negative-sense RNA virions.

    Science.gov (United States)

    Liljeroos, Lassi; Butcher, Sarah J

    2013-01-01

    Matrix proteins are essential components of most negative-sense RNA, enveloped viruses. They serve a wide range of duties ranging from self-driven membrane budding and coordination of other viral components to modulation of viral transcription. The functional similarity between these proteins is striking, despite major differences in their structures. Whereas biochemical and structural studies have partly been hindered by the inherent aggregation properties of these proteins, their cellular functions are beginning to be understood. In this review we summarize the current knowledge on negative-sense RNA virus matrix proteins and their interactions with other viral and cellular proteins. We also discuss the similarities and differences in matrix protein functions between the different families within the negative-sense RNA viruses.

  8. Hendra virus.

    Science.gov (United States)

    Middleton, Deborah

    2014-12-01

    Hendra virus infection of horses occurred sporadically between 1994 and 2010 as a result of spill-over from the viral reservoir in Australian mainland flying-foxes, and occasional onward transmission to people also followed from exposure to affected horses. An unprecedented number of outbreaks were recorded in 2011 leading to heightened community concern. Release of an inactivated subunit vaccine for horses against Hendra virus represents the first commercially available product that is focused on mitigating the impact of a Biosafety Level 4 pathogen. Through preventing the development of acute Hendra virus disease in horses, vaccine use is also expected to reduce the risk of transmission of infection to people. Crown Copyright © 2014. Published by Elsevier Inc. All rights reserved.

  9. Ceramic matrix and resin matrix composites - A comparison

    Science.gov (United States)

    Hurwitz, Frances I.

    1987-01-01

    The underlying theory of continuous fiber reinforcement of ceramic matrix and resin matrix composites, their fabrication, microstructure, physical and mechanical properties are contrasted. The growing use of organometallic polymers as precursors to ceramic matrices is discussed as a means of providing low temperature processing capability without the fiber degradation encountered with more conventional ceramic processing techniques. Examples of ceramic matrix composites derived from particulate-filled, high char yield polymers and silsesquioxane precursors are provided.

  10. Ceramic matrix and resin matrix composites: A comparison

    Science.gov (United States)

    Hurwitz, Frances I.

    1987-01-01

    The underlying theory of continuous fiber reinforcement of ceramic matrix and resin matrix composites, their fabrication, microstructure, physical and mechanical properties are contrasted. The growing use of organometallic polymers as precursors to ceramic matrices is discussed as a means of providing low temperature processing capability without the fiber degradation encountered with more conventional ceramic processing techniques. Examples of ceramic matrix composites derived from particulate-filled, high char yield polymers and silsesquioxane precursors are provided.

  11. A matrix big bang

    Science.gov (United States)

    Craps, Ben; Sethi, Savdeep; Verlinde, Erik

    2005-10-01

    The light-like linear dilaton background represents a particularly simple time-dependent 1/2 BPS solution of critical type-IIA superstring theory in ten dimensions. Its lift to M-theory, as well as its Einstein frame metric, are singular in the sense that the geometry is geodesically incomplete and the Riemann tensor diverges along a light-like subspace of codimension one. We study this background as a model for a big bang type singularity in string theory/M-theory. We construct the dual Matrix theory description in terms of a (1+1)-d supersymmetric Yang-Mills theory on a time-dependent world-sheet given by the Milne orbifold of (1+1)-d Minkowski space. Our model provides a framework in which the physics of the singularity appears to be under control.

  12. Light cone matrix product

    Energy Technology Data Exchange (ETDEWEB)

    Hastings, Matthew B [Los Alamos National Laboratory

    2009-01-01

    We show how to combine the light-cone and matrix product algorithms to simulate quantum systems far from equilibrium for long times. For the case of the XXZ spin chain at {Delta} = 0.5, we simulate to a time of {approx} 22.5. While part of the long simulation time is due to the use of the light-cone method, we also describe a modification of the infinite time-evolving bond decimation algorithm with improved numerical stability, and we describe how to incorporate symmetry into this algorithm. While statistical sampling error means that we are not yet able to make a definite statement, the behavior of the simulation at long times indicates the appearance of either 'revivals' in the order parameter as predicted by Hastings and Levitov (e-print arXiv:0806.4283) or of a distinct shoulder in the decay of the order parameter.

  13. A matrix big bang

    International Nuclear Information System (INIS)

    Craps, Ben; Sethi, Savdeep; Verlinde, Erik

    2005-01-01

    The light-like linear dilaton background represents a particularly simple time-dependent 1/2 BPS solution of critical type-IIA superstring theory in ten dimensions. Its lift to M-theory, as well as its Einstein frame metric, are singular in the sense that the geometry is geodesically incomplete and the Riemann tensor diverges along a light-like subspace of codimension one. We study this background as a model for a big bang type singularity in string theory/M-theory. We construct the dual Matrix theory description in terms of a (1+1)-d supersymmetric Yang-Mills theory on a time-dependent world-sheet given by the Milne orbifold of (1+1)-d Minkowski space. Our model provides a framework in which the physics of the singularity appears to be under control

  14. A matrix big bang

    Energy Technology Data Exchange (ETDEWEB)

    Craps, Ben [Instituut voor Theoretische Fysica, Universiteit van Amsterdam, Valckenierstraat 65, 1018 XE Amsterdam (Netherlands); Sethi, Savdeep [Enrico Fermi Institute, University of Chicago, Chicago, IL 60637 (United States); Verlinde, Erik [Instituut voor Theoretische Fysica, Universiteit van Amsterdam, Valckenierstraat 65, 1018 XE Amsterdam (Netherlands)

    2005-10-15

    The light-like linear dilaton background represents a particularly simple time-dependent 1/2 BPS solution of critical type-IIA superstring theory in ten dimensions. Its lift to M-theory, as well as its Einstein frame metric, are singular in the sense that the geometry is geodesically incomplete and the Riemann tensor diverges along a light-like subspace of codimension one. We study this background as a model for a big bang type singularity in string theory/M-theory. We construct the dual Matrix theory description in terms of a (1+1)-d supersymmetric Yang-Mills theory on a time-dependent world-sheet given by the Milne orbifold of (1+1)-d Minkowski space. Our model provides a framework in which the physics of the singularity appears to be under control.

  15. Correntropy Based Matrix Completion

    Directory of Open Access Journals (Sweden)

    Yuning Yang

    2018-03-01

    Full Text Available This paper studies the matrix completion problems when the entries are contaminated by non-Gaussian noise or outliers. The proposed approach employs a nonconvex loss function induced by the maximum correntropy criterion. With the help of this loss function, we develop a rank constrained, as well as a nuclear norm regularized model, which is resistant to non-Gaussian noise and outliers. However, its non-convexity also leads to certain difficulties. To tackle this problem, we use the simple iterative soft and hard thresholding strategies. We show that when extending to the general affine rank minimization problems, under proper conditions, certain recoverability results can be obtained for the proposed algorithms. Numerical experiments indicate the improved performance of our proposed approach.

  16. Schmallenberg Virus

    Indian Academy of Sciences (India)

    IAS Admin

    combat many infectious-disease-causing agents over the years. However, evolution is a continuous process ... newly emerging virus infection that poses threat to the livestock industries. In addition to describing the life ... are the Symptoms of Infection by SBV. The first clinical signs in adult animals are acute diarrhoea, a dip.

  17. An Application of Matrix Multiplication

    Indian Academy of Sciences (India)

    IAS Admin

    vector whose entries are all non-negative and have sum. 1, and a transition matrix to be a square matrix, each of whose rows is a probability vector. We then define a finite Markov chain (or simply a chain) to consist of an n × n transition matrix P and a 1 × n row vector x: The positions Ei are the states of the chain and our aim.

  18. Homolumo Gap and Matrix Model

    CERN Document Server

    Andric, I; Jurman, D; Nielsen, H B

    2007-01-01

    We discuss a dynamical matrix model by which probability distribution is associated with Gaussian ensembles from random matrix theory. We interpret the matrix M as a Hamiltonian representing interaction of a bosonic system with a single fermion. We show that a system of second-quantized fermions influences the ground state of the whole system by producing a gap between the highest occupied eigenvalue and the lowest unoccupied eigenvalue.

  19. HUMAN PAPILLOMA VIRUS — ONCOGENIC VIRUS

    Directory of Open Access Journals (Sweden)

    A.N. Mayansky

    2010-01-01

    Full Text Available The lecture is devoted to oncogenic viruses, particularly human papilloma virus. Papilloma viral infection is found in all parts of the globe and highly contagious. In addition to exhaustive current data on classification, specifics of papilloma viruses composition and epidemiology, the author describes in great detail the malignization mechanisms of papilloma viruses pockets. Also, issues of diagnostics and specific prevention and treatment of diseases caused by this virus are illustrated. Key words: oncogenic viruses, papilloma viruses, prevention, vaccination. (Pediatric Pharmacology. – 2010; 7(4:48-55

  20. Multivariate Matrix-Exponential Distributions

    DEFF Research Database (Denmark)

    Bladt, Mogens; Nielsen, Bo Friis

    2010-01-01

    be written as linear combinations of the elements in the exponential of a matrix. For this reason we shall refer to multivariate distributions with rational Laplace transform as multivariate matrix-exponential distributions (MVME). The marginal distributions of an MVME are univariate matrix......-exponential distributions. We prove a characterization that states that a distribution is an MVME distribution if and only if all non-negative, non-null linear combinations of the coordinates have a univariate matrix-exponential distribution. This theorem is analog to a well-known characterization theorem...

  1. G. Einstein matrix and nano-biophotonic treatment

    Science.gov (United States)

    Przybyl-Einstein, George; Moratin, Holdy; Garcia, Eduardo

    2005-04-01

    The publication is presenting the Einstein Matrix Treatment Method and initial results for blood borne diseases on example of hepatitis, HIV and arthritis. The initial research was conducted at Einstein Clinical Laboratories S.A. on limited funds. The treatment and method is strongly recommended for specific viruses bacteria in blood borne diseases but also for treatment of none specific viruses and bacteria in emergency treatments as SARS or ANTHRAX to safe life of the human. In the past years the Individual's Safety is in jeopardy by natural viral infections as well as by engineering cultured viruses and bacteria. Viruses mutate and become more resistant to current known medical treatment, in many cases partially efficient. This event required new testing method to investigate the possibility of treatments and to create new vaccine for non-specific viral and bacteria or viruses infections that causes death to thousands adults and children. The authors present in this paper the possibility of treatment of the non-specific viral, bacterial infections of the blood in human body. This treatment has safe procedure and no known side effect up to this time for patients that were treated at Einstein Clinical Laboratories SA.

  2. Oligomerization and polymerization of the filovirus matrix protein VP40

    International Nuclear Information System (INIS)

    Timmins, Joanna; Schoehn, Guy; Kohlhaas, Christine; Klenk, Hans-Dieter; Ruigrok, Rob W.H.; Weissenhorn, Winfried

    2003-01-01

    The matrix protein VP40 from Ebola virus plays an important role in the assembly process of virus particles by interacting with cellular factors, cellular membranes, and the ribonuclearprotein particle complex. Here we show that the N-terminal domain of VP40 folds into a mixture of two different oligomeric states in vitro, namely hexameric and octameric ringlike structures, as detected by gel filtration chromatography, chemical cross-linking, and electron microscopy. Octamer formation depends largely on the interaction with nucleic acids, which in turn confers in vitro SDS resistance. Refolding experiments with a nucleic acid free N-terminal domain preparation reveal a mostly dimeric form of VP40, which is transformed into an SDS resistant octamer upon incubation with E. coli nucleic acids. In addition, we demonstrate that the N-terminal domain of Marburg virus VP40 also folds into ringlike structures, similar to Ebola virus VP40. Interestingly, Marburg virus VP40 rings reveal a high tendency to polymerize into rods composed of stacked rings. These results may suggest distinct roles for different oligomeric forms of VP40 in the filovirus life cycle

  3. Oligomerization and polymerization of the filovirus matrix protein VP40.

    Science.gov (United States)

    Timmins, Joanna; Schoehn, Guy; Kohlhaas, Christine; Klenk, Hans-Dieter; Ruigrok, Rob W H; Weissenhorn, Winfríed

    2003-08-01

    The matrix protein VP40 from Ebola virus plays an important role in the assembly process of virus particles by interacting with cellular factors, cellular membranes, and the ribonuclearprotein particle complex. Here we show that the N-terminal domain of VP40 folds into a mixture of two different oligomeric states in vitro, namely hexameric and octameric ringlike structures, as detected by gel filtration chromatography, chemical cross-linking, and electron microscopy. Octamer formation depends largely on the interaction with nucleic acids, which in turn confers in vitro SDS resistance. Refolding experiments with a nucleic acid free N-terminal domain preparation reveal a mostly dimeric form of VP40, which is transformed into an SDS resistant octamer upon incubation with E. coli nucleic acids. In addition, we demonstrate that the N-terminal domain of Marburg virus VP40 also folds into ringlike structures, similar to Ebola virus VP40. Interestingly, Marburg virus VP40 rings reveal a high tendency to polymerize into rods composed of stacked rings. These results may suggest distinct roles for different oligomeric forms of VP40 in the filovirus life cycle.

  4. New vaccines against influenza virus

    Science.gov (United States)

    Lee, Young-Tae; Kim, Ki-Hye; Ko, Eun-Ju; Lee, Yu-Na; Kim, Min-Chul; Kwon, Young-Man; Tang, Yinghua; Cho, Min-Kyoung; Lee, Youn-Jeong

    2014-01-01

    Vaccination is one of the most effective and cost-benefit interventions that prevent the mortality and reduce morbidity from infectious pathogens. However, the licensed influenza vaccine induces strain-specific immunity and must be updated annually based on predicted strains that will circulate in the upcoming season. Influenza virus still causes significant health problems worldwide due to the low vaccine efficacy from unexpected outbreaks of next epidemic strains or the emergence of pandemic viruses. Current influenza vaccines are based on immunity to the hemagglutinin antigen that is highly variable among different influenza viruses circulating in humans and animals. Several scientific advances have been endeavored to develop universal vaccines that will induce broad protection. Universal vaccines have been focused on regions of viral proteins that are highly conserved across different virus subtypes. The strategies of universal vaccines include the matrix 2 protein, the hemagglutinin HA2 stalk domain, and T cell-based multivalent antigens. Supplemented and/or adjuvanted vaccination in combination with universal target antigenic vaccines would have much promise. This review summarizes encouraging scientific advances in the field with a focus on novel vaccine designs. PMID:24427759

  5. Oropuche virus: A virus present but ignored

    Directory of Open Access Journals (Sweden)

    Salim Mattar V.

    2015-09-01

    Full Text Available Bunyaviruses are RNA viruses that affect animals and plants; they have five genera and four of them affect humans: Orthobunyavirus, Nairovirus, Phlebovirus and Hantavirus. All of them are Arbovirus, except Hantavirus. The Orthobunyaviruses comprise Oropouche, Tahyna, La Crosse virus, California encephalitis virus and Heartland virus recently discovered (1. Except for Heartland virus which is transmitted by ticks of the genus Amblyoma, these Phleboviruses have as vectors mosquitoes, which bite small mammals which are able to be as reservoirs amplifiers.

  6. Virus Pathogenity of Newcastle Disease in Chicken

    Directory of Open Access Journals (Sweden)

    Dyah Ayu Hewajuli

    2011-06-01

    Full Text Available Newcastle disease (ND is one of the highly infectious diseases in poultry industry. Newcastle disease causes high morbidity and mortality in birds, then it causes significant loss for poultry industry. This disease is caused by Avian paramyxovirus-1, included in the genus of Avulavirus and family of Paramyxoviridae. This virus has six prior proteins and two non structural proteins that evolving its genom. Those proteins are Nucleocapsid protein (N, Phosphoprotein (P, Matrix protein (M, Fusion protein (F, Hemagglutinin-neuraminidase protein (HN and Large polymerase protein (L and two non structural proteins iVe and W protein which are produced during the transcriptation process of P gen on editing process. Each of the protein has a specific role that responsible for the virulence of the virus. The previous result showed that HN and F proteins have significant contribution in the virulence and spreading of ND virus in the hosts. Virulence of ND virus primarily is determined by the cleavage site of F protein, but the recent research showed that the cleavage site motiv of F0 protein is not the only factor to determine the virulence of ND virus. Besides F protein, other proteins also contribute patern to the virulence of ND virus. ND virus can infect more than 200 species of birds, but the severity level of the disease varies depending on the host and strain of ND virus. Chicken has the highest pathogenicity index compared to other birds. Generally, the immunity system in chicken against infection of ND virus is similar to the immunity system of other birds. Cell mediated and humoral immunity responses play an important role in overcome ND virus.

  7. Clay matrix voltammetry

    International Nuclear Information System (INIS)

    Perdicakis, Michel

    2012-01-01

    Document available in extended abstract form only. In many countries, it is planned that the long life highly radioactive nuclear spent fuel will be stored in deep argillaceous rocks. The sites selected for this purpose are anoxic and satisfy several recommendations as mechanical stability, low permeability and low redox potential. Pyrite (FeS 2 ), iron(II) carbonate, iron(II) bearing clays and organic matter that are present in very small amounts (about 1% w:w) in soils play a major role in their reactivity and are considered today as responsible for the low redox potential values of these sites. In this communication, we describe an electrochemical technique derived from 'Salt matrix voltammetry' and allowing the almost in-situ voltammetric characterization of air-sensitive samples of soils after the only addition of the minimum humidity required for electrolytic conduction. Figure 1 shows the principle of the developed technique. It consists in the entrapment of the clay sample between a graphite working electrode and a silver counter/quasi-reference electrode. The sample was previously humidified by passing a water saturated inert gas through the electrochemical cell. The technique leads to well-defined voltammetric responses of the electro-active components of the clays. Figure 2 shows a typical voltammogram relative to a Callovo-Oxfordian argillite sample from Bure, the French place planned for the underground nuclear waste disposal. During the direct scan, one can clearly distinguish the anodic voltammetric signals for the oxidation of the iron (II) species associated with the clay and the oxidation of pyrite. The reverse scan displays a small cathodic signal for the reduction of iron (III) associated with the clay that demonstrates that the majority of the previously oxidized iron (II) species were transformed into iron (III) oxides reducible at lower potentials. When a second voltammetric cycle is performed, one can notice that the signal for iron (II

  8. Crystal structure of the Hendra virus attachment G glycoprotein bound to a potent cross-reactive neutralizing human monoclonal antibody.

    Science.gov (United States)

    Xu, Kai; Rockx, Barry; Xie, Yihu; DeBuysscher, Blair L; Fusco, Deborah L; Zhu, Zhongyu; Chan, Yee-Peng; Xu, Yan; Luu, Truong; Cer, Regina Z; Feldmann, Heinz; Mokashi, Vishwesh; Dimitrov, Dimiter S; Bishop-Lilly, Kimberly A; Broder, Christopher C; Nikolov, Dimitar B

    2013-01-01

    The henipaviruses, represented by Hendra (HeV) and Nipah (NiV) viruses are highly pathogenic zoonotic paramyxoviruses with uniquely broad host tropisms responsible for repeated outbreaks in Australia, Southeast Asia, India and Bangladesh. The high morbidity and mortality rates associated with infection and lack of licensed antiviral therapies make the henipaviruses a potential biological threat to humans and livestock. Henipavirus entry is initiated by the attachment of the G envelope glycoprotein to host cell membrane receptors. Previously, henipavirus-neutralizing human monoclonal antibodies (hmAb) have been isolated using the HeV-G glycoprotein and a human naïve antibody library. One cross-reactive and receptor-blocking hmAb (m102.4) was recently demonstrated to be an effective post-exposure therapy in two animal models of NiV and HeV infection, has been used in several people on a compassionate use basis, and is currently in development for use in humans. Here, we report the crystal structure of the complex of HeV-G with m102.3, an m102.4 derivative, and describe NiV and HeV escape mutants. This structure provides detailed insight into the mechanism of HeV and NiV neutralization by m102.4, and serves as a blueprint for further optimization of m102.4 as a therapeutic agent and for the development of entry inhibitors and vaccines.

  9. Crystal structure of the Hendra virus attachment G glycoprotein bound to a potent cross-reactive neutralizing human monoclonal antibody.

    Directory of Open Access Journals (Sweden)

    Kai Xu

    Full Text Available The henipaviruses, represented by Hendra (HeV and Nipah (NiV viruses are highly pathogenic zoonotic paramyxoviruses with uniquely broad host tropisms responsible for repeated outbreaks in Australia, Southeast Asia, India and Bangladesh. The high morbidity and mortality rates associated with infection and lack of licensed antiviral therapies make the henipaviruses a potential biological threat to humans and livestock. Henipavirus entry is initiated by the attachment of the G envelope glycoprotein to host cell membrane receptors. Previously, henipavirus-neutralizing human monoclonal antibodies (hmAb have been isolated using the HeV-G glycoprotein and a human naïve antibody library. One cross-reactive and receptor-blocking hmAb (m102.4 was recently demonstrated to be an effective post-exposure therapy in two animal models of NiV and HeV infection, has been used in several people on a compassionate use basis, and is currently in development for use in humans. Here, we report the crystal structure of the complex of HeV-G with m102.3, an m102.4 derivative, and describe NiV and HeV escape mutants. This structure provides detailed insight into the mechanism of HeV and NiV neutralization by m102.4, and serves as a blueprint for further optimization of m102.4 as a therapeutic agent and for the development of entry inhibitors and vaccines.

  10. Lectin-Dependent Enhancement of Ebola Virus Infection via Soluble and Transmembrane C-type Lectin Receptors

    Science.gov (United States)

    Lear, Calli; Chen, Li; Yantosca, L. Michael; Scully, Corinne; Sarraju, Ashish; Sokolovska, Anna; Zariffard, M. Reza; Eisen, Damon P.; Mungall, Bruce A.; Kotton, Darrell N.; Omari, Amel; Huang, I-Chueh; Farzan, Michael; Takahashi, Kazue; Stuart, Lynda; Stahl, Gregory L.; Ezekowitz, Alan B.; Spear, Gregory T.; Olinger, Gene G.; Schmidt, Emmett V.; Michelow, Ian C.

    2013-01-01

    Mannose-binding lectin (MBL) is a key soluble effector of the innate immune system that recognizes pathogen-specific surface glycans. Surprisingly, low-producing MBL genetic variants that may predispose children and immunocompromised individuals to infectious diseases are more common than would be expected in human populations. Since certain immune defense molecules, such as immunoglobulins, can be exploited by invasive pathogens, we hypothesized that MBL might also enhance infections in some circumstances. Consequently, the low and intermediate MBL levels commonly found in human populations might be the result of balancing selection. Using model infection systems with pseudotyped and authentic glycosylated viruses, we demonstrated that MBL indeed enhances infection of Ebola, Hendra, Nipah and West Nile viruses in low complement conditions. Mechanistic studies with Ebola virus (EBOV) glycoprotein pseudotyped lentiviruses confirmed that MBL binds to N-linked glycan epitopes on viral surfaces in a specific manner via the MBL carbohydrate recognition domain, which is necessary for enhanced infection. MBL mediates lipid-raft-dependent macropinocytosis of EBOV via a pathway that appears to require less actin or early endosomal processing compared with the filovirus canonical endocytic pathway. Using a validated RNA interference screen, we identified C1QBP (gC1qR) as a candidate surface receptor that mediates MBL-dependent enhancement of EBOV infection. We also identified dectin-2 (CLEC6A) as a potentially novel candidate attachment factor for EBOV. Our findings support the concept of an innate immune haplotype that represents critical interactions between MBL and complement component C4 genes and that may modify susceptibility or resistance to certain glycosylated pathogens. Therefore, higher levels of native or exogenous MBL could be deleterious in the setting of relative hypocomplementemia which can occur genetically or because of immunodepletion during active

  11. Lectin-dependent enhancement of Ebola virus infection via soluble and transmembrane C-type lectin receptors.

    Directory of Open Access Journals (Sweden)

    Matthew Brudner

    Full Text Available Mannose-binding lectin (MBL is a key soluble effector of the innate immune system that recognizes pathogen-specific surface glycans. Surprisingly, low-producing MBL genetic variants that may predispose children and immunocompromised individuals to infectious diseases are more common than would be expected in human populations. Since certain immune defense molecules, such as immunoglobulins, can be exploited by invasive pathogens, we hypothesized that MBL might also enhance infections in some circumstances. Consequently, the low and intermediate MBL levels commonly found in human populations might be the result of balancing selection. Using model infection systems with pseudotyped and authentic glycosylated viruses, we demonstrated that MBL indeed enhances infection of Ebola, Hendra, Nipah and West Nile viruses in low complement conditions. Mechanistic studies with Ebola virus (EBOV glycoprotein pseudotyped lentiviruses confirmed that MBL binds to N-linked glycan epitopes on viral surfaces in a specific manner via the MBL carbohydrate recognition domain, which is necessary for enhanced infection. MBL mediates lipid-raft-dependent macropinocytosis of EBOV via a pathway that appears to require less actin or early endosomal processing compared with the filovirus canonical endocytic pathway. Using a validated RNA interference screen, we identified C1QBP (gC1qR as a candidate surface receptor that mediates MBL-dependent enhancement of EBOV infection. We also identified dectin-2 (CLEC6A as a potentially novel candidate attachment factor for EBOV. Our findings support the concept of an innate immune haplotype that represents critical interactions between MBL and complement component C4 genes and that may modify susceptibility or resistance to certain glycosylated pathogens. Therefore, higher levels of native or exogenous MBL could be deleterious in the setting of relative hypocomplementemia which can occur genetically or because of immunodepletion

  12. Ceramic matrix composite article and process of fabricating a ceramic matrix composite article

    Science.gov (United States)

    Cairo, Ronald Robert; DiMascio, Paul Stephen; Parolini, Jason Robert

    2016-01-12

    A ceramic matrix composite article and a process of fabricating a ceramic matrix composite are disclosed. The ceramic matrix composite article includes a matrix distribution pattern formed by a manifold and ceramic matrix composite plies laid up on the matrix distribution pattern, includes the manifold, or a combination thereof. The manifold includes one or more matrix distribution channels operably connected to a delivery interface, the delivery interface configured for providing matrix material to one or more of the ceramic matrix composite plies. The process includes providing the manifold, forming the matrix distribution pattern by transporting the matrix material through the manifold, and contacting the ceramic matrix composite plies with the matrix material.

  13. Viruses of hyperthermophilic Crenarchaea

    DEFF Research Database (Denmark)

    Prangishvili, D.; Garrett, R. A.

    2005-01-01

    , when one examines the archaeal viruses, the picture appears complex. Most viruses that are known to infect members of the kingdom Euryarchaeota resemble bacterial viruses, whereas those associated with the kingdom Crenarchaeota show little resemblance to either bacterial or eukaryal viruses....... This review summarizes our current knowledge of this group of exceptional and highly diverse archaeal viruses....

  14. Glass matrix armor

    Science.gov (United States)

    Calkins, Noel C.

    1991-01-01

    An armor system which utilizes glass. A plurality of constraint cells are mounted on a surface of a substrate, which is metal armor plate or a similar tough material, such that the cells almost completely cover the surface of the substrate. Each constraint cell has a projectile-receiving wall parallel to the substrate surface and has sides which are perpendicular to and surround the perimeter of the receiving wall. The cells are mounted such that, in one embodiment, the substrate surface serves as a sixth side or closure for each cell. Each cell has inside of it a plate, termed the front plate, which is parallel to and in contact with substantially all of the inside surface of the receiving wall. The balance of each cell is completely filled with a projectile-abrading material consisting of glass and a ceramic material and, in certain embodiments, a polymeric material. The glass may be in monolithic form or particles of ceramic may be dispersed in a glass matrix. The ceramic material may be in monolithic form or may be in the form of particles dispersed in glass or dispersed in said polymer.

  15. Strategy BMT Al-Ittihad Using Matrix IE, Matrix SWOT 8K, Matrix SPACE and Matrix TWOS

    Directory of Open Access Journals (Sweden)

    Nofrizal Nofrizal

    2018-03-01

    Full Text Available This research aims to formulate and select BMT Al-Ittihad Rumbai strategy to face the changing of business environment both from internal environment such as organization resources, finance, member and external business such as competitor, economy, politics and others. This research method used Analysis of EFAS, IFAS, IE Matrix, SWOT-8K Matrix, SPACE Matrix and TWOS Matrix. our hope from this research it can assist BMT Al-Ittihad in formulating and selecting strategies for the sustainability of BMT Al-Ittihad in the future. The sample in this research is using purposive sampling technique that is the manager and leader of BMT Al-IttihadRumbaiPekanbaru. The result of this research shows that the position of BMT Al-Ittihad using IE Matrix, SWOT-8K Matrix and SPACE Matrix is in growth position, stabilization and aggressive. The choice of strategy after using TWOS Matrix is market penetration, market development, vertical integration, horizontal integration, and stabilization (careful.

  16. How to Study a Matrix

    Science.gov (United States)

    Jairam, Dharmananda; Kiewra, Kenneth A.; Kauffman, Douglas F.; Zhao, Ruomeng

    2012-01-01

    This study investigated how best to study a matrix. Fifty-three participants studied a matrix topically (1 column at a time), categorically (1 row at a time), or in a unified way (all at once). Results revealed that categorical and unified study produced higher: (a) performance on relationship and fact tests, (b) study material satisfaction, and…

  17. Quantum mechanics in matrix form

    CERN Document Server

    Ludyk, Günter

    2018-01-01

    This book gives an introduction to quantum mechanics with the matrix method. Heisenberg's matrix mechanics is described in detail. The fundamental equations are derived by algebraic methods using matrix calculus. Only a brief description of Schrödinger's wave mechanics is given (in most books exclusively treated), to show their equivalence to Heisenberg's matrix  method. In the first part the historical development of Quantum theory by Planck, Bohr and Sommerfeld is sketched, followed by the ideas and methods of Heisenberg, Born and Jordan. Then Pauli's spin and exclusion principles are treated. Pauli's exclusion principle leads to the structure of atoms. Finally, Dirac´s relativistic quantum mechanics is shortly presented. Matrices and matrix equations are today easy to handle when implementing numerical algorithms using standard software as MAPLE and Mathematica.

  18. A Generic Quantitative Risk Assessment Framework for the Entry of Bat-Borne Zoonotic Viruses into the European Union.

    Directory of Open Access Journals (Sweden)

    Robin R L Simons

    Full Text Available Bat-borne viruses have been linked to a number of zoonotic diseases; in 2014 there have been human cases of Nipah virus (NiV in Bangladesh and Ebola virus in West and Central Africa. Here we describe a model designed to provide initial quantitative predictions of the risk of entry of such viruses to European Union (EU Member States (MSs through four routes: human travel, legal trade (e.g. fruit and animal products, live animal movements and illegal importation of bushmeat. The model utilises available datasets to assess the movement via these routes between individual countries of the world and EU MSs. These data are combined with virus specific data to assess the relative risk of entry between EU MSs. As a case study, the model was parameterised for NiV. Scenario analyses showed that the selection of exporting countries with NiV and potentially contaminated trade products were essential to the accuracy of all model outputs. Uncertainty analyses of other model parameters identified that the model expected number of years to an introduction event within the EU was highly susceptible to the prevalence of NiV in bats. The relative rankings of the MSs and routes, however, were more robust. The UK, the Netherlands and Germany were consistently the most likely points of entry and the ranking of most MSs varied by no more than three places (maximum variation five places. Legal trade was consistently the most likely route of entry, only falling below human travel when the estimate of the prevalence of NiV in bats was particularly low. Any model-based calculation is dependent on the data available to feed into the model and there are distinct gaps in our knowledge, particularly in regard to various pathogen/virus as well as host/bat characteristics. However, the strengths of this model lie in the provision of relative comparisons of risk among routes and MSs. The potential for expansion of the model to include other routes and viruses and the possibility

  19. A Generic Quantitative Risk Assessment Framework for the Entry of Bat-Borne Zoonotic Viruses into the European Union.

    Science.gov (United States)

    Simons, Robin R L; Horigan, Verity; Gale, Paul; Kosmider, Rowena D; Breed, Andrew C; Snary, Emma L

    2016-01-01

    Bat-borne viruses have been linked to a number of zoonotic diseases; in 2014 there have been human cases of Nipah virus (NiV) in Bangladesh and Ebola virus in West and Central Africa. Here we describe a model designed to provide initial quantitative predictions of the risk of entry of such viruses to European Union (EU) Member States (MSs) through four routes: human travel, legal trade (e.g. fruit and animal products), live animal movements and illegal importation of bushmeat. The model utilises available datasets to assess the movement via these routes between individual countries of the world and EU MSs. These data are combined with virus specific data to assess the relative risk of entry between EU MSs. As a case study, the model was parameterised for NiV. Scenario analyses showed that the selection of exporting countries with NiV and potentially contaminated trade products were essential to the accuracy of all model outputs. Uncertainty analyses of other model parameters identified that the model expected number of years to an introduction event within the EU was highly susceptible to the prevalence of NiV in bats. The relative rankings of the MSs and routes, however, were more robust. The UK, the Netherlands and Germany were consistently the most likely points of entry and the ranking of most MSs varied by no more than three places (maximum variation five places). Legal trade was consistently the most likely route of entry, only falling below human travel when the estimate of the prevalence of NiV in bats was particularly low. Any model-based calculation is dependent on the data available to feed into the model and there are distinct gaps in our knowledge, particularly in regard to various pathogen/virus as well as host/bat characteristics. However, the strengths of this model lie in the provision of relative comparisons of risk among routes and MSs. The potential for expansion of the model to include other routes and viruses and the possibility of rapid

  20. Zika Virus and Pregnancy

    Medline Plus

    Full Text Available ... Education & Events Advocacy For Patients About ACOG Zika Virus and Pregnancy Home For Patients Zika Virus and ... Education Pamphlets - Spanish Share: PEV002, September 2016 Zika Virus and Pregnancy There are risks to your fetus ...

  1. Zika Virus and Pregnancy

    Medline Plus

    Full Text Available ... Advocacy For Patients About ACOG Zika Virus and Pregnancy Home For Patients Zika Virus and Pregnancy Page ... Spanish Share: PEV002, September 2016 Zika Virus and Pregnancy There are risks to your fetus if you ...

  2. Zika Virus and Pregnancy

    Medline Plus

    Full Text Available ... Management Education & Events Advocacy For Patients About ACOG Zika Virus and Pregnancy Home For Patients Zika Virus and ... Patient Education Pamphlets - Spanish Share: PEV002, September 2016 Zika Virus and Pregnancy There are risks to your fetus ...

  3. Zika Virus and Pregnancy

    Science.gov (United States)

    ... Management Education & Events Advocacy For Patients About ACOG Zika Virus and Pregnancy Home For Patients Zika Virus and ... Patient Education Pamphlets - Spanish Share: PEV002, September 2016 Zika Virus and Pregnancy There are risks to your fetus ...

  4. Zika Virus and Pregnancy

    Medline Plus

    Full Text Available ... Management Education & Events Advocacy For Patients About ACOG Zika Virus and Pregnancy Home For Patients Zika Virus ... Patient Education Pamphlets - Spanish Share: PEV002, September 2016 Zika Virus and Pregnancy There are risks to your ...

  5. Computer Viruses: An Overview.

    Science.gov (United States)

    Marmion, Dan

    1990-01-01

    Discusses the early history and current proliferation of computer viruses that occur on Macintosh and DOS personal computers, mentions virus detection programs, and offers suggestions for how libraries can protect themselves and their users from damage by computer viruses. (LRW)

  6. Using routine surveillance data to estimate the epidemic potential of emerging zoonoses: application to the emergence of US swine origin influenza A H3N2v virus.

    Science.gov (United States)

    Cauchemez, Simon; Epperson, Scott; Biggerstaff, Matthew; Swerdlow, David; Finelli, Lyn; Ferguson, Neil M

    2013-01-01

    Prior to emergence in human populations, zoonoses such as SARS cause occasional infections in human populations exposed to reservoir species. The risk of widespread epidemics in humans can be assessed by monitoring the reproduction number R (average number of persons infected by a human case). However, until now, estimating R required detailed outbreak investigations of human clusters, for which resources and expertise are not always available. Additionally, existing methods do not correct for important selection and under-ascertainment biases. Here, we present simple estimation methods that overcome many of these limitations. Our approach is based on a parsimonious mathematical model of disease transmission and only requires data collected through routine surveillance and standard case investigations. We apply it to assess the transmissibility of swine-origin influenza A H3N2v-M virus in the US, Nipah virus in Malaysia and Bangladesh, and also present a non-zoonotic example (cholera in the Dominican Republic). Estimation is based on two simple summary statistics, the proportion infected by the natural reservoir among detected cases (G) and among the subset of the first detected cases in each cluster (F). If detection of a case does not affect detection of other cases from the same cluster, we find that R can be estimated by 1-G; otherwise R can be estimated by 1-F when the case detection rate is low. In more general cases, bounds on R can still be derived. We have developed a simple approach with limited data requirements that enables robust assessment of the risks posed by emerging zoonoses. We illustrate this by deriving transmissibility estimates for the H3N2v-M virus, an important step in evaluating the possible pandemic threat posed by this virus. Please see later in the article for the Editors' Summary.

  7. Using routine surveillance data to estimate the epidemic potential of emerging zoonoses: application to the emergence of US swine origin influenza A H3N2v virus.

    Directory of Open Access Journals (Sweden)

    Simon Cauchemez

    Full Text Available Prior to emergence in human populations, zoonoses such as SARS cause occasional infections in human populations exposed to reservoir species. The risk of widespread epidemics in humans can be assessed by monitoring the reproduction number R (average number of persons infected by a human case. However, until now, estimating R required detailed outbreak investigations of human clusters, for which resources and expertise are not always available. Additionally, existing methods do not correct for important selection and under-ascertainment biases. Here, we present simple estimation methods that overcome many of these limitations.Our approach is based on a parsimonious mathematical model of disease transmission and only requires data collected through routine surveillance and standard case investigations. We apply it to assess the transmissibility of swine-origin influenza A H3N2v-M virus in the US, Nipah virus in Malaysia and Bangladesh, and also present a non-zoonotic example (cholera in the Dominican Republic. Estimation is based on two simple summary statistics, the proportion infected by the natural reservoir among detected cases (G and among the subset of the first detected cases in each cluster (F. If detection of a case does not affect detection of other cases from the same cluster, we find that R can be estimated by 1-G; otherwise R can be estimated by 1-F when the case detection rate is low. In more general cases, bounds on R can still be derived.We have developed a simple approach with limited data requirements that enables robust assessment of the risks posed by emerging zoonoses. We illustrate this by deriving transmissibility estimates for the H3N2v-M virus, an important step in evaluating the possible pandemic threat posed by this virus. Please see later in the article for the Editors' Summary.

  8. Dengue virus receptor

    OpenAIRE

    Hidari, Kazuya I.P.J.; Suzuki, Takashi

    2011-01-01

    Dengue virus is an arthropod-borne virus transmitted by Aedes mosquitoes. Dengue virus causes fever and hemorrhagic disorders in humans and non-human primates. Direct interaction of the virus introduced by a mosquito bite with host receptor molecule(s) is crucial for virus propagation and the pathological progression of dengue diseases. Therefore, elucidation of the molecular mechanisms underlying the interaction between dengue virus and its receptor(s) in both humans and mosquitoes is essent...

  9. Computer Virus and Trends

    OpenAIRE

    Tutut Handayani; Soenarto Usna,Drs.MMSI

    2004-01-01

    Since its appearance the first time in the mid-1980s, computer virus has invited various controversies that still lasts to this day. Along with the development of computer systems technology, viruses komputerpun find new ways to spread itself through a variety of existing communications media. This paper discusses about some things related to computer viruses, namely: the definition and history of computer viruses; the basics of computer viruses; state of computer viruses at this time; and ...

  10. M-theoretic matrix models

    Science.gov (United States)

    Grassi, Alba; Mariño, Marcos

    2015-02-01

    Some matrix models admit, on top of the usual 't Hooft expansion, an M-theory-like expansion, i.e. an expansion at large N but where the rest of the parameters are fixed, instead of scaling with N . These models, which we call M-theoretic matrix models, appear in the localization of Chern-Simons-matter theories, and also in two-dimensional statistical physics. Generically, their partition function receives non-perturbative corrections which are not captured by the 't Hooft expansion. In this paper, we discuss general aspects of these type of matrix integrals and we analyze in detail two different examples. The first one is the matrix model computing the partition function of supersymmetric Yang-Mills theory in three dimensions with one adjoint hypermultiplet and N f fundamentals, which has a conjectured M-theory dual, and which we call the N f matrix model. The second one, which we call the polymer matrix model, computes form factors of the 2d Ising model and is related to the physics of 2d polymers. In both cases we determine their exact planar limit. In the N f matrix model, the planar free energy reproduces the expected behavior of the M-theory dual. We also study their M-theory expansion by using Fermi gas techniques, and we find non-perturbative corrections to the 't Hooft expansion.

  11. Containment Code Validation Matrix

    International Nuclear Information System (INIS)

    Chin, Yu-Shan; Mathew, P.M.; Glowa, Glenn; Dickson, Ray; Liang, Zhe; Leitch, Brian; Barber, Duncan; Vasic, Aleks; Bentaib, Ahmed; Journeau, Christophe; Malet, Jeanne; Studer, Etienne; Meynet, Nicolas; Piluso, Pascal; Gelain, Thomas; Michielsen, Nathalie; Peillon, Samuel; Porcheron, Emmanuel; Albiol, Thierry; Clement, Bernard; Sonnenkalb, Martin; Klein-Hessling, Walter; Arndt, Siegfried; Weber, Gunter; Yanez, Jorge; Kotchourko, Alexei; Kuznetsov, Mike; Sangiorgi, Marco; Fontanet, Joan; Herranz, Luis; Garcia De La Rua, Carmen; Santiago, Aleza Enciso; Andreani, Michele; Paladino, Domenico; Dreier, Joerg; Lee, Richard; Amri, Abdallah

    2014-01-01

    The Committee on the Safety of Nuclear Installations (CSNI) formed the CCVM (Containment Code Validation Matrix) task group in 2002. The objective of this group was to define a basic set of available experiments for code validation, covering the range of containment (ex-vessel) phenomena expected in the course of light and heavy water reactor design basis accidents and beyond design basis accidents/severe accidents. It was to consider phenomena relevant to pressurised heavy water reactor (PHWR), pressurised water reactor (PWR) and boiling water reactor (BWR) designs of Western origin as well as of Eastern European VVER types. This work would complement the two existing CSNI validation matrices for thermal hydraulic code validation (NEA/CSNI/R(1993)14) and In-vessel core degradation (NEA/CSNI/R(2001)21). The report initially provides a brief overview of the main features of a PWR, BWR, CANDU and VVER reactors. It also provides an overview of the ex-vessel corium retention (core catcher). It then provides a general overview of the accident progression for light water and heavy water reactors. The main focus is to capture most of the phenomena and safety systems employed in these reactor types and to highlight the differences. This CCVM contains a description of 127 phenomena, broken down into 6 categories: - Containment Thermal-hydraulics Phenomena; - Hydrogen Behaviour (Combustion, Mitigation and Generation) Phenomena; - Aerosol and Fission Product Behaviour Phenomena; - Iodine Chemistry Phenomena; - Core Melt Distribution and Behaviour in Containment Phenomena; - Systems Phenomena. A synopsis is provided for each phenomenon, including a description, references for further information, significance for DBA and SA/BDBA and a list of experiments that may be used for code validation. The report identified 213 experiments, broken down into the same six categories (as done for the phenomena). An experiment synopsis is provided for each test. Along with a test description

  12. The matrix of inspiration

    Science.gov (United States)

    Oehlmann, Dietmar; Ohlmann, Odile M.; Danzebrink, Hans U.

    2005-04-01

    perform this exchange, as a matrix, understood as source, of new ideas.

  13. Differential in situ hybridization for herpes simplex virus typing in routine skin biopsies

    NARCIS (Netherlands)

    Botma, H. J.; Dekker, H.; van Amstel, P.; Cairo, I.; van den Berg, F. M.

    1995-01-01

    A herpes simplex virus (HSV) type 2 specific recombinant plasmid probe designated pH2S3 was constructed from non-HSV-1 crossreactive regions of the HSV-2 genome. DNA in situ hybridization on in vitro reconstructed tissue samples of sheep collagen matrix impregnated with herpes virus-infected human

  14. Matrix Converter in Hybrid Drives

    Czech Academy of Sciences Publication Activity Database

    Lettl, Jiří; Flígl, S.

    -, č. 3 (2004), s. 77-80 ISSN 0204-3599 Institutional research plan: CEZ:AV0Z2057903 Keywords : matrix converter * hybrid drive * electric power splitting Subject RIV: JA - Electronics ; Optoelectronics, Electrical Engineering

  15. GoM Diet Matrix

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — This data set was taken from CRD 08-18 at the NEFSC. Specifically, the Gulf of Maine diet matrix was developed for the EMAX exercise described in that center...

  16. Radiation resistant ceramic matrix composites

    International Nuclear Information System (INIS)

    Jones, R.H.; Steiner, D.; Heinisch, H.L.; Newsome, G.A.; Kerch, H.M.

    1997-01-01

    Ceramic matrix composites are of interest for nuclear applications because of their high-temperature properties, corrosion resistance, fracture toughness relative to monolithic ceramics, and low neutron activation and after heat. Evaluations of the radiation resistance of commercially available SiC/SiC composites have revealed their promise for this application, but also the need for further development to achieve the desired performance. This paper summarizes the results of a workshop cosponsored by the Offices of Fusion Energy and Basic Energy Sciences of the US Department of Energy and Lockheed-Martin Corporation with forty attendees from national laboratories, universities and industry. A number of promising routes for optimizing the radiation stability of ceramic matrix composites were identified at this workshop. These routes included the newer, more stoichiometric fibers and alternate fiber/matrix interfaces and matrix processing routes. (orig.)

  17. The R-matrix theory

    International Nuclear Information System (INIS)

    Descouvemont, P; Baye, D

    2010-01-01

    The different facets of the R-matrix method are presented pedagogically in a general framework. Two variants have been developed over the years: (i) The 'calculable' R-matrix method is a calculational tool to derive scattering properties from the Schroedinger equation in a large variety of physical problems. It was developed rather independently in atomic and nuclear physics with too little mutual influence. (ii) The 'phenomenological' R-matrix method is a technique to parametrize various types of cross sections. It was mainly (or uniquely) used in nuclear physics. Both directions are explained by starting from the simple problem of scattering by a potential. They are illustrated by simple examples in nuclear and atomic physics. In addition to elastic scattering, the R-matrix formalism is applied to inelastic and radiative-capture reactions. We also present more recent and more ambitious applications of the theory in nuclear physics.

  18. Matrix analysis of electrical machinery

    CERN Document Server

    Hancock, N N

    2013-01-01

    Matrix Analysis of Electrical Machinery, Second Edition is a 14-chapter edition that covers the systematic analysis of electrical machinery performance. This edition discusses the principles of various mathematical operations and their application to electrical machinery performance calculations. The introductory chapters deal with the matrix representation of algebraic equations and their application to static electrical networks. The following chapters describe the fundamentals of different transformers and rotating machines and present torque analysis in terms of the currents based on the p

  19. Bilateral matrix-exponential distributions

    DEFF Research Database (Denmark)

    Bladt, Mogens; Esparza, Luz Judith R; Nielsen, Bo Friis

    2012-01-01

    In this article we define the classes of bilateral and multivariate bilateral matrix-exponential distributions. These distributions have support on the entire real space and have rational moment-generating functions. These distributions extend the class of bilateral phasetype distributions of [1]....... As an application we demonstrate that certain multivariate disions, which are governed by the underlying Markov jump process generating a phasetype distribution, have a bilateral matrix-exponential distribution at the time of absorption, see also [4]....

  20. Matrix Effects in XRF Measurements

    International Nuclear Information System (INIS)

    Kandil, A.T.; Gabr, N.A.; El-Aryan, S.M.

    2015-01-01

    This research treats the matrix effect on XRF measurements. The problem is treated by preparing general oxide program, which contains many samples that represent all materials in cement factories, then by using T rail Lachance m ethod to correct errors of matrix effect. This work compares the effect of using lithium tetraborate or sodium tetraborate as a fluxing agent in terms of accuracy and economic cost

  1. Capacitance matrix method in TRAC and MELPROG

    International Nuclear Information System (INIS)

    Steinke, R.G.; Dearing, J.F.

    1989-01-01

    The capacitance matrix method has been used in the TRAC and MELPROG transient, thermal-hydraulic, safety-analysis computer programs to solve the multi-dimensional-vessel matrix equations. A full-matrix solver rather than a more efficient banded-matrix solver was used previously because of nonzero elements lying outside the matrix bandwidth. These outlying nonzero elements result from vessel external and internal pipe flow channels connecting non-adjacent cells in the multidimensional vessel component. The capacitance matrix method provides a more efficient solution algorithm by solving the banded portion of the vessel-matrix equation with a banded-matrix solver. The effect of the nonzero outlying elements on that solution is accounted for through matrix algebra and a lower order capacitance-matrix equation solution that modifies the banded-matrix solution to give the full-matrix solution. 5 refs., 2 figs

  2. An optimized polymerase chain reaction assay to identify avian virus vaccine contamination with Chicken anemia virus.

    Science.gov (United States)

    Amer, Haitham M; Elzahed, Hanan M; Elabiare, Elham A; Badawy, Ahmed A; Yousef, Ausama A

    2011-01-01

    The use of embryonating chicken eggs in preparation of avian virus vaccines is the principle cause for contamination with Chicken anemia virus (CAV). Identification of CAV in contaminated vaccines relies on the expensive, tedious, and time-consuming practice of virus isolation in lymphoblastoid cell lines. The experience of the last 2 decades indicates that polymerase chain reaction is extending to replace most of the classic methods for detection of infectious agents. In the present report, a simple, rapid, and accurate polymerase chain reaction method for detection of CAV in poultry vaccines is described. Oligonucleotide primers homologous to highly conserved sequences of the VP1 gene were used to amplify a fragment of 676 bp. The developed assay was specific for detecting CAV from different sources, with no cross reactivity with many avian viruses. No inter- and intra-assay variations were observed. The analytical sensitivity of the test was high enough to detect 5 TCID(50) (50% tissue culture infective dose) of the virus per reaction; however, different factors related to the vaccine matrix showed considerable effects on the detection limit. In conclusion, this method may represent a suitable alternative to virus isolation for identification of CAV contamination of poultry virus vaccines.

  3. EISPACK, Subroutines for Eigenvalues, Eigenvectors, Matrix Operations

    International Nuclear Information System (INIS)

    Garbow, Burton S.; Cline, A.K.; Meyering, J.

    1993-01-01

    1 - Description of problem or function: EISPACK3 is a collection of 75 FORTRAN subroutines, both single- and double-precision, that compute the eigenvalues and eigenvectors of nine classes of matrices. The package can determine the Eigen-system of complex general, complex Hermitian, real general, real symmetric, real symmetric band, real symmetric tridiagonal, special real tridiagonal, generalized real, and generalized real symmetric matrices. In addition, there are two routines which use the singular value decomposition to solve certain least squares problem. The individual subroutines are - Identification/Description: BAKVEC: Back transform vectors of matrix formed by FIGI; BALANC: Balance a real general matrix; BALBAK: Back transform vectors of matrix formed by BALANC; BANDR: Reduce sym. band matrix to sym. tridiag. matrix; BANDV: Find some vectors of sym. band matrix; BISECT: Find some values of sym. tridiag. matrix; BQR: Find some values of sym. band matrix; CBABK2: Back transform vectors of matrix formed by CBAL; CBAL: Balance a complex general matrix; CDIV: Perform division of two complex quantities; CG: Driver subroutine for a complex general matrix; CH: Driver subroutine for a complex Hermitian matrix; CINVIT: Find some vectors of complex Hess. matrix; COMBAK: Back transform vectors of matrix formed by COMHES; COMHES: Reduce complex matrix to complex Hess. (elementary); COMLR: Find all values of complex Hess. matrix (LR); COMLR2: Find all values/vectors of cmplx Hess. matrix (LR); CCMQR: Find all values of complex Hessenberg matrix (QR); COMQR2: Find all values/vectors of cmplx Hess. matrix (QR); CORTB: Back transform vectors of matrix formed by CORTH; CORTH: Reduce complex matrix to complex Hess. (unitary); CSROOT: Find square root of complex quantity; ELMBAK: Back transform vectors of matrix formed by ELMHES; ELMHES: Reduce real matrix to real Hess. (elementary); ELTRAN: Accumulate transformations from ELMHES (for HQR2); EPSLON: Estimate unit roundoff

  4. A novel model of lethal Hendra virus infection in African green monkeys and the effectiveness of ribavirin treatment.

    Science.gov (United States)

    Rockx, Barry; Bossart, Katharine N; Feldmann, Friederike; Geisbert, Joan B; Hickey, Andrew C; Brining, Douglas; Callison, Julie; Safronetz, David; Marzi, Andrea; Kercher, Lisa; Long, Dan; Broder, Christopher C; Feldmann, Heinz; Geisbert, Thomas W

    2010-10-01

    The henipaviruses, Hendra virus (HeV) and Nipah virus (NiV), are emerging zoonotic paramyxoviruses that can cause severe and often lethal neurologic and/or respiratory disease in a wide variety of mammalian hosts, including humans. There are presently no licensed vaccines or treatment options approved for human or veterinarian use. Guinea pigs, hamsters, cats, and ferrets, have been evaluated as animal models of human HeV infection, but studies in nonhuman primates (NHP) have not been reported, and the development and approval of any vaccine or antiviral for human use will likely require efficacy studies in an NHP model. Here, we examined the pathogenesis of HeV in the African green monkey (AGM) following intratracheal inoculation. Exposure of AGMs to HeV produced a uniformly lethal infection, and the observed clinical signs and pathology were highly consistent with HeV-mediated disease seen in humans. Ribavirin has been used to treat patients infected with either HeV or NiV; however, its utility in improving outcome remains, at best, uncertain. We examined the antiviral effect of ribavirin in a cohort of nine AGMs before or after exposure to HeV. Ribavirin treatment delayed disease onset by 1 to 2 days, with no significant benefit for disease progression and outcome. Together our findings introduce a new disease model of acute HeV infection suitable for testing antiviral strategies and also demonstrate that, while ribavirin may have some antiviral activity against the henipaviruses, its use as an effective standalone therapy for HeV infection is questionable.

  5. Active Surveillance for Avian Influenza Virus, Egypt, 2010–2012

    Science.gov (United States)

    Kandeil, Ahmed; El-Shesheny, Rabeh; Kayed, Ahmed S.; Gomaa, Mokhtar M.; Maatouq, Asmaa M.; Shehata, Mahmoud M.; Moatasim, Yassmin; Bagato, Ola; Cai, Zhipeng; Rubrum, Adam; Kutkat, Mohamed A.; McKenzie, Pamela P.; Webster, Robert G.; Webby, Richard J.; Ali, Mohamed A.

    2014-01-01

    Continuous circulation of influenza A(H5N1) virus among poultry in Egypt has created an epicenter in which the viruses evolve into newer subclades and continue to cause disease in humans. To detect influenza viruses in Egypt, since 2009 we have actively surveyed various regions and poultry production sectors. From August 2010 through January 2013, >11,000 swab samples were collected; 10% were positive by matrix gene reverse transcription PCR. During this period, subtype H9N2 viruses emerged, cocirculated with subtype H5N1 viruses, and frequently co-infected the same avian host. Genetic and antigenic analyses of viruses revealed that influenza A(H5N1) clade 2.2.1 viruses are dominant and that all subtype H9N2 viruses are G1-like. Cocirculation of different subtypes poses concern for potential reassortment. Avian influenza continues to threaten public and animal health in Egypt, and continuous surveillance for avian influenza virus is needed. PMID:24655395

  6. Hendra virus infection dynamics in Australian fruit bats.

    Science.gov (United States)

    Field, Hume; de Jong, Carol; Melville, Deb; Smith, Craig; Smith, Ina; Broos, Alice; Kung, Yu Hsin Nina; McLaughlin, Amanda; Zeddeman, Anne

    2011-01-01

    Hendra virus is a recently emerged zoonotic agent in Australia. Since first described in 1994, the virus has spilled from its wildlife reservoir (pteropid fruit bats, or 'flying foxes') on multiple occasions causing equine and human fatalities. We undertook a three-year longitudinal study to detect virus in the urine of free-living flying foxes (a putative route of excretion) to investigate Hendra virus infection dynamics. Pooled urine samples collected off plastic sheets placed beneath roosting flying foxes were screened for Hendra virus genome by quantitative RT-PCR, using a set of primers and probe derived from the matrix protein gene. A total of 1672 pooled urine samples from 67 sampling events was collected and tested between 1 July 2008 and 30 June 2011, with 25% of sampling events and 2.5% of urine samples yielding detections. The proportion of positive samples was statistically associated with year and location. The findings indicate that Hendra virus excretion occurs periodically rather than continuously, and in geographically disparate flying fox populations in the state of Queensland. The lack of any detection in the Northern Territory suggests prevalence may vary across the range of flying foxes in Australia. Finally, our findings suggest that flying foxes can excrete virus at any time of year, and that the apparent seasonal clustering of Hendra virus incidents in horses and associated humans (70% have occurred June to October) reflects factors other than the presence of virus. Identification of these factors will strengthen risk minimization strategies for horses and ultimately humans.

  7. A survey of matrix theory and matrix inequalities

    CERN Document Server

    Marcus, Marvin

    2010-01-01

    Written for advanced undergraduate students, this highly regarded book presents an enormous amount of information in a concise and accessible format. Beginning with the assumption that the reader has never seen a matrix before, the authors go on to provide a survey of a substantial part of the field, including many areas of modern research interest.Part One of the book covers not only the standard ideas of matrix theory, but ones, as the authors state, ""that reflect our own prejudices,"" among them Kronecker products, compound and induced matrices, quadratic relations, permanents, incidence

  8. Virus-Vectored Influenza Virus Vaccines

    Science.gov (United States)

    Tripp, Ralph A.; Tompkins, S. Mark

    2014-01-01

    Despite the availability of an inactivated vaccine that has been licensed for >50 years, the influenza virus continues to cause morbidity and mortality worldwide. Constant evolution of circulating influenza virus strains and the emergence of new strains diminishes the effectiveness of annual vaccines that rely on a match with circulating influenza strains. Thus, there is a continued need for new, efficacious vaccines conferring cross-clade protection to avoid the need for biannual reformulation of seasonal influenza vaccines. Recombinant virus-vectored vaccines are an appealing alternative to classical inactivated vaccines because virus vectors enable native expression of influenza antigens, even from virulent influenza viruses, while expressed in the context of the vector that can improve immunogenicity. In addition, a vectored vaccine often enables delivery of the vaccine to sites of inductive immunity such as the respiratory tract enabling protection from influenza virus infection. Moreover, the ability to readily manipulate virus vectors to produce novel influenza vaccines may provide the quickest path toward a universal vaccine protecting against all influenza viruses. This review will discuss experimental virus-vectored vaccines for use in humans, comparing them to licensed vaccines and the hurdles faced for licensure of these next-generation influenza virus vaccines. PMID:25105278

  9. QCD Matrix Elements + Parton Showers

    CERN Document Server

    Catani, S; Kühn, R; Webber, Bryan R

    2001-01-01

    We propose a method for combining QCD matrix elements and parton showers in Monte Carlo simulations of hadronic final states in $e^+e^-$ annihilation. The matrix element and parton shower domains are separated at some value $y_{ini}$ of the jet resolution, defined according to the $k_T$-clustering algorithm. The matrix elements are modified by Sudakov form factors and the parton showers are subjected to a veto procedure to cancel dependence on $y_{ini}$ to next-to-leading logarithmic accuracy. The method provides a leading-order description of hard multi-jet configurations together with jet fragmentation, while avoiding the most serious problems of double counting. We present first results of an approximate implementation using the event generator APACIC++.

  10. Lectures on matrix field theory

    CERN Document Server

    Ydri, Badis

    2017-01-01

    These lecture notes provide a systematic introduction to matrix models of quantum field theories with non-commutative and fuzzy geometries. The book initially focuses on the matrix formulation of non-commutative and fuzzy spaces, followed by a description of the non-perturbative treatment of the corresponding field theories. As an example, the phase structure of non-commutative phi-four theory is treated in great detail, with a separate chapter on the multitrace approach. The last chapter offers a general introduction to non-commutative gauge theories, while two appendices round out the text. Primarily written as a self-study guide for postgraduate students – with the aim of pedagogically introducing them to key analytical and numerical tools, as well as useful physical models in applications – these lecture notes will also benefit experienced researchers by providing a reference guide to the fundamentals of non-commutative field theory with an emphasis on matrix models and fuzzy geometries.

  11. Noncommutative spaces from matrix models

    Science.gov (United States)

    Lu, Lei

    Noncommutative (NC) spaces commonly arise as solutions to matrix model equations of motion. They are natural generalizations of the ordinary commutative spacetime. Such spaces may provide insights into physics close to the Planck scale, where quantum gravity becomes relevant. Although there has been much research in the literature, aspects of these NC spaces need further investigation. In this dissertation, we focus on properties of NC spaces in several different contexts. In particular, we study exact NC spaces which result from solutions to matrix model equations of motion. These spaces are associated with finite-dimensional Lie-algebras. More specifically, they are two-dimensional fuzzy spaces that arise from a three-dimensional Yang-Mills type matrix model, four-dimensional tensor-product fuzzy spaces from a tensorial matrix model, and Snyder algebra from a five-dimensional tensorial matrix model. In the first part of this dissertation, we study two-dimensional NC solutions to matrix equations of motion of extended IKKT-type matrix models in three-space-time dimensions. Perturbations around the NC solutions lead to NC field theories living on a two-dimensional space-time. The commutative limit of the solutions are smooth manifolds which can be associated with closed, open and static two-dimensional cosmologies. One particular solution is a Lorentzian fuzzy sphere, which leads to essentially a fuzzy sphere in the Minkowski space-time. In the commutative limit, this solution leads to an induced metric that does not have a fixed signature, and have a non-constant negative scalar curvature, along with singularities at two fixed latitudes. The singularities are absent in the matrix solution which provides a toy model for resolving the singularities of General relativity. We also discussed the two-dimensional fuzzy de Sitter space-time, which has irreducible representations of su(1,1) Lie-algebra in terms of principal, complementary and discrete series. Field

  12. White Spot Syndrome Virus infection in Penaeus monodon is ...

    Indian Academy of Sciences (India)

    In this study, we have employed one-dimensional and two-dimension virus overlay protein binding assay (VOPBA) followed by matrix-assisted laser desorption ionization-time of flight mass spectrometry (MALDI-TOF MS) to identify the host proteins of Penaeus monodon that could interact with WSSV. The VOPBA results ...

  13. Supersymmetry in random matrix theory

    Energy Technology Data Exchange (ETDEWEB)

    Kieburg, Mario

    2010-05-04

    I study the applications of supersymmetry in random matrix theory. I generalize the supersymmetry method and develop three new approaches to calculate eigenvalue correlation functions. These correlation functions are averages over ratios of characteristic polynomials. In the first part of this thesis, I derive a relation between integrals over anti-commuting variables (Grassmann variables) and differential operators with respect to commuting variables. With this relation I rederive Cauchy- like integral theorems. As a new application I trace the supermatrix Bessel function back to a product of two ordinary matrix Bessel functions. In the second part, I apply the generalized Hubbard-Stratonovich transformation to arbitrary rotation invariant ensembles of real symmetric and Hermitian self-dual matrices. This extends the approach for unitarily rotation invariant matrix ensembles. For the k-point correlation functions I derive supersymmetric integral expressions in a unifying way. I prove the equivalence between the generalized Hubbard-Stratonovich transformation and the superbosonization formula. Moreover, I develop an alternative mapping from ordinary space to superspace. After comparing the results of this approach with the other two supersymmetry methods, I obtain explicit functional expressions for the probability densities in superspace. If the probability density of the matrix ensemble factorizes, then the generating functions exhibit determinantal and Pfaffian structures. For some matrix ensembles this was already shown with help of other approaches. I show that these structures appear by a purely algebraic manipulation. In this new approach I use structures naturally appearing in superspace. I derive determinantal and Pfaffian structures for three types of integrals without actually mapping onto superspace. These three types of integrals are quite general and, thus, they are applicable to a broad class of matrix ensembles. (orig.)

  14. Supersymmetry in random matrix theory

    International Nuclear Information System (INIS)

    Kieburg, Mario

    2010-01-01

    I study the applications of supersymmetry in random matrix theory. I generalize the supersymmetry method and develop three new approaches to calculate eigenvalue correlation functions. These correlation functions are averages over ratios of characteristic polynomials. In the first part of this thesis, I derive a relation between integrals over anti-commuting variables (Grassmann variables) and differential operators with respect to commuting variables. With this relation I rederive Cauchy- like integral theorems. As a new application I trace the supermatrix Bessel function back to a product of two ordinary matrix Bessel functions. In the second part, I apply the generalized Hubbard-Stratonovich transformation to arbitrary rotation invariant ensembles of real symmetric and Hermitian self-dual matrices. This extends the approach for unitarily rotation invariant matrix ensembles. For the k-point correlation functions I derive supersymmetric integral expressions in a unifying way. I prove the equivalence between the generalized Hubbard-Stratonovich transformation and the superbosonization formula. Moreover, I develop an alternative mapping from ordinary space to superspace. After comparing the results of this approach with the other two supersymmetry methods, I obtain explicit functional expressions for the probability densities in superspace. If the probability density of the matrix ensemble factorizes, then the generating functions exhibit determinantal and Pfaffian structures. For some matrix ensembles this was already shown with help of other approaches. I show that these structures appear by a purely algebraic manipulation. In this new approach I use structures naturally appearing in superspace. I derive determinantal and Pfaffian structures for three types of integrals without actually mapping onto superspace. These three types of integrals are quite general and, thus, they are applicable to a broad class of matrix ensembles. (orig.)

  15. Polychoric/Tetrachoric Matrix or Pearson Matrix? A methodological study

    Directory of Open Access Journals (Sweden)

    Dominguez Lara, Sergio Alexis

    2014-04-01

    Full Text Available The use of product-moment correlation of Pearson is common in most studies in factor analysis in psychology, but it is known that this statistic is only applicable when the variables related are in interval scale and normally distributed, and when are used in ordinal data may to produce a distorted correlation matrix . Thus is a suitable option using polychoric/tetrachoric matrices in item-level factor analysis when the items are in level measurement nominal or ordinal. The aim of this study was to show the differences in the KMO, Bartlett`s Test and Determinant of the Matrix, percentage of variance explained and factor loadings in depression trait scale of Depression Inventory Trait - State and the Neuroticism dimension of the short form of the Eysenck Personality Questionnaire -Revised, regarding the use of matrices polychoric/tetrachoric matrices and Pearson. These instruments was analyzed with different extraction methods (Maximum Likelihood, Minimum Rank Factor Analysis, Unweighted Least Squares and Principal Components, keeping constant the rotation method Promin were analyzed. Were observed differences regarding sample adequacy measures, as well as with respect to the explained variance and the factor loadings, for solutions having as polychoric/tetrachoric matrix. So it can be concluded that the polychoric / tetrachoric matrix give better results than Pearson matrices when it comes to item-level factor analysis using different methods.

  16. Symmetries and Interactions in Matrix String Theory

    NARCIS (Netherlands)

    Hacquebord, F.H.

    1999-01-01

    This PhD-thesis reviews matrix string theory and recent developments therein. The emphasis is put on symmetries, interactions and scattering processes in the matrix model. We start with an introduction to matrix string theory and a review of the orbifold model that flows out of matrix string theory

  17. On the Matrix (I + X)-1

    NARCIS (Netherlands)

    Engwerda, J.C.

    2005-01-01

    In this note we consider the question under which conditions all entries of the matrix I-(I+X)-1 are nonnegative in case matrix X is a real positive definite matrix.Sufficient conditions are presented as well as some necessary conditions.One sufficient condition is that matrix X-1 is an inverse

  18. Matrix models of induced QCD

    International Nuclear Information System (INIS)

    Makeenko, Yu.

    1994-01-01

    I review recent works on the problem of inducing large-N QCD by matrix fields. In the first part of the talk I describe the matrix models which induce large-N QCD and present the results of studies of their phase structure by the standard lattice technology (in particular, by the mean field method). The second part is devoted to the exact solution of these models in the strong coupling region by means of the loop equations. I describe the solution of the Kazakov-Migdal model with the quadratic and logarithmic potentials as well as that of analogous fermionic models with the quadratic potential. (orig.)

  19. Inverse Interval Matrix: A Survey

    Czech Academy of Sciences Publication Activity Database

    Rohn, Jiří; Farhadsefat, R.

    2011-01-01

    Roč. 22, - (2011), s. 704-719 E-ISSN 1081-3810 R&D Projects: GA ČR GA201/09/1957; GA ČR GC201/08/J020 Institutional research plan: CEZ:AV0Z10300504 Keywords : interval matrix * inverse interval matrix * NP-hardness * enclosure * unit midpoint * inverse sign stability * nonnegative invertibility * absolute value equation * algorithm Subject RIV: BA - General Mathematics Impact factor: 0.808, year: 2010 http://www.math.technion.ac.il/iic/ela/ela-articles/articles/vol22_pp704-719.pdf

  20. The eWOM Matrix

    DEFF Research Database (Denmark)

    Martensen, Anne; Jensen, J.S; Gyrd-Jones, Richard

    Consumers often share opinions and personal consumption experiences on web-based consumer opinion platforms. These e-Word-of-Mouth (eWOM) reviews are powerful as they can prompt other consumers to consider a company and its offerings, but they can also cause the opposite effect. This article......WOM Matrix - where the customers’ touch points are the strategic connection between analysis and implementation of eWOM issues. The eWOM Matrix serves as a management tool, visually assisting companies to explore about which touch-points their customers’ primarily construct negative or positive e...

  1. Towards Google matrix of brain

    Energy Technology Data Exchange (ETDEWEB)

    Shepelyansky, D.L., E-mail: dima@irsamc.ups-tlse.f [Laboratoire de Physique Theorique (IRSAMC), Universite de Toulouse, UPS, F-31062 Toulouse (France); LPT - IRSAMC, CNRS, F-31062 Toulouse (France); Zhirov, O.V. [Budker Institute of Nuclear Physics, 630090 Novosibirsk (Russian Federation)

    2010-07-12

    We apply the approach of the Google matrix, used in computer science and World Wide Web, to description of properties of neuronal networks. The Google matrix G is constructed on the basis of neuronal network of a brain model discussed in PNAS 105 (2008) 3593. We show that the spectrum of eigenvalues of G has a gapless structure with long living relaxation modes. The PageRank of the network becomes delocalized for certain values of the Google damping factor {alpha}. The properties of other eigenstates are also analyzed. We discuss further parallels and similarities between the World Wide Web and neuronal networks.

  2. Towards Google matrix of brain

    International Nuclear Information System (INIS)

    Shepelyansky, D.L.; Zhirov, O.V.

    2010-01-01

    We apply the approach of the Google matrix, used in computer science and World Wide Web, to description of properties of neuronal networks. The Google matrix G is constructed on the basis of neuronal network of a brain model discussed in PNAS 105 (2008) 3593. We show that the spectrum of eigenvalues of G has a gapless structure with long living relaxation modes. The PageRank of the network becomes delocalized for certain values of the Google damping factor α. The properties of other eigenstates are also analyzed. We discuss further parallels and similarities between the World Wide Web and neuronal networks.

  3. Viruses infecting reptiles.

    Science.gov (United States)

    Marschang, Rachel E

    2011-11-01

    A large number of viruses have been described in many different reptiles. These viruses include arboviruses that primarily infect mammals or birds as well as viruses that are specific for reptiles. Interest in arboviruses infecting reptiles has mainly focused on the role reptiles may play in the epidemiology of these viruses, especially over winter. Interest in reptile specific viruses has concentrated on both their importance for reptile medicine as well as virus taxonomy and evolution. The impact of many viral infections on reptile health is not known. Koch's postulates have only been fulfilled for a limited number of reptilian viruses. As diagnostic testing becomes more sensitive, multiple infections with various viruses and other infectious agents are also being detected. In most cases the interactions between these different agents are not known. This review provides an update on viruses described in reptiles, the animal species in which they have been detected, and what is known about their taxonomic positions.

  4. Virus-Like Particles Exhibit Potential as a Pan-Filovirus Vaccine for Both Ebola and Marburg Viral Infections

    National Research Council Canada - National Science Library

    Swenson, Dana L; Warfield, Kelly L; Negley, Diane L; Schmaljohn, Alan; Aman, M. J; Bavari, Sina

    2005-01-01

    .... Previously, we showed that expression of the homologous glycoprotein (GP) and matrix protein VP40 from a single filovirus, either EBOV or MARV, resulted in formation of wild-type virus-like particles (VLPs) in mammalian cells...

  5. Analyzing Influenza Virus Sequences using Binary Encoding Approach

    Directory of Open Access Journals (Sweden)

    Ham Ching Lam

    2012-01-01

    Full Text Available Capturing mutation patterns of each individual influenza virus sequence is often challenging; in this paper, we demonstrated that using a binary encoding scheme coupled with dimension reduction technique, we were able to capture the intrinsic mutation pattern of the virus. Our approach looks at the variance between sequences instead of the commonly used p-distance or Hamming distance. We first convert the influenza genetic sequences to a binary strings and form a binary sequence alignment matrix and then apply Principal Component Analysis (PCA to this matrix. PCA also provides identification power to identify reassortant virus by using data projection technique. Due to the sparsity of the binary string, we were able to analyze large volume of influenza sequence data in a very short time. For protein sequences, our scheme also allows the incorporation of biophysical properties of each amino acid. Here, we present various encouraging results from analyzing influenza nucleotide, protein and genome sequences using the proposed approach.

  6. Matrix theory selected topics and useful results

    CERN Document Server

    Mehta, Madan Lal

    1989-01-01

    Matrices and operations on matrices ; determinants ; elementary operations on matrices (continued) ; eigenvalues and eigenvectors, diagonalization of normal matrices ; functions of a matrix ; positive definiteness, various polar forms of a matrix ; special matrices ; matrices with quaternion elements ; inequalities ; generalised inverse of a matrix ; domain of values of a matrix, location and dispersion of eigenvalues ; symmetric functions ; integration over matrix variables ; permanents of doubly stochastic matrices ; infinite matrices ; Alexander matrices, knot polynomials, torsion numbers.

  7. Molecular characterization of AI viruses from poultry and wild bird surveillance in Denmark

    DEFF Research Database (Denmark)

    Larsen, Lars Erik; Krog, Jesper Schak; Madsen, Jesper J.

    Infection with avian influenza virus (AIV) in poultry may cause devastating disease although the same virus may not cause disease in wild birds. Since AI viruses can be exchanged between poultry and wild birds, surveillance in wild birds provides important knowledge for control of disease...... in poultry. AIV’s from the Danish wild bird active surveillance were characterized, focusing on viruses from 2012, and from outbreaks of AI in poultry in Denmark. The matrix (M) gene from more than 50 viruses of different subtypes and the hemagglutinin (HA) gene from more than 30 subtype H5 low pathogenic...... viruses were sequenced and compared by alignment and phylogenetic analyses. The aim was to evaluate: the origin of viruses from outbreaks of AI in Danish poultry, the design of active surveillance in Denmark, and the suitability of the molecular diagnostic RT-PCR tests employed. All M-genes from Danish...

  8. Virus Infection

    Directory of Open Access Journals (Sweden)

    Hiroshi Abe

    2013-01-01

    Full Text Available Of 168 patients with chronic hepatitis B virus (HBV infection-related liver disease, 20 patients who had received 100 mg of lamivudine plus 10 mg/day of adefovir dipivoxil (ADV (ADV group and 124 patients who had received 0.5 mg/day of entecavir or 100 mg/day of lamivudine (non-ADV group for >1 year were enrolled. For comparative analyses, 19 well-matched pairs were obtained from the groups by propensity scores. At the time of enrollment, serum creatinine and phosphate concentrations were similar between the ADV and non-ADV groups; however, urinary phosphate ( and serum bone-specific alkaline phosphatase (BAP ( concentrations were significantly higher in the ADV group than in the non-ADV group. Serum BAP was significantly higher at the time of enrollment than before ADV administration in the ADV group (, although there was no significant change in serum BAP concentration in the non-ADV group. There was a significant positive correlation between the period of ADV therapy and ΔBAP (, . Serum BAP concentration increased before increase in serum creatinine concentration and was useful for early detection of adverse events and for developing adequate measures for continuing ADV for chronic HBV infection-related liver disease.

  9. Matrix Treatment of Ray Optics.

    Science.gov (United States)

    Quon, W. Steve

    1996-01-01

    Describes a method to combine two learning experiences--optical physics and matrix mathematics--in a straightforward laboratory experiment that allows engineering/physics students to integrate a variety of learning insights and technical skills, including using lasers, studying refraction through thin lenses, applying concepts of matrix…

  10. Parallel Sparse Matrix - Vector Product

    DEFF Research Database (Denmark)

    Alexandersen, Joe; Lazarov, Boyan Stefanov; Dammann, Bernd

    This technical report contains a case study of a sparse matrix-vector product routine, implemented for parallel execution on a compute cluster with both pure MPI and hybrid MPI-OpenMP solutions. C++ classes for sparse data types were developed and the report shows how these class can be used...

  11. A two-matrix alternative

    Czech Academy of Sciences Publication Activity Database

    Rohn, Jiří

    2013-01-01

    Roč. 26, 15 December (2013), s. 836-841 ISSN 1537-9582 Institutional support: RVO:67985807 Keywords : two-matrix alternative * solution * algorithm Subject RIV: BA - General Mathematics Impact factor: 0.514, year: 2013 http://www.math.technion.ac.il/iic/ela/ela-articles/articles/vol26_pp836-841.pdf

  12. Amorphous metal matrix composite ribbons

    International Nuclear Information System (INIS)

    Barczy, P.; Szigeti, F.

    1998-01-01

    Composite ribbons with amorphous matrix and ceramic (SiC, WC, MoB) particles were produced by modified planar melt flow casting methods. Weldability, abrasive wear and wood sanding examinations were carried out in order to find optimal material and technology for elevated wear resistance and sanding durability. The correlation between structure and composite properties is discussed. (author)

  13. Extracellular matrix and wound healing.

    Science.gov (United States)

    Maquart, F X; Monboisse, J C

    2014-04-01

    Extracellular matrix has been known for a long time as an architectural support for the tissues. Many recent data, however, have shown that extracellular matrix macromolecules (collagens, elastin, glycosaminoglycans, proteoglycans and connective tissue glycoproteins) are able to regulate many important cell functions, such as proliferation, migration, protein synthesis or degradation, apoptosis, etc., making them able to play an important role in the wound repair process. Not only the intact macromolecules but some of their specific domains, that we called "Matrikines", are also able to regulate many cell activities. In this article, we will summarize main findings showing the effects of extracellular matrix macromolecules and matrikines on connective tissue and epithelial cells, particularly in skin, and their potential implication in the wound healing process. These examples show that extracellular matrix macromolecules or some of their specific domains may play a major role in wound healing. Better knowledge of these interactions may suggest new therapeutic targets in wound healing defects. Copyright © 2014 Elsevier Masson SAS. All rights reserved.

  14. Concept for Energy Security Matrix

    International Nuclear Information System (INIS)

    Kisel, Einari; Hamburg, Arvi; Härm, Mihkel; Leppiman, Ando; Ots, Märt

    2016-01-01

    The following paper presents a discussion of short- and long-term energy security assessment methods and indicators. The aim of the current paper is to describe diversity of approaches to energy security, to structure energy security indicators used by different institutions and papers, and to discuss several indicators that also play important role in the design of energy policy of a state. Based on this analysis the paper presents a novel Energy Security Matrix that structures relevant energy security indicators from the aspects of Technical Resilience and Vulnerability, Economic Dependence and Political Affectability for electricity, heat and transport fuel sectors. Earlier publications by different authors have presented energy security assessment methodologies that use publicly available indicators from different databases. Current paper challenges viability of some of these indicators and introduces new indicators that would deliver stronger energy security policy assessments. Energy Security Matrix and its indicators are based on experiences that the authors have gathered as high-level energy policymakers in Estonia, where all different aspects of energy security can be observed. - Highlights: •Energy security should be analysed in technical, economic and political terms; •Energy Security Matrix provides a framework for energy security analyses; •Applicability of Matrix is limited due to the lack of statistical data and sensitivity of output.

  15. The COMPADRE Plant Matrix Database

    DEFF Research Database (Denmark)

    2014-01-01

    COMPADRE contains demographic information on hundreds of plant species. The data in COMPADRE are in the form of matrix population models and our goal is to make these publicly available to facilitate their use for research and teaching purposes. COMPADRE is an open-access database. We only request...

  16. Unravelling the nuclear matrix proteome

    DEFF Research Database (Denmark)

    Albrethsen, Jakob; Knol, Jaco C; Jimenez, Connie R

    2009-01-01

    The nuclear matrix (NM) model posits the presence of a protein/RNA scaffold that spans the mammalian nucleus. The NM proteins are involved in basic nuclear function and are a promising source of protein biomarkers for cancer. Importantly, the NM proteome is operationally defined as the proteins...

  17. Hyper-systolic matrix multiplication

    NARCIS (Netherlands)

    Lippert, Th.; Petkov, N.; Palazzari, P.; Schilling, K.

    A novel parallel algorithm for matrix multiplication is presented. It is based on a 1-D hyper-systolic processor abstraction. The procedure can be implemented on all types of parallel systems. (C) 2001 Elsevier Science B,V. All rights reserved.

  18. Regularization in Matrix Relevance Learning

    NARCIS (Netherlands)

    Schneider, Petra; Bunte, Kerstin; Stiekema, Han; Hammer, Barbara; Villmann, Thomas; Biehl, Michael

    A In this paper, we present a regularization technique to extend recently proposed matrix learning schemes in learning vector quantization (LVQ). These learning algorithms extend the concept of adaptive distance measures in LVQ to the use of relevance matrices. In general, metric learning can

  19. Prenatal brain MRI of fetuses with Zika virus infection.

    Science.gov (United States)

    Guillemette-Artur, Prisca; Besnard, Marianne; Eyrolle-Guignot, Dominique; Jouannic, Jean-Marie; Garel, Catherine

    2016-06-01

    An outbreak of Zika virus was observed in French Polynesia in 2013-2014. Maternal Zika virus infection has been associated with fetal microcephaly and severe cerebral damage. To analyze the MRI cerebral findings in fetuses with intrauterine Zika virus infection. We retrospectively analyzed prospectively collected data. Inclusion criteria comprised cases with (1) estimated conception date between June 2013 and May 2014, (2) available US and MRI scans revealing severe fetal brain lesions and (3) positive polymerase chain reaction for Zika virus in the amniotic fluid. We recorded pregnancy history of Zika virus infection and analyzed US and MRI scans. Three out of 12 cases of severe cerebral lesions fulfilled all inclusion criteria. History of maternal Zika virus infection had been documented in two cases. Calcifications and ventriculomegaly were present at US in all cases. MRI showed micrencephaly (n = 3), low cerebellar biometry (n = 2), occipital subependymal pseudocysts (n = 2), polymicrogyria with laminar necrosis and opercular dysplasia (n = 3), absent (n = 1) or hypoplastic (n = 1) corpus callosum and hypoplastic brainstem (n = 1). Severe cerebral damage was observed in our series, with indirect findings suggesting that the germinal matrix is the principal target for Zika virus. The lesions are very similar to severe forms of congenital cytomegalovirus and lymphocytic choriomeningitis virus infections.

  20. Prenatal brain MRI of fetuses with Zika virus infection

    Energy Technology Data Exchange (ETDEWEB)

    Guillemette-Artur, Prisca [Centre Hospitalier de Polynesie Francaise, Service de Radiologie, Pirae, Tahiti (Country Unknown); Besnard, Marianne [Centre Hospitalier de Polynesie Francaise, Service de Reanimation Neo-natale, Pirae, Tahiti (Country Unknown); Eyrolle-Guignot, Dominique [Centre Hospitalier de Polynesie Francaise, Service d' Obstetrique, Pirae, Tahiti (Country Unknown); Jouannic, Jean-Marie [Universite Pierre et Marie Curie, Service de Medecine Foetale, Hopital d' Enfants Armand-Trousseau, Paris (France); Garel, Catherine [Hopital d' Enfants Armand-Trousseau, Department of Radiology, Paris (France)

    2016-06-15

    An outbreak of Zika virus was observed in French Polynesia in 2013-2014. Maternal Zika virus infection has been associated with fetal microcephaly and severe cerebral damage. To analyze the MRI cerebral findings in fetuses with intrauterine Zika virus infection. We retrospectively analyzed prospectively collected data. Inclusion criteria comprised cases with (1) estimated conception date between June 2013 and May 2014, (2) available US and MRI scans revealing severe fetal brain lesions and (3) positive polymerase chain reaction for Zika virus in the amniotic fluid. We recorded pregnancy history of Zika virus infection and analyzed US and MRI scans. Three out of 12 cases of severe cerebral lesions fulfilled all inclusion criteria. History of maternal Zika virus infection had been documented in two cases. Calcifications and ventriculomegaly were present at US in all cases. MRI showed micrencephaly (n = 3), low cerebellar biometry (n = 2), occipital subependymal pseudocysts (n = 2), polymicrogyria with laminar necrosis and opercular dysplasia (n = 3), absent (n = 1) or hypoplastic (n = 1) corpus callosum and hypoplastic brainstem (n = 1). Severe cerebral damage was observed in our series, with indirect findings suggesting that the germinal matrix is the principal target for Zika virus. The lesions are very similar to severe forms of congenital cytomegalovirus and lymphocytic choriomeningitis virus infections. (orig.)

  1. Prenatal brain MRI of fetuses with Zika virus infection

    International Nuclear Information System (INIS)

    Guillemette-Artur, Prisca; Besnard, Marianne; Eyrolle-Guignot, Dominique; Jouannic, Jean-Marie; Garel, Catherine

    2016-01-01

    An outbreak of Zika virus was observed in French Polynesia in 2013-2014. Maternal Zika virus infection has been associated with fetal microcephaly and severe cerebral damage. To analyze the MRI cerebral findings in fetuses with intrauterine Zika virus infection. We retrospectively analyzed prospectively collected data. Inclusion criteria comprised cases with (1) estimated conception date between June 2013 and May 2014, (2) available US and MRI scans revealing severe fetal brain lesions and (3) positive polymerase chain reaction for Zika virus in the amniotic fluid. We recorded pregnancy history of Zika virus infection and analyzed US and MRI scans. Three out of 12 cases of severe cerebral lesions fulfilled all inclusion criteria. History of maternal Zika virus infection had been documented in two cases. Calcifications and ventriculomegaly were present at US in all cases. MRI showed micrencephaly (n = 3), low cerebellar biometry (n = 2), occipital subependymal pseudocysts (n = 2), polymicrogyria with laminar necrosis and opercular dysplasia (n = 3), absent (n = 1) or hypoplastic (n = 1) corpus callosum and hypoplastic brainstem (n = 1). Severe cerebral damage was observed in our series, with indirect findings suggesting that the germinal matrix is the principal target for Zika virus. The lesions are very similar to severe forms of congenital cytomegalovirus and lymphocytic choriomeningitis virus infections. (orig.)

  2. Disease: H00391 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available (50-100%). Infectious disease ... Hendra virus [GN:T40046] Nipah virus [GN:T40047...] ... Vector: Pteropus bats (flying foxex) MeSH: D045464 PMID:22483665 (description) ... AUTHORS ... Marsh GA, W

  3. [Mechanisms of viral emergence and interspecies transmission: the exemple of simian foamy viruses in Central Africa].

    Science.gov (United States)

    Gessain, Antoine

    2013-12-01

    A large proportion of viral pathogens that have emerged during the last decades in humans are considered to have originated from various animal species. This is well exemplified by several recent epidemics such as those of Nipah, Severe Acute Respiratory Syndrome, Avian flu, Ebola, Monkeypox, and Hantaviruses. After the initial interspecies transmission per se, the viruses can disseminate into the human population through various and distinct mechanisms. Some of them are well characterized and understood, thus allowing a certain level of risk control and prevention. Surprisingly and in contrast, the initial steps that lead to the emergence of several viruses, and of their associated diseases, remain still poorly understood. Epidemiological field studies conducted in certain specific high-risk populations are thus necessary to obtain new insights into the early events of this emergence process. Human infections by simian viruses represent increasing public health concerns. Indeed, by virtue of their genetic andphysiological similarities, non-human primates (NHPs) are considered to be likely the sources of viruses that can infect humans and thus may pose a significant threat to human population. This is well illustrated by retroviruses, which have the ability to cross species, adapt to a new host and sometimes spread within these new species. Sequence comparison and phylogenetic studies have thus clearly showed that the emergence of human immunodeficiency virus type 1 (HIV-1) and HIV-2 in humans have resulted from several independent interspecies transmissions of different SIV types from Chimpanzees and African monkeys (including sooty mangabeys), respectively, probably during the first part of the last century. The situation for Human T cell Lymphotropic virus type 1 (HTLV-1) is, for certain aspects, quite comparable. Indeed, the origin of most HTLV-1 subtypes appears to be linked to interspecies transmission between STLV-1-infected monkeys and humans, followed by

  4. Human Parainfluenza Viruses

    Science.gov (United States)

    ... Search Form Controls Cancel Submit Search The CDC Human Parainfluenza Viruses (HPIVs) Note: Javascript is disabled or ... CDC.gov . Recommend on Facebook Tweet Share Compartir Human parainfluenza viruses (HPIVs) commonly cause respiratory illnesses in ...

  5. Hepatitis virus panel

    Science.gov (United States)

    ... page: //medlineplus.gov/ency/article/003558.htm Hepatitis virus panel To use the sharing features on this page, please enable JavaScript. The hepatitis virus panel is a series of blood tests used ...

  6. Zika Virus and Pregnancy

    Medline Plus

    Full Text Available ... My ACOG ACOG Departments Donate Shop Career Connection Home Clinical Guidance & Publications Practice Management Education & Events Advocacy For Patients About ACOG Zika Virus and Pregnancy Home For Patients Zika Virus and Pregnancy Page Navigation ▼ ...

  7. Influenza (Flu) Viruses

    Science.gov (United States)

    ... and antigenic shift. Transmission of Influenza Viruses from Animals to People Influenza A viruses also are found in many different animals, including ducks, chickens, pigs, whales, horses and seals. ...

  8. Zika Virus - Multiple Languages

    Science.gov (United States)

    ... Are Here: Home → Multiple Languages → All Health Topics → Zika Virus URL of this page: https://medlineplus.gov/languages/ ... V W XYZ List of All Topics All Zika Virus - Multiple Languages To use the sharing features on ...

  9. Viruses and human cancer

    Energy Technology Data Exchange (ETDEWEB)

    Gallo, R.C.; Haseltine, W.; Klein, G.; Zur Hausen, H.

    1987-01-01

    This book contains papers on the following topics: Immunology and Epidemiology, Biology and Pathogenesis, Models of Pathogenesis and Treatment, Simian and Bovine Retroviruses, Human Papilloma Viruses, EBV and Herpesvirus, and Hepatitis B Virus.

  10. Viruses and Breast Cancer

    Energy Technology Data Exchange (ETDEWEB)

    Lawson, James S., E-mail: james.lawson@unsw.edu.au; Heng, Benjamin [School of Biotechnology and Biomolecular Sciences, University of New South Wales, Sydney (Australia)

    2010-04-30

    Viruses are the accepted cause of many important cancers including cancers of the cervix and anogenital area, the liver, some lymphomas, head and neck cancers and indirectly human immunodeficiency virus associated cancers. For over 50 years, there have been serious attempts to identify viruses which may have a role in breast cancer. Despite these efforts, the establishment of conclusive evidence for such a role has been elusive. However, the development of extremely sophisticated new experimental techniques has allowed the recent development of evidence that human papilloma virus, Epstein-Barr virus, mouse mammary tumor virus and bovine leukemia virus may each have a role in the causation of human breast cancers. This is potentially good news as effective vaccines are already available to prevent infections from carcinogenic strains of human papilloma virus, which causes cancer of the uterine cervix.

  11. Viruses and Breast Cancer

    International Nuclear Information System (INIS)

    Lawson, James S.; Heng, Benjamin

    2010-01-01

    Viruses are the accepted cause of many important cancers including cancers of the cervix and anogenital area, the liver, some lymphomas, head and neck cancers and indirectly human immunodeficiency virus associated cancers. For over 50 years, there have been serious attempts to identify viruses which may have a role in breast cancer. Despite these efforts, the establishment of conclusive evidence for such a role has been elusive. However, the development of extremely sophisticated new experimental techniques has allowed the recent development of evidence that human papilloma virus, Epstein-Barr virus, mouse mammary tumor virus and bovine leukemia virus may each have a role in the causation of human breast cancers. This is potentially good news as effective vaccines are already available to prevent infections from carcinogenic strains of human papilloma virus, which causes cancer of the uterine cervix

  12. Matrix-Free Preconditioning using Partial Matrix Estimation

    Czech Academy of Sciences Publication Activity Database

    Cullum, J. K.; Tůma, Miroslav

    2006-01-01

    Roč. 46, č. 4 (2006), s. 711-729 ISSN 0006-3835 R&D Projects: GA AV ČR 1ET400300415; GA AV ČR IAA1030405 Institutional research plan: CEZ:AV0Z10300504 Keywords : matrix-free algorithms * linear algebraic equations * large sparse matrices * preconditioned iterative methods Subject RIV: BA - General Mathematics Impact factor: 0.841, year: 2006

  13. Matrix metalloproteinases in fish biology and matrix turnover.

    Science.gov (United States)

    Pedersen, Mona E; Vuong, Tram T; Rønning, Sissel B; Kolset, Svein O

    2015-01-01

    Matrix metalloproteinases have important functions for tissue turnover in fish, with relevance both for the fish industry and molecular and cellular research on embryology, inflammation and tissue repair. These metalloproteinases have been studied in different fish types, subjected to both aquaculture and experimental conditions. This review highlights studies on these metalloproteinases in relation to both fish quality and health and further, the future importance of fish for basic research studies. Copyright © 2015. Published by Elsevier B.V.

  14. Protein and modified vaccinia virus Ankara-based influenza virus nucleoprotein vaccines are differentially immunogenic in BALB/c mice.

    Science.gov (United States)

    Altenburg, A F; Magnusson, S E; Bosman, F; Stertman, L; de Vries, R D; Rimmelzwaan, G F

    2017-10-01

    Because of the high variability of seasonal influenza viruses and the eminent threat of influenza viruses with pandemic potential, there is great interest in the development of vaccines that induce broadly protective immunity. Most probably, broadly protective influenza vaccines are based on conserved proteins, such as nucleoprotein (NP). NP is a vaccine target of interest as it has been shown to induce cross-reactive antibody and T cell responses. Here we tested and compared various NP-based vaccine preparations for their capacity to induce humoral and cellular immune responses to influenza virus NP. The immunogenicity of protein-based vaccine preparations with Matrix-M™ adjuvant as well as recombinant viral vaccine vector modified Vaccinia virus Ankara (MVA) expressing the influenza virus NP gene, with or without modifications that aim at optimization of CD8 + T cell responses, was addressed in BALB/c mice. Addition of Matrix-M™ adjuvant to NP wild-type protein-based vaccines significantly improved T cell responses. Furthermore, recombinant MVA expressing the influenza virus NP induced strong antibody and CD8 + T cell responses, which could not be improved further by modifications of NP to increase antigen processing and presentation. © 2017 British Society for Immunology.

  15. Omentin-1 prevents cartilage matrix destruction by regulating matrix metalloproteinases.

    Science.gov (United States)

    Li, Zhigang; Liu, Baoyi; Zhao, Dewei; Wang, BenJie; Liu, Yupeng; Zhang, Yao; Li, Borui; Tian, Fengde

    2017-08-01

    Matrix metalloproteinases (MMPs) play a crucial role in the degradation of the extracellular matrix and pathological progression of osteoarthritis (OA). Omentin-1 is a newly identified anti-inflammatory adipokine. Little information regarding the protective effects of omentin-1 in OA has been reported before. In the current study, our results indicated that omentin-1 suppressed expression of MMP-1, MMP-3, and MMP-13 induced by the proinflammatory cytokine interleukin-1β (IL-1β) at both the mRNA and protein levels in human chondrocytes. Importantly, administration of omentin-1 abolished IL-1β-induced degradation of type II collagen (Col II) and aggrecan, the two major extracellular matrix components in articular cartilage, in a dose-dependent manner. Mechanistically, omentin-1 ameliorated the expression of interferon regulatory factor 1 (IRF-1) by blocking the JAK-2/STAT3 pathway. Our results indicate that omentin-1 may have a potential chondroprotective therapeutic capacity. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

  16. Nairobi sheep disease virus/Ganjam virus.

    Science.gov (United States)

    M D, Baron; B, Holzer

    2015-08-01

    Nairobi sheep disease virus (NSDV) is a tick-borne virus which causes a severe disease in sheep and goats, and has been responsible for several outbreaks of disease in East Africa. The virus is also found in the Indian subcontinent, where it is known as Ganjam virus. The virus only spreads through the feeding of competent infected ticks, and is therefore limited in its geographic distribution by the distribution of those ticks, Rhipicephalus appendiculata in Africa and Haemaphysalis intermedia in India. Animals bred in endemic areas do not normally develop disease, and the impact is therefore primarily on animals being moved for trade or breeding purposes. The disease caused by NSDV has similarities to several other ruminant diseases, and laboratory diagnosis is necessary for confirmation. There are published methods for diagnosis based on polymerase chain reaction, for virus growth in cell culture and for other simple diagnostic tests, though none has been commercialised. There is no established vaccine against NSDV, although cell-culture attenuated strains have been developed which show promise and could be put into field trials if it were deemed necessary. The virus is closely related to Crimean-Congo haemorrhagic fever virus, and studies on NSDV may therefore be useful in understanding this important human pathogen.

  17. Immunomodulation by viruses: the myxoma virus story.

    Science.gov (United States)

    Nash, P; Barrett, J; Cao, J X; Hota-Mitchell, S; Lalani, A S; Everett, H; Xu, X M; Robichaud, J; Hnatiuk, S; Ainslie, C; Seet, B T; McFadden, G

    1999-04-01

    Myxoma virus is a poxvirus pathogen of rabbits that has evolved to replicate successfully in the presence of an active immune response by an infected host. To accomplish this, the virus has developed a variety of strategies to avoid detection by or obstruct specific aspects of the antiviral response whose consolidated action is antagonistic to virus survival. We describe two distinct viral strategies carried out by viral proteins with which myxoma virus subverts the host immune response. The first strategy is the production of virus-encoded proteins known as viroceptors or virokines that mimic host receptors or cytokines. These seek to actively block extracellular immune signals required for effective virus clearance and produce a local environment in the infected tissue that is "virus friendly". The second strategy, carried out by intracellular viral proteins, seeks to retard the innate antiviral responses such as apoptosis, and hinder attempts by the infected cell to communicate with the cellular arm of the immune system. By studying these viral strategies of immune evasion, the myxoma system can provide insights into virus-host interactions and also provide new insights into the complex immune system.

  18. Characteristic of pandemic virus

    Indian Academy of Sciences (India)

    First page Back Continue Last page Graphics. Characteristic of pandemic virus. The virus was highly transmissible. Risk of hospitalization was 2X and risk of death was about 11X more in comparison to seasonal influenza. Virus continues to be susceptible to Osaltamivir, the only drug available. Vaccines are available but ...

  19. Computer Virus Protection

    Science.gov (United States)

    Rajala, Judith B.

    2004-01-01

    A computer virus is a program--a piece of executable code--that has the unique ability to replicate. Like biological viruses, computer viruses can spread quickly and are often difficult to eradicate. They can attach themselves to just about any type of file, and are spread by replicating and being sent from one individual to another. Simply having…

  20. The doubly negative matrix completion problem

    OpenAIRE

    Araújo, C. Mendes; Torregrosa, Juan R.; Urbano, Ana M.

    2005-01-01

    An $n\\times n$ matrix over the field of real numbers is a doubly negative matrix if it is symmetric, negative definite and entry-wise negative. In this paper, we are interested in the doubly negative matrix completion problem, that is when does a partial matrix have a doubly negative matrix completion. In general, we cannot guarantee the existence of such a completion. In this paper, we prove that every partial doubly negative matrix whose associated graph is a $p$-chorda...

  1. Minimal solution for inconsistent singular fuzzy matrix equations

    Directory of Open Access Journals (Sweden)

    M. Nikuie

    2013-10-01

    Full Text Available The fuzzy matrix equations $Ailde{X}=ilde{Y}$ is called a singular fuzzy matrix equations while the coefficients matrix of its equivalent crisp matrix equations be a singular matrix. The singular fuzzy matrix equations are divided into two parts: consistent singular matrix equations and inconsistent fuzzy matrix equations. In this paper, the inconsistent singular fuzzy matrix equations is studied and the effect of generalized inverses in finding minimal solution of an inconsistent singular fuzzy matrix equations are investigated.

  2. The gravitational S-matrix

    CERN Document Server

    Giddings, Steven B

    2010-01-01

    We investigate the hypothesized existence of an S-matrix for gravity, and some of its expected general properties. We first discuss basic questions regarding existence of such a matrix, including those of infrared divergences and description of asymptotic states. Distinct scattering behavior occurs in the Born, eikonal, and strong gravity regimes, and we describe aspects of both the partial wave and momentum space amplitudes, and their analytic properties, from these regimes. Classically the strong gravity region would be dominated by formation of black holes, and we assume its unitary quantum dynamics is described by corresponding resonances. Masslessness limits some powerful methods and results that apply to massive theories, though a continuation path implying crossing symmetry plausibly still exists. Physical properties of gravity suggest nonpolynomial amplitudes, although crossing and causality constrain (with modest assumptions) this nonpolynomial behavior, particularly requiring a polynomial bound in c...

  3. Matrix Factorization for Evolution Data

    Directory of Open Access Journals (Sweden)

    Xiao-Yu Huang

    2014-01-01

    Full Text Available We study a matrix factorization problem, that is, to find two factor matrices U and V such that R≈UT×V, where R is a matrix composed of the values of the objects O1,O2,…,On at consecutive time points T1,T2,…,Tt. We first present MAFED, a constrained optimization model for this problem, which straightforwardly performs factorization on R. Then based on the interplay of the data in U, V, and R, a probabilistic graphical model using the same optimization objects is constructed, in which structural dependencies of the data in these matrices are revealed. Finally, we present a fitting algorithm to solve the proposed MAFED model, which produces the desired factorization. Empirical studies on real-world datasets demonstrate that our approach outperforms the state-of-the-art comparison algorithms.

  4. Random matrix improved subspace clustering

    KAUST Repository

    Couillet, Romain

    2017-03-06

    This article introduces a spectral method for statistical subspace clustering. The method is built upon standard kernel spectral clustering techniques, however carefully tuned by theoretical understanding arising from random matrix findings. We show in particular that our method provides high clustering performance while standard kernel choices provably fail. An application to user grouping based on vector channel observations in the context of massive MIMO wireless communication networks is provided.

  5. Coherence matrix of plasmonic beams

    DEFF Research Database (Denmark)

    Novitsky, Andrey; Lavrinenko, Andrei

    2013-01-01

    We consider monochromatic electromagnetic beams of surface plasmon-polaritons created at interfaces between dielectric media and metals. We theoretically study non-coherent superpositions of elementary surface waves and discuss their spectral degree of polarization, Stokes parameters, and the for...... of the spectral coherence matrix. We compare the polarization properties of the surface plasmonspolaritons as three-dimensional and two-dimensional fields concluding that the latter is superior....

  6. Viruses of asparagus.

    Science.gov (United States)

    Tomassoli, Laura; Tiberini, Antonio; Vetten, Heinrich-Josef

    2012-01-01

    The current knowledge on viruses infecting asparagus (Asparagus officinalis) is reviewed. Over half a century, nine virus species belonging to the genera Ilarvirus, Cucumovirus, Nepovirus, Tobamovirus, Potexvirus, and Potyvirus have been found in this crop. The potyvirus Asparagus virus 1 (AV1) and the ilarvirus Asparagus virus 2 (AV2) are widespread and negatively affect the economic life of asparagus crops reducing yield and increasing the susceptibility to biotic and abiotic stress. The main properties and epidemiology of AV1 and AV2 as well as diagnostic techniques for their detection and identification are described. Minor viruses and control are briefly outlined. Copyright © 2012 Elsevier Inc. All rights reserved.

  7. Understanding Ebola Virus Transmission

    Directory of Open Access Journals (Sweden)

    Seth Judson

    2015-02-01

    Full Text Available An unprecedented number of Ebola virus infections among healthcare workers and patients have raised questions about our understanding of Ebola virus transmission. Here, we explore different routes of Ebola virus transmission between people, summarizing the known epidemiological and experimental data. From this data, we expose important gaps in Ebola virus research pertinent to outbreak situations. We further propose experiments and methods of data collection that will enable scientists to fill these voids in our knowledge about the transmission of Ebola virus.

  8. ICTV Virus Taxonomy Profile

    DEFF Research Database (Denmark)

    Simmonds, Peter; Becher, Paul; Bukh, Jens

    2017-01-01

    The Flaviviridae is a family of small enveloped viruses with RNA genomes of 9000-13 000 bases. Most infect mammals and birds. Many flaviviruses are host-specific and pathogenic, such as hepatitis C virus in the genus Hepacivirus. The majority of known members in the genus Flavivirus are arthropod...... borne, and many are important human and veterinary pathogens (e.g. yellow fever virus, dengue virus). This is a summary of the current International Committee on Taxonomy of Viruses (ICTV) report on the taxonomy of the Flaviviridae, which is available at www.ictv.global/report/flaviviridae....

  9. Cubic Matrix, Nambu Mechanics and Beyond

    OpenAIRE

    Yoshiharu, KAWAMURA; Department of Physics, Shinshu University

    2003-01-01

    We propose a generalization of cubic matrix mechanics by introducing a canonical triplet and study its relation to Nambu mechanics. The generalized cubic matrix mechanics we consider can be interpreted as a 'quantum' generalization of Nambu mechanics.

  10. Matrix Models and String World Sheet Duality

    OpenAIRE

    de Alwis, S. P.

    1997-01-01

    The scaling limit used recently to derive matrix models, and a certain analyticity assumption, are invoked to argue that the agreement between some matrix model calculations and supergravity is a consequence of string world sheet duality.

  11. Cubic Matrix, Nambu Mechanics and Beyond

    OpenAIRE

    Kawamura, Yoshiharu

    2002-01-01

    We propose a generalization of cubic matrix mechanics by introducing a canonical triplet and study its relation to Nambu mechanics. The generalized cubic matrix mechanics we consider can be interpreted as a “quantum” generalization of Nambu mechanics.

  12. Glomerular extracellular matrix components and integrins

    NARCIS (Netherlands)

    Sterk, L. M.; de Melker, A. A.; Kramer, D.; Kuikman, I.; Chand, A.; Claessen, N.; Weening, J. J.; Sonnenberg, A.

    1998-01-01

    It has become apparent that extracellular matrix components and their cellular receptors, the integrins, are important regulators of glomerular development and function. In this rapidly evolving field we studied the production of extracellular matrix components and integrins by rat glomerular

  13. Protoplasts and plant viruses

    International Nuclear Information System (INIS)

    Murakishi, H.; Lesney, M.S.; Carlson, P.

    1984-01-01

    The use of protoplasts in the study of plant viruses has attracted considerable attention since its inception in the late 1960s. This article is an attempt to assess the current status of protoplasts (primarily) and all cell cultures (in some instances) in studies of virus infection, virus replication, cytopathology, cross-protection, virus resistance, and the use of in vitro methods and genetic engineering to recover virus-resistant plants. These areas of study proved difficult to do entirely with whole plants or plant parts. However, because protoplasts could be synchronously infected with virus, they provided a valuable alternative means of following biochemical and cytological events in relation to the virus growth cycle in a more precise manner than previously possible

  14. Vaccinia virus immune evasion.

    Science.gov (United States)

    Smith, G L

    1999-01-01

    Vaccinia virus expresses many virulence factors that are non-essential for virus replication in cell culture but are important in vivo. In this paper three mechanisms are described that are used by vaccinia virus to evade the host immune response to infection. One of these is the release of a soluble protein that binds CC chemokines and that is unrelated to cellular chemokine receptors. The other two mechanisms are displayed by virus particles that are released from infected cells. This form of vaccinia virus is called extracellular enveloped virus (EEV) and is resistant to neutralisation by antibody and to destruction by complement. Resistance to complement is mediated by the acquisition of host complement control proteins, particularly CD55, during virus release from infected cells.

  15. Analytic matrix elements with shifted correlated Gaussians

    DEFF Research Database (Denmark)

    Fedorov, D. V.

    2017-01-01

    Matrix elements between shifted correlated Gaussians of various potentials with several form-factors are calculated analytically. Analytic matrix elements are of importance for the correlated Gaussian method in quantum few-body physics.......Matrix elements between shifted correlated Gaussians of various potentials with several form-factors are calculated analytically. Analytic matrix elements are of importance for the correlated Gaussian method in quantum few-body physics....

  16. A quenched c = 1 critical matrix model

    International Nuclear Information System (INIS)

    Qiu, Zongan; Rey, Soo-Jong.

    1990-12-01

    We study a variant of the Penner-Distler-Vafa model, proposed as a c = 1 quantum gravity: 'quenched' matrix model with logarithmic potential. The model is exactly soluble, and exhibits a two-cut branching as observed in multicritical unitary matrix models and multicut Hermitian matrix models. Using analytic continuation of the power in the conventional polynomial potential, we also show that both the Penner-Distler-Vafa model and our 'quenched' matrix model satisfy Virasoro algebra constraints

  17. Construction of covariance matrix for experimental data

    International Nuclear Information System (INIS)

    Liu Tingjin; Zhang Jianhua

    1992-01-01

    For evaluators and experimenters, the information is complete only in the case when the covariance matrix is given. The covariance matrix of the indirectly measured data has been constructed and discussed. As an example, the covariance matrix of 23 Na(n, 2n) cross section is constructed. A reasonable result is obtained

  18. Modeling dense-colloid and virus cotransport in three-dimensional porous media.

    Science.gov (United States)

    Katzourakis, Vasileios E; Chrysikopoulos, Constantinos V

    2015-10-01

    A three-dimensional numerical model was developed to investigate the simultaneous transport (cotransport) of dense colloids and viruses in homogeneous, water saturated, porous media with horizontal uniform flow. The dense colloids are assumed to exist in two different phases: suspended in the aqueous phase, and attached reversibly and/or irreversibly onto the solid matrix. The viruses are assumed to exist in four different phases: suspended in aqueous phase, attached onto the solid matrix, attached onto suspended colloids, and attached onto colloids already attached onto the solid matrix. The viruses in each of the four phases are assumed to undergo inactivation with different rates. Moreover, the suspended dense colloids as well as viruses attached onto suspended dense colloids are assumed to exhibit a "restricted" settling velocity as a consequence of the gravitational force; whereas, viruses due to their small sizes and densities are assumed to have negligible "restricted" settling velocity. The governing differential equations were solved numerically with the finite difference schemes, implicitly or explicitly implemented. Model simulations have shown that the presence of dense colloid particles can either enhance or hinder the horizontal transport of viruses, but also can increase the vertical migration of viruses. Copyright © 2015 Elsevier B.V. All rights reserved.

  19. Hexagonal response matrix using symmetries

    International Nuclear Information System (INIS)

    Gotoh, Y.

    1991-01-01

    A response matrix for use in core calculations for nuclear reactors with hexagonal fuel assemblies is presented. It is based on the incoming currents averaged over the half-surface of a hexagonal node by applying symmetry theory. The boundary conditions of the incoming currents on the half-surface of the node are expressed by a complete set of orthogonal vectors which are constructed from symmetrized functions. The expansion coefficients of the functions are determined by the boundary conditions of incoming currents. (author)

  20. Geometric phase from dielectric matrix

    International Nuclear Information System (INIS)

    Banerjee, D.

    2005-10-01

    The dielectric property of the anisotropic optical medium is found by considering the polarized photon as two component spinor of spherical harmonics. The Geometric Phase of a polarized photon has been evaluated in two ways: the phase two-form of the dielectric matrix through a twist and the Pancharatnam phase (GP) by changing the angular momentum of the incident polarized photon over a closed triangular path on the extended Poincare sphere. The helicity in connection with the spin angular momentum of the chiral photon plays the key role in developing these phase holonomies. (author)

  1. Distributively generated matrix near rings

    International Nuclear Information System (INIS)

    Abbasi, S.J.

    1993-04-01

    It is known that if R is a near ring with identity then (I,+) is abelian if (I + ,+) is abelian and (I,+) is abelian if (I*,+) is abelian [S.J. Abbasi, J.D.P. Meldrum, 1991]. This paper extends these results. We show that if R is a distributively generated near ring with identity then (I,+) is included in Z(R), the center of R, if (I + ,+) is included in Z(M n (R)), the center of matrix near ring M n (R). Furthermore (I,+) is included in Z(R) if (I*,+) is included in Z(M n (R)). (author). 5 refs

  2. The COMPADRE Plant Matrix Database

    DEFF Research Database (Denmark)

    Salguero-Gomez, Roberto; Jones, Owen; Archer, C. Ruth

    2015-01-01

    growth or decline, such data furthermore help us understand how different biomes shape plant ecology, how plant populations and communities respond to global change, and how to develop successful management tools for endangered or invasive species. 2. Matrix population models summarize the life cycle......Bank), functional plant ecology (TRY, BIEN, D3), and grassland community ecology (NutNet). Here we present COMPADRE, a similar data-rich and ecologically relevant resource for plant demography. Open access to this information, its frequent updates, and its integration with other online resources will allow...

  3. Matrix regularization of 4-manifolds

    OpenAIRE

    Trzetrzelewski, M.

    2012-01-01

    We consider products of two 2-manifolds such as S^2 x S^2, embedded in Euclidean space and show that the corresponding 4-volume preserving diffeomorphism algebra can be approximated by a tensor product SU(N)xSU(N) i.e. functions on a manifold are approximated by the Kronecker product of two SU(N) matrices. A regularization of the 4-sphere is also performed by constructing N^2 x N^2 matrix representations of the 4-algebra (and as a byproduct of the 3-algebra which makes the regularization of S...

  4. Viruses of botrytis.

    Science.gov (United States)

    Pearson, Michael N; Bailey, Andrew M

    2013-01-01

    Botrytis cinerea (gray mold) is one of the most widespread and destructive fungal diseases of horticultural crops. Propagation and dispersal is usually by asexual conidia but the sexual stage (Botryotinia fuckeliana (de Bary) Whetzel) also occurs in nature. DsRNAs, indicative of virus infection, are common in B. cinerea, but only four viruses (Botrytis virus F (BVF), Botrytis virus X (BVX), Botrytis cinerea mitovirus 1 (BcMV1), and Botrytis porri RNA virus) have been sequenced. BVF and BVX are unusual mycoviruses being ssRNA flexous rods and have been designated the type species of the genera Mycoflexivirus and Botrexvirus (family Betaflexivirdae), respectively. The reported effects of viruses on Botrytis range from negligible to severe, with Botrytis cinerea mitovirus 1 causing hypovirulence. Little is currently known about the effects of viruses on Botrytis metabolism but recent complete sequencing of the B. cinerea genome now provides an opportunity to investigate the host-pathogen interactions at the molecular level. There is interest in the possible use of mycoviruses as biological controls for Botrytis because of the common problem of fungicide resistance. Unfortunately, hyphal anastomosis is the only known mechanism of horizontal virus transmission and the large number of vegetative incompatibility groups in Botrytis is a potential constraint on the spread of an introduced virus. Although some Botrytis viruses, such as BVF and BVX, are known to have international distribution, there is a distinct lack of epidemiological data and the means of spread are unknown. Copyright © 2013 Elsevier Inc. All rights reserved.

  5. Fragmentation of extracellular matrix by hypochlorous acid

    DEFF Research Database (Denmark)

    Woods, Alan A; Davies, Michael Jonathan

    2003-01-01

    of the MPO-derived oxidant hypochlorous acid (HOCl) with extracellular matrix from vascular smooth muscle cells and healthy pig arteries has been examined. HOCl is rapidly consumed by such matrix samples, with the formation of matrix-derived chloramines or chloramides. The yield of these intermediates....../chloramide decomposition, with copper and iron ions being effective catalysts, and decreased by compounds which scavenge chloramines/chloramides, or species derived from them. The effect of such matrix modifications on cellular behaviour is poorly understood, though it is known that changes in matrix materials can have...

  6. Confocal microscopy imaging of the biofilm matrix

    DEFF Research Database (Denmark)

    Schlafer, Sebastian; Meyer, Rikke L

    2017-01-01

    The extracellular matrix is an integral part of microbial biofilms and an important field of research. Confocal laser scanning microscopy is a valuable tool for the study of biofilms, and in particular of the biofilm matrix, as it allows real-time visualization of fully hydrated, living specimens....... Confocal microscopes are held by many research groups, and a number of methods for qualitative and quantitative imaging of the matrix have emerged in recent years. This review provides an overview and a critical discussion of techniques used to visualize different matrix compounds, to determine...... the concentration of solutes and the diffusive properties of the biofilm matrix....

  7. Linear algebra and matrix analysis for statistics

    CERN Document Server

    Banerjee, Sudipto

    2014-01-01

    Matrices, Vectors, and Their OperationsBasic definitions and notations Matrix addition and scalar-matrix multiplication Matrix multiplication Partitioned matricesThe ""trace"" of a square matrix Some special matricesSystems of Linear EquationsIntroduction Gaussian elimination Gauss-Jordan elimination Elementary matrices Homogeneous linear systems The inverse of a matrixMore on Linear EquationsThe LU decompositionCrout's Algorithm LU decomposition with row interchanges The LDU and Cholesky factorizations Inverse of partitioned matrices The LDU decomposition for partitioned matricesThe Sherman-W

  8. The q-Laguerre matrix polynomials.

    Science.gov (United States)

    Salem, Ahmed

    2016-01-01

    The Laguerre polynomials have been extended to Laguerre matrix polynomials by means of studying certain second-order matrix differential equation. In this paper, certain second-order matrix q-difference equation is investigated and solved. Its solution gives a generalized of the q-Laguerre polynomials in matrix variable. Four generating functions of this matrix polynomials are investigated. Two slightly different explicit forms are introduced. Three-term recurrence relation, Rodrigues-type formula and the q-orthogonality property are given.

  9. Postmortem stability of Ebola virus.

    Science.gov (United States)

    Prescott, Joseph; Bushmaker, Trenton; Fischer, Robert; Miazgowicz, Kerri; Judson, Seth; Munster, Vincent J

    2015-05-01

    The ongoing Ebola virus outbreak in West Africa has highlighted questions regarding stability of the virus and detection of RNA from corpses. We used Ebola virus-infected macaques to model humans who died of Ebola virus disease. Viable virus was isolated <7 days posteuthanasia; viral RNA was detectable for 10 weeks.

  10. Hepatitis viruses and hepatocellular carcinoma

    African Journals Online (AJOL)

    Hepatitis viruses and hepatocellular carcinoma. Michael C. Kew. Of the hepatitis viruses that have been identified and their pathological consequences characterised, three - hepatitis. B virus (HBV), hepatitis C virus (HCV) and hepatitis D virus. (HDV) - have been implicated as risk factors for hepatocellular carcinoma (HCC) ...

  11. Colored graphs and matrix integrals

    International Nuclear Information System (INIS)

    Artamkin, I.V.

    2007-12-01

    In this article we discuss two different asymptotic expansions of matrix integrals. The original approach using the so-called Feynman diagram techniques leads to sums over isomorphism classes of ribbon graphs. Asymptotic expansions of more general Gaussian integrals are sums over isomorphism classes of colored graphs without ribbon structure. Here we derive the former expansion from the latter one. This provides an independent proof for the expansion used by Kontsevich. It might be very interesting to compare the algebra arising in these two approaches. The asymptotic expansion using ribbon graphs leads to the tau function of the KDV hierarchy while the sums over colored graphs satisfy simple partial differential equations which generalize the Burgers equation. We describe the general approach using colored graphs in the second section. In the third section we specialize the results of the second section for the matrix integral. In this section we also derive the expansion over ribbon graphs. The proof is based on simple topological considerations which are contained in section 5. In the last section we give an explicit calculation of the first term of the expansion using colored graphs

  12. Interpolation of rational matrix functions

    CERN Document Server

    Ball, Joseph A; Rodman, Leiba

    1990-01-01

    This book aims to present the theory of interpolation for rational matrix functions as a recently matured independent mathematical subject with its own problems, methods and applications. The authors decided to start working on this book during the regional CBMS conference in Lincoln, Nebraska organized by F. Gilfeather and D. Larson. The principal lecturer, J. William Helton, presented ten lectures on operator and systems theory and the interplay between them. The conference was very stimulating and helped us to decide that the time was ripe for a book on interpolation for matrix valued functions (both rational and non-rational). When the work started and the first partial draft of the book was ready it became clear that the topic is vast and that the rational case by itself with its applications is already enough material for an interesting book. In the process of writing the book, methods for the rational case were developed and refined. As a result we are now able to present the rational case as an indepe...

  13. Matrix metalloproteinases and TGFbeta1 modulate oral tumor cell matrix.

    Science.gov (United States)

    Dang, Dongmin; Yang, Yongjian; Li, Xiaowu; Atakilit, Amha; Regezi, Joseph; Eisele, David; Ellis, Duncan; Ramos, Daniel M

    2004-04-09

    The integrin beta6 has been shown to promote invasion and experimental metastasis by oral squamous cell carcinoma (SCC). In this study, we demonstrate that the expression of beta6 by oral SCC9 cells increased activation of the UPA --> MMP3 --> MMP9 pathway. We also demonstrate that the deposition of fibronectin and tenascin-C matrices by SCC9beta6 cells and peritumor fibroblast cocultures is counter-regulated by the UPA --> MMP3 --> MMP9 pathway. Suppression of individual components of this pathway increased the deposition of fibronectin, but decreased tenascin-C matrix assembly by the cocultures. When the SCC9beta6/PTF cocultures were incubated with TGFbeta1, the deposition of fibronectin and tenascin-C as well as the activation of MMP3 and MMP9 was increased. These results indicate that MMP3, MMP9, and TGFbeta1 are important for the modulation, composition, and maintenance of the ECM in oral SCC.

  14. Viruses of the Archaea

    DEFF Research Database (Denmark)

    Prangishvili,, David; Basta, Tamara; Garrett, Roger Antony

    2016-01-01

    Viruses infecting members of Archaea, the third domain of life, constitute an integral, yet unique part of the virosphere. Many of these viruses, specifically the species that infect hyperthermophilic hosts, display morphotypes – for example, bottle shaped, spindle shaped, droplet shaped, coil...... proteins with exceptional structures and unknown functions. Moreover, the ways in which these viruses interact with their hosts are also unique, as indicated by a unique virion egress mechanism, which involves formation of pyramidal portals on the cell surface. Some viruses that infect extremely halophilic...... Archaea are morphologically highly similar to head‐tail bacterial viruses of the order Caudovirales and apparently share an ancestry with them. Identified archaeal viruses almost exclusively carry double‐stranded deoxyribonucleic acid (DNA) genomes and only a few species have single‐stranded DNA genomes....

  15. DNA Virus Replication Compartments

    Science.gov (United States)

    Schmid, Melanie; Speiseder, Thomas; Dobner, Thomas

    2014-01-01

    Viruses employ a variety of strategies to usurp and control cellular activities through the orchestrated recruitment of macromolecules to specific cytoplasmic or nuclear compartments. Formation of such specialized virus-induced cellular microenvironments, which have been termed viroplasms, virus factories, or virus replication centers, complexes, or compartments, depends on molecular interactions between viral and cellular factors that participate in viral genome expression and replication and are in some cases associated with sites of virion assembly. These virus-induced compartments function not only to recruit and concentrate factors required for essential steps of the viral replication cycle but also to control the cellular mechanisms of antiviral defense. In this review, we summarize characteristic features of viral replication compartments from different virus families and discuss similarities in the viral and cellular activities that are associated with their assembly and the functions they facilitate for viral replication. PMID:24257611

  16. Viruses of the Archaea

    DEFF Research Database (Denmark)

    Basta, T.; Garrett, Roger Antony; Prangishvili,, David

    2009-01-01

    Double-stranded deoxyribonucleic acid (DNA) viruses that infect members of the third domain of life, the Archaea, are diverse and exceptional in both their morphotypes and their genomic properties. The majority of characterized species infect hyperthermophilic hosts and carry morphological features...... which have not been observed for viruses from the other domains of life, the Bacteria and the Eukarya. This exceptional status of the archaeal viruses is reinforced by the finding that a large majority of their predicted genes yield no sequence matches in public sequence databases, and their functions...... remain unknown. One of the viruses, the bicaudavirus ATV (Acidianus two-tailed virus), is quite unique in that it undergoes a major morphological change, growing long tail structures, extracellularly. A small minority of archaeal viruses, which exclusively infect mesophilic or moderately thermophilic...

  17. Constructing computer virus phylogenies

    Energy Technology Data Exchange (ETDEWEB)

    Goldberg, L.A. [Warwick Univ., Coventry (United Kingdom) Dept. of Computer Science; Goldberg, P.W. [Aston Univ., Birmingham (United Kingdom) Dept. of Applied Mathematics; Phillips, C.A. [Sandia National Labs., Albuquerque, NM (United States); Sorkin, G.B. [International Business Machines Corp., Yorktown Heights, NY (United States). Thomas J. Watson Research Center

    1996-03-01

    There has been much recent algorithmic work on the problem of reconstructing the evolutionary history of biological species. Computer virus specialists are interested in finding the evolutionary history of computer viruses--a virus is often written using code fragments from one or more other viruses, which are its immediate ancestors. A phylogeny for a collection of computer viruses is a directed acyclic graph whose nodes are the viruses and whose edges map ancestors to descendants and satisfy the property that each code fragment is ``invented`` only once. To provide a simple explanation for the data, we consider the problem of constructing such a phylogeny with a minimal number of edges. In general, this optimization problem cannot be solved in quasi-polynomial time unless NQP=QP; we present positive and negative results for associated approximated problems. When tree solutions exist, they can be constructed and randomly sampled in polynomial time.

  18. Viruses infecting bivalve molluscs

    OpenAIRE

    Renault, Tristan; Novoa, Beatriz

    2004-01-01

    Bivalve molluscs are filter feeders and as a consequence they may bioaccumulate in their tissues viruses that infect humans and higher vertebrates. However, there have also been described mortalities of bivalve molluscs associated with viruses belonging to different families. Mass mortalities of adult Portuguese oysters, Crassostrea angulata, among French livestocks (between 1967 and 1973) were associated with irido-like virus infections. Herpesviruses were reported in the eastern oyster, Pac...

  19. Zika virus infection.

    Science.gov (United States)

    Pougnet, Laurence; Thill, Chloé; Pougnet, Richard; Auvinet, Henri; Giacardi, Christophe; Drouillard, Isabelle

    2016-12-01

    A 21-year old woman from New-Caledonia had 40 ̊C fever with vomiting, arthralgia, myalgia, and measles-like rash. Etiological analyses showed primary infection with Zika virus. Because of severe clinical presentation, she was hospitalized in the intensive care unit of the Brest military Hospital. Zika virus is mainly transmitted by Aedes mosquitoes. If they settle in Metropolitan France, Zika virus might also spread there.

  20. The human oncogenic viruses

    Energy Technology Data Exchange (ETDEWEB)

    Luderer, A.A.; Weetall, H.H

    1986-01-01

    This book contains eight selections. The titles are: Cytogenetics of the Leukemias and Lymphomas; Cytogenetics of Solid Tumors: Renal Cell Carcinoma, Malignant Melanoma, Retinoblastoma, and Wilms' Tumor; Elucidation of a Normal Function for a Human Proto-Oncogene; Detection of HSV-2 Genes and Gene Products in Cervical Neoplasia; Papillomaviruses in Anogennital Neoplasms; Human Epstein-Barr Virus and Cancer; Hepatitis B Virus and Hepatocellular Carcinoma; and Kaposi's Sarcoma: Acquired Immunodeficiency Syndrome (AIDS) and Associated Viruses.

  1. Testing for Human Immunodeficiency Virus

    Science.gov (United States)

    ... Physicians patient education Fact Sheet PFS005: Testing for Human Immunodeficiency Virus AUGUST 2015 • Reasons for Getting Tested • ... HIV Testing • For More Information • Glossary Testing for Human Immunodeficiency Virus Human immunodeficiency virus (HIV) is the ...

  2. Viruses of the Archaea

    DEFF Research Database (Denmark)

    Basta, T.; Garrett, Roger Antony; Prangishvili,, David

    2009-01-01

    Double-stranded deoxyribonucleic acid (DNA) viruses that infect members of the third domain of life, the Archaea, are diverse and exceptional in both their morphotypes and their genomic properties. The majority of characterized species infect hyperthermophilic hosts and carry morphological features...... remain unknown. One of the viruses, the bicaudavirus ATV (Acidianus two-tailed virus), is quite unique in that it undergoes a major morphological change, growing long tail structures, extracellularly. A small minority of archaeal viruses, which exclusively infect mesophilic or moderately thermophilic...

  3. Zika Virus and Pregnancy

    Medline Plus

    Full Text Available ... My ACOG ACOG Departments Donate Shop Career Connection Home Clinical Guidance & Publications Practice Management Education & Events Advocacy For Patients About ACOG Zika Virus ...

  4. Water system virus detection

    Science.gov (United States)

    Fraser, A. S.; Wells, A. F.; Tenoso, H. J.

    1975-01-01

    A monitoring system developed to test the capability of a water recovery system to reject the passage of viruses into the recovered water is described. A nonpathogenic marker virus, bacteriophage F2, is fed into the process stream before the recovery unit and the reclaimed water is assayed for its presence. Detection of the marker virus consists of two major components, concentration and isolation of the marker virus, and detection of the marker virus. The concentration system involves adsorption of virus to cellulose acetate filters in the presence of trivalent cations and low pH with subsequent desorption of the virus using volumes of high pH buffer. The detection of the virus is performed by a passive immune agglutination test utilizing specially prepared polystyrene particles. An engineering preliminary design was performed as a parallel effort to the laboratory development of the marker virus test system. Engineering schematics and drawings of a fully functional laboratory prototype capable of zero-G operation are presented. The instrument consists of reagent pump/metering system, reagent storage containers, a filter concentrator, an incubation/detector system, and an electronic readout and control system.

  5. Viruses in renovated waters

    CSIR Research Space (South Africa)

    Nupen, EM

    1974-06-01

    Full Text Available to three logs ?4-. in a water treatment plant, a total of seven to eight log reduction in virus results. This leaves a water containing perhaps one TOlD of virus. per 1 000 litres. Shuval? ? suggests thht this is not an unimportant amount. On the basis...~~ water resources and by the direct treatment of waste water, is examined, as is the virus risk involved in the discharge of insufficiently treated wastewater into the environment. -~ VIRUSES IN RENOVATED WATERS Ethel 14. Nupen [National Institute...

  6. In vitro reassortment between endemic H1N2 and 2009 H1N1 pandemic swine influenza viruses generates attenuated viruses.

    Directory of Open Access Journals (Sweden)

    Ben M Hause

    Full Text Available The pandemic H1N1 (pH1N1 influenza virus was first reported in humans in the spring of 2009 and soon thereafter was identified in numerous species, including swine. Reassortant viruses, presumably arising from the co-infection of pH1N1 and endemic swine influenza virus (SIV, were subsequently identified from diagnostic samples collected from swine. In this study, co-infection of swine testicle (ST cells with swine-derived endemic H1N2 (MN745 and pH1N1 (MN432 yielded two reassortant H1N2 viruses (R1 and R2, both possessing a matrix gene derived from pH1N1. In ST cells, the reassortant viruses had growth kinetics similar to the parental H1N2 virus and reached titers approximately 2 log(10 TCID(50/mL higher than the pH1N1 virus, while in A549 cells these viruses had similar growth kinetics. Intranasal challenge of pigs with H1N2, pH1N1, R1 or R2 found that all viruses were capable of infecting and transmitting between direct contact pigs as measured by real time reverse transcription PCR of nasal swabs. Lung samples were also PCR-positive for all challenge groups and influenza-associated microscopic lesions were detected by histology. Interestingly, infectious virus was detected in lung samples for pigs challenged with the parental H1N2 and pH1N1 at levels significantly higher than either reassortant virus despite similar levels of viral RNA. Results of our experiment suggested that the reassortant viruses generated through in vitro cell culture system were attenuated without gaining any selective growth advantage in pigs over the parental lineages. Thus, reassortant influenza viruses described in this study may provide a good system to study genetic basis of the attenuation and its mechanism.

  7. Inequalities Involving Upper Bounds for Certain Matrix Operators

    Indian Academy of Sciences (India)

    Home; Journals; Proceedings – Mathematical Sciences; Volume 116; Issue 3. Inequalities Involving Upper Bounds for Certain Matrix Operators. R Lashkaripour D Foroutannia. Volume ... Keywords. Inequality; norm; summability matrix; Hausdorff matrix; Hilbert matrix; weighted sequence space; Lorentz sequence space.

  8. Petz recovery versus matrix reconstruction

    Science.gov (United States)

    Holzäpfel, Milan; Cramer, Marcus; Datta, Nilanjana; Plenio, Martin B.

    2018-04-01

    The reconstruction of the state of a multipartite quantum mechanical system represents a fundamental task in quantum information science. At its most basic, it concerns a state of a bipartite quantum system whose subsystems are subjected to local operations. We compare two different methods for obtaining the original state from the state resulting from the action of these operations. The first method involves quantum operations called Petz recovery maps, acting locally on the two subsystems. The second method is called matrix (or state) reconstruction and involves local, linear maps that are not necessarily completely positive. Moreover, we compare the quantities on which the maps employed in the two methods depend. We show that any state that admits Petz recovery also admits state reconstruction. However, the latter is successful for a strictly larger set of states. We also compare these methods in the context of a finite spin chain. Here, the state of a finite spin chain is reconstructed from the reduced states of a few neighbouring spins. In this setting, state reconstruction is the same as the matrix product operator reconstruction proposed by Baumgratz et al. [Phys. Rev. Lett. 111, 020401 (2013)]. Finally, we generalize both these methods so that they employ long-range measurements instead of relying solely on short-range correlations embodied in such local reduced states. Long-range measurements enable the reconstruction of states which cannot be reconstructed from measurements of local few-body observables alone and hereby we improve existing methods for quantum state tomography of quantum many-body systems.

  9. Hendra virus infection dynamics in Australian fruit bats.

    Directory of Open Access Journals (Sweden)

    Hume Field

    Full Text Available Hendra virus is a recently emerged zoonotic agent in Australia. Since first described in 1994, the virus has spilled from its wildlife reservoir (pteropid fruit bats, or 'flying foxes' on multiple occasions causing equine and human fatalities. We undertook a three-year longitudinal study to detect virus in the urine of free-living flying foxes (a putative route of excretion to investigate Hendra virus infection dynamics. Pooled urine samples collected off plastic sheets placed beneath roosting flying foxes were screened for Hendra virus genome by quantitative RT-PCR, using a set of primers and probe derived from the matrix protein gene. A total of 1672 pooled urine samples from 67 sampling events was collected and tested between 1 July 2008 and 30 June 2011, with 25% of sampling events and 2.5% of urine samples yielding detections. The proportion of positive samples was statistically associated with year and location. The findings indicate that Hendra virus excretion occurs periodically rather than continuously, and in geographically disparate flying fox populations in the state of Queensland. The lack of any detection in the Northern Territory suggests prevalence may vary across the range of flying foxes in Australia. Finally, our findings suggest that flying foxes can excrete virus at any time of year, and that the apparent seasonal clustering of Hendra virus incidents in horses and associated humans (70% have occurred June to October reflects factors other than the presence of virus. Identification of these factors will strengthen risk minimization strategies for horses and ultimately humans.

  10. Antigenic and Molecular Characterization of Avian Influenza A(H9N2) Viruses, Bangladesh

    Science.gov (United States)

    Shanmuganatham, Karthik; Feeroz, Mohammed M.; Jones-Engel, Lisa; Smith, Gavin J.D.; Fourment, Mathieu; Walker, David; McClenaghan, Laura; Alam, S.M. Rabiul; Hasan, M. Kamrul; Seiler, Patrick; Franks, John; Danner, Angie; Barman, Subrata; McKenzie, Pamela; Krauss, Scott; Webby, Richard J.

    2013-01-01

    Human infection with avian influenza A(H9N2) virus was identified in Bangladesh in 2011. Surveillance for influenza viruses in apparently healthy poultry in live-bird markets in Bangladesh during 2008–2011 showed that subtype H9N2 viruses are isolated year-round, whereas highly pathogenic subtype H5N1 viruses are co-isolated with subtype H9N2 primarily during the winter months. Phylogenetic analysis of the subtype H9N2 viruses showed that they are reassortants possessing 3 gene segments related to subtype H7N3; the remaining gene segments were from the subtype H9N2 G1 clade. We detected no reassortment with subtype H5N1 viruses. Serologic analyses of subtype H9N2 viruses from chickens revealed antigenic conservation, whereas analyses of viruses from quail showed antigenic drift. Molecular analysis showed that multiple mammalian-specific mutations have become fixed in the subtype H9N2 viruses, including changes in the hemagglutinin, matrix, and polymerase proteins. Our results indicate that these viruses could mutate to be transmissible from birds to mammals, including humans. PMID:23968540

  11. Response matrix method for large LMFBR analysis

    International Nuclear Information System (INIS)

    King, M.J.

    1977-06-01

    The feasibility of using response matrix techniques for computational models of large LMFBRs is examined. Since finite-difference methods based on diffusion theory have generally found a place in fast-reactor codes, a brief review of their general matrix foundation is given first in order to contrast it to the general strategy of response matrix methods. Then, in order to present the general method of response matrix technique, two illustrative examples are given. Matrix algorithms arising in the application to large LMFBRs are discussed, and the potential of the response matrix method is explored for a variety of computational problems. Principal properties of the matrices involved are derived with a view to application of numerical methods of solution. The Jacobi iterative method as applied to the current-balance eigenvalue problem is discussed

  12. Convex nonnegative matrix factorization with manifold regularization.

    Science.gov (United States)

    Hu, Wenjun; Choi, Kup-Sze; Wang, Peiliang; Jiang, Yunliang; Wang, Shitong

    2015-03-01

    Nonnegative Matrix Factorization (NMF) has been extensively applied in many areas, including computer vision, pattern recognition, text mining, and signal processing. However, nonnegative entries are usually required for the data matrix in NMF, which limits its application. Besides, while the basis and encoding vectors obtained by NMF can represent the original data in low dimension, the representations do not always reflect the intrinsic geometric structure embedded in the data. Motivated by manifold learning and Convex NMF (CNMF), we propose a novel matrix factorization method called Graph Regularized and Convex Nonnegative Matrix Factorization (GCNMF) by introducing a graph regularized term into CNMF. The proposed matrix factorization technique not only inherits the intrinsic low-dimensional manifold structure, but also allows the processing of mixed-sign data matrix. Clustering experiments on nonnegative and mixed-sign real-world data sets are conducted to demonstrate the effectiveness of the proposed method. Copyright © 2014 Elsevier Ltd. All rights reserved.

  13. Covariance matrix estimation for stationary time series

    OpenAIRE

    Xiao, Han; Wu, Wei Biao

    2011-01-01

    We obtain a sharp convergence rate for banded covariance matrix estimates of stationary processes. A precise order of magnitude is derived for spectral radius of sample covariance matrices. We also consider a thresholded covariance matrix estimator that can better characterize sparsity if the true covariance matrix is sparse. As our main tool, we implement Toeplitz [Math. Ann. 70 (1911) 351–376] idea and relate eigenvalues of covariance matrices to the spectral densities or Fourier transforms...

  14. Matrix orderings and their associated skew fields

    International Nuclear Information System (INIS)

    Mahdavi-Hezavehi, M.

    1990-08-01

    Matrix orderings on rings are investigated. It is shown that in the commutative case they are essentially positive cones. This is proved by reducing it to the field case; similarly one can show that on a skew field, matrix positive cones can be reduced to positive cones by using the Dieudonne determinant. Our main result shows that there is a natural bijection between the matrix positive cones on a ring R and the ordered epic R-fields. (author). 7 refs

  15. Matrix-assisted peptide synthesis on nanoparticles.

    Science.gov (United States)

    Khandadash, Raz; Machtey, Victoria; Weiss, Aryeh; Byk, Gerardo

    2014-09-01

    We report a new method for multistep peptide synthesis on polymeric nanoparticles of differing sizes. Polymeric nanoparticles were functionalized via their temporary embedment into a magnetic inorganic matrix that allows multistep peptide synthesis. The matrix is removed at the end of the process for obtaining nanoparticles functionalized with peptides. The matrix-assisted synthesis on nanoparticles was proved by generating various biologically relevant peptides. Copyright © 2014 European Peptide Society and John Wiley & Sons, Ltd.

  16. Drosophila C virus systemic infection leads to intestinal obstruction.

    Science.gov (United States)

    Chtarbanova, Stanislava; Lamiable, Olivier; Lee, Kwang-Zin; Galiana, Delphine; Troxler, Laurent; Meignin, Carine; Hetru, Charles; Hoffmann, Jules A; Daeffler, Laurent; Imler, Jean-Luc

    2014-12-01

    Drosophila C virus (DCV) is a positive-sense RNA virus belonging to the Dicistroviridae family. This natural pathogen of the model organism Drosophila melanogaster is commonly used to investigate antiviral host defense in flies, which involves both RNA interference and inducible responses. Although lethality is used routinely as a readout for the efficiency of the antiviral immune response in these studies, virus-induced pathologies in flies still are poorly understood. Here, we characterize the pathogenesis associated with systemic DCV infection. Comparison of the transcriptome of flies infected with DCV or two other positive-sense RNA viruses, Flock House virus and Sindbis virus, reveals that DCV infection, unlike those of the other two viruses, represses the expression of a large number of genes. Several of these genes are expressed specifically in the midgut and also are repressed by starvation. We show that systemic DCV infection triggers a nutritional stress in Drosophila which results from intestinal obstruction with the accumulation of peritrophic matrix at the entry of the midgut and the accumulation of the food ingested in the crop, a blind muscular food storage organ. The related virus cricket paralysis virus (CrPV), which efficiently grows in Drosophila, does not trigger this pathology. We show that DCV, but not CrPV, infects the smooth muscles surrounding the crop, causing extensive cytopathology and strongly reducing the rate of contractions. We conclude that the pathogenesis associated with systemic DCV infection results from the tropism of the virus for an important organ within the foregut of dipteran insects, the crop. DCV is one of the few identified natural viral pathogens affecting the model organism Drosophila melanogaster. As such, it is an important virus for the deciphering of host-virus interactions in insects. We characterize here the pathogenesis associated with DCV infection in flies and show that it results from the tropism of the

  17. Hepatitis viruses overview

    African Journals Online (AJOL)

    Hepatitis is major cause of morbidity or mortality worldwide, particularly in the developing world. The major causes of infective hepatitis are hepatitis viruses. A, B, C, D or E. In the acute phase, there are no clinical features that can reliably differentiate between these viruses. Infection may be asymptomatic or can present as.

  18. Zika Virus Fact Sheet

    Science.gov (United States)

    ... collaboration with experts and other health agencies. Zika Strategic Response Framework العربية 中文 français русский español Highlight Zika virus disease Zika podcast series History of Zika: digital timeline Zika virus Q&A Mosquito-borne diseases ...

  19. Viral Haemorrhagic Septicaemia Virus

    DEFF Research Database (Denmark)

    Olesen, Niels Jørgen; Skall, Helle Frank

    2013-01-01

    This chapter covers the genetics (genotypes and serotypes), clinical signs, host species, transmission, prevalence, diagnosis, control and prevention of viral haemorrhagic septicaemia virus.......This chapter covers the genetics (genotypes and serotypes), clinical signs, host species, transmission, prevalence, diagnosis, control and prevention of viral haemorrhagic septicaemia virus....

  20. Zika Virus Fact Sheet

    Science.gov (United States)

    ... fever. Sexual transmission of Zika virus is also possible. Other modes of transmission such as blood transfusion are being investigated. Diagnosis Infection with Zika virus may be suspected based on symptoms and recent history of travel (e.g. residence in or travel ...

  1. Blue Tongue Virus

    African Journals Online (AJOL)

    Anupama

    thromboses and necrosis of infected tissues (Erasmus,. 1975) (Figure 1). In sheep, the onset of the disease is .... the skin to the local lymph nodes (Hemati et al., 2009), the sites of initial virus replication (MacLachlan, 2004). .... effects and provide protection against challenge with virulent virus of the same serotype. Animals ...

  2. Viruses in reptiles.

    Science.gov (United States)

    Ariel, Ellen

    2011-09-21

    The etiology of reptilian viral diseases can be attributed to a wide range of viruses occurring across different genera and families. Thirty to forty years ago, studies of viruses in reptiles focused mainly on the zoonotic potential of arboviruses in reptiles and much effort went into surveys and challenge trials of a range of reptiles with eastern and western equine encephalitis as well as Japanese encephalitis viruses. In the past decade, outbreaks of infection with West Nile virus in human populations and in farmed alligators in the USA has seen the research emphasis placed on the issue of reptiles, particularly crocodiles and alligators, being susceptible to, and reservoirs for, this serious zoonotic disease. Although there are many recognised reptilian viruses, the evidence for those being primary pathogens is relatively limited. Transmission studies establishing pathogenicity and cofactors are likewise scarce, possibly due to the relatively low commercial importance of reptiles, difficulties with the availability of animals and permits for statistically sound experiments, difficulties with housing of reptiles in an experimental setting or the inability to propagate some viruses in cell culture to sufficient titres for transmission studies. Viruses as causes of direct loss of threatened species, such as the chelonid fibropapilloma associated herpesvirus and ranaviruses in farmed and wild tortoises and turtles, have re-focused attention back to the characterisation of the viruses as well as diagnosis and pathogenesis in the host itself.

  3. Avian influenza virus

    Science.gov (United States)

    Avian influenza virus (AIV) is type A influenza that is adapted to avian host species. Although the virus can be isolated from numerous avian species, the natural host reservoir species are dabbling ducks, shorebirds and gulls. Domestic poultry species (poultry being defined as birds that are rais...

  4. Tobacco ringspot virus

    Science.gov (United States)

    Tobacco ringspot virus (TRSV), and its vector, the dagger nematodes (Xiphinema americanum and related species) are widely distributed throughout the world. Cucumber, melon, and watermelon are particularly affected by TRSV. Symptoms can vary with plant age, the strain of the virus, and environment...

  5. Hepatitis E Virus

    African Journals Online (AJOL)

    Abstract. Hepatitis E virus (HEV) is the most common cause of acute viral hepatitis in the developing world. It is a waterborne virus that can cause epidemics in the face of overcrowding and poor sanitation. Although the hepatitis illness is usually self-limiting, it has a high mortality in pregnant women and can become a ...

  6. Basic matrix algebra and transistor circuits

    CERN Document Server

    Zelinger, G

    1963-01-01

    Basic Matrix Algebra and Transistor Circuits deals with mastering the techniques of matrix algebra for application in transistors. This book attempts to unify fundamental subjects, such as matrix algebra, four-terminal network theory, transistor equivalent circuits, and pertinent design matters. Part I of this book focuses on basic matrix algebra of four-terminal networks, with descriptions of the different systems of matrices. This part also discusses both simple and complex network configurations and their associated transmission. This discussion is followed by the alternative methods of de

  7. Risk matrix model for rotating equipment

    Directory of Open Access Journals (Sweden)

    Wassan Rano Khan

    2014-07-01

    Full Text Available Different industries have various residual risk levels for their rotating equipment. Accordingly the occurrence rate of the failures and associated failure consequences categories are different. Thus, a generalized risk matrix model is developed in this study which can fit various available risk matrix standards. This generalized risk matrix will be helpful to develop new risk matrix, to fit the required risk assessment scenario for rotating equipment. Power generation system was taken as case study. It was observed that eight subsystems were under risk. Only vibration monitor system was under high risk category, while remaining seven subsystems were under serious and medium risk categories.

  8. Matrix Krylov subspace methods for image restoration

    Directory of Open Access Journals (Sweden)

    khalide jbilou

    2015-09-01

    Full Text Available In the present paper, we consider some matrix Krylov subspace methods for solving ill-posed linear matrix equations and in those problems coming from the restoration of blurred and noisy images. Applying the well known Tikhonov regularization procedure leads to a Sylvester matrix equation depending the Tikhonov regularized parameter. We apply the matrix versions of the well known Krylov subspace methods, namely the Least Squared (LSQR and the conjugate gradient (CG methods to get approximate solutions representing the restored images. Some numerical tests are presented to show the effectiveness of the proposed methods.

  9. Hartree--Fock density matrix equation

    International Nuclear Information System (INIS)

    Cohen, L.; Frishberg, C.

    1976-01-01

    An equation for the Hartree--Fock density matrix is discussed and the possibility of solving this equation directly for the density matrix instead of solving the Hartree--Fock equation for orbitals is considered. Toward that end the density matrix is expanded in a finite basis to obtain the matrix representative equation. The closed shell case is considered. Two numerical schemes are developed and applied to a number of examples. One example is given where the standard orbital method does not converge while the method presented here does

  10. SYMAT, COVAR: Test Procedures for Matrix Calculations

    Science.gov (United States)

    Morris, W. L.; Wiginton, C. L.; Lowell, D. K.

    1972-01-01

    The FORTRAN subroutine SYMAT and related subroutines are described. In essence SYMAT is an iterative algorithm in which the problem of finding eigenvalues and eigenvectors of a real symmetric matrix is transformed into an equivalent problem of finding eigenvalues and eigenvectors of an infinite sequence of matrices of order two. A DEMO PROGRAM contains a subroutine COVAR which is used to compute the covariance matrix (denoted by A) of a data matrix (denoted by X). Since a covariance matrix is symmetric it can be analyzed by using subroutine SYMAT.

  11. Random Correlation Matrix and De-Noising

    OpenAIRE

    Ken-ichi Mitsui; Yoshio Tabata

    2006-01-01

    In Finance, the modeling of a correlation matrix is one of the important problems. In particular, the correlation matrix obtained from market data has the noise. Here we apply the de-noising processing based on the wavelet analysis to the noisy correlation matrix, which is generated by a parametric function with random parameters. First of all, we show that two properties, i.e. symmetry and ones of all diagonal elements, of the correlation matrix preserve via the de-noising processing and the...

  12. Finding Nonoverlapping Substructures of a Sparse Matrix

    Energy Technology Data Exchange (ETDEWEB)

    Pinar, Ali; Vassilevska, Virginia

    2005-08-11

    Many applications of scientific computing rely on computations on sparse matrices. The design of efficient implementations of sparse matrix kernels is crucial for the overall efficiency of these applications. Due to the high compute-to-memory ratio and irregular memory access patterns, the performance of sparse matrix kernels is often far away from the peak performance on a modern processor. Alternative data structures have been proposed, which split the original matrix A into A{sub d} and A{sub s}, so that A{sub d} contains all dense blocks of a specified size in the matrix, and A{sub s} contains the remaining entries. This enables the use of dense matrix kernels on the entries of A{sub d} producing better memory performance. In this work, we study the problem of finding a maximum number of nonoverlapping dense blocks in a sparse matrix, which is previously not studied in the sparse matrix community. We show that the maximum nonoverlapping dense blocks problem is NP-complete by using a reduction from the maximum independent set problem on cubic planar graphs. We also propose a 2/3-approximation algorithm that runs in linear time in the number of nonzeros in the matrix. This extended abstract focuses on our results for 2x2 dense blocks. However we show that our results can be generalized to arbitrary sized dense blocks, and many other oriented substructures, which can be exploited to improve the memory performance of sparse matrix operations.

  13. Titanium Matrix Composite Pressure Vessel, Phase II

    Data.gov (United States)

    National Aeronautics and Space Administration — For over 15 years, FMW Composite Systems has developed Metal Matrix Composite manufacturing methodologies for fabricating silicon-carbide-fiber-reinforced titanium...

  14. Titanium Matrix Composite Pressure Vessel Project

    Data.gov (United States)

    National Aeronautics and Space Administration — For over 15 years, FMW Composite Systems has developed Metal Matrix Composite manufacturing methodologies for fabricating silicon-carbide-fiber-reinforced titanium...

  15. Strategy as a Virus

    DEFF Research Database (Denmark)

    Obed Madsen, Søren

    This article is based on virus theory (Røvik, 2007, 2011), and proposes to develop a framework that defines technology as a virus that penetrates the organism of an organization. The framework develops a new vocabulary, which can help in analyzing technologies and their negative effects on actors...... and organizations. In this paper, the virus theory is used to analyze a strategy process in an organization as an example of a technology. It shows how the strategy over time creates a memory loss, where the managers who are exposed to the virus forget their critique of the new strategy concept. The article also...... shows how resistant can be understood as being immune to a virus, since the strategy concepts bears resemblance to a former strategy concept. The article also argues that there should be more focus on the negative impacts of management tool and especially how organizations and managers are dealing...

  16. On the global stability of an epidemic model of computer viruses.

    Science.gov (United States)

    Parsaei, Mohammad Reza; Javidan, Reza; Shayegh Kargar, Narges; Saberi Nik, Hassan

    2017-12-01

    In this paper, we study the global properties of a computer virus propagation model. It is, interesting to note that the classical method of Lyapunov functions combined with the Volterra-Lyapunov matrix properties, can lead to the proof of the endemic global stability of the dynamical model characterizing the spread of computer viruses over the Internet. The analysis and results presented in this paper make building blocks towards a comprehensive study and deeper understanding of the fundamental mechanism in computer virus propagation model. A numerical study of the model is also carried out to investigate the analytical results.

  17. Representation of viruses in the remediated PDB archive

    International Nuclear Information System (INIS)

    Lawson, Catherine L.; Dutta, Shuchismita; Westbrook, John D.; Henrick, Kim; Berman, Helen M.

    2008-01-01

    A new data model for PDB entries of viruses and other biological assemblies with regular noncrystallographic symmetry is described. A new scheme has been devised to represent viruses and other biological assemblies with regular noncrystallographic symmetry in the Protein Data Bank (PDB). The scheme describes existing and anticipated PDB entries of this type using generalized descriptions of deposited and experimental coordinate frames, symmetry and frame transformations. A simplified notation has been adopted to express the symmetry generation of assemblies from deposited coordinates and matrix operations describing the required point, helical or crystallographic symmetry. Complete correct information for building full assemblies, subassemblies and crystal asymmetric units of all virus entries is now available in the remediated PDB archive

  18. Analysis Matrix for Smart Cities

    Directory of Open Access Journals (Sweden)

    Pablo E. Branchi

    2014-01-01

    Full Text Available The current digital revolution has ignited the evolution of communications grids and the development of new schemes for productive systems. Traditional technologic scenarios have been challenged, and Smart Cities have become the basis for urban competitiveness. The citizen is the one who has the power to set new scenarios, and that is why a definition of the way people interact with their cities is needed, as is commented in the first part of the article. At the same time, a lack of clarity has been detected in the way of describing what Smart Cities are, and the second part will try to set the basis for that. For all before, the information and communication technologies that manage and transform 21st century cities must be reviewed, analyzing their impact on new social behaviors that shape the spaces and means of communication, as is posed in the experimental section, setting the basis for an analysis matrix to score the different elements that affect a Smart City environment. So, as the better way to evaluate what a Smart City is, there is a need for a tool to score the different technologies on the basis of their usefulness and consequences, considering the impact of each application. For all of that, the final section describes the main objective of this article in practical scenarios, considering how the technologies are used by citizens, who must be the main concern of all urban development.

  19. Factorization of the coherency matrix of polarization optics.

    Science.gov (United States)

    Sheppard, Colin J R; Le Gratiet, Aymeric; Diaspro, Alberto

    2018-04-01

    We show that the coherency matrix associated with a general depolarizing Mueller matrix can be factorized into the product of a matrix, the coherency matrix factor, and its conjugate transpose. The coherency matrix factor contains all the information in the Mueller matrix, and directly shows useful properties in an illustrative fashion. Propagation through a nondeterministic uniform medium is analyzed. Some examples for simple systems are shown, and an experimental Mueller matrix is considered. The coherency matrix and the coherency matrix factor can be diagonalized, even if the Mueller matrix cannot.

  20. Computer Viruses: Pathology and Detection.

    Science.gov (United States)

    Maxwell, John R.; Lamon, William E.

    1992-01-01

    Explains how computer viruses were originally created, how a computer can become infected by a virus, how viruses operate, symptoms that indicate a computer is infected, how to detect and remove viruses, and how to prevent a reinfection. A sidebar lists eight antivirus resources. (four references) (LRW)

  1. Molecular characterization of Lelystad virus

    NARCIS (Netherlands)

    Meulenberg, J.J.M.; Petersen-den Besten, A.; Kluyver, de E.; Nieuwstadt, van A.; Wensvoort, G.; Moormann, R.J.M.

    1997-01-01

    Lelystad virus (LV), the prototype of porcine reproductive respiratory syndrome virus, is a small enveloped virus, containing a positive strand RNA genome of 15 kb. LV is tentatively classified in the family Arteriviridae, which consists of lactate dehydrogenase-elevating virus (LDV), equine

  2. Photoacoustic measurement of lutein in biological matrix

    NARCIS (Netherlands)

    Bicanic, D.D.; Luterotti, S.; Becucci, M.; Fogliano, V.; Versloot, P.

    2005-01-01

    Photoacoustic (PA) spectroscopy was applied for the first time to quantify lutein in a complex biological matrix. Standard addition of lutein to a biological low-lutein matrix was used for the calibration. The PA signal was found linearly proportional (R > 0.98) to lutein concentration up to 0.3%

  3. CKM matrix exponential parametrization and Euler angles

    International Nuclear Information System (INIS)

    Dattoli, G.; Sabia, E.; Torre, A.

    1997-01-01

    They show that the exponential parametrization of the CKM matrix allows to establish exact relations between the Euler weak rotation angles and the entries of the CKM generating matrix, which has already been shown to include the hierarchy features of the Wolfenstein parametrization. The analysis includes CP-violating effects and its usefulness to treat the experimental data is also proved

  4. Matrix perturbations: bounding and computing eigenvalues

    NARCIS (Netherlands)

    Reis da Silva, R.J.

    2011-01-01

    Despite the somewhat negative connotation of the word, not every perturbation is a bad perturbation. In fact, while disturbing the matrix entries, many perturbations still preserve useful properties such as the orthonormality of the basis of eigenvectors or the Hermicity of the original matrix. In

  5. two-body random matrix ensembles

    Indian Academy of Sciences (India)

    2015-02-03

    Feb 3, 2015 ... Random matrix theory (RMT) introduced to describe statistical properties of the energy levels of complex nuclei has seen tremendous growth recently [1]. It is now well rec- ognized that, the quantum system whose classical counterpart is chaotic, will follow one of the three classical random matrix ensembles ...

  6. Differential analysis of matrix convex functions II

    DEFF Research Database (Denmark)

    Hansen, Frank; Tomiyama, Jun

    2009-01-01

    We continue the analysis in [F. Hansen, and J. Tomiyama, Differential analysis of matrix convex functions. Linear Algebra Appl., 420:102--116, 2007] of matrix convex functions of a fixed order defined in a real interval by differential methods as opposed to the characterization in terms of divided...

  7. The Molecules of the Cell Matrix.

    Science.gov (United States)

    Weber, Klaus; Osborn, Mary

    1985-01-01

    Cytoplasmic proteins form a highly structured yet changeable matrix that affects cell shape, division, motion, and transport of vesicles and organelles. Types of microfilaments, research techniques, actin and myosin, tumor cells, and other topics are addressed. Evidence indicates that the cell matrix might have a bearing on metabolism. (DH)

  8. Differentiating Instruction Using a Matrix Plan.

    Science.gov (United States)

    Distad, Linda; Heacox, Diane

    2000-01-01

    Describes the Matrix Plan that is a planning grid with operational verbs related to Bloom's taxonomy and acts as a means for assisting teachers in differentiating instruction in the regular classroom. Explores a case where pre-service teachers utilized the Matrix Plan in order to help them learn about differential instruction. (CMK)

  9. QUEUEING DISCIPLINES BASED ON PRIORITY MATRIX

    Directory of Open Access Journals (Sweden)

    Taufik I. Aliev

    2014-11-01

    Full Text Available The paper deals with queueing disciplines for demands of general type in queueing systems with multivendor load. A priority matrix is proposed to be used for the purpose of mathematical description of such disciplines, which represents the priority type (preemptive priority, not preemptive priority or no priority between any two demands classes. Having an intuitive and simple way of priority assignment, such description gives mathematical dependencies of system operation characteristics on its parameters. Requirements for priority matrix construction are formulated and the notion of canonical priority matrix is given. It is shown that not every matrix, constructed in accordance with such requirements, is correct. The notion of incorrect priority matrix is illustrated by an example, and it is shown that such matrixes do not ensure any unambiguousness and determinacy in design of algorithm, which realizes corresponding queueing discipline. Rules governing construction of correct matrixes are given for canonical priority matrixes. Residence time for demands of different classes in system, which is the sum of waiting time and service time, is considered as one of the most important characteristics. By introducing extra event method Laplace transforms for these characteristics are obtained, and mathematical dependencies are derived on their basis for calculation of two first moments for corresponding characteristics of demands queueing

  10. Density matrix technique for groundstate calculations

    NARCIS (Netherlands)

    Croo de Jongh, du M.S.L.; Doumen, J.M.; Leeuwen, van J.M.J.

    1999-01-01

    The density matrix approach is a technique to calculate the lowest eigenvalue of a large matrix such as occurring in quantum mechanical systems. So far the method works very well for systems with a linear structure. The limitations for a planar structure, from critical correlations and from

  11. Systolic triple-matrix product calculations

    Science.gov (United States)

    Caulfield, H. J.; Verber, C. M.; Stermer, R. L.

    1984-01-01

    In order to handle arbitrary-sized matrices with fixed-sized optical matrix processors, it is necessary to expand or contract the problem to fit the processor. This preprocessing is examined. It is applied to the type of triple-matrix product calculation needed for Kalman filtering. Emphasis will be placed on systolic-type processors.

  12. Matrix representation of a Neural Network

    DEFF Research Database (Denmark)

    Christensen, Bjørn Klint

    Processing, by David Rummelhart (Rummelhart 1986) for an easy-to-read introduction. What the paper does explain is how a matrix representation of a neural net allows for a very simple implementation. The matrix representation is introduced in (Rummelhart 1986, chapter 9), but only for a two-layer linear...

  13. Random matrix model for disordered conductors

    Indian Academy of Sciences (India)

    We present a random matrix ensemble where real, positive semi-definite matrix elements, , are log-normal distributed, exp ⁡ [ − log 2 ⁡ ( x ) ] . We show that the level density varies with energy, , as 2/(1 + ) for large , in the unitary family, consistent with the expectation for disordered conductors. The two-level ...

  14. Modeling and Simulation of Matrix Converter

    DEFF Research Database (Denmark)

    Liu, Fu-rong; Klumpner, Christian; Blaabjerg, Frede

    2005-01-01

    This paper discusses the modeling and simulation of matrix converter. Two models of matrix converter are presented: one is based on indirect space vector modulation and the other is based on power balance equation. The basis of these two models is• given and the process on modeling is introduced...

  15. Preparation and Characterization of Sustained Release Matrix ...

    African Journals Online (AJOL)

    Purpose: To formulate matrix type sustained-release (SR) tablets of tizanidine hydrochloride (TH) for prolonged drug release and improvement in motor activity after spinal injuries. Methods: Matrix tablets were prepared by the wet granulation method using four polymers (hydroxyl propyl methyl cellulose [HPMC] K 100, ethyl ...

  16. Rovibrational matrix elements of the multipole moments

    Indian Academy of Sciences (India)

    Rovibrational matrix elements of the multipole moments ℓ up to rank 10 and of the linear polarizability of the H2 molecule in the condensed phase have been computed taking into account the effect of the intermolecular potential. Comparison with gas phase matrix elements shows that the effect of solid state interactions is ...

  17. Matrix Approach to Cooperative Game Theory

    NARCIS (Netherlands)

    Xu Genjiu, G.

    2008-01-01

    In this monograph, the algebraic representation and the matrix approach are applied to study linear operators on the game space, more precisely, linear transformations on games and linear values. In terms of the essential notion of a coalitional matrix, these linear operators are represented

  18. Indecomposability of polynomials via Jacobian matrix

    International Nuclear Information System (INIS)

    Cheze, G.; Najib, S.

    2007-12-01

    Uni-multivariate decomposition of polynomials is a special case of absolute factorization. Recently, thanks to the Ruppert's matrix some effective results about absolute factorization have been improved. Here we show that with a jacobian matrix we can get sharper bounds for the special case of uni-multivariate decomposition. (author)

  19. Ocular tropism of respiratory viruses.

    Science.gov (United States)

    Belser, Jessica A; Rota, Paul A; Tumpey, Terrence M

    2013-03-01

    Respiratory viruses (including adenovirus, influenza virus, respiratory syncytial virus, coronavirus, and rhinovirus) cause a broad spectrum of disease in humans, ranging from mild influenza-like symptoms to acute respiratory failure. While species D adenoviruses and subtype H7 influenza viruses are known to possess an ocular tropism, documented human ocular disease has been reported following infection with all principal respiratory viruses. In this review, we describe the anatomical proximity and cellular receptor distribution between ocular and respiratory tissues. All major respiratory viruses and their association with human ocular disease are discussed. Research utilizing in vitro and in vivo models to study the ability of respiratory viruses to use the eye as a portal of entry as well as a primary site of virus replication is highlighted. Identification of shared receptor-binding preferences, host responses, and laboratory modeling protocols among these viruses provides a needed bridge between clinical and laboratory studies of virus tropism.

  20. Interfaces between a fibre and its matrix

    DEFF Research Database (Denmark)

    Lilholt, Hans; Sørensen, Bent F.

    2017-01-01

    parameters (applied load, debond length and relative fibre/matrix displacement) are rather similar for these test modes. A simplified analysis allows the direct determination of the three interface parameters from two plots for the experimental data. The complete analysis is demonstrated for steel fibres...... in polyester matrix. The analysis of existing experimental literature data is demonstrated for steel fibres in epoxy matrix and for tungsten wires in copper matrix. These latter incomplete analyses show that some results can be obtained even if all three experimental parameters are not recorded.......The interface between a fibre and its matrix represents an important element in the characterization and exploitation of composite materials. Both theoretical models and analyses of experimental data have been presented in the literature since modern composite were developed and many experiments...