WorldWideScience

Sample records for nipah virus attachment

  1. Structural and Functional Studies on the Fusion and Attachment Envelope Glycoproteins of Nipah Virus and Hendra Virus

    National Research Council Canada - National Science Library

    Bossart, Katharine

    2003-01-01

    Nipah virus (NiV) and Hendra (HeV) virus are emerging, biosafety level 4 paramyxoviruses responsible for fatal zoonotic infections of humans from pigs and horses, respectively, and are the prototypic members of a new Paramyxovirinae...

  2. Towards understanding of Nipah virus attachment protein assembly and the role of protein affinity and crowding for membrane curvature events.

    Energy Technology Data Exchange (ETDEWEB)

    Stachowiak, Jeanne C.; Hayden, Carl C.; Negrete, Oscar.; Davis, Ryan Wesley; Sasaki, Darryl Y

    2013-10-01

    Pathogenic viruses are a primary threat to our national security and to the health and economy of our world. Effective defense strategies to combat viral infection and spread require the development of understanding of the mechanisms that these pathogens use to invade the host cell. We present in this report results of our research into viral particle recognition and fusion to cell membranes and the role that protein affinity and confinement in lipid domains plays in membrane curvature in cellular fusion and fission events. Herein, we describe 1) the assembly of the G attachment protein of Nipah virus using point mutation studies to define its role in viral particle fusion to the cell membrane, 2) how lateral pressure of membrane bound proteins induce curvature in model membrane systems, and 3) the role of membrane curvature in the selective partitioning of molecular receptors and specific affinity of associated proteins.

  3. Nipah virus transmission in a hamster model.

    Directory of Open Access Journals (Sweden)

    Emmie de Wit

    2011-12-01

    Full Text Available Based on epidemiological data, it is believed that human-to-human transmission plays an important role in Nipah virus outbreaks. No experimental data are currently available on the potential routes of human-to-human transmission of Nipah virus. In a first dose-finding experiment in Syrian hamsters, it was shown that Nipah virus was predominantly shed via the respiratory tract within nasal and oropharyngeal secretions. Although Nipah viral RNA was detected in urogenital and rectal swabs, no infectious virus was recovered from these samples, suggesting no viable virus was shed via these routes. In addition, hamsters inoculated with high doses shed significantly higher amounts of viable Nipah virus particles in comparison with hamsters infected with lower inoculum doses. Using the highest inoculum dose, three potential routes of Nipah virus transmission were investigated in the hamster model: transmission via fomites, transmission via direct contact and transmission via aerosols. It was demonstrated that Nipah virus is transmitted efficiently via direct contact and inefficiently via fomites, but not via aerosols. These findings are in line with epidemiological data which suggest that direct contact with nasal and oropharyngeal secretions of Nipah virus infected individuals resulted in greater risk of Nipah virus infection. The data provide new and much-needed insights into the modes and efficiency of Nipah virus transmission and have important public health implications with regards to the risk assessment and management of future Nipah virus outbreaks.

  4. Nipah Virus Transmission in a Hamster Model

    Science.gov (United States)

    de Wit, Emmie; Bushmaker, Trenton; Scott, Dana; Feldmann, Heinz; Munster, Vincent J.

    2011-01-01

    Based on epidemiological data, it is believed that human-to-human transmission plays an important role in Nipah virus outbreaks. No experimental data are currently available on the potential routes of human-to-human transmission of Nipah virus. In a first dose-finding experiment in Syrian hamsters, it was shown that Nipah virus was predominantly shed via the respiratory tract within nasal and oropharyngeal secretions. Although Nipah viral RNA was detected in urogenital and rectal swabs, no infectious virus was recovered from these samples, suggesting no viable virus was shed via these routes. In addition, hamsters inoculated with high doses shed significantly higher amounts of viable Nipah virus particles in comparison with hamsters infected with lower inoculum doses. Using the highest inoculum dose, three potential routes of Nipah virus transmission were investigated in the hamster model: transmission via fomites, transmission via direct contact and transmission via aerosols. It was demonstrated that Nipah virus is transmitted efficiently via direct contact and inefficiently via fomites, but not via aerosols. These findings are in line with epidemiological data which suggest that direct contact with nasal and oropharyngeal secretions of Nipah virus infected individuals resulted in greater risk of Nipah virus infection. The data provide new and much-needed insights into the modes and efficiency of Nipah virus transmission and have important public health implications with regards to the risk assessment and management of future Nipah virus outbreaks. PMID:22180802

  5. Nipah Virus: A Public Health Concern

    Directory of Open Access Journals (Sweden)

    Abu Bakar Siddique

    2016-05-01

    Full Text Available Nipah virus, a member of the genus Henipavirus, a new class of virus in the Paramyxoviridae family, has drawn attention as an emerging zoonotic virus in South-East and South Asian region. Case fatality rate of Nipah virus infection ranges from 40–70% although it has been as high as 100% in some outbreaks. Many of the outbreaks were attributed to pigs consuming fruits, partially eaten by fruit bats, and transmission of infection to humans. In Bangladesh, Nipah virus infection was associated with contact with a sick cow, consumption of fresh date palm sap (potentially contaminated with pteropid bat saliva, and person-to-person transmission. In 2014, 18 cases of Nipah virus infection have been reported in Bangladesh, of which 9 cases died. In the most recent epidemic at least 6 people died out of nine cases due to Nipah virus infection in the remote northern Bangladesh in 2015. Human infections range from asymptomatic infection to fatal encephalitis. Some people can also experience atypical pneumonia and severe respiratory problems. The virus is detected by ELISA, PCR, immunofluoroscence assay and isolation by cell culture. Treatment is mostly symptomatic and supportive as the effect of antiviral drugs is not satisfactory, and an effective vaccine is yet to be developed. So the very high case fatality addresses the need for adequate and strict control and preventive measures.

  6. Structural and Functional Studies on the Fusion and Attachment Envelope Glycoproteins of Nipah Virus and Hendra Virus

    Science.gov (United States)

    2003-01-01

    subcloned into the vaccinia virus promoter driven expression vector pMCO2 (90) and recombinant vaccinia viruses were generated using standard...characteristics and properties of these novel viruses , and may provide insights into membrane fusion mechanisms, the virus infection process, and towards...these novel viruses , and may provide insights into membrane fusion mechanisms, the virus infection process, and towards the development of therapeutics

  7. The Role of the Hendra Virus and Nipah Virus Attachment Glycoproteins in Receptor Binding and Antibody Neutralization

    Science.gov (United States)

    2014-01-31

    glycoproteins, such as HIV gp140 and Rabies glycoprotein, its ability to form trimers but not tetramers makes it ineffective for correct oligomerization of...Oldstone MB. 2000. V and C proteins of measles virus function as virulence factors in vivo. Virology 267:80-9.   216 148. Playford EG, McCall B...2005. Stable trimerization of recombinant rabies virus glycoprotein ectodomain is required for interaction with the p75NTR receptor. J Gen Virol 86

  8. Nipah virus infection in bats (order Chiroptera) in peninsular Malaysia.

    Science.gov (United States)

    Yob, J. M.; Field, H.; Rashdi, A. M.; Morrissy, C.; van der Heide, B.; Rota, P.; bin Adzhar, A.; White, J.; Daniels, P.; Jamaluddin, A.; Ksiazek, T.

    2001-01-01

    Nipah virus, family Paramyxoviridae, caused disease in pigs and humans in peninsular Malaysia in 1998-99. Because Nipah virus appears closely related to Hendra virus, wildlife surveillance focused primarily on pteropid bats (suborder Megachiroptera), a natural host of Hendra virus in Australia. We collected 324 bats from 14 species on peninsular Malaysia. Neutralizing antibodies to Nipah virus were demonstrated in five species, suggesting widespread infection in bat populations in peninsular Malaysia. PMID:11384522

  9. Quantitative estimation of Nipah virus replication kinetics in vitro

    Directory of Open Access Journals (Sweden)

    Hassan Sharifah

    2006-06-01

    Full Text Available Abstract Background Nipah virus is a zoonotic virus isolated from an outbreak in Malaysia in 1998. The virus causes infections in humans, pigs, and several other domestic animals. It has also been isolated from fruit bats. The pathogenesis of Nipah virus infection is still not well described. In the present study, Nipah virus replication kinetics were estimated from infection of African green monkey kidney cells (Vero using the one-step SYBR® Green I-based quantitative real-time reverse transcriptase-polymerase chain reaction (qRT-PCR assay. Results The qRT-PCR had a dynamic range of at least seven orders of magnitude and can detect Nipah virus from as low as one PFU/μL. Following initiation of infection, it was estimated that Nipah virus RNA doubles at every ~40 minutes and attained peak intracellular virus RNA level of ~8.4 log PFU/μL at about 32 hours post-infection (PI. Significant extracellular Nipah virus RNA release occurred only after 8 hours PI and the level peaked at ~7.9 log PFU/μL at 64 hours PI. The estimated rate of Nipah virus RNA released into the cell culture medium was ~0.07 log PFU/μL per hour and less than 10% of the released Nipah virus RNA was infectious. Conclusion The SYBR® Green I-based qRT-PCR assay enabled quantitative assessment of Nipah virus RNA synthesis in Vero cells. A low rate of Nipah virus extracellular RNA release and low infectious virus yield together with extensive syncytial formation during the infection support a cell-to-cell spread mechanism for Nipah virus infection.

  10. Evaluation of Nipah Virus as a Human and Animal Biological Terrorism and Warfare Agent

    Science.gov (United States)

    2001-09-01

    Molecular analyses have confirmed that Nipah virus and Hendra virus are closely related, but different viruses . The N, C, P. V, M, F and G genes of Nipah...encephalitis and 106 of them have died. The Nipah virus outbreak also devastated Malaysia’s pig-farming industry. The Nipah virus or so-called Hendra ...Nipah virus belongs to the Paramnyxoviirit strain, which shows similarities to the Hendra virus , which was discovered in Australia in 1994

  11. Hendra virus and Nipah virus animal vaccines.

    Science.gov (United States)

    Broder, Christopher C; Weir, Dawn L; Reid, Peter A

    2016-06-24

    Hendra virus (HeV) and Nipah virus (NiV) are zoonotic viruses that emerged in the mid to late 1990s causing disease outbreaks in livestock and people. HeV appeared in Queensland, Australia in 1994 causing a severe respiratory disease in horses along with a human case fatality. NiV emerged a few years later in Malaysia and Singapore in 1998-1999 causing a large outbreak of encephalitis with high mortality in people and also respiratory disease in pigs which served as amplifying hosts. The key pathological elements of HeV and NiV infection in several species of mammals, and also in people, are a severe systemic and often fatal neurologic and/or respiratory disease. In people, both HeV and NiV are also capable of causing relapsed encephalitis following recovery from an acute infection. The known reservoir hosts of HeV and NiV are several species of pteropid fruit bats. Spillovers of HeV into horses continue to occur in Australia and NiV has caused outbreaks in people in Bangladesh and India nearly annually since 2001, making HeV and NiV important transboundary biological threats. NiV in particular possesses several features that underscore its potential as a pandemic threat, including its ability to infect humans directly from natural reservoirs or indirectly from other susceptible animals, along with a capacity of limited human-to-human transmission. Several HeV and NiV animal challenge models have been developed which have facilitated an understanding of pathogenesis and allowed for the successful development of both active and passive immunization countermeasures. Published by Elsevier Ltd.

  12. Passive immunization and active vaccination against Hendra and Nipah viruses.

    Science.gov (United States)

    Broder, C C

    2013-01-01

    Hendra virus and Nipah virus are viral zoonoses first recognized in the mid and late 1990's and are now categorized as the type species of the genus Henipavirus within the family Paramyxoviridae. Their broad species tropism together with their capacity to cause severe and often fatal disease in both humans and animals make Hendra and Nipah "overlap agents" and significant biosecurity threats. The development of effective vaccination strategies to prevent or treat henipavirus infection and disease has been an important area of research. Here, henipavirus active and passive vaccination strategies that have been examined in animal challenge models of Hendra and Nipah virus disease are summarized and discussed.

  13. Nipah virus entry can occur by macropinocytosis

    International Nuclear Information System (INIS)

    Pernet, Olivier; Pohl, Christine; Ainouze, Michelle; Kweder, Hasan; Buckland, Robin

    2009-01-01

    Nipah virus (NiV) is a zoonotic biosafety level 4 paramyxovirus that emerged recently in Asia with high mortality in man. NiV is a member, with Hendra virus (HeV), of the Henipavirus genus in the Paramyxoviridae family. Although NiV entry, like that of other paramyxoviruses, is believed to occur via pH-independent fusion with the host cell's plasma membrane we present evidence that entry can occur by an endocytic pathway. The NiV receptor ephrinB2 has receptor kinase activity and we find that ephrinB2's cytoplasmic domain is required for entry but is dispensable for post-entry viral spread. The mutation of a single tyrosine residue (Y304F) in ephrinB2's cytoplasmic tail abrogates NiV entry. Moreover, our results show that NiV entry is inhibited by constructions and drugs specific for the endocytic pathway of macropinocytosis. Our findings could potentially permit the rapid development of novel low-cost antiviral treatments not only for NiV but also HeV.

  14. Receptor-Targeted Nipah Virus Glycoproteins Improve Cell-Type Selective Gene Delivery and Reveal a Preference for Membrane-Proximal Cell Attachment.

    Directory of Open Access Journals (Sweden)

    Ruben R Bender

    2016-06-01

    Full Text Available Receptor-targeted lentiviral vectors (LVs can be an effective tool for selective transfer of genes into distinct cell types of choice. Moreover, they can be used to determine the molecular properties that cell surface proteins must fulfill to act as receptors for viral glycoproteins. Here we show that LVs pseudotyped with receptor-targeted Nipah virus (NiV glycoproteins effectively enter into cells when they use cell surface proteins as receptors that bring them closely enough to the cell membrane (less than 100 Å distance. Then, they were flexible in receptor usage as demonstrated by successful targeting of EpCAM, CD20, and CD8, and as selective as LVs pseudotyped with receptor-targeted measles virus (MV glycoproteins, the current standard for cell-type specific gene delivery. Remarkably, NiV-LVs could be produced at up to two orders of magnitude higher titers compared to their MV-based counterparts and were at least 10,000-fold less effectively neutralized than MV glycoprotein pseudotyped LVs by pooled human intravenous immunoglobulin. An important finding for NiV-LVs targeted to Her2/neu was an about 100-fold higher gene transfer activity when particles were targeted to membrane-proximal regions as compared to particles binding to a more membrane-distal epitope. Likewise, the low gene transfer activity mediated by NiV-LV particles bound to the membrane distal domains of CD117 or the glutamate receptor subunit 4 (GluA4 was substantially enhanced by reducing receptor size to below 100 Å. Overall, the data suggest that the NiV glycoproteins are optimally suited for cell-type specific gene delivery with LVs and, in addition, for the first time define which parts of a cell surface protein should be targeted to achieve optimal gene transfer rates with receptor-targeted LVs.

  15. Identifying Early Target Cells of Nipah Virus Infection in Syrian Hamsters

    OpenAIRE

    Baseler, Laura; Scott, Dana P.; Saturday, Greg; Horne, Eva; Rosenke, Rebecca; Thomas, Tina; Meade-White, Kimberly; Haddock, Elaine; Feldmann, Heinz; de Wit, Emmie

    2016-01-01

    Background Nipah virus causes respiratory and neurologic disease with case fatality rates up to 100% in individual outbreaks. End stage lesions have been described in the respiratory and nervous systems, vasculature and often lymphoid organs in fatal human cases; however, the initial target organs of Nipah virus infection have not been identified. Here, we detected the initial target tissues and cells of Nipah virus and tracked virus dissemination during the early phase of infection in Syrian...

  16. Antibodies to Nipah-like virus in bats (Pteropus lylei), Cambodia.

    Science.gov (United States)

    Olson, James G; Rupprecht, Charles; Rollin, Pierre E; An, Ung Sam; Niezgoda, Michael; Clemins, Travis; Walston, Joe; Ksiazek, Thomas G

    2002-09-01

    Serum specimens from fruit bats were obtained at restaurants in Cambodia. We detected antibodies cross-reactive to Nipah virus by enzyme immunoassay in 11 (11.5%) of 96 Lyle's flying foxes (Pteropus lylei). Our study suggests that viruses closely related to Nipah or Hendra viruses are more widespread in Southeast Asia than previously documented.

  17. Pathogenesis of Hendra and Nipah virus infection in humans.

    Science.gov (United States)

    Escaffre, Olivier; Borisevich, Viktoriya; Rockx, Barry

    2013-04-17

    Hendra virus (HeV) and Nipah virus (NiV) are emerging zoonotic viruses that cause severe and often lethal respiratory illness and encephalitis in humans. Henipaviruses can infect a wide range of species and human-to-human transmission has been observed for NiV. While the exact route of transmission in humans is not known, experimental infection in different animal species suggests that infection can be efficiently initiated after respiratory challenge. The limited data on histopathological changes in fatal human cases of HeV and NiV suggest that endothelial cells are an important target during the terminal stage of infection; however, it is unknown where these viruses initially establish infection and how the virus disseminates from the respiratory tract to the central nervous system and other organs. Here we review the current concepts in henipavirus pathogenesis in humans.

  18. Hendra and Nipah viruses: why are they so deadly?

    Science.gov (United States)

    Marsh, Glenn A; Wang, Lin-Fa

    2012-06-01

    Henipavirus, including Hendra and Nipah viruses, is a group of emerging bat-borne paramyxoviruses which were responsible for severe disease outbreaks in humans, horses and pigs. The mortality rate of human infection varies between 50 and 100%, making them one of the most deadly viruses known to infect humans. Its use of highly conserved cell surface molecules (ephrin) as entry receptors and its highly effective replication and fusion strategies are believed to be important characteristics responsible for its high pathogenicity. Henipavirus also encodes multiple accessory proteins which play a key role in evasion of host innate immune responses. Our recent study on the mechanism of IFN antagonism by henipaviruses indicated that a better understanding of the virus-host interaction provides great potential to develop new therapeutic strategies against these viruses. Crown Copyright © 2012. Published by Elsevier B.V. All rights reserved.

  19. A treatment for and vaccine against the deadly Hendra and Nipah viruses.

    Science.gov (United States)

    Broder, Christopher C; Xu, Kai; Nikolov, Dimitar B; Zhu, Zhongyu; Dimitrov, Dimiter S; Middleton, Deborah; Pallister, Jackie; Geisbert, Thomas W; Bossart, Katharine N; Wang, Lin-Fa

    2013-10-01

    Hendra virus and Nipah virus are bat-borne paramyxoviruses that are the prototypic members of the genus Henipavirus. The henipaviruses emerged in the 1990s, spilling over from their natural bat hosts and causing serious disease outbreaks in humans and livestock. Hendra virus emerged in Australia and since 1994 there have been 7 human infections with 4 case fatalities. Nipah virus first appeared in Malaysia and subsequent outbreaks have occurred in Bangladesh and India. In total, there have been an estimated 582 human cases of Nipah virus and of these, 54% were fatal. Their broad species tropism and ability to cause fatal respiratory and/or neurologic disease in humans and animals make them important transboundary biological threats. Recent experimental findings in animals have demonstrated that a human monoclonal antibody targeting the viral G glycoprotein is an effective post-exposure treatment against Hendra and Nipah virus infection. In addition, a subunit vaccine based on the G glycoprotein of Hendra virus affords protection against Hendra and Nipah virus challenge. The vaccine has been developed for use in horses in Australia and is the first vaccine against a Biosafety Level-4 (BSL-4) agent to be licensed and commercially deployed. Together, these advances offer viable approaches to address Hendra and Nipah virus infection of livestock and people. Published by Elsevier B.V.

  20. Cytoplasmic Motifs in the Nipah Virus Fusion Protein Modulate Virus Particle Assembly and Egress.

    Science.gov (United States)

    Johnston, Gunner P; Contreras, Erik M; Dabundo, Jeffrey; Henderson, Bryce A; Matz, Keesha M; Ortega, Victoria; Ramirez, Alfredo; Park, Arnold; Aguilar, Hector C

    2017-05-15

    Nipah virus (NiV), a paramyxovirus in the genus Henipavirus , has a mortality rate in humans of approximately 75%. While several studies have begun our understanding of NiV particle formation, the mechanism of this process remains to be fully elucidated. For many paramyxoviruses, M proteins drive viral assembly and egress; however, some paramyxoviral glycoproteins have been reported as important or essential in budding. For NiV the matrix protein (M), the fusion glycoprotein (F) and, to a much lesser extent, the attachment glycoprotein (G) autonomously induce the formation of virus-like particles (VLPs). However, functional interactions between these proteins during assembly and egress remain to be fully understood. Moreover, if the F-driven formation of VLPs occurs through interactions with host cell machinery, the cytoplasmic tail (CT) of F is a likely interactive domain. Therefore, we analyzed NiV F CT deletion and alanine mutants and report that several but not all regions of the F CT are necessary for efficient VLP formation. Two of these regions contain YXXØ or dityrosine motifs previously shown to interact with cellular machinery involved in F endocytosis and transport. Importantly, our results showed that F-driven, M-driven, and M/F-driven viral particle formation enhanced the recruitment of G into VLPs. By identifying key motifs, specific residues, and functional viral protein interactions important for VLP formation, we improve our understanding of the viral assembly/egress process and point to potential interactions with host cell machinery. IMPORTANCE Henipaviruses can cause deadly infections of medical, veterinary, and agricultural importance. With recent discoveries of new henipa-like viruses, understanding the mechanisms by which these viruses reproduce is paramount. We have focused this study on identifying the functional interactions of three Nipah virus proteins during viral assembly and particularly on the role of one of these proteins, the

  1. Nipah virus encephalitis: A cause for concern for Indian neurologists?

    Directory of Open Access Journals (Sweden)

    Halder Amit

    2006-01-01

    Full Text Available The first and only recorded outbreak of Nipah virus (NV encephalitis in India occurred in the winter of 2001, although the causative organism could only be identified 5 years down the line in 2006. The first ever-recorded outbreak of NV encephalitis occurred in the Malaysian peninsula in 1998-99; though between 2001 and 2005, at least four outbreaks occurred in our neighboring country of Bangladesh. The threat of further outbreaks of this dangerous disease looms large on the Indian subcontinent, given the natural reservoir of the definitive host, namely, fruit-eating bats of the genus Pteropus. This review would briefly highlight the epidemiology, clinical aspects and diagnosis of NV encephalitis to enlighten the neurological community of the country for early detection and implementation of preventive measures in the event of further outbreaks, especially those which are generally passed of as ′mystery diseases′ in the lay press and even by governmental agencies.

  2. Nipah and hendra virus interactions with the innate immune system.

    Science.gov (United States)

    Basler, Christopher F

    2012-01-01

    Nipah virus and Hendra virus are related, highly pathogenic paramyxoviruses with unusually broad host ranges. Henipaviruses encode several proteins that block innate immune responses, and these are likely to serve as virulence factors. Specfically, four virus-encoded proteins, the phosphoprotein (P), the V protein, the W protein, and the C protein have each been demonstrated to counteract aspects of the interferon (IFN)-α/β response, a key component of the innate immune response to virus infection. The available data indicate that V and W can inhibit the production of IFNα/β in response to various stimuli, while the P, V, and W proteins also block the ability of IFNs to signal and induce an antiviral state in cells. The C protein also inhibits the antiviral effects of IFNα/β by a poorly characterized mechanism. Reverse genetics systems, which allow the generation of recombinant viruses bearing specific mutations, have demonstrated the importance of the viral IFN-antagonists for replication. With these systems in hand, the field is now poised to define how specific viral IFN-antagonist functions influence viral pathogenesis.

  3. A mature and fusogenic form of the Nipah virus fusion protein requires proteolytic processing by cathepsin L

    International Nuclear Information System (INIS)

    Pager, Cara Theresia; Craft, Willie Warren; Patch, Jared; Dutch, Rebecca Ellis

    2006-01-01

    The Nipah virus fusion (F) protein is proteolytically processed to F 1 + F 2 subunits. We demonstrate here that cathepsin L is involved in this important maturation event. Cathepsin inhibitors ablated cleavage of Nipah F. Proteolytic processing of Nipah F and fusion activity was dramatically reduced in cathepsin L shRNA-expressing Vero cells. Additionally, Nipah virus F-mediated fusion was inhibited in cathepsin L-deficient cells, but coexpression of cathepsin L restored fusion activity. Both purified cathepsin L and B could cleave immunopurified Nipah F protein, but only cathepsin L produced products of the correct size. Our results suggest that endosomal cathepsins can cleave Nipah F, but that cathepsin L specifically converts Nipah F to a mature and fusogenic form

  4. Identifying Early Target Cells of Nipah Virus Infection in Syrian Hamsters.

    Directory of Open Access Journals (Sweden)

    Laura Baseler

    2016-11-01

    Full Text Available Nipah virus causes respiratory and neurologic disease with case fatality rates up to 100% in individual outbreaks. End stage lesions have been described in the respiratory and nervous systems, vasculature and often lymphoid organs in fatal human cases; however, the initial target organs of Nipah virus infection have not been identified. Here, we detected the initial target tissues and cells of Nipah virus and tracked virus dissemination during the early phase of infection in Syrian hamsters inoculated with a Nipah virus isolate from Malaysia (NiV-M or Bangladesh (NiV-B.Syrian hamsters were euthanized between 4 and 48 hours post intranasal inoculation and tissues were collected and analyzed for the presence of viral RNA, viral antigen and infectious virus. Virus replication was first detected at 8 hours post inoculation (hpi. Nipah virus initially targeted type I pneumocytes, bronchiolar respiratory epithelium and alveolar macrophages in the lung and respiratory and olfactory epithelium lining the nasal turbinates. By 16 hpi, virus disseminated to epithelial cells lining the larynx and trachea. Although the pattern of viral dissemination was similar for both virus isolates, the rate of spread was slower for NiV-B. Infectious virus was not detected in the nervous system or blood and widespread vascular infection and lesions within lymphoid organs were not observed, even at 48 hpi.Nipah virus initially targets the respiratory system. Virus replication in the brain and infection of blood vessels in non-respiratory tissues does not occur during the early phase of infection. However, virus replicates early in olfactory epithelium and may serve as the first step towards nervous system dissemination, suggesting that development of vaccines that block virus dissemination or treatments that can access the brain and spinal cord and directly inhibit virus replication may be necessary for preventing central nervous system pathology.

  5. Identifying Early Target Cells of Nipah Virus Infection in Syrian Hamsters.

    Science.gov (United States)

    Baseler, Laura; Scott, Dana P; Saturday, Greg; Horne, Eva; Rosenke, Rebecca; Thomas, Tina; Meade-White, Kimberly; Haddock, Elaine; Feldmann, Heinz; de Wit, Emmie

    2016-11-01

    Nipah virus causes respiratory and neurologic disease with case fatality rates up to 100% in individual outbreaks. End stage lesions have been described in the respiratory and nervous systems, vasculature and often lymphoid organs in fatal human cases; however, the initial target organs of Nipah virus infection have not been identified. Here, we detected the initial target tissues and cells of Nipah virus and tracked virus dissemination during the early phase of infection in Syrian hamsters inoculated with a Nipah virus isolate from Malaysia (NiV-M) or Bangladesh (NiV-B). Syrian hamsters were euthanized between 4 and 48 hours post intranasal inoculation and tissues were collected and analyzed for the presence of viral RNA, viral antigen and infectious virus. Virus replication was first detected at 8 hours post inoculation (hpi). Nipah virus initially targeted type I pneumocytes, bronchiolar respiratory epithelium and alveolar macrophages in the lung and respiratory and olfactory epithelium lining the nasal turbinates. By 16 hpi, virus disseminated to epithelial cells lining the larynx and trachea. Although the pattern of viral dissemination was similar for both virus isolates, the rate of spread was slower for NiV-B. Infectious virus was not detected in the nervous system or blood and widespread vascular infection and lesions within lymphoid organs were not observed, even at 48 hpi. Nipah virus initially targets the respiratory system. Virus replication in the brain and infection of blood vessels in non-respiratory tissues does not occur during the early phase of infection. However, virus replicates early in olfactory epithelium and may serve as the first step towards nervous system dissemination, suggesting that development of vaccines that block virus dissemination or treatments that can access the brain and spinal cord and directly inhibit virus replication may be necessary for preventing central nervous system pathology.

  6. Novel Functions of Hendra Virus G N-Glycans and Comparisons to Nipah Virus.

    Science.gov (United States)

    Bradel-Tretheway, Birgit G; Liu, Qian; Stone, Jacquelyn A; McInally, Samantha; Aguilar, Hector C

    2015-07-01

    Hendra virus (HeV) and Nipah virus (NiV) are reportedly the most deadly pathogens within the Paramyxoviridae family. These two viruses bind the cellular entry receptors ephrin B2 and/or ephrin B3 via the viral attachment glycoprotein G, and the concerted efforts of G and the viral fusion glycoprotein F result in membrane fusion. Membrane fusion is essential for viral entry into host cells and for cell-cell fusion, a hallmark of the disease pathobiology. HeV G is heavily N-glycosylated, but the functions of the N-glycans remain unknown. We disrupted eight predicted N-glycosylation sites in HeV G by conservative mutations (Asn to Gln) and found that six out of eight sites were actually glycosylated (G2 to G7); one in the stalk (G2) and five in the globular head domain (G3 to G7). We then tested the roles of individual and combined HeV G N-glycan mutants and found functions in the modulation of shielding against neutralizing antibodies, intracellular transport, G-F interactions, cell-cell fusion, and viral entry. Between the highly conserved HeV and NiV G glycoproteins, similar trends in the effects of N-glycans on protein functions were observed, with differences in the levels at which some N-glycan mutants affected such functions. While the N-glycan in the stalk domain (G2) had roles that were highly conserved between HeV and NiV G, individual N-glycans in the head affected the levels of several protein functions differently. Our findings are discussed in the context of their contributions to our understanding of HeV and NiV pathogenesis and immune responses. Viral envelope glycoproteins are important for viral pathogenicity and immune evasion. N-glycan shielding is one mechanism by which immune evasion can be achieved. In paramyxoviruses, viral attachment and membrane fusion are governed by the close interaction of the attachment proteins H/HN/G and the fusion protein F. In this study, we show that the attachment glycoprotein G of Hendra virus (HeV), a deadly

  7. Affinity selection of Nipah and Hendra virus-related vaccine candidates from a complex random peptide library displayed on bacteriophage virus-like particles

    Energy Technology Data Exchange (ETDEWEB)

    Peabody, David S.; Chackerian, Bryce; Ashley, Carlee; Carnes, Eric; Negrete, Oscar

    2017-01-24

    The invention relates to virus-like particles of bacteriophage MS2 (MS2 VLPs) displaying peptide epitopes or peptide mimics of epitopes of Nipah Virus envelope glycoprotein that elicit an immune response against Nipah Virus upon vaccination of humans or animals. Affinity selection on Nipah Virus-neutralizing monoclonal antibodies using random sequence peptide libraries on MS2 VLPs selected peptides with sequence similarity to peptide sequences found within the envelope glycoprotein of Nipah itself, thus identifying the epitopes the antibodies recognize. The selected peptide sequences themselves are not necessarily identical in all respects to a sequence within Nipah Virus glycoprotein, and therefore may be referred to as epitope mimics VLPs displaying these epitope mimics can serve as vaccine. On the other hand, display of the corresponding wild-type sequence derived from Nipah Virus and corresponding to the epitope mapped by affinity selection, may also be used as a vaccine.

  8. A review of Nipah and Hendra viruses with an historical aside.

    Science.gov (United States)

    Ksiazek, Thomas G; Rota, Paul A; Rollin, Pierre E

    2011-12-01

    The emergence of Hendra and Nipah viruses in the 1990s has been followed by the further emergence of these viruses in the tropical Old World. The history and current knowledge of the disease, the viruses and their epidemiology is reviewed in this article. A historical aside summarizes the role that Dr. Brian W.J. Mahy played at critical junctures in the early stories of these viruses. Copyright © 2011 Elsevier B.V. All rights reserved.

  9. Comparison of the pathogenicity of Nipah virus isolates from Bangladesh and Malaysia in the Syrian hamster.

    Directory of Open Access Journals (Sweden)

    Blair L DeBuysscher

    Full Text Available Nipah virus is a zoonotic pathogen that causes severe disease in humans. The mechanisms of pathogenesis are not well described. The first Nipah virus outbreak occurred in Malaysia, where human disease had a strong neurological component. Subsequent outbreaks have occurred in Bangladesh and India and transmission and disease processes in these outbreaks appear to be different from those of the Malaysian outbreak. Until this point, virtually all Nipah virus studies in vitro and in vivo, including vaccine and pathogenesis studies, have utilized a virus isolate from the original Malaysian outbreak (NiV-M. To investigate potential differences between NiV-M and a Nipah virus isolate from Bangladesh (NiV-B, we compared NiV-M and NiV-B infection in vitro and in vivo. In hamster kidney cells, NiV-M-infection resulted in extensive syncytia formation and cytopathic effects, whereas NiV-B-infection resulted in little to no morphological changes. In vivo, NiV-M-infected Syrian hamsters had accelerated virus replication, pathology and death when compared to NiV-B-infected animals. NiV-M infection also resulted in the activation of host immune response genes at an earlier time point. Pathogenicity was not only a result of direct effects of virus replication, but likely also had an immunopathogenic component. The differences observed between NiV-M and NiV-B pathogeneis in hamsters may relate to differences observed in human cases. Characterization of the hamster model for NiV-B infection allows for further research of the strain of Nipah virus responsible for the more recent outbreaks in humans. This model can be used to study NiV-B pathogenesis, transmission, and countermeasures that could be used to control outbreaks.

  10. Induction of neutralizing antibodies to Hendra and Nipah glycoproteins using a Venezuelan equine encephalitis virus in vivo expression system.

    Science.gov (United States)

    Defang, Gabriel N; Khetawat, Dimple; Broder, Christopher C; Quinnan, Gerald V

    2010-12-16

    The emergence of Hendra Virus (HeV) and Nipah Virus (NiV) which can cause fatal infections in both animals and humans has triggered a search for an effective vaccine. Here, we have explored the potential for generating an effective humoral immune response to these zoonotic pathogens using an alphavirus-based vaccine platform. Groups of mice were immunized with Venezuelan equine encephalitis virus replicon particles (VRPs) encoding the attachment or fusion glycoproteins of either HeV or NiV. We demonstrate the induction of highly potent cross-reactive neutralizing antibodies to both viruses using this approach. Preliminary study suggested early enhancement in the antibody response with use of a modified version of VRP. Overall, these data suggest that the use of an alphavirus-derived vaccine platform might serve as a viable approach for the development of an effective vaccine against the henipaviruses. Published by Elsevier Ltd.

  11. Antiviral activity of gliotoxin, gentian violet and brilliant green against Nipah and Hendra virus in vitro

    Directory of Open Access Journals (Sweden)

    Meyer Adam G

    2009-11-01

    Full Text Available Abstract Background Using a recently described monolayer assay amenable to high throughput screening format for the identification of potential Nipah virus and Hendra virus antivirals, we have partially screened a low molecular weight compound library (>8,000 compounds directly against live virus infection and identified twenty eight promising lead molecules. Initial single blind screens were conducted with 10 μM compound in triplicate with a minimum efficacy of 90% required for lead selection. Lead compounds were then further characterised to determine the median efficacy (IC50, cytotoxicity (CC50 and the in vitro therapeutic index in live virus and pseudotype assay formats. Results While a number of leads were identified, the current work describes three commercially available compounds: brilliant green, gentian violet and gliotoxin, identified as having potent antiviral activity against Nipah and Hendra virus. Similar efficacy was observed against pseudotyped Nipah and Hendra virus, vesicular stomatitis virus and human parainfluenza virus type 3 while only gliotoxin inhibited an influenza A virus suggesting a non-specific, broad spectrum activity for this compound. Conclusion All three of these compounds have been used previously for various aspects of anti-bacterial and anti-fungal therapy and the current results suggest that while unsuitable for internal administration, they may be amenable to topical antiviral applications, or as disinfectants and provide excellent positive controls for future studies.

  12. A neutralizing human monoclonal antibody protects against lethal disease in a new ferret model of acute nipah virus infection.

    Directory of Open Access Journals (Sweden)

    Katharine N Bossart

    2009-10-01

    Full Text Available Nipah virus is a broadly tropic and highly pathogenic zoonotic paramyxovirus in the genus Henipavirus whose natural reservoirs are several species of Pteropus fruit bats. Nipah virus has repeatedly caused outbreaks over the past decade associated with a severe and often fatal disease in humans and animals. Here, a new ferret model of Nipah virus pathogenesis is described where both respiratory and neurological disease are present in infected animals. Severe disease occurs with viral doses as low as 500 TCID(50 within 6 to 10 days following infection. The underlying pathology seen in the ferret closely resembles that seen in Nipah virus infected humans, characterized as a widespread multisystemic vasculitis, with virus replicating in highly vascular tissues including lung, spleen and brain, with recoverable virus from a variety of tissues. Using this ferret model a cross-reactive neutralizing human monoclonal antibody, m102.4, targeting the henipavirus G glycoprotein was evaluated in vivo as a potential therapeutic agent. All ferrets that received m102.4 ten hours following a high dose oral-nasal Nipah virus challenge were protected from disease while all controls died. This study is the first successful post-exposure passive antibody therapy for Nipah virus using a human monoclonal antibody.

  13. Quantitative analysis of Nipah virus proteins released as virus-like particles reveals central role for the matrix protein

    Directory of Open Access Journals (Sweden)

    Eaton Bryan T

    2007-01-01

    Full Text Available Abstract Background Nipah virus (NiV is an emerging paramyxovirus distinguished by its ability to cause fatal disease in both animal and human hosts. Together with Hendra virus (HeV, they comprise the genus Henipavirus in the Paramyxoviridae family. NiV and HeV are also restricted to Biosafety Level-4 containment and this has hampered progress towards examining details of their replication and morphogenesis. Here, we have established recombinant expression systems to study NiV particle assembly and budding through the formation of virus-like particles (VLPs. Results When expressed by recombinant Modified Vaccinia virus Ankara (rMVA or plasmid transfection, individual NiV matrix (M, fusion (F and attachment (G proteins were all released into culture supernatants in a membrane-associated state as determined by sucrose density gradient flotation and immunoprecipitation. However, co-expression of F and G along with M revealed a shift in their distribution across the gradient, indicating association with M in VLPs. Protein release was also altered depending on the context of viral proteins being expressed, with F, G and nucleocapsid (N protein reducing M release, and N release dependent on the co-expression of M. Immunoelectron microscopy and density analysis revealed VLPs that were similar to authentic virus. Differences in the budding dynamics of NiV proteins were also noted between rMVA and plasmid based strategies, suggesting that over-expression by poxvirus may not be appropriate for studying the details of recombinant virus particle assembly and release. Conclusion Taken together, the results indicate that NiV M, F, and G each possess some ability to bud from expressing cells, and that co-expression of these viral proteins results in a more organized budding process with M playing a central role. These findings will aid our understanding of paramyxovirus particle assembly in general and could help facilitate the development of a novel vaccine

  14. Hendra and Nipah viruses: pathogenesis, animal models and recent breakthroughs in vaccination

    Directory of Open Access Journals (Sweden)

    Weingartl HM

    2015-09-01

    Full Text Available Hana M Weingartl National Centre for Foreign Animal Disease, Canadian Food Inspection Agency, Winnipeg, MB, Canada Abstract: Hendra and Nipah viruses are two highly pathogenic zoonotic members of the genus Henipavirus, family Paramyxoviridae, requiring work under biosafety level 4 conditions due to a lack of effective therapy and human vaccines. Several vaccine candidates were protective in animal models: recombinant vaccinia virus expressing Nipah virus (NiV F and G proteins in hamsters against NiV; recombinant ALVAC–NiV F and G in swine against NiV; recombinant Hendra virus (HeV soluble G protein (sGHeV against HeV and NiV in cats, ferrets, horses, and African green monkeys (AGM; recombinant vesicular stomatitis virus-based vectors expressing NiV F or G against NiV in hamsters and ferrets; measles virus-based NiV G vaccine candidate in hamsters and AGMs against NiV; and adenoassociated virus expressing NiG protein, which protected hamsters against NiV. The sGHeV was licensed for use in horses (Equivac HeV® in 2012. It is the first vaccine candidate licensed against a biosafety level 4 agent. With the development of suitable animal models (ferret, hamster and, importantly, AGM, progress can be made toward development of a human vaccine.Keywords: henipavirus, equine, swine, human infection, animal models, vaccine candidates

  15. Use of monoclonal antibodies against Hendra and Nipah viruses in an antigen capture ELISA

    Directory of Open Access Journals (Sweden)

    Spiropoulou Christina F

    2010-06-01

    Full Text Available Abstract Background Outbreaks of Hendra (HeV and Nipah (NiV viruses have been reported starting in 1994 and 1998, respectively. Both viruses are capable of causing fatal disease in humans and effecting great economical loss in the livestock industry. Results Through screening of hybridomas derived from mice immunized with γ-irradiated Nipah virus, we identified two secreted antibodies; one reactive with the nucleocapsid (N protein and the other, the phosphoprotein (P of henipaviruses. Epitope mapping and protein sequence alignments between NiV and HeV suggest the last 14 amino acids of the carboxyl terminus of the N protein is the target of the anti-N antibody. The anti-P antibody recognizes an epitope in the amino-terminal half of P protein. These monoclonal antibodies were used to develop two antigen capture ELISAs, one for virus detection and the other for differentiation between NiV and HeV. The lower limit of detection of the capture assay with both monoclonal antibodies was 400 pfu. The anti-N antibody was used to successfully detect NiV in a lung tissue suspension from an infected pig. Conclusion The antigen capture ELISA developed is potentially affordable tool to provide rapid detection and differentiation between the henipaviruses.

  16. Use of monoclonal antibodies against Hendra and Nipah viruses in an antigen capture ELISA.

    Science.gov (United States)

    Chiang, Cheng-Feng; Lo, Michael K; Rota, Paul A; Spiropoulou, Christina F; Rollin, Pierre E

    2010-06-03

    Outbreaks of Hendra (HeV) and Nipah (NiV) viruses have been reported starting in 1994 and 1998, respectively. Both viruses are capable of causing fatal disease in humans and effecting great economical loss in the livestock industry. Through screening of hybridomas derived from mice immunized with gamma-irradiated Nipah virus, we identified two secreted antibodies; one reactive with the nucleocapsid (N) protein and the other, the phosphoprotein (P) of henipaviruses. Epitope mapping and protein sequence alignments between NiV and HeV suggest the last 14 amino acids of the carboxyl terminus of the N protein is the target of the anti-N antibody. The anti-P antibody recognizes an epitope in the amino-terminal half of P protein. These monoclonal antibodies were used to develop two antigen capture ELISAs, one for virus detection and the other for differentiation between NiV and HeV. The lower limit of detection of the capture assay with both monoclonal antibodies was 400 pfu. The anti-N antibody was used to successfully detect NiV in a lung tissue suspension from an infected pig. The antigen capture ELISA developed is potentially affordable tool to provide rapid detection and differentiation between the henipaviruses.

  17. Matrix proteins of Nipah and Hendra viruses interact with beta subunits of AP-3 complexes.

    Science.gov (United States)

    Sun, Weina; McCrory, Thomas S; Khaw, Wei Young; Petzing, Stephanie; Myers, Terrell; Schmitt, Anthony P

    2014-11-01

    Paramyxoviruses and other negative-strand RNA viruses encode matrix proteins that coordinate the virus assembly process. The matrix proteins link the viral glycoproteins and the viral ribonucleoproteins at virus assembly sites and often recruit host machinery that facilitates the budding process. Using a co-affinity purification strategy, we have identified the beta subunit of the AP-3 adapter protein complex, AP3B1, as a binding partner for the M proteins of the zoonotic paramyxoviruses Nipah virus and Hendra virus. Binding function was localized to the serine-rich and acidic Hinge domain of AP3B1, and a 29-amino-acid Hinge-derived polypeptide was sufficient for M protein binding in coimmunoprecipitation assays. Virus-like particle (VLP) production assays were used to assess the relationship between AP3B1 binding and M protein function. We found that for both Nipah virus and Hendra virus, M protein expression in the absence of any other viral proteins led to the efficient production of VLPs in transfected cells, and this VLP production was potently inhibited upon overexpression of short M-binding polypeptides derived from the Hinge region of AP3B1. Both human and bat (Pteropus alecto) AP3B1-derived polypeptides were highly effective at inhibiting the production of VLPs. VLP production was also impaired through small interfering RNA (siRNA)-mediated depletion of AP3B1 from cells. These findings suggest that AP-3-directed trafficking processes are important for henipavirus particle production and identify a new host protein-virus protein binding interface that could become a useful target in future efforts to develop small molecule inhibitors to combat paramyxoviral infections. Henipaviruses cause deadly infections in humans, with a mortality rate of about 40%. Hendra virus outbreaks in Australia, all involving horses and some involving transmission to humans, have been a continuing problem. Nipah virus caused a large outbreak in Malaysia in 1998, killing 109 people

  18. Microsphere suspension array assays for detection and differentiation of Hendra and Nipah viruses.

    Science.gov (United States)

    Foord, Adam J; White, John R; Colling, Axel; Heine, Hans G

    2013-01-01

    Microsphere suspension array systems enable the simultaneous fluorescent identification of multiple separate nucleotide targets in a single reaction. We have utilized commercially available oligo-tagged microspheres (Luminex MagPlex-TAG) to construct and evaluate multiplexed assays for the detection and differentiation of Hendra virus (HeV) and Nipah virus (NiV). Both these agents are bat-borne zoonotic paramyxoviruses of increasing concern for veterinary and human health. Assays were developed targeting multiple sites within the nucleoprotein (N) and phosphoprotein (P) encoding genes. The relative specificities and sensitivities of the assays were determined using reference isolates of each virus type, samples from experimentally infected horses, and archival veterinary diagnostic submissions. Results were assessed in direct comparison with an established qPCR. The microsphere array assays achieved unequivocal differentiation of HeV and NiV and the sensitivity of HeV detection was comparable to qPCR, indicating high analytical and diagnostic specificity and sensitivity.

  19. Inhibition of Henipavirus fusion and infection by heptad-derived peptides of the Nipah virus fusion glycoprotein

    Science.gov (United States)

    Bossart, Katharine N; Mungall, Bruce A; Crameri, Gary; Wang, Lin-Fa; Eaton, Bryan T; Broder, Christopher C

    2005-01-01

    Background The recent emergence of four new members of the paramyxovirus family has heightened the awareness of and re-energized research on new and emerging diseases. In particular, the high mortality and person to person transmission associated with the most recent Nipah virus outbreaks, as well as the very recent re-emergence of Hendra virus, has confirmed the importance of developing effective therapeutic interventions. We have previously shown that peptides corresponding to the C-terminal heptad repeat (HR-2) of the fusion envelope glycoprotein of Hendra virus and Nipah virus were potent inhibitors of both Hendra virus and Nipah virus-mediated membrane fusion using recombinant expression systems. In the current study, we have developed shorter, second generation HR-2 peptides which include a capped peptide via amidation and acetylation and two poly(ethylene glycol)-linked (PEGylated) peptides, one with the PEG moity at the C-terminus and the other at the N-terminus. Here, we have evaluated these peptides as well as the corresponding scrambled peptide controls in Nipah virus and Hendra virus-mediated membrane fusion and against infection by live virus in vitro. Results Unlike their predecessors, the second generation HR-2 peptides exhibited high solubility and improved synthesis yields. Importantly, both Nipah virus and Hendra virus-mediated fusion as well as live virus infection were potently inhibited by both capped and PEGylated peptides with IC50 concentrations similar to the original HR-2 peptides, whereas the scrambled modified peptides had no inhibitory effect. These data also indicate that these chemical modifications did not alter the functional properties of the peptides as inhibitors. Conclusion Nipah virus and Hendra virus infection in vitro can be potently blocked by specific HR-2 peptides. The improved synthesis and solubility characteristics of the second generation HR-2 peptides will facilitate peptide synthesis for pre-clinical trial

  20. Inhibition of Henipavirus fusion and infection by heptad-derived peptides of the Nipah virus fusion glycoprotein

    Directory of Open Access Journals (Sweden)

    Eaton Bryan T

    2005-07-01

    Full Text Available Abstract Background The recent emergence of four new members of the paramyxovirus family has heightened the awareness of and re-energized research on new and emerging diseases. In particular, the high mortality and person to person transmission associated with the most recent Nipah virus outbreaks, as well as the very recent re-emergence of Hendra virus, has confirmed the importance of developing effective therapeutic interventions. We have previously shown that peptides corresponding to the C-terminal heptad repeat (HR-2 of the fusion envelope glycoprotein of Hendra virus and Nipah virus were potent inhibitors of both Hendra virus and Nipah virus-mediated membrane fusion using recombinant expression systems. In the current study, we have developed shorter, second generation HR-2 peptides which include a capped peptide via amidation and acetylation and two poly(ethylene glycol-linked (PEGylated peptides, one with the PEG moity at the C-terminus and the other at the N-terminus. Here, we have evaluated these peptides as well as the corresponding scrambled peptide controls in Nipah virus and Hendra virus-mediated membrane fusion and against infection by live virus in vitro. Results Unlike their predecessors, the second generation HR-2 peptides exhibited high solubility and improved synthesis yields. Importantly, both Nipah virus and Hendra virus-mediated fusion as well as live virus infection were potently inhibited by both capped and PEGylated peptides with IC50 concentrations similar to the original HR-2 peptides, whereas the scrambled modified peptides had no inhibitory effect. These data also indicate that these chemical modifications did not alter the functional properties of the peptides as inhibitors. Conclusion Nipah virus and Hendra virus infection in vitro can be potently blocked by specific HR-2 peptides. The improved synthesis and solubility characteristics of the second generation HR-2 peptides will facilitate peptide synthesis for pre

  1. Host cell recognition by the henipaviruses: Crystal structures of the Nipah G attachment glycoprotein and its complex with ephrin-B3

    Energy Technology Data Exchange (ETDEWEB)

    Xu, Kai; Rajashankar, Kanagalaghatta R.; Chan, Yee-Peng; Himanen, Juha P.; Broder, Christopher C.; Nikolov, Dimitar B. (USUHS); (Cornell); (MSKCC)

    2008-07-28

    Nipah virus (NiV) and Hendra virus are the type species of the highly pathogenic paramyxovirus genus Henipavirus, which can cause severe respiratory disease and fatal encephalitis infections in humans, with case fatality rates approaching 75%. NiV contains two envelope glycoproteins, the receptor-binding G glycoprotein (NiV-G) that facilitates attachment to host cells and the fusion (F) glycoprotein that mediates membrane merger. The henipavirus G glycoproteins lack both hemagglutinating and neuraminidase activities and, instead, engage the highly conserved ephrin-B2 and ephrin-B3 cell surface proteins as their entry receptors. Here, we report the crystal structures of the NiV-G both in its receptor-unbound state and in complex with ephrin-B3, providing, to our knowledge, the first view of a paramyxovirus attachment complex in which a cellular protein is used as the virus receptor. Complex formation generates an extensive protein-protein interface around a protruding ephrin loop, which is inserted in the central cavity of the NiV-G {beta}-propeller. Analysis of the structural data reveals the molecular basis for the highly specific interactions of the henipavirus G glycoproteins with only two members (ephrin-B2 and ephrin-B3) of the very large ephrin family and suggests how they mediate in a unique fashion both cell attachment and the initiation of membrane fusion during the virus infection processes. The structures further suggest that the NiV-G/ephrin interactions can be effectively targeted to disrupt viral entry and provide the foundation for structure-based antiviral drug design.

  2. Potent Human Monoclonal Antibodies against SARS CoV, Nipah and Hendra Viruses

    Science.gov (United States)

    Prabakaran, Ponraj; Zhongyu, Zhu; Xiao, Xiaodong; Biragyn, Arya; Dimitrov, Antony S.; Broder, Christopher C.; Dimitrov, Dimiter S.

    2009-01-01

    Polyclonal antibodies have a century-old history of being effective against some viruses; recently, monoclonal antibodies (mAbs) have also shown success. The humanized mAb Synagis (palivizumab) remains still the only mAb against respiratory syncytial virus (RSV) infections approved by the U.S. Food and Drug Administration (FDA). Recently, several potent human monoclonal antibodies (hmAbs) targeting the Severe Acute Respiratory Syndrome-Associated coronavirus (SARS CoV) S glycoproteins were developed quickly after the virus was identified in 2003. Among these antibodies, m396 and S230.15 exhibit exceptional potency and cross-reactivity as they neutralize isolates from the first and second outbreaks and from palm civets both in vitroand in mice. Similarly, the first fully hmAbs against two other paramyxoviruses, Hendra virus (HeV) and Nipah virus (NiV), which can cause up to 75% mortality, were recently developed; one of them, m102.4, shows exceptional cross-reactive potency against both NiV and HeV. Three-dimensional molecular structures of envelope glycoproteins from these viruses in complexes with antibodies and/or receptors were recently determined. Structural analyses along with other experiments have provided insights into the molecular mechanisms of receptor recognition and antibody neutralization, and suggested that these antibodies alone or in combination could successfully fight the viruses’ heterogeneity and mutability which is a major problem in the development of effective therapeutic agents against viruses, including therapeutic antibodies. PMID:19216624

  3. Unraveling a three-step spatiotemporal mechanism of triggering of receptor-induced Nipah virus fusion and cell entry.

    Directory of Open Access Journals (Sweden)

    Qian Liu

    Full Text Available Membrane fusion is essential for entry of the biomedically-important paramyxoviruses into their host cells (viral-cell fusion, and for syncytia formation (cell-cell fusion, often induced by paramyxoviral infections [e.g. those of the deadly Nipah virus (NiV]. For most paramyxoviruses, membrane fusion requires two viral glycoproteins. Upon receptor binding, the attachment glycoprotein (HN/H/G triggers the fusion glycoprotein (F to undergo conformational changes that merge viral and/or cell membranes. However, a significant knowledge gap remains on how HN/H/G couples cell receptor binding to F-triggering. Via interdisciplinary approaches we report the first comprehensive mechanism of NiV membrane fusion triggering, involving three spatiotemporally sequential cell receptor-induced conformational steps in NiV-G: two in the head and one in the stalk. Interestingly, a headless NiV-G mutant was able to trigger NiV-F, and the two head conformational steps were required for the exposure of the stalk domain. Moreover, the headless NiV-G prematurely triggered NiV-F on virions, indicating that the NiV-G head prevents premature triggering of NiV-F on virions by concealing a F-triggering stalk domain until the correct time and place: receptor-binding. Based on these and recent paramyxovirus findings, we present a comprehensive and fundamentally conserved mechanistic model of paramyxovirus membrane fusion triggering and cell entry.

  4. The distribution of henipaviruses in Southeast Asia and Australasia: is Wallace's line a barrier to Nipah virus?

    Directory of Open Access Journals (Sweden)

    Andrew C Breed

    Full Text Available Nipah virus (NiV (Genus Henipavirus is a recently emerged zoonotic virus that causes severe disease in humans and has been found in bats of the genus Pteropus. Whilst NiV has not been detected in Australia, evidence for NiV-infection has been found in pteropid bats in some of Australia's closest neighbours. The aim of this study was to determine the occurrence of henipaviruses in fruit bat (Family Pteropodidae populations to the north of Australia. In particular we tested the hypothesis that Nipah virus is restricted to west of Wallace's Line. Fruit bats from Australia, Papua New Guinea, East Timor and Indonesia were tested for the presence of antibodies to Hendra virus (HeV and Nipah virus, and tested for the presence of HeV, NiV or henipavirus RNA by PCR. Evidence was found for the presence of Nipah virus in both Pteropus vampyrus and Rousettus amplexicaudatus populations from East Timor. Serology and PCR also suggested the presence of a henipavirus that was neither HeV nor NiV in Pteropus alecto and Acerodon celebensis. The results demonstrate the presence of NiV in the fruit bat populations on the eastern side of Wallace's Line and within 500 km of Australia. They indicate the presence of non-NiV, non-HeV henipaviruses in fruit bat populations of Sulawesi and Sumba and possibly in Papua New Guinea. It appears that NiV is present where P. vampyrus occurs, such as in the fruit bat populations of Timor, but where this bat species is absent other henipaviruses may be present, as on Sulawesi and Sumba. Evidence was obtained for the presence henipaviruses in the non-Pteropid species R. amplexicaudatus and in A. celebensis. The findings of this work fill some gaps in knowledge in geographical and species distribution of henipaviruses in Australasia which will contribute to planning of risk management and surveillance activities.

  5. The distribution of henipaviruses in Southeast Asia and Australasia: is Wallace's line a barrier to Nipah virus?

    Science.gov (United States)

    Breed, Andrew C; Meers, Joanne; Sendow, Indrawati; Bossart, Katharine N; Barr, Jennifer A; Smith, Ina; Wacharapluesadee, Supaporn; Wang, Linfa; Field, Hume E

    2013-01-01

    Nipah virus (NiV) (Genus Henipavirus) is a recently emerged zoonotic virus that causes severe disease in humans and has been found in bats of the genus Pteropus. Whilst NiV has not been detected in Australia, evidence for NiV-infection has been found in pteropid bats in some of Australia's closest neighbours. The aim of this study was to determine the occurrence of henipaviruses in fruit bat (Family Pteropodidae) populations to the north of Australia. In particular we tested the hypothesis that Nipah virus is restricted to west of Wallace's Line. Fruit bats from Australia, Papua New Guinea, East Timor and Indonesia were tested for the presence of antibodies to Hendra virus (HeV) and Nipah virus, and tested for the presence of HeV, NiV or henipavirus RNA by PCR. Evidence was found for the presence of Nipah virus in both Pteropus vampyrus and Rousettus amplexicaudatus populations from East Timor. Serology and PCR also suggested the presence of a henipavirus that was neither HeV nor NiV in Pteropus alecto and Acerodon celebensis. The results demonstrate the presence of NiV in the fruit bat populations on the eastern side of Wallace's Line and within 500 km of Australia. They indicate the presence of non-NiV, non-HeV henipaviruses in fruit bat populations of Sulawesi and Sumba and possibly in Papua New Guinea. It appears that NiV is present where P. vampyrus occurs, such as in the fruit bat populations of Timor, but where this bat species is absent other henipaviruses may be present, as on Sulawesi and Sumba. Evidence was obtained for the presence henipaviruses in the non-Pteropid species R. amplexicaudatus and in A. celebensis. The findings of this work fill some gaps in knowledge in geographical and species distribution of henipaviruses in Australasia which will contribute to planning of risk management and surveillance activities.

  6. The Nature of Exposure Drives Transmission of Nipah Viruses from Malaysia and Bangladesh in Ferrets.

    Directory of Open Access Journals (Sweden)

    Bronwyn A Clayton

    2016-06-01

    Full Text Available Person-to-person transmission is a key feature of human Nipah virus outbreaks in Bangladesh. In contrast, in an outbreak of Nipah virus in Malaysia, people acquired infections from pigs. It is not known whether this important epidemiological difference is driven primarily by differences between NiV Bangladesh (NiV-BD and Malaysia (NiV-MY at a virus level, or by environmental or host factors. In a time course study, ferrets were oronasally exposed to equivalent doses of NiV-BD or NiV-MY. More rapid onset of productive infection and higher levels of virus replication in respiratory tract tissues were seen for NiV-BD compared to NiV-MY, corroborating our previous report of increased oral shedding of NiV-BD in ferrets and suggesting a contributory mechanism for increased NiV-BD transmission between people compared to NiV-MY. However, we recognize that transmission occurs within a social and environmental framework that may have an important and differentiating role in NiV transmission rates. With this in mind, ferret-to-ferret transmission of NiV-BD and NiV-MY was assessed under differing viral exposure conditions. Transmission was not identified for either virus when naïve ferrets were cohoused with experimentally-infected animals. In contrast, all naïve ferrets developed acute infection following assisted and direct exposure to oronasal fluid from animals that were shedding either NiV-BD or NiV-MY. Our findings for ferrets indicate that, although NiV-BD may be shed at higher levels than NiV-MY, transmission risk may be equivalently low under exposure conditions provided by cohabitation alone. In contrast, active transfer of infected bodily fluids consistently results in transmission, regardless of the virus strain. These observations suggest that the risk of NiV transmission is underpinned by social and environmental factors, and will have practical implications for managing transmission risk during outbreaks of human disease.

  7. Hendra and Nipah Virus Infection in Cultured Human Olfactory Epithelial Cells.

    Science.gov (United States)

    Borisevich, Viktoriya; Ozdener, Mehmet Hakan; Malik, Bilal; Rockx, Barry

    2017-01-01

    Henipaviruses are emerging zoonotic viruses and causative agents of encephalitis in humans. However, the mechanisms of entry into the central nervous system (CNS) in humans are not known. Here, we evaluated the possible role of olfactory epithelium in virus entry into the CNS. We characterized Hendra virus (HeV) and Nipah virus (NiV) infection of primary human olfactory epithelial cultures. We show that henipaviruses can infect mature olfactory sensory neurons. Henipaviruses replicated efficiently, resulting in cytopathic effect and limited induction of host responses. These results show that human olfactory epithelium is susceptible to infection with henipaviruses, suggesting that this could be a pathway for neuroinvasion in humans. IMPORTANCE Henipaviruses are emerging zoonotic pathogens that can cause acute and severe respiratory and neurological disease in humans. The pathways by which henipaviruses enter the central nervous system (CNS) in humans are still unknown. The observation that human olfactory neurons are highly susceptible to infection with henipaviruses demonstrates that the olfactory epithelium can serve as a site of Henipavirus entry into the CNS.

  8. Microsphere Suspension Array Assays for Detection and Differentiation of Hendra and Nipah Viruses

    Directory of Open Access Journals (Sweden)

    Adam J. Foord

    2013-01-01

    Full Text Available Microsphere suspension array systems enable the simultaneous fluorescent identification of multiple separate nucleotide targets in a single reaction. We have utilized commercially available oligo-tagged microspheres (Luminex MagPlex-TAG to construct and evaluate multiplexed assays for the detection and differentiation of Hendra virus (HeV and Nipah virus (NiV. Both these agents are bat-borne zoonotic paramyxoviruses of increasing concern for veterinary and human health. Assays were developed targeting multiple sites within the nucleoprotein (N and phosphoprotein (P encoding genes. The relative specificities and sensitivities of the assays were determined using reference isolates of each virus type, samples from experimentally infected horses, and archival veterinary diagnostic submissions. Results were assessed in direct comparison with an established qPCR. The microsphere array assays achieved unequivocal differentiation of HeV and NiV and the sensitivity of HeV detection was comparable to qPCR, indicating high analytical and diagnostic specificity and sensitivity.

  9. Inhibition of Nipah Virus Infectin In Vivo: Targeting an Early Stage of Paramyxovirus Fusion Activation during Viral Entry

    Energy Technology Data Exchange (ETDEWEB)

    M Porotto; B Rockx; C Yokoyama; A Talekar; I DeVito; l Palermo; J Liu; R Cortese; M Lu; et al.

    2011-12-31

    In the paramyxovirus cell entry process, receptor binding triggers conformational changes in the fusion protein (F) leading to viral and cellular membrane fusion. Peptides derived from C-terminal heptad repeat (HRC) regions in F have been shown to inhibit fusion by preventing formation of the fusogenic six-helix bundle. We recently showed that the addition of a cholesterol group to HRC peptides active against Nipah virus targets these peptides to the membrane where fusion occurs, dramatically increasing their antiviral effect. In this work, we report that unlike the untagged HRC peptides, which bind to the postulated extended intermediate state bridging the viral and cell membranes, the cholesterol tagged HRC-derived peptides interact with F before the fusion peptide inserts into the target cell membrane, thus capturing an earlier stage in the F-activation process. Furthermore, we show that cholesterol tagging renders these peptides active in vivo: the cholesterol-tagged peptides cross the blood brain barrier, and effectively prevent and treat in an established animal model what would otherwise be fatal Nipah virus encephalitis. The in vivo efficacy of cholesterol-tagged peptides, and in particular their ability to penetrate the CNS, suggests that they are promising candidates for the prevention or therapy of infection by Nipah and other lethal paramyxoviruses.

  10. Nipah virus infects specific subsets of porcine peripheral blood mononuclear cells.

    Directory of Open Access Journals (Sweden)

    Beata Stachowiak

    Full Text Available Nipah virus (NiV, a zoonotic paramyxovirus, is highly contagious in swine, and can cause fatal infections in humans following transmission from the swine host. The main viral targets in both species are the respiratory and central nervous systems, with viremia implicated as a mode of dissemination of NiV throughout the host. The presented work focused on the role of peripheral blood mononuclear cells (PBMC in the viremic spread of the virus in the swine host. B lymphocytes, CD4-CD8-, as well as CD4+CD8- T lymphocytes were not permissive to NiV, and expansion of the CD4+CD8- cells early post infection was consistent with functional humoral response to NiV infection observed in swine. In contrast, significant drop in the CD4+CD8- T cell frequency was observed in piglets which succumbed to the experimental infection, supporting the hypothesis that antibody development is the critical component of the protective immune response. Productive viral replication was detected in monocytes, CD6+CD8+ T lymphocytes and NK cells by recovery of infectious virus in the cell supernatants. Virus replication was supported by detection of the structural N and the non-structural C proteins or by detection of genomic RNA increase in the infected cells. Infection of T cells carrying CD6 marker, a strong ligand for the activated leukocyte cell adhesion molecule ALCAM (CD166 highly expressed on the microvascular endothelial cell of the blood-air and the blood-brain barrier may explain NiV preferential tropism for small blood vessels of the lung and brain.

  11. Nipah virus infects specific subsets of porcine peripheral blood mononuclear cells.

    Science.gov (United States)

    Stachowiak, Beata; Weingartl, Hana M

    2012-01-01

    Nipah virus (NiV), a zoonotic paramyxovirus, is highly contagious in swine, and can cause fatal infections in humans following transmission from the swine host. The main viral targets in both species are the respiratory and central nervous systems, with viremia implicated as a mode of dissemination of NiV throughout the host. The presented work focused on the role of peripheral blood mononuclear cells (PBMC) in the viremic spread of the virus in the swine host. B lymphocytes, CD4-CD8-, as well as CD4+CD8- T lymphocytes were not permissive to NiV, and expansion of the CD4+CD8- cells early post infection was consistent with functional humoral response to NiV infection observed in swine. In contrast, significant drop in the CD4+CD8- T cell frequency was observed in piglets which succumbed to the experimental infection, supporting the hypothesis that antibody development is the critical component of the protective immune response. Productive viral replication was detected in monocytes, CD6+CD8+ T lymphocytes and NK cells by recovery of infectious virus in the cell supernatants. Virus replication was supported by detection of the structural N and the non-structural C proteins or by detection of genomic RNA increase in the infected cells. Infection of T cells carrying CD6 marker, a strong ligand for the activated leukocyte cell adhesion molecule ALCAM (CD166) highly expressed on the microvascular endothelial cell of the blood-air and the blood-brain barrier may explain NiV preferential tropism for small blood vessels of the lung and brain.

  12. The YPLGVG sequence of the Nipah virus matrix protein is required for budding

    Directory of Open Access Journals (Sweden)

    Yan Lianying

    2008-11-01

    Full Text Available Abstract Background Nipah virus (NiV is a recently emerged paramyxovirus capable of causing fatal disease in a broad range of mammalian hosts, including humans. Together with Hendra virus (HeV, they comprise the genus Henipavirus in the family Paramyxoviridae. Recombinant expression systems have played a crucial role in studying the cell biology of these Biosafety Level-4 restricted viruses. Henipavirus assembly and budding occurs at the plasma membrane, although the details of this process remain poorly understood. Multivesicular body (MVB proteins have been found to play a role in the budding of several enveloped viruses, including some paramyxoviruses, and the recruitment of MVB proteins by viral proteins possessing late budding domains (L-domains has become an important concept in the viral budding process. Previously we developed a system for producing NiV virus-like particles (VLPs and demonstrated that the matrix (M protein possessed an intrinsic budding ability and played a major role in assembly. Here, we have used this system to further explore the budding process by analyzing elements within the M protein that are critical for particle release. Results Using rationally targeted site-directed mutagenesis we show that a NiV M sequence YPLGVG is required for M budding and that mutation or deletion of the sequence abrogates budding ability. Replacement of the native and overlapping Ebola VP40 L-domains with the NiV sequence failed to rescue VP40 budding; however, it did induce the cellular morphology of extensive filamentous projection consistent with wild-type VP40-expressing cells. Cells expressing wild-type NiV M also displayed this morphology, which was dependent on the YPLGVG sequence, and deletion of the sequence also resulted in nuclear localization of M. Dominant-negative VPS4 proteins had no effect on NiV M budding, suggesting that unlike other viruses such as Ebola, NiV M accomplishes budding independent of MVB cellular proteins

  13. Molecular characterization of Nipah virus from Pteropus hypomelanus in Southern Thailand.

    Science.gov (United States)

    Wacharapluesadee, Supaporn; Samseeneam, Panumas; Phermpool, Mana; Kaewpom, Thongchai; Rodpan, Apaporn; Maneeorn, Pattarapol; Srongmongkol, Phimchanok; Kanchanasaka, Budsabong; Hemachudha, Thiravat

    2016-03-25

    Nipah virus (NiV) first emerged in Malaysia in 1998, with two bat species (Pteropus hypomelanus and P. vampyrus) as the putative natural reservoirs. In 2002, NiV IgG antibodies were detected in these species from Thailand, but viral RNA could not be detected for strain characterization. Two strains of NiV (Malaysia and Bangladesh) have been found in P. lylei in central Thailand, although Bangladesh strain, the causative strain for the outbreak in Bangladesh since 2001, was dominant. To understand the diversity of NiV in Thailand, this study identified NiV strain, using molecular characterizations, from P. hypomelanus in southern Thailand. Pooled bat urine specimens were collected from plastic sheet underneath bat roosts in April 2010, and then monthly from December 2010 to May 2011 at an island in southern Thailand. Five in 184 specimens were positive for NiV, using duplex nested RT-PCR assay on partial nucleocapsid fragment (357 bp). Whole sequences of nucleocapsid gene from four bats were characterized. All 5 partial fragments and 4 whole nucleocapsid genes formed a monophyletic with NiV-MY. Our study showed that P. hypomelanus in southern Thailand and from Malaysia, a bordering country, harbored similar NiV. This finding indicates that NiV is not limited to central Thailand or P. lylei species, and it may be a source of inter-species transmission. This indicates a higher potential for a widespread NiV outbreak in Thailand. NiV surveillance in Pteropus bats, the major natural reservoirs, should be conducted continuously in countries or regions with high susceptibility to outbreaks.

  14. Nipah Virus Transmission from Bats to Humans Associated with Drinking Traditional Liquor Made from Date Palm Sap, Bangladesh, 2011–2014

    Centers for Disease Control (CDC) Podcasts

    2016-06-30

    Sarah Gregory reads an abridged version of the article, Nipah Virus Transmission from Bats to Humans Associated with Drinking Traditional Liquor Made from Date Palm Sap, Bangladesh, 2011–2014.  Created: 6/30/2016 by National Center for Emerging and Zoonotic Infectious Diseases (NCEZID).   Date Released: 6/30/2016.

  15. Dimeric architecture of the Hendra virus attachment glycoprotein: evidence for a conserved mode of assembly.

    Science.gov (United States)

    Bowden, Thomas A; Crispin, Max; Harvey, David J; Jones, E Yvonne; Stuart, David I

    2010-06-01

    Hendra virus is a negative-sense single-stranded RNA virus within the Paramyxoviridae family which, together with Nipah virus, forms the Henipavirus genus. Infection with bat-borne Hendra virus leads to a disease with high mortality rates in humans. We determined the crystal structure of the unliganded six-bladed beta-propeller domain and compared it to the previously reported structure of Hendra virus attachment glycoprotein (HeV-G) in complex with its cellular receptor, ephrin-B2. As observed for the related unliganded Nipah virus structure, there is plasticity in the Glu579-Pro590 and Lys236-Ala245 ephrin-binding loops prior to receptor engagement. These data reveal that henipaviral attachment glycoproteins undergo common structural transitions upon receptor binding and further define the structural template for antihenipaviral drug design. Our analysis also provides experimental evidence for a dimeric arrangement of HeV-G that exhibits striking similarity to those observed in crystal structures of related paramyxovirus receptor-binding glycoproteins. The biological relevance of this dimer is further supported by the positional analysis of glycosylation sites from across the paramyxoviruses. In HeV-G, the sites lie away from the putative dimer interface and remain accessible to alpha-mannosidase processing on oligomerization. We therefore propose that the overall mode of dimer assembly is conserved for all paramyxoviruses; however, while the geometry of dimerization is rather closely similar for those viruses that bind flexible glycan receptors, significant (up to 60 degrees ) and different reconfigurations of the subunit packing (associated with a significant decrease in the size of the dimer interface) have accompanied the independent switching to high-affinity protein receptor binding in Hendra and measles viruses.

  16. Agricultural intensification, priming for persistence and the emergence of Nipah virus: a lethal bat-borne zoonosis.

    Science.gov (United States)

    Pulliam, Juliet R C; Epstein, Jonathan H; Dushoff, Jonathan; Rahman, Sohayati A; Bunning, Michel; Jamaluddin, Aziz A; Hyatt, Alex D; Field, Hume E; Dobson, Andrew P; Daszak, Peter

    2012-01-07

    Emerging zoonoses threaten global health, yet the processes by which they emerge are complex and poorly understood. Nipah virus (NiV) is an important threat owing to its broad host and geographical range, high case fatality, potential for human-to-human transmission and lack of effective prevention or therapies. Here, we investigate the origin of the first identified outbreak of NiV encephalitis in Malaysia and Singapore. We analyse data on livestock production from the index site (a commercial pig farm in Malaysia) prior to and during the outbreak, on Malaysian agricultural production, and from surveys of NiV's wildlife reservoir (flying foxes). Our analyses suggest that repeated introduction of NiV from wildlife changed infection dynamics in pigs. Initial viral introduction produced an explosive epizootic that drove itself to extinction but primed the population for enzootic persistence upon reintroduction of the virus. The resultant within-farm persistence permitted regional spread and increased the number of human infections. This study refutes an earlier hypothesis that anomalous El Niño Southern Oscillation-related climatic conditions drove emergence and suggests that priming for persistence drove the emergence of a novel zoonotic pathogen. Thus, we provide empirical evidence for a causative mechanism previously proposed as a precursor to widespread infection with H5N1 avian influenza and other emerging pathogens.

  17. Transcriptome Profiling of the Virus-Induced Innate Immune Response in Pteropus vampyrus and Its Attenuation by Nipah Virus Interferon Antagonist Functions.

    Science.gov (United States)

    Glennon, Nicole B; Jabado, Omar; Lo, Michael K; Shaw, Megan L

    2015-08-01

    Bats are important reservoirs for several viruses, many of which cause lethal infections in humans but have reduced pathogenicity in bats. As the innate immune response is critical for controlling viruses, the nature of this response in bats and how it may differ from that in other mammals are of great interest. Using next-generation transcriptome sequencing (mRNA-seq), we profiled the transcriptional response of Pteropus vampyrus bat kidney (PVK) cells to Newcastle disease virus (NDV), an avian paramyxovirus known to elicit a strong innate immune response in mammalian cells. The Pteropus genus is a known reservoir of Nipah virus (NiV) and Hendra virus (HeV). Analysis of the 200 to 300 regulated genes showed that genes for interferon (IFN) and antiviral pathways are highly upregulated in NDV-infected PVK cells, including genes for beta IFN, RIG-I, MDA5, ISG15, and IRF1. NDV-infected cells also upregulated several genes not previously characterized to be antiviral, such as RND1, SERTAD1, CHAC1, and MORC3. In fact, we show that MORC3 is induced by both IFN and NDV infection in PVK cells but is not induced by either stimulus in human A549 cells. In contrast to NDV infection, HeV and NiV infection of PVK cells failed to induce these innate immune response genes. Likewise, an attenuated response was observed in PVK cells infected with recombinant NDVs expressing the NiV IFN antagonist proteins V and W. This study provides the first global profile of a robust virus-induced innate immune response in bats and indicates that henipavirus IFN antagonist mechanisms are likely active in bat cells. Bats are the reservoir host for many highly pathogenic human viruses, including henipaviruses, lyssaviruses, severe acute respiratory syndrome coronavirus, and filoviruses, and many other viruses have also been isolated from bats. Viral infections are reportedly asymptomatic or heavily attenuated in bat populations. Despite their ecological importance to viral maintenance, research

  18. The Matrix Protein of Nipah Virus Targets the E3-Ubiquitin Ligase TRIM6 to Inhibit the IKKε Kinase-Mediated Type-I IFN Antiviral Response.

    Directory of Open Access Journals (Sweden)

    Preeti Bharaj

    2016-09-01

    Full Text Available For efficient replication, viruses have developed mechanisms to evade innate immune responses, including the antiviral type-I interferon (IFN-I system. Nipah virus (NiV, a highly pathogenic member of the Paramyxoviridae family (genus Henipavirus, is known to encode for four P gene-derived viral proteins (P/C/W/V with IFN-I antagonist functions. Here we report that NiV matrix protein (NiV-M, which is important for virus assembly and budding, can also inhibit IFN-I responses. IFN-I production requires activation of multiple signaling components including the IκB kinase epsilon (IKKε. We previously showed that the E3-ubiquitin ligase TRIM6 catalyzes the synthesis of unanchored K48-linked polyubiquitin chains, which are not covalently attached to any protein, and activate IKKε for induction of IFN-I mediated antiviral responses. Using co-immunoprecipitation assays and confocal microscopy we show here that the NiV-M protein interacts with TRIM6 and promotes TRIM6 degradation. Consequently, NiV-M expression results in reduced levels of unanchored K48-linked polyubiquitin chains associated with IKKε leading to impaired IKKε oligomerization, IKKε autophosphorylation and reduced IFN-mediated responses. This IFN antagonist function of NiV-M requires a conserved lysine residue (K258 in the bipartite nuclear localization signal that is found in divergent henipaviruses. Consistent with this, the matrix proteins of Ghana, Hendra and Cedar viruses were also able to inhibit IFNβ induction. Live NiV infection, but not a recombinant NiV lacking the M protein, reduced the levels of endogenous TRIM6 protein expression. To our knowledge, matrix proteins of paramyxoviruses have never been reported to be involved in innate immune antagonism. We report here a novel mechanism of viral innate immune evasion by targeting TRIM6, IKKε and unanchored polyubiquitin chains. These findings expand the universe of viral IFN antagonism strategies and provide a new

  19. Raw Sap Consumption Habits and Its Association with Knowledge of Nipah Virus in Two Endemic Districts in Bangladesh.

    Science.gov (United States)

    Nahar, Nazmun; Paul, Repon C; Sultana, Rebeca; Gurley, Emily S; Garcia, Fernando; Abedin, Jaynal; Sumon, Shariful Amin; Banik, Kajal Chandra; Asaduzzaman, Mohammad; Rimi, Nadia Ali; Rahman, Mahmudur; Luby, Stephen P

    2015-01-01

    Human Nipah virus (NiV) infection in Bangladesh is a fatal disease that can be transmitted from bats to humans who drink contaminated raw date palm sap collected overnight during the cold season. Our study aimed to understand date palm sap consumption habits of rural residents and factors associated with consumption. In November-December 2012 the field team interviewed adult respondents from randomly selected villages from Rajbari and Kushtia Districts in Bangladesh. We calculated the proportion of people who consumed raw sap and had heard about a disease from raw sap consumption. We assessed the factors associated with raw sap consumption by calculating prevalence ratios (PR) adjusted for village level clustering effects. Among the 1,777 respondents interviewed, half (50%) reported drinking raw sap during the previous sap collection season and 37% consumed raw sap at least once per month. Few respondents (5%) heard about NiV. Thirty-seven percent of respondents reported hearing about a disease transmitted through raw sap consumption, inclusive of a 10% who related it with milder illness like diarrhea, vomiting or indigestion rather than NiV. Respondents who harvested date palm trees in their household were more likely to drink sap than those who did not own date palm trees (79% vs. 65% PR 1.2, 95% CI 1.1-1.3, psap was available, respondents who heard about a disease from raw sap consumption were just as likely to drink it as those who did not hear about a disease (69% vs. 67%, PR 1.0, 95% CI 0.9-1.1, p = 0.512). Respondents' knowledge of NiV was low. They might not have properly understood the risk of NiV, and were likely to drink sap when it was available. Implementing strategies to increase awareness about the risks of NiV and protect sap from bats might reduce the risk of NiV transmission.

  20. Hendra and Nipah virus infection in cultured human olfactory epithelial cells

    NARCIS (Netherlands)

    Borisevich, V. (Viktoriya); Ozdener, M.H. (Mehmet Hakan); Malik, B. (Bilal); B. Rockx (Barry)

    2017-01-01

    textabstractHenipaviruses are emerging zoonotic viruses and causative agents of encephalitis in humans. However, the mechanisms of entry into the central nervous system (CNS) in humans are not known. Here, we evaluated the possible role of olfactory epithelium in virus entry into the CNS. We

  1. Development and validation of a chemiluminescent immunodetection assay amenable to high throughput screening of antiviral drugs for Nipah and Hendra virus.

    Science.gov (United States)

    Aljofan, Mohamad; Porotto, Matteo; Moscona, Anne; Mungall, Bruce A

    2008-04-01

    There are currently no antiviral drugs approved for the highly lethal Biosafety Level 4 pathogens Nipah and Hendra virus. A number of researchers are developing surrogate assays amenable to Biosafety Level 2 biocontainment but ultimately, the development of a high throughput screening method for directly quantifying these viruses in a Biosafety Level 4 environment will be critical for final evaluation of antiviral drugs identified in surrogate assays, in addition to reducing the time required for effective antiviral drug development. By adapting an existing immunoplaque assay and using enzyme linked immunodetection in a microtitre plate format, the current experiments describe a simple two step assay protocol involving an overnight virus inoculation of Vero cell monolayers (with or without antiviral drug treatment) at Biosafety Level 4, followed by cell fixation and virus inactivation enabling removal of plates from the Biosafety Level 4 laboratory and a subsequent immunodetection assay using a chemiluminescent horse radish peroxidase substrate to be performed at Biosafety Level 2. The analytical sensitivity (limit of detection) of this assay is 100 tissue culture infectious dose50/ml of either Nipah or Hendra virus. In addition this assay enables linear quantitation of virus over three orders of magnitude and is unaffected by dimethyl sulfoxide concentrations of 1% or less. Intra-assay coefficients of variation are acceptable (less than 20%) when detecting a minimum of 1000 tissue culture infectious dose50/ml of either virus although inter-assay variation is considerably greater. By an assessment of efficacies of the broad spectrum antiviral Ribavirin and an experimental fusion inhibitory peptide, this assay reveals a good correlation with previously published fluorescent immunodetection assays. The current experiments describe for the first time, a high throughput screening method amenable for direct assessment of live henipavirus antiviral drug activity.

  2. In silico identification and characterization of common epitope-based peptide vaccine for Nipah and Hendra viruses.

    Science.gov (United States)

    Saha, Chayan Kumar; Mahbub Hasan, Md; Saddam Hossain, Md; Asraful Jahan, Md; Azad, Abul Kalam

    2017-06-01

    To explore a common B- and T-cell epitope-based vaccine that can elicit an immune response against encephalitis causing genus Henipaviruses, Hendra virus (HeV) and Nipah virus (NiV). Membrane proteins F, G and M of HeV and NiV were retrieved from the protein database and subjected to different bioinformatics tools to predict antigenic B-cell epitopes. Best B-cell epitopes were then analyzed to predict their T-cell antigenic potentiality. Antigenic B- and T-cell epitopes that shared maximum identity with HeV and NiV were selected. Stability of the selected epitopes was predicted. Finally, the selected epitopes were subjected to molecular docking simulation with HLA-DR to confirm their antigenic potentiality in silico. One epitope from G proteins, one from M proteins and none from F proteins were selected based on their antigenic potentiality. The epitope from the G proteins was stable whereas that from M was unstable. The M-epitope was made stable by adding flanking dipeptides. The 15-mer G-epitope (VDPLRVQWRNNSVIS) showed at least 66% identity with all NiV and HeV G protein sequences, while the 15-mer M-epitope (GKLEFRRNNAIAFKG) with the dipeptide flanking residues showed 73% identity with all NiV and HeV M protein sequences available in the database. Molecular docking simulation with most frequent MHC class-II (MHC II) and class-I (MHC I) molecules showed that these epitopes could bind within HLA binding grooves to elicit an immune response. Data in our present study revealed the notion that the epitopes from G and M proteins might be the target for peptide-based subunit vaccine design against HeV and NiV. However, the biochemical analysis is necessary to experimentally validate the interaction of epitopes individually with the MHC molecules through elucidation of immunity induction. Copyright © 2017 Hainan Medical University. Production and hosting by Elsevier B.V. All rights reserved.

  3. A Randomized Controlled Trial of Interventions to Impede Date Palm Sap Contamination by Bats to Prevent Nipah Virus Transmission in Bangladesh

    Science.gov (United States)

    Khan, Salah Uddin; Gurley, Emily S.; Hossain, M. Jahangir; Nahar, Nazmun; Sharker, M. A. Yushuf; Luby, Stephen P.

    2012-01-01

    Background Drinking raw date palm sap is a risk factor for human Nipah virus (NiV) infection. Fruit bats, the natural reservoir of NiV, commonly contaminate raw sap with saliva by licking date palm’s sap producing surface. We evaluated four types of physical barriers that may prevent bats from contacting sap. Methods During 2009, we used a crossover design and randomly selected 20 date palm sap producing trees and observed each tree for 2 nights: one night with a bamboo skirt intervention applied and one night without the intervention. During 2010, we selected 120 trees and randomly assigned four types of interventions to 15 trees each: bamboo, dhoincha (local plant), jute stick and polythene skirts covering the shaved part, sap stream, tap and collection pot. We enrolled the remaining 60 trees as controls. We used motion sensor activated infrared cameras to examine bat contact with sap. Results During 2009 bats contacted date palm sap in 85% of observation nights when no intervention was used compared with 35% of nights when the intervention was used [psap when the skirt did not entirely cover the sap producing surface. Therefore, in 2010 we requested the sap harvesters to use larger skirts. During 2010 bats contacted date palm sap [2% vs. 83%, psap in trees with bamboo (psap during one night (7%) with the jute stick skirt (psap producing areas of a tree effectively prevented bat-sap contact. Community interventions should promote applying these skirts to prevent occasional Nipah spillovers to human. PMID:22905160

  4. Efficient reverse genetics reveals genetic determinants of budding and fusogenic differences between Nipah and Hendra viruses and enables real-time monitoring of viral spread in small animal models of henipavirus infection.

    Science.gov (United States)

    Yun, Tatyana; Park, Arnold; Hill, Terence E; Pernet, Olivier; Beaty, Shannon M; Juelich, Terry L; Smith, Jennifer K; Zhang, Lihong; Wang, Yao E; Vigant, Frederic; Gao, Junling; Wu, Ping; Lee, Benhur; Freiberg, Alexander N

    2015-01-15

    Nipah virus (NiV) and Hendra virus (HeV) are closely related henipaviruses of the Paramyxovirinae. Spillover from their fruit bat reservoirs can cause severe disease in humans and livestock. Despite their high sequence similarity, NiV and HeV exhibit apparent differences in receptor and tissue tropism, envelope-mediated fusogenicity, replicative fitness, and other pathophysiologic manifestations. To investigate the molecular basis for these differences, we first established a highly efficient reverse genetics system that increased rescue titers by ≥3 log units, which offset the difficulty of generating multiple recombinants under constraining biosafety level 4 (BSL-4) conditions. We then replaced, singly and in combination, the matrix (M), fusion (F), and attachment glycoprotein (G) genes in mCherry-expressing recombinant NiV (rNiV) with their HeV counterparts. These chimeric but isogenic rNiVs replicated well in primary human endothelial and neuronal cells, indicating efficient heterotypic complementation. The determinants of budding efficiency, fusogenicity, and replicative fitness were dissociable: HeV-M budded more efficiently than NiV-M, accounting for the higher replicative titers of HeV-M-bearing chimeras at early times, while the enhanced fusogenicity of NiV-G-bearing chimeras did not correlate with increased replicative fitness. Furthermore, to facilitate spatiotemporal studies on henipavirus pathogenesis, we generated a firefly luciferase-expressing NiV and monitored virus replication and spread in infected interferon alpha/beta receptor knockout mice via bioluminescence imaging. While intraperitoneal inoculation resulted in neuroinvasion following systemic spread and replication in the respiratory tract, intranasal inoculation resulted in confined spread to regions corresponding to olfactory bulbs and salivary glands before subsequent neuroinvasion. This optimized henipavirus reverse genetics system will facilitate future investigations into the

  5. Identification of a broad-spectrum antiviral small molecule against severe acute respiratory syndrome coronavirus and Ebola, Hendra, and Nipah viruses by using a novel high-throughput screening assay.

    Science.gov (United States)

    Elshabrawy, Hatem A; Fan, Jilao; Haddad, Christine S; Ratia, Kiira; Broder, Christopher C; Caffrey, Michael; Prabhakar, Bellur S

    2014-04-01

    Severe acute respiratory syndrome coronavirus (SARS-CoV) and Ebola, Hendra, and Nipah viruses are members of different viral families and are known causative agents of fatal viral diseases. These viruses depend on cathepsin L for entry into their target cells. The viral glycoproteins need to be primed by protease cleavage, rendering them active for fusion with the host cell membrane. In this study, we developed a novel high-throughput screening assay based on peptides, derived from the glycoproteins of the aforementioned viruses, which contain the cathepsin L cleavage site. We screened a library of 5,000 small molecules and discovered a small molecule that can inhibit the cathepsin L cleavage of all viral peptides with minimal inhibition of cleavage of a host protein-derived peptide (pro-neuropeptide Y). The small molecule inhibited the entry of all pseudotyped viruses in vitro and the cleavage of SARS-CoV spike glycoprotein in an in vitro cleavage assay. In addition, the Hendra and Nipah virus fusion glycoproteins were not cleaved in the presence of the small molecule in a cell-based cleavage assay. Furthermore, we demonstrate that the small molecule is a mixed inhibitor of cathepsin L. Our broad-spectrum antiviral small molecule appears to be an ideal candidate for future optimization and development into a potent antiviral against SARS-CoV and Ebola, Hendra, and Nipah viruses. We developed a novel high-throughput screening assay to identify small molecules that can prevent cathepsin L cleavage of viral glycoproteins derived from SARS-CoV and Ebola, Hendra, and Nipah viruses that are required for their entry into the host cell. We identified a novel broad-spectrum small molecule that could block cathepsin L-mediated cleavage and thus inhibit the entry of pseudotypes bearing the glycoprotein derived from SARS-CoV or Ebola, Hendra, or Nipah virus. The small molecule can be further optimized and developed into a potent broad-spectrum antiviral drug.

  6. Contribution of Human Lung Parenchyma and Leukocyte Influx to Oxidative Stress and Immune System-Mediated Pathology following Nipah Virus Infection.

    Science.gov (United States)

    Escaffre, Olivier; Saito, Tais B; Juelich, Terry L; Ikegami, Tetsuro; Smith, Jennifer K; Perez, David D; Atkins, Colm; Levine, Corri B; Huante, Matthew B; Nusbaum, Rebecca J; Endsley, Janice J; Freiberg, Alexander N; Rockx, Barry

    2017-08-01

    Nipah virus (NiV) is a zoonotic emerging paramyxovirus that can cause fatal respiratory illness or encephalitis in humans. Despite many efforts, the molecular mechanisms of NiV-induced acute lung injury (ALI) remain unclear. We previously showed that NiV replicates to high titers in human lung grafts in NOD-SCID/γ mice, resulting in a robust inflammatory response. Interestingly, these mice can undergo human immune system reconstitution by the bone marrow, liver, and thymus (BLT) reconstitution method, in addition to lung tissue engraftment, giving altogether a realistic model to study human respiratory viral infections. Here, we characterized NiV Bangladesh strain (NiV-B) infection of human lung grafts from human immune system-reconstituted mice in order to identify the overall effect of immune cells on NiV pathogenesis of the lung. We show that NiV-B replicated to high titers in human lung grafts and caused similar cytopathic effects irrespective of the presence of human leukocytes in mice. However, the human immune system interfered with virus spread across lung grafts, responded to infection by leukocyte migration to small airways and alveoli of the lung grafts, and accelerated oxidative stress in lung grafts. In addition, the presence of human leukocytes increased the expression of cytokines and chemokines that regulate inflammatory influx to sites of infection and tissue damage. These results advance our understanding of how the immune system limits NiV dissemination and contributes to ALI and inform efforts to identify therapeutic targets. IMPORTANCE Nipah virus (NiV) is an emerging paramyxovirus that can cause a lethal respiratory and neurological disease in humans. Only limited data are available on NiV pathogenesis in the human lung, and the relative contribution of the innate immune response and NiV to acute lung injury (ALI) is still unknown. Using human lung grafts in a human immune system-reconstituted mouse model, we showed that the NiV Bangladesh

  7. Piloting the use of indigenous methods to prevent Nipah virus infection by interrupting bats' access to date palm sap in Bangladesh.

    Science.gov (United States)

    Nahar, Nazmun; Mondal, Utpal Kumar; Sultana, Rebeca; Hossain, M Jahangir; Khan, M Salah Uddin; Gurley, Emily S; Oliveras, Elizabeth; Luby, Stephen P

    2013-09-01

    People in Bangladesh frequently drink fresh date palm sap. Fruit bats (Pteropus giganteus) also drink raw sap and may contaminate the sap by shedding Nipah virus through saliva and urine. In a previous study we identified two indigenous methods to prevent bats accessing the sap, bamboo skirts and lime (calcium carbonate). We conducted a pilot study to assess the acceptability of these two methods among sap harvesters. We used interactive community meetings and group discussions to encourage all the sap harvesters (n = 12) from a village to use either bamboo skirts or lime smear that some of them (n = 4) prepared and applied. We measured the preparation and application time and calculated the cost of bamboo skirts. We conducted interviews after the use of each method. The sap harvesters found skirts effective in preventing bats from accessing sap. They were sceptical that lime would be effective as the lime was washed away by the sap flow. Preparation of the skirt took ∼105 min. The application of each method took ∼1 min. The cost of the bamboo skirt is minimal because bamboo is widely available and they made the skirts with pieces of used bamboo. The bamboo skirt method appeared practical and affordable to the sap harvesters. Further studies should explore its ability to prevent bats from accessing date palm sap and assess if its use produces more or better quality sap, which would provide further incentives to make it more acceptable for its regular use.

  8. Endothelial galectin-1 binds to specific glycans on nipah virus fusion protein and inhibits maturation, mobility, and function to block syncytia formation.

    Directory of Open Access Journals (Sweden)

    Omai B Garner

    2010-07-01

    Full Text Available Nipah virus targets human endothelial cells via NiV-F and NiV-G envelope glycoproteins, resulting in endothelial syncytia formation and vascular compromise. Endothelial cells respond to viral infection by releasing innate immune effectors, including galectins, which are secreted proteins that bind to specific glycan ligands on cell surface glycoproteins. We demonstrate that galectin-1 reduces NiV-F mediated fusion of endothelial cells, and that endogenous galectin-1 in endothelial cells is sufficient to inhibit syncytia formation. Galectin-1 regulates NiV-F mediated cell fusion at three distinct points, including retarding maturation of nascent NiV-F, reducing NiV-F lateral mobility on the plasma membrane, and directly inhibiting the conformational change in NiV-F required for triggering fusion. Characterization of the NiV-F N-glycome showed that the critical site for galectin-1 inhibition is rich in glycan structures known to bind galectin-1. These studies identify a unique set of mechanisms for regulating pathophysiology of NiV infection at the level of the target cell.

  9. Biochemical and structural studies of the oligomerization domain of the Nipah virus phosphoprotein: evidence for an elongated coiled-coil homotrimer.

    Science.gov (United States)

    Blocquel, David; Beltrandi, Matilde; Erales, Jenny; Barbier, Pascale; Longhi, Sonia

    2013-11-01

    Nipah virus (NiV) is a recently emerged severe human pathogen that belongs to the Henipavirus genus within the Paramyxoviridae family. The NiV genome is encapsidated by the nucleoprotein (N) within a helical nucleocapsid that is the substrate used by the polymerase for transcription and replication. The polymerase is recruited onto the nucleocapsid via its cofactor, the phosphoprotein (P). The NiV P protein has a modular organization, with alternating disordered and ordered domains. Among these latter, is the P multimerization domain (PMD) that was predicted to adopt a coiled-coil conformation. Using both biochemical and biophysical approaches, we show that NiV PMD forms a highly stable and elongated coiled-coil trimer, a finding in striking contrast with respect to the PMDs of Paramyxoviridae members investigated so far that were all found to tetramerize. The present results therefore represent the first report of a paramyxoviral P protein forming trimers. © 2013 Elsevier Inc. All rights reserved.

  10. New insights into the Hendra virus attachment and entry process from structures of the virus G glycoprotein and its complex with Ephrin-B2.

    Directory of Open Access Journals (Sweden)

    Kai Xu

    Full Text Available Hendra virus and Nipah virus, comprising the genus Henipavirus, are recently emerged, highly pathogenic and often lethal zoonotic agents against which there are no approved therapeutics. Two surface glycoproteins, the attachment (G and fusion (F, mediate host cell entry. The crystal structures of the Hendra G glycoprotein alone and in complex with the ephrin-B2 receptor reveal that henipavirus uses Tryptophan 122 on ephrin-B2/B3 as a "latch" to facilitate the G-receptor association. Structural-based mutagenesis of residues in the Hendra G glycoprotein at the receptor binding interface document their importance for viral attachments and entry, and suggest that the stability of the Hendra-G-ephrin attachment complex does not strongly correlate with the efficiency of viral entry. In addition, our data indicates that conformational rearrangements of the G glycoprotein head domain upon receptor binding may be the trigger leading to the activation of the viral F fusion glycoprotein during virus infection.

  11. Expression, characterisation and antigenicity of a truncated Hendra virus attachment protein expressed in the protozoan host Leishmania tarentolae.

    Science.gov (United States)

    Fischer, Kerstin; dos Reis, Vinicius Pinho; Finke, Stefan; Sauerhering, Lucie; Stroh, Eileen; Karger, Axel; Maisner, Andrea; Groschup, Martin H; Diederich, Sandra; Balkema-Buschmann, Anne

    2016-02-01

    Hendra virus (HeV) is an emerging zoonotic paramyxovirus within the genus Henipavirus that has caused severe morbidity and mortality in humans and horses in Australia since 1994. HeV infection of host cells is mediated by the membrane bound attachment (G) and fusion (F) glycoproteins, that are essential for receptor binding and fusion of viral and cellular membranes. The eukaryotic unicellular parasite Leishmania tarentolae has recently been established as a powerful tool to express recombinant proteins with mammalian-like glycosylation patterns, but only few viral proteins have been expressed in this system so far. Here, we describe the purification of a truncated, Strep-tag labelled and soluble version of the HeV attachment protein (sHeV G) expressed in stably transfected L. tarentolae cells. After Strep-tag purification the identity of sHeV G was confirmed by immunoblotting and mass spectrometry. The functional binding of sHeV G to the HeV cell entry receptor ephrin-B2 was confirmed in several binding assays. Generated polyclonal rabbit antiserum against sHeV G reacted with both HeV and Nipah virus (NiV) G proteins in immunofluorescence assay and efficiently neutralised NiV infection, thus further supporting the preserved antigenicity of the purified protein. Copyright © 2015 The Authors. Published by Elsevier B.V. All rights reserved.

  12. Nipah and Hendra Virus Nucleoproteins Inhibit Nuclear Accumulation of Signal Transducer and Activator of Transcription 1 (STAT1) and STAT2 by Interfering with Their Complex Formation.

    Science.gov (United States)

    Sugai, Akihiro; Sato, Hiroki; Takayama, Ikuyo; Yoneda, Misako; Kai, Chieko

    2017-11-01

    Henipaviruses, such as Nipah (NiV) and Hendra (HeV) viruses, are highly pathogenic zoonotic agents within the Paramyxoviridae family. The phosphoprotein (P) gene products of the paramyxoviruses have been well characterized for their interferon (IFN) antagonist activity and their contribution to viral pathogenicity. In this study, we demonstrated that the nucleoprotein (N) of henipaviruses also prevents the host IFN signaling response. Reporter assays demonstrated that the NiV and HeV N proteins (NiV-N and HeV-N, respectively) dose-dependently suppressed both type I and type II IFN responses and that the inhibitory effect was mediated by their core domains. Additionally, NiV-N prevented the nuclear transport of signal transducer and activator of transcription 1 (STAT1) and STAT2. However, NiV-N did not associate with Impα5, Impβ1, or Ran, which are members of the nuclear transport system for STATs. Although P protein is known as a binding partner of N protein and actively retains N protein in the cytoplasm, the IFN antagonist activity of N protein was not abolished by the coexpression of P protein. This suggests that the IFN inhibition by N protein occurs in the cytoplasm. Furthermore, we demonstrated that the complex formation of STATs was hampered in the N protein-expressing cells. As a result, STAT nuclear accumulation was reduced, causing a subsequent downregulation of interferon-stimulated genes (ISGs) due to low promoter occupancy by STAT complexes. This novel route for preventing host IFN responses by henipavirus N proteins provides new insight into the pathogenesis of these viruses. IMPORTANCE Paramyxoviruses are well known for suppressing interferon (IFN)-mediated innate immunity with their phosphoprotein (P) gene products, and the henipaviruses also possess P, V, W, and C proteins for evading host antiviral responses. There are numerous studies providing evidence for the relationship between viral pathogenicity and antagonistic activities against IFN

  13. Hendra and Nipah infection: emerging paramyxoviruses.

    Science.gov (United States)

    Aljofan, Mohamad

    2013-11-06

    Since their first emergence in mid 1990s henipaviruses continued to re emerge in Australia and South East Asia almost every year. In total there has been more than 12 Nipah and 48 Hendra virus outbreaks reported in South East Asia and Australia, respectively. These outbreaks are associated with significant economic and health damages that most high risks countries (particularly in South East Asia) cannot bear the burden of such economical threats. Up until recently, there were no actual therapeutics available to treat or prevent these lethal infections. However, an international collaborative research has resulted in the identification of a potential equine Hendra vaccine capable of providing antibody protection against Hendra virus infections. Consequently, with the current findings and after nearly 2 decades since their first detection, are we there yet? This review recaps the chronicle of the henipavirus emergence and briefly evaluates potential anti-henipavirus vaccines and antivirals. Copyright © 2013 Elsevier B.V. All rights reserved.

  14. Crystal structure of the Hendra virus attachment G glycoprotein bound to a potent cross-reactive neutralizing human monoclonal antibody.

    Science.gov (United States)

    Xu, Kai; Rockx, Barry; Xie, Yihu; DeBuysscher, Blair L; Fusco, Deborah L; Zhu, Zhongyu; Chan, Yee-Peng; Xu, Yan; Luu, Truong; Cer, Regina Z; Feldmann, Heinz; Mokashi, Vishwesh; Dimitrov, Dimiter S; Bishop-Lilly, Kimberly A; Broder, Christopher C; Nikolov, Dimitar B

    2013-01-01

    The henipaviruses, represented by Hendra (HeV) and Nipah (NiV) viruses are highly pathogenic zoonotic paramyxoviruses with uniquely broad host tropisms responsible for repeated outbreaks in Australia, Southeast Asia, India and Bangladesh. The high morbidity and mortality rates associated with infection and lack of licensed antiviral therapies make the henipaviruses a potential biological threat to humans and livestock. Henipavirus entry is initiated by the attachment of the G envelope glycoprotein to host cell membrane receptors. Previously, henipavirus-neutralizing human monoclonal antibodies (hmAb) have been isolated using the HeV-G glycoprotein and a human naïve antibody library. One cross-reactive and receptor-blocking hmAb (m102.4) was recently demonstrated to be an effective post-exposure therapy in two animal models of NiV and HeV infection, has been used in several people on a compassionate use basis, and is currently in development for use in humans. Here, we report the crystal structure of the complex of HeV-G with m102.3, an m102.4 derivative, and describe NiV and HeV escape mutants. This structure provides detailed insight into the mechanism of HeV and NiV neutralization by m102.4, and serves as a blueprint for further optimization of m102.4 as a therapeutic agent and for the development of entry inhibitors and vaccines.

  15. Crystal structure of the Hendra virus attachment G glycoprotein bound to a potent cross-reactive neutralizing human monoclonal antibody.

    Directory of Open Access Journals (Sweden)

    Kai Xu

    Full Text Available The henipaviruses, represented by Hendra (HeV and Nipah (NiV viruses are highly pathogenic zoonotic paramyxoviruses with uniquely broad host tropisms responsible for repeated outbreaks in Australia, Southeast Asia, India and Bangladesh. The high morbidity and mortality rates associated with infection and lack of licensed antiviral therapies make the henipaviruses a potential biological threat to humans and livestock. Henipavirus entry is initiated by the attachment of the G envelope glycoprotein to host cell membrane receptors. Previously, henipavirus-neutralizing human monoclonal antibodies (hmAb have been isolated using the HeV-G glycoprotein and a human naïve antibody library. One cross-reactive and receptor-blocking hmAb (m102.4 was recently demonstrated to be an effective post-exposure therapy in two animal models of NiV and HeV infection, has been used in several people on a compassionate use basis, and is currently in development for use in humans. Here, we report the crystal structure of the complex of HeV-G with m102.3, an m102.4 derivative, and describe NiV and HeV escape mutants. This structure provides detailed insight into the mechanism of HeV and NiV neutralization by m102.4, and serves as a blueprint for further optimization of m102.4 as a therapeutic agent and for the development of entry inhibitors and vaccines.

  16. Proteoglycans act as cellular hepatitis delta virus attachment receptors.

    Directory of Open Access Journals (Sweden)

    Oscar Lamas Longarela

    Full Text Available The hepatitis delta virus (HDV is a small, defective RNA virus that requires the presence of the hepatitis B virus (HBV for its life cycle. Worldwide more than 15 million people are co-infected with HBV and HDV. Although much effort has been made, the early steps of the HBV/HDV entry process, including hepatocyte attachment and receptor interaction are still not fully understood. Numerous possible cellular HBV/HDV binding partners have been described over the last years; however, so far only heparan sulfate proteoglycans have been functionally confirmed as cell-associated HBV attachment factors. Recently, it has been suggested that ionotrophic purinergic receptors (P2XR participate as receptors in HBV/HDV entry. Using the HBV/HDV susceptible HepaRG cell line and primary human hepatocytes (PHH, we here demonstrate that HDV entry into hepatocytes depends on the interaction with the glycosaminoglycan (GAG side chains of cellular heparan sulfate proteoglycans. We furthermore provide evidence that P2XR are not involved in HBV/HDV entry and that effects observed with inhibitors for these receptors are a consequence of their negative charge. HDV infection was abrogated by soluble GAGs and other highly sulfated compounds. Enzymatic removal of defined carbohydrate structures from the cell surface using heparinase III or the obstruction of GAG synthesis by sodium chlorate inhibited HDV infection of HepaRG cells. Highly sulfated P2XR antagonists blocked HBV/HDV infection of HepaRG cells and PHH. In contrast, no effect on HBV/HDV infection was found when uncharged P2XR antagonists or agonists were applied. In summary, HDV infection, comparable to HBV infection, requires binding to the carbohydrate side chains of hepatocyte-associated heparan sulfate proteoglycans as attachment receptors, while P2XR are not actively involved.

  17. Hendra and Nipah Infection: Pathology, Models and Potential Therapies

    Science.gov (United States)

    Vigant, Frederic; Lee, Benhur

    2011-01-01

    The Paramyxoviridae family comprises of several genera that contain emerging or re-emerging threats for human and animal health with no real specific effective treatment available. Hendra and Nipah virus are members of a newly identified genus of emerging paramyxoviruses, Henipavirus. Since their discovery in the 1990s, henipaviruses outbreaks have been associated with high economic and public health threat potential. When compared to other paramyxoviruses, henipaviruses appear to have unique characteristics. Henipaviruses are zoonotic paramyxoviruses with a broader tropism than most other paramyxoviruses, and can cause severe acute encephalitis with unique features among viral encephalitides. There are currently no approved effective prophylactic or therapeutic treatments for henipavirus infections. Although ribavirin was empirically used and seemed beneficial during the biggest outbreak caused by one of these viruses, the Nipah virus, its efficacy is disputed in light of its lack of efficacy in several animal models of henipavirus infection. Nevertheless, because of its highly pathogenic nature, much effort has been spent in developing anti-henipavirus therapeutics. In this review we describe the unique features of henipavirus infections and the different strategies and animal models that have been developed so far in order to identify and test potential drugs to prevent or treat henipavirus infections. Some of these components have the potential to be broad-spectrum antivirals as they target effectors of viral pathogenecity common to other viruses. We will focus on small molecules or biologics, rather than vaccine strategies, that have been developed as anti-henipaviral therapeutics. PMID:21488828

  18. Attachments

    International Nuclear Information System (INIS)

    2000-01-01

    In this attachment to the Annual report 1999 of the Nuclear Regulatory Authority of the Slovak Republic (UJD) the economic and personnel data of the UJD, used abbreviations, as well as the International nuclear event scales - INES are presented. Professional level of staff of the UJD is influenced by the education structure of its staff, when nearly 75% of the total number of staff has a university degree. A of 31.12.1999 there were 79 employees as average calculated number. Financing of the regulator in 1999 was mainly provided from the state budget, which represented 96% of all expenditures. The total volume of expenditures for UJD activity funded from the state budget achieved as of 31.12.1999 Slovak crowns (SK) 67 067 thousands. In the main category of expenditures an amount of SK 63 499 thous. was used for current activities, and the difference of SK 3 587 thous. was used for raising capital assets. Significant increase expenditures in the evaluated year compared to the 1998 was caused by a special purpose payment made by the Slovakia into the Fund for reconstruction of the Chernobyl cover (SK 19 996 thous.) funded through the budget chapter of the regulator. In the structure of current expenditures the highest share is taken by current transfers to abroad in total of SK 22 543 thous., i.e. contribution to reconstruction of Chernobyl cover made to the EBRD and contributions to the Fund of Technical Co-operation of the IAEA. For procurement of goods and services an amount of SK 19 814 thous. was spent, of which SK 7 054 thous. was used for funding science and technology tasks which were contracted out. The decision-making process in performing state supervision forced UJD to contact out various expert opinions and studies, for which UJD paid SK 2 058 thous. in total. Other expenditures in a volume of SK 10 702 thous. represent travel expenses, goods and services for UJD, rent for offices and other inevitable expenses. Salaries of staff represented SK 15 953

  19. Avian metapneumovirus (AMPV) attachment protein involvement in probable virus evolution concurrent with mass live vaccine introduction.

    Science.gov (United States)

    Cecchinato, Mattia; Catelli, Elena; Lupini, Caterina; Ricchizzi, Enrico; Clubbe, Jayne; Battilani, Mara; Naylor, Clive J

    2010-11-20

    Avian metapneumoviruses detected in Northern Italy between 1987 and 2007 were sequenced in their fusion (F) and attachment (G) genes together with the same genes from isolates collected throughout western European prior to 1994. Fusion protein genes sequences were highly conserved while G protein sequences showed much greater heterogeneity. Phylogenetic studies based on both genes clearly showed that later Italian viruses were significantly different to all earlier virus detections, including early detections from Italy. Furthermore a serine residue in the G proteins and lysine residue in the fusion protein were exclusive to Italian viruses, indicating that later viruses probably arose within the country and the notion that these later viruses evolved from earlier Italian progenitors cannot be discounted. Biocomputing analysis applied to F and G proteins of later Italian viruses predicted that only G contained altered T cell epitopes. It appears likely that Italian field viruses evolved in response to selection pressure from vaccine induced immunity. Copyright © 2010 Elsevier B.V. All rights reserved.

  20. Inhibition of HIV Virus by Neutralizing Vhh Attached to Dual Functional Liposomes Encapsulating Dapivirine

    Science.gov (United States)

    Wang, Scarlet Xiaoyan; Michiels, Johan; Ariën, Kevin K.; New, Roger; Vanham, Guido; Roitt, Ivan

    2016-07-01

    Although highly active antiretroviral therapy (HAART) has greatly improved the life expectancy of HIV/AIDS patients, the treatment is not curative. It is a global challenge which fosters an urgent need to develop an effective drug or neutralizing antibody delivery approach for the prevention and treatment of this disease. Due to the low density of envelope spikes with restricted mobility present on the surface of HIV virus, which limit the antibody potency and allow virus mutation and escape from the immune system, it is important for a neutralizing antibody to form bivalent or multivalent bonds with the virus. Liposome constructs could fulfil this need due to the flexible mobility of the membrane with its attached antibodies and the capacity for drug encapsulation. In this study, we evaluated the neutralization activity of a range of liposome formulations in different sizes coated with anti-gp120 llama antibody fragments (Vhhs) conjugated via either non-covalent metal chelation or a covalent linkage. The non-covalent construct demonstrated identical binding affinity to HIV-1 envelope glycoprotein gp120 and neutralizing ability for HIV virus as free Vhh. Although covalently linked Vhh showed significant binding affinity to gp120, it unexpectedly had a lower neutralization potency. This may be due to the comparability in size of the viral and liposome particles restricting the number which can be bound to the liposome surface so involving only a fraction of the antibodies, whereas non-covalently attached antibodies dissociate from the surface after acting with gp120 and free the remainder to bind further viruses. Covalently conjugated Vhh might also trigger the cellular uptake of a liposome-virion complex. To explore the possible ability of the antibody-coated liposomes to have a further function, we encapsulated the hydrophobic antiviral drug dapivirine into both of the non-covalently and covalently conjugated liposome formulations, both of which revealed high

  1. A new class of synthetic anti-lipopolysaccharide peptides inhibits influenza A virus replication by blocking cellular attachment.

    Science.gov (United States)

    Hoffmann, Julia; Schneider, Carola; Heinbockel, Lena; Brandenburg, Klaus; Reimer, Rudolph; Gabriel, Gülsah

    2014-04-01

    Influenza A viruses are a continuous threat to human health as illustrated by the 2009 H1N1 pandemic. Since circulating influenza virus strains become increasingly resistant against currently available drugs, the development of novel antivirals is urgently needed. Here, we have evaluated a recently described new class of broad-spectrum antiviral peptides (synthetic anti-lipopolysaccharide peptides; SALPs) for their potential to inhibit influenza virus replication in vitro and in vivo. We found that particularly SALP PEP 19-2.5 shows high binding affinities for the influenza virus receptor molecule, N-Acetylneuraminic acid, leading to impaired viral attachment and cellular entry. As a result, replication of several influenza virus subtypes (H7N7, H3N2 and 2009 pandemic H1N1) was strongly reduced. Furthermore, mice co-treated with PEP 19-2.5 were protected against an otherwise 100% lethal H7N7 influenza virus infection. These findings show that SALPs exhibit antiviral activity against influenza viruses by blocking virus attachment and entry into host cells. Thus, SALPs present a new class of broad-spectrum antiviral peptides for further development for influenza virus therapy. Copyright © 2014 Elsevier B.V. All rights reserved.

  2. Attachment and Postattachment Receptors Important for Hepatitis C Virus Infection and Cell-to-Cell Transmission.

    Science.gov (United States)

    Fan, Huahao; Qiao, Luhua; Kang, Kyung-Don; Fan, Junfen; Wei, Wensheng; Luo, Guangxiang

    2017-07-01

    Hepatitis C virus (HCV) requires multiple receptors for its attachment to and entry into cells. Our previous studies found that human syndecan-1 (SDC-1), SDC-2, and T cell immunoglobulin and mucin domain-containing protein 1 (TIM-1) are HCV attachment receptors. Other cell surface molecules, such as CD81, Claudin-1 (CLDN1), Occludin (OCLN), SR-BI, and low-density lipoprotein receptor (LDLR), function mainly at postattachment steps and are considered postattachment receptors. The underlying molecular mechanisms of different receptors in HCV cell-free and cell-to-cell transmission remain elusive. In the present study, we used a clustered regularly interspaced short palindromic repeat (CRISPR)-Cas9 technology, gene-specific small interfering RNAs, and a newly developed luciferase-based reporter system to quantitatively determine the importance of individual receptors in HCV cell-free and cell-to-cell transmission. Knockouts of SDC-1 and SDC-2 resulted in remarkable reductions of HCV infection and cell attachment, whereas SDC-3 and SDC-4 knockouts did not affect HCV infection. Defective HCV attachment to SDC-1 and/or SDC-2 knockout cells was completely restored by SDC-1 and SDC-2 but not SDC-4 expression. Knockout of the attachment receptors SDC-1, SDC-2, and TIM-1 also modestly decreased HCV cell-to-cell transmission. In contrast, silencing and knockout of the postattachment receptors CD81, CLDN1, OCLN, SR-BI, and LDLR greatly impaired both HCV cell-free and cell-to-cell transmission. Additionally, apolipoprotein E was found to be important for HCV cell-to-cell spread, but very-low-density lipoprotein (VLDL)-containing mouse serum did not affect HCV cell-to-cell transmission, although it inhibited cell-free infection. These findings demonstrate that attachment receptors are essential for initial HCV binding and that postattachment receptors are important for both HCV cell-free and cell-to-cell transmission. IMPORTANCE The importance and underlying molecular mechanisms

  3. Nipah Encephalitis – A Dangerous Zooanthroponosis Of Indo-Malaysian Region Of South-Еast Asia

    Directory of Open Access Journals (Sweden)

    E. P. Lukin

    2014-01-01

    Full Text Available The review provides information on a new zooanthroponosis – Nipah encephalitis. Characteristics of the pathogen and its ecology and clinic are presented. The purpose of the review is to get Russian specialist acquainted with new dangerous disease unknown in Russia. The research method – analytical. Infection by humans were first described in Malaysia (1999, after in Bangladesh (2004 and India (2006. The causative agent was identified as a new member of paramyxoviruses and then, together with related Hendra virus, separated in a new genus Henipavirus of the family Paramyxoviridae (2000. Reservoir in nature – fruit bats, predominantly carnivorous flying foxes of 8 species of the genus Pteropus, secondary reservoir – domestic pigs. Nipah virus is highly contagious for humans and swine. The last act as amplifying and reservoir host. The disease inhumans is characterized by symptoms and signs of acute encephalitis and pulmonary insufficiency. Rapidly developing coma, lethality – up to 92,0%. Outbreaks with transmission of the virus from person-to-person are known. Specific treatment has not been developed, prevention is nonspecific.

  4. Bovine parainfluenza virus type 3 (PIV3) expressing the respiratory syncytial virus (RSV) attachment and fusion proteins protects hamsters from challenge with human PIV3 and RSV.

    Science.gov (United States)

    Haller, Aurelia A; Mitiku, Misrach; MacPhail, Mia

    2003-08-01

    Parainfluenza virus type 3 (PIV3) and respiratory syncytial virus (RSV) are the main causes of ubiquitous acute respiratory diseases of infancy and early childhood, causing 20-25 % of pneumonia and 45-50 % of bronchiolitis in hospitalized children. The primary goal of this study was to create an effective and safe RSV vaccine based on utilizing attenuated bovine PIV3 (bPIV3) as a virus vector backbone. bPIV3 had been evaluated in human clinical trials and was shown to be attenuated and immunogenic in children as young as 2 months of age. The ability of bPIV3 to function as a virus vaccine vector was explored further by introducing the RSV attachment (G) and fusion (F) genes into the bPIV3 RNA genome. The resulting virus, bPIV3/RSV(I), contained an insert of 2900 nt, comprising two translationally competent transcription units. Despite this increase in genetic material, the virus replicated to high titres in Vero cells. This recombinant virus expressed the RSV G and F proteins sufficiently to evoke a protective immune response in hamsters upon challenge with RSV or human PIV3 and to elicit RSV neutralizing and PIV3 haemagglutinin inhibition serum antibodies. In effect, a bivalent vaccine was produced that could protect vaccinees from RSV as well as PIV3. Such a vaccine would vastly reduce the respiratory disease burden, the associated hospitalization costs and, most importantly, decrease morbidity and mortality of infants, immunocompromised individuals and the elderly.

  5. KAJIAN ASPEK TEKNIS DAN FINASIAL USAHA RUMAH TANGGA BRIKET BIOMASSA DARI KULIT NIPAH DENGAN TEMPURUNG KELAPA

    Directory of Open Access Journals (Sweden)

    Martanto Martanto

    2016-04-01

    Full Text Available Nipah merupakan salah satu tanaman  didaerah pasang surut. Di Indonesia terdapat Sekitar tujuh juta hektar (7 Ha  tanaman Nipah. Pemanfaatan kulit nipah  sampai saat ini belum maksimal. Penelitian ini mencoba membuat briket arang dengan campuran arang kelapa. Metode pernelitian ini menggunakan eksperimen untuk pembuatan briket kulit nipah dan metode kuantitatif tehadap nilai ekonomisnya Dari hasil penelitian didapat kadar air 9,2 % ,kadar abu 3,51 % dan kadar zat menguap  2,62 %. Hasil penelitian tersebut layak dan kulaitasnya hampir sama dengan batu bara muda. Dari perhitungan analisa finansial perhitungan NPV, IRR, Payback period  B/C ratio adalah masing-masing menghasilkan nilai masing-masing adalah 8.843.001, 41 %, 3 tahun 7 bulan dan  2,04. Sehingga usaha briket arang dari kulit nipah dengan tempurung kelapa sangat layak untuk dijadikan usaha skala rumah tangga

  6. Fluorescence Adherence Inhibition Assay: A Novel Functional Assessment of Blocking Virus Attachment by Vaccine-Induced Antibodies.

    Directory of Open Access Journals (Sweden)

    Atul Asati

    Full Text Available Neutralizing antibodies induced by vaccination or natural infection play a critically important role in protection against the viral diseases. In general, neutralization of the viral infection occurs via two major pathways: pre- and post-attachment modes, the first being the most important for such infections as influenza and polio, the latter being significant for filoviruses. Neutralizing capacity of antibodies is typically evaluated by virus neutralization assays that assess reduction of viral infectivity to the target cells in the presence of functional antibodies. Plaque reduction neutralization test, microneutralization and immunofluorescent assays are often used as gold standard virus neutralization assays. However, these methods are associated with several important prerequisites such as use of live virus requiring safety precautions, tedious evaluation procedure and long assessment time. Hence, there is a need for a robust, inexpensive high throughput functional assay that can be performed rapidly using inactivated virus, without extensive safety precautions. Herein, we report a novel high throughput Fluorescence Adherence Inhibition assay (fADI using inactivated virus labeled with fluorescent secondary antibodies virus and Vero cells or erythrocytes as targets. It requires only few hours to assess pre-attachment neutralizing capacity of donor sera. fADI assay was tested successfully on donors immunized with polio, yellow fever and influenza vaccines. To further simplify and improve the throughput of the assay, we have developed a mathematical approach for calculating the 50% titers from a single sample dilution, without the need to analyze multi-point titration curves. Assessment of pre- and post-vaccination human sera from subjects immunized with IPOL®, YF-VAX® and 2013-2014 Fluzone® vaccines demonstrated high efficiency of the assay. The results correlated very well with microneutralization assay performed independently by the FDA

  7. Distribution patterns of influenza virus receptors and viral attachment patterns in the respiratory and intestinal tracts of seven avian species

    Directory of Open Access Journals (Sweden)

    Costa Taiana

    2012-04-01

    Full Text Available Abstract This study assessed the presence of sialic acid α-2,3 and α-2,6 linked glycan receptors in seven avian species. The respiratory and intestinal tracts of the chicken, common quail, red-legged partridge, turkey, golden pheasant, ostrich, and mallard were tested by means of lectin histochemistry, using the lectins Maackia amurensis agglutinin II and Sambucus nigra agglutinin, which show affinity for α-2,3 and α-2,6 receptors, respectively. Additionally, the pattern of virus attachment (PVA was evaluated with virus histochemistry, using an avian-origin H4N5 virus and a human-origin seasonal H1N1 virus. There was a great variation of receptor distribution among the tissues and avian species studied. Both α-2,3 and α-2,6 receptors were present in the respiratory and intestinal tracts of the chicken, common quail, red-legged partridge, turkey, and golden pheasant. In ostriches, the expression of the receptor was basically restricted to α-2,3 in both the respiratory and intestinal tracts and in mallards the α-2,6 receptors were absent from the intestinal tract. The results obtained with the lectin histochemistry were, in general, in agreement with the PVA. The differential expression and distribution of α-2,3 and α-2,6 receptors among various avian species might reflect a potentially decisive factor in the emergence of new viral strains.

  8. In vitro assessment of attachment pattern and replication efficiency of H5N1 influenza A viruses with altered receptor specificity.

    Science.gov (United States)

    Chutinimitkul, Salin; van Riel, Debby; Munster, Vincent J; van den Brand, Judith M A; Rimmelzwaan, Guus F; Kuiken, Thijs; Osterhaus, Albert D M E; Fouchier, Ron A M; de Wit, Emmie

    2010-07-01

    The continuous circulation of the highly pathogenic avian influenza (HPAI) H5N1 virus has been a cause of great concern. The possibility of this virus acquiring specificity for the human influenza A virus receptor, alpha2,6-linked sialic acids (SA), and being able to transmit efficiently among humans is a constant threat to human health. Different studies have described amino acid substitutions in hemagglutinin (HA) of clinical HPAI H5N1 isolates or that were introduced experimentally that resulted in an increased, but not exclusive, binding of these virus strains to alpha2,6-linked SA. We introduced all previously described amino acid substitutions and combinations thereof into a single genetic background, influenza virus A/Indonesia/5/05 HA, and tested the receptor specificity of these 27 mutant viruses. The attachment pattern to ferret and human tissues of the upper and lower respiratory tract of viruses with alpha2,6-linked SA receptor preference was then determined and compared to the attachment pattern of a human influenza A virus (H3N2). At least three mutant viruses showed an attachment pattern to the human respiratory tract similar to that of the human H3N2 virus. Next, the replication efficiencies of these mutant viruses and the effects of three different neuraminidases on virus replication were determined. These data show that influenza virus A/Indonesia/5/05 potentially requires only a single amino acid substitution to acquire human receptor specificity, while at the same time remaining replication competent, thus suggesting that the pandemic threat posed by HPAI H5N1 is far from diminished.

  9. In Vitro Assessment of Attachment Pattern and Replication Efficiency of H5N1 Influenza A Viruses with Altered Receptor Specificity▿

    Science.gov (United States)

    Chutinimitkul, Salin; van Riel, Debby; Munster, Vincent J.; van den Brand, Judith M. A.; Rimmelzwaan, Guus F.; Kuiken, Thijs; Osterhaus, Albert D. M. E.; Fouchier, Ron A. M.; de Wit, Emmie

    2010-01-01

    The continuous circulation of the highly pathogenic avian influenza (HPAI) H5N1 virus has been a cause of great concern. The possibility of this virus acquiring specificity for the human influenza A virus receptor, α2,6-linked sialic acids (SA), and being able to transmit efficiently among humans is a constant threat to human health. Different studies have described amino acid substitutions in hemagglutinin (HA) of clinical HPAI H5N1 isolates or that were introduced experimentally that resulted in an increased, but not exclusive, binding of these virus strains to α2,6-linked SA. We introduced all previously described amino acid substitutions and combinations thereof into a single genetic background, influenza virus A/Indonesia/5/05 HA, and tested the receptor specificity of these 27 mutant viruses. The attachment pattern to ferret and human tissues of the upper and lower respiratory tract of viruses with α2,6-linked SA receptor preference was then determined and compared to the attachment pattern of a human influenza A virus (H3N2). At least three mutant viruses showed an attachment pattern to the human respiratory tract similar to that of the human H3N2 virus. Next, the replication efficiencies of these mutant viruses and the effects of three different neuraminidases on virus replication were determined. These data show that influenza virus A/Indonesia/5/05 potentially requires only a single amino acid substitution to acquire human receptor specificity, while at the same time remaining replication competent, thus suggesting that the pandemic threat posed by HPAI H5N1 is far from diminished. PMID:20392847

  10. Calcium spirulan derived from Spirulina platensis inhibits herpes simplex virus 1 attachment to human keratinocytes and protects against herpes labialis.

    Science.gov (United States)

    Mader, Julia; Gallo, Antonio; Schommartz, Tim; Handke, Wiebke; Nagel, Claus-Henning; Günther, Patrick; Brune, Wolfram; Reich, Kristian

    2016-01-01

    Chronic infections with herpes simplex virus (HSV) type 1 are highly prevalent in populations worldwide and cause recurrent oral lesions in up to 40% of infected subjects. We investigated the antiviral activity of a defined Spirulina platensis microalga extract and of purified calcium spirulan (Ca-SP), a sulfated polysaccharide contained therein. The inhibitory effects of HSV-1 were assessed by using a plaque reduction assay and quantitative PCR in a susceptible mammalian epithelial cell line and confirmed in human keratinocytes. Time-of-addition and attachment experiments and fluorescence detection of the HSV-1 tegument protein VP16 were used to analyze the mechanism of HSV-1 inhibition. Effects of Ca-SP on Kaposi sarcoma-associated herpesvirus/human herpes virus 8 replication and uptake of the ORF45 tegument protein were tested in human retinal pigment epithelial cells. In an observational trial the prophylactic effects of topically applied Ca-SP were compared with those of systemic and topical nucleoside analogues in 198 volunteers with recurrent herpes labialis receiving permanent lip makeup. Ca-SP inhibited HSV-1 infection in vitro with a potency at least comparable to that of acyclovir by blocking viral attachment and penetration into host cells. Ca-SP also inhibited entry of Kaposi sarcoma-associated herpesvirus/human herpes virus 8. In the clinical model of herpes exacerbation, the prophylactic effect of a Ca-SP and microalgae extract containing cream was superior to that of acyclovir cream. These data indicate a potential clinical use of Ca-SP containing Spirulina species extract for the prophylactic treatment of herpes labialis and suggest possible activity of Ca-SP against infections caused by other herpesviruses. Copyright © 2015 American Academy of Allergy, Asthma & Immunology. Published by Elsevier Inc. All rights reserved.

  11. Chimeric Bovine Respiratory Syncytial Virus with Attachment and Fusion Glycoproteins Replaced by Bovine Parainfluenza Virus Type 3 Hemagglutinin-Neuraminidase and Fusion Proteins

    Science.gov (United States)

    Stope, Matthias B.; Karger, Axel; Schmidt, Ulrike; Buchholz, Ursula J.

    2001-01-01

    Chimeric bovine respiratory syncytial viruses (BRSV) expressing glycoproteins of bovine parainfluenza virus type 3 (BPIV-3) instead of BRSV glycoproteins were generated from cDNA. In the BRSV antigenome cDNA, the open reading frames of the major BRSV glycoproteins, attachment protein G and fusion protein F, were replaced individually or together by those of the BPIV-3 hemagglutinin-neuraminidase (HN) and/or fusion (F) glycoproteins. Recombinant virus could not be recovered from cDNA when the BRSV F open reading frame was replaced by the BPIV-3 F open reading frame. However, cDNA recovery of the chimeric virus rBRSV-HNF, with both glycoproteins replaced simultaneously, and of the chimeric virus rBRSV-HN, with the BRSV G protein replaced by BPIV-3 HN, was successful. The replication rates of both chimeras were similar to that of standard rBRSV. Moreover, rBRSV-HNF was neutralized by antibodies specific for BPIV-3, but not by antibodies specific to BRSV, demonstrating that the BRSV glycoproteins can be functionally replaced by BPIV-3 glycoproteins. In contrast, rBRSV-HN was neutralized by BRSV-specific antisera, but not by BPIV-3 specific sera, showing that infection of rBRSV-HN is mediated by BRSV F. Hemadsorption of cells infected with rBRSV-HNF and rBRSV-HN proved that BPIV-3 HN protein expressed by rBRSV is functional. Colocalization of the BPIV-3 glycoproteins with BRSV M protein was demonstrated by confocal laser scan microscopy. Moreover, protein analysis revealed that the BPIV-3 glycoproteins were present in chimeric virions. Taken together, these data indicate that the heterologous glycoproteins were not only expressed but were incorporated into the envelope of recombinant BRSV. Thus, the envelope glycoproteins derived from a member of the Respirovirus genus can together functionally replace their homologs in a Pneumovirus background. PMID:11533200

  12. Genetic and antigenic analysis of the G attachment protein of bovine respiratory syncytial virus strains

    DEFF Research Database (Denmark)

    Elvander, M.; Vilcek, S.; Baule, C.

    1998-01-01

    Antigenic and genetic studies of bovine respiratory syncytial virus (BRSV) were made on isolates obtained from three continents over 27 years. Antigenic variation between eight isolates was initially determined using protein G-specific monoclonal antibodies. Four distinct reaction patterns were...... of a 731 nucleotide fragment in the G protein gene. Nine of the BRSV strains were analysed by direct sequencing of RT-PCR amplicons whereas sequences of 18 BRSV and three human respiratory syncytial virus (HRSV) strains were obtained from GenBank. The analysis revealed similarities of 88-100% among BRSV...

  13. UJI FITOKIMIA SENYAWA KIMIA AKTIF AKAR NIPAH (Nyfa Fruticans WURMB SEBAGAI TUMBUHAN OBAT DI KALIMANTAN SELATAN

    Directory of Open Access Journals (Sweden)

    Rosidah R Radam

    2017-02-01

    Full Text Available Nipa (Nypa fruticans WURMB classified in Palma family and grow in riptide area. This Research aims to know active Chemical compounds in Nipa root. We Hope that this Research will provide new information about active Chemical compounds in Nipa root, so that we can improve the benefit value of Nipa as One of the medicinal herb. Nipa root samples is taken in Tanah Bumbu District, samples examined in Laboratory of F-MIPA UNLAM. The observed parameters in thus Chemical Test are the active Chemical compounds: alkaloid, steroid, triterpenoid, flavonoid, and tannin. The Content of active Chemical compound is presented in Table and concluded descriptively. The Result of active Chemical compound consist in Nipa’s root shows that Alkaloid, Steroid, Triterpenoid, Flavonoid , and tannin compound is do contains in Nipa root. This active Chemical compound in Nipa root can be Led as the basic Chemical informative to utilize Nipa root as analgesics Medical for such disease. Nipah (nypa fruticans WURMB merupakan tumbuhan yang termasuk famili Palmae dan   tumbuh di daerah  pasang   surut.  Penelitian ini bertujuan untuk mengetahui  kandungan senyawa-senyawa kimia aktif pada akar nipah. Manfaat dari penelitian ini untuk memberikan informasi baru tentang senyawa aktif yang terdapat pada akar nipah, sehingga dapat meningkatkan nilai guna dan manfaat tumbuhan nipah sebagai salah satu tanaman obat. Pengambilan sample akar nipah dilakukan Kabupaten Tanah Bumbu  sedangkan pengujian sample akar nipah dilakukan di Laboratorium F-MIFA UNLAM. Parameter-parameter yang diamati pada pengujian kimia tersebut adalah senyawa-senyawa kimia aktif yaitu alkaloid, steroid, triterpenoid flavonoid, dan tanin. Data hasil uji kandungan senyawa kimia aktif  ditabulasi dan disimpulkan secara diskriptif. Hasil pengujian terhadap senyawa kimia aktif yang terkandung dalam akar Nifah ini menunjukan bahwa senyawa Alkaloid, Steroid, Triterpenoid, Flavonoid , dan tanin memang dikandung

  14. Field and laboratory investigations of inactivation of viruses (PRD1 and MS2) attached to iron oxide-coated quartz san

    Science.gov (United States)

    Ryan, Joseph N.; Harvey, Ronald W.; Metge, David W.; Elimelech, Menachem; Navigato, Theresa; Pieper, Ann P.

    2002-01-01

    Field and laboratory experiments were conducted to investigate inactivation of viruses attached to mineral surfaces. In a natural gradient transport field experiment, bacteriophage PRD1, radiolabeled with 32P, was injected into a ferric oxyhydroxide-coated sand aquifer with bromide and linear alkylbenzene sulfonates. In a zone of the aquifer contaminated by secondary sewage infiltration, small fractions of infective and 32P-labeled PRD1 broke through with the bromide tracer, followed by the slow release of 84% of the 32P activity and only 0.011% of the infective PRD1. In the laboratory experiments, the inactivation of PRD1, labeled with 35S (protein capsid), and MS2, dual radiolabeled with 35S (protein capsid) and 32P (nucleic acid), was monitored in the presence of groundwater and sediment from the contaminated zone of the field site. Release of infective viruses decreased at a much faster rate than release of the radiolabels, indicating that attached viruses were undergoing surface inactivation. Disparities between 32P and35S release suggest that the inactivated viruses were released in a disintegrated state. Comparison of estimated solution and surface inactivation rates indicates solution inactivation is ∼3 times as fast as surface inactivation. The actual rate of surface inactivation may be substantially underestimated owing to slow release of inactivated viruses.

  15. Neutralizing antibodies induced by recombinant virus-like particles of enterovirus 71 genotype C4 inhibit infection at pre- and post-attachment steps.

    Directory of Open Access Journals (Sweden)

    Zhiqiang Ku

    Full Text Available BACKGROUND: Enterovirus 71 (EV71 is a major causative agent of hand, foot and mouth disease, which has been prevalent in Asia-Pacific regions, causing significant morbidity and mortality in young children. Antibodies elicited by experimental EV71 vaccines could neutralize infection in vitro and passively protect animal models from lethal challenge, indicating that neutralizing antibodies play an essential role in protection. However, how neutralizing antibodies inhibit infection in vitro remains unclear. METHODS/FINDINGS: In the present study, we explored the mechanisms of neutralization by antibodies against EV71 virus-like particles (VLPs. Recombinant VLPs of EV71 genotype C4 were produced in insect cells using baculovirus vectors. Immunization with the VLPs elicited a high-titer, EV71-specific antibody response in mice. Anti-VLP mouse sera potently neutralized EV71 infection in vitro. The neutralizing antibodies in the anti-VLP mouse sera were found to target mainly an extremely conserved epitope (FGEHKQEKDLEYGAC located at the GH loop of the VP1 protein. The neutralizing anti-VLP antisera were able to inhibit virus binding to target cells efficiently. In addition, post-attachment treatment of virus-bound cells with the anti-VLP antisera also neutralized virus infection, although the antibody concentration required was higher than that of the pre-attachment treatment. CONCLUSIONS: Collectively, our findings represent a valuable addition to the understanding of mechanisms of EV71 neutralization and have strong implications for EV71 vaccine development.

  16. Comparison of in vivo toxicity, antioxidant and immunomodulatory activities of coconut, nipah and pineapple juice vinegars.

    Science.gov (United States)

    Mohamad, Nurul Elyani; Keong Yeap, Swee; Beh, Boon Keen; Romli, Muhammad Firdaus; Yusof, Hamidah Mohd; Kristeen-Teo, Ye Wen; Sharifuddin, Shaiful Adzni; Long, Kamariah; Alitheen, Noorjahan Banu

    2018-01-01

    Vinegar is widely used as a food additive, in food preparation and as a food supplement. This study compared the phenolic acid profiles and in vivo toxicities, and antioxidant and immunomodulatory effects of coconut, nipah and pineapple juice vinegars, which were respectively prepared via a two-step fermentation using Saccharomyces cerevisiae 7013 INRA and Acetobacter aceti vat Europeans. Pineapple juice vinegar, which had the highest total phenolic acid content, also exhibited the greatest in vitro antioxidant capacity compared to coconut juice and nipah juice vinegars. Following acute and sub-chronic in vivo toxicity evaluation, no toxicity and mortality were evident and there were no significant differences in the serum biochemical profiles between mice administered the vinegars versus the control group. In the sub-chronic toxicity evaluation, the highest liver antioxidant levels were found in mice fed with pineapple juice vinegar, followed by coconut juice and nipah juice vinegars. However, compared to the pineapple juice and nipah juice vinegars, the mice fed with coconut juice vinegar, exhibited a higher population of CD4 + and CD8 + T-lymphocytes in the spleen, which was associated with greater levels of serum interleukin-2 and interferon-γ cytokines. Overall, the data suggested that not all vinegar samples cause acute and sub-chronic toxicity in vivo. Moreover, the in vivo immunity and organ antioxidant levels were enhanced, to varying extents, by the phenolic acids present in the vinegars. The results obtained in this study provide appropriate guidelines for further in vivo bioactivity studies and pre-clinical assessments of vinegar consumption. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.

  17. Protection from Hendra virus infection with Canarypox recombinant vaccine.

    Science.gov (United States)

    Guillaume-Vasselin, Vanessa; Lemaitre, Laurent; Dhondt, Kévin P; Tedeschi, Laurence; Poulard, Amelie; Charreyre, Catherine; Horvat, Branka

    2016-01-01

    Hendra virus (HeV) is an emerging zoonotic pathogen, which causes severe respiratory illness and encephalitis in humans and horses. Since its first appearance in 1994, spillovers of HeV from its natural reservoir fruit bats occur on almost an annual basis. The high mortality rate in both humans and horses and the wide-ranging reservoir distribution are making HeV a serious public health problem, especially for people exposed to sick horses. This study has aimed to develop an efficient low-cost HeV vaccine for horses based on Canarypox recombinant vector expressing HeV glycoproteins, attachment glycoprotein (G) and fusion protein (F). This vaccine was used to immunise hamsters and then challenged intraperitoneally with HeV 3 weeks later. The higher tested dose of the vaccine efficiently prevented oropharyngeal virus shedding and protected animals from clinical disease and virus-induced mortality. Vaccine induced generation of seroneutralising antibodies and prevented virus-induced histopathological changes and a production of viral RNA and antigens in animal tissues. Interestingly, some vaccinated animals, including those immunised at a lower dose, were protected in the absence of detectable specific antibodies, suggesting the induction of an efficient virus-specific cellular immunity. Finally, ponies immunised using the same vaccination protocol as hamsters developed strong seroneutralising titres against both HeV and closely related Nipah virus, indicating that this vaccine may have the ability to induce cross-protection against Henipavirus infection. These data suggest that Canarypox-based vectors encoding for HeV glycoproteins present very promising new vaccine candidate to prevent infection and shedding of the highly lethal HeV.

  18. Henipavirus Mediated Membrane Fusion, Virus Entry and Targeted Therapeutics

    Directory of Open Access Journals (Sweden)

    Dimitar B. Nikolov

    2012-02-01

    Full Text Available The Paramyxoviridae genus Henipavirus is presently represented by the type species Hendra and Nipah viruses which are both recently emerged zoonotic viral pathogens responsible for repeated outbreaks associated with high morbidity and mortality in Australia, Southeast Asia, India and Bangladesh. These enveloped viruses bind and enter host target cells through the coordinated activities of their attachment (G and class I fusion (F envelope glycoproteins. The henipavirus G glycoprotein interacts with host cellular B class ephrins, triggering conformational alterations in G that lead to the activation of the F glycoprotein, which facilitates the membrane fusion process. Using the recently published structures of HeV-G and NiV-G and other paramyxovirus glycoproteins, we review the features of the henipavirus envelope glycoproteins that appear essential for mediating the viral fusion process, including receptor binding, G-F interaction, F activation, with an emphasis on G and the mutations that disrupt viral infectivity. Finally, recent candidate therapeutics for henipavirus-mediated disease are summarized in light of their ability to inhibit HeV and NiV entry by targeting their G and F glycoproteins.

  19. Emerging Foodborne and Agriculture-Related Viruses.

    Science.gov (United States)

    Kingsley, David H

    2016-08-01

    Viruses rapidly evolve and can emerge in unpredictable ways. Transmission pathways by which foodborne viruses may enter human populations and evolutionary mechanisms by which viruses can become virulent are discussed in this chapter. A majority of viruses emerge from zoonotic animal reservoirs, often by adapting and infecting intermediate hosts, such as domestic animals and livestock. Viruses that are known foodborne threats include hepatitis E virus, tick-borne encephalitis virus, enteroviruses, adenovirus, and astroviruses, among others. Viruses may potentially evolve and emerge as a result of modern agricultural practices which can concentrate livestock and bring them into contact with wild animals. Examples of viruses that have emerged in this manner are influenza, coronaviruses such as severe acute respiratory syndrome and Middle East respiratory syndrome, and the Nipah virus. The role of bats, bush meat, rodents, pigs, cattle, and poultry as reservoirs from which infectious pathogenic viruses emerge are discussed.

  20. Rapid Screening for Entry Inhibitors of Highly Pathogenic Viruses under Low-Level Biocontainment

    Science.gov (United States)

    Talekar, Aparna; Pessi, Antonello; Glickman, Fraser; Sengupta, Uttara; Briese, Thomas; Whitt, Michael A.; Mathieu, Cyrille; Horvat, Branka; Moscona, Anne; Porotto, Matteo

    2012-01-01

    Emerging viruses including Nipah, Hendra, Lujo, and Junin viruses have enormous potential to spread rapidly. Nipah virus, after emerging as a zoonosis, has also evolved the capacity for human-to-human transmission. Most of the diseases caused by these pathogens are untreatable and require high biocontainment conditions. Universal methods for rapidly identifying and screening candidate antivirals are urgently needed. We have developed a modular antiviral platform strategy that relies on simple bioinformatic and genetic information about each pathogen. Central to this platform is the use of envelope glycoprotein cDNAs to establish multi-cycle replication systems under BSL2 conditions for viral pathogens that normally require BSL3 and BSL4 facilities. We generated monoclonal antibodies against Nipah G by cDNA immunization in rats, and we showed that these antibodies neutralize both Nipah and Hendra live viruses. We then used these effective Henipavirus inhibitors to validate our screening strategy. Our proposed strategy should contribute to the response capability for emerging infectious diseases, providing a way to initiate antiviral development immediately upon identifying novel viruses. PMID:22396728

  1. Rapid screening for entry inhibitors of highly pathogenic viruses under low-level biocontainment.

    Directory of Open Access Journals (Sweden)

    Aparna Talekar

    Full Text Available Emerging viruses including Nipah, Hendra, Lujo, and Junin viruses have enormous potential to spread rapidly. Nipah virus, after emerging as a zoonosis, has also evolved the capacity for human-to-human transmission. Most of the diseases caused by these pathogens are untreatable and require high biocontainment conditions. Universal methods for rapidly identifying and screening candidate antivirals are urgently needed. We have developed a modular antiviral platform strategy that relies on simple bioinformatic and genetic information about each pathogen. Central to this platform is the use of envelope glycoprotein cDNAs to establish multi-cycle replication systems under BSL2 conditions for viral pathogens that normally require BSL3 and BSL4 facilities. We generated monoclonal antibodies against Nipah G by cDNA immunization in rats, and we showed that these antibodies neutralize both Nipah and Hendra live viruses. We then used these effective Henipavirus inhibitors to validate our screening strategy. Our proposed strategy should contribute to the response capability for emerging infectious diseases, providing a way to initiate antiviral development immediately upon identifying novel viruses.

  2. Structure and stabilization of the Hendra virus F glycoprotein in its prefusion form.

    Science.gov (United States)

    Wong, Joyce J W; Paterson, Reay G; Lamb, Robert A; Jardetzky, Theodore S

    2016-01-26

    Hendra virus (HeV) is one of the two prototypical members of the Henipavirus genus of paramyxoviruses, which are designated biosafety level 4 (BSL-4) organisms due to the high mortality rate of Nipah virus (NiV) and HeV in humans. Paramyxovirus cell entry is mediated by the fusion protein, F, in response to binding of a host receptor by the attachment protein. During posttranslational processing, the fusion peptide of F is released and, upon receptor-induced triggering, inserts into the host cell membrane. As F undergoes a dramatic refolding from its prefusion to postfusion conformation, the fusion peptide brings the host and viral membranes together, allowing entry of the viral RNA. Here, we present the crystal structure of the prefusion form of the HeV F ectodomain. The structure shows very high similarity to the structure of prefusion parainfluenza virus 5 (PIV5) F, with the main structural differences in the membrane distal apical loops and the fusion peptide cleavage loop. Functional assays of mutants show that the apical loop can tolerate perturbation in length and surface residues without loss of function, except for residues involved in the stability and conservation of the F protein fold. Structure-based disulfide mutants were designed to anchor the fusion peptide to conformationally invariant residues of the F head. Two mutants were identified that inhibit F-mediated fusion by stabilizing F in its prefusion conformation.

  3. Canine distemper virus persistence in demyelinating encephalitis by swift intracellular cell-to-cell spread in astrocytes is controlled by the viral attachment protein.

    Science.gov (United States)

    Wyss-Fluehmann, Gaby; Zurbriggen, Andreas; Vandevelde, Marc; Plattet, Philippe

    2010-05-01

    The mechanism of viral persistence, the driving force behind the chronic progression of inflammatory demyelination in canine distemper virus (CDV) infection, is associated with non-cytolytic viral cell-to-cell spread. Here, we studied the molecular mechanisms of viral spread of a recombinant fluorescent protein-expressing virulent CDV in primary canine astrocyte cultures. Time-lapse video microscopy documented that CDV spread was very efficient using cell processes contacting remote target cells. Strikingly, CDV transmission to remote cells could occur in less than 6 h, suggesting that a complete viral cycle with production of extracellular free particles was not essential in enabling CDV to spread in glial cells. Titration experiments and electron microscopy confirmed a very low CDV particle production despite higher titers of membrane-associated viruses. Interestingly, confocal laser microscopy and lentivirus transduction indicated expression and functionality of the viral fusion machinery, consisting of the viral fusion (F) and attachment (H) glycoproteins, at the cell surface. Importantly, using a single-cycle infectious recombinant H-knockout, H-complemented virus, we demonstrated that H, and thus potentially the viral fusion complex, was necessary to enable CDV spread. Furthermore, since we could not detect CD150/SLAM expression in brain cells, the presence of a yet non-identified glial receptor for CDV was suggested. Altogether, our findings indicate that persistence in CDV infection results from intracellular cell-to-cell transmission requiring the CDV-H protein. Viral transfer, happening selectively at the tip of astrocytic processes, may help the virus to cover long distances in the astroglial network, "outrunning" the host's immune response in demyelinating plaques, thus continuously eliciting new lesions.

  4. Genetic diversity and phylogenetic analysis of the attachment glycoprotein of phocine distemper viruses of the 2002 and 1988 epizootics

    DEFF Research Database (Denmark)

    Nielsen, L; Arctander, P; Jensen, T H

    2009-01-01

    of phocine distemper virus (PDV) together with other morbilliviruses, suggests that the re-emergent 2002 PDV is more closely related to a putative recent ancestral PDV than the 1988 PDV isolates. Moreover, upsurges of distemper disease in land-living carnivores linked in time and locality to the 2002 seal...

  5. A recombinant Hendra virus G glycoprotein-based subunit vaccine protects ferrets from lethal Hendra virus challenge.

    Science.gov (United States)

    Pallister, Jackie; Middleton, Deborah; Wang, Lin-Fa; Klein, Reuben; Haining, Jessica; Robinson, Rachel; Yamada, Manabu; White, John; Payne, Jean; Feng, Yan-Ru; Chan, Yee-Peng; Broder, Christopher C

    2011-08-05

    The henipaviruses, Hendra virus (HeV) and Nipah virus (NiV), are two deadly zoonotic viruses for which no vaccines or therapeutics have yet been approved for human or livestock use. In 14 outbreaks since 1994 HeV has been responsible for multiple fatalities in horses and humans, with all known human infections resulting from close contact with infected horses. A vaccine that prevents virus shedding in infected horses could interrupt the chain of transmission to humans and therefore prevent HeV disease in both. Here we characterise HeV infection in a ferret model and show that it closely mirrors the disease seen in humans and horses with induction of systemic vasculitis, including involvement of the pulmonary and central nervous systems. This model of HeV infection in the ferret was used to assess the immunogenicity and protective efficacy of a subunit vaccine based on a recombinant soluble version of the HeV attachment glycoprotein G (HeVsG), adjuvanted with CpG. We report that ferrets vaccinated with a 100 μg, 20 μg or 4 μg dose of HeVsG remained free of clinical signs of HeV infection following a challenge with 5000 TCID₅₀ of HeV. In addition, and of considerable importance, no evidence of virus or viral genome was detected in any tissues or body fluids in any ferret in the 100 and 20 μg groups, while genome was detected in the nasal washes only of one animal in the 4 μg group. Together, our findings indicate that 100 μg or 20 μg doses of HeVsG vaccine can completely prevent a productive HeV infection in the ferret, suggesting that vaccination to prevent the infection and shedding of HeV is possible. Copyright © 2011 Elsevier Ltd. All rights reserved.

  6. The 5’cap of Tobacco Mosaic Virus (TMV) is required for virion attachment to the actin/ER network during early infection

    DEFF Research Database (Denmark)

    Christensen, Nynne Meyn; Tilsner, Jens; Bell, Karen

    to the motile cortical actin/ER network within minutes of injection. Granule movement on actin/ER was arrested by actin inhibitors indicating actindependent RNA movement. The 5’ methylguanosine TMV cap was shown to be required for vRNA anchoring to the ER. TMV vRNA lacking the 5’cap failed to form granules...... the fluorescent vRNA pool nor co-injected GFP left the injected trichome, indicating that the synthesis of unlabelled progeny viral (v)RNA is required to initiate cell-cell movement, and that virus movement is not accompanied by passive plasmodesmatal gating. Cy3-vRNA formed granules that became anchored...... on the same ER-bound granules, indicating that TMV virions may become attached to the ER prior to uncoating of the viral genome....

  7. Bat flight and zoonotic viruses

    Science.gov (United States)

    O'Shea, Thomas J.; Cryan, Paul M.; Cunningham, Andrew A.; Fooks, Anthony R.; Hayman, David T.S.; Luis, Angela D.; Peel, Alison J.; Plowright, Raina K.; Wood, James L.N.

    2014-01-01

    Bats are sources of high viral diversity and high-profile zoonotic viruses worldwide. Although apparently not pathogenic in their reservoir hosts, some viruses from bats severely affect other mammals, including humans. Examples include severe acute respiratory syndrome coronaviruses, Ebola and Marburg viruses, and Nipah and Hendra viruses. Factors underlying high viral diversity in bats are the subject of speculation. We hypothesize that flight, a factor common to all bats but to no other mammals, provides an intensive selective force for coexistence with viral parasites through a daily cycle that elevates metabolism and body temperature analogous to the febrile response in other mammals. On an evolutionary scale, this host–virus interaction might have resulted in the large diversity of zoonotic viruses in bats, possibly through bat viruses adapting to be more tolerant of the fever response and less virulent to their natural hosts.

  8. Virus-like attachment sites and plastic CpG islands:landmarks of diversity in plant Del retrotransposons.

    Directory of Open Access Journals (Sweden)

    Guilherme M Q Cruz

    Full Text Available Full-length Del elements from ten angiosperm genomes, 5 monocot and 5 dicot, were retrieved and putative attachment (att sites were identified. In the 2432 Del elements, two types of U5 att sites and a single conserved type of U3 att site were identified. Retroviral att sites confer specificity to the integration process, different att sites types therefore implies lineage specificity. While some features are common to all Del elements, CpG island patterns within the LTRs were particular to lineage specific clusters. All eudicot copies grouped into one single clade while the monocots harbour a more diverse collection of elements. Furthermore, full-length Del elements and truncated copies were unevenly distributed amongst chromosomes. Elements of Del lineage are organized in plants into three clusters and each cluster is composed of elements with distinct LTR features. Our results suggest that the Del lineage efficiently amplified in the monocots and that one branch is probably a newly emerging sub-lineage. Finally, sequences in all groups are under purifying selection. These results show the LTR region is dynamic and important in the evolution of LTR-retrotransposons, we speculate that it is a trigger for retrotransposon diversification.

  9. Canine Distemper Virus Infects Canine Keratinocytes and Immune Cells by Using Overlapping and Distinct Regions Located on One Side of the Attachment Protein▿

    Science.gov (United States)

    Langedijk, Johannes P. M.; Janda, Jozef; Origgi, Francesco C.; Örvell, Claes; Vandevelde, Marc; Zurbriggen, Andreas; Plattet, Philippe

    2011-01-01

    The morbilliviruses measles virus (MeV) and canine distemper virus (CDV) both rely on two surface glycoproteins, the attachment (H) and fusion proteins, to promote fusion activity for viral cell entry. Growing evidence suggests that morbilliviruses infect multiple cell types by binding to distinct host cell surface receptors. Currently, the only known in vivo receptor used by morbilliviruses is CD150/SLAM, a molecule expressed in certain immune cells. Here we investigated the usage of multiple receptors by the highly virulent and demyelinating CDV strain A75/17. We based our study on the assumption that CDV-H may interact with receptors similar to those for MeV, and we conducted systematic alanine-scanning mutagenesis on CDV-H throughout one side of the β-propeller documented in MeV-H to contain multiple receptor-binding sites. Functional and biochemical assays performed with SLAM-expressing cells and primary canine epithelial keratinocytes identified 11 residues mutation of which selectively abrogated fusion in keratinocytes. Among these, four were identical to amino acids identified in MeV-H as residues contacting a putative receptor expressed in polarized epithelial cells. Strikingly, when mapped on a CDV-H structural model, all residues clustered in or around a recessed groove located on one side of CDV-H. In contrast, reported CDV-H mutants with SLAM-dependent fusion deficiencies were characterized by additional impairments to the promotion of fusion in keratinocytes. Furthermore, upon transfer of residues that selectively impaired fusion induction in keratinocytes into the CDV-H of the vaccine strain, fusion remained largely unaltered. Taken together, our results suggest that a restricted region on one side of CDV-H contains distinct and overlapping sites that control functional interaction with multiple receptors. PMID:21849439

  10. The Central Role of the Matrix Protein in Nipah Virus Assembly and Morphogenesis

    Science.gov (United States)

    2007-03-23

    attention paid to the cytoplasmic domains of these proteins. Co-localization of M and at least one envelope glycoprotein has been observed for SeV (111...from pCP630 (NiV M gene in pFastBac HTa ) using primers 5’- GTTTAAACCACCATGGAGCCGGACATC (NIVMS) and 5’- GTTTAAACTTAGCCCTTTAGAATTCTC (NIVMAS). The NiV...lipid rafts in assembly has received the most attention for MeV. The measles F and H glycoproteins associate with lipid rafts in the trans-Golgi

  11. Product Attachment

    NARCIS (Netherlands)

    Mugge, R.

    2007-01-01

    The topic of this doctoral research is the concept of product attachment for ordinary consumer durables. Product attachment is defined as the strength of the emotional bond a consumer experiences with a specific product. Specifically, the research investigated how this bond develops over time and

  12. In vitro assessment of attachment pattern and replication efficiency of H5N1 influenza A viruses with altered receptor specificity

    NARCIS (Netherlands)

    S. Chutinimitkul (Salin); D.A.J. van Riel (Debby); V.J. Munster (Vincent); J.M.A. van den Brand (Judith); G.F. Rimmelzwaan (Guus); T. Kuiken (Thijs); A.D.M.E. Osterhaus (Albert); R.A.M. Fouchier (Ron); E. de Wit (Emmie)

    2010-01-01

    textabstractThe continuous circulation of the highly pathogenic avian influenza (HPAI) H5N1 virus has been a cause of great concern. The possibility of this virus acquiring specificity for the human influenza A virus receptor, α2,6-linked sialic acids (SA), and being able to transmit efficiently

  13. Comparison of Shear Strength Properties for Undisturbed and Reconstituted Parit Nipah Peat, Johor

    Science.gov (United States)

    Azhar, A. T. S.; Norhaliza, W.; Ismail, B.; Abdullah, M. E.; Zakaria, M. N.

    2016-11-01

    Shear strength of soil is required to determine the soil stability and design the foundations. Peat is known as a soil with complex natural formations which also contributes problems to the researchers, developers, engineers and contractors in constructions and infrastructures. Most researchers conducted experiment and investigation of shear strength on peat using shear box test and simple shear test, but only a few had discovered the behavior of peat using triaxial consolidated undrained test. The aim of this paper is to determine the undrained shear strength properties of reconstituted peat and undisturbed peat of Parit Nipah, Johor for comparison purposes. All the reconstituted peat samples were formed with the size that passed opening sieve 3.35 mm and preconsolidation pressure at 100 kPa. The result of undrained shear strength of reconstituted peat was 21kPa for cohesion with the angle of friction, 41° compare to the undisturbed peat with cohesion 10 kPa and angle of friction, 16°. The undrained shear strength properties result obtained shows that the reconstituted peat has higher strength than undisturbed peat. For relationship deviator stress-strain, σd max and excess pore pressure, Δu, it shows that both of undisturbed and reconstituted gradually increased when σ’ increased, but at the end of the test, the values are slightly dropped. The physical properties of undisturbed and reconstituted peat were also investigated to correlate with the undrained shear strength results.

  14. Pengaruh Konsentrasi Asam Sitrat dan Suhu Pengempaan terhadap Kualitas Papan Partikel Pelepah Nipah

    Directory of Open Access Journals (Sweden)

    Ragil Widyorini

    2014-01-01

    Full Text Available Papan partikel tanpa perekat sintesis atau binderlessboard merupakan alternatif produk ramah lingkungan yang potensial dikembangkan di Indonesia. Kelemahan produk tersebut diantaranya adalah kestabilan dimensinya yang relatif rendah. Alternatif perbaikan produk bisa dilakukan dengan menambahkan bahan pengaktif komponen kimia. Asam sitrat memiliki tiga gugus karboksil dan diharapkan dapat membentuk ikatan ester dengan gugus hidroksil pada permukaan kayu. Penelitian menggunakan asam sitrat relatif baru dan belum banyak dikembangkan, oleh karena itu penelitian ini ditujukan untuk pengembangan produk biokomposit dengan menggunakan asam sitrat sebagai bahan pengikat. Bahan yang digunakan adalah pelepah nipah dengan ukuran partikel (halus dan kasar, konsentrasi asam sitrat (0% dan 10%, dan suhu pengempaan (180ºC dan 200°C. Pengujian sifat fisika dan mekanika dilakukan berdasarkan Japanese Industrial Standard untuk papan partikel (JIS A 5908. Penambahan asam sitrat memperlihatkan kenaikan sifat fisika (penyerapan air dan mekanika papan partikel. Perbedaan ukuran partikel mempengaruhi sifat mekanika papan partikel dimana ukuran partikel kasar memberikan nilai mekanika yang lebih baik dibandingkan dengan ukuran partikel halus. Kualitas papan partikel optimum diperoleh pada kondisi pengempaan 180ºC, penambahan asam sitrat 10% dari partikel ukuran kasar dengan nilai pengembangan tebal 2,4%, penyerapan air 41%, kekuatan rekat internal 0,2 MPa, modulus patah 5,5 MPa, dan modulus elastisitas 1,6 GPa. Kata kunci: asam sitrat, pelepah nipah, konsentrasi asam sitrat, suhu pengempa   Effect of Citric Acid Concentration and Pressing Temperature on the Quality of Particleboard from Nypa Frond Abstract Binderlessboard is one of the potential eco friendly products that can be developed in Indonesia. However, its boards usually have low in dimensional stability. Addition of the chemical agent, such as citric acid, that can improve the dimensional stability is

  15. Functional Expression. Ephrin Receptor Tropism, and Heterotypic Functionality of the Attachment and Fusion Glycoproteins of Cedar Virus, a Newly Discovered Henipavirus

    Science.gov (United States)

    2012-08-20

    the apparent absence of NiV disease episodes in Cambodia are due to differences in the virulence of NiV lineages is not currently known. 1.3...relationships to viruses and human health. This represents a renewed interest in work that was begun with the discovery of 25 rabies virus in bats in...develop detection methods that are specific enough to distinguish the highly virulent NiV and HeV from other circulating “henipa-like” viruses. Here

  16. Activity of the HIV-1 attachment inhibitor BMS-626529, the active component of the prodrug BMS-663068, against CD4-independent viruses and HIV-1 envelopes resistant to other entry inhibitors.

    Science.gov (United States)

    Li, Zhufang; Zhou, Nannan; Sun, Yongnian; Ray, Neelanjana; Lataillade, Max; Hanna, George J; Krystal, Mark

    2013-09-01

    BMS-626529 is a novel small-molecule HIV-1 attachment inhibitor active against both CCR5- and CXCR4-tropic viruses. BMS-626529 functions by preventing gp120 from binding to CD4. A prodrug of this compound, BMS-663068, is currently in clinical development. As a theoretical resistance pathway to BMS-663068 could be the development of a CD4-independent phenotype, we examined the activity of BMS-626529 against CD4-independent viruses and investigated whether resistance to BMS-626529 could be associated with a CD4-independent phenotype. Finally, we evaluated whether cross-resistance exists between BMS-626529 and other HIV-1 entry inhibitors. Two laboratory-derived envelopes with a CD4-independent phenotype (one CXCR4 tropic and one CCR5 tropic), five envelopes from clinical isolates with preexisting BMS-626529 resistance, and several site-specific mutant BMS-626529-resistant envelopes were examined for their dependence on CD4 for infectivity or susceptibility to BMS-626529. Viruses resistant to other entry inhibitors (enfuvirtide, maraviroc, and ibalizumab) were also examined for susceptibility to BMS-626529. Both CD4-independent laboratory isolates retained sensitivity to BMS-626529 in CD4(-) cells, while HIV-1 envelopes from viruses resistant to BMS-626529 exhibited no evidence of a CD4-independent phenotype. BMS-626529 also exhibited inhibitory activity against ibalizumab- and enfuvirtide-resistant envelopes. While there appeared to be some association between maraviroc resistance and reduced susceptibility to BMS-626529, an absolute correlation cannot be presumed, since some CCR5-tropic maraviroc-resistant envelopes remained sensitive to BMS-626529. Clinical use of the prodrug BMS-663068 is unlikely to promote resistance via generation of CD4-independent virus. No cross-resistance between BMS-626529 and other HIV entry inhibitors was observed, which could allow for sequential or concurrent use with different classes of entry inhibitors.

  17. Antioxidant and Atibacterial Activities of Nipah (Nypa fruticans against Vibrio sp. Isolated From Mud Crab (Scylla sp.

    Directory of Open Access Journals (Sweden)

    Imra Imra

    2016-12-01

    Full Text Available Nipah (Nypa fruticans is the potential plant for source of active compound such as antioksidant and antibacterial substances. The plants are dispersed in Sumatera, Kalimantan, Sulawesi, Maluku and Papua Island. The aim of this research were determine the antioxidant and antibacterial activity from of nipah (fruit and leaf that it extraction with methanol, and than determine toxicity and active compound contained in this extract. Diffusion agar and DPPH method were use for antibacterial and antioxsidant assay, respectively. Antioxsidant activity from nipah’s leaf extract was more effective (22,5 µg/mL than nipah’s fruit extract (415 µg/mL. This activity to be classified to the strong antioxidant activity (IC50<50 µg/mL. The antibacterial activity from leaf extract was strong to inhibited Vibrio sp. with inhibition zone 8,75 mm. The crude extract of nipah’s leaf was toxic with toxicity value is 663,598 µg/mL. Flavonoids, steroids, tanin, saponin and phenol hidroquinon were the active compounds contained in the extract of nipah’s leaf.

  18. Antioxidant and Atibacterial Activities of Nipah (Nypa fruticans against Vibrio sp. Isolated From Mud Crab (Scylla sp.

    Directory of Open Access Journals (Sweden)

    Imra Imra

    2017-02-01

    Full Text Available AbstractNipah (Nypa fruticans is the potential plant for source of active compound such as antioksidant and antibacterial substances. The plants are dispersed in Sumatera, Kalimantan, Sulawesi, Maluku and Papua Island. The aim of this research were determine the antioxidant and antibacterial activity from of nipah (fruit and leaf that it extraction with methanol, and than determine toxicity and active compound contained in this extract. Diffusion agar and DPPH method were use for antibacterial and antioxsidant assay, respectively. Antioxsidant activity from nipah’s leaf extract was more effective (22,5 μg/mL than nipah’s fruit extract (415 μg/mL. This activity to be classified to the strong antioxidant activity (IC50<50 μg/mL. The antibacterial activity from leaf extract was strong to inhibited Vibrio sp. with inhibition zone 8,75 mm. The crude extract of nipah’s leaf was toxic with toxicity value is 663,598 μg/mL. Flavonoids, steroids, tanin, saponin and phenol hidroquinon were the active compounds contained in the extract of nipah’s leaf.

  19. Lectin-Dependent Enhancement of Ebola Virus Infection via Soluble and Transmembrane C-type Lectin Receptors

    Science.gov (United States)

    Lear, Calli; Chen, Li; Yantosca, L. Michael; Scully, Corinne; Sarraju, Ashish; Sokolovska, Anna; Zariffard, M. Reza; Eisen, Damon P.; Mungall, Bruce A.; Kotton, Darrell N.; Omari, Amel; Huang, I-Chueh; Farzan, Michael; Takahashi, Kazue; Stuart, Lynda; Stahl, Gregory L.; Ezekowitz, Alan B.; Spear, Gregory T.; Olinger, Gene G.; Schmidt, Emmett V.; Michelow, Ian C.

    2013-01-01

    Mannose-binding lectin (MBL) is a key soluble effector of the innate immune system that recognizes pathogen-specific surface glycans. Surprisingly, low-producing MBL genetic variants that may predispose children and immunocompromised individuals to infectious diseases are more common than would be expected in human populations. Since certain immune defense molecules, such as immunoglobulins, can be exploited by invasive pathogens, we hypothesized that MBL might also enhance infections in some circumstances. Consequently, the low and intermediate MBL levels commonly found in human populations might be the result of balancing selection. Using model infection systems with pseudotyped and authentic glycosylated viruses, we demonstrated that MBL indeed enhances infection of Ebola, Hendra, Nipah and West Nile viruses in low complement conditions. Mechanistic studies with Ebola virus (EBOV) glycoprotein pseudotyped lentiviruses confirmed that MBL binds to N-linked glycan epitopes on viral surfaces in a specific manner via the MBL carbohydrate recognition domain, which is necessary for enhanced infection. MBL mediates lipid-raft-dependent macropinocytosis of EBOV via a pathway that appears to require less actin or early endosomal processing compared with the filovirus canonical endocytic pathway. Using a validated RNA interference screen, we identified C1QBP (gC1qR) as a candidate surface receptor that mediates MBL-dependent enhancement of EBOV infection. We also identified dectin-2 (CLEC6A) as a potentially novel candidate attachment factor for EBOV. Our findings support the concept of an innate immune haplotype that represents critical interactions between MBL and complement component C4 genes and that may modify susceptibility or resistance to certain glycosylated pathogens. Therefore, higher levels of native or exogenous MBL could be deleterious in the setting of relative hypocomplementemia which can occur genetically or because of immunodepletion during active

  20. Lectin-dependent enhancement of Ebola virus infection via soluble and transmembrane C-type lectin receptors.

    Directory of Open Access Journals (Sweden)

    Matthew Brudner

    Full Text Available Mannose-binding lectin (MBL is a key soluble effector of the innate immune system that recognizes pathogen-specific surface glycans. Surprisingly, low-producing MBL genetic variants that may predispose children and immunocompromised individuals to infectious diseases are more common than would be expected in human populations. Since certain immune defense molecules, such as immunoglobulins, can be exploited by invasive pathogens, we hypothesized that MBL might also enhance infections in some circumstances. Consequently, the low and intermediate MBL levels commonly found in human populations might be the result of balancing selection. Using model infection systems with pseudotyped and authentic glycosylated viruses, we demonstrated that MBL indeed enhances infection of Ebola, Hendra, Nipah and West Nile viruses in low complement conditions. Mechanistic studies with Ebola virus (EBOV glycoprotein pseudotyped lentiviruses confirmed that MBL binds to N-linked glycan epitopes on viral surfaces in a specific manner via the MBL carbohydrate recognition domain, which is necessary for enhanced infection. MBL mediates lipid-raft-dependent macropinocytosis of EBOV via a pathway that appears to require less actin or early endosomal processing compared with the filovirus canonical endocytic pathway. Using a validated RNA interference screen, we identified C1QBP (gC1qR as a candidate surface receptor that mediates MBL-dependent enhancement of EBOV infection. We also identified dectin-2 (CLEC6A as a potentially novel candidate attachment factor for EBOV. Our findings support the concept of an innate immune haplotype that represents critical interactions between MBL and complement component C4 genes and that may modify susceptibility or resistance to certain glycosylated pathogens. Therefore, higher levels of native or exogenous MBL could be deleterious in the setting of relative hypocomplementemia which can occur genetically or because of immunodepletion

  1. Ecological dynamics of emerging bat virus spillover

    Science.gov (United States)

    Plowright, Raina K.; Eby, Peggy; Hudson, Peter J.; Smith, Ina L.; Westcott, David; Bryden, Wayne L.; Middleton, Deborah; Reid, Peter A.; McFarlane, Rosemary A.; Martin, Gerardo; Tabor, Gary M.; Skerratt, Lee F.; Anderson, Dale L.; Crameri, Gary; Quammen, David; Jordan, David; Freeman, Paul; Wang, Lin-Fa; Epstein, Jonathan H.; Marsh, Glenn A.; Kung, Nina Y.; McCallum, Hamish

    2015-01-01

    Viruses that originate in bats may be the most notorious emerging zoonoses that spill over from wildlife into domestic animals and humans. Understanding how these infections filter through ecological systems to cause disease in humans is of profound importance to public health. Transmission of viruses from bats to humans requires a hierarchy of enabling conditions that connect the distribution of reservoir hosts, viral infection within these hosts, and exposure and susceptibility of recipient hosts. For many emerging bat viruses, spillover also requires viral shedding from bats, and survival of the virus in the environment. Focusing on Hendra virus, but also addressing Nipah virus, Ebola virus, Marburg virus and coronaviruses, we delineate this cross-species spillover dynamic from the within-host processes that drive virus excretion to land-use changes that increase interaction among species. We describe how land-use changes may affect co-occurrence and contact between bats and recipient hosts. Two hypotheses may explain temporal and spatial pulses of virus shedding in bat populations: episodic shedding from persistently infected bats or transient epidemics that occur as virus is transmitted among bat populations. Management of livestock also may affect the probability of exposure and disease. Interventions to decrease the probability of virus spillover can be implemented at multiple levels from targeting the reservoir host to managing recipient host exposure and susceptibility. PMID:25392474

  2. Mechanism of human immunodeficiency virus type 1 resistance to monoclonal antibody B12 that effectively targets the site of CD4 attachment.

    Science.gov (United States)

    Wu, Xueling; Zhou, Tongqing; O'Dell, Sijy; Wyatt, Richard T; Kwong, Peter D; Mascola, John R

    2009-11-01

    The region of the human immunodeficiency virus type 1 (HIV-1) envelope glycoprotein gp120 that engages its primary cellular receptor CD4 forms a site of vulnerability to neutralizing antibodies. The monoclonal antibody b12 exploits the conservation and accessibility of the CD4-binding site to neutralize many, though not all, HIV-1 isolates. To understand the basis of viral resistance to b12, we used the atomic-level definition of b12-gp120 contact sites to study a panel of diverse circulating viruses. A combination of sequence analysis, computational modeling, and site-directed mutagenesis was used to determine the influence of amino acid variants on binding and neutralization by b12. We found that several substitutions within the dominant b12 contact surface, called the CD4-binding loop, mediated b12 resistance, and that these substitutions resided just proximal to the known CD4 contact surface. Hence, viruses varied in key b12 contact residues that are proximal to, but not part of, the CD4 contact surface. This explained how viral isolates were able to evade b12 neutralization while maintaining functional binding to CD4. In addition, some viruses were resistant to b12 despite minimal sequence variation at b12 contact sites. Such neutralization resistance usually could be reversed by alterations at residues thought to influence the quaternary configuration of the viral envelope spike. To design immunogens that elicit neutralizing antibodies directed to the CD4-binding site, researchers need to address the antigenic variation within this region of gp120 and the restricted access to the CD4-binding site imposed by the native configuration of the trimeric viral envelope spike.

  3. Myristic acid, a rare fatty acid, is the lipid attached to the transforming protein of Rous sarcoma virus and its cellular homolog

    International Nuclear Information System (INIS)

    Buss, J.E.; Sefton, B.M.

    1985-01-01

    The lipid bound to p60/sub src/, the transforming protein of Rous sarcoma virus, has been identified by gas and thin-layer chromatography as the 14-carbon saturated fatty acid, myristic acid. The protein can be labeled biosynthetically with either [ 3 H]myristic acid or [ 3 H]palmitic acid. Incorporation of [ 3 H]myristic acid was noticeably greater than incorporation of [ 3 H]palmitic acid. All of the [ 3 H]myristic acid-derived label in p60/sub src/ was present as myristic acid. In contrast, none of the radioactivity derived from [ 3 H]palmitic acid was recovered as palmitic acid. Instead, all 3 H incorporated into p60/sub src/ from [ 3 H]palmitic acid arose by metabolism to myristic acid. The cellular tyrosine kinase, p60c-/sub src/ also contains myristic acid. By comparison of the extent of myristylation of p60v-/sub src/ with that of the Moloney murine leukemia virus structural protein precursor, Pr65gag, the authors estimate that greater than 80% of the molecules of p60v-/sub src/ contain one molecule of this fatty acid. Myristylation is a rare form of protein modification. p60v-/sub src/ contains 10 to 40% of the myristic acid bound to protein in cells transformed by Rous sarcoma virus and is easily identified in total cell lysates when [ 3 H]myristic acid-labeled proteins are separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis. Comparison of the amount of [ 3 H]myristic acid-labeled p60/sub src/ in total cell lysates and in immunoprecipitates suggests that immunoprecipitation with rabbit anti-Rous sarcoma virus tumor sera detects ca. 25% of the p60/sub src/ present in cells

  4. Paternal Attachment, Parenting Beliefs and Children's Attachment

    Science.gov (United States)

    Howard, Kimberly S.

    2010-01-01

    Relationships between fathers' romantic attachment style, parenting beliefs and father-child attachment security and dependence were examined in a diverse sample of 72 fathers of young children. Paternal romantic attachment style was coded based on fathers' endorsement of a particular style represented in the Hazan and Shaver Three-Category…

  5. Neuraminidase Receptor Binding Variants of Human Influenza A(H3N2) Viruses Resulting from Substitution of Aspartic Acid 151 in the Catalytic Site: a Role in Virus Attachment?▿

    Science.gov (United States)

    Lin, Yi Pu; Gregory, Victoria; Collins, Patrick; Kloess, Johannes; Wharton, Stephen; Cattle, Nicholas; Lackenby, Angie; Daniels, Rodney; Hay, Alan

    2010-01-01

    Changes in the receptor binding characteristics of human H3N2 viruses have been evident from changes in the agglutination of different red blood cells (RBCs) and the reduced growth capacity of recently isolated viruses, particularly in embryonated eggs. An additional peculiarity of viruses circulating in 2005 to 2009 has been the poor inhibition of hemagglutination by postinfection ferret antisera for many viruses isolated in MDCK cells, including homologous reference viruses. This was shown not to be due to an antigenic change in hemagglutinin (HA) but was shown to be the result of a mutation in aspartic acid 151 of neuraminidase (NA) to glycine, asparagine, or alanine, which caused an oseltamivir-sensitive agglutination of RBCs. The D151G substitution was shown to cause a change in the specificity of NA such that it acquired the capacity to bind receptors, which were refractory to enzymatic cleavage, without altering its ability to remove receptors for HA. Thus, the inhibition of NA-dependent agglutination by the inclusion of oseltamivir carboxylate in the assay was effective in restoring the anti-HA specificity of the hemagglutination inhibition (HI) assay for monitoring antigenic changes in HA. Since the NA-dependent binding activity did not affect virus neutralization, and virus populations in clinical specimens possessed, at most, low levels of the “151 mutant,” the biological significance of this feature of NA in, for example, immune evasion is unclear. It is apparent, however, that an important role of aspartic acid 151 in the activity of NA may be to restrict the specificity of the NA interaction and its receptor-destroying activity to complement that of HA receptor binding. PMID:20410266

  6. Attachment behavior in rats

    NARCIS (Netherlands)

    Sigling, H.O.

    2009-01-01

    This thesis describes studies into the rat as an animal model for attachment, along the lines of Bowlby's attachment theory. First, the relation between attachment and human psychopathology is reviewed. The conclusion is that psychopathology is more frequent in insecure attached persons and that

  7. Computer Virus Protection

    Science.gov (United States)

    Rajala, Judith B.

    2004-01-01

    A computer virus is a program--a piece of executable code--that has the unique ability to replicate. Like biological viruses, computer viruses can spread quickly and are often difficult to eradicate. They can attach themselves to just about any type of file, and are spread by replicating and being sent from one individual to another. Simply having…

  8. Deduced sequences of the membrane fusion and attachment proteins of canine distemper viruses isolated from dogs and wild animals in Korea.

    Science.gov (United States)

    Bae, Chae-Wun; Lee, Joong-Bok; Park, Seung-Yong; Song, Chang-Seon; Lee, Nak-Hyung; Seo, Kun-Ho; Kang, Young-Sun; Park, Choi-Kyu; Choi, In-Soo

    2013-08-01

    Canine distemper virus (CDV) causes highly contagious respiratory, gastrointestinal, and neurological diseases in wild and domestic animal species. Despite a broad vaccination campaign, the disease is still a serious problem worldwide. In this study, six field CDV strains were isolated from three dogs, two raccoon dogs, and one badger in Korea. The full sequence of the genes encoding fusion (F) and hemagglutinin (H) proteins were compared with those of other CDVs including field and vaccine strains. The phylogenetic analysis for the F and H genes indicated that the two CDV strains isolated from dogs were most closely related to Chinese strains in the Asia-1 genotype. Another four strains were closely related to Japanese strains in the Asia-2 genotype. The six currently isolated strains shared 90.2-92.1% and 88.2-91.8% identities with eight commercial vaccine strains in their nucleotide and amino acid sequences of the F protein, respectively. They also showed 90.1-91.4% and 87.8-90.7% identities with the same vaccine strains in their nucleotide and deduced amino acid sequences of the H protein, respectively. Different N-linked glycosylation sites were identified in the F and H genes of the six isolates from the prototype vaccine strain Onderstepoort. Collectively, these results demonstrate that at least two different CDV genotypes currently exist in Korea. The considerable genetic differences between the vaccine strains and wild-type isolates would be a major factor of the incomplete protection of dogs from CDV infections.

  9. Attachment and social networks.

    Science.gov (United States)

    Gillath, Omri; C Karantzas, Gery; Lee, Juwon

    2018-02-21

    The current review covers two lines of research linking attachment and social networks. One focuses on attachment networks (the people who fulfill one's attachment needs), examining composition and age-related differences pertaining to these networks. The other line integrates attachment with social network analysis to investigate how individual differences in adult attachment are associated with the management and characteristics (e.g., density, multiplexity, and centrality) of people's social networks. We show that most people's attachment networks are small and hierarchical, with one figure being the primary attachment figure (often a mother or romantic partner, depending on age). Furthermore, attachment style predicts network characteristics and management, such that insecurity is associated with less closeness, multiplexity, centrality, and poorer management (less maintenance, more dissolution). Copyright © 2018 Elsevier Ltd. All rights reserved.

  10. Attachment and Related Variables

    Directory of Open Access Journals (Sweden)

    Umit Morsunbul

    2011-09-01

    Full Text Available Attachment which is defined as strong emotional bond people develop for significant others have been investigated by researchers for long years. Attachment theory proposes that attachment patterns developed in the first stages of life are carried onto next stages of life with internal working models. Additionally it is also proposed that attachment patterns are important to determine individual’s social-emotional competence. This study aims to review how attachment patterns differ according to life stages, continuity/discontiniuty of attachment patterns developed in the first stages of life and evaluate the relations between attachment patterns and social-emotional competence. The basic features of social relations model, relationship between attachment patterns and identity development, and risk taking behavior in adolescence have also been investigated in this review.

  11. Attachment Without Fear.

    Science.gov (United States)

    Bell, David C

    2009-12-01

    John Bowlby hypothesized an attachment system that interacts with caregiving, exploration, and fear systems in the brain, with a particular emphasis on fear. Neurobiological research confirms many of his hypotheses and also raises some new questions. A psychological model based on this neurobiological research is presented here. The model extends conventional attachment theory by describing additional attachment processes independent of fear. In this model, the attachment elements of trust, openness, and dependence interact with the caregiving elements of caring, empathy, and responsibility.

  12. Attachment Without Fear

    OpenAIRE

    Bell, David C.

    2009-01-01

    John Bowlby hypothesized an attachment system that interacts with caregiving, exploration, and fear systems in the brain, with a particular emphasis on fear. Neurobiological research confirms many of his hypotheses and also raises some new questions. A psychological model based on this neurobiological research is presented here. The model extends conventional attachment theory by describing additional attachment processes independent of fear. In this model, the attachment elements of trust, o...

  13. Electron-attachment processes

    International Nuclear Information System (INIS)

    Christophorou, L.G.; McCorkle, D.L.; Christodoulides, A.A.

    1982-01-01

    Topics covered include: (1) modes of production of negative ions, (2) techniques for the study of electron attachment processes, (3) dissociative electron attachment to ground-state molecules, (4) dissociative electron attachment to hot molecules (effects of temperature on dissociative electron attachment), (5) molecular parent negative ions, and (6) negative ions formed by ion-pair processes and by collisions of molecules with ground state and Rydberg atoms

  14. Belt attachment and system

    Energy Technology Data Exchange (ETDEWEB)

    Schneider, Abraham D.; Davidson, Erick M.

    2018-03-06

    Disclosed herein is a belt assembly including a flexible belt with an improved belt attachment. The belt attachment includes two crossbars spaced along the length of the belt. The crossbars retain bearings that allow predetermined movement in six degrees of freedom. The crossbars are connected by a rigid body that attaches to the bearings. Implements that are attached to the rigid body are simply supported but restrained in pitching rotation.

  15. Belt attachment and system

    Science.gov (United States)

    Schneider, Abraham D.; Davidson, Erick M.

    2016-02-02

    Disclosed herein is a belt assembly including a flexible belt with an improved belt attachment. The belt attachment includes two crossbars spaced along the length of the belt. The crossbars retain bearings that allow predetermined movement in six degrees of freedom. The crossbars are connected by a rigid body that attaches to the bearings. Implements that are attached to the rigid body are simply supported but restrained in pitching rotation.

  16. Attachment and Psychopathology

    Directory of Open Access Journals (Sweden)

    Mehmet Fatih Ustundag

    2011-06-01

    Full Text Available The type of attachment defined in the early stages of life and thought to be continuous, is a phenomenon that shapes the pattern of how a person makes contact with others. The clinical appearance of every type of attachment is different and each one has prospective and retrospective phenomenological reflections. In all stages of life and in close relationships, it can be observed if a person gets in close contact with someone else and if this relation bears supportive and protective qualities. According to attachment theorists, once it is defined as safe or unsafe during nursing period, it shows little change. Starting from Bowlby’s work, unsafe attachment type is considered as the determining factor of psychopathology in the later periods of life, while safe attachment is considered as in relation with healthy processes. The nature’s original model is safe attachment. Anxious/indecisive attachment, an unsafe attachment type, is associated with anxiety disorders and depressive disorder, while avoidant attachment is associated with behavior disorder and other extroverted pathologies. Disorganized/disoriented attachment is considered to be together with dissociative disorder. The aim of this paper is to review attachment theory and the relation between attachment and psychopathology.

  17. Attachment over Time.

    Science.gov (United States)

    Lewis, Michael; Feiring, Candice; Rosenthal, Saul

    2000-01-01

    Examined continuity in attachment classification from infancy through adolescence and related it to autobiographical memories of childhood, divorce, and maladjustment in white middle-class children. Found no continuity in attachment classification from 1 to 18 years and no relation between infant attachment status and adolescent adjustment.…

  18. Special Attachments. Module 19.

    Science.gov (United States)

    South Carolina State Dept. of Education, Columbia. Office of Vocational Education.

    This module on special attachments, one in a series dealing with industrial sewing machines, their attachments, and operation, covers four topics: gauges; cording attachment; zipper foot; and hemming, shirring, and binding. For each topic these components are provided: an introduction, directions, an objective, learning activities, student…

  19. European Bats as Carriers of Viruses with Zoonotic Potential

    Directory of Open Access Journals (Sweden)

    Claudia Kohl

    2014-08-01

    Full Text Available Bats are being increasingly recognized as reservoir hosts of highly pathogenic and zoonotic emerging viruses (Marburg virus, Nipah virus, Hendra virus, Rabies virus, and coronaviruses. While numerous studies have focused on the mentioned highly human-pathogenic bat viruses in tropical regions, little is known on similar human-pathogenic viruses that may be present in European bats. Although novel viruses are being detected, their zoonotic potential remains unclear unless further studies are conducted. At present, it is assumed that the risk posed by bats to the general public is rather low. In this review, selected viruses detected and isolated in Europe are discussed from our point of view in regard to their human-pathogenic potential. All European bat species and their roosts are legally protected and some European species are even endangered. Nevertheless, the increasing public fear of bats and their viruses is an obstacle to their protection. Educating the public regarding bat lyssaviruses might result in reduced threats to both the public and the bats.

  20. European bats as carriers of viruses with zoonotic potential.

    Science.gov (United States)

    Kohl, Claudia; Kurth, Andreas

    2014-08-13

    Bats are being increasingly recognized as reservoir hosts of highly pathogenic and zoonotic emerging viruses (Marburg virus, Nipah virus, Hendra virus, Rabies virus, and coronaviruses). While numerous studies have focused on the mentioned highly human-pathogenic bat viruses in tropical regions, little is known on similar human-pathogenic viruses that may be present in European bats. Although novel viruses are being detected, their zoonotic potential remains unclear unless further studies are conducted. At present, it is assumed that the risk posed by bats to the general public is rather low. In this review, selected viruses detected and isolated in Europe are discussed from our point of view in regard to their human-pathogenic potential. All European bat species and their roosts are legally protected and some European species are even endangered. Nevertheless, the increasing public fear of bats and their viruses is an obstacle to their protection. Educating the public regarding bat lyssaviruses might result in reduced threats to both the public and the bats.

  1. BEWARE OF OPENING ATTACHMENTS IN E-MAIL

    CERN Multimedia

    2000-01-01

    Following the recent e-mail viruses you are asked to be cautious when opening e-mail attachments on your PC. Attachments that are apparently harmless might hide active content producing nasty effects as soon as they are opened. Some of these so called 'Trojan horses' can conceal themselves in very attractive pictures and funny slide shows.On the PC Windows infrastructure, CERN runs software to protect users from known viruses, but new ones can sometimes arrive before our software recognises them. They can enter your system when you open an attachment. To remove them it may be necessary to re-install the Windows software on your PC.

  2. ATTACHMENT AND TRANSFER

    OpenAIRE

    Pasare, Daniela

    2011-01-01

    Bowlby's concept of attachment and Freud's concept of transference are two of the most influential theories of how we construct mental representations of human relationships. The attachment’s theory offers one more strategy for the therapeutic approach. Factors that lead to a secure attachment between mother and child may also be applied to the relationship between patient and psychotherapist. Psychotherapy may help a patient create himself new attachment and relationship patterns. Creating a...

  3. Electron attachment in tetrafluoromethane

    International Nuclear Information System (INIS)

    Dutton, J.; Lucas, A.K.; Williams, A.W.; Goodings, A.

    1987-01-01

    A pulsed drift-tube technique has been employed to measure electron attachment coefficients in CF 4 . Previous measurements have been extended from approx. 45 Td to approx. 20 Td [1 Td = 10 -21 Vm 2 ] showing a decrease in the reduced attachment coefficient of approx. 2 orders of magnitude through this range of E/N [electric field/gas number density]. Absolute attachment coefficients as low as 1 x 10 -4 cm -1 have been determined. (author)

  4. Immunology of Bats and Their Viruses: Challenges and Opportunities

    Science.gov (United States)

    Schountz, Tony

    2014-01-01

    Bats are reservoir hosts of several high-impact viruses that cause significant human diseases, including Nipah virus, Marburg virus and rabies virus. They also harbor many other viruses that are thought to have caused disease in humans after spillover into intermediate hosts, including SARS and MERS coronaviruses. As is usual with reservoir hosts, these viruses apparently cause little or no pathology in bats. Despite the importance of bats as reservoir hosts of zoonotic and potentially zoonotic agents, virtually nothing is known about the host/virus relationships; principally because few colonies of bats are available for experimental infections, a lack of reagents, methods and expertise for studying bat antiviral responses and immunology, and the difficulty of conducting meaningful field work. These challenges can be addressed, in part, with new technologies that are species-independent that can provide insight into the interactions of bats and viruses, which should clarify how the viruses persist in nature, and what risk factors might facilitate transmission to humans and livestock. PMID:25494448

  5. Immunology of Bats and Their Viruses: Challenges and Opportunities

    Directory of Open Access Journals (Sweden)

    Tony Schountz

    2014-12-01

    Full Text Available Bats are reservoir hosts of several high-impact viruses that cause significant human diseases, including Nipah virus, Marburg virus and rabies virus. They also harbor many other viruses that are thought to have caused disease in humans after spillover into intermediate hosts, including SARS and MERS coronaviruses. As is usual with reservoir hosts, these viruses apparently cause little or no pathology in bats. Despite the importance of bats as reservoir hosts of zoonotic and potentially zoonotic agents, virtually nothing is known about the host/virus relationships; principally because few colonies of bats are available for experimental infections, a lack of reagents, methods and expertise for studying bat antiviral responses and immunology, and the difficulty of conducting meaningful field work. These challenges can be addressed, in part, with new technologies that are species-independent that can provide insight into the interactions of bats and viruses, which should clarify how the viruses persist in nature, and what risk factors might facilitate transmission to humans and livestock.

  6. Immunology of bats and their viruses: challenges and opportunities.

    Science.gov (United States)

    Schountz, Tony

    2014-12-01

    Bats are reservoir hosts of several high-impact viruses that cause significant human diseases, including Nipah virus, Marburg virus and rabies virus. They also harbor many other viruses that are thought to have caused disease in humans after spillover into intermediate hosts, including SARS and MERS coronaviruses. As is usual with reservoir hosts, these viruses apparently cause little or no pathology in bats. Despite the importance of bats as reservoir hosts of zoonotic and potentially zoonotic agents, virtually nothing is known about the host/virus relationships; principally because few colonies of bats are available for experimental infections, a lack of reagents, methods and expertise for studying bat antiviral responses and immunology, and the difficulty of conducting meaningful field work. These challenges can be addressed, in part, with new technologies that are species-independent that can provide insight into the interactions of bats and viruses, which should clarify how the viruses persist in nature, and what risk factors might facilitate transmission to humans and livestock.

  7. Attachment Security and Pain

    DEFF Research Database (Denmark)

    Andersen, Tonny Elmose; Lahav, Yael; Defrin, Ruth

    2015-01-01

    The present study assesses for the first time, the possible disruption effect of posttraumatic stress symptoms (PTSS) with regard to the protective role of attachment on pain, among ex-POWs. While secure attachment seems to serve as a buffer, decreasing the perception of pain, this function may...... and pain, as well as the mediation role of attachment between captivity and pain. The results imply that although attachment can be an important resource for coping with pain, it can be severely disrupted by PTSS among trauma survivors....

  8. Synthetic protocells interact with viral nanomachinery and inactivate pathogenic human virus.

    Directory of Open Access Journals (Sweden)

    Matteo Porotto

    Full Text Available We present a new antiviral strategy and research tool that could be applied to a wide range of enveloped viruses that infect human beings via membrane fusion. We test this strategy on two emerging zoonotic henipaviruses that cause fatal encephalitis in humans, Nipah (NiV and Hendra (HeV viruses. In the new approach, artificial cell-like particles (protocells presenting membrane receptors in a biomimetic manner were developed and found to attract and inactivate henipavirus envelope glycoprotein pseudovirus particles, preventing infection. The protocells do not accumulate virus during the inactivation process. The use of protocells that interact with, but do not accumulate, viruses may provide significant advantages over current antiviral drugs, and this general approach may have wide potential for antiviral development.

  9. Attachment Theory and Mindfulness

    Science.gov (United States)

    Snyder, Rose; Shapiro, Shauna; Treleaven, David

    2012-01-01

    We initiate a dialog between two central areas in the field of psychology today: attachment theory/research and mindfulness studies. The impact of the early mother-infant relationship on child development has been well established in the literature, with attachment theorists having focused on the correlation between a mother's capacity for…

  10. Attachment and psychosis

    NARCIS (Netherlands)

    Korver, N.

    2014-01-01

    The main goal of this thesis was to further our understanding of current psychosocial models by introducing attachment as a relevant developmental framework. Firstly, attachment theory provides a psychosocial model for a developmental pathway to psychosis. Secondly, after expression of psychotic

  11. Temperament and Attachment Disorders

    Science.gov (United States)

    Zeanah, Charles H.; Fox, Nathan A.

    2004-01-01

    Reviewed in this article is research on children with reactive attachment disorder (RAD) who exhibit specific patterns of socially aberrant behavior resulting from being maltreated or having limited opportunities to form selective attachments. There are no data explaining why 2 different patterns of the disorder, an emotionally withdrawn-inhibited…

  12. The Attachment Imperative

    DEFF Research Database (Denmark)

    Navne, Laura Emdal; Svendsen, Mette Nordahl; Gammeltoft, Tine

    2017-01-01

    argue that there are nuances in practices of relationmaking in need of more attention (i.e., the nexus of attachment and detachment). Refraining from touching, holding, and feeding their infants during critical periods, the parents enact detachment as integral to their practices of attachment...

  13. The neurobiology of attachment.

    Science.gov (United States)

    Insel, T R; Young, L J

    2001-02-01

    It is difficult to think of any behavioural process that is more intrinsically important to us than attachment. Feeding, sleeping and locomotion are all necessary for survival, but humans are, as Baruch Spinoza famously noted, "a social animal" and it is our social attachments that we live for. Over the past decade, studies in a range of vertebrates, including humans, have begun to address the neural basis of attachment at a molecular, cellular and systems level. This review describes some of the important insights from this work.

  14. Adult attachment and anxiety

    DEFF Research Database (Denmark)

    Nielsen, Sara Kerstine Kaya; Lønfeldt, Nicole Nadine; Wolitzky-Taylor, Kate

    2017-01-01

    Although there is substantial evidence for the role of emotion regulation in the etiology and maintenance of anxiety disorders, knowledge about what contributes to emotion dysregulation is sparse. Attachment style is related to emotion regulation and anxiety symptoms, but these variables have...... rarely been examined together. Examining emotion dysregulation within the context of anxiety disorders through an attachment theory framework will lead to a better understanding of the etiology and maintenance of anxiety disorders. In the present study we combined theoretically and empirically derived...... knowledge to examine the mediating role of emotion regulation between attachment dimensions (avoidance and anxiety) and anxiety symptoms....

  15. Aggression And Attachment Security

    Directory of Open Access Journals (Sweden)

    Prem Verma

    2007-06-01

    Full Text Available Objective:The aim of the present study is to examine the factors related aggression in Iranian and Indian school children. Method: Attachment security (dependency, availability, and total considered as the variable. The KSS questionnaire was administrated students in the 5th grade; 300 were Iranian and 300 were Indian consisted of 150 boys and 150 girls. Results: Attachment security demonstrated significant negative correlations with aggression in the boys, girls and the total Iranian sample. The dependency on mothers was the only case with insignificant correlation.In the Indian sample, attachment security was also found to be significantly negatively correlated with aggression. The only exception was the correlation between mother's availability and aggression in girls, which was not significant Conclusion: It is important that parents treat their children in a tender, manner so that a secure attachment develop between them.

  16. Attachment and internet addiction

    OpenAIRE

    Dolejšová, Aneta

    2014-01-01

    My bachelor thesis is concerned with attachment and internet addiction. Therefore it attempts to establish correlation between these two terms through four research questions. These questions focus on presence of both the attachment types and scores for dimension of avoidance and anxiety in terms of extent gravity of internet addiction either by respondents at risk of potential addiction problems or by respondents already showing some symptoms of addiction. Theoretical part deals with definit...

  17. Coronavirus Attachment and Replication

    Science.gov (United States)

    1988-03-28

    receptors on intestinal brush border membranes from normal host species were developed for canine (CCV), feline (FIPV), porcine ( TGEV ), human (HCV...229E), and bovine (BCV) coronaviruses. The antigenically related coronaviruses, CCV, FIPV, TGEV , and HCV -229E bound to intestinal brush border...Forest virus SPA staphylococcal protein A STM sample treatment mix TCA trichloroacetic acid TCV turkey corona virus TGEV transmissible

  18. E-mail security: new restriction on attachments

    CERN Multimedia

    The Mail Team

    2006-01-01

    In order to further protect CERN mail users against viruses that spread using malicious files, from 1st March onwards dangerous file types already forbidden as mail attachments will also be forbidden as contents of an archive attachment (.zip and .rar compressed files). More details, including a list of blocked file types, can be found at http://cern.ch/mmmservices/Help/?kbid=171010 The Mail Team

  19. E-mail security: new restriction on attachments

    CERN Multimedia

    The Mail Team

    2006-01-01

    In order to further protect CERN mail users against viruses that spread using malicious files, from 1st March onwards dangerous file types already forbidden as mail attachments will also be forbidden as contents of an archive attachment (.zip and .rar compressed files). More details, including a list of blocked file types, can be found at http://cern.ch/mmmservices/Help/?kbid=171010. The Mail Team

  20. Attachment and coercive sexual behavior.

    Science.gov (United States)

    Smallbone, S W; Dadds, M R

    2000-01-01

    This study examined the relationships between childhood attachment and coercive sexual behavior. One hundred sixty-two male undergraduate students completed self-report measures of childhood maternal attachment, childhood paternal attachment, adult attachment, antisociality, aggression, and coercive sexual behavior. As predicted, insecure childhood attachment, especially insecure paternal attachment, was associated with antisociality, aggression, and coercive sexual behavior. Moreover, childhood attachment independently predicted coercive sexual behavior after antisociality and aggression were statistically controlled. The hypothesis that paternal avoidant attachment would predict coercive sexual behavior independently of its relationship with aggression and antisociality was also supported. Posthoc analysis indicated that maternal anxious attachment was associated with antisociality and that paternal avoidant attachment was associated with both antisociality and coercive sexual behavior. These results are consistent with criminological and psychological research linking adverse early family experiences with offending and lend support to an attachment-theoretical framework for understanding offending behavior in general and sexual offending behavior in particular.

  1. Fuel rod attachment system

    International Nuclear Information System (INIS)

    Christiansen, D.W.

    1982-01-01

    A reusable system for removably attaching a nuclear reactor fuel rod to a support member. A locking cap is secured to the fuel rod and a locking strip is fastened to the support member or vice versa. The locking cap has two opposing fingers and shaped to form a socket having a body portion. The locking strip has an extension shaped to rigidly attach to the socket's body portion. The locking cap's fingers are resiliently deflectable. For attachment, the locking cap is longitudinally pushed onto the locking strip causing the extension to temporarily deflect open the fingers to engage the socket's body portion. For removal, the process is reversed. In an alternative embodiment, the cap is rigid and the strip is transversely resiliently compressible. (author)

  2. Love attitudes and attachment

    Directory of Open Access Journals (Sweden)

    María Elena Brenlla

    2016-02-01

    Full Text Available Love styles described by Lee are Eros (passionate love, Ludus (game-pla- ying love, Storge (friendship love, Mania (possessive, dependent love, Pragma (logical, “shopping list” love and Agape (all-giving, selfless love. Based on those types, Hendrick and Hendrick developed a 42-ítem rating questionnaire with 7 items measuring each love style (Love Attitudes Scale. Beside, inform about frequency in love relationships and attachment style. The purpose of this study was analyze the reliability and factor structure of the Love Attitudes Scale and to investigate the association between love attitudes and the attachment style. The results (N=280 participants indicate adequate internal consistency (alfa = 0,73. The items were intercorrelated and factored. The best solution extracted six factors using varimax rotation and all six factors accounted 41% of the total variance. Secure attachment was related positively to eros. 

  3. Pain, Affect, and Attachment

    Directory of Open Access Journals (Sweden)

    Carl Eduard Scheidt

    2015-05-01

    Full Text Available Various psychodynamic processes may underlie the development of psychogenic pain disorder such as conversion, the displacement of affect, or narcissistic defenses. However, many of the processes suggested are related to a disorder of affect regulation. The term affect regulation in psychoanalytic literature refers to phenomena which are often described by the concept of alexithymia. Empirical observations suggest that alexithymia is correlated to insecure attachment, especially an insecure dismissing representation of attachment. Psychodynamic psychotherapy in psychogenic pain disorder should focus on the reintegration of split-off affects which may provoke intensive counter-transference and which in order to be used therapeutically must be linked to attachment experiences within and outside of the therapeutic relationship.

  4. Insights into the coiled-coil organization of the Hendra virus phosphoprotein from combined biochemical and SAXS studies.

    Science.gov (United States)

    Beltrandi, Matilde; Blocquel, David; Erales, Jenny; Barbier, Pascale; Cavalli, Andrea; Longhi, Sonia

    2015-03-01

    Nipah and Hendra viruses are recently emerged paramyxoviruses belonging to the Henipavirus genus. The Henipavirus phosphoprotein (P) consists of a large intrinsically disordered domain and a C-terminal domain (PCT) containing alternating disordered and ordered regions. Among these latter is the P multimerization domain (PMD). Using biochemical, analytical ultracentrifugation and small-angle X-ray scattering (SAXS) studies, we show that Hendra virus (HeV) PMD forms an elongated coiled-coil homotrimer in solution, in agreement with our previous findings on Nipah virus (NiV) PMD. However, the orientation of the N-terminal region differs from that observed in solution for NiV PMD, consistent with the ability of this region to adopt different conformations. SAXS studies provided evidence for a trimeric organization also in the case of PCT, thus extending and strengthening our findings on PMD. The present results are discussed in light of conflicting reports in the literature pointing to a tetrameric organization of paramyxoviral P proteins. Copyright © 2014 Elsevier Inc. All rights reserved.

  5. Ladder attachment platform

    Science.gov (United States)

    Swygert,; Richard, W [Springfield, SC

    2012-08-28

    A ladder attachment platform is provided that includes a base for attachment to a ladder that has first and second side rails and a plurality of rungs that extend between in a lateral direction. Also included is a user platform for having a user stand thereon that is carried by the base. The user platform may be positioned with respect to the ladder so that it is not located between a first plane that extends through the first side rail and is perpendicular to the lateral direction and a second plane that extends through the second side rail and is perpendicular to the lateral direction.

  6. Possibility of using combined treatment of processing and ionizing radiation to eliminate contaminated viruses from non-screened donor of tissue allografts

    International Nuclear Information System (INIS)

    Nazly Hilmy; Paramita Pandansari

    2008-01-01

    Full text: New emerging and re- emerging infectious diseases caused by viruses are outbreak and re- outbreak around the world. Most of the viruses come from animals ( zoonoses) and jump to human beings ( host jumping ) such as corona virus ( SARS), HIV, bird flu/ Avian flu H5N1, hepatitis viruses, Dengue fever virus, West Nile virus/WNV, Hantavirus, Marburg haemorrhagic fever virus, Hendra virus, Nipah virus etc. Transmission of those diseases through transplantation of contaminated tissue allograft to recipient can happened if the donor could not be screened properly. The donor can be well screened from some of those viruses such as HIV, hepatitis viruses and WNV. Processing of tissue allografts by pasteurization, washing and soaking in H 2 O 2 and soap can eliminate contaminated viruses to a certain amount, have been reported by several authors. Viruses are very small microbes, they have DNA/RNA, resistant to radiation but to a certain degree they can be well eliminated by radiation. Their D10 - values vary from 4 to 13 kGy. This paper discribes briefly the possibility of using combined treatment of processing, lyophilization and sterilisation by radiation to overcome problems of non screened donor from some contaminated viruses. (Author)

  7. Impact of Maternal Attachment Style on Mother to Infant Attachment

    Directory of Open Access Journals (Sweden)

    Moghaddam Hoseini V

    2011-08-01

    Full Text Available Background and Objectives: Maternal attachment has the potential to affect both child development and parenting. As such, mother-infant attachment has been considered an important topic in recent years. The aim of this study was to determine the relationship between maternal adult attachment style, the maternal obstetric and demographic characteristics and mother-infant attachment.Methods: In this descriptive-correlational study, 102 women who had referred to health centers in Mashhad in 2008 and who had inclusion criteriawere selected using stratified cluster sampling. After interview about obstetric and demographic characteristics, they were asked to complete the "Revised Adult Attachment Scale" and "Mother to Infant Attachment Inventory" for assessment of maternal attachment style and mother-infant attachment 4-5 weeks after delivery. Data were analyzed by Pearson Correlation, Kruskal-wallis and Mann-whitney statistical tests.Results: In this study, themean of mother-infant attachment was found to be 97.486.12 and the mean of secure adult attachment was higher than that of other styles (16.893.97. Although, there were negative significant relationship between maternal avoidant style and mother-infant attachment (p=0.037,r=-0/20, there were no relationship between maternal age and education, parity, type of delivery and mother-infant attachment.Conclusion: The results of this research show that maternal attachment style is one of the factors of mother -infant attachment.

  8. Quick-attach clamp

    Science.gov (United States)

    Vano, A. E.

    1968-01-01

    Clamp of the slideable jaw type can be applied to moving lines such as cables or ropes. The clamp has a trigger-operated jaw that can be attached to a redrop parachute on a moving tow cable. The trigger mechanism maintains the jaws retracted in the housing until they are released for clamping.

  9. God attachment, mother attachment, and father attachment in early and middle adolescence.

    Science.gov (United States)

    Sim, Tick Ngee; Yow, Amanda Shixian

    2011-06-01

    The present study examined the interplay of attachment to God, attachment to mother, and attachment to father with respect to adjustment (hope, self-esteem, depression) for 130 early and 106 middle adolescents in Singapore. Results showed that the parental attachments were generally linked (in expected directions) to adjustment. God attachment, however, had unique results. At the bivariate level, God attachment was only linked to early adolescents' self-esteem. When considered together with parental attachments (including interactions), God attachment did not emerge as the key moderator in attachment interactions and yielded some unexpected results (e.g., being positively linked to depression). These results are discussed viz-a-viz the secure base and safe haven functions that God and parental attachments may play during adolescence.

  10. Workspace appropriation and attachment

    Directory of Open Access Journals (Sweden)

    M. PAVALACHE-ILIE

    2016-11-01

    Full Text Available This literature synthesis presents a short history of the evolution of the concepts of space appropriation and place attachment, highlighting the difficulty of their operationalisation from a cultural point of view. The next subject brought into discussion is the relation between the affective dimension of the connection between a person and the work place and the behaviours which are prone to insure the proper functioning of organizations, such as the organizational civism and the organizational commitment.

  11. Human Hendra virus infection causes acute and relapsing encephalitis.

    Science.gov (United States)

    Wong, K T; Robertson, T; Ong, B B; Chong, J W; Yaiw, K C; Wang, L F; Ansford, A J; Tannenberg, A

    2009-06-01

    To study the pathology of two cases of human Hendra virus infection, one with no clinical encephalitis and one with relapsing encephalitis. Autopsy tissues were investigated by light microscopy, immunohistochemistry and in situ hybridization. In the patient with acute pulmonary syndrome but not clinical acute encephalitis, vasculitis was found in the brain, lung, heart and kidney. Occasionally, viral antigens were demonstrated in vascular walls but multinucleated endothelial syncytia were absent. In the lung, there was severe inflammation, necrosis and viral antigens in type II pneumocytes and macrophages. The rare kidney glomerulus showed inflammation and viral antigens in capillary walls and podocytes. Discrete necrotic/vacuolar plaques in the brain parenchyma were associated with antigens and viral RNA. Brain inflammation was mild although CD68(+) microglia/macrophages were significantly increased. Cytoplasmic viral inclusions and antigens and viral RNA in neurones and ependyma suggested viral replication. In the case of relapsing encephalitis, there was severe widespread meningoencephalitis characterized by neuronal loss, macrophages and other inflammatory cells, reactive blood vessels and perivascular cuffing. Antigens and viral RNA were mainly found in neurones. Vasculitis was absent in all the tissues examined. The case of acute Hendra virus infection demonstrated evidence of systemic infection and acute encephalitis. The case of relapsing Hendra virus encephalitis showed no signs of extraneural infection but in the brain, extensive inflammation and infected neurones were observed. Hendra virus can cause acute and relapsing encephalitis and the findings suggest that the pathology and pathogenesis are similar to Nipah virus infection.

  12. [Summary of research works on viruses in the Vietnam Research Station, Institute of Tropical Medicine, Nagasaki University].

    Science.gov (United States)

    Yamashiro, Tetsu

    2013-01-01

    Institute of Tropical Medicine, Nagasaki University (NEKKEN) and National Institute of Hygiene and Epidemiology, Vietnam (NIHE) jointly conducted a project from 2006 on Emerging and Re-emerging Infectious Diseases (ERID) granted by the Ministry of Education, Science, Culture and Technology (MEXT) of Japan. Fifteen independent researches have been carried out by 7 scientists who stationed in the Vietnam Research Station (VRS), and by approximately 60 visiting scientists. A wide variety of viruses have been studied in the research activities in the VRS, of those, topics of'' Nipah virus infection in bats in Vietnam'', ''Nam Dinh virus, a newly discovered insect nidovirus'', and'' Risk factors of dengue fever in southern Vietnam'' were summarized. It is important to develop a mechanism to facilitate young scientists to use the VRS in their research works, and then a scope to establish the VRS as a gateway to a successful career path for young scientists in the field of the infectious diseases would be realized.

  13. Duration of Maternal Antibodies against Canine Distemper Virus and Hendra Virus in Pteropid Bats

    Science.gov (United States)

    Zambrana-Torrelio, Carlos; Middleton, Deborah; Barr, Jennifer A.; DuBovi, Edward; Boyd, Victoria; Pope, Brian; Todd, Shawn; Crameri, Gary; Walsh, Allyson; Pelican, Katey; Fielder, Mark D.; Davies, Angela J.; Wang, Lin-Fa; Daszak, Peter

    2013-01-01

    Old World frugivorous bats have been identified as natural hosts for emerging zoonotic viruses of significant public health concern, including henipaviruses (Nipah and Hendra virus), Ebola virus, and Marburg virus. Epidemiological studies of these viruses in bats often utilize serology to describe viral dynamics, with particular attention paid to juveniles, whose birth increases the overall susceptibility of the population to a viral outbreak once maternal immunity wanes. However, little is understood about bat immunology, including the duration of maternal antibodies in neonates. Understanding duration of maternally derived immunity is critical for characterizing viral dynamics in bat populations, which may help assess the risk of spillover to humans. We conducted two separate studies of pregnant Pteropus bat species and their offspring to measure the half-life and duration of antibodies to 1) canine distemper virus antigen in vaccinated captive Pteropus hypomelanus; and 2) Hendra virus in wild-caught, naturally infected Pteropus alecto. Both of these pteropid bat species are known reservoirs for henipaviruses. We found that in both species, antibodies were transferred from dam to pup. In P. hypomelanus pups, titers against CDV waned over a mean period of 228.6 days (95% CI: 185.4–271.8) and had a mean terminal phase half-life of 96.0 days (CI 95%: 30.7–299.7). In P. alecto pups, antibodies waned over 255.13 days (95% CI: 221.0–289.3) and had a mean terminal phase half-life of 52.24 days (CI 95%: 33.76–80.83). Each species showed a duration of transferred maternal immunity of between 7.5 and 8.5 months, which was longer than has been previously estimated. These data will allow for more accurate interpretation of age-related Henipavirus serological data collected from wild pteropid bats. PMID:23826322

  14. Duration of Maternal Antibodies against Canine Distemper Virus and Hendra Virus in Pteropid Bats.

    Directory of Open Access Journals (Sweden)

    Jonathan H Epstein

    Full Text Available Old World frugivorous bats have been identified as natural hosts for emerging zoonotic viruses of significant public health concern, including henipaviruses (Nipah and Hendra virus, Ebola virus, and Marburg virus. Epidemiological studies of these viruses in bats often utilize serology to describe viral dynamics, with particular attention paid to juveniles, whose birth increases the overall susceptibility of the population to a viral outbreak once maternal immunity wanes. However, little is understood about bat immunology, including the duration of maternal antibodies in neonates. Understanding duration of maternally derived immunity is critical for characterizing viral dynamics in bat populations, which may help assess the risk of spillover to humans. We conducted two separate studies of pregnant Pteropus bat species and their offspring to measure the half-life and duration of antibodies to 1 canine distemper virus antigen in vaccinated captive Pteropus hypomelanus; and 2 Hendra virus in wild-caught, naturally infected Pteropus alecto. Both of these pteropid bat species are known reservoirs for henipaviruses. We found that in both species, antibodies were transferred from dam to pup. In P. hypomelanus pups, titers against CDV waned over a mean period of 228.6 days (95% CI: 185.4-271.8 and had a mean terminal phase half-life of 96.0 days (CI 95%: 30.7-299.7. In P. alecto pups, antibodies waned over 255.13 days (95% CI: 221.0-289.3 and had a mean terminal phase half-life of 52.24 days (CI 95%: 33.76-80.83. Each species showed a duration of transferred maternal immunity of between 7.5 and 8.5 months, which was longer than has been previously estimated. These data will allow for more accurate interpretation of age-related Henipavirus serological data collected from wild pteropid bats.

  15. Duration of Maternal Antibodies against Canine Distemper Virus and Hendra Virus in Pteropid Bats.

    Science.gov (United States)

    Epstein, Jonathan H; Baker, Michelle L; Zambrana-Torrelio, Carlos; Middleton, Deborah; Barr, Jennifer A; Dubovi, Edward; Boyd, Victoria; Pope, Brian; Todd, Shawn; Crameri, Gary; Walsh, Allyson; Pelican, Katey; Fielder, Mark D; Davies, Angela J; Wang, Lin-Fa; Daszak, Peter

    2013-01-01

    Old World frugivorous bats have been identified as natural hosts for emerging zoonotic viruses of significant public health concern, including henipaviruses (Nipah and Hendra virus), Ebola virus, and Marburg virus. Epidemiological studies of these viruses in bats often utilize serology to describe viral dynamics, with particular attention paid to juveniles, whose birth increases the overall susceptibility of the population to a viral outbreak once maternal immunity wanes. However, little is understood about bat immunology, including the duration of maternal antibodies in neonates. Understanding duration of maternally derived immunity is critical for characterizing viral dynamics in bat populations, which may help assess the risk of spillover to humans. We conducted two separate studies of pregnant Pteropus bat species and their offspring to measure the half-life and duration of antibodies to 1) canine distemper virus antigen in vaccinated captive Pteropus hypomelanus; and 2) Hendra virus in wild-caught, naturally infected Pteropus alecto. Both of these pteropid bat species are known reservoirs for henipaviruses. We found that in both species, antibodies were transferred from dam to pup. In P. hypomelanus pups, titers against CDV waned over a mean period of 228.6 days (95% CI: 185.4-271.8) and had a mean terminal phase half-life of 96.0 days (CI 95%: 30.7-299.7). In P. alecto pups, antibodies waned over 255.13 days (95% CI: 221.0-289.3) and had a mean terminal phase half-life of 52.24 days (CI 95%: 33.76-80.83). Each species showed a duration of transferred maternal immunity of between 7.5 and 8.5 months, which was longer than has been previously estimated. These data will allow for more accurate interpretation of age-related Henipavirus serological data collected from wild pteropid bats.

  16. SAM: The School Attachment Monitor

    OpenAIRE

    Vo, Dong-Bach; Tayarani, Mohammad; Rooksby, Maki; Huan, Rui; Vinciarelli, Alessandro; Minnis, Helen; Brewster, Stephen A.

    2017-01-01

    Secure Attachment relationships have been shown to minimise social and behavioural problems in children and boosts resilience to risks such as antisocial behaviour, heart pathologies, and suicide later in life. Attachment assessment is an expensive and time-consuming process that is not often performed. The School Attachment Monitor (SAM) automates Attachment assessment to support expert assessors. It uses doll-play activities with the dolls augmented with sensors and the child's play recorde...

  17. SAM: The School Attachment Monitor

    OpenAIRE

    Vo, Dong-Bach; Rooksby, Maki; Tayarani, Mohammad; Huan, Rui; Vinciarelli, Alessandro; Minnis, Helen; Brewster, Stephen A.

    2017-01-01

    Secure Attachment relationships have been shown to minimise social and behavioural problems in children and boosts resilience to risks later on such as antisocial behaviour, heart pathologies, and suicide. Attachment assessment is an expensive and time-consuming process that is not often performed. The School Attachment Monitor (SAM) automates Attachment assessment to support expert assessors. It uses doll-play activities with the dolls augmented with sensors and the child's play recorded wit...

  18. A novel monoclonal antibody specific to the C-terminal tail of the gap envelope transmembrane protein of human immunodeficiency virus type 1 that preferentially neutralizes virus after it has attached to the target cell and inhibits the production of infectious progeny

    International Nuclear Information System (INIS)

    Reading, Steven A; Heap, Caroline J; Dimmock, Nigel J.

    2003-01-01

    SAR1 is a new IgG2a murine monoclonal antibody derived by immunization with a plant virus expressing the sequence GERDRDR from the C-terminal tail of the gp41 transmembrane glycoprotein of human immunodeficiency virus type 1 (HIV-1). SAR1 binds to peptides and proteins carrying the GERDRDR sequence, to some but not all preparations of purified virus, and to cells infected with all viruses tested. In a standard neutralization assay, SAR1 failed to neutralize, or neutralized poorly, a number of T cell line-adapted viruses. However, it was more effective at postattachment neutralization. This was measured by two assays, the inhibition of the syncytium production by input virus, and the inhibition of the production of infectious progeny virus. In general SAR1 was more effective at neutralizing progeny virus than inoculum virus. Fifty percent inhibition of progeny virus production by different HIV-1 strains was obtained with 2-26 μg/ml of SAR1. The SAR1 neutralizing epitope was mapped specifically to the gp41 C-terminal tail. SAR1 is an unusual, if not unique, antibody whose activity supports the view that part of the gp41 C-terminal tail is exposed on the outside of the virion

  19. Attachment Theory: Retrospect and Prospect.

    Science.gov (United States)

    Bretherton, Inge

    1985-01-01

    Provides overview of attachment theory as parented by John Bowlby in "Attachment and Loss". Uses two major concepts from this work to interpret refinements and elaborations of attachment theory attibuted to Mary Ainsworth. Considers how recent insights into development of socioemotional understanding and development of event…

  20. Attachment: Theoretical Development and Critique

    Science.gov (United States)

    Slater, Ruth

    2007-01-01

    Zeanah argues that ethological attachment theory, as outlined by John Bowlby, has provided one of the most important frameworks for understanding crucial risk and protective factors in social and emotional development. However, although attachment theory and the notion of attachment disorders have influenced such initiatives, many psychologists,…

  1. Next Steps in Attachment Theory.

    Science.gov (United States)

    Bell, David C

    2012-12-01

    Thanks to the phenomenal success of attachment theory, great progress has been made in understanding child and adult relationships. The success of attachment theory opens the way to new research directions that can extend its successes even further. In particular, more work on the fundamental nature of attachment that respects recent biological research is important, as is concentrated effort on the related caregiving system.

  2. Introduction: attachment theory and psychotherapy.

    Science.gov (United States)

    Levy, Kenneth N

    2013-11-01

    In this introduction to the JCLP: In Session 69(11) issue on attachment theory and psychotherapy, the key points of attachment theory (Bowlby, , , 1981) and its relevance to psychotherapy are briefly described. The aim of this issue is to provide case illustrations of how an attachment theory perspective and principles can expand our understanding of psychotherapy practice. © 2013 Wiley Periodicals, Inc.

  3. Next Steps in Attachment Theory

    OpenAIRE

    Bell, David C.

    2012-01-01

    Thanks to the phenomenal success of attachment theory, great progress has been made in understanding child and adult relationships. The success of attachment theory opens the way to new research directions that can extend its successes even further. In particular, more work on the fundamental nature of attachment that respects recent biological research is important, as is concentrated effort on the related caregiving system.

  4. Clinical attachment: a learning experience

    African Journals Online (AJOL)

    2012-08-03

    Aug 3, 2012 ... A clinical attachment is an opportunity for doctors from South Sudan to experience the hospital and clinical practice in a setting different from their own. What they learn in the attachment will help them improve their medical practice on their return. I attended a clinical attachment in Oral and Maxillofacial ...

  5. Potential for Introduction of Bat-Borne Zoonotic Viruses into the EU: A Review

    Directory of Open Access Journals (Sweden)

    Robin R. L. Simons

    2014-05-01

    Full Text Available Bat-borne viruses can pose a serious threat to human health, with examples including Nipah virus (NiV in Bangladesh and Malaysia, and Marburg virus (MARV in Africa. To date, significant human outbreaks of such viruses have not been reported in the European Union (EU. However, EU countries have strong historical links with many of the countries where NiV and MARV are present and a corresponding high volume of commercial trade and human travel, which poses a potential risk of introduction of these viruses into the EU. In assessing the risks of introduction of these bat-borne zoonotic viruses to the EU, it is important to consider the location and range of bat species known to be susceptible to infection, together with the virus prevalence, seasonality of viral pulses, duration of infection and titre of virus in different bat tissues. In this paper, we review the current scientific knowledge of all these factors, in relation to the introduction of NiV and MARV into the EU.

  6. Impact of Maternal Attachment Style on Mother to Infant Attachment

    Directory of Open Access Journals (Sweden)

    V Moghaddam Hoseini

    2012-05-01

    Full Text Available

    Background and Objectives: Maternal attachment has the potential to affect both child development and parenting. As such, mother-infant attachment has been considered an important topic in recent years. The aim of this study was to determine the relationship between maternal adult attachment style, the maternal obstetric and demographic characteristics and mother-infant attachment.

     

    Methods: In this descriptive-correlational study, 102 women who had referred to health centers in Mashhad in 2008 and who had inclusion criteriawere selected using stratified cluster sampling. After interview about obstetric and demographic characteristics, they were asked to complete the "Revised Adult Attachment Scale" and "Mother to Infant Attachment Inventory" for assessment of maternal attachment style and mother-infant attachment 4-5 weeks after delivery. Data were analyzed by Pearson Correlation, Kruskal-wallis and Mann-whitney statistical tests.

     

    Results: In this study, themean of mother-infant attachment was found to be 97.48±6.12 and the mean of secure adult attachment was higher than that of other styles (16.89±3.97. Although, there were negative significant relationship between maternal avoidant style and mother-infant attachment (p=0.037,r=-0/20, there were no relationship between maternal age and education, parity, type of delivery and mother-infant attachment.

     

    Conclusion: The results of this research show that maternal attachment style is one of the factors of mother -infant attachment.

  7. Kecernaan In Vitro Fraksi Serat (NDF, ADF dan Selulosa Lima Jenis Rumput Laut Coklat dari Pantai Sungai Nipah Kabupaten Pesisir Selatan Sumatera Barat

    Directory of Open Access Journals (Sweden)

    Y.L. Dewi

    2015-10-01

    Full Text Available Penelitian ini bertujuan untuk mengetahui kecernaan fraksi serat (NDF, ADF dan Selulosa lima jenis rumput laut coklat dari Pantai Sungai Nipah Kabupaten Pesisir Selatan Sumatera Barat secara in vitro. Metode penelitian yang digunakan adalah metode eksperimen dengan Rancangan Acak Kelompok (RAK terdiri dari lima perlakuan rumput laut coklat yang berbeda jenis ( A = Padina australis, B = Turbinaria decurrens, C = Turbinaria murayana, D = Sargassum crassifolium dan E = Sargassum binderi dan masing-masing perlakuan diulang 3 kali sebagai kelompok. Kelompok didasarkan atas tiga kali pengambilan cairan rumen kambing yang berbeda. Parameter yang diamati pada penelitian ini adalah kecernaan NDF, kecernaan ADF dan kecernaan selulosa. Hasil penelitian menunjukkan 5 jenis rumput laut coklat berpengaruh sangat nyata (P<0,01 terhadap kecernaan NDF, kecernaan ADF dan kecernaan selulosa. Hasil penelitian ini dapat disimpulkan bahwa rumput laut Sargassum crassifolium dan Sargassum binderi memiliki kecernaan NDF tertinggi (15,65% dan 20,56% dan ADF tertinggi (15,43% dan 17,80% dibandingkan dengan jenis rumput laut coklat lainnya.

  8. Attachment is a dynamic system

    Directory of Open Access Journals (Sweden)

    Zlatka Cugmas

    2003-04-01

    Full Text Available On the basis of the study of recent scientific literature about the development of attachment, the author answers the following questions: which are the postulates the theory of attachment has about the stability of the patterns of attachment, which level of stability in the patterns of attachment from infancy to adulthood these studies illuminate and which factors significantly influence the (instability of the patterns of attachment in time. The theory of attachment assumes that normal circumstances elicit stability. Changes, however, can be the result of important events influencing the sensitivity of the object of attachment. Agreement has not yet been reached regarding the percentage of stability in the patterns of attachment. There is more agreement regarding attachment in adulthood than that in childhood. The results depend on the size and characteristics of the subjects of the research, the measuring instruments, type of data analysis etc. The author concludes that attachment is a dynamic system influenced by significant changes in life (the cognitive development of the child, external care, parents' divorce, different stressful situations. As the influence of stressful events on the individual person' s quality of attachment is examined, it is necessary to consider also his/her temperamental characteristics, role of other people in their lives, etc.

  9. Stochastic analysis of virus transport in aquifers

    Science.gov (United States)

    Campbell Rehmann, Linda L.; Welty, Claire; Harvey, Ronald W.

    1999-01-01

    A large-scale model of virus transport in aquifers is derived using spectral perturbation analysis. The effects of spatial variability in aquifer hydraulic conductivity and virus transport (attachment, detachment, and inactivation) parameters on large-scale virus transport are evaluated. A stochastic mean model of virus transport is developed by linking a simple system of local-scale free-virus transport and attached-virus conservation equations from the current literature with a random-field representation of aquifer and virus transport properties. The resultant mean equations for free and attached viruses are found to differ considerably from the local-scale equations on which they are based and include effects such as a free-virus effective velocity that is a function of aquifer heterogeneity as well as virus transport parameters. Stochastic mean free-virus breakthrough curves are compared with local model output in order to observe the effects of spatial variability on mean one-dimensional virus transport in three-dimensionally heterogeneous porous media. Significant findings from this theoretical analysis include the following: (1) Stochastic model breakthrough occurs earlier than local model breakthrough, and this effect is most pronounced for the least conductive aquifers studied. (2) A high degree of aquifer heterogeneity can lead to virus breakthrough actually preceding that of a conservative tracer. (3) As the mean hydraulic conductivity is increased, the mean model shows less sensitivity to the variance of the natural-logarithm hydraulic conductivity and mean virus diameter. (4) Incorporation of a heterogeneous colloid filtration term results in higher predicted concentrations than a simple first-order adsorption term for a given mean attachment rate. (5) Incorporation of aquifer heterogeneity leads to a greater range of virus diameters for which significant breakthrough occurs. (6) The mean model is more sensitive to the inactivation rate of viruses

  10. MRI findings in acute Hendra virus meningoencephalitis

    Energy Technology Data Exchange (ETDEWEB)

    Nakka, P.; Amos, G.J. [Department of Diagnostic Radiology, Princess Alexandra Hospital, Woolloongabba, Qld 4102 (Australia); Saad, N., E-mail: nivena100@hotmail.com [Department of Diagnostic Radiology, Princess Alexandra Hospital, Woolloongabba, Qld 4102 (Australia); Jeavons, S. [Department of Diagnostic Radiology, Princess Alexandra Hospital, Woolloongabba, Qld 4102 (Australia)

    2012-05-15

    Aim: To describe serial changes in brain magnetic resonance imaging (MRI) in acute human infection from two outbreaks of Hendra virus (HeV), relate these changes to disease prognosis, and compare HeV encephalitis to reported cases of Nipah virus encephalitis. Materials and methods: The MRI images of three human cases (two of which were fatal) of acute HeV meningoencephalitis were reviewed. Results: Cortical selectivity early in the disease is evident in all three patients, while deep white matter involvement appears to be a late and possibly premorbid finding. This apparent early grey matter selectivity may be related to viral biology or ribavirin pharmacokinetics. Neuronal loss is evident at MRI, and the rate of progression of MRI abnormalities can predict the outcome of the infection. In both fatal cases, the serial changes in the MRI picture mirrored the clinical course. Conclusion: This is the first comprehensive report of serial MRI findings in acute human cerebral HeV infection from two outbreaks. The cortical selectivity appears to be an early finding while deep white matter involvement a late, and possibly premorbid, finding. In both fatal cases, the serial changes in MRI mirrored the clinical course.

  11. Gonococcal attachment to eukaryotic cells

    Energy Technology Data Exchange (ETDEWEB)

    James, J.F.; Lammel, C.J.; Draper, D.L.; Brown, D.A.; Sweet, R.L.; Brooks, G.F.

    The attachment of Neisseria gonorrhoeae to eukaryotic cells grown in tissue culture was analyzed by use of light and electron microscopy and by labeling of the bacteria with (/sup 3/H)- and (/sup 14/C)adenine. Isogenic piliated and nonpiliated N. gonorrhoeae from opaque and transparent colonies were studied. The results of light microscopy studies showed that the gonococci attached to cells of human origin, including Flow 2000, HeLa 229, and HEp 2. Studies using radiolabeled gonococci gave comparable results. Piliated N. gonorrhoeae usually attached in larger numbers than nonpiliated organisms, and those from opaque colonies attached more often than isogenic variants from transparent colonies. Day-to-day variation in rate of attachment was observed. Scanning electron microscopy studies showed the gonococcal attachment to be specific for microvilli of the host cells. It is concluded that more N. gonorrhoeae from opaque colonies, as compared with isogenic variants from transparent colonies, attach to eukaryotic cells grown in tissue culture.

  12. Attachment Theory in Tourism

    Directory of Open Access Journals (Sweden)

    Maximiliano Korstanje

    2007-01-01

    Full Text Available The following work is intended to a revision on attachment theory. The postulates of the theory of the sure base point that the system of exploration meets in narrow relation the system of conducts of attachment and the figure of the keepers. The conducts that characterize and symbolize the relation of the adult with the environment are carried back to the early age, in the moment in which the child develops the affective capacity. What difference does exist between someone who decides to journey to England and that one that one decides to travel to Mar del Plata? How it is possible to study this topic of on a manner trustworthy? These three questions were key to begin the investigation. Nevertheless, the matter began to find certain limitations linked to the methodology that had to be in use. It is possible to use careless they on the leisure scope, a theory which still demonstrates certain inconsistencies in its own clinical application?

  13. Electron attachment cross sections obtained from electron attachment spectroscopy

    International Nuclear Information System (INIS)

    Popp, P.; Baumbach, J.I.; Leonhardt, J.W.; Mothes, S.

    1988-01-01

    Electron capture detectors have a high sensitivity for substances with high thermal electron attachment cross sections. The electron attachment spectroscopy makes it possible to change the mean electron energy in such a way that the maximum for dissociative electron attachment is reached. Thus, best operation modes of the detection system as well as significant dependencies of electron attachment coefficients are available. Cross sections for electron attachment as a function of the electron energy are obtained with the knowledge of electron energy distribution functions from Boltzmann equation analysis by a special computer code. A disadvantage of this electron attachment spectroscopy is the superposition of space charge effects due to the decrease of the electron drift velocity with increasing mean electron energy. These influences are discussed. (author)

  14. The immune evasion function of J and Beilong virus V proteins is distinct from that of other paramyxoviruses, consistent with their inclusion in the proposed genus Jeilongvirus.

    Science.gov (United States)

    Audsley, Michelle D; Marsh, Glenn A; Lieu, Kim G; Tachedjian, Mary; Joubert, D Albert; Wang, Lin-Fa; Jans, David A; Moseley, Gregory W

    2016-03-01

    IFN-antagonist function is a major determinant of pathogenicity and cross-species infection by viruses, but remains poorly defined for many potentially zoonotic viruses resident in animal species. The paramyxovirus family contains several zoonotic viruses, including highly pathogenic viruses such as Nipah virus and Hendra virus, and an increasing number of largely uncharacterized animal viruses. Here, we report the characterization of IFN antagonism by the rodent viruses J virus (JPV) and Beilong virus (BeiPV) of the proposed genus Jeilongvirus of the paramyxoviruses. Infection of cells by JPV and BeiPV was found to inhibit IFN-activated nuclear translocation of signal transducer and activator of transcription 1 (STAT1). However, in contrast to most other paramyxoviruses, the JPV and BeiPV V proteins did not interact with or inhibit signalling by STAT1 or STAT2, suggesting that JPV/BeiPV use an atypical V protein-independent strategy to target STATs, consistent with their inclusion in a separate genus. Nevertheless, the V proteins of both viruses interacted with melanoma differentiation-associated protein 5 (MDA5) and robustly inhibited MDA5-dependent activation of the IFN-β promoter. This supports a growing body of evidence that MDA5 is a universal target of paramyxovirus V proteins, such that the V-MDA5 interaction represents a potential target for broad-spectrum antiviral approaches.

  15. [Bats and Viruses: complex relationships].

    Science.gov (United States)

    Rodhain, F

    2015-10-01

    With more than 1 200 species, bats and flying foxes (Order Chiroptera) constitute the most important and diverse order of Mammals after Rodents. Many species of bats are insectivorous while others are frugivorous and few of them are hematophagous. Some of these animals fly during the night, others are crepuscular or diurnal. Some fly long distances during seasonal migrations. Many species are colonial cave-dwelling, living in a rather small home range while others are relatively solitary. However, in spite of the importance of bats for terrestrial biotic communities and ecosystem ecology, the diversity in their biology and lifestyles remain poorly known and underappreciated. More than sixty viruses have been detected or isolated in bats; these animals are therefore involved in the natural cycles of many of them. This is the case, for instance, of rabies virus and other Lyssavirus (Family Rhabdoviridae), Nipah and Hendra viruses (Paramyxoviridae), Ebola and Marburg viruses (Filoviridae), SARS-CoV and MERS-CoV (Coronaviridae). For these zoonotic viruses, a number of bat species are considered as important reservoir hosts, efficient disseminators or even directly responsible of the transmission. Some of these bat-borne viruses cause highly pathogenic diseases while others are of potential significance for humans and domestic or wild animals; so, bats are an important risk in human and animal public health. Moreover, some groups of viruses developed through different phylogenetic mechanisms of coevolution between viruses and bats. The fact that most of these viral infections are asymptomatic in bats has been observed since a long time but the mechanisms of the viral persistence are not clearly understood. The various bioecology of the different bat populations allows exchange of virus between migrating and non-migrating conspecific species. For a better understanding of the role of bats in the circulation of these viral zoonoses, epidemiologists must pay attention to

  16. Attachment theory: Old and new approach

    OpenAIRE

    Polovina Nada

    2005-01-01

    The article is an attempt to present holistically the key concepts of attachment theory rediscovered for its potentials. The presented concepts include: narrow definition of attachment, behavioral control system of attachment, attachment working model and patterns of attachment. The concepts are presented in the context of child attachment theory and adult attachment theory, in addition to description of the development of attachment. Concepts, as well as developmental processes are presented...

  17. Sentence-Level Attachment Prediction

    Science.gov (United States)

    Albakour, M.-Dyaa; Kruschwitz, Udo; Lucas, Simon

    Attachment prediction is the task of automatically identifying email messages that should contain an attachment. This can be useful to tackle the problem of sending out emails but forgetting to include the relevant attachment (something that happens all too often). A common Information Retrieval (IR) approach in analyzing documents such as emails is to treat the entire document as a bag of words. Here we propose a finer-grained analysis to address the problem. We aim at identifying individual sentences within an email that refer to an attachment. If we detect any such sentence, we predict that the email should have an attachment. Using part of the Enron corpus for evaluation we find that our finer-grained approach outperforms previously reported document-level attachment prediction in similar evaluation settings.

  18. Dissociative attachment to lithium dimers

    International Nuclear Information System (INIS)

    Wadehra, J.M.

    1987-01-01

    The cross sections and the rates of production of negative ions of atomic lithium by the process of dissociative electron attachment to lithium dimers are obtained by using the resonant scattering theory. Both the cross sections as well as the rates of attachment are enhanced if the lithium molecule is initially vibrationally excited. General expressions for approximately obtaining the rates of electron attachment to any vibrational level of Li 2 are presented

  19. Using attachment theory in mentoring.

    Science.gov (United States)

    Miles, Kerri

    Attachment theory is a useful way to understand the bond between children and the people with whom they have emotional ties--usually caregivers. The theory can also help us to understand any adult relationship that provides closeness and a sense of attachment, especially in times of stress or need. Understanding the nature, cause and effect of the role and function of attachment from a training and development perspective, and different styles of attachment, may improve the quality of the mentoring experience for both mentors and mentees.

  20. Systemic therapy and attachment narratives: Attachment Narrative Therapy.

    Science.gov (United States)

    Dallos, Rudi; Vetere, Arlene

    2014-10-01

    This article outlines an integration of attachment theory with narrative theory and systemic theory and practice: Attachment Narrative Therapy (ANT). This integration offers a more powerful explanatory formulation of the development and maintenance of human distress in relationships, families and communities, and gives direction to psychotherapeutic intervention. © The Author(s) 2014.

  1. From security to attachment : Mary Ainsworth's contribution to attachment theory

    NARCIS (Netherlands)

    Rosmalen, Lenette (Lenny) van

    2015-01-01

    Even though John Bowlby (1907-1990) is generally regarded as the founder of attachment theory, Mary Ainsworth’s (1913-1999) contribution is considerable and goes beyond the design of the Strange Situation Procedure and the introduction of maternal sensitivity as decisive for a secure attachment

  2. Protein Attachment on Nanodiamonds.

    Science.gov (United States)

    Lin, Chung-Lun; Lin, Cheng-Huang; Chang, Huan-Cheng; Su, Meng-Chih

    2015-07-16

    A recent advance in nanotechnology is the scale-up production of small and nonaggregated diamond nanoparticles suitable for biological applications. Using detonation nanodiamonds (NDs) with an average diameter of ∼4 nm as the adsorbents, we have studied the static attachment of three proteins (myoglobin, bovine serum albumin, and insulin) onto the nanoparticles by optical spectroscopy, mass spectrometry, and dynamic light scattering, and electrophoretic zeta potential measurements. Results show that the protein surface coverage is predominantly determined by the competition between protein-protein and protein-ND interactions, giving each protein a unique and characteristic structural configuration in its own complex. Specifically, both myoglobin and bovine serum albumin show a Langmuir-type adsorption behavior, forming 1:1 complexes at saturation, whereas insulin folds into a tightly bound multimer before adsorption. The markedly different adsorption patterns appear to be independent of the protein concentration and are closely related to the affinity of the individual proteins for the NDs. The present study provides a fundamental understanding for the use of NDs as a platform for nanomedical drug delivery.

  3. Ebola Virus and Marburg Virus

    Science.gov (United States)

    Ebola virus and Marburg virus Overview Ebola virus and Marburg virus are related viruses that cause hemorrhagic fevers — illnesses marked by severe bleeding (hemorrhage), organ failure and, in many ...

  4. Attachment, caring and prosocial behavior

    NARCIS (Netherlands)

    Erez, Ayelet

    2007-01-01

    The thesis focuses on 5 studies examining the role of adult attachment in volunteering by defining volunteerism as a form of caregiving. By that we suggest an effect of one behavioral system, attachment, on another, caring or prosocial behaviors in individual or group settings. Studies 1 and 2

  5. Mapping and measuring place attachment

    DEFF Research Database (Denmark)

    Brown, Greg; Raymond, Christopher Mark; Corcoran, Jonathan

    2015-01-01

    The concept of place attachment has been studied extensively across multiple disciplines but only recently with empirical measurement using public participation GIS (PPGIS) and related crowd-sourcing mapping methods. This research trialed a spatially explicit method for identifying place attachment...

  6. Emerging tropical diseases in Australia. Part 5. Hendra virus.

    Science.gov (United States)

    Tulsiani, S M; Graham, G C; Moore, P R; Jansen, C C; Van Den Hurk, A F; Moore, F A J; Simmons, R J; Craig, S B

    2011-01-01

    Hendra virus (HeV) was first isolated in 1994, from a disease outbreak involving at least 21 horses and two humans in the Brisbane suburb of Hendra, Australia. The affected horses and humans all developed a severe but unidentified respiratory disease that resulted in the deaths of one of the human cases and the deaths or putting down of 14 of the horses. The virus, isolated by culture from a horse and the kidney of the fatal human case, was initially characterised as a new member of the genus Morbillivirus in the family Paramyxoviridae. Comparative sequence analysis of part of the matrix protein gene of the virus and the discovery that the virus had an exceptionally large genome subsequently led to HeV being assigned to a new genus, Henipavirus, along with Nipah virus (a newly emergent virus in pigs). The regular outbreaks of HeV-related disease that have occurred in Australia since 1994 have all been characterised by acute respiratory and neurological manifestations, with high levels of morbidity and mortality in the affected horses and humans. The modes of transmission of HeV remain largely unknown. Although fruit bats have been identified as natural hosts of the virus, direct bat-horse, bat-human or human-human transmission has not been reported. Human infection can occur via exposure to infectious urine, saliva or nasopharyngeal fluid from horses. The treatment options and efficacy are very limited and no vaccine exists. Reports on the outbreaks of HeV in Australia are collated in this review and the available data on the biology, transmission and detection of the pathogen are summarized and discussed.

  7. Attachment and Dyadic Regulation Processes.

    Science.gov (United States)

    Overall, Nickola C; Simpson, Jeffry A

    2015-02-01

    Insecurely attached people have relatively unhappy and unstable romantic relationships, but the quality of their relationships depends on how their partners regulate them. Some partners find ways to regulate the emotional and behavioral reactions of insecurely attached individuals, which promotes greater relationship satisfaction and security. We discuss attachment theory and interdependence dilemmas, and then explain how and why certain responses by partners assuage the cardinal concerns of insecure individuals in key interdependent situations. We then review recent studies illustrating how partners can successfully regulate the reactions of anxiously and avoidantly attached individuals, yielding more constructive interactions. We finish by considering how these regulation processes can create a more secure dyadic environment, which helps to improve relationships and attachment security across time.

  8. [Emergence of new viruses in Asia: is climate change involved?].

    Science.gov (United States)

    Chastel, C

    2004-11-01

    Tropical Africa is not the only area where deadly viruses have recently emerged. In South-East Asia severe epidemics of dengue hemorrhagic fever started in 1954 and flu pandemics have originated from China such as the Asian flu (H2N2) in 1957, the Hong-Kong flu (H3N2) in 1968, and the Russian flu (H1N1) in 1977. However, it is especially during the last ten years that very dangerous viruses for mankind have repeatedly developed in Asia, with the occurrence of Alkhurma hemorrhagic fever in Saudi Arabia (1995), avian flu (H5N1) in Hong-Kong (1997), Nipah virus encephalitis in Malaysia (1998,) and, above all, the SARS pandemic fever from Southern China (2002). The evolution of these viral diseases was probably not directly affected by climate change. In fact, their emergential success may be better explained by the development of large industry poultry flocks increasing the risks of epizootics, dietary habits, economic and demographic constraints, and negligence in the surveillance and reporting of the first cases.

  9. Attachment of bacteriophages MS2 and PhiX174 onto kaolinite and montmorillonite: extended-DLVO interactions

    Science.gov (United States)

    Chrysikopoulos, C. V.; Syngouna, V. I.

    2012-04-01

    This study aims to gain insights into the interaction of virus particles with clay colloids. Bacteriophages MS2 and ΦX174 were used as model viruses and kaolinite (KGa-1b) and montmorillonite (STx-1b) as model colloids. The experimental data obtained from batch experiments of MS2 and ΦX174 attachment onto KGa-1b and STx-1b suggested that virus attachment is adequately described by the Freundlich isotherm equation. Both MS2 and ΦX174 were attached in greater amounts onto KGa-1b than STx-1b with MS2 having greater affinity than ΦX174 for both clays. Furthermore, extended-DLVO interaction energy calculations explained that the attachment of viruses onto model clay colloids was primarily caused by hydrophobic interaction. The theoretical and experimental results of this study were found to be in good agreement with previous findings.

  10. Attachment of bacteriophages MS2 and ΦX174 onto kaolinite and montmorillonite: non-DLVO interactions

    Science.gov (United States)

    Chrysikopoulos, C.; Syngouna, V. I.

    2011-12-01

    This study aims to gain insights into the interaction of virus particles with clay colloids. Bacteriophages MS2 and ΦX174 were used as model viruses and kaolinite (KGa-1b) and montmorillonite (STx-1b) as model colloids. The experimental data obtained from batch experiments of MS2 and ΦX174 attachment onto KGa-1b and STx-1b suggested that virus attachment is adequately described by the Freundlich isotherm equation. Both MS2 and ΦX174 were attached in greater amounts onto KGa-1b than STx-1b. Furthermore, theoretical interaction energy calculations suggested that electrostatic as well as Lewis acid-base interactions are of vital importance in the attachment of viruses onto clay colloids.

  11. Electron attachment to excited molecules

    International Nuclear Information System (INIS)

    Christophorou, L.G.; Pinnaduwage, L.A.; Datskos, P.G.

    1993-01-01

    Studies on electron attachment to molecules rotationally/vibrationally excited thermally or via infrared-laser excitation showed that the effect of internal energy of a molecule on its electron attachment properties depends on the mode--dissociative or nondissociative--of electron attachment. They quantified the effect of the internal energy of the molecule on the rate of destruction (by autodissociation or by autodetachment) of its parent transient anion. Generally, increases in ro-vibrational molecular energy increase the cross section for dissociative electron attachment and decrease the effective cross section for parent anion formation due mainly to increased autodetachment. These findings and their understanding are discussed. A discussion is given, also, of recent investigations of electron attachment to electronically excited molecules, especially photoenhanced dissociative electron attachment to long- and short-lived excited electronic states of molecules produced directly or indirectly by laser irradiation. These studies showed that the cross sections for dissociative electron attachment to electronically excited molecules usually are many orders of magnitude larger than those for the ground-state molecules. The new techniques that have been developed for such studies are briefly described also

  12. From security to attachment: Mary Ainsworth's contribution to attachment theory

    OpenAIRE

    Rosmalen, Lenette (Lenny) van

    2015-01-01

    Even though John Bowlby (1907-1990) is generally regarded as the founder of attachment theory, Mary Ainsworth’s (1913-1999) contribution is considerable and goes beyond the design of the Strange Situation Procedure and the introduction of maternal sensitivity as decisive for a secure attachment relationship. Ainsworth worked in Toronto with William Blatz (1895-1964) for almost two decades before she moved to London and worked with Bowlby in 1950. Ainsworth was heavily influenced by Blatz and ...

  13. Kanyawara Virus: A Novel Rhabdovirus Infecting Newly Discovered Nycteribiid Bat Flies Infesting Previously Unknown Pteropodid Bats in Uganda.

    Science.gov (United States)

    Goldberg, Tony L; Bennett, Andrew J; Kityo, Robert; Kuhn, Jens H; Chapman, Colin A

    2017-07-13

    Bats are natural reservoir hosts of highly virulent pathogens such as Marburg virus, Nipah virus, and SARS coronavirus. However, little is known about the role of bat ectoparasites in transmitting and maintaining such viruses. The intricate relationship between bats and their ectoparasites suggests that ectoparasites might serve as viral vectors, but evidence to date is scant. Bat flies, in particular, are highly specialized obligate hematophagous ectoparasites that incidentally bite humans. Using next-generation sequencing, we discovered a novel ledantevirus (mononegaviral family Rhabdoviridae, genus Ledantevirus) in nycteribiid bat flies infesting pteropodid bats in western Uganda. Mitochondrial DNA analyses revealed that both the bat flies and their bat hosts belong to putative new species. The coding-complete genome of the new virus, named Kanyawara virus (KYAV), is only distantly related to that of its closest known relative, Mount Elgon bat virus, and was found at high titers in bat flies but not in blood or on mucosal surfaces of host bats. Viral genome analysis indicates unusually low CpG dinucleotide depletion in KYAV compared to other ledanteviruses and rhabdovirus groups, with KYAV displaying values similar to rhabdoviruses of arthropods. Our findings highlight the possibility of a yet-to-be-discovered diversity of potentially pathogenic viruses in bat ectoparasites.

  14. Cedar virus: a novel Henipavirus isolated from Australian bats.

    Directory of Open Access Journals (Sweden)

    Glenn A Marsh

    Full Text Available The genus Henipavirus in the family Paramyxoviridae contains two viruses, Hendra virus (HeV and Nipah virus (NiV for which pteropid bats act as the main natural reservoir. Each virus also causes serious and commonly lethal infection of people as well as various species of domestic animals, however little is known about the associated mechanisms of pathogenesis. Here, we report the isolation and characterization of a new paramyxovirus from pteropid bats, Cedar virus (CedPV, which shares significant features with the known henipaviruses. The genome size (18,162 nt and organization of CedPV is very similar to that of HeV and NiV; its nucleocapsid protein displays antigenic cross-reactivity with henipaviruses; and it uses the same receptor molecule (ephrin-B2 for entry during infection. Preliminary challenge studies with CedPV in ferrets and guinea pigs, both susceptible to infection and disease with known henipaviruses, confirmed virus replication and production of neutralizing antibodies although clinical disease was not observed. In this context, it is interesting to note that the major genetic difference between CedPV and HeV or NiV lies within the coding strategy of the P gene, which is known to play an important role in evading the host innate immune system. Unlike HeV, NiV, and almost all known paramyxoviruses, the CedPV P gene lacks both RNA editing and also the coding capacity for the highly conserved V protein. Preliminary study indicated that CedPV infection of human cells induces a more robust IFN-β response than HeV.

  15. Understanding Polymer-Cell Attachment.

    Science.gov (United States)

    Venturato, Andrea; MacFarlane, Gillian; Geng, Jin; Bradley, Mark

    2016-12-01

    The development of polymeric materials with cell adhesion abilities requires an understanding of cell-surface interactions which vary with cell type. To investigate the correlation between cell attachment and the nature of the polymer, a series of random and block copolymers composed of 2-(dimethylamino)ethyl acrylate and ethyl acrylate are synthesized through single electron transfer living radical polymerization. The polymers are synthesized with highly defined and controlled monomer compositions and exhibited narrow polydispersity indices. These polymers are examined for their performance in the attachment and growth of HeLa and HEK cells, with attachment successfully modeled on monomer composition and polymer chain length, with both cell lines found to preferentially attach to moderately hydrophobic functional materials. The understanding of the biological-material interactions assessed in this study will underpin further investigations of engineered polymer scaffolds with predictable cell binding performance. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  16. Attachment at work and performance.

    Science.gov (United States)

    Neustadt, Elizabeth A; Chamorro-Premuzic, Tomas; Furnham, Adrian

    2011-09-01

    This paper examines the relations between self-reported attachment orientation at work and personality, self-esteem, trait emotional intelligence (aka emotional self-efficacy), and independently assessed career potential and job performance. Self-report data were collected from 211 managers in an international business in the hospitality industry; independent assessments of these managers' job performance and career potential were separately obtained from the organization. A self-report measure of romantic attachment was adapted for application in the work context; a two-factor solution was found for this measure. Secure/autonomous attachment orientation at work was positively related to self-esteem, trait emotional intelligence, extraversion, agreeableness, and conscientiousness, and also to job performance. Not only was secure/autonomous attachment orientation at work statistically predictive of job performance, but the new measure also made a distinct contribution, beyond conscientiousness, to this prediction.

  17. Facilitating attachment after international adoption.

    Science.gov (United States)

    Murphy, Natalie L

    2009-01-01

    Americans have increasingly turned to international adoption (IA) as an alternative way to build a family. Unfortunately, IA families are often being developed under conditions of loss, and sometimes these families struggle to form healthy attachments to each other. Disordered attachment (the failure to form a reciprocal, loving bond between parent and child) can occur, and can have devastating consequences. In some instances, IA children have been relinquished into state foster care systems; other families simply struggle for years caring for a developmentally delayed child who appears to have no emotion for his/her adoptive family. Nurses are likely to have contact with IA families and can use their education about attachment and bonding to help facilitate attachment in these developing families. Swanson's caring theory provides a clinically useful guide to meet this need.

  18. Religious Conflict, Attachment, and Psychopathology

    OpenAIRE

    Counted, Victor

    2017-01-01

    The presentation explores an alternative interpretation of religious conflict as an aspect of attachment-psychopathology. Paper was shared at the Religion, Conflict, and Peace Summer School, University of Groningen.

  19. Attachment Narratives in Refugee Children

    DEFF Research Database (Denmark)

    De Haene, L.; Dalgård, Nina Thorup; Montgomery, E.

    2013-01-01

    J Trauma Stress. 2013 Jun;26(3):413-7. doi: 10.1002/jts.21820. Attachment narratives in refugee children: interrater reliability and qualitative analysis in pilot findings from a two-site study.......J Trauma Stress. 2013 Jun;26(3):413-7. doi: 10.1002/jts.21820. Attachment narratives in refugee children: interrater reliability and qualitative analysis in pilot findings from a two-site study....

  20. Development of human monoclonal antibodies against diseases caused by emerging and biodefense-related viruses.

    Science.gov (United States)

    Zhu, Zhongyu; Dimitrov, Antony S; Chakraborti, Samitabh; Dimitrova, Dimana; Xiao, Xiaodong; Broder, Christopher C; Dimitrov, Dimiter S

    2006-02-01

    Polyclonal antibodies have a century-old history of being effective against some viruses; recently, monoclonal antibodies (mAbs) have also shown success. The humanized mAb Synagis (palivizumab), which is still the only mAb against a viral disease approved by the US FDA, has been widely used as a prophylactic measure against respiratory syncytial virus infections in neonates and immunocompromised individuals. The first fully human mAbs against two other paramyxoviruses, Hendra and Nipah virus, which can cause high (up to 75%) mortality, were recently developed; one of them, m101, showed exceptional potency against infectious virus. In an amazing pace of research, several potent human mAbs targeting the severe acute respiratory syndrome coronavirus S glycoprotein that can affect infections in animal models have been developed months after the virus was identified in 2003. A potent humanized mAb with therapeutic potential was recently developed against the West Nile virus. The progress in developing neutralizing human mAbs against Ebola, Crimean-Congo hemorrhagic fever, vaccinia and other emerging and biodefense-related viruses is slow. A major problem in the development of effective therapeutic agents against viruses, including therapeutic antibodies, is the viruses' heterogeneity and mutability. A related problem is the low binding affinity of crossreactive antibodies able to neutralize a variety of primary isolates. Combinations of mAbs or mAbs with other drugs, and/or the identification of potent new mAbs and their derivatives that target highly conserved viral structures, which are critical for virus entry into cells, are some of the possible solutions to these problems, and will continue to be a major focus of antiviral research.

  1. Transmission or Within-Host Dynamics Driving Pulses of Zoonotic Viruses in Reservoir–Host Populations

    Science.gov (United States)

    Plowright, Raina K.; Peel, Alison J.; Streicker, Daniel G.; Gilbert, Amy T.; McCallum, Hamish; Wood, James; Baker, Michelle L.; Restif, Olivier

    2016-01-01

    Progress in combatting zoonoses that emerge from wildlife is often constrained by limited knowledge of the biology of pathogens within reservoir hosts. We focus on the host–pathogen dynamics of four emerging viruses associated with bats: Hendra, Nipah, Ebola, and Marburg viruses. Spillover of bat infections to humans and domestic animals often coincides with pulses of viral excretion within bat populations, but the mechanisms driving such pulses are unclear. Three hypotheses dominate current research on these emerging bat infections. First, pulses of viral excretion could reflect seasonal epidemic cycles driven by natural variations in population densities and contact rates among hosts. If lifelong immunity follows recovery, viruses may disappear locally but persist globally through migration; in either case, new outbreaks occur once births replenish the susceptible pool. Second, epidemic cycles could be the result of waning immunity within bats, allowing local circulation of viruses through oscillating herd immunity. Third, pulses could be generated by episodic shedding from persistently infected bats through a combination of physiological and ecological factors. The three scenarios can yield similar patterns in epidemiological surveys, but strategies to predict or manage spillover risk resulting from each scenario will be different. We outline an agenda for research on viruses emerging from bats that would allow for differentiation among the scenarios and inform development of evidence-based interventions to limit threats to human and animal health. These concepts and methods are applicable to a wide range of pathogens that affect humans, domestic animals, and wildlife. PMID:27489944

  2. Carbohydrate determinants in ferret conjunctiva are affected by infection with influenza H1N1 virus

    DEFF Research Database (Denmark)

    Kirkeby, Svend; Martel, Cyril; Aasted, Bent

    2013-01-01

    Carbohydrates often accomplish as cell-surface receptors for microorganisms and influenza virus preferentially binds to sialic acid through the viral haemagglutinin. The virus may attach not only to the epithelium in the airways, but also to the surface ocular epithelium.......Carbohydrates often accomplish as cell-surface receptors for microorganisms and influenza virus preferentially binds to sialic acid through the viral haemagglutinin. The virus may attach not only to the epithelium in the airways, but also to the surface ocular epithelium....

  3. Activating Attachments Reduces Memories of Traumatic Images.

    Science.gov (United States)

    Bryant, Richard A; Foord, Rachael

    2016-01-01

    Emotional memories, and especially intrusive memories, are a common feature of many psychological disorders, and are overconsolidated by stress. Attachment theory posits that activation of mental representations of attachment figures can reduce stress and boost coping. This study tested the proposition that attachment activation would reduce consolidation of emotional and intrusive memories. Sixty-seven undergraduate students viewed subliminal presentations of traumatic and neutral images, which were preceded by subliminal presentations of either attachment-related images or non-attachment-related images; free recall and intrusive memories were assessed two days later. Participants with low avoidant attachment tendencies who received the attachment primes recalled fewer memories and reported fewer intrusions than those who received the non-attachment primes. Unexpectedly, those with high anxious attachment tendencies reported fewer memories. These findings generally accord with attachment theory, and suggest that consolidation of emotional memories can be moderated by activation of attachment representations.

  4. Activating Attachments Reduces Memories of Traumatic Images.

    Directory of Open Access Journals (Sweden)

    Richard A Bryant

    Full Text Available Emotional memories, and especially intrusive memories, are a common feature of many psychological disorders, and are overconsolidated by stress. Attachment theory posits that activation of mental representations of attachment figures can reduce stress and boost coping. This study tested the proposition that attachment activation would reduce consolidation of emotional and intrusive memories. Sixty-seven undergraduate students viewed subliminal presentations of traumatic and neutral images, which were preceded by subliminal presentations of either attachment-related images or non-attachment-related images; free recall and intrusive memories were assessed two days later. Participants with low avoidant attachment tendencies who received the attachment primes recalled fewer memories and reported fewer intrusions than those who received the non-attachment primes. Unexpectedly, those with high anxious attachment tendencies reported fewer memories. These findings generally accord with attachment theory, and suggest that consolidation of emotional memories can be moderated by activation of attachment representations.

  5. Attachment for mass exchange apparatus

    Energy Technology Data Exchange (ETDEWEB)

    Maksimenko, M.Z.; Maksimenko, M.M.; Prokopov, O.I.

    1982-01-01

    An attachment is proposed which contains a cylindrical housing in which the windows are profiled with inward bent windows. In order to improve the effectiveness of the attachment by increasing its surface, and mobility, the ends of the housing are equipped with inner annular partitions with radial cross sections. The sections of the partitions between them are bent inwards towards the forming housing in series, from the side of each section. The inward-bent sections of the partitions and the edges are directed to one side or to different sides.

  6. Structural Interfaces and Attachments in Biology

    CERN Document Server

    Birman, Victor; Genin, Guy

    2013-01-01

    Attachment of dissimilar materials in engineering and surgical practice is a perennial challenge. Bimaterial attachment sites are common locations for injury, repeated injury, and mechanical failure. Nature presents several highly effective solutions to the challenge of bimaterial attachment that differ from those found in engineering practice. Structural Interfaces and Attachments in Biology describes the attachment of dissimilar materials from multiple perspectives. The text will simultaneously elucidate natural bimaterial attachments and outline engineering principles underlying successful attachments to the communities of tissue engineers and surgeons. Included an in-depth analysis of the biology of attachments in the body and mechanisms by which robust attachments are formed, a review of current concepts of attaching dissimilar materials in surgical practice and a discussion of bioengineering approaches that are currently being developed. This book also: Provides the first comprehensive treatment of phys...

  7. Attachment Theory: Progress and Future Directions

    OpenAIRE

    Fearon, R. M. P.; Roisman, G. I.

    2017-01-01

    Attachment is a key subfield in the area of parenting and parent-child relationships research. In this brief overview, we summarise what we consider to be the state-of-the-art of attachment research, focusing primarily on the nature and significance of attachment in infancy and early childhood. We review 4 major topics that are central issues in the scientific literature on attachment: (1) the role of the environment in the development of attachment, (2) the intergenerational transmission of ...

  8. Variability of femoral muscle attachments.

    Science.gov (United States)

    Duda, G N; Brand, D; Freitag, S; Lierse, W; Schneider, E

    1996-09-01

    Analytical and experimental models of the musculoskeletal system often assume single values rather than ranges for anatomical input parameters. The hypothesis of the present study was that anatomical variability significantly influences the results of biomechanical analyses, specifically regarding the moment arms of the various thigh muscles. Insertions and origins of muscles crossing or attaching to the femur were digitized in six specimens. Muscle volumes were measured; muscle attachment area and centroid location were computed. To demonstrate the influence of inter-individual anatomic variability on a mechanical modeling parameter, the corresponding range of muscle moment arms were calculated. Standard deviations, as a percentage of the mean, were about 70% for attachment area and 80% for muscle volume and attachment centroid location. The resulting moment arms of the m. gluteus maximus and m. rectus femoris were especially sensitive to anatomical variations (SD 65%). The results indicate that sensitivity to anatomical variations should be analyzed in any investigation simulating musculoskeletal interactions. To avoid misinterpretations, investigators should consider using several anatomical configurations rather than relying on a mean data set.

  9. Adult attachment and psychosocial functioning

    NARCIS (Netherlands)

    Pielage, Suzanne Brenda

    2006-01-01

    In the trilogy Attachment, Separation and Loss (1969, 1973, 1980), Bowlby theorized that early experiences with caregivers affect the quality of individuals’ later (romantic) relationships and, consequently, their mental health. The current thesis set out to examine the relationships between adult

  10. WEAVING THE FABRIC OF ATTACHMENT

    Directory of Open Access Journals (Sweden)

    Lindsay Stewart

    2011-09-01

    Full Text Available This article is the Keynote Address given at the 5th International Integrative Psychotherapy Association Conference in Vichy, France, April 21, 2011. In the article author describes development of secure attachment with the help of the case study.

  11. ECHO virus

    Science.gov (United States)

    ... page: //medlineplus.gov/ency/article/001340.htm ECHO virus To use the sharing features on this page, please enable JavaScript. Enteric cytopathic human orphan (ECHO) viruses are a group of viruses that can lead ...

  12. Domain Walls with Strings Attached

    Energy Technology Data Exchange (ETDEWEB)

    Shmakova, Marina

    2001-08-20

    We have constructed a bulk and brane action of IIA theory which describes a pair of BPS domain walls on S{sub 1}/Z{sub 2}, with strings attached. The walls are given by two orientifold O8-planes with coincident D8-branes and F1-D0-strings are stretched between the walls. This static configuration satisfies all matching conditions for the string and domain wall sources and has 1/4 of unbroken supersymmetry.

  13. Temperature dependency of virus and nanoparticle transport and retention in saturated porous media

    Science.gov (United States)

    The influence of temperature (4 and 20 °C) on virus and nanoparticle attachment in columns packed with quartz sand was studied under various physiochemical conditions. Fitted values of the attachment rate coefficient (katt) and the solid fraction that contributed to attachment (Sf) were found to be...

  14. Attaching Chuck Keys to Machine Tools

    Science.gov (United States)

    Richardson, V.

    1984-01-01

    Chuck keys attached to portable machine tools by retracting lanyards. Lanyard held taut by recoil caddy attached to tool base. Chuck key available for use when needed and safely secured during operation of tool.

  15. Attachment theory: progress and future directions.

    Science.gov (United States)

    Fearon, R M Pasco; Roisman, Glenn I

    2017-06-01

    Attachment is a key subfield in the area of parenting and parent-child relationships research. In this brief overview, we summarise what we consider to be the state-of-the-art of attachment research, focusing primarily on the nature and significance of attachment in infancy and early childhood. We review 4 major topics that are central issues in the scientific literature on attachment: (1) the role of the environment in the development of attachment, (2) the intergenerational transmission of patterns of attachment, (3) the stability of attachment patterns through early adulthood, and (4) the role of attachment in adjustment and maladjustment. We conclude by highlighting several critical unresolved issues and priorities for future research. Copyright © 2017. Published by Elsevier Ltd.

  16. Attachment Theory, Foster Parents and Diversity Tolerance

    OpenAIRE

    Kenny, Michael; Fleming, Ted

    2009-01-01

    relevance to attachment within the biological and foster family. Yet every foster parent has a childhood attachment history that influences their interpersonal relationships in adulthood. The primary concern of the foster parent and their supports is with the foster child. But as a result the foster parent may distract or block reflection on their own attachment history. This presentation will focus on attachment theory and the adult, with particular reference to the foster parent. The pre...

  17. Antibodies to henipavirus or henipa-like viruses in domestic pigs in Ghana, West Africa.

    Directory of Open Access Journals (Sweden)

    David T S Hayman

    Full Text Available Henipaviruses, Hendra virus (HeV and Nipah virus (NiV, have Pteropid bats as their known natural reservoirs. Antibodies against henipaviruses have been found in Eidolon helvum, an old world fruit bat species, and henipavirus-like nucleic acid has been detected in faecal samples from E. helvum in Ghana. The initial outbreak of NiV in Malaysia led to over 265 human encephalitis cases, including 105 deaths, with infected pigs acting as amplifier hosts for NiV during the outbreak. We detected non-neutralizing antibodies against viruses of the genus Henipavirus in approximately 5% of pig sera (N = 97 tested in Ghana, but not in a small sample of other domestic species sampled under a E. helvum roost. Although we did not detect neutralizing antibody, our results suggest prior exposure of the Ghana pig population to henipavirus(es. Because a wide diversity of henipavirus-like nucleic acid sequences have been found in Ghanaian E. helvum, we hypothesise that these pigs might have been infected by henipavirus(es sufficiently divergent enough from HeVor NiV to produce cross-reactive, but not cross-neutralizing antibodies to HeV or NiV.

  18. Attachment Representation of Institutionalized Children in Japan

    Science.gov (United States)

    Katsurada, Emiko

    2007-01-01

    This exploratory study represents one of the first attachment investigations of Japanese children who have been institutionalized. Mental representation of attachment was assessed using George and Solomon's (1990, 1996, 2000) Attachment Doll Play Classification System of the Bretherton et al. (1990) doll play story stems. Participants were 32…

  19. Attachment in rat pups, an experimental approach

    NARCIS (Netherlands)

    Gispen, W.H.; Sigling, H.; Engeland, H. van; Spruijt, B.M.

    1998-01-01

    John Bowlby's attachment theory states that attachment behavior has been strengthened throughout evolution as a consequence of its adaptive value. We investigated the presence of attachment-like behavior in rat pups, by offering a choice between the home nest and a same aged other nest. Rat pups

  20. Hot-Melt Adhesive Attachment System

    Science.gov (United States)

    Fox, R. L.; Frizzell, A. W.; Little, B. D.; Progar, D. J.; Coultrip, R. H.; Couch, R. H.; Stein, B. A.; Buckley, J. D.; St. Clair, T. L.; Gleason, J. R.

    1983-01-01

    Adhesive system is as effective on Earth as in space. Fiberglass cloth mounted in head assembly. When adhesive reaches melt temperature head is attached to metals composites, ceramics, and other materials. Once attached, head cooled rapidly for quick stick. Used to tether tools or attach temporary scaffolding to walls, buildings, or beams.

  1. Attachment in Middle Childhood: Progress and Prospects

    Science.gov (United States)

    Bosmans, Guy; Kerns, Kathryn A.

    2015-01-01

    Contrary to the substantial amount of research on infant, preschool, adolescent, and adult attachment, middle childhood has long been neglected by the international attachment research community. In the past two decades, however, there has been a steep increase in research focusing on middle childhood attachment. This article provides an overview…

  2. The Importance of Quality of Care: Effects of Perinatal HIV Infection and Early Institutional Rearing on Preschoolers' Attachment and Indiscriminate Friendliness

    Science.gov (United States)

    Dobrova-Krol, Natasha A.; Bakermans-Kranenburg, Marian J.; Van IJzendoorn, Marinus H.; Juffer, Femmie

    2010-01-01

    Background: The rearing environment of human immunodeficiency virus (HIV)-infected children is often compromised, putting these children at additional risks. Positive caregiving may ameliorate the impact of adverse circumstances and promote attachment security. The goal of the present study was to examine the attachment relationships of…

  3. La experiencia de los virus emergentes en el Caribe colombiano

    Directory of Open Access Journals (Sweden)

    Salim Máttar V

    2010-04-01

    Full Text Available Existe una interrelación muy estrecha entre el hombre, su ecología y el mundo microbiano, tanto el ser humano como los agentes infecciosos han coevolucionado durante milenios (1. La historia demuestra que ha existido una confluencia de diferentes enfermedades infecciosas y las principales civilizaciones. En los últimos años las enfermedades zoonoticas emergentes han ido cobrando una importancia creciente en el terreno de la salud humana y animal, surgiendo nuevas enfermedades procedentes siempre de lugares insospechados y causantes de graves problemas para el hombre o los animales (2. La mayoría de patógenos involucrados en las enfermedades infecciosas emergentes (EIE son de origen bacteriano o rickettsial (54.3%. En este grupo están incluidos los patógenos bacterianos resistentes a los antibióticos. Los patógenos de origen viral y los priones, constituyen el 25.4% de eventos de las EIE, los protozoarios representan el 10.7%, seguido de los hongos 6.3% y los helmintos en un 3.3%. El 60.3% de las enfermedades infecciosas emergentes son causadas por patógenos zoonoticos (2. El 71.8% de estas zoonosis son causados por patógenos que se originan de la fauna silvestre, como la emergencia del virus de Nipah en Malasia y el síndrome respiratorio agudo severo (SARS en China (3.

  4. Multiple roles of genome-attached bacteriophage terminal proteins

    International Nuclear Information System (INIS)

    Redrejo-Rodríguez, Modesto; Salas, Margarita

    2014-01-01

    Protein-primed replication constitutes a generalized mechanism to initiate DNA or RNA synthesis in linear genomes, including viruses, gram-positive bacteria, linear plasmids and mobile elements. By this mechanism a specific amino acid primes replication and becomes covalently linked to the genome ends. Despite the fact that TPs lack sequence homology, they share a similar structural arrangement, with the priming residue in the C-terminal half of the protein and an accumulation of positively charged residues at the N-terminal end. In addition, various bacteriophage TPs have been shown to have DNA-binding capacity that targets TPs and their attached genomes to the host nucleoid. Furthermore, a number of bacteriophage TPs from different viral families and with diverse hosts also contain putative nuclear localization signals and localize in the eukaryotic nucleus, which could lead to the transport of the attached DNA. This suggests a possible role of bacteriophage TPs in prokaryote-to-eukaryote horizontal gene transfer. - Highlights: • Protein-primed genome replication constitutes a strategy to initiate DNA or RNA synthesis in linear genomes. • Bacteriophage terminal proteins (TPs) are covalently attached to viral genomes by their primary function priming DNA replication. • TPs are also DNA-binding proteins and target phage genomes to the host nucleoid. • TPs can also localize in the eukaryotic nucleus and may have a role in phage-mediated interkingdom gene transfer

  5. Multiple roles of genome-attached bacteriophage terminal proteins

    Energy Technology Data Exchange (ETDEWEB)

    Redrejo-Rodríguez, Modesto; Salas, Margarita, E-mail: msalas@cbm.csic.es

    2014-11-15

    Protein-primed replication constitutes a generalized mechanism to initiate DNA or RNA synthesis in linear genomes, including viruses, gram-positive bacteria, linear plasmids and mobile elements. By this mechanism a specific amino acid primes replication and becomes covalently linked to the genome ends. Despite the fact that TPs lack sequence homology, they share a similar structural arrangement, with the priming residue in the C-terminal half of the protein and an accumulation of positively charged residues at the N-terminal end. In addition, various bacteriophage TPs have been shown to have DNA-binding capacity that targets TPs and their attached genomes to the host nucleoid. Furthermore, a number of bacteriophage TPs from different viral families and with diverse hosts also contain putative nuclear localization signals and localize in the eukaryotic nucleus, which could lead to the transport of the attached DNA. This suggests a possible role of bacteriophage TPs in prokaryote-to-eukaryote horizontal gene transfer. - Highlights: • Protein-primed genome replication constitutes a strategy to initiate DNA or RNA synthesis in linear genomes. • Bacteriophage terminal proteins (TPs) are covalently attached to viral genomes by their primary function priming DNA replication. • TPs are also DNA-binding proteins and target phage genomes to the host nucleoid. • TPs can also localize in the eukaryotic nucleus and may have a role in phage-mediated interkingdom gene transfer.

  6. Physiological stress and Hendra virus in flying-foxes (Pteropus spp., Australia.

    Directory of Open Access Journals (Sweden)

    Lee McMichael

    Full Text Available Pteropid bats (flying-foxes are the natural reservoir of Hendra virus, an emergent paramyxovirus responsible for fatal infection in horses and humans in Australia. Pteropus alecto (the Black flying-fox and the paraphyletic P. conspicillatus (the Spectacled flying-fox appear to be the primary reservoir hosts. Previous studies have suggested that physiological and ecological factors may underpin infection dynamics in flying-foxes, and subsequent spillover to horses and in turn humans. We sought to examine temporal trends in urinary cortisol concentration in wild Australian flying-fox populations, to elucidate the putative relationship between Hendra virus infection and physiological stress. Pooled and individual urine samples were non-invasively collected from under roosting flying-foxes at two latitudinally disparate regions in the eastern Australian state of Queensland. Hendra virus detection, and (in individual urine samples sex and species determination were PCR-based. Urinary cortisol measurement used a validated enzyme immunoassay. We found no direct correlation between increased urinary cortisol and Hendra virus excretion, but our findings do suggest a biologically plausible association between low winter temperatures and elevated cortisol levels in P. alecto in the lower latitude Southeast Queensland roosts. We hypothesize an indirect association between low winter temperatures and increased Hendra virus infection and excretion, mediated by the physiological cost of thermoregulation. Our findings and our approach are directly relevant to elaboration of the disease ecology of Nipah virus and other emerging henipaviruses in bats. More broadly, they inform investigation of emerging disease infection dynamics across the wildlife/livestock/human interface.

  7. Henipavirus microsphere immuno-assays for detection of antibodies against Hendra virus.

    Science.gov (United States)

    McNabb, Leanne; Barr, J; Crameri, G; Juzva, S; Riddell, S; Colling, A; Boyd, V; Broder, C; Wang, L-F; Lunt, R

    2014-05-01

    Hendra and Nipah viruses (HeV and NiV) are closely related zoonotic pathogens of the Paramyxoviridae family. Both viruses belong to the Henipavirus genus and cause fatal disease in animals and humans, though only HeV is endemic in Australia. In general and due to the acute nature of the disease, agent detection by PCR and virus isolation are the primary tools for diagnostic investigations. Assays for the detection of antibodies against HeV are fit more readily for the purpose of surveillance testing in disease epidemiology and to meet certification requirements in the international movement of horses. The first generation indirect ELISA has been affected by non-specific reactions which must be resolved using virus neutralisation serology conducted at laboratory bio-safety level 4 containment (PC4). Recent developments have enabled improvements in the available serology assays. The production of an expressed recombinant truncated HeV G protein has been utilised in ELISA and in Luminex-based multiplexed microsphere assays. In the latter format, two Luminex assays have been developed for use in henipavirus serology: a binding assay (designed for antibody detection and differentiation) and a blocking assay (designed as a surrogate for virus neutralisation). Equine and canine field sera were used to evaluate the two Luminex assays relative to ELISA and virus neutralisation serology. Results showed that Luminex assays can be effective as rapid, sensitive and specific tests for the detection of HeV antibody in horse and dog sera. The tests do not require PC4 containment and are appropriate for high throughput applications as might be required for disease investigations and other epidemiological surveillance. Also, the results show that the Luminex assays detect effectively HeV vaccine-induced antibodies. Copyright © 2014 Elsevier B.V. All rights reserved.

  8. Physiological stress and Hendra virus in flying-foxes (Pteropus spp.), Australia.

    Science.gov (United States)

    McMichael, Lee; Edson, Daniel; Smith, Craig; Mayer, David; Smith, Ina; Kopp, Steven; Meers, Joanne; Field, Hume

    2017-01-01

    Pteropid bats (flying-foxes) are the natural reservoir of Hendra virus, an emergent paramyxovirus responsible for fatal infection in horses and humans in Australia. Pteropus alecto (the Black flying-fox) and the paraphyletic P. conspicillatus (the Spectacled flying-fox) appear to be the primary reservoir hosts. Previous studies have suggested that physiological and ecological factors may underpin infection dynamics in flying-foxes, and subsequent spillover to horses and in turn humans. We sought to examine temporal trends in urinary cortisol concentration in wild Australian flying-fox populations, to elucidate the putative relationship between Hendra virus infection and physiological stress. Pooled and individual urine samples were non-invasively collected from under roosting flying-foxes at two latitudinally disparate regions in the eastern Australian state of Queensland. Hendra virus detection, and (in individual urine samples) sex and species determination were PCR-based. Urinary cortisol measurement used a validated enzyme immunoassay. We found no direct correlation between increased urinary cortisol and Hendra virus excretion, but our findings do suggest a biologically plausible association between low winter temperatures and elevated cortisol levels in P. alecto in the lower latitude Southeast Queensland roosts. We hypothesize an indirect association between low winter temperatures and increased Hendra virus infection and excretion, mediated by the physiological cost of thermoregulation. Our findings and our approach are directly relevant to elaboration of the disease ecology of Nipah virus and other emerging henipaviruses in bats. More broadly, they inform investigation of emerging disease infection dynamics across the wildlife/livestock/human interface.

  9. Modeling the co-transport of viruses and colloids in unsaturated porous media.

    Science.gov (United States)

    Seetha, N; Mohan Kumar, M S; Majid Hassanizadeh, S

    2015-10-01

    A mathematical model is developed to simulate the co-transport of viruses and colloids in unsaturated porous media under steady-state flow conditions. The virus attachment to the mobile and immobile colloids is described using a linear reversible kinetic model. Colloid transport is assumed to be decoupled from virus transport; that is, we assume that colloids are not affected by the presence of attached viruses on their surface. The governing equations are solved numerically using an alternating three-step operator splitting approach. The model is verified by fitting three sets of experimental data published in the literature: (1) Syngouna and Chrysikopoulos (2013) and (2) Walshe et al. (2010), both on the co-transport of viruses and clay colloids under saturated conditions, and (3) Syngouna and Chrysikopoulos (2015) for the co-transport of viruses and clay colloids under unsaturated conditions. We found a good agreement between observed and fitted breakthrough curves (BTCs) under both saturated and unsaturated conditions. Then, the developed model was used to simulate the co-transport of viruses and colloids in porous media under unsaturated conditions, with the aim of understanding the relative importance of various processes on the co-transport of viruses and colloids in unsaturated porous media. The virus retention in porous media in the presence of colloids is greater during unsaturated conditions as compared to the saturated conditions due to: (1) virus attachment to the air-water interface (AWI), and (2) co-deposition of colloids with attached viruses on its surface to the AWI. A sensitivity analysis of the model to various parameters showed that the virus attachment to AWI is the most sensitive parameter affecting the BTCs of both free viruses and total mobile viruses and has a significant effect on all parts of the BTC. The free and the total mobile viruses BTCs are mainly influenced by parameters describing virus attachment to the AWI, virus interaction

  10. Multiple proteins of White spot syndrome virus involved in ...

    Indian Academy of Sciences (India)

    The recognition and attachment of virus to its host cell surface is a critical step for viral infection. Recent research revealed that -integrin was involved in White spot syndrome virus (WSSV) infection. In this study, the interaction of -integrin with structure proteins of WSSV and motifs involved in WSSV infection was ...

  11. The cellular receptors for infectious bursal disease virus | Zhu ...

    African Journals Online (AJOL)

    Virus receptors are simplistically defined as cell surface molecules that mediate binding (attachment, adsorption) and/or trigger membrane fusion or entry through other processes. Infectious bursal disease virus (IBDV) entry into host cells occurs by recognition of specific cellular receptor(s) with viral envelope glycoprotein, ...

  12. Crystal Structure of the Marburg Virus VP35 Oligomerization Domain

    Energy Technology Data Exchange (ETDEWEB)

    Bruhn, Jessica F.; Kirchdoerfer, Robert N.; Urata, Sarah M.; Li, Sheng; Tickle, Ian J.; Bricogne, Gérard; Saphire, Erica Ollmann (Scripps); (Globel Phasing); (UCSD)

    2016-11-09

    ABSTRACT

    Marburg virus (MARV) is a highly pathogenic filovirus that is classified in a genus distinct from that of Ebola virus (EBOV) (generaMarburgvirusandEbolavirus, respectively). Both viruses produce a multifunctional protein termed VP35, which acts as a polymerase cofactor, a viral protein chaperone, and an antagonist of the innate immune response. VP35 contains a central oligomerization domain with a predicted coiled-coil motif. This domain has been shown to be essential for RNA polymerase function. Here we present crystal structures of the MARV VP35 oligomerization domain. These structures and accompanying biophysical characterization suggest that MARV VP35 is a trimer. In contrast, EBOV VP35 is likely a tetramer in solution. Differences in the oligomeric state of this protein may explain mechanistic differences in replication and immune evasion observed for MARV and EBOV.

    IMPORTANCEMarburg virus can cause severe disease, with up to 90% human lethality. Its genome is concise, only producing seven proteins. One of the proteins, VP35, is essential for replication of the viral genome and for evasion of host immune responses. VP35 oligomerizes (self-assembles) in order to function, yet the structure by which it assembles has not been visualized. Here we present two crystal structures of this oligomerization domain. In both structures, three copies of VP35 twist about each other to form a coiled coil. This trimeric assembly is in contrast to tetrameric predictions for VP35 of Ebola virus and to known structures of homologous proteins in the measles, mumps, and Nipah viruses. Distinct oligomeric states of the Marburg and Ebola virus VP35 proteins may explain differences between them in polymerase function and immune evasion. These findings may provide a more accurate understanding of the

  13. This could be the start of something big—20 years since the identification of bats as the natural host of Hendra virus

    Directory of Open Access Journals (Sweden)

    Peter Black

    2015-12-01

    Full Text Available Hendra virus was first described in 1994 in Australia, causally associated with a cluster of fatal equine and human cases at a thoroughbred racing stable in the Brisbane suburb of Hendra. This year marks the twentieth anniversary of the identification of pteropid bats (flying-foxes as the natural host of the virus, and it is timely to reflect on a pivotal meeting of an eclectic group of scientists in that process. They included animal and public health experts, environmental scientists, veterinary and horse industry representatives, and wildlife experts. The task was to review and prioritise wildlife surveillance seeking the origin of the previously unknown virus. The group determined that the likely reservoir must occur in disparate locations, and be capable of moving between locations, or exist in continuous, overlapping populations spanning multiple locations. Flying-foxes were considered to be a more probable source of the novel virus than birds. Within weeks, antibodies were detected in several species of flying-fox, and the virus was subsequently isolated. While the identification of the natural host of Hendra virus within 18 months of its description was remarkable in itself, a broader legacy followed. In the subsequent years, a suite of zoonotic viruses including Australian bat lyssavirus, Nipah virus, SARS coronavirus, and Ebola and Marburg viruses have been detected in bats. Bats are now the “go to” taxa for novel viruses. History has repeatedly demonstrated that knowledge begets knowledge. This simple notion of bringing a diverse group of people together in an environment of mutual respect reinforced this principle and proves that the sum is often so much more powerful than the parts.

  14. This could be the start of something big-20 years since the identification of bats as the natural host of Hendra virus.

    Science.gov (United States)

    Black, Peter; Douglas, Ian; Field, Hume

    2015-12-01

    Hendra virus was first described in 1994 in Australia, causally associated with a cluster of fatal equine and human cases at a thoroughbred racing stable in the Brisbane suburb of Hendra. This year marks the twentieth anniversary of the identification of pteropid bats (flying-foxes) as the natural host of the virus, and it is timely to reflect on a pivotal meeting of an eclectic group of scientists in that process. They included animal and public health experts, environmental scientists, veterinary and horse industry representatives, and wildlife experts. The task was to review and prioritise wildlife surveillance seeking the origin of the previously unknown virus. The group determined that the likely reservoir must occur in disparate locations, and be capable of moving between locations, or exist in continuous, overlapping populations spanning multiple locations. Flying-foxes were considered to be a more probable source of the novel virus than birds. Within weeks, antibodies were detected in several species of flying-fox, and the virus was subsequently isolated. While the identification of the natural host of Hendra virus within 18 months of its description was remarkable in itself, a broader legacy followed. In the subsequent years, a suite of zoonotic viruses including Australian bat lyssavirus, Nipah virus, SARS coronavirus, and Ebola and Marburg viruses have been detected in bats. Bats are now the "go to" taxa for novel viruses. History has repeatedly demonstrated that knowledge begets knowledge. This simple notion of bringing a diverse group of people together in an environment of mutual respect reinforced this principle and proves that the sum is often so much more powerful than the parts.

  15. Networked Attached Devices at SNS

    CERN Document Server

    Blokland, W

    2003-01-01

    The Spallation Neutron Source (SNS) diagnostic instruments at Oak Ridge National Laboratory are based on the Network Attached Device (NAD) concept. Each pickup or sensor has its own resources such as timing, data acquisition and processing. NADs are individually connected to the network, thus reducing the brittleness inherent in tightly coupled systems. This architecture allows an individual device to fail or to be serviced or removed without disrupting other devices. This paper describes our implementation of the nearly 400 NADs to be deployed. The hardware consists of rack-mounted PCs with standard motherboards and PCI data-acquisition boards. The software environment is based on LabVIEW and EPICS. LabVIEW supports the agile development demanded by modern diagnostic systems. EPICS is the control system standard for the entire SNS facility. To achieve high performance, LabVIEW and EPICS communicate through shared memory. SNS diagnostics are developed by a multi-laboratory partnership including ORNL, BNL, LAN...

  16. Silicon Nanowire as Virus Sensor in a Total Analysis System

    DEFF Research Database (Denmark)

    Svendsen, Winnie Edith; Jørgensen, Michael; Andresen, Lars

    2011-01-01

    Silicon nanowires are very promising candidates for the sensitive detection of viruses or even early detection of cancer. Due to their small dimensions the attachment of even one particle on their surface leads to detectable changes in their conductivity. In this paper we describe the development...... (fabrication and testing) of a silicon nanowire biosensor equipped with microfludic channels and automatized data aquisition for the detection of antibodies against a small virus (Aleutian Disease Virus) causing plasmacytosis on mink and ferrets....

  17. Zika Virus

    Science.gov (United States)

    ... through blood transfusions. There have been outbreaks of Zika virus in the United States, Africa, Southeast Asia, the ... not travel to areas where there is a Zika virus outbreak. If you do decide to travel, first ...

  18. Zika Virus

    Science.gov (United States)

    ... which is responsible for transmitting Zika virus. Photo Courtesy of: James Gathany, Centers for Disease Control and ... National Institute of Allergy and Infectious Diseases. Photo Courtesy of NIH "You could have a Zika virus ...

  19. Chikungunya Virus

    Science.gov (United States)

    ... Gaines, PhD, MPH, MA, CHES Differentiating Chikungunya From Dengue: A Clinical Challenge For Travelers CDC Travelers' Health Chikungunya Virus Home Prevention Transmission Symptoms & Treatment Geographic Distribution Chikungunya virus in the United States ...

  20. Attachment theory: A review of research

    Directory of Open Access Journals (Sweden)

    Polovina Nada

    2005-01-01

    Full Text Available Research of attachment is numerous and versatile. They differ according to problems addressed, methodology applied (longitudinal studies, studies with horizontal designs, different instruments used, different methods of data analysis, and characteristics of samples involved (concerning age socio/economic status, family ecology. The research is commonly relied on the core assumptions of the theory itself, and the shared characteristic is orientation to explore complex phenomena of human experience and functioning. From the vast variety of research only those who most directly test the basic assumptions of the attachment theory are focused and addressed in the paper: representation of patterns of attachment in the childhood and adulthood, stability and change of attachment security from infancy to early adulthood, transgenerational transmission of attachment characteristics, the place and the role of attachment behavioral system in the personality development. The aim of the paper is to highlight the basic research and theory issues and directions, and illustrate them with concrete research date.

  1. Place attachment and natural environmental risk

    DEFF Research Database (Denmark)

    Bonaiuto, Marino; Alves, Susana; De Dominicis, Stefano

    2016-01-01

    Little is known about place attachment affecting natural environmental risk perception and coping. A systematic search of social science databases revealed 31 works (1996–2016) directly addressing place attachment in relation to different types of natural hazard risks (e.g., seismic, volcanic, etc.......). Across different contexts, the research shows: (a) positive and/or negative relationships between place attachment and natural environmental risk perception; (b) positive and/or negative relationships between place attachment and risk coping; and (c) mediating and moderating relationships. In particular......, results show that: (a) highly attached individuals perceive natural environmental risks but underestimate their potential effects; (b) highly attached individuals are unwilling to relocate when facing natural environmental risks and more likely to return to risky areas after a natural environmental...

  2. Association Between Insecure Attachment and ADHD

    DEFF Research Database (Denmark)

    Storebo, Ole Jakob; Darling Rasmussen, Pernille; Simonsen, Erik

    2016-01-01

    Objective: Psychological theories have postulated an association between insecure attachment and ADHD. The objective of this study is to investigate possible association between insecure attachment and ADHD in children and adults. Method: Review of literature was performed using the Psyc......INFO, Medline, and EMBASE databases. Results: Twenty-nine studies were included in the review. Overall, the studies showed that parental attachment problems and environmental mediating factors were significantly associated with childhood ADHD. Adults with ADHD had a much higher incidence of insecure attachment...... styles than reported in the general population. Conclusion: There seems to be a clear association between ADHD and insecure attachment. It is likely that early intervention in the form of parent training and pharmacological treatment may prevent development of attachment problems. But such studies have...

  3. Hepadna viruses

    Energy Technology Data Exchange (ETDEWEB)

    Robinson, W.; Koike, K.; Will, H.

    1987-01-01

    This book examines the molecular biology, disease pathogenesis, epidemiology, and clinical features of hepadna and other viruses with hepatic tropism and outlines future directions and approaches for their management. The volume's six sections provide a review of the various features, mechanisms, and functions of these viruses, ranging from hepadna virus replication and regulation of gene expression to the structure and function of hepadna-virus gene products.

  4. Security for Network Attached Storage Devices

    National Research Council Canada - National Science Library

    Gobioff, Howard

    1997-01-01

    This paper presents a novel cryptographic capability system addressing the security and performance needs of network attached storage systems in which file management functions occur at a different...

  5. Temperament and attachment: one construct or two?

    Science.gov (United States)

    Mangelsdorf, S C; Frosch, C A

    1999-01-01

    In this chapter we described the constructs of temperament and attachment and have discussed similarities and differences between the two. We addressed the issue of whether temperament contributes to overall attachment security or to the specific type of attachment that children display. We conclude that although temperament may influence the type of secure and insecure attachment relationship children form with their parent, temperament alone will not determine if a child is classified as securely or insecurely attached. We presented evidence suggesting that certain dimensions of temperament, specifically negative emotionality, may be associated with infants' behavior during the Strange Situation, such as proneness-to-distress during separations. However, we noted that these temperament dimensions do not predict overall security of attachment. It is likely that although no single temperament characteristic, such as proneness-to-distress, in and of itself determines overall attachment security, it is possible that a constellation of temperament characteristics may be more strongly related to attachment security. The examination of constellations of temperament characteristics may be particularly useful for furthering our understanding of individual differences within attachment classifications. Such an approach may elucidate the reasons why infants are classified into one subgroup of secure, insecure-avoidant, or insecure-resistant attachment versus another subgroup. Furthermore, we suggest that the collection of findings regarding temperament and attachment not only underscores the importance of a transactional approach to early social-emotional development, but emphasizes that temperament and attachment can make unique and interactive contributions to children's social-emotional functioning. That is, the goodness-of-fit between infant and parent characteristics may best predict security of attachment. Although child characteristics clearly contribute to the

  6. Overdenture locator attachments for atrophic mandible

    Directory of Open Access Journals (Sweden)

    Neerja Mahajan

    2013-01-01

    Full Text Available Implant-supported overdentures provide a good opportunity for dentists to improve oral health and quality-of-life of patients. Atrophic mandible poses a significant challenge to successful oral rehabilitation with dental implants. In this article, the fabrication of lower overdenture by two narrow platform implants is described with dual retentive, resilient, self-locating locator attachment system. The locator attachment system has the lowest profile in comparison with the ball and bar attachments and is versatile up to 40΀ of divergence between two implants. By using locators as attachments, we can meet functional, economic and social expectation of patients with ease and satisfaction.

  7. Sine-Bar Attachment For Machine Tools

    Science.gov (United States)

    Mann, Franklin D.

    1988-01-01

    Sine-bar attachment for collets, spindles, and chucks helps machinists set up quickly for precise angular cuts that require greater precision than provided by graduations of machine tools. Machinist uses attachment to index head, carriage of milling machine or lathe relative to table or turning axis of tool. Attachment accurate to 1 minute or arc depending on length of sine bar and precision of gauge blocks in setup. Attachment installs quickly and easily on almost any type of lathe or mill. Requires no special clamps or fixtures, and eliminates many trial-and-error measurements. More stable than improvised setups and not jarred out of position readily.

  8. Attachment style and interpersonal trauma in refugees.

    Science.gov (United States)

    Morina, Naser; Schnyder, Ulrich; Schick, Matthis; Nickerson, Angela; Bryant, Richard A

    2016-12-01

    Refugees can suffer many experiences that threaten their trust in others. Although models of refugee mental health have postulated that attachment securities may be damaged by refugee experiences, this has yet to be empirically tested. This study aimed to understand the relationship between the nature of traumatic experiences sustained by refugees and attachment styles. In a cross-sectional study, treatment-seeking refugees (N = 134) were assessed for traumatic exposure using the Harvard Trauma Questionnaire and Posttraumatic Diagnostic Scale. Attachment style was assessed using the Experiences in Close Relationship Scale. Whereas gender and severity of interpersonal traumatic events predicted avoidant attachment style (accounting for 11% of the variance), neither these factors nor non-interpersonal trauma predicted anxious attachment. Exposure to interpersonal traumatic events, including torture, is associated with enduring avoidant attachment tendencies in refugees. This finding accords with attachment theories that prior adverse interpersonal experiences can undermine secure attachment systems, and may promote avoidance of attachment seeking. This finding may point to an important process maintaining poor psychological health in refugees affected by interpersonal trauma. © The Royal Australian and New Zealand College of Psychiatrists 2016.

  9. Attachment theory: Old and new approach

    Directory of Open Access Journals (Sweden)

    Polovina Nada

    2005-01-01

    Full Text Available The article is an attempt to present holistically the key concepts of attachment theory rediscovered for its potentials. The presented concepts include: narrow definition of attachment, behavioral control system of attachment, attachment working model and patterns of attachment. The concepts are presented in the context of child attachment theory and adult attachment theory, in addition to description of the development of attachment. Concepts, as well as developmental processes are presented from the stand point of pioneers in this field (John Bowlby and Mary Ainsworth as well as from the standpoint of their successors (Everett Waters and Malcolm West. Compacted ness of the theory, possibilities for operationalization of its key concepts and its application to empirical studies of complex psychological issues that have never been scientifically explored, makes it a very prospective theory in view of possible integration of existing research findings and initiating new research and new practices in psychotherapy, social work and work in schools. The goal of this integral presentation of attachment theory is to highlight its benefits and possibilities for understanding and research complex field of human's psychosocial functioning.

  10. Hyperthermophilic Archaeal Viruses as Novel Nanoplatforms

    DEFF Research Database (Denmark)

    Uldahl, Kristine Buch

    ; attachment, alignment, and fusion. Upon infection, the intracellular replication cycle lasts 8 h at which point the virus particles are released as spindle-shaped tailless particles. Chapter II builds on the replication and purification methods in Chapter I to study the interaction between the two...

  11. C-terminal tyrosine residues modulate the fusion activity of the Hendra virus fusion protein.

    Science.gov (United States)

    Popa, Andreea; Pager, Cara Teresia; Dutch, Rebecca Ellis

    2011-02-15

    The paramyxovirus family includes important human pathogens such as measles, mumps, respiratory syncytial virus, and the recently emerged, highly pathogenic Hendra and Nipah viruses. The viral fusion (F) protein plays critical roles in infection, promoting both the virus-cell membrane fusion events needed for viral entry as well as cell-cell fusion events leading to syncytia formation. We describe the surprising finding that addition of the short epitope HA tag to the cytoplasmic tail (CT) of the Hendra virus F protein leads to a significant increase in the extent of cell-cell membrane fusion. This increase was not due to alterations in surface expression, cleavage state, or association with lipid microdomains. Addition of a Myc tag of similar length did not alter Hendra F protein fusion activity, indicating that the observed stimulation was not solely a result of lengthening the CT. Three tyrosine residues within the HA tag were critical for the increase in the extent of fusion, suggesting C-terminal tyrosines may modulate Hendra fusion activity. The effects of addition of the HA tag varied with other fusion proteins, as parainfluenza virus 5 F-HA showed a decreased level of surface expression and no stimulation of fusion. These results indicate that additions to the C-terminal end of the F protein CT can modulate protein function in a sequence specific manner, reinforcing the need for careful analysis of epitope-tagged glycoproteins. In addition, our results implicate C-terminal tyrosine residues in the modulation of the membrane fusion reaction promoted by these viral glycoproteins.

  12. Pharmacological inhibition of feline immunodeficiency virus (FIV).

    Science.gov (United States)

    Mohammadi, Hakimeh; Bienzle, Dorothee

    2012-05-01

    Feline immunodeficiency virus (FIV) is a member of the retroviridae family of viruses and causes an acquired immunodeficiency syndrome (AIDS) in domestic and non-domestic cats worldwide. Genome organization of FIV and clinical characteristics of the disease caused by the virus are similar to those of human immunodeficiency virus (HIV). Both viruses infect T lymphocytes, monocytes and macrophages, and their replication cycle in infected cells is analogous. Due to marked similarity in genomic organization, virus structure, virus replication and disease pathogenesis of FIV and HIV, infection of cats with FIV is a useful tool to study and develop novel drugs and vaccines for HIV. Anti-retroviral drugs studied extensively in HIV infection have targeted different steps of the virus replication cycle: (1) inhibition of virus entry into susceptible cells at the level of attachment to host cell surface receptors and co-receptors; (2) inhibition of fusion of the virus membrane with the cell membrane; (3) blockade of reverse transcription of viral genomic RNA; (4) interruption of nuclear translocation and viral DNA integration into host genomes; (5) prevention of viral transcript processing and nuclear export; and (6) inhibition of virion assembly and maturation. Despite much success of anti-retroviral therapy slowing disease progression in people, similar therapy has not been thoroughly investigated in cats. In this article we review current pharmacological approaches and novel targets for anti-lentiviral therapy, and critically assess potentially suitable applications against FIV infection in cats.

  13. Measuring Patients’ Attachment Avoidance in Psychotherapy: Development of the Attachment Avoidance in Therapy Scale (AATS

    Directory of Open Access Journals (Sweden)

    András Láng

    2012-11-01

    Full Text Available A new scale measuring patient-therapist attachment avoidance was developed. Attachment Avoidance in Therapy Scale is a new measure based on the Bartholomew model of adult attachment (Bartholomew & Horowitz, 1991 and the Experience in Close Relationships Scale (Brennan, Clark, & Shaver, 1998 to measure patients’ attachment avoidance towards therapists. With 112 patient-therapist dyads participating in the study, validation of a preliminary scale – measuring both attachment anxiety and attachment avoidance in therapy – took place using therapists’ evaluations of patients’ relational behavior and patients’ self-reports about their attitude toward psychotherapy. Analysis of the data revealed six underlying scales. Results showed all six scales to be reliable. Validation of scales measuring attachment anxiety failed. The importance of Attachment Avoidance in Therapy Scale and its subscales is discussed.

  14. Attachment theory and reactive attachment disorder: theoretical perspectives and treatment implications.

    Science.gov (United States)

    Hardy, Lyons T

    2007-02-01

    Attachment theory and reactive attachment disorder (RAD). To highlight current perspectives on attachment theory, RAD, and treatment implications using a case study of an 8-year-old patient with RAD. Selected multidisciplinary literature related to attachment theory and RAD. The literature provides a body of work that substantiates the importance of early attachment relationships to human development and highlights gaps in our knowledge related to treatment of children with RAD. The quality of early attachment relationships is correlated with future personality and brain development. Attachment disturbances are associated with psychopathology in childhood and adulthood. Although evidence for the effective treatment of children with attachment disorders is minimal and inconclusive, the two major perspectives, developmental psychology and neuropsychoanalysis, offer guidelines for practice.

  15. Smartphone attachment for stethoscope recording.

    Science.gov (United States)

    Thompson, Jeff

    2015-01-01

    With the ubiquity of smartphones and the rising technology of 3D printing, novel devices can be developed that leverage the "computer in your pocket" and rapid prototyping technologies toward scientific, medical, engineering, and creative purposes. This paper describes such a device: a simple 3D-printed extension for Apple's iPhone that allows the sound from an off-the-shelf acoustic stethoscope to be recorded using the phone's built-in microphone. The attachment's digital 3D files can be easily shared, modified for similar phones and devices capable of recording audio, and in combination with 3D printing technology allow for fabrication of a durable device without need for an entire factory of expensive and specialized machining tools. It is hoped that by releasing this device as an open source set of printable files that can be downloaded and reproduced cheaply, others can make use of these developments where access to cost-prohibitive, specialized medical instruments are not available. Coupled with specialized smartphone software ("apps"), more sophisticated and automated diagnostics may also be possible on-site.

  16. Parent attachment, childrearing behaviour, and child attachment: Mediated effect that predict externalizing behaviour in preschoolers.

    OpenAIRE

    Roskam, Isabelle; Meunier, Jean-Christophe; Stievenart, Marie

    2011-01-01

    Attachment theory provides an interesting background for thinking about externalizing behavior (EB) in early childhood and for understanding how parenting influences the child's outcomes. The study examined how attachment and parenting could be combined to explain preschoolers' EB. Data were collected from 117 preschoolers aged from 4 to 6 clinically referred for EB and their parents from a middle-high income population. Child attachment was measured with the Attachment Q-set; parent's rememb...

  17. Adolescent Self-Esteem, Attachment and Loneliness

    Science.gov (United States)

    Dhal, Anubha; Bhatia, Sangeeta; Sharma, Vidhi; Gupta, Priyanka

    2007-01-01

    Objectives: To assess self-esteem, loneliness and attachment styles among adolescents and examine their association with each other and with age and gender. Method: Adolescents (55 males and 55 females) from a public school in Delhi, aged 10-13 years were administered Coopersmith Self-Esteem Inventory (School Form), Attachment Scale and UCLA…

  18. Attachment and Socioemotional Problems in Middle Childhood

    Science.gov (United States)

    Moss, Ellen; Lecompte, Vanessa

    2015-01-01

    In this article, we will evaluate the evidence concerning links between attachment and behavior problems in the middle childhood period. We will first provide a general introduction to the question of attachment and maladaptation in the middle childhood period, and then examine the recent empirical evidence with respect to both externalizing and…

  19. Insecure attachment and anxiety in student athletes.

    Science.gov (United States)

    Han, D H; Kim, S M; Zaichkowsky, L

    2013-06-01

    The main purpose of our research was to examine attachment type and competition anxiety in high school student athletes and general high school students. We recruited 465 student athletes and 543 general students to participate in our study. The Revised Korean version of the Experiences in Close Relationships Scale (K-ECRS) and the Competitive State Anxiety Inventory-2 (CSAI-2) were given to all students. In χ2 tests, athletes showed attachment types in the following order of prevalence: fearful, dismissive, and preoccupied, compared to the fearful, preoccupied, and dismissive order observed in general students. In parametric, independent t-tests, athletes reported significantly higher cognitive anxiety scores, relative to general students. Further, athletes with insecure attachment compared to those with secure attachment reported higher cognitive anxiety scores and self-confidence scores. In both the athletes with insecure attachment and general students with insecure attachment groups, the K-ECRS anxiety subscale was significantly correlated with CSAI-2 total score. In post hoc analysis in the athletes with insecure attachment group, the K-ECRS anxiety subscale was also significantly correlated with the CSAI-2 cognitive anxiety subscale. These results suggest that anxious athletes with an insecure attachment style tend to exaggerate threats from both external and internal sources, which negatively affect their performances.

  20. Mother-Infant Attachment in Adoptive Families.

    Science.gov (United States)

    Singer, Leslie M.; And Others

    1985-01-01

    No differences were found in mother-infant attachment between nonadopted and intraracial adopted subjects or between intraracial and interracial adopted subjects. Suggests that the higher incidence of psychological problems found among adoptees in middle childhood and adolescence cannot be explained in terms of insecure attachment relationships…

  1. An Attachment Perspective on Anger among Adolescents

    Science.gov (United States)

    Konishi, Chiaki; Hymel, Shelley

    2014-01-01

    Extending John Bowlby's hypothesis that dysfunctional anger is a predictable outcome of insecure attachments to parents, this study investigated the relationship between current parent-adolescent attachment and both the experience and expression of anger. Participants included 776 students (379 boys and 397 girls) in grades 8-12. As predicted by…

  2. Separation-individuation theory and attachment theory.

    Science.gov (United States)

    Blum, Harold P

    2004-01-01

    Separation-individuation and attachment theories are compared and assessed in the context of psychoanalytic developmental theory and their application to clinical work. As introduced by Margaret Mahler and John Bowlby, respectively, both theories were initially regarded as diverging from traditional views. Separation-individuation theory, though it has had to be corrected in important respects, and attachment theory, despite certain limitations, have nonetheless enriched psychoanalytic thought. Without attachment an infant would die, and with severely insecure attachment is at greater risk for serious disorders. Development depends on continued attachment to a responsive and responsible caregiver. Continued attachment to the primary object was regarded by Mahler as as intrinsic to the process of separation-individuation. Attachment theory does not account for the essential development of separateness, and separation-individuation is important for the promotion of autonomy, independence, and identity. Salient historical and theoretical issues are addressed, including the renewed interest in attachment theory and the related decline of interest in separation-individuation theory.

  3. Study on thermocouple attachment in reflood experiments

    International Nuclear Information System (INIS)

    Sugimoto, Jun

    1977-03-01

    The method of thermocouple attachment to a heater rods has been studied for surface temperature measurement in reflood experiments. The method used as far in JAERI's reflood experiments had some possibilities of not estimating exactly the quench times. Various attachment method have been tested and some proved to be effective in the respect. (auth.)

  4. Attachment of Salmonella spp. to pork meat

    DEFF Research Database (Denmark)

    Hansen, Trine; Riber, Leise; Löfström, Charlotta

    2011-01-01

    Five strains of Salmonella, one wildtype and four knock-out mutants (the prg, flhDC, yhjH and fliC genes) were investigated based on their probability to attach and subsequently detach from a surface of pork fillet. The attachment followed by detachment was measured and modelled for two different...

  5. Attachment Parenting: A Style That Works.

    Science.gov (United States)

    Sears, William

    1995-01-01

    Discusses the benefits of attachment parenting, which emphasizes parental commitment, a low-stress pregnancy, childbirth preparation, breast-feeding with child-led weaning, prompt response to the baby's crying, flexible sleeping arrangements, close-knit father-mother-baby functioning, and the avoidance of detachment parenting. Attachment parenting…

  6. Attachment style, family and romantic relationships.

    Science.gov (United States)

    Erwin, P G; Salter, K; Purves, D G

    2001-06-01

    In 1987 Hazan and Shaver showed that patterns of romantic love reflected attachment styles. In an extension of that study with 39 men and 33 women in college (ages 18-36 years), this research shows that family relationships may also affect romantic relationships indirectly through their association with attachment styles.

  7. Attachment Theory and Neuroscience for Care Managers.

    Science.gov (United States)

    Blakely, Thomas J; Dziadosz, Gregory M

    2016-09-01

    This article describes a model for care managers that is based on attachment theory supplemented by knowledge from neuroscience. Together, attachment theory and basic knowledge from neuroscience provide for both an organizing conceptual framework and a scientific, measureable approach to assessment and planning interventions in a care plan.

  8. Electron attachment to Van der Waals clusters

    International Nuclear Information System (INIS)

    Stamatovic, A.

    1988-01-01

    This paper deals with attachment of thermal electrons to Van der Waals clusters at zero energy. The underlying theory is treated briefly. Three different major types of experiments for studying thermal electron attachment to molecules and clusters: swarm experiments, beam experiments and collisions with Rydberg atoms, are described and some results are reviewed. 42 refs.; 5 figs

  9. An Attachment Model of University Connectedness

    Science.gov (United States)

    Wilson, Steffen; Gore, Jonathan

    2013-01-01

    Students with high levels of connectedness to the university have been found to be more likely to complete their college degree than are students with low levels of university connectedness. This study examined the role of parental and peer attachment as distal predictors of school connectedness. As predicted, it was found that attachment style to…

  10. Attachment and children's biased attentional processing: evidence for the exclusion of attachment-related information.

    Directory of Open Access Journals (Sweden)

    Eva Vandevivere

    Full Text Available Research in both infants and adults demonstrated that attachment expectations are associated with the attentional processing of attachment-related information. However, this research suffered from methodological issues and has not been validated across ages. Employing a more ecologically valid paradigm to measure attentional processes by virtue of eye tracking, the current study tested the defensive exclusion hypothesis in late childhood. According to this hypothesis, insecurely attached children are assumed to defensively exclude attachment-related information. We hypothesized that securely attached children process attachment- related neutral and emotional information in a more open manner compared to insecurely attached children. Sixty-two children (59.7% girls, 8-12 years completed two different tasks, while eye movements were recorded: task one presented an array of neutral faces including mother and unfamiliar women and task two presented the same with happy and angry faces. Results indicated that more securely attached children looked longer at mother's face regardless of the emotional expression. Also, they tend to have more maintained attention to mother's neutral face. Furthermore, more attachment avoidance was related to a reduced total viewing time of mother's neutral, happy, and angry face. Attachment anxiety was not consistently related to the processing of mother's face. Findings support the theoretical assumption that securely attached children have an open manner of processing all attachment-related information.

  11. Variations in Early Attachment Mechanisms Contribute to Attachment Quality: Case Studies Including Babies Born Preterm

    Science.gov (United States)

    Witting, Andrea; Ruiz, Nina; Ahnert, Lieselotte

    2016-01-01

    Three boys (an extremely preterm, a moderate preterm twin and a full-term toddler; all 12 to 15 months old) were selected from a large sample to investigate mechanisms of parent-child attachments, specifically of babies born preterm. Attachments were observed at home with the Attachment-Q-Sort (AQS) as well as in the lab with the Strange Situation…

  12. Adult Attachment, Culturally Adjusted Attachment, and Interpersonal Difficulties of Taiwanese Adults

    Science.gov (United States)

    Wang, Chia-Chih DC; Scalise, Dominick A.

    2010-01-01

    This study examines the applicability of Western adult attachment perspectives to interpersonal difficulties experienced by individuals with indigenous Chinese cultural backgrounds. A total of 275 Taiwanese university students completed self-report surveys of adult attachment, ideal attachment, and interpersonal problems. Culturally adjusted…

  13. Attachment and eating disorders: a research update.

    Science.gov (United States)

    Tasca, Giorgio A

    2018-03-16

    Prominent models of eating disorders tend to focus on cognitive and behavioral features, but tend not to consider important developmental issues related to affect regulation, interpersonal style, self concept, and mentalization-all of which are well conceptualized within attachment theory. Higher levels of attachment insecurity across diagnoses are related to greater eating disorder symptoms. Low parental care and early trauma may lead to attachment insecurity that then might lead to greater eating disorder symptoms. The association between insecure attachment and eating disorder severity is likely mediated by affect dysregulation and perfectionism. Recent research using the Adult Attachment Interview highlights the importance of reflective functioning in predicting treatment response and therapeutic processes, and on the utility of therapies that increase mentalization. Copyright © 2018 Elsevier Ltd. All rights reserved.

  14. Breastfeeding, Parenting, and Infant Attachment Behaviors.

    Science.gov (United States)

    Gibbs, Benjamin G; Forste, Renata; Lybbert, Emily

    2018-04-01

    Objectives Infants and toddlers need secure attachments in order to develop the social competence required to successfully navigate later peer and adult relationships. Breastfeeding is a parenting factor that has been associated with child emotional development-specifically the attachment between children and their mothers. Yet, this link may simply be the result of other parenting behaviors that are associated with breastfeeding. Thus, our objective is to examine whether the link between infant attachment behaviors and breastfeeding endures when accounting for a broad array of in-depth measures of parenting. Methods We use the Early Childhood Longitudinal Study of children from 9 months to 2 years of age collected by the National Center for Education Statistics. Using Ordinary Least Squares regression, data analyses examine the association between the Toddler Attachment Sort-45 (TAS-45) measures of toddler-parent attachment (infant attachment security and temperamental dependency) and breastfeeding practices. We also examine individual items of the TAS-45 to isolate specific attachment behaviors that have the strongest associations with breastfeeding. Results We find an enduring link between children who are predominantly breastfed for six or more months and infant attachment security. However, we find no evidence that breastfeeding is linked to a child's temperamental dependency. Of the nine items used to examine infant attachment behaviors, we find that breastfed children are rated as having slightly higher scores on two measures ("warm and cuddly," "cooperative") and lower scores on one measure ("demanding/angry"). Conclusions for Practice Breastfeeding has an important link to the child's use of their caregiver as a secure base for exploration and a place of comfort when distressed (infant attachment security). Yet, breastfeeding does not appear to reduce a child's temperamental dependency or level of clinginess as measured by how demanding, fussy or

  15. Inactivated Recombinant Rabies Viruses Displaying Canine Distemper Virus Glycoproteins Induce Protective Immunity against Both Pathogens.

    Science.gov (United States)

    da Fontoura Budaszewski, Renata; Hudacek, Andrew; Sawatsky, Bevan; Krämer, Beate; Yin, Xiangping; Schnell, Matthias J; von Messling, Veronika

    2017-04-15

    The development of multivalent vaccines is an attractive methodology for the simultaneous prevention of several infectious diseases in vulnerable populations. Both canine distemper virus (CDV) and rabies virus (RABV) cause lethal disease in wild and domestic carnivores. While RABV vaccines are inactivated, the live-attenuated CDV vaccines retain residual virulence for highly susceptible wildlife species. In this study, we developed recombinant bivalent vaccine candidates based on recombinant vaccine strain rabies virus particles, which concurrently display the protective CDV and RABV glycoprotein antigens. The recombinant viruses replicated to near-wild-type titers, and the heterologous glycoproteins were efficiently expressed and incorporated in the viral particles. Immunization of ferrets with beta-propiolactone-inactivated recombinant virus particles elicited protective RABV antibody titers, and animals immunized with a combination of CDV attachment protein- and fusion protein-expressing recombinant viruses were protected from lethal CDV challenge. However, animals that were immunized with only a RABV expressing the attachment protein of CDV vaccine strain Onderstepoort succumbed to infection with a more recent wild-type strain, indicating that immune responses to the more conserved fusion protein contribute to protection against heterologous CDV strains. IMPORTANCE Rabies virus and canine distemper virus (CDV) cause high mortality rates and death in many carnivores. While rabies vaccines are inactivated and thus have an excellent safety profile and high stability, live-attenuated CDV vaccines can retain residual virulence in highly susceptible species. Here we generated recombinant inactivated rabies viruses that carry one of the CDV glycoproteins on their surface. Ferrets immunized twice with a mix of recombinant rabies viruses carrying the CDV fusion and attachment glycoproteins were protected from lethal CDV challenge, whereas all animals that received

  16. Use of PRD1 bacteriophage in groundwater viral transport, inactivation, and attachment studies

    Science.gov (United States)

    Harvey, Ronald W.; Ryan, Joseph N.

    2004-01-01

    PRD1, an icosahedra-shaped, 62 nm (diameter), double-stranded DNA bacteriophage with an internal membrane, has emerged as an important model virus for studying the manner in which microorganisms are transported through a variety of groundwater environments. The popularity of this phage for use in transport studies involving geologic media is due, in part, to its relative stability over a range of temperatures and low degree of attachment in aquifer sediments. Laboratory and field investigations employing PRD1 are leading to a better understanding of viral attachment and transport behaviors in saturated geologic media and to improved methods for describing mathematically subsurface microbial transport at environmentally significant field scales. Radioisotopic labeling of PRD1 is facilitating additional information about the nature of viral interactions with solid surfaces in geologic media, the importance of iron oxide surfaces, and allowing differentiation between inactivation and attachment in field-scale tracer tests.

  17. Modeling dense-colloid and virus cotransport in three-dimensional porous media.

    Science.gov (United States)

    Katzourakis, Vasileios E; Chrysikopoulos, Constantinos V

    2015-10-01

    A three-dimensional numerical model was developed to investigate the simultaneous transport (cotransport) of dense colloids and viruses in homogeneous, water saturated, porous media with horizontal uniform flow. The dense colloids are assumed to exist in two different phases: suspended in the aqueous phase, and attached reversibly and/or irreversibly onto the solid matrix. The viruses are assumed to exist in four different phases: suspended in aqueous phase, attached onto the solid matrix, attached onto suspended colloids, and attached onto colloids already attached onto the solid matrix. The viruses in each of the four phases are assumed to undergo inactivation with different rates. Moreover, the suspended dense colloids as well as viruses attached onto suspended dense colloids are assumed to exhibit a "restricted" settling velocity as a consequence of the gravitational force; whereas, viruses due to their small sizes and densities are assumed to have negligible "restricted" settling velocity. The governing differential equations were solved numerically with the finite difference schemes, implicitly or explicitly implemented. Model simulations have shown that the presence of dense colloid particles can either enhance or hinder the horizontal transport of viruses, but also can increase the vertical migration of viruses. Copyright © 2015 Elsevier B.V. All rights reserved.

  18. The attachment system in fledgling relationships: an activating role for attachment anxiety.

    Science.gov (United States)

    Eastwick, Paul W; Finkel, Eli J

    2008-09-01

    Is it sensible to study attachment dynamics between potential romantic partners before they share a full-fledged attachment bond? The present data indicate that such an approach may reveal novel insights about initial attraction processes. Four studies suggest that the state-like experience of attachment anxiety has functional implications within fledgling (i.e., desired or undeveloped) romantic relationships, well before the formation of an attachment bond. Studies 1 and 3 reveal that attachment anxiety directed toward a particular romantic interest is elevated before (in comparison with after) participants report being in an established relationship. Studies 2 and 3 demonstrate that such partner-specific attachment anxiety predicts attachment-relevant outcomes in fledgling relationships, including proximity seeking, safe haven, secure base, passionate love, and other approach behaviors. These associations were reliable above and beyond (and were typically as strong as or stronger than) the effect of sexual desire. Finally, Study 4 presents evidence that partner-specific attachment anxiety may cause several of these attachment-relevant outcomes. Attachment anxiety seems to be a normative experience and may signal the activation of the attachment system during the earliest stages of romantic relationships.

  19. The Adult Attachment Interview and self-reports of attachment style: an empirical rapprochement.

    Science.gov (United States)

    Roisman, Glenn I; Holland, Ashley; Fortuna, Keren; Fraley, R Chris; Clausell, Eric; Clarke, Alexis

    2007-04-01

    Although 10 studies have been published on the empirical overlap of the Adult Attachment Interview (AAI) and measures of self-reported attachment style, results in this literature have been inconsistently interpreted in narrative reviews. This report was designed as a rapprochement of the AAI and attachment style literatures and includes 3 studies. Study 1 (combined N = 961) is a meta-analytic review showing that by J. Cohen's (1992) criteria (mean r = .09), the association between AAI security and attachment style dimensions is trivial to small. Study 2 (N = 160) confirms meta-analytic results with state-of-the-art assessments of attachment security and also examines attachment dimensions in relation to the Big 5 personality traits. Finally, Study 3 is an investigation of 50 engaged couples that shows that developmental and social psychological measures of attachment security predict somewhat distinct--though theoretically anticipated--aspects of functioning in adult relationships.

  20. Environmental and genetic influences on early attachment

    Directory of Open Access Journals (Sweden)

    Gervai Judit

    2009-09-01

    Full Text Available Abstract Attachment theory predicts and subsequent empirical research has amply demonstrated that individual variations in patterns of early attachment behaviour are primarily influenced by differences in sensitive responsiveness of caregivers. However, meta-analyses have shown that parenting behaviour accounts for about one third of the variance in attachment security or disorganisation. The exclusively environmental explanation has been challenged by results demonstrating some, albeit inconclusive, evidence of the effect of infant temperament. In this paper, after reviewing briefly the well-demonstrated familial and wider environmental influences, the evidence is reviewed for genetic and gene-environment interaction effects on developing early attachment relationships. Studies investigating the interaction of genes of monoamine neurotransmission with parenting environment in the course of early relationship development suggest that children's differential susceptibility to the rearing environment depends partly on genetic differences. In addition to the overview of environmental and genetic contributions to infant attachment, and especially to disorganised attachment relevant to mental health issues, the few existing studies of gene-attachment interaction effects on development of childhood behavioural problems are also reviewed. A short account of the most important methodological problems to be overcome in molecular genetic studies of psychological and psychiatric phenotypes is also given. Finally, animal research focusing on brain-structural aspects related to early care and the new, conceptually important direction of studying environmental programming of early development through epigenetic modification of gene functioning is examined in brief.

  1. Mutations in the Transmembrane Domain and Cytoplasmic Tail of Hendra Virus Fusion Protein Disrupt Virus-Like-Particle Assembly.

    Science.gov (United States)

    Cifuentes-Muñoz, Nicolás; Sun, Weina; Ray, Greeshma; Schmitt, Phuong Tieu; Webb, Stacy; Gibson, Kathleen; Dutch, Rebecca Ellis; Schmitt, Anthony P

    2017-07-15

    Hendra virus (HeV) is a zoonotic paramyxovirus that causes deadly illness in horses and humans. An intriguing feature of HeV is the utilization of endosomal protease for activation of the viral fusion protein (F). Here we investigated how endosomal F trafficking affects HeV assembly. We found that the HeV matrix (M) and F proteins each induced particle release when they were expressed alone but that their coexpression led to coordinated assembly of virus-like particles (VLPs) that were morphologically and physically distinct from M-only or F-only VLPs. Mutations to the F protein transmembrane domain or cytoplasmic tail that disrupted endocytic trafficking led to failure of F to function with M for VLP assembly. Wild-type F functioned normally for VLP assembly even when its cleavage was prevented with a cathepsin inhibitor, indicating that it is endocytic F trafficking that is important for VLP assembly, not proteolytic F cleavage. Under specific conditions of reduced M expression, we found that M could no longer induce significant VLP release but retained the ability to be incorporated as a passenger into F-driven VLPs, provided that the F protein was competent for endocytic trafficking. The F and M proteins were both found to traffic through Rab11-positive recycling endosomes (REs), suggesting a model in which F and M trafficking pathways converge at REs, enabling these proteins to preassemble before arriving at plasma membrane budding sites. IMPORTANCE Hendra virus and Nipah virus are zoonotic paramyxoviruses that cause lethal infections in humans. Unlike that for most paramyxoviruses, activation of the henipavirus fusion protein occurs in recycling endosomal compartments. In this study, we demonstrate that the unique endocytic trafficking pathway of Hendra virus F protein is required for proper viral assembly and particle release. These results advance our basic understanding of the henipavirus assembly process and provide a novel model for the interplay between

  2. New world bats harbor diverse influenza A viruses.

    Directory of Open Access Journals (Sweden)

    Suxiang Tong

    Full Text Available Aquatic birds harbor diverse influenza A viruses and are a major viral reservoir in nature. The recent discovery of influenza viruses of a new H17N10 subtype in Central American fruit bats suggests that other New World species may similarly carry divergent influenza viruses. Using consensus degenerate RT-PCR, we identified a novel influenza A virus, designated as H18N11, in a flat-faced fruit bat (Artibeus planirostris from Peru. Serologic studies with the recombinant H18 protein indicated that several Peruvian bat species were infected by this virus. Phylogenetic analyses demonstrate that, in some gene segments, New World bats harbor more influenza virus genetic diversity than all other mammalian and avian species combined, indicative of a long-standing host-virus association. Structural and functional analyses of the hemagglutinin and neuraminidase indicate that sialic acid is not a ligand for virus attachment nor a substrate for release, suggesting a unique mode of influenza A virus attachment and activation of membrane fusion for entry into host cells. Taken together, these findings indicate that bats constitute a potentially important and likely ancient reservoir for a diverse pool of influenza viruses.

  3. Slides with no attached paper

    International Nuclear Information System (INIS)

    Warin, Dominique; Wallenius, Janne; Ouzounian, Gerald; Wikberg, Peter; Todd, Terry A.; Kormilitsyn, Mikhael V.; Osipenko, Alexander G.; Mayorshin, A.A.; McLachlan, Fiona; Nash, Ken L.; Nilsson, M.; Grimes, T.; Braley, J.C.; TAKESHITA, Kenji; Babain, Vasiliy A.; Spendlikova, I.; Distler, P.; John, J.; Sebesta, F.; VU, Trong-Hung; SIMONIN, Jean-Pierre; PAULENOVA, Alena; PRECEK, Martin; HARTIG, Kyle; KNAPP, Nathan; Vidick, Geoffrey; Bouslimani, Nouri; Desreux, Jean F.; Lewis, F.W.; Hudson, M.J.; Harwood, L.M.; Nunez, Ana; Nagarajan, K.; Vasudeva Rao, P.R.; Raj, Baldev; Ignatiev, Victor; Surenkov, Alexander; Pouchon, Manuel A.; Skarnemark, Gunnar; Allard, Stefan; Ekberg, Christian; Retegan, Teodora; Nordlund, Anders; John, Jan; Maershin, Alexander; Zakirov, R.; Panov, A.; Toropov, Andrey

    2010-01-01

    This document brings together the different presentations (slides) given at the workshop but with no attached paper. These slides refer to the following presentations: - Presentation of ITN (Instituto Tecnologico e Nuclear); - Minor Actinide Partitioning (Dominique Warin); - Transmutation (Janne Wallenius); - Radioactive Waste Management, IGD-TP (Gerald Ouzounian); - Present status of the Swedish nuclear waste management programme (Peter Wikberg); - The U.S. Fuel Cycle Research and Development Program - Separations Research and Development (Terry Todd); - Strategies and national programs of closed fuel cycles - Russian Expert Vision (Mikhael Kormilitsyn) - Extraction Studies Of Potential Solvent Formulations For The GANEX Process (Fiona MacLachlan); - Investigations of The Fundamental Chemistry of the TALSPEAK Process (Ken Nash); - Extraction Separation of Trivalent Minor Actinides and Lanthanides by Hexa-dentate Nitrogen-donor Extractant, TPEN, and its Analogs (Kenji Takeshita); - Fluorinated Diluents for HLW Processing - technological point of view (Vasiliy Babain); - Extraction properties of some new pyridine molecules and search for better diluents (Irena Spendlikova); - Kinetics of extraction of Eu 3+ ion by TODGA and CyMe 4 -BTBP studied using the RMC technique (Trong Hung Vu); - Redox Chemistry of Neptunium in Solutions of Nitric Acid (Alena Paulenova); - NMR applied to actinide ions and their complexes. In search of covalency effects (Geoffrey Vidick); - Towards 'Stability Rules' for Radiolysis of bis-DGA compounds (Ana Nunez); - Pyroprocess Research Activities at IGCAR, Kalpakkam, India (K. Nagarajan); - Critical issues of nuclear energy systems employing molten salt fluorides: from ISTC No. 1606 to No. 3749 (1. year of project activity) and MARS/EVOL cooperation (Victor Ignatiev); - Conversion processes: Internal Gelation and the Sphere-pac concept (Manuel Pouchon); - A Combined Nuclear Technology and Nuclear Chemistry Master. A Unique

  4. CHLORELLA VIRUSES

    Science.gov (United States)

    Yamada, Takashi; Onimatsu, Hideki; Van Etten, James L.

    2007-01-01

    Chlorella viruses or chloroviruses are large, icosahedral, plaque‐forming, double‐stranded‐DNA—containing viruses that replicate in certain strains of the unicellular green alga Chlorella. DNA sequence analysis of the 330‐kbp genome of Paramecium bursaria chlorella virus 1 (PBCV‐1), the prototype of this virus family (Phycodnaviridae), predict ∼366 protein‐encoding genes and 11 tRNA genes. The predicted gene products of ∼50% of these genes resemble proteins of known function, including many that are completely unexpected for a virus. In addition, the chlorella viruses have several features and encode many gene products that distinguish them from most viruses. These products include: (1) multiple DNA methyltransferases and DNA site‐specific endonucleases, (2) the enzymes required to glycosylate their proteins and synthesize polysaccharides such as hyaluronan and chitin, (3) a virus‐encoded K+ channel (called Kcv) located in the internal membrane of the virions, (4) a SET domain containing protein (referred to as vSET) that dimethylates Lys27 in histone 3, and (5) PBCV‐1 has three types of introns; a self‐splicing intron, a spliceosomal processed intron, and a small tRNA intron. Accumulating evidence indicates that the chlorella viruses have a very long evolutionary history. This review mainly deals with research on the virion structure, genome rearrangements, gene expression, cell wall degradation, polysaccharide synthesis, and evolution of PBCV‐1 as well as other related viruses. PMID:16877063

  5. Mycoplasma genitalium attaches to human spermatozoa

    DEFF Research Database (Denmark)

    Svenstrup, Helle Friis; Fedder, Jens; Abraham-Peskir, Joanna

    2003-01-01

    , M.genitalium was seen at the head but not at the tail. By X-ray microscopy, it was possible to observe the diffentiated structure of M.genitalium, and the attachment seemed to be mediated by the tip. CONCLUSIONS: Mycoplasma genitalium can bind to human spermatozoa and thus could be carried by motile...... to adhere to the head, midpiece and tail of the spermatozoa. The spermatozoa became immotile when many M.genitalium were attached. However, the motile spermatozoa were demonstrated to carry M.genitalium and in this case the mycoplasmas were seen to attach mostly to the midpiece or neck region. Occasionally...

  6. Clinical evaluation of mandibular implant overdentures via Locator implant attachment and Locator bar attachment.

    Science.gov (United States)

    Seo, Yong-Ho; Bae, Eun-Bin; Kim, Jung-Woo; Lee, So-Hyoun; Yun, Mi-Jung; Jeong, Chang-Mo; Jeon, Young-Chan; Huh, Jung-Bo

    2016-08-01

    The aim of this study was to evaluate the clinical findings and patient satisfaction on implant overdenture designed with Locator implant attachment or Locator bar attachment in mandibular edentulous patients. Implant survival rate, marginal bone loss, probing depth, peri-implant inflammation, bleeding, plaque, calculus, complications, and satisfaction were evaluated on sixteen patients who were treated with mandibular overdenture and have used it for at least 1 year (Locator implant attachment: n=8, Locator bar attachment: n=8). Marginal bone loss, probing depth, plaque index of the Locator bar attachment group were significantly lower than the Locator implant attachment group (Pimplant inflammation, and patient satisfaction between the two denture types (P>.05). The replacement of the attachment components was the most common complication in both groups. Although there was no correlation between marginal bone loss and plaque index, a significant correlation was found between marginal bone loss and probing depth. The Locator bar attachment group indicates lesser marginal bone loss and need for maintenance, as compared with the Locator implant attachment group. This may be due to the splinting effect among implants rather than the types of Locator attachment.

  7. [The interpretation of attachment in the Szondi test and in the questionnaire processes of attachment theory].

    Science.gov (United States)

    Török I, András; Vincze, Gábor

    2011-01-01

    [corrected] The Szondi-test is widely applied in clinical diagnostics in Hungary too, and the evidence resulting from the theory is that we can get information about attachment during its interpreting. Its validity is proven by empirical research and clinical experiences. By analyzing the modern attachment theory more thoroughly, it becomes clear in what ways the Szondi-test constellations regarding attachment are different from the classificationbased on questionnaires, allowing the discrete measurement of the attachment style. With the Szondi-test the classification to attachment style is more insecure, but if it is completed with exploration, it is more informative in vector C (vector of relation, attachment information), while short questionnaires make the classification to attachment style possible. In our empirical analysis we represent the integration of the above mentioned clinical and theoretical experiences. In the present analysis we compare the vector C and S constellation of the two-profile Szondi-test of 80 persons with the dimensions of ECR-R questionnaire and with Collins and Read's questionnaire classification regarding attachment style. The statistical results refer to the fact that there is a legitimacy to compare questionnaire processes allowing the discrete classification of attachment and the Szondi-test's information content regarding attachment. With applying the methods together, we get a unique, complementary section of the information relating to attachment. Comparing the two methods (projective and questionnaire) establishes the need of theoretical integration as well. We also make an attempt to explain Fraley's evolutionary non-adaptivity of avoidant attachment, in the case of whose presence adaptivity of early attachment, counterbalancing the exploration and security need, and providing closeness--farness loses its balance.

  8. Preferential attachment in evolutionary earthquake networks

    Science.gov (United States)

    Rezaei, Soghra; Moghaddasi, Hanieh; Darooneh, Amir Hossein

    2018-04-01

    Earthquakes as spatio-temporal complex systems have been recently studied using complex network theory. Seismic networks are dynamical networks due to addition of new seismic events over time leading to establishing new nodes and links to the network. Here we have constructed Iran and Italy seismic networks based on Hybrid Model and testified the preferential attachment hypothesis for the connection of new nodes which states that it is more probable for newly added nodes to join the highly connected nodes comparing to the less connected ones. We showed that the preferential attachment is present in the case of earthquakes network and the attachment rate has a linear relationship with node degree. We have also found the seismic passive points, the most probable points to be influenced by other seismic places, using their preferential attachment values.

  9. Topological systems versus attachment relations | Guido ...

    African Journals Online (AJOL)

    ... localification procedure introduced by S. Vickers for topological systems. Keywords: Adjoint functor, algebra, attachment relation, embedding functor, localification of topological systems, spatialization of topological systems, topological system, topological theory, variety of algebras. Quaestiones Mathematicae 37(2014), ...

  10. Mobile electrons in electron-attaching liquids

    International Nuclear Information System (INIS)

    Nyikos, L.

    1981-01-01

    Based on recent observations of mobile electrons in electron-attaching liquids some ideas are presented concerning the nature of the fas carrier. To explain the observed phenomena quantum chemical calculations and modified percolation theory are applied. (author)

  11. Adolescent attachment, family functioning and depressive symptoms ...

    African Journals Online (AJOL)

    Background. Adolescence represents a challenging transitional period where changes in biological, emotional, cognitive and social domains can increase the risk of developing internalised problems including subthreshold depression. Adolescent-parent attachment style, perceived support and family functioning may ...

  12. God as an Attachment Figure : A Case Study of the God Attachment Language and God Concepts of Anxiously Attached Christian Youths in South Africa

    NARCIS (Netherlands)

    Counted, Victor

    2016-01-01

    This study examines the role of the Christian God as an attachment figure, using the attachment language criteria of a strong and enduring affectionate bond. Respondents were 15 anxiously attached Christian youths, purposefully selected for in-depth interviews to explore their God attachment

  13. Adult Attachment Style, Hardiness, and Mood

    Science.gov (United States)

    2014-04-01

    Maddi, S. R. (2004). Hardiness: An operationalization of existential cour- age. Journal of Humanistic Psychology , 44, 279–298. doi: 10.1177...but not challenge, predict positive mood. These results suggest that more secure attachment style and psychological hardiness serve as resilience...S. (1978). Pat- terns of attachment: A psychological study of the strange situation. Hill- sdale, NJ: Erlbaum. Ainsworth, M. D. S., & Wittig, B. A

  14. SARS virus

    Indian Academy of Sciences (India)

    First page Back Continue Last page Overview Graphics. SARS virus. Novel corona virus emerges in the new millenia. Genome sequences invariant- global isolates do not show differences of consequence.Protein spike similar. HE gene absent. 2787 nucleotides. Largest genome. Jumps species by genetic deletion.

  15. CHANDIPURA VIRUS

    Indian Academy of Sciences (India)

    First page Back Continue Last page Overview Graphics. CHANDIPURA VIRUS. First isolated from a village called Chandipura near Nagpur in 1965 in India. Belongs to rhabdoviridae family. Used as a Model System to study RNA virus multiplication in the infected cell at molecular level. Notes:

  16. Schmallenberg Virus

    Indian Academy of Sciences (India)

    IAS Admin

    challenged with emerging and re-emerging infections that pose a constant threat to human and animal health. Indeed, researchers around the globe are still fighting deadly diseases like malaria, trypanosomosis and AIDS. In this article, we focus on a recently identified virus, namely, Schmallenberg virus as an example of a.

  17. Phytophthora viruses.

    Science.gov (United States)

    Cai, Guohong; Hillman, Bradley I

    2013-01-01

    Phytophthora sp. is a genus in the oomycetes, which are similar to filamentous fungi in morphology and habitat, but phylogenetically more closely related to brown algae and diatoms and fall in the kingdom Stramenopila. In the past few years, several viruses have been characterized in Phytophthora species, including four viruses from Phytophthora infestans, the late blight pathogen, and an endornavirus from an unnamed Phytophthora species from Douglas fir. Studies on Phytophthora viruses have revealed several interesting systems. Phytophthora infestans RNA virus 1 (PiRV-1) and PiRV-2 are likely the first members of two new virus families; studies on PiRV-3 support the establishment of a new virus genus that is not affiliated with established virus families; PiRV-4 is a member of Narnaviridae, most likely in the genus Narnavirus; and Phytophthora endornavirus 1 (PEV1) was the first nonplant endornavirus at the time of reporting. Viral capsids have not been found in any of the above-mentioned viruses. PiRV-1 demonstrated a unique genome organization that requires further examination, and PiRV-2 may have played a role in late blight resurgence in 1980s-1990s. Copyright © 2013 Elsevier Inc. All rights reserved.

  18. Attachment of Adolescents to Parents: Turkey Profile

    Directory of Open Access Journals (Sweden)

    Turkan Dogan

    2016-12-01

    Full Text Available The present study aims to determine the attachment of adolescents to their parents according to geographical regions in Turkey and gender. The research group consisted of 6061 adolescents. With an age average of 15.53 years. The Inventory of Attachment to Parents and Friends- Brief Form (EABE was used as data acquisition tool. The results of the study indicated significant difference between the scores of students regarding the inventory of attachment to parents according to regions. Evaluating the findings regarding attachment to father and mother together, the findings were similar, and the attachment levels of adolescents in Middle Anatolia, Eastern Anatolia and Black Sea Region were found to be higher than the ones in other regions. This result may be related with socioeconomic, geographical and cultural structures of the regions. Examining the finding according to gender variable, the scores of male students are significantly lower than the scores of female students. As a result according to the data gained from a wide sample group; the main factors for the attachment of adolescents to their parents in Turkey are the geographical regions in Turkey and the gender. [Psikiyatride Guncel Yaklasimlar - Current Approaches in Psychiatry 2016; 8(4.000: 406-419

  19. Personality and Attachment in Transsexual Adults.

    Science.gov (United States)

    Lingiardi, Vittorio; Giovanardi, Guido; Fortunato, Alexandro; Nassisi, Valentina; Speranza, Anna Maria

    2017-07-01

    The main aim of this study was to investigate the associations between personality features and attachment patterns in transsexual adults. We explored mental representations of attachment, assessed personality traits, and possible personality disorders. Forty-four individuals diagnosed with gender identity disorder (now gender dysphoria), 28 male-to-female and 16 female-to-male, were evaluated using the Shedler-Westen assessment procedure-200 (SWAP-200) to assess personality traits and disorders; the adult attachment interview was used to evaluate their attachment state-of-mind. With respect to attachment, our sample differed both from normative samples because of the high percentage of disorganized states of mind (50% of the sample), and from clinical samples for the conspicuous percentage of secure states of mind (37%). Furthermore, we found that only 16% of our sample presented a personality disorder, while 50% showed a high level of functioning according to the SWAP-200 scales. In order to find latent subgroups that shared personality characteristics, we performed a Q-factor analysis. Three personality clusters then emerged: Healthy Functioning (54% of the sample); Depressive/Introverted (32%) and Histrionic/Extroverted (14%). These data indicate that in terms of personality and attachment, GD individuals are a heterogeneous sample and show articulate and diverse types with regard to these constructs.

  20. Attachment of gaseous fission products to aerosols

    International Nuclear Information System (INIS)

    Skyrme, G.

    1985-01-01

    Accidents may occur in which the integrity of fuel cladding is breached and volatile fission products are released to the containment atmosphere. In order to assess the magnitude of the subsequent radiological hazard it is necessary to know the transport behaviour of such fission products. It is frequently assumed that the fission products remain in the gaseous phase. There is a possibility, however, that they may attach themselves to particles and hence substantially modify their transport properties. This paper provides a theoretical assessment of the conditions under which gaseous fission products may be attached to aerosol particles. Specific topics discussed are: the mass transfer of a gaseous fission product to an isolated aerosol particle in an infinite medium; the rate at which the concentration of fission products in the gas phase diminishes within a container as a result of deposition on a population of particles; and the distribution of deposited fission product between different particle sizes in a log-normal distribution. It is shown that, for a given mass, small particles are more efficient for fission product attachment, and that only small concentrations of such particles may be necessary to achieve rapid attachment. Conditions under which gaseous fission products are not attached to particles are also considered, viz, the competing processes of deposition onto the containment walls and onto aerosol particles, and the possibility of the removal of aerosols from the containment by various deposition processes, or agglomeration, before attachment takes place. (author)

  1. The relationship between attachment and cognitive development

    Directory of Open Access Journals (Sweden)

    Tošić Milica

    2013-01-01

    Full Text Available Emotional and cognitive development of personality have mostly been explored independently in the history of psychology. However, in the last decades, there have been more and more frequent arguments in favour of the idea that the emotional relationship between the mother and the child in early childhood, through forming a secure or insecure attachment style, is to a certain extent linked to the cognitive development. For example, securely attached children, compared to the insecurely attached, have more frequent and longer episodes of symbolic play and are more advanced in the domain of language in early childhood. Securely attached children are also more efficient and persistent in solving problems. Before starting school, securely attached children understand better the feelings and beliefs of others, as well as the fact that these determine people’s behaviour, thus having an opportunity to understand and predict this behaviour better. In this paper, we will attempt to point out some of the mechanisms that are assumed to be mediators between the emotional and cognitive development. Namely, since it enables a more independent exploration of the surroundings, more quality social relations among children, higher self-esteem, better focus and more developed communicative skills, secure attachment might potentially be linked to the cognitive development. [Projekat Ministarstva nauke Republike Srbije, br. 179002

  2. Attachment and hikikomori: a psychosocial developmental model.

    Science.gov (United States)

    Krieg, Alexander; Dickie, Jane R

    2013-02-01

    Hikikomori (acute social withdrawal) is a social issue in Japan that affects both the society and the lives of the individual sufferers. This study aims to connect attachment theory and hikikomori by using a culturally sensitive psychosocial developmental model that outlines the various stages of attachment throughout the developmental years. Twenty-four hikikomori sufferers and 60 comparison group participants were given questionnaires assessing parent and peer relationships, temperament and school experiences. We found the hikikomori participants had a higher incidence of ambivalent attachment, reported more parental and peer rejection and bullying, and expressed greater temperamental shyness. Path analysis supported our developmental model. We found that shy temperament and parental rejection predicted ambivalent attachment, which when coupled with peer rejection predicted hikikomori. Our model implies that treatment and prevention may require attention to attachment insecurities in early childhood, peer rejection in middle childhood and/or early adolescence. We believe it is helpful in understanding hikikomori to first understand how the attachment system balances security with exploration and the anxiety associated with novelty and challenge. Finally, we examine implications of the model for intervention, treatment and future research.

  3. Wait Up!: Attachment and Sovereign Power

    Science.gov (United States)

    Duschinsky, Robbie; Greco, Monica; Solomon, Judith

    2017-01-01

    Sociologists and feminist scholars have, over many decades, characterised attachment as a social construction that functions to support political and gender conservatism. We accept that attachment theory has seen use to these ends and consider recent deployments of attachment theory as justification for a minimal State within conservative political discourse in the UK since 2009. However, we contest that attachment is reducible to its discursive construction. We consider Judith Butler’s depiction of the infant attached to an abusive caregiver as a foundation and parallel to the position of the adult citizen subjected to punitive cultural norms and political institutions. We develop and qualify Butler’s account, drawing on the insights offered by the work of Lauren Berlant. We also return to Foucault’s Psychiatric Power lectures, in which familial relations are situated as an island of sovereign power within the sea of modern disciplinary institutions. These reflections help advance analysis of three important issues: the social and political implications of attachment research; the relationship between disciplinary and sovereign power in the affective dynamic of subjection; and the political and ethical status of professional activity within the psy disciplines. PMID:28904425

  4. Electron attachment rate constant measurement by photoemission electron attachment ion mobility spectrometry (PE-EA-IMS)

    International Nuclear Information System (INIS)

    Su, Desheng; Niu, Wenqi; Liu, Sheng; Shen, Chengyin; Huang, Chaoqun; Wang, Hongmei; Jiang, Haihe; Chu, Yannan

    2012-01-01

    Photoemission electron attachment ion mobility spectrometry (PE-EA-IMS), with a source of photoelectrons induced by vacuum ultraviolet radiation on a metal surface, has been developed to study electron attachment reaction at atmospheric pressure using nitrogen as the buffer gas. Based on the negative ion mobility spectra, the rate constants for electron attachment to tetrachloromethane and chloroform were measured at ambient temperature as a function of the average electron energy in the range from 0.29 to 0.96 eV. The experimental results are in good agreement with the data reported in the literature. - Highlights: ► Photoemission electron attachment ion mobility spectrometry (PE-EA-IMS) was developed to study electron attachment reaction. ► The rate constants of electron attachment to CCl 4 and CHCl 3 were determined. ► The present experimental results are in good agreement with the previously reported data.

  5. God as the ultimate attachment figure for older adults.

    Science.gov (United States)

    Cicirelli, Victor G

    2004-12-01

    Attachment to God among older adults is an area of research that has been neglected thus far. The existence of such an attachment was explored in a study of 109 elders aged 70-97. A modest proportion of elders displayed a strong attachment to God, assessed by coding interview data for indicators of attachment. Strength of attachment to God was related (p God than those with other affiliations. Findings are interpreted in relation to existing literature on attachment to God.

  6. Tissue interactions of avian viral attachment proteins

    NARCIS (Netherlands)

    Ambepitiya Wickramasinghe, I.N.

    2015-01-01

    Viruses can infect a wide range of hosts; varying from bacteria and plants to animals and humans. While many viral infections may pass unnoticed, some are of major importance due to their implications on health and welfare of plants, animals and/or humans. In particular, viruses that can infect

  7. An experimental evaluation of the State Adult Attachment Measure: the influence of attachment primes on the content of state attachment representations

    OpenAIRE

    Bosmans, Guy; Bowles, David P.; Dewitte, Marieke; De Winter, Simon; Braet, Caroline

    2014-01-01

    Attachment theory predicts cross-contextual stability of attachment representations, but research findings are rather mixed. Recently, it has been suggested that these mixed findings reflect the existence of both state and trait attachment components. The development of the State Adult Attachment Measure (SAAM) has enabled an investigation of this hypothesis. The current study aimed to evaluate the extent to which the SAAM is a useful instrument for studying such state attachment hypotheses. ...

  8. 'Adoption and attachment theory' the attachment models of adoptive mothers and the revision of attachment patterns of their late-adopted children.

    Science.gov (United States)

    Pace, C S; Zavattini, G C

    2011-01-01

    This study examined the attachment patterns of late-adopted children (aged 4-7) and their adoptive mothers during the first 7- to 8-month period after adoption and aimed to evaluate the effect of adoptive mothers' attachment security on the revision of the attachment patterns of their late-adopted children. We assessed attachment patterns in 20 adoptive dyads and 12 genetically related dyads at two different times: T1 (time 1) within 2 months of adoption and T2 (time 2) 6 months after T1. The children's behavioural attachment patterns were assessed using the Separation-Reunion Procedure and the children's representational (verbal) attachment patterns using the Manchester Child Attachment Story Task. The attachment models of the adoptive mothers were classified using the Adult Attachment Interview. We found that there was a significant enhancement of the late-adopted children's attachment security across the time period considered (P= 0.008). Moreover, all the late-adopted children who showed a change from insecurity to security had adoptive mothers with secure attachment models (P= 0.044). However, the matching between maternal attachment models and late-adopted children's attachment patterns (behaviours and representations) was not significant. Our data suggest that revision of the attachment patterns in the late-adopted children is possible but gradual, and that the adoptive mothers' attachment security makes it more likely to occur. © 2010 Blackwell Publishing Ltd.

  9. Childhood Attachment to Pets: Associations between Pet Attachment, Attitudes to Animals, Compassion, and Humane Behaviour.

    Science.gov (United States)

    Hawkins, Roxanne D; Williams, Joanne M; Scottish Society For The Prevention Of Cruelty To Animals Scottish Spca

    2017-05-06

    Attachment to pets has an important role in children's social, emotional, and cognitive development, mental health, well-being, and quality of life. This study examined associations between childhood attachment to pets and caring and friendship behaviour, compassion, and attitudes towards animals. This study also examined socio-demographic differences, particularly pet ownership and pet type. A self-report survey of over one thousand 7 to 12 year-olds in Scotland, UK, revealed that the majority of children are strongly attached to their pets, but attachment scores differ depending on pet type and child gender. Analysis revealed that attachment to pets is facilitated by compassion and caring and pet-directed friendship behaviours and that attachment to pets significantly predicts positive attitudes towards animals. The findings have implications for the promotion of prosocial and humane behaviour. Encouraging children to participate in pet care behaviour may promote attachment between children and their pet, which in turn may have a range of positive outcomes for both children (such as reduced aggression, better well-being, and quality of life) and pets (such as humane treatment). This study enhances our understanding of childhood pet attachment and has implications for humane education and promoting secure emotional attachments in childhood.

  10. Childhood Attachment to Pets: Associations between Pet Attachment, Attitudes to Animals, Compassion, and Humane Behaviour

    Directory of Open Access Journals (Sweden)

    Roxanne D. Hawkins

    2017-05-01

    Full Text Available Attachment to pets has an important role in children’s social, emotional, and cognitive development, mental health, well-being, and quality of life. This study examined associations between childhood attachment to pets and caring and friendship behaviour, compassion, and attitudes towards animals. This study also examined socio-demographic differences, particularly pet ownership and pet type. A self-report survey of over one thousand 7 to 12 year-olds in Scotland, UK, revealed that the majority of children are strongly attached to their pets, but attachment scores differ depending on pet type and child gender. Analysis revealed that attachment to pets is facilitated by compassion and caring and pet-directed friendship behaviours and that attachment to pets significantly predicts positive attitudes towards animals. The findings have implications for the promotion of prosocial and humane behaviour. Encouraging children to participate in pet care behaviour may promote attachment between children and their pet, which in turn may have a range of positive outcomes for both children (such as reduced aggression, better well-being, and quality of life and pets (such as humane treatment. This study enhances our understanding of childhood pet attachment and has implications for humane education and promoting secure emotional attachments in childhood.

  11. Childhood Attachment to Pets: Associations between Pet Attachment, Attitudes to Animals, Compassion, and Humane Behaviour

    Science.gov (United States)

    Hawkins, Roxanne D.; Williams, Joanne M.

    2017-01-01

    Attachment to pets has an important role in children’s social, emotional, and cognitive development, mental health, well-being, and quality of life. This study examined associations between childhood attachment to pets and caring and friendship behaviour, compassion, and attitudes towards animals. This study also examined socio-demographic differences, particularly pet ownership and pet type. A self-report survey of over one thousand 7 to 12 year-olds in Scotland, UK, revealed that the majority of children are strongly attached to their pets, but attachment scores differ depending on pet type and child gender. Analysis revealed that attachment to pets is facilitated by compassion and caring and pet-directed friendship behaviours and that attachment to pets significantly predicts positive attitudes towards animals. The findings have implications for the promotion of prosocial and humane behaviour. Encouraging children to participate in pet care behaviour may promote attachment between children and their pet, which in turn may have a range of positive outcomes for both children (such as reduced aggression, better well-being, and quality of life) and pets (such as humane treatment). This study enhances our understanding of childhood pet attachment and has implications for humane education and promoting secure emotional attachments in childhood. PMID:28481256

  12. Cross-structural priming: prepositional phrase attachment primes relative clause attachment.

    Science.gov (United States)

    Loncke, Maaike; Van Laere, Sébastien M J; Desmet, Timothy

    2011-01-01

    In this paper we show that attachment height (high vs. low attachment) of a modifier to a complex noun phrase (CNP; e.g., "the servant of the actress"), can be primed between dissimilar syntactic structures. In a sentence completion experiment, we found that the attachment height of a prepositional phrase (PP) in the prime sentence primed the attachment height of a relative clause (RC) in the target sentence. This cross-structural priming effect cannot be explained in terms of the priming of specific phrase-structure rules or even sequences of specific phrase-structure rules (Scheepers, 2003), because the attachment of a PP to a CNP is generated by a different phrase-structure rule than the attachment of an RC. However, the present data suggest that the location at which the RC is attached to the CNP is mentally represented, independent of the specific phrase-structure rule that is attached, or by extension, that the abstract hierarchical configuration of the full CNP and the attached RC is represented (Desmet & Declercq, 2006). This is the first demonstration of a cross-structural priming effect that cannot be captured by phrase-structure rules.

  13. Concordance of attachment representations in preschool siblings assessed by the attachment story completion task

    OpenAIRE

    Werner, Helene; Zahn, Salome; Titze, Karl; Walitza, Susanne; Zulauf Logoz, Marina

    2015-01-01

    Several studies have indicated only a modest concordance of attachment security in siblings in infancy. Until now, very little was known about the concordance of siblings’ attachment security beyond infancy, as assessed by the attachment story completion task. This cross-sectional study aims to examine the concordance of attachment representations of 38 first-born (4–7 years) and 38 second-born (3–5 years) siblings living in middle-class two-parent families. Personality factors and the level ...

  14. Antiviral activity of Aloe vera against herpes simplex virus type 2: An ...

    African Journals Online (AJOL)

    In this study we tested the antiviral activity of a crude hot glycerine extract of Aloe vera gel which was grown in Bushehr (Southwest of Iran) against HSV-2 replication in Vero cell line. The extract showed antiviral activity against HSV-2 not only before attachment and entry of virus to the Vero cells but also on post attachment ...

  15. Strategies of highly pathogenic RNA viruses to block dsRNA detection by RIG-I-like receptors: hide, mask, hit.

    Science.gov (United States)

    Zinzula, Luca; Tramontano, Enzo

    2013-12-01

    Double-stranded RNA (dsRNA) is synthesized during the course of infection by RNA viruses as a byproduct of replication and transcription and acts as a potent trigger of the host innate antiviral response. In the cytoplasm of the infected cell, recognition of the presence of viral dsRNA as a signature of "non-self" nucleic acid is carried out by RIG-I-like receptors (RLRs), a set of dedicated helicases whose activation leads to the production of type I interferon α/β (IFN-α/β). To overcome the innate antiviral response, RNA viruses encode suppressors of IFN-α/β induction, which block RLRs recognition of dsRNA by means of different mechanisms that can be categorized into: (i) dsRNA binding and/or shielding ("hide"), (ii) dsRNA termini processing ("mask") and (iii) direct interaction with components of the RLRs pathway ("hit"). In light of recent functional, biochemical and structural findings, we review the inhibition mechanisms of RLRs recognition of dsRNA displayed by a number of highly pathogenic RNA viruses with different disease phenotypes such as haemorrhagic fever (Ebola, Marburg, Lassa fever, Lujo, Machupo, Junin, Guanarito, Crimean-Congo, Rift Valley fever, dengue), severe respiratory disease (influenza, SARS, Hendra, Hantaan, Sin Nombre, Andes) and encephalitis (Nipah, West Nile). Copyright © 2013 Elsevier B.V. All rights reserved.

  16. Cotransport of clay colloids and viruses through water-saturated vertically oriented columns packed with glass beads: Gravity effects.

    Science.gov (United States)

    Syngouna, Vasiliki I; Chrysikopoulos, Constantinos V

    2016-03-01

    The cotransport of clay colloids and viruses in vertically oriented laboratory columns packed with glass beads was investigated. Bacteriophages MS2 and ΦX174 were used as model viruses, and kaolinite (ΚGa-1b) and montmorillonite (STx-1b) as model clay colloids. A steady flow rate of Q=1.5 mL/min was applied in both vertical up (VU) and vertical down (VD) flow directions. In the presence of KGa-1b, estimated mass recovery values for both viruses were higher for VD than VU flow direction, while in the presence of STx-1b the opposite was observed. However, for all cases examined, the produced mass of viruses attached onto suspended clay particles were higher for VD than VU flow direction, suggesting that the flow direction significantly influences virus attachment onto clays, as well as packed column retention of viruses attached onto suspended clays. KGa-1b hindered the transport of ΦX174 under VD flow, while STx-1b facilitated the transport of ΦX174 under both VU and VD flow directions. Moreover, KGa-1b and STx-1b facilitated the transport of MS2 in most of the cases examined except of the case where KGa-1b was present under VD flow. Also, the experimental data were used for the estimation of virus surface-coverages and virus surface concentrations generated by virus diffusion-limited attachment, as well as virus attachment due to sedimentation. Both sedimentation and diffusion limited virus attachment were higher for VD than VU flow, except the case of MS2 and STx-1b cotransport. The diffusion-limited attachment was higher for MS2 than ΦΧ174 for all cases examined. Copyright © 2015 Elsevier B.V. All rights reserved.

  17. Transport and fate of viruses in sediment and stormwater from a Managed Aquifer Recharge site

    Science.gov (United States)

    Sasidharan, Salini; Bradford, Scott A.; Šimůnek, Jiří; Torkzaban, Saeed; Vanderzalm, Joanne

    2017-12-01

    Enteric viruses are one of the major concerns in water reclamation and reuse at Managed Aquifer Recharge (MAR) sites. In this study, the transport and fate of bacteriophages MS2, PRD1, and ΦX174 were studied in sediment and stormwater (SW) collected from a MAR site in Parafield, Australia. Column experiments were conducted using SW, stormwater in equilibrium with the aquifer sediment (EQ-SW), and two pore-water velocities (1 and 5 m day-1) to encompass expected behavior at the MAR site. The aquifer sediment removed >92.3% of these viruses under all of the considered MAR conditions. However, much greater virus removal (4.6 logs) occurred at the lower pore-water velocity and in EQ-SW that had a higher ionic strength and Ca2+ concentration. Virus removal was greatest for MS2, followed by PRD1, and then ΦX174 for a given physicochemical condition. The vast majority of the attached viruses were irreversibly attached or inactivated on the solid phase, and injection of Milli-Q water or beef extract at pH = 10 only mobilized a small fraction of attached viruses (Virus breakthrough curves (BTCs) were successfully simulated using an advective-dispersive model that accounted for rates of attachment (katt), detachment (kdet), irreversible attachment or solid phase inactivation (μs), and blocking. Existing MAR guidelines only consider the removal of viruses via liquid phase inactivation (μl). However, our results indicated that katt > μs > kdet > μl, and katt was several orders of magnitude greater than μl. Therefore, current microbial risk assessment methods in the MAR guideline may be overly conservative in some instances. Interestingly, virus BTCs exhibited blocking behavior and the calculated solid surface area that contributed to the attachment was very small. Additional research is therefore warranted to study the potential influence of blocking on virus transport and potential implications for MAR guidelines.

  18. Attachment, intellectual disabilities and mental health: research, assessment and intervention.

    Science.gov (United States)

    Schuengel, Carlo; de Schipper, Johanna Clasien; Sterkenburg, Paula S; Kef, Sabina

    2013-01-01

    Attachment theory is highly influential in child and adult mental health research and practice. Research and practice have started now to explore the potential value of an attachment perspective for understanding and alleviating the challenges that persons with intellectual disabilities face in mental health and social participation. Research on attachment and intellectual disabilities is reviewed on its importance for knowledge, assessment and intervention. Progress was found in understanding and distinguishing attachment behaviours, attachment relationships, attachment representations, attachment styles and attachment disorders and their respective implications for assessment and intervention. Of the various attachment-related concepts, insights into attachment behaviours and relationships showed the most promise for practical applications in the field of intellectual disabilities. Findings on representations, styles and disorders were inconclusive or preliminary. Attachment-informed research and practice can be part of emerging developmental understanding of functioning with intellectual disabilities. © 2012 Blackwell Publishing Ltd.

  19. Computer viruses

    Science.gov (United States)

    Denning, Peter J.

    1988-01-01

    The worm, Trojan horse, bacterium, and virus are destructive programs that attack information stored in a computer's memory. Virus programs, which propagate by incorporating copies of themselves into other programs, are a growing menace in the late-1980s world of unprotected, networked workstations and personal computers. Limited immunity is offered by memory protection hardware, digitally authenticated object programs,and antibody programs that kill specific viruses. Additional immunity can be gained from the practice of digital hygiene, primarily the refusal to use software from untrusted sources. Full immunity requires attention in a social dimension, the accountability of programmers.

  20. The V domain of dog PVRL4 (nectin-4) mediates canine distemper virus entry and virus cell-to-cell spread.

    Science.gov (United States)

    Delpeut, Sebastien; Noyce, Ryan S; Richardson, Christopher D

    2014-04-01

    The entry of canine distemper virus (CDV) is a multistep process that involves the attachment of CDV hemagglutinin (H) to its cellular receptor, followed by fusion between virus and cell membranes. Our laboratory recently identified PVRL4 (nectin-4) to be the epithelial receptor for measles and canine distemper viruses. In this study, we demonstrate that the V domain of PVRL4 is critical for CDV entry and virus cell-to-cell spread. Furthermore, four key amino acid residues within the V domain of dog PVRL4 and two within the CDV hemagglutinin were shown to be essential for receptor-mediated virus entry. Copyright © 2014 Elsevier Inc. All rights reserved.

  1. Overview for Attached Payload Accommodations and Environments

    Science.gov (United States)

    Schaffer, Craig; Cook, Gene; Nabizadeh, Rodney; Phillion, James

    2007-01-01

    External payload accommodations are provided at attach sites on the U.S provided ELC, U.S. Truss, the Japanese Experiment Module Exposed Facility (JEM EF) and the Columbus EPF (External Payload Facilities). The Integrated Truss Segment (ITS) provides the backbone structure for the ISS. It attaches the solar and thermal control arrays to the rest of the complex, and houses cable distribution trays Extravehicular Activity (EVA) support equipment such as handholds and lighting; and providing for Extravehicular Robotic (EVR) accommodations using the Mobile Servicing System (MSS). It also provides logistics and maintenance, and payload attachment sites. The attachment sites accommodate logistics and maintenance and payloads carriers, zenith and nadir. The JEM-EF, a back porch-like attachment to the JEM Pressurized Module, accommodates up to eight payloads, which can be serviced by the crew via the JEM PM's airlock and dedicated robotic arm. The Columbus-EPF is another porch-like platform that can accommodate two zenith and two nadir looking payloads.

  2. Surface-attachment sequence in Vibrio Cholerae

    Science.gov (United States)

    Utada, Andrew; Gibiansky, Maxsim; Wong, Gerard

    2013-03-01

    Vibrio cholerae is a gram-negative bacterium that causes the human disease cholera. It is found natively in brackish costal waters in temperate climates, where it attaches to the surfaces of a variety of different aquatic life. V. cholerae has a single polar flagellum making it highly motile, as well as a number of different pili types, enabling it to attach to both biotic and abiotic surfaces. Using in-house built tracking software we track all surface-attaching bacteria from high-speed movies to examine the early-time attachment profile of v. cholerae onto a smooth glass surface. Similar to previous work, we observe right-handed circular swimming trajectories near surfaces; however, in addition we see a host of distinct motility mechanisms that enable rapid exploration of the surface before forming a more permanent attachment. Using isogenic mutants we show that the motility mechanisms observed are due to a complex combination of hydrodynamics and pili-surface interactions. Lauga, E., DiLuzio, W. R., Whitesides, G. M., Stone, H. A. Biophys. J. 90, 400 (2006).

  3. Growing networks with mixed attachment mechanisms

    International Nuclear Information System (INIS)

    Shao Zhigang; Zou Xianwu; Tan Zhijie; Jin Zhunzhi

    2006-01-01

    Networks grow and evolve when new nodes and links are added in. There are two methods to add the links: uniform attachment and preferential attachment. We take account of the addition of links with mixed attachment between uniform attachment and preferential attachment in proportion. By using numerical simulations and analysis based on a continuum theory, we obtain that the degree distribution P(k) has an extended power-law form P(k) ∼ (k + k 0 ) -γ . When the number of edges k of a node is much larger than a certain value k 0 , the degree distribution reduces to the power-law form P(k) ∼ k -γ ; and when k is much smaller than k 0 , the degree distribution degenerates into the exponential form P(k)∼exp(-yk/k 0 ). It has been found that degree distribution possesses this extended power-law form for many real networks, such as the movie actor network, the citation network of scientific papers and diverse protein interaction networks

  4. Tissue interactions of avian viral attachment proteins

    OpenAIRE

    Ambepitiya Wickramasinghe, I.N.

    2015-01-01

    Viruses can infect a wide range of hosts; varying from bacteria and plants to animals and humans. While many viral infections may pass unnoticed, some are of major importance due to their implications on health and welfare of plants, animals and/or humans. In particular, viruses that can infect avian hosts have been studied intensively due the occurrence of the pandemics of highly pathogenic influenza A virus infection or “bird flu’’. Viral infections in domesticated birds can result in huge ...

  5. Covalently Attached Monolayers on Crystalline Hydrogen-Terminated Silicon: Extremely Mild Attachment by Visible Light

    NARCIS (Netherlands)

    Sun, Q.Y.; Smet, de L.C.P.M.; Lagen, van B.; Giesbers, M.; Thüne, P.C.; Engelenburg, van J.; Wolf, de F.A.; Zuilhof, H.; Sudhölter, E.J.R.

    2005-01-01

    A very mild method was developed for the attachment of high-quality organic monolayers on crystalline silicon surfaces. By using visible light sources, from 447 to 658 nm, a variety of 1-alkenes and 1-alkynes were attached to hydrogen-terminated Si(100) and Si(111) surfaces at room temperature. The

  6. Childhood Sexual Abuse, Attachment, and Trauma Symptoms in College Females: The Moderating Role of Attachment

    Science.gov (United States)

    Aspelmeier, Jeffery E.; Elliott, Ann N.; Smith, Christopher H.

    2007-01-01

    Objective: The present study tests a model linking attachment, childhood sexual abuse (CSA), and adult psychological functioning. It expands on previous work by assessing the degree to which attachment security moderates the relationship between a history of child sexual abuse and trauma-related symptoms in college females. Method: Self-reports of…

  7. Parent Attachment, Childrearing Behavior, and Child Attachment: Mediated Effects Predicting Preschoolers' Externalizing Behavior

    Science.gov (United States)

    Roskam, Isabelle; Meunier, Jean-Christophe; Stievenart, Marie

    2011-01-01

    Attachment theory provides an interesting background for thinking about externalizing behavior (EB) in early childhood and for understanding how parenting influences the child's outcomes. The study examined how attachment and parenting could be combined to explain preschoolers' EB. Data were collected from 117 preschoolers aged from 4 to 6…

  8. [Attachment and Adoption: Diagnostics, Psychopathology, and Therapy].

    Science.gov (United States)

    Brisch, Karl-Heinz

    2015-01-01

    This presentation describes the development of attachment between adopted children and their adoptive parents with a focus on the particular issues seen in international adoptions. The questions of settling in, trauma in the country of origin, and the motivations of the adoptive parents will be discussed. Diagnosis and various psychopathological manifestations will be examined, as will outpatient and inpatient modes of therapy. The treatment of children of various ages will be covered along with the necessity for intensive counseling and psychotherapy for the adoptive parents. This will enable the parents to work through early trauma, which will give them and their adopted child the basis for developing healthy attachment patterns. This in turn will enable the child to mature and integrate into society. Possibilities of prevention are discussed. Many of the approaches discussed here regarding attachment and adoption may be applied to foster children and their foster parents.

  9. [ADHD and attachment processes: are they related?].

    Science.gov (United States)

    Franc, N; Maury, M; Purper-Ouakil, D

    2009-06-01

    Attention-deficit/hyperactivity disorder (ADHD) is defined on the basis of developmentally inappropriate inattention, motor activity and impulsivity that emerges early in development and causes impairment in social and academic functioning. ADHD is described as a multifactorial disease, with a well studied genetic vulnerability, and early environmental factors also playing an important role in the development and course of the disorder. Current aetiological models emphasize interaction between genes and environment. The concept of attachment, as proposed by John Bowlby, reflects quality of early interactions, and should therefore be considered as an early developmental factor. First, clinical findings emphasize similitude between both disorders; emotional dysregulation is an important feature in reactive attachment disorder as well as in ADHD. Emotion regulation is highly related to attachment security in young children and could play a part in the development of early attention processes. Moreover, difficult temperament is associated with higher risk for ADHD on the one hand, and can disturb the process of attachment on the other. Parental caregiving - including maternal sensitivity, positive parenting practices - is a main factor involved in the development of attachment, and has shown to be associated with better outcomes in ADHD children, especially with less oppositional/conduct disorders. Second, the aim of our review is to present clinical studies that have looked for a link between ADHD and attachment: the type of attachment could play a part in the course of the disorder: insecure and disorganised attachment types tend to be associated with a higher risk of externalised behaviors in children. For ADHD, this effect seems to be weaker than for other externalised disorders, and has been shown only in populations of at-risk children. Clinical studies also raise the question of possible links between reactive attachment disorder and ADHD. In children suffering

  10. Attachment theory: a biological basis for psychotherapy?

    Science.gov (United States)

    Holmes, J

    1993-10-01

    John Bowlby bemoaned the separation between the biological and psychological approaches in psychiatry, and hoped that attachment theory, which brings together psychoanalysis and the science of ethology, would help bridge the rift between them. Recent findings in developmental psychology have delineated features of parent-infant interaction, especially responsiveness, attunement, and modulation of affect, which lead to either secure or insecure attachment. Similar principles can be applied to the relationship between psychotherapist and patient--the provision of a secure base, the emergence of a shared narrative ('autobiographical competence'), the processing of affect, coping with loss--these are common to most effective psychotherapies and provide the basis for a new interpersonal paradigm within psychotherapy. Attachment theory suggests they rest on a sound ethological and hence biological foundation.

  11. Attachment at (not to) work: applying attachment theory to explain individual behavior in organizations.

    Science.gov (United States)

    Richards, David A; Schat, Aaron C H

    2011-01-01

    In this article, we report the results of 2 studies that were conducted to investigate whether adult attachment theory explains employee behavior at work. In the first study, we examined the structure of a measure of adult attachment and its relations with measures of trait affectivity and the Big Five. In the second study, we examined the relations between dimensions of attachment and emotion regulation behaviors, turnover intentions, and supervisory reports of counterproductive work behavior and organizational citizenship behavior. Results showed that anxiety and avoidance represent 2 higher order dimensions of attachment that predicted these criteria (except for counterproductive work behavior) after controlling for individual difference variables and organizational commitment. The implications of these results for the study of attachment at work are discussed.

  12. Interpretation bias in middle childhood attachment: Causal effects on attachment memories and scripts.

    Science.gov (United States)

    De Winter, Simon; Salemink, Elske; Bosmans, Guy

    2018-03-01

    Attachment theory implies the causal influence of interpretation bias on the attachment-related expectations. Previous research demonstrated that training children to interpret maternal behavior as more supportive increased their trust in maternal support. The current study explored possible training effects on two attachment script-related processes: recollection of attachment-related memories and secure base script knowledge. Children (9-12 years old; N = 84) were assigned to either a secure training condition, training children to interpret mother's behavior as supportive, or a neutral placebo condition, where interpretations about maternal behavior were unrelated to support. Findings replicated the training effect on interpretation bias and trust. Furthermore, children's recollection of attachment-related memories became more positive. No training effect was found for secure base script knowledge. Copyright © 2017 Elsevier Ltd. All rights reserved.

  13. Adolescent attachment, family functioning and depressive symptoms

    Directory of Open Access Journals (Sweden)

    Nishola Rawatlal

    2015-08-01

    Full Text Available Background. Adolescence represents a challenging transitional period where changes in biological, emotional, cognitive and social domains can increase the risk of developing internalised problems including subthreshold depression. Adolescent-parent attachment style, perceived support and family functioning may increase risk for depressive symptoms or may reduce such risk. Adolescent-parent attachment, adolescent-perceived support from parents and family functioning were examined as correlates of depressive symptom presentation within this age group. Methods. Participants included a maternal parent and an adolescent (65.5% female from each family. Adolescents were in Grade 7 (n=175 or Grade 10 (n=31. Data were collected through home interviews. The Self-Report of Family Inventory (SFI, Experiences of Close Relationships Scale (ECR, Network of Relationships Inventory (NRI, Children’s Depression Inventory (CDI and Child Behavior Checklist (CBCL were used to assess depression, parental support and attachment.  Results. Two models were examined: one with adolescent report of depressive symptoms as the outcome and a second with parent report of adolescent internalising symptoms as the outcome. The model predicting adolescent-reported depressive symptoms was significant with older age, higher levels of avoidant attachment, and higher levels of youth-reported dysfunctional family interaction associated with more depressive symptomatology. In the model predicting parent report of adolescent internalising symptoms only higher levels of dysfunctional family interaction, as reported by the parent, were associated with higher levels of internalising symptoms. Conclusion. Positive family communication, cohesion and support predictive of a secure parent-adolescent attachment relationship reduced the risk of a depressive symptom outcome. Secure adolescents were able to regulate their emotions, knowing that they could seek out secure base attachment relations

  14. Manure- and Biosolids-Resident Murine Norovirus 1 Attachment to and Internalization by Romaine Lettuce▿

    Science.gov (United States)

    Wei, Jie; Jin, Yan; Sims, Tom; Kniel, Kalmia E.

    2010-01-01

    The attachment of murine norovirus 1 (MNV) in biosolids, swine manure, and dairy manure to Romaine lettuce and internalization of this virus were evaluated. The MNV in animal manures had behavior similar to that of pure MNV; however, MNV in biosolids had significantly higher levels of attachment and internalization than pure MNV or MNV in manures. The incubation time did not affect the attachment of MNV in biosolids or manure. Confocal microscopy was used to observe MNV on lettuce after SYBR gold-labeled MNV was added directly to lettuce or after lettuce was submersed in labeled virus. MNV was observed on the lettuce surface, inside open cuts, and occasionally within stomata. In general, lettuce pieces with a long cut on the edge and short cuts on the stem was more likely to contain internalized MNV than intact lettuce pieces, as observed by confocal microscopy; however, while the difference was visible, it was not statistically significant. This study showed that the presence of MNV in biosolids may increase the risk of fresh produce contamination and that the MNV in open cuts and stomata is likely to be protected from sanitization. PMID:19933344

  15. Attachment in Institutionalized and Community Children in Romania

    Science.gov (United States)

    Zeanah, Charles H.; Smyke, Anna T.; Koga, Sebastian F.; Carlson, Elizabeth

    2005-01-01

    This study examined attachment in institutionalized and community children 12-31 months of age in Bucharest, Romania. Attachment was assessed using ratings of attachment behaviors and ratings of caregiver descriptions in a structured interview. As predicted, children raised in institutions exhibited serious disturbances of attachment as assessed…

  16. Preschool Teacher Attachment, School Readiness and Risk of Learning Difficulties

    Science.gov (United States)

    Commodari, Elena

    2013-01-01

    Attachment is the emotional bond between children and their caregivers (parents or otherwise). Infants and young children usually have more than one selective attachment, and all of these attachment relationships, including those between children and teachers, have important effects on cognitive and social development. Secure attachment to a…

  17. Effects of Emotion Regulation Training on Attachment Style of Primiparous Pregnant Women with Insecure Attachment

    Directory of Open Access Journals (Sweden)

    Tayebeh Reyhani

    2016-04-01

    Full Text Available Background: Pregnant women with insecure attachment style are at high risk of psychiatric disorders. Since emotions are the first coordinators of attachment behavior, emotion regulation training can alter maternal attachment style. In this study, we aimed to evaluate the effects of emotion regulation training on the attachment styles of primiparous pregnant women with insecure attachment style. Aim: This study aimed to evaluate the effects of training programs on the headache of patients after spinal anesthesia. Method: This randomized, clinical trial on 40 primiparous pregnant women with age range of 30-34 years, who were referred to healthcare centers of Mashhad, Iran, during 2014. The data collection instrument was Revised Adult Attachment Scale (RAAS. The participants were assigned to intervention and control groups. A training program was implemented on emotion regulation based on dialectical behavior therapy (DBT for the intervention group. After delivery, RAAS was completed by the mothers again. The control group only received the routine care. To analyze the data, Chi-square and independent t-test were run using SPSS, version 15. Results: Mean ages of the mothers in the intervention and control groups were 26.9±4.04 and 27.5±3.5 years, respectively. According to the results of independent t-test, the difference between the groups was non-significant (P=0.77. The groups were analogous in terms of attachment style pre-intervention. After the intervention, independent t-test did not reflect any significant differences between the groups regarding avoidant (P=0.37 and anxious (P=0.11 attachment styles. However, mean score for secure attachment style was significantly enhanced (P=0.01. Implications for Practice: Our findings revealed that implementation of emotion regulation training increased secure attachment scores. Thus, implementing emotion regulation training program is recommended as part of a program for pre-natal care in healthcare

  18. Clinical decision - making review on magnetic attachments versus mechanical attachments in dental prosthetics

    Directory of Open Access Journals (Sweden)

    Francesca Fabiano

    2017-11-01

    Full Text Available Background Conventional dentures in edentulous patients show some limitations due to the lack of retention, support and stability thus resulting in difficulty to chew. The modern implantology allows to use different implant overdentures and different attachment systems. The selection of the attachment by practitioners is mainly influenced by the clinical experience or technical preferences. Aims The aim of the present review is to provide an adequate background to the clinicians, in order to select the prosthetic attachments according to the current literature. The mechanical attachments have been compared to the magnetic devices, with the aim to guide the decision of the practitioners. Methods Articles topics selection was based on the use of magnetic attachments in dentistry and the comparison between them and mechanical connectors. The databases used were PubMed/MEDLINE, Google Scholar and ISI Web of Science. A critical evaluation of the selected paper has been made to choose the ones that matched the inclusion criteria. Results Nowadays, few studies have compared different attachments in a manner useful for clinical decision-making. The main problem limiting long-term durability of magnetic attachments in the oral fluid is the poor corrosion resistance of permanent magnets and the consequent leaching of cytotoxic ions. Conclusion Magnetic attachments in comparison with other attaching systems can be useful in patients with special needs, in patients with limited interocclusal space, or in patients with neuromuscular limitations, thanks to the automatic reseating properties. However, it’s important to highlight that the mechanical attachments still represent the best choice in common conditions requiring dental prostheses.

  19. Lightning attachment process to common buildings

    Science.gov (United States)

    Saba, M. M. F.; Paiva, A. R.; Schumann, C.; Ferro, M. A. S.; Naccarato, K. P.; Silva, J. C. O.; Siqueira, F. V. C.; Custódio, D. M.

    2017-05-01

    The physical mechanism of lightning attachment to grounded structures is one of the most important issues in lightning physics research, and it is the basis for the design of the lightning protection systems. Most of what is known about the attachment process comes from leader propagation models that are mostly based on laboratory observations of long electrical discharges or from observations of lightning attachment to tall structures. In this paper we use high-speed videos to analyze the attachment process of downward lightning flashes to an ordinary residential building. For the first time, we present characteristics of the attachment process to common structures that are present in almost every city (in this case, two buildings under 60 m in São Paulo City, Brazil). Parameters like striking distance and connecting leaders speed, largely used in lightning attachment models and in lightning protection standards, are revealed in this work.Plain Language SummarySince the time of Benjamin Franklin, no one has ever recorded high-speed video images of a lightning connection to a common building. It is very difficult to do it. Cameras need to be very close to the structure chosen to be observed, and long observation time is required to register one lightning strike to that particular structure. Models and theories used to determine the zone of protection of a lightning rod have been developed, but they all suffer from the lack of field data. The submitted manuscript provides results from high-speed video observations of lightning attachment to low buildings that are commonly found in almost every populated area around the world. The proximity of the camera and the high frame rate allowed us to see interesting details that will improve the understanding of the attachment process and, consequently, the models and theories used by lightning protection standards. This paper also presents spectacular images and videos of lightning flashes connecting lightning rods that

  20. Understanding Members’ Attachment to Social Networking Sites

    DEFF Research Database (Denmark)

    Lim, Eric T. K.; Cyr, Dianne; Tan, Chee-Wee

    2014-01-01

    , socializing with others and much more. This study therefore endeavors to shed light on this growing trend by decomposing members’ motives for participating within SNSs into identity-based, bondbased and comparison-based attachments. Each of these forms of attachment in turn affects members’ cooperative......Social Networking Sites (SNSs) are pervasive phenomena in today’s society. With greater connectivity and interactivity enabled through emerging technologies, SNSs provide communication platforms for individuals to bridge spatial and temporal differences when making friends, sharing experiences...

  1. Attachments to the common-place

    DEFF Research Database (Denmark)

    Blok, Anders

    2015-01-01

    on Thévenot's notion of ‘commonality in the plural’, the article shows how a range of personal affinities to the architectural form of the kyō-machiya, positioned as an urban ‘common-place’, serves to coordinate across otherwise divergent interests. By taking seriously the role of attachments to common-places...... change. To understand the dynamic interplay of architecture and community-building in this case, the article stages a theoretical debate on the politics of shared attachments between three proponents of French pragmatic sociology: Bruno Latour, Antoine Hennion, and Laurent Thévenot. Drawing in particular...

  2. Giant gravitons-with strings attached (I)

    International Nuclear Information System (INIS)

    Mello Koch, Robert de; Smolic, Jelena; Smolic, Milena

    2007-01-01

    In this article, the free field theory limit of operators dual to giant gravitons with open strings attached, are studied. We introduce a graphical notation, which employs Young diagrams, for these operators. The computation of two point correlation functions is reduced to the application of three simple rules, written as graphical operations performed on the Young diagram labels of the operators. Using this technology, we have studied gravitational radiation by giant gravitons and bound states of giant gravitons, transitions between excited giant graviton states and joining of open strings attached to the giant

  3. Electron attachment to Van der Waals molecules

    International Nuclear Information System (INIS)

    Hatano, Y.

    1986-01-01

    A survey is given of recent experimental studies of low-energy electron attachment to O 2 , N 2 O and other molecules in dense gases and in sonic nozzle beams with emphasis on the important role of pre-existing van der Waals molecules in the attachment mechanism. The experimental results particularly for O 2 are compared with recent theories. A survey is also given briefly of recent studies on electron solvation and localization in the condensed phase from the viewpoint of the studies on electron interaction with van der Waals molecules. (Auth.)

  4. Modeling the co-transport of viruses and colloids in unsaturated porous media

    NARCIS (Netherlands)

    Seetha, N.; Mohan Kumar, M. S.; Hassanizadeh, S. Majid

    2015-01-01

    A mathematical model is developed to simulate the co-transport of viruses and colloids in unsaturated porous media under steady-state flow conditions. The virus attachment to the mobile and immobile colloids is described using a linear reversible kinetic model. Colloid transport is assumed to be

  5. Virophages or satellite viruses?

    Science.gov (United States)

    Krupovic, Mart; Cvirkaite-Krupovic, Virginija

    2011-11-01

    It has been argued that the smaller viruses associated with giant DNA viruses are a new biological entity. However, Mart Krupovic and Virginija Cvirkaite-Krupovic argue here that these smaller viruses should be classified with the satellite viruses.

  6. Structural characterization by transmission electron microscopy and immunoreactivity of recombinant Hendra virus nucleocapsid protein expressed and purified from Escherichia coli.

    Science.gov (United States)

    Pearce, Lesley A; Yu, Meng; Waddington, Lynne J; Barr, Jennifer A; Scoble, Judith A; Crameri, Gary S; McKinstry, William J

    2015-12-01

    Hendra virus (family Paramyxoviridae) is a negative sense single-stranded RNA virus (NSRV) which has been found to cause disease in humans, horses, and experimentally in other animals, e.g. pigs and cats. Pteropid bats commonly known as flying foxes have been identified as the natural host reservoir. The Hendra virus nucleocapsid protein (HeV N) represents the most abundant viral protein produced by the host cell, and is highly immunogenic with naturally infected humans and horses producing specific antibodies towards this protein. The purpose of this study was to express and purify soluble, functionally active recombinant HeV N, suitable for use as an immunodiagnostic reagent to detect antibodies against HeV. We expressed both full-length HeV N, (HeV NFL), and a C-terminal truncated form, (HeV NCORE), using a bacterial heterologous expression system. Both HeV N constructs were engineered with an N-terminal Hisx6 tag, and purified using a combination of immobilized metal affinity chromatography (IMAC) and size exclusion chromatography (SEC). Purified recombinant HeV N proteins self-assembled into soluble higher order oligomers as determined by SEC and negative-stain transmission electron microscopy. Both HeV N proteins were highly immuno-reactive with sera from animals and humans infected with either HeV or the closely related Nipah virus (NiV), but displayed no immuno-reactivity towards sera from animals infected with a non-pathogenic paramyxovirus (CedPV), or animals receiving Equivac® (HeV G glycoprotein subunit vaccine), using a Luminex-based multiplexed microsphere assay. Crown Copyright © 2015. Published by Elsevier Inc. All rights reserved.

  7. The V protein of Tioman virus is incapable of blocking type I interferon signaling in human cells.

    Directory of Open Access Journals (Sweden)

    Grégory Caignard

    Full Text Available The capacity of a virus to cross species barriers is determined by the development of bona fide interactions with cellular components of new hosts, and in particular its ability to block IFN-α/β antiviral signaling. Tioman virus (TioV, a close relative of mumps virus (MuV, has been isolated in giant fruit bats in Southeast Asia. Nipah and Hendra viruses, which are present in the same bat colonies, are highly pathogenic in human. Despite serological evidences of close contacts between TioV and human populations, whether TioV is associated to some human pathology remains undetermined. Here we show that in contrast to the V protein of MuV, the V protein of TioV (TioV-V hardly interacts with human STAT2, does not degrade STAT1, and cannot block IFN-α/β signaling in human cells. In contrast, TioV-V properly binds to human STAT3 and MDA5, and thus interferes with IL-6 signaling and IFN-β promoter induction in human cells. Because STAT2 binding was previously identified as a host restriction factor for some Paramyxoviridae, we established STAT2 sequence from giant fruit bats, and binding to TioV-V was tested. Surprisingly, TioV-V interaction with STAT2 from giant fruit bats is also extremely weak and barely detectable. Altogether, our observations question the capacity of TioV to appropriately control IFN-α/β signaling in both human and giant fruit bats that are considered as its natural host.

  8. Effect of Attachment-Based Therapy on Behavioral Disorders in Girls with Attachment Problems

    Directory of Open Access Journals (Sweden)

    Marzieh Jahanbakhsh

    2014-09-01

    Full Text Available Background: Multidimensional and complex nature of children`s behavioral disorders requires assessment and usage of modern treatments. The present study investigated the effects of attachment-based therapy on behavioral disorders (depression, over anxiety and oppositional defiant in girl students of primary school who had attachment problems. Materials and Methods: This study is an empirical plan with pretest-posttest and control group. The target samples were 34 individuals of 388 second and fourth grade students of primary school that had highest scores on attachment problems and behavioral disorders (depression, over anxiety and oppositional defiant. Evaluation implemented using Randolph attachment disorder questionnaire (RADQ and Ontario mental health test. Mothers were presented in 10 group sessions of attachment-based intervention and its effects investigated in their girl`s behavioral disorders (depression, over anxiety and oppositional defiant. Results: Reduction rate of behavioral disorders general scores (depression, over anxiety and oppositional defiant of experimental group compared with control group showed significant decreases in posttest and three months follow up. Conclusion: The attachment based therapy offered for mothers of the girls with attachment problems was effective to reduction of behavioral disorders (depression, over anxiety and oppositional defiant symptoms in their children and the mother`s continues attention to interventional methods showed more improvement in follow up evaluation.

  9. Measuring infant attachment security in rhesus macaques (Macaca mulatta): adaptation of the attachment Q-set.

    Science.gov (United States)

    Warfield, James J; Kondo-Ikemura, Kiyomi; Waters, Everett

    2011-02-01

    John Bowlby defined offspring-parent attachment as a relationship in which an infant or child uses one or a few preferred adults as a secure base from which to explore and as a haven of safety. He defined attachment security in terms of confidence in the adult's availability and responsiveness and the smooth organization of exploration and proximity seeking. Developmental psychologists have found this perspective productive in both observational and laboratory research. At the same time, they emphasize that such a construct cannot be operationalized in terms of one or a few behaviors. Instead, naturalistic observations of human infant attachment typically employ the Q-sort method to develop the Attachment q-set (AQS), 90 behaviorally descriptive items sorted in terms of how characteristic each item is of the infant's typical behavior. Meta-analyses of research using the AQS attest to its reliability and validity. This article reports an adaptation of the AQS to the task of assessing infant attachment security in nonhuman primates and illustrates its use. The availability of comparable measures of attachment security will contribute to an expanded understanding of patterns of attachment behavior in nonhuman primate societies and will facilitate interaction between comparative and developmental psychologists. © 2010 Wiley-Liss, Inc.

  10. Sexuality examined through the lens of attachment theory: attachment, caregiving, and sexual satisfaction.

    Science.gov (United States)

    Péloquin, Katherine; Brassard, Audrey; Lafontaine, Marie-France; Shaver, Phillip R

    2014-01-01

    Attachment researchers have proposed that the attachment, caregiving, and sexual behavioral systems are interrelated in adult love relationships (Mikulincer & Shaver, 2007 ). This study examined whether aspects of partners' caregiving (proximity, sensitivity, control, compulsive caregiving) mediated the association between their attachment insecurities (anxiety and avoidance) and each other's sexual satisfaction in two samples of committed couples (Study 1: 126 cohabiting or married couples from the general community; Study 2: 55 clinically distressed couples). Partners completed the Experiences in Close Relationships measure (Brennan, Clark, & Shaver, 1998 ), the Caregiving Questionnaire (Kunce & Shaver, 1994 ), and the Global Measure of Sexual Satisfaction (Lawrance & Byers, 1998 ). Path analyses based on the actor-partner interdependence model (APIM) revealed that caregiving proximity mediated the association between low attachment avoidance and partners' sexual satisfaction in distressed and nondistressed couples. Sensitivity mediated this association in nondistressed couples only. Control mediated the association between men's insecurities (attachment-related avoidance and anxiety) and their partners' low sexual satisfaction in nondistressed couples. Attachment anxiety predicted compulsive caregiving, but this caregiving dimension was not a significant mediator. These results are discussed in light of attachment theory and their implications for treating distressed couples.

  11. performance characteristics of a cam turning attachment

    African Journals Online (AJOL)

    Dr Obe

    cams on the lathe machine. To assess the performance of the attachment, cutting forces have been measured using a 'Sigma' Cutting Tool. Dynamometer. Furthermore, the effect of cutting parameters, such as, cutting speed, depth of cut and feed rate on the cutting forces, machining power and specific cutting energy have ...

  12. Clinical Perspective Attachment, parenting styles and bullying ...

    African Journals Online (AJOL)

    Research that focuses on combining attachment, parenting styles, bullying and the reciprocal nature thereof in the parent–adolescent and peer relationships is limited. The bio-psychosocial changes that adolescents experience open up broader social realities and are perceived differently by parents and adolescents.

  13. Dissociative electron attachment to ozone: rate constant

    International Nuclear Information System (INIS)

    Skalny, J.D.; Cicman, P.; Maerk, T.D.

    2002-01-01

    The rate constant for dissociative electron attachment to ozone has been derived over the energy range of 0-10 eV by using previously measured cross section data revisited here in regards to discrimination effect occurring during the extraction of ions. The obtained data for both possible channels exhibit the maximum at mean electron energies close to 1 eV. (author)

  14. Attachment at School Age and Academic Performance.

    Science.gov (United States)

    Moss, Ellen; St-Laurent, Diane

    2001-01-01

    Examined longitudinally the association between attachment at age 6 and school-related cognitive functioning 2 years later in a French Canadian sample. Found that secure children had higher scores than insecure peers on communication, cognitive engagement, and mastery motivation. Controlling children were at greatest risk for school…

  15. Parental Attachment as Predictor of Delinquency

    Science.gov (United States)

    Gaik, Lee Phaik; Abdullah, Maria Chong; Elias, Habibah; Uli, Jegak

    2013-01-01

    Purpose: The purpose of this study is to find out the relationship between adolescents' parental attachment and delinquent behaviour in the aspects of trust, communication and alienation. In this study, delinquent behaviour refers to the set of behaviours which is against any mainstream established rules or norms. It is believed that delinquent…

  16. No Strings Attached: Open Source Solutions

    Science.gov (United States)

    Fredricks, Kathy

    2009-01-01

    Imagine downloading a new software application and not having to worry about licensing, finding dollars in the budget, or incurring additional maintenance costs. Imagine finding a Web design tool in the public domain--free for use. Imagine major universities that provide online courses with no strings attached. Imagine online textbooks without a…

  17. Attachment Styles, Abuse Experiences and Depression

    Science.gov (United States)

    Gunduz, Bulent; Capri, Burhan; Akbay, Sinem Evin; Tunc, Aygul

    2013-01-01

    This study aims to examine the relationship between abuse experiences, depression and attachment styles. The data for this study was collected from 251 students (123 females and 128 males) who attend Mersin University. As a part of the data collection, students completed the Experiences in Affiliation Inventory, Childhood Trauma Scale and Brief…

  18. Attachment Contexts of Adolescent Friendship and Romance

    Science.gov (United States)

    Miller, Judi Beinstein; Hoicowitz, Tova

    2004-01-01

    The purpose of this study was to compare memories of attachments to parents, friends, and romantic partners in relation to the maintenance of high school friendships and romantic relationships. College students recorded the length of their friendships and romantic relationships during high school and rated the quality of each. They also rated…

  19. Attachment Theory: Implications for School Psychology

    Science.gov (United States)

    Kennedy, Janice H.; Kennedy, Charles E.

    2004-01-01

    The effective practice of school psychology requires a strong research and theoretical base, a framework that encompasses developmental processes and outcomes, both adaptive and maladaptive, which facilitates assessment and intervention and offers insight into classroom and family dynamics. Attachment theory provides the school psychologist with…

  20. Childhood Abuse and Attachment Styles of Adolescents

    Science.gov (United States)

    Karakus, Ozlem

    2012-01-01

    Introduction: The fact that emotional and social experiences in early childhood period within the family influence the experiences in adolescence and adulthood (communication skills, interpersonal relations) is not a new case. Therefore, the aim of this study is to examine the relationship between childhood abuse and attachment styles. Method: The…

  1. Computer Viruses. Technology Update.

    Science.gov (United States)

    Ponder, Tim, Comp.; Ropog, Marty, Comp.; Keating, Joseph, Comp.

    This document provides general information on computer viruses, how to help protect a computer network from them, measures to take if a computer becomes infected. Highlights include the origins of computer viruses; virus contraction; a description of some common virus types (File Virus, Boot Sector/Partition Table Viruses, Trojan Horses, and…

  2. The statistical behaviour of attached eddies

    Science.gov (United States)

    Woodcock, J. D.; Marusic, I.

    2015-01-01

    Townsend's attached eddy hypothesis forms the basis of an established model of the logarithmic layer in wall-bounded turbulent flows in which this inertially dominated region is characterised by a hierarchy of geometrically self-similar eddying motions that scale with their distance to the wall. The hypothesis has gained considerable support from high Reynolds number measurements of the second-order moments of the fluctuating velocities. Recently, Meneveau and Marusic ["Generalized logarithmic law for high-order moments in turbulent boundary layers," J. Fluid Mech. 719, R1 (2013)] presented experimental evidence that all even-ordered moments of the streamwise velocity will exhibit a logarithmic dependence on the distance from the wall. They demonstrated that this was consistent with the attached eddy hypothesis, so long as the velocity distribution is assumed to be Gaussian (which allows the use of the central limit theorem). In this paper, we derive this result from the attached eddy model without assuming a Gaussian velocity distribution, and find that such logarithmic behaviours are valid in the large Reynolds number limit. We also revisit the physical and mathematical basis of the attached eddy hypothesis, in order to increase rigour and minimise the assumptions required to apply the hypothesis. To this end, we have extended the proof of Campbell's theorem to apply to the velocity field corresponding to a forest of variously sized eddies that are randomly placed on the wall. This enables us to derive all moments of the velocity in the logarithmic region, including cross-correlations between different components of the velocity. By contrast, previous studies of the attached eddy hypothesis have considered only the mean velocity and its second order moments. From this, we obtain qualitatively correct skewnesses and flatnesses for the spanwise and wall-normal fluctuations. The issue of the Reynolds number dependence of von Kármán's constant is also addressed.

  3. Sulfur isotope separation by dissociative electron attachment

    International Nuclear Information System (INIS)

    Allen, J.E. Jr.

    1976-01-01

    A new method is proposed for isotope separation in polyatomic molecules. In this method a laser is tuned to selectively excite a vibration mode of the molecules which contain the isotope to be removed. Before deactivation can occur, an electron is attached, resulting in an excited negative ion. Under the proper conditions this ion may dissociate, producing fragments which can be removed chemically. This technique is particularly suited to isotope separation in SF 6 . Potential energy curves are developed for this molecule to aid in explaining the mechanism of dissociative electron attachment. These curves incorporate much of the information known about attachment of electrons to SF 6 and represent an improvement over previously published curves. A rough estimate of the effectiveness of this method is made, based upon the temperature-dependent branching ratio for SF 5 - and SF 6 - . The calculations indicate that the fractional 34 S content in a sample of processed SF 6 may increase 4760 times the content in a natural sample. A kinetics model is presented to describe the attachment of electrons to SF 6 . Numerical solutions of the appropriate rate equations indicate that application of the proposed technique to SF 6 will require a low pressure environment and a large number of zero energy electrons. A simple theory is developed to determine threshold intensities for laser-induced dissociation on the basis of experimentally measurable quantities, the total laser power and the reaction volume. Using the focused beam method, a series of experiments performed to separate isotopes in SF 6 establishes a value of 6.0 MW/cm 2 for the threshold intensity. This eliminates dissociative electron attachment as an explanation of isotope separation by the focused beam method, but does not exclude it as a viable technique for separating isotopes

  4. THERMOPHILE ENDOSPORES HAVE RESPONSIVE EXOSPORIUM FOR ATTACHMENT

    Energy Technology Data Exchange (ETDEWEB)

    PANESSA-WARREN,B.; TORTORA,G.T.; WARREN,J.; SABATINI,R.

    1999-08-01

    Recently studies examining the colonization of Clostridial pathogens on agar and human tissue culture cells, demonstrated that (C. sporogenes ATCC 3584, C. difficile ATCC 43594 [patient isolate], C. difficile ATCC 9689 [non-clinical], C. clostridioforme [patient isolate]) bacterial spores (endospores) of the genus Clostridia have an outer membrane that becomes responsive at activation and exhibits extensions of the exosporial membrane that facilitate and maintain spore attachment to a nutritive substrate during germination and initial outgrowth of the newly developed bacterial cell. Therefore this attachment phenomenon plays an important role in insuring bacterial colonization of a surface and the initial stages of the infective process. To see if other non-clinical members of this genus also have this ability to attach to a substrate or food-source during spore germination, and how this attachment process in environmental thermophiles compares to the clinical paradigm (in relation to time sequence, exosporial membrane structure, type of attachment structures, composition of the membrane etc...), sediment samples were collected in sterile transport containers at 4 geothermal sites at Yellowstone National Park in Wyoming. Because spore forming bacteria will produce spores when conditions are unfavorable for growth, the samples were sealed and stored at 4 C. After 8 months the samples were screened for the presence of spores by light microscope examination using malachite green/safranin, and traditional endospores were identified in significant quantities from the Terrace Spring site (a 46 C lake with bacterial mats and a rapidly moving run-off channel leading to a traditional hot spring). The highest spore population was found in the top sediment and benthic water of the run-off channel, pH 8.1.

  5. Electron attachment rate constant measurement by photoemission electron attachment ion mobility spectrometry (PE-EA-IMS)

    Science.gov (United States)

    Su, Desheng; Niu, Wenqi; Liu, Sheng; Shen, Chengyin; Huang, Chaoqun; Wang, Hongmei; Jiang, Haihe; Chu, Yannan

    2012-12-01

    Photoemission electron attachment ion mobility spectrometry (PE-EA-IMS), with a source of photoelectrons induced by vacuum ultraviolet radiation on a metal surface, has been developed to study electron attachment reaction at atmospheric pressure using nitrogen as the buffer gas. Based on the negative ion mobility spectra, the rate constants for electron attachment to tetrachloromethane and chloroform were measured at ambient temperature as a function of the average electron energy in the range from 0.29 to 0.96 eV. The experimental results are in good agreement with the data reported in the literature.

  6. A Comparison of Trojan Virus Behavior in Linux and Windows Operating Systems

    OpenAIRE

    Al-Saadoon, Ghossoon. M. W.; Al-Bayatti, Hilal M. Y.

    2011-01-01

    Trojan virus attacks pose one of the most serious threats to computer security. A Trojan horse is typically separated into two parts - a server and a client. It is the client that is cleverly disguised as significant software and positioned in peer-to-peer file sharing networks, or unauthorized download websites. The most common means of infection is through email attachments. The developer of the virus usually uses various spamming techniques in order to distribute the virus to unsuspecting ...

  7. Hendra virus.

    Science.gov (United States)

    Middleton, Deborah

    2014-12-01

    Hendra virus infection of horses occurred sporadically between 1994 and 2010 as a result of spill-over from the viral reservoir in Australian mainland flying-foxes, and occasional onward transmission to people also followed from exposure to affected horses. An unprecedented number of outbreaks were recorded in 2011 leading to heightened community concern. Release of an inactivated subunit vaccine for horses against Hendra virus represents the first commercially available product that is focused on mitigating the impact of a Biosafety Level 4 pathogen. Through preventing the development of acute Hendra virus disease in horses, vaccine use is also expected to reduce the risk of transmission of infection to people. Crown Copyright © 2014. Published by Elsevier Inc. All rights reserved.

  8. Activating attachment representations during memory retrieval modulates intrusive traumatic memories.

    Science.gov (United States)

    Bryant, Richard A; Chan, Iris

    2017-10-01

    Although priming mental representations of attachment security reduces arousal, research has not examined the effect of attachment on the retrieval of emotionally arousing memories. This study investigated the effect of priming attachment security on the retrieval of emotional memories. Seventy-five participants viewed negative and neutral images, and two days later received either an attachment prime or a control prime immediately prior to free recall of the images. Two days later, participants reported how frequently they experienced intrusions of the negative images. The attachment group had less distress, and reported fewer subsequent intrusions than the control group. Attachment style moderated these effects such that individuals with an avoidant attachment style were not impacted by the attachment prime. These findings suggest that priming attachment security decreases distress during memory reactivation, and this may reduce subsequent intrusive memories. Copyright © 2017 Elsevier Inc. All rights reserved.

  9. Attachment within life history theory: an evolutionary perspective on individual differences in attachment.

    Science.gov (United States)

    Szepsenwol, Ohad; Simpson, Jeffry A

    2018-03-15

    In this article, we discuss theory and research on how individual differences in adult attachment mediate the adaptive calibration of reproductive strategies, cognitive schemas, and emotional expression and regulation. We first present an integration of attachment theory and life history theory. Then, we discuss how early harsh and/or unpredictable environments may promote insecure attachment by hampering parents' ability to provide sensitive and reliable care to their children. Finally, we discuss how, in the context of harsh and/or unpredictable environments, different types of insecure attachment (i.e. anxiety and avoidance) may promote evolutionary adaptive reproductive strategies, cognitive schemas, and emotional expression and regulation profiles. Copyright © 2018 Elsevier Ltd. All rights reserved.

  10. Insecure attachment behavior and partner violence: incorporating couple perceptions of insecure attachment and relational aggression.

    Science.gov (United States)

    Oka, Megan; Sandberg, Jonathan G; Bradford, Angela B; Brown, Andrew

    2014-10-01

    Intimate partner violence and insecure attachment are therapeutically relevant concepts when working with couples. The link between attachment and intimate partner violence has been examined in the literature, but an area of aggression that often goes unexamined is relational aggression, or using third parties as a means of being aggressive toward a partner. We asked how participants' attachment behaviors were related to their own and partners' relational and physical aggression. We used structural equation modeling to estimate actor-partner interdependence among these relationships in 644 heterosexual couples. Results indicated significant partner paths from attachment to relational aggression, as well as significant actor paths between relational aggression and physical aggression. Implications were discussed. Data for this study were collected from the RELATE assessment. © 2014 American Association for Marriage and Family Therapy.

  11. Clinical evaluation of mandibular implant overdentures via Locator implant attachment and Locator bar attachment

    OpenAIRE

    Seo, Yong-Ho; Bae, Eun-Bin; Kim, Jung-Woo; Lee, So-Hyoun; Yun, Mi-Jung; Jeong, Chang-Mo; Jeon, Young-Chan; Huh, Jung-Bo

    2016-01-01

    PURPOSE The aim of this study was to evaluate the clinical findings and patient satisfaction on implant overdenture designed with Locator implant attachment or Locator bar attachment in mandibular edentulous patients. MATERIALS AND METHODS Implant survival rate, marginal bone loss, probing depth, peri-implant inflammation, bleeding, plaque, calculus, complications, and satisfaction were evaluated on sixteen patients who were treated with mandibular overdenture and have used it for at least 1 ...

  12. Seroprevalence of Hepatitis C virus antibody in public servants of ...

    African Journals Online (AJOL)

    screening exercise for civil servants of Enugu State of Nigeria. Method Civil servants of Enugu State attached to the Government House, Enugu were screened for anti-HCV antibody using a third generation enzyme linked immunosorbent assay (ELISA). Risk factors for Hepatitis C Virus (HCV) infection were also determined ...

  13. Pharmacological Inhibition of Feline Immunodeficiency Virus (FIV

    Directory of Open Access Journals (Sweden)

    Dorothee Bienzle

    2012-04-01

    Full Text Available Feline immunodeficiency virus (FIV is a member of the retroviridae family of viruses and causes an acquired immunodeficiency syndrome (AIDS in domestic and non-domestic cats worldwide. Genome organization of FIV and clinical characteristics of the disease caused by the virus are similar to those of human immunodeficiency virus (HIV. Both viruses infect T lymphocytes, monocytes and macrophages, and their replication cycle in infected cells is analogous. Due to marked similarity in genomic organization, virus structure, virus replication and disease pathogenesis of FIV and HIV, infection of cats with FIV is a useful tool to study and develop novel drugs and vaccines for HIV. Anti-retroviral drugs studied extensively in HIV infection have targeted different steps of the virus replication cycle: (1 inhibition of virus entry into susceptible cells at the level of attachment to host cell surface receptors and co-receptors; (2 inhibition of fusion of the virus membrane with the cell membrane; (3 blockade of reverse transcription of viral genomic RNA; (4 interruption of nuclear translocation and viral DNA integration into host genomes; (5 prevention of viral transcript processing and nuclear export; and (6 inhibition of virion assembly and maturation. Despite much success of anti-retroviral therapy slowing disease progression in people, similar therapy has not been thoroughly investigated in cats. In this article we review current pharmacological approaches and novel targets for anti-lentiviral therapy, and critically assess potentially suitable applications against FIV infection in cats.

  14. The Multimodal Assessment of Adult Attachment Security: Developing the Biometric Attachment Test.

    Science.gov (United States)

    Parra, Federico; Miljkovitch, Raphaële; Persiaux, Gwenaelle; Morales, Michelle; Scherer, Stefan

    2017-04-06

    Attachment theory has been proven essential for mental health, including psychopathology, development, and interpersonal relationships. Validated psychometric instruments to measure attachment abound but suffer from shortcomings common to traditional psychometrics. Recent developments in multimodal fusion and machine learning pave the way for new automated and objective psychometric instruments for adult attachment that combine psychophysiological, linguistic, and behavioral analyses in the assessment of the construct. The aim of this study was to present a new exposure-based, automatic, and objective adult-attachment assessment, the Biometric Attachment Test (BAT), which exposes participants to a short standardized set of visual and music stimuli, whereas their immediate reactions and verbal responses, captured by several computer sense modalities, are automatically analyzed for scoring and classification. We also aimed to empirically validate two of its assumptions: its capacity to measure attachment security and the viability of using themes as placeholders for rotating stimuli. A total of 59 French participants from the general population were assessed using the Adult Attachment Questionnaire (AAQ), the Adult Attachment Projective Picture System (AAP), and the Attachment Multiple Model Interview (AMMI) as ground truth for attachment security. They were then exposed to three different BAT stimuli sets, whereas their faces, voices, heart rate (HR), and electrodermal activity (EDA) were recorded. Psychophysiological features, such as skin-conductance response (SCR) and Bayevsky stress index; behavioral features, such as gaze and facial expressions; as well as linguistic and paralinguistic features, were automatically extracted. An exploratory analysis was conducted using correlation matrices to uncover the features that are most associated with attachment security. A confirmatory analysis was conducted by creating a single composite effects index and by testing it

  15. Effect of attachment strategies on bipartite networks

    DEFF Research Database (Denmark)

    Ganguly, N.; Saha, S.; Maiti, A.

    2013-01-01

    Bipartite systems show remarkable variations in their topological asymptotic properties, e. g., in their degree distribution. Such variations depend on the underlying growth dynamics. A scenario of particular importance is when the two partitions of the bipartite structure do not grow at an equal...... rate. Here, we focus on the case where one of the partitions can be assumed to be fixed while the other partition grows in time as observed in the codon-gene or alphabet-word network. We show that subtle changes in growth dynamics, particularly in the attachment kernel, can lead to drastic changes...... of the emergent topological properties. We present a detail analysis of various growth strategies, including sequential and parallel addition of nodes, as well as with and without replacement attachment kernels. Analytical results have been compared with stochastic simulations as well as with real systems showing...

  16. Smartphone Magnification Attachment: Microscope or Magnifying Glass

    Science.gov (United States)

    Hergemöller, Timo; Laumann, Daniel

    2017-09-01

    Today smartphones and tablets do not merely pervade our daily life, but also play a major role in STEM education in general, and in experimental investigations in particular. Enabling teachers and students to make use of these new techniques in physics lessons requires supplying capable and affordable applications. Our article presents the improvement of a low-cost technique turning smartphones into powerful magnifying glasses or microscopes. Adding only a 3D-printed clip attached to the smartphone's camera and inserting a small glass bead in this clip enables smartphones to take pictures with up to 780x magnification (see Fig. 1). In addition, the construction of the smartphone attachments helps to explain and examine the differences between magnifying glasses and microscopes, and shows that the widespread term "smartphone microscope" for this technique is inaccurate from a physics educational perspective.

  17. Vegetation attached to the elephant trunk.

    Science.gov (United States)

    Tanaka, Akiko; Sakamoto, Toshihito; Okada, Kenji; Okita, Yutaka

    2013-09-01

    The elephant trunk technique is used as a standard method in the approach to staged repair of extensive thoracic aneurysms. Here, we present a rare case of a graft infection, in which vegetation was attached to the distal end of the elephant trunk. A 36-year old male who had undergone total arch replacement with elephant trunk installation for type A aortic dissection was readmitted for high-grade fever. At the time of admission, Osler's nodules were present and brain magnetic resonance imaging showed multiple small emboli and haemorrhages. Transoesophageal echocardiography could not locate any sign of infection within the cardiac chambers, but disclosed vegetation attached to the elephant trunk. He underwent successful emergent graft replacement of the lesion, and no recurrence of the infection has been observed.

  18. Attachment theory and John Bowlby: some reflections.

    Science.gov (United States)

    Stevenson-Hinde, Joan

    2007-12-01

    The 100th anniversary of Edward John Mostyn Bowlby's birth (February 26th, 1907) was celebrated at the Tavistock Clinic in London by his family and colleagues, with presentations of ongoing research as well as reflections on both the person and his theory. My own reflections include the influence of ethological thinking on the development of attachment theory, Bowlby's focus on observations followed by explanation, his appreciation of emotional communication as well as behavior, and his recognition of the role of the family as well as the child/caregiver dyad. While always remaining open to new avenues of research, John Bowlby was firmly insistent on the precise use of attachment terminology, and quite rightly too!

  19. Attachment to the physical dimension of places.

    Science.gov (United States)

    Hidalgo, M Carmen; Hernández, Bernardo

    2002-12-01

    Social relationships had been important in explanation and prediction of attachment to places. Although some have asserted the importance of physical aspects of the environment in the formation of attachment ties to a place, the social environment is required for the formation of bonds to a place, although strong emphasis on the social aspect has been questioned and the importance of the physical environment noted. The present objective in two studies was to test whether college students (ns = 30 and 27) show a preference for a place they know, independently of the social interactions developed in them. Results confirmed the hypothesis, i.e., after a very brief stay in a certain place with nobody else there, these college students preferred that place to another with which they had not had previous contact.

  20. Lethal fish hook attachment - An unusual occurrence.

    Science.gov (United States)

    Byard, Roger W

    2013-02-01

    A 39-year-old fisherman is reported who was dragged into the water from a boat after he became entangled in fishing line. His death was attributed to salt water drowning. At autopsy the cause of death was confirmed and the mechanism of the lethal event elucidated. Specifically, a large fish hook attached to line was embedded in his right wrist. The hook had passed beneath flexor tendons and had firmly attached him to fishing line that was being dropped from the vessel. There were no other significant injuries or underlying diseases present. This case demonstrates another rare situation in the commercial fishing industry that may result in a victim being dragged from a boat and drowned. Copyright © 2012 Elsevier Ltd and Faculty of Forensic and Legal Medicine. All rights reserved.

  1. Contribution of the attachment G glycoprotein to pathogenicity and immunogenicity of avian metapneumovirus subgroup C.

    Science.gov (United States)

    Govindarajan, Dhanasekaran; Kim, Shin-Hee; Samal, Siba K

    2010-03-01

    Avian metapneumovirus (AMPV) causes an upper respiratory tract infection in turkeys leading to serious economic losses to the turkey industry. The G glycoprotein of AMPV is known to be associated with viral attachment and pathogenesis. In this study, we determined the role of the G glycoprotein in the pathogenicity and immunogenicity of AMPV strain Colorado (AMPV/CO). Recombinant AMPV/CO lacking the G protein (rAMPV/CO-deltaG) was generated using a reverse-genetics system. The recovered rAMPV/CO-deltaG replicated slightly better than did wild-type AMPV in Vero cells. However, deletion of the G gene in AMPV resulted in attenuation of the virus in turkeys. The mutant virus induced less-severe clinical signs and a weaker immune response in turkeys than did the wild-type AMPV. Our results suggest that the G glycoprotein is an important determinant for the pathogenicity and immunogenicity of AMPV.

  2. Schmallenberg Virus

    Indian Academy of Sciences (India)

    IAS Admin

    combat many infectious-disease-causing agents over the years. However, evolution is a continuous process ... newly emerging virus infection that poses threat to the livestock industries. In addition to describing the life ... are the Symptoms of Infection by SBV. The first clinical signs in adult animals are acute diarrhoea, a dip.

  3. Interaction of Human Tumor Viruses with Host Cell Surface Receptors and Cell Entry

    Directory of Open Access Journals (Sweden)

    Georgia Schäfer

    2015-05-01

    Full Text Available Currently, seven viruses, namely Epstein-Barr virus (EBV, Kaposi’s sarcoma-associated herpes virus (KSHV, high-risk human papillomaviruses (HPVs, Merkel cell polyomavirus (MCPyV, hepatitis B virus (HBV, hepatitis C virus (HCV and human T cell lymphotropic virus type 1 (HTLV-1, have been described to be consistently associated with different types of human cancer. These oncogenic viruses belong to distinct viral families, display diverse cell tropism and cause different malignancies. A key to their pathogenicity is attachment to the host cell and entry in order to replicate and complete their life cycle. Interaction with the host cell during viral entry is characterized by a sequence of events, involving viral envelope and/or capsid molecules as well as cellular entry factors that are critical in target cell recognition, thereby determining cell tropism. Most oncogenic viruses initially attach to cell surface heparan sulfate proteoglycans, followed by conformational change and transfer of the viral particle to secondary high-affinity cell- and virus-specific receptors. This review summarizes the current knowledge of the host cell surface factors and molecular mechanisms underlying oncogenic virus binding and uptake by their cognate host cell(s with the aim to provide a concise overview of potential target molecules for prevention and/or treatment of oncogenic virus infection.

  4. Regulation of Initial Attachment of P. aeruginosa

    Science.gov (United States)

    2010-12-08

    planktonic- and attachment-specific phosphorylation events. Two procedures were used to do so, a combination of 2D/PAGE and immunoblot analysis and...modification. According to the results of this study, most if not all major effects of BfiSR can be ascribed to the combined action of rsmY and rsmZ...treatment with norfloxacin (Fig. 14). Moreover, no difference in susceptibility was noted for P. aeruginosa wild type biofilms and bfiS mutant biofilms

  5. Cesarean Births and Attachment Behaviors of Fathers.

    Science.gov (United States)

    1984-01-01

    1984 Thesis and Abstract Approved: 7 • < l ,’/’ M. Virginia Ruth, R.N., Dr.P.H. Associate Professor and Chairman Community Health Nursing Maternal and...culture and current psychological literature. Child Development, 36, 261-297. Newton, L . D. (1975). Description of maternal backgrounds, maternal ...knowledge about breastfeeding and maternal breastfeeding and attachment behaviors of a group of primiparous mothers on the first post- partum day

  6. Attachment and conduct disorder: The Response Programme.

    OpenAIRE

    Holland, R.; Moretti, M. M.; Verlaan, V.; Peterson, S.

    1993-01-01

    An increasing number of youths are being identified as suffering from behavioral problems that cause difficulties in their family and peer relations, which in turn reduce their chances of academic and vocational success. The common diagnosis given to these disaffiliated youths is conduct disorder. A community-oriented program designed to ensure long-term care for these youths is described. The program is designed to focus members of the youth's environment on the attachment and affiliation is...

  7. Cladding Attachment Over Thick Exterior Insulating Sheathing

    Energy Technology Data Exchange (ETDEWEB)

    Baker, P. [Building Science Corporation, Somerville, MA (United States); Eng, P. [Building Science Corporation, Somerville, MA (United States); Lepage, R. [Building Science Corporation, Somerville, MA (United States)

    2014-01-01

    The addition of insulation to the exterior of buildings is an effective means of increasing the thermal resistance of both wood framed walls as well as mass masonry wall assemblies. For thick layers of exterior insulation (levels greater than 1.5 inches), the use of wood furring strips attached through the insulation back to the structure has been used by many contractors and designers as a means to provide a convenient cladding attachment location (Straube and Smegal 2009, Pettit 2009, Joyce 2009, Ueno 2010). The research presented in this report is intended to help develop a better understanding of the system mechanics involved and the potential for environmental exposure induced movement between the furring strip and the framing. BSC sought to address the following research questions: 1.What are the relative roles of the mechanisms and the magnitudes of the force that influence the vertical displacement resistance of the system? 2.Can the capacity at a specified deflection be reliably calculated using mechanics based equations? 3.What are the impacts of environmental exposure on the vertical displacement of furring strips attached directly through insulation back to a wood structure?

  8. Cladding Attachment Over Thick Exterior Insulating Sheathing

    Energy Technology Data Exchange (ETDEWEB)

    Baker, P. [Building Science Corporation, Somerville, MA (United States); Eng, P. [Building Science Corporation, Somerville, MA (United States); Lepage, R. [Building Science Corporation, Somerville, MA (United States)

    2014-01-01

    The addition of insulation to the exterior of buildings is an effective means of increasing the thermal resistance of both wood framed walls as well as mass masonry wall assemblies. For thick layers of exterior insulation (levels greater than 1.5 inches), the use of wood furring strips attached through the insulation back to the structure has been used by many contractors and designers as a means to provide a convenient cladding attachment location (Straube and Smegal 2009, Pettit 2009, Joyce 2009, Ueno 2010). The research presented in this report is intended to help develop a better understanding of the system mechanics involved and the potential for environmental exposure induced movement between the furring strip and the framing. BSC sought to address the following research questions: 1. What are the relative roles of the mechanisms and the magnitudes of the force that influence the vertical displacement resistance of the system? 2. Can the capacity at a specified deflection be reliably calculated using mechanics based equations? 3. What are the impacts of environmental exposure on the vertical displacement of furring strips attached directly through insulation back to a wood structure?

  9. Machiavellianism and Parental Attachment in Adolescence

    Directory of Open Access Journals (Sweden)

    András Láng

    2015-02-01

    Full Text Available Machiavellianism is a well-studied topic in several branches of psychology. Still, it has received little attention from a developmental perspective. Previous retrospective studies linked Machiavellianism to poor parental care, but actual reports of adolescents who live in their family of origin have been ignored so far. Therefore, we investigated the relationship between Machiavellianism and parental attachment in adolescence and possible sex differences based on life history theory. An adolescent sample (N = 376; 17.27 ± .77 years of age completed the Mach-IV and the maternal and paternal versions of revised Inventory of Parent and Peer Attachment (IPPA-R. According to our results, significant sex differences emerged in the relationship between Machiavellianism and attachment to parents. For girls, maternal alienation proved to be the only significant predictor of Machiavellianism, whereas for boys, low intensity and quality of verbal communication with father predicted higher levels of Machiavellianism. Results are discussed from an evolutionary perspective of socialization and from the perspective of emotion regulation.

  10. Infant-parent attachment: Definition, types, antecedents, measurement and outcome.

    Science.gov (United States)

    Benoit, Diane

    2004-10-01

    Attachment theory is one of the most popular and empirically grounded theories relating to parenting. The purpose of the present article is to review some pertinent aspects of attachment theory and findings from attachment research. Attachment is one specific aspect of the relationship between a child and a parent with its purpose being to make a child safe, secure and protected. Attachment is distinguished from other aspects of parenting, such as disciplining, entertaining and teaching. Common misconceptions about what attachment is and what it is not are discussed. The distinction between attachment and bonding is provided. The recognized method to assess infant-parent attachment, the Strange Situation procedure, is described. In addition, a description is provided for the four major types of infant-parent attachment, ie, secure, insecure-avoidant, insecure-resistant and insecure-disorganized. The antecedents and consequences of each of the four types of infant-parent attachment are discussed. A special emphasis is placed on the description of disorganized attachment because of its association with significant emotional and behavioural problems, and poor social and emotional outcomes in high-risk groups and in the majority of children who have disorganized attachment with their primary caregiver. Practical applications of attachment theory and research are presented.

  11. HUMAN PAPILLOMA VIRUS — ONCOGENIC VIRUS

    Directory of Open Access Journals (Sweden)

    A.N. Mayansky

    2010-01-01

    Full Text Available The lecture is devoted to oncogenic viruses, particularly human papilloma virus. Papilloma viral infection is found in all parts of the globe and highly contagious. In addition to exhaustive current data on classification, specifics of papilloma viruses composition and epidemiology, the author describes in great detail the malignization mechanisms of papilloma viruses pockets. Also, issues of diagnostics and specific prevention and treatment of diseases caused by this virus are illustrated. Key words: oncogenic viruses, papilloma viruses, prevention, vaccination. (Pediatric Pharmacology. – 2010; 7(4:48-55

  12. Gold nanorod vaccine for respiratory syncytial virus

    International Nuclear Information System (INIS)

    Stone, John W; Thornburg, Natalie J; Blum, David L; Kuhn, Sam J; Crowe Jr, James E; Wright, David W

    2013-01-01

    Respiratory syncytial virus (RSV) is a major cause of pneumonia and wheezing in infants and the elderly, but to date there is no licensed vaccine. We developed a gold nanorod construct that displayed the major protective antigen of the virus, the fusion protein (F). Nanorods conjugated to RSV F were formulated as a candidate vaccine preparation by covalent attachment of viral protein using a layer-by-layer approach. In vitro studies using ELISA, electron microscopy and circular dichroism revealed that conformation-dependent epitopes were maintained during conjugation, and transmission electron microscopy studies showed that a dispersed population of particles could be achieved. Human dendritic cells treated with the vaccine induced immune responses in primary human T cells. These results suggest that this vaccine approach may be a potent method for immunizing against viruses such as RSV with surface glycoproteins that are targets for the human immune response. (paper)

  13. Oropuche virus: A virus present but ignored

    Directory of Open Access Journals (Sweden)

    Salim Mattar V.

    2015-09-01

    Full Text Available Bunyaviruses are RNA viruses that affect animals and plants; they have five genera and four of them affect humans: Orthobunyavirus, Nairovirus, Phlebovirus and Hantavirus. All of them are Arbovirus, except Hantavirus. The Orthobunyaviruses comprise Oropouche, Tahyna, La Crosse virus, California encephalitis virus and Heartland virus recently discovered (1. Except for Heartland virus which is transmitted by ticks of the genus Amblyoma, these Phleboviruses have as vectors mosquitoes, which bite small mammals which are able to be as reservoirs amplifiers.

  14. Attachment Insecurity Predicts Punishment Sensitivity in Anorexia Nervosa.

    Science.gov (United States)

    Keating, Charlotte; Castle, David J; Newton, Richard; Huang, Chia; Rossell, Susan L

    2016-10-01

    Individuals with anorexia nervosa (AN) experience insecure attachment. We investigated whether insecure attachment is associated with punishment and reward sensitivity in women with AN. Women with AN (n = 24) and comparison women (n = 26) (CW) completed The Eating Disorder Examination Questionnaire, Depression Anxiety Stress Scale, The Attachment Style Questionnaire, and Sensitivity to Punishment/Sensitivity to Reward Questionnaire. Participants with AN returned higher ratings for insecure attachment (anxious and avoidant) experiences and greater sensitivity to punishment (p = 0.001) than CW. In AN, sensitivity to punishment was positively correlated with anxious attachment and negative emotionality but not eating disorder symptoms. Regression analysis revealed that anxious attachment independently predicted punishment sensitivity in AN. Anxious attachment experiences are related to punishment sensitivity in AN, independent of negative emotionality and eating disorder symptoms. Results support ongoing investigation of the contribution of attachment experiences in treatment and recovery.

  15. Active Disks - Remote Execution for Network-Attached Storage

    National Research Council Canada - National Science Library

    Riedel, Erik

    1997-01-01

    .... One development in this direction is Network Attached Secure Disks (NASD) which attaches storage devices directly to the network and raises the storage interface above the simple (fixed size block...

  16. Androgyny and Attachment Security: Two Related Models of Optimal Personality.

    Science.gov (United States)

    Shaver, Phillip R.; And Others

    1996-01-01

    Three studies explore similarities between attachment style typologies and sex role typologies. Both are defined by pairs of dimensions: self model and other model (attachment styles); masculinity, or agency, and femininity, or communion (sex role orientations). Discusses results. (KW)

  17. The use and limitations of attachment theory in child psychotherapy.

    Science.gov (United States)

    Zilberstein, Karen

    2014-03-01

    Attachment theory and research has proliferated in recent years, spawning new ideas and applications to child therapy. Some of those interventions are creative and useful and rest on solid theory and research, whereas others derive from tenuous assumptions. As an important developmental construct, attachment plays a role in every therapy, but defining that role can be difficult. Therapists must recognize the significance of attachment in treatment but not at the expense of recognizing and treating other issues. This article provides an overview of attachment theory and attachment-based interventions and discusses how to apply those constructs to therapeutic work with children. It reviews attachment theory, assessment, and treatments, and discusses how attachment-focused interventions can be combined with other therapeutic needs and methods. It also considers limitations in the current clinical application of attachment and makes recommendations for further research. (PsycINFO Database Record (c) 2014 APA, all rights reserved).

  18. Gender moderates the relationship between attachment insecurities and emotion dysregulation

    NARCIS (Netherlands)

    Velotti, P.; D’Aguanno, M.; de Campora, G.; di Francescantonio, S.; Garofalo, C.; Giromini, L.; Petrocchi, C.; Terrasi, M.; Zavattini, G.C.

    2016-01-01

    The relation between attachment styles and emotion regulation is well documented, and emotion dysregulation is considered characteristic of individuals with insecure attachment styles. Although gender differences in emotion regulation have often been reported, it is not clear whether the association

  19. Attachment and autonomy problems in adults with ADHD

    NARCIS (Netherlands)

    Koemans, R.G.; van Vroenhoven, S.; Karreman, A.; Bekker, M.H.J.

    2015-01-01

    Objective: Attachment security and autonomy were examined in adults with ADHD. Insecure attachment and autonomy problems were expected to be negatively associated with general psychological functioning. Method: Questionnaires were administered (Relationship Questionnaire, Autonomy-Connectedness

  20. Inactivation of pathogenic viruses by plant-derived tannins: strong effects of extracts from persimmon (Diospyros kaki on a broad range of viruses.

    Directory of Open Access Journals (Sweden)

    Kyoko Ueda

    Full Text Available Tannins, plant-derived polyphenols and other related compounds, have been utilized for a long time in many fields such as the food industry and manufacturing. In this study, we investigated the anti-viral effects of tannins on 12 different viruses including both enveloped viruses (influenza virus H3N2, H5N3, herpes simplex virus-1, vesicular stomatitis virus, Sendai virus and Newcastle disease virus and non-enveloped viruses (poliovirus, coxsachievirus, adenovirus, rotavirus, feline calicivirus and mouse norovirus. We found that extracts from persimmon (Diospyros kaki, which contains ca. 22% of persimmon tannin, reduced viral infectivity in more than 4-log scale against all of the viruses tested, showing strong anti-viral effects against a broad range of viruses. Other tannins derived from green tea, acacia and gallnuts were effective for some of the viruses, while the coffee extracts were not effective for any of the virus. We then investigated the mechanism of the anti-viral effects of persimmon extracts by using mainly influenza virus. Persimmon extracts were effective within 30 seconds at a concentration of 0.25% and inhibited attachment of the virus to cells. Pretreatment of cells with the persimmon extracts before virus infection or post-treatment after virus infection did not inhibit virus replication. Protein aggregation seems to be a fundamental mechanism underlying the anti-viral effect of persimmon tannin, since viral proteins formed aggregates when purified virions were treated with the persimmon extracts and since the anti-viral effect was competitively inhibited by a non-specific protein, bovine serum albumin. Considering that persimmon tannin is a food supplement, it has a potential to be utilized as a safe and highly effective anti-viral reagent against pathogenic viruses.

  1. The Association between State Attachment Security and State Mindfulness

    OpenAIRE

    Pepping, Christopher A.; Davis, Penelope J.; O?Donovan, Analise

    2015-01-01

    Recent research suggests that attachment and mindfulness are related, though the nature of this association is unclear. Here we present two studies examining whether there is a causal relationship between state attachment and state mindfulness. Study 1 investigated the effects of experimentally increasing state mindfulness on state attachment security. State mindfulness was successfully enhanced, but this led to no change in state attachment security. Study 2 investigated the effects of exper...

  2. Attachment and the Development of Personality and Social Functioning

    OpenAIRE

    Fransson, Mari

    2014-01-01

    According to attachment theory, the establishment of an attachment bond to a caregiver not only provides the infant with protection from danger, but also many other resources presumably beneficial to the child’s general psychological development. Although there is substantial empirical support for a link between attachment security and social functioning in childhood and adolescence, less is known about whether childhood attachment contributes to social functioning beyond adolescence. Similar...

  3. High Prevalence of Insecure Attachment in Patients with Primary Hypertension.

    Science.gov (United States)

    Balint, Elisabeth M; Gander, Manuela; Pokorny, Dan; Funk, Alexandra; Waller, Christiane; Buchheim, Anna

    2016-01-01

    Hypertension is a major cardiovascular (CV) risk factor and is predicted by heightened CV reactivity to stress in healthy individuals. Patients with hypertension also show an altered stress response, while insecure attachment is linked to a heightened stress reactivity as well. This is the first study aiming to assess attachment representations in patients with primary hypertension and to investigate their CV responses when their attachment system is activated. We studied 50 patients (38 men, 12 women) with primary hypertension. The Adult Attachment Projective Picture System (AAP), a widely used and validated interview, was performed to measure the patients' attachment representations, and to activate their attachment system. Blood pressure and heart rate were measured after 10 min at rest prior to and directly after the AAP interview. Mood and state anxiety were assessed using the Multidimensional Mood State Questionnaire (MDBF) and the State Trait Anxiety Inventory-State (STAI-S) before and after the experiment. The prevalence of insecure attachment (dismissing, preoccupied, unresolved) in hypertensive patients was predominant (88%), while in non-clinical populations, only about 50% of individuals had insecure attachment patterns. Blood pressure (p < 0.001), heart rate (p = 0.016), and rate pressure product (p < 0.001) significantly increased in response to the attachment interview. Secure attached patients showed the highest rise in systolic blood pressure (p = 0.020) and the lowest heart rate compared to the other attachment groups (p = 0.043). However, attachment representation showed no significant group or interaction effects on diastolic blood pressure (DBP) and rate pressure product. Insecure attachment was highly over-represented in our sample of patients with primary hypertension. Additionally, a robust CV response to the attachment-activating stimulus was observed. Our data suggest that insecure attachment is significantly linked to primary hypertension

  4. Precision Attachments for Aesthetics and Function: A Case Report

    OpenAIRE

    Shetty, Nitin Bhaskar; Shetty, Sanyuktha; E, Nagaraj; Shetty, Omkar; D’souza, Raina

    2014-01-01

    Successful restoration of the dentition requires plenty of contemporary and conventional treatment techniques and planning and attachment retained partial dentures are one such kind of treatment modality in prosthodontics. Limited space for extracoronal attachments is a serious gap in the design and the fabrication of a precision attachment Removable Partial Denture (RPD). A custom semi-precision attachment with a partial denture offers strength and improved aesthetics in cases with minimal s...

  5. The application of attachment theory to a psychotherapy case

    OpenAIRE

    2012-01-01

    M.A. The purpose of this study is to illustrate the psychotherapeutic use of Attachment Theory. Attachment Theory is an interpersonal theory which refers to the way an individual internalises an emotional-cognitive model of his relationships with his various attachment figures. These models of ways of relating are reflected in the way an individual speaks. The methodology of the study entailed conducting the semi-structured Adult Attachment Interview to elicit a psychotherapy client's narr...

  6. Viruses of hyperthermophilic Crenarchaea

    DEFF Research Database (Denmark)

    Prangishvili, D.; Garrett, R. A.

    2005-01-01

    , when one examines the archaeal viruses, the picture appears complex. Most viruses that are known to infect members of the kingdom Euryarchaeota resemble bacterial viruses, whereas those associated with the kingdom Crenarchaeota show little resemblance to either bacterial or eukaryal viruses....... This review summarizes our current knowledge of this group of exceptional and highly diverse archaeal viruses....

  7. Attachment representation in institutionalized children: a preliminary study using the child attachment interview.

    Science.gov (United States)

    Zaccagnino, Maria; Cussino, Martina; Preziosa, Alessandra; Veglia, Fabio; Carassa, Antonella

    2015-01-01

    The experience of being removed from one's home and the transition to a residential care system pose enormous challenges for a child. Substantial evidence has been found regarding severe developmental effects due to early exposition to extreme psychosocial and affective deprivation. The research on Bowlby's theoretical proposals has highlighted the link between insecure, disorganized and atypical attachment patterns and children both living in foster care facilities and adopted out of those institutions. The goal of this pilot study is to investigate the attachment representation in an Italian sample of children in middle childhood (9-13 years old) who have been removed from their homes. Two compared groups of children participated in this study. The first group was composed of 24 Italian children who had been removed from their homes. The second group, considered as the control group, was composed of 35 Italian children who had never been in foster care placement. The quality of children's attachment to their primary caregivers was assessed by the Child Attachment Interview, an innovative semi-structured interview that seeks to bridge the measurement gap identified in middle childhood The children in foster care placement show a higher percentage of insecure and disorganized attachment representations and lower scores on the Child Reflective Functioning Scale. The clinical implications and enhancements to effective intervention for foster children's caretaking are discussed. Copyright © 2014 John Wiley & Sons, Ltd.

  8. From secure dependency to attachment: Mary Ainsworth's integration of Blatz's security theory into Bowlby's attachment theory.

    Science.gov (United States)

    van Rosmalen, Lenny; van der Horst, Frank C P; van der Veer, René

    2016-02-01

    John Bowlby is generally regarded as the founder of attachment theory, with the help of Mary Ainsworth. Through her Uganda and Baltimore studies Ainsworth provided empirical evidence for attachment theory, and she contributed the notion of the secure base and exploratory behavior, the Strange Situation Procedure and its classification system, and the notion of maternal sensitivity. On closer scrutiny, many of these contributions appear to be heavily influenced by William Blatz and his security theory. Even though Blatz's influence on Ainsworth has been generally acknowledged, this article, partly based on understudied correspondence from several personal archives, is the first to show which specific parts of attachment theory can be traced back directly to Blatz and his security theory. When Ainsworth started working with Bowlby in the 1950s, around the time he turned to evolutionary theory for an explanation of his findings, she integrated much of Blatzian security theory into Bowlby's theory in the making and used her theoretical and practical experience to enrich attachment theory. Even though Blatz is hardly mentioned nowadays, several of his ideas live on in attachment theory. (c) 2016 APA, all rights reserved).

  9. Separation-Individuation, Adult Attachment Style, and College Adjustment.

    Science.gov (United States)

    Lapsley, Daniel K.; Edgerton, Jason

    2002-01-01

    Examines the relationship between separation- individuation, adult attachment styles, and college adjustment. Results reveal that college adjustment was positively associated with secure adult attachment and counterindicated by fearful and preoccupied attachments. Implications for counseling practice and directions for future research are…

  10. 30 CFR 75.1438 - End attachment replacement.

    Science.gov (United States)

    2010-07-01

    ... 30 Mineral Resources 1 2010-07-01 2010-07-01 false End attachment replacement. 75.1438 Section 75.1438 Mineral Resources MINE SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR COAL MINE SAFETY AND... attachment replacement. Wire rope attachments shall be replaced when cracked, deformed, or excessively worn. ...

  11. 30 CFR 57.19028 - End attachment replacement.

    Science.gov (United States)

    2010-07-01

    ... 30 Mineral Resources 1 2010-07-01 2010-07-01 false End attachment replacement. 57.19028 Section 57.19028 Mineral Resources MINE SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR METAL AND NONMETAL... Hoisting Wire Ropes § 57.19028 End attachment replacement. Wire rope attachments shall be replaced when...

  12. 30 CFR 56.19028 - End attachment replacement.

    Science.gov (United States)

    2010-07-01

    ... 30 Mineral Resources 1 2010-07-01 2010-07-01 false End attachment replacement. 56.19028 Section 56.19028 Mineral Resources MINE SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR METAL AND NONMETAL... Wire Ropes § 56.19028 End attachment replacement. Wire rope attachments shall be replaced when cracked...

  13. 30 CFR 77.1438 - End attachment replacement.

    Science.gov (United States)

    2010-07-01

    ... 30 Mineral Resources 1 2010-07-01 2010-07-01 false End attachment replacement. 77.1438 Section 77.1438 Mineral Resources MINE SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR COAL MINE SAFETY AND... Personnel Hoisting Wire Ropes § 77.1438 End attachment replacement. Wire rope attachments shall be replaced...

  14. The Development of an Assessment Protocol for Reactive Attachment Disorder.

    Science.gov (United States)

    Sheperis, Carl J.; Doggett, R. Anthony; Hoda, Nicholas E.; Blanchard, Tracy; Renfro-Michel, Edina L.; Holdiness, Sacky H.; Schlagheck, Robyn

    2003-01-01

    Proposes a battery of semi-structured interviews, global assessment scales, attachment-specific scales, and behavioral observations to help mental health counselors identify Reactive Attachment Disorder, a syndrome associated with extreme attachment problems. (Contains 25 references and 2 tables.) (GCP)

  15. Attachment systems for mandibular implant overdentures: a systematic review.

    Science.gov (United States)

    Kim, Ha-Young; Lee, Jeong-Yol; Shin, Sang-Wan; Bryant, S Ross

    2012-11-01

    The aim of this systematic review was to address treatment outcome according to attachment systems for mandibular implant overdentures in terms of implant survival rate, prosthetic maintenance and complications, and patient satisfaction. A systematic literature search was conducted using PubMed and hand searching of relevant journals considering inclusion and exclusion criteria. Clinical trial studies on mandibular implant overdentures until August, 2010 were selected if more than one type of overdenture attachment was reported. Twenty four studies from 1098 studies were finally included and the data on implant survival rate, prosthetic maintenance and complications, patient satisfaction were analyzed relative to attachment systems. Four studies presented implant survival rates (95.8 - 97.5% for bar, 96.2 - 100% for ball, 91.7% for magnet) according to attachment system. Ten other studies presented an implant survival rate ranging from 93.3% to 100% without respect to the attachment groups. Common prosthetic maintenance and complications were replacement of an assay for magnet attachments, and activation of a matrix or clip for ball or bar attachments. Prosthetic maintenance and complications most commonly occurred in the magnet groups. Conflicting findings were found on the rate of prosthetic maintenance and complications comparing ball and bar attachments. Most studies showed no significant differences in patient satisfaction depending upon attachment systems. The implant survival rate of mandibular overdentures seemed to be high regardless attachment systems. The prosthetic maintenance and complications may be influenced by attachment systems. However patient satisfaction may be independent of the attachment system.

  16. Preferential Attachment in Online Networks: Measurement and Explanations

    NARCIS (Netherlands)

    Kunegis, J; Blattner, M; Moser, C.

    2013-01-01

    We perform an empirical study of the preferential attachment phenomenon in temporal networks and show that on the Web, networks follow a nonlinear preferential attachment model in which the exponent depends on the type of network considered. The classical preferential attachment model for networks

  17. Stability and Transmission of Attachment across Three Generations.

    Science.gov (United States)

    Benoit, Diane; Parker, Kevin C. H.

    1994-01-01

    The stability of adult attachment and transmission of attachment across 3 generations were examined in a longitudinal study of 96 infants, their mothers, and maternal grandmothers. The study found that mothers' Adult Attachment Interview (AAI) classifications were stable over 12 months in 90% of mothers and 73% of grandmothers, using the AAI's…

  18. Parental Attachment, Interparental Conflict, and Young Adults' Emotional Adjustment

    Science.gov (United States)

    Ross, Jennifer; Fuertes, Jairo

    2010-01-01

    This study extends Engels et al.'s model of emotional adjustment to young adults and includes the constructs of interparental conflict and conflict resolution. Results indicate that parental attachment is better conceived as a two-factor construct of mother and father attachment and that although attachment to both mothers and fathers directly…

  19. Attachment and eating disorders: a review of current research.

    Science.gov (United States)

    Tasca, Giorgio A; Balfour, Louise

    2014-11-01

    Attachment insecurity may confer risk for developing an eating disorder. We describe domains of attachment functioning that are relevant to eating disorders including: affect regulation, interpersonal style, coherence of mind, and reflective functioning. Research since 2000 on attachment and eating disorders related to these domains is reviewed. We searched MedLine/Pubmed and PsycINFO from January 2000 to February 2014 and kept articles that: were empirical, included adults with a diagnosed eating disorder, and used a standard attachment measure. We retained 50 relevant studies. Compared to controls, those with eating disorders had higher levels of attachment insecurity and disorganized mental states. Lower reflective functioning was specifically associated with anorexia nervosa. Attachment anxiety was associated with eating disorder symptom severity, and this relationship may be mediated by perfectionism and affect regulation strategies. Type of attachment insecurity had specific negative impacts on psychotherapy processes and outcomes, such that higher attachment avoidance may lead to dropping out and higher attachment anxiety may lead to poorer treatment outcomes. Research to date suggests a possible relationship between attachment insecurity and risk for an eating disorder. More research is needed that uses attachment interviews, and longitudinal and case control designs. Clinicians can assess attachment insecurity to help inform therapeutic stances and interventions. © 2014 Wiley Periodicals, Inc.

  20. Adult Attachment and Disordered Eating in Undergraduate Men and Women

    Science.gov (United States)

    Elgin, Jenna; Pritchard, Mary

    2006-01-01

    Previous research on gender differences between males and females on the risk factors leading to disordered eating is sparse, especially on males and eating disorders using attachment theory. This study examined the relationship between adult attachment style and disordered eating in men and women. Secure attachment scores were significantly…

  1. Dimensions of attachment among fans within the South African ...

    African Journals Online (AJOL)

    Attachment to the level of sport in general appeared to be the most highly correlated form of attachment with attendance. Fans appear to attach greater importance to the sport, the level of soccer and the team as opposed to specific players or the coach. The study proposes a framework reflecting both its practical application ...

  2. Predictors of Child Molestation: Adult Attachment, Cognitive Distortions, and Empathy

    Science.gov (United States)

    Wood, Eric; Riggs, Shelley

    2008-01-01

    A conceptual model derived from attachment theory was tested by examining adult attachment style, cognitive distortions, and both general and victim empathy in a sample of 61 paroled child molesters and 51 community controls. Results of logistic multiple regression showed that attachment anxiety, cognitive distortions, high general empathy but low…

  3. Attachment Theory in Supervision: A Critical Incident Experience

    Science.gov (United States)

    Pistole, M. Carole; Fitch, Jenelle C.

    2008-01-01

    Critical incident experiences are a powerful source of counselor development (T. M. Skovholt & P. R. McCarthy, 1988a, 1988b) and are relevant to attachment issues. An attachment theory perspective of supervision is presented and applied to a critical incident case scenario. By focusing on the behavioral systems (i.e., attachment, caregiving, and…

  4. Attachment and group psychotherapy: introduction to a special section.

    Science.gov (United States)

    Tasca, Giorgio A

    2014-03-01

    The application of attachment theory to adult psychotherapy represents a growing area of research and practice. Despite the conceptual overlap between group therapeutic factors, attachment theory, and therapeutic tasks as outlined by Bowlby (1988), there is little research on attachment functioning in group therapy. Hence, there remain substantial questions about the role of attachment theory in understanding group therapy processes and outcomes. The three studies in this special section advance the research in some of these important areas, including showing that positive changes in self-reported attachment insecurity among clients persist long after group therapy ends; attachment anxiety affects the level and rate of interpersonal learning in groups; and change in attachment to the therapy group has an impact on longer term change in individual group members' attachment. Each article also examines the impact of these attachment concepts on treatment outcomes. Numerous areas remain to be explored when it comes to the implications of attachment theory for understanding and conducting group therapy, including the conceptual and practical overlap between attachment concepts such as security and exploration with group therapeutic factors such as cohesion and interpersonal learning. The articles in this special section begin to address some of these issues related to attachment theory and its implications for group therapists. (c) 2014 APA, all rights reserved.

  5. The difficult patient: an attachment perspective | Panzer | South ...

    African Journals Online (AJOL)

    Stressors such as illness, injury and hospitalisation are likely to activate attachment behaviours. The way people react to these stressors (i.e. their illness behaviour) varies widely and is strongly correlated with their attachment style. In this paper we briefly review attachment theory, with reference to difficult patient ...

  6. Early Attachment Relationships and the Early Childhood Curriculum

    Science.gov (United States)

    Cortazar, Alejandra; Herreros, Francisca

    2010-01-01

    This article explores the relationship between attachment theory and the early childhood curriculum. During the first years of life children develop early attachment relationships with their primary caregivers. These attachment relationships, either secure or insecure, will shape children's socio-emotional development. In the USA, the predominant…

  7. Epistemological Development and Attachment in European College Students

    Science.gov (United States)

    Faria, Carla; Soares, Isabel; Silva, Carolina; Bastos, Alice

    2015-01-01

    Epistemological development and attachment theory have been independent frameworks for understanding psychological development. This study examined the association between epistemological development (using the Measure of Epistemological Reflection) and attachment (using the Adult Attachment Interview) in a sample of 60 pre- and postgraduated…

  8. Attachment Styles among Bullies, Victims and Uninvolved Adolescents

    Science.gov (United States)

    Koiv, Kristi

    2012-01-01

    Attachment theory provides a frame for understanding the role of attachment styles in the development of bullying behaviour in adolescence. The present study examined attachment styles (secure, avoidant and anxious/ambivalent) that differentiated bullies, victims, bully/victims and uninvolved adolescents. A total of 1,921 students (1,006 girls and…

  9. Fathers in Attachment Theory and Research: A Review

    Science.gov (United States)

    Bretherton, Inge

    2010-01-01

    This paper provides a brief history of attachment research on fathers as a backdrop against which the other contributions to this volume can be viewed. Empirical research on child-father attachment progressed in four phases and began before Bowlby in 1969 published the first volume of his attachment trilogy. During each phase a different set of…

  10. Photoswitchable method for the ordered attachment of proteins to surfaces

    Science.gov (United States)

    Camarero, Julio A.; De Yoreo, James J.; Kwon, Youngeun

    2010-04-20

    Described herein is a method for the attachment of proteins to any solid support with control over the orientation of the attachment. The method is extremely efficient, not requiring the previous purification of the protein to be attached, and can be activated by UV-light. Spatially addressable arrays of multiple protein components can be generated by using standard photolithographic techniques.

  11. 30 CFR 75.1436 - Drum end attachment.

    Science.gov (United States)

    2010-07-01

    ... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Drum end attachment. 75.1436 Section 75.1436 Mineral Resources MINE SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR COAL MINE SAFETY AND HEALTH MANDATORY SAFETY STANDARDS-UNDERGROUND COAL MINES Hoisting and Mantrips Wire Ropes § 75.1436 Drum end attachment. (a) For drum end attachment, wir...

  12. Neutralizing antibody response during human immunodeficiency virus type 1 infection: type and group specificity and viral escape

    DEFF Research Database (Denmark)

    Arendrup, M; Sönnerborg, A; Svennerholm, B

    1993-01-01

    of recombinant soluble gp120IIIB to cell-associated CD4, but group-specific virus neutralization required binding of NA to HIV-1 prior to viral attachment to target cells. Consecutive escape virus isolates were tested for sensitivity to neutralization by heterologous sera. Only minor differences were...

  13. Effects of implant angulations and attachment configurations on the retentive forces of locator attachment-retained overdentures.

    Science.gov (United States)

    Uludag, Bulent; Polat, Serdar; Sahin, Volkan; Çomut, Ali Alper

    2014-01-01

    The aim of this study was to evaluate the effects of different implant angulations and attachment configurations on the retentive forces of locator attachment-retained overdentures over a simulated time period of 6 months. Two acrylic resin models (models 1 and 2) were fabricated to represent an edentulous mandible. In model 1, the midline implant (in the central region) was vertical and the other two implants (in the canine regions) were 20 degrees divergent from the midline, reaching a total divergence of 40 degrees. In model 2, all three implants were vertically oriented, perpendicular to the occlusal plane and parallel to each other. Three-point vertical pull-out forces were employed in a universal testing machine at a constant crosshead speed of 50 mm/min after overdenture construction and a simulation of 6 months of repeated insertions/removals of the overdenture. Locator attachments with different male combinations and bar and clip attachments were tested in model 1. Clear locator attachments and bar and clip attachments were tested in model 2 and served as controls. The initial retentive forces of all attachments in both models ranged from 26.58 to 62.05 N, whereas the initial retentive forces of the attachments for only model 1 ranged from 49.58 to 62.05 N. The highest retention value was recorded for clear green locator attachments and the lowest for hader bar yellow clip attachments. Locator attachments showed higher retention values than hader bar yellow clip attachments. All attachment systems demonstrated a decrease in retention over time. Locator attachments provided better retention than hader bar yellow clip attachments. The highest retention values were obtained when green male locators were used in combination with male attachments.

  14. A Generic Quantitative Risk Assessment Framework for the Entry of Bat-Borne Zoonotic Viruses into the European Union.

    Directory of Open Access Journals (Sweden)

    Robin R L Simons

    Full Text Available Bat-borne viruses have been linked to a number of zoonotic diseases; in 2014 there have been human cases of Nipah virus (NiV in Bangladesh and Ebola virus in West and Central Africa. Here we describe a model designed to provide initial quantitative predictions of the risk of entry of such viruses to European Union (EU Member States (MSs through four routes: human travel, legal trade (e.g. fruit and animal products, live animal movements and illegal importation of bushmeat. The model utilises available datasets to assess the movement via these routes between individual countries of the world and EU MSs. These data are combined with virus specific data to assess the relative risk of entry between EU MSs. As a case study, the model was parameterised for NiV. Scenario analyses showed that the selection of exporting countries with NiV and potentially contaminated trade products were essential to the accuracy of all model outputs. Uncertainty analyses of other model parameters identified that the model expected number of years to an introduction event within the EU was highly susceptible to the prevalence of NiV in bats. The relative rankings of the MSs and routes, however, were more robust. The UK, the Netherlands and Germany were consistently the most likely points of entry and the ranking of most MSs varied by no more than three places (maximum variation five places. Legal trade was consistently the most likely route of entry, only falling below human travel when the estimate of the prevalence of NiV in bats was particularly low. Any model-based calculation is dependent on the data available to feed into the model and there are distinct gaps in our knowledge, particularly in regard to various pathogen/virus as well as host/bat characteristics. However, the strengths of this model lie in the provision of relative comparisons of risk among routes and MSs. The potential for expansion of the model to include other routes and viruses and the possibility

  15. A Generic Quantitative Risk Assessment Framework for the Entry of Bat-Borne Zoonotic Viruses into the European Union.

    Science.gov (United States)

    Simons, Robin R L; Horigan, Verity; Gale, Paul; Kosmider, Rowena D; Breed, Andrew C; Snary, Emma L

    2016-01-01

    Bat-borne viruses have been linked to a number of zoonotic diseases; in 2014 there have been human cases of Nipah virus (NiV) in Bangladesh and Ebola virus in West and Central Africa. Here we describe a model designed to provide initial quantitative predictions of the risk of entry of such viruses to European Union (EU) Member States (MSs) through four routes: human travel, legal trade (e.g. fruit and animal products), live animal movements and illegal importation of bushmeat. The model utilises available datasets to assess the movement via these routes between individual countries of the world and EU MSs. These data are combined with virus specific data to assess the relative risk of entry between EU MSs. As a case study, the model was parameterised for NiV. Scenario analyses showed that the selection of exporting countries with NiV and potentially contaminated trade products were essential to the accuracy of all model outputs. Uncertainty analyses of other model parameters identified that the model expected number of years to an introduction event within the EU was highly susceptible to the prevalence of NiV in bats. The relative rankings of the MSs and routes, however, were more robust. The UK, the Netherlands and Germany were consistently the most likely points of entry and the ranking of most MSs varied by no more than three places (maximum variation five places). Legal trade was consistently the most likely route of entry, only falling below human travel when the estimate of the prevalence of NiV in bats was particularly low. Any model-based calculation is dependent on the data available to feed into the model and there are distinct gaps in our knowledge, particularly in regard to various pathogen/virus as well as host/bat characteristics. However, the strengths of this model lie in the provision of relative comparisons of risk among routes and MSs. The potential for expansion of the model to include other routes and viruses and the possibility of rapid

  16. Phenotypes of non-attached Pseudomonas aeruginosa aggregates resemble surface attached biofilm.

    Directory of Open Access Journals (Sweden)

    Morten Alhede

    Full Text Available For a chronic infection to be established, bacteria must be able to cope with hostile conditions such as low iron levels, oxidative stress, and clearance by the host defense, as well as antibiotic treatment. It is generally accepted that biofilm formation facilitates tolerance to these adverse conditions. However, microscopic investigations of samples isolated from sites of chronic infections seem to suggest that some bacteria do not need to be attached to surfaces in order to establish chronic infections. In this study we employed scanning electron microscopy, confocal laser scanning microscopy, RT-PCR as well as traditional culturing techniques to study the properties of Pseudomonas aeruginosa aggregates. We found that non-attached aggregates from stationary-phase cultures have comparable growth rates to surface attached biofilms. The growth rate estimations indicated that, independently of age, both aggregates and flow-cell biofilm had the same slow growth rate as a stationary phase shaking cultures. Internal structures of the aggregates matrix components and their capacity to survive otherwise lethal treatments with antibiotics (referred to as tolerance and resistance to phagocytes were also found to be strikingly similar to flow-cell biofilms. Our data indicate that the tolerance of both biofilms and non-attached aggregates towards antibiotics is reversible by physical disruption. We provide evidence that the antibiotic tolerance is likely to be dependent on both the physiological states of the aggregates and particular matrix components. Bacterial surface-attachment and subsequent biofilm formation are considered hallmarks of the capacity of microbes to cause persistent infections. We have observed non-attached aggregates in the lungs of cystic fibrosis patients; otitis media; soft tissue fillers and non-healing wounds, and we propose that aggregated cells exhibit enhanced survival in the hostile host environment, compared with non

  17. Is social attachment an addictive disorder?

    Science.gov (United States)

    Insel, Thomas R

    2003-08-01

    There is a considerable literature on the neurobiology of reward, based largely on studies of addiction or substance abuse. This review considers the possibility that the neural circuits that mediate reward evolved for ethologically relevant cues, such as social attachment. Specifically, mesocorticolimbic dopamine appears important for maternal behavior in rats and pair bonding in monogamous voles. It is not yet clear that dopamine in this pathway mediates the hedonic properties of social bond formation or whether dopamine's role is more relevant to developing associative networks or assigning salience to social stimuli. The neuropeptides oxytocin (OT) and vasopressin (AVP) appear to be critical for linking social signals to the mesocorticolimbic circuit.

  18. The ebbs and flows of attachment: Within-person variation in attachment undermine secure individuals' relationship wellbeing across time.

    Science.gov (United States)

    Girme, Yuthika U; Agnew, Christopher R; VanderDrift, Laura E; Harvey, S Marie; Rholes, W Steven; Simpson, Jeffry A

    2018-03-01

    Although attachment security is relatively stable over time, individuals do experience significant within-person variation in their attachment security across time. No research to date, however, has assessed the relational consequences of within-person variation (fluctuations) in attachment security toward a specific attachment figure. Study 1 (N = 409) first examined whether attachment security was associated with individuals' expectations that their current intimate relationship would be stable and consistent over time (vs. inconsistent and unstable). Studies 2 and 3 extended this by examining the prevalence and consequences of actual within-person variation (fluctuations) in relationship-specific attachment security toward an intimate partner in 2 multiwave longitudinal studies that assessed individuals (Study 2, N = 324) and couples (Study 3, N = 171 dyads). The results indicate that secure individuals (those low in attachment anxiety or attachment avoidance) expect their current relationship to remain relatively stable and consistent over time (Study 1). However, Studies 2 and 3 demonstrated that most individuals do experience fluctuations in their relationship-specific attachment security. Moreover, greater fluctuations predict declines in relationship satisfaction (Studies 2 and 3) and increases in relationship distress (Study 3) over time, but primarily for secure individuals (those low in baseline attachment anxiety or attachment avoidance). This set of findings highlight the importance of examining within-person fluctuations in attachment security, which are associated with declines in trajectories of relationship wellbeing, particularly for secure individuals who anticipate greater stability in their relationships. (PsycINFO Database Record (c) 2018 APA, all rights reserved).

  19. Zika Virus and Pregnancy

    Medline Plus

    Full Text Available ... Education & Events Advocacy For Patients About ACOG Zika Virus and Pregnancy Home For Patients Zika Virus and ... Education Pamphlets - Spanish Share: PEV002, September 2016 Zika Virus and Pregnancy There are risks to your fetus ...

  20. Zika Virus and Pregnancy

    Medline Plus

    Full Text Available ... Advocacy For Patients About ACOG Zika Virus and Pregnancy Home For Patients Zika Virus and Pregnancy Page ... Spanish Share: PEV002, September 2016 Zika Virus and Pregnancy There are risks to your fetus if you ...

  1. Zika Virus and Pregnancy

    Medline Plus

    Full Text Available ... Management Education & Events Advocacy For Patients About ACOG Zika Virus and Pregnancy Home For Patients Zika Virus and ... Patient Education Pamphlets - Spanish Share: PEV002, September 2016 Zika Virus and Pregnancy There are risks to your fetus ...

  2. Zika Virus and Pregnancy

    Science.gov (United States)

    ... Management Education & Events Advocacy For Patients About ACOG Zika Virus and Pregnancy Home For Patients Zika Virus and ... Patient Education Pamphlets - Spanish Share: PEV002, September 2016 Zika Virus and Pregnancy There are risks to your fetus ...

  3. Zika Virus and Pregnancy

    Medline Plus

    Full Text Available ... Management Education & Events Advocacy For Patients About ACOG Zika Virus and Pregnancy Home For Patients Zika Virus ... Patient Education Pamphlets - Spanish Share: PEV002, September 2016 Zika Virus and Pregnancy There are risks to your ...

  4. Computer Viruses: An Overview.

    Science.gov (United States)

    Marmion, Dan

    1990-01-01

    Discusses the early history and current proliferation of computer viruses that occur on Macintosh and DOS personal computers, mentions virus detection programs, and offers suggestions for how libraries can protect themselves and their users from damage by computer viruses. (LRW)

  5. Attachment security, personality, and adjustment of elementary school children.

    Science.gov (United States)

    Goldner, Limor; Scharf, Miri

    2013-01-01

    Children's development is assumed to be closely related to their attachment security and their personality. The authors' aim was to examine the joint contribution of attachment security and personality traits to children's adjustment by examining diverse children's outcomes (emotional symptoms, social functioning, and behavioral problems) and using various perspectives (children, parents, and teachers). The sample comprised 247 8-12-year-old children from low socioeconomic status neighborhoods. Personality and attachment contribute to the different domains of adjustment. In cases of moderation, attachment security moderates the implications of personality traits on children's adjustment. The findings highlight the contribution of positive personality tendencies in playing down the difficulties of insecurely attached children.

  6. Precision Attachments for Aesthetics and Function: A Case Report

    Science.gov (United States)

    Shetty, Nitin Bhaskar; Shetty, Sanyuktha; E, Nagaraj; Shetty, Omkar; D’souza, Raina

    2014-01-01

    Successful restoration of the dentition requires plenty of contemporary and conventional treatment techniques and planning and attachment retained partial dentures are one such kind of treatment modality in prosthodontics. Limited space for extracoronal attachments is a serious gap in the design and the fabrication of a precision attachment Removable Partial Denture (RPD). A custom semi-precision attachment with a partial denture offers strength and improved aesthetics in cases with minimal space. This article presents a method of fabrication of semi-precision attachment to eliminate metal display and enhance aestheticity. PMID:24596792

  7. Attachment and prejudice: The mediating role of empathy.

    Science.gov (United States)

    Boag, Elle M; Carnelley, Katherine B

    2016-06-01

    In two studies, we examined the novel hypothesis that empathy is a mechanism through which the relationship between attachment patterns and prejudice can be explained. Study 1 examined primed attachment security (vs. neutral prime), empathy, and prejudice towards immigrants. Study 2 examined primed attachment patterns (secure, avoidant, anxious), empathy subscales (perspective taking, empathic concern, personal distress), and prejudice towards Muslims. Across both studies, empathy mediated the relationship between primed attachment security and low prejudice levels. The findings suggest that enhancing felt security and empathic skills in individuals high in attachment-avoidance may lead to reduced prejudice. © 2015 The British Psychological Society.

  8. Using routine surveillance data to estimate the epidemic potential of emerging zoonoses: application to the emergence of US swine origin influenza A H3N2v virus.

    Science.gov (United States)

    Cauchemez, Simon; Epperson, Scott; Biggerstaff, Matthew; Swerdlow, David; Finelli, Lyn; Ferguson, Neil M

    2013-01-01

    Prior to emergence in human populations, zoonoses such as SARS cause occasional infections in human populations exposed to reservoir species. The risk of widespread epidemics in humans can be assessed by monitoring the reproduction number R (average number of persons infected by a human case). However, until now, estimating R required detailed outbreak investigations of human clusters, for which resources and expertise are not always available. Additionally, existing methods do not correct for important selection and under-ascertainment biases. Here, we present simple estimation methods that overcome many of these limitations. Our approach is based on a parsimonious mathematical model of disease transmission and only requires data collected through routine surveillance and standard case investigations. We apply it to assess the transmissibility of swine-origin influenza A H3N2v-M virus in the US, Nipah virus in Malaysia and Bangladesh, and also present a non-zoonotic example (cholera in the Dominican Republic). Estimation is based on two simple summary statistics, the proportion infected by the natural reservoir among detected cases (G) and among the subset of the first detected cases in each cluster (F). If detection of a case does not affect detection of other cases from the same cluster, we find that R can be estimated by 1-G; otherwise R can be estimated by 1-F when the case detection rate is low. In more general cases, bounds on R can still be derived. We have developed a simple approach with limited data requirements that enables robust assessment of the risks posed by emerging zoonoses. We illustrate this by deriving transmissibility estimates for the H3N2v-M virus, an important step in evaluating the possible pandemic threat posed by this virus. Please see later in the article for the Editors' Summary.

  9. Using routine surveillance data to estimate the epidemic potential of emerging zoonoses: application to the emergence of US swine origin influenza A H3N2v virus.

    Directory of Open Access Journals (Sweden)

    Simon Cauchemez

    Full Text Available Prior to emergence in human populations, zoonoses such as SARS cause occasional infections in human populations exposed to reservoir species. The risk of widespread epidemics in humans can be assessed by monitoring the reproduction number R (average number of persons infected by a human case. However, until now, estimating R required detailed outbreak investigations of human clusters, for which resources and expertise are not always available. Additionally, existing methods do not correct for important selection and under-ascertainment biases. Here, we present simple estimation methods that overcome many of these limitations.Our approach is based on a parsimonious mathematical model of disease transmission and only requires data collected through routine surveillance and standard case investigations. We apply it to assess the transmissibility of swine-origin influenza A H3N2v-M virus in the US, Nipah virus in Malaysia and Bangladesh, and also present a non-zoonotic example (cholera in the Dominican Republic. Estimation is based on two simple summary statistics, the proportion infected by the natural reservoir among detected cases (G and among the subset of the first detected cases in each cluster (F. If detection of a case does not affect detection of other cases from the same cluster, we find that R can be estimated by 1-G; otherwise R can be estimated by 1-F when the case detection rate is low. In more general cases, bounds on R can still be derived.We have developed a simple approach with limited data requirements that enables robust assessment of the risks posed by emerging zoonoses. We illustrate this by deriving transmissibility estimates for the H3N2v-M virus, an important step in evaluating the possible pandemic threat posed by this virus. Please see later in the article for the Editors' Summary.

  10. Dengue virus receptor

    OpenAIRE

    Hidari, Kazuya I.P.J.; Suzuki, Takashi

    2011-01-01

    Dengue virus is an arthropod-borne virus transmitted by Aedes mosquitoes. Dengue virus causes fever and hemorrhagic disorders in humans and non-human primates. Direct interaction of the virus introduced by a mosquito bite with host receptor molecule(s) is crucial for virus propagation and the pathological progression of dengue diseases. Therefore, elucidation of the molecular mechanisms underlying the interaction between dengue virus and its receptor(s) in both humans and mosquitoes is essent...

  11. Computer Virus and Trends

    OpenAIRE

    Tutut Handayani; Soenarto Usna,Drs.MMSI

    2004-01-01

    Since its appearance the first time in the mid-1980s, computer virus has invited various controversies that still lasts to this day. Along with the development of computer systems technology, viruses komputerpun find new ways to spread itself through a variety of existing communications media. This paper discusses about some things related to computer viruses, namely: the definition and history of computer viruses; the basics of computer viruses; state of computer viruses at this time; and ...

  12. A systematic review of adult attachment and social anxiety.

    Science.gov (United States)

    Manning, Ray P C; Dickson, Joanne M; Palmier-Claus, Jasper; Cunliffe, Alexandra; Taylor, Peter J

    2017-03-15

    Attachment has been implicated in the development of social anxiety. Our aim was to synthesise the extant literature exploring the role of adult attachment in these disorders. Search terms relating to social anxiety and attachment were entered into MEDLINE, PsycINFO and Web of Science. Risk of bias of included studies was assessed using and adapted version of the Agency for Healthcare Research and Quality assessment tool. Eligible studies employed validated social anxiety and attachment assessments in adult clinical and analogue samples. The review included cross sectional, interventional and longitudinal research. Of the 30 identified studies, 28 showed a positive association between attachment insecurity and social anxiety. This association was particularly strong when considering attachment anxiety. Cognitive variables and evolutionary behaviours were identified as potential mediators, concordant with psychological theory. Due to a lack of longitudinal research, the direction of effect between attachment and social anxiety variables could not be inferred. There was substantial heterogeneity in the way that attachment was conceptualised and assessed across studies. The literature indicates that attachment style is associated with social anxiety. Clinicians may wish to consider attachment theory when working clinically with this population. In the future, it may be useful to target the processes that mediate the relationship between attachment and social anxiety. Copyright © 2017 Elsevier B.V. All rights reserved.

  13. Relationship between attachment and executive dysfunction in the homeless.

    Science.gov (United States)

    Rodríguez-Pellejero, José M; Núñez, Juan L

    2018-02-01

    The executive functions of the homeless may be contributing to the success or failure of social integration processes. The goal of this study was to analyze the relationship between attachment and executive dysfunction in the homeless, specifically, to analyze the prevalence of adult attachment and executive dysfunction patterns, as well as the predictive power of different types of attachment for executive functioning. Participants were 107 homeless. Descriptive analysis revealed the prevalence of insecure attachment, and a high prevalence of clinically significant executive dysfunction. Regression analysis showed that attachment predicts all the executive functions, although the predictive power of attachment decreased when entering the variable drug addiction. People in a situation of chronic social exclusion are characterized by an insecure attachment style and moderate levels of executive dysfunction.

  14. The association between state attachment security and state Mindfulness.

    Directory of Open Access Journals (Sweden)

    Christopher A Pepping

    Full Text Available Recent research suggests that attachment and mindfulness are related, though the nature of this association is unclear. Here we present two studies examining whether there is a causal relationship between state attachment and state mindfulness. Study 1 investigated the effects of experimentally increasing state mindfulness on state attachment security. State mindfulness was successfully enhanced, but this led to no change in state attachment security. Study 2 investigated the effects of experimentally enhancing state attachment security on state mindfulness. State attachment security was successfully enhanced, but this did not lead to any change in state mindfulness. These findings suggest that there is not a direct, immediate causal relationship between state attachment and state mindfulness as a result of brief experimental manipulations. Future research should examine these associations in longer term interventions.

  15. Relationships between attachment and marital satisfaction in married couples

    Directory of Open Access Journals (Sweden)

    Patrícia Gallerová

    2016-01-01

    Full Text Available Theory of attachment strongly influences exploring of close relationships in childhood and in adulthood as well. According Bowlby attachment is "lasting relationship bond characterized by need of seeking and maintaining proximity with a person in stressful situations especially (Bowbly, 2010. Hazan a Shaver (1987 applied theory of early attachment in romantic relationships of adults. Behavior of adult human in relationships is more or less predictable by style of attachment in childhood (Feeney, 1999. Brennan, Clark a Shaver (1998 created four-dimensional model of attachment which was based on Ainsworth´s theory as well. The model was formed of two dimensions - anxiety and avoidance. The authors identified four types of attachment: secure, fearful, dismissive and preoccupied style of attachment (Brennan, Clark, & Shaver, 1998. Satisfaction in romantic relationship can be explained as a degree in which is relationship for a human enojyable. Attachment influences satisfaction in relationship in terms of meeting need of proximity and safety (Mikulincer, Florian, Cowan, & Cowan, 2002. Several researches show that safe attachment is associated with higher satisfaction in marriage and on the other hand people with insecure style of attachment show lower degree of satisfaction in relationship (Alexandrov, Cowan, & Cowan, 2005; Treboux, Crowell, & Waters, 2004. At the same time style of attachment of the partner also influences individual a lot, satisfaction does not depend only on his own style of attachment but also on attachment of his partner (Farinelli, & McEwan, 2009. The study examined relations between the relationship attachment and marital satisfaction. The goal was to explain the relationship between the adult attachment and marital satisfaction of the individual and her/his husband/wife. The research examined relationship between adult attachment and marital satisfaction as well. Quantitative questionnaire survey: The battery consisted of

  16. Adolescent attachment insecurity and parasympathetic functioning predict future loss adjustment.

    Science.gov (United States)

    Fagundes, Christopher P; Diamond, Lisa M; Allen, Kendrick P

    2012-06-01

    Losing a close relationship is highly stressful and a robust predictor of major depression in adolescents. The current study examined relationships between attachment insecurity, parasympathetic nervous system activity, indexed by respiratory sinus arrhythmia (RSA), and adolescent adjustment to the loss of a close social partner. Adolescents with more attachment anxiety to their mother at age 14 were more likely to report poorer adjustment to a subsequent loss than adolescents with less attachment anxiety. Attachment avoidance interacted with stress-induced changes in RSA to predict loss adjustment. Among adolescents with higher RSA in response to the stressor, those with more attachment avoidance reported better loss adjustment, whereas among adolescents with lower RSA in response to the stressor, those with more attachment avoidance reported poorer loss adjustment. In sum, the combination of attachment insecurity and stress-induced changes in RSA predicted how well adolescents adjusted to a loss.

  17. No serological evidence that harbour porpoises are additional hosts of influenza B viruses.

    Directory of Open Access Journals (Sweden)

    Rogier Bodewes

    Full Text Available Influenza A and B viruses circulate among humans causing epidemics almost annually. While various hosts for influenza A viruses exist, influenza B viruses have been detected only in humans and seals. However, recurrent infections of seals in Dutch coastal waters with influenza B viruses that are antigenetically distinct from influenza B viruses circulating among humans suggest that influenza B viruses have been introduced into this seal population by another, non-human, host. Harbour porpoises (Phocoena phocoena are sympatric with seals in these waters and are also occasionally in close contact with humans after stranding and subsequent rehabilitation. In addition, virus attachment studies demonstrated that influenza B viruses can bind to cells of the respiratory tract of these animals. Therefore, we hypothesized that harbour porpoises might be a reservoir of influenza B viruses. In the present study, an unique set of serum samples from 79 harbour porpoises, stranded alive on the Dutch coast between 2003 and 2013, was tested for the presence of antibodies against influenza B viruses by use of the hemagglutination inhibition test and for antibodies against influenza A viruses by use of a competitive influenza A nucleoprotein ELISA. No antibodies were detected against either virus, suggesting that influenza A and B virus infections of harbour porpoises in Dutch coastal waters are not common, which was supported by statistical analysis of the dataset.

  18. No serological evidence that harbour porpoises are additional hosts of influenza B viruses.

    Science.gov (United States)

    Bodewes, Rogier; van de Bildt, Marco W G; van Elk, Cornelis E; Bunskoek, Paulien E; van de Vijver, David A M C; Smits, Saskia L; Osterhaus, Albert D M E; Kuiken, Thijs

    2014-01-01

    Influenza A and B viruses circulate among humans causing epidemics almost annually. While various hosts for influenza A viruses exist, influenza B viruses have been detected only in humans and seals. However, recurrent infections of seals in Dutch coastal waters with influenza B viruses that are antigenetically distinct from influenza B viruses circulating among humans suggest that influenza B viruses have been introduced into this seal population by another, non-human, host. Harbour porpoises (Phocoena phocoena) are sympatric with seals in these waters and are also occasionally in close contact with humans after stranding and subsequent rehabilitation. In addition, virus attachment studies demonstrated that influenza B viruses can bind to cells of the respiratory tract of these animals. Therefore, we hypothesized that harbour porpoises might be a reservoir of influenza B viruses. In the present study, an unique set of serum samples from 79 harbour porpoises, stranded alive on the Dutch coast between 2003 and 2013, was tested for the presence of antibodies against influenza B viruses by use of the hemagglutination inhibition test and for antibodies against influenza A viruses by use of a competitive influenza A nucleoprotein ELISA. No antibodies were detected against either virus, suggesting that influenza A and B virus infections of harbour porpoises in Dutch coastal waters are not common, which was supported by statistical analysis of the dataset.

  19. Peer attachment: a meta-analytic review of gender and age differences and associations with parent attachment.

    Science.gov (United States)

    Gorrese, Anna; Ruggieri, Ruggero

    2012-05-01

    In adolescence, peers represent key actors within individual social network. Given the relevance of peer connections and the growing literature examining them, the purpose of this article was to review, through a meta-analytic approach, studies on adolescent and youth peer relationships within the theoretical framework of attachment. First, we synthesized results of 44 studies focused on relationships between parent and peer attachment. Second, we summarized findings of 54 studies reporting gender differences on peer attachment. Third, we computed an overall effect for age differences on peer attachment documented in 19 studies. Main findings highlighted that parent attachment is moderately correlated to peer attachment; that females were significantly more attached to their peers than males; and that the correlation between age and peer attachment was not significant. This set of findings was confirmed examining both overall peer attachment as well as specific dimensions of attachment, such as trust and communication. Furthermore, since a significant heterogeneity was found across studies, we tested the effects of various categorical (i.e., year and language of publication, country, attachment measure) and continuous (i.e., mean age and percentage of females of the sample, number of items of the peer attachment scale) moderators related to characteristics of the study samples and designs. Implications of these findings for future research are discussed. A focus on cultural dimensions and on peer attachment processes would be worthwhile to address relevant research questions: How do peer relationships progressively become mature attachment relationships? How is this process shaped for individuals with different parent attachment histories?

  20. Neoechinulin B and its analogues as potential entry inhibitors of influenza viruses, targeting viral hemagglutinin.

    Science.gov (United States)

    Chen, Xueqing; Si, Longlong; Liu, Dong; Proksch, Peter; Zhang, Lihe; Zhou, Demin; Lin, Wenhan

    2015-03-26

    A class of prenylated indole diketopiperazine alkaloids including 15 new compounds namely rubrumlines A-O obtained from marine-derived fungus Eurotium rubrum, were tested against influenza A/WSN/33 virus. Neoechinulin B (18) exerted potent inhibition against H1N1 virus infected in MDCK cells, and is able to inhibit a panel of influenza virus strains including amantadine- and oseltamivir-resistant clinical isolates. Mechanism of action studies indicated that neoechinulin B binds to influenza envelope hemagglutinin, disrupting its interaction with the sialic acid receptor and the attachment of viruses to host cells. In addition, neoechinulin B was still efficient in inhibiting influenza A/WSN/33 virus propagation even after a fifth passage. The high potency and broad-spectrum activities against influenza viruses with less drug resistance make neoechinulin B as a new lead for the development of potential inhibitor of influenza viruses. Copyright © 2015 Elsevier Masson SAS. All rights reserved.

  1. Charisma and attachment theory: a crossdisciplinary interpretation.

    Science.gov (United States)

    Aberbach, D

    1995-08-01

    The attachment theory of Bowlby and his followers has not previously been applied to the interpretation of charismatic phenomena in the bonding of large numbers of people with their leaders in crisis. This essay, which builds on the author's 'Surviving trauma: loss, literature and psychoanalysis', attempts to use attachment theory and sociological concepts such as homogamy, anomie, negative imprinting and de-individuation, as well as classical Freudian concepts such as transference and splitting of the ego, in interpreting the charismatic bond. It is argued that charismatic homogamy becomes viable at the point of intersection between the inner world of the charismatic leader and social and political reality. The bonding of the individual and the public may be based partly upon a symbolic link between public crisis and the charismatic's experience of trauma that has deeply scarred or even ended the affectional bonds in his family of orientation. This trauma, however, is a source of insight and power as well as of disability, for it has schooled him in crisis and given him the capacity to offer directional leadership. The charismatic and his society are bonded in crisis through a mutual attempt to break free of anomie and alienation, and a sense of powerlessness and despair.

  2. A Galloping Energy Harvester with Attached Flow

    Science.gov (United States)

    Denissenko, Petr; Khovanov, Igor; Tucker-Harvey, Sam

    2017-11-01

    Aeroelastic energy harvesters are a promising technology for the operation of wireless sensors and microelectromechanical systems, as well as providing the possibility of harvesting wind energy in applications were conventional wind turbines are ineffective, such as in highly turbulent flows, or unreliable, such as in harsh environmental conditions. The development of aeroelastic energy harvesters to date has focused on the flutter of airfoils, the galloping of prismatic structures, and the vortex induced vibrations. We present a novel type of galloping energy harvester with the flow becoming attached when the oscillation amplitude is high enough. With the flow attached, the harvester blade acts closer to an aerofoil than a bluff body, which results in a higher efficiency. The dynamics of a prototype device has been characterised experimentally with the use of a motion tracking system. The flow structure in the vicinity of the device has been studied using smoke visualisation and PIV measurements. A lumped parameter mathematical model has been developed and related to the experimental results.

  3. Configurations of polymers attached to probes

    Science.gov (United States)

    Bubis, Roy; Kantor, Yacov; Kardar, Mehran

    2009-11-01

    We study polymers attached to spherical (circular) or paraboloidal (parabolic) probes in three (two) dimensions. Both self-avoiding and random walks are examined numerically. The behavior of a polymer of size R0 attached to the tip of a probe with radius of curvature R, differs qualitatively for large and small values of the ratio s=R0/R. We demonstrate that the scaled compliance (inverse force constant) S/R02, and scaled mean position of the polymer end-point langx⊥rang/R can be expressed as a function of s. Scaled compliance is anisotropic, and quite large in the direction parallel to the surface when R0~R. The exponent γ, characterizing the number of polymer configurations, crosses over from a value of γ1 - characteristic of a planar boundary - at small s to one reflecting the overall shape of the probe at large s. For a spherical probe the crossover is to an unencumbered polymer, while for a parabolic probe we cannot rule out a new exponent.

  4. Predicting Envelope Leakage in Attached Dwellings

    Energy Technology Data Exchange (ETDEWEB)

    Faakye, O.; Arena, L.; Griffiths, D.

    2013-07-01

    The most common method for measuring air leakage is to use a single blower door to pressurize and/or depressurize the test unit. In detached housing, the test unit is the entire home and the single blower door measures air leakage to the outside. In attached housing, this 'single unit', 'total', or 'solo' test method measures both the air leakage between adjacent units through common surfaces as well air leakage to the outside. Measuring and minimizing this total leakage is recommended to avoid indoor air quality issues between units, reduce energy losses to the outside, reduce pressure differentials between units, and control stack effect. However, two significant limitations of the total leakage measurement in attached housing are: for retrofit work, if total leakage is assumed to be all to the outside, the energy benefits of air sealing can be significantly over predicted; for new construction, the total leakage values may result in failing to meet an energy-based house tightness program criterion. The scope of this research is to investigate an approach for developing a viable simplified algorithm that can be used by contractors to assess energy efficiency program qualification and/or compliance based upon solo test results.

  5. [Early attachement relationships and epigenetic customization].

    Science.gov (United States)

    Rocchi, Giordana; Serio, Valentina; Carluccio, Giuseppe Mattia; Marini, Isabella; Meuti, Valentina; Zaccagni, Michela; Giacchetti, Nicoletta; Aceti, Franca

    2015-01-01

    Recently, new findings in epigenetic science switched the focus from the observation of physiological intragenomic dynamics to the idea of an environmental co-construction of phenotypic expression. In psichodynamic field, objectual relations and attachement theoreticians emphasized the interpersonal dimension of individual development, focusing the attention on the relational matrix of self organization. The construction of stable affective-behavioral traits throughout different parenting styles has actually found a coincidence in ethological studies, which have explored the epigenetic processes underlying the relationship between caregiving and HPA stress responsiveness. An adequate parenting style seems to support affective regulation throughout psychobiological hidden moderators, which would tend to rebalance the physiological systems homeostasis; an unconfident attachment style would promote, on the other hand, the allostatic load rise. Sites of longlife epigenetic susceptibility have also been identified in humans; although associated with risk of maladaptive developing in adverse environmental conditions, they seem to confer protection under favorable conditions. This persisting possibility of reorganization of stable traits throughout lifetime, which seems to be activated by a relevant environmental input, grant to significant relationships, and to therapeutical one as well, an implicit reconditioning potential which could result into the configuration of new stable affective-behavioral styles.

  6. Electron attachment to indole and related molecules

    Science.gov (United States)

    Modelli, Alberto; Jones, Derek; Pshenichnyuk, Stanislav A.

    2013-11-01

    Gas-phase formation of temporary negative ion states via resonance attachment of low-energy (0-6 eV) electrons into vacant molecular orbitals of indoline (I), indene (II), indole (III), 2-methylen-1,3,3-trimethylindoline (IV), and 2,3,3-trimethyl-indolenine (V) was investigated for the first time by electron transmission spectroscopy (ETS). The description of their empty-level structures was supported by density functional theory and Hartree-Fock calculations, using empirically calibrated linear equations to scale the calculated virtual orbital energies. Dissociative electron attachment spectroscopy (DEAS) was used to measure the fragment anion yields generated through dissociative decay channels of the parent molecular anions of compounds I-V, detected with a mass filter as a function of the incident electron energy in the 0-14 eV energy range. The vertical and adiabatic electron affinities were evaluated at the B3LYP/6-31+G(d) level as the anion/neutral total energy difference. The same theoretical method is also used for evaluation of the thermodynamic energy thresholds for production of the negative fragments observed in the DEA spectra. The loss of a hydrogen atom from the parent molecular anion ([M-H]-) provides the most intense signal in compounds I-IV. The gas-phase DEAS data can provide support for biochemical reaction mechanisms in vivo involving initial hydrogen abstraction from the nitrogen atom of the indole moiety, present in a variety of biologically important molecules.

  7. Points d’attache : Derrida, Cixous

    Directory of Open Access Journals (Sweden)

    Laura Hughes

    2015-10-01

    Full Text Available Les manuscrits échangés entre Hélène Cixous et Jacques Derrida portent les traces de leur amitié, dont le dialogue traverse des décennies d’écriture littéraire et philosophique. Sur les manuscrits du Prénom de Dieu, de Voiles, et de « Circonfession » – qui ont circulé entre les deux auteurs – on peut lire les marginalia, la ponctuation élargie, et la mise en page reconstituée comme des points d’attache entre manuscrit, écrivain, et lecteur. Nous sommes amenés à considérer la surface de l’objet manuscrit comme un lieu de rencontres perpétuelles qui réactivent l’écriture en archive et au-delà – sujet qui regagne en urgence quant aux nouvelles technologies comme les logiciels de traitement de texte et les disques durs. Ces objets textuels servent aussi bien à lier les deux écrivains à la scène de l’écriture, le lecteur étant pris à témoin, qu’à renouer les attaches entre Cixous et Derrida, les solidifiant à travers l’écriture – même de manière posthume.

  8. Technical Scientific Attaches and domotics. A special issue; Technisch Wetenschappelijk Attaches en domotica. Special

    Energy Technology Data Exchange (ETDEWEB)

    Kleinenberg, R.A. [Ministerie van Economische Zaken, The Hague (Netherlands); Uythof, B.H. [Invenit, Domotica Platform Nederland, Amsterdam (Netherlands); Benedetti, D [Ufficio Tecnico-Scientifico, Ambasciata del Regno dei Paesi Bassi, Rome (Italy); Van Wijngaarden, W.L. [Buero fuer Wissenschaft und Technologie, Kgl. Niederlaendische Botschaft, Bonn (Germany); Leniger, H.D.F. [Bureau du Conseiller Scientifique et Technique, Ambassade des Pays-Bas, Paris (France); Kieboom, J.P. [Office for Science and Technology, Royal Netherlands Embassy, Singapore (Singapore); Van Kooij, E.H. [Netherlands Office for Science and Technology, Royal Netherlands Embassy, Tokyo (Japan); Schuurmans, H.J.A. [Netherlands Office for Science and Technology, San Mateo, CA (United States)

    2000-04-01

    In this Dutch magazine Dutch businesses and institutes are informed about technological developments in industrialized countries (USA, Canada, Japan, South Korea, Taiwan, Singapore, Germany, France and Italy). In this special issue attaches in the different countries present information on developments and trends with respect to domotics, building automation, home networks, etc.

  9. Childhood attachment and schizophrenia: the "attachment-developmental-cognitive" (ADC) hypothesis.

    Science.gov (United States)

    Rajkumar, Ravi Philip

    2014-09-01

    Schizophrenia is a complex psychiatric syndrome whose exact causes remain unclear. However, current scientific consensus has highlighted the importance of neurodevelopmental and neurocognitive processes in the development of schizophrenic symptoms. Research over the past three decades, motivated by the findings of the World Health Organization's large-scale studies, has highlighted the importance of psychosocial adversities - including childhood abuse and neglect - in this disorder. In this paper, I propose a hypothesis based on John Bowlby's framework of attachment theory, which I have termed the attachment-developmental-cognitive (ADC) hypothesis. The ADC hypothesis integrates recent developments related to (1) existing models of schizophrenia, (2) studies examining the effect of attachment on brain biology and cognitive development, and (3) various known facts about the course and outcome of this disorder. In doing so, it explains how disturbed childhood attachment leads to core psychological and neurochemical abnormalities which are implicated in the genesis of schizophrenia and also affect its outcome. The ADC hypothesis compasses and expands on earlier formulations, such as the "social defeat" and "traumagenic" models, and has important implications regarding the prevention and treatment of schizophrenia. Ways of testing and refining this hypothesis are outlined as avenues for future research. Though provisional, the ADC hypothesis is entirely consistent with both biological and psychosocial research into the origins of schizophrenia. Copyright © 2014 Elsevier Ltd. All rights reserved.

  10. Place Attachment in the Bible : The role of attachment to sacred places in religious life

    NARCIS (Netherlands)

    Counted, Agina Victor; Watts, Fraser

    2017-01-01

    This paper examines the role of place attachment in religious life by analyzing various significant place events in the Bible, using analysis of biblical discourse. The paper looks at various biblical places, and explores the implications of approaching these sacred settings in terms of place

  11. Predicting Preschoolers' Attachment Security from Parenting Behaviours, Parents' Attachment Relationships and Their Use of Social Support

    Science.gov (United States)

    Coyl, Diana D.; Newland, Lisa A.; Freeman, Harry

    2010-01-01

    Associations between preschoolers' attachment security, parenting behaviours (i.e. parent-child involvement, parenting consistency and co-parenting consistency) and parenting context (i.e. parents' internal working models (IWMs) and use of social support) were examined in a sample of 235 culturally diverse families. The authors predicted that…

  12. Threats to Parental and Romantic Attachment Figures' Availability and Adult Attachment Insecurity

    Science.gov (United States)

    Holman, Thomas B.; Galbraith, Richard C.; Timmons, Nicole Mead; Steed, April; Tobler, Samuel B.

    2009-01-01

    This study tested hypotheses based on the theoretical idea that threats to parental availability would have a direct effect on later adult attachment insecurity and that this relationship would be partially, but not fully, mediated by threats to the availability of a romantic partner. Participants were 1,063 individuals in a married or unmarried…

  13. Structural Bases of Coronavirus Attachment to Host Aminopeptidase N and Its Inhibition by Neutralizing Antibodies

    Science.gov (United States)

    Mudgal, Gaurav; Ordoño, Desiderio; Enjuanes, Luis; Casasnovas, José M.

    2012-01-01

    The coronaviruses (CoVs) are enveloped viruses of animals and humans associated mostly with enteric and respiratory diseases, such as the severe acute respiratory syndrome and 10–20% of all common colds. A subset of CoVs uses the cell surface aminopeptidase N (APN), a membrane-bound metalloprotease, as a cell entry receptor. In these viruses, the envelope spike glycoprotein (S) mediates the attachment of the virus particles to APN and subsequent cell entry, which can be blocked by neutralizing antibodies. Here we describe the crystal structures of the receptor-binding domains (RBDs) of two closely related CoV strains, transmissible gastroenteritis virus (TGEV) and porcine respiratory CoV (PRCV), in complex with their receptor, porcine APN (pAPN), or with a neutralizing antibody. The data provide detailed information on the architecture of the dimeric pAPN ectodomain and its interaction with the CoV S. We show that a protruding receptor-binding edge in the S determines virus-binding specificity for recessed glycan-containing surfaces in the membrane-distal region of the pAPN ectodomain. Comparison of the RBDs of TGEV and PRCV to those of other related CoVs, suggests that the conformation of the S receptor-binding region determines cell entry receptor specificity. Moreover, the receptor-binding edge is a major antigenic determinant in the TGEV envelope S that is targeted by neutralizing antibodies. Our results provide a compelling view on CoV cell entry and immune neutralization, and may aid the design of antivirals or CoV vaccines. APN is also considered a target for cancer therapy and its structure, reported here, could facilitate the development of anti-cancer drugs. PMID:22876187

  14. Structural bases of coronavirus attachment to host aminopeptidase N and its inhibition by neutralizing antibodies.

    Directory of Open Access Journals (Sweden)

    Juan Reguera

    Full Text Available The coronaviruses (CoVs are enveloped viruses of animals and humans associated mostly with enteric and respiratory diseases, such as the severe acute respiratory syndrome and 10-20% of all common colds. A subset of CoVs uses the cell surface aminopeptidase N (APN, a membrane-bound metalloprotease, as a cell entry receptor. In these viruses, the envelope spike glycoprotein (S mediates the attachment of the virus particles to APN and subsequent cell entry, which can be blocked by neutralizing antibodies. Here we describe the crystal structures of the receptor-binding domains (RBDs of two closely related CoV strains, transmissible gastroenteritis virus (TGEV and porcine respiratory CoV (PRCV, in complex with their receptor, porcine APN (pAPN, or with a neutralizing antibody. The data provide detailed information on the architecture of the dimeric pAPN ectodomain and its interaction with the CoV S. We show that a protruding receptor-binding edge in the S determines virus-binding specificity for recessed glycan-containing surfaces in the membrane-distal region of the pAPN ectodomain. Comparison of the RBDs of TGEV and PRCV to those of other related CoVs, suggests that the conformation of the S receptor-binding region determines cell entry receptor specificity. Moreover, the receptor-binding edge is a major antigenic determinant in the TGEV envelope S that is targeted by neutralizing antibodies. Our results provide a compelling view on CoV cell entry and immune neutralization, and may aid the design of antivirals or CoV vaccines. APN is also considered a target for cancer therapy and its structure, reported here, could facilitate the development of anti-cancer drugs.

  15. The glycoprotein of measles virus

    International Nuclear Information System (INIS)

    Anttonen, O.; Jokinen, M.; Salmi, A.; Vainionpaeae, R.; Gahmberg, C.G.

    1980-01-01

    Measles virus was propagated in VERO cells and purified from the culture supernatants by two successive tartrate-density-gradient centrifugations. Surface carbohydrates were labelled both in vitro and in vivo with 3 H after treatment with galactose oxidase/NaB 3 H 4 or with [ 3 H]glucosamine. The major labelled glycoprotein in measles virions had a mol.wt. of 79000. After labelling with periodate/NaB 3 H 4 , which would result in specific labelling of sialic acid residues, the 79000-mol.wt. glycoprotein was very weakly labelled. This suggested that there is no or a very low amount of sialic acid in the virions. Further analysis of the glycoprotein showed that galactose is the terminal carbohydrate unit in the oligosaccharide, and the molecular weight of the glycopeptide obtained after Pronase digestion is about 3000. The oligosaccharide is attached to the polypeptide through an alkali-stable bond, indicating a N-glycosidic asparagine linkage. (author)

  16. Scaling and biomechanics of surface attachment in climbing animals

    Science.gov (United States)

    Labonte, David; Federle, Walter

    2015-01-01

    Attachment devices are essential adaptations for climbing animals and valuable models for synthetic adhesives. A major unresolved question for both natural and bioinspired attachment systems is how attachment performance depends on size. Here, we discuss how contact geometry and mode of detachment influence the scaling of attachment forces for claws and adhesive pads, and how allometric data on biological systems can yield insights into their mechanism of attachment. Larger animals are expected to attach less well to surfaces, due to their smaller surface-to-volume ratio, and because it becomes increasingly difficult to distribute load uniformly across large contact areas. In order to compensate for this decrease of weight-specific adhesion, large animals could evolve overproportionally large pads, or adaptations that increase attachment efficiency (adhesion or friction per unit contact area). Available data suggest that attachment pad area scales close to isometry within clades, but pad efficiency in some animals increases with size so that attachment performance is approximately size-independent. The mechanisms underlying this biologically important variation in pad efficiency are still unclear. We suggest that switching between stress concentration (easy detachment) and uniform load distribution (strong attachment) via shear forces is one of the key mechanisms enabling the dynamic control of adhesion during locomotion. PMID:25533088

  17. Relationship between attachment styles and happiness in medical students

    Directory of Open Access Journals (Sweden)

    Marzyeh Moghadam

    2016-01-01

    Full Text Available Background: Attachment theory is one of the most important achievements of contemporary psychology. Role of medical students in the community health is important, so we need to know about the situation of happiness and attachment style in these students. Objectives: This study was aimed to assess the relationship between medical students′ attachment styles and demographic characteristics. Materials and Methods: This cross-sectional study was conducted on randomly selected students of Medical Sciences in Kurdistan University, in 2012. To collect data, Hazan and Shaver′s attachment style measure and the Oxford Happiness Questionnaire were used. The results were analyzed using the  SPSS software version 16 (IBM, Chicago IL, USA and statistical analysis was performed via t-test, Chi-square test, and multiple regression tests. Results: Secure attachment style was the most common attachment style and the least common was ambivalent attachment style. Avoidant attachment style was more common among single persons than married people (P = 0.03. No significant relationship was observed between attachment style and gender and grade point average of the studied people. The mean happiness score of students was 62.71. In multivariate analysis, the variables of secure attachment style (P = 0.001, male gender (P = 0.005, and scholar achievement (P = 0.047 were associated with higher happiness score. Conclusion: The most common attachment style was secure attachment style, which can be a positive prognostic factor in medical students, helping them to manage stress. Higher frequency of avoidant attachment style among single persons, compared with married people, is mainly due to their negative attitude toward others and failure to establish and maintain relationships with others.

  18. Adult attachment styles and the psychological response to infant bereavement

    Directory of Open Access Journals (Sweden)

    Mark Shevlin

    2014-05-01

    Full Text Available Background: Based on Bowlby's attachment theory, Bartholomew proposed a four-category attachment typology by which individuals judged themselves and adult relationships. This explanatory model has since been used to help explain the risk of psychiatric comorbidity. Objective: The current study aimed to identify attachment typologies based on Bartholomew's attachment styles in a sample of bereaved parents on dimensions of closeness/dependency and anxiety. In addition, it sought to assess the relationship between the resultant attachment typology with a range of psychological trauma variables. Method: The current study was based on a sample of 445 bereaved parents who had experienced either peri- or post-natal death of an infant. Adult attachment was assessed using the Revised Adult Attachment Scale (RAAS while reaction to trauma was assessed using the Trauma Symptom Checklist (TSC. A latent profile analysis was conducted on scores from the RAAS closeness/dependency and anxiety subscales to ascertain if there were underlying homogeneous attachment classes. Emergent classes were used to determine if these were significantly different in terms of mean scores on TSC scales. Results: A four-class solution was considered the optimal based on fit statistics and interpretability of the results. Classes were labelled “Fearful,” “Preoccupied,” “Dismissing,” and “Secure.” Females were almost eight times more likely than males to be members of the fearful attachment class. This class evidenced the highest scores across all TSC scales while the secure class showed the lowest scores. Conclusions: The results are consistent with Bartholomew's four-category attachment styles with classes representing secure, fearful, preoccupied, and dismissing types. While the loss of an infant is a devastating experience for any parent, securely attached individuals showed the lowest levels of psychopathology compared to fearful, preoccupied, or dismissing

  19. Relationship between attachment styles and happiness in medical students.

    Science.gov (United States)

    Moghadam, Marzyeh; Rezaei, Farzin; Ghaderi, Ebrahim; Rostamian, Negar

    2016-01-01

    Attachment theory is one of the most important achievements of contemporary psychology. Role of medical students in the community health is important, so we need to know about the situation of happiness and attachment style in these students. This study was aimed to assess the relationship between medical students' attachment styles and demographic characteristics. This cross-sectional study was conducted on randomly selected students of Medical Sciences in Kurdistan University, in 2012. To collect data, Hazan and Shaver's attachment style measure and the Oxford Happiness Questionnaire were used. The results were analyzed using the SPSS software version 16 (IBM, Chicago IL, USA) and statistical analysis was performed via t-test, Chi-square test, and multiple regression tests. Secure attachment style was the most common attachment style and the least common was ambivalent attachment style. Avoidant attachment style was more common among single persons than married people ( P = 0.03). No significant relationship was observed between attachment style and gender and grade point average of the studied people. The mean happiness score of students was 62.71. In multivariate analysis, the variables of secure attachment style ( P = 0.001), male gender ( P = 0.005), and scholar achievement ( P = 0.047) were associated with higher happiness score. The most common attachment style was secure attachment style, which can be a positive prognostic factor in medical students, helping them to manage stress. Higher frequency of avoidant attachment style among single persons, compared with married people, is mainly due to their negative attitude toward others and failure to establish and maintain relationships with others.

  20. Localized attachment loss in Pendred syndrome: incidental?

    Science.gov (United States)

    Sharma, C G Dileep; Pradeep, A R

    2007-05-01

    Pendred syndrome is a rare, inherited, autosomal recessive disorder with an iodine organification defect of thyroxin produced by the thyroid gland. Its clinical features include sensorineural hearing loss, classically congenital and prelingual, and goiter. This is the first case report of Pendred syndrome in the dental literature with oral findings that include localized extensive attachment loss involving mandibular incisor teeth and idiopathic hypercementosis involving multiple teeth in addition to other oral manifestations, suggesting hypothyroidism-like macroglossia and macrocheilia. Furthermore, serum alkaline phosphatase along with inorganic calcium and phosphate levels were also elevated. Peripheral neutrophil function test suggested a defective function of neutrophils. Management of the case included augmenting thyroxin supplementation, in consultation with an endocrinologist, and extraction of hopeless mandibular central incisors followed by placement of immediate transitional dentures. A comprehensive medical history and systemic and laboratory evaluations should be considered a prerequisite to identify, manage, and report such rare conditions in routine clinical practice.