WorldWideScience

Sample records for nipah virus edits

  1. Nipah virus transmission in a hamster model.

    Directory of Open Access Journals (Sweden)

    Emmie de Wit

    2011-12-01

    Full Text Available Based on epidemiological data, it is believed that human-to-human transmission plays an important role in Nipah virus outbreaks. No experimental data are currently available on the potential routes of human-to-human transmission of Nipah virus. In a first dose-finding experiment in Syrian hamsters, it was shown that Nipah virus was predominantly shed via the respiratory tract within nasal and oropharyngeal secretions. Although Nipah viral RNA was detected in urogenital and rectal swabs, no infectious virus was recovered from these samples, suggesting no viable virus was shed via these routes. In addition, hamsters inoculated with high doses shed significantly higher amounts of viable Nipah virus particles in comparison with hamsters infected with lower inoculum doses. Using the highest inoculum dose, three potential routes of Nipah virus transmission were investigated in the hamster model: transmission via fomites, transmission via direct contact and transmission via aerosols. It was demonstrated that Nipah virus is transmitted efficiently via direct contact and inefficiently via fomites, but not via aerosols. These findings are in line with epidemiological data which suggest that direct contact with nasal and oropharyngeal secretions of Nipah virus infected individuals resulted in greater risk of Nipah virus infection. The data provide new and much-needed insights into the modes and efficiency of Nipah virus transmission and have important public health implications with regards to the risk assessment and management of future Nipah virus outbreaks.

  2. Nipah Virus Transmission in a Hamster Model

    Science.gov (United States)

    de Wit, Emmie; Bushmaker, Trenton; Scott, Dana; Feldmann, Heinz; Munster, Vincent J.

    2011-01-01

    Based on epidemiological data, it is believed that human-to-human transmission plays an important role in Nipah virus outbreaks. No experimental data are currently available on the potential routes of human-to-human transmission of Nipah virus. In a first dose-finding experiment in Syrian hamsters, it was shown that Nipah virus was predominantly shed via the respiratory tract within nasal and oropharyngeal secretions. Although Nipah viral RNA was detected in urogenital and rectal swabs, no infectious virus was recovered from these samples, suggesting no viable virus was shed via these routes. In addition, hamsters inoculated with high doses shed significantly higher amounts of viable Nipah virus particles in comparison with hamsters infected with lower inoculum doses. Using the highest inoculum dose, three potential routes of Nipah virus transmission were investigated in the hamster model: transmission via fomites, transmission via direct contact and transmission via aerosols. It was demonstrated that Nipah virus is transmitted efficiently via direct contact and inefficiently via fomites, but not via aerosols. These findings are in line with epidemiological data which suggest that direct contact with nasal and oropharyngeal secretions of Nipah virus infected individuals resulted in greater risk of Nipah virus infection. The data provide new and much-needed insights into the modes and efficiency of Nipah virus transmission and have important public health implications with regards to the risk assessment and management of future Nipah virus outbreaks. PMID:22180802

  3. Nipah Virus: A Public Health Concern

    Directory of Open Access Journals (Sweden)

    Abu Bakar Siddique

    2016-05-01

    Full Text Available Nipah virus, a member of the genus Henipavirus, a new class of virus in the Paramyxoviridae family, has drawn attention as an emerging zoonotic virus in South-East and South Asian region. Case fatality rate of Nipah virus infection ranges from 40–70% although it has been as high as 100% in some outbreaks. Many of the outbreaks were attributed to pigs consuming fruits, partially eaten by fruit bats, and transmission of infection to humans. In Bangladesh, Nipah virus infection was associated with contact with a sick cow, consumption of fresh date palm sap (potentially contaminated with pteropid bat saliva, and person-to-person transmission. In 2014, 18 cases of Nipah virus infection have been reported in Bangladesh, of which 9 cases died. In the most recent epidemic at least 6 people died out of nine cases due to Nipah virus infection in the remote northern Bangladesh in 2015. Human infections range from asymptomatic infection to fatal encephalitis. Some people can also experience atypical pneumonia and severe respiratory problems. The virus is detected by ELISA, PCR, immunofluoroscence assay and isolation by cell culture. Treatment is mostly symptomatic and supportive as the effect of antiviral drugs is not satisfactory, and an effective vaccine is yet to be developed. So the very high case fatality addresses the need for adequate and strict control and preventive measures.

  4. Nipah virus infection in bats (order Chiroptera) in peninsular Malaysia.

    Science.gov (United States)

    Yob, J. M.; Field, H.; Rashdi, A. M.; Morrissy, C.; van der Heide, B.; Rota, P.; bin Adzhar, A.; White, J.; Daniels, P.; Jamaluddin, A.; Ksiazek, T.

    2001-01-01

    Nipah virus, family Paramyxoviridae, caused disease in pigs and humans in peninsular Malaysia in 1998-99. Because Nipah virus appears closely related to Hendra virus, wildlife surveillance focused primarily on pteropid bats (suborder Megachiroptera), a natural host of Hendra virus in Australia. We collected 324 bats from 14 species on peninsular Malaysia. Neutralizing antibodies to Nipah virus were demonstrated in five species, suggesting widespread infection in bat populations in peninsular Malaysia. PMID:11384522

  5. Quantitative estimation of Nipah virus replication kinetics in vitro

    Directory of Open Access Journals (Sweden)

    Hassan Sharifah

    2006-06-01

    Full Text Available Abstract Background Nipah virus is a zoonotic virus isolated from an outbreak in Malaysia in 1998. The virus causes infections in humans, pigs, and several other domestic animals. It has also been isolated from fruit bats. The pathogenesis of Nipah virus infection is still not well described. In the present study, Nipah virus replication kinetics were estimated from infection of African green monkey kidney cells (Vero using the one-step SYBR® Green I-based quantitative real-time reverse transcriptase-polymerase chain reaction (qRT-PCR assay. Results The qRT-PCR had a dynamic range of at least seven orders of magnitude and can detect Nipah virus from as low as one PFU/μL. Following initiation of infection, it was estimated that Nipah virus RNA doubles at every ~40 minutes and attained peak intracellular virus RNA level of ~8.4 log PFU/μL at about 32 hours post-infection (PI. Significant extracellular Nipah virus RNA release occurred only after 8 hours PI and the level peaked at ~7.9 log PFU/μL at 64 hours PI. The estimated rate of Nipah virus RNA released into the cell culture medium was ~0.07 log PFU/μL per hour and less than 10% of the released Nipah virus RNA was infectious. Conclusion The SYBR® Green I-based qRT-PCR assay enabled quantitative assessment of Nipah virus RNA synthesis in Vero cells. A low rate of Nipah virus extracellular RNA release and low infectious virus yield together with extensive syncytial formation during the infection support a cell-to-cell spread mechanism for Nipah virus infection.

  6. Evaluation of Nipah Virus as a Human and Animal Biological Terrorism and Warfare Agent

    Science.gov (United States)

    2001-09-01

    Molecular analyses have confirmed that Nipah virus and Hendra virus are closely related, but different viruses . The N, C, P. V, M, F and G genes of Nipah...encephalitis and 106 of them have died. The Nipah virus outbreak also devastated Malaysia’s pig-farming industry. The Nipah virus or so-called Hendra ...Nipah virus belongs to the Paramnyxoviirit strain, which shows similarities to the Hendra virus , which was discovered in Australia in 1994

  7. Hendra virus and Nipah virus animal vaccines.

    Science.gov (United States)

    Broder, Christopher C; Weir, Dawn L; Reid, Peter A

    2016-06-24

    Hendra virus (HeV) and Nipah virus (NiV) are zoonotic viruses that emerged in the mid to late 1990s causing disease outbreaks in livestock and people. HeV appeared in Queensland, Australia in 1994 causing a severe respiratory disease in horses along with a human case fatality. NiV emerged a few years later in Malaysia and Singapore in 1998-1999 causing a large outbreak of encephalitis with high mortality in people and also respiratory disease in pigs which served as amplifying hosts. The key pathological elements of HeV and NiV infection in several species of mammals, and also in people, are a severe systemic and often fatal neurologic and/or respiratory disease. In people, both HeV and NiV are also capable of causing relapsed encephalitis following recovery from an acute infection. The known reservoir hosts of HeV and NiV are several species of pteropid fruit bats. Spillovers of HeV into horses continue to occur in Australia and NiV has caused outbreaks in people in Bangladesh and India nearly annually since 2001, making HeV and NiV important transboundary biological threats. NiV in particular possesses several features that underscore its potential as a pandemic threat, including its ability to infect humans directly from natural reservoirs or indirectly from other susceptible animals, along with a capacity of limited human-to-human transmission. Several HeV and NiV animal challenge models have been developed which have facilitated an understanding of pathogenesis and allowed for the successful development of both active and passive immunization countermeasures. Published by Elsevier Ltd.

  8. Passive immunization and active vaccination against Hendra and Nipah viruses.

    Science.gov (United States)

    Broder, C C

    2013-01-01

    Hendra virus and Nipah virus are viral zoonoses first recognized in the mid and late 1990's and are now categorized as the type species of the genus Henipavirus within the family Paramyxoviridae. Their broad species tropism together with their capacity to cause severe and often fatal disease in both humans and animals make Hendra and Nipah "overlap agents" and significant biosecurity threats. The development of effective vaccination strategies to prevent or treat henipavirus infection and disease has been an important area of research. Here, henipavirus active and passive vaccination strategies that have been examined in animal challenge models of Hendra and Nipah virus disease are summarized and discussed.

  9. Nipah virus entry can occur by macropinocytosis

    International Nuclear Information System (INIS)

    Pernet, Olivier; Pohl, Christine; Ainouze, Michelle; Kweder, Hasan; Buckland, Robin

    2009-01-01

    Nipah virus (NiV) is a zoonotic biosafety level 4 paramyxovirus that emerged recently in Asia with high mortality in man. NiV is a member, with Hendra virus (HeV), of the Henipavirus genus in the Paramyxoviridae family. Although NiV entry, like that of other paramyxoviruses, is believed to occur via pH-independent fusion with the host cell's plasma membrane we present evidence that entry can occur by an endocytic pathway. The NiV receptor ephrinB2 has receptor kinase activity and we find that ephrinB2's cytoplasmic domain is required for entry but is dispensable for post-entry viral spread. The mutation of a single tyrosine residue (Y304F) in ephrinB2's cytoplasmic tail abrogates NiV entry. Moreover, our results show that NiV entry is inhibited by constructions and drugs specific for the endocytic pathway of macropinocytosis. Our findings could potentially permit the rapid development of novel low-cost antiviral treatments not only for NiV but also HeV.

  10. Identifying Early Target Cells of Nipah Virus Infection in Syrian Hamsters

    OpenAIRE

    Baseler, Laura; Scott, Dana P.; Saturday, Greg; Horne, Eva; Rosenke, Rebecca; Thomas, Tina; Meade-White, Kimberly; Haddock, Elaine; Feldmann, Heinz; de Wit, Emmie

    2016-01-01

    Background Nipah virus causes respiratory and neurologic disease with case fatality rates up to 100% in individual outbreaks. End stage lesions have been described in the respiratory and nervous systems, vasculature and often lymphoid organs in fatal human cases; however, the initial target organs of Nipah virus infection have not been identified. Here, we detected the initial target tissues and cells of Nipah virus and tracked virus dissemination during the early phase of infection in Syrian...

  11. Antibodies to Nipah-like virus in bats (Pteropus lylei), Cambodia.

    Science.gov (United States)

    Olson, James G; Rupprecht, Charles; Rollin, Pierre E; An, Ung Sam; Niezgoda, Michael; Clemins, Travis; Walston, Joe; Ksiazek, Thomas G

    2002-09-01

    Serum specimens from fruit bats were obtained at restaurants in Cambodia. We detected antibodies cross-reactive to Nipah virus by enzyme immunoassay in 11 (11.5%) of 96 Lyle's flying foxes (Pteropus lylei). Our study suggests that viruses closely related to Nipah or Hendra viruses are more widespread in Southeast Asia than previously documented.

  12. Pathogenesis of Hendra and Nipah virus infection in humans.

    Science.gov (United States)

    Escaffre, Olivier; Borisevich, Viktoriya; Rockx, Barry

    2013-04-17

    Hendra virus (HeV) and Nipah virus (NiV) are emerging zoonotic viruses that cause severe and often lethal respiratory illness and encephalitis in humans. Henipaviruses can infect a wide range of species and human-to-human transmission has been observed for NiV. While the exact route of transmission in humans is not known, experimental infection in different animal species suggests that infection can be efficiently initiated after respiratory challenge. The limited data on histopathological changes in fatal human cases of HeV and NiV suggest that endothelial cells are an important target during the terminal stage of infection; however, it is unknown where these viruses initially establish infection and how the virus disseminates from the respiratory tract to the central nervous system and other organs. Here we review the current concepts in henipavirus pathogenesis in humans.

  13. Hendra and Nipah viruses: why are they so deadly?

    Science.gov (United States)

    Marsh, Glenn A; Wang, Lin-Fa

    2012-06-01

    Henipavirus, including Hendra and Nipah viruses, is a group of emerging bat-borne paramyxoviruses which were responsible for severe disease outbreaks in humans, horses and pigs. The mortality rate of human infection varies between 50 and 100%, making them one of the most deadly viruses known to infect humans. Its use of highly conserved cell surface molecules (ephrin) as entry receptors and its highly effective replication and fusion strategies are believed to be important characteristics responsible for its high pathogenicity. Henipavirus also encodes multiple accessory proteins which play a key role in evasion of host innate immune responses. Our recent study on the mechanism of IFN antagonism by henipaviruses indicated that a better understanding of the virus-host interaction provides great potential to develop new therapeutic strategies against these viruses. Crown Copyright © 2012. Published by Elsevier B.V. All rights reserved.

  14. A treatment for and vaccine against the deadly Hendra and Nipah viruses.

    Science.gov (United States)

    Broder, Christopher C; Xu, Kai; Nikolov, Dimitar B; Zhu, Zhongyu; Dimitrov, Dimiter S; Middleton, Deborah; Pallister, Jackie; Geisbert, Thomas W; Bossart, Katharine N; Wang, Lin-Fa

    2013-10-01

    Hendra virus and Nipah virus are bat-borne paramyxoviruses that are the prototypic members of the genus Henipavirus. The henipaviruses emerged in the 1990s, spilling over from their natural bat hosts and causing serious disease outbreaks in humans and livestock. Hendra virus emerged in Australia and since 1994 there have been 7 human infections with 4 case fatalities. Nipah virus first appeared in Malaysia and subsequent outbreaks have occurred in Bangladesh and India. In total, there have been an estimated 582 human cases of Nipah virus and of these, 54% were fatal. Their broad species tropism and ability to cause fatal respiratory and/or neurologic disease in humans and animals make them important transboundary biological threats. Recent experimental findings in animals have demonstrated that a human monoclonal antibody targeting the viral G glycoprotein is an effective post-exposure treatment against Hendra and Nipah virus infection. In addition, a subunit vaccine based on the G glycoprotein of Hendra virus affords protection against Hendra and Nipah virus challenge. The vaccine has been developed for use in horses in Australia and is the first vaccine against a Biosafety Level-4 (BSL-4) agent to be licensed and commercially deployed. Together, these advances offer viable approaches to address Hendra and Nipah virus infection of livestock and people. Published by Elsevier B.V.

  15. Nipah virus encephalitis: A cause for concern for Indian neurologists?

    Directory of Open Access Journals (Sweden)

    Halder Amit

    2006-01-01

    Full Text Available The first and only recorded outbreak of Nipah virus (NV encephalitis in India occurred in the winter of 2001, although the causative organism could only be identified 5 years down the line in 2006. The first ever-recorded outbreak of NV encephalitis occurred in the Malaysian peninsula in 1998-99; though between 2001 and 2005, at least four outbreaks occurred in our neighboring country of Bangladesh. The threat of further outbreaks of this dangerous disease looms large on the Indian subcontinent, given the natural reservoir of the definitive host, namely, fruit-eating bats of the genus Pteropus. This review would briefly highlight the epidemiology, clinical aspects and diagnosis of NV encephalitis to enlighten the neurological community of the country for early detection and implementation of preventive measures in the event of further outbreaks, especially those which are generally passed of as ′mystery diseases′ in the lay press and even by governmental agencies.

  16. Structural and Functional Studies on the Fusion and Attachment Envelope Glycoproteins of Nipah Virus and Hendra Virus

    National Research Council Canada - National Science Library

    Bossart, Katharine

    2003-01-01

    Nipah virus (NiV) and Hendra (HeV) virus are emerging, biosafety level 4 paramyxoviruses responsible for fatal zoonotic infections of humans from pigs and horses, respectively, and are the prototypic members of a new Paramyxovirinae...

  17. Nipah and hendra virus interactions with the innate immune system.

    Science.gov (United States)

    Basler, Christopher F

    2012-01-01

    Nipah virus and Hendra virus are related, highly pathogenic paramyxoviruses with unusually broad host ranges. Henipaviruses encode several proteins that block innate immune responses, and these are likely to serve as virulence factors. Specfically, four virus-encoded proteins, the phosphoprotein (P), the V protein, the W protein, and the C protein have each been demonstrated to counteract aspects of the interferon (IFN)-α/β response, a key component of the innate immune response to virus infection. The available data indicate that V and W can inhibit the production of IFNα/β in response to various stimuli, while the P, V, and W proteins also block the ability of IFNs to signal and induce an antiviral state in cells. The C protein also inhibits the antiviral effects of IFNα/β by a poorly characterized mechanism. Reverse genetics systems, which allow the generation of recombinant viruses bearing specific mutations, have demonstrated the importance of the viral IFN-antagonists for replication. With these systems in hand, the field is now poised to define how specific viral IFN-antagonist functions influence viral pathogenesis.

  18. A mature and fusogenic form of the Nipah virus fusion protein requires proteolytic processing by cathepsin L

    International Nuclear Information System (INIS)

    Pager, Cara Theresia; Craft, Willie Warren; Patch, Jared; Dutch, Rebecca Ellis

    2006-01-01

    The Nipah virus fusion (F) protein is proteolytically processed to F 1 + F 2 subunits. We demonstrate here that cathepsin L is involved in this important maturation event. Cathepsin inhibitors ablated cleavage of Nipah F. Proteolytic processing of Nipah F and fusion activity was dramatically reduced in cathepsin L shRNA-expressing Vero cells. Additionally, Nipah virus F-mediated fusion was inhibited in cathepsin L-deficient cells, but coexpression of cathepsin L restored fusion activity. Both purified cathepsin L and B could cleave immunopurified Nipah F protein, but only cathepsin L produced products of the correct size. Our results suggest that endosomal cathepsins can cleave Nipah F, but that cathepsin L specifically converts Nipah F to a mature and fusogenic form

  19. Identifying Early Target Cells of Nipah Virus Infection in Syrian Hamsters.

    Directory of Open Access Journals (Sweden)

    Laura Baseler

    2016-11-01

    Full Text Available Nipah virus causes respiratory and neurologic disease with case fatality rates up to 100% in individual outbreaks. End stage lesions have been described in the respiratory and nervous systems, vasculature and often lymphoid organs in fatal human cases; however, the initial target organs of Nipah virus infection have not been identified. Here, we detected the initial target tissues and cells of Nipah virus and tracked virus dissemination during the early phase of infection in Syrian hamsters inoculated with a Nipah virus isolate from Malaysia (NiV-M or Bangladesh (NiV-B.Syrian hamsters were euthanized between 4 and 48 hours post intranasal inoculation and tissues were collected and analyzed for the presence of viral RNA, viral antigen and infectious virus. Virus replication was first detected at 8 hours post inoculation (hpi. Nipah virus initially targeted type I pneumocytes, bronchiolar respiratory epithelium and alveolar macrophages in the lung and respiratory and olfactory epithelium lining the nasal turbinates. By 16 hpi, virus disseminated to epithelial cells lining the larynx and trachea. Although the pattern of viral dissemination was similar for both virus isolates, the rate of spread was slower for NiV-B. Infectious virus was not detected in the nervous system or blood and widespread vascular infection and lesions within lymphoid organs were not observed, even at 48 hpi.Nipah virus initially targets the respiratory system. Virus replication in the brain and infection of blood vessels in non-respiratory tissues does not occur during the early phase of infection. However, virus replicates early in olfactory epithelium and may serve as the first step towards nervous system dissemination, suggesting that development of vaccines that block virus dissemination or treatments that can access the brain and spinal cord and directly inhibit virus replication may be necessary for preventing central nervous system pathology.

  20. Identifying Early Target Cells of Nipah Virus Infection in Syrian Hamsters.

    Science.gov (United States)

    Baseler, Laura; Scott, Dana P; Saturday, Greg; Horne, Eva; Rosenke, Rebecca; Thomas, Tina; Meade-White, Kimberly; Haddock, Elaine; Feldmann, Heinz; de Wit, Emmie

    2016-11-01

    Nipah virus causes respiratory and neurologic disease with case fatality rates up to 100% in individual outbreaks. End stage lesions have been described in the respiratory and nervous systems, vasculature and often lymphoid organs in fatal human cases; however, the initial target organs of Nipah virus infection have not been identified. Here, we detected the initial target tissues and cells of Nipah virus and tracked virus dissemination during the early phase of infection in Syrian hamsters inoculated with a Nipah virus isolate from Malaysia (NiV-M) or Bangladesh (NiV-B). Syrian hamsters were euthanized between 4 and 48 hours post intranasal inoculation and tissues were collected and analyzed for the presence of viral RNA, viral antigen and infectious virus. Virus replication was first detected at 8 hours post inoculation (hpi). Nipah virus initially targeted type I pneumocytes, bronchiolar respiratory epithelium and alveolar macrophages in the lung and respiratory and olfactory epithelium lining the nasal turbinates. By 16 hpi, virus disseminated to epithelial cells lining the larynx and trachea. Although the pattern of viral dissemination was similar for both virus isolates, the rate of spread was slower for NiV-B. Infectious virus was not detected in the nervous system or blood and widespread vascular infection and lesions within lymphoid organs were not observed, even at 48 hpi. Nipah virus initially targets the respiratory system. Virus replication in the brain and infection of blood vessels in non-respiratory tissues does not occur during the early phase of infection. However, virus replicates early in olfactory epithelium and may serve as the first step towards nervous system dissemination, suggesting that development of vaccines that block virus dissemination or treatments that can access the brain and spinal cord and directly inhibit virus replication may be necessary for preventing central nervous system pathology.

  1. Affinity selection of Nipah and Hendra virus-related vaccine candidates from a complex random peptide library displayed on bacteriophage virus-like particles

    Energy Technology Data Exchange (ETDEWEB)

    Peabody, David S.; Chackerian, Bryce; Ashley, Carlee; Carnes, Eric; Negrete, Oscar

    2017-01-24

    The invention relates to virus-like particles of bacteriophage MS2 (MS2 VLPs) displaying peptide epitopes or peptide mimics of epitopes of Nipah Virus envelope glycoprotein that elicit an immune response against Nipah Virus upon vaccination of humans or animals. Affinity selection on Nipah Virus-neutralizing monoclonal antibodies using random sequence peptide libraries on MS2 VLPs selected peptides with sequence similarity to peptide sequences found within the envelope glycoprotein of Nipah itself, thus identifying the epitopes the antibodies recognize. The selected peptide sequences themselves are not necessarily identical in all respects to a sequence within Nipah Virus glycoprotein, and therefore may be referred to as epitope mimics VLPs displaying these epitope mimics can serve as vaccine. On the other hand, display of the corresponding wild-type sequence derived from Nipah Virus and corresponding to the epitope mapped by affinity selection, may also be used as a vaccine.

  2. A review of Nipah and Hendra viruses with an historical aside.

    Science.gov (United States)

    Ksiazek, Thomas G; Rota, Paul A; Rollin, Pierre E

    2011-12-01

    The emergence of Hendra and Nipah viruses in the 1990s has been followed by the further emergence of these viruses in the tropical Old World. The history and current knowledge of the disease, the viruses and their epidemiology is reviewed in this article. A historical aside summarizes the role that Dr. Brian W.J. Mahy played at critical junctures in the early stories of these viruses. Copyright © 2011 Elsevier B.V. All rights reserved.

  3. Comparison of the pathogenicity of Nipah virus isolates from Bangladesh and Malaysia in the Syrian hamster.

    Directory of Open Access Journals (Sweden)

    Blair L DeBuysscher

    Full Text Available Nipah virus is a zoonotic pathogen that causes severe disease in humans. The mechanisms of pathogenesis are not well described. The first Nipah virus outbreak occurred in Malaysia, where human disease had a strong neurological component. Subsequent outbreaks have occurred in Bangladesh and India and transmission and disease processes in these outbreaks appear to be different from those of the Malaysian outbreak. Until this point, virtually all Nipah virus studies in vitro and in vivo, including vaccine and pathogenesis studies, have utilized a virus isolate from the original Malaysian outbreak (NiV-M. To investigate potential differences between NiV-M and a Nipah virus isolate from Bangladesh (NiV-B, we compared NiV-M and NiV-B infection in vitro and in vivo. In hamster kidney cells, NiV-M-infection resulted in extensive syncytia formation and cytopathic effects, whereas NiV-B-infection resulted in little to no morphological changes. In vivo, NiV-M-infected Syrian hamsters had accelerated virus replication, pathology and death when compared to NiV-B-infected animals. NiV-M infection also resulted in the activation of host immune response genes at an earlier time point. Pathogenicity was not only a result of direct effects of virus replication, but likely also had an immunopathogenic component. The differences observed between NiV-M and NiV-B pathogeneis in hamsters may relate to differences observed in human cases. Characterization of the hamster model for NiV-B infection allows for further research of the strain of Nipah virus responsible for the more recent outbreaks in humans. This model can be used to study NiV-B pathogenesis, transmission, and countermeasures that could be used to control outbreaks.

  4. Antiviral activity of gliotoxin, gentian violet and brilliant green against Nipah and Hendra virus in vitro

    Directory of Open Access Journals (Sweden)

    Meyer Adam G

    2009-11-01

    Full Text Available Abstract Background Using a recently described monolayer assay amenable to high throughput screening format for the identification of potential Nipah virus and Hendra virus antivirals, we have partially screened a low molecular weight compound library (>8,000 compounds directly against live virus infection and identified twenty eight promising lead molecules. Initial single blind screens were conducted with 10 μM compound in triplicate with a minimum efficacy of 90% required for lead selection. Lead compounds were then further characterised to determine the median efficacy (IC50, cytotoxicity (CC50 and the in vitro therapeutic index in live virus and pseudotype assay formats. Results While a number of leads were identified, the current work describes three commercially available compounds: brilliant green, gentian violet and gliotoxin, identified as having potent antiviral activity against Nipah and Hendra virus. Similar efficacy was observed against pseudotyped Nipah and Hendra virus, vesicular stomatitis virus and human parainfluenza virus type 3 while only gliotoxin inhibited an influenza A virus suggesting a non-specific, broad spectrum activity for this compound. Conclusion All three of these compounds have been used previously for various aspects of anti-bacterial and anti-fungal therapy and the current results suggest that while unsuitable for internal administration, they may be amenable to topical antiviral applications, or as disinfectants and provide excellent positive controls for future studies.

  5. A neutralizing human monoclonal antibody protects against lethal disease in a new ferret model of acute nipah virus infection.

    Directory of Open Access Journals (Sweden)

    Katharine N Bossart

    2009-10-01

    Full Text Available Nipah virus is a broadly tropic and highly pathogenic zoonotic paramyxovirus in the genus Henipavirus whose natural reservoirs are several species of Pteropus fruit bats. Nipah virus has repeatedly caused outbreaks over the past decade associated with a severe and often fatal disease in humans and animals. Here, a new ferret model of Nipah virus pathogenesis is described where both respiratory and neurological disease are present in infected animals. Severe disease occurs with viral doses as low as 500 TCID(50 within 6 to 10 days following infection. The underlying pathology seen in the ferret closely resembles that seen in Nipah virus infected humans, characterized as a widespread multisystemic vasculitis, with virus replicating in highly vascular tissues including lung, spleen and brain, with recoverable virus from a variety of tissues. Using this ferret model a cross-reactive neutralizing human monoclonal antibody, m102.4, targeting the henipavirus G glycoprotein was evaluated in vivo as a potential therapeutic agent. All ferrets that received m102.4 ten hours following a high dose oral-nasal Nipah virus challenge were protected from disease while all controls died. This study is the first successful post-exposure passive antibody therapy for Nipah virus using a human monoclonal antibody.

  6. Hendra and Nipah viruses: pathogenesis, animal models and recent breakthroughs in vaccination

    Directory of Open Access Journals (Sweden)

    Weingartl HM

    2015-09-01

    Full Text Available Hana M Weingartl National Centre for Foreign Animal Disease, Canadian Food Inspection Agency, Winnipeg, MB, Canada Abstract: Hendra and Nipah viruses are two highly pathogenic zoonotic members of the genus Henipavirus, family Paramyxoviridae, requiring work under biosafety level 4 conditions due to a lack of effective therapy and human vaccines. Several vaccine candidates were protective in animal models: recombinant vaccinia virus expressing Nipah virus (NiV F and G proteins in hamsters against NiV; recombinant ALVAC–NiV F and G in swine against NiV; recombinant Hendra virus (HeV soluble G protein (sGHeV against HeV and NiV in cats, ferrets, horses, and African green monkeys (AGM; recombinant vesicular stomatitis virus-based vectors expressing NiV F or G against NiV in hamsters and ferrets; measles virus-based NiV G vaccine candidate in hamsters and AGMs against NiV; and adenoassociated virus expressing NiG protein, which protected hamsters against NiV. The sGHeV was licensed for use in horses (Equivac HeV® in 2012. It is the first vaccine candidate licensed against a biosafety level 4 agent. With the development of suitable animal models (ferret, hamster and, importantly, AGM, progress can be made toward development of a human vaccine.Keywords: henipavirus, equine, swine, human infection, animal models, vaccine candidates

  7. Cytoplasmic Motifs in the Nipah Virus Fusion Protein Modulate Virus Particle Assembly and Egress.

    Science.gov (United States)

    Johnston, Gunner P; Contreras, Erik M; Dabundo, Jeffrey; Henderson, Bryce A; Matz, Keesha M; Ortega, Victoria; Ramirez, Alfredo; Park, Arnold; Aguilar, Hector C

    2017-05-15

    Nipah virus (NiV), a paramyxovirus in the genus Henipavirus , has a mortality rate in humans of approximately 75%. While several studies have begun our understanding of NiV particle formation, the mechanism of this process remains to be fully elucidated. For many paramyxoviruses, M proteins drive viral assembly and egress; however, some paramyxoviral glycoproteins have been reported as important or essential in budding. For NiV the matrix protein (M), the fusion glycoprotein (F) and, to a much lesser extent, the attachment glycoprotein (G) autonomously induce the formation of virus-like particles (VLPs). However, functional interactions between these proteins during assembly and egress remain to be fully understood. Moreover, if the F-driven formation of VLPs occurs through interactions with host cell machinery, the cytoplasmic tail (CT) of F is a likely interactive domain. Therefore, we analyzed NiV F CT deletion and alanine mutants and report that several but not all regions of the F CT are necessary for efficient VLP formation. Two of these regions contain YXXØ or dityrosine motifs previously shown to interact with cellular machinery involved in F endocytosis and transport. Importantly, our results showed that F-driven, M-driven, and M/F-driven viral particle formation enhanced the recruitment of G into VLPs. By identifying key motifs, specific residues, and functional viral protein interactions important for VLP formation, we improve our understanding of the viral assembly/egress process and point to potential interactions with host cell machinery. IMPORTANCE Henipaviruses can cause deadly infections of medical, veterinary, and agricultural importance. With recent discoveries of new henipa-like viruses, understanding the mechanisms by which these viruses reproduce is paramount. We have focused this study on identifying the functional interactions of three Nipah virus proteins during viral assembly and particularly on the role of one of these proteins, the

  8. Use of monoclonal antibodies against Hendra and Nipah viruses in an antigen capture ELISA

    Directory of Open Access Journals (Sweden)

    Spiropoulou Christina F

    2010-06-01

    Full Text Available Abstract Background Outbreaks of Hendra (HeV and Nipah (NiV viruses have been reported starting in 1994 and 1998, respectively. Both viruses are capable of causing fatal disease in humans and effecting great economical loss in the livestock industry. Results Through screening of hybridomas derived from mice immunized with γ-irradiated Nipah virus, we identified two secreted antibodies; one reactive with the nucleocapsid (N protein and the other, the phosphoprotein (P of henipaviruses. Epitope mapping and protein sequence alignments between NiV and HeV suggest the last 14 amino acids of the carboxyl terminus of the N protein is the target of the anti-N antibody. The anti-P antibody recognizes an epitope in the amino-terminal half of P protein. These monoclonal antibodies were used to develop two antigen capture ELISAs, one for virus detection and the other for differentiation between NiV and HeV. The lower limit of detection of the capture assay with both monoclonal antibodies was 400 pfu. The anti-N antibody was used to successfully detect NiV in a lung tissue suspension from an infected pig. Conclusion The antigen capture ELISA developed is potentially affordable tool to provide rapid detection and differentiation between the henipaviruses.

  9. Use of monoclonal antibodies against Hendra and Nipah viruses in an antigen capture ELISA.

    Science.gov (United States)

    Chiang, Cheng-Feng; Lo, Michael K; Rota, Paul A; Spiropoulou, Christina F; Rollin, Pierre E

    2010-06-03

    Outbreaks of Hendra (HeV) and Nipah (NiV) viruses have been reported starting in 1994 and 1998, respectively. Both viruses are capable of causing fatal disease in humans and effecting great economical loss in the livestock industry. Through screening of hybridomas derived from mice immunized with gamma-irradiated Nipah virus, we identified two secreted antibodies; one reactive with the nucleocapsid (N) protein and the other, the phosphoprotein (P) of henipaviruses. Epitope mapping and protein sequence alignments between NiV and HeV suggest the last 14 amino acids of the carboxyl terminus of the N protein is the target of the anti-N antibody. The anti-P antibody recognizes an epitope in the amino-terminal half of P protein. These monoclonal antibodies were used to develop two antigen capture ELISAs, one for virus detection and the other for differentiation between NiV and HeV. The lower limit of detection of the capture assay with both monoclonal antibodies was 400 pfu. The anti-N antibody was used to successfully detect NiV in a lung tissue suspension from an infected pig. The antigen capture ELISA developed is potentially affordable tool to provide rapid detection and differentiation between the henipaviruses.

  10. Matrix proteins of Nipah and Hendra viruses interact with beta subunits of AP-3 complexes.

    Science.gov (United States)

    Sun, Weina; McCrory, Thomas S; Khaw, Wei Young; Petzing, Stephanie; Myers, Terrell; Schmitt, Anthony P

    2014-11-01

    Paramyxoviruses and other negative-strand RNA viruses encode matrix proteins that coordinate the virus assembly process. The matrix proteins link the viral glycoproteins and the viral ribonucleoproteins at virus assembly sites and often recruit host machinery that facilitates the budding process. Using a co-affinity purification strategy, we have identified the beta subunit of the AP-3 adapter protein complex, AP3B1, as a binding partner for the M proteins of the zoonotic paramyxoviruses Nipah virus and Hendra virus. Binding function was localized to the serine-rich and acidic Hinge domain of AP3B1, and a 29-amino-acid Hinge-derived polypeptide was sufficient for M protein binding in coimmunoprecipitation assays. Virus-like particle (VLP) production assays were used to assess the relationship between AP3B1 binding and M protein function. We found that for both Nipah virus and Hendra virus, M protein expression in the absence of any other viral proteins led to the efficient production of VLPs in transfected cells, and this VLP production was potently inhibited upon overexpression of short M-binding polypeptides derived from the Hinge region of AP3B1. Both human and bat (Pteropus alecto) AP3B1-derived polypeptides were highly effective at inhibiting the production of VLPs. VLP production was also impaired through small interfering RNA (siRNA)-mediated depletion of AP3B1 from cells. These findings suggest that AP-3-directed trafficking processes are important for henipavirus particle production and identify a new host protein-virus protein binding interface that could become a useful target in future efforts to develop small molecule inhibitors to combat paramyxoviral infections. Henipaviruses cause deadly infections in humans, with a mortality rate of about 40%. Hendra virus outbreaks in Australia, all involving horses and some involving transmission to humans, have been a continuing problem. Nipah virus caused a large outbreak in Malaysia in 1998, killing 109 people

  11. Novel Functions of Hendra Virus G N-Glycans and Comparisons to Nipah Virus.

    Science.gov (United States)

    Bradel-Tretheway, Birgit G; Liu, Qian; Stone, Jacquelyn A; McInally, Samantha; Aguilar, Hector C

    2015-07-01

    Hendra virus (HeV) and Nipah virus (NiV) are reportedly the most deadly pathogens within the Paramyxoviridae family. These two viruses bind the cellular entry receptors ephrin B2 and/or ephrin B3 via the viral attachment glycoprotein G, and the concerted efforts of G and the viral fusion glycoprotein F result in membrane fusion. Membrane fusion is essential for viral entry into host cells and for cell-cell fusion, a hallmark of the disease pathobiology. HeV G is heavily N-glycosylated, but the functions of the N-glycans remain unknown. We disrupted eight predicted N-glycosylation sites in HeV G by conservative mutations (Asn to Gln) and found that six out of eight sites were actually glycosylated (G2 to G7); one in the stalk (G2) and five in the globular head domain (G3 to G7). We then tested the roles of individual and combined HeV G N-glycan mutants and found functions in the modulation of shielding against neutralizing antibodies, intracellular transport, G-F interactions, cell-cell fusion, and viral entry. Between the highly conserved HeV and NiV G glycoproteins, similar trends in the effects of N-glycans on protein functions were observed, with differences in the levels at which some N-glycan mutants affected such functions. While the N-glycan in the stalk domain (G2) had roles that were highly conserved between HeV and NiV G, individual N-glycans in the head affected the levels of several protein functions differently. Our findings are discussed in the context of their contributions to our understanding of HeV and NiV pathogenesis and immune responses. Viral envelope glycoproteins are important for viral pathogenicity and immune evasion. N-glycan shielding is one mechanism by which immune evasion can be achieved. In paramyxoviruses, viral attachment and membrane fusion are governed by the close interaction of the attachment proteins H/HN/G and the fusion protein F. In this study, we show that the attachment glycoprotein G of Hendra virus (HeV), a deadly

  12. Microsphere suspension array assays for detection and differentiation of Hendra and Nipah viruses.

    Science.gov (United States)

    Foord, Adam J; White, John R; Colling, Axel; Heine, Hans G

    2013-01-01

    Microsphere suspension array systems enable the simultaneous fluorescent identification of multiple separate nucleotide targets in a single reaction. We have utilized commercially available oligo-tagged microspheres (Luminex MagPlex-TAG) to construct and evaluate multiplexed assays for the detection and differentiation of Hendra virus (HeV) and Nipah virus (NiV). Both these agents are bat-borne zoonotic paramyxoviruses of increasing concern for veterinary and human health. Assays were developed targeting multiple sites within the nucleoprotein (N) and phosphoprotein (P) encoding genes. The relative specificities and sensitivities of the assays were determined using reference isolates of each virus type, samples from experimentally infected horses, and archival veterinary diagnostic submissions. Results were assessed in direct comparison with an established qPCR. The microsphere array assays achieved unequivocal differentiation of HeV and NiV and the sensitivity of HeV detection was comparable to qPCR, indicating high analytical and diagnostic specificity and sensitivity.

  13. Inhibition of Henipavirus fusion and infection by heptad-derived peptides of the Nipah virus fusion glycoprotein

    Science.gov (United States)

    Bossart, Katharine N; Mungall, Bruce A; Crameri, Gary; Wang, Lin-Fa; Eaton, Bryan T; Broder, Christopher C

    2005-01-01

    Background The recent emergence of four new members of the paramyxovirus family has heightened the awareness of and re-energized research on new and emerging diseases. In particular, the high mortality and person to person transmission associated with the most recent Nipah virus outbreaks, as well as the very recent re-emergence of Hendra virus, has confirmed the importance of developing effective therapeutic interventions. We have previously shown that peptides corresponding to the C-terminal heptad repeat (HR-2) of the fusion envelope glycoprotein of Hendra virus and Nipah virus were potent inhibitors of both Hendra virus and Nipah virus-mediated membrane fusion using recombinant expression systems. In the current study, we have developed shorter, second generation HR-2 peptides which include a capped peptide via amidation and acetylation and two poly(ethylene glycol)-linked (PEGylated) peptides, one with the PEG moity at the C-terminus and the other at the N-terminus. Here, we have evaluated these peptides as well as the corresponding scrambled peptide controls in Nipah virus and Hendra virus-mediated membrane fusion and against infection by live virus in vitro. Results Unlike their predecessors, the second generation HR-2 peptides exhibited high solubility and improved synthesis yields. Importantly, both Nipah virus and Hendra virus-mediated fusion as well as live virus infection were potently inhibited by both capped and PEGylated peptides with IC50 concentrations similar to the original HR-2 peptides, whereas the scrambled modified peptides had no inhibitory effect. These data also indicate that these chemical modifications did not alter the functional properties of the peptides as inhibitors. Conclusion Nipah virus and Hendra virus infection in vitro can be potently blocked by specific HR-2 peptides. The improved synthesis and solubility characteristics of the second generation HR-2 peptides will facilitate peptide synthesis for pre-clinical trial

  14. Inhibition of Henipavirus fusion and infection by heptad-derived peptides of the Nipah virus fusion glycoprotein

    Directory of Open Access Journals (Sweden)

    Eaton Bryan T

    2005-07-01

    Full Text Available Abstract Background The recent emergence of four new members of the paramyxovirus family has heightened the awareness of and re-energized research on new and emerging diseases. In particular, the high mortality and person to person transmission associated with the most recent Nipah virus outbreaks, as well as the very recent re-emergence of Hendra virus, has confirmed the importance of developing effective therapeutic interventions. We have previously shown that peptides corresponding to the C-terminal heptad repeat (HR-2 of the fusion envelope glycoprotein of Hendra virus and Nipah virus were potent inhibitors of both Hendra virus and Nipah virus-mediated membrane fusion using recombinant expression systems. In the current study, we have developed shorter, second generation HR-2 peptides which include a capped peptide via amidation and acetylation and two poly(ethylene glycol-linked (PEGylated peptides, one with the PEG moity at the C-terminus and the other at the N-terminus. Here, we have evaluated these peptides as well as the corresponding scrambled peptide controls in Nipah virus and Hendra virus-mediated membrane fusion and against infection by live virus in vitro. Results Unlike their predecessors, the second generation HR-2 peptides exhibited high solubility and improved synthesis yields. Importantly, both Nipah virus and Hendra virus-mediated fusion as well as live virus infection were potently inhibited by both capped and PEGylated peptides with IC50 concentrations similar to the original HR-2 peptides, whereas the scrambled modified peptides had no inhibitory effect. These data also indicate that these chemical modifications did not alter the functional properties of the peptides as inhibitors. Conclusion Nipah virus and Hendra virus infection in vitro can be potently blocked by specific HR-2 peptides. The improved synthesis and solubility characteristics of the second generation HR-2 peptides will facilitate peptide synthesis for pre

  15. Potent Human Monoclonal Antibodies against SARS CoV, Nipah and Hendra Viruses

    Science.gov (United States)

    Prabakaran, Ponraj; Zhongyu, Zhu; Xiao, Xiaodong; Biragyn, Arya; Dimitrov, Antony S.; Broder, Christopher C.; Dimitrov, Dimiter S.

    2009-01-01

    Polyclonal antibodies have a century-old history of being effective against some viruses; recently, monoclonal antibodies (mAbs) have also shown success. The humanized mAb Synagis (palivizumab) remains still the only mAb against respiratory syncytial virus (RSV) infections approved by the U.S. Food and Drug Administration (FDA). Recently, several potent human monoclonal antibodies (hmAbs) targeting the Severe Acute Respiratory Syndrome-Associated coronavirus (SARS CoV) S glycoproteins were developed quickly after the virus was identified in 2003. Among these antibodies, m396 and S230.15 exhibit exceptional potency and cross-reactivity as they neutralize isolates from the first and second outbreaks and from palm civets both in vitroand in mice. Similarly, the first fully hmAbs against two other paramyxoviruses, Hendra virus (HeV) and Nipah virus (NiV), which can cause up to 75% mortality, were recently developed; one of them, m102.4, shows exceptional cross-reactive potency against both NiV and HeV. Three-dimensional molecular structures of envelope glycoproteins from these viruses in complexes with antibodies and/or receptors were recently determined. Structural analyses along with other experiments have provided insights into the molecular mechanisms of receptor recognition and antibody neutralization, and suggested that these antibodies alone or in combination could successfully fight the viruses’ heterogeneity and mutability which is a major problem in the development of effective therapeutic agents against viruses, including therapeutic antibodies. PMID:19216624

  16. The distribution of henipaviruses in Southeast Asia and Australasia: is Wallace's line a barrier to Nipah virus?

    Directory of Open Access Journals (Sweden)

    Andrew C Breed

    Full Text Available Nipah virus (NiV (Genus Henipavirus is a recently emerged zoonotic virus that causes severe disease in humans and has been found in bats of the genus Pteropus. Whilst NiV has not been detected in Australia, evidence for NiV-infection has been found in pteropid bats in some of Australia's closest neighbours. The aim of this study was to determine the occurrence of henipaviruses in fruit bat (Family Pteropodidae populations to the north of Australia. In particular we tested the hypothesis that Nipah virus is restricted to west of Wallace's Line. Fruit bats from Australia, Papua New Guinea, East Timor and Indonesia were tested for the presence of antibodies to Hendra virus (HeV and Nipah virus, and tested for the presence of HeV, NiV or henipavirus RNA by PCR. Evidence was found for the presence of Nipah virus in both Pteropus vampyrus and Rousettus amplexicaudatus populations from East Timor. Serology and PCR also suggested the presence of a henipavirus that was neither HeV nor NiV in Pteropus alecto and Acerodon celebensis. The results demonstrate the presence of NiV in the fruit bat populations on the eastern side of Wallace's Line and within 500 km of Australia. They indicate the presence of non-NiV, non-HeV henipaviruses in fruit bat populations of Sulawesi and Sumba and possibly in Papua New Guinea. It appears that NiV is present where P. vampyrus occurs, such as in the fruit bat populations of Timor, but where this bat species is absent other henipaviruses may be present, as on Sulawesi and Sumba. Evidence was obtained for the presence henipaviruses in the non-Pteropid species R. amplexicaudatus and in A. celebensis. The findings of this work fill some gaps in knowledge in geographical and species distribution of henipaviruses in Australasia which will contribute to planning of risk management and surveillance activities.

  17. The distribution of henipaviruses in Southeast Asia and Australasia: is Wallace's line a barrier to Nipah virus?

    Science.gov (United States)

    Breed, Andrew C; Meers, Joanne; Sendow, Indrawati; Bossart, Katharine N; Barr, Jennifer A; Smith, Ina; Wacharapluesadee, Supaporn; Wang, Linfa; Field, Hume E

    2013-01-01

    Nipah virus (NiV) (Genus Henipavirus) is a recently emerged zoonotic virus that causes severe disease in humans and has been found in bats of the genus Pteropus. Whilst NiV has not been detected in Australia, evidence for NiV-infection has been found in pteropid bats in some of Australia's closest neighbours. The aim of this study was to determine the occurrence of henipaviruses in fruit bat (Family Pteropodidae) populations to the north of Australia. In particular we tested the hypothesis that Nipah virus is restricted to west of Wallace's Line. Fruit bats from Australia, Papua New Guinea, East Timor and Indonesia were tested for the presence of antibodies to Hendra virus (HeV) and Nipah virus, and tested for the presence of HeV, NiV or henipavirus RNA by PCR. Evidence was found for the presence of Nipah virus in both Pteropus vampyrus and Rousettus amplexicaudatus populations from East Timor. Serology and PCR also suggested the presence of a henipavirus that was neither HeV nor NiV in Pteropus alecto and Acerodon celebensis. The results demonstrate the presence of NiV in the fruit bat populations on the eastern side of Wallace's Line and within 500 km of Australia. They indicate the presence of non-NiV, non-HeV henipaviruses in fruit bat populations of Sulawesi and Sumba and possibly in Papua New Guinea. It appears that NiV is present where P. vampyrus occurs, such as in the fruit bat populations of Timor, but where this bat species is absent other henipaviruses may be present, as on Sulawesi and Sumba. Evidence was obtained for the presence henipaviruses in the non-Pteropid species R. amplexicaudatus and in A. celebensis. The findings of this work fill some gaps in knowledge in geographical and species distribution of henipaviruses in Australasia which will contribute to planning of risk management and surveillance activities.

  18. The Nature of Exposure Drives Transmission of Nipah Viruses from Malaysia and Bangladesh in Ferrets.

    Directory of Open Access Journals (Sweden)

    Bronwyn A Clayton

    2016-06-01

    Full Text Available Person-to-person transmission is a key feature of human Nipah virus outbreaks in Bangladesh. In contrast, in an outbreak of Nipah virus in Malaysia, people acquired infections from pigs. It is not known whether this important epidemiological difference is driven primarily by differences between NiV Bangladesh (NiV-BD and Malaysia (NiV-MY at a virus level, or by environmental or host factors. In a time course study, ferrets were oronasally exposed to equivalent doses of NiV-BD or NiV-MY. More rapid onset of productive infection and higher levels of virus replication in respiratory tract tissues were seen for NiV-BD compared to NiV-MY, corroborating our previous report of increased oral shedding of NiV-BD in ferrets and suggesting a contributory mechanism for increased NiV-BD transmission between people compared to NiV-MY. However, we recognize that transmission occurs within a social and environmental framework that may have an important and differentiating role in NiV transmission rates. With this in mind, ferret-to-ferret transmission of NiV-BD and NiV-MY was assessed under differing viral exposure conditions. Transmission was not identified for either virus when naïve ferrets were cohoused with experimentally-infected animals. In contrast, all naïve ferrets developed acute infection following assisted and direct exposure to oronasal fluid from animals that were shedding either NiV-BD or NiV-MY. Our findings for ferrets indicate that, although NiV-BD may be shed at higher levels than NiV-MY, transmission risk may be equivalently low under exposure conditions provided by cohabitation alone. In contrast, active transfer of infected bodily fluids consistently results in transmission, regardless of the virus strain. These observations suggest that the risk of NiV transmission is underpinned by social and environmental factors, and will have practical implications for managing transmission risk during outbreaks of human disease.

  19. Hendra and Nipah Virus Infection in Cultured Human Olfactory Epithelial Cells.

    Science.gov (United States)

    Borisevich, Viktoriya; Ozdener, Mehmet Hakan; Malik, Bilal; Rockx, Barry

    2017-01-01

    Henipaviruses are emerging zoonotic viruses and causative agents of encephalitis in humans. However, the mechanisms of entry into the central nervous system (CNS) in humans are not known. Here, we evaluated the possible role of olfactory epithelium in virus entry into the CNS. We characterized Hendra virus (HeV) and Nipah virus (NiV) infection of primary human olfactory epithelial cultures. We show that henipaviruses can infect mature olfactory sensory neurons. Henipaviruses replicated efficiently, resulting in cytopathic effect and limited induction of host responses. These results show that human olfactory epithelium is susceptible to infection with henipaviruses, suggesting that this could be a pathway for neuroinvasion in humans. IMPORTANCE Henipaviruses are emerging zoonotic pathogens that can cause acute and severe respiratory and neurological disease in humans. The pathways by which henipaviruses enter the central nervous system (CNS) in humans are still unknown. The observation that human olfactory neurons are highly susceptible to infection with henipaviruses demonstrates that the olfactory epithelium can serve as a site of Henipavirus entry into the CNS.

  20. Microsphere Suspension Array Assays for Detection and Differentiation of Hendra and Nipah Viruses

    Directory of Open Access Journals (Sweden)

    Adam J. Foord

    2013-01-01

    Full Text Available Microsphere suspension array systems enable the simultaneous fluorescent identification of multiple separate nucleotide targets in a single reaction. We have utilized commercially available oligo-tagged microspheres (Luminex MagPlex-TAG to construct and evaluate multiplexed assays for the detection and differentiation of Hendra virus (HeV and Nipah virus (NiV. Both these agents are bat-borne zoonotic paramyxoviruses of increasing concern for veterinary and human health. Assays were developed targeting multiple sites within the nucleoprotein (N and phosphoprotein (P encoding genes. The relative specificities and sensitivities of the assays were determined using reference isolates of each virus type, samples from experimentally infected horses, and archival veterinary diagnostic submissions. Results were assessed in direct comparison with an established qPCR. The microsphere array assays achieved unequivocal differentiation of HeV and NiV and the sensitivity of HeV detection was comparable to qPCR, indicating high analytical and diagnostic specificity and sensitivity.

  1. Inhibition of Nipah Virus Infectin In Vivo: Targeting an Early Stage of Paramyxovirus Fusion Activation during Viral Entry

    Energy Technology Data Exchange (ETDEWEB)

    M Porotto; B Rockx; C Yokoyama; A Talekar; I DeVito; l Palermo; J Liu; R Cortese; M Lu; et al.

    2011-12-31

    In the paramyxovirus cell entry process, receptor binding triggers conformational changes in the fusion protein (F) leading to viral and cellular membrane fusion. Peptides derived from C-terminal heptad repeat (HRC) regions in F have been shown to inhibit fusion by preventing formation of the fusogenic six-helix bundle. We recently showed that the addition of a cholesterol group to HRC peptides active against Nipah virus targets these peptides to the membrane where fusion occurs, dramatically increasing their antiviral effect. In this work, we report that unlike the untagged HRC peptides, which bind to the postulated extended intermediate state bridging the viral and cell membranes, the cholesterol tagged HRC-derived peptides interact with F before the fusion peptide inserts into the target cell membrane, thus capturing an earlier stage in the F-activation process. Furthermore, we show that cholesterol tagging renders these peptides active in vivo: the cholesterol-tagged peptides cross the blood brain barrier, and effectively prevent and treat in an established animal model what would otherwise be fatal Nipah virus encephalitis. The in vivo efficacy of cholesterol-tagged peptides, and in particular their ability to penetrate the CNS, suggests that they are promising candidates for the prevention or therapy of infection by Nipah and other lethal paramyxoviruses.

  2. Nipah virus infects specific subsets of porcine peripheral blood mononuclear cells.

    Directory of Open Access Journals (Sweden)

    Beata Stachowiak

    Full Text Available Nipah virus (NiV, a zoonotic paramyxovirus, is highly contagious in swine, and can cause fatal infections in humans following transmission from the swine host. The main viral targets in both species are the respiratory and central nervous systems, with viremia implicated as a mode of dissemination of NiV throughout the host. The presented work focused on the role of peripheral blood mononuclear cells (PBMC in the viremic spread of the virus in the swine host. B lymphocytes, CD4-CD8-, as well as CD4+CD8- T lymphocytes were not permissive to NiV, and expansion of the CD4+CD8- cells early post infection was consistent with functional humoral response to NiV infection observed in swine. In contrast, significant drop in the CD4+CD8- T cell frequency was observed in piglets which succumbed to the experimental infection, supporting the hypothesis that antibody development is the critical component of the protective immune response. Productive viral replication was detected in monocytes, CD6+CD8+ T lymphocytes and NK cells by recovery of infectious virus in the cell supernatants. Virus replication was supported by detection of the structural N and the non-structural C proteins or by detection of genomic RNA increase in the infected cells. Infection of T cells carrying CD6 marker, a strong ligand for the activated leukocyte cell adhesion molecule ALCAM (CD166 highly expressed on the microvascular endothelial cell of the blood-air and the blood-brain barrier may explain NiV preferential tropism for small blood vessels of the lung and brain.

  3. Nipah virus infects specific subsets of porcine peripheral blood mononuclear cells.

    Science.gov (United States)

    Stachowiak, Beata; Weingartl, Hana M

    2012-01-01

    Nipah virus (NiV), a zoonotic paramyxovirus, is highly contagious in swine, and can cause fatal infections in humans following transmission from the swine host. The main viral targets in both species are the respiratory and central nervous systems, with viremia implicated as a mode of dissemination of NiV throughout the host. The presented work focused on the role of peripheral blood mononuclear cells (PBMC) in the viremic spread of the virus in the swine host. B lymphocytes, CD4-CD8-, as well as CD4+CD8- T lymphocytes were not permissive to NiV, and expansion of the CD4+CD8- cells early post infection was consistent with functional humoral response to NiV infection observed in swine. In contrast, significant drop in the CD4+CD8- T cell frequency was observed in piglets which succumbed to the experimental infection, supporting the hypothesis that antibody development is the critical component of the protective immune response. Productive viral replication was detected in monocytes, CD6+CD8+ T lymphocytes and NK cells by recovery of infectious virus in the cell supernatants. Virus replication was supported by detection of the structural N and the non-structural C proteins or by detection of genomic RNA increase in the infected cells. Infection of T cells carrying CD6 marker, a strong ligand for the activated leukocyte cell adhesion molecule ALCAM (CD166) highly expressed on the microvascular endothelial cell of the blood-air and the blood-brain barrier may explain NiV preferential tropism for small blood vessels of the lung and brain.

  4. The YPLGVG sequence of the Nipah virus matrix protein is required for budding

    Directory of Open Access Journals (Sweden)

    Yan Lianying

    2008-11-01

    Full Text Available Abstract Background Nipah virus (NiV is a recently emerged paramyxovirus capable of causing fatal disease in a broad range of mammalian hosts, including humans. Together with Hendra virus (HeV, they comprise the genus Henipavirus in the family Paramyxoviridae. Recombinant expression systems have played a crucial role in studying the cell biology of these Biosafety Level-4 restricted viruses. Henipavirus assembly and budding occurs at the plasma membrane, although the details of this process remain poorly understood. Multivesicular body (MVB proteins have been found to play a role in the budding of several enveloped viruses, including some paramyxoviruses, and the recruitment of MVB proteins by viral proteins possessing late budding domains (L-domains has become an important concept in the viral budding process. Previously we developed a system for producing NiV virus-like particles (VLPs and demonstrated that the matrix (M protein possessed an intrinsic budding ability and played a major role in assembly. Here, we have used this system to further explore the budding process by analyzing elements within the M protein that are critical for particle release. Results Using rationally targeted site-directed mutagenesis we show that a NiV M sequence YPLGVG is required for M budding and that mutation or deletion of the sequence abrogates budding ability. Replacement of the native and overlapping Ebola VP40 L-domains with the NiV sequence failed to rescue VP40 budding; however, it did induce the cellular morphology of extensive filamentous projection consistent with wild-type VP40-expressing cells. Cells expressing wild-type NiV M also displayed this morphology, which was dependent on the YPLGVG sequence, and deletion of the sequence also resulted in nuclear localization of M. Dominant-negative VPS4 proteins had no effect on NiV M budding, suggesting that unlike other viruses such as Ebola, NiV M accomplishes budding independent of MVB cellular proteins

  5. Induction of neutralizing antibodies to Hendra and Nipah glycoproteins using a Venezuelan equine encephalitis virus in vivo expression system.

    Science.gov (United States)

    Defang, Gabriel N; Khetawat, Dimple; Broder, Christopher C; Quinnan, Gerald V

    2010-12-16

    The emergence of Hendra Virus (HeV) and Nipah Virus (NiV) which can cause fatal infections in both animals and humans has triggered a search for an effective vaccine. Here, we have explored the potential for generating an effective humoral immune response to these zoonotic pathogens using an alphavirus-based vaccine platform. Groups of mice were immunized with Venezuelan equine encephalitis virus replicon particles (VRPs) encoding the attachment or fusion glycoproteins of either HeV or NiV. We demonstrate the induction of highly potent cross-reactive neutralizing antibodies to both viruses using this approach. Preliminary study suggested early enhancement in the antibody response with use of a modified version of VRP. Overall, these data suggest that the use of an alphavirus-derived vaccine platform might serve as a viable approach for the development of an effective vaccine against the henipaviruses. Published by Elsevier Ltd.

  6. Quantitative analysis of Nipah virus proteins released as virus-like particles reveals central role for the matrix protein

    Directory of Open Access Journals (Sweden)

    Eaton Bryan T

    2007-01-01

    Full Text Available Abstract Background Nipah virus (NiV is an emerging paramyxovirus distinguished by its ability to cause fatal disease in both animal and human hosts. Together with Hendra virus (HeV, they comprise the genus Henipavirus in the Paramyxoviridae family. NiV and HeV are also restricted to Biosafety Level-4 containment and this has hampered progress towards examining details of their replication and morphogenesis. Here, we have established recombinant expression systems to study NiV particle assembly and budding through the formation of virus-like particles (VLPs. Results When expressed by recombinant Modified Vaccinia virus Ankara (rMVA or plasmid transfection, individual NiV matrix (M, fusion (F and attachment (G proteins were all released into culture supernatants in a membrane-associated state as determined by sucrose density gradient flotation and immunoprecipitation. However, co-expression of F and G along with M revealed a shift in their distribution across the gradient, indicating association with M in VLPs. Protein release was also altered depending on the context of viral proteins being expressed, with F, G and nucleocapsid (N protein reducing M release, and N release dependent on the co-expression of M. Immunoelectron microscopy and density analysis revealed VLPs that were similar to authentic virus. Differences in the budding dynamics of NiV proteins were also noted between rMVA and plasmid based strategies, suggesting that over-expression by poxvirus may not be appropriate for studying the details of recombinant virus particle assembly and release. Conclusion Taken together, the results indicate that NiV M, F, and G each possess some ability to bud from expressing cells, and that co-expression of these viral proteins results in a more organized budding process with M playing a central role. These findings will aid our understanding of paramyxovirus particle assembly in general and could help facilitate the development of a novel vaccine

  7. Molecular characterization of Nipah virus from Pteropus hypomelanus in Southern Thailand.

    Science.gov (United States)

    Wacharapluesadee, Supaporn; Samseeneam, Panumas; Phermpool, Mana; Kaewpom, Thongchai; Rodpan, Apaporn; Maneeorn, Pattarapol; Srongmongkol, Phimchanok; Kanchanasaka, Budsabong; Hemachudha, Thiravat

    2016-03-25

    Nipah virus (NiV) first emerged in Malaysia in 1998, with two bat species (Pteropus hypomelanus and P. vampyrus) as the putative natural reservoirs. In 2002, NiV IgG antibodies were detected in these species from Thailand, but viral RNA could not be detected for strain characterization. Two strains of NiV (Malaysia and Bangladesh) have been found in P. lylei in central Thailand, although Bangladesh strain, the causative strain for the outbreak in Bangladesh since 2001, was dominant. To understand the diversity of NiV in Thailand, this study identified NiV strain, using molecular characterizations, from P. hypomelanus in southern Thailand. Pooled bat urine specimens were collected from plastic sheet underneath bat roosts in April 2010, and then monthly from December 2010 to May 2011 at an island in southern Thailand. Five in 184 specimens were positive for NiV, using duplex nested RT-PCR assay on partial nucleocapsid fragment (357 bp). Whole sequences of nucleocapsid gene from four bats were characterized. All 5 partial fragments and 4 whole nucleocapsid genes formed a monophyletic with NiV-MY. Our study showed that P. hypomelanus in southern Thailand and from Malaysia, a bordering country, harbored similar NiV. This finding indicates that NiV is not limited to central Thailand or P. lylei species, and it may be a source of inter-species transmission. This indicates a higher potential for a widespread NiV outbreak in Thailand. NiV surveillance in Pteropus bats, the major natural reservoirs, should be conducted continuously in countries or regions with high susceptibility to outbreaks.

  8. Nipah Virus Transmission from Bats to Humans Associated with Drinking Traditional Liquor Made from Date Palm Sap, Bangladesh, 2011–2014

    Centers for Disease Control (CDC) Podcasts

    2016-06-30

    Sarah Gregory reads an abridged version of the article, Nipah Virus Transmission from Bats to Humans Associated with Drinking Traditional Liquor Made from Date Palm Sap, Bangladesh, 2011–2014.  Created: 6/30/2016 by National Center for Emerging and Zoonotic Infectious Diseases (NCEZID).   Date Released: 6/30/2016.

  9. Towards understanding of Nipah virus attachment protein assembly and the role of protein affinity and crowding for membrane curvature events.

    Energy Technology Data Exchange (ETDEWEB)

    Stachowiak, Jeanne C.; Hayden, Carl C.; Negrete, Oscar.; Davis, Ryan Wesley; Sasaki, Darryl Y

    2013-10-01

    Pathogenic viruses are a primary threat to our national security and to the health and economy of our world. Effective defense strategies to combat viral infection and spread require the development of understanding of the mechanisms that these pathogens use to invade the host cell. We present in this report results of our research into viral particle recognition and fusion to cell membranes and the role that protein affinity and confinement in lipid domains plays in membrane curvature in cellular fusion and fission events. Herein, we describe 1) the assembly of the G attachment protein of Nipah virus using point mutation studies to define its role in viral particle fusion to the cell membrane, 2) how lateral pressure of membrane bound proteins induce curvature in model membrane systems, and 3) the role of membrane curvature in the selective partitioning of molecular receptors and specific affinity of associated proteins.

  10. Agricultural intensification, priming for persistence and the emergence of Nipah virus: a lethal bat-borne zoonosis.

    Science.gov (United States)

    Pulliam, Juliet R C; Epstein, Jonathan H; Dushoff, Jonathan; Rahman, Sohayati A; Bunning, Michel; Jamaluddin, Aziz A; Hyatt, Alex D; Field, Hume E; Dobson, Andrew P; Daszak, Peter

    2012-01-07

    Emerging zoonoses threaten global health, yet the processes by which they emerge are complex and poorly understood. Nipah virus (NiV) is an important threat owing to its broad host and geographical range, high case fatality, potential for human-to-human transmission and lack of effective prevention or therapies. Here, we investigate the origin of the first identified outbreak of NiV encephalitis in Malaysia and Singapore. We analyse data on livestock production from the index site (a commercial pig farm in Malaysia) prior to and during the outbreak, on Malaysian agricultural production, and from surveys of NiV's wildlife reservoir (flying foxes). Our analyses suggest that repeated introduction of NiV from wildlife changed infection dynamics in pigs. Initial viral introduction produced an explosive epizootic that drove itself to extinction but primed the population for enzootic persistence upon reintroduction of the virus. The resultant within-farm persistence permitted regional spread and increased the number of human infections. This study refutes an earlier hypothesis that anomalous El Niño Southern Oscillation-related climatic conditions drove emergence and suggests that priming for persistence drove the emergence of a novel zoonotic pathogen. Thus, we provide empirical evidence for a causative mechanism previously proposed as a precursor to widespread infection with H5N1 avian influenza and other emerging pathogens.

  11. Transcriptome Profiling of the Virus-Induced Innate Immune Response in Pteropus vampyrus and Its Attenuation by Nipah Virus Interferon Antagonist Functions.

    Science.gov (United States)

    Glennon, Nicole B; Jabado, Omar; Lo, Michael K; Shaw, Megan L

    2015-08-01

    Bats are important reservoirs for several viruses, many of which cause lethal infections in humans but have reduced pathogenicity in bats. As the innate immune response is critical for controlling viruses, the nature of this response in bats and how it may differ from that in other mammals are of great interest. Using next-generation transcriptome sequencing (mRNA-seq), we profiled the transcriptional response of Pteropus vampyrus bat kidney (PVK) cells to Newcastle disease virus (NDV), an avian paramyxovirus known to elicit a strong innate immune response in mammalian cells. The Pteropus genus is a known reservoir of Nipah virus (NiV) and Hendra virus (HeV). Analysis of the 200 to 300 regulated genes showed that genes for interferon (IFN) and antiviral pathways are highly upregulated in NDV-infected PVK cells, including genes for beta IFN, RIG-I, MDA5, ISG15, and IRF1. NDV-infected cells also upregulated several genes not previously characterized to be antiviral, such as RND1, SERTAD1, CHAC1, and MORC3. In fact, we show that MORC3 is induced by both IFN and NDV infection in PVK cells but is not induced by either stimulus in human A549 cells. In contrast to NDV infection, HeV and NiV infection of PVK cells failed to induce these innate immune response genes. Likewise, an attenuated response was observed in PVK cells infected with recombinant NDVs expressing the NiV IFN antagonist proteins V and W. This study provides the first global profile of a robust virus-induced innate immune response in bats and indicates that henipavirus IFN antagonist mechanisms are likely active in bat cells. Bats are the reservoir host for many highly pathogenic human viruses, including henipaviruses, lyssaviruses, severe acute respiratory syndrome coronavirus, and filoviruses, and many other viruses have also been isolated from bats. Viral infections are reportedly asymptomatic or heavily attenuated in bat populations. Despite their ecological importance to viral maintenance, research

  12. Unraveling a three-step spatiotemporal mechanism of triggering of receptor-induced Nipah virus fusion and cell entry.

    Directory of Open Access Journals (Sweden)

    Qian Liu

    Full Text Available Membrane fusion is essential for entry of the biomedically-important paramyxoviruses into their host cells (viral-cell fusion, and for syncytia formation (cell-cell fusion, often induced by paramyxoviral infections [e.g. those of the deadly Nipah virus (NiV]. For most paramyxoviruses, membrane fusion requires two viral glycoproteins. Upon receptor binding, the attachment glycoprotein (HN/H/G triggers the fusion glycoprotein (F to undergo conformational changes that merge viral and/or cell membranes. However, a significant knowledge gap remains on how HN/H/G couples cell receptor binding to F-triggering. Via interdisciplinary approaches we report the first comprehensive mechanism of NiV membrane fusion triggering, involving three spatiotemporally sequential cell receptor-induced conformational steps in NiV-G: two in the head and one in the stalk. Interestingly, a headless NiV-G mutant was able to trigger NiV-F, and the two head conformational steps were required for the exposure of the stalk domain. Moreover, the headless NiV-G prematurely triggered NiV-F on virions, indicating that the NiV-G head prevents premature triggering of NiV-F on virions by concealing a F-triggering stalk domain until the correct time and place: receptor-binding. Based on these and recent paramyxovirus findings, we present a comprehensive and fundamentally conserved mechanistic model of paramyxovirus membrane fusion triggering and cell entry.

  13. Raw Sap Consumption Habits and Its Association with Knowledge of Nipah Virus in Two Endemic Districts in Bangladesh.

    Science.gov (United States)

    Nahar, Nazmun; Paul, Repon C; Sultana, Rebeca; Gurley, Emily S; Garcia, Fernando; Abedin, Jaynal; Sumon, Shariful Amin; Banik, Kajal Chandra; Asaduzzaman, Mohammad; Rimi, Nadia Ali; Rahman, Mahmudur; Luby, Stephen P

    2015-01-01

    Human Nipah virus (NiV) infection in Bangladesh is a fatal disease that can be transmitted from bats to humans who drink contaminated raw date palm sap collected overnight during the cold season. Our study aimed to understand date palm sap consumption habits of rural residents and factors associated with consumption. In November-December 2012 the field team interviewed adult respondents from randomly selected villages from Rajbari and Kushtia Districts in Bangladesh. We calculated the proportion of people who consumed raw sap and had heard about a disease from raw sap consumption. We assessed the factors associated with raw sap consumption by calculating prevalence ratios (PR) adjusted for village level clustering effects. Among the 1,777 respondents interviewed, half (50%) reported drinking raw sap during the previous sap collection season and 37% consumed raw sap at least once per month. Few respondents (5%) heard about NiV. Thirty-seven percent of respondents reported hearing about a disease transmitted through raw sap consumption, inclusive of a 10% who related it with milder illness like diarrhea, vomiting or indigestion rather than NiV. Respondents who harvested date palm trees in their household were more likely to drink sap than those who did not own date palm trees (79% vs. 65% PR 1.2, 95% CI 1.1-1.3, psap was available, respondents who heard about a disease from raw sap consumption were just as likely to drink it as those who did not hear about a disease (69% vs. 67%, PR 1.0, 95% CI 0.9-1.1, p = 0.512). Respondents' knowledge of NiV was low. They might not have properly understood the risk of NiV, and were likely to drink sap when it was available. Implementing strategies to increase awareness about the risks of NiV and protect sap from bats might reduce the risk of NiV transmission.

  14. Hendra and Nipah virus infection in cultured human olfactory epithelial cells

    NARCIS (Netherlands)

    Borisevich, V. (Viktoriya); Ozdener, M.H. (Mehmet Hakan); Malik, B. (Bilal); B. Rockx (Barry)

    2017-01-01

    textabstractHenipaviruses are emerging zoonotic viruses and causative agents of encephalitis in humans. However, the mechanisms of entry into the central nervous system (CNS) in humans are not known. Here, we evaluated the possible role of olfactory epithelium in virus entry into the CNS. We

  15. Development and validation of a chemiluminescent immunodetection assay amenable to high throughput screening of antiviral drugs for Nipah and Hendra virus.

    Science.gov (United States)

    Aljofan, Mohamad; Porotto, Matteo; Moscona, Anne; Mungall, Bruce A

    2008-04-01

    There are currently no antiviral drugs approved for the highly lethal Biosafety Level 4 pathogens Nipah and Hendra virus. A number of researchers are developing surrogate assays amenable to Biosafety Level 2 biocontainment but ultimately, the development of a high throughput screening method for directly quantifying these viruses in a Biosafety Level 4 environment will be critical for final evaluation of antiviral drugs identified in surrogate assays, in addition to reducing the time required for effective antiviral drug development. By adapting an existing immunoplaque assay and using enzyme linked immunodetection in a microtitre plate format, the current experiments describe a simple two step assay protocol involving an overnight virus inoculation of Vero cell monolayers (with or without antiviral drug treatment) at Biosafety Level 4, followed by cell fixation and virus inactivation enabling removal of plates from the Biosafety Level 4 laboratory and a subsequent immunodetection assay using a chemiluminescent horse radish peroxidase substrate to be performed at Biosafety Level 2. The analytical sensitivity (limit of detection) of this assay is 100 tissue culture infectious dose50/ml of either Nipah or Hendra virus. In addition this assay enables linear quantitation of virus over three orders of magnitude and is unaffected by dimethyl sulfoxide concentrations of 1% or less. Intra-assay coefficients of variation are acceptable (less than 20%) when detecting a minimum of 1000 tissue culture infectious dose50/ml of either virus although inter-assay variation is considerably greater. By an assessment of efficacies of the broad spectrum antiviral Ribavirin and an experimental fusion inhibitory peptide, this assay reveals a good correlation with previously published fluorescent immunodetection assays. The current experiments describe for the first time, a high throughput screening method amenable for direct assessment of live henipavirus antiviral drug activity.

  16. In silico identification and characterization of common epitope-based peptide vaccine for Nipah and Hendra viruses.

    Science.gov (United States)

    Saha, Chayan Kumar; Mahbub Hasan, Md; Saddam Hossain, Md; Asraful Jahan, Md; Azad, Abul Kalam

    2017-06-01

    To explore a common B- and T-cell epitope-based vaccine that can elicit an immune response against encephalitis causing genus Henipaviruses, Hendra virus (HeV) and Nipah virus (NiV). Membrane proteins F, G and M of HeV and NiV were retrieved from the protein database and subjected to different bioinformatics tools to predict antigenic B-cell epitopes. Best B-cell epitopes were then analyzed to predict their T-cell antigenic potentiality. Antigenic B- and T-cell epitopes that shared maximum identity with HeV and NiV were selected. Stability of the selected epitopes was predicted. Finally, the selected epitopes were subjected to molecular docking simulation with HLA-DR to confirm their antigenic potentiality in silico. One epitope from G proteins, one from M proteins and none from F proteins were selected based on their antigenic potentiality. The epitope from the G proteins was stable whereas that from M was unstable. The M-epitope was made stable by adding flanking dipeptides. The 15-mer G-epitope (VDPLRVQWRNNSVIS) showed at least 66% identity with all NiV and HeV G protein sequences, while the 15-mer M-epitope (GKLEFRRNNAIAFKG) with the dipeptide flanking residues showed 73% identity with all NiV and HeV M protein sequences available in the database. Molecular docking simulation with most frequent MHC class-II (MHC II) and class-I (MHC I) molecules showed that these epitopes could bind within HLA binding grooves to elicit an immune response. Data in our present study revealed the notion that the epitopes from G and M proteins might be the target for peptide-based subunit vaccine design against HeV and NiV. However, the biochemical analysis is necessary to experimentally validate the interaction of epitopes individually with the MHC molecules through elucidation of immunity induction. Copyright © 2017 Hainan Medical University. Production and hosting by Elsevier B.V. All rights reserved.

  17. Structural and Functional Studies on the Fusion and Attachment Envelope Glycoproteins of Nipah Virus and Hendra Virus

    Science.gov (United States)

    2003-01-01

    subcloned into the vaccinia virus promoter driven expression vector pMCO2 (90) and recombinant vaccinia viruses were generated using standard...characteristics and properties of these novel viruses , and may provide insights into membrane fusion mechanisms, the virus infection process, and towards...these novel viruses , and may provide insights into membrane fusion mechanisms, the virus infection process, and towards the development of therapeutics

  18. A Randomized Controlled Trial of Interventions to Impede Date Palm Sap Contamination by Bats to Prevent Nipah Virus Transmission in Bangladesh

    Science.gov (United States)

    Khan, Salah Uddin; Gurley, Emily S.; Hossain, M. Jahangir; Nahar, Nazmun; Sharker, M. A. Yushuf; Luby, Stephen P.

    2012-01-01

    Background Drinking raw date palm sap is a risk factor for human Nipah virus (NiV) infection. Fruit bats, the natural reservoir of NiV, commonly contaminate raw sap with saliva by licking date palm’s sap producing surface. We evaluated four types of physical barriers that may prevent bats from contacting sap. Methods During 2009, we used a crossover design and randomly selected 20 date palm sap producing trees and observed each tree for 2 nights: one night with a bamboo skirt intervention applied and one night without the intervention. During 2010, we selected 120 trees and randomly assigned four types of interventions to 15 trees each: bamboo, dhoincha (local plant), jute stick and polythene skirts covering the shaved part, sap stream, tap and collection pot. We enrolled the remaining 60 trees as controls. We used motion sensor activated infrared cameras to examine bat contact with sap. Results During 2009 bats contacted date palm sap in 85% of observation nights when no intervention was used compared with 35% of nights when the intervention was used [psap when the skirt did not entirely cover the sap producing surface. Therefore, in 2010 we requested the sap harvesters to use larger skirts. During 2010 bats contacted date palm sap [2% vs. 83%, psap in trees with bamboo (psap during one night (7%) with the jute stick skirt (psap producing areas of a tree effectively prevented bat-sap contact. Community interventions should promote applying these skirts to prevent occasional Nipah spillovers to human. PMID:22905160

  19. Engineered Viruses as Genome Editing Devices.

    Science.gov (United States)

    Chen, Xiaoyu; Gonçalves, Manuel A F V

    2016-03-01

    Genome editing based on sequence-specific designer nucleases, also known as programmable nucleases, seeks to modify in a targeted and precise manner the genetic information content of living cells. Delivering into cells designer nucleases alone or together with donor DNA templates, which serve as surrogate homologous recombination (HR) substrates, can result in gene knockouts or gene knock-ins, respectively. As engineered replication-defective viruses, viral vectors are having an increasingly important role as delivery vehicles for donor DNA templates and designer nucleases, namely, zinc-finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs) and clustered, regularly interspaced, short palindromic repeats (CRISPR)-associated Cas9 (CRISPR-Cas9) nucleases, also known as RNA-guided nucleases (RGNs). We review this dual role played by engineered viral particles on genome editing while focusing on their main scaffolds, consisting of lentiviruses, adeno-associated viruses, and adenoviruses. In addition, the coverage of the growing body of research on the repurposing of viral vectors as delivery systems for genome editing tools is complemented with information regarding their main characteristics, pros, and cons. Finally, this information is framed by a concise description of the chief principles, tools, and applications of the genome editing field as a whole.

  20. The Role of the Hendra Virus and Nipah Virus Attachment Glycoproteins in Receptor Binding and Antibody Neutralization

    Science.gov (United States)

    2014-01-31

    glycoproteins, such as HIV gp140 and Rabies glycoprotein, its ability to form trimers but not tetramers makes it ineffective for correct oligomerization of...Oldstone MB. 2000. V and C proteins of measles virus function as virulence factors in vivo. Virology 267:80-9.   216 148. Playford EG, McCall B...2005. Stable trimerization of recombinant rabies virus glycoprotein ectodomain is required for interaction with the p75NTR receptor. J Gen Virol 86

  1. Identification of a broad-spectrum antiviral small molecule against severe acute respiratory syndrome coronavirus and Ebola, Hendra, and Nipah viruses by using a novel high-throughput screening assay.

    Science.gov (United States)

    Elshabrawy, Hatem A; Fan, Jilao; Haddad, Christine S; Ratia, Kiira; Broder, Christopher C; Caffrey, Michael; Prabhakar, Bellur S

    2014-04-01

    Severe acute respiratory syndrome coronavirus (SARS-CoV) and Ebola, Hendra, and Nipah viruses are members of different viral families and are known causative agents of fatal viral diseases. These viruses depend on cathepsin L for entry into their target cells. The viral glycoproteins need to be primed by protease cleavage, rendering them active for fusion with the host cell membrane. In this study, we developed a novel high-throughput screening assay based on peptides, derived from the glycoproteins of the aforementioned viruses, which contain the cathepsin L cleavage site. We screened a library of 5,000 small molecules and discovered a small molecule that can inhibit the cathepsin L cleavage of all viral peptides with minimal inhibition of cleavage of a host protein-derived peptide (pro-neuropeptide Y). The small molecule inhibited the entry of all pseudotyped viruses in vitro and the cleavage of SARS-CoV spike glycoprotein in an in vitro cleavage assay. In addition, the Hendra and Nipah virus fusion glycoproteins were not cleaved in the presence of the small molecule in a cell-based cleavage assay. Furthermore, we demonstrate that the small molecule is a mixed inhibitor of cathepsin L. Our broad-spectrum antiviral small molecule appears to be an ideal candidate for future optimization and development into a potent antiviral against SARS-CoV and Ebola, Hendra, and Nipah viruses. We developed a novel high-throughput screening assay to identify small molecules that can prevent cathepsin L cleavage of viral glycoproteins derived from SARS-CoV and Ebola, Hendra, and Nipah viruses that are required for their entry into the host cell. We identified a novel broad-spectrum small molecule that could block cathepsin L-mediated cleavage and thus inhibit the entry of pseudotypes bearing the glycoprotein derived from SARS-CoV or Ebola, Hendra, or Nipah virus. The small molecule can be further optimized and developed into a potent broad-spectrum antiviral drug.

  2. Contribution of Human Lung Parenchyma and Leukocyte Influx to Oxidative Stress and Immune System-Mediated Pathology following Nipah Virus Infection.

    Science.gov (United States)

    Escaffre, Olivier; Saito, Tais B; Juelich, Terry L; Ikegami, Tetsuro; Smith, Jennifer K; Perez, David D; Atkins, Colm; Levine, Corri B; Huante, Matthew B; Nusbaum, Rebecca J; Endsley, Janice J; Freiberg, Alexander N; Rockx, Barry

    2017-08-01

    Nipah virus (NiV) is a zoonotic emerging paramyxovirus that can cause fatal respiratory illness or encephalitis in humans. Despite many efforts, the molecular mechanisms of NiV-induced acute lung injury (ALI) remain unclear. We previously showed that NiV replicates to high titers in human lung grafts in NOD-SCID/γ mice, resulting in a robust inflammatory response. Interestingly, these mice can undergo human immune system reconstitution by the bone marrow, liver, and thymus (BLT) reconstitution method, in addition to lung tissue engraftment, giving altogether a realistic model to study human respiratory viral infections. Here, we characterized NiV Bangladesh strain (NiV-B) infection of human lung grafts from human immune system-reconstituted mice in order to identify the overall effect of immune cells on NiV pathogenesis of the lung. We show that NiV-B replicated to high titers in human lung grafts and caused similar cytopathic effects irrespective of the presence of human leukocytes in mice. However, the human immune system interfered with virus spread across lung grafts, responded to infection by leukocyte migration to small airways and alveoli of the lung grafts, and accelerated oxidative stress in lung grafts. In addition, the presence of human leukocytes increased the expression of cytokines and chemokines that regulate inflammatory influx to sites of infection and tissue damage. These results advance our understanding of how the immune system limits NiV dissemination and contributes to ALI and inform efforts to identify therapeutic targets. IMPORTANCE Nipah virus (NiV) is an emerging paramyxovirus that can cause a lethal respiratory and neurological disease in humans. Only limited data are available on NiV pathogenesis in the human lung, and the relative contribution of the innate immune response and NiV to acute lung injury (ALI) is still unknown. Using human lung grafts in a human immune system-reconstituted mouse model, we showed that the NiV Bangladesh

  3. Piloting the use of indigenous methods to prevent Nipah virus infection by interrupting bats' access to date palm sap in Bangladesh.

    Science.gov (United States)

    Nahar, Nazmun; Mondal, Utpal Kumar; Sultana, Rebeca; Hossain, M Jahangir; Khan, M Salah Uddin; Gurley, Emily S; Oliveras, Elizabeth; Luby, Stephen P

    2013-09-01

    People in Bangladesh frequently drink fresh date palm sap. Fruit bats (Pteropus giganteus) also drink raw sap and may contaminate the sap by shedding Nipah virus through saliva and urine. In a previous study we identified two indigenous methods to prevent bats accessing the sap, bamboo skirts and lime (calcium carbonate). We conducted a pilot study to assess the acceptability of these two methods among sap harvesters. We used interactive community meetings and group discussions to encourage all the sap harvesters (n = 12) from a village to use either bamboo skirts or lime smear that some of them (n = 4) prepared and applied. We measured the preparation and application time and calculated the cost of bamboo skirts. We conducted interviews after the use of each method. The sap harvesters found skirts effective in preventing bats from accessing sap. They were sceptical that lime would be effective as the lime was washed away by the sap flow. Preparation of the skirt took ∼105 min. The application of each method took ∼1 min. The cost of the bamboo skirt is minimal because bamboo is widely available and they made the skirts with pieces of used bamboo. The bamboo skirt method appeared practical and affordable to the sap harvesters. Further studies should explore its ability to prevent bats from accessing date palm sap and assess if its use produces more or better quality sap, which would provide further incentives to make it more acceptable for its regular use.

  4. Endothelial galectin-1 binds to specific glycans on nipah virus fusion protein and inhibits maturation, mobility, and function to block syncytia formation.

    Directory of Open Access Journals (Sweden)

    Omai B Garner

    2010-07-01

    Full Text Available Nipah virus targets human endothelial cells via NiV-F and NiV-G envelope glycoproteins, resulting in endothelial syncytia formation and vascular compromise. Endothelial cells respond to viral infection by releasing innate immune effectors, including galectins, which are secreted proteins that bind to specific glycan ligands on cell surface glycoproteins. We demonstrate that galectin-1 reduces NiV-F mediated fusion of endothelial cells, and that endogenous galectin-1 in endothelial cells is sufficient to inhibit syncytia formation. Galectin-1 regulates NiV-F mediated cell fusion at three distinct points, including retarding maturation of nascent NiV-F, reducing NiV-F lateral mobility on the plasma membrane, and directly inhibiting the conformational change in NiV-F required for triggering fusion. Characterization of the NiV-F N-glycome showed that the critical site for galectin-1 inhibition is rich in glycan structures known to bind galectin-1. These studies identify a unique set of mechanisms for regulating pathophysiology of NiV infection at the level of the target cell.

  5. Biochemical and structural studies of the oligomerization domain of the Nipah virus phosphoprotein: evidence for an elongated coiled-coil homotrimer.

    Science.gov (United States)

    Blocquel, David; Beltrandi, Matilde; Erales, Jenny; Barbier, Pascale; Longhi, Sonia

    2013-11-01

    Nipah virus (NiV) is a recently emerged severe human pathogen that belongs to the Henipavirus genus within the Paramyxoviridae family. The NiV genome is encapsidated by the nucleoprotein (N) within a helical nucleocapsid that is the substrate used by the polymerase for transcription and replication. The polymerase is recruited onto the nucleocapsid via its cofactor, the phosphoprotein (P). The NiV P protein has a modular organization, with alternating disordered and ordered domains. Among these latter, is the P multimerization domain (PMD) that was predicted to adopt a coiled-coil conformation. Using both biochemical and biophysical approaches, we show that NiV PMD forms a highly stable and elongated coiled-coil trimer, a finding in striking contrast with respect to the PMDs of Paramyxoviridae members investigated so far that were all found to tetramerize. The present results therefore represent the first report of a paramyxoviral P protein forming trimers. © 2013 Elsevier Inc. All rights reserved.

  6. Receptor-Targeted Nipah Virus Glycoproteins Improve Cell-Type Selective Gene Delivery and Reveal a Preference for Membrane-Proximal Cell Attachment.

    Directory of Open Access Journals (Sweden)

    Ruben R Bender

    2016-06-01

    Full Text Available Receptor-targeted lentiviral vectors (LVs can be an effective tool for selective transfer of genes into distinct cell types of choice. Moreover, they can be used to determine the molecular properties that cell surface proteins must fulfill to act as receptors for viral glycoproteins. Here we show that LVs pseudotyped with receptor-targeted Nipah virus (NiV glycoproteins effectively enter into cells when they use cell surface proteins as receptors that bring them closely enough to the cell membrane (less than 100 Å distance. Then, they were flexible in receptor usage as demonstrated by successful targeting of EpCAM, CD20, and CD8, and as selective as LVs pseudotyped with receptor-targeted measles virus (MV glycoproteins, the current standard for cell-type specific gene delivery. Remarkably, NiV-LVs could be produced at up to two orders of magnitude higher titers compared to their MV-based counterparts and were at least 10,000-fold less effectively neutralized than MV glycoprotein pseudotyped LVs by pooled human intravenous immunoglobulin. An important finding for NiV-LVs targeted to Her2/neu was an about 100-fold higher gene transfer activity when particles were targeted to membrane-proximal regions as compared to particles binding to a more membrane-distal epitope. Likewise, the low gene transfer activity mediated by NiV-LV particles bound to the membrane distal domains of CD117 or the glutamate receptor subunit 4 (GluA4 was substantially enhanced by reducing receptor size to below 100 Å. Overall, the data suggest that the NiV glycoproteins are optimally suited for cell-type specific gene delivery with LVs and, in addition, for the first time define which parts of a cell surface protein should be targeted to achieve optimal gene transfer rates with receptor-targeted LVs.

  7. The Matrix Protein of Nipah Virus Targets the E3-Ubiquitin Ligase TRIM6 to Inhibit the IKKε Kinase-Mediated Type-I IFN Antiviral Response.

    Directory of Open Access Journals (Sweden)

    Preeti Bharaj

    2016-09-01

    Full Text Available For efficient replication, viruses have developed mechanisms to evade innate immune responses, including the antiviral type-I interferon (IFN-I system. Nipah virus (NiV, a highly pathogenic member of the Paramyxoviridae family (genus Henipavirus, is known to encode for four P gene-derived viral proteins (P/C/W/V with IFN-I antagonist functions. Here we report that NiV matrix protein (NiV-M, which is important for virus assembly and budding, can also inhibit IFN-I responses. IFN-I production requires activation of multiple signaling components including the IκB kinase epsilon (IKKε. We previously showed that the E3-ubiquitin ligase TRIM6 catalyzes the synthesis of unanchored K48-linked polyubiquitin chains, which are not covalently attached to any protein, and activate IKKε for induction of IFN-I mediated antiviral responses. Using co-immunoprecipitation assays and confocal microscopy we show here that the NiV-M protein interacts with TRIM6 and promotes TRIM6 degradation. Consequently, NiV-M expression results in reduced levels of unanchored K48-linked polyubiquitin chains associated with IKKε leading to impaired IKKε oligomerization, IKKε autophosphorylation and reduced IFN-mediated responses. This IFN antagonist function of NiV-M requires a conserved lysine residue (K258 in the bipartite nuclear localization signal that is found in divergent henipaviruses. Consistent with this, the matrix proteins of Ghana, Hendra and Cedar viruses were also able to inhibit IFNβ induction. Live NiV infection, but not a recombinant NiV lacking the M protein, reduced the levels of endogenous TRIM6 protein expression. To our knowledge, matrix proteins of paramyxoviruses have never been reported to be involved in innate immune antagonism. We report here a novel mechanism of viral innate immune evasion by targeting TRIM6, IKKε and unanchored polyubiquitin chains. These findings expand the universe of viral IFN antagonism strategies and provide a new

  8. Nipah and Hendra Virus Nucleoproteins Inhibit Nuclear Accumulation of Signal Transducer and Activator of Transcription 1 (STAT1) and STAT2 by Interfering with Their Complex Formation.

    Science.gov (United States)

    Sugai, Akihiro; Sato, Hiroki; Takayama, Ikuyo; Yoneda, Misako; Kai, Chieko

    2017-11-01

    Henipaviruses, such as Nipah (NiV) and Hendra (HeV) viruses, are highly pathogenic zoonotic agents within the Paramyxoviridae family. The phosphoprotein (P) gene products of the paramyxoviruses have been well characterized for their interferon (IFN) antagonist activity and their contribution to viral pathogenicity. In this study, we demonstrated that the nucleoprotein (N) of henipaviruses also prevents the host IFN signaling response. Reporter assays demonstrated that the NiV and HeV N proteins (NiV-N and HeV-N, respectively) dose-dependently suppressed both type I and type II IFN responses and that the inhibitory effect was mediated by their core domains. Additionally, NiV-N prevented the nuclear transport of signal transducer and activator of transcription 1 (STAT1) and STAT2. However, NiV-N did not associate with Impα5, Impβ1, or Ran, which are members of the nuclear transport system for STATs. Although P protein is known as a binding partner of N protein and actively retains N protein in the cytoplasm, the IFN antagonist activity of N protein was not abolished by the coexpression of P protein. This suggests that the IFN inhibition by N protein occurs in the cytoplasm. Furthermore, we demonstrated that the complex formation of STATs was hampered in the N protein-expressing cells. As a result, STAT nuclear accumulation was reduced, causing a subsequent downregulation of interferon-stimulated genes (ISGs) due to low promoter occupancy by STAT complexes. This novel route for preventing host IFN responses by henipavirus N proteins provides new insight into the pathogenesis of these viruses. IMPORTANCE Paramyxoviruses are well known for suppressing interferon (IFN)-mediated innate immunity with their phosphoprotein (P) gene products, and the henipaviruses also possess P, V, W, and C proteins for evading host antiviral responses. There are numerous studies providing evidence for the relationship between viral pathogenicity and antagonistic activities against IFN

  9. Editing plants for virus resistance using CRISPR-Cas.

    Science.gov (United States)

    Green, J C; Hu, J S

    This minireview summarizes recent advancements using the clustered regularly interspaced palindromic repeats-associated nuclease systems (CRISPR-Cas) derived from prokaryotes to breed plants resistant to DNA and RNA viruses. The CRISPR-Cas system represents a powerful tool able to edit and insert novel traits into plants precisely at chosen loci offering enormous advantages to classical breeding. Approaches to engineering plant virus resistance in both transgenic and non-transgenic plants are discussed. Iterations of the CRISPR-Cas system, FnCas9 and C2c2 capable of editing RNA in eukaryotic cells offer a particular advantage for providing resistance to RNA viruses which represent the great majority of known plant viruses. Scientists have obtained conflicting results using gene silencing technology to produce transgenic plants resistant to geminiviruses. CRISPR-Cas systems engineered in plants to target geminiviruses have consistently reduced virus accumulation providing increased resistance to virus infection. CRISPR-Cas may provide novel and reliable approaches to control geminiviruses and other ssDNA viruses such as Banana bunchy top virus (BBTV).

  10. RNA Editing and its Control in Hepatitis Delta Virus Replication

    Directory of Open Access Journals (Sweden)

    John L. Casey

    2010-01-01

    Full Text Available The hepatitis delta virus genome is a small circular RNA, similar to viroids. Although HDV contains a gene, the protein produced (HDAg is encoded by less than half the genome and possesses no RNA polymerase activity. Because of this limited coding capacity, HDV relies heavily on host functions and on structural features of the viral RNA—very much like viroids. The virus’ use of host RNA editing activity to produce two functionally distinct forms of HDAg is a particularly good example of this reliance. This review covers the mechanisms and control of RNA editing in the HDV replication cycle.

  11. Hendra and Nipah infection: emerging paramyxoviruses.

    Science.gov (United States)

    Aljofan, Mohamad

    2013-11-06

    Since their first emergence in mid 1990s henipaviruses continued to re emerge in Australia and South East Asia almost every year. In total there has been more than 12 Nipah and 48 Hendra virus outbreaks reported in South East Asia and Australia, respectively. These outbreaks are associated with significant economic and health damages that most high risks countries (particularly in South East Asia) cannot bear the burden of such economical threats. Up until recently, there were no actual therapeutics available to treat or prevent these lethal infections. However, an international collaborative research has resulted in the identification of a potential equine Hendra vaccine capable of providing antibody protection against Hendra virus infections. Consequently, with the current findings and after nearly 2 decades since their first detection, are we there yet? This review recaps the chronicle of the henipavirus emergence and briefly evaluates potential anti-henipavirus vaccines and antivirals. Copyright © 2013 Elsevier B.V. All rights reserved.

  12. Efficient reverse genetics reveals genetic determinants of budding and fusogenic differences between Nipah and Hendra viruses and enables real-time monitoring of viral spread in small animal models of henipavirus infection.

    Science.gov (United States)

    Yun, Tatyana; Park, Arnold; Hill, Terence E; Pernet, Olivier; Beaty, Shannon M; Juelich, Terry L; Smith, Jennifer K; Zhang, Lihong; Wang, Yao E; Vigant, Frederic; Gao, Junling; Wu, Ping; Lee, Benhur; Freiberg, Alexander N

    2015-01-15

    Nipah virus (NiV) and Hendra virus (HeV) are closely related henipaviruses of the Paramyxovirinae. Spillover from their fruit bat reservoirs can cause severe disease in humans and livestock. Despite their high sequence similarity, NiV and HeV exhibit apparent differences in receptor and tissue tropism, envelope-mediated fusogenicity, replicative fitness, and other pathophysiologic manifestations. To investigate the molecular basis for these differences, we first established a highly efficient reverse genetics system that increased rescue titers by ≥3 log units, which offset the difficulty of generating multiple recombinants under constraining biosafety level 4 (BSL-4) conditions. We then replaced, singly and in combination, the matrix (M), fusion (F), and attachment glycoprotein (G) genes in mCherry-expressing recombinant NiV (rNiV) with their HeV counterparts. These chimeric but isogenic rNiVs replicated well in primary human endothelial and neuronal cells, indicating efficient heterotypic complementation. The determinants of budding efficiency, fusogenicity, and replicative fitness were dissociable: HeV-M budded more efficiently than NiV-M, accounting for the higher replicative titers of HeV-M-bearing chimeras at early times, while the enhanced fusogenicity of NiV-G-bearing chimeras did not correlate with increased replicative fitness. Furthermore, to facilitate spatiotemporal studies on henipavirus pathogenesis, we generated a firefly luciferase-expressing NiV and monitored virus replication and spread in infected interferon alpha/beta receptor knockout mice via bioluminescence imaging. While intraperitoneal inoculation resulted in neuroinvasion following systemic spread and replication in the respiratory tract, intranasal inoculation resulted in confined spread to regions corresponding to olfactory bulbs and salivary glands before subsequent neuroinvasion. This optimized henipavirus reverse genetics system will facilitate future investigations into the

  13. Hendra and Nipah Infection: Pathology, Models and Potential Therapies

    Science.gov (United States)

    Vigant, Frederic; Lee, Benhur

    2011-01-01

    The Paramyxoviridae family comprises of several genera that contain emerging or re-emerging threats for human and animal health with no real specific effective treatment available. Hendra and Nipah virus are members of a newly identified genus of emerging paramyxoviruses, Henipavirus. Since their discovery in the 1990s, henipaviruses outbreaks have been associated with high economic and public health threat potential. When compared to other paramyxoviruses, henipaviruses appear to have unique characteristics. Henipaviruses are zoonotic paramyxoviruses with a broader tropism than most other paramyxoviruses, and can cause severe acute encephalitis with unique features among viral encephalitides. There are currently no approved effective prophylactic or therapeutic treatments for henipavirus infections. Although ribavirin was empirically used and seemed beneficial during the biggest outbreak caused by one of these viruses, the Nipah virus, its efficacy is disputed in light of its lack of efficacy in several animal models of henipavirus infection. Nevertheless, because of its highly pathogenic nature, much effort has been spent in developing anti-henipavirus therapeutics. In this review we describe the unique features of henipavirus infections and the different strategies and animal models that have been developed so far in order to identify and test potential drugs to prevent or treat henipavirus infections. Some of these components have the potential to be broad-spectrum antivirals as they target effectors of viral pathogenecity common to other viruses. We will focus on small molecules or biologics, rather than vaccine strategies, that have been developed as anti-henipaviral therapeutics. PMID:21488828

  14. CRISPR/Cas9-mediated genome editing of Epstein-Barr virus in human cells.

    Science.gov (United States)

    Yuen, Kit-San; Chan, Chi-Ping; Wong, Nok-Hei Mickey; Ho, Chau-Ha; Ho, Ting-Hin; Lei, Ting; Deng, Wen; Tsao, Sai Wah; Chen, Honglin; Kok, Kin-Hang; Jin, Dong-Yan

    2015-03-01

    The CRISPR (clustered regularly interspaced short palindromic repeats)/Cas9 (CRISPR-associated 9) system is a highly efficient and powerful tool for RNA-guided editing of the cellular genome. Whether CRISPR/Cas9 can also cleave the genome of DNA viruses such as Epstein-Barr virus (EBV), which undergo episomal replication in human cells, remains to be established. Here, we reported on CRISPR/Cas9-mediated editing of the EBV genome in human cells. Two guide RNAs (gRNAs) were used to direct a targeted deletion of 558 bp in the promoter region of BART (BamHI A rightward transcript) which encodes viral microRNAs (miRNAs). Targeted editing was achieved in several human epithelial cell lines latently infected with EBV, including nasopharyngeal carcinoma C666-1 cells. CRISPR/Cas9-mediated editing of the EBV genome was efficient. A recombinant virus with the desired deletion was obtained after puromycin selection of cells expressing Cas9 and gRNAs. No off-target cleavage was found by deep sequencing. The loss of BART miRNA expression and activity was verified, supporting the BART promoter as the major promoter of BART RNA. Although CRISPR/Cas9-mediated editing of the multicopy episome of EBV in infected HEK293 cells was mostly incomplete, viruses could be recovered and introduced into other cells at low m.o.i. Recombinant viruses with an edited genome could be further isolated through single-cell sorting. Finally, a DsRed selectable marker was successfully introduced into the EBV genome during the course of CRISPR/Cas9-mediated editing. Taken together, our work provided not only the first genetic evidence that the BART promoter drives the expression of the BART transcript, but also a new and efficient method for targeted editing of EBV genome in human cells. © 2015 The Authors.

  15. Nipah Encephalitis – A Dangerous Zooanthroponosis Of Indo-Malaysian Region Of South-Еast Asia

    Directory of Open Access Journals (Sweden)

    E. P. Lukin

    2014-01-01

    Full Text Available The review provides information on a new zooanthroponosis – Nipah encephalitis. Characteristics of the pathogen and its ecology and clinic are presented. The purpose of the review is to get Russian specialist acquainted with new dangerous disease unknown in Russia. The research method – analytical. Infection by humans were first described in Malaysia (1999, after in Bangladesh (2004 and India (2006. The causative agent was identified as a new member of paramyxoviruses and then, together with related Hendra virus, separated in a new genus Henipavirus of the family Paramyxoviridae (2000. Reservoir in nature – fruit bats, predominantly carnivorous flying foxes of 8 species of the genus Pteropus, secondary reservoir – domestic pigs. Nipah virus is highly contagious for humans and swine. The last act as amplifying and reservoir host. The disease inhumans is characterized by symptoms and signs of acute encephalitis and pulmonary insufficiency. Rapidly developing coma, lethality – up to 92,0%. Outbreaks with transmission of the virus from person-to-person are known. Specific treatment has not been developed, prevention is nonspecific.

  16. KAJIAN ASPEK TEKNIS DAN FINASIAL USAHA RUMAH TANGGA BRIKET BIOMASSA DARI KULIT NIPAH DENGAN TEMPURUNG KELAPA

    Directory of Open Access Journals (Sweden)

    Martanto Martanto

    2016-04-01

    Full Text Available Nipah merupakan salah satu tanaman  didaerah pasang surut. Di Indonesia terdapat Sekitar tujuh juta hektar (7 Ha  tanaman Nipah. Pemanfaatan kulit nipah  sampai saat ini belum maksimal. Penelitian ini mencoba membuat briket arang dengan campuran arang kelapa. Metode pernelitian ini menggunakan eksperimen untuk pembuatan briket kulit nipah dan metode kuantitatif tehadap nilai ekonomisnya Dari hasil penelitian didapat kadar air 9,2 % ,kadar abu 3,51 % dan kadar zat menguap  2,62 %. Hasil penelitian tersebut layak dan kulaitasnya hampir sama dengan batu bara muda. Dari perhitungan analisa finansial perhitungan NPV, IRR, Payback period  B/C ratio adalah masing-masing menghasilkan nilai masing-masing adalah 8.843.001, 41 %, 3 tahun 7 bulan dan  2,04. Sehingga usaha briket arang dari kulit nipah dengan tempurung kelapa sangat layak untuk dijadikan usaha skala rumah tangga

  17. UJI FITOKIMIA SENYAWA KIMIA AKTIF AKAR NIPAH (Nyfa Fruticans WURMB SEBAGAI TUMBUHAN OBAT DI KALIMANTAN SELATAN

    Directory of Open Access Journals (Sweden)

    Rosidah R Radam

    2017-02-01

    Full Text Available Nipa (Nypa fruticans WURMB classified in Palma family and grow in riptide area. This Research aims to know active Chemical compounds in Nipa root. We Hope that this Research will provide new information about active Chemical compounds in Nipa root, so that we can improve the benefit value of Nipa as One of the medicinal herb. Nipa root samples is taken in Tanah Bumbu District, samples examined in Laboratory of F-MIPA UNLAM. The observed parameters in thus Chemical Test are the active Chemical compounds: alkaloid, steroid, triterpenoid, flavonoid, and tannin. The Content of active Chemical compound is presented in Table and concluded descriptively. The Result of active Chemical compound consist in Nipa’s root shows that Alkaloid, Steroid, Triterpenoid, Flavonoid , and tannin compound is do contains in Nipa root. This active Chemical compound in Nipa root can be Led as the basic Chemical informative to utilize Nipa root as analgesics Medical for such disease. Nipah (nypa fruticans WURMB merupakan tumbuhan yang termasuk famili Palmae dan   tumbuh di daerah  pasang   surut.  Penelitian ini bertujuan untuk mengetahui  kandungan senyawa-senyawa kimia aktif pada akar nipah. Manfaat dari penelitian ini untuk memberikan informasi baru tentang senyawa aktif yang terdapat pada akar nipah, sehingga dapat meningkatkan nilai guna dan manfaat tumbuhan nipah sebagai salah satu tanaman obat. Pengambilan sample akar nipah dilakukan Kabupaten Tanah Bumbu  sedangkan pengujian sample akar nipah dilakukan di Laboratorium F-MIFA UNLAM. Parameter-parameter yang diamati pada pengujian kimia tersebut adalah senyawa-senyawa kimia aktif yaitu alkaloid, steroid, triterpenoid flavonoid, dan tanin. Data hasil uji kandungan senyawa kimia aktif  ditabulasi dan disimpulkan secara diskriptif. Hasil pengujian terhadap senyawa kimia aktif yang terkandung dalam akar Nifah ini menunjukan bahwa senyawa Alkaloid, Steroid, Triterpenoid, Flavonoid , dan tanin memang dikandung

  18. Cedar virus: a novel Henipavirus isolated from Australian bats.

    Directory of Open Access Journals (Sweden)

    Glenn A Marsh

    Full Text Available The genus Henipavirus in the family Paramyxoviridae contains two viruses, Hendra virus (HeV and Nipah virus (NiV for which pteropid bats act as the main natural reservoir. Each virus also causes serious and commonly lethal infection of people as well as various species of domestic animals, however little is known about the associated mechanisms of pathogenesis. Here, we report the isolation and characterization of a new paramyxovirus from pteropid bats, Cedar virus (CedPV, which shares significant features with the known henipaviruses. The genome size (18,162 nt and organization of CedPV is very similar to that of HeV and NiV; its nucleocapsid protein displays antigenic cross-reactivity with henipaviruses; and it uses the same receptor molecule (ephrin-B2 for entry during infection. Preliminary challenge studies with CedPV in ferrets and guinea pigs, both susceptible to infection and disease with known henipaviruses, confirmed virus replication and production of neutralizing antibodies although clinical disease was not observed. In this context, it is interesting to note that the major genetic difference between CedPV and HeV or NiV lies within the coding strategy of the P gene, which is known to play an important role in evading the host innate immune system. Unlike HeV, NiV, and almost all known paramyxoviruses, the CedPV P gene lacks both RNA editing and also the coding capacity for the highly conserved V protein. Preliminary study indicated that CedPV infection of human cells induces a more robust IFN-β response than HeV.

  19. Comparison of in vivo toxicity, antioxidant and immunomodulatory activities of coconut, nipah and pineapple juice vinegars.

    Science.gov (United States)

    Mohamad, Nurul Elyani; Keong Yeap, Swee; Beh, Boon Keen; Romli, Muhammad Firdaus; Yusof, Hamidah Mohd; Kristeen-Teo, Ye Wen; Sharifuddin, Shaiful Adzni; Long, Kamariah; Alitheen, Noorjahan Banu

    2018-01-01

    Vinegar is widely used as a food additive, in food preparation and as a food supplement. This study compared the phenolic acid profiles and in vivo toxicities, and antioxidant and immunomodulatory effects of coconut, nipah and pineapple juice vinegars, which were respectively prepared via a two-step fermentation using Saccharomyces cerevisiae 7013 INRA and Acetobacter aceti vat Europeans. Pineapple juice vinegar, which had the highest total phenolic acid content, also exhibited the greatest in vitro antioxidant capacity compared to coconut juice and nipah juice vinegars. Following acute and sub-chronic in vivo toxicity evaluation, no toxicity and mortality were evident and there were no significant differences in the serum biochemical profiles between mice administered the vinegars versus the control group. In the sub-chronic toxicity evaluation, the highest liver antioxidant levels were found in mice fed with pineapple juice vinegar, followed by coconut juice and nipah juice vinegars. However, compared to the pineapple juice and nipah juice vinegars, the mice fed with coconut juice vinegar, exhibited a higher population of CD4 + and CD8 + T-lymphocytes in the spleen, which was associated with greater levels of serum interleukin-2 and interferon-γ cytokines. Overall, the data suggested that not all vinegar samples cause acute and sub-chronic toxicity in vivo. Moreover, the in vivo immunity and organ antioxidant levels were enhanced, to varying extents, by the phenolic acids present in the vinegars. The results obtained in this study provide appropriate guidelines for further in vivo bioactivity studies and pre-clinical assessments of vinegar consumption. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.

  20. Ebola Virus Infections in Nonhuman Primates Are Temporally Influenced by Glycoprotein Poly-U Editing Site Populations in the Exposure Material

    Directory of Open Access Journals (Sweden)

    John C. Trefry

    2015-12-01

    Full Text Available Recent experimentation with the variants of the Ebola virus that differ in the glycoprotein’s poly-uridine site, which dictates the form of glycoprotein produced through a transcriptional stutter, has resulted in questions regarding the pathogenicity and lethality of the stocks used to develop products currently undergoing human clinical trials to combat the disease. In order to address these concerns and prevent the delay of these critical research programs, we designed an experiment that permitted us to intramuscularly challenge statistically significant numbers of naïve and vaccinated cynomolgus macaques with either a 7U or 8U variant of the Ebola virus, Kikwit isolate. In naïve animals, no difference in survivorship was observed; however, there was a significant delay in the disease course between the two groups. Significant differences were also observed in time-of-fever, serum chemistry, and hematology. In vaccinated animals, there was no statistical difference in survivorship between either challenge groups, with two succumbing in the 7U group compared to 1 in the 8U challenge group. In summary, survivorship was not affected, but the Ebola virus disease course in nonhuman primates is temporally influenced by glycoprotein poly-U editing site populations.

  1. Resource Manual for Handling Body Fluids in the School Setting To Prevent Transmission of Human Immunodeficiency Virus and Hepatitis B Virus. Revised Edition.

    Science.gov (United States)

    Maryland State Dept. of Health and Mental Hygiene, Baltimore.

    This Maryland resource manual provides local education agencies with guidelines on how to handle body fluids to prevent the transmission of diseases, especially Human Immunodeficiency Virus (HIV) and Hepatitis B Virus (HBV), in the school setting. The first section summarizes the reasons for development of the manual. The second section summarizes…

  2. Emerging Foodborne and Agriculture-Related Viruses.

    Science.gov (United States)

    Kingsley, David H

    2016-08-01

    Viruses rapidly evolve and can emerge in unpredictable ways. Transmission pathways by which foodborne viruses may enter human populations and evolutionary mechanisms by which viruses can become virulent are discussed in this chapter. A majority of viruses emerge from zoonotic animal reservoirs, often by adapting and infecting intermediate hosts, such as domestic animals and livestock. Viruses that are known foodborne threats include hepatitis E virus, tick-borne encephalitis virus, enteroviruses, adenovirus, and astroviruses, among others. Viruses may potentially evolve and emerge as a result of modern agricultural practices which can concentrate livestock and bring them into contact with wild animals. Examples of viruses that have emerged in this manner are influenza, coronaviruses such as severe acute respiratory syndrome and Middle East respiratory syndrome, and the Nipah virus. The role of bats, bush meat, rodents, pigs, cattle, and poultry as reservoirs from which infectious pathogenic viruses emerge are discussed.

  3. Rapid Screening for Entry Inhibitors of Highly Pathogenic Viruses under Low-Level Biocontainment

    Science.gov (United States)

    Talekar, Aparna; Pessi, Antonello; Glickman, Fraser; Sengupta, Uttara; Briese, Thomas; Whitt, Michael A.; Mathieu, Cyrille; Horvat, Branka; Moscona, Anne; Porotto, Matteo

    2012-01-01

    Emerging viruses including Nipah, Hendra, Lujo, and Junin viruses have enormous potential to spread rapidly. Nipah virus, after emerging as a zoonosis, has also evolved the capacity for human-to-human transmission. Most of the diseases caused by these pathogens are untreatable and require high biocontainment conditions. Universal methods for rapidly identifying and screening candidate antivirals are urgently needed. We have developed a modular antiviral platform strategy that relies on simple bioinformatic and genetic information about each pathogen. Central to this platform is the use of envelope glycoprotein cDNAs to establish multi-cycle replication systems under BSL2 conditions for viral pathogens that normally require BSL3 and BSL4 facilities. We generated monoclonal antibodies against Nipah G by cDNA immunization in rats, and we showed that these antibodies neutralize both Nipah and Hendra live viruses. We then used these effective Henipavirus inhibitors to validate our screening strategy. Our proposed strategy should contribute to the response capability for emerging infectious diseases, providing a way to initiate antiviral development immediately upon identifying novel viruses. PMID:22396728

  4. Rapid screening for entry inhibitors of highly pathogenic viruses under low-level biocontainment.

    Directory of Open Access Journals (Sweden)

    Aparna Talekar

    Full Text Available Emerging viruses including Nipah, Hendra, Lujo, and Junin viruses have enormous potential to spread rapidly. Nipah virus, after emerging as a zoonosis, has also evolved the capacity for human-to-human transmission. Most of the diseases caused by these pathogens are untreatable and require high biocontainment conditions. Universal methods for rapidly identifying and screening candidate antivirals are urgently needed. We have developed a modular antiviral platform strategy that relies on simple bioinformatic and genetic information about each pathogen. Central to this platform is the use of envelope glycoprotein cDNAs to establish multi-cycle replication systems under BSL2 conditions for viral pathogens that normally require BSL3 and BSL4 facilities. We generated monoclonal antibodies against Nipah G by cDNA immunization in rats, and we showed that these antibodies neutralize both Nipah and Hendra live viruses. We then used these effective Henipavirus inhibitors to validate our screening strategy. Our proposed strategy should contribute to the response capability for emerging infectious diseases, providing a way to initiate antiviral development immediately upon identifying novel viruses.

  5. Precise gene editing of chicken Na+/H+ exchange type 1 (chNHE1) confers resistance to avian leukosis virus subgroup J (ALV-J).

    Science.gov (United States)

    Lee, Hong Jo; Lee, Kyung Youn; Jung, Kyung Min; Park, Kyung Je; Lee, Ko On; Suh, Jeong-Yong; Yao, Yongxiu; Nair, Venugopal; Han, Jae Yong

    2017-12-01

    Avian leukosis virus subgroup J (ALV-J), first isolated in the late 1980s, has caused economic losses to the poultry industry in many countries. As all chicken lines studied to date are susceptible to ALV infection, there is enormous interest in developing resistant chicken lines. The ALV-J receptor, chicken Na + /H + exchange 1 (chNHE1) and the critical amino acid sequences involved in viral attachment and entry have already been characterized. However, there are no reported attempts to induce resistance to the virus by targeted genome modification of the receptor sequences. In an attempt to induce resistance to ALV-J infection, we used clustered regularly interspaced short palindromic repeats (CRISPR)-associated (CRISPR/Cas9)-based genome editing approaches to modify critical residues of the chNHE1 receptor in chicken cells. The susceptibility of the modified cell lines to ALV-J infection was examined using enhanced green fluorescent protein (EGFP)-expressing marker viruses. We showed that modifying the chNHE1 receptor by artificially generating a premature stop codon induced absolute resistance to viral infection, with mutations of the tryptophan residue at position 38 (Trp38) being very critical. Single-stranded oligodeoxynucleotide (ssODN)-mediated targeted recombination of the Trp38 region revealed that deletions involving the Trp38 residue were most effective in conferring resistance to ALV-J. Moreover, protein structure analysis of the chNHE1 receptor sequence suggested that its intrinsically disordered region undergoes local conformational changes through genetic alteration. Collectively, these results demonstrate that targeted mutations on chNHE1 alter the susceptibility to ALV-J and the technique is expected to contribute to develop disease-resistant chicken lines. Copyright © 2017 Elsevier Ltd. All rights reserved.

  6. Bat flight and zoonotic viruses

    Science.gov (United States)

    O'Shea, Thomas J.; Cryan, Paul M.; Cunningham, Andrew A.; Fooks, Anthony R.; Hayman, David T.S.; Luis, Angela D.; Peel, Alison J.; Plowright, Raina K.; Wood, James L.N.

    2014-01-01

    Bats are sources of high viral diversity and high-profile zoonotic viruses worldwide. Although apparently not pathogenic in their reservoir hosts, some viruses from bats severely affect other mammals, including humans. Examples include severe acute respiratory syndrome coronaviruses, Ebola and Marburg viruses, and Nipah and Hendra viruses. Factors underlying high viral diversity in bats are the subject of speculation. We hypothesize that flight, a factor common to all bats but to no other mammals, provides an intensive selective force for coexistence with viral parasites through a daily cycle that elevates metabolism and body temperature analogous to the febrile response in other mammals. On an evolutionary scale, this host–virus interaction might have resulted in the large diversity of zoonotic viruses in bats, possibly through bat viruses adapting to be more tolerant of the fever response and less virulent to their natural hosts.

  7. Pea early-browning virus -mediated genome editing via the CRISPR/Cas9 system in Nicotiana benthamiana and Arabidopsis

    KAUST Repository

    Ali, Zahir

    2017-10-17

    The clustered regularly interspaced palindromic repeats (CRISPR)/CRISPR-associated (Cas9) system has enabled efficient genome engineering in diverse plant species. However, delivery of genome engineering reagents, such as the single guide RNA (sgRNA), into plant cells remains challenging. Here, we report the engineering of Tobacco rattle virus (TRV) and Pea early browning virus (PEBV) to deliver one or multiple sgRNAs into Nicotiana benthamiana and Arabidopsis thaliana (Col-0) plants that overexpress a nuclear localization signal containing Cas9. Our data showed that TRV and PEBV can deliver sgRNAs into inoculated and systemic leaves, and this resulted in mutagenesis of the targeted genomic loci. Moreover, in N. benthamiana, PEBV-based sgRNA delivery resulted in more targeted mutations than TRV-based delivery. Our data indicate that TRV and PEBV can facilitate plant genome engineering and can be used to produce targeted mutations for functional analysis and other biotechnological applications across diverse plant species.Key message: Delivery of genome engineering reagents into plant cells is challenging and inefficient and this limit the applications of this technology in many plant species. RNA viruses such as TRV and PEBV provide an efficient tool to systemically deliver sgRNAs for targeted genome modification.

  8. genome editing

    Indian Academy of Sciences (India)

    2016-02-11

    Feb 11, 2016 ... terms in molecular biology, but I have the premonition that we are living a similar event, with identically dra- ... meaning of 'editing' occurred in the French language and in biology. In both cases, computers played ..... Tiegs SL, Russell DM and Nemazee D 1993 Receptor editing in self-reactive bone marrow.

  9. Host cell recognition by the henipaviruses: Crystal structures of the Nipah G attachment glycoprotein and its complex with ephrin-B3

    Energy Technology Data Exchange (ETDEWEB)

    Xu, Kai; Rajashankar, Kanagalaghatta R.; Chan, Yee-Peng; Himanen, Juha P.; Broder, Christopher C.; Nikolov, Dimitar B. (USUHS); (Cornell); (MSKCC)

    2008-07-28

    Nipah virus (NiV) and Hendra virus are the type species of the highly pathogenic paramyxovirus genus Henipavirus, which can cause severe respiratory disease and fatal encephalitis infections in humans, with case fatality rates approaching 75%. NiV contains two envelope glycoproteins, the receptor-binding G glycoprotein (NiV-G) that facilitates attachment to host cells and the fusion (F) glycoprotein that mediates membrane merger. The henipavirus G glycoproteins lack both hemagglutinating and neuraminidase activities and, instead, engage the highly conserved ephrin-B2 and ephrin-B3 cell surface proteins as their entry receptors. Here, we report the crystal structures of the NiV-G both in its receptor-unbound state and in complex with ephrin-B3, providing, to our knowledge, the first view of a paramyxovirus attachment complex in which a cellular protein is used as the virus receptor. Complex formation generates an extensive protein-protein interface around a protruding ephrin loop, which is inserted in the central cavity of the NiV-G {beta}-propeller. Analysis of the structural data reveals the molecular basis for the highly specific interactions of the henipavirus G glycoproteins with only two members (ephrin-B2 and ephrin-B3) of the very large ephrin family and suggests how they mediate in a unique fashion both cell attachment and the initiation of membrane fusion during the virus infection processes. The structures further suggest that the NiV-G/ephrin interactions can be effectively targeted to disrupt viral entry and provide the foundation for structure-based antiviral drug design.

  10. The Central Role of the Matrix Protein in Nipah Virus Assembly and Morphogenesis

    Science.gov (United States)

    2007-03-23

    attention paid to the cytoplasmic domains of these proteins. Co-localization of M and at least one envelope glycoprotein has been observed for SeV (111...from pCP630 (NiV M gene in pFastBac HTa ) using primers 5’- GTTTAAACCACCATGGAGCCGGACATC (NIVMS) and 5’- GTTTAAACTTAGCCCTTTAGAATTCTC (NIVMAS). The NiV...lipid rafts in assembly has received the most attention for MeV. The measles F and H glycoproteins associate with lipid rafts in the trans-Golgi

  11. Cluster editing

    DEFF Research Database (Denmark)

    Böcker, S.; Baumbach, Jan

    2013-01-01

    . The problem has been the inspiration for numerous algorithms in bioinformatics, aiming at clustering entities such as genes, proteins, phenotypes, or patients. In this paper, we review exact and heuristic methods that have been proposed for the Cluster Editing problem, and also applications...

  12. genome editing

    Indian Academy of Sciences (India)

    2016-02-11

    Feb 11, 2016 ... What history tells us. XL. The success story of the expression 'genome editing'. MICHEL MORANGE. Centre Cavaillès, République des Savoirs: Lettres, Sciences, Philosophie USR 3608, Ecole. Normale Supérieure, 29 Rue d'Ulm, 75230, Paris Cedex 05, France. (Fax, 33-144-323941; Email, ...

  13. Comparison of Shear Strength Properties for Undisturbed and Reconstituted Parit Nipah Peat, Johor

    Science.gov (United States)

    Azhar, A. T. S.; Norhaliza, W.; Ismail, B.; Abdullah, M. E.; Zakaria, M. N.

    2016-11-01

    Shear strength of soil is required to determine the soil stability and design the foundations. Peat is known as a soil with complex natural formations which also contributes problems to the researchers, developers, engineers and contractors in constructions and infrastructures. Most researchers conducted experiment and investigation of shear strength on peat using shear box test and simple shear test, but only a few had discovered the behavior of peat using triaxial consolidated undrained test. The aim of this paper is to determine the undrained shear strength properties of reconstituted peat and undisturbed peat of Parit Nipah, Johor for comparison purposes. All the reconstituted peat samples were formed with the size that passed opening sieve 3.35 mm and preconsolidation pressure at 100 kPa. The result of undrained shear strength of reconstituted peat was 21kPa for cohesion with the angle of friction, 41° compare to the undisturbed peat with cohesion 10 kPa and angle of friction, 16°. The undrained shear strength properties result obtained shows that the reconstituted peat has higher strength than undisturbed peat. For relationship deviator stress-strain, σd max and excess pore pressure, Δu, it shows that both of undisturbed and reconstituted gradually increased when σ’ increased, but at the end of the test, the values are slightly dropped. The physical properties of undisturbed and reconstituted peat were also investigated to correlate with the undrained shear strength results.

  14. Pengaruh Konsentrasi Asam Sitrat dan Suhu Pengempaan terhadap Kualitas Papan Partikel Pelepah Nipah

    Directory of Open Access Journals (Sweden)

    Ragil Widyorini

    2014-01-01

    Full Text Available Papan partikel tanpa perekat sintesis atau binderlessboard merupakan alternatif produk ramah lingkungan yang potensial dikembangkan di Indonesia. Kelemahan produk tersebut diantaranya adalah kestabilan dimensinya yang relatif rendah. Alternatif perbaikan produk bisa dilakukan dengan menambahkan bahan pengaktif komponen kimia. Asam sitrat memiliki tiga gugus karboksil dan diharapkan dapat membentuk ikatan ester dengan gugus hidroksil pada permukaan kayu. Penelitian menggunakan asam sitrat relatif baru dan belum banyak dikembangkan, oleh karena itu penelitian ini ditujukan untuk pengembangan produk biokomposit dengan menggunakan asam sitrat sebagai bahan pengikat. Bahan yang digunakan adalah pelepah nipah dengan ukuran partikel (halus dan kasar, konsentrasi asam sitrat (0% dan 10%, dan suhu pengempaan (180ºC dan 200°C. Pengujian sifat fisika dan mekanika dilakukan berdasarkan Japanese Industrial Standard untuk papan partikel (JIS A 5908. Penambahan asam sitrat memperlihatkan kenaikan sifat fisika (penyerapan air dan mekanika papan partikel. Perbedaan ukuran partikel mempengaruhi sifat mekanika papan partikel dimana ukuran partikel kasar memberikan nilai mekanika yang lebih baik dibandingkan dengan ukuran partikel halus. Kualitas papan partikel optimum diperoleh pada kondisi pengempaan 180ºC, penambahan asam sitrat 10% dari partikel ukuran kasar dengan nilai pengembangan tebal 2,4%, penyerapan air 41%, kekuatan rekat internal 0,2 MPa, modulus patah 5,5 MPa, dan modulus elastisitas 1,6 GPa. Kata kunci: asam sitrat, pelepah nipah, konsentrasi asam sitrat, suhu pengempa   Effect of Citric Acid Concentration and Pressing Temperature on the Quality of Particleboard from Nypa Frond Abstract Binderlessboard is one of the potential eco friendly products that can be developed in Indonesia. However, its boards usually have low in dimensional stability. Addition of the chemical agent, such as citric acid, that can improve the dimensional stability is

  15. Antioxidant and Atibacterial Activities of Nipah (Nypa fruticans against Vibrio sp. Isolated From Mud Crab (Scylla sp.

    Directory of Open Access Journals (Sweden)

    Imra Imra

    2016-12-01

    Full Text Available Nipah (Nypa fruticans is the potential plant for source of active compound such as antioksidant and antibacterial substances. The plants are dispersed in Sumatera, Kalimantan, Sulawesi, Maluku and Papua Island. The aim of this research were determine the antioxidant and antibacterial activity from of nipah (fruit and leaf that it extraction with methanol, and than determine toxicity and active compound contained in this extract. Diffusion agar and DPPH method were use for antibacterial and antioxsidant assay, respectively. Antioxsidant activity from nipah’s leaf extract was more effective (22,5 µg/mL than nipah’s fruit extract (415 µg/mL. This activity to be classified to the strong antioxidant activity (IC50<50 µg/mL. The antibacterial activity from leaf extract was strong to inhibited Vibrio sp. with inhibition zone 8,75 mm. The crude extract of nipah’s leaf was toxic with toxicity value is 663,598 µg/mL. Flavonoids, steroids, tanin, saponin and phenol hidroquinon were the active compounds contained in the extract of nipah’s leaf.

  16. Antioxidant and Atibacterial Activities of Nipah (Nypa fruticans against Vibrio sp. Isolated From Mud Crab (Scylla sp.

    Directory of Open Access Journals (Sweden)

    Imra Imra

    2017-02-01

    Full Text Available AbstractNipah (Nypa fruticans is the potential plant for source of active compound such as antioksidant and antibacterial substances. The plants are dispersed in Sumatera, Kalimantan, Sulawesi, Maluku and Papua Island. The aim of this research were determine the antioxidant and antibacterial activity from of nipah (fruit and leaf that it extraction with methanol, and than determine toxicity and active compound contained in this extract. Diffusion agar and DPPH method were use for antibacterial and antioxsidant assay, respectively. Antioxsidant activity from nipah’s leaf extract was more effective (22,5 μg/mL than nipah’s fruit extract (415 μg/mL. This activity to be classified to the strong antioxidant activity (IC50<50 μg/mL. The antibacterial activity from leaf extract was strong to inhibited Vibrio sp. with inhibition zone 8,75 mm. The crude extract of nipah’s leaf was toxic with toxicity value is 663,598 μg/mL. Flavonoids, steroids, tanin, saponin and phenol hidroquinon were the active compounds contained in the extract of nipah’s leaf.

  17. Ecological dynamics of emerging bat virus spillover

    Science.gov (United States)

    Plowright, Raina K.; Eby, Peggy; Hudson, Peter J.; Smith, Ina L.; Westcott, David; Bryden, Wayne L.; Middleton, Deborah; Reid, Peter A.; McFarlane, Rosemary A.; Martin, Gerardo; Tabor, Gary M.; Skerratt, Lee F.; Anderson, Dale L.; Crameri, Gary; Quammen, David; Jordan, David; Freeman, Paul; Wang, Lin-Fa; Epstein, Jonathan H.; Marsh, Glenn A.; Kung, Nina Y.; McCallum, Hamish

    2015-01-01

    Viruses that originate in bats may be the most notorious emerging zoonoses that spill over from wildlife into domestic animals and humans. Understanding how these infections filter through ecological systems to cause disease in humans is of profound importance to public health. Transmission of viruses from bats to humans requires a hierarchy of enabling conditions that connect the distribution of reservoir hosts, viral infection within these hosts, and exposure and susceptibility of recipient hosts. For many emerging bat viruses, spillover also requires viral shedding from bats, and survival of the virus in the environment. Focusing on Hendra virus, but also addressing Nipah virus, Ebola virus, Marburg virus and coronaviruses, we delineate this cross-species spillover dynamic from the within-host processes that drive virus excretion to land-use changes that increase interaction among species. We describe how land-use changes may affect co-occurrence and contact between bats and recipient hosts. Two hypotheses may explain temporal and spatial pulses of virus shedding in bat populations: episodic shedding from persistently infected bats or transient epidemics that occur as virus is transmitted among bat populations. Management of livestock also may affect the probability of exposure and disease. Interventions to decrease the probability of virus spillover can be implemented at multiple levels from targeting the reservoir host to managing recipient host exposure and susceptibility. PMID:25392474

  18. Basic Wiring. Third Edition. Teacher Edition [and] Student Edition.

    Science.gov (United States)

    Kaltwasser, Stan; Flowers, Gary; Blasingame, Don; Batson, Larry; Ipock, Dan; Carroll, Charles; Friesen, Wade; Fleming, Glenn

    This publication contains both a teacher edition and a student edition of materials for a foundation course in an electrical wiring program. The course introduces basic concepts and skills that are prerequisites to residential wiring and commercial and industrial wiring courses. The contents of the materials are tied to measurable and observable…

  19. Diesel Technology: Introduction. Teacher Edition [and] Student Edition. Second Edition.

    Science.gov (United States)

    Joerschke, John D.; Eichhorn, Lane

    This complete teacher edition of a diesel technology course consists of introductory pages, teacher pages, and the student edition. The introductory pages provide these tools: training and competency profile; National Automotive Technicians Education Foundation Crosswalk; instructional/task analysis; basic skills icons and classifications; basic…

  20. Wikipedia editing dynamics

    Science.gov (United States)

    Gandica, Y.; Carvalho, J.; Sampaio dos Aidos, F.

    2015-01-01

    A model for the probabilistic function followed in editing Wikipedia is presented and compared with simulations and real data. It is argued that the probability of editing is proportional to the editor's number of previous edits (preferential attachment), to the editor's fitness, and to an aging factor. Using these simple ingredients, it is possible to reproduce the results obtained for Wikipedia editing dynamics for a collection of single pages as well as the averaged results. Using a stochastic process framework, a recursive equation was obtained for the average of the number of edits per editor that seems to describe the editing behavior in Wikipedia.

  1. Genetically edited pigs lacking CD163 show no resistance following infection with the African swine fever virus isolate, Georgia 2007/1.

    Science.gov (United States)

    Popescu, Luca; Gaudreault, Natasha N; Whitworth, Kristen M; Murgia, Maria V; Nietfeld, Jerome C; Mileham, Alan; Samuel, Melissa; Wells, Kevin D; Prather, Randall S; Rowland, Raymond R R

    2017-01-15

    African swine fever is a highly contagious, often fatal disease of swine for which there is no vaccine or other curative treatment. The macrophage marker, CD163, is a putative receptor for African swine fever virus (ASFV). Pigs possessing a complete knockout of CD163 on macrophages were inoculated with Georgia 2007/1, a genotype 2 isolate. Knockout and wild type pen mates became infected and showed no differences in clinical signs, mortality, pathology or viremia. There was also no difference following in vitro infection of macrophages. The results do not rule out the possibility that other ASFV strains utilize CD163, but demonstrate that CD163 is not necessary for infection with the Georgia 2007/1 isolate. This work rules out a significant role for CD163 in ASFV infection and creates opportunities to focus on alternative receptors and entry mechanisms. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

  2. Multiplex editing system

    DEFF Research Database (Denmark)

    2015-01-01

    The present invention relates to a multiplex editing system. The system allows multiple editing of nucleic acid sequences such as genomic sequences, such as knockins of genes of interest in a genome, knockouts of genomic sequences and/or allele replacement. Also provided herein are a method...

  3. Generation of novel resistance genes using mutation and targeted gene editing

    Science.gov (United States)

    Classical breeding for virus resistance is a lengthy process and is restricted by the availability of resistance genes. Precise genome editing is a "dream technology" to improve plants for virus resistance and these tools have opened new and very promising ways to generate virus resistant plants by ...

  4. European Bats as Carriers of Viruses with Zoonotic Potential

    Directory of Open Access Journals (Sweden)

    Claudia Kohl

    2014-08-01

    Full Text Available Bats are being increasingly recognized as reservoir hosts of highly pathogenic and zoonotic emerging viruses (Marburg virus, Nipah virus, Hendra virus, Rabies virus, and coronaviruses. While numerous studies have focused on the mentioned highly human-pathogenic bat viruses in tropical regions, little is known on similar human-pathogenic viruses that may be present in European bats. Although novel viruses are being detected, their zoonotic potential remains unclear unless further studies are conducted. At present, it is assumed that the risk posed by bats to the general public is rather low. In this review, selected viruses detected and isolated in Europe are discussed from our point of view in regard to their human-pathogenic potential. All European bat species and their roosts are legally protected and some European species are even endangered. Nevertheless, the increasing public fear of bats and their viruses is an obstacle to their protection. Educating the public regarding bat lyssaviruses might result in reduced threats to both the public and the bats.

  5. European bats as carriers of viruses with zoonotic potential.

    Science.gov (United States)

    Kohl, Claudia; Kurth, Andreas

    2014-08-13

    Bats are being increasingly recognized as reservoir hosts of highly pathogenic and zoonotic emerging viruses (Marburg virus, Nipah virus, Hendra virus, Rabies virus, and coronaviruses). While numerous studies have focused on the mentioned highly human-pathogenic bat viruses in tropical regions, little is known on similar human-pathogenic viruses that may be present in European bats. Although novel viruses are being detected, their zoonotic potential remains unclear unless further studies are conducted. At present, it is assumed that the risk posed by bats to the general public is rather low. In this review, selected viruses detected and isolated in Europe are discussed from our point of view in regard to their human-pathogenic potential. All European bat species and their roosts are legally protected and some European species are even endangered. Nevertheless, the increasing public fear of bats and their viruses is an obstacle to their protection. Educating the public regarding bat lyssaviruses might result in reduced threats to both the public and the bats.

  6. CRISPR Genome Editing

    Science.gov (United States)

    A research article about a technique for gene editing known as CRISPR-Cas9. The technique has made it much easier and faster for cancer researchers to study mutations and test new therapeutic targets.

  7. The genome editing revolution

    DEFF Research Database (Denmark)

    Stella, Stefano; Montoya, Guillermo

    2016-01-01

    -Cas system has become the main tool for genome editing in many laboratories. Currently the targeted genome editing technology has been used in many fields and may be a possible approach for human gene therapy. Furthermore, it can also be used to modifying the genomes of model organisms for studying human......In the last 10 years, we have witnessed a blooming of targeted genome editing systems and applications. The area was revolutionized by the discovery and characterization of the transcription activator-like effector proteins, which are easier to engineer to target new DNA sequences than...... sequence). This ribonucleoprotein complex protects bacteria from invading DNAs, and it was adapted to be used in genome editing. The CRISPR ribonucleic acid (RNA) molecule guides to the specific DNA site the Cas9 nuclease to cleave the DNA target. Two years and more than 1000 publications later, the CRISPR...

  8. Immunology of Bats and Their Viruses: Challenges and Opportunities

    Science.gov (United States)

    Schountz, Tony

    2014-01-01

    Bats are reservoir hosts of several high-impact viruses that cause significant human diseases, including Nipah virus, Marburg virus and rabies virus. They also harbor many other viruses that are thought to have caused disease in humans after spillover into intermediate hosts, including SARS and MERS coronaviruses. As is usual with reservoir hosts, these viruses apparently cause little or no pathology in bats. Despite the importance of bats as reservoir hosts of zoonotic and potentially zoonotic agents, virtually nothing is known about the host/virus relationships; principally because few colonies of bats are available for experimental infections, a lack of reagents, methods and expertise for studying bat antiviral responses and immunology, and the difficulty of conducting meaningful field work. These challenges can be addressed, in part, with new technologies that are species-independent that can provide insight into the interactions of bats and viruses, which should clarify how the viruses persist in nature, and what risk factors might facilitate transmission to humans and livestock. PMID:25494448

  9. Immunology of Bats and Their Viruses: Challenges and Opportunities

    Directory of Open Access Journals (Sweden)

    Tony Schountz

    2014-12-01

    Full Text Available Bats are reservoir hosts of several high-impact viruses that cause significant human diseases, including Nipah virus, Marburg virus and rabies virus. They also harbor many other viruses that are thought to have caused disease in humans after spillover into intermediate hosts, including SARS and MERS coronaviruses. As is usual with reservoir hosts, these viruses apparently cause little or no pathology in bats. Despite the importance of bats as reservoir hosts of zoonotic and potentially zoonotic agents, virtually nothing is known about the host/virus relationships; principally because few colonies of bats are available for experimental infections, a lack of reagents, methods and expertise for studying bat antiviral responses and immunology, and the difficulty of conducting meaningful field work. These challenges can be addressed, in part, with new technologies that are species-independent that can provide insight into the interactions of bats and viruses, which should clarify how the viruses persist in nature, and what risk factors might facilitate transmission to humans and livestock.

  10. Immunology of bats and their viruses: challenges and opportunities.

    Science.gov (United States)

    Schountz, Tony

    2014-12-01

    Bats are reservoir hosts of several high-impact viruses that cause significant human diseases, including Nipah virus, Marburg virus and rabies virus. They also harbor many other viruses that are thought to have caused disease in humans after spillover into intermediate hosts, including SARS and MERS coronaviruses. As is usual with reservoir hosts, these viruses apparently cause little or no pathology in bats. Despite the importance of bats as reservoir hosts of zoonotic and potentially zoonotic agents, virtually nothing is known about the host/virus relationships; principally because few colonies of bats are available for experimental infections, a lack of reagents, methods and expertise for studying bat antiviral responses and immunology, and the difficulty of conducting meaningful field work. These challenges can be addressed, in part, with new technologies that are species-independent that can provide insight into the interactions of bats and viruses, which should clarify how the viruses persist in nature, and what risk factors might facilitate transmission to humans and livestock.

  11. Neurosurgery. Fourth edition

    International Nuclear Information System (INIS)

    Simon, L.; Thomas, D.G.T.; Clark, W.K.

    1987-01-01

    The Fourth Edition of this volume in the Operative Surgery Series has been considerably revised to accommodate the many changes which have changed the practice of neurosurgery in the past eight years. There have been advances in technology, such as the wider application of CT scanning, in surgical technique, and in the design of new implantable materials. All these developments have substantially affected both the practice of neurosurgery and the prognosis for the patient and are fully reflected in the new edition

  12. Human Germline Genome Editing

    OpenAIRE

    Ormond, Kelly E.; Mortlock, Douglas P.; Scholes, Derek T.; Bombard, Yvonne; Brody, Lawrence C.; Faucett, W. Andrew; Garrison, Nanibaa’ A.; Hercher, Laura; Isasi, Rosario; Middleton, Anna; Musunuru, Kiran; Shriner, Daniel; Virani, Alice; Young, Caroline E.

    2017-01-01

    With CRISPR/Cas9 and other genome-editing technologies, successful somatic and germline genome editing are becoming feasible. To respond, an American Society of Human Genetics (ASHG) workgroup developed this position statement, which was approved by the ASHG Board in March 2017. The workgroup included representatives from the UK Association of Genetic Nurses and Counsellors, Canadian Association of Genetic Counsellors, International Genetic Epidemiology Society, and US National Society of Gen...

  13. Decimal Classification Editions

    Directory of Open Access Journals (Sweden)

    Zenovia Niculescu

    2009-01-01

    Full Text Available The study approaches the evolution of Dewey Decimal Classification editions from the perspective of updating the terminology, reallocating and expanding the main and auxilary structure of Dewey indexing language. The comparative analysis of DDC editions emphasizes the efficiency of Dewey scheme from the point of view of improving the informational offer, through basic index terms, revised and developed, as well as valuing the auxilary notations.

  14. Developing new levels of edit

    Energy Technology Data Exchange (ETDEWEB)

    Prono, J.K.

    1997-06-01

    Since 1985, Los Alamos National Laboratory (LANL) staff have had four levels of edit to choose from for technical reports. When a CQI survey showed that both authors and editors felt the levels were not meeting author needs, LANL set about revising them. The goals were to simplify the editing process, focus editing on improving technical clarity, and ensure value added in editing. This paper describes the revision process and product--three author-based levels of edit.

  15. Synthetic protocells interact with viral nanomachinery and inactivate pathogenic human virus.

    Directory of Open Access Journals (Sweden)

    Matteo Porotto

    Full Text Available We present a new antiviral strategy and research tool that could be applied to a wide range of enveloped viruses that infect human beings via membrane fusion. We test this strategy on two emerging zoonotic henipaviruses that cause fatal encephalitis in humans, Nipah (NiV and Hendra (HeV viruses. In the new approach, artificial cell-like particles (protocells presenting membrane receptors in a biomimetic manner were developed and found to attract and inactivate henipavirus envelope glycoprotein pseudovirus particles, preventing infection. The protocells do not accumulate virus during the inactivation process. The use of protocells that interact with, but do not accumulate, viruses may provide significant advantages over current antiviral drugs, and this general approach may have wide potential for antiviral development.

  16. Dimeric architecture of the Hendra virus attachment glycoprotein: evidence for a conserved mode of assembly.

    Science.gov (United States)

    Bowden, Thomas A; Crispin, Max; Harvey, David J; Jones, E Yvonne; Stuart, David I

    2010-06-01

    Hendra virus is a negative-sense single-stranded RNA virus within the Paramyxoviridae family which, together with Nipah virus, forms the Henipavirus genus. Infection with bat-borne Hendra virus leads to a disease with high mortality rates in humans. We determined the crystal structure of the unliganded six-bladed beta-propeller domain and compared it to the previously reported structure of Hendra virus attachment glycoprotein (HeV-G) in complex with its cellular receptor, ephrin-B2. As observed for the related unliganded Nipah virus structure, there is plasticity in the Glu579-Pro590 and Lys236-Ala245 ephrin-binding loops prior to receptor engagement. These data reveal that henipaviral attachment glycoproteins undergo common structural transitions upon receptor binding and further define the structural template for antihenipaviral drug design. Our analysis also provides experimental evidence for a dimeric arrangement of HeV-G that exhibits striking similarity to those observed in crystal structures of related paramyxovirus receptor-binding glycoproteins. The biological relevance of this dimer is further supported by the positional analysis of glycosylation sites from across the paramyxoviruses. In HeV-G, the sites lie away from the putative dimer interface and remain accessible to alpha-mannosidase processing on oligomerization. We therefore propose that the overall mode of dimer assembly is conserved for all paramyxoviruses; however, while the geometry of dimerization is rather closely similar for those viruses that bind flexible glycan receptors, significant (up to 60 degrees ) and different reconfigurations of the subunit packing (associated with a significant decrease in the size of the dimer interface) have accompanied the independent switching to high-affinity protein receptor binding in Hendra and measles viruses.

  17. Precision genome editing

    DEFF Research Database (Denmark)

    Steentoft, Catharina; Bennett, Eric P; Schjoldager, Katrine Ter-Borch Gram

    2014-01-01

    of glycobiology, primarily due to their low efficiencies, with resultant failure to impose substantial phenotypic consequences upon the final glycosylation products. Here, we review novel nuclease-based precision genome editing techniques enabling efficient and stable gene editing, including gene disruption......Precise and stable gene editing in mammalian cell lines has until recently been hampered by the lack of efficient targeting methods. While different gene silencing strategies have had tremendous impact on many biological fields, they have generally not been applied with wide success in the field...... by introducing single or double-stranded breaks at a defined genomic sequence. We here compare and contrast the different techniques and summarize their current applications, highlighting cases from the field of glycobiology as well as pointing to future opportunities. The emerging potential of precision gene...

  18. Human Germline Genome Editing.

    Science.gov (United States)

    Ormond, Kelly E; Mortlock, Douglas P; Scholes, Derek T; Bombard, Yvonne; Brody, Lawrence C; Faucett, W Andrew; Garrison, Nanibaa' A; Hercher, Laura; Isasi, Rosario; Middleton, Anna; Musunuru, Kiran; Shriner, Daniel; Virani, Alice; Young, Caroline E

    2017-08-03

    With CRISPR/Cas9 and other genome-editing technologies, successful somatic and germline genome editing are becoming feasible. To respond, an American Society of Human Genetics (ASHG) workgroup developed this position statement, which was approved by the ASHG Board in March 2017. The workgroup included representatives from the UK Association of Genetic Nurses and Counsellors, Canadian Association of Genetic Counsellors, International Genetic Epidemiology Society, and US National Society of Genetic Counselors. These groups, as well as the American Society for Reproductive Medicine, Asia Pacific Society of Human Genetics, British Society for Genetic Medicine, Human Genetics Society of Australasia, Professional Society of Genetic Counselors in Asia, and Southern African Society for Human Genetics, endorsed the final statement. The statement includes the following positions. (1) At this time, given the nature and number of unanswered scientific, ethical, and policy questions, it is inappropriate to perform germline gene editing that culminates in human pregnancy. (2) Currently, there is no reason to prohibit in vitro germline genome editing on human embryos and gametes, with appropriate oversight and consent from donors, to facilitate research on the possible future clinical applications of gene editing. There should be no prohibition on making public funds available to support this research. (3) Future clinical application of human germline genome editing should not proceed unless, at a minimum, there is (a) a compelling medical rationale, (b) an evidence base that supports its clinical use, (c) an ethical justification, and (d) a transparent public process to solicit and incorporate stakeholder input. Copyright © 2017 American Society of Human Genetics. All rights reserved.

  19. Next-Generation Sequencing and Genome Editing in Plant Virology

    Directory of Open Access Journals (Sweden)

    Ahmed Hadidi

    2016-08-01

    Full Text Available Next-generation sequencing (NGS has been applied to plant virology since 2009. NGS provides highly efficient, rapid, low cost DNA or RNA high-throughput sequencing of the genomes of plant viruses and viroids and of the specific small RNAs generated during the infection process. These small RNAs, which cover frequently the whole genome of the infectious agent, are 21-24 nt long and are known as vsRNAs for viruses and vd-sRNAs for viroids. NGS has been used in a number of studies in plant virology including, but not limited to, discovery of novel viruses and viroids as well as detection and identification of those pathogens already known, analysis of genome diversity and evolution, and study of pathogen epidemiology. The genome engineering editing method, clustered regularly interspaced short palindromic repeats (CRISPR-Cas9 system has been successfully used recently to engineer resistance to DNA geminiviruses (family, Geminiviridae by targeting different viral genome sequences in infected Nicotiana benthamiana or Arabidopsis plants. The DNA viruses targeted include tomato yellow leaf curl virus and merremia mosaic virus (begomovirus; beet curly top virus and beet severe curly top virus (curtovirus; and bean yellow dwarf virus (mastrevirus. The technique has also been used against the RNA viruses zucchini yellow mosaic virus, papaya ringspot virus and turnip mosaic virus (potyvirus and cucumber vein yellowing virus (ipomovirus, family, Potyviridae by targeting the translation initiation genes eIF4E in cucumber or Arabidopsis plants. From these recent advances of major importance, it is expected that NGS and CRISPR-Cas technologies will play a significant role in the very near future in advancing the field of plant virology and connecting it with other related fields of biology.Keywords: Next-generation sequencing, NGS, plant virology, plant viruses, viroids, resistance to plant viruses by CRISPR-Cas9

  20. Editing tools. Transcribing and encoding

    NARCIS (Netherlands)

    Spadini, E.

    2015-01-01

    This paper deals with editing tools and editing platforms, i.e. programs used by editors in order to fulfil one or more tasks in the creation of a scholarly digital edition (SDE). Recurring themes in the field of SDEs are the standardization of XML-TEI markup and the success of documentary digital

  1. Nair handbook. 1995 edition

    International Nuclear Information System (INIS)

    1995-01-01

    This Handbook contains general background, administrative and technical information for those participating in the National Arrangements for Incidents involving Radioactivity (NAIR), updating and replacing the previous edition published in 1987. The overriding need for revision was brought about as a result of changes introduced by British Telecom to the telephone numbers of establishments. (UK)

  2. Beginning to edit physics

    Energy Technology Data Exchange (ETDEWEB)

    Murphy, P.W.

    1995-02-01

    A physicist-turned-editor shows you the basics required for copyediting physics papers (physical quantities, symbols, units, scientific notation, the structure of mathematical expressions, the nature of graphs), and points the way to learning enough ``editorial physics`` to begin substantive editing.

  3. MENTAL DEFICIENCY. SECOND EDITION.

    Science.gov (United States)

    HILLIARD, L.T.; KIRMAN, BRIAN H.

    REVISED TO INCLUDE LEGISLATIVE AND ADMINISTRATIVE PROCEDURES NEW IN BRITAIN SINCE THE 1957 EDITION, THE TEXT INCLUDES RECENT ADVANCES IN ETIOLOGY, PATHOLOGY, AND TREATMENT OF MENTAL DEFICIENCY. CONSIDERATION OF THE BACKGROUND OF MENTAL DEFICIENCY INCLUDES HISTORICAL AND LEGAL ASPECTS, THE SOCIAL BACKGROUND OF MENTAL DEFECT, PRENATAL CAUSES OF…

  4. Newspaper Editing: English, Journalism.

    Science.gov (United States)

    Bullock, Johanna

    A course designed to groom editors for the newspaper is presented. Editing copy, copyreading and proofreading, principles of headlining, responsibility of the press, libel and slander laws, and problems of censorship are covered. Course objectives include the following: (1) The student will recognize and correct all newspaper items that do not…

  5. Black Psychology. Third Edition.

    Science.gov (United States)

    Jones, Reginald L., Ed.

    This book is the third edition of a resource for advanced students and professionals in black psychology in the form of 41 papers organized under 5 subheadings. The "overview" section includes one classic article and offers a new, world view paper. A "perspectives" section treats Afrocentric, humanistic, historical,…

  6. The Craft of Editing

    DEFF Research Database (Denmark)

    Moeran, Brian

    To edit is to make a choice, or series of choices. Will I write a rough draft of this essay in longhand, or hammer it out on my computer? If the latter, what font shall I use? Times New Roman, Book Antiqua, or Garamond? Once I get started, what style shall I adopt: realistic, confessional or impr...

  7. Tokamaks (Second Edition)

    International Nuclear Information System (INIS)

    Stott, Peter

    1998-01-01

    The first edition of John Wesson's book on tokamaks, published in 1987, established itself as essential reading for researchers in the field of magnetic confinement fusion: it was an excellent introduction for students to tokamak physics and also a valuable reference work for the more experienced. The second edition, published in 1997, has been completely rewritten and substantially enlarged (680 pages compared with 300). The new edition maintains the aim of providing a simple introduction to basic tokamak physics, but also includes discussion of the substantial advances in fusion research during the past decade. The new book, like its predecessor, is well written and commendable for its clarity and accuracy. In fact many of the chapters are written by a series of co-authors bringing the benefits of a wide range of expertise but, by careful editing, Wesson has maintained a uniformity of style and presentation. The chapter headings and coverage for the most part remain the same - but are expanded considerably and brought up to date. The most substantial change is that the single concluding chapter in the first edition on 'Experiments' has been replaced by three chapters: 'Tokamak experiments' which deals with some of the earlier key experiments plus a selection of recent small and medium-sized devices, 'Large experiments' which gives an excellent summary of the main results from the four large tokamaks - TFTR, JET, JT60/JT60U and DIII-D, and 'The future' which gives a very short (possibly too short in my opinion) account of reactors and ITER. This is an excellent book, which I strongly recommend should have a place - on the desk rather than in the bookshelf - of researchers in magnetic confinement fusion. (book review)

  8. Fan edits and the legacy of The Phantom Edit

    Directory of Open Access Journals (Sweden)

    Joshua Wille

    2014-09-01

    Full Text Available A fan edit can generally be defined as an alternative version of a film or television text created by a fan. It offers a different viewing experience, much as a song remix offers a different listening experience. The contemporary wave of fan edits has emerged during the remix zeitgeist of digital media and at a time when digital video editing technology has become more affordable and popular. The increasing number of alternative versions of films and the works of revisionist Hollywood filmmakers such as George Lucas have contributed to a greater public understanding of cinema as a fluid medium instead of one that exists in a fixed form. The Phantom Edit (2000, a seminal fan edit based on Lucas's Star Wars Episode I: The Phantom Menace (1999, inspired new ranks of fan editors. However, critics have misunderstood fan edits as merely the work of disgruntled fans. In order to provide a critical and historical basis for studies in fan editing as a creative practice, I examine previous interpretations of fan edits in the context of relevant contemporary works, and I use an annotated chronology of The Phantom Edit to trace its influence on subsequent fan editing communities and uncover their relationship with intellectual property disputes.

  9. Insights into the coiled-coil organization of the Hendra virus phosphoprotein from combined biochemical and SAXS studies.

    Science.gov (United States)

    Beltrandi, Matilde; Blocquel, David; Erales, Jenny; Barbier, Pascale; Cavalli, Andrea; Longhi, Sonia

    2015-03-01

    Nipah and Hendra viruses are recently emerged paramyxoviruses belonging to the Henipavirus genus. The Henipavirus phosphoprotein (P) consists of a large intrinsically disordered domain and a C-terminal domain (PCT) containing alternating disordered and ordered regions. Among these latter is the P multimerization domain (PMD). Using biochemical, analytical ultracentrifugation and small-angle X-ray scattering (SAXS) studies, we show that Hendra virus (HeV) PMD forms an elongated coiled-coil homotrimer in solution, in agreement with our previous findings on Nipah virus (NiV) PMD. However, the orientation of the N-terminal region differs from that observed in solution for NiV PMD, consistent with the ability of this region to adopt different conformations. SAXS studies provided evidence for a trimeric organization also in the case of PCT, thus extending and strengthening our findings on PMD. The present results are discussed in light of conflicting reports in the literature pointing to a tetrameric organization of paramyxoviral P proteins. Copyright © 2014 Elsevier Inc. All rights reserved.

  10. Preface to Special Edition

    Directory of Open Access Journals (Sweden)

    Renee Nathanson

    2012-04-01

    Full Text Available Given that reading comprehension is at the forefront of global literacy discourse, this special edition of Per Linguam, the first number that is also published online, features a collection of articles that cover different aspects of reading comprehension and instruction, such as, strategies for comprehending texts, metacognitive awareness, the reciprocity of assessment and comprehension instruction and socio-affective factors that influence comprehension.

  11. UN-EDITED VERSION

    Indian Academy of Sciences (India)

    57

    1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. 13. 14. 15. 16. 17. 18. 19. 20. 21. 22. 23. 24. 25. 26. 27. 28. 29. 30. 31. 32. 33. 34. 35. 36. 37. 38. 39. 40. 41. 42. 43. 44. 45. 46. 47. 48. 49. 50. 51. 52. 53. 54. 55. 56. 57. 58. 59. 60. 61. 62. 63. 64. 65. UN-EDITED VERSION ...

  12. Possibility of using combined treatment of processing and ionizing radiation to eliminate contaminated viruses from non-screened donor of tissue allografts

    International Nuclear Information System (INIS)

    Nazly Hilmy; Paramita Pandansari

    2008-01-01

    Full text: New emerging and re- emerging infectious diseases caused by viruses are outbreak and re- outbreak around the world. Most of the viruses come from animals ( zoonoses) and jump to human beings ( host jumping ) such as corona virus ( SARS), HIV, bird flu/ Avian flu H5N1, hepatitis viruses, Dengue fever virus, West Nile virus/WNV, Hantavirus, Marburg haemorrhagic fever virus, Hendra virus, Nipah virus etc. Transmission of those diseases through transplantation of contaminated tissue allograft to recipient can happened if the donor could not be screened properly. The donor can be well screened from some of those viruses such as HIV, hepatitis viruses and WNV. Processing of tissue allografts by pasteurization, washing and soaking in H 2 O 2 and soap can eliminate contaminated viruses to a certain amount, have been reported by several authors. Viruses are very small microbes, they have DNA/RNA, resistant to radiation but to a certain degree they can be well eliminated by radiation. Their D10 - values vary from 4 to 13 kGy. This paper discribes briefly the possibility of using combined treatment of processing, lyophilization and sterilisation by radiation to overcome problems of non screened donor from some contaminated viruses. (Author)

  13. CRISPR/Cas9-Advancing Orthopoxvirus Genome Editing for Vaccine and Vector Development.

    Science.gov (United States)

    Okoli, Arinze; Okeke, Malachy I; Tryland, Morten; Moens, Ugo

    2018-01-22

    The clustered regularly interspaced short palindromic repeat (CRISPR)/associated protein 9 (Cas9) technology is revolutionizing genome editing approaches. Its high efficiency, specificity, versatility, flexibility, simplicity and low cost have made the CRISPR/Cas9 system preferable to other guided site-specific nuclease-based systems such as TALENs (Transcription Activator-like Effector Nucleases) and ZFNs (Zinc Finger Nucleases) in genome editing of viruses. CRISPR/Cas9 is presently being applied in constructing viral mutants, preventing virus infections, eradicating proviral DNA, and inhibiting viral replication in infected cells. The successful adaptation of CRISPR/Cas9 to editing the genome of Vaccinia virus paves the way for its application in editing other vaccine/vector-relevant orthopoxvirus (OPXV) strains. Thus, CRISPR/Cas9 can be used to resolve some of the major hindrances to the development of OPXV-based recombinant vaccines and vectors, including sub-optimal immunogenicity; transgene and genome instability; reversion of attenuation; potential of spread of transgenes to wildtype strains and close contacts, which are important biosafety and risk assessment considerations. In this article, we review the published literature on the application of CRISPR/Cas9 in virus genome editing and discuss the potentials of CRISPR/Cas9 in advancing OPXV-based recombinant vaccines and vectors. We also discuss the application of CRISPR/Cas9 in combating viruses of clinical relevance, the limitations of CRISPR/Cas9 and the current strategies to overcome them.

  14. CRISPR/Cas9—Advancing Orthopoxvirus Genome Editing for Vaccine and Vector Development

    Science.gov (United States)

    Okoli, Arinze; Okeke, Malachy I.; Tryland, Morten; Moens, Ugo

    2018-01-01

    The clustered regularly interspaced short palindromic repeat (CRISPR)/associated protein 9 (Cas9) technology is revolutionizing genome editing approaches. Its high efficiency, specificity, versatility, flexibility, simplicity and low cost have made the CRISPR/Cas9 system preferable to other guided site-specific nuclease-based systems such as TALENs (Transcription Activator-like Effector Nucleases) and ZFNs (Zinc Finger Nucleases) in genome editing of viruses. CRISPR/Cas9 is presently being applied in constructing viral mutants, preventing virus infections, eradicating proviral DNA, and inhibiting viral replication in infected cells. The successful adaptation of CRISPR/Cas9 to editing the genome of Vaccinia virus paves the way for its application in editing other vaccine/vector-relevant orthopoxvirus (OPXV) strains. Thus, CRISPR/Cas9 can be used to resolve some of the major hindrances to the development of OPXV-based recombinant vaccines and vectors, including sub-optimal immunogenicity; transgene and genome instability; reversion of attenuation; potential of spread of transgenes to wildtype strains and close contacts, which are important biosafety and risk assessment considerations. In this article, we review the published literature on the application of CRISPR/Cas9 in virus genome editing and discuss the potentials of CRISPR/Cas9 in advancing OPXV-based recombinant vaccines and vectors. We also discuss the application of CRISPR/Cas9 in combating viruses of clinical relevance, the limitations of CRISPR/Cas9 and the current strategies to overcome them. PMID:29361752

  15. CRISPR/Cas9—Advancing Orthopoxvirus Genome Editing for Vaccine and Vector Development

    Directory of Open Access Journals (Sweden)

    Arinze Okoli

    2018-01-01

    Full Text Available The clustered regularly interspaced short palindromic repeat (CRISPR/associated protein 9 (Cas9 technology is revolutionizing genome editing approaches. Its high efficiency, specificity, versatility, flexibility, simplicity and low cost have made the CRISPR/Cas9 system preferable to other guided site-specific nuclease-based systems such as TALENs (Transcription Activator-like Effector Nucleases and ZFNs (Zinc Finger Nucleases in genome editing of viruses. CRISPR/Cas9 is presently being applied in constructing viral mutants, preventing virus infections, eradicating proviral DNA, and inhibiting viral replication in infected cells. The successful adaptation of CRISPR/Cas9 to editing the genome of Vaccinia virus paves the way for its application in editing other vaccine/vector-relevant orthopoxvirus (OPXV strains. Thus, CRISPR/Cas9 can be used to resolve some of the major hindrances to the development of OPXV-based recombinant vaccines and vectors, including sub-optimal immunogenicity; transgene and genome instability; reversion of attenuation; potential of spread of transgenes to wildtype strains and close contacts, which are important biosafety and risk assessment considerations. In this article, we review the published literature on the application of CRISPR/Cas9 in virus genome editing and discuss the potentials of CRISPR/Cas9 in advancing OPXV-based recombinant vaccines and vectors. We also discuss the application of CRISPR/Cas9 in combating viruses of clinical relevance, the limitations of CRISPR/Cas9 and the current strategies to overcome them.

  16. Revising and editing for translators

    CERN Document Server

    Mossop, Brian

    2014-01-01

    Revising and Editing for Translators provides guidance and learning materials for translation students learning to edit texts written by others, and professional translators wishing to improve their self-revision ability or learning to revise the work of others. Editing is understood as making corrections and improvements to texts, with particular attention to tailoring them to the given readership. Revising is this same task applied to draft translations. The linguistic work of editors and revisers is related to the professional situations in which they work. Mossop offers in-depth coverage of a wide range of topics, including copyediting, style editing, structural editing, checking for consistency, revising procedures and principles, and translation quality assessment. This third edition provides extended coverage of computer aids for revisers, and of the different degrees of revision suited to different texts. The inclusion of suggested activities and exercises, numerous real-world examples, a proposed gra...

  17. Photo Editing: A Neglected Art.

    Science.gov (United States)

    Bergeman, Rich

    1987-01-01

    Offers guidelines for using photographs effectively in campus newspapers. Reviews the stages in the photo editing process, suggests alternatives to traditional photographic approaches, and offers technical advice. (AYC)

  18. REDIdb: the RNA editing database.

    Science.gov (United States)

    Picardi, Ernesto; Regina, Teresa Maria Rosaria; Brennicke, Axel; Quagliariello, Carla

    2007-01-01

    The RNA Editing Database (REDIdb) is an interactive, web-based database created and designed with the aim to allocate RNA editing events such as substitutions, insertions and deletions occurring in a wide range of organisms. The database contains both fully and partially sequenced DNA molecules for which editing information is available either by experimental inspection (in vitro) or by computational detection (in silico). Each record of REDIdb is organized in a specific flat-file containing a description of the main characteristics of the entry, a feature table with the editing events and related details and a sequence zone with both the genomic sequence and the corresponding edited transcript. REDIdb is a relational database in which the browsing and identification of editing sites has been simplified by means of two facilities to either graphically display genomic or cDNA sequences or to show the corresponding alignment. In both cases, all editing sites are highlighted in colour and their relative positions are detailed by mousing over. New editing positions can be directly submitted to REDIdb after a user-specific registration to obtain authorized secure access. This first version of REDIdb database stores 9964 editing events and can be freely queried at http://biologia.unical.it/py_script/search.html.

  19. Genome Editing Tools in Plants

    Directory of Open Access Journals (Sweden)

    Tapan Kumar Mohanta

    2017-12-01

    Full Text Available Genome editing tools have the potential to change the genomic architecture of a genome at precise locations, with desired accuracy. These tools have been efficiently used for trait discovery and for the generation of plants with high crop yields and resistance to biotic and abiotic stresses. Due to complex genomic architecture, it is challenging to edit all of the genes/genomes using a particular genome editing tool. Therefore, to overcome this challenging task, several genome editing tools have been developed to facilitate efficient genome editing. Some of the major genome editing tools used to edit plant genomes are: Homologous recombination (HR, zinc finger nucleases (ZFNs, transcription activator-like effector nucleases (TALENs, pentatricopeptide repeat proteins (PPRs, the CRISPR/Cas9 system, RNA interference (RNAi, cisgenesis, and intragenesis. In addition, site-directed sequence editing and oligonucleotide-directed mutagenesis have the potential to edit the genome at the single-nucleotide level. Recently, adenine base editors (ABEs have been developed to mutate A-T base pairs to G-C base pairs. ABEs use deoxyadeninedeaminase (TadA with catalytically impaired Cas9 nickase to mutate A-T base pairs to G-C base pairs.

  20. A REVIEW ON GENOME EDITING

    OpenAIRE

    Akshay Patil, Latesh Patil, H. P. Suryawanshi, S. P. Pawar

    2017-01-01

    The Present Review report contains the information about Genome Editing. In this report genome editing is illustrated at the basic level for better understanding. It contains History of Genome Editing from 1800 to Current day i.e. from concept of DNA till current time. Genome editing is an technique to make every human smarter not our choice, by customizing next generation the way we want it to be like to be look and also the intellectual capacity. In this Concept, the viral Immunity is used ...

  1. A geminivirus-based guide RNA delivery system for CRISPR/Cas9 mediated plant genome editing

    OpenAIRE

    Yin, Kangquan; Han, Ting; Liu, Guang; Chen, Tianyuan; Wang, Ying; Yu, Alice Yunzi L.; Liu, Yule

    2015-01-01

    CRISPR/Cas has emerged as potent genome editing technology and has successfully been applied in many organisms, including several plant species. However, delivery of genome editing reagents remains a challenge in plants. Here, we report a virus-based guide RNA (gRNA) delivery system for CRISPR/Cas9 mediated plant genome editing (VIGE) that can be used to precisely target genome locations and cause mutations. VIGE is performed by using a modified Cabbage Leaf Curl virus (CaLCuV) vector to expr...

  2. Human Hendra virus infection causes acute and relapsing encephalitis.

    Science.gov (United States)

    Wong, K T; Robertson, T; Ong, B B; Chong, J W; Yaiw, K C; Wang, L F; Ansford, A J; Tannenberg, A

    2009-06-01

    To study the pathology of two cases of human Hendra virus infection, one with no clinical encephalitis and one with relapsing encephalitis. Autopsy tissues were investigated by light microscopy, immunohistochemistry and in situ hybridization. In the patient with acute pulmonary syndrome but not clinical acute encephalitis, vasculitis was found in the brain, lung, heart and kidney. Occasionally, viral antigens were demonstrated in vascular walls but multinucleated endothelial syncytia were absent. In the lung, there was severe inflammation, necrosis and viral antigens in type II pneumocytes and macrophages. The rare kidney glomerulus showed inflammation and viral antigens in capillary walls and podocytes. Discrete necrotic/vacuolar plaques in the brain parenchyma were associated with antigens and viral RNA. Brain inflammation was mild although CD68(+) microglia/macrophages were significantly increased. Cytoplasmic viral inclusions and antigens and viral RNA in neurones and ependyma suggested viral replication. In the case of relapsing encephalitis, there was severe widespread meningoencephalitis characterized by neuronal loss, macrophages and other inflammatory cells, reactive blood vessels and perivascular cuffing. Antigens and viral RNA were mainly found in neurones. Vasculitis was absent in all the tissues examined. The case of acute Hendra virus infection demonstrated evidence of systemic infection and acute encephalitis. The case of relapsing Hendra virus encephalitis showed no signs of extraneural infection but in the brain, extensive inflammation and infected neurones were observed. Hendra virus can cause acute and relapsing encephalitis and the findings suggest that the pathology and pathogenesis are similar to Nipah virus infection.

  3. [Summary of research works on viruses in the Vietnam Research Station, Institute of Tropical Medicine, Nagasaki University].

    Science.gov (United States)

    Yamashiro, Tetsu

    2013-01-01

    Institute of Tropical Medicine, Nagasaki University (NEKKEN) and National Institute of Hygiene and Epidemiology, Vietnam (NIHE) jointly conducted a project from 2006 on Emerging and Re-emerging Infectious Diseases (ERID) granted by the Ministry of Education, Science, Culture and Technology (MEXT) of Japan. Fifteen independent researches have been carried out by 7 scientists who stationed in the Vietnam Research Station (VRS), and by approximately 60 visiting scientists. A wide variety of viruses have been studied in the research activities in the VRS, of those, topics of'' Nipah virus infection in bats in Vietnam'', ''Nam Dinh virus, a newly discovered insect nidovirus'', and'' Risk factors of dengue fever in southern Vietnam'' were summarized. It is important to develop a mechanism to facilitate young scientists to use the VRS in their research works, and then a scope to establish the VRS as a gateway to a successful career path for young scientists in the field of the infectious diseases would be realized.

  4. Clinical Applications of Genome Editing to HIV Cure.

    Science.gov (United States)

    Wang, Cathy X; Cannon, Paula M

    2016-12-01

    Despite significant advances in HIV drug treatment regimens, which grant near-normal life expectancies to infected individuals who have good virological control, HIV infection itself remains incurable. In recent years, novel gene- and cell-based therapies have gained increasing attention due to their potential to provide a functional or even sterilizing cure for HIV infection with a one-shot treatment. A functional cure would keep the infection in check and prevent progression to AIDS, while a sterilizing cure would eradicate all HIV viruses from the patient. Genome editing is the most precise form of gene therapy, able to achieve permanent genetic disruption, modification, or insertion at a predesignated genetic locus. The most well-studied candidate for anti-HIV genome editing is CCR5, an essential coreceptor for the majority of HIV strains, and the lack of which confers HIV resistance in naturally occurring homozygous individuals. Genetic disruption of CCR5 to treat HIV has undergone clinical testing, with seven completed or ongoing trials in T cells and hematopoietic stem and progenitor cells, and has shown promising safety and potential efficacy profiles. Here we summarize clinical findings of CCR5 editing for HIV therapy, as well as other genome editing-based approaches under pre-clinical development. The anticipated development of more sophisticated genome editing technologies should continue to benefit HIV cure efforts.

  5. Duration of Maternal Antibodies against Canine Distemper Virus and Hendra Virus in Pteropid Bats

    Science.gov (United States)

    Zambrana-Torrelio, Carlos; Middleton, Deborah; Barr, Jennifer A.; DuBovi, Edward; Boyd, Victoria; Pope, Brian; Todd, Shawn; Crameri, Gary; Walsh, Allyson; Pelican, Katey; Fielder, Mark D.; Davies, Angela J.; Wang, Lin-Fa; Daszak, Peter

    2013-01-01

    Old World frugivorous bats have been identified as natural hosts for emerging zoonotic viruses of significant public health concern, including henipaviruses (Nipah and Hendra virus), Ebola virus, and Marburg virus. Epidemiological studies of these viruses in bats often utilize serology to describe viral dynamics, with particular attention paid to juveniles, whose birth increases the overall susceptibility of the population to a viral outbreak once maternal immunity wanes. However, little is understood about bat immunology, including the duration of maternal antibodies in neonates. Understanding duration of maternally derived immunity is critical for characterizing viral dynamics in bat populations, which may help assess the risk of spillover to humans. We conducted two separate studies of pregnant Pteropus bat species and their offspring to measure the half-life and duration of antibodies to 1) canine distemper virus antigen in vaccinated captive Pteropus hypomelanus; and 2) Hendra virus in wild-caught, naturally infected Pteropus alecto. Both of these pteropid bat species are known reservoirs for henipaviruses. We found that in both species, antibodies were transferred from dam to pup. In P. hypomelanus pups, titers against CDV waned over a mean period of 228.6 days (95% CI: 185.4–271.8) and had a mean terminal phase half-life of 96.0 days (CI 95%: 30.7–299.7). In P. alecto pups, antibodies waned over 255.13 days (95% CI: 221.0–289.3) and had a mean terminal phase half-life of 52.24 days (CI 95%: 33.76–80.83). Each species showed a duration of transferred maternal immunity of between 7.5 and 8.5 months, which was longer than has been previously estimated. These data will allow for more accurate interpretation of age-related Henipavirus serological data collected from wild pteropid bats. PMID:23826322

  6. Duration of Maternal Antibodies against Canine Distemper Virus and Hendra Virus in Pteropid Bats.

    Directory of Open Access Journals (Sweden)

    Jonathan H Epstein

    Full Text Available Old World frugivorous bats have been identified as natural hosts for emerging zoonotic viruses of significant public health concern, including henipaviruses (Nipah and Hendra virus, Ebola virus, and Marburg virus. Epidemiological studies of these viruses in bats often utilize serology to describe viral dynamics, with particular attention paid to juveniles, whose birth increases the overall susceptibility of the population to a viral outbreak once maternal immunity wanes. However, little is understood about bat immunology, including the duration of maternal antibodies in neonates. Understanding duration of maternally derived immunity is critical for characterizing viral dynamics in bat populations, which may help assess the risk of spillover to humans. We conducted two separate studies of pregnant Pteropus bat species and their offspring to measure the half-life and duration of antibodies to 1 canine distemper virus antigen in vaccinated captive Pteropus hypomelanus; and 2 Hendra virus in wild-caught, naturally infected Pteropus alecto. Both of these pteropid bat species are known reservoirs for henipaviruses. We found that in both species, antibodies were transferred from dam to pup. In P. hypomelanus pups, titers against CDV waned over a mean period of 228.6 days (95% CI: 185.4-271.8 and had a mean terminal phase half-life of 96.0 days (CI 95%: 30.7-299.7. In P. alecto pups, antibodies waned over 255.13 days (95% CI: 221.0-289.3 and had a mean terminal phase half-life of 52.24 days (CI 95%: 33.76-80.83. Each species showed a duration of transferred maternal immunity of between 7.5 and 8.5 months, which was longer than has been previously estimated. These data will allow for more accurate interpretation of age-related Henipavirus serological data collected from wild pteropid bats.

  7. Duration of Maternal Antibodies against Canine Distemper Virus and Hendra Virus in Pteropid Bats.

    Science.gov (United States)

    Epstein, Jonathan H; Baker, Michelle L; Zambrana-Torrelio, Carlos; Middleton, Deborah; Barr, Jennifer A; Dubovi, Edward; Boyd, Victoria; Pope, Brian; Todd, Shawn; Crameri, Gary; Walsh, Allyson; Pelican, Katey; Fielder, Mark D; Davies, Angela J; Wang, Lin-Fa; Daszak, Peter

    2013-01-01

    Old World frugivorous bats have been identified as natural hosts for emerging zoonotic viruses of significant public health concern, including henipaviruses (Nipah and Hendra virus), Ebola virus, and Marburg virus. Epidemiological studies of these viruses in bats often utilize serology to describe viral dynamics, with particular attention paid to juveniles, whose birth increases the overall susceptibility of the population to a viral outbreak once maternal immunity wanes. However, little is understood about bat immunology, including the duration of maternal antibodies in neonates. Understanding duration of maternally derived immunity is critical for characterizing viral dynamics in bat populations, which may help assess the risk of spillover to humans. We conducted two separate studies of pregnant Pteropus bat species and their offspring to measure the half-life and duration of antibodies to 1) canine distemper virus antigen in vaccinated captive Pteropus hypomelanus; and 2) Hendra virus in wild-caught, naturally infected Pteropus alecto. Both of these pteropid bat species are known reservoirs for henipaviruses. We found that in both species, antibodies were transferred from dam to pup. In P. hypomelanus pups, titers against CDV waned over a mean period of 228.6 days (95% CI: 185.4-271.8) and had a mean terminal phase half-life of 96.0 days (CI 95%: 30.7-299.7). In P. alecto pups, antibodies waned over 255.13 days (95% CI: 221.0-289.3) and had a mean terminal phase half-life of 52.24 days (CI 95%: 33.76-80.83). Each species showed a duration of transferred maternal immunity of between 7.5 and 8.5 months, which was longer than has been previously estimated. These data will allow for more accurate interpretation of age-related Henipavirus serological data collected from wild pteropid bats.

  8. Instrumental analysis, second edition

    International Nuclear Information System (INIS)

    Christian, G.D.; O'Reilly, J.E.

    1988-01-01

    The second edition of Instrumental Analysis is a survey of the major instrument-based methods of chemical analysis. It appears to be aimed at undergraduates but would be equally useful in a graduate course. The volume explores all of the classical quantitative methods and contains sections on techniques that usually are not included in a semester course in instrumentation (such as electron spectroscopy and the kinetic methods). Adequate coverage of all of the methods contained in this book would require several semesters of focused study. The 25 chapters were written by different authors, yet the style throughout the book is more uniform than in the earlier edition. With the exception of a two-chapter course in analog and digital circuits, the book purports to de-emphasize instrumentation, focusing more on the theory behind the methods and the application of the methods to analytical problems. However, a detailed analysis of the instruments used in each method is by no means absent. The book has the favor of a user's guide to analysis

  9. Quantitative Seismology, Second Edition

    Science.gov (United States)

    Lay, Thorne

    As recently as 1980, anyone seeking a rigorous treatment of the fundamentals of elastodynamics relevant to the rapidly maturing field of seismology had to delve into a host of primary sources, some of which were rather obscure or difficult to obtain. Classical texts in this field tended to focus on limited topics and to treat some areas either superficially or in excessive depth. Graduate education in the field of seismology tended to reflect local faculty expertise and interests, often with compendia of handwritten notes, inconsistent notation, and variable generality. That situation was dramatically changed with the appearance of the first edition of Quantitative Seismology, a two-volume set that distilled the key foundations of elastodynamics for linear elastic materials into an accessible and satisfyingly thorough presentation of seismological theory. The adoption of a uniform, consistent notation in which many previous contributions were represented was perhaps as great of a contribution to the field as the many conceptual insights revealed by the authors' treatment of the topic. That work has become a disciplinary standard, with tremendous impact on the education of students and the research of advanced practitioners in the field. No subsequent text has supplanted this cornerstone of the discipline, but over time the second volume went out of print and a second edition became necessary.

  10. Natural Hazards, Second Edition

    Science.gov (United States)

    Rouhban, Badaoui

    Natural disaster loss is on the rise, and the vulnerability of the human and physical environment to the violent forces of nature is increasing. In many parts of the world, disasters caused by natural hazards such as earthquakes, floods, landslides, drought, wildfires, intense windstorms, tsunami, and volcanic eruptions have caused the loss of human lives, injury, homelessness, and the destruction of economic and social infrastructure. Over the last few years, there has been an increase in the occurrence, severity, and intensity of disasters, culminating with the devastating tsunami of 26 December 2004 in South East Asia.Natural hazards are often unexpected or uncontrollable natural events of varying magnitude. Understanding their mechanisms and assessing their distribution in time and space are necessary for refining risk mitigation measures. This second edition of Natural Hazards, (following a first edition published in 1991 by Cambridge University Press), written by Edward Bryant, associate dean of science at Wollongong University, Australia, grapples with this crucial issue, aspects of hazard prediction, and other issues. The book presents a comprehensive analysis of different categories of hazards of climatic and geological origin.

  11. With this Special Edition

    Directory of Open Access Journals (Sweden)

    Oscar Antonio Martínez Molina

    2017-02-01

    Full Text Available With this Special Edition, the refereed Scientific Magazine, published in February 2017, presents a nourished and multidisciplinary theme, from the relationship of Environmental Education, in this ecological sharing man-environment; the social responsibility from the Management environment and the motivational values ​​conducive to the teaching performance in the different educational levels. Twenty-five (25 articles, generated from research production in university environments at the International level, are a signature of the quality of articles / essays presented in this Special Edition. Several reasons motivate the literary pen of our authors, adjusting to the rhythm of the times and the use of new technologies; and in correspondence with the care of the environment, this way of disseminating and making visible the scientific contents of humanistic and social court, support the care and protection of the forests, being an online production, in the Cloud. Thanks to the support of the Instituto Internacional de Investigación y Desarrollo Tecnológico Educativo INDTEC, CA, Scientific Magazine has been able to develop from the cooperative work of the people who compose its different committees: Editorial Academic Committee, Academic Scientific Committee and the Arbitrators in the review and valuation of the quality of the articles. With these assets, the Scientific Magazine, opening to the general public and especially to the academic new intellectual horizons.

  12. Annotation in Digital Scholarly Editions

    NARCIS (Netherlands)

    Boot, P.; Haentjens Dekker, R.

    2016-01-01

    Annotation in digital scholarly editions (of historical documents, literary works, letters, etc.) has long been recognized as an important desideratum, but has also proven to be an elusive ideal. In so far as annotation functionality is available, it is usually developed for a single edition and

  13. Potential for Introduction of Bat-Borne Zoonotic Viruses into the EU: A Review

    Directory of Open Access Journals (Sweden)

    Robin R. L. Simons

    2014-05-01

    Full Text Available Bat-borne viruses can pose a serious threat to human health, with examples including Nipah virus (NiV in Bangladesh and Malaysia, and Marburg virus (MARV in Africa. To date, significant human outbreaks of such viruses have not been reported in the European Union (EU. However, EU countries have strong historical links with many of the countries where NiV and MARV are present and a corresponding high volume of commercial trade and human travel, which poses a potential risk of introduction of these viruses into the EU. In assessing the risks of introduction of these bat-borne zoonotic viruses to the EU, it is important to consider the location and range of bat species known to be susceptible to infection, together with the virus prevalence, seasonality of viral pulses, duration of infection and titre of virus in different bat tissues. In this paper, we review the current scientific knowledge of all these factors, in relation to the introduction of NiV and MARV into the EU.

  14. Fundamentals of Welding. Teacher Edition [and] Student Edition [and] Student Workbook. Second Edition.

    Science.gov (United States)

    Fortney, Clarence; Gregory, Mike; New, Larry

    Teacher and student editions and a student workbook for fundamentals of welding comprise the first of six in a series of competency-based instructional materials for welding programs. Introductory pages in the teacher edition are training and competency profile, instructional/task analysis, basic skills icons and classifications, basic skills…

  15. Oxyacetylene Welding and Oxyfuel Cutting. Third Edition. Teacher Edition [and] Student Edition [and] Student Workbook.

    Science.gov (United States)

    Knapp, John; Harper, Eddie

    This Oklahoma curriculum guide, which includes a teacher edition, a student edition, and a student workbook, provides three units for a course on oxyacetylene welding, oxyfuel cutting, and cutting done with alternative fuels such as MAPP, propane, and natural gas. The three units are: "Oxyacetylene Welding"; "Oxyfuel Cutting";…

  16. Kecernaan In Vitro Fraksi Serat (NDF, ADF dan Selulosa Lima Jenis Rumput Laut Coklat dari Pantai Sungai Nipah Kabupaten Pesisir Selatan Sumatera Barat

    Directory of Open Access Journals (Sweden)

    Y.L. Dewi

    2015-10-01

    Full Text Available Penelitian ini bertujuan untuk mengetahui kecernaan fraksi serat (NDF, ADF dan Selulosa lima jenis rumput laut coklat dari Pantai Sungai Nipah Kabupaten Pesisir Selatan Sumatera Barat secara in vitro. Metode penelitian yang digunakan adalah metode eksperimen dengan Rancangan Acak Kelompok (RAK terdiri dari lima perlakuan rumput laut coklat yang berbeda jenis ( A = Padina australis, B = Turbinaria decurrens, C = Turbinaria murayana, D = Sargassum crassifolium dan E = Sargassum binderi dan masing-masing perlakuan diulang 3 kali sebagai kelompok. Kelompok didasarkan atas tiga kali pengambilan cairan rumen kambing yang berbeda. Parameter yang diamati pada penelitian ini adalah kecernaan NDF, kecernaan ADF dan kecernaan selulosa. Hasil penelitian menunjukkan 5 jenis rumput laut coklat berpengaruh sangat nyata (P<0,01 terhadap kecernaan NDF, kecernaan ADF dan kecernaan selulosa. Hasil penelitian ini dapat disimpulkan bahwa rumput laut Sargassum crassifolium dan Sargassum binderi memiliki kecernaan NDF tertinggi (15,65% dan 20,56% dan ADF tertinggi (15,43% dan 17,80% dibandingkan dengan jenis rumput laut coklat lainnya.

  17. Approximating Tree Edit Distance through String Edit Distance

    OpenAIRE

    Akutsu, Tatsuya; Fukagawa, Daiji; Takasu, Atsuhiro

    2010-01-01

    We present an algorithm to approximate edit distance between two ordered and rooted trees of bounded degree. In this algorithm, each input tree is transformed into a string by computing the Euler string, where labels of some edges in the input trees are modified so that structures of small subtrees are reflected to the labels. We show that the edit distance between trees is at least 1/6 and at most O(n 3/4) of the edit distance between the transformed strings, where n is the maximum size of t...

  18. MRI findings in acute Hendra virus meningoencephalitis

    Energy Technology Data Exchange (ETDEWEB)

    Nakka, P.; Amos, G.J. [Department of Diagnostic Radiology, Princess Alexandra Hospital, Woolloongabba, Qld 4102 (Australia); Saad, N., E-mail: nivena100@hotmail.com [Department of Diagnostic Radiology, Princess Alexandra Hospital, Woolloongabba, Qld 4102 (Australia); Jeavons, S. [Department of Diagnostic Radiology, Princess Alexandra Hospital, Woolloongabba, Qld 4102 (Australia)

    2012-05-15

    Aim: To describe serial changes in brain magnetic resonance imaging (MRI) in acute human infection from two outbreaks of Hendra virus (HeV), relate these changes to disease prognosis, and compare HeV encephalitis to reported cases of Nipah virus encephalitis. Materials and methods: The MRI images of three human cases (two of which were fatal) of acute HeV meningoencephalitis were reviewed. Results: Cortical selectivity early in the disease is evident in all three patients, while deep white matter involvement appears to be a late and possibly premorbid finding. This apparent early grey matter selectivity may be related to viral biology or ribavirin pharmacokinetics. Neuronal loss is evident at MRI, and the rate of progression of MRI abnormalities can predict the outcome of the infection. In both fatal cases, the serial changes in the MRI picture mirrored the clinical course. Conclusion: This is the first comprehensive report of serial MRI findings in acute human cerebral HeV infection from two outbreaks. The cortical selectivity appears to be an early finding while deep white matter involvement a late, and possibly premorbid, finding. In both fatal cases, the serial changes in MRI mirrored the clinical course.

  19. The immune evasion function of J and Beilong virus V proteins is distinct from that of other paramyxoviruses, consistent with their inclusion in the proposed genus Jeilongvirus.

    Science.gov (United States)

    Audsley, Michelle D; Marsh, Glenn A; Lieu, Kim G; Tachedjian, Mary; Joubert, D Albert; Wang, Lin-Fa; Jans, David A; Moseley, Gregory W

    2016-03-01

    IFN-antagonist function is a major determinant of pathogenicity and cross-species infection by viruses, but remains poorly defined for many potentially zoonotic viruses resident in animal species. The paramyxovirus family contains several zoonotic viruses, including highly pathogenic viruses such as Nipah virus and Hendra virus, and an increasing number of largely uncharacterized animal viruses. Here, we report the characterization of IFN antagonism by the rodent viruses J virus (JPV) and Beilong virus (BeiPV) of the proposed genus Jeilongvirus of the paramyxoviruses. Infection of cells by JPV and BeiPV was found to inhibit IFN-activated nuclear translocation of signal transducer and activator of transcription 1 (STAT1). However, in contrast to most other paramyxoviruses, the JPV and BeiPV V proteins did not interact with or inhibit signalling by STAT1 or STAT2, suggesting that JPV/BeiPV use an atypical V protein-independent strategy to target STATs, consistent with their inclusion in a separate genus. Nevertheless, the V proteins of both viruses interacted with melanoma differentiation-associated protein 5 (MDA5) and robustly inhibited MDA5-dependent activation of the IFN-β promoter. This supports a growing body of evidence that MDA5 is a universal target of paramyxovirus V proteins, such that the V-MDA5 interaction represents a potential target for broad-spectrum antiviral approaches.

  20. [Bats and Viruses: complex relationships].

    Science.gov (United States)

    Rodhain, F

    2015-10-01

    With more than 1 200 species, bats and flying foxes (Order Chiroptera) constitute the most important and diverse order of Mammals after Rodents. Many species of bats are insectivorous while others are frugivorous and few of them are hematophagous. Some of these animals fly during the night, others are crepuscular or diurnal. Some fly long distances during seasonal migrations. Many species are colonial cave-dwelling, living in a rather small home range while others are relatively solitary. However, in spite of the importance of bats for terrestrial biotic communities and ecosystem ecology, the diversity in their biology and lifestyles remain poorly known and underappreciated. More than sixty viruses have been detected or isolated in bats; these animals are therefore involved in the natural cycles of many of them. This is the case, for instance, of rabies virus and other Lyssavirus (Family Rhabdoviridae), Nipah and Hendra viruses (Paramyxoviridae), Ebola and Marburg viruses (Filoviridae), SARS-CoV and MERS-CoV (Coronaviridae). For these zoonotic viruses, a number of bat species are considered as important reservoir hosts, efficient disseminators or even directly responsible of the transmission. Some of these bat-borne viruses cause highly pathogenic diseases while others are of potential significance for humans and domestic or wild animals; so, bats are an important risk in human and animal public health. Moreover, some groups of viruses developed through different phylogenetic mechanisms of coevolution between viruses and bats. The fact that most of these viral infections are asymptomatic in bats has been observed since a long time but the mechanisms of the viral persistence are not clearly understood. The various bioecology of the different bat populations allows exchange of virus between migrating and non-migrating conspecific species. For a better understanding of the role of bats in the circulation of these viral zoonoses, epidemiologists must pay attention to

  1. Application of CRISPR/Cas9 system in virus research

    Directory of Open Access Journals (Sweden)

    ZHENG Qingfen

    2016-01-01

    Full Text Available To date, the clustered regularly interspaced short palindromic repeat (CRISPR/Cas9 system has been widely used to edit the genome in many species and cells. The system is the third generation of artificial endonuclease, which can edit DNA by recognizing short DNA sequences. This paper reviews the structural features of the system and its application in virus research, such as the functional studies of virus-related genes and the exploration of antiviral therapies (including HIV, HBV, and EB virus, looking forward to the future direction of virus research.

  2. [Preface for genome editing special issue].

    Science.gov (United States)

    Gu, Feng; Gao, Caixia

    2017-10-25

    Genome editing technology, as an innovative biotechnology, has been widely used for editing the genome from model organisms, animals, plants and microbes. CRISPR/Cas9-based genome editing technology shows its great value and potential in the dissection of functional genomics, improved breeding and genetic disease treatment. In the present special issue, the principle and application of genome editing techniques has been summarized. The advantages and disadvantages of the current genome editing technology and future prospects would also be highlighted.

  3. Marine botany. Second edition

    Energy Technology Data Exchange (ETDEWEB)

    Dawes, C.J. [Univ. of South Florida, Tampa, FL (United States)

    1998-12-01

    Marine plants are a diverse group that include unicellular algae, seaweeds, seagrasses, salt marshes, and mangrove forests. They carry out a variety of ecological functions and serve as the primary producers in coastal wetlands and oceanic waters. The theme that connects such a wide variety of plants is their ecology, which was also emphasized in the 1981 edition. The goal of this revision is to present taxonomic, physiological, chemical, and ecological aspects of marine plants, their adaptations, and how abiotic and biotic factors interact in their communities. The data are presented in a concise, comparative manner in order to identify similarities and differences between communities such as salt marsh and mangroves or subtidal seaweeds and seagrasses. To accomplish this, the text is organized into five chapters that introduce the marine habitats, consider abiotic and biotic factors, and anthropogenic influences on the communities followed by seven chapters that deal with microalgae, seaweeds, salt marshes, mangroves, seagrasses, and coral reefs. Two appendixes are included; one presents simple field techniques and the other is a summary of seaweed uses.

  4. Genome editing in cardiovascular diseases.

    Science.gov (United States)

    Strong, Alanna; Musunuru, Kiran

    2017-01-01

    Genome-editing tools, which include zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), and clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated 9 (Cas9) systems, have emerged as an invaluable technology to achieve somatic and germline genomic manipulation in cells and model organisms for multiple applications, including the creation of knockout alleles, introducing desired mutations into genomic DNA, and inserting novel transgenes. Genome editing is being rapidly adopted into all fields of biomedical research, including the cardiovascular field, where it has facilitated a greater understanding of lipid metabolism, electrophysiology, cardiomyopathies, and other cardiovascular disorders, has helped to create a wider variety of cellular and animal models, and has opened the door to a new class of therapies. In this Review, we discuss the applications of genome-editing technology throughout cardiovascular disease research and the prospect of in vivo genome-editing therapies in the future. We also describe some of the existing limitations of genome-editing tools that will need to be addressed if cardiovascular genome editing is to achieve its full scientific and therapeutic potential.

  5. Genome Editing Mediated by Primordial Germ Cell in Chicken.

    Science.gov (United States)

    Han, Jae Yong; Lee, Hong Jo

    2017-01-01

    Rapid development of genome editing technology has facilitated the studies on exploring specific gene functions and establishment of model animals. In livestock, the technology has contributed to create high value in industry fields, e.g., enhancing productivity or acquiring the resistance against disease. Meanwhile, genome editing in avian species has been emphasized because of their applicable possibilities in terms of highly productive chickens, disease-controlled avian lines, and development of novel biological models. Induction of exogenous gene using virus system or transposition in chicken primordial germ cells (PGCs) has been widely used for producing transgenic chicken, and recently developed programmable genome editing (PGE) technologies such as tale transcription activator-like effector nuclease (TALEN) and clustered regularly interspaced short palindromic repeat (CRISPR) and CRISPR-associated (Cas9) are expected to maximize the applicable potentials of avian species. In this regard, this chapter will cover the methods for producing genome-edited chicken by piggyBac transposition and gene targeting technology, TALEN, and CRISPR/Cas9.

  6. To edit or not to edit: regulation of ADAR editing specificity and efficiency.

    Science.gov (United States)

    Deffit, Sarah N; Hundley, Heather A

    2016-01-01

    Hundreds to millions of adenosine (A)-to-inosine (I) modifications are present in eukaryotic transcriptomes and play an essential role in the creation of proteomic and phenotypic diversity. As adenosine and inosine have different base-pairing properties, the functional consequences of these modifications or 'edits' include altering coding potential, splicing, and miRNA-mediated gene silencing of transcripts. However, rather than serving as a static control of gene expression, A-to-I editing provides a means to dynamically rewire the genetic code during development and in a cell-type specific manner. Interestingly, during normal development, in specific cells, and in both neuropathological diseases and cancers, the extent of RNA editing does not directly correlate with levels of the substrate mRNA or the adenosine deaminase that act on RNA (ADAR) editing enzymes, implying that cellular factors are required for spatiotemporal regulation of A-to-I editing. The factors that affect the specificity and extent of ADAR activity have been thoroughly dissected in vitro. Yet, we still lack a complete understanding of how specific ADAR family members can selectively deaminate certain adenosines while others cannot. Additionally, in the cellular environment, ADAR specificity and editing efficiency is likely to be influenced by cellular factors, which is currently an area of intense investigation. Data from many groups have suggested two main mechanisms for controlling A-to-I editing in the cell: (1) regulating ADAR accessibility to target RNAs and (2) protein-protein interactions that directly alter ADAR enzymatic activity. Recent studies suggest cis- and trans-acting RNA elements, heterodimerization and RNA-binding proteins play important roles in regulating RNA editing levels in vivo. WIREs RNA 2016, 7:113-127. doi: 10.1002/wrna.1319. © 2015 Wiley Periodicals, Inc.

  7. Ebola Virus and Marburg Virus

    Science.gov (United States)

    Ebola virus and Marburg virus Overview Ebola virus and Marburg virus are related viruses that cause hemorrhagic fevers — illnesses marked by severe bleeding (hemorrhage), organ failure and, in many ...

  8. Emerging tropical diseases in Australia. Part 5. Hendra virus.

    Science.gov (United States)

    Tulsiani, S M; Graham, G C; Moore, P R; Jansen, C C; Van Den Hurk, A F; Moore, F A J; Simmons, R J; Craig, S B

    2011-01-01

    Hendra virus (HeV) was first isolated in 1994, from a disease outbreak involving at least 21 horses and two humans in the Brisbane suburb of Hendra, Australia. The affected horses and humans all developed a severe but unidentified respiratory disease that resulted in the deaths of one of the human cases and the deaths or putting down of 14 of the horses. The virus, isolated by culture from a horse and the kidney of the fatal human case, was initially characterised as a new member of the genus Morbillivirus in the family Paramyxoviridae. Comparative sequence analysis of part of the matrix protein gene of the virus and the discovery that the virus had an exceptionally large genome subsequently led to HeV being assigned to a new genus, Henipavirus, along with Nipah virus (a newly emergent virus in pigs). The regular outbreaks of HeV-related disease that have occurred in Australia since 1994 have all been characterised by acute respiratory and neurological manifestations, with high levels of morbidity and mortality in the affected horses and humans. The modes of transmission of HeV remain largely unknown. Although fruit bats have been identified as natural hosts of the virus, direct bat-horse, bat-human or human-human transmission has not been reported. Human infection can occur via exposure to infectious urine, saliva or nasopharyngeal fluid from horses. The treatment options and efficacy are very limited and no vaccine exists. Reports on the outbreaks of HeV in Australia are collated in this review and the available data on the biology, transmission and detection of the pathogen are summarized and discussed.

  9. [Emergence of new viruses in Asia: is climate change involved?].

    Science.gov (United States)

    Chastel, C

    2004-11-01

    Tropical Africa is not the only area where deadly viruses have recently emerged. In South-East Asia severe epidemics of dengue hemorrhagic fever started in 1954 and flu pandemics have originated from China such as the Asian flu (H2N2) in 1957, the Hong-Kong flu (H3N2) in 1968, and the Russian flu (H1N1) in 1977. However, it is especially during the last ten years that very dangerous viruses for mankind have repeatedly developed in Asia, with the occurrence of Alkhurma hemorrhagic fever in Saudi Arabia (1995), avian flu (H5N1) in Hong-Kong (1997), Nipah virus encephalitis in Malaysia (1998,) and, above all, the SARS pandemic fever from Southern China (2002). The evolution of these viral diseases was probably not directly affected by climate change. In fact, their emergential success may be better explained by the development of large industry poultry flocks increasing the risks of epizootics, dietary habits, economic and demographic constraints, and negligence in the surveillance and reporting of the first cases.

  10. Connectivity editing for quadrilateral meshes

    KAUST Repository

    Peng, Chihan

    2011-12-01

    We propose new connectivity editing operations for quadrilateral meshes with the unique ability to explicitly control the location, orientation, type, and number of the irregular vertices (valence not equal to four) in the mesh while preserving sharp edges. We provide theoretical analysis on what editing operations are possible and impossible and introduce three fundamental operations to move and re-orient a pair of irregular vertices. We argue that our editing operations are fundamental, because they only change the quad mesh in the smallest possible region and involve the fewest irregular vertices (i.e., two). The irregular vertex movement operations are supplemented by operations for the splitting, merging, canceling, and aligning of irregular vertices. We explain how the proposed high-level operations are realized through graph-level editing operations such as quad collapses, edge flips, and edge splits. The utility of these mesh editing operations are demonstrated by improving the connectivity of quad meshes generated from state-of-art quadrangulation techniques.

  11. Connectivity editing for quadrilateral meshes

    KAUST Repository

    Peng, Chihan

    2011-12-12

    We propose new connectivity editing operations for quadrilateral meshes with the unique ability to explicitly control the location, orientation, type, and number of the irregular vertices (valence not equal to four) in the mesh while preserving sharp edges. We provide theoretical analysis on what editing operations are possible and impossible and introduce three fundamental operations to move and re-orient a pair of irregular vertices. We argue that our editing operations are fundamental, because they only change the quad mesh in the smallest possible region and involve the fewest irregular vertices (i.e., two). The irregular vertex movement operations are supplemented by operations for the splitting, merging, canceling, and aligning of irregular vertices. We explain how the proposed highlevel operations are realized through graph-level editing operations such as quad collapses, edge flips, and edge splits. The utility of these mesh editing operations are demonstrated by improving the connectivity of quad meshes generated from state-of-art quadrangulation techniques. © 2011 ACM.

  12. [Genome editing of industrial microorganism].

    Science.gov (United States)

    Zhu, Linjiang; Li, Qi

    2015-03-01

    Genome editing is defined as highly-effective and precise modification of cellular genome in a large scale. In recent years, such genome-editing methods have been rapidly developed in the field of industrial strain improvement. The quickly-updating methods thoroughly change the old mode of inefficient genetic modification, which is "one modification, one selection marker, and one target site". Highly-effective modification mode in genome editing have been developed including simultaneous modification of multiplex genes, highly-effective insertion, replacement, and deletion of target genes in the genome scale, cut-paste of a large DNA fragment. These new tools for microbial genome editing will certainly be applied widely, and increase the efficiency of industrial strain improvement, and promote the revolution of traditional fermentation industry and rapid development of novel industrial biotechnology like production of biofuel and biomaterial. The technological principle of these genome-editing methods and their applications were summarized in this review, which can benefit engineering and construction of industrial microorganism.

  13. Interactive Editing of Live Visuals

    Science.gov (United States)

    Müller, Pascal; Müller Arisona, Stefan; Schubiger-Banz, Simon; Specht, Matthias

    This paper describes novel concepts for the interactive composition of artistic real-time graphics, so-called live visuals. By establishing two fundamental techniques dealing with the structured media integration and the intrinsic design process, we significantly increase the efficiency of interactive editing in live visuals applications. First, we present a media manager that supports the user in both retrieval and utilization of automatically annotated digital media. The computer-assisted application of individual media items permits the interactive control of non-linear editing (NLE) of video in real-time. Second, we optimize the design process by introducing the design tree, which collects and organizes the artist's work in an intuitive way. Design tree operations provide interactive high-level editing methods which allow for exploration, combination, reuse, and evolution of designs before and particularly during the performance. We examined the effectiveness of our techniques on numerous long-lasting live performances from which representative examples are demonstrated.

  14. Boneless Pose Editing and Animation

    DEFF Research Database (Denmark)

    Bærentzen, Jakob Andreas; Hansen, Kristian Evers; Erleben, Kenny

    2007-01-01

    In this paper, we propose a pose editing and animation method for triangulated surfaces based on a user controlled partitioning of the model into deformable parts and rigid parts which are denoted handles. In our pose editing system, the user can sculpt a set of poses simply by transforming...... the handles for each pose. Using Laplacian editing, the deformable parts are deformed to match the handles. In our animation system the user can constrain one or several handles in order to define a new pose. New poses are interpolated from the examples poses, by solving a small non-linear optimization...... problem in order to obtain the interpolation weights. While the system can be used simply for building poses, it is also an animation system. The user can specify a path for a given constraint and the model is animated correspondingly....

  15. Editörden

    Directory of Open Access Journals (Sweden)

    Nadir Arıcan

    2007-04-01

    Full Text Available Değerli Adli Bilimci’ler, Dergimizin ilk baskısının yapıldığı 1996 yılından 2006 yılı sonuna kadar 11 ciltten oluşan dizisini ara vermeden kesintisiz olarak yayınlanma başarısını gösteren Adli Tıp Bülteni Yayın Kurulu adına saygı ile selamlıyoruz. Dergimizin 12. cildinin ilk sayısı, yayın kurulundaki görev değişikliği ile elinize ulaşıyor. “Adli Tıp Bülteni”ni tüm olumsuz koşullara karşın, siz alana emek veren adli bilimcilerin de büyük desteği ile yayın hayatım başarı ile sürdürdü. Bu başarıda başta editörlerimiz sayın Prof. Dr. Serpil Salaçin ve sayın Prof. Dr. Şebnem Korur Fincancı ile yayın kurulunda görev almış meslektaşlarımıza teşekkür ediyor ve desteklerinin artarak devam edeceğini ümit ediyoruz. Adli Tıp Bülteni, ilk editörü sayın Prof. Dr. Serpil Salaçin’in bültenin 1. sayısında belirttiği amaca uygun olarak, her geçen gün daha da güçlenerek yayın hayatını sürdürmektedir. Yayın akışında zaman zaman kesintiler olsa da, amacı doğrultusunda “alanındaki bilgi akışını sağlama ve bilimsel gelişmelerin önemli bir parçası olma özelliğini” Adli Tıp Uzmanları Derneği’nin resmi bilimsel yayın organı kimliği ile devam ettirmektedir. Hedefleri doğrultusunda uluslararası indekslerce taranan bir dergi olma yolunda ilk adımını atan dergimizin bu alandaki çalışmaları sayın Prof. Dr. Şebnem Korur Fincancı tarafından yürütülmektedir. Görevini genç meslektaşına devretmiş olsa da alanımızdaki uluslar arası deneyimi ile Adli Tıp Bülteni’ni çok farklı noktalara taşıyacağı inancındayım. Bu alanda yapacağı katkılardan dolayı sayın hocama biz kez daha teşekkür etmek istiyorum. Bundan böyle Adli Tıp Bülteni’ne yayınlanmak üzere gönderdiğiniz çalışmalarınızın değerlendirmesini daha hızlı yapabilmek ve baskı aşamasına getirmek amacı ile iletişimi elektronik ortamda yapmaya

  16. Tokamaks - Third Edition

    International Nuclear Information System (INIS)

    Rogister, A L

    2004-01-01

    John Wesson's well known book, now re-edited for the third time, provides an excellent introduction to fusion oriented plasma physics in tokamaks. The author's task was a very challenging one, for a confined plasma is a complex system characterised by a variety of dimensionless parameters and its properties change qualitatively when certain threshold values are reached in this multi-parameter space. As a consequence, theoretical description is required at different levels, which are complementary: particle orbits, kinetic and fluid descriptions, but also intuitive and empirical approaches. Theory must be carried out on many fronts: equilibrium, instabilities, heating, transport etc. Since the properties of the confined plasma depend on the boundary conditions, the physics of plasmas along open magnetic field lines and plasma surface interaction processes must also be accounted for. Those subjects (and others) are discussed in depth in chapters 2-9. Chapter 1 mostly deals with ignition requirements and the tokamak concept, while chapter 14 provides a list of useful relations: differential operators, collision times, characteristic lengths and frequencies, expressions for the neoclassical resistivity and heat conduction, the bootstrap current etc. The presentation is sufficiently broad and thorough that specialists within tokamak research can either pick useful and up-to-date information or find an authoritative introduction into other areas of the subject. It is also clear and concise so that it should provide an attractive and accurate initiation for those wishing to enter the field and for outsiders who would like to understand the concepts and be informed about the goals and challenges on the horizon. Validation of theoretical models requires adequately resolved experimental data for the various equilibrium profiles (clearly a challenge in the vicinity of transport barriers) and the fluctuations to which instabilities give rise. Chapter 10 is therefore devoted to

  17. Understanding Editing Behaviors in Multilingual Wikipedia.

    Science.gov (United States)

    Kim, Suin; Park, Sungjoon; Hale, Scott A; Kim, Sooyoung; Byun, Jeongmin; Oh, Alice H

    2016-01-01

    Multilingualism is common offline, but we have a more limited understanding of the ways multilingualism is displayed online and the roles that multilinguals play in the spread of content between speakers of different languages. We take a computational approach to studying multilingualism using one of the largest user-generated content platforms, Wikipedia. We study multilingualism by collecting and analyzing a large dataset of the content written by multilingual editors of the English, German, and Spanish editions of Wikipedia. This dataset contains over two million paragraphs edited by over 15,000 multilingual users from July 8 to August 9, 2013. We analyze these multilingual editors in terms of their engagement, interests, and language proficiency in their primary and non-primary (secondary) languages and find that the English edition of Wikipedia displays different dynamics from the Spanish and German editions. Users primarily editing the Spanish and German editions make more complex edits than users who edit these editions as a second language. In contrast, users editing the English edition as a second language make edits that are just as complex as the edits by users who primarily edit the English edition. In this way, English serves a special role bringing together content written by multilinguals from many language editions. Nonetheless, language remains a formidable hurdle to the spread of content: we find evidence for a complexity barrier whereby editors are less likely to edit complex content in a second language. In addition, we find that multilinguals are less engaged and show lower levels of language proficiency in their second languages. We also examine the topical interests of multilingual editors and find that there is no significant difference between primary and non-primary editors in each language.

  18. Understanding Editing Behaviors in Multilingual Wikipedia.

    Directory of Open Access Journals (Sweden)

    Suin Kim

    Full Text Available Multilingualism is common offline, but we have a more limited understanding of the ways multilingualism is displayed online and the roles that multilinguals play in the spread of content between speakers of different languages. We take a computational approach to studying multilingualism using one of the largest user-generated content platforms, Wikipedia. We study multilingualism by collecting and analyzing a large dataset of the content written by multilingual editors of the English, German, and Spanish editions of Wikipedia. This dataset contains over two million paragraphs edited by over 15,000 multilingual users from July 8 to August 9, 2013. We analyze these multilingual editors in terms of their engagement, interests, and language proficiency in their primary and non-primary (secondary languages and find that the English edition of Wikipedia displays different dynamics from the Spanish and German editions. Users primarily editing the Spanish and German editions make more complex edits than users who edit these editions as a second language. In contrast, users editing the English edition as a second language make edits that are just as complex as the edits by users who primarily edit the English edition. In this way, English serves a special role bringing together content written by multilinguals from many language editions. Nonetheless, language remains a formidable hurdle to the spread of content: we find evidence for a complexity barrier whereby editors are less likely to edit complex content in a second language. In addition, we find that multilinguals are less engaged and show lower levels of language proficiency in their second languages. We also examine the topical interests of multilingual editors and find that there is no significant difference between primary and non-primary editors in each language.

  19. Kanyawara Virus: A Novel Rhabdovirus Infecting Newly Discovered Nycteribiid Bat Flies Infesting Previously Unknown Pteropodid Bats in Uganda.

    Science.gov (United States)

    Goldberg, Tony L; Bennett, Andrew J; Kityo, Robert; Kuhn, Jens H; Chapman, Colin A

    2017-07-13

    Bats are natural reservoir hosts of highly virulent pathogens such as Marburg virus, Nipah virus, and SARS coronavirus. However, little is known about the role of bat ectoparasites in transmitting and maintaining such viruses. The intricate relationship between bats and their ectoparasites suggests that ectoparasites might serve as viral vectors, but evidence to date is scant. Bat flies, in particular, are highly specialized obligate hematophagous ectoparasites that incidentally bite humans. Using next-generation sequencing, we discovered a novel ledantevirus (mononegaviral family Rhabdoviridae, genus Ledantevirus) in nycteribiid bat flies infesting pteropodid bats in western Uganda. Mitochondrial DNA analyses revealed that both the bat flies and their bat hosts belong to putative new species. The coding-complete genome of the new virus, named Kanyawara virus (KYAV), is only distantly related to that of its closest known relative, Mount Elgon bat virus, and was found at high titers in bat flies but not in blood or on mucosal surfaces of host bats. Viral genome analysis indicates unusually low CpG dinucleotide depletion in KYAV compared to other ledanteviruses and rhabdovirus groups, with KYAV displaying values similar to rhabdoviruses of arthropods. Our findings highlight the possibility of a yet-to-be-discovered diversity of potentially pathogenic viruses in bat ectoparasites.

  20. Medical writing, revising and editing

    DEFF Research Database (Denmark)

    Pilegaard, Morten

    2006-01-01

    The globalization of science makes medical writing, editing and revision a rapidly growing field of linguistic study and practice. Medical science texts are written according to uniform, general guidelines and medical genres have become highly conventionalized in terms of structure and linguistic...... form. Medical editing often takes the form of peer review and mainly addresses issues of contents and overall validity. Medical revision incorporates the checking of the macrostructure and the microstructure of the text, its language and style and its suitability for the target reader or client...

  1. Handbook of ecotoxicology, second edition

    Science.gov (United States)

    Hoffman, David J.; Rattner, Barnett A.; Burton, G. Allen; Cairns, John

    2003-01-01

    Handbook of Ecotoxicology, Second Edition focuses on toxic substances and how they affect ecosystems worldwide. It presents methods for quantifying and measuring ecotoxicological effects in the field and in the lab, as well as methods for estimating, predicting, and modeling in ecotoxicology studies. Completely revised and updated with 18 new chapters, this second edition includes contributions from over 75 international experts. Also, a Technical Review Board reviewed all manuscripts for accuracy and currency. This authoritative work is the definitive reference for students, researchers, consultants, and other professionals in the environmental sciences, toxicology, chemistry, biology, and ecology - in academia, industry, and government.

  2. Beginning XML, 5th Edition

    CERN Document Server

    Fawcett, Joe; Quin, Liam R E

    2012-01-01

    A complete update covering the many advances to the XML language The XML language has become the standard for writing documents on the Internet and is constantly improving and evolving. This new edition covers all the many new XML-based technologies that have appeared since the previous edition four years ago, providing you with an up-to-date introductory guide and reference. Packed with real-world code examples, best practices, and in-depth coverage of the most important and relevant topics, this authoritative resource explores both the advantages and disadvantages of XML and addresses the mo

  3. Introducing ZBrush 3rd Edition

    CERN Document Server

    Keller, Eric

    2012-01-01

    Learn ZBrush inside and out with this updated new edition Get totally comfortable sculpting in a digital environment with the latest edition of this bestselling beginner's guide to ZBrush. Fully updated for the newest version of the software, ZBrush 4R3, this book dispels any fears you might have about the difficulty of using ZBrush and soon has you creating realistic, cartoon, and organic models with flair. Learn all the essentials, as you complete fun tutorials on painting, meshes, organic scripting, hard surface sculpting, lighting, rendering, and more. Introduces you to ZBrush, the sculpt

  4. Language Editing at Astronomy & Astrophysics

    Science.gov (United States)

    Adams, J.

    2011-07-01

    In 2002, the A&A Board of Directors voted that all articles must be written in English and decided to improve the overall quality of the language in the articles with the help of a team of language editors. This article reviews the general advantages of editing the English expression and describes both the aims of this effort and its place in the full publication process. This is followed by the Guide to language editing that has been available on the Journal's website for several years now.

  5. Genome editing comes of age.

    Science.gov (United States)

    Kim, Jin-Soo

    2016-09-01

    Genome editing harnesses programmable nucleases to cut and paste genetic information in a targeted manner in living cells and organisms. Here, I review the development of programmable nucleases, including zinc finger nucleases (ZFNs), TAL (transcription-activator-like) effector nucleases (TALENs) and CRISPR (cluster of regularly interspaced palindromic repeats)-Cas9 (CRISPR-associated protein 9) RNA-guided endonucleases (RGENs). I specifically highlight the key advances that set the foundation for the rapid and widespread implementation of CRISPR-Cas9 genome editing approaches that has revolutionized the field.

  6. Shielded Metal Arc Pipe Welding. Teacher Edition. Second Edition.

    Science.gov (United States)

    Fortney, Clarence; And Others

    This second edition of the shielded metal arc pipe welding curriculum guide presents both basic and advanced pipe welding skills. All specifications for procedure and welder qualification are presented according to national standards. The standards also include the test position for both groove and fillet pipe welding. The guide contains three…

  7. Editing Dialogics: Ethical Issues Concerning Student Contributors in Edited Collections.

    Science.gov (United States)

    Tassoni, John Paul; Tayko, Gail

    2003-01-01

    Discusses the authors' attempts to enact a process they have come to call "editing dialogics" and its relation to the Conference on College Composition and Communication's "Guidelines for the Ethical Treatment of Students and Student Writing in Composition Studies." Makes their roles explicit to expose elements of scholarly…

  8. Gas Tungsten Arc Welding and Plasma Arc Cutting. Teacher Edition [and] Student Edition [and] Student Workbook. Second Edition.

    Science.gov (United States)

    Harper, Eddie; Knapp, John

    This packet of instructional materials for a gas tungsten arc welding (GTAW) and plasma arc cutting course is comprised of a teacher edition, student edition, and student workbook. The teacher edition consists of introductory pages and teacher pages. Introductory pages include training and competency profile, state duty/task crosswalk,…

  9. Gas Metal Arc Welding and Flux-Cored Arc Welding. Third Edition. Teacher Edition [and] Student Edition [and] Student Workbook.

    Science.gov (United States)

    Knapp, John; Harper, Eddie

    This packet, containing a teacher's edition, a student edition, and a student workbook, introduces students to high deposition welding and processes for "shielding" a weld. In addition to general information, the teacher edition consists of introductory pages and teacher pages, as well as unit information that corresponds to the…

  10. RNA editing machinery in plant organelles.

    Science.gov (United States)

    Yan, Junjie; Zhang, Qunxia; Yin, Ping

    2018-02-01

    RNA editing is a type of post-transcriptional modification that includes nucleotide insertion/deletion or conversion. Different categories of RNA editing have been widely observed in distinct RNAs from divergent organisms. In flowering plants, RNA editing usually alters cytidine to uridine in plastids and mitochondria, playing important roles in various plant developmental processes, including organelle biogenesis, adaptation to environmental changes, and signal transduction. Numerous studies have demonstrated that a number of factors are involved in plant RNA editing, such as pentatricopeptide repeat (PPR) proteins, multiple organelle RNA editing factors (MORF, also known as RIP), organelle RNA recognition motif (ORRM) containing proteins, protoporphyrinogen IX oxidase 1 (PPO1) and organelle zinc finger 1 (OZ1). These factors play diverse roles in plant RNA editing due to their distinct characteristics. In this review, we discuss the functional roles of the individual editing factors and their associations in plant RNA editing.

  11. Protection from Hendra virus infection with Canarypox recombinant vaccine.

    Science.gov (United States)

    Guillaume-Vasselin, Vanessa; Lemaitre, Laurent; Dhondt, Kévin P; Tedeschi, Laurence; Poulard, Amelie; Charreyre, Catherine; Horvat, Branka

    2016-01-01

    Hendra virus (HeV) is an emerging zoonotic pathogen, which causes severe respiratory illness and encephalitis in humans and horses. Since its first appearance in 1994, spillovers of HeV from its natural reservoir fruit bats occur on almost an annual basis. The high mortality rate in both humans and horses and the wide-ranging reservoir distribution are making HeV a serious public health problem, especially for people exposed to sick horses. This study has aimed to develop an efficient low-cost HeV vaccine for horses based on Canarypox recombinant vector expressing HeV glycoproteins, attachment glycoprotein (G) and fusion protein (F). This vaccine was used to immunise hamsters and then challenged intraperitoneally with HeV 3 weeks later. The higher tested dose of the vaccine efficiently prevented oropharyngeal virus shedding and protected animals from clinical disease and virus-induced mortality. Vaccine induced generation of seroneutralising antibodies and prevented virus-induced histopathological changes and a production of viral RNA and antigens in animal tissues. Interestingly, some vaccinated animals, including those immunised at a lower dose, were protected in the absence of detectable specific antibodies, suggesting the induction of an efficient virus-specific cellular immunity. Finally, ponies immunised using the same vaccination protocol as hamsters developed strong seroneutralising titres against both HeV and closely related Nipah virus, indicating that this vaccine may have the ability to induce cross-protection against Henipavirus infection. These data suggest that Canarypox-based vectors encoding for HeV glycoproteins present very promising new vaccine candidate to prevent infection and shedding of the highly lethal HeV.

  12. Human Genome Editing and Ethical Considerations.

    Science.gov (United States)

    Krishan, Kewal; Kanchan, Tanuj; Singh, Bahadur

    2016-04-01

    Editing human germline genes may act as boon in some genetic and other disorders. Recent editing of the genome of the human embryo with the CRISPR/Cas9 editing tool generated a debate amongst top scientists of the world for the ethical considerations regarding its effect on the future generations. It needs to be seen as to what transformation human gene editing brings to humankind in the times to come.

  13. Development of human monoclonal antibodies against diseases caused by emerging and biodefense-related viruses.

    Science.gov (United States)

    Zhu, Zhongyu; Dimitrov, Antony S; Chakraborti, Samitabh; Dimitrova, Dimana; Xiao, Xiaodong; Broder, Christopher C; Dimitrov, Dimiter S

    2006-02-01

    Polyclonal antibodies have a century-old history of being effective against some viruses; recently, monoclonal antibodies (mAbs) have also shown success. The humanized mAb Synagis (palivizumab), which is still the only mAb against a viral disease approved by the US FDA, has been widely used as a prophylactic measure against respiratory syncytial virus infections in neonates and immunocompromised individuals. The first fully human mAbs against two other paramyxoviruses, Hendra and Nipah virus, which can cause high (up to 75%) mortality, were recently developed; one of them, m101, showed exceptional potency against infectious virus. In an amazing pace of research, several potent human mAbs targeting the severe acute respiratory syndrome coronavirus S glycoprotein that can affect infections in animal models have been developed months after the virus was identified in 2003. A potent humanized mAb with therapeutic potential was recently developed against the West Nile virus. The progress in developing neutralizing human mAbs against Ebola, Crimean-Congo hemorrhagic fever, vaccinia and other emerging and biodefense-related viruses is slow. A major problem in the development of effective therapeutic agents against viruses, including therapeutic antibodies, is the viruses' heterogeneity and mutability. A related problem is the low binding affinity of crossreactive antibodies able to neutralize a variety of primary isolates. Combinations of mAbs or mAbs with other drugs, and/or the identification of potent new mAbs and their derivatives that target highly conserved viral structures, which are critical for virus entry into cells, are some of the possible solutions to these problems, and will continue to be a major focus of antiviral research.

  14. Transmission or Within-Host Dynamics Driving Pulses of Zoonotic Viruses in Reservoir–Host Populations

    Science.gov (United States)

    Plowright, Raina K.; Peel, Alison J.; Streicker, Daniel G.; Gilbert, Amy T.; McCallum, Hamish; Wood, James; Baker, Michelle L.; Restif, Olivier

    2016-01-01

    Progress in combatting zoonoses that emerge from wildlife is often constrained by limited knowledge of the biology of pathogens within reservoir hosts. We focus on the host–pathogen dynamics of four emerging viruses associated with bats: Hendra, Nipah, Ebola, and Marburg viruses. Spillover of bat infections to humans and domestic animals often coincides with pulses of viral excretion within bat populations, but the mechanisms driving such pulses are unclear. Three hypotheses dominate current research on these emerging bat infections. First, pulses of viral excretion could reflect seasonal epidemic cycles driven by natural variations in population densities and contact rates among hosts. If lifelong immunity follows recovery, viruses may disappear locally but persist globally through migration; in either case, new outbreaks occur once births replenish the susceptible pool. Second, epidemic cycles could be the result of waning immunity within bats, allowing local circulation of viruses through oscillating herd immunity. Third, pulses could be generated by episodic shedding from persistently infected bats through a combination of physiological and ecological factors. The three scenarios can yield similar patterns in epidemiological surveys, but strategies to predict or manage spillover risk resulting from each scenario will be different. We outline an agenda for research on viruses emerging from bats that would allow for differentiation among the scenarios and inform development of evidence-based interventions to limit threats to human and animal health. These concepts and methods are applicable to a wide range of pathogens that affect humans, domestic animals, and wildlife. PMID:27489944

  15. Strategies of Qualitative Inquiry. Third Edition

    Science.gov (United States)

    Denzin, Norman K., Ed.; Lincoln, Yvonna S., Ed.

    2007-01-01

    "Strategies of Qualitative Inquiry, Third Edition," the second volume in the paperback version of "The SAGE Handbook of Qualitative Research, 3rd Edition," consists of Part III of the handbook ("Strategies of Inquiry"). "Strategies of Qualitative Inquiry, Third Edition" presents the major tactics--historically, the research methods--that…

  16. Promoting School Success. Third Edition

    Science.gov (United States)

    Lovitt, Thomas C.

    2007-01-01

    Like its two predecessors, "Preventing School Dropouts" [C1991] and "Preventing School Failure" [C2000], this third edition is a book about teaching. Although primarily written for teachers, tutors and parents may also find this book helpful. It is a collection of carefully selected teaching techniques aimed at helping young adults learn important…

  17. Money and Schools. Fifth Edition

    Science.gov (United States)

    Thompson, David C.; Crampton, Faith E.; Wood, R. Craig

    2012-01-01

    In the new edition of this essential, all-inclusive text, the authors provide more important research for future principals and others enrolled in graduate-level school finance courses. Written in a style that is highly readable, the book offers strong connections to real-world experiences. Readers get both a broad overview of funding concepts and…

  18. Nuclear Electricity. 5th Edition.

    Science.gov (United States)

    Hore-Lacy, Ian

    Educators must address the need for young people to be informed about both the scientific concepts and the reasons for controversy when dealing with controversial issues. Young people must be given the opportunity to form their own opinions when presented with evidence for conflicting arguments. Previous editions of "Nuclear Electricity" have…

  19. Veterinary Microbiology, 3rd Edition

    Science.gov (United States)

    Veterinary Microbiology, Third Edition is organized into four sections and begins with an updated and expanded introductory section on infectious disease pathogenesis, diagnosis and clinical management. The second section covers bacterial and fungal pathogens, and the third section describes viral d...

  20. Gene editing. Time to reflection.

    OpenAIRE

    Santaló Pedro, Josep

    2017-01-01

    The development of new gene editing technologies and their special characteristics have led to a passionate debate on the suitability and reliability of their use both in plant and animal species and in the human species itself. A brief analysis of the arguments used in this debate as well as a summary of some of the most relevant statements in this regard is made.

  1. In Vivo Genome Editing Restores Dystrophin Expression and Cardiac Function in Dystrophic Mice.

    Science.gov (United States)

    El Refaey, Mona; Xu, Li; Gao, Yandi; Canan, Benjamin D; Adesanya, T M Ayodele; Warner, Sarah C; Akagi, Keiko; Symer, David E; Mohler, Peter J; Ma, Jianjie; Janssen, Paul M L; Han, Renzhi

    2017-09-29

    Duchenne muscular dystrophy is a severe inherited form of muscular dystrophy caused by mutations in the reading frame of the dystrophin gene disrupting its protein expression. Dystrophic cardiomyopathy is a leading cause of death in Duchenne muscular dystrophy patients, and currently no effective treatment exists to halt its progression. Recent advancement in genome editing technologies offers a promising therapeutic approach in restoring dystrophin protein expression. However, the impact of this approach on Duchenne muscular dystrophy cardiac function has yet to be evaluated. Therefore, we assessed the therapeutic efficacy of CRISPR (clustered regularly interspaced short palindromic repeats)-mediated genome editing on dystrophin expression and cardiac function in mdx/Utr +/- mice after a single systemic delivery of recombinant adeno-associated virus. To examine the efficiency and physiological impact of CRISPR-mediated genome editing on cardiac dystrophin expression and function in dystrophic mice. Here, we packaged SaCas9 (clustered regularly interspaced short palindromic repeat-associated 9 from Staphylococcus aureus ) and guide RNA constructs into an adeno-associated virus vector and systemically delivered them to mdx/Utr +/- neonates. We showed that CRIPSR-mediated genome editing efficiently excised the mutant exon 23 in dystrophic mice, and immunofluorescence data supported the restoration of dystrophin protein expression in dystrophic cardiac muscles to a level approaching 40%. Moreover, there was a noted restoration in the architecture of cardiac muscle fibers and a reduction in the extent of fibrosis in dystrophin-deficient hearts. The contractility of cardiac papillary muscles was also restored in CRISPR-edited cardiac muscles compared with untreated controls. Furthermore, our targeted deep sequencing results confirmed that our adeno-associated virus-CRISPR/Cas9 strategy was very efficient in deleting the ≈23 kb of intervening genomic sequences. This

  2. Configuring Symantec AntiVirus

    CERN Document Server

    Shimonski, Robert

    2003-01-01

    This is the only book that will teach system administrators how to configure, deploy, and troubleshoot Symantec Enterprise Edition in an enterprise network. The book will reflect Symantec''s philosophy of "Centralized Antivirus Management." For the same reasons that Symantec bundled together these previously separate products, the book will provide system administrators with a holistic approach to defending their networks from malicious viruses. This book will also serve as a Study Guide for those pursuing Symantec Product Specialist Certifications.Configuring Symantec AntiVirus Enterprise Edition contains step-by-step instructions on how to Design, implement and leverage the Symantec Suite of products in the enterprise.ØFirst book published on market leading product and fast-growing certification. Despite the popularity of Symantec''s products and Symantec Product Specialist certifications, there are no other books published or announced.ØLess expensive substitute for costly on-sight training. Symantec off...

  3. Diesel Technology: Steering and Suspension. Second Edition. Teacher Edition [and] Student Edition.

    Science.gov (United States)

    Miller, Roger; Scarberry, Terry; Tesch, Carl; Kellum, Mary

    These teacher and student editions on steering and suspension are part of the diesel mechanics series of instructional materials. The series aligns with the medium/heavy duty truck task list developed by the National Automotive Technicians Education Foundation and used by the National Institute for Automotive Service Excellence in the…

  4. Diesel Technology: Safety Skills. Teacher Edition [and] Student Edition. Second Edition.

    Science.gov (United States)

    Kellum, Mary

    Teacher and student editions of this document are one in a series of competency-based instructional materials for diesel technology programs. The series aligns with the medium/heavy diesel duty truck task list used by the National Institute for Automotive Service Excellence in the certification of medium/heavy duty truck technicians. Introductory…

  5. Editing CCR5: a novel approach to HIV gene therapy.

    Science.gov (United States)

    Cornu, Tatjana I; Mussolino, Claudio; Bloom, Kristie; Cathomen, Toni

    2015-01-01

    Acquired immunodeficiency syndrome (AIDS) is a life-threatening disorder caused by infection of individuals with the human immunodeficiency virus (HIV). Entry of HIV-1 into target cells depends on the presence of two surface proteins on the cell membrane: CD4, which serves as the main receptor, and either CCR5 or CXCR4 as a co-receptor. A limited number of people harbor a genomic 32-bp deletion in the CCR5 gene (CCR5∆32), leading to expression of a truncated gene product that provides resistance to HIV-1 infection in individuals homozygous for this mutation. Moreover, allogeneic hematopoietic stem cell (HSC) transplantation with CCR5∆32 donor cells seems to confer HIV-1 resistance to the recipient as well. However, since Δ32 donors are scarce and allogeneic HSC transplantation is not exempt from risks, the development of gene editing tools to knockout CCR5 in the genome of autologous cells is highly warranted. Targeted gene editing can be accomplished with designer nucleases, which essentially are engineered restriction enzymes that can be designed to cleave DNA at specific sites. During repair of these breaks, the cellular repair pathway often introduces small mutations at the break site, which makes it possible to disrupt the ability of the targeted locus to express a functional protein, in this case CCR5. Here, we review the current promise and limitations of CCR5 gene editing with engineered nucleases, including factors affecting the efficiency of gene disruption and potential off-target effects.

  6. Statistical Physics Approaches to RNA Editing

    Science.gov (United States)

    Bundschuh, Ralf

    2012-02-01

    The central dogma of molecular Biology states that DNA is transcribed base by base into RNA which is in turn translated into proteins. However, some organisms edit their RNA before translation by inserting, deleting, or substituting individual or short stretches of bases. In many instances the mechanisms by which an organism recognizes the positions at which to edit or by which it performs the actual editing are unknown. One model system that stands out by its very high rate of on average one out of 25 bases being edited are the Myxomycetes, a class of slime molds. In this talk we will show how the computational methods and concepts from statistical Physics can be used to analyze DNA and protein sequence data to predict editing sites in these slime molds and to guide experiments that identified previously unknown types of editing as well as the complete set of editing events in the slime mold Physarum polycephalum.

  7. Progress and prospects in plant genome editing.

    Science.gov (United States)

    Yin, Kangquan; Gao, Caixia; Qiu, Jin-Long

    2017-07-31

    The emergence of sequence-specific nucleases that enable genome editing is revolutionizing basic and applied biology. Since the introduction of CRISPR-Cas9, genome editing has become widely used in transformable plants for characterizing gene function and improving traits, mainly by inducing mutations through non-homologous end joining of double-stranded breaks generated by CRISPR-Cas9. However, it would be highly desirable to perform precision gene editing in plants, especially in transformation-recalcitrant species. Recently developed Cas9 variants, novel RNA-guided nucleases and base-editing systems, and DNA-free CRISPR-Cas9 delivery methods now provide great opportunities for plant genome engineering. In this Review Article, we describe the current status of plant genome editing, focusing on newly developed genome editing tools and methods and their potential applications in plants. We also discuss the specific challenges facing plant genome editing, and future prospects.

  8. Henipavirus Mediated Membrane Fusion, Virus Entry and Targeted Therapeutics

    Directory of Open Access Journals (Sweden)

    Dimitar B. Nikolov

    2012-02-01

    Full Text Available The Paramyxoviridae genus Henipavirus is presently represented by the type species Hendra and Nipah viruses which are both recently emerged zoonotic viral pathogens responsible for repeated outbreaks associated with high morbidity and mortality in Australia, Southeast Asia, India and Bangladesh. These enveloped viruses bind and enter host target cells through the coordinated activities of their attachment (G and class I fusion (F envelope glycoproteins. The henipavirus G glycoprotein interacts with host cellular B class ephrins, triggering conformational alterations in G that lead to the activation of the F glycoprotein, which facilitates the membrane fusion process. Using the recently published structures of HeV-G and NiV-G and other paramyxovirus glycoproteins, we review the features of the henipavirus envelope glycoproteins that appear essential for mediating the viral fusion process, including receptor binding, G-F interaction, F activation, with an emphasis on G and the mutations that disrupt viral infectivity. Finally, recent candidate therapeutics for henipavirus-mediated disease are summarized in light of their ability to inhibit HeV and NiV entry by targeting their G and F glycoproteins.

  9. A recombinant Hendra virus G glycoprotein-based subunit vaccine protects ferrets from lethal Hendra virus challenge.

    Science.gov (United States)

    Pallister, Jackie; Middleton, Deborah; Wang, Lin-Fa; Klein, Reuben; Haining, Jessica; Robinson, Rachel; Yamada, Manabu; White, John; Payne, Jean; Feng, Yan-Ru; Chan, Yee-Peng; Broder, Christopher C

    2011-08-05

    The henipaviruses, Hendra virus (HeV) and Nipah virus (NiV), are two deadly zoonotic viruses for which no vaccines or therapeutics have yet been approved for human or livestock use. In 14 outbreaks since 1994 HeV has been responsible for multiple fatalities in horses and humans, with all known human infections resulting from close contact with infected horses. A vaccine that prevents virus shedding in infected horses could interrupt the chain of transmission to humans and therefore prevent HeV disease in both. Here we characterise HeV infection in a ferret model and show that it closely mirrors the disease seen in humans and horses with induction of systemic vasculitis, including involvement of the pulmonary and central nervous systems. This model of HeV infection in the ferret was used to assess the immunogenicity and protective efficacy of a subunit vaccine based on a recombinant soluble version of the HeV attachment glycoprotein G (HeVsG), adjuvanted with CpG. We report that ferrets vaccinated with a 100 μg, 20 μg or 4 μg dose of HeVsG remained free of clinical signs of HeV infection following a challenge with 5000 TCID₅₀ of HeV. In addition, and of considerable importance, no evidence of virus or viral genome was detected in any tissues or body fluids in any ferret in the 100 and 20 μg groups, while genome was detected in the nasal washes only of one animal in the 4 μg group. Together, our findings indicate that 100 μg or 20 μg doses of HeVsG vaccine can completely prevent a productive HeV infection in the ferret, suggesting that vaccination to prevent the infection and shedding of HeV is possible. Copyright © 2011 Elsevier Ltd. All rights reserved.

  10. Editing as a psychological practice.

    Science.gov (United States)

    Beebe, John

    2006-06-01

    The experience of the Jungian analyst in the role of editor of manuscripts by creative colleagues is examined. Historical precedents include Michael Fordham's editorial correspondence with Jung around the latter's synchronicity essay; Jung's handling of manuscripts submitted by Sabina Spielrein to the Jahrbuch für psychoanalytische und psychopathologische Forschungen and various authors to the Zentralblatt für Psychotherapie und ihre Grenzgebiete, and the author's close editing of a paper submitted by Andrew Samuels to the Journal of Analytical Psychology. In addition to mustering an adequate amount of generosity, erudition, and availability, the analytic editor must know how to clarify a psychological argument and to gauge the psychological impact of the written text. Notwithstanding transference/countertransference phenomena that can emerge around issues of competition, envy, and territoriality when author and editor are also fellow-authors working in the same field, the editor needs to be comfortable about serving as the author's selfobject and midwife. From an analytic perspective, although communicating decisions about the best way to put ideas into words can sometimes attract transference to the editor, the more profound transference that analysts experience in the editing situation is toward the text being edited, which helps to motivate donated time spent caring for journal manuscripts.

  11. RNA editing in plants and its evolution.

    Science.gov (United States)

    Takenaka, Mizuki; Zehrmann, Anja; Verbitskiy, Daniil; Härtel, Barbara; Brennicke, Axel

    2013-01-01

    RNA editing alters the identity of nucleotides in RNA molecules such that the information for a protein in the mRNA differs from the prediction of the genomic DNA. In chloroplasts and mitochondria of flowering plants, RNA editing changes C nucleotides to U nucleotides; in ferns and mosses, it also changes U to C. The approximately 500 editing sites in mitochondria and 40 editing sites in plastids of flowering plants are individually addressed by specific proteins, genes for which are amplified in plant species with organellar RNA editing. These proteins contain repeat elements that bind to cognate RNA sequence motifs just 5' to the edited nucleotide. In flowering plants, the site-specific proteins interact selectively with individual members of a different, smaller family of proteins. These latter proteins may be connectors between the site-specific proteins and the as yet unknown deaminating enzymatic activity.

  12. Connectivity editing for quad-dominant meshes

    KAUST Repository

    Peng, Chihan

    2013-08-01

    We propose a connectivity editing framework for quad-dominant meshes. In our framework, the user can edit the mesh connectivity to control the location, type, and number of irregular vertices (with more or fewer than four neighbors) and irregular faces (non-quads). We provide a theoretical analysis of the problem, discuss what edits are possible and impossible, and describe how to implement an editing framework that realizes all possible editing operations. In the results, we show example edits and illustrate the advantages and disadvantages of different strategies for quad-dominant mesh design. © 2013 The Author(s) Computer Graphics Forum © 2013 The Eurographics Association and John Wiley & Sons Ltd.

  13. Operational Transformation In Co-Operative Editing

    Directory of Open Access Journals (Sweden)

    Mandeep Kaur

    2015-08-01

    Full Text Available Cooperative Editing Systems in real-time allows a virtual team to view and edit a shared document at the same time. The document shared must be synchronized in order to ensure consistency for all the participants. This paper describes the Operational Transformation the evolution of its techniques its various applications major issues and achievements. In addition this paper will present working of a platform where two users can edit a code programming file at the same time.

  14. ECHO virus

    Science.gov (United States)

    ... page: //medlineplus.gov/ency/article/001340.htm ECHO virus To use the sharing features on this page, please enable JavaScript. Enteric cytopathic human orphan (ECHO) viruses are a group of viruses that can lead ...

  15. New insights into the Hendra virus attachment and entry process from structures of the virus G glycoprotein and its complex with Ephrin-B2.

    Directory of Open Access Journals (Sweden)

    Kai Xu

    Full Text Available Hendra virus and Nipah virus, comprising the genus Henipavirus, are recently emerged, highly pathogenic and often lethal zoonotic agents against which there are no approved therapeutics. Two surface glycoproteins, the attachment (G and fusion (F, mediate host cell entry. The crystal structures of the Hendra G glycoprotein alone and in complex with the ephrin-B2 receptor reveal that henipavirus uses Tryptophan 122 on ephrin-B2/B3 as a "latch" to facilitate the G-receptor association. Structural-based mutagenesis of residues in the Hendra G glycoprotein at the receptor binding interface document their importance for viral attachments and entry, and suggest that the stability of the Hendra-G-ephrin attachment complex does not strongly correlate with the efficiency of viral entry. In addition, our data indicates that conformational rearrangements of the G glycoprotein head domain upon receptor binding may be the trigger leading to the activation of the viral F fusion glycoprotein during virus infection.

  16. Activity and specificity of TRV-mediated gene editing in plants

    KAUST Repository

    Ali, Zahir

    2015-06-03

    © 2015 Taylor and Francis Group, LLC. Plant trait engineering requires efficient targeted genome-editing technologies. Clustered regularly interspaced palindromic repeats (CRISPRs)/ CRISPR associated (Cas) type II system is used for targeted genome-editing applications across eukaryotic species including plants. Delivery of genome engineering reagents and recovery of mutants remain challenging tasks for in planta applications. Recently, we reported the development of Tobacco rattle virus (TRV)-mediated genome editing in Nicotiana benthamiana. TRV infects the growing points and possesses small genome size; which facilitate cloning, multiplexing, and agroinfections. Here, we report on the persistent activity and specificity of the TRV-mediated CRISPR/Cas9 system for targeted modification of the Nicotiana benthamiana genome. Our data reveal the persistence of the TRVmediated Cas9 activity for up to 30 d post-agroinefection. Further, our data indicate that TRV-mediated genome editing exhibited no off-target activities at potential off-targets indicating the precision of the system for plant genome engineering. Taken together, our data establish the feasibility and exciting possibilities of using virus-mediated CRISPR/Cas9 for targeted engineering of plant genomes.

  17. Fuel Cell Handbook, Fourth Edition

    Energy Technology Data Exchange (ETDEWEB)

    Stauffer, D.B; Hirschenhofer, J.H.; Klett, M.G.; Engleman, R.R.

    1998-11-01

    Robust progress has been made in fuel cell technology since the previous edition of the Fuel Cell Handbook was published in January 1994. This Handbook provides a foundation in fuel cells for persons wanting a better understanding of the technology, its benefits, and the systems issues that influence its application. Trends in technology are discussed, including next-generation concepts that promise ultra high efficiency and low cost, while providing exceptionally clean power plant systems. Section 1 summarizes fuel cell progress since the last edition and includes existing power plant nameplate data. Section 2 addresses the thermodynamics of fuel cells to provide an understanding of fuel cell operation at two levels (basic and advanced). Sections 3 through 6 describe the four major fuel cell types and their performance based on cell operating conditions. The section on polymer electrolyte membrane fuel cells has been added to reflect their emergence as a significant fuel cell technology. Phosphoric acid, molten carbonate, and solid oxide fuel cell technology description sections have been updated from the previous edition. New information indicates that manufacturers have stayed with proven cell designs, focusing instead on advancing the system surrounding the fuel cell to lower life cycle costs. Section 7, Fuel Cell Systems, has been significantly revised to characterize near-term and next-generation fuel cell power plant systems at a conceptual level of detail. Section 8 provides examples of practical fuel cell system calculations. A list of fuel cell URLs is included in the Appendix. A new index assists the reader in locating specific information quickly.

  18. GPU Computing Gems Emerald Edition

    CERN Document Server

    Hwu, Wen-mei W

    2011-01-01

    ".the perfect companion to Programming Massively Parallel Processors by Hwu & Kirk." -Nicolas Pinto, Research Scientist at Harvard & MIT, NVIDIA Fellow 2009-2010 Graphics processing units (GPUs) can do much more than render graphics. Scientists and researchers increasingly look to GPUs to improve the efficiency and performance of computationally-intensive experiments across a range of disciplines. GPU Computing Gems: Emerald Edition brings their techniques to you, showcasing GPU-based solutions including: Black hole simulations with CUDA GPU-accelerated computation and interactive display of

  19. Paramyxovirus RNA synthesis, mRNA editing, and genome hexamer phase: A review.

    Science.gov (United States)

    Kolakofsky, Daniel

    2016-11-01

    The recent flurry of high resolution structures of Negative Strand RNA Virus RNA-dependent RNA polymerases has rekindled interest in the manner in which these polymerases, and in particular those of the nonsegmented viruses, recognize the RNA sequences that control mRNA synthesis and genome replication. In the light of these polymerase structures, we re-examine some unusual aspects of the Paramyxoviridae, namely bipartite replication promoters and mRNA editing, and the manner in which these properties are governed by genome hexamer phase. Copyright © 2016 Elsevier Inc. All rights reserved.

  20. Applications of genome editing by programmable nucleases to the metabolic engineering of secondary metabolites.

    Science.gov (United States)

    Leitão, Ana Lúcia; Costa, Marina C; Enguita, Francisco J

    2017-01-10

    Genome engineering is a branch of modern biotechnology composed of a cohort of protocols designed to construct and modify a genotype with the main objective of giving rise to a desired phenotype. Conceptually, genome engineering is based on the so called genome editing technologies, a group of genetic techniques that allow either to delete or to insert genetic information in a particular genomic locus. Ten years ago, genome editing tools were limited to virus-driven integration and homologous DNA recombination. However, nowadays the uprising of programmable nucleases is rapidly changing this paradigm. There are two main families of modern tools for genome editing depending on the molecule that controls the specificity of the system and drives the editor machinery to its place of action. Enzymes such as Zn-finger and TALEN nucleases are protein-driven genome editors; while CRISPR system is a nucleic acid-guided editing system. Genome editing techniques are still not widely applied for the design of new compounds with pharmacological activity, but they are starting to be considered as promising tools for rational genome manipulation in biotechnology applications. In this review we will discuss the potential applications of programmable nucleases for the metabolic engineering of secondary metabolites with biological activity. Copyright © 2016 Elsevier B.V. All rights reserved.

  1. RCC-MX (2008 edition)

    International Nuclear Information System (INIS)

    Bravo, X.; Drubay, B.

    2008-10-01

    The RCC-MX books is a compilation of design and construction rules for the mechanical materials of experimental reactors, for their auxiliaries and irradiation devices. This second edition includes the updates of references to NF, EN and ISO standards, the compliance with the regulations for nuclear pressure equipments, and the feedback since the 2005 edition. It comprises 9 books and a CD-Rom and includes a presentation document. The RCC-MX has been developed for the Jules Horowitz reactor but can be used for the design and construction of new projects of new experimental reactors or new equipments and devices for existing facilities. Content: - Book 1: general dispositions, materials for experimental reactors and their auxiliaries, for irradiation devices and for control or handling mechanisms, complementary requirements and particular dispositions; - Book 2: materials for the reactor and for its level 1 auxiliaries; - Book 3: materials for the reactor and for its level 2 and level 3 auxiliaries, control and handling mechanisms, materials for irradiation devices; - Book 4: technical appendixes - materials characteristics (steels and alloys); - Book 5: technical appendixes (design rules); - Book 6: technical specifications of materials; - Book 7: tests and control methods; - Book 8: welding; - Book 9: fabrication. (J.S.)

  2. Bibliography of Fynbos ecology: 2nd edition

    CSIR Research Space (South Africa)

    Manders, PT

    1989-12-01

    Full Text Available The first edition of a bibliography of fynbos ecology was produced in 1981 and comprised 814 references to work completed or commenced prior to the initiation of the Fynbos Biome Project. It is appropriate that this second edition...

  3. The Technique of Editing 16mm. Films.

    Science.gov (United States)

    Burder, John

    For professionals and advanced amateurs, this book covers all aspects of editing 16 millimeter film. Beginning with basic matters of film gauge, equipment, and editing facilities, it covers the mechanics of the subject using a how-to-do-it approach. The techniques discussed include preparation of the sound track, cutting, mixing, choice of pace…

  4. Site-specific photochemical RNA editing.

    Science.gov (United States)

    Fujimoto, Kenzo; Konishi-Hiratsuka, Kaoru; Sakamoto, Takashi; Yoshimura, Yoshinaga

    2010-10-28

    Photo-induced artificial RNA editing was demonstrated using photo-reactive oligonucleotides containing 3-cyanovinylcarbazole nucleoside. This non-enzymatic and sequence-specific methodology will make a major contribution to the elucidation of RNA functions including non-coding RNAs and to the development of drugs based on sequence-specific RNA editing.

  5. The Aldine Edition of Aristotle's De Sensu

    DEFF Research Database (Denmark)

    Bloch, David Kristian

    2006-01-01

    This small article examines the quality of and the textual foundation for the først printed edition ever of Aristotle's De Sensu et Sensibilibus, that is, Aldus Manutius' (1497).......This small article examines the quality of and the textual foundation for the først printed edition ever of Aristotle's De Sensu et Sensibilibus, that is, Aldus Manutius' (1497)....

  6. Sex Differences in Cognitive Abilities. Fourth Edition

    Science.gov (United States)

    Halpern, Diane F.

    2011-01-01

    The fourth edition of "Sex Differences in Cognitive Abilities" critically examines the breadth of research on this complex and controversial topic, with the principal aim of helping the reader to understand where sex differences are found--and where they are not. Since the publication of the third edition, there have been many exciting and…

  7. Structure and stabilization of the Hendra virus F glycoprotein in its prefusion form.

    Science.gov (United States)

    Wong, Joyce J W; Paterson, Reay G; Lamb, Robert A; Jardetzky, Theodore S

    2016-01-26

    Hendra virus (HeV) is one of the two prototypical members of the Henipavirus genus of paramyxoviruses, which are designated biosafety level 4 (BSL-4) organisms due to the high mortality rate of Nipah virus (NiV) and HeV in humans. Paramyxovirus cell entry is mediated by the fusion protein, F, in response to binding of a host receptor by the attachment protein. During posttranslational processing, the fusion peptide of F is released and, upon receptor-induced triggering, inserts into the host cell membrane. As F undergoes a dramatic refolding from its prefusion to postfusion conformation, the fusion peptide brings the host and viral membranes together, allowing entry of the viral RNA. Here, we present the crystal structure of the prefusion form of the HeV F ectodomain. The structure shows very high similarity to the structure of prefusion parainfluenza virus 5 (PIV5) F, with the main structural differences in the membrane distal apical loops and the fusion peptide cleavage loop. Functional assays of mutants show that the apical loop can tolerate perturbation in length and surface residues without loss of function, except for residues involved in the stability and conservation of the F protein fold. Structure-based disulfide mutants were designed to anchor the fusion peptide to conformationally invariant residues of the F head. Two mutants were identified that inhibit F-mediated fusion by stabilizing F in its prefusion conformation.

  8. Antibodies to henipavirus or henipa-like viruses in domestic pigs in Ghana, West Africa.

    Directory of Open Access Journals (Sweden)

    David T S Hayman

    Full Text Available Henipaviruses, Hendra virus (HeV and Nipah virus (NiV, have Pteropid bats as their known natural reservoirs. Antibodies against henipaviruses have been found in Eidolon helvum, an old world fruit bat species, and henipavirus-like nucleic acid has been detected in faecal samples from E. helvum in Ghana. The initial outbreak of NiV in Malaysia led to over 265 human encephalitis cases, including 105 deaths, with infected pigs acting as amplifier hosts for NiV during the outbreak. We detected non-neutralizing antibodies against viruses of the genus Henipavirus in approximately 5% of pig sera (N = 97 tested in Ghana, but not in a small sample of other domestic species sampled under a E. helvum roost. Although we did not detect neutralizing antibody, our results suggest prior exposure of the Ghana pig population to henipavirus(es. Because a wide diversity of henipavirus-like nucleic acid sequences have been found in Ghanaian E. helvum, we hypothesise that these pigs might have been infected by henipavirus(es sufficiently divergent enough from HeVor NiV to produce cross-reactive, but not cross-neutralizing antibodies to HeV or NiV.

  9. Enhancing Wikipedia Editing with WAI-ARIA

    Science.gov (United States)

    Senette, Caterina; Buzzi, Maria Claudia; Buzzi, Marina; Leporini, Barbara

    Nowadays Web 2.0 applications allow anyone to create, share and edit on-line content, but accessibility and usability issues still exist. For instance, Wikipedia presents many difficulties for blind users, especially when they want to write or edit articles. In a previous stage of our study we proposed and discussed how to apply the W3C ARIA suite to simplify the Wikipedia editing page when interacting via screen reader. In this paper we present the results of a user test involving totally blind end-users as they interacted with both the original and the modified Wikipedia editing pages. Specifically, the purpose of the test was to compare the editing and formatting process for original and ARIA-implemented Wikipedia user interfaces, and to evaluate the improvements.

  10. Fuel Cell Handbook, Fifth Edition

    Energy Technology Data Exchange (ETDEWEB)

    Energy and Environmental Solutions

    2000-10-31

    Progress continues in fuel cell technology since the previous edition of the Fuel Cell Handbook was published in November 1998. Uppermost, polymer electrolyte fuel cells, molten carbonate fuel cells, and solid oxide fuel cells have been demonstrated at commercial size in power plants. The previously demonstrated phosphoric acid fuel cells have entered the marketplace with more than 220 power plants delivered. Highlighting this commercial entry, the phosphoric acid power plant fleet has demonstrated 95+% availability and several units have passed 40,000 hours of operation. One unit has operated over 49,000 hours. Early expectations of very low emissions and relatively high efficiencies have been met in power plants with each type of fuel cell. Fuel flexibility has been demonstrated using natural gas, propane, landfill gas, anaerobic digester gas, military logistic fuels, and coal gas, greatly expanding market opportunities. Transportation markets worldwide have shown remarkable interest in fuel cells; nearly every major vehicle manufacturer in the U.S., Europe, and the Far East is supporting development. This Handbook provides a foundation in fuel cells for persons wanting a better understanding of the technology, its benefits, and the systems issues that influence its application. Trends in technology are discussed, including next-generation concepts that promise ultrahigh efficiency and low cost, while providing exceptionally clean power plant systems. Section 1 summarizes fuel cell progress since the last edition and includes existing power plant nameplate data. Section 2 addresses the thermodynamics of fuel cells to provide an understanding of fuel cell operation at two levels (basic and advanced). Sections 3 through 8 describe the six major fuel cell types and their performance based on cell operating conditions. Alkaline and intermediate solid state fuel cells were added to this edition of the Handbook. New information indicates that manufacturers have stayed

  11. La experiencia de los virus emergentes en el Caribe colombiano

    Directory of Open Access Journals (Sweden)

    Salim Máttar V

    2010-04-01

    Full Text Available Existe una interrelación muy estrecha entre el hombre, su ecología y el mundo microbiano, tanto el ser humano como los agentes infecciosos han coevolucionado durante milenios (1. La historia demuestra que ha existido una confluencia de diferentes enfermedades infecciosas y las principales civilizaciones. En los últimos años las enfermedades zoonoticas emergentes han ido cobrando una importancia creciente en el terreno de la salud humana y animal, surgiendo nuevas enfermedades procedentes siempre de lugares insospechados y causantes de graves problemas para el hombre o los animales (2. La mayoría de patógenos involucrados en las enfermedades infecciosas emergentes (EIE son de origen bacteriano o rickettsial (54.3%. En este grupo están incluidos los patógenos bacterianos resistentes a los antibióticos. Los patógenos de origen viral y los priones, constituyen el 25.4% de eventos de las EIE, los protozoarios representan el 10.7%, seguido de los hongos 6.3% y los helmintos en un 3.3%. El 60.3% de las enfermedades infecciosas emergentes son causadas por patógenos zoonoticos (2. El 71.8% de estas zoonosis son causados por patógenos que se originan de la fauna silvestre, como la emergencia del virus de Nipah en Malasia y el síndrome respiratorio agudo severo (SARS en China (3.

  12. CRISPR Editing Technology in Biological and Biomedical Investigation.

    Science.gov (United States)

    White, Martyn K; Kaminski, Rafal; Young, Won-Bin; Roehm, Pamela C; Khalili, Kamel

    2017-11-01

    The CRISPR or clustered regularly interspaced short palindromic repeats system is currently the most advanced approach to genome editing and is notable for providing an unprecedented degree of specificity, effectiveness, and versatility in genetic manipulation. CRISPR evolved as a prokaryotic immune system to provide an acquired immunity and resistance to foreign genetic elements such as bacteriophages. It has recently been developed into a tool for the specific targeting of nucleotide sequences within complex eukaryotic genomes for the purpose of genetic manipulation. The power of CRISPR lies in its simplicity and ease of use, its flexibility to be targeted to any given nucleotide sequence by the choice of an easily synthesized guide RNA, and its ready ability to continue to undergo technical improvements. Applications for CRISPR are numerous including creation of novel transgenic cell animals for research, high-throughput screening of gene function, potential clinical gene therapy, and nongene-editing approaches such as modulating gene activity and fluorescent tagging. In this prospect article, we will describe the salient features of the CRISPR system with an emphasis on important drawbacks and considerations with respect to eliminating off-target events and obtaining efficient CRISPR delivery. We will discuss recent technical developments to the system and we will illustrate some of the most recent applications with an emphasis on approaches to eliminate human viruses including HIV-1, JCV and HSV-1 and prospects for the future. J. Cell. Biochem. 118: 3586-3594, 2017. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

  13. Physiological stress and Hendra virus in flying-foxes (Pteropus spp., Australia.

    Directory of Open Access Journals (Sweden)

    Lee McMichael

    Full Text Available Pteropid bats (flying-foxes are the natural reservoir of Hendra virus, an emergent paramyxovirus responsible for fatal infection in horses and humans in Australia. Pteropus alecto (the Black flying-fox and the paraphyletic P. conspicillatus (the Spectacled flying-fox appear to be the primary reservoir hosts. Previous studies have suggested that physiological and ecological factors may underpin infection dynamics in flying-foxes, and subsequent spillover to horses and in turn humans. We sought to examine temporal trends in urinary cortisol concentration in wild Australian flying-fox populations, to elucidate the putative relationship between Hendra virus infection and physiological stress. Pooled and individual urine samples were non-invasively collected from under roosting flying-foxes at two latitudinally disparate regions in the eastern Australian state of Queensland. Hendra virus detection, and (in individual urine samples sex and species determination were PCR-based. Urinary cortisol measurement used a validated enzyme immunoassay. We found no direct correlation between increased urinary cortisol and Hendra virus excretion, but our findings do suggest a biologically plausible association between low winter temperatures and elevated cortisol levels in P. alecto in the lower latitude Southeast Queensland roosts. We hypothesize an indirect association between low winter temperatures and increased Hendra virus infection and excretion, mediated by the physiological cost of thermoregulation. Our findings and our approach are directly relevant to elaboration of the disease ecology of Nipah virus and other emerging henipaviruses in bats. More broadly, they inform investigation of emerging disease infection dynamics across the wildlife/livestock/human interface.

  14. Henipavirus microsphere immuno-assays for detection of antibodies against Hendra virus.

    Science.gov (United States)

    McNabb, Leanne; Barr, J; Crameri, G; Juzva, S; Riddell, S; Colling, A; Boyd, V; Broder, C; Wang, L-F; Lunt, R

    2014-05-01

    Hendra and Nipah viruses (HeV and NiV) are closely related zoonotic pathogens of the Paramyxoviridae family. Both viruses belong to the Henipavirus genus and cause fatal disease in animals and humans, though only HeV is endemic in Australia. In general and due to the acute nature of the disease, agent detection by PCR and virus isolation are the primary tools for diagnostic investigations. Assays for the detection of antibodies against HeV are fit more readily for the purpose of surveillance testing in disease epidemiology and to meet certification requirements in the international movement of horses. The first generation indirect ELISA has been affected by non-specific reactions which must be resolved using virus neutralisation serology conducted at laboratory bio-safety level 4 containment (PC4). Recent developments have enabled improvements in the available serology assays. The production of an expressed recombinant truncated HeV G protein has been utilised in ELISA and in Luminex-based multiplexed microsphere assays. In the latter format, two Luminex assays have been developed for use in henipavirus serology: a binding assay (designed for antibody detection and differentiation) and a blocking assay (designed as a surrogate for virus neutralisation). Equine and canine field sera were used to evaluate the two Luminex assays relative to ELISA and virus neutralisation serology. Results showed that Luminex assays can be effective as rapid, sensitive and specific tests for the detection of HeV antibody in horse and dog sera. The tests do not require PC4 containment and are appropriate for high throughput applications as might be required for disease investigations and other epidemiological surveillance. Also, the results show that the Luminex assays detect effectively HeV vaccine-induced antibodies. Copyright © 2014 Elsevier B.V. All rights reserved.

  15. Physiological stress and Hendra virus in flying-foxes (Pteropus spp.), Australia.

    Science.gov (United States)

    McMichael, Lee; Edson, Daniel; Smith, Craig; Mayer, David; Smith, Ina; Kopp, Steven; Meers, Joanne; Field, Hume

    2017-01-01

    Pteropid bats (flying-foxes) are the natural reservoir of Hendra virus, an emergent paramyxovirus responsible for fatal infection in horses and humans in Australia. Pteropus alecto (the Black flying-fox) and the paraphyletic P. conspicillatus (the Spectacled flying-fox) appear to be the primary reservoir hosts. Previous studies have suggested that physiological and ecological factors may underpin infection dynamics in flying-foxes, and subsequent spillover to horses and in turn humans. We sought to examine temporal trends in urinary cortisol concentration in wild Australian flying-fox populations, to elucidate the putative relationship between Hendra virus infection and physiological stress. Pooled and individual urine samples were non-invasively collected from under roosting flying-foxes at two latitudinally disparate regions in the eastern Australian state of Queensland. Hendra virus detection, and (in individual urine samples) sex and species determination were PCR-based. Urinary cortisol measurement used a validated enzyme immunoassay. We found no direct correlation between increased urinary cortisol and Hendra virus excretion, but our findings do suggest a biologically plausible association between low winter temperatures and elevated cortisol levels in P. alecto in the lower latitude Southeast Queensland roosts. We hypothesize an indirect association between low winter temperatures and increased Hendra virus infection and excretion, mediated by the physiological cost of thermoregulation. Our findings and our approach are directly relevant to elaboration of the disease ecology of Nipah virus and other emerging henipaviruses in bats. More broadly, they inform investigation of emerging disease infection dynamics across the wildlife/livestock/human interface.

  16. Genome edited animals: Learning from GM crops?

    Science.gov (United States)

    Bruce, Ann

    2017-06-01

    Genome editing of livestock is poised to become commercial reality, yet questions remain as to appropriate regulation, potential impact on the industry sector and public acceptability of products. This paper looks at how genome editing of livestock has attempted to learn some of the lessons from commercialisation of GM crops, and takes a systemic approach to explore some of the complexity and ambiguity in incorporating genome edited animals in a food production system. Current applications of genome editing are considered, viewed from the perspective of past technological applications. The question of what is genome editing, and can it be considered natural is examined. The implications of regulation on development of different sectors of livestock production systems are studied, with a particular focus on the veterinary sector. From an EU perspective, regulation of genome edited animals, although not necessarily the same as for GM crops, is advocated from a number of different perspectives. This paper aims to open up new avenues of research on genome edited animals, extending from the current primary focus on science and regulation, to engage with a wider-range of food system actors.

  17. Crystal Structure of the Marburg Virus VP35 Oligomerization Domain

    Energy Technology Data Exchange (ETDEWEB)

    Bruhn, Jessica F.; Kirchdoerfer, Robert N.; Urata, Sarah M.; Li, Sheng; Tickle, Ian J.; Bricogne, Gérard; Saphire, Erica Ollmann (Scripps); (Globel Phasing); (UCSD)

    2016-11-09

    ABSTRACT

    Marburg virus (MARV) is a highly pathogenic filovirus that is classified in a genus distinct from that of Ebola virus (EBOV) (generaMarburgvirusandEbolavirus, respectively). Both viruses produce a multifunctional protein termed VP35, which acts as a polymerase cofactor, a viral protein chaperone, and an antagonist of the innate immune response. VP35 contains a central oligomerization domain with a predicted coiled-coil motif. This domain has been shown to be essential for RNA polymerase function. Here we present crystal structures of the MARV VP35 oligomerization domain. These structures and accompanying biophysical characterization suggest that MARV VP35 is a trimer. In contrast, EBOV VP35 is likely a tetramer in solution. Differences in the oligomeric state of this protein may explain mechanistic differences in replication and immune evasion observed for MARV and EBOV.

    IMPORTANCEMarburg virus can cause severe disease, with up to 90% human lethality. Its genome is concise, only producing seven proteins. One of the proteins, VP35, is essential for replication of the viral genome and for evasion of host immune responses. VP35 oligomerizes (self-assembles) in order to function, yet the structure by which it assembles has not been visualized. Here we present two crystal structures of this oligomerization domain. In both structures, three copies of VP35 twist about each other to form a coiled coil. This trimeric assembly is in contrast to tetrameric predictions for VP35 of Ebola virus and to known structures of homologous proteins in the measles, mumps, and Nipah viruses. Distinct oligomeric states of the Marburg and Ebola virus VP35 proteins may explain differences between them in polymerase function and immune evasion. These findings may provide a more accurate understanding of the

  18. Control of virus diseases in soybeans.

    Science.gov (United States)

    Hill, John H; Whitham, Steven A

    2014-01-01

    Soybean, one of the world's most important sources of animal feed and vegetable oil, can be infected by numerous viruses. However, only a small number of the viruses that can potentially infect soybean are considered as major economic problems to soybean production. Therefore, we consider management options available to control diseases caused by eight viruses that cause, or have the potential to cause, significant economic loss to producers. We summarize management tactics in use and suggest direction for the future. Clearly, the most important tactic is disease resistance. Several resistance genes are available for three of the eight viruses discussed. Other options include use of virus-free seed and avoidance of alternative virus hosts when planting. Attempts at arthropod vector control have generally not provided consistent disease management. In the future, disease management will be considerably enhanced by knowledge of the interaction between soybean and viral proteins. Identification of genes required for soybean defense may represent key regulatory hubs that will enhance or broaden the spectrum of basal resistance to viruses. It may be possible to create new recessive or dominant negative alleles of host proteins that do not support viral functions but perform normal cellular function. The future approach to virus control based on gene editing or exploiting allelic diversity points to necessary research into soybean-virus interactions. This will help to generate the knowledge needed for rational design of durable resistance that will maximize global production.

  19. This could be the start of something big—20 years since the identification of bats as the natural host of Hendra virus

    Directory of Open Access Journals (Sweden)

    Peter Black

    2015-12-01

    Full Text Available Hendra virus was first described in 1994 in Australia, causally associated with a cluster of fatal equine and human cases at a thoroughbred racing stable in the Brisbane suburb of Hendra. This year marks the twentieth anniversary of the identification of pteropid bats (flying-foxes as the natural host of the virus, and it is timely to reflect on a pivotal meeting of an eclectic group of scientists in that process. They included animal and public health experts, environmental scientists, veterinary and horse industry representatives, and wildlife experts. The task was to review and prioritise wildlife surveillance seeking the origin of the previously unknown virus. The group determined that the likely reservoir must occur in disparate locations, and be capable of moving between locations, or exist in continuous, overlapping populations spanning multiple locations. Flying-foxes were considered to be a more probable source of the novel virus than birds. Within weeks, antibodies were detected in several species of flying-fox, and the virus was subsequently isolated. While the identification of the natural host of Hendra virus within 18 months of its description was remarkable in itself, a broader legacy followed. In the subsequent years, a suite of zoonotic viruses including Australian bat lyssavirus, Nipah virus, SARS coronavirus, and Ebola and Marburg viruses have been detected in bats. Bats are now the “go to” taxa for novel viruses. History has repeatedly demonstrated that knowledge begets knowledge. This simple notion of bringing a diverse group of people together in an environment of mutual respect reinforced this principle and proves that the sum is often so much more powerful than the parts.

  20. This could be the start of something big-20 years since the identification of bats as the natural host of Hendra virus.

    Science.gov (United States)

    Black, Peter; Douglas, Ian; Field, Hume

    2015-12-01

    Hendra virus was first described in 1994 in Australia, causally associated with a cluster of fatal equine and human cases at a thoroughbred racing stable in the Brisbane suburb of Hendra. This year marks the twentieth anniversary of the identification of pteropid bats (flying-foxes) as the natural host of the virus, and it is timely to reflect on a pivotal meeting of an eclectic group of scientists in that process. They included animal and public health experts, environmental scientists, veterinary and horse industry representatives, and wildlife experts. The task was to review and prioritise wildlife surveillance seeking the origin of the previously unknown virus. The group determined that the likely reservoir must occur in disparate locations, and be capable of moving between locations, or exist in continuous, overlapping populations spanning multiple locations. Flying-foxes were considered to be a more probable source of the novel virus than birds. Within weeks, antibodies were detected in several species of flying-fox, and the virus was subsequently isolated. While the identification of the natural host of Hendra virus within 18 months of its description was remarkable in itself, a broader legacy followed. In the subsequent years, a suite of zoonotic viruses including Australian bat lyssavirus, Nipah virus, SARS coronavirus, and Ebola and Marburg viruses have been detected in bats. Bats are now the "go to" taxa for novel viruses. History has repeatedly demonstrated that knowledge begets knowledge. This simple notion of bringing a diverse group of people together in an environment of mutual respect reinforced this principle and proves that the sum is often so much more powerful than the parts.

  1. Generation of Gene-Edited Chrysanthemum morifolium Using Multicopy Transgenes as Targets and Markers.

    Science.gov (United States)

    Kishi-Kaboshi, Mitsuko; Aida, Ryutaro; Sasaki, Katsutomo

    2017-02-01

    The most widely used gene editing technology-the CRISPR/Cas9 system-employs a bacterial monomeric DNA endonuclease known as clustered regularly interspaced short palindromic repeats (CRISPR)-associated protein 9 (Cas9) and single-guide RNA (sgRNA) that directs Cas9 to a complementary target DNA. However, introducing mutations into higher polyploid plant species, especially for species without genome information, has been difficult. Chrysanthemum morifolium (chrysanthemum) is one of the most important ornamental plants, but it is a hexaploid with a large genome; moreover, it lacks whole-genome information. These characteristics hinder genome editing in chrysanthemum. In the present study, we attempted to perform gene editing using the CRISPR/Cas9 system to introduce mutations into chrysanthemum. We constructed transgenic chrysanthemum plants expressing the yellowish-green fluorescent protein gene from Chiridius poppei (CpYGFP) and targeted CpYGFP for gene editing. We compared the activity of a Cauliflower mosaic virus (CaMV) 35S promoter and parsley ubiquitin promoter in chrysanthemum calli and chose the parsley ubiquitin promoter to drive Cas9. We selected two sgRNAs to target different positions in the CpYGFP gene and obtained transgenic calli containing mutated CpYGFP genes (CRISPR-CpYGFP-chrysanthemum). A DNA sequencing analysis and fluorescence observations indicated that cells containing the mutated CpYGFP gene grew independently of cells containing the original CpYGFP gene in one callus. We finally obtained the CRISPR-CpYGFP-chrysanthemum shoot containing a mutation in the CpYGFP sequence. This is the first report of gene editing using the CRISPR/Cas9 system in chrysanthemum and sheds light on chrysanthemum genome editing. © The Author 2017. Published by Oxford University Press on behalf of Japanese Society of Plant Physiologists. All rights reserved. For permissions, please email: journals.permissions@oup.com.

  2. KWIC Index of nuclear codes (1975 edition)

    International Nuclear Information System (INIS)

    Akanuma, Makoto; Hirakawa, Takashi

    1976-01-01

    It is a KWIC Index for 254 nuclear codes in the Nuclear Code Abstracts (1975 edition). The classification of nuclear codes and the form of index are the same as those in the Computer Programme Library at Ispra, Italy. (auth.)

  3. Specification Editing and Discovery Assistant Project

    Data.gov (United States)

    National Aeronautics and Space Administration — The project will prototype a specification editing and discovery tool (SPEEDY) for C/C++ that will assist software developers with modular formal verification tasks...

  4. A genome editing primer for the hematologist

    Science.gov (United States)

    Hoban, Megan D.

    2016-01-01

    Gene editing enables the site-specific modification of the genome. These technologies have rapidly advanced such that they have entered common use in experimental hematology to investigate genetic function. In addition, genome editing is becoming increasingly plausible as a treatment modality to rectify genetic blood disorders and improve cellular therapies. Genome modification typically ensues from site-specific double-strand breaks and may result in a myriad of outcomes. Even single-strand nicks and targeted biochemical modifications that do not permanently alter the DNA sequence (epigenome editing) may be powerful instruments. In this review, we examine the various technologies, describe their advantages and shortcomings for engendering useful genetic alterations, and consider future prospects for genome editing to impact hematology. PMID:27053532

  5. LabVIEW 8 student edition

    CERN Document Server

    Bishop, Robert H

    2007-01-01

    For courses in Measurement and Instrumentation, Electrical Engineering lab, and Physics and Chemistry lab. This revised printing has been updated to include new LabVIEW 8.2 Student Edition. National Instruments' LabVIEW is the defacto industry standard for test, measurement, and automation software solutions. With the Student Edition of LabVIEW, students can design graphical programming solutions to their classroom problems and laboratory experiments with software that delivers the graphical programming capabilites of the LabVIEW professional version. . The Student Edition is also compatible with all National Instruments data acquisition and instrument control hardware. Note: The LabVIEW Student Edition is available to students, faculty, and staff for personal educational use only. It is not intended for research, institutional, or commercial use. For more information about these licensing options, please visit the National Instruments website at (http:www.ni.com/academic/)

  6. Zika Virus

    Science.gov (United States)

    ... through blood transfusions. There have been outbreaks of Zika virus in the United States, Africa, Southeast Asia, the ... not travel to areas where there is a Zika virus outbreak. If you do decide to travel, first ...

  7. Zika Virus

    Science.gov (United States)

    ... which is responsible for transmitting Zika virus. Photo Courtesy of: James Gathany, Centers for Disease Control and ... National Institute of Allergy and Infectious Diseases. Photo Courtesy of NIH "You could have a Zika virus ...

  8. Chikungunya Virus

    Science.gov (United States)

    ... Gaines, PhD, MPH, MA, CHES Differentiating Chikungunya From Dengue: A Clinical Challenge For Travelers CDC Travelers' Health Chikungunya Virus Home Prevention Transmission Symptoms & Treatment Geographic Distribution Chikungunya virus in the United States ...

  9. Introductory physics of nuclear medicine. Third edition

    International Nuclear Information System (INIS)

    Chandra, R.

    1987-01-01

    The new third edition includes essential details and many examples and problems taken from the routine practice of nuclear medicine. Basic principles and underlying concepts are explained, although it is assumed that the reader has some current use as a bone densitometer. For resident physicians in nuclear medicine, residents in pathology, radiology, and internal medicine, and students of nuclear medicine technology, the third edition offers a simplified and reliable approach to the physics and basic sciences of nuclear medicine

  10. Nuclear electronics laboratory manual 1989 edition

    International Nuclear Information System (INIS)

    1989-10-01

    This manual is a joint product of several electronics experts who have been associated with IAEA activity in this field for many years. It is based on the experience of conducting twenty-three training courses on nuclear electronics. Compared with the first edition, published 1984, this edition contains many new experiments, mainly on the advanced technical level. The total number of experiments and special projects is 58. Tabs and figs

  11. Non-GMO genetically edited crop plants.

    Science.gov (United States)

    Kanchiswamy, Chidananda Nagamangala; Malnoy, Mickael; Velasco, Riccardo; Kim, Jin-Soo; Viola, Roberto

    2015-09-01

    Direct delivery of purified Cas9 protein with guide RNA into plant cells, as opposed to plasmid-mediated delivery, displays high efficiency and reduced off-target effects. Following regeneration from edited cells, the ensuing plant is also likely to bypass genetically modified organism (GMO) legislation as the genome editing complex is degraded in the recipient cells. Copyright © 2015 Elsevier Ltd. All rights reserved.

  12. The Ethics of Germline Gene Editing

    OpenAIRE

    Gyngell, Christopher; Douglas, Thomas; Savulescu, Julian

    2016-01-01

    Germline Gene Editing (GGE) has enormous potential both as a research tool and a therapeutic intervention. While other types of gene editing are relatively uncontroversial, GGE has been strongly resisted. In this paper, we analyze the ethical arguments for and against pursuing GGE, which we take to consist in allowing and funding its development. We argue there is a strong case for pursuing GGE for the prevention of disease. We then examine objections that have been raised against pursuing GG...

  13. Genome Editing in Sugarcane: Challenges Ahead

    OpenAIRE

    Mohan, Chakravarthi

    2016-01-01

    Genome editing opens new and unique opportunities for researchers to enhance crop production. Until 2013, the zinc finger nucleases (ZFNs) and transcription activator-like effector nucleases (TALENs) were the key tools used for genome editing applications. The advent of RNA-guided engineered nucleases - the type II clustered regularly interspaced short palindromic repeat (CRISPR)/Cas9 (CRISPR-associated) system from Streptococcus pyogenes holds great potential since it is simple, effective an...

  14. A genome editing primer for the hematologist

    OpenAIRE

    Hoban, Megan D.; Bauer, Daniel E.

    2016-01-01

    Gene editing enables the site-specific modification of the genome. These technologies have rapidly advanced such that they have entered common use in experimental hematology to investigate genetic function. In addition, genome editing is becoming increasingly plausible as a treatment modality to rectify genetic blood disorders and improve cellular therapies. Genome modification typically ensues from site-specific double-strand breaks and may result in a myriad of outcomes. Even single-strand ...

  15. Hepadna viruses

    Energy Technology Data Exchange (ETDEWEB)

    Robinson, W.; Koike, K.; Will, H.

    1987-01-01

    This book examines the molecular biology, disease pathogenesis, epidemiology, and clinical features of hepadna and other viruses with hepatic tropism and outlines future directions and approaches for their management. The volume's six sections provide a review of the various features, mechanisms, and functions of these viruses, ranging from hepadna virus replication and regulation of gene expression to the structure and function of hepadna-virus gene products.

  16. Computational Physics - 2nd Edition

    Science.gov (United States)

    Thijssen, J. M.

    1998-11-01

    This second edition describes the computational methods used in theoretical physics, and has been fully updated. New sections have been added to cover finite element methods and lattice Boltzmann simulation, density functional theory, quantum molecular dynamics, Monte Carlo simulation, and diagonalisation of one-dimensional quantum systems. It covers many different areas of physics research and different computational methodologies, including computational methods such as Monte Carlo and molecular dynamics, various electronic structure methodologies, methods for solving partial differential equations, and lattice gauge theory. Throughout the book the relations between the methods used in different fields of physics are emphasised. Several new programs are described and can be downloaded from www.cambridge.org/9780521833462. The book requires a background in elementary programming, numerical analysis, and field theory, as well as undergraduate knowledge on condensed matter theory and statistical physics. It will be of interest to graduate students and researchers in theoretical, computational and experimental physics. Completely revised with new chapters including finite element methods and lattice Boltzmann simulation Describes several new programs which can be downloaded from www.cambridge.org/9780521833462 Contains questions on theory and implementation at the end of each chapter

  17. On the evaluation of segmentation editing tools

    Science.gov (United States)

    Heckel, Frank; Moltz, Jan H.; Meine, Hans; Geisler, Benjamin; Kießling, Andreas; D’Anastasi, Melvin; dos Santos, Daniel Pinto; Theruvath, Ashok Joseph; Hahn, Horst K.

    2014-01-01

    Abstract. Efficient segmentation editing tools are important components in the segmentation process, as no automatic methods exist that always generate sufficient results. Evaluating segmentation editing algorithms is challenging, because their quality depends on the user’s subjective impression. So far, no established methods for an objective, comprehensive evaluation of such tools exist and, particularly, intermediate segmentation results are not taken into account. We discuss the evaluation of editing algorithms in the context of tumor segmentation in computed tomography. We propose a rating scheme to qualitatively measure the accuracy and efficiency of editing tools in user studies. In order to objectively summarize the overall quality, we propose two scores based on the subjective rating and the quantified segmentation quality over time. Finally, a simulation-based evaluation approach is discussed, which allows a more reproducible evaluation without the need for human input. This automated evaluation complements user studies, allowing a more convincing evaluation, particularly during development, where frequent user studies are not possible. The proposed methods have been used to evaluate two dedicated editing algorithms on 131 representative tumor segmentations. We show how the comparison of editing algorithms benefits from the proposed methods. Our results also show the correlation of the suggested quality score with the qualitative ratings. PMID:26158063

  18. Genome editing with engineered nucleases in plants.

    Science.gov (United States)

    Osakabe, Yuriko; Osakabe, Keishi

    2015-03-01

    Numerous examples of successful 'genome editing' now exist. Genome editing uses engineered nucleases as powerful tools to target specific DNA sequences to edit genes precisely in the genomes of both model and crop plants, as well as a variety of other organisms. The DNA-binding domains of zinc finger (ZF) proteins were the first to be used as genome editing tools, in the form of designed ZF nucleases (ZFNs). More recently, transcription activator-like effector nucleases (TALENs), as well as the clustered regularly interspaced short palindromic repeats/Cas9 (CRISPR/Cas9) system, which utilizes RNA-DNA interactions, have proved useful. A key step in genome editing is the generation of a double-stranded DNA break that is specific to the target gene. This is achieved by custom-designed endonucleases, which enable site-directed mutagenesis via a non-homologous end-joining (NHEJ) repair pathway and/or gene targeting via homologous recombination (HR) to occur efficiently at specific sites in the genome. This review provides an overview of recent advances in genome editing technologies in plants, and discusses how these can provide insights into current plant molecular biology research and molecular breeding technology. © The Author 2014. Published by Oxford University Press on behalf of Japanese Society of Plant Physiologists. All rights reserved. For permissions, please email: journals.permissions@oup.com.

  19. Genome editing systems in novel therapies.

    Science.gov (United States)

    Jang, Yoon-Young; Cai, Liuhong; Ye, Zhaohui

    2016-01-01

    Genome editing is the process in which DNA sequences at precise genomic locations are modified. In the past three decades, genome editing by homologous recombination has been successfully performed in mouse for generating genetic models. The low efficiency of this process in human cells, however, had prevented its clinical application until the recent advancements in designer endonuclease technologies. The significantly improved genome editing efficiencies aided by ZFN, TALEN, and CRISPR systems provide unprecedented opportunities not only for biomedical research, but also for developing novel therapies. Applications based on these genome editing tools to disrupt deleterious genes, correct genetic mutations, deliver functional transgenes more effectively or even modify the epigenetic landscape are being actively investigated for gene and cell therapy purposes. Encouraging results have been obtained in limited clinical trials in the past two years. While most of the applications are still in proof-of-principle or preclinical development stages, it is anticipated that the coming years will see increasing clinical success in novel therapies based on the modern genome editing technologies. It should be noted that critical issues still remain before the technologies can be translated into more reliable therapies. These key issues include off-target evaluation, establishing appropriate preclinical models and improving the currently low efficiency of homology-based precise gene replacement. In this review we discuss the preclinical and clinical studies aiming at translating the genome editing technologies as well as the issues that are important for more successful translation.

  20. The commercialization of genome-editing technologies.

    Science.gov (United States)

    Brinegar, Katelyn; K Yetisen, Ali; Choi, Sun; Vallillo, Emily; Ruiz-Esparza, Guillermo U; Prabhakar, Anand M; Khademhosseini, Ali; Yun, Seok-Hyun

    2017-11-01

    The emergence of new gene-editing technologies is profoundly transforming human therapeutics, agriculture, and industrial biotechnology. Advances in clustered regularly interspaced short palindromic repeats (CRISPR) have created a fertile environment for mass-scale manufacturing of cost-effective products ranging from basic research to translational medicine. In our analyses, we evaluated the patent landscape of gene-editing technologies and found that in comparison to earlier gene-editing techniques, CRISPR has gained significant traction and this has established dominance. Although most of the gene-editing technologies originated from the industry, CRISPR has been pioneered by academic research institutions. The spinout of CRISPR biotechnology companies from academic institutions demonstrates a shift in entrepreneurship strategies that were previously led by the industry. These academic institutions, and their subsequent companies, are competing to generate comprehensive intellectual property portfolios to rapidly commercialize CRISPR products. Our analysis shows that the emergence of CRISPR has resulted in a fivefold increase in genome-editing bioenterprise investment over the last year. This entrepreneurial movement has spurred a global biotechnology revolution in the realization of novel gene-editing technologies. This global shift in bioenterprise will continue to grow as the demand for personalized medicine, genetically modified crops and environmentally sustainable biofuels increases. However, the monopolization of intellectual property, negative public perception of genetic engineering and ambiguous regulatory policies may limit the growth of these market segments.

  1. Adenosine Deaminases Acting on RNA (ADARs) are both Antiviral and Proviral Dependent upon the Virus

    Science.gov (United States)

    Samuel, Charles E.

    2010-01-01

    A-to-I RNA editing, the deamination of adenosine (A) to inosine (I) that occurs in regions of RNA with double-stranded character, is catalyzed by a family of Adenosine Deaminases Acting on RNA (ADARs). In mammals there are three ADAR genes. Two encode proteins that possess demonstrated deaminase activity: ADAR1, which is interferon-inducible, and ADAR2 which is constitutively expressed. ADAR3, by contrast, has not yet been shown to bean active enzyme. The specificity of the ADAR1 and ADAR2 deaminases ranges from highly site-selective to non-selective, dependent on the duplex structure of the substrate RNA. A-to-I editing is a form of nucleotide substitution editing, because I is decoded as guanosine (G) instead of A by ribosomes during translation and by polymerases during RNA-dependent RNA replication. Additionally, A-to-I editing can alter RNA structure stability as I:U mismatches are less stable than A:U base pairs. Both viral and cellular RNAs are edited by ADARs. A-to-I editing is of broad physiologic significance. Among the outcomes of A-to-I editing are biochemical changes that affect how viruses interact with their hosts, changes that can lead to either enhanced or reduced virus growth and persistence dependent upon the specific virus. PMID:21211811

  2. C-terminal tyrosine residues modulate the fusion activity of the Hendra virus fusion protein.

    Science.gov (United States)

    Popa, Andreea; Pager, Cara Teresia; Dutch, Rebecca Ellis

    2011-02-15

    The paramyxovirus family includes important human pathogens such as measles, mumps, respiratory syncytial virus, and the recently emerged, highly pathogenic Hendra and Nipah viruses. The viral fusion (F) protein plays critical roles in infection, promoting both the virus-cell membrane fusion events needed for viral entry as well as cell-cell fusion events leading to syncytia formation. We describe the surprising finding that addition of the short epitope HA tag to the cytoplasmic tail (CT) of the Hendra virus F protein leads to a significant increase in the extent of cell-cell membrane fusion. This increase was not due to alterations in surface expression, cleavage state, or association with lipid microdomains. Addition of a Myc tag of similar length did not alter Hendra F protein fusion activity, indicating that the observed stimulation was not solely a result of lengthening the CT. Three tyrosine residues within the HA tag were critical for the increase in the extent of fusion, suggesting C-terminal tyrosines may modulate Hendra fusion activity. The effects of addition of the HA tag varied with other fusion proteins, as parainfluenza virus 5 F-HA showed a decreased level of surface expression and no stimulation of fusion. These results indicate that additions to the C-terminal end of the F protein CT can modulate protein function in a sequence specific manner, reinforcing the need for careful analysis of epitope-tagged glycoproteins. In addition, our results implicate C-terminal tyrosine residues in the modulation of the membrane fusion reaction promoted by these viral glycoproteins.

  3. Book Review: New Perspectives on Technical Editing

    Science.gov (United States)

    Murphy, A. J. (Ed.); Sterken, Christiaan

    2012-08-01

    New Perspectives on Technical Editing by Avon J. Murphy (ed.) ISBN : 978-0895033949 (2010) Baywood Publishing Company Inc, Hardcover, 210 pages, 35.5 GBP This book presents a collection of 10 chapters dealing with diverse aspects of technical editing (ie, editorial planning, and analysis and structural changes made to other people's technological documents): research in technical editing, trends and teaching of technical editing, copyediting, and technical journal editing. The role and function of the modern journal and book editor is also dealt with in detail. Each chapter is written by an expert in the field: senior editors, university professors in technical communication, technical writers and linguists. The ever-evolving role of the editor is clearly elucidated in several historical reviews, and in the descriptions of the expectations for the future. A very striking aspect of this book is its extensive collection of bibliographic resources: every chapter lists dozens of very useful references, and the closing chapter, and annotated bibliography, contain many not so well known references, and are most useful. All in all, the book is a treasure trove listing more than 400 references, in addition to numerous webpage URLs embedded in the texts. The book is designed to help the reader to understand current practices and norms in technical editing, and to help to take action in editing as well as in teaching and educating would-be editors. The audience for this book thus includes editors and teachers, but also writers, researchers and students. A deep reading of this book will result in a better understanding of the difference between full technical editing and its much narrower component so well known as copyediting, and will convince any prospective editor that editing should not be undertaken if the people involved do not master the art of precision and accuracy in technical (as well as in human) communication, do not possess the technical know how and computer

  4. Residential Wiring. Fourth Edition. Teacher Edition [and] Student Guide [and] Student Workbook.

    Science.gov (United States)

    Taylor, Mark

    Residential Wiring, the second publication in a series of three wiring publications, prepares students for entry-level employment in the residential wiring trade. Instructional materials include a teacher edition, student guide, and student workbook. The teacher edition begins with introductory pages, including a training and competency profile,…

  5. Targeted viral-mediated plant genome editing using crispr/cas9

    KAUST Repository

    Mahfouz, Magdy M.

    2015-12-17

    The present disclosure provides a viral-mediated genome-editing platform that facilitates multiplexing, obviates stable transformation, and is applicable across plant species. The RNA2 genome of the tobacco rattle virus (TRV) was engineered to carry and systemically deliver a guide RNA molecules into plants overexpressing Cas9 endonuclease. High genomic modification frequencies were observed in inoculated as well as systemic leaves including the plant growing points. This system facilitates multiplexing and can lead to germinal transmission of the genomic modifications in the progeny, thereby obviating the requirements of repeated transformations and tissue culture. The editing platform of the disclosure is useful in plant genome engineering and applicable across plant species amenable to viral infections for agricultural biotechnology applications.

  6. BOOK REVIEW: Quantum Gravity: third edition Quantum Gravity: third edition

    Science.gov (United States)

    Rovelli, Carlo

    2012-09-01

    The request by Classical and Quantum Gravity to review the third edition of Claus Kiefer's 'Quantum Gravity' puts me in a slightly awkward position. This is a remarkably good book, which every person working in quantum gravity should have on the shelf. But in my opinion quantum gravity has undergone some dramatic advances in the last few years, of which the book makes no mention. Perhaps the omission only attests to the current vitality of the field, where progress is happening fast, but it is strange for me to review a thoughtful, knowledgeable and comprehensive book on my own field of research, which ignores what I myself consider the most interesting results to date. Kiefer's book is unique as a broad introduction and a reliable overview of quantum gravity. There are numerous books in the field which (often notwithstanding titles) focus on a single approach. There are also countless conference proceedings and article collections aiming to be encyclopaedic, but offering disorganized patchworks. Kiefer's book is a careful and thoughtful presentation of all aspects of the immense problem of quantum gravity. Kiefer is very learned, and brings together three rare qualities: he is pedagogical, he is capable of simplifying matter to the bones and capturing the essential, and he offers a serious and balanced evaluation of views and ideas. In a fractured field based on a major problem that does not yet have a solution, these qualities are precious. I recommend Kiefer's book to my students entering the field: to work in quantum gravity one needs a vast amount of technical knowledge as well as a grasp of different ideas, and Kiefer's book offers this with remarkable clarity. This novel third edition simplifies and improves the presentation of several topics, but also adds very valuable new material on quantum gravity phenomenology, loop quantum cosmology, asymptotic safety, Horava-Lifshitz gravity, analogue gravity, the holographic principle, and more. This is a testament

  7. Post-transcriptional m6A editing of HIV-1 mRNAs enhances viral gene expression

    Science.gov (United States)

    Kennedy, Edward M.; Bogerd, Hal P.; Kornepati, Anand V. R.; Kang, Dong; Ghoshal, Delta; Marshall, Joy B.; Poling, Brigid C.; Tsai, Kevin; Gokhale, Nandan S.; Horner, Stacy M.; Cullen, Bryan R.

    2016-01-01

    Summary Covalent addition of a methyl group to the adenosine N6 (m6A) is an evolutionarily conserved and common RNA modification that is thought to modulate several aspects of RNA metabolism. While the presence of multiple m6A editing sites on diverse viral RNAs was reported starting almost 40 years ago, how m6A editing affects virus replication has remained unclear. Here, we used photo-crosslinking-assisted m6A sequencing techniques to precisely map several m6A editing sites on the HIV-1 genome and report that they cluster in the HIV-1 3’ untranslated region (3'UTR). Viral 3'UTR m6A sites or analogous cellular m6A sites strongly enhanced mRNA expression in cis by recruiting the cellular YTHDF m6A “reader” proteins. Reducing YTHDF expression inhibited, while YTHDF overexpression enhanced, HIV-1 protein and RNA expression, and virus replication in CD4+ T cells. These data identify m6A editing, and the resultant recruitment of YTHDF proteins, as major positive regulators of HIV-1 mRNA expression. PMID:27117054

  8. A geminivirus-based guide RNA delivery system for CRISPR/Cas9 mediated plant genome editing.

    Science.gov (United States)

    Yin, Kangquan; Han, Ting; Liu, Guang; Chen, Tianyuan; Wang, Ying; Yu, Alice Yunzi L; Liu, Yule

    2015-10-09

    CRISPR/Cas has emerged as potent genome editing technology and has successfully been applied in many organisms, including several plant species. However, delivery of genome editing reagents remains a challenge in plants. Here, we report a virus-based guide RNA (gRNA) delivery system for CRISPR/Cas9 mediated plant genome editing (VIGE) that can be used to precisely target genome locations and cause mutations. VIGE is performed by using a modified Cabbage Leaf Curl virus (CaLCuV) vector to express gRNAs in stable transgenic plants expressing Cas9. DNA sequencing confirmed VIGE of endogenous NbPDS3 and NbIspH genes in non-inoculated leaves because CaLCuV can infect plants systemically. Moreover, VIGE of NbPDS3 and NbIspH in newly developed leaves caused photo-bleached phenotype. These results demonstrate that geminivirus-based VIGE could be a powerful tool in plant genome editing.

  9. Genome Editing of Monogenic Neuromuscular Diseases

    Science.gov (United States)

    Long, Chengzu; Amoasii, Leonela; Bassel-Duby, Rhonda; Olson, Eric N.

    2017-01-01

    IMPORTANCE Muscle weakness, the most common symptom of neuromuscular disease, may result from muscle dysfunction or may be caused indirectly by neuronal and neuromuscular junction abnormalities. To date, more than 780 monogenic neuromuscular diseases, linked to 417 different genes, have been identified in humans. Genome-editing methods, especially the CRISPR (clustered regularly interspaced short palindromic repeats)–Cas9 (CRISPR-associated protein 9) system, hold clinical potential for curing many monogenic disorders, including neuromuscular diseases such as Duchenne muscular dystrophy, spinal muscular atrophy, amyotrophic lateral sclerosis, and myotonic dystrophy type 1. OBJECTIVES To provide an overview of genome-editing approaches; to summarize published reports on the feasibility, efficacy, and safety of current genome-editing methods as they relate to the potential correction of monogenic neuromuscular diseases; and to highlight scientific and clinical opportunities and obstacles toward permanent correction of disease-causing mutations responsible for monogenic neuromuscular diseases by genome editing. EVIDENCE REVIEW PubMed and Google Scholar were searched for articles published from June 30, 1989, through June 9, 2016, using the following keywords: genome editing, CRISPR-Cas9, neuromuscular disease, Duchenne muscular dystrophy, spinal muscular atrophy, amyotrophic lateral sclerosis, andmyotonic dystrophy type 1. The following sources were reviewed: 341 articles describing different approaches to edit mammalian genomes; 330 articles describing CRISPR-Cas9–mediated genome editing in cell culture lines (in vitro) and animal models (in vivo); 16 websites used to generate single-guide RNA; 4 websites for off-target effects; and 382 articles describing viral and nonviral delivery systems. Articles describing neuromuscular diseases, including Duchenne muscular dystrophy, spinal muscular atrophy, amyotrophic lateral sclerosis, and myotonic dystrophy type 1

  10. Designed nucleases for targeted genome editing.

    Science.gov (United States)

    Lee, Junwon; Chung, Jae-Hee; Kim, Ho Min; Kim, Dong-Wook; Kim, Hyongbum

    2016-02-01

    Targeted genome-editing technology using designed nucleases has been evolving rapidly, and its applications are widely expanding in research, medicine and biotechnology. Using this genome-modifying technology, researchers can precisely and efficiently insert, remove or change specific sequences in various cultured cells, micro-organisms, animals and plants. This genome editing is based on the generation of double-strand breaks (DSBs), repair of which modifies the genome through nonhomologous end-joining (NHEJ) or homology-directed repair (HDR). In addition, designed nickase-induced generation of single-strand breaks can also lead to precise genome editing through HDR, albeit at relatively lower efficiencies than that induced by nucleases. Three kinds of designed nucleases have been used for targeted DSB formation: zinc-finger nucleases, transcription activator-like effector nucleases, and RNA-guided engineered nucleases derived from the bacterial clustered regularly interspaced short palindromic repeat (CRISPR)-Cas (CRISPR-associated) system. A growing number of researchers are using genome-editing technologies, which have become more accessible and affordable since the discovery and adaptation of CRISPR-Cas9. Here, the repair mechanism and outcomes of DSBs are reviewed and the three types of designed nucleases are discussed with the hope that such understanding will facilitate applications to genome editing. © 2015 Society for Experimental Biology, Association of Applied Biologists and John Wiley & Sons Ltd.

  11. BOOK REVIEW: A Journey with Fred Hoyle (Second Edition)

    Science.gov (United States)

    Wickramasinghe, Chandra; Sterken, Christiaan

    2013-12-01

    the accepted views on the origin of life (the primordial soup theory). This led to their two "heresies": disease-causing viruses come from space, and microbial life is omnipresent in interstellar space. They also opposed Darwinian theory, and launched a frontal assault on conventional theories of biological evolution on Earth. Hoyle, though, always played the role of devil's advocate until he was convinced that there were overwhelming arguments to support one of his radical propositions. All of this was done before the era of mass communication and powerful computers. The book also is a testimony about how scientists really work and how they cope with deep cultural bias, argumentation based on articles of faith, misrepresentations, standard dogmas, prejudices, jealousies, political intrigues, irrelevant squabbles in the "cloisters of universities" and politicised academies of science. Most interesting is also that, already in the first edition, reference is made to the detrimental impact of the practice of counting research papers and citations, to the role of the media in reporting on big science, and to how the publishing business works. The story also reveals that, despite high productivity, the continuity of their team was repeatedly threatened. In this context, Chandra Wickramasinghe's statement "my work was a solace" can be seen as pep talk for the ears of any desperate young scientist. This book is well worth reading, not only by astronomy students (and their supervisors), but also by any student in the physical sciences. The book is beautifully typeset in LaTeX by Stallion Press, and printed on fine glossy paper. It is a pity that the graphics are rather poor reproductions of the original graphs. More disturbing, though, is the number of typographical errors that were present in the first edition, and were not corrected for the second edition.

  12. Genome and Epigenome Editing in Mechanistic Studies of Human Aging and Aging-Related Disease.

    Science.gov (United States)

    Lau, Cia-Hin; Suh, Yousin

    2017-01-01

    The recent advent of genome and epigenome editing technologies has provided a new paradigm in which the landscape of the human genome and epigenome can be precisely manipulated in their native context. Genome and epigenome editing technologies can be applied to many aspects of aging research and offer the potential to develop novel therapeutics against age-related diseases. Here, we discuss the latest technological advances in the CRISPR-based genome and epigenome editing toolbox, and provide insight into how these synthetic biology tools could facilitate aging research by establishing in vitro cell and in vivo animal models to dissect genetic and epigenetic mechanisms underlying aging and age-related diseases. We discuss recent developments in the field with the aims to precisely modulate gene expression and dynamic epigenetic landscapes in a spatial and temporal manner in cellular and animal models, by complementing the CRISPR-based editing capability with conditional genetic manipulation tools including chemically inducible expression systems, optogenetics, logic gate genetic circuits, tissue-specific promoters, and the serotype-specific adeno-associated virus. We also discuss how the combined use of genome and epigenome editing tools permits investigators to uncover novel molecular pathways involved in the pathophysiology and etiology conferred by risk variants associated with aging and aging-related disease. A better understanding of the genetic and epigenetic regulatory mechanisms underlying human aging and age-related disease will significantly contribute to the developments of new therapeutic interventions for extending health span and life span, ultimately improving the quality of life in the elderly populations. © 2016 S. Karger AG, Basel.

  13. Introduction to nuclear science, second edition

    CERN Document Server

    Bryan, Jeff C.

    2013-01-01

    This book was written to provide students who have limited backgrounds in the physical sciences and math with an accessible textbook on nuclear science. Expanding on the foundation of the bestselling first edition, Introduction to Nuclear Science, Second Edition provides a clear and complete introduction to nuclear chemistry and physics, from basic concepts to nuclear power and medical applications. Incorporating suggestions from professors using this book for their courses, the author has created a new text that is approximately 60 percent larger and more comprehensive and flexible than the first.New to This Edition: Thorough review of nuclear forensics, radiology, gamma cameras, and decay through proton or neutron emission More detailed explanations of the necessary mathematics A chapter on dosimetry of radiation fields Expanded discussion of applications, introduced earlier in the text More in-depth coverage of nuclear reactors, including a new chapter examining more reactor types, their safety systems,...

  14. Ethical and regulatory aspects of genome editing.

    Science.gov (United States)

    Kohn, Donald B; Porteus, Matthew H; Scharenberg, Andrew M

    2016-05-26

    Gene editing is a rapidly developing area of biotechnology in which the nucleotide sequence of the genome of living cells is precisely changed. The use of genome-editing technologies to modify various types of blood cells, including hematopoietic stem cells, has emerged as an important field of therapeutic development for hematopoietic disease. Although these technologies offer the potential for generation of transformative therapies for patients suffering from myriad disorders of hematopoiesis, their application for therapeutic modification of primary human cells is still in its infancy. Consequently, development of ethical and regulatory frameworks that ensure their safe and effective use is an increasingly important consideration. Here, we review a number of issues that have the potential to impact the clinical implementation of genome-editing technologies, and suggest paths forward for resolving them such that new therapies can be safely and rapidly translated to the clinic. © 2016 by The American Society of Hematology.

  15. Mutations in the Transmembrane Domain and Cytoplasmic Tail of Hendra Virus Fusion Protein Disrupt Virus-Like-Particle Assembly.

    Science.gov (United States)

    Cifuentes-Muñoz, Nicolás; Sun, Weina; Ray, Greeshma; Schmitt, Phuong Tieu; Webb, Stacy; Gibson, Kathleen; Dutch, Rebecca Ellis; Schmitt, Anthony P

    2017-07-15

    Hendra virus (HeV) is a zoonotic paramyxovirus that causes deadly illness in horses and humans. An intriguing feature of HeV is the utilization of endosomal protease for activation of the viral fusion protein (F). Here we investigated how endosomal F trafficking affects HeV assembly. We found that the HeV matrix (M) and F proteins each induced particle release when they were expressed alone but that their coexpression led to coordinated assembly of virus-like particles (VLPs) that were morphologically and physically distinct from M-only or F-only VLPs. Mutations to the F protein transmembrane domain or cytoplasmic tail that disrupted endocytic trafficking led to failure of F to function with M for VLP assembly. Wild-type F functioned normally for VLP assembly even when its cleavage was prevented with a cathepsin inhibitor, indicating that it is endocytic F trafficking that is important for VLP assembly, not proteolytic F cleavage. Under specific conditions of reduced M expression, we found that M could no longer induce significant VLP release but retained the ability to be incorporated as a passenger into F-driven VLPs, provided that the F protein was competent for endocytic trafficking. The F and M proteins were both found to traffic through Rab11-positive recycling endosomes (REs), suggesting a model in which F and M trafficking pathways converge at REs, enabling these proteins to preassemble before arriving at plasma membrane budding sites. IMPORTANCE Hendra virus and Nipah virus are zoonotic paramyxoviruses that cause lethal infections in humans. Unlike that for most paramyxoviruses, activation of the henipavirus fusion protein occurs in recycling endosomal compartments. In this study, we demonstrate that the unique endocytic trafficking pathway of Hendra virus F protein is required for proper viral assembly and particle release. These results advance our basic understanding of the henipavirus assembly process and provide a novel model for the interplay between

  16. [Application progress of CRISPR/Cas9 genome editing technology in the treatment of HIV-1 infection].

    Science.gov (United States)

    Han, Ying-lun; Li, Qing-wei

    2016-01-01

    The goal of gene therapy is to introduce foreign genes into human target cells in a certain way to correct or compensate diseases caused by defective or abnormal genes. Therefore, gene therapy has great practical significance in studying the treatment of persistent or latent HIV-1 infection. At present, the existing methods of gene therapy have some major defects such as limited target site recognition and high frequency of off-targets. The latest research showed that the clustered regularly interspaced short palindromic repeats (CRISPR) /CRISPR-associated nuclease 9 (Cas9) system from bacteria and archaea has been successfully reformed to a targeted genome editing tool. Thus, how to achieve the goal of treating HIV-1 infection by modifying targeted HIV-1 virus genome effectively using the CRISPR/Cas9 system has become a current research focus. Here we review the latest achievements worldwide and briefly introduce applications of the CRISPR/Cas9 genome editing technology in the treatment of HIV-1 infection, including CCR5 gene editing, removal of HIV-1 virus and activation of HIV-1 virus, in order to provide reference for the prevention and treatment of HIV-1 infection.

  17. CHLORELLA VIRUSES

    Science.gov (United States)

    Yamada, Takashi; Onimatsu, Hideki; Van Etten, James L.

    2007-01-01

    Chlorella viruses or chloroviruses are large, icosahedral, plaque‐forming, double‐stranded‐DNA—containing viruses that replicate in certain strains of the unicellular green alga Chlorella. DNA sequence analysis of the 330‐kbp genome of Paramecium bursaria chlorella virus 1 (PBCV‐1), the prototype of this virus family (Phycodnaviridae), predict ∼366 protein‐encoding genes and 11 tRNA genes. The predicted gene products of ∼50% of these genes resemble proteins of known function, including many that are completely unexpected for a virus. In addition, the chlorella viruses have several features and encode many gene products that distinguish them from most viruses. These products include: (1) multiple DNA methyltransferases and DNA site‐specific endonucleases, (2) the enzymes required to glycosylate their proteins and synthesize polysaccharides such as hyaluronan and chitin, (3) a virus‐encoded K+ channel (called Kcv) located in the internal membrane of the virions, (4) a SET domain containing protein (referred to as vSET) that dimethylates Lys27 in histone 3, and (5) PBCV‐1 has three types of introns; a self‐splicing intron, a spliceosomal processed intron, and a small tRNA intron. Accumulating evidence indicates that the chlorella viruses have a very long evolutionary history. This review mainly deals with research on the virion structure, genome rearrangements, gene expression, cell wall degradation, polysaccharide synthesis, and evolution of PBCV‐1 as well as other related viruses. PMID:16877063

  18. Transportation Energy Data Book, Edition 19

    Energy Technology Data Exchange (ETDEWEB)

    Davis, S.C.

    1999-09-01

    The Transportation Energy Data Book: Edition 19 is a statistical compendium prepared and published by Oak Ridge National Laboratory (ORNL) under contract with the Office of Transportation Technologies in the Department of Energy (DOE). Designed for use as a desk-top reference, the data book represents an assembly and display of statistics and information that characterize transportation activity, and presents data on other factors that influence transportation energy use. The purpose of this document is to present relevant statistical data in the form of tables and graphs. The latest editions of the Data Book are available to a larger audience via the Internet (http://www-cta.ornl.gov/data/tedb.htm).

  19. The art of editing RNA structural alignments

    DEFF Research Database (Denmark)

    Andersen, Ebbe Sloth

    2014-01-01

    Manual editing of RNA structural alignments may be considered more art than science, since it still requires an expert biologist to take multiple levels of information into account and be slightly creative when constructing high-quality alignments. Even though the task is rather tedious, it is re......Manual editing of RNA structural alignments may be considered more art than science, since it still requires an expert biologist to take multiple levels of information into account and be slightly creative when constructing high-quality alignments. Even though the task is rather tedious...

  20. The Ethics of Germline Gene Editing.

    Science.gov (United States)

    Gyngell, Christopher; Douglas, Thomas; Savulescu, Julian

    2017-08-01

    Germline Gene Editing (GGE) has enormous potential both as a research tool and a therapeutic intervention. While other types of gene editing are relatively uncontroversial, GGE has been strongly resisted. In this article, we analyse the ethical arguments for and against pursuing GGE by allowing and funding its development. We argue there is a strong case for pursuing GGE for the prevention of disease. We then examine objections that have been raised against pursuing GGE and argue that these fail. We conclude that the moral case in favour of pursuing GGE is stronger than the case against. This suggests that pursuing GGE is morally permissible and indeed morally desirable.

  1. Genome editing in zebrafish: a practical overview.

    Science.gov (United States)

    Sertori, Robert; Trengove, Monique; Basheer, Faiza; Ward, Alister C; Liongue, Clifford

    2016-07-01

    Zebrafish is a powerful model for the study of vertebrate development, being amenable to a wide range of genetic and other manipulations to probe the molecular basis of development and its perturbation in disease. Over recent years, genome editing approaches have become increasingly used as an efficient and sophisticated approach to precisely engineer the zebrafish genome, which has further enhanced the utility of this organism. This review provides a practical overview of genome editing and its application in zebrafish research, including alternate strategies for introducing and screening for specific genetic changes. © The Author 2015. Published by Oxford University Press. All rights reserved. For permissions, please email: journals.permissions@oup.com.

  2. Genome Editing in Human Pluripotent Stem Cells.

    Science.gov (United States)

    Carlson-Stevermer, Jared; Saha, Krishanu

    2017-01-01

    Genome editing in human pluripotent stem cells (hPSCs) enables the generation of reporter lines and knockout cell lines. Zinc finger nucleases, transcription activator-like effector nucleases (TALENs), and CRISPR/Cas9 technology have recently increased the efficiency of proper gene editing by creating double strand breaks (DSB) at defined sequences in the human genome. These systems typically use plasmids to transiently transcribe nucleases within the cell. Here, we describe the process for preparing hPSCs for transient expression of nucleases via electroporation and subsequent analysis to create genetically modified stem cell lines.

  3. Global Bathymetry: Machine Learning for Data Editing

    Science.gov (United States)

    Sandwell, D. T.; Tea, B.; Freund, Y.

    2017-12-01

    The accuracy of global bathymetry depends primarily on the coverage and accuracy of the sounding data and secondarily on the depth predicted from gravity. A main focus of our research is to add newly-available data to the global compilation. Most data sources have 1-12% of erroneous soundings caused by a wide array of blunders and measurement errors. Over the years we have hand-edited this data using undergraduate employees at UCSD (440 million soundings at 500 m resolution). We are developing a machine learning approach to refine the flagging of the older soundings and provide automated editing of newly-acquired soundings. The approach has three main steps: 1) Combine the sounding data with additional information that may inform the machine learning algorithm. The additional parameters include: depth predicted from gravity; distance to the nearest sounding from other cruises; seafloor age; spreading rate; sediment thickness; and vertical gravity gradient. 2) Use available edit decisions as training data sets for a boosted tree algorithm with a binary logistic objective function and L2 regularization. Initial results with poor quality single beam soundings show that the automated algorithm matches the hand-edited data 89% of the time. The results show that most of the information for detecting outliers comes from predicted depth with secondary contributions from distance to the nearest sounding and longitude. A similar analysis using very high quality multibeam data shows that the automated algorithm matches the hand-edited data 93% of the time. Again, most of the information for detecting outliers comes from predicted depth secondary contributions from distance to the nearest sounding and longitude. 3) The third step in the process is to use the machine learning parameters, derived from the training data, to edit 12 million newly acquired single beam sounding data provided by the National Geospatial-Intelligence Agency. The output of the learning algorithm will be

  4. Current and future editing reagent delivery systems for plant genome editing.

    Science.gov (United States)

    Ran, Yidong; Liang, Zhen; Gao, Caixia

    2017-05-01

    Many genome editing tools have been developed and new ones are anticipated; some have been extensively applied in plant genetics, biotechnology and breeding, especially the CRISPR/Cas9 system. These technologies have opened up a new era for crop improvement due to their precise editing of user-specified sequences related to agronomic traits. In this review, we will focus on an update of recent developments in the methodologies of editing reagent delivery, and consider the pros and cons of current delivery systems. Finally, we will reflect on possible future directions.

  5. Shielded Metal Arc Welding and Carbon Arc Cutting--Air. Teacher Edition [and] Student Edition [and] Student Workbook. Third Edition.

    Science.gov (United States)

    Harper, Eddie; Knapp, John

    This document contains the teacher and student texts and student workbook for a secondary-level course in shielded metal arc welding (SMAW) and carbon arc cutting that consists of units on the following topics: SMAW safety; SMAW equipment, applications, and techniques; hardfacing; and carbon arc cutting--air. The teacher edition includes the…

  6. Experimental Stochatics (2nd edition)

    International Nuclear Information System (INIS)

    Wiberg, P

    2004-01-01

    for teachers of computational stochastic methods, is the main contribution of this electronic monograph. However, both the book and software suffer from several severe problems. Firstly, I feel that the structure of the text is weak. Probably this is partly the result of the text from the CD-ROM being put into a book format, but the short paragraphs and poorly structured sentences destroy the reading experience. Secondly, although the software is functional, I believe that, like me, many users will be disappointed by the quality of the user interface and the visualizations. The opportunities to interact with the simulations are limited. Thirdly, the presentation is slightly old fashioned and lacking in pedagogical structure. For example, flow charts and Pascal programs are used to present algorithms. To conclude, I am surprised that this electronic monograph warranted a second edition in this form. Teachers may find the examples useful as a starting point, but students and researchers are advised to look elsewhere. (book review)

  7. Unravelling the Franklin Mystery, Second Edition with David C. Woodman

    DEFF Research Database (Denmark)

    Burke, Danita Catherine

    2017-01-01

    This is a forthcoming book review of David C. Woodman's second edition of his book "Unravelling the Franklin Mystery."......This is a forthcoming book review of David C. Woodman's second edition of his book "Unravelling the Franklin Mystery."...

  8. Direct Visual Editing of Node Attributes in Graphs

    Directory of Open Access Journals (Sweden)

    Christian Eichner

    2016-10-01

    Full Text Available There are many expressive visualization techniques for analyzing graphs. Yet, there is only little research on how existing visual representations can be employed to support data editing. An increasingly relevant task when working with graphs is the editing of node attributes. We propose an integrated visualize-and-edit approach to editing attribute values via direct interaction with the visual representation. The visualize part is based on node-link diagrams paired with attribute-dependent layouts. The edit part is as easy as moving nodes via drag-and-drop gestures. We present dedicated interaction techniques for editing quantitative as well as qualitative attribute data values. The benefit of our novel integrated approach is that one can directly edit the data while the visualization constantly provides feedback on the implications of the data modifications. Preliminary user feedback indicates that our integrated approach can be a useful complement to standard non-visual editing via external tools.

  9. Virus Pathogenity of Newcastle Disease in Chicken

    Directory of Open Access Journals (Sweden)

    Dyah Ayu Hewajuli

    2011-06-01

    Full Text Available Newcastle disease (ND is one of the highly infectious diseases in poultry industry. Newcastle disease causes high morbidity and mortality in birds, then it causes significant loss for poultry industry. This disease is caused by Avian paramyxovirus-1, included in the genus of Avulavirus and family of Paramyxoviridae. This virus has six prior proteins and two non structural proteins that evolving its genom. Those proteins are Nucleocapsid protein (N, Phosphoprotein (P, Matrix protein (M, Fusion protein (F, Hemagglutinin-neuraminidase protein (HN and Large polymerase protein (L and two non structural proteins iVe and W protein which are produced during the transcriptation process of P gen on editing process. Each of the protein has a specific role that responsible for the virulence of the virus. The previous result showed that HN and F proteins have significant contribution in the virulence and spreading of ND virus in the hosts. Virulence of ND virus primarily is determined by the cleavage site of F protein, but the recent research showed that the cleavage site motiv of F0 protein is not the only factor to determine the virulence of ND virus. Besides F protein, other proteins also contribute patern to the virulence of ND virus. ND virus can infect more than 200 species of birds, but the severity level of the disease varies depending on the host and strain of ND virus. Chicken has the highest pathogenicity index compared to other birds. Generally, the immunity system in chicken against infection of ND virus is similar to the immunity system of other birds. Cell mediated and humoral immunity responses play an important role in overcome ND virus.

  10. SARS virus

    Indian Academy of Sciences (India)

    First page Back Continue Last page Overview Graphics. SARS virus. Novel corona virus emerges in the new millenia. Genome sequences invariant- global isolates do not show differences of consequence.Protein spike similar. HE gene absent. 2787 nucleotides. Largest genome. Jumps species by genetic deletion.

  11. CHANDIPURA VIRUS

    Indian Academy of Sciences (India)

    First page Back Continue Last page Overview Graphics. CHANDIPURA VIRUS. First isolated from a village called Chandipura near Nagpur in 1965 in India. Belongs to rhabdoviridae family. Used as a Model System to study RNA virus multiplication in the infected cell at molecular level. Notes:

  12. Schmallenberg Virus

    Indian Academy of Sciences (India)

    IAS Admin

    challenged with emerging and re-emerging infections that pose a constant threat to human and animal health. Indeed, researchers around the globe are still fighting deadly diseases like malaria, trypanosomosis and AIDS. In this article, we focus on a recently identified virus, namely, Schmallenberg virus as an example of a.

  13. Phytophthora viruses.

    Science.gov (United States)

    Cai, Guohong; Hillman, Bradley I

    2013-01-01

    Phytophthora sp. is a genus in the oomycetes, which are similar to filamentous fungi in morphology and habitat, but phylogenetically more closely related to brown algae and diatoms and fall in the kingdom Stramenopila. In the past few years, several viruses have been characterized in Phytophthora species, including four viruses from Phytophthora infestans, the late blight pathogen, and an endornavirus from an unnamed Phytophthora species from Douglas fir. Studies on Phytophthora viruses have revealed several interesting systems. Phytophthora infestans RNA virus 1 (PiRV-1) and PiRV-2 are likely the first members of two new virus families; studies on PiRV-3 support the establishment of a new virus genus that is not affiliated with established virus families; PiRV-4 is a member of Narnaviridae, most likely in the genus Narnavirus; and Phytophthora endornavirus 1 (PEV1) was the first nonplant endornavirus at the time of reporting. Viral capsids have not been found in any of the above-mentioned viruses. PiRV-1 demonstrated a unique genome organization that requires further examination, and PiRV-2 may have played a role in late blight resurgence in 1980s-1990s. Copyright © 2013 Elsevier Inc. All rights reserved.

  14. Human Resources Administration: A School-Based Perspective. Fourth Edition

    Science.gov (United States)

    Smith, Richard

    2009-01-01

    Enhanced and updated, this Fourth Edition of Richard E. Smith's highly successful text examines the growing role of the principal in planning, hiring, staff development, supervision, and other human resource functions. The Fourth Edition includes new sections on ethics, induction, and the role of the mentor teacher. This edition also introduces…

  15. Editing modifies the GABA(A) receptor subunit alpha3

    DEFF Research Database (Denmark)

    Ohlson, Johan; Pedersen, Jakob Skou; Haussler, David

    2007-01-01

    to find selectively edited sites and combined it with bioinformatic techniques that find stem-loop structures suitable for editing. We present here the first verified editing candidate detected by this screening procedure. We show that Gabra-3, which codes for the alpha3 subunit of the GABA(A) receptor...

  16. Editing Bosman's stories | MacKenzie | Current Writing: Text and ...

    African Journals Online (AJOL)

    This article looks back at the editing work that went into the fourteen-volume Anniversary Edition of Herman Charles Bosman (1998–2005) and pays particular attention to the editing of Bosman's stories. It examines some of the problems that were encountered in arriving at 'authoritative' versions of the stories and argues ...

  17. The role of RNA editing in dynamic environments

    Energy Technology Data Exchange (ETDEWEB)

    Rocha, L. M. (Luis Mateus); Huang, C. F. (Chien-Feng)

    2004-01-01

    This paper presents a computational methodology based on Genetic Algorithms with Genotype Editing (GAE) for investigating the role of RNA editing in dynamic environments. This model is constructed based on several genetic editing characteristics that are gleaned from the RNA editing system as observed in several organisms. We have previously expanded the traditional Genetic Algorithm (GA) with artificial editing mechanisms (Rocha, 1995, 1997), and studied the benefits of including straightforward Genotype Editing in GA for several machine learning problems (Huang and Rocha, 2003, 2004). We show that the incorporation of genotype editing provides a means for artificial agents with genetic descriptions to gain greater phenotypic plasticity. Artificial agents use genotype edition to their advantage by linking it to environmental context. The ability to link changes in the environment with editing parameters gives organisms an adaptive advantage as genotype expression can become contextually regulated. The study of this RNA editing model in changing environments has shed some light into the evolutionary implications of RNA editing. We expect that our methodology will both facilitate determining the evolutionary role of RNA editing in biology, and advance the current state of research in Evolutionary Computation and Artificial Life.

  18. Soil Carbon Sequestration and the Greenhouse Effect (2nd Edition)

    Science.gov (United States)

    This volume is a second edition of the book “Soil Carbon Sequestration and The Greenhouse Effect”. The first edition was published in 2001 as SSSA Special Publ. #57. The present edition is an update of the concepts, processes, properties, practices and the supporting data. All chapters are new co...

  19. Let's Talk About Docs (NCSA Edition)

    OpenAIRE

    Sick, Jonathan

    2016-01-01

    User documentation is an essential part of delivering great software. This presentation frames how we should think about user documentation (as software developers and researchers). It covers the three types of documentation (tutorials, user guides and references), and how these formats work together. Finally, the presentation gives some advice on effective technical writing and editing.

  20. Positive Behavior Support Training Curriculum. Second Edition

    Science.gov (United States)

    Reid, Dennis H.; Parsons, Marsha B.

    2007-01-01

    The American Association on Intellectual and Developmental Disabilities' (AAIDD's) Positive Behavior Support Training Curriculum," Second Edition" ("PBSTC"), is a curriculum for training direct support personnel and their supervisors in the values and practices of Positive Behavior Support. The curriculum is designed for direct support persons and…

  1. Does Money Matter in Education? Second Edition

    Science.gov (United States)

    Baker, Bruce D.

    2016-01-01

    This second edition policy brief revisits the long and storied literature on whether money matters in providing a quality education. It includes research released since the original brief in 2012 and covers a handful of additional topics. Increasingly, political rhetoric adheres to the unfounded certainty that money does not make a difference in…

  2. The NMC Horizon Report: 2013 Museum Edition

    Science.gov (United States)

    Johnson, L.; Adams Becker, S.; Freeman, A.

    2013-01-01

    The "NMC Horizon Report: 2013 Museum Edition," is a co-production with the Marcus Institute for Digital Education in the Arts (MIDEA), and examines six emerging technologies for their potential impact on and use in education and interpretation within the museum environment: BYOD (Bring Your Own Device), crowdsourcing, electronic…

  3. The Art of Electronics - 2nd Edition

    Science.gov (United States)

    Horowitz, Paul; Hill, Winfield

    1989-09-01

    This is the thoroughly revised and updated second edition of the hugely successful The Art of Electronics. Widely accepted as the single authoritative text and reference on electronic circuit design, both analog and digital, the original edition sold over 125,000 copies worldwide and was translated into eight languages. The book revolutionized the teaching of electronics by emphasizing the methods actually used by citcuit designers - a combination of some basic laws, rules to thumb, and a large nonmathematical treatment that encourages circuit values and performance. The new Art of Electronics retains the feeling of informality and easy access that helped make the first edition so successful and popular. It is an ideal first textbook on electronics for scientists and engineers and an indispensable reference for anyone, professional or amateur, who works with electronic circuits. The best self-teaching book and reference book in electronics Simply indispensable, packed with essential information for all scientists and engineers who build electronic circuits Totally rewritten chapters on microcomputers and microprocessors The first edition of this book has sold over 100,000 copies in seven years, it has a market in virtually all research centres where electronics is important

  4. Handbook of paediatric radiography. Second edition

    International Nuclear Information System (INIS)

    Gyll, C.

    1985-01-01

    This book gives some ideas on how to achieve good radiographs of children. In this second edition most papers are expanded and brought up to date, the paper on the neonate completely rewritten, and a discussion of child development and child psychology added

  5. Ladybugs of South Dakota, 2nd edition

    Science.gov (United States)

    Images of the 80 species of Coccinellidae, commonly known as lady beetles, that occur in South Dakota are presented in taxonomic order. The second edition updates information, including the addition of a species new to South Dakota. Information on each species includes genus-species name, sub-fami...

  6. International guide to the circus. - 2015 edition

    NARCIS (Netherlands)

    Huey, R.; Albrecht, E.; Belbahri, N.; Brunsdale, M.; Christian, J.; Garcia, J.; Giarola, A.; Jando, D.; Lehmann, R.; Marier, F.; Nieminen, K.; Parkinson, G.; Pierce, R.D.; Revolledo Cárdenas, J.; Rodenhuis, W.; Serena, A.; Schlotfeldt, A.; Shaina, C.; Shrake, P.; Simon, M.; St. Leon, M.; Stone, C.; Cooper, J.; Tamaoki, V.; Winkler, G.

    2015-01-01

    An easy-to-read publication defining 100 key circus terms translated in nine languages. The 2015 edition has been re-created in a smaller "pocket" version, 44 pages in length and weighing 63 grams per book. Additional images have been added to illustrate terms and each book is sold complete with a

  7. Thermodynamics of Fluids Under Flow Second Edition

    CERN Document Server

    Jou, David; Criado-Sancho, Manuel

    2011-01-01

    This is the second edition of the book “Thermodynamics of Fluids under Flow,” which was published in 2000 and has now been corrected, expanded and updated. This is a companion book to our other title Extended irreversible thermodynamics (D. Jou, J. Casas-Vázquez and G. Lebon, Springer, 4th edition 2010), and of the textbook Understanding non-equilibrium thermodynamics (G. Lebon, D. Jou and J. Casas-Vázquez, Springer, 2008. The present book is more specialized than its counterpart, as it focuses its attention on the non-equilibrium thermodynamics of flowing fluids, incorporating non-trivial thermodynamic contributions of the flow, going beyond local equilibrium theories, i.e., including the effects of internal variables and of external forcing due to the flow. Whereas the book's first edition was much more focused on polymer solutions, with brief glimpses into ideal and real gases, the present edition covers a much wider variety of systems, such as: diluted and concentrated polymer solutions, polymer ble...

  8. Handbook: Emergency Legal Procedures. [Third Edition].

    Science.gov (United States)

    Apperson, Ron; Waxman, Everett

    This is the latest edition of a handbook designed to assist school administrators in preventing and dealing with school disruptions and certain related legal matters. Because the handbook was prepared specifically for use by administrators in the Los Angeles Unified School District, it is based on laws and regulations that may not apply elsewhere.…

  9. Efficient Communication Protocols for Deciding Edit Distance

    DEFF Research Database (Denmark)

    Jowhari, Hossein

    2012-01-01

    In this paper we present two communication protocols on computing edit distance. In our first result, we give a one-way protocol for the following Document Exchange problem. Namely given x ∈ Σn to Alice and y ∈ Σn to Bob and integer k to both, Alice sends a message to Bob so that he learns x...

  10. A Snapshot of Photo Editing Options

    Science.gov (United States)

    Bolkan, J.V.

    2004-01-01

    Plenty of digital imaging professionals claim that Adobe's Photoshop CS is the best photo editing application money can buy. This document reviews Adobe's Photoshop CS and its worthy competitors. In addition to Adobe, the following programs are reviewed in this document: (1) Adobe Photoshop Elements 2.0; (2) Arcsoft PhotoImpression; (3) Jasc Paint…

  11. Power Technologies Data Book 2003 Edition

    Energy Technology Data Exchange (ETDEWEB)

    Aabakken, J.

    2004-06-01

    The 2003 edition of this report, prepared by NREL's Energy Analysis Office, includes up-to-date information on power technologies, including complete technology profiles. The data book also contains charts on electricity restructuring, power technology forecasts and comparisons, electricity supply, electricity capability, electricity generation, electricity demand, prices, economic indicators, environmental indicators, conversion factors, and selected congressional questions and answers.

  12. A DESCRIPTIVE INDONESIAN GRAMMAR--PRELIMINARY EDITION.

    Science.gov (United States)

    DYEN, ISIDORE

    THIS PRELIMINARY EDITION COMPRISES A DESCRIPTIVE GRAMMAR OF INDONESIAN (BAHASA INDONESIA), THE OFFICIAL LANGUAGE OF THE REPUBLIC OF INDONESIA. THE THREE SECTIONS--PHONOLOGY, SYNTAX, AND MORPHOLOGY--PRESENT A COMPREHENSIVE LINGUISTIC ANALYSIS OF INDONESIAN, WITH OCCASIONAL CONTRASTIVE REFERENCE TO MALAY, JAVANESE, SUNDANESE, AND SUMATRAN. THIS…

  13. Grants for Children & Youth--2012 Digital Edition

    Science.gov (United States)

    Foundation Center, 2011

    2011-01-01

    This publication is only available as a downloadable file. See who's giving and getting grants in your field. Strengthen your search for funds with the Foundation Center's digital edition of "Grants for Children & Youth." This new "Grant Guide" reveals the scope of current foundation giving in the field. You'll find descriptions of 37,992 grants…

  14. Grants for Higher Education. 2012 Digital Edition

    Science.gov (United States)

    Foundation Center, 2011

    2011-01-01

    This publication is only available as a downloadable file. See who's giving and getting grants in your field. Strengthen your search for funds with the Foundation Center's digital edition of "Grants for Higher Education." This new "Grant Guide" reveals the scope of current foundation giving in the field. You'll find descriptions of 19,705 grants…

  15. Grants for Employment--2012 Digital Edition

    Science.gov (United States)

    Foundation Center, 2011

    2011-01-01

    This publication is only available as a downloadable file. See who's giving and getting grants in your field. Strengthen your search for funds with the Foundation Center's digital edition of "Grants for Employment." This new "Grant Guide" reveals the scope of current foundation giving in the field. You'll find descriptions of 4,129 grants of…

  16. Genome Editing in Sugarcane: Challenges ahead

    Directory of Open Access Journals (Sweden)

    Chakravarthi Mohan

    2016-10-01

    Full Text Available Genome editing opens new and unique opportunities for researchers to enhance crop production. Until 2013, the zinc finger nucleases (ZFNs and transcription activator-like effector nucleases (TALENs were the key tools used for genome editing applications. The advent of RNA-guided engineered nucleases - the type II clustered regularly interspaced short palindromic repeat (CRISPR/Cas9 (CRISPR-associated system from Streptococcus pyogenes holds great potential since it is simple, effective and more versatile than ZFNs and TALENs. CRISPR/Cas9 system has already been successfully employed in several crop plants. Use of these techniques is in its infant stage in sugarcane. Jung and Altpeter (2016 have reported TALEN mediated approach for the first time to reduce lignin content in sugarcane to make it amenable for biofuel production. This is so far the only report describing genome editing in sugarcane. Large genome size, polyploidy, low transformation efficiency, transgene silencing and lack of high throughput screening techniques are certainly great challenges for genome editing in sugarcane which would be discussed in detail in this review.

  17. Edit Distance to Monotonicity in Sliding Windows

    DEFF Research Database (Denmark)

    Chan, Ho-Leung; Lam, Tak-Wah; Lee, Lap Kei

    2011-01-01

    of a data stream is becoming well-understood over the past few years. Motivated by applications on network quality monitoring, we extend the study to estimating the edit distance to monotonicity of a sliding window covering the w most recent items in the stream for any w ≥ 1. We give a deterministic...

  18. School Law: Cases and Concepts. Seventh Edition.

    Science.gov (United States)

    LaMorte, Michael W.

    This book examines the sizable body of school law that outlines legally defensible decisions. A substantial part of it contains edited, reported, and verbatim decisions. Historical perspective is provided, as well as specific case and statutory law. Chapter 1 discusses sources of law for educators, state school board policies, attorneys-general…

  19. Telling Mathematical Stories with Live Editing

    Science.gov (United States)

    Thomson, Ian

    2017-01-01

    Using "live editing" it is possible to write code that can be run a section at a time. This makes it easier to spot and correct errors. It can also be used to create an interactive mathematical story. This brief article shows how MATLAB software can be used to take the user on a mathematical journey with historical connections.

  20. Qualities of Effective Teachers. 2nd Edition

    Science.gov (United States)

    Stronge, James H.

    2007-01-01

    Thousands of educators who are involved with teacher professional development--from training to hiring, mentoring to supervising--rely on this authoritative book to focus on cultivating teacher qualities that are most apt to raise student achievement. Now, this new edition extends this results-based approach to include teachers who work with…

  1. Introduction to Energy - 2nd Edition

    Science.gov (United States)

    Cassedy, Edward S.; Grossman, Peter Z.

    1998-12-01

    Energy issues such as pollution, resource depletion, global warming, nuclear power and waste are problems that demand timely solutions. This book provides a critical examination of the resources, market forces, and social impacts of modern energy production. The book addresses the dilemmas that have arisen due to society's crucial dependence on energy, particularly fossil fuels, and explores the available alternative energy producing technologies. The second edition has increased emphasis on those issues at the forefront of the current energy debate: energy sustainability, climate change, and the radical restructuring of the power industry due to de-regulation. Assuming no prior technical expertise and avoiding complex mathematical formulation, it is directed at a broad readership. The second edition will follow the first in proving especially useful as a textbook for undergraduate programs in Science, Technology and Society (STS), and as a supplementary text in a variety of courses which touch upon energy studies, including environmental and technology policy, environmental, mineral and business law, energy and resource economics. Fully updated second edition of successful first edition that was adopted on Science, Technology and Society courses Provides a critical examination of all aspects of modern energy production for non-technical readers For a broad readership from a variety of backgrounds

  2. Kids & Family Reading Report™. 6th Edition

    Science.gov (United States)

    Scholastic Inc., 2017

    2017-01-01

    This report presents the 6th Edition of Scholastic's biannual study of children's and parents' attitudes and behaviors about reading. The latest research touches on: (1) Reading Books for Fun; (2) Reading Aloud; (3) Summer Reading; and (4) Favorite Children's Books. This research provides both reasons to celebrate as well as a strong motivation to…

  3. 10 Tempting Image-Editing Tasks

    Science.gov (United States)

    Guhin, Paula

    2009-01-01

    Asking students to manipulate digital photos on the computer is one of the easiest ways the author knows to engage their attention. It's fabulous fun for them and a great teaching tool for educators. In this article, the author presents 10 ways to impress students with image-editing software. These are: (1) filters are fascinating; (2) get a move…

  4. ISEE : An Intuitive Sound Editing Environment

    NARCIS (Netherlands)

    Vertegaal, R.P.H.; Bonis, E.

    1994-01-01

    This article presents ISEE, an intuitive sound editing environment, as a general sound synthesis model based on expert auditory perception and cognition of musical instruments. It discusses the backgrounds of current synthesizer user interface design and related timbre space research. Of the three

  5. A Model for Flexibly Editing CSCL Scripts

    Science.gov (United States)

    Sobreira, Pericles; Tchounikine, Pierre

    2012-01-01

    This article presents a model whose primary concern and design rationale is to offer users (teachers) with basic ICT skills an intuitive, easy, and flexible way of editing scripts. The proposal is based on relating an end-user representation as a table and a machine model as a tree. The table-tree model introduces structural expressiveness and…

  6. Precision genome editing in the CRISPR era.

    Science.gov (United States)

    Salsman, Jayme; Dellaire, Graham

    2017-04-01

    With the introduction of precision genome editing using CRISPR-Cas9 technology, we have entered a new era of genetic engineering and gene therapy. With RNA-guided endonucleases, such as Cas9, it is possible to engineer DNA double strand breaks (DSB) at specific genomic loci. DSB repair by the error-prone non-homologous end-joining (NHEJ) pathway can disrupt a target gene by generating insertions and deletions. Alternatively, Cas9-mediated DSBs can be repaired by homology-directed repair (HDR) using an homologous DNA repair template, thus allowing precise gene editing by incorporating genetic changes into the repair template. HDR can introduce gene sequences for protein epitope tags, delete genes, make point mutations, or alter enhancer and promoter activities. In anticipation of adapting this technology for gene therapy in human somatic cells, much focus has been placed on increasing the fidelity of CRISPR-Cas9 and increasing HDR efficiency to improve precision genome editing. In this review, we will discuss applications of CRISPR technology for gene inactivation and genome editing with a focus on approaches to enhancing CRISPR-Cas9-mediated HDR for the generation of cell and animal models, and conclude with a discussion of recent advances and challenges towards the application of this technology for gene therapy in humans.

  7. CRISPR-Cas9 gene editing

    NARCIS (Netherlands)

    Oude Blenke, Erik; Evers, Martijn J.W.; Mastrobattista, Enrico; Oost, van der John

    2016-01-01

    The CRISPR-Cas9 gene editing system has taken the biomedical science field by storm, initiating rumors about future Nobel Prizes and heating up a fierce patent war, but also making significant scientific impact. The Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR), together with

  8. Genome Editing in Sugarcane: Challenges Ahead.

    Science.gov (United States)

    Mohan, Chakravarthi

    2016-01-01

    Genome editing opens new and unique opportunities for researchers to enhance crop production. Until 2013, the zinc finger nucleases (ZFNs) and transcription activator-like effector nucleases (TALENs) were the key tools used for genome editing applications. The advent of RNA-guided engineered nucleases - the type II clustered regularly interspaced short palindromic repeat (CRISPR)/Cas9 (CRISPR-associated) system from Streptococcus pyogenes holds great potential since it is simple, effective and more versatile than ZFNs and TALENs. CRISPR/Cas9 system has already been successfully employed in several crop plants. Use of these techniques is in its infant stage in sugarcane. Jung and Altpeter (2016) have reported TALEN mediated approach for the first time to reduce lignin content in sugarcane to make it amenable for biofuel production. This is so far the only report describing genome editing in sugarcane. Large genome size, polyploidy, low transformation efficiency, transgene silencing and lack of high throughput screening techniques are certainly great challenges for genome editing in sugarcane which would be discussed in detail in this review.

  9. Genome editing in fishes and their applications.

    Science.gov (United States)

    Zhu, Bo; Ge, Wei

    2018-02-01

    There have been revolutionary progresses in genome engineering in the past few years. The newly-emerged genome editing technologies including zinc-finger nuclease (ZFN), transcription activator-like effector nuclease (TALEN) and clustered regularly interspaced short palindromic repeats associated with Cas9 (CRISPR/Cas9) have enabled biological scientists to perform efficient and precise targeted genome editing in different species. Fish represent the largest group of vertebrates with many species having values for both scientific research and aquaculture industry. Genome editing technologies have found extensive applications in different fish species for basic functional studies as well asapplied research in such fields as disease modeling and aquaculture. This mini-review focuses on recent advancements and applications of the new generation of genome editing technologies in fish species, with particular emphasis on their applications in understanding reproductive functions because the reproductive axis has been most systematically and best studied among others and its function has been difficult to address with reverse genetics approach. Copyright © 2017 Elsevier Inc. All rights reserved.

  10. Evolving edited k-nearest neighbor classifiers.

    Science.gov (United States)

    Gil-Pita, Roberto; Yao, Xin

    2008-12-01

    The k-nearest neighbor method is a classifier based on the evaluation of the distances to each pattern in the training set. The edited version of this method consists of the application of this classifier with a subset of the complete training set in which some of the training patterns are excluded, in order to reduce the classification error rate. In recent works, genetic algorithms have been successfully applied to determine which patterns must be included in the edited subset. In this paper we propose a novel implementation of a genetic algorithm for designing edited k-nearest neighbor classifiers. It includes the definition of a novel mean square error based fitness function, a novel clustered crossover technique, and the proposal of a fast smart mutation scheme. In order to evaluate the performance of the proposed method, results using the breast cancer database, the diabetes database and the letter recognition database from the UCI machine learning benchmark repository have been included. Both error rate and computational cost have been considered in the analysis. Obtained results show the improvement achieved by the proposed editing method.

  11. Edit propagation using geometric relationship functions

    KAUST Repository

    Guerrero, Paul

    2014-04-15

    We propose a method for propagating edit operations in 2D vector graphics, based on geometric relationship functions. These functions quantify the geometric relationship of a point to a polygon, such as the distance to the boundary or the direction to the closest corner vertex. The level sets of the relationship functions describe points with the same relationship to a polygon. For a given query point, we first determine a set of relationships to local features, construct all level sets for these relationships, and accumulate them. The maxima of the resulting distribution are points with similar geometric relationships. We show extensions to handle mirror symmetries, and discuss the use of relationship functions as local coordinate systems. Our method can be applied, for example, to interactive floorplan editing, and it is especially useful for large layouts, where individual edits would be cumbersome. We demonstrate populating 2D layouts with tens to hundreds of objects by propagating relatively few edit operations. © 2014 ACM 0730-0301/2014/03- ART15 $15.00.

  12. Feature sensitive multiscale editing on surfaces

    NARCIS (Netherlands)

    Clarenz, U.; Griebel, M.; Rumpf, M.; Schweitzer, M.A.; Telea, A.

    2004-01-01

    A novel editing method for large triangular meshes is presented. We detect surface features, such as edge and corners, by computing local zero and first surface moments, using a robust and noise resistant method. The feature detection is encoded in a finite element matrix, passed to an algebraic

  13. Collecting and Interpreting Qualitative Materials. Third Edition

    Science.gov (United States)

    Denzin, Norman K., Ed.; Lincoln, Yvonna, Ed.

    2007-01-01

    This book is the third volume of the paperback versions of "The SAGE Handbook of Qualitative Research, Third Edition." This portion of the handbook considers the tasks of collecting, analyzing, and interpreting empirical materials, and comprises the Handbook's Parts IV ("Methods of Collecting and Analyzing Empirical Materials") and V ("The Art and…

  14. The Landscape of Qualitative Research. Third Edition

    Science.gov (United States)

    Denzin, Norman K., Ed.; Lincoln, Yvonna, Ed.

    2007-01-01

    This book, the first volume of the paperback versions of the "The SAGE Handbook of Qualitative Research, Third Edition," takes a look at the field from a broadly theoretical perspective, and is composed of the Handbook's Parts I ("Locating the Field"), II ("Major Paradigms and Perspectives"), and VI ("The Future of Qualitative Research"). "The…

  15. Handbook of Qualitative Research. Second Edition.

    Science.gov (United States)

    Denzin, Norman K., Ed.; Lincoln, Yvonna S., Ed.

    This handbook's second edition represents the state of the art for the theory and practice of qualitative inquiry. It features eight new topics, including autoethnography, critical race theory, applied ethnography, queer theory, and "testimonio"every chapter in the handbook has been thoroughly revised and updated. The book…

  16. Home Study Course Development Handbook. Second Edition.

    Science.gov (United States)

    Lambert, Michael P., Ed.; Welch, Sally R., Ed.

    Intended to help developers of home study courses and their directors of education create good correspondence courses, this document updates the 1980 edition and was developed by members of the National Home Study Council's Research and Educational Standards Committee. The document begins with photographs and biographies of its authors. The…

  17. Kids & Family Reading Report™. 5th Edition

    Science.gov (United States)

    Scholastic Inc., 2015

    2015-01-01

    This report presents the 5th Edition of Scholastic's biannual study of children's and parents' attitudes and behaviors about reading. The latest research touches on reading aloud to children of all ages, the impact of reading independently for fun at school and at home, the importance of frequent reading, and the books children want most to read.…

  18. Nanoparticles for Site Specific Genome Editing

    Science.gov (United States)

    McNeer, Nicole Ali

    Triplex-forming peptide nucleic acids (PNAs) can be used to coordinate the recombination of short 50-60 by "donor DNA" fragments into genomic DNA, resulting in site-specific correction of genetic mutations or the introduction of advantageous genetic modifications. Site-specific gene editing in hematopoietic stem and progenitor cells (HSPCs) could result in treatment or cure of inherited disorders of the blood such as beta-thalassemia. Gene editing in HSPCs and differentiated T cells could help combat HIV/AIDs by modifying receptors, such as CCR5, necessary for R5-tropic HIV entry. However, translation of genome modification technologies to clinical practice is limited by challenges in intracellular delivery, especially in difficult-to-transfect hematolymphoid cells. In vivo gene editing could also provide novel treatment for systemic monogenic disorders such as cystic fibrosis, an autosomal recessive disorder caused by mutations in the cystic fibrosis transmembrane receptor. Here, we have engineered biodegradable nanoparticles to deliver oligonucleotides for site-specific genome editing of disease-relevant genes in human cells, with high efficiency, low toxicity, and editing of clinically relevant cell types. We designed nanoparticles to edit the human beta-globin and CCR5 genes in hematopoietic cells. We show that poly(lactic-co-glycolic acid) (PLGA) nanoparticles can delivery PNA and donor DNA for site-specific gene modification in human hematopoietic cells in vitro and in vivo in NOD-scid IL2rgammanull mice. Nanoparticles delivered by tail vein localized to hematopoietic compartments in the spleen and bone marrow of humanized mice, resulting in modification of the beta-globin and CCR5 genes. Modification frequencies ranged from 0.005 to 20% of cells depending on the organ and cell type, without detectable toxicity. This project developed highly versatile methods for delivery of therapeutics to hematolymphoid cells and hematopoietic stem cells, and will help to

  19. C-to-U editing and site-directed RNA editing for the correction of genetic mutations.

    Science.gov (United States)

    Vu, Luyen Thi; Tsukahara, Toshifumi

    2017-07-24

    Cytidine to uridine (C-to-U) editing is one type of substitutional RNA editing. It occurs in both mammals and plants. The molecular mechanism of C-to-U editing involves the hydrolytic deamination of a cytosine to a uracil base. C-to-U editing is mediated by RNA-specific cytidine deaminases and several complementation factors, which have not been completely identified. Here, we review recent findings related to the regulation and enzymatic basis of C-to-U RNA editing. More importantly, when C-to-U editing occurs in coding regions, it has the power to reprogram genetic information on the RNA level, therefore it has great potential for applications in transcript repair (diseases related to thymidine to cytidine (T>C) or adenosine to guanosine (A>G) point mutations). If it is possible to manipulate or mimic C-to-U editing, T>C or A>G genetic mutation-related diseases could be treated. Enzymatic and non-enzymatic site-directed RNA editing are two different approaches for mimicking C-to-U editing. For enzymatic site-directed RNA editing, C-to-U editing has not yet been successfully performed, and in theory, adenosine to inosine (A-to-I) editing involves the same strategy as C-to-U editing. Therefore, in this review, for applications in transcript repair, we will provide a detailed overview of enzymatic site-directed RNA editing, with a focus on A-to-I editing and non-enzymatic site-directed C-to-U editing.

  20. Informing the Historical Record of Experimental Nonhuman Primate Infections with Ebola Virus: Genomic Characterization of USAMRIID Ebola Virus/H.sapiens-tc/COD/1995/Kikwit-9510621 Challenge Stock R4368 and Its Replacement R4415

    Science.gov (United States)

    2016-03-20

    immune evasion has been described [21]. Editing appears to be 94 tightly controlled, with the ratio of proteins expressed from a 7U virus of roughly 95...the ratio of expressed sGP:GP1,2 in different environments (8U-containing 106 Kugelman et al. EBOV Challenge Stock Characterization 6 viruses ...by Chain et al. using classical dideoxynucleotide sequencing. “134” 141 (passage 3) is cell culture-adapted, consisting predominantly of viruses with

  1. Expression, characterisation and antigenicity of a truncated Hendra virus attachment protein expressed in the protozoan host Leishmania tarentolae.

    Science.gov (United States)

    Fischer, Kerstin; dos Reis, Vinicius Pinho; Finke, Stefan; Sauerhering, Lucie; Stroh, Eileen; Karger, Axel; Maisner, Andrea; Groschup, Martin H; Diederich, Sandra; Balkema-Buschmann, Anne

    2016-02-01

    Hendra virus (HeV) is an emerging zoonotic paramyxovirus within the genus Henipavirus that has caused severe morbidity and mortality in humans and horses in Australia since 1994. HeV infection of host cells is mediated by the membrane bound attachment (G) and fusion (F) glycoproteins, that are essential for receptor binding and fusion of viral and cellular membranes. The eukaryotic unicellular parasite Leishmania tarentolae has recently been established as a powerful tool to express recombinant proteins with mammalian-like glycosylation patterns, but only few viral proteins have been expressed in this system so far. Here, we describe the purification of a truncated, Strep-tag labelled and soluble version of the HeV attachment protein (sHeV G) expressed in stably transfected L. tarentolae cells. After Strep-tag purification the identity of sHeV G was confirmed by immunoblotting and mass spectrometry. The functional binding of sHeV G to the HeV cell entry receptor ephrin-B2 was confirmed in several binding assays. Generated polyclonal rabbit antiserum against sHeV G reacted with both HeV and Nipah virus (NiV) G proteins in immunofluorescence assay and efficiently neutralised NiV infection, thus further supporting the preserved antigenicity of the purified protein. Copyright © 2015 The Authors. Published by Elsevier B.V. All rights reserved.

  2. Strategies of highly pathogenic RNA viruses to block dsRNA detection by RIG-I-like receptors: hide, mask, hit.

    Science.gov (United States)

    Zinzula, Luca; Tramontano, Enzo

    2013-12-01

    Double-stranded RNA (dsRNA) is synthesized during the course of infection by RNA viruses as a byproduct of replication and transcription and acts as a potent trigger of the host innate antiviral response. In the cytoplasm of the infected cell, recognition of the presence of viral dsRNA as a signature of "non-self" nucleic acid is carried out by RIG-I-like receptors (RLRs), a set of dedicated helicases whose activation leads to the production of type I interferon α/β (IFN-α/β). To overcome the innate antiviral response, RNA viruses encode suppressors of IFN-α/β induction, which block RLRs recognition of dsRNA by means of different mechanisms that can be categorized into: (i) dsRNA binding and/or shielding ("hide"), (ii) dsRNA termini processing ("mask") and (iii) direct interaction with components of the RLRs pathway ("hit"). In light of recent functional, biochemical and structural findings, we review the inhibition mechanisms of RLRs recognition of dsRNA displayed by a number of highly pathogenic RNA viruses with different disease phenotypes such as haemorrhagic fever (Ebola, Marburg, Lassa fever, Lujo, Machupo, Junin, Guanarito, Crimean-Congo, Rift Valley fever, dengue), severe respiratory disease (influenza, SARS, Hendra, Hantaan, Sin Nombre, Andes) and encephalitis (Nipah, West Nile). Copyright © 2013 Elsevier B.V. All rights reserved.

  3. Cre Fused with RVG Peptide Mediates Targeted Genome Editing in Mouse Brain Cells In Vivo.

    Science.gov (United States)

    Zou, Zhiyuan; Sun, Zhaolin; Li, Pan; Feng, Tao; Wu, Sen

    2016-12-14

    Cell penetrating peptides (CPPs) are short peptides that can pass through cell membranes. CPPs can facilitate the cellular entry of proteins, macromolecules, nanoparticles and drugs. RVG peptide (RVG hereinafter) is a 29-amino-acid CPP derived from a rabies virus glycoprotein that can cross the blood-brain barrier (BBB) and enter brain cells. However, whether RVG can be used for genome editing in the brain has not been reported. In this work, we combined RVG with Cre recombinase for bacterial expression. The purified RVG-Cre protein cut plasmids in vitro and traversed cell membranes in cultured Neuro2a cells. By tail vein-injecting RVG-Cre into Cre reporter mouse lines mTmG and Rosa26 lacZ , we demonstrated that RVG-Cre could target brain cells and achieve targeted somatic genome editing in adult mice. This direct delivery of the gene-editing enzyme protein into mouse brains with RVG is much safer than plasmid- or viral-based methods, holding promise for further applications in the treatment of various brain diseases.

  4. Postnatal genome editing partially restores dystrophin expression in a mouse model of muscular dystrophy.

    Science.gov (United States)

    Long, Chengzu; Amoasii, Leonela; Mireault, Alex A; McAnally, John R; Li, Hui; Sanchez-Ortiz, Efrain; Bhattacharyya, Samadrita; Shelton, John M; Bassel-Duby, Rhonda; Olson, Eric N

    2016-01-22

    CRISPR/Cas9-mediated genome editing holds clinical potential for treating genetic diseases, such as Duchenne muscular dystrophy (DMD), which is caused by mutations in the dystrophin gene. To correct DMD by skipping mutant dystrophin exons in postnatal muscle tissue in vivo, we used adeno-associated virus-9 (AAV9) to deliver gene-editing components to postnatal mdx mice, a model of DMD. Different modes of AAV9 delivery were systematically tested, including intraperitoneal at postnatal day 1 (P1), intramuscular at P12, and retro-orbital at P18. Each of these methods restored dystrophin protein expression in cardiac and skeletal muscle to varying degrees, and expression increased from 3 to 12 weeks after injection. Postnatal gene editing also enhanced skeletal muscle function, as measured by grip strength tests 4 weeks after injection. This method provides a potential means of correcting mutations responsible for DMD and other monogenic disorders after birth. Copyright © 2016, American Association for the Advancement of Science.

  5. Computer viruses

    Science.gov (United States)

    Denning, Peter J.

    1988-01-01

    The worm, Trojan horse, bacterium, and virus are destructive programs that attack information stored in a computer's memory. Virus programs, which propagate by incorporating copies of themselves into other programs, are a growing menace in the late-1980s world of unprotected, networked workstations and personal computers. Limited immunity is offered by memory protection hardware, digitally authenticated object programs,and antibody programs that kill specific viruses. Additional immunity can be gained from the practice of digital hygiene, primarily the refusal to use software from untrusted sources. Full immunity requires attention in a social dimension, the accountability of programmers.

  6. IMRT fluence map editing to control hot and cold spots

    International Nuclear Information System (INIS)

    Taylor Cook, J.; Tobler, Matt; Leavitt, Dennis D.; Watson, Gordon

    2005-01-01

    Manually editing intensity-modulated radiation therapy (IMRT) fluence maps effectively controls hot and cold spots that the IMRT optimization cannot control. Many times, re-optimizing does not reduce the hot spots or increase the cold spots. In fact, re-optimizing only places the hot and cold spots in different locations. Fluence-map editing provides manual control of dose delivery and provides the best treatment plan possible. Several IMRT treatments were planned using the Varian Eclipse planning system. We compare the effects on dose distributions between fluence-map editing and re-optimization, discuss techniques for fluence-map editing, and analyze differences between fluence editing on one beam vs. multiple beams. When editing a beam's fluence map, it is essential to choose a beam that least affects dose to the tumor and critical structures. Editing fluence maps gives an advantage in treatment planning and provides controlled delivery of IMRT dose

  7. Promotion of Hendra virus replication by microRNA 146a.

    Science.gov (United States)

    Stewart, Cameron R; Marsh, Glenn A; Jenkins, Kristie A; Gantier, Michael P; Tizard, Mark L; Middleton, Deborah; Lowenthal, John W; Haining, Jessica; Izzard, Leonard; Gough, Tamara J; Deffrasnes, Celine; Stambas, John; Robinson, Rachel; Heine, Hans G; Pallister, Jackie A; Foord, Adam J; Bean, Andrew G; Wang, Lin-Fa

    2013-04-01

    Hendra virus is a highly pathogenic zoonotic paramyxovirus in the genus Henipavirus. Thirty-nine outbreaks of Hendra virus have been reported since its initial identification in Queensland, Australia, resulting in seven human infections and four fatalities. Little is known about cellular host factors impacting Hendra virus replication. In this work, we demonstrate that Hendra virus makes use of a microRNA (miRNA) designated miR-146a, an NF-κB-responsive miRNA upregulated by several innate immune ligands, to favor its replication. miR-146a is elevated in the blood of ferrets and horses infected with Hendra virus and is upregulated by Hendra virus in human cells in vitro. Blocking miR-146a reduces Hendra virus replication in vitro, suggesting a role for this miRNA in Hendra virus replication. In silico analysis of miR-146a targets identified ring finger protein (RNF)11, a member of the A20 ubiquitin editing complex that negatively regulates NF-κB activity, as a novel component of Hendra virus replication. RNA interference-mediated silencing of RNF11 promotes Hendra virus replication in vitro, suggesting that increased NF-κB activity aids Hendra virus replication. Furthermore, overexpression of the IκB superrepressor inhibits Hendra virus replication. These studies are the first to demonstrate a host miRNA response to Hendra virus infection and suggest an important role for host miRNAs in Hendra virus disease.

  8. Wireline logging tool catalog; 2nd edition

    International Nuclear Information System (INIS)

    Anon.

    1986-01-01

    This catalog facilitates wireline logging by (1) drawing up programs, (2) showing the adaptation of tools to downhole conditions, drilling fluids, and formations to be measured, and (3) monitoring operations such as recording speeds and calibration control. This edition now represents the tools and services of five additional companies beyond the two companies in the first edition. The participating companies are: BPB Instrument Ltd, Dresser Atlas, Gearhart Geoservices, Micro Log, Prakla Seismos, Schlumberger, and Welex. For quick consultation of the catalog, the tools are classified by ''families.'' For each family of tools, there is a background to the technology and an explanation of the principles of measurement and applications, along with examples of recorded curves. Case documents submitted by service companies include technical data sheets, sketches of tools and their main combinations, and examples of calibration

  9. Building java programs (3rd edition)

    CERN Document Server

    Reges, Stuart

    2013-01-01

    Building Java Programs: A Back to Basics Approach, Third Edition, introduces novice programmers to basic constructs and common pitfalls by emphasizing the essentials of procedural programming, problem solving, and algorithmic reasoning. By using objects early to solve interesting problems and defining objects later in the course, Building Java Programs develops programming knowledge for a broad audience. NEW! This edition is available with MyProgrammingLab, an innovative online homework and assessment tool. Through the power of practice and immediate personalized feedback, MyProgrammingLab helps students fully grasp the logic, semantics, and syntax of programming. Note: If you are purchasing the standalone text or electronic version, MyProgrammingLab does not come automatically packaged with the text. To purchase MyProgrammingLab, please visit: myprogramminglab.com or you can purchase a package of the physical text + MyProgrammingLab by searching the Pearson Higher Education web site. MyProgrammi...

  10. Handbook of radioactivity analysis. Second edition

    International Nuclear Information System (INIS)

    L'Annunziata, M.

    2003-07-01

    This updated and much expanded Second Edition is an authoritative handbook providing the principles, practical techniques, and procedures for the accurate measurement of radioactivity from the very low levels encountered in the environment to higher levels measured in radioisotope research, clinical laboratories, biological sciences, radionuclide standardization, nuclear medicine, nuclear power, fuel cycle facilities, and in the implementation of nuclear safeguards. The book describes the preparation of samples from a wide variety of matrices, assists the investigator or technician in the selection and use of appropriate radiation detectors, and presents state-of-the-art methods of analysis. Fundamentals of radioactivity properties, radionuclide decay, the calculations involved, and methods of detection provide the basis for a thorough understanding of the analytical procedures. The Handbook of Radioactivity Analysis, Second Edition is suitable as a teaching text for university and professional training courses

  11. Transportation Energy Data Book, Edition 18

    Energy Technology Data Exchange (ETDEWEB)

    Davis, Stacy C.

    1998-09-01

    The Transportation Energy Data Book: Edition 18 is a statistical compendium prepared and published by Oak Ridge National Laboratory (ORNL) under contract with the Office of Transportation Technologies in the Department of Energy (DOE). Designed for use as a desk-top reference, the data book represents an assembly and display of statistics and information that characterize transportation activity, and presents data on other factors that influence transportation energy use. The purpose of this document is to present relevant statistical data in the form of tables and graphs. This edition of the Data Book has 11 chapters which focus on various aspects of the transportation industry. Chapter 1 focuses on petroleum; Chapter 2 - energy Chapter 3 - emissions; Chapter 4 - transportation and the economy; Chapter 5 - highway vehicles; Chapter 6 - Light vehicles; Chapter 7 - heavy vehicles; Chapter 8 - alternative fuel vehicles; Chapter 9 - fleet vehicles; Chapter 10 - household vehicles; and Chapter 11 - nonhighway modes. The sources used represent the latest available data.

  12. Migration and Remittances Factbook 2016, Third Edition

    OpenAIRE

    World Bank Group

    2016-01-01

    The Migration and Remittances Factbook 2016 attempts to present numbers and facts behind the stories of international migration and remittances, drawing on authoritative, publicly available data. It provides a snapshot of statistics on immigration, emigration, skilled emigration, and remittance flows for 210 countries and 15 regional and income groups. The Migration and Remittances Factbook 2016 updates the 2011 edition of the Factbook with additional data on bilateral migration and remittanc...

  13. Geometry of Graph Edit Distance Spaces

    OpenAIRE

    Jain, Brijnesh J.

    2015-01-01

    In this paper we study the geometry of graph spaces endowed with a special class of graph edit distances. The focus is on geometrical results useful for statistical pattern recognition. The main result is the Graph Representation Theorem. It states that a graph is a point in some geometrical space, called orbit space. Orbit spaces are well investigated and easier to explore than the original graph space. We derive a number of geometrical results from the orbit space representation, translate ...

  14. CERN Video News, 2nd edition

    CERN Multimedia

    2002-01-01

    This week you will be able to watch on the web the second edition of CERN's video news (see Bulletin n°45/2002, p.3). On this news reel: the ATRAP experiment's latest achievements, superconducting cable production for CMS, the CAST experiment and the European digital conferencing project InDiCo. Go to : www.cern.ch/video, or Bulletin web page.

  15. European Code against Cancer 4th Edition

    DEFF Research Database (Denmark)

    Friis, Søren; Kesminiene, Ausrele; Espina, Carolina

    2015-01-01

    The 4th edition of the European Code against Cancer recommends limiting - or avoiding when possible - the use of hormone replacement therapy (HRT) because of the increased risk of cancer, nevertheless acknowledging that prescription of HRT may be indicated under certain medical conditions. Current...... health benefits; however, prudent practices need to be in place, with procedures and techniques providing the needed diagnostic information or therapeutic gain with the lowest possible radiation exposure. For pharmaceutical drugs and medical radiation exposure with convincing evidence...

  16. Gene Editing in Human Lymphoid Cells: Role for Donor DNA, Type of Genomic Nuclease and Cell Selection Method

    Directory of Open Access Journals (Sweden)

    Anastasia Zotova

    2017-11-01

    Full Text Available Programmable endonucleases introduce DNA breaks at specific sites, which are repaired by non-homologous end joining (NHEJ or homology recombination (HDR. Genome editing in human lymphoid cells is challenging as these difficult-to-transfect cells may also inefficiently repair DNA by HDR. Here, we estimated efficiencies and dynamics of knockout (KO and knockin (KI generation in human T and B cell lines depending on repair template, target loci and types of genomic endonucleases. Using zinc finger nuclease (ZFN, we have engineered Jurkat and CEM cells with the 8.2 kb human immunodeficiency virus type 1 (HIV-1 ∆Env genome integrated at the adeno-associated virus integration site 1 (AAVS1 locus that stably produce virus particles and mediate infection upon transfection with helper vectors. Knockouts generated by ZFN or clustered regularly interspaced short palindromic repeats (CRISPR/Cas9 double nicking techniques were comparably efficient in lymphoid cells. However, unlike polyclonal sorted cells, gene-edited cells selected by cloning exerted tremendous deviations in functionality as estimated by replication of HIV-1 and human T cell leukemia virus type 1 (HTLV-1 in these cells. Notably, the recently reported high-fidelity eCas9 1.1 when combined to the nickase mutation displayed gene-dependent decrease in on-target activity. Thus, the balance between off-target effects and on-target efficiency of nucleases, as well as choice of the optimal method of edited cell selection should be taken into account for proper gene function validation in lymphoid cells.

  17. Transportation Energy Data Book: Edition 26

    Energy Technology Data Exchange (ETDEWEB)

    Davis, Stacy Cagle [ORNL; Diegel, Susan W [ORNL

    2007-07-01

    The Transportation Energy Data Book: Edition 26 is a statistical compendium prepared and published by Oak Ridge National Laboratory (ORNL) under contract with the Office of Planning, Budget Formulation, and Analysis, under the Energy Efficiency and Renewable Energy (EERE) program in the Department of Energy (DOE). Designed for use as a desk-top reference, the data book represents an assembly and display of statistics and information that characterize transportation activity, and presents data on other factors that influence transportation energy use. The purpose of this document is to present relevant statistical data in the form of tables and graphs. The latest editions of the Data Book are available to a larger audience via the Internet (cta.ornl.gov/data). This edition of the Data Book has 12 chapters which focus on various aspects of the transportation industry. Chapter 1 focuses on petroleum; Chapter 2 - energy; Chapter 3 - highway vehicles; Chapter 4 - light vehicles; Chapter 5 - heavy vehicles; Chapter 6 - alternative fuel vehicles; Chapter 7 - fleet vehicles; Chapter 8 - household vehicles; and Chapter 9- nonhighway modes; Chapter 10 - transportation and the economy; Chapter 11 - greenhouse gas emissions; and Chapter 12 - criteria pollutant emissions. The sources used represent the latest available data. There are also three appendices which include detailed source information for some tables, measures of conversion, and the definition of Census divisions and regions. A glossary of terms and a title index are also included for the readers convenience.

  18. Transportation Energy Data Book: Edition 21; TOPICAL

    International Nuclear Information System (INIS)

    Davis, SC

    2001-01-01

    The Transportation Energy Data Book: Edition 21 is a statistical compendium prepared and published by Oak Ridge National Laboratory (ORNL) under contract with the Office of Transportation Technologies in the Department of Energy (DOE). Designed for use as a desk-top reference, the data book represents an assembly and display of statistics and information that characterize transportation activity, and presents data on other factors that influence transportation energy use. The purpose of this document is to present relevant statistical data in the form of tables and graphs. The latest editions of the Data Book are available to a larger audience via the Internet (www-cta.ornl.gov/data/tedb.htm). This edition of the Data Book has 12 chapters which focus on various aspects of the transportation industry. Chapter 1 focuses on petroleum; Chapter 2-energy; Chapter 3-greenhouse gas emissions; Chapter 4-criteria pollutant emissions; Chapter 5-transportation and the economy; Chapter 6-highway vehicles; Chapter 7-light vehicles; Chapter 8-heavy vehicles; Chapter 9-alternative fuel vehicles; Chapter 10-fleet vehicles; Chapter 11-household vehicles; and Chapter 12-nonhighway modes. The sources used represent the latest available data. There are also three appendices which include detailed source information for some tables, measures of conversion, and the definition of Census divisions and regions. A glossary of terms and a title index are also included for the readers convenience

  19. ADAR RNA editing below the backbone.

    Science.gov (United States)

    Keegan, Liam; Khan, Anzer; Vukic, Dragana; O'Connell, Mary

    2017-09-01

    ADAR RNA editing enzymes ( a denosine d e a minases acting on R NA) that convert adenosine bases to inosines were first identified biochemically 30 years ago. Since then, studies on ADARs in genetic model organisms, and evolutionary comparisons between them, continue to reveal a surprising range of pleiotropic biological effects of ADARs. This review focuses on Drosophila melanogaster , which has a single Adar gene encoding a homolog of vertebrate ADAR2 that site-specifically edits hundreds of transcripts to change individual codons in ion channel subunits and membrane and cytoskeletal proteins. Drosophila ADAR is involved in the control of neuronal excitability and neurodegeneration and, intriguingly, in the control of neuronal plasticity and sleep. Drosophila ADAR also interacts strongly with RNA interference, a key antiviral defense mechanism in invertebrates. Recent crystal structures of human ADAR2 deaminase domain-RNA complexes help to interpret available information on Drosophila ADAR isoforms and on the evolution of ADARs from tRNA deaminase ADAT proteins. ADAR RNA editing is a paradigm for the now rapidly expanding range of RNA modifications in mRNAs and ncRNAs. Even with recent progress, much remains to be understood about these groundbreaking ADAR RNA modification systems. © 2017 Keegan et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

  20. Handbook of Adhesion, 2nd Edition

    Science.gov (United States)

    Packham, D. E.

    2005-06-01

    This second edition of the successful Handbook of Adhesion provides concise and authoritative articles covering many aspects of the science and technology associated with adhesion and adhesives. It is intended to fill a gap between the necessarily simplified treatment of the student textbook and the full and thorough treatment of the research monograph and review article. The articles are structured in such a way, with internal cross-referencing and external literature references, that the reader can build up a broader and deeper understanding, as their needs require. This second edition includes many new articles covering developments which have risen in prominence in the intervening years, such as scanning probe techniques, the surface forces apparatus and the relation between adhesion and fractal surfaces. Advances in understanding polymer - polymer interdiffusion are reflected in articles drawing out the implications for adhesive bonding. In addition, articles derived from the earlier edition have been revised and updated where needed. Throughout the book there is a renewed emphasis on environmental implications of the use of adhesives and sealants. The scope of the Handbook, which features nearly 250 articles from over 60 authors, includes the background science - physics, chemistry and material science - and engineering, and also aspects of adhesion relevant to the use of adhesives, including topics such as: Sealants and mastics Paints and coatings Printing and composite materials Welding and autohesion Engineering design The Handbook of Adhesion is intended for scientists and engineers in both academia and industry, requiring an understanding of the various facets of adhesion.

  1. Transportation Energy Data Book: Edition 36

    Energy Technology Data Exchange (ETDEWEB)

    Williams, Susan E. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Davis, Stacy Cagle [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Boundy, Robert Gary [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States)

    2017-12-01

    The Transportation Energy Data Book: Edition 36 is a statistical compendium prepared and published by Oak Ridge National Laboratory (ORNL) under contract with the U.S. Department of Energy, Office of Energy Efficiency and Renewable Energy, Vehicle Technologies Office. Designed for use as a desk-top reference, the Data Book represents an assembly and display of statistics and information that characterize transportation activity, and presents data on other factors that influence transportation energy use. The purpose of this document is to present relevant statistical data in the form of tables and graphs. The latest edition of the Data Book is available via the Internet (cta.ornl.gov/data). This edition of the Data Book has 12 chapters which focus on various aspects of the transportation industry. Chapter 1 focuses on petroleum; Chapter 2 – energy; Chapter 3 – highway vehicles; Chapter 4 – light vehicles; Chapter 5 – heavy vehicles; Chapter 6 – alternative fuel vehicles; Chapter 7 – fleet vehicles; Chapter 8 – household vehicles; Chapter 9 – nonhighway modes; Chapter 10 – transportation and the economy; Chapter 11 – greenhouse gas emissions; and Chapter 12 – criteria pollutant emissions. The sources used represent the latest available data. There are also three appendices which include detailed source information for some tables, measures of conversion, and the definition of Census divisions and regions. A glossary of terms is also included for the reader’s convenience.

  2. Transportation Energy Data Book: Edition 24

    Energy Technology Data Exchange (ETDEWEB)

    Davis, S.C.

    2005-03-08

    The ''Transportation Energy Data Book: Edition 24'' is a statistical compendium prepared and published by Oak Ridge National Laboratory (ORNL) under contract with the Office of Planning, Budget Formulation, and Analysis, under the Energy Efficiency and Renewable Energy (EERE) program in the Department of Energy (DOE). Designed for use as a desk-top reference, the data book represents an assembly and display of statistics and information that characterize transportation activity, and presents data on other factors that influence transportation energy use. The purpose of this document is to present relevant statistical data in the form of tables and graphs. The latest editions of the Data Book are available to a larger audience via the Internet (cta.ornl.gov/data). This edition of the Data Book has 12 chapters which focus on various aspects of the transportation industry. Chapter 1 focuses on petroleum; Chapter 2--energy; Chapter 3--highway vehicles; Chapter 4--light vehicles; Chapter 5--heavy vehicles; Chapter 6--alternative fuel vehicles; Chapter 7--fleet vehicles; Chapter 8--household vehicles; and Chapter 9--nonhighway modes; Chapter 10--transportation and the economy; Chapter 11--greenhouse gas emissions; and Chapter 12--criteria pollutant emissions. The sources used represent the latest available data. There are also three appendices which include detailed source information for some tables, measures of conversion, and the definition of Census divisions and regions. A glossary of terms and a title index are also included for the readers convenience.

  3. Transportation Energy Data Book: Edition 23

    Energy Technology Data Exchange (ETDEWEB)

    Davis, S.C.

    2003-10-24

    The ''Transportation Energy Data Book: Edition 23'' is a statistical compendium prepared and published by Oak Ridge National Laboratory (ORNL) under contract with the Office of Planning, Budget Formulation, and Analysis, under the Energy Efficiency and Renewable Energy (EERE) program in the Department of Energy (DOE). Designed for use as a desk-top reference, the data book represents an assembly and display of statistics and information that characterize transportation activity, and presents data on other factors that influence transportation energy use. The purpose of this document is to present relevant statistical data in the form of tables and graphs. The latest editions of the Data Book are available to a larger audience via the Internet (www-cta.ornl.gov/data). This edition of the Data Book has 12 chapters which focus on various aspects of the transportation industry. Chapter 1 focuses on petroleum; Chapter 2--energy; Chapter 3--highway vehicles; Chapter 4--light vehicles; Chapter 5--heavy vehicles; Chapter 6--alternative fuel vehicles; Chapter 7--fleet vehicles; Chapter 8--household vehicles; and Chapter 9--nonhighway modes; Chapter 10--transportation and the economy; Chapter 11--greenhouse gas emissions; and Chapter 12--criteria pollutant emissions. The sources used represent the latest available data. There are also three appendices which include detailed source information for some tables, measures of conversion, and the definition of Census divisions and regions. A glossary of terms and a title index are also included for the readers convenience.

  4. Transportation Energy Data Book: Edition 27

    Energy Technology Data Exchange (ETDEWEB)

    Davis, Stacy Cagle [ORNL; Diegel, Susan W [ORNL; Boundy, Robert Gary [ORNL

    2008-06-01

    The Transportation Energy Data Book: Edition 27 is a statistical compendium prepared and published by Oak Ridge National Laboratory (ORNL) under contract with the Office of Planning, Budget Formulation, and Analysis, under the Energy Efficiency and Renewable Energy (EERE) program in the Department of Energy (DOE). Designed for use as a desk-top reference, the data book represents an assembly and display of statistics and information that characterize transportation activity, and presents data on other factors that influence transportation energy use. The purpose of this document is to present relevant statistical data in the form of tables and graphs. The latest editions of the Data Book are available to a larger audience via the Internet (cta.ornl.gov/data). This edition of the Data Book has 12 chapters which focus on various aspects of the transportation industry. Chapter 1 focuses on petroleum; Chapter 2 energy; Chapter 3 highway vehicles; Chapter 4 light vehicles; Chapter 5 heavy vehicles; Chapter 6 alternative fuel vehicles; Chapter 7 fleet vehicles; Chapter 8 household vehicles; and Chapter 9 nonhighway modes; Chapter 10 transportation and the economy; Chapter 11 greenhouse gas emissions; and Chapter 12 criteria pollutant emissions. The sources used represent the latest available data. There are also three appendices which include detailed source information for some tables, measures of conversion, and the definition of Census divisions and regions. A glossary of terms and a title index are also included for the readers convenience.

  5. Transportation Energy Data Book: Edition 28

    Energy Technology Data Exchange (ETDEWEB)

    Davis, Stacy Cagle [ORNL; Diegel, Susan W [ORNL; Boundy, Robert Gary [ORNL

    2009-06-01

    The Transportation Energy Data Book: Edition 28 is a statistical compendium prepared and published by Oak Ridge National Laboratory (ORNL) under contract with U.S Department of Energy, Office of Energy Efficiency and Renewable Energy, Vehicle Technologies Program and the Hydrogen, Fuel Cells, and Infrastructure Technologies Program. Designed for use as a desk-top reference, the data book represents an assembly and display of statistics and information that characterize transportation activity, and presents data on other factors that influence transportation energy use. The purpose of this document is to present relevant statistical data in the form of tables and graphs. The latest edition of the Data Book are available to a larger audience via the Internet (cta.ornl.gov/data). This edition of the Data Book has 12 chapters which focus on various aspects of the transportation industry. Chapter 1 focuses on petroleum; Chapter 2 energy; Chapter 3 highway vehicles; Chapter 4 light vehicles; Chapter 5 heavy vehicles; Chapter 6 alternative fuel vehicles; Chapter 7 fleet vehicles; Chapter 8 household vehicles; and Chapter 9 nonhighway modes; Chapter 10 transportation and the economy; Chapter 11 greenhouse gas emissions; and Chapter 12 criteria pollutant emissions. The sources used represent the latest available data. There are also three appendices which include detailed source information for some tables, measures of conversion, and the definition of Census divisions and regions. A glossary of terms and a title index are also included for the readers convenience.

  6. Transportation Energy Data Book: Edition 31

    Energy Technology Data Exchange (ETDEWEB)

    Davis, Stacy Cagle [ORNL; Diegel, Susan W [ORNL; Boundy, Robert Gary [ORNL

    2012-08-01

    The Transportation Energy Data Book: Edition 31 is a statistical compendium prepared and published by Oak Ridge National Laboratory (ORNL) under contract with the U.S. Department of Energy, Office of Energy Efficiency and Renewable Energy, Vehicle Technologies Program. Designed for use as a desk-top reference, the Data Book represents an assembly and display of statistics and information that characterize transportation activity, and presents data on other factors that influence transportation energy use. The purpose of this document is to present relevant statistical data in the form of tables and graphs. The latest edition of the Data Book is available to a larger audience via the Internet (cta.ornl.gov/data). This edition of the Data Book has 12 chapters which focus on various aspects of the transportation industry. Chapter 1 focuses on petroleum; Chapter 2 energy; Chapter 3 highway vehicles; Chapter 4 light vehicles; Chapter 5 heavy vehicles; Chapter 6 alternative fuel vehicles; Chapter 7 fleet vehicles; Chapter 8 household vehicles; Chapter 9 nonhighway modes; Chapter 10 transportation and the economy; Chapter 11 greenhouse gas emissions; and Chapter 12 criteria pollutant emissions. The sources used represent the latest available data. There are also three appendices which include detailed source information for some tables, measures of conversion, and the definition of Census divisions and regions. A glossary of terms and a title index are also included for the reader s convenience.

  7. Transportation Energy Data Book: Edition 30

    Energy Technology Data Exchange (ETDEWEB)

    Davis, Stacy Cagle [ORNL; Diegel, Susan W [ORNL; Boundy, Robert Gary [ORNL

    2011-07-01

    The Transportation Energy Data Book: Edition 30 is a statistical compendium prepared and published by Oak Ridge National Laboratory (ORNL) under contract with the U.S. Department of Energy, Office of Energy Efficiency and Renewable Energy, Vehicle Technologies Program. Designed for use as a desk-top reference, the Data Book represents an assembly and display of statistics and information that characterize transportation activity, and presents data on other factors that influence transportation energy use. The purpose of this document is to present relevant statistical data in the form of tables and graphs. The latest edition of the Data Book is available to a larger audience via the Internet (cta.ornl.gov/data). This edition of the Data Book has 12 chapters which focus on various aspects of the transportation industry. Chapter 1 focuses on petroleum; Chapter 2 energy; Chapter 3 highway vehicles; Chapter 4 light vehicles; Chapter 5 heavy vehicles; Chapter 6 alternative fuel vehicles; Chapter 7 fleet vehicles; Chapter 8 household vehicles; Chapter 9 nonhighway modes; Chapter 10 transportation and the economy; Chapter 11 greenhouse gas emissions; and Chapter 12 criteria pollutant emissions. The sources used represent the latest available data. There are also three appendices which include detailed source information for some tables, measures of conversion, and the definition of Census divisions and regions. A glossary of terms and a title index are also included for the reader s convenience.

  8. Transportation Energy Data Book: Edition 29

    Energy Technology Data Exchange (ETDEWEB)

    Davis, Stacy Cagle [ORNL; Diegel, Susan W [ORNL; Boundy, Robert Gary [ORNL

    2010-07-01

    The Transportation Energy Data Book: Edition 29 is a statistical compendium prepared and published by Oak Ridge National Laboratory (ORNL) under contract with the U.S. Department of Energy, Office of Energy Efficiency and Renewable Energy, Vehicle Technologies Program. Designed for use as a desk-top reference, the Data Book represents an assembly and display of statistics and information that characterize transportation activity, and presents data on other factors that influence transportation energy use. The purpose of this document is to present relevant statistical data in the form of tables and graphs. The latest edition of the Data Book is available to a larger audience via the Internet (cta.ornl.gov/data). This edition of the Data Book has 12 chapters which focus on various aspects of the transportation industry. Chapter 1 focuses on petroleum; Chapter 2 energy; Chapter 3 highway vehicles; Chapter 4 light vehicles; Chapter 5 heavy vehicles; Chapter 6 alternative fuel vehicles; Chapter 7 fleet vehicles; Chapter 8 household vehicles; Chapter 9 nonhighway modes; Chapter 10 transportation and the economy; Chapter 11 greenhouse gas emissions; and Chapter 12 criteria pollutant emissions. The sources used represent the latest available data. There are also three appendices which include detailed source information for some tables, measures of conversion, and the definition of Census divisions and regions. A glossary of terms and a title index are also included for the reader s convenience.

  9. Transportation Energy Data Book: Edition 32

    Energy Technology Data Exchange (ETDEWEB)

    Davis, Stacy Cagle [ORNL; Diegel, Susan W [ORNL; Boundy, Robert Gary [ORNL

    2013-08-01

    The Transportation Energy Data Book: Edition 32 is a statistical compendium prepared and published by Oak Ridge National Laboratory (ORNL) under contract with the U.S. Department of Energy, Office of Energy Efficiency and Renewable Energy, Vehicle Technologies Office. Designed for use as a desk-top reference, the Data Book represents an assembly and display of statistics and information that characterize transportation activity, and presents data on other factors that influence transportation energy use. The purpose of this document is to present relevant statistical data in the form of tables and graphs. The latest edition of the Data Book is available to a larger audience via the Internet (cta.ornl.gov/data). This edition of the Data Book has 12 chapters which focus on various aspects of the transportation industry. Chapter 1 focuses on petroleum; Chapter 2 energy; Chapter 3 highway vehicles; Chapter 4 light vehicles; Chapter 5 heavy vehicles; Chapter 6 alternative fuel vehicles; Chapter 7 fleet vehicles; Chapter 8 household vehicles; Chapter 9 nonhighway modes; Chapter 10 transportation and the economy; Chapter 11 greenhouse gas emissions; and Chapter 12 criteria pollutant emissions. The sources used represent the latest available data. There are also three appendices which include detailed source information for some tables, measures of conversion, and the definition of Census divisions and regions. A glossary of terms and a title index are also included for the reader s convenience.

  10. Transportation Energy Data Book: Edition 21

    Energy Technology Data Exchange (ETDEWEB)

    Davis, S.C.

    2001-09-13

    The ''Transportation Energy Data Book: Edition 21'' is a statistical compendium prepared and published by Oak Ridge National Laboratory (ORNL) under contract with the Office of Transportation Technologies in the Department of Energy (DOE). Designed for use as a desk-top reference, the data book represents an assembly and display of statistics and information that characterize transportation activity, and presents data on other factors that influence transportation energy use. The purpose of this document is to present relevant statistical data in the form of tables and graphs. The latest editions of the Data Book are available to a larger audience via the Internet (www-cta.ornl.gov/data/tedb.htm). This edition of the Data Book has 12 chapters which focus on various aspects of the transportation industry. Chapter 1 focuses on petroleum; Chapter 2--energy; Chapter 3--greenhouse gas emissions; Chapter 4--criteria pollutant emissions; Chapter 5--transportation and the economy; Chapter 6--highway vehicles; Chapter 7--light vehicles; Chapter 8--heavy vehicles; Chapter 9--alternative fuel vehicles; Chapter 10--fleet vehicles; Chapter 11--household vehicles; and Chapter 12--nonhighway modes. The sources used represent the latest available data. There are also three appendices which include detailed source information for some tables, measures of conversion, and the definition of Census divisions and regions. A glossary of terms and a title index are also included for the readers convenience.

  11. Transportation Energy Data Book: Edition 22

    Energy Technology Data Exchange (ETDEWEB)

    Davis, Stacy C.; Diegel, Susan W.

    2002-12-04

    The Transportation Energy Data Book: Edition 22 is a statistical compendium prepared and published by Oak Ridge National Laboratory (ORNL) under contract with the Office of Planning, Budget Formulation, and Analysis, under the Energy Efficiency and Renewable Energy (EERE) program in the Department of Energy (DOE). Designed for use as a desk-top reference, the data book represents an assembly and display of statistics and information that characterize transportation activity, and presents data on other factors that influence transportation energy use. The purpose of this document is to present relevant statistical data in the form of tables and graphs. The latest editions of the Data Book are available to a larger audience via the Internet (www.cta.ornl.gov/data). This edition of the Data Book has 12 chapters which focus on various aspects of the transportation industry. Chapter 1 focuses on petroleum; Chapter 2 - energy; Chapter 3 - greenhouse gas emissions; Chapter 4 - criteria pollutant emissions; Chapter 5 - transportation and the economy; Chapter 6 - highway vehicles; Chapter 7 - light vehicles; Chapter 8 - heavy vehicles; Chapter 9 - alternative fuel vehicles; Chapter 10 - fleet vehicles; Chapter 11 - household vehicles; and Chapter 12- nonhighway modes. The sources used represent the latest available data. There are also three appendices which include detailed source information for some tables, measures of conversion, and the definition of Census divisions and regions. A glossary of terms and a title index are also included for the readers convenience.

  12. Transportation Energy Data Book: Edition 25

    Energy Technology Data Exchange (ETDEWEB)

    Davis, Stacy Cagle [ORNL; Diegel, Susan W [ORNL

    2006-06-01

    The Transportation Energy Data Book: Edition 25 is a statistical compendium prepared and published by Oak Ridge National Laboratory (ORNL) under contract with the Office of Planning, Budget Formulation, and Analysis, under the Energy Efficiency and Renewable Energy (EERE) program in the Department of Energy (DOE). Designed for use as a desk-top reference, the data book represents an assembly and display of statistics and information that characterize transportation activity, and presents data on other factors that influence transportation energy use. The purpose of this document is to present relevant statistical data in the form of tables and graphs. The latest editions of the Data Book are available to a larger audience via the Internet (cta.ornl.gov/data). This edition of the Data Book has 12 chapters which focus on various aspects of the transportation industry. Chapter 1 focuses on petroleum; Chapter 2 - energy; Chapter 3 - highway vehicles; Chapter 4 - light vehicles; Chapter 5 - heavy vehicles; Chapter 6 - alternative fuel vehicles; Chapter 7 - fleet vehicles; Chapter 8 - household vehicles; and Chapter 9- nonhighway modes; Chapter 10 - transportation and the economy; Chapter 11 - greenhouse gas emissions; and Chapter 12 - criteria pollutant emissions. The sources used represent the latest available data. There are also three appendices which include detailed source information for some tables, measures of conversion, and the definition of Census divisions and regions. A glossary of terms and a title index are also included for the readers convenience.

  13. Transportation Energy Data Book (Edition 20)

    Energy Technology Data Exchange (ETDEWEB)

    Davis, S.C.

    2000-10-09

    The ''Transportation Energy Data Book: Edition 20'' is a statistical compendium prepared and published by Oak Ridge National Laboratory (ORNL) under contract with the Office of Transportation Technologies in the Department of Energy (DOE). Designed for use as a desk-top reference, the data book represents an assembly and display of statistics and information that characterize transportation activity, and presents data on other factors that influence transportation energy use. The purpose of this document is to present relevant statistical data in the form of tables and graphs. The latest editions of the Data Book are available to a larger audience via the Internet (www-cta.ornl.gov/data/tedb.htm). This edition of the Data Book has 12 chapters which focus on various aspects of the transportation industry. Chapter 1 focuses on petroleum; Chapter 2--energy; Chapter 3--greenhouse gas emissions; Chapter 4--criteria pollutant emissions; Chapter 5--transportation and the economy; Chapter 6--highway vehicles; Chapter 7--light vehicles; Chapter 8--heavy vehicles; Chapter 9--alternative fuel vehicles; Chapter 10--fleet vehicles; Chapter 11--household vehicles; and Chapter 12--nonhighway modes. The sources used represent the latest available data. There are also three appendices which include detailed source information for some tables, measures of conversion, and the definition of Census divisions and regions. A glossary of terms and a title index are also included for the readers convenience.

  14. Technology Roadmap: Wind Energy. 2013 edition

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2013-07-01

    The IEA Wind Power Technology Roadmap 2013 Edition recognises the very significant progress made since the first edition was published in 2009. The technology continues to improve rapidly, and costs of generation from land-based wind installations continue to fall. Wind power is now being deployed in countries with good resources without any dedicated financial incentives. The 2013 Edition targets an increased share (15% to 18%) of global electricity to be provided by wind power in 2050, compared to 12% in the original roadmap of 2009. However, increasing levels of low-cost wind still require predictable, supportive regulatory environments and appropriate market designs. The challenges of integrating higher levels of variable wind power into the grid need to be addressed. For offshore wind, much remains to be done to develop appropriate large-scale systems and to reduce costs. The 2013 Wind Power Roadmap also provides updated analysis on the barriers that exist for the technology and suggests ways to address them, including legal and regulatory recommendations.

  15. Transportation Energy Data Book. Edition 33

    Energy Technology Data Exchange (ETDEWEB)

    Davis, Stacy Cagle [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Williams, Susan E. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Boundy, Robert Gary [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States)

    2014-07-01

    The Transportation Energy Data Book: Edition 33 is a statistical compendium prepared and published by Oak Ridge National Laboratory (ORNL) under contract with the U.S. Department of Energy, Office of Energy Efficiency and Renewable Energy, Vehicle Technologies Office. Designed for use as a desk-top reference, the Data Book represents an assembly and display of statistics and information that characterize transportation activity, and presents data on other factors that influence transportation energy use. The purpose of this document is to present relevant statistical data in the form of tables and graphs. The latest edition of the Data Book is available to a larger audience via the Internet (cta.ornl.gov/data). This edition of the Data Book has 12 chapters which focus on various aspects of the transportation industry. Chapter 1 focuses on petroleum; Chapter 2 energy; Chapter 3 highway vehicles; Chapter 4 light vehicles; Chapter 5 heavy vehicles; Chapter 6 alternative fuel vehicles; Chapter 7 fleet vehicles; Chapter 8 household vehicles; Chapter 9 nonhighway modes; Chapter 10 transportation and the economy; Chapter 11 greenhouse gas emissions; and Chapter 12 criteria pollutant emissions. The sources used represent the latest available data. There are also three appendices which include detailed source information for some tables, measures of conversion, and the definition of Census divisions and regions. A glossary of terms and a title index are also included for the reader s convenience.

  16. Transportation Energy Data Book: Edition 34

    Energy Technology Data Exchange (ETDEWEB)

    Davis, Stacy Cagle [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Williams, Susan E [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Boundy, Robert Gary [Roltek, Inc., Clinton, TN (United States)

    2015-08-01

    The Transportation Energy Data Book: Edition 34 is a statistical compendium prepared and published by Oak Ridge National Laboratory (ORNL) under contract with the U.S. Department of Energy, Office of Energy Efficiency and Renewable Energy, Vehicle Technologies Office. Designed for use as a desk-top reference, the Data Book represents an assembly and display of statistics and information that characterize transportation activity, and presents data on other factors that influence transportation energy use. The purpose of this document is to present relevant statistical data in the form of tables and graphs. The latest edition of the Data Book is available to a larger audience via the Internet (cta.ornl.gov/data). This edition of the Data Book has 12 chapters which focus on various aspects of the transportation industry. Chapter 1 focuses on petroleum; Chapter 2 energy; Chapter 3 highway vehicles; Chapter 4 light vehicles; Chapter 5 heavy vehicles; Chapter 6 alternative fuel vehicles; Chapter 7 fleet vehicles; Chapter 8 household vehicles; Chapter 9 nonhighway modes; Chapter 10 transportation and the economy; Chapter 11 greenhouse gas emissions; and Chapter 12 criteria pollutant emissions. The sources used represent the latest available data. There are also three appendices which include detailed source information for some tables, measures of conversion, and the definition of Census divisions and regions. A glossary of terms and a title index are also included for the reader s convenience.

  17. Transportation Energy Data Book: Edition 35

    Energy Technology Data Exchange (ETDEWEB)

    Davis, Stacy Cagle [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Williams, Susan E. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Boundy, Robert Gary [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States)

    2016-10-01

    The Transportation Energy Data Book: Edition 35 is a statistical compendium prepared and published by Oak Ridge National Laboratory (ORNL) under contract with the U.S. Department of Energy, Office of Energy Efficiency and Renewable Energy, Vehicle Technologies Office. Designed for use as a desk-top reference, the Data Book represents an assembly and display of statistics and information that characterize transportation activity, and presents data on other factors that influence transportation energy use. The purpose of this document is to present relevant statistical data in the form of tables and graphs. The latest edition of the Data Book is available to a larger audience via the Internet (cta.ornl.gov/data). This edition of the Data Book has 12 chapters which focus on various aspects of the transportation industry. Chapter 1 focuses on petroleum; Chapter 2 energy; Chapter 3 highway vehicles; Chapter 4 light vehicles; Chapter 5 heavy vehicles; Chapter 6 alternative fuel vehicles; Chapter 7 fleet vehicles; Chapter 8 household vehicles; Chapter 9 nonhighway modes; Chapter 10 transportation and the economy; Chapter 11 greenhouse gas emissions; and Chapter 12 criteria pollutant emissions. The sources used represent the latest available data. There are also three appendices which include detailed source information for some tables, measures of conversion, and the definition of Census divisions and regions. A glossary of terms and a title index are also included for the reader s convenience.

  18. Genome-wide analysis of differential RNA editing in epilepsy

    Science.gov (United States)

    Srivastava, Prashant Kumar; Bagnati, Marta; Delahaye-Duriez, Andree; Ko, Jeong-Hun; Rotival, Maxime; Langley, Sarah R.; Shkura, Kirill; Mazzuferi, Manuela; Danis, Bénédicte; van Eyll, Jonathan; Foerch, Patrik; Behmoaras, Jacques; Kaminski, Rafal M.; Petretto, Enrico; Johnson, Michael R.

    2017-01-01

    The recoding of genetic information through RNA editing contributes to proteomic diversity, but the extent and significance of RNA editing in disease is poorly understood. In particular, few studies have investigated the relationship between RNA editing and disease at a genome-wide level. Here, we developed a framework for the genome-wide detection of RNA sites that are differentially edited in disease. Using RNA-sequencing data from 100 hippocampi from mice with epilepsy (pilocarpine–temporal lobe epilepsy model) and 100 healthy control hippocampi, we identified 256 RNA sites (overlapping with 87 genes) that were significantly differentially edited between epileptic cases and controls. The degree of differential RNA editing in epileptic mice correlated with frequency of seizures, and the set of genes differentially RNA-edited between case and control mice were enriched for functional terms highly relevant to epilepsy, including “neuron projection” and “seizures.” Genes with differential RNA editing were preferentially enriched for genes with a genetic association to epilepsy. Indeed, we found that they are significantly enriched for genes that harbor nonsynonymous de novo mutations in patients with epileptic encephalopathy and for common susceptibility variants associated with generalized epilepsy. These analyses reveal a functional convergence between genes that are differentially RNA-edited in acquired symptomatic epilepsy and those that contribute risk for genetic epilepsy. Taken together, our results suggest a potential role for RNA editing in the epileptic hippocampus in the occurrence and severity of epileptic seizures. PMID:28250018

  19. Virophages or satellite viruses?

    Science.gov (United States)

    Krupovic, Mart; Cvirkaite-Krupovic, Virginija

    2011-11-01

    It has been argued that the smaller viruses associated with giant DNA viruses are a new biological entity. However, Mart Krupovic and Virginija Cvirkaite-Krupovic argue here that these smaller viruses should be classified with the satellite viruses.

  20. In vivo genome editing in animals using AAV-CRISPR system: applications to translational research of human disease

    Science.gov (United States)

    Lau, Cia-Hin; Suh, Yousin

    2017-01-01

    Adeno-associated virus (AAV) has shown promising therapeutic efficacy with a good safety profile in a wide range of animal models and human clinical trials. With the advent of clustered regulatory interspaced short palindromic repeat (CRISPR)-based genome-editing technologies, AAV provides one of the most suitable viral vectors to package, deliver, and express CRISPR components for targeted gene editing. Recent discoveries of smaller Cas9 orthologues have enabled the packaging of Cas9 nuclease and its chimeric guide RNA into a single AAV delivery vehicle for robust in vivo genome editing. Here, we discuss how the combined use of small Cas9 orthologues, tissue-specific minimal promoters, AAV serotypes, and different routes of administration has advanced the development of efficient and precise in vivo genome editing and comprehensively review the various AAV-CRISPR systems that have been effectively used in animals. We then discuss the clinical implications and potential strategies to overcome off-target effects, immunogenicity, and toxicity associated with CRISPR components and AAV delivery vehicles. Finally, we discuss ongoing non-viral-based ex vivo gene therapy clinical trials to underscore the current challenges and future prospects of CRISPR/Cas9 delivery for human therapeutics. PMID:29333255

  1. Structural characterization by transmission electron microscopy and immunoreactivity of recombinant Hendra virus nucleocapsid protein expressed and purified from Escherichia coli.

    Science.gov (United States)

    Pearce, Lesley A; Yu, Meng; Waddington, Lynne J; Barr, Jennifer A; Scoble, Judith A; Crameri, Gary S; McKinstry, William J

    2015-12-01

    Hendra virus (family Paramyxoviridae) is a negative sense single-stranded RNA virus (NSRV) which has been found to cause disease in humans, horses, and experimentally in other animals, e.g. pigs and cats. Pteropid bats commonly known as flying foxes have been identified as the natural host reservoir. The Hendra virus nucleocapsid protein (HeV N) represents the most abundant viral protein produced by the host cell, and is highly immunogenic with naturally infected humans and horses producing specific antibodies towards this protein. The purpose of this study was to express and purify soluble, functionally active recombinant HeV N, suitable for use as an immunodiagnostic reagent to detect antibodies against HeV. We expressed both full-length HeV N, (HeV NFL), and a C-terminal truncated form, (HeV NCORE), using a bacterial heterologous expression system. Both HeV N constructs were engineered with an N-terminal Hisx6 tag, and purified using a combination of immobilized metal affinity chromatography (IMAC) and size exclusion chromatography (SEC). Purified recombinant HeV N proteins self-assembled into soluble higher order oligomers as determined by SEC and negative-stain transmission electron microscopy. Both HeV N proteins were highly immuno-reactive with sera from animals and humans infected with either HeV or the closely related Nipah virus (NiV), but displayed no immuno-reactivity towards sera from animals infected with a non-pathogenic paramyxovirus (CedPV), or animals receiving Equivac® (HeV G glycoprotein subunit vaccine), using a Luminex-based multiplexed microsphere assay. Crown Copyright © 2015. Published by Elsevier Inc. All rights reserved.

  2. The V protein of Tioman virus is incapable of blocking type I interferon signaling in human cells.

    Directory of Open Access Journals (Sweden)

    Grégory Caignard

    Full Text Available The capacity of a virus to cross species barriers is determined by the development of bona fide interactions with cellular components of new hosts, and in particular its ability to block IFN-α/β antiviral signaling. Tioman virus (TioV, a close relative of mumps virus (MuV, has been isolated in giant fruit bats in Southeast Asia. Nipah and Hendra viruses, which are present in the same bat colonies, are highly pathogenic in human. Despite serological evidences of close contacts between TioV and human populations, whether TioV is associated to some human pathology remains undetermined. Here we show that in contrast to the V protein of MuV, the V protein of TioV (TioV-V hardly interacts with human STAT2, does not degrade STAT1, and cannot block IFN-α/β signaling in human cells. In contrast, TioV-V properly binds to human STAT3 and MDA5, and thus interferes with IL-6 signaling and IFN-β promoter induction in human cells. Because STAT2 binding was previously identified as a host restriction factor for some Paramyxoviridae, we established STAT2 sequence from giant fruit bats, and binding to TioV-V was tested. Surprisingly, TioV-V interaction with STAT2 from giant fruit bats is also extremely weak and barely detectable. Altogether, our observations question the capacity of TioV to appropriately control IFN-α/β signaling in both human and giant fruit bats that are considered as its natural host.

  3. One small edit for humans, one giant edit for humankind? Points and questions to consider for a responsible way forward for gene editing in humans.

    Science.gov (United States)

    Howard, Heidi C; van El, Carla G; Forzano, Francesca; Radojkovic, Dragica; Rial-Sebbag, Emmanuelle; de Wert, Guido; Borry, Pascal; Cornel, Martina C

    2018-01-01

    Gene editing, which allows for specific location(s) in the genome to be targeted and altered by deleting, adding or substituting nucleotides, is currently the subject of important academic and policy discussions. With the advent of efficient tools, such as CRISPR-Cas9, the plausibility of using gene editing safely in humans for either somatic or germ line gene editing is being considered seriously. Beyond safety issues, somatic gene editing in humans does raise ethical, legal and social issues (ELSI), however, it is suggested to be less challenging to existing ethical and legal frameworks; indeed somatic gene editing is already applied in (pre-) clinical trials. In contrast, the notion of altering the germ line or embryo such that alterations could be heritable in humans raises a large number of ELSI; it is currently debated whether it should even be allowed in the context of basic research. Even greater ELSI debates address the potential use of germ line or embryo gene editing for clinical purposes, which, at the moment is not being conducted and is prohibited in several jurisdictions. In the context of these ongoing debates surrounding gene editing, we present herein guidance to further discussion and investigation by highlighting three crucial areas that merit the most attention, time and resources at this stage in the responsible development and use of gene editing technologies: (1) conducting careful scientific research and disseminating results to build a solid evidence base; (2) conducting ethical, legal and social issues research; and (3) conducting meaningful stakeholder engagement, education and dialogue.

  4. Computer Viruses. Technology Update.

    Science.gov (United States)

    Ponder, Tim, Comp.; Ropog, Marty, Comp.; Keating, Joseph, Comp.

    This document provides general information on computer viruses, how to help protect a computer network from them, measures to take if a computer becomes infected. Highlights include the origins of computer viruses; virus contraction; a description of some common virus types (File Virus, Boot Sector/Partition Table Viruses, Trojan Horses, and…

  5. DESIGNING ENGLISH FOR SPECIFIC PURPOSE SYLLABUS FOR EDITING COURSE

    Directory of Open Access Journals (Sweden)

    Wieka Barathayomi

    2016-09-01

    Full Text Available The objective of this research is to design an English for specific purposes syllabus for Editing Course. This research used Research and Development method. This research consists of two main activities: 1 need analysis and 2 designing an English for specific purposes syllabus for editing course. The data for this research were collected through an open-ended questionnaire consisting of 7 items, and study of literature. The open-ended questionnaire was used to collect data about students’ understanding of Editing. The study of literature was used as supporting theories to design and develop Syllabus for Editing Course. The study showed that the syllabus of Editing Course need to be designed based on prerequisite knowledge and skills of an Editor, such as knowledge and skills in mechanical, content, and language editing.

  6. Hendra virus.

    Science.gov (United States)

    Middleton, Deborah

    2014-12-01

    Hendra virus infection of horses occurred sporadically between 1994 and 2010 as a result of spill-over from the viral reservoir in Australian mainland flying-foxes, and occasional onward transmission to people also followed from exposure to affected horses. An unprecedented number of outbreaks were recorded in 2011 leading to heightened community concern. Release of an inactivated subunit vaccine for horses against Hendra virus represents the first commercially available product that is focused on mitigating the impact of a Biosafety Level 4 pathogen. Through preventing the development of acute Hendra virus disease in horses, vaccine use is also expected to reduce the risk of transmission of infection to people. Crown Copyright © 2014. Published by Elsevier Inc. All rights reserved.

  7. Online Learning for Neural Machine Translation Post-editing

    OpenAIRE

    Peris, Álvaro; Cebrián, Luis; Casacuberta, Francisco

    2017-01-01

    Neural machine translation has meant a revolution of the field. Nevertheless, post-editing the outputs of the system is mandatory for tasks requiring high translation quality. Post-editing offers a unique opportunity for improving neural machine translation systems, using online learning techniques and treating the post-edited translations as new, fresh training data. We review classical learning methods and propose a new optimization algorithm. We thoroughly compare online learning algorithm...

  8. The potential and pitfalls of editions in educational contexts

    OpenAIRE

    Horlacher, Rebekka

    2014-01-01

    By the example of school reformer and education scholar Johann Heinrich Pestalozzi (1746-1827) along with editions of his writings and correspondence, this article examines the relationship between sources, research traditions, historiography, and the production of editions. What emerges is that those sources that have been turned into editions for use by researchers exercise a significant influence on the issues researchers explore and on historiography, while the kind of historiography domi...

  9. Current status and perspectives of genome editing technology for microalgae

    OpenAIRE

    Jeon, Seungjib; Lim, Jong-Min; Lee, Hyung-Gwan; Shin, Sung-Eun; Kang, Nam Kyu; Park, Youn-Il; Oh, Hee-Mock; Jeong, Won-Joong; Jeong, Byeong-ryool; Chang, Yong Keun

    2017-01-01

    Genome editing techniques are critical for manipulating genes not only to investigate their functions in biology but also to improve traits for genetic engineering in biotechnology. Genome editing has been greatly facilitated by engineered nucleases, dubbed molecular scissors, including zinc-finger nuclease (ZFN), TAL effector endonuclease (TALEN) and clustered regularly interspaced palindromic sequences (CRISPR)/Cas9. In particular, CRISPR/Cas9 has revolutionized genome editing fields with i...

  10. Search-and-replace editing for personal photo collections

    OpenAIRE

    Hasinoff, Samuel W.; Jozwiak, Martyna Anna; Durand, Fredo; Freeman, William T.

    2010-01-01

    We propose a new system for editing personal photo collections, inspired by search-and-replace editing for text. In our system, local edits specified by the user in a single photo (e.g., using the “clone brush” tool) can be propagated automatically to other photos in the same collection, by matching the edited region across photos. To achieve this, we build on tools from computer vision for image matching. Our experimental results on real photo collections demonstrate the feasibility and pote...

  11. Bibliography of integral charged particle nuclear data. Archival edition

    International Nuclear Information System (INIS)

    Burrows, T.W.; Dempsey, P.

    1980-03-01

    This is the fourth annual edition of the National Nuclear Data Center charged-particle bibliography. This edition is cumulative and supersedes the previous editions. The bibliography's primary aims are to satisfy the need for a concise and comprehensive index of integral charged-particle cross section data and to provide an index of charged-particle data compiled in the international exchange format. References in this Part are by target for the various incident charged particles (in order of increasing A). The present publication is an archival volume; future publications will be cumulative supplements to this edition

  12. Bibliography of integral charged particle nuclear data. Archival edition

    International Nuclear Information System (INIS)

    Burrows, T.W.; Dempsey, P.

    1980-03-01

    This is the fourth annual edition of the National Nuclear Data Center charged-particle bibliography. This edition is cumulative and supersedes the previous editions. The bibliography's primary aims are to satisfy the need for a concise and comprehensive index of integral charged-particle cross section data and to provide an index of charged-particle data compiled in the international exchange format, EXFOR. This part of the publication deals with isotope production; references are ordered by mass of the nuclide produced. The present publication is an archival volume; future publications will be cumulative supplements to this edition

  13. [Genome editing technology and its application in forage legumes].

    Science.gov (United States)

    Liu, Huan; Meng, Yingying; Niu, Lifang; Lin, Hao

    2017-10-25

    Genome editing is a novel targeted genome modification biotechnology, which could successfully mutate specific loci as well as generate gene replacement and insertion in various organisms. So far, genome editing technology has been widely applied in investigating gene function and developing valuable traits in both model plants and major crops. In this review, we briefly survey the historical development of genome editing technology, summarize recent progress using the CRISPR/Cas9 system for plant genome editing and explore the potential of the CRISPR/Cas technology in improving forage legumes.

  14. DNA-free genome editing methods for targeted crop improvement.

    Science.gov (United States)

    Kanchiswamy, Chidananda Nagamangala

    2016-07-01

    Evolution of the next-generation clustered, regularly interspaced, short palindromic repeat/Cas9 (CRISPR/Cas9) genome editing tools, ribonucleoprotein (RNA)-guided endonuclease (RGEN) RNPs, is paving the way for developing DNA-free genetically edited crop plants. In this review, I discuss the various methods of RGEN RNPs tool delivery into plant cells and their limitations to adopt this technology to numerous crop plants. Furthermore, focus is given on the importance of developing DNA-free genome edited crop plants, including perennial crop plants. The possible regulation on the DNA-free, next-generation genome-edited crop plants is also highlighted.

  15. Special Edition: Environment in Sustainable Development

    Directory of Open Access Journals (Sweden)

    Stephen Morse

    2014-11-01

    Full Text Available When we were invited by the editors of Sustainability to put together a special edition on “Environment in Sustainable Development” our first reaction was to question whether this was really needed. After all, the environment has long been regarded as a central plank in sustainability and there are countless articles and books published on an annual basis that explore the impact of our economic and social activities on our environment. Just what is it that a special edition can achieve? What new angles could we hope to provide? Our initial thinking was to link the special edition to a particular, almost unique, location in time rather than space. We are in the process of recovering, albeit stuttering, from the deepest economic crash experienced by the European and North American economies. The crash has brought some national economies to their knees and, if economic commentators are to be believed, almost destroyed the Euro. Recovery from that crash has been slow and it is arguable whether at the time of writing this has developed much momentum. There is still the skewed perception that prosperity equals economic growth and that economic growth can take place without real (sustainable development or by simply implementing austerity measures and surely without people’s participation. An analogy from National Parks worldwide is when conservation agencies try to enforce protection without local people’s support. All such attempts have either failed or resurrected only once people’s involvement was secured and guaranteed. The unidirectional austerity measures imposed mainly in the countries of southern Europe have destroyed social cohesion leaving deeply wounded societies, while at the same time have also put up for grabs important assets (including natural capital in each of these countries and therefore in jeopardy even their long term recovery.

  16. Targeted Genome Regulation and Editing in Plants

    KAUST Repository

    Piatek, Agnieszka

    2016-03-01

    The ability to precisely regulate gene expression patterns and to modify genome sequence in a site-specific manner holds much promise in determining gene function and linking genotype to phenotype. DNA-binding modules have been harnessed to generate customizable and programmable chimeric proteins capable of binding to site-specific DNA sequences and regulating the genome and epigenome. Modular DNA-binding domains from zinc fingers (ZFs) and transcriptional activator-like effectors (TALEs) are amenable to engineering to bind any DNA target sequence of interest. Deciphering the code of TALE repeat binding to DNA has helped to engineer customizable TALE proteins capable of binding to any sequence of interest. Therefore TALE repeats provide a rich resource for bioengineering applications. However, the TALE system is limited by the requirement to re-engineer one or two proteins for each new target sequence. Recently, the clustered regularly interspaced palindromic repeats (CRISPR)/ CRISPR associated 9 (Cas9) has been used as a versatile genome editing tool. This machinery has been also repurposed for targeted transcriptional regulation. Due to the facile engineering, simplicity and precision, the CRISPR/Cas9 system is poised to revolutionize the functional genomics studies across diverse eukaryotic species. In this dissertation I employed transcription activator-like effectors and CRISPR/Cas9 systems for targeted genome regulation and editing and my achievements include: 1) I deciphered and extended the DNA-binding code of Ralstonia TAL effectors providing new opportunities for bioengineering of customizable proteins; 2) I repurposed the CRISPR/Cas9 system for site-specific regulation of genes in plant genome; 3) I harnessed the power of CRISPR/Cas9 gene editing tool to study the function of the serine/arginine-rich (SR) proteins.

  17. Groundwork for a Better Vocabulary. Second Edition. Instructor's Edition. Townsend Press Vocabulary Series.

    Science.gov (United States)

    Smith, R. Kent; Johnson, Beth; Mohr, Carole

    This instructor's edition of a vocabulary textbook for college students, who read at the fifth to eighth grade level, features 25 chapters and teaches 250 basic words. The first and third chapters in each unit contain word-part practices. The second and fourth chapters in each unit contain synonym-antonym practices. The book's last chapter in each…

  18. Anatomy and Physiology. Module Set II: Major Body Systems. Teacher Edition [and] Student Edition. Surgical Technology.

    Science.gov (United States)

    Hilley, Robert

    This document, which is the second part of a two-part set of modules on anatomy and physiology for future surgical technicians, contains the teacher and student editions of an introduction to anatomy and physiology that consists of modules on the following body systems: integumentary system; skeletal system; muscular system; nervous system;…

  19. Self-Instructional Course in Business Machines. Teacher Edition and Student Edition.

    Science.gov (United States)

    Andrews, Frances K.

    The self-instruction office machines course provides both student's and teacher's manuals and includes, in the teacher's edition, scripts to be used with 21 instructional sound films for the machines covered. These may be used without the films as detailed operating instructions. The teacher's manual also contains instructions on operating each…

  20. Genome editing: Bioethics shows the way.

    Directory of Open Access Journals (Sweden)

    Carolyn P Neuhaus

    2017-03-01

    Full Text Available When some scientists hear the word "bioethics," they break out in intellectual hives. They shouldn't. Good bioethics is about enabling science to move forward. Bioethics pushes scientists to acknowledge that they operate not within a vacuum but within a society in which diverse perspectives and values must be engaged. Bioethicists give voice to those divergent perspectives and provide a framework to facilitate informed and inclusive discussions that spur progress, rather than stall it. The field is needed to advance cutting-edge biomedical research in domains in which the benefits to be had are enormous, such as genome editing, but ethical concerns persist.

  1. European Corporate Law, 2nd edition

    DEFF Research Database (Denmark)

    Werlauff, Erik; Dorresteijn, Adriaan; Monteiro, Tiago Pereira

    Europe and the common law system of the UK. The book provides in-depth examination of the implications involved in such issues and trends as the following: ; acknowledgement by other Member States of the legal status of a company formed in accordance with a particular national law; a company's freedom......As in the First Edition (1995) of this well-known book, the authors demonstrate that analysis and comparison of national corporate laws on a number of issues yield highly valuable general principles and observations, not least because business organisations, wherever located, tend to show......-up varieties of existing company forms; and developments regarding group law.  ...

  2. Genome editing: Bioethics shows the way.

    Science.gov (United States)

    Neuhaus, Carolyn P; Caplan, Arthur L

    2017-03-01

    When some scientists hear the word "bioethics," they break out in intellectual hives. They shouldn't. Good bioethics is about enabling science to move forward. Bioethics pushes scientists to acknowledge that they operate not within a vacuum but within a society in which diverse perspectives and values must be engaged. Bioethicists give voice to those divergent perspectives and provide a framework to facilitate informed and inclusive discussions that spur progress, rather than stall it. The field is needed to advance cutting-edge biomedical research in domains in which the benefits to be had are enormous, such as genome editing, but ethical concerns persist.

  3. Country Nuclear Power Profiles - 2013 Edition

    International Nuclear Information System (INIS)

    2013-08-01

    The Country Nuclear Power Profiles compile background information on the status and development of nuclear power programmes in Member States. The CNPP summarizes organizational and industrial aspects of nuclear power programs and provides information about the relevant legislative, regulatory, and international framework in each country. Its descriptive and statistical overview of the overall economic, energy, and electricity situation in each country and its nuclear power framework is intended to serve as an integrated source of key background information about nuclear power programs in the world. This 2013 edition, issued on CD-ROM and Web pages, contains updated country information for 51 countries

  4. Books in Action: Armed Services Editions

    Science.gov (United States)

    1984-01-01

    EDGCUMB. Dan Sickles 1047 PINCKNECY, JOSEPHINE. Three O’Clock Dinner j-297 POE , EDGAR ALLAN . Selected Storiest .Abridged. t"Made" Book; selected...especially for an Armed Services Edition Appendix: A List of the ASE 65 767 POE , EDGAR ALLAN . Selected Storiest (Reprint) R-21 PORTER, KATHERINE ANNE. Selected...a n Q e n S r e1026 BoNNAMIY, FRANCIS. Th igI ed nQenSre 1299 BOSWORTHI, ALLAN R. Hang and Rattle 892 BoTKIN, B. A., editor. The Skyj sthe Limitt P-3

  5. Country Nuclear Power Profiles. 2016 Edition

    International Nuclear Information System (INIS)

    2016-12-01

    The Country Nuclear Power Profiles compile background information on the status and development of nuclear power programmes in Member States. The publication summarizes organizational and industrial aspects of nuclear power programmes and provides information about the relevant legislative, regulatory and international framework in each State. Its descriptive and statistical overview of the overall economic, energy and electricity situation in each State and its nuclear power framework is intended to serve as an integrated source of key background information about nuclear power programmes throughout the world. This 2016 edition, issued on CD-ROM, contains updated country information for 51 States.

  6. Country Nuclear Power Profiles - 2015 Edition

    International Nuclear Information System (INIS)

    2015-08-01

    The Country Nuclear Power Profiles compile background information on the status and development of nuclear power programmes in Member States. The publication summarizes organizational and industrial aspects of nuclear power programmes and provides information about the relevant legislative, regulatory and international framework in each State. Its descriptive and statistical overview of the overall economic, energy and electricity situation in each State and its nuclear power framework is intended to serve as an integrated source of key background information about nuclear power programmes throughout the world. This 2015 edition, issued on CD-ROM, contains updated country information for 51 States

  7. Genome editing with engineered zinc finger nucleases.

    Science.gov (United States)

    Urnov, Fyodor D; Rebar, Edward J; Holmes, Michael C; Zhang, H Steve; Gregory, Philip D

    2010-09-01

    Reverse genetics in model organisms such as Drosophila melanogaster, Arabidopsis thaliana, zebrafish and rats, efficient genome engineering in human embryonic stem and induced pluripotent stem cells, targeted integration in crop plants, and HIV resistance in immune cells - this broad range of outcomes has resulted from the application of the same core technology: targeted genome cleavage by engineered, sequence-specific zinc finger nucleases followed by gene modification during subsequent repair. Such 'genome editing' is now established in human cells and a number of model organisms, thus opening the door to a range of new experimental and therapeutic possibilities.

  8. Emerging technologies planning guide, 1993 edition

    Energy Technology Data Exchange (ETDEWEB)

    1992-11-01

    Information system technology enhancements during the next five years are expected to provide some of the most significant individual and organization work improvements ever made in the office environment. This guide is an aid to planning these technologies and assessing their roles in improving the effectiveness of Headquarters programs. Their implementation will cost-effectively support Departmental operations and the National Energy Strategy. At the hear of this process is an understanding of the relationship which exists between technology introduction and the planning, budgeting and acquisition process. The 1993 edition of this guide covers the 1993--1997 time frame.

  9. Observing Optional Number in DDC Edition 23

    Directory of Open Access Journals (Sweden)

    Rotmianto Mohamad

    2018-01-01

    Full Text Available Dewey Decimal Classification is a most popular classification system in the world because of its completeness and most up-to-date. There are many optional number in this classification system, although it rarely to be discussed even it is important to known well about that optional number, especially for a librarian as classifier. This paper is a literature study about Dewey Decimal Classification Edition 23, to describe about optional numbers, particularly the number in relationship with Indonesia’s subject and discipline. This paper is to avoid misunderstanding in interpreted about optional number among librarians, especially for who that does not understand well about optional numbers.

  10. Development of CRISPR/Cas9 mediated virus resistance in agriculturally important crops.

    Science.gov (United States)

    Khatodia, Surender; Bhatotia, Kirti; Tuteja, Narendra

    2017-05-04

    Clustered regulatory interspaced short palindromic repeats (CRISPR)/CRISPR associated nuclease 9 (Cas9) system of targeted genome editing has already revolutionized the plant science research. This is a RNA guided programmable endonuclease based system composed of 2 components, the Cas9 nuclease and an engineered guide RNA targeting any DNA sequence of the form N20-NGG for novel genome editing applications. The CRISPR/Cas9 technology of targeted genome editing has been recently applied for imparting virus resistance in plants. The robustness, wide adaptability, and easy engineering of this system has proved its potential as an antiviral tool for plants. Novel DNA free genome editing by using the preassembled Cas9/gRNA ribonucleoprotein complex for development of virus resistance in any plant species have been prospected for the future. Also, in this review we have discussed the reports of CRISPR/Cas9 mediated virus resistance strategy against geminiviruses by targeting the viral genome and transgene free strategy against RNA viruses by targeting the host plant factors. In conclusion, CRISPR/Cas9 technology will provide a more durable and broad spectrum viral resistance in agriculturally important crops which will eventually lead to public acceptance and commercialization in the near future.

  11. Evidence for ADAR-induced hypermutation of the Drosophila sigma virus (Rhabdoviridae

    Directory of Open Access Journals (Sweden)

    O'Connell Mary A

    2009-11-01

    Full Text Available Abstract Background ADARs are RNA editing enzymes that target double stranded RNA and convert adenosine to inosine, which is read by translation machinery as if it were guanosine. Aside from their role in generating protein diversity in the central nervous system, ADARs have been implicated in the hypermutation of some RNA viruses, although why this hypermutation occurs is not well understood. Results Here we describe the hypermutation of adenosines to guanosines in the genome of the sigma virus--a negative sense RNA virus that infects Drosophila melanogaster. The clustering of these mutations and the context in which they occur indicates that they have been caused by ADARs. However, ADAR-editing of viral RNA is either rare or edited viral RNA are rapidly degraded, as we only detected evidence for editing in two of the 104 viral isolates we studied. Conclusion This is the first evidence for ADARs targeting viruses outside of mammals, and it raises the possibility that ADARs could play a role in the antiviral defences of insects.

  12. Schmallenberg Virus

    Indian Academy of Sciences (India)

    IAS Admin

    combat many infectious-disease-causing agents over the years. However, evolution is a continuous process ... newly emerging virus infection that poses threat to the livestock industries. In addition to describing the life ... are the Symptoms of Infection by SBV. The first clinical signs in adult animals are acute diarrhoea, a dip.

  13. HUMAN PAPILLOMA VIRUS — ONCOGENIC VIRUS

    Directory of Open Access Journals (Sweden)

    A.N. Mayansky

    2010-01-01

    Full Text Available The lecture is devoted to oncogenic viruses, particularly human papilloma virus. Papilloma viral infection is found in all parts of the globe and highly contagious. In addition to exhaustive current data on classification, specifics of papilloma viruses composition and epidemiology, the author describes in great detail the malignization mechanisms of papilloma viruses pockets. Also, issues of diagnostics and specific prevention and treatment of diseases caused by this virus are illustrated. Key words: oncogenic viruses, papilloma viruses, prevention, vaccination. (Pediatric Pharmacology. – 2010; 7(4:48-55

  14. Replication of many human viruses is refractory to inhibition by endogenous cellular microRNAs.

    Science.gov (United States)

    Bogerd, Hal P; Skalsky, Rebecca L; Kennedy, Edward M; Furuse, Yuki; Whisnant, Adam W; Flores, Omar; Schultz, Kimberly L W; Putnam, Nicole; Barrows, Nicholas J; Sherry, Barbara; Scholle, Frank; Garcia-Blanco, Mariano A; Griffin, Diane E; Cullen, Bryan R

    2014-07-01

    The issue of whether viruses are subject to restriction by endogenous microRNAs (miRNAs) and/or by virus-induced small interfering RNAs (siRNAs) in infected human somatic cells has been controversial. Here, we address this question in two ways. First, using deep sequencing, we demonstrate that infection of human cells by the RNA virus dengue virus (DENV) or West Nile virus (WNV) does not result in the production of any virus-derived siRNAs or viral miRNAs. Second, to more globally assess the potential of small regulatory RNAs to inhibit virus replication, we used gene editing to derive human cell lines that lack a functional Dicer enzyme and that therefore are unable to produce miRNAs or siRNAs. Infection of these cells with a wide range of viruses, including DENV, WNV, yellow fever virus, Sindbis virus, Venezuelan equine encephalitis virus, measles virus, influenza A virus, reovirus, vesicular stomatitis virus, human immunodeficiency virus type 1, or herpes simplex virus 1 (HSV-1), failed to reveal any enhancement in the replication of any of these viruses, although HSV-1, which encodes at least eight Dicer-dependent viral miRNAs, did replicate somewhat more slowly in the absence of Dicer. We conclude that most, and perhaps all, human viruses have evolved to be resistant to inhibition by endogenous human miRNAs during productive replication and that dependence on a cellular miRNA, as seen with hepatitis C virus, is rare. How viruses have evolved to avoid inhibition by endogenous cellular miRNAs, which are generally highly conserved during metazoan evolution, remains to be determined. Importance: Eukaryotic cells express a wide range of small regulatory RNAs, including miRNAs, that have the potential to inhibit the expression of mRNAs that show sequence complementarity. Indeed, previous work has suggested that endogenous miRNAs have the potential to inhibit viral gene expression and replication. Here, we demonstrate that the replication of a wide range of

  15. CRISPR-Cas9 as a Powerful Tool for Efficient Creation of Oncolytic Viruses

    Directory of Open Access Journals (Sweden)

    Ming Yuan

    2016-03-01

    Full Text Available The development of oncolytic viruses has led to an emerging new class of cancer therapeutics. Although the safety profile has been encouraging, the transition of oncolytic viruses to the clinical setting has been a slow process due to modifications. Therefore, a new generation of more potent oncolytic viruses needs to be exploited, following our better understanding of the complex interactions between the tumor, its microenvironment, the virus, and the host immune response. The conventional method for creation of tumor-targeted oncolytic viruses is based on homologous recombination. However, the creation of new mutant oncolytic viruses with large genomes remains a challenge due to the multi-step process and low efficiency of homologous recombination. The CRISPR-associated endonuclease Cas9 has hugely advanced the potential to edit the genomes of various organisms due to the ability of Cas9 to target a specific genomic site by a single guide RNA. In this review, we discuss the CRISPR-Cas9 system as an efficient viral editing method for the creation of new oncolytic viruses, as well as its potential future applications in the development of oncolytic viruses. Further, this review discusses the potential of off-target effects as well as CRISPR-Cas9 as a tool for basic research into viral biology.

  16. CRISPR-Cas9 as a Powerful Tool for Efficient Creation of Oncolytic Viruses.

    Science.gov (United States)

    Yuan, Ming; Webb, Eika; Lemoine, Nicholas Robert; Wang, Yaohe

    2016-03-07

    The development of oncolytic viruses has led to an emerging new class of cancer therapeutics. Although the safety profile has been encouraging, the transition of oncolytic viruses to the clinical setting has been a slow process due to modifications. Therefore, a new generation of more potent oncolytic viruses needs to be exploited, following our better understanding of the complex interactions between the tumor, its microenvironment, the virus, and the host immune response. The conventional method for creation of tumor-targeted oncolytic viruses is based on homologous recombination. However, the creation of new mutant oncolytic viruses with large genomes remains a challenge due to the multi-step process and low efficiency of homologous recombination. The CRISPR-associated endonuclease Cas9 has hugely advanced the potential to edit the genomes of various organisms due to the ability of Cas9 to target a specific genomic site by a single guide RNA. In this review, we discuss the CRISPR-Cas9 system as an efficient viral editing method for the creation of new oncolytic viruses, as well as its potential future applications in the development of oncolytic viruses. Further, this review discusses the potential of off-target effects as well as CRISPR-Cas9 as a tool for basic research into viral biology.

  17. How Online Access Changed Amateur Video Editing

    Directory of Open Access Journals (Sweden)

    Eugster Benjamin

    2014-12-01

    Full Text Available Digital technology has often been discussed in relation to how it changed either the production or the reception of audiovisual cultures. This paper will consider a combination of both as a crucial part in understanding strategies of inter- and transmedial amateur creativity. Based on an experimental ethnography of the online video subgenre/subculture “YouTubePoop,” the paper will elaborate on the connection between the individual experience and the creation of digital media. The loose collective of independent amateurs behind the YouTubePoop videos makes use of already existing audiovisual material ranging from television shows to videos of other YouTube users. The re-created remixes and mash-ups are characterized by their random selection of original material and their nonsensical humour. Hence, the rapid montage of this heterogeneous content is just as much part of the intensified aesthetic expressiveness as are the applied special effects available in the digital video editing software. Both aspects highlight the strong interdependence of the rapid accessibility of online content and digital technology and the new aesthetic expressions they are fostering. The paper will show how the experience and navigation of digital interfaces (editing software, media players, or homepages affect the design and practice of these video-remixes. This will open the discussion about intertextual strategies of media appropriation to an aesthetic and praxeological analysis of media interaction.

  18. Neuroimmune Pharmacology, 2nd Edition - A Perspective.

    Science.gov (United States)

    Gelbard, Harris A

    2017-06-01

    It has been almost nine years since the 1st edition of Neuroimmune Pharmacology was published on May 23rd, 2008. The 2nd edition of Neuroimmune Pharmacology by Ikezu and Gendelman (Editors) with Przedborski, Masliah and Cosentino (Associate Editors) manages to fulfill two separate missions: to provide comprehensive, but highly topical access to a rapidly evolving field and to serve as a standalone reference for scientists and clinicians in need of guidance regarding questions pertinent to neuroimmune pharmacology. Doing a PubMed search on the terms neuroimmune and pharmacology yields 1090 publications, with a first publication by Dougherty and Dafny, published in the Journal of Neuroscience Research in 1988, entitled "Neuroimmune intercommunication, central opioids, and the immune response to bacterial endotoxin." Since 2000, there have been 979 publications using these search terms, with 137 published since the beginning of 2016. The obvious conclusion to be drawn is that this is a burgeoning field that represents the cusp between our understanding of relationships between the immune and nervous systems and how we might treat disease with pharmacologic approaches when normal homeostatic mechanisms go awry.

  19. Light-Emitting Diodes - 2nd Edition

    Science.gov (United States)

    Schubert, E. Fred

    2006-06-01

    Revised and fully up-dated, the second edition of this graduate textbook offers a comprehensive explanation of the technology and physics of LEDs such as infrared, visible-spectrum, ultraviolet, and white LEDs made from III-V semiconductors. Elementary properties such as electrical and optical characteristics are reviewed, followed by the analysis of advanced device structures. With nine additional chapters, the treatment of LEDs has been vastly expanded, including new material on device packaging, reflectors, UV LEDs, III-V nitride materials, solid-state sources for illumination applications, and junction temperature. Radiative and non-radiative recombination dynamics, methods for improving light extraction, high-efficiency and high-power device designs, white-light emitters with wavelength-converting phosphor materials, optical reflectors, and spontaneous recombination in resonant-cavity structures are discussed in detail. With exercises, solutions, and illustrative examples, this textbook will be of interest to scientists and engineers working on LEDs and graduate students in electrical engineering, applied physics, and materials science. Contains 30 exercises, over 20 of which have solutions provided in the book Many illustrative examples Contains the same broad perspective as the first edition but is significantly expanded with new material on device packaging, reflectors, UV LEDs, solid-state sources for illumination applications, junction temperature, and III-V nitride materials

  20. The multimedia corrosion guide, 2. edition

    International Nuclear Information System (INIS)

    Audisio, S.

    2006-01-01

    Collecting the knowledge and experience of 26 international experts, the Multimedia Corrosion Guide is a reference book in the field of corrosion, for scientists, engineers, technicians and students. Also available in English, the second edition is more than just an update; it contains new chapters, new corrosion case studies and new smart functions. When knowledge is combined with experience, the result is a work of unprecedented quality and detail. Under the supervision of Professor Dr. S. Audisio of the Industrial Physical Chemistry Laboratory, INSA de Lyon, France, leading corrosion specialists from industry (Aerospatiale, CEA, EDF, ELF, Fragema, GDF, Pechiney, Renault, Rhone-Poulenc, Ugine...) have joined forces with experts from renowned French universities (INSA, UTC, ENSEEP, ENSCP, ENSAM...) to produce this book. In addition to the Corrosion Treatise, this program also contains a Case Studies Library, a corrosion database to which users can add their own experience base. New cases are automatically inserted alongside the existing ones, with the same selection criteria. Numerous other advanced functions make this second edition a unique, intelligent, professional and invaluable reference tool. (authors)

  1. Safe Handling of Radioisotopes. 1973 Edition

    International Nuclear Information System (INIS)

    1973-01-01

    Under its Statute the International Atomic Energy Agency is empowered to provide for the application of standards of safety for protection against radiation to its own operations and to operations making use of assistance provided by it or with which it is otherwise directly associated. To this end authorities receiving such assistance are required to observe relevant health and safety measures prescribed by the Agency. As a first step, it was considered an urgent task to provide users of radionuclides with a manual of practice for the safe handling of these substances. The first edition of such a manual was published in 1958 and represented the first of the ''Safety Series'', a series of manuals and codes on health and safety published by the Agency. It was prepared after careful consideration of existing national and international codes of radiation safety by a group of international experts and in consultation with other international bodies. This edition presents the second revision. In response to the suggestion made by some Member States, the term 'radioisotopes' has been changed to 'radionuclides' in the title and, as appropriate, in the text because the term 'radionuclides' includes the radioactive element itself as well as the isotopes. The series of manuals and codes published in the Safety Series and the Technical Reports Series give more complete advice to the user on specialized topics.

  2. Gene Editing, Enhancing and Women's Role.

    Science.gov (United States)

    Simonstein, Frida

    2017-02-02

    A recent article on the front page of The Independent (September 18, 2015) reported that the genetic 'manipulation' of IVF embryos is to start in Britain, using a new revolutionary gene-editing technique, called Crispr/Cas9. About three weeks later (Saturday 10, October 2015), on the front page of the same newspaper, it was reported that the National Health Service (NHS) faces a one billion pound deficit only 3 months into the new year. The hidden connection between these reports is that gene editing could be used to solve issues related to health care allocation. Improving the health of future generations might coincide with public health goals; it might improve the health of individuals and communities, and, if successful, might be seen as a public good. However, enhancing future generations will require In Vitro Fertilisation and Pre-implantation Genetic Diagnosis. Remarkably, the necessary involvement of women in an enhancing scenario has not been discussed by its proponents. The present discourse on moral obligations of future generations, although not referring to women, seems to imply that women might be required, morally, if not legally, to reproduce with IVF. Enhancing future generations will be gendered, unless the artificial womb is developed. These are challenging issues that require a wider perspective, of both women and men. Despite the lack of a unified feminist conclusion in the discussions about the merits and risks of human genome modification, there is an urgent need to clarify the role of women in this scenario.

  3. Country Nuclear Power Profiles - 2009 Edition

    International Nuclear Information System (INIS)

    2009-08-01

    The Country Nuclear Power Profiles compiles background information on the status and development of nuclear power programs in Member States. It consists of organizational and industrial aspects of nuclear power programs and provides information about the relevant legislative, regulatory, and international framework in each country. Its descriptive and statistical overview of the overall economic, energy, and electricity situation in each country, and its nuclear power framework is intended to serve as an integrated source of key background information about nuclear power programs in the world. The preparation of Country Nuclear Power Profiles (CNPP) was initiated in 1990s. It responded to a need for a database and a technical publication containing a description of the energy and economic situation, the energy and the electricity sector, and the primary organizations involved in nuclear power in IAEA Member States. This is the 2009 edition issued on CD-ROM and Web pages. It updates the country information for 44 countries. The CNPP is updated based on information voluntarily provided by participating IAEA Member States. Participants include the 30 countries that have operating nuclear power plants, as well as 14 countries having past or planned nuclear power programmes (Bangladesh, Egypt, Ghana, Indonesia, the Islamic Republic of Iran, Italy, Kazakhstan, Nigeria, Philippines, Poland, Thailand, Tunisia, Turkey and Vietnam). For the 2009 edition, 26 countries provided updated or new profiles. For the other countries, the IAEA updated the profile statistical tables on nuclear power, energy development, and economic indicators based on information from IAEA and World Bank databases

  4. Oropuche virus: A virus present but ignored

    Directory of Open Access Journals (Sweden)

    Salim Mattar V.

    2015-09-01

    Full Text Available Bunyaviruses are RNA viruses that affect animals and plants; they have five genera and four of them affect humans: Orthobunyavirus, Nairovirus, Phlebovirus and Hantavirus. All of them are Arbovirus, except Hantavirus. The Orthobunyaviruses comprise Oropouche, Tahyna, La Crosse virus, California encephalitis virus and Heartland virus recently discovered (1. Except for Heartland virus which is transmitted by ticks of the genus Amblyoma, these Phleboviruses have as vectors mosquitoes, which bite small mammals which are able to be as reservoirs amplifiers.

  5. Crystal structure of the Hendra virus attachment G glycoprotein bound to a potent cross-reactive neutralizing human monoclonal antibody.

    Science.gov (United States)

    Xu, Kai; Rockx, Barry; Xie, Yihu; DeBuysscher, Blair L; Fusco, Deborah L; Zhu, Zhongyu; Chan, Yee-Peng; Xu, Yan; Luu, Truong; Cer, Regina Z; Feldmann, Heinz; Mokashi, Vishwesh; Dimitrov, Dimiter S; Bishop-Lilly, Kimberly A; Broder, Christopher C; Nikolov, Dimitar B

    2013-01-01

    The henipaviruses, represented by Hendra (HeV) and Nipah (NiV) viruses are highly pathogenic zoonotic paramyxoviruses with uniquely broad host tropisms responsible for repeated outbreaks in Australia, Southeast Asia, India and Bangladesh. The high morbidity and mortality rates associated with infection and lack of licensed antiviral therapies make the henipaviruses a potential biological threat to humans and livestock. Henipavirus entry is initiated by the attachment of the G envelope glycoprotein to host cell membrane receptors. Previously, henipavirus-neutralizing human monoclonal antibodies (hmAb) have been isolated using the HeV-G glycoprotein and a human naïve antibody library. One cross-reactive and receptor-blocking hmAb (m102.4) was recently demonstrated to be an effective post-exposure therapy in two animal models of NiV and HeV infection, has been used in several people on a compassionate use basis, and is currently in development for use in humans. Here, we report the crystal structure of the complex of HeV-G with m102.3, an m102.4 derivative, and describe NiV and HeV escape mutants. This structure provides detailed insight into the mechanism of HeV and NiV neutralization by m102.4, and serves as a blueprint for further optimization of m102.4 as a therapeutic agent and for the development of entry inhibitors and vaccines.

  6. Crystal structure of the Hendra virus attachment G glycoprotein bound to a potent cross-reactive neutralizing human monoclonal antibody.

    Directory of Open Access Journals (Sweden)

    Kai Xu

    Full Text Available The henipaviruses, represented by Hendra (HeV and Nipah (NiV viruses are highly pathogenic zoonotic paramyxoviruses with uniquely broad host tropisms responsible for repeated outbreaks in Australia, Southeast Asia, India and Bangladesh. The high morbidity and mortality rates associated with infection and lack of licensed antiviral therapies make the henipaviruses a potential biological threat to humans and livestock. Henipavirus entry is initiated by the attachment of the G envelope glycoprotein to host cell membrane receptors. Previously, henipavirus-neutralizing human monoclonal antibodies (hmAb have been isolated using the HeV-G glycoprotein and a human naïve antibody library. One cross-reactive and receptor-blocking hmAb (m102.4 was recently demonstrated to be an effective post-exposure therapy in two animal models of NiV and HeV infection, has been used in several people on a compassionate use basis, and is currently in development for use in humans. Here, we report the crystal structure of the complex of HeV-G with m102.3, an m102.4 derivative, and describe NiV and HeV escape mutants. This structure provides detailed insight into the mechanism of HeV and NiV neutralization by m102.4, and serves as a blueprint for further optimization of m102.4 as a therapeutic agent and for the development of entry inhibitors and vaccines.

  7. An Introduction to Music Therapy: Theory and Practice. Third Edition

    Science.gov (United States)

    Davis, William B.; Gfeller, Kate E.; Thaut, Michael H.

    2008-01-01

    "An Introduction to Music Therapy: Theory and Practice, Third Edition," provides a comprehensive overview of the practice of music therapy for the 21st century. It looks at where we have been, where we are today, and where we might be in the future. Combining sound pedagogy with recent research findings, this new edition has been updated and…

  8. DJ Prinsloo and BP Sathekge (compil- ers — revised edition).

    African Journals Online (AJOL)

    The compilers of this new edition have successfully highlighted the important additions to the last edition of the dictionary. It is important to inform pro- spective users about new information. It is also a marketing strategy to announce the contents of a new product in both the preface and at the back of the cover page, as is the ...

  9. Foundations of Psychological Testing: A Practical Approach. Second Edition

    Science.gov (United States)

    McIntire, Sandra A.; Miller, Leslie A.

    2006-01-01

    The second edition of "Foundations of Psychological Testing: A Practical Approach" is a text for undergraduate students new to the field of psychological testing. Using a conversational format, the authors aim to prepare students to be informed consumers as test users or test takers. Features new to the second edition include: (1) New Content; (2)…

  10. Genome editing: progress and challenges for medical applications

    Directory of Open Access Journals (Sweden)

    Dana Carroll

    2016-11-01

    Full Text Available Editorial summary The development of the CRISPR-Cas platform for genome editing has greatly simplified the process of making targeted genetic modifications. Applications of genome editing are expected to have a substantial impact on human therapies through the development of better animal models, new target discovery, and direct therapeutic intervention.

  11. A SANE approach to annotation in the digital edition

    NARCIS (Netherlands)

    Boot, P.; Braungart, Georg; Jannidis, Fotis; Gendolla, Peter

    2007-01-01

    Robinson and others have recently called for dynamic and collaborative digital scholarly editions. Annotation is a key component for editions that are not merely passive, read-only repositories of knowledge. Annotation facilities (both annotation creation and display), however, require complex

  12. Content Area Literacy: An Integrated Approach. Sixth Edition.

    Science.gov (United States)

    Readence, John E.; Bean, Thomas W.; Baldwin, R. Scott

    The sixth edition of this book presents preservice and inservice teachers with theory and related teaching strategies designed to assist middle and secondary students in reading and learning from their textbooks, and this edition seeks to integrate the current state of the art with some personal ideas. It includes a CD-ROM Digital Supplement which…

  13. Environmental Restoration and Waste Management: An Introduction. Student Edition.

    Science.gov (United States)

    Department of Energy, Washington, DC.

    This technical document focuses on the Department of Energy's (DOE) efforts to restore the environment and manage nuclear waste. This student edition was rewritten and edited by a team of high school students in order to make it "user-friendly" for high school students and the general public. The document focuses on the efforts of the…

  14. Dead links, vaporcuts, and creativity in fan edit replication

    Directory of Open Access Journals (Sweden)

    Joshua Wille

    2015-09-01

    Full Text Available In my examination of a Star Wars prequel trilogy fan edit reportedly made by Topher Grace, I introduce the term vaporcut to describe fan edits with reputations that may generate critical discourse but that are not publicly released. I explore the ways some fan editors attempt to recreate intangible projects but inevitably produce variant works that reflect their own creative perspectives.

  15. Human Embryo Editing: Opportunities and Importance of Transnational Cooperation.

    Science.gov (United States)

    Pei, Duanqing; Beier, David W; Levy-Lahad, Ephrat; Marchant, Gary; Rossant, Janet; Izpisua Belmonte, Juan Carlos; Lovell-Badge, Robin; Jaenisch, Rudolf; Charo, Alta; Baltimore, David

    2017-10-05

    A recent National Academies report articulates a path forward for research, ethics, and governance of clinical applications involving genome editing. In light of recent human embryo editing developments, scientists and stakeholders from all nations should cooperate to take advantage of this historic opportunity for medicine and also basic human biology. Copyright © 2017 Elsevier Inc. All rights reserved.

  16. Recollection Rejection: How Children Edit Their False Memories.

    Science.gov (United States)

    Brainerd, C. J.; Reyna, V. F.

    2002-01-01

    Presents new measure of children's use of an editing operation that suppresses false memories by accessing verbatim traces of true events. Application of the methodology showed that false-memory editing increased dramatically between early and middle childhood. Measure reacted appropriately to experimental manipulations. Developmental reductions…

  17. Qualitative Data Analysis: A Methods Sourcebook. Third Edition

    Science.gov (United States)

    Miles, Matthew B.; Huberman, A. Michael; Saldana, Johnny

    2014-01-01

    The Third Edition of Miles & Huberman's classic research methods text is updated and streamlined by Johnny Saldaña, author of "The Coding Manual for Qualitative Researchers." Several of the data display strategies from previous editions are now presented in re-envisioned and reorganized formats to enhance reader accessibility and…

  18. Genome editing: the breakthrough technology for inherited retinal disease?

    Science.gov (United States)

    Smith, Andrew J; Carter, Stephen P; Kennedy, Breandán N

    2017-10-01

    Genetic alterations resulting in a dysfunctional retinal pigment epithelium and/or degenerating photoreceptors cause impaired vision. These juxtaposed cells in the retina of the posterior eye are crucial for the visual cycle or phototransduction. Deficits in these biochemical processes perturb neural processing of images capturing the external environment. Notably, there is a distinct lack of clinically approved pharmacological, cell- or gene-based therapies for inherited retinal disease. Gene editing technologies are rapidly advancing as a realistic therapeutic option. Areas covered: Recent discovery of endonuclease-mediated gene editing technologies has culminated in a surge of investigations into their therapeutic potential. In this review, the authors discuss gene editing technologies and their applicability in treating inherited retinal diseases, the limitations of the technology and the research obstacles to overcome before editing a patient's genome becomes a viable treatment option. Expert opinion: The ability to strategically edit a patient's genome constitutes a treatment revolution. However, concerns remain over the safety and efficacy of either transplanting iPSC-derived retinal cells following ex vivo gene editing, or with direct gene editing in vivo. Ultimately, further refinements to improve efficacy and safety profiles are paramount for gene editing to emerge as a widely available treatment option.

  19. A Minimal Cognitive Model for Translating and Post-editing

    DEFF Research Database (Denmark)

    Schaeffer, Moritz; Carl, Michael

    2017-01-01

    This study investigates the coordination of reading (input) and writing (output) activities in from-scratch translation and post-editing. We segment logged eye movements and keylogging data into minimal units of reading and writing activity and model the process of post-editing and from-scratch...

  20. Introduction to Educational Administration: Standards, Theories, and Practice. Second Edition

    Science.gov (United States)

    Fiore, Douglas J.

    2009-01-01

    Organized around the ISLLC standards, this text introduces students to the concepts and theories of educational leadership. The new edition adds coverage of such topics as data usage, ethics, innovative hiring practices, and student discipline. Appearing in the second edition are chapter-ending sections called "Point-Counterpoint" which prompt…

  1. Towards the professionalisation of editing in South Africa | Law ...

    African Journals Online (AJOL)

    Towards the professionalisation of editing in South Africa. Melanie Ann Law, Haidee Kruger. Abstract. In South Africa, the professional status of editors remains largely undefined. In certain industries, such as the publishing industry, editing is regarded as a professional activity, requiring well-defined, high-level skills linked ...

  2. Lectin-Dependent Enhancement of Ebola Virus Infection via Soluble and Transmembrane C-type Lectin Receptors

    Science.gov (United States)

    Lear, Calli; Chen, Li; Yantosca, L. Michael; Scully, Corinne; Sarraju, Ashish; Sokolovska, Anna; Zariffard, M. Reza; Eisen, Damon P.; Mungall, Bruce A.; Kotton, Darrell N.; Omari, Amel; Huang, I-Chueh; Farzan, Michael; Takahashi, Kazue; Stuart, Lynda; Stahl, Gregory L.; Ezekowitz, Alan B.; Spear, Gregory T.; Olinger, Gene G.; Schmidt, Emmett V.; Michelow, Ian C.

    2013-01-01

    Mannose-binding lectin (MBL) is a key soluble effector of the innate immune system that recognizes pathogen-specific surface glycans. Surprisingly, low-producing MBL genetic variants that may predispose children and immunocompromised individuals to infectious diseases are more common than would be expected in human populations. Since certain immune defense molecules, such as immunoglobulins, can be exploited by invasive pathogens, we hypothesized that MBL might also enhance infections in some circumstances. Consequently, the low and intermediate MBL levels commonly found in human populations might be the result of balancing selection. Using model infection systems with pseudotyped and authentic glycosylated viruses, we demonstrated that MBL indeed enhances infection of Ebola, Hendra, Nipah and West Nile viruses in low complement conditions. Mechanistic studies with Ebola virus (EBOV) glycoprotein pseudotyped lentiviruses confirmed that MBL binds to N-linked glycan epitopes on viral surfaces in a specific manner via the MBL carbohydrate recognition domain, which is necessary for enhanced infection. MBL mediates lipid-raft-dependent macropinocytosis of EBOV via a pathway that appears to require less actin or early endosomal processing compared with the filovirus canonical endocytic pathway. Using a validated RNA interference screen, we identified C1QBP (gC1qR) as a candidate surface receptor that mediates MBL-dependent enhancement of EBOV infection. We also identified dectin-2 (CLEC6A) as a potentially novel candidate attachment factor for EBOV. Our findings support the concept of an innate immune haplotype that represents critical interactions between MBL and complement component C4 genes and that may modify susceptibility or resistance to certain glycosylated pathogens. Therefore, higher levels of native or exogenous MBL could be deleterious in the setting of relative hypocomplementemia which can occur genetically or because of immunodepletion during active

  3. Lectin-dependent enhancement of Ebola virus infection via soluble and transmembrane C-type lectin receptors.

    Directory of Open Access Journals (Sweden)

    Matthew Brudner

    Full Text Available Mannose-binding lectin (MBL is a key soluble effector of the innate immune system that recognizes pathogen-specific surface glycans. Surprisingly, low-producing MBL genetic variants that may predispose children and immunocompromised individuals to infectious diseases are more common than would be expected in human populations. Since certain immune defense molecules, such as immunoglobulins, can be exploited by invasive pathogens, we hypothesized that MBL might also enhance infections in some circumstances. Consequently, the low and intermediate MBL levels commonly found in human populations might be the result of balancing selection. Using model infection systems with pseudotyped and authentic glycosylated viruses, we demonstrated that MBL indeed enhances infection of Ebola, Hendra, Nipah and West Nile viruses in low complement conditions. Mechanistic studies with Ebola virus (EBOV glycoprotein pseudotyped lentiviruses confirmed that MBL binds to N-linked glycan epitopes on viral surfaces in a specific manner via the MBL carbohydrate recognition domain, which is necessary for enhanced infection. MBL mediates lipid-raft-dependent macropinocytosis of EBOV via a pathway that appears to require less actin or early endosomal processing compared with the filovirus canonical endocytic pathway. Using a validated RNA interference screen, we identified C1QBP (gC1qR as a candidate surface receptor that mediates MBL-dependent enhancement of EBOV infection. We also identified dectin-2 (CLEC6A as a potentially novel candidate attachment factor for EBOV. Our findings support the concept of an innate immune haplotype that represents critical interactions between MBL and complement component C4 genes and that may modify susceptibility or resistance to certain glycosylated pathogens. Therefore, higher levels of native or exogenous MBL could be deleterious in the setting of relative hypocomplementemia which can occur genetically or because of immunodepletion

  4. Viruses of hyperthermophilic Crenarchaea

    DEFF Research Database (Denmark)

    Prangishvili, D.; Garrett, R. A.

    2005-01-01

    , when one examines the archaeal viruses, the picture appears complex. Most viruses that are known to infect members of the kingdom Euryarchaeota resemble bacterial viruses, whereas those associated with the kingdom Crenarchaeota show little resemblance to either bacterial or eukaryal viruses....... This review summarizes our current knowledge of this group of exceptional and highly diverse archaeal viruses....

  5. Molecular Diversity through RNA Editing: A Balancing Act

    Science.gov (United States)

    Farajollahi, Sanaz; Maas, Stefan

    2010-01-01

    RNA editing by adenosine deamination fuels the generation of RNA and protein diversity in eukaryotes, particularly in higher organisms. This includes the recoding of translated exons, widespread editing of retrotransposon-derived repeat elements and sequence modification of miRNA transcripts. Such changes can bring about specific amino acid substitutions, alternative splicing and changes in gene expression levels. Although the overall prevalence of A-to-I editing and its specific functional impact on many of the affected genes are not yet known, the importance of balancing RNA modification levels across time and space is becoming increasingly evident. In particular, transcriptome instabilities in form of too much or too little RNA editing activity, or misguided editing manifest in several human disease phenotypes which disrupt that balance. PMID:20395010

  6. Genome Editing Gene Therapy for Duchenne Muscular Dystrophy.

    Science.gov (United States)

    Hotta, Akitsu

    2015-09-22

    Duchenne muscular dystrophy (DMD) is a severe genetic disorder caused by loss of function of the dystrophin gene on the X chromosome. Gene augmentation of dystrophin is challenging due to the large size of the dystrophin cDNA. Emerging genome editing technologies, such as TALEN and CRISPR-Cas9 systems, open a new erain the restoration of functional dystrophin and are a hallmark of bona fide gene therapy. In this review, we summarize current genome editing approaches, properties of target cell types for ex vivo gene therapy, and perspectives of in vivo gene therapy including genome editing in human zygotes. Although technical challenges, such as efficacy, accuracy, and delivery of the genome editing components, remain to be further improved, yet genome editing technologies offer a new avenue for the gene therapy of DMD.

  7. Genome Editing Redefines Precision Medicine in the Cardiovascular Field

    Directory of Open Access Journals (Sweden)

    Elda Dzilic

    2018-01-01

    Full Text Available Genome editing is a powerful tool to study the function of specific genes and proteins important for development or disease. Recent technologies, especially CRISPR/Cas9 which is characterized by convenient handling and high precision, revolutionized the field of genome editing. Such tools have enormous potential for basic science as well as for regenerative medicine. Nevertheless, there are still several hurdles that have to be overcome, but patient-tailored therapies, termed precision medicine, seem to be within reach. In this review, we focus on the achievements and limitations of genome editing in the cardiovascular field. We explore different areas of cardiac research and highlight the most important developments: (1 the potential of genome editing in human pluripotent stem cells in basic research for disease modelling, drug screening, or reprogramming approaches and (2 the potential and remaining challenges of genome editing for regenerative therapies. Finally, we discuss social and ethical implications of these new technologies.

  8. Genome Editing for the Study of Cardiovascular Diseases.

    Science.gov (United States)

    Chadwick, Alexandra C; Musunuru, Kiran

    2017-03-01

    The opportunities afforded through the recent advent of genome-editing technologies have allowed investigators to more easily study a number of diseases. The advantages and limitations of the most prominent genome-editing technologies are described in this review, along with potential applications specifically focused on cardiovascular diseases. The recent genome-editing tools using programmable nucleases, such as zinc-finger nucleases, transcription activator-like effector nucleases, and clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated 9 (Cas9), have rapidly been adapted to manipulate genes in a variety of cellular and animal models. A number of recent cardiovascular disease-related publications report cases in which specific mutations are introduced into disease models for functional characterization and for testing of therapeutic strategies. Recent advances in genome-editing technologies offer new approaches to understand and treat diseases. Here, we discuss genome editing strategies to easily characterize naturally occurring mutations and offer strategies with potential clinical relevance.

  9. Germline genome-editing research and its socioethical implications.

    Science.gov (United States)

    Ishii, Tetsuya

    2015-08-01

    Genetically modifying eggs, sperm, and zygotes ('germline' modification) can impact on the entire body of the resulting individual and on subsequent generations. With the advent of genome-editing technology, human germline gene modification is no longer theoretical. Owing to increasing concerns about human germline gene modification, a voluntary moratorium on human genome-editing research and/or the clinical application of human germline genome editing has recently been called for. However, whether such research should be suspended or encouraged warrants careful consideration. The present article reviews recent research on mammalian germline genome editing, discusses the importance of public dialogue on the socioethical implications of human germline genome-editing research, and considers the relevant guidelines and legislation in different countries. Copyright © 2015 Elsevier Ltd. All rights reserved.

  10. The ethics of creating genetically modified children using genome editing.

    Science.gov (United States)

    Ishii, Tetsuya

    2017-12-01

    To review the recent ethical, legal, and social issues surrounding human reproduction involving germline genome editing. Genome editing techniques, such as CRISPR/Cas9, have facilitated genetic modification in human embryos. The most likely purpose of germline genome editing is the prevention of serious genetic disease in offspring. However, complex issues still remain, including irremediable risks to fetuses and future generations, the role of women, the availability of alternatives, long-term follow-up, health insurance coverage, misuse for human enhancement, and the potential effects on adoption. Further discussions, a broad consensus, and appropriate regulations are required before human germline genome editing is introduced into the global society. Before germline genome editing is used for disease prevention, a broad consensus must be formed by carefully discussing its ethical, legal, and social issues.

  11. Quantifying on- and off-target genome editing.

    Science.gov (United States)

    Hendel, Ayal; Fine, Eli J; Bao, Gang; Porteus, Matthew H

    2015-02-01

    Genome editing with engineered nucleases is a rapidly growing field thanks to transformative technologies that allow researchers to precisely alter genomes for numerous applications including basic research, biotechnology, and human gene therapy. While the ability to make precise and controlled changes at specified sites throughout the genome has grown tremendously in recent years, we still lack a comprehensive and standardized battery of assays for measuring the different genome editing outcomes created at endogenous genomic loci. Here we review the existing assays for quantifying on- and off-target genome editing and describe their utility in advancing the technology. We also highlight unmet assay needs for quantifying on- and off-target genome editing outcomes and discuss their importance for the genome editing field. Copyright © 2014 Elsevier Ltd. All rights reserved.

  12. An Era of CRISPR/ Cas9 Mediated Plant Genome Editing.

    Science.gov (United States)

    Khurshid, Haris; Jan, Sohail Ahmad; Shinwari, Zabta Khan; Jamal, Muhammad; Shah, Sabir Hussain

    2018-01-01

    Recently the engineered nucleases have revolutionized genome editing to perturb gene expression at specific sites in complex eukaryotic genomes. Three important classes of these genome editing tools are Moreover, the more recent type II Clustered Regularly Inter-spaced Short Palindromic Repeats/Crispr associated protein (CRISPR/Cas9) system has become the most favorite plant genome editing tool for its precision and RNA based specificity unlike its counterparts which rely on protein based specificity. Plasmid-mediated co-delivery of multiple sgRNAs and Cas9 to the Plant cell can simultaneously alter more than one target loci which enable multiplex genome editing. In this review, we discuss recent advancements in the CRISPR/ Cas9 technology mechanism, theory and its applications in plants and agriculture. We also suggest that the CRISPR/ Cas9 as an effective genome editing tool, has vast potential for crop improvement and studying gene regulation mechanism and chromatin remodeling.

  13. Genome editing: intellectual property and product development in plant biotechnology.

    Science.gov (United States)

    Schinkel, Helga; Schillberg, Stefan

    2016-07-01

    Genome editing is a revolutionary technology in molecular biology. While scientists are fascinated with the unlimited possibilities provided by directed and controlled changes in DNA in eukaryotes and have eagerly adopted such tools for their own experiments, an understanding of the intellectual property (IP) implications involved in bringing genome editing-derived products to market is often lacking. Due to the ingenuity of genome editing, the time between new product conception and its actual existence can be relatively short; therefore knowledge about IP of the various genome editing methods is relevant. This point must be regarded in a national framework as patents are instituted nationally. Therefore, when designing scientific work that could lead to a product, it is worthwhile to consider the different methods used for genome editing not only for their scientific merits but also for their compatibility with a speedy and reliable launch into the desired market.

  14. IJMBR ARTHRITIS edited 4.3.1

    African Journals Online (AJOL)

    MJP

    2015-10-28

    Oct 28, 2015 ... various pathogens most commonly caused by a variety of bacteria. However, viruses, mycobacteria, ... [3] Salmonella typhi and Klebsiella spp are also implicated especially in sickle cell disease. ... The signs and symptoms of septic arthritis include joint pain, swelling and soreness with joint immobility; fever ...

  15. Genome editing in pluripotent stem cells: research and therapeutic applications

    Energy Technology Data Exchange (ETDEWEB)

    Deleidi, Michela, E-mail: michela.deleidi@dzne.de [German Center for Neurodegenerative Diseases (DZNE) Tübingen within the Helmholtz Association, Tübingen (Germany); Hertie Institute for Clinical Brain Research, University of Tübingen (Germany); Yu, Cong [Department of Microbiology and Immunology, School of Medicine and Biomedical Sciences, University at Buffalo, New York (United States)

    2016-05-06

    Recent progress in human pluripotent stem cell (hPSC) and genome editing technologies has opened up new avenues for the investigation of human biology in health and disease as well as the development of therapeutic applications. Gene editing approaches with programmable nucleases have been successfully established in hPSCs and applied to study gene function, develop novel animal models and perform genetic and chemical screens. Several studies now show the successful editing of disease-linked alleles in somatic and patient-derived induced pluripotent stem cells (iPSCs) as well as in animal models. Importantly, initial clinical trials have shown the safety of programmable nucleases for ex vivo somatic gene therapy. In this context, the unlimited proliferation potential and the pluripotent properties of iPSCs may offer advantages for gene targeting approaches. However, many technical and safety issues still need to be addressed before genome-edited iPSCs are translated into the clinical setting. Here, we provide an overview of the available genome editing systems and discuss opportunities and perspectives for their application in basic research and clinical practice, with a particular focus on hPSC based research and gene therapy approaches. Finally, we discuss recent research on human germline genome editing and its social and ethical implications. - Highlights: • Programmable nucleases have proven efficient and specific for genome editing in human pluripotent stem cells (hPSCs). • Genome edited hPSCs can be employed to study gene function in health and disease as well as drug and chemical screens. • Genome edited hPSCs hold great promise for ex vivo gene therapy approaches. • Technical and safety issues should be first addressed to advance the clinical use of gene-edited hPSCs.

  16. Genome editing in pluripotent stem cells: research and therapeutic applications

    International Nuclear Information System (INIS)

    Deleidi, Michela; Yu, Cong

    2016-01-01

    Recent progress in human pluripotent stem cell (hPSC) and genome editing technologies has opened up new avenues for the investigation of human biology in health and disease as well as the development of therapeutic applications. Gene editing approaches with programmable nucleases have been successfully established in hPSCs and applied to study gene function, develop novel animal models and perform genetic and chemical screens. Several studies now show the successful editing of disease-linked alleles in somatic and patient-derived induced pluripotent stem cells (iPSCs) as well as in animal models. Importantly, initial clinical trials have shown the safety of programmable nucleases for ex vivo somatic gene therapy. In this context, the unlimited proliferation potential and the pluripotent properties of iPSCs may offer advantages for gene targeting approaches. However, many technical and safety issues still need to be addressed before genome-edited iPSCs are translated into the clinical setting. Here, we provide an overview of the available genome editing systems and discuss opportunities and perspectives for their application in basic research and clinical practice, with a particular focus on hPSC based research and gene therapy approaches. Finally, we discuss recent research on human germline genome editing and its social and ethical implications. - Highlights: • Programmable nucleases have proven efficient and specific for genome editing in human pluripotent stem cells (hPSCs). • Genome edited hPSCs can be employed to study gene function in health and disease as well as drug and chemical screens. • Genome edited hPSCs hold great promise for ex vivo gene therapy approaches. • Technical and safety issues should be first addressed to advance the clinical use of gene-edited hPSCs.

  17. Basic Wiring. Fourth Edition. Teacher Edition [and] Student Guide [and] Student Workbook 1 [and] Student Workbook 2.

    Science.gov (United States)

    Kaltwasser, Stan; Flowers, Gary; Blasingame, Don

    Basic Wiring, first in a series of three wiring publications, serves as the foundation for students enrolled in a wiring program. It is a prerequisite to Commercial and Industrial Wiring or Residential Wiring. Instructional materials include a teacher edition, student guide, and two student workbooks. The teacher edition begins with introductory…

  18. Commercial and Industrial Wiring. Fourth Edition. Teacher Edition [and] Student Guide [and] Student Workbook 1 [and] Student Workbook 2.

    Science.gov (United States)

    Kaltwasser, Stan; Flowers, Gary

    Commercial and Industrial Wiring, third in a series of three wiring publications, includes the additional technical knowledge and applications required for job entry in the commercial and industrial wiring trade. Instructional materials include a teacher edition, student guide, and two student workbooks. The teacher edition begins with…

  19. From engineering to editing the rat genome.

    Science.gov (United States)

    Meek, Stephen; Mashimo, Tomoji; Burdon, Tom

    2017-08-01

    Since its domestication over 100 years ago, the laboratory rat has been the preferred experimental animal in many areas of biomedical research (Lindsey and Baker The laboratory rat. Academic, New York, pp 1-52, 2006). Its physiology, size, genetics, reproductive cycle, cognitive and behavioural characteristics have made it a particularly useful animal model for studying many human disorders and diseases. Indeed, through selective breeding programmes numerous strains have been derived that are now the mainstay of research on hypertension, obesity and neurobiology (Okamoto and Aoki Jpn Circ J 27:282-293, 1963; Zucker and Zucker J Hered 52(6):275-278, 1961). Despite this wealth of genetic and phenotypic diversity, the ability to manipulate and interrogate the genetic basis of existing phenotypes in rat strains and the methodology to generate new rat models has lagged significantly behind the advances made with its close cousin, the laboratory mouse. However, recent technical developments in stem cell biology and genetic engineering have again brought the rat to the forefront of biomedical studies and enabled researchers to exploit the increasingly accessible wealth of genome sequence information. In this review, we will describe how a breakthrough in understanding the molecular basis of self-renewal of the pluripotent founder cells of the mammalian embryo, embryonic stem (ES) cells, enabled the derivation of rat ES cells and their application in transgenesis. We will also describe the remarkable progress that has been made in the development of gene editing enzymes that enable the generation of transgenic rats directly through targeted genetic modifications in the genomes of zygotes. The simplicity, efficiency and cost-effectiveness of the CRISPR/Cas gene editing system, in particular, mean that the ability to engineer the rat genome is no longer a limiting factor. The selection of suitable targets and gene modifications will now become a priority: a challenge where

  20. A Generic Quantitative Risk Assessment Framework for the Entry of Bat-Borne Zoonotic Viruses into the European Union.

    Directory of Open Access Journals (Sweden)

    Robin R L Simons

    Full Text Available Bat-borne viruses have been linked to a number of zoonotic diseases; in 2014 there have been human cases of Nipah virus (NiV in Bangladesh and Ebola virus in West and Central Africa. Here we describe a model designed to provide initial quantitative predictions of the risk of entry of such viruses to European Union (EU Member States (MSs through four routes: human travel, legal trade (e.g. fruit and animal products, live animal movements and illegal importation of bushmeat. The model utilises available datasets to assess the movement via these routes between individual countries of the world and EU MSs. These data are combined with virus specific data to assess the relative risk of entry between EU MSs. As a case study, the model was parameterised for NiV. Scenario analyses showed that the selection of exporting countries with NiV and potentially contaminated trade products were essential to the accuracy of all model outputs. Uncertainty analyses of other model parameters identified that the model expected number of years to an introduction event within the EU was highly susceptible to the prevalence of NiV in bats. The relative rankings of the MSs and routes, however, were more robust. The UK, the Netherlands and Germany were consistently the most likely points of entry and the ranking of most MSs varied by no more than three places (maximum variation five places. Legal trade was consistently the most likely route of entry, only falling below human travel when the estimate of the prevalence of NiV in bats was particularly low. Any model-based calculation is dependent on the data available to feed into the model and there are distinct gaps in our knowledge, particularly in regard to various pathogen/virus as well as host/bat characteristics. However, the strengths of this model lie in the provision of relative comparisons of risk among routes and MSs. The potential for expansion of the model to include other routes and viruses and the possibility

  1. A Generic Quantitative Risk Assessment Framework for the Entry of Bat-Borne Zoonotic Viruses into the European Union.

    Science.gov (United States)

    Simons, Robin R L; Horigan, Verity; Gale, Paul; Kosmider, Rowena D; Breed, Andrew C; Snary, Emma L

    2016-01-01

    Bat-borne viruses have been linked to a number of zoonotic diseases; in 2014 there have been human cases of Nipah virus (NiV) in Bangladesh and Ebola virus in West and Central Africa. Here we describe a model designed to provide initial quantitative predictions of the risk of entry of such viruses to European Union (EU) Member States (MSs) through four routes: human travel, legal trade (e.g. fruit and animal products), live animal movements and illegal importation of bushmeat. The model utilises available datasets to assess the movement via these routes between individual countries of the world and EU MSs. These data are combined with virus specific data to assess the relative risk of entry between EU MSs. As a case study, the model was parameterised for NiV. Scenario analyses showed that the selection of exporting countries with NiV and potentially contaminated trade products were essential to the accuracy of all model outputs. Uncertainty analyses of other model parameters identified that the model expected number of years to an introduction event within the EU was highly susceptible to the prevalence of NiV in bats. The relative rankings of the MSs and routes, however, were more robust. The UK, the Netherlands and Germany were consistently the most likely points of entry and the ranking of most MSs varied by no more than three places (maximum variation five places). Legal trade was consistently the most likely route of entry, only falling below human travel when the estimate of the prevalence of NiV in bats was particularly low. Any model-based calculation is dependent on the data available to feed into the model and there are distinct gaps in our knowledge, particularly in regard to various pathogen/virus as well as host/bat characteristics. However, the strengths of this model lie in the provision of relative comparisons of risk among routes and MSs. The potential for expansion of the model to include other routes and viruses and the possibility of rapid

  2. INES: The International Nuclear and Radiological Event Scale User's Manual. 2008 Edition (Spanish Edition)

    International Nuclear Information System (INIS)

    2010-11-01

    INES, the International Nuclear and Radiological Event Scale, was developed in 1990 by experts convened by the IAEA and the OECD Nuclear Energy Agency with the aim of communicating the safety significance of events. This edition of the INES User?s Manual is designed to facilitate the task of those who are required to rate the safety significance of events using the scale. It includes additional guidance and clarifications, and provides examples and comments on the continued use of INES. With this new edition, it is anticipated that INES will be widely used by Member States and become the worldwide scale for putting into proper perspective the safety significance of any event associated with the transport, storage and use of radioactive material and radiation sources, whether or not the event occurs at a facility.

  3. INES: The International Nuclear and Radiological Event Scale User's Manual. 2008 Edition (Chinese Edition)

    International Nuclear Information System (INIS)

    2012-01-01

    INES, the International Nuclear and Radiological Event Scale, was developed in 1990 by experts convened by the IAEA and the OECD Nuclear Energy Agency with the aim of communicating the safety significance of events. This edition of the INES User's Manual is designed to facilitate the task of those who are required to rate the safety significance of events using the scale. It includes additional guidance and clarifications, and provides examples and comments on the continued use of INES. With this new edition, it is anticipated that INES will be widely used by Member States and become the worldwide scale for putting into proper perspective the safety significance of any event associated with the transport, storage and use of radioactive material and radiation sources, whether or not the event occurs at a facility.

  4. NEW APPROACHES IN TEXTUAL EDITING. A SELECTION OF ELECTRONIC EDITIONS UNDER ANALYSIS

    Directory of Open Access Journals (Sweden)

    Isabel De la Cruz

    2005-12-01

    Full Text Available In the present article, we make an approach to the world of digital editions available in electronic format. Using as a starting point Professor González Fernández-Corugedo's classification of some of the best web pages related to the topic (available at http://www.uniovi.es/HELL/Hyptxed.html we have examined the design and contents of some sites that deal with texts mainly in Old and Middle English. The readers are offered an outline of what they are expected to find in every page, highlighting their main virtues and shortcomings. As a result of the analysis of al1 these pages we are ready to propose certain steps necessary in the elaboration of a 'good' electronic edition.

  5. INES: The International Nuclear and Radiological Event Scale User's Manual. 2008 Edition (French Edition)

    International Nuclear Information System (INIS)

    2011-01-01

    INES, the International Nuclear and Radiological Event Scale, was developed in 1990 by experts convened by the IAEA and the OECD Nuclear Energy Agency with the aim of communicating the safety significance of events. This edition of the INES User?s Manual is designed to facilitate the task of those who are required to rate the safety significance of events using the scale. It includes additional guidance and clarifications, and provides examples and comments on the continued use of INES. With this new edition, it is anticipated that INES will be widely used by Member States and become the worldwide scale for putting into proper perspective the safety significance of any event associated with the transport, storage and use of radioactive material and radiation sources, whether or not the event occurs at a facility.

  6. Engineering Molecular Immunity Against Plant Viruses

    KAUST Repository

    Zaidi, Syed Shan-e-Ali

    2017-04-26

    Genomic engineering has been used to precisely alter eukaryotic genomes at the single-base level for targeted gene editing, replacement, fusion, and mutagenesis, and plant viruses such as Tobacco rattle virus have been developed into efficient vectors for delivering genome-engineering reagents. In addition to altering the host genome, these methods can target pathogens to engineer molecular immunity. Indeed, recent studies have shown that clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated 9 (Cas9) systems that target the genomes of DNA viruses can interfere with viral activity and limit viral symptoms in planta, demonstrating the utility of this system for engineering molecular immunity in plants. CRISPR/Cas9 can efficiently target single and multiple viral infections and confer plant immunity. Here, we discuss the use of site-specific nucleases to engineer molecular immunity against DNA and RNA viruses in plants. We also explore how to address the potential challenges encountered when producing plants with engineered resistance to single and mixed viral infections.

  7. Zika Virus and Pregnancy

    Medline Plus

    Full Text Available ... Education & Events Advocacy For Patients About ACOG Zika Virus and Pregnancy Home For Patients Zika Virus and ... Education Pamphlets - Spanish Share: PEV002, September 2016 Zika Virus and Pregnancy There are risks to your fetus ...

  8. Zika Virus and Pregnancy

    Medline Plus

    Full Text Available ... Advocacy For Patients About ACOG Zika Virus and Pregnancy Home For Patients Zika Virus and Pregnancy Page ... Spanish Share: PEV002, September 2016 Zika Virus and Pregnancy There are risks to your fetus if you ...

  9. Zika Virus and Pregnancy

    Medline Plus

    Full Text Available ... Management Education & Events Advocacy For Patients About ACOG Zika Virus and Pregnancy Home For Patients Zika Virus and ... Patient Education Pamphlets - Spanish Share: PEV002, September 2016 Zika Virus and Pregnancy There are risks to your fetus ...

  10. Zika Virus and Pregnancy

    Science.gov (United States)

    ... Management Education & Events Advocacy For Patients About ACOG Zika Virus and Pregnancy Home For Patients Zika Virus and ... Patient Education Pamphlets - Spanish Share: PEV002, September 2016 Zika Virus and Pregnancy There are risks to your fetus ...

  11. Zika Virus and Pregnancy

    Medline Plus

    Full Text Available ... Management Education & Events Advocacy For Patients About ACOG Zika Virus and Pregnancy Home For Patients Zika Virus ... Patient Education Pamphlets - Spanish Share: PEV002, September 2016 Zika Virus and Pregnancy There are risks to your ...

  12. Computer Viruses: An Overview.

    Science.gov (United States)

    Marmion, Dan

    1990-01-01

    Discusses the early history and current proliferation of computer viruses that occur on Macintosh and DOS personal computers, mentions virus detection programs, and offers suggestions for how libraries can protect themselves and their users from damage by computer viruses. (LRW)

  13. The Effects of Nuclear Weapons. Third edition

    Energy Technology Data Exchange (ETDEWEB)

    Glasstone, S; Dolan, P J

    1977-01-01

    Since the last edition of ''The Effects of Nuclear Weapons'' in 1962 much new information has become available concerning nuclear weapon effects. This has come in part from the series of atmospheric tests, including several at very high altitudes, conducted in the Pacific Ocean area in 1962. In addition, laboratory studies, theoretical calculations, and computer simulations have provided a better understanding of the various effects. A new chapter has been added on the electromagnetic pulse. The chapter titles are as follows: general principles of nuclear explosions; descriptions of nuclear explosions; air blast phenomena in air and surface bursts; air blast loading; structural damage from air blast; shock effects of surface and subsurface bursts; thermal radiation and its effects; initial nuclear radiation; residual nuclear radiation and fallout; radio and radar effects; the electromagnetic pulse and its effects; and biological effects. (LTN)

  14. WYLBUR reference manual. [For interactive text editing

    Energy Technology Data Exchange (ETDEWEB)

    Krupp, R.F.; Messina, P.C.; Peavler, J.M.; Schustack, S.; Starai, T.

    1977-04-01

    WYLBUR is a system for manipulating various kinds of text, such as computer programs, manuscripts, letters, forms, articles, or reports. Its on-line interactive text-editing capabilities allow the user to create, change, and correct text, and to search and display it. WYLBUR also has facilities for job submission and retrieval from remote terminals that make it possible for a user to inquire about the status of any job in the system, cancel jobs that are executing or awaiting execution, reroute output, raise job priority, or get information on the backlog of batch jobs. WYLBUR also has excellent recovery capabilities and a fast response time. This manual describes the WYLBUR version currently used at ANL. It is intended primarily as a reference manual; thus, examples of WYLBUR commands are kept to a minimum. (RWR)

  15. Post-editing through Speech Recognition

    DEFF Research Database (Denmark)

    Mesa-Lao, Bartolomé

    . As a continuation of the pioneering work done in the SEECAT project, our presentation will report on a feasibility study where post-editor trainees will be asked to post-edit raw MT using voice and keyboard as an input method. This feasibility study will explore the potential of combining one of the most popular...... computer-aided translation workbenches in the market (i.e. MemoQ) together with one of the most well-known ASR packages (i.e. Dragon Naturally Speaking from Nuance). Two data correction modes will be considered: a) keyboard vs. b) keyboard and speech combined. These two different ways of verifying...... and correcting raw MT output will be examined making comparisons in terms of: i) overall time to complete the task, ii) final quality of the target text, and iii) user satisfaction....

  16. National solar energy education directory. Second edition

    Energy Technology Data Exchange (ETDEWEB)

    Corcoleotes, G; Cronin, S; Kramer, K; O& #x27; Connor, K

    1980-01-01

    The information contained in this directory is derived from responses to a national survey of educational institutions and organizations involved in solar energy educational activities beyond the secondary school level. Phone calls and follow-up mail requests were used to gather additional information when necessary. Every survey instrument was read, coded, and edited before entry into the data base from which this directory was produced. The Directory is organized alphabetically by state. Institutions and organizations within each state are categorized according to type (Colleges and Universities, Junior/Community Colleges, Vocational/Technical Schools, and Other Educational Institutions and Organizations) and listed alphabetically within these categories. Within each institutional listing the amount of information provided will vary according to the completeness of the survey response received from that institution. (MHR)

  17. Invitation to number theory second edition

    CERN Document Server

    Ore, Oystein

    2017-01-01

    Number theory is the branch of mathematics concerned with the counting numbers, 1, 2, 3, … and their multiples and factors. Of particular importance are odd and even numbers, squares and cubes, and prime numbers. But in spite of their simplicity, you will meet a multitude of topics in this book: magic squares, cryptarithms, finding the day of the week for a given date, constructing regular polygons, pythagorean triples, and many more. In this revised edition, John Watkins and Robin Wilson have updated the text to bring it in line with contemporary developments. They have added new material on Fermat's Last Theorem, the role of computers in number theory, and the use of number theory in cryptography, and have made numerous minor changes in the presentation and layout of the text and the exercises.

  18. Flatland an edition with notes and commentary

    CERN Document Server

    Abbott, Edwin A; Banchoff, Thomas F

    2010-01-01

    Flatland, Edwin Abbott Abbott's story of a two-dimensional universe, as told by one of its inhabitants who is introduced to the mysteries of three-dimensional space, has enjoyed an enduring popularity from the time of its publication in 1884. This fully annotated edition enables the modern-day reader to understand and appreciate the many "dimensions" of this classic satire. Mathematical notes and illustrations enhance the usefulness of Flatland as an elementary introduction to higher-dimensional geometry. Historical notes show connections to late-Victorian England and to classical Greece. Citations from Abbott's other writings as well as the works of Plato and Aristotle serve to interpret the text. Commentary on language and literary style includes numerous definitions of obscure words. An appendix gives a comprehensive account of the life and work of Flatland's remarkable author.

  19. Atomic Energy Control Board vocabulary - preliminary edition

    International Nuclear Information System (INIS)

    Nolet, D.

    1995-09-01

    This preliminary edition was prepared at the Board's request to help it establish a standardized terminology. It was produced by scanning the 99 French and English documents listed at the end of this Vocabulary. The documents include legislation concerning atomic energy and the transportation of radioactive materials, as well as the Board's publications, such as the Consultative Documents, Regulatory Documents and Notices. The terms included from the following areas are: radiation protection, reactor technology, nuclear fuel cycle, radioactive material packaging and transportation, radioactive waste management, uranium mines, and medical and industrial applications of radioelements. Also included are the titles of publications and the names of organizations and units. The vocabulary contains 2,589 concepts, sometimes accompanied by definitions, contexts or usage examples. Where terms have been standardized by the Canadian Committee for the Standardization of Nuclear Terminology, this has been indicated. Where possible, we have verified the terms using the TERMIUM, the Government of Canada Linguistic Data Bank. (author)

  20. Observing Optional Number in DDC Edition 23

    Directory of Open Access Journals (Sweden)

    Mohamad Rotmianto

    2015-04-01

    Full Text Available Dewey Decimal Classification is a most popular classification system in the world because of its completeness and most up-to-date. There are many optional number in this classification system, although it rarely to be discussed even it is important to known well about that optional number, especially  for  a  librarian  as  classifier.  This  paper  is  a  literature  study  about  Dewey  Decimal Classification  Edition  23,  to  describe  about  optional  numbers,  particularly  the  number  in relationship with Indonesia’s subject and discipline. This paper is to avoid misunderstanding in interpreted about optional number among librarians, especially for who that does not understand well about optional numbers.

  1. TALE: a tale of genome editing.

    Science.gov (United States)

    Zhang, Mingjie; Wang, Feng; Li, Shifei; Wang, Yan; Bai, Yun; Xu, Xueqing

    2014-01-01

    Transcription activator-like effectors (TALEs), first identified in Xanthomonas bacteria, are naturally occurring or artificially designed proteins that modulate gene transcription. These proteins recognize and bind DNA sequences based on a variable numbers of tandem repeats. Each repeat is comprised of a set of ∼ 34 conserved amino acids; within this conserved domain, there are usually two amino acids that distinguish one TALE from another. Interestingly, TALEs have revealed a simple cipher for the one-to-one recognition of proteins for DNA bases. Synthetic TALEs have been used to successfully target genes in a variety of species, including humans. Depending on the type of functional domain that is fused to the TALE of interest, these proteins can have diverse biological effects. For example, after binding DNA, TALEs fused to transcriptional activation domains can function as robust transcription factors (TALE-TFs), while fused to restriction endonucleases (TALENs) can cut DNA. Targeted genome editing, in theory, is capable of modifying any endogenous gene sequence of interest; this can be performed in cells or organisms, and may be applied to clinical gene-based therapies in the future. With current technologies, highly accurate, specific, and reliable gene editing cannot be achieved. Thus, recognition and binding mechanisms governing TALE biology are currently hot research areas. In this review, we summarize the major advances in TALE technology over the past several years with a focus on the interaction between TALEs and DNA, TALE design and construction, potential applications for this technology, and unique characteristics that make TALEs superior to zinc finger endonucleases. Copyright © 2013 Elsevier Ltd. All rights reserved.

  2. Safety research plan, JFY 2013 edition

    International Nuclear Information System (INIS)

    2013-09-01

    As for the regulatory issues the governments or JNES considered necessary, JNES had updated every year 'safety research plan' in respective research areas necessary for solving the regulatory issues (safety research needs) and was conducting safety research to obtain the results, etc. 'Safety research plan, JFY 2013 Edition' was compiled aiming at promotion of appropriate reflection and flexible application of research achievements for tacking the regulatory issues taking account of importance and urgency dependent on trend of nuclear safety regulations as well as collective management of safety research and safety survey. 5 new research projects were established with 4 unified research projects and 6 terminated research projects. Finally modified safety research areas, subjects and research projects, JFY 2013 Edition were as follows: design review of nuclear power plant (7 subjects and each subject having several research projects totaled 19), control management of nuclear power plant (one subject having 4 research projects), nuclear fuel cycle (2 subjects and each subject having several research projects totaled 4), nuclear fuel cycle backend (2 subjects and each subject having several research projects totaled 5), nuclear emergency preparedness and response (3 subjects and each subject having several research projects totaled 7) and bases of nuclear safety technology (3 subjects and each subject having several research projects totaled 6). Safety reviews consisted of 6 projects in 3 areas extracting the regulatory issues. As for urgent research projects on the basis of the disaster at Fukushima Daiichi NPP accident, 7 research projects in 4 urgent subjects were as follows: examination for new safety regulation (4 research projects generalized in the above research projects), development of newly necessary evaluation methods (one research project generalized in the above research project), evaluation of the validity for the work for

  3. Country Nuclear Power Profiles - 2011 Edition

    International Nuclear Information System (INIS)

    2011-08-01

    The Country Nuclear Power Profiles compiles background information on the status and development of nuclear power programs in Member States. It consists of organizational and industrial aspects of nuclear power programs and provides information about the relevant legislative, regulatory, and international framework in each country. Its descriptive and statistical overview of the overall economic, energy, and electricity situation in each country, and its nuclear power framework is intended to serve as an integrated source of key background information about nuclear power programs in the world. The preparation of Country Nuclear Power Profiles (CNPP) was initiated in 1990s. It responded to a need for a database and a technical publication containing a description of the energy and economic situation, the energy and the electricity sector, and the primary organizations involved in nuclear power in IAEA Member States. This is the 2011 edition issued on CD-ROM and Web pages. It updates the country information for 50 countries. The CNPP is updated based on information voluntarily provided by participating IAEA Member States. Participants include the 29 countries that have operating nuclear power plants, as well as 21 countries having past or planned nuclear power programmes (Bangladesh, Belarus, Chile, Egypt, Ghana, Indonesia, the Islamic Republic of Iran, Italy, Jordan, Kazakhstan, Kuwait, Lithuania, Morocco, Nigeria, Philippines, Poland, Syrian Arab Republic, Thailand, Tunisia, Turkey and Vietnam). For the 2011 edition, 23 countries provided updated or new profiles. For the other countries, the IAEA updated the profile statistical tables on nuclear power, energy development, and economic indicators based on information from IAEA and World Bank databases.

  4. Country Nuclear Power Profiles - 2010 Edition

    International Nuclear Information System (INIS)

    2010-08-01

    The Country Nuclear Power Profiles compiles background information on the status and development of nuclear power programs in Member States. It consists of organizational and industrial aspects of nuclear power programs and provides information about the relevant legislative, regulatory, and international framework in each country. Its descriptive and statistical overview of the overall economic, energy, and electricity situation in each country, and its nuclear power framework is intended to serve as an integrated source of key background information about nuclear power programs in the world. The preparation of Country Nuclear Power Profiles (CNPP) was initiated in 1990s. It responded to a need for a database and a technical publication containing a description of the energy and economic situation, the energy and the electricity sector, and the primary organizations involved in nuclear power in IAEA Member States. This is the 2010 edition issued on CD-ROM and Web pages. It updates the country information for 48 countries. The CNPP is updated based on information voluntarily provided by participating IAEA Member States. Participants include the 29 countries that have operating nuclear power plants, as well as 19 countries having past or planned nuclear power programmes (Bangladesh, Belarus, Chile, Egypt, Ghana, Indonesia, the Islamic Republic of Iran, Italy, Jordan, Kazakhstan, Lithuania, Morocco, Nigeria, Philippines, Poland, Thailand, Tunisia, Turkey and Vietnam). For the 2010 edition, 24 countries provided updated or new profiles. For the other countries, the IAEA updated the profile statistical tables on nuclear power, energy development, and economic indicators based on information from IAEA and World Bank databases. The CNPP reports have been prepared by each Member State in accordance with the IAEA format. The IAEA is not responsible for the content of these reports

  5. Country Nuclear Power Profiles - 2007 Edition

    International Nuclear Information System (INIS)

    2008-01-01

    The preparation of Country Nuclear Power Profiles (CNPP) was initiated within the framework of the IAEA's programme on assessment and feedback of nuclear power plant performance. It responded to a need for a database and a technical publication containing a description of the energy and economic situation, the energy and the electricity sector, and the primary organizations involved in nuclear power in IAEA Member States. It covers background information on the status and development of nuclear power programmes in countries having nuclear plants in operation and/or plants under construction. This is the 2007 edition issued on CD-ROM and Web pages. It updates the country information, in general, to the end of 2006 for 39 countries. The CNPP is updated based on information voluntarily provided by participating IAEA Member States. Participants include the 30 countries that have operating nuclear power plants, as well as nine countries having past or planned nuclear power programmes (Bangladesh, Egypt, Indonesia, the Islamic Republic of Iran, Italy, Kazakhstan, Poland, Turkey, and Vietnam). For the 2007 edition, 21 countries provided information to the IAEA to update their profiles. For the 18 other countries, the IAEA updated the profile statistical tables on nuclear power, energy development, and economic indicators based on information from IAEA and World Bank databases. These 18 countries are Argentina, Belgium, Bulgaria, Canada, China, Egypt, Finland, Indonesia, Japan, Mexico, Netherlands, Poland, Romania, Slovenia, South Africa, Spain, Switzerland, and Ukraine. Overall, the CNPP reviews the organizational and industrial aspects of nuclear power programmes in participating countries, and provides information about the relevant legislative, regulatory and international frameworks in each country. It compiles the current issues in the new environment within which the electricity and nuclear sector operates, i.e. energy policy, and privatization and deregulation in

  6. Using routine surveillance data to estimate the epidemic potential of emerging zoonoses: application to the emergence of US swine origin influenza A H3N2v virus.

    Science.gov (United States)

    Cauchemez, Simon; Epperson, Scott; Biggerstaff, Matthew; Swerdlow, David; Finelli, Lyn; Ferguson, Neil M

    2013-01-01

    Prior to emergence in human populations, zoonoses such as SARS cause occasional infections in human populations exposed to reservoir species. The risk of widespread epidemics in humans can be assessed by monitoring the reproduction number R (average number of persons infected by a human case). However, until now, estimating R required detailed outbreak investigations of human clusters, for which resources and expertise are not always available. Additionally, existing methods do not correct for important selection and under-ascertainment biases. Here, we present simple estimation methods that overcome many of these limitations. Our approach is based on a parsimonious mathematical model of disease transmission and only requires data collected through routine surveillance and standard case investigations. We apply it to assess the transmissibility of swine-origin influenza A H3N2v-M virus in the US, Nipah virus in Malaysia and Bangladesh, and also present a non-zoonotic example (cholera in the Dominican Republic). Estimation is based on two simple summary statistics, the proportion infected by the natural reservoir among detected cases (G) and among the subset of the first detected cases in each cluster (F). If detection of a case does not affect detection of other cases from the same cluster, we find that R can be estimated by 1-G; otherwise R can be estimated by 1-F when the case detection rate is low. In more general cases, bounds on R can still be derived. We have developed a simple approach with limited data requirements that enables robust assessment of the risks posed by emerging zoonoses. We illustrate this by deriving transmissibility estimates for the H3N2v-M virus, an important step in evaluating the possible pandemic threat posed by this virus. Please see later in the article for the Editors' Summary.

  7. Using routine surveillance data to estimate the epidemic potential of emerging zoonoses: application to the emergence of US swine origin influenza A H3N2v virus.

    Directory of Open Access Journals (Sweden)

    Simon Cauchemez

    Full Text Available Prior to emergence in human populations, zoonoses such as SARS cause occasional infections in human populations exposed to reservoir species. The risk of widespread epidemics in humans can be assessed by monitoring the reproduction number R (average number of persons infected by a human case. However, until now, estimating R required detailed outbreak investigations of human clusters, for which resources and expertise are not always available. Additionally, existing methods do not correct for important selection and under-ascertainment biases. Here, we present simple estimation methods that overcome many of these limitations.Our approach is based on a parsimonious mathematical model of disease transmission and only requires data collected through routine surveillance and standard case investigations. We apply it to assess the transmissibility of swine-origin influenza A H3N2v-M virus in the US, Nipah virus in Malaysia and Bangladesh, and also present a non-zoonotic example (cholera in the Dominican Republic. Estimation is based on two simple summary statistics, the proportion infected by the natural reservoir among detected cases (G and among the subset of the first detected cases in each cluster (F. If detection of a case does not affect detection of other cases from the same cluster, we find that R can be estimated by 1-G; otherwise R can be estimated by 1-F when the case detection rate is low. In more general cases, bounds on R can still be derived.We have developed a simple approach with limited data requirements that enables robust assessment of the risks posed by emerging zoonoses. We illustrate this by deriving transmissibility estimates for the H3N2v-M virus, an important step in evaluating the possible pandemic threat posed by this virus. Please see later in the article for the Editors' Summary.

  8. Dengue virus receptor

    OpenAIRE

    Hidari, Kazuya I.P.J.; Suzuki, Takashi

    2011-01-01

    Dengue virus is an arthropod-borne virus transmitted by Aedes mosquitoes. Dengue virus causes fever and hemorrhagic disorders in humans and non-human primates. Direct interaction of the virus introduced by a mosquito bite with host receptor molecule(s) is crucial for virus propagation and the pathological progression of dengue diseases. Therefore, elucidation of the molecular mechanisms underlying the interaction between dengue virus and its receptor(s) in both humans and mosquitoes is essent...

  9. Computer Virus and Trends

    OpenAIRE

    Tutut Handayani; Soenarto Usna,Drs.MMSI

    2004-01-01

    Since its appearance the first time in the mid-1980s, computer virus has invited various controversies that still lasts to this day. Along with the development of computer systems technology, viruses komputerpun find new ways to spread itself through a variety of existing communications media. This paper discusses about some things related to computer viruses, namely: the definition and history of computer viruses; the basics of computer viruses; state of computer viruses at this time; and ...

  10. The clinical applications of genome editing in HIV.

    Science.gov (United States)

    Wang, Cathy X; Cannon, Paula M

    2016-05-26

    HIV/AIDS has long been at the forefront of the development of gene- and cell-based therapies. Although conventional gene therapy approaches typically involve the addition of anti-HIV genes to cells using semirandomly integrating viral vectors, newer genome editing technologies based on engineered nucleases are now allowing more precise genetic manipulations. The possible outcomes of genome editing include gene disruption, which has been most notably applied to the CCR5 coreceptor gene, or the introduction of small mutations or larger whole gene cassette insertions at a targeted locus. Disruption of CCR5 using zinc finger nucleases was the first-in-human application of genome editing and remains the most clinically advanced platform, with 7 completed or ongoing clinical trials in T cells and hematopoietic stem/progenitor cells (HSPCs). Here we review the laboratory and clinical findings of CCR5 editing in T cells and HSPCs for HIV therapy and summarize other promising genome editing approaches for future clinical development. In particular, recent advances in the delivery of genome editing reagents and the demonstration of highly efficient homology-directed editing in both T cells and HSPCs are expected to spur the development of even more sophisticated applications of this technology for HIV therapy. © 2016 by The American Society of Hematology.

  11. Current status and perspectives of genome editing technology for microalgae.

    Science.gov (United States)

    Jeon, Seungjib; Lim, Jong-Min; Lee, Hyung-Gwan; Shin, Sung-Eun; Kang, Nam Kyu; Park, Youn-Il; Oh, Hee-Mock; Jeong, Won-Joong; Jeong, Byeong-Ryool; Chang, Yong Keun

    2017-01-01

    Genome editing techniques are critical for manipulating genes not only to investigate their functions in biology but also to improve traits for genetic engineering in biotechnology. Genome editing has been greatly facilitated by engineered nucleases, dubbed molecular scissors, including zinc-finger nuclease (ZFN), TAL effector endonuclease (TALEN) and clustered regularly interspaced palindromic sequences (CRISPR)/Cas9. In particular, CRISPR/Cas9 has revolutionized genome editing fields with its simplicity, efficiency and accuracy compared to previous nucleases. CRISPR/Cas9-induced genome editing is being used in numerous organisms including microalgae. Microalgae have been subjected to extensive genetic and biological engineering due to their great potential as sustainable biofuel and chemical feedstocks. However, progress in microalgal engineering is slow mainly due to a lack of a proper transformation toolbox, and the same problem also applies to genome editing techniques. Given these problems, there are a few reports on successful genome editing in microalgae. It is, thus, time to consider the problems and solutions of genome editing in microalgae as well as further applications of this exciting technology for other scientific and engineering purposes.

  12. CRISPR-Cas9-Mediated Genome Editing in Leishmania donovani.

    Science.gov (United States)

    Zhang, Wen-Wei; Matlashewski, Greg

    2015-07-21

    The prokaryotic CRISPR (clustered regularly interspaced short palindromic repeat)-Cas9, an RNA-guided endonuclease, has been shown to mediate efficient genome editing in a wide variety of organisms. In the present study, the CRISPR-Cas9 system has been adapted to Leishmania donovani, a protozoan parasite that causes fatal human visceral leishmaniasis. We introduced the Cas9 nuclease into L. donovani and generated guide RNA (gRNA) expression vectors by using the L. donovani rRNA promoter and the hepatitis delta virus (HDV) ribozyme. It is demonstrated within that L. donovani mainly used homology-directed repair (HDR) and microhomology-mediated end joining (MMEJ) to repair the Cas9 nuclease-created double-strand DNA break (DSB). The nonhomologous end-joining (NHEJ) pathway appears to be absent in L. donovani. With this CRISPR-Cas9 system, it was possible to generate knockouts without selection by insertion of an oligonucleotide donor with stop codons and 25-nucleotide homology arms into the Cas9 cleavage site. Likewise, we disrupted and precisely tagged endogenous genes by inserting a bleomycin drug selection marker and GFP gene into the Cas9 cleavage site. With the use of Hammerhead and HDV ribozymes, a double-gRNA expression vector that further improved gene-targeting efficiency was developed, and it was used to make precise deletion of the 3-kb miltefosine transporter gene (LdMT). In addition, this study identified a novel single point mutation caused by CRISPR-Cas9 in LdMT (M381T) that led to miltefosine resistance, a concern for the only available oral antileishmanial drug. Together, these results demonstrate that the CRISPR-Cas9 system represents an effective genome engineering tool for L. donovani. Leishmania donovani is the causative agent of fatal visceral leishmaniasis. To understand Leishmania infection and pathogenesis and identify new drug targets for control of leishmaniasis, more-efficient ways to manipulate this parasite genome are required. In this

  13. Viral (hepatitis C virus, hepatitis B virus, HIV) persistence and immune homeostasis

    Science.gov (United States)

    Zhou, Yun; Zhang, Ying; Moorman, Jonathan P; Yao, Zhi Q; Jia, Zhan S

    2014-01-01

    Immune homeostasis is a host characteristic that maintains biological balance within a host. Humans have evolved many host defence mechanisms that ensure the survival of individuals upon encountering a pathogenic infection, with recovery or persistence from a viral infection being determined by both viral factors and host immunity. Chronic viral infections, such as hepatitis B virus, hepatitis C virus and HIV, often result in chronic fluctuating viraemia in the face of host cellular and humoral immune responses, which are dysregulated by multi-faceted mechanisms that are incompletely understood. This review attempts to illuminate the mechanisms involved in this process, focusing on immune homeostasis in the setting of persistent viral infection from the aspects of host defence mechanism, including interferon-stimulated genes, apolipoprotein B mRNA editing enzyme catalytic polypeptide 3 (APOBEC3), autophagy and interactions of various immune cells, cytokines and regulatory molecules. PMID:24965611

  14. [CRISPR/CAS9, the King of Genome Editing Tools].

    Science.gov (United States)

    Bannikov, A V; Lavrov, A V

    2017-01-01

    The discovery of CRISPR/Cas9 brought a hope for having an efficient, reliable, and readily available tool for genome editing. CRISPR/Cas9 is certainly easy to use, while its efficiency and reliability remain the focus of studies. The review describes the general principles of the organization and function of Cas nucleases and a number of important issues to be considered while planning genome editing experiments with CRISPR/Cas9. The issues include evaluation of the efficiency and specificity for Cas9, sgRNA selection, Cas9 variants designed artificially, and use of homologous recombination and nonhomologous end joining in DNA editing.

  15. The Star Wars franchise, fan edits, and Lucasfilm [symposium

    Directory of Open Access Journals (Sweden)

    Forrest Phillips

    2012-03-01

    Full Text Available Fan edits assert that fan authority is on par with that of a work's original creator; this authority is generated not only through the argument, but through the structure of the text itself. Fan edits adhere to classical filmmaking techniques, creating coherent plots and editing for continuity. These recut texts are emblematic of current ownership debates; they are the read/write culture brought to fandom. The Star Wars series of films are among the most frequently recut texts and are my focus here.

  16. Gene-Editing: Interpretation of Current Law and Legal Policy

    OpenAIRE

    Kim, Na-Kyoung

    2017-01-01

    ABSTRACT With the development of the third-generation gene scissors, CRISPR-Cas9, concerns are being raised about ethical and social repercussions of the new gene-editing technology. In this situation, this article explores the legislation and interpretation of the positive laws in South Korea. The BioAct does not specify and regulate 'gene editing' itself. However, assuming that genetic editing is used in the process of research and treatment, we can look to the specific details of the regul...

  17. [From random mutagenesis to precise genome editing: the development and evolution of genome editing techniques in Drosophila].

    Science.gov (United States)

    Su, Fang; Huang, Zong-liang; Guo, Ya-wen; Jiao, Ren-jie; Zi, Li; Chen, Jian-ming; Liu, Ji-yong

    2016-01-01

    Drosophila melanogaster, an important model organism for studying life science, has contributed more to the research of genetics, developmental biology and biomedicine with the development of genome editing techniques. Drosophila genome-editing techniques have evolved from random mutagenesis to precise genome editing and from simple mutant construction to diverse genome editing methods since the 20th century. Chemical mutagenesis, using Ethyl methanesulfonate (EMS), is an important technique to study gene function in forward genetics, however, the precise knockout of Drosophila genes could not be achieved. The gene targeting technology, based on homologous recombination, has accomplished the precise editing of Drosophila genome for the first time, but with low efficiency. The CRISPR/Cas9 (Clustered regularly interspaced short palindromic repeats/CRISPR-associated protein)-mediated precise genome editing is simple, fast and highly efficient compared with the gene targeting technology in Drosophila. In this review, we focus on Drosophila gene knockout, and summarize the evolution of genome editing techniques in Drosophila, emphasizing the development and applications of gene targeting, zinc-finger nuclease (ZFN), transcription activator-like effector nuclease (TALEN) and CRISPR/Cas9 techniques.

  18. Arrangements for transition from the 1985 edition (as amended 1990) to the 1996 edition of the IAEA Transport Regulations

    International Nuclear Information System (INIS)

    2001-03-01

    The purpose of this publication is to provide guidance to National Competent Authorities to facilitate compliance during, and after, transition from the previous edition of the International Atomic Energy Agency's (IAEA's) Transport Regulations (Safety Series No. 6, 1985 Edition, as Amended 1990) to the 1996 editions (TS-R-1 [ST-1, Revised], in English; ST-1 in French, Russian and Spanish) of the regulations. This may also provide guidance to other users of the IAEA's Transport Regulations such as consignors, carriers, consignees, owners and designers and fabricators of radioactive material and package designers and fabrications

  19. Mutagenesis and Genome Engineering of Epstein-Barr Virus in Cultured Human Cells by CRISPR/Cas9.

    Science.gov (United States)

    Yuen, Kit-San; Chan, Chi-Ping; Kok, Kin-Hang; Jin, Dong-Yan

    2017-01-01

    The clustered regularly interspaced short palindromic repeats (CRISPR)-CRISPR associated protein 9 nuclease (Cas9) system is a powerful genome-editing tool for both chromosomal and extrachromosomal DNA. DNA viruses such as Epstein-Barr virus (EBV), which undergoes episomal replication in human cells, can be effectively edited by CRISPR/Cas9. We have demonstrated targeted editing of the EBV genome by CRISPR/Cas9 in several lines of EBV-infected cells. CRISPR/Cas9-based mutagenesis and genome engineering of EBV provides a new method for genetic analysis, which has some advantages over bacterial artificial chromosome-based recombineering. This approach might also prove useful in the cure of EBV infection. In this chapter, we use the knockout of the BART promoter as an example to detail the experimental procedures for construction of recombinant EBV in human cells.

  20. Country Nuclear Power Profiles - 2012 Edition

    International Nuclear Information System (INIS)

    2012-08-01

    The Country Nuclear Power Profiles compile background information on the status and development of nuclear power programmes in Member States. The CNPP's main objectives are to consolidate information about the nuclear power infrastructures in participating countries, and to present factors related to the effective planning, decision making and implementation of nuclear power programmes that together lead to safe and economical operations of nuclear power plants. The CNPP summarizes organizational and industrial aspects of nuclear power programs and provides information about the relevant legislative, regulatory, and international framework in each country. Its descriptive and statistical overview of the overall economic, energy, and electricity situation in each country and its nuclear power framework is intended to serve as an integrated source of key background information about nuclear power programs in the world. Topics such as reactor safety, nuclear fuel cycle, radioactive waste management and research programmes are for the most part not discussed in detail. Statistical data about nuclear plant operations, population, energy and electricity use are drawn from the PRIS, EEDB, World Development Indicators (WDI) of the World Bank and the national contributions. This publication is updated and the scope of coverage expanded annually. This is the 2012 edition, issued on CD-ROM and Web pages. It contains updated country information for 51 countries. The CNPP is updated based on information voluntarily provided by participating IAEA Member States. Participants include the 29 countries that have operating nuclear power plants, as well as 22 countries with past or planned nuclear power. Each of the 51 profiles in this publication is self-standing, and contains information officially provided by the respective national authorities. For the 2012 edition, 20 countries provided updated or new profiles. These are Argentina, Armenia, Bangladesh, Chile, Germany, Ghana