International Nuclear Information System (INIS)
Amin, Md Ruhul; Ghannad, Leda; Othman, Ahmad; Gill, Ravinder K.; Dudeja, Pradeep K.; Ramaswamy, Krishnamurthy; Malakooti, Jaleh
2009-01-01
Serotonin (5-HT) decreases NHE2 and NHE3 activities under acute conditions in human intestinal epithelial cells. Here, we have investigated the effects of 5-HT on expression of the human NHE3 gene and the mechanisms underlying its transcriptional regulation in differentiated C2BBe1 cells. Treatment of the human intestinal epithelial cell line, C2BBe1, with 5-HT (20 μM) resulted in a significant decrease in NHE3 mRNA and protein expression. In transient transfection studies, 5-HT repressed the NHE3 promoter activity by ∼55%. The repression of the NHE3 promoter activity in response to 5-HT was accompanied by reduced DNA-binding activity of transcription factors Sp1 and Sp3 to the NHE3 promoter without alteration in their nuclear levels. Pharmacological inhibitors of protein kinase C reversed the inhibitory effect of 5-HT on the promoter activity. Our data indicate that 5-HT suppresses the transcriptional activity of the NHE3 promoter and this effect may be mediated by PKCα and modulation of DNA-binding affinities of Sp1 and Sp3.
Choe, Keith P; Kato, Akira; Hirose, Shigehisa; Plata, Consuelo; Sindic, Aleksandra; Romero, Michael F; Claiborne, J B; Evans, David H
2005-11-01
In mammals, the Na+/H+ exchanger 3 (NHE3) is expressed with Na+/K+-ATPase in renal proximal tubules, where it secretes H+ and absorbs Na+ to maintain blood pH and volume. In elasmobranchs (sharks, skates, and stingrays), the gills are the dominant site of pH and osmoregulation. This study was conducted to determine whether epithelial NHE homologs exist in elasmobranchs and, if so, to localize their expression in gills and determine whether their expression is altered by environmental salinity or hypercapnia. Degenerate primers and RT-PCR were used to deduce partial sequences of mammalian NHE2 and NHE3 homologs from the gills of the euryhaline Atlantic stingray (Dasyatis sabina). Real-time PCR was then used to demonstrate that mRNA expression of the NHE3 homolog increased when stingrays were transferred to low salinities but not during hypercapnia. Expression of the NHE2 homolog did not change with either treatment. Rapid amplification of cDNA was then used to deduce the complete sequence of a putative NHE3. The 2,744-base pair cDNA includes a coding region for a 2,511-amino acid protein that is 70% identical to human NHE3 (SLC9A3). Antisera generated against the carboxyl tail of the putative stingray NHE3 labeled the apical membranes of Na+/K+-ATPase-rich epithelial cells, and acclimation to freshwater caused a redistribution of labeling in the gills. This study provides the first NHE3 cloned from an elasmobranch and is the first to demonstrate an increase in gill NHE3 expression during acclimation to low salinities, suggesting that NHE3 can absorb Na+ from ion-poor environments.
Local pH domains regulate NHE3-mediated Na+ reabsorption in the renal proximal tubule
Burford, James L.; McDonough, Alicia A.; Holstein-Rathlou, Niels-Henrik; Peti-Peterdi, Janos
2014-01-01
The proximal tubule Na+/H+ exchanger 3 (NHE3), located in the apical dense microvilli (brush border), plays a major role in the reabsorption of NaCl and water in the renal proximal tubule. In response to a rise in blood pressure NHE3 redistributes in the plane of the plasma membrane to the base of the brush border, where NHE3 activity is reduced. This NHE3 redistribution is assumed to provoke pressure natriuresis; however, it is unclear how NHE3 redistribution per se reduces NHE3 activity. To investigate if the distribution of NHE3 in the brush border can change the reabsorption rate, we constructed a spatiotemporal mathematical model of NHE3-mediated Na+ reabsorption across a proximal tubule cell and compared the model results with in vivo experiments in rats. The model predicts that when NHE3 is localized exclusively at the base of the brush border, it creates local pH microdomains that reduce NHE3 activity by >30%. We tested the model's prediction experimentally: the rat kidney cortex was loaded with the pH-sensitive fluorescent dye BCECF, and cells of the proximal tubule were imaged in vivo using confocal fluorescence microscopy before and after an increase of blood pressure by ∼50 mmHg. The experimental results supported the model by demonstrating that a rise of blood pressure induces the development of pH microdomains near the bottom of the brush border. These local changes in pH reduce NHE3 activity, which may explain the pressure natriuresis response to NHE3 redistribution. PMID:25298526
Renal tubular NHE3 is required in the maintenance of water and sodium chloride homeostasis.
Fenton, Robert A; Poulsen, Søren B; de la Mora Chavez, Samantha; Soleimani, Manoocher; Dominguez Rieg, Jessica A; Rieg, Timo
2017-08-01
The sodium/proton exchanger isoform 3 (NHE3) is expressed in the intestine and the kidney, where it facilitates sodium (re)absorption and proton secretion. The importance of NHE3 in the kidney for sodium chloride homeostasis, relative to the intestine, is unknown. Constitutive tubule-specific NHE3 knockout mice (NHE3 loxloxCre) did not show significant differences compared to control mice in body weight, blood pH or bicarbonate and plasma sodium, potassium, or aldosterone levels. Fluid intake, urinary flow rate, urinary sodium/creatinine, and pH were significantly elevated in NHE3 loxloxCre mice, while urine osmolality and GFR were significantly lower. Water deprivation revealed a small urinary concentrating defect in NHE3 loxloxCre mice on a control diet, exaggerated on low sodium chloride. Ten days of low or high sodium chloride diet did not affect plasma sodium in control mice; however, NHE3 loxloxCre mice were susceptible to low sodium chloride (about -4 mM) or high sodium chloride intake (about +2 mM) versus baseline, effects without differences in plasma aldosterone between groups. Blood pressure was significantly lower in NHE3 loxloxCre mice and was sodium chloride sensitive. In control mice, the expression of the sodium/phosphate co-transporter Npt2c was sodium chloride sensitive. However, lack of tubular NHE3 blunted Npt2c expression. Alterations in the abundances of sodium/chloride cotransporter and its phosphorylation at threonine 58 as well as the abundances of the α-subunit of the epithelial sodium channel, and its cleaved form, were also apparent in NHE3 loxloxCre mice. Thus, renal NHE3 is required to maintain blood pressure and steady-state plasma sodium levels when dietary sodium chloride intake is modified. Copyright © 2017 International Society of Nephrology. Published by Elsevier Inc. All rights reserved.
Mechanisms of the Regulation of the Intestinal Na+/H+ Exchanger NHE3
Directory of Open Access Journals (Sweden)
Peijian He
2010-01-01
Full Text Available A major of Na+ absorptive process in the proximal part of intestine and kidney is electroneutral exchange of Na+ and H+ by Na+/H+ exchanger type 3 (NHE3. During the past decade, significant advance has been achieved in the mechanisms of NHE3 regulation. A bulk of the current knowledge on Na+/H+ exchanger regulation is based on heterologous expression of mammalian Na+/H+ exchangers in Na+/H+ exchanger deficient fibroblasts, renal epithelial, and intestinal epithelial cells. Based on the reductionist's approach, an understanding of NHE3 regulation has been greatly advanced. More recently, confirmations of in vitro studies have been made using animals deficient in one or more proteins but in some cases unexpected findings have emerged. The purpose of this paper is to provide a brief overview of recent progress in the regulation and functions of NHE3 present in the luminal membrane of the intestinal tract.
Na+/H+ and Na+/NH4+ exchange activities of zebrafish NHE3b expressed in Xenopus oocytes
Ito, Yusuke; Kato, Akira; Hirata, Taku; Hirose, Shigehisa
2014-01-01
Zebrafish Na+/H+ exchanger 3b (zNHE3b) is highly expressed in the apical membrane of ionocytes where Na+ is absorbed from ion-poor fresh water against a concentration gradient. Much in vivo data indicated that zNHE3b is involved in Na+ absorption but not leakage. However, zNHE3b-mediated Na+ absorption has not been thermodynamically explained, and zNHE3b activity has not been measured. To address this issue, we overexpressed zNHE3b in Xenopus oocytes and characterized its activity by electrophysiology. Exposure of zNHE3b oocytes to Na+-free media resulted in significant decrease in intracellular pH (pHi) and intracellular Na+ activity (aNai). aNai increased significantly when the cytoplasm was acidified by media containing CO2-HCO3− or butyrate. Activity of zNHE3b was inhibited by amiloride or 5-ethylisopropyl amiloride (EIPA). Although the activity was accompanied by a large hyperpolarization of ∼50 mV, voltage-clamp experiments showed that Na+/H+ exchange activity of zNHE3b is electroneutral. Exposure of zNHE3b oocytes to medium containing NH3/NH4+ resulted in significant decreases in pHi and aNai and significant increase in intracellular NH4+ activity, indicating that zNHE3b mediates the Na+/NH4+ exchange. In low-Na+ (0.5 mM) media, zNHE3b oocytes maintained aNai of 1.3 mM, and Na+-influx was observed when pHi was decreased by media containing CO2-HCO3− or butyrate. These results provide thermodynamic evidence that zNHE3b mediates Na+ absorption from ion-poor fresh water by its Na+/H+ and Na+/NH4+ exchange activities. PMID:24401990
IRBIT plays an important role in NHE3-mediated pHi regulation in HSG cells.
Tran, Tien Manh; Park, Moon-Yong; Lee, Jiyeon; Bae, Jun-Seok; Hwang, Sung-Min; Choi, Se-Young; Mikoshiba, Katsuhiko; Park, Kyungpyo
2013-07-19
Expression of inositol-1,4,5-trisphosphate (IP3) receptor-binding protein (IRBIT) has been reported in epithelial cells. However, its role in pHi regulation is not well understood. In this study, we investigated the role of IRBIT in pHi regulation, mediated by Na(+)/H(+) exchangers (NHEs), in salivary glands. We measured pHi recovery from cell acidification in BCECF-loaded salivary HSG cells. Western blot and co-immunoprecipitation (CO-IP) assays were also performed, showing that NHE1, 2 and 3 are expressed, and IRBIT binds to NHE3. HOE642, a specific NHE1 blocker, inhibited pHi recovery, but 40% pH(i) recovery was still observed even at the highest concentration of HOE642. Furthermore, pretreatment of the cells with siIRBIT significantly inhibited pHi recovery, indicating that NHE3 potentially plays a role in pHi recovery as well. The amount of membrane-localized NHE3 and its interaction with IRBIT are also significantly increased by cell acidification. In addition, we found that Ste20p-related proline alanine-rich kinase (SPAK) reverses the effect of IRBIT on membrane NHE3 translocation. Taken together, we conclude that IRBIT plays an important role in pHi regulation, mediated by NHE3, and further regulated by SPAK. Copyright © 2013 Elsevier Inc. All rights reserved.
The Angiotensin II Type 1 Receptor Antagonist Losartan Affects NHE1-Dependent Melanoma Cell Behavior
Directory of Open Access Journals (Sweden)
Daniel Navin Olschewski
2018-03-01
Full Text Available Background/Aims: The peptide hormone angiotensin II (ATII plays a prominent role in regulating vasoconstriction and blood pressure. Its primary target is the angiotensin II receptor type 1 (AT1, the stimulation of which induces an increase in cytosolic [Ca2+] and calmodulin activation. Ca2+-bound (activated calmodulin stimulates the activity of the Na+/ H+ exchanger isoform 1 (NHE1; and increased NHE1 activity is known to promote melanoma cell motility. The competitive AT1 receptor inhibitor losartan is often used to lower blood pressure in hypertensive patients. Since AT1 mediates ATII-stimulated NHE1 activity, we set out to investigate whether ATII and losartan have an impact on NHE1-dependent behavior of human melanoma (MV3 cells. Methods: ATII receptor expression was verified by PCR, F-actin was visualized using fluorescently labeled phalloidin, and cytosolic [Ca2+] and pH were determined ratiometrically using Fura-2 and BCECF, respectively. MV3 cell behavior was analyzed using migration, adhesion, invasion and proliferation assays. Results: MV3 cells express both AT1 and the angiotensin II receptor type 2 (AT2. Stimulation of MV3 cells with ATII increased NHE1 activity which could be counteracted by both losartan and the Ca2+/ calmodulin inhibitor ophiobolin-A. ATII stimulation induced a decrease in MV3 cell migration and a more spherical cell morphology accompanied by an increase in the density of F-actin. Independently of the presence of ATII, both NHE1 and migratory activity were reduced when AT1 was blocked by losartan. On the other hand, losartan clearly increased cell adhesion to, and the invasion of, a collagen type I substrate. The AT2 inhibitor PD123319 did not affect NHE1 activity, proliferation and migration, but increased adhesion and invasion. Conclusion: Losartan inhibits NHE1 activity and the migration of human melanoma cells. At the same time, losartan promotes MV3 cell adhesion and invasion. The therapeutic use of AT1
NHE8 plays important roles in gastric mucosal protection
Xu, Hua; Li, Jing; Chen, Huacong; Wang, Chunhui
2013-01-01
Sodium/hydrogen exchanger (NHE) 8 is an apically expressed membrane protein in the intestinal epithelial cells. It plays important roles in sodium absorption and bicarbonate secretion in the intestine. Although NHE8 mRNA has been detected in the stomach, the precise location and physiological role of NHE8 in the gastric glands remain unclear. In the current study, we successfully detected the expression of NHE8 in the glandular region of the stomach by Western blotting and located NHE8 protein at the apical membrane in the surface mucous cells by a confocal microscopic method. We also identified the expression of downregulated-in-adenoma (DRA) in the surface mucous cells in the stomach. Using NHE8−/− mice, we found that NHE8 plays little or no role in basal gastric acid production, yet NHE8−/− mice have reduced gastric mucosal surface pH and higher incidence of developing gastric ulcer. DRA expression was reduced significantly in the stomach in NHE8−/− mice. The propensity for gastric ulcer, reduced mucosal surface pH, and low DRA expression suggest that NHE8 is indirectly involved in gastric bicarbonate secretion and gastric mucosal protection. PMID:23220221
International Nuclear Information System (INIS)
Phung, Danh; Ganash, Magdah; Sedelnikova, Svetlana E.; Lindbäck, Toril; Granum, Per Einar; Artymiuk, Peter J.
2012-01-01
The NheA component of the B. cereus Nhe toxin was overexpressed in E. coli, purified and crystallized. Diffraction data were collected and processed to 2.05 Å resolution. The nonhaemolytic enterotoxin (Nhe) of Bacillus cereus plays a key role in cases of B. cereus food poisoning. The toxin is comprised of three different proteins: NheA, NheB and NheC. Here, the expression in Escherichia coli, purification and crystallization of the NheA protein are reported. The protein was crystallized by the sitting-drop vapour-diffusion method using PEG 3350 as a precipitant. The crystals of NheA diffracted to 2.05 Å resolution and belonged to space group C2, with unit-cell parameters a = 308.7, b = 58.2, c = 172.9 Å, β = 110.6°. Calculation of V M values suggests that there are approximately eight protein molecules per asymmetric unit
Comparative biology of the ubiquitous Na+/H+ exchanger, NHE1: lessons from erythrocytes
DEFF Research Database (Denmark)
Pedersen, Stine Falsig; Cala, Peter Michael
2004-01-01
of NHE1 in erythrocytes, in their own right and as model systems, but pertinent findings from non-erythroid cells are also discussed. NHE1 plays a key role in the regulation of cell volume and pH, and consequently in the control of such diverse processes as blood O2/CO2 transport, and cell proliferation......, motility, and survival. Disturbances in NHE1 function are involved in important pathological states such as hypoxic cell damage and cancer development. NHE1 has a predicted topology of 12 transmembrane domains, and a hydrophilic C-terminus thought to be the major site for NHE1 regulation. NHE1 is highly...... conserved throughout the vertebrate phylum, particularly in the transmembrane region and the proximal part of the C-terminus. In non-erythroid, and probably also in erythroid cells, this part of the hydrophilic C-terminus interacts with multiple binding partners important for NHE1 function. Erythrocyte NHE1...
The Intracellular Distal Tail of the Na+/H+ Exchanger NHE1 Is Intrinsically Disordered
DEFF Research Database (Denmark)
Nørholm, Ann-Beth; Hendus-Altenburger, Ruth; Bjerre, Gabriel
2011-01-01
disrupted the putative binding feature. When this mutant NHE1 was expressed in full length NHE1 in AP1 cells, it exhibited impaired trafficking to the plasma membrane. This study demonstrated that the distal regulatory domain of NHE1 is intrinsically disordered yet contains conserved regions of transient...... structure. We suggest that normal NHE1 function depends on a protein recognition element within the ID region that may be linked to NHE1 trafficking via an acidic ER export motif....
Directory of Open Access Journals (Sweden)
Jorge Elías Torres-López
2013-01-01
Full Text Available Intracellular pH is a fundamental parameter to cell function that requires tight homeostasis. In the absence of any regulation, excessive acidification of the cytosol would have the tendency to produce cellular damage. Mammalian Na+/H+ exchangers (NHEs are electroneutral Na+-dependent proteins that exchange extracellular Na+ for intracellular H+. To date, there are 9 identified NHE isoforms where NHE1 is the most ubiquitous member, known as the housekeeping exchanger. NHE1 seems to have a protective role in the ischemia-reperfusion injury and other inflammatory diseases. In nociception, NHE1 is found in neurons along nociceptive pathways, and its pharmacological inhibition increases nociceptive behavior in acute pain models at peripheral and central levels. Electrophysiological studies also show that NHE modulates electrical activity of primary nociceptive terminals. However, its role in neuropathic pain still remains controversial. In humans, NHE1 may be responsible for inflammatory bowel diseases since its expression is reduced in Crohn’s disease and ulcerative colitis. The purpose of this work is to provide a review of the evidence about participation of NHE1 in the nociceptive processing.
DEFF Research Database (Denmark)
Pedersen, Stine F; King, Scott A; Nygaard, Eva B
2007-01-01
NHE1). Although highly homologous to the amiloride- and HOE-sensitive human NHE1 (hNHE1), AtNHE1 is insensitive to HOE-type and PaNHE1 to both amiloride- and HOE-type compounds. Here we generated chimeras to "knock in" amiloride and HOE sensitivity to PaNHE1, and we thereby identified several NHE1...
Mechanisms of activation of NHE by cell shrinkage and by calyculin A in Ehrlich ascites tumor cells
DEFF Research Database (Denmark)
Pedersen, Stine Helene Falsig; Varming, Camilla; Hoffmann, E K
2002-01-01
The Na+/H+ exchanger isoforms NHE1, NHE2, and NHE3 were all found to be expressed in Ehrlich ascites tumor cells, as evaluated by Western blotting and confocal microscopy. Under unstimulated conditions, NHE1 was found predominantly in the plasma membrane, NHE3 intracellularly, and NHE2 in both co....... It is concluded that shrinkage-induced NHE activation is dependent on PKC and p38 MAPK, but not on MLCK or ERK1/2. NHE activity under both iso- and hypertonic conditions is increased by inhibition of serine/threonine phosphatases, and this effect appears to be PKC-dependent....
Sultan, Ayesha; Luo, Min; Yu, Qin; Riederer, Brigitte; Xia, Weiliang; Chen, Mingmin; Lissner, Simone; Gessner, Johannes E; Donowitz, Mark; Yun, C Chris; deJonge, Hugo; Lamprecht, Georg; Seidler, Ursula
2013-01-01
Trafficking, brush border membrane (BBM) retention, and signal-specific regulation of the Na+/H+ exchanger NHE3 is regulated by the Na+/H+ Exchanger Regulatory Factor (NHERF) family of PDZ-adaptor proteins, which enable the formation of multiprotein complexes. It is unclear, however, what determines signal specificity of these NHERFs. Thus, we studied the association of NHE3, NHERF1 (EBP50), NHERF2 (E3KARP), and NHERF3 (PDZK1) with lipid rafts in murine small intestinal BBM. Detergent resistant membranes ("lipid rafts") were isolated by floatation of Triton X-incubated small intestinal BBM from a variety of knockout mouse strains in an Optiprep step gradient. Acid-activated NHE3 activity was measured fluorometrically in BCECF-loaded microdissected villi, or by assessment of CO2/HCO3(-) mediated increase in fluid absorption in perfused jejunal loops of anethetized mice. NHE3 was found to partially associate with lipid rafts in the native BBM, and NHE3 raft association had an impact on NHE3 transport activity and regulation in vivo. NHERF1, 2 and 3 were differentially distributed to rafts and non-rafts, with NHERF2 being most raft-associated and NHERF3 entirely non-raft associated. NHERF2 expression enhanced the localization of NHE3 to membrane rafts. The use of acid sphingomyelinase-deficient mice, which have altered membrane lipid as well as lipid raft composition, allowed us to test the validity of the lipid raft concept in vivo. The differential association of the NHERFs with the raft-associated and the non-raft fraction of NHE3 in the brush border membrane is one component of the differential and signal-specific NHE3 regulation by the different NHERFs. © 2013 S. Karger AG, Basel.
DEFF Research Database (Denmark)
Andersen, Anne Poder; Samsøe-Petersen, Jacob; Oernbo, Eva Kjer
2018-01-01
High metabolic and proliferative rates in cancer cells lead to production of large amounts of H+ and CO2 , and as a result, net acid extruding transporters are essential for the function and survival of cancer cells. We assessed protein expression of the Na+ /H+ exchanger NHE1, the Na+ - HCO3......- cotransporter NBCn1, and the lactate-H+ cotransporters MCT1 and -4 by immunohistochemical analysis of a large cohort of breast cancer samples. We found robust expression of these transporters in 20, 10, 4 and 11% of samples, respectively. NHE1 and NBCn1 expression both correlated positively with progesterone...
Chen, Honglang; Song, Lijun; Li, Guixian; Chen, Wenfeng; Zhao, Shumin; Zhou, Ruoxia; Shi, Xiaoying; Peng, Zhenying; Zhao, Wenchang
2017-06-01
Rotavirus (RV) is the most common cause of severe gastroenteritis and fatal dehydration in human infants and neonates of different species. However, the pathogenesis of rotavirus-induced diarrhea is poorly understood. Secretory diarrhea caused by rotavirus may lead to a combination of excessive secretion of fluid and electrolytes into the intestinal lumen. Fluid absorption in the small intestine is driven by Na + -coupled transport mechanisms at the luminal membrane, including Na + /H + exchanger (NHE). Here, we performed qRT-PCR to detect the transcription of NHEs. Western blotting was employed for protein detection. Furthermore, immunocytochemistry was used to validate the NHE's protein expression. Finally, intracellular Ca 2+ concentration was detected by confocal laser scanning microscopy. The results demonstrated that the NHE6 mRNA and protein expressed in the human colon adenocarcinoma cell line (Caco-2). Furthermore, RV-Wa induced decreased expression of the NHE1 and NHE6 in Caco-2 cell in a time-dependent manner. In addition, intracellular Ca 2+ concentration in RV-Wa-infected Caco-2 cells was higher than that in the mock-infected cells. Furthermore, RV-Wa also can downregulate the expression of calmodulin (CaM) and calmodulin kinase II (CaMKII) in Caco-2 cells. These findings provides important insights into the mechanisms of rotavirus-induced diarrhea. Further studies on the underlying pathophysiological mechanisms that downregulate NHEs in RV-induced diarrhea are required.
Directory of Open Access Journals (Sweden)
Rosa Angela Cardone
2015-02-01
Full Text Available Pancreatic ductal adenocarcinoma (PDAC is one of the most lethal cancers principally because of early invasion and metastasis. The epidermal growth factor receptor (EGFR is essential for PDAC development even in the presence of Kras, but its inhibition with erlotinib gives only a modest clinical response, making the discovery of novel EGFR targets of critical interest. Here, we revealed by mining a human pancreatic gene expression database that the metastasis promoter Na+/H+ exchanger (NHE1 associates with the EGFR in PDAC. In human PDAC cell lines, we confirmed that NHE1 drives both basal and EGF-stimulated three-dimensional growth and early invasion via invadopodial extracellular matrix digestion. EGF promoted the complexing of EGFR with NHE1 via the scaffolding protein Na+/H+ exchanger regulatory factor 1, engaging EGFR in a negative transregulatory loop that controls the extent and duration of EGFR oncogenic signaling and stimulates NHE1. The specificity of NHE1 for growth or invasion depends on the segregation of the transient EGFR/Na+/H+ exchanger regulatory factor 1/NHE1 signaling complex into dimeric subcomplexes in different lipid raftlike membrane domains. This signaling complex was also found in tumors developed in orthotopic mice. Importantly, the specific NHE1 inhibitor cariporide reduced both three-dimensional growth and invasion independently of PDAC subtype and synergistically sensitized these behaviors to low doses of erlotinib.
Directory of Open Access Journals (Sweden)
Melinda A. Engevik
2013-12-01
Full Text Available Background: The mechanisms bacteria use to proliferate and alter the normal bacterial composition remain unknown. The ability to link changes in the intestinal micro-environment, such as ion composition and pH, to bacterial proliferation is clinically advantageous for diseases that involve an altered gut microbiota, such as Inflammatory Bowel Disease, obesity and diabetes. In human and mouse intestine, the apical Na+/H+ exchangers NHE2 and NHE3 affect luminal Na+, water, and pH. Loss of NHE2 results in acidic luminal pH. Since acid resistance systems in gram-positive bacteria are well documented, we hypothesize that gram-positive bacteria would increase in representation in the acidic NHE2-/- intestine. Methods: Intestinal ion composition was measured by fame photometry and chloridometry and pH measured electrochemically. DNA extracted from intestinal flushes or from mucosal scrapings was analyzed by qRT-PCR to examine luminal and mucosa-associated bacterial populations. Epithelial mucus oligosaccharide patterns were examined by histology with FIT-C labeled lectins. Results: Although total luminal and mucosa-associated bacteria were unchanged in NHE2-/- intestine, gram-positive bacterial phyla were increased in the mucosa-associated bacterial population in a region-specific manner. The genera Clostridium and Lactobacillus were increased in the cecum and colon which corresponded to changes in NHE2-/- mucus oligosaccharide composition of mannose, N-acetyglucosamine, N-acetygalactosamine and galactose. Conclusions: Together these data indicate that changes in ion transport induce region-specific bacterial changes, which alter host mucus oligosaccharide patterns. These host-bacterial interactions provide a possible mechanism of niche-development and shed insight on how certain groups proliferate in changing environments and maintain their proliferation by altering the host.
Silva, Pedro Henrique Imenez; Girardi, Adriana Castello Costa; Neri, Elida Adalgisa; Rebouças, Nancy Amaral
2012-04-01
The Na(+/)H(+) exchanger isoform 3 (NHE3) is essential for HCO(3)(-) reabsorption in renal proximal tubules. The expression and function of NHE3 must adapt to acid-base conditions. The goal of this study was to elucidate the mechanisms responsible for higher proton secretion in proximal tubules during acidosis and to evaluate whether there are differences between metabolic and respiratory acidosis with regard to NHE3 modulation and, if so, to identify the relevant parameters that may trigger these distinct adaptive responses. We achieved metabolic acidosis by lowering HCO(3)(-) concentration in the cell culture medium and respiratory acidosis by increasing CO(2) tension in the incubator chamber. We found that cell-surface NHE3 expression was increased in response to both forms of acidosis. Mild (pH 7.21 ± 0.02) and severe (6.95 ± 0.07) metabolic acidosis increased mRNA levels, at least in part due to up-regulation of transcription, whilst mild (7.11 ± 0.03) and severe (6.86 ± 0.01) respiratory acidosis did not up-regulate NHE3 expression. Analyses of the Nhe3 promoter region suggested that the regulatory elements sensitive to metabolic acidosis are located between -466 and -153 bp, where two consensus binding sites for SP1, a transcription factor up-regulated in metabolic acidosis, were localised. We conclude that metabolic acidosis induces Nhe3 promoter activation, which results in higher mRNA and total protein level. At the plasma membrane surface, NHE3 expression was increased in metabolic and respiratory acidosis alike, suggesting that low pH is responsible for NHE3 displacement to the cell surface.
Acidosis-mediated regulation of the NHE1 isoform of the Na⁺/H⁺ exchanger in renal cells.
Odunewu, Ayodeji; Fliegel, Larry
2013-08-01
The mammalian Na⁺/H⁺ exchanger isoform 1 (NHE1) is a ubiquitous plasma membrane protein that regulates intracellular pH by removing a proton in exchange for extracellular sodium. Renal tissues are subject to metabolic and respiratory acidosis, and acidosis has been shown to acutely activate NHE1 activity in other cell types. We examined if NHE1 is activated by acute acidosis in HEK293 and Madin-Darby canine kidney (MDCK) cells. Acute sustained intracellular acidosis (SIA) activated NHE1 in both cell types. We expressed wild-type and mutant NHE1 cDNAs in MDCK cells. All the cDNAs had a L163F/G174S mutation, which conferred a 100-fold resistance to EMD87580, an NHE1-specific inhibitor. We assayed exogenous NHE1 activity while inhibiting endogenous activity with EMD87580 and while inhibiting the NHE3 isoform of the Na⁺/H⁺ exchanger using the isoform-specific inhibitor S3226. We examined the activation and phosphorylation of the wild-type and mutant NHE1 proteins in response to SIA. In MDCK cells we demonstrated that the amino acids Ser⁷⁷¹, Ser⁷⁷⁶, Thr⁷⁷⁹, and Ser⁷⁸⁵ are important for NHE1 phosphorylation and activation after acute SIA. SIA activated ERK-dependent pathways in MDCK cells, and this was blocked by treatment with the MEK inhibitor U0126. Treatment with U0126 also blocked activation of NHE1 by SIA. These results suggest that acute acidosis activates NHE1 in mammalian kidney cells and that in MDCK cells this activation occurs through an ERK-dependent pathway affecting phosphorylation of a distinct set of amino acids in the cytosolic regulatory tail of NHE1.
Decreased Expression of Na+/K+-ATPase, NHE3, NBC1, AQP1 and OAT in Gentamicin-induced Nephropathy
Bae, Woo Kyun; Lee, JongUn; Park, Jeong Woo; Bae, Eun Hui; Ma, Seong Kwon; Kim, Suhn Hee
2008-01-01
The present study was aimed to determine whether there is an altered regulation of tubular transporters in gentamicin-induced nephropathy. Sprague-Dawley male rats (200~250 g) were subcutaneously injected with gentamicin (100 mg/kg per day) for 7 days, and the expression of tubular transporters was determined by immunoblotting and immunohistochemistry. The mRNA and protein expression of OAT was also determined. Gentamicin-treated rats exhibited significantly decreased creatinine clearance along with increased plasma creatinine levels. Accordingly, the fractional excretion of sodium increased. Urine volume was increased, while urine osmolality and free water reabsorption were decreased. Immunoblotting and immunohistochemistry revealed decreased expression of Na+/K+-ATPase, NHE3, NBC1, and AQP1 in the kidney of gentamicin-treated rats. The expression of OAT1 and OAT3 was also decreased. Gentamicin-induced nephropathy may at least in part be causally related with a decreased expression of Na+/K+-ATPase, NHE3, NBC1, AQP1 and OAT. PMID:19967075
NHE1 deficiency in liver: Implications for non-alcoholic fatty liver disease
Energy Technology Data Exchange (ETDEWEB)
Prasad, Vikram, E-mail: prasadvm@ucmail.uc.edu [Department of Molecular Genetics, Biochemistry, and Microbiology, University of Cincinnati College of Medicine (United States); Chirra, Shivani [Department of Molecular Genetics, Biochemistry, and Microbiology, University of Cincinnati College of Medicine (United States); Kohli, Rohit [Department of Gastroenterology, Hepatology, and Nutrition, Cincinnati Children’s Hospital, University of Cincinnati, Cincinnati, OH 45267 (United States); Shull, Gary E. [Department of Molecular Genetics, Biochemistry, and Microbiology, University of Cincinnati College of Medicine (United States)
2014-07-25
Highlights: • FXR, PGC1α and PPARγ levels are upregulated in NHE1 deficient livers. • NHE1 deficiency downregulates expression of pro-lipogenic genes in liver. • Chronic exposure to high-fat diet upregulates hepatic NHE1 expression. • Loss of NHE1 better preserves hepatic insulin signaling in high-fat diet-fed mice. - Abstract: Non-alcoholic fatty liver disease NAFLD is closely associated with the dysregulation of lipid homeostasis. Diet-induced hepatic steatosis, which can initiate NAFLD progression, has been shown to be dramatically reduced in mice lacking the electroneutral Na{sup +}/H{sup +} exchanger NHE1 (Slc9a1). In this study, we investigated if NHE1 deficiency had effects in liver that could contribute to the apparent protection against aberrant lipid accumulation. RT-PCR and immunoblot analyses of wild-type and NHE1-null livers revealed an expression profile that strongly suggested attenuation of both de novo lipogenesis and hepatic stellate cell activation, which is implicated in liver fibrosis. This included upregulation of the farnesoid X receptor FXR, peroxisome proliferator-activated receptor PPARγ, its co-activator PGC1α, and sestrin 2, an antioxidant protein involved in hepatic metabolic homeostasis. Furthermore, expression levels of the pro-lipogenic liver X receptor LXRα, and acetyl CoA carboxylases 1 and 2 were downregulated. These changes were associated with evidence of reduced cellular stress, which persisted even upon exposure to a high-fat diet, and the better preservation of insulin signaling, as evidenced by protein kinase B/Akt phosphorylation (Ser473). These results indicate that NHE1 deficiency may protect against NAFLD pathogenesis, which is significant given the availability of highly specific NHE1 inhibitors.
NHE1 deficiency in liver: Implications for non-alcoholic fatty liver disease
International Nuclear Information System (INIS)
Prasad, Vikram; Chirra, Shivani; Kohli, Rohit; Shull, Gary E.
2014-01-01
Highlights: • FXR, PGC1α and PPARγ levels are upregulated in NHE1 deficient livers. • NHE1 deficiency downregulates expression of pro-lipogenic genes in liver. • Chronic exposure to high-fat diet upregulates hepatic NHE1 expression. • Loss of NHE1 better preserves hepatic insulin signaling in high-fat diet-fed mice. - Abstract: Non-alcoholic fatty liver disease NAFLD is closely associated with the dysregulation of lipid homeostasis. Diet-induced hepatic steatosis, which can initiate NAFLD progression, has been shown to be dramatically reduced in mice lacking the electroneutral Na + /H + exchanger NHE1 (Slc9a1). In this study, we investigated if NHE1 deficiency had effects in liver that could contribute to the apparent protection against aberrant lipid accumulation. RT-PCR and immunoblot analyses of wild-type and NHE1-null livers revealed an expression profile that strongly suggested attenuation of both de novo lipogenesis and hepatic stellate cell activation, which is implicated in liver fibrosis. This included upregulation of the farnesoid X receptor FXR, peroxisome proliferator-activated receptor PPARγ, its co-activator PGC1α, and sestrin 2, an antioxidant protein involved in hepatic metabolic homeostasis. Furthermore, expression levels of the pro-lipogenic liver X receptor LXRα, and acetyl CoA carboxylases 1 and 2 were downregulated. These changes were associated with evidence of reduced cellular stress, which persisted even upon exposure to a high-fat diet, and the better preservation of insulin signaling, as evidenced by protein kinase B/Akt phosphorylation (Ser473). These results indicate that NHE1 deficiency may protect against NAFLD pathogenesis, which is significant given the availability of highly specific NHE1 inhibitors
Energy Technology Data Exchange (ETDEWEB)
Neri, Elida Adalgisa; Bezerra, Camila Nogueira Alves, E-mail: camilab@icb.usp.br; Queiroz-Leite, Gabriella Duarte; Polidoro, Juliano Zequini; Rebouças, Nancy Amaral
2015-06-12
The main transport mechanism of reabsorption of sodium bicarbonate and fluid in the renal proximal tubules involves Na{sup +}/H{sup +} exchanger 3 (NHE3), which is acutely and chronically downregulated by parathyroid hormone (PTH). Although PTH is known to exert an inhibitory effect on NHE3 expression and transcription, the molecular mechanisms involved remain unclear. Here, we demonstrated that, in opossum kidney proximal tubule (OKP) cells, PTH-induced inhibition of Nhe3 gene promoter occurs even in the core promoter that controls expression of the reporter gene. We found that inhibition of the protein kinase A (PKA) and Janus kinase/signal transducer and activator of transcription (JAK/STAT) pathways transformed PTH from an inhibitor of promoter activity into an activator of that same activity, as did point mutations in the EGR1, Sp1, and Sp3 binding consensus elements in the promoter. In nuclear extracts of PTH-treated OKP cells, we also observed increased expression of EGR1 mRNA and of some Sp3 isoforms. Electrophoretic mobility shift assay showed a supershift of the −61 to −42-bp probe with an anti-EGR1 antibody in PTH-treated cells, suggesting that EGR1 binding is relevant for the inhibitory activity of PTH. We conclude that PTH-induced inhibition of NHE3 transcription is related to higher EGR1 expression; to EGR1 binding to the proximal and core promoters; and to PKA and JAK/STAT pathway activation. This mechanism might be responsible, at least in part, for lower NHE3 expression and sodium reabsorption in renal proximal tubules in the presence of high PTH levels. - Highlights: • PTH regulation of Nhe3 promoter depends on EGR1 binding. • EGR1, PKA and JAK/STAT are involved in PTH inhibition of the Nhe3 promoter. • PTH alters expression of EGR1 and Sp3. • PTH inhibits the Nhe3 promoter by regulating PKA and JAK/STAT signaling.
International Nuclear Information System (INIS)
Ben Ammar, Youssef; Takeda, Soichi; Sugawara, Mitsuaki; Miyano, Masashi; Mori, Hidezo; Wakabayashi, Shigeo
2005-01-01
Crystallization of the human CHP2–NHE1 binding domain complex. Calcineurin homologous protein (CHP) is a Ca 2+ -binding protein that directly interacts with and regulates the activity of all plasma-membrane Na + /H + -exchanger (NHE) family members. In contrast to the ubiquitous isoform CHP1, CHP2 is highly expressed in cancer cells. To understand the regulatory mechanism of NHE1 by CHP2, the complex CHP2–NHE1 (amino acids 503–545) has been crystallized by the sitting-drop vapour-diffusion method using PEG 3350 as precipitant. The crystals diffract to 2.7 Å and belong to a tetragonal space group, with unit-cell parameters a = b = 49.96, c = 103.20 Å
DEFF Research Database (Denmark)
Thorup, Gitte Ehrenreich
and cell motility. The molecular mechanisms contributing to altered pHi regulation in cancer cells are incomplete understood. Overexpression of ErbB2 is common in breast cancer and the expression of an N-terminally truncated, constitutively active ErbB2 receptor (ΔNErbB2) is associated with increased....... Pharmacological inhibition of NHE1 enhances cisdiamminedichloroplatinum (II) (cisplatin) induced cell death, especially in ΔNErbB2 expressing cells. In Paper III we show that upon cisplatin treatment, expression of ΔNErbB2 results in increased caspase-9 and -7 cleavage, which is further augmented by specific...... inhibition of NHE1. Moreover, NBCN1, yet not NHE1, is lost from the plasma membrane upon cisplatin treatment, and this may explain why inhibition of NHE1 sensitizes the cells to cisplatin-induced cell death. In Paper II we show that in MCF-7 breast cancer cells, the expression levels of NBCn1 and NHE1...
DEFF Research Database (Denmark)
Petersen, Stine Helene Falsig; Rasmussen, Maria; Darborg, Barbara Vasek
2007-01-01
Osmotic stress modulates mitogen activated protein kinase (MAPK) activities, leading to altered gene transcription and cell death/survival balance, however, the mechanisms involved are incompletely elucidated. Here, we show, using a combination of biochemical and molecular biology approaches...... by human (h) NHE1 expression in cells lacking endogenous NHE1 activity. The effect of NHE1 on ERK1/2 was pH(i)-independent and upstream of MEK1/2. Shrinkage-activation of JNK1/2 was attenuated by EIPA, augmented by hNHE1 expression, and abolished in the presence of HCO(3)(-). Basal JNK activity...
Energy Technology Data Exchange (ETDEWEB)
Ben Ammar, Youssef [Department of Molecular Physiology, National Cardiovascular Center Research Institute, Fujishiro-dai 5-7-1, Suita, Osaka 565-8565 (Japan); Takeda, Soichi [Department of Cardiac Physiology, National Cardiovascular Center Research Institute, Fujishiro-dai 5-7-1, Suita, Osaka 565-8565 (Japan); Sugawara, Mitsuaki; Miyano, Masashi [Structural Biophysics Laboratory, RIKEN Harima Institute at SPring-8, Kouto, Mikazuki, Sayo, Hyogo 679-5148 (Japan); Mori, Hidezo [Department of Cardiac Physiology, National Cardiovascular Center Research Institute, Fujishiro-dai 5-7-1, Suita, Osaka 565-8565 (Japan); Wakabayashi, Shigeo, E-mail: wak@ri.ncvc.go.jp [Department of Molecular Physiology, National Cardiovascular Center Research Institute, Fujishiro-dai 5-7-1, Suita, Osaka 565-8565 (Japan)
2005-10-01
Crystallization of the human CHP2–NHE1 binding domain complex. Calcineurin homologous protein (CHP) is a Ca{sup 2+}-binding protein that directly interacts with and regulates the activity of all plasma-membrane Na{sup +}/H{sup +}-exchanger (NHE) family members. In contrast to the ubiquitous isoform CHP1, CHP2 is highly expressed in cancer cells. To understand the regulatory mechanism of NHE1 by CHP2, the complex CHP2–NHE1 (amino acids 503–545) has been crystallized by the sitting-drop vapour-diffusion method using PEG 3350 as precipitant. The crystals diffract to 2.7 Å and belong to a tetragonal space group, with unit-cell parameters a = b = 49.96, c = 103.20 Å.
In vivo PTH provokes apical NHE3 and NaPi2 redistribution and Na-K-ATPase inhibition
DEFF Research Database (Denmark)
Zhang, Y; Norian, J M; Magyar, C E
1999-01-01
and to determine whether the same cellular signals drive the changes in apical and basolateral transporters. PTH-(1-34) (20 U), which couples to adenylate cyclase (AC), phospholipase C (PLC), and phospholipase A2 (PLA2), or [Nle8,18,Tyr34]PTH-(3-34) (10 U), which couples to PLC and PLA2 but not AC, were given....../diuresis and NHE3 and NaPi2 internalization, and that Na-K-ATPase inhibition is not secondary to depressed apical Na+ transport....
DJ-1/Park7 Sensitive Na+ /H+ Exchanger 1 (NHE1) in CD4+ T Cells.
Zhou, Yuetao; Shi, Xiaolong; Chen, Hong; Zhang, Shaqiu; Salker, Madhuri S; Mack, Andreas F; Föller, Michael; Mak, Tak W; Singh, Yogesh; Lang, Florian
2017-11-01
DJ-1/Park7 is a redox-sensitive chaperone protein counteracting oxidation and presumably contributing to the control of oxidative stress responses and thus inflammation. DJ-1 gene deletion exacerbates the progression of Parkinson's disease presumably by augmenting oxidative stress. Formation of reactive oxygen species (ROS) is paralleled by activation of the Na + /H + exchanger 1 (NHE1). ROS formation in CD4 + T cells plays a decisive role in regulating inflammatory responses. In the present study, we explored whether DJ-1 is expressed in CD4 + T cells, and affects ROS production as well as NHE1 in those cells. To this end, DJ-1 and NHE1 transcript, and protein levels were quantified by qRT-PCR and Western blotting, respectively, intracellular pH (pH i ) utilizing bis-(2-carboxyethyl)-5-(and-6)-carboxyfluorescein (BCECF) fluorescence, NHE activity from realkalinization after an ammonium pulse, and ROS production utilizing 2',7' -dichlorofluorescin diacetate (DCFDA) fluorescence. As a result DJ-1 was expressed in CD4 + T cells. ROS formation, NHE1 transcript levels, NHE1 protein, and NHE activity were higher in CD4 + T cells from DJ-1 deficient mice than in CD4 + T cells from wild type mice. Antioxidant N-acetyl-cysteine (NAC) and protein tyrosine kinase (PTK) inhibitor staurosporine decreased the NHE activity in DJ-1 deficient CD4 + T cells, and blunted the difference between DJ-1 -/- and DJ-1 +/+ CD4 + T cells, an observation pointing to a role of ROS in the up-regulation of NHE1 in DJ-1 -/- CD4 + T cells. In conclusion, DJ-1 is a powerful regulator of ROS production as well as NHE1 expression and activity in CD4 + T cells. J. Cell. Physiol. 232: 3050-3059, 2017. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.
Directory of Open Access Journals (Sweden)
Patricia G Vallés
2015-08-01
Full Text Available The sodium-hydrogen exchanger isoform-1 [NHE1] is a ubiquitously expressed plasma membrane protein that plays a central role in intracellular pH and cell volume homeostasis by catalyzing an electroneutral exchange of extracellular sodium and intracellular hydrogen. Outside of this important physiological function, the NHE1 cytosolic tail domain acts as a molecular scaffold regulating cell survival and actin cytoskeleton organization through NHE1-dependent signaling proteins. NHE1 plays main roles in response to physiological stress conditions which in addition to cell shrinkage and acidification, include hypoxia and mechanical stimuli, such as cell stretch. NHE1-mediated modulation of programmed cell death results from the exchanger-mediated changes in pHi, cell volume, and/or [Na+]I; and, it has recently become known that regulation of cellular signaling pathways are involved as well. This review focuses on NHE1 functions and regulations. We describe evidence showing how these structural actions integrate with ion translocation in regulating renal tubule epithelial cell survival.
DEFF Research Database (Denmark)
Pedersen, Stine Helene Falsig; Darborg, Barbara Vasek; Rentsch, Maria Louise
2006-01-01
activity is regulated by a three-tiered phosphorelay system, which is in turn regulated by a complex network of signaling events and scaffolding proteins. The ubiquitous plasma membrane Na(+)/H(+) exchanger NHE1 is activated by, and implicated in, the physiological/pathophysiological responses to many...... of the same stimuli that modulate MAPK activity. While under some conditions, NHE1 is regulated by MAPKs, a number of studies have, conversely, implicated NHE1 in the regulation of MAPK activity. Here, we discuss the current evidence indicating the involvement of NHE1 in MAPK regulation, the mechanisms...
Na(+) /H(+) exchanger 1 (NHE1) function is necessary for maintaining mammary tissue architecture.
Jenkins, Edmund C; Debnath, Shawon; Varriano, Sophia; Gundry, Stephen; Fata, Jimmie E
2014-02-01
The mammary gland is an ideal model to study the link between form and function in normal tissue. Perhaps as interesting as the cues necessary to generate this structure are the signals required to maintain its branched architecture over the lifetime of the organism, since likely these pathways are de-regulated in malignancies. Previously, we have shown that the Na(+) /H(+) exchanger 1 (NHE1), a critical regulator of intracellular pH, was necessary for mammary branching morphogenesis. Here we provide strong evidence that NHE1 function is also necessary for maintaining mammary branched architecture. Inhibition of NHE1 with 5-N-Methy-N-isobutyl amiloride (MIA) on branched structures resulted in a rapid (within 24 hr) and reversible loss of branched architecture that was not accompanied by any overt changes in cell proliferation or cell death. NHE1 inhibition led to a significant acidification of intracellular pH in the branched end buds that preceded a number of events, including altered tissue polarity of myoepithelial cells, loss of NHE1 basal polarity, F-actin rearrangements, and decreased E-cadherin expression. Our results implicate NHE1 function and intracellular pH homeostasis as key factors that maintain mammary tissue architecture, thus, indirectly allowing for mammary function as a milk-providing (form) and -producing (function) gland. Copyright © 2013 Wiley Periodicals, Inc.
Prasad, Vikram; Lorenz, John N; Miller, Marian L; Vairamani, Kanimozhi; Nieman, Michelle L; Wang, Yigang; Shull, Gary E
2013-12-01
Acute inhibition of the NHE1 Na(+)/H(+) exchanger protects against ischemia-reperfusion injury and chronic inhibition attenuates development of cardiac hypertrophy and failure. To determine the cardiac effects of chronic inhibition of NHE1 under non-pathological conditions we used NHE1-null mice as a model of long-term NHE1 inhibition. Cardiovascular performance was relatively normal in Nhe1(-/-) mice although cardiac contractility and relaxation were slightly improved in mutant mice of the FVB/N background. GSH levels and GSH:GSSG ratios were elevated in Nhe1(-/-) hearts indicating an enhanced redox potential. Consistent with a reduced need for antioxidant protection, expression of heat shock proteins Hsp60 and Hsp25 was lower in Nhe1(-/-) hearts. Similarly, expression of mitochondrial superoxide dismutase 2 was reduced, with no increase in expression of other ROS scavenging enzymes. GLUT1 levels were increased in Nhe1(-/-) hearts, the number of lipid droplets in myocytes was reduced, and PDK4 expression was refractory to high-fat diet-induced upregulation observed in wild-type hearts. High-fat diet-induced stress was attenuated in Nhe1(-/-) hearts, as indicated by smaller increases in phosphorylation of Hsp25 and α-B crystallin, and there was better preservation of insulin sensitivity, as evidenced by PKB/Akt phosphorylation. Plasma glucose and insulin levels were lower and high-fat diet-induced hepatic lipid accumulation was reduced in Nhe1(-/-) mice, demonstrating extracardiac effects of NHE1 ablation. These data indicate that long-term ablation of NHE1 activity increases the redox potential, mitigates high-fat diet-induced myocardial stress and fatty liver disease, leads to better preservation of insulin sensitivity, and may alter both cardiac and systemic metabolic substrate handling in mice. © 2013 Elsevier Ltd. All rights reserved.
Yeves, A M; Burgos, J I; Medina, A J; Villa-Abrille, M C; Ennis, I L
2018-05-13
Myocardial Na + /H + exchanger-1 (NHE-1) hyperactivity and oxidative stress are interrelated phenomena playing pivotal roles in the development of pathological cardiac hypertrophy and heart failure. Exercise training is effective to convert pathological into physiological hypertrophy in the spontaneously hypertensive rats (SHR), and IGF-1-key humoral mediator of exercise training-inhibits myocardial NHE-1, at least in normotensive rats. Therefore, we hypothesize that IGF-1 by hampering NHE-1 hyperactivity and oxidative stress should exert a cardioprotective effect in the SHR. NHE-1 activity [proton efflux (JH+) mmol L -1 min -1 ], expression and phosphorylation; H 2 O 2 production; superoxide dismutase (SOD) activity; contractility and calcium transients were measured in SHR hearts in the presence/absence of IGF-1. IGF-1 significantly decreased NHE-1 activity (JH+ at pH i 6.95: 1.39 ± 0.32, n = 9 vs C 3.27 ± 0.3, n = 20, P IGF-1 receptor (2.7 ± 0.4, n = 7); by the PI3K inhibitor wortmannin (3.14 ± 0.41, n = 7); and the AKT inhibitor MK2206 (3.37 ± 0.43, n = 14). Moreover, IGF-1 exerted an antioxidant effect revealed by a significant reduction in H 2 O 2 production accompanied by an increase in SOD activity. In addition, IGF-1 improved cardiomyocyte contractility as evidenced by an increase in sarcomere shortening and a decrease in the relaxation constant, underlined by an increase in the amplitude and rate of decay of the calcium transients. IGF-1 exerts a cardioprotective role on the hypertrophied hearts of the SHR, in which the inhibition of NHE-1 hyperactivity, as well as the positive inotropic and antioxidant effects, emerges as key players. © 2018 Scandinavian Physiological Society. Published by John Wiley & Sons Ltd.
Lee, Hong Jo; Lee, Kyung Youn; Jung, Kyung Min; Park, Kyung Je; Lee, Ko On; Suh, Jeong-Yong; Yao, Yongxiu; Nair, Venugopal; Han, Jae Yong
2017-12-01
Avian leukosis virus subgroup J (ALV-J), first isolated in the late 1980s, has caused economic losses to the poultry industry in many countries. As all chicken lines studied to date are susceptible to ALV infection, there is enormous interest in developing resistant chicken lines. The ALV-J receptor, chicken Na + /H + exchange 1 (chNHE1) and the critical amino acid sequences involved in viral attachment and entry have already been characterized. However, there are no reported attempts to induce resistance to the virus by targeted genome modification of the receptor sequences. In an attempt to induce resistance to ALV-J infection, we used clustered regularly interspaced short palindromic repeats (CRISPR)-associated (CRISPR/Cas9)-based genome editing approaches to modify critical residues of the chNHE1 receptor in chicken cells. The susceptibility of the modified cell lines to ALV-J infection was examined using enhanced green fluorescent protein (EGFP)-expressing marker viruses. We showed that modifying the chNHE1 receptor by artificially generating a premature stop codon induced absolute resistance to viral infection, with mutations of the tryptophan residue at position 38 (Trp38) being very critical. Single-stranded oligodeoxynucleotide (ssODN)-mediated targeted recombination of the Trp38 region revealed that deletions involving the Trp38 residue were most effective in conferring resistance to ALV-J. Moreover, protein structure analysis of the chNHE1 receptor sequence suggested that its intrinsically disordered region undergoes local conformational changes through genetic alteration. Collectively, these results demonstrate that targeted mutations on chNHE1 alter the susceptibility to ALV-J and the technique is expected to contribute to develop disease-resistant chicken lines. Copyright © 2017 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
P. Hima Kumari
2018-05-01
Full Text Available Na+ transporters play an important role during salt stress and development. The present study is aimed at genome-wide identification, in silico analysis of sodium-proton antiporter (NHX and sodium-proton exchanger (NHE-type transporters in Sorghum bicolor and their expression patterns under varied abiotic stress conditions. In Sorghum, seven NHX and nine NHE homologs were identified. Amiloride (a known inhibitor of Na+/H+ exchanger activity binding motif was noticed in both types of the transporters. Chromosome 2 was found to be a hotspot region with five sodium transporters. Phylogenetic analysis inferred six ortholog and three paralog groups. To gain an insight into functional divergence of SbNHX/NHE transporters, real-time gene expression was performed under salt, drought, heat, and cold stresses in embryo, root, stem, and leaf tissues. Expression patterns revealed that both SbNHXs and SbNHEs are responsive either to single or multiple abiotic stresses. The predicted protein–protein interaction networks revealed that only SbNHX7 is involved in the calcineurin B-like proteins (CBL- CBL interacting protein kinases (CIPK pathway. The study provides insights into the functional divergence of SbNHX/NHE transporter genes with tissue specific expressions in Sorghum under different abiotic stress conditions.
Lamoureux, Lorissa; Radhakrishnan, Jeejabai; Mason, Thomas G; Kraut, Jeffrey A; Gazmuri, Raúl J
2016-11-01
Major myocardial abnormalities occur during cardiac arrest and resuscitation including intracellular acidosis-partly caused by CO 2 accumulation-and activation of the Na + -H + exchanger isoform-1 (NHE-1). We hypothesized that a favorable interaction may result from NHE-1 inhibition during cardiac resuscitation followed by administration of a CO 2 -consuming buffer upon return of spontaneous circulation (ROSC). Ventricular fibrillation was electrically induced in 24 male rats and left untreated for 8 min followed by defibrillation after 8 min of cardiopulmonary resuscitation (CPR). Rats were randomized 1:1:1 to the NHE-1 inhibitor zoniporide or vehicle during CPR and disodium carbonate/sodium bicarbonate buffer or normal saline (30 ml/kg) after ROSC. Survival at 240 min declined from 100% with Zoniporide/Saline to 50% with Zoniporide/Buffer and 25% with Vehicle/Buffer (P = 0.004), explained by worsening postresuscitation myocardial dysfunction. Marked alkalemia occurred after buffer administration along with lactatemia that was maximal after Vehicle/Buffer, attenuated by Zoniporide/Buffer, and minimal with Zoniporide/Saline [13.3 ± 4.8 (SD), 9.2 ± 4.6, and 2.7 ± 1.0 mmol/l; P ≤ 0.001]. We attributed the intense postresuscitation lactatemia to enhanced glycolysis consequent to severe buffer-induced alkalemia transmitted intracellularly by an active NHE-1. We attributed the worsened postresuscitation myocardial dysfunction also to severe alkalemia intensifying Na + entry via NHE-1 with consequent Ca 2+ overload injuring mitochondria, evidenced by increased plasma cytochrome c Both buffer-induced effects were ameliorated by zoniporide. Accordingly, buffer-induced alkalemia after ROSC worsened myocardial function and survival, likely through enhancing NHE-1 activity. Zoniporide attenuated these effects and uncovered a complex postresuscitation acid-base physiology whereby blood pH drives NHE-1 activity and compromises mitochondrial function and integrity along
DEFF Research Database (Denmark)
Lauritzen, Gitte; Stock, Christian-Martin; Lemaire, Justine
2012-01-01
We and others have shown central roles of the Na(+)/H(+) exchanger NHE1 in cell motility. The aim of this study was to determine the roles of NHE1 and of the Na(+), HCO(3)(-) cotransporter NBCn1 in motility of serum-starved MCF-7 breast cancer cells expressing constitutively active ErbB2 (¿NErbB2...
Bonde, L; Boedtkjer, E
2017-10-01
The electroneutral Na + , HCO3- cotransporter NBCn1 and Na + /H + exchanger NHE1 regulate acid-base balance in vascular smooth muscle cells (VSMCs) and modify artery function and structure. Pathological conditions - notably ischaemia - can dramatically perturb intracellular (i) and extracellular (o) pH and [Na + ]. We examined effects of low [Na + ] o and pH o on NBCn1 and NHE1 activity in VSMCs of small arteries. We measured pH i by 2',7'-bis-(2-carboxyethyl)-5-(and-6)-carboxyfluorescein-based fluorescence microscopy of mouse mesenteric arteries and induced intracellular acidification by NH4+ prepulse technique. NBCn1 activity - defined as Na + -dependent, amiloride-insensitive net base uptake with CO 2 /HCO3- present - was inhibited equally when pH o decreased from 7.4 (22 mm HCO3-/5% CO 2 ) by metabolic (pH o 7.1/11 mm HCO3-: 22 ± 8%; pH o 6.8/5.5 mm HCO3-: 61 ± 7%) or respiratory (pH o 7.1/10% CO 2 : 35 ± 11%; pH o 6.8/20% CO 2 : 56 ± 7%) acidosis. Extracellular acidosis more prominently inhibited NHE1 activity - defined as Na + -dependent net acid extrusion without CO 2 /HCO3- present - at both pH o 7.1 (45 ± 9%) and 6.8 (85 ± 5%). Independently of pH o , lowering [Na + ] o from 140 to 70 mm reduced NBCn1 and NHE1 activity respiratory (ΔpH i /ΔpH o = 71 ± 4%) than metabolic (ΔpH i /ΔpH o = 30 ± 7%) acidosis. Extracellular acidification inhibits NBCn1 and NHE1 activity in VSMCs. NBCn1 is equivalently inhibited when pCO 2 is raised or [HCO3-] o decreased. Lowering [Na + ] o inhibits NBCn1 and NHE1 markedly only below the typical physiological and pathophysiological range. We propose that inhibition of Na + -dependent net acid extrusion at low pH o protects against cellular Na + overload at the cost of intracellular acidification. © 2017 Scandinavian Physiological Society. Published by John Wiley & Sons Ltd.
Ismail, Nurain; Giribabu, Nelli; Muniandy, Sekaran; Salleh, Naguib
2015-01-01
Restoring the pH of cervicovaginal fluid is important for the cervicovaginal health after menopause. Genistein, which is a widely consumed dietary health supplement to overcome the post-menopausal complications could help to restore the cervicovaginal fluid pH. We hypothesized that genistien effect involves changes in expression of NHE-1, 2 and 4 proteins and mRNAs in the cervix. This study investigated effect of genistein on NHE-1, 2 and 4 protein and mRNA expression in the cervix in order to elucidate the mechanisms underlying possible effect of this compound on cervicovaginal fluid pH after menopause. Ovariectomised adult female rats received 25, 50 and 100 mg/kg/day genistein for seven consecutive days. At the end of the treatment, animals were sacrificed and cervix was harvested. Expression of Nhe-1, 2 and 4 mRNA were analyzed by Real-time PCR while distribution of NHE-1, 2 and 4 protein were observed by immunohistochemistry. Treatment with 50 and 100 mg/kg/day genistein caused marked increase in the levels of expression and distribution of NHE-1, 2 and 4 proteins in the endocervical epithelia. Levels of Nhe-1, 2 and 4 mRNA in the cervix were also increased. Coadministration of ICI 182 780 and genistein reduced the expression levels of NHE-1, 2 and 4 proteins and mRNAs in the cervix. Enhanced expression of NHE-1, 2 and 4 proteins and mRNAs expression in cervix under genistein influence could help to restore the cervicovaginal fluid pH that might help to prevent cervicovaginal complications related to menopause.
NHE-1 sequence and expression in toad, snake and fish red blood cells
DEFF Research Database (Denmark)
Thomsen, Steffen Nyegaard; Wang, Tobias; Kristensen, Torsten
Red blood cells (RBC) from reptiles appear not to express regulatory volume increase (RVI) upon shrinkage (Kristensen et al., 2008). In other vertebrates, the RVI response is primarily mediated by activation of the Na+/H+ exchanger (NHE-1) and we, therefore decided to investigate whether red cells...... of reptiles express a different NHE-1 that responds less to volume activation compared to other vertebrates or simply lack the Na+/H+ exchanger. Using various tissues from the ball python (Python regius), Cane toad (Bufo marinus) and European perch (Perca fluviatilis), cDNA libraries were created...
Nhe I and Hinc II polymorphisms in the human laminin B1 chain gene on 7q22
Energy Technology Data Exchange (ETDEWEB)
Pikkarainen, T; Savolainen, E R; Tryggvason, K [Univ. of Oulu (Finland)
1989-06-12
pHL-40 and pHL-42 are overlapping cDNA clones that code for 4.2 kb of the 3{prime} end of the 5.5 kb mRNA. Nhe I detects a two allele polymorphism with fragments of 4.3 kb or 4.0 kb and an invariant band of 10.0 kb. Hinc II detects a two allele polymorphism with fragments of 6.6 kb or 5.5 kb and 1.1 kb and invariant bands of 7.8 kb, 4.0 kb, 3.3 kb, 2.3 kb and 0.6 kb. The allele frequency was studied in 60 chromosomes of unrelated Finnish individuals. The probe was localized to chromosome 7q22 by somatic cell and in situ hybridization. Co-dominant inheritance of the Nhe I RFLP was shown in one family and of the Hinc II RFLP in five families.
DEFF Research Database (Denmark)
Zhang, Y B; Magyar, C E; Holstein-Rathlou, N H
1998-01-01
by cobalt chloride (CoCl2). Four groups of rats (n = 4 to 5) were studied: (1) sham-operated; (2) 50 mg of CoCl2/kg subcutaneously for 2 d; (3) acute hypertension by constricting arteries for 5 min; and (4) acute hypertension after CoCl2 treatment as in group 3. Renal cortex was analyzed after sorbitol...... reabsorption and diuresis and abolishes Na,K-ATPase inhibition and NHE-3 redistribution during acute hypertension, evidence that these responses may be mediated by cytochrome P-450 arachidonate metabolites....
Directory of Open Access Journals (Sweden)
Juliana Martins da Costa-Pessoa
2014-02-01
Full Text Available Aims: In models of diabetes, distal nephron cells contribute to glucose uptake and oxidation. How these cells contribute to the use of glucose for the regulation of H+ extrusion remains unknown. We used Madin-Darby Canine Kidney (MDCK cells to investigate the effect of acute or chronic high glucose concentration on the abundance and activity of the Na+/H+ exchanger (NHE-1. Methods: Using RT-PCR, we also evaluated the mRNA expression for sodium glucose co-transporters SGLT1 and SGLT2. Protein abundance was analyzed using immunoblotting, and intracellular pH (pHi recovery was evaluated using microscopy in conjunction with the fluorescent probe BCECF/AM. The Na+-dependent pHi recovery rate was monitored with HOE-694 (50 µM and/or S3226 (10 µM, specific NHE-1 and NHE-3 inhibitors. Results: MDCK cells did not express the mRNA for SGLT1 or SGLT2 but did express the GLUT2, NHE-1 and NHE-3 proteins. Under control conditions, we observed a greater contribution of NHE-1 to pHi recovery relative to the other H+ transporters. Acute high glucose treatment increased the HOE-694-sensitive pHi recovery rate and p-Erk1/2 and p90RSK abundance. These parameters were reduced by PD-98059, a Mek inhibitor (1 µM. Chronic high glucose treatment also increased the HOE-694-sensitive pHi recovery rate and p-p38MAPK abundance. Both parameters were reduced by SB-203580, a p38MAPK inhibitor (10 µM. Conclusion: These results suggested that extracellular high glucose stimulated NHE-1 acutely and chronically through Mek/Erk1/2/p90RSK and p38MAPK pathways, respectively.
Singh, Yogesh; Zhou, Yuetao; Zhang, Shaqiu; Abdelazeem, Khalid N M; Elvira, Bernat; Salker, Madhuri S; Lang, Florian
2017-01-01
MicroRNAs (miRNAs) negatively regulate gene expression at a post-transcriptional level. Dicer, a cytoplasmic RNase III enzyme, is required for the maturation of miRNAs from precursor miRNAs. Dicer, therefore, is a critical enzyme involved in the biogenesis and processing of miRNAs. Several biological processes are controlled by miRNAs, including the regulation of T cell development and function. T cells generate reactive oxygen species (ROS) with parallel H+ extrusion accomplished by the Na+/H+-exchanger 1 (NHE1). The present study explored whether ROS production, as well as NHE1 expression and function are sensitive to the lack of Dicer (miRNAs deficient) and could be modified by individual miRNAs. CD4+ T cells were isolated from CD4 specific Dicer deficient (DicerΔ/Δ) mice and the respective control mice (Dicerfl/fl). Transcript and protein levels were quantified with RT-PCR and Western blotting, respectively. For determination of intracellular pH (pHi) cells were incubated with the pH sensitive dye bis-(2-carboxyethyl)-5-(and-6)-carboxyfluorescein (BCECF) and Na+/H+ exchanger (NHE) activity was calculated from re-alkalinization after an ammonium pulse. Changes in cell volume were measured using the forward scatter in flow cytometry, and ROS production utilizing 2',7' -dichlorofluorescin diacetate (DCFDA) fluorescence. Transfection of miRNA-control and mimics in T cells was performed using DharmaFECT3 reagent. ROS production, cytosolic H+ concentration, NHE1 transcript and protein levels, NHE activity, and cell volume were all significantly higher in CD4+ T cells from DicerΔ/Δ mice than in CD4+ T cells from Dicerfl/fl mice. Furthermore, individual miR-200b and miR-15b modify pHi and NHE activity in Dicerfl/fl and DicerΔ/Δ CD4+ T cells, respectively. Lack of Dicer leads to oxidative stress, cytosolic acidification, upregulated NHE1 expression and activity as well as swelling of CD4+ T cells, functions all reversed by miR-15b or miR-200b. © 2017 The Author
S3226, a novel NHE3 inhibitor, attenuates ischemia-induced acute renal failure in rats.
Hropot, M; Juretschke, H P; Langer, K H; Schwark, J R
2001-12-01
Acute renal failure (ARF) remains a major problem in clinical nephrology characterized by sudden loss of the kidney function due to ischemia, trauma, and/or nephrotoxic drugs. The current therapy of ARF is symptomatic with mortality rates exceeding 50%. The aim of this study was to investigate the effects of an intravenous infusion of S3226 (3-[2-(3-guanidino-2-methyl-3-oxopropenyl)-5-methyl-phenyl]-N-isopropylidene-2-methyl-acrylamide dihydrochloride), a selective Na+/H+ exchange subtype 3 (NHE3) blocker, in ischemia-induced ARF in rats. In a second series of experiments cytosolic pH (pHi) changes in the kidney during ARF were continuously measured by means of nuclear magnetic resonance spectroscopy (MRS). ARF was induced by bilateral occlusion of renal arteries for 40 minutes in three groups of anaesthetized Wistar rats. Control rats (N = 12) were infused with saline (6.25 mL/kg over 30 min) before occlusion and the compound groups (each N = 12) were infused with S3226 at a dose of 20 mg/kg over 30 minutes either before initiation of ischemia or immediately after release of clamps. Plasma creatinine (PCr), creatinine clearance (CCr), urine volume, sodium, and potassium excretion were determined up to seven days after release of clamps. In the second series of experiments in anaesthetized rats the left kidney was exposed by flank incision and fixed in a non-magnetic device. An inflatable cuff was positioned around the pedicle to induce ischemia without removing animals from the magnet. A double-tuned 1H-31P home-built surface coil was placed above the exposed kidney for the detection of pHi. At day 1 after ischemia CCr in the control group was significantly lower as compared to S3226-treated animals (control 0.30 +/- 0.05 vs. before 0.90 +/- 0.26 and reperfusion 0.83 +/- 0.15 mL/min/kg, respectively). PCr increased from 18 +/- 0.1 micromol/L before occlusion to 245 +/- 7 micromol/L in the control. The increase in PCr was significantly lower in the S3226 treated
Meng, Wei; Zhou, Defang; Li, Chengui; Wang, Guihua; Huang, Libo; Cheng, Ziqiang
2018-05-02
Avian leukosis virus subgroup J (ALV-J), an oncogenic retrovirus, induces myelocytomas and other various tumors, leading to great economical losses in poultry industry. It is a great challenge to develop effective preventive methods for ALV-J control due to its antigenic variations in the variable regions of envelope. In present study, we generated a mouse polyclonal antibody targeting the first extracellular loop (ECL1) of chicken Na + /H + exchanger isoform 1 (chNHE1), the receptor of ALV-J, to block ALV-J infection in vitro and in vivo. In ALV-J infected DF-1 cells, chNHE1 expression and the intracellular pH (pHi) were up-regulated with "wave" pattern, indicating that the disequilibrium of ALV-J infected cells associated with chNHE1. Next, we validated that ALV-J infection was significantly blocked with time dependent after treating with anti-ECL1 antibody and accordingly the pHi value were recovered, indicating the blockage of ALV-J infection did not affect Na + /H + exchange. Furthermore, in anti-ECL1 antibody treatment chickens that infected by ALV-J, weight gain and immune organs were recovered, and viral loads were significantly decreased, and the tissue injury and inflammation were reduced significantly from 21 to 35 days of age. The study demonstrated that anti-ECL1 antibody effectively blocks ALV-J infection without affecting Na + /H + exchange, and sheds light on a novel strategy for retroviruses control. Copyright © 2018 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Pelin Cengiz
Full Text Available Hypoxia ischemia (HI-related brain injury is the major cause of long-term morbidity in neonates. One characteristic hallmark of neonatal HI is the development of reactive astrogliosis in the hippocampus. However, the impact of reactive astrogliosis in hippocampal damage after neonatal HI is not fully understood. In the current study, we investigated the role of Na(+/H(+ exchanger isoform 1 (NHE1 protein in mouse reactive hippocampal astrocyte function in an in vitro ischemia model (oxygen/glucose deprivation and reoxygenation, OGD/REOX. 2 h OGD significantly increased NHE1 protein expression and NHE1-mediated H(+ efflux in hippocampal astrocytes. NHE1 activity remained stimulated during 1-5 h REOX and returned to the basal level at 24 h REOX. NHE1 activation in hippocampal astrocytes resulted in intracellular Na(+ and Ca(2+ overload. The latter was mediated by reversal of Na(+/Ca(2+ exchange. Hippocampal astrocytes also exhibited a robust release of gliotransmitters (glutamate and pro-inflammatory cytokines IL-6 and TNFα during 1-24 h REOX. Interestingly, inhibition of NHE1 activity with its potent inhibitor HOE 642 not only reduced Na(+ overload but also gliotransmitter release from hippocampal astrocytes. The noncompetitive excitatory amino acid transporter inhibitor TBOA showed a similar effect on blocking the glutamate release. Taken together, we concluded that NHE1 plays an essential role in maintaining H(+ homeostasis in hippocampal astrocytes. Over-stimulation of NHE1 activity following in vitro ischemia disrupts Na(+ and Ca(2+ homeostasis, which reduces Na(+-dependent glutamate uptake and promotes release of glutamate and cytokines from reactive astrocytes. Therefore, blocking sustained NHE1 activation in reactive astrocytes may provide neuroprotection following HI.
Roles of pH and the Na+/H+ exchanger NHE1 in cancer
DEFF Research Database (Denmark)
Stock, Christian; Pedersen, Stine Helene Falsig
2017-01-01
Acidosis is characteristic of the solid tumor microenvironment. Tumor cells, because they are highly proliferative and anabolic, have greatly elevated metabolic acid production. To sustain a normal cytosolic pH homeostasis they therefore need to either extrude excess protons or to neutralize them...... with tumor malignancy. The present review discusses current evidence on how altered pH homeostasis, and in particular NHE1, contributes to tumor cell motility, invasion, proliferation, and growth and facilitates evasion of chemotherapeutic cell death. We summarize data from in vitro studies, 2D-, 3D...
Czech Academy of Sciences Publication Activity Database
Reinišová, Markéta; Plachý, Jiří; Kučerová, Dana; Šenigl, Filip; Vinkler, M.; Hejnar, Jiří
2016-01-01
Roč. 11, č. 3 (2016), e0150589-e0150589 E-ISSN 1932-6203 R&D Projects: GA MŠk LO1419; GA ČR GA13-30983S Institutional support: RVO:68378050 Keywords : avian leukosis virus * NHE1 * Genetic Diversity Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 2.806, year: 2016
Zoratto, F; Palombelli, G M; Ruocco, L A; Carboni, E; Laviola, G; Sadile, A G; Adriani, W; Canese, R
2017-08-30
Due to a hyperfunctioning mesocorticolimbic system, Naples-High-Excitability (NHE) rats have been proposed to model for the meso-cortical variant of attention deficit/hyperactivity disorder (ADHD). Compared to Naples Random-Bred (NRB) controls, NHE rats show hyperactivity, impaired non-selective attention (Aspide et al., 1998), and impaired selective spatial attention (Ruocco et al., 2009a, 2014). Alteration in limbic functions has been proposed; however, resulting unbalance among forebrain areas has not been assessed yet. By resting-state functional Magnetic-Resonance Imaging (fMRI) in vivo, we investigated the connectivity of neuronal networks belonging to limbic vs. cortical loops in NHE and NRB rats (n=10 each). Notably, resting-state fMRI was applied using a multi-slice sagittal, gradient-echo sequence. Voxel-wise connectivity maps at rest, based on temporal correlation among fMRI time-series, were computed by seeding the hippocampus (Hip), nucleus accumbens (NAcc), dorsal striatum (dStr), amygdala (Amy) and dorsal/medial prefrontal cortex (PFC), both hemispheres. To summarize patterns of altered connection, clearly directional connectivity was evident within the cortical loop: bilaterally and specularly, from orbital and dorsal PFCs through dStr and hence towards Hip. Such network communication was reduced in NHE rats (also, with less mesencephalic/pontine innervation). Conversely, enhanced network activity emerged within the limbic loop of NHE rats: from left PFC, both through the NAcc and directly, to the Hip (all of which received greater ventral tegmental innervation, likely dopamine). Together with tuned-down cortical loop, this potentiated limbic loop may serve a major role in controlling ADHD-like behavioral symptoms in NHE rats. Copyright © 2017 Elsevier B.V. All rights reserved.
Cytotoxic mechanisms of Zn2+ and Cd2+ involve Na+/H+ exchanger (NHE) activation by ROS
International Nuclear Information System (INIS)
Koutsogiannaki, Sophia; Evangelinos, Nikolaos; Koliakos, George; Kaloyianni, Martha
2006-01-01
The signaling mechanism induced by cadmium (Cd) and zinc (Zn) in gill cells of Mytilus galloprovincialis was investigated. Both metals cause an increase in ·O 2 - production, with Cd to be more potent (216 ± 15%) than Zn (150 ± 9.5%), in relation to control value (100%). The metals effect was reversed after incubation with the amiloride analogue, EIPA, a selective Na + /H + exchanger (NHE) inhibitor as well as in the presence of calphostin C, a protein kinase C (PKC) inhibitor. The heavy metals effect on ·O 2 - production was mediated via the interaction of metal ions with α 1 - and β-adrenergic receptors, as shown after incubation with their respective agonists and antagonists. In addition, both metals caused an increase in intracellular pH (pHi) of gill cells. EIPA together with either metal significantly reduced the effect of each metal treatment on pHi. Incubation of gill cells with the oxidants rotenone, antimycin A and pyruvate caused a significant increase in pHi (ΔpHi 0.830, 0.272 and 0.610, respectively), while in the presence of the anti-oxidant N-acetyl cysteine (NAC) a decrease in pHi (ΔpHi -0.090) was measured, indicating that change in reactive oxygen species (ROS) production by heavy metals affects NHE activity. When rosiglitazone was incubated together with either heavy metal a decrease in O 2 - production was observed. Our results show a key role of NHE in the signal transduction pathway induced by Zn and Cd in gill cells, with the involvement of ROS, PKC, adrenergic and PPAR-γ receptors. In addition, differences between the two metals concerning NHE activation, O 2 - production and interaction with adrenergic receptors were observed
New PAH gene promoter KLF1 and 3'-region C/EBPalpha motifs influence transcription in vitro.
Klaassen, Kristel; Stankovic, Biljana; Kotur, Nikola; Djordjevic, Maja; Zukic, Branka; Nikcevic, Gordana; Ugrin, Milena; Spasovski, Vesna; Srzentic, Sanja; Pavlovic, Sonja; Stojiljkovic, Maja
2017-02-01
Phenylketonuria (PKU) is a metabolic disease caused by mutations in the phenylalanine hydroxylase (PAH) gene. Although the PAH genotype remains the main determinant of PKU phenotype severity, genotype-phenotype inconsistencies have been reported. In this study, we focused on unanalysed sequences in non-coding PAH gene regions to assess their possible influence on the PKU phenotype. We transiently transfected HepG2 cells with various chloramphenicol acetyl transferase (CAT) reporter constructs which included PAH gene non-coding regions. Selected non-coding regions were indicated by in silico prediction to contain transcription factor binding sites. Furthermore, electrophoretic mobility shift assay (EMSA) and supershift assays were performed to identify which transcriptional factors were engaged in the interaction. We found novel KLF1 motif in the PAH promoter, which decreases CAT activity by 50 % in comparison to basal transcription in vitro. The cytosine at the c.-170 promoter position creates an additional binding site for the protein complex involving KLF1 transcription factor. Moreover, we assessed for the first time the role of a multivariant variable number tandem repeat (VNTR) region located in the 3'-region of the PAH gene. We found that the VNTR3, VNTR7 and VNTR8 constructs had approximately 60 % of CAT activity. The regulation is mediated by the C/EBPalpha transcription factor, present in protein complex binding to VNTR3. Our study highlighted two novel promoter KLF1 and 3'-region C/EBPalpha motifs in the PAH gene which decrease transcription in vitro and, thus, could be considered as PAH expression modifiers. New transcription motifs in non-coding regions will contribute to better understanding of the PKU phenotype complexity and may become important for the optimisation of PKU treatment.
International Nuclear Information System (INIS)
Lee, Seoung Hoon; Kim, Taesoo; Park, Eui-Soon; Yang, Sujeong; Jeong, Daewon; Choi, Yongwon; Rho, Jaerang
2008-01-01
Bone homeostasis is tightly regulated by the balanced actions of osteoblasts (OBs) and osteoclasts (OCs). We previously analyzed the gene expression profile of OC differentiation using a cDNA microarray, and identified a novel osteoclastogenic gene candidate, clone OCL-1-E7 [J. Rho, C.R. Altmann, N.D. Socci, L. Merkov, N. Kim, H. So, O. Lee, M. Takami, A.H. Brivanlou, Y. Choi, Gene expression profiling of osteoclast differentiation by combined suppression subtractive hybridization (SSH) and cDNA microarray analysis, DNA Cell Biol. 21 (2002) 541-549]. In this study, we have isolated full-length cDNAs corresponding to this clone from mice and humans to determine the functional roles of this gene in osteoclastogenesis. The full-length cDNA of OCL-1-E7 encodes 12 membrane-spanning domains that are typical of isoforms of the Na + /H + exchangers (NHEs), indicating that this clone is a novel member of the NHE family (hereafter referred to as NHE10). Here, we show that NHE10 is highly expressed in OCs in response to receptor activator of nuclear factor-κB ligand signaling and is required for OC differentiation and survival
Physiology, pharmacology and pathophysiology of the pH regulatory transport proteins NHE1 and NBCn1
DEFF Research Database (Denmark)
Bødtkjer, Ebbe; Bunch, Lennart; Pedersen, Stine Helene Falsig
2012-01-01
and are differentially regulated. Here, we provide an update on the basic structure, function, regulation, physiology and pharmacology of NHE1 and NBCn1, with particular focus on the factors responsible for their functional similarities and differences. Finally, we highlight recent findings implicating...
Ito, Yusuke; Kobayashi, Sayako; Nakamura, Nobuhiro; Miyagi, Hisako; Esaki, Masahiro; Hoshijima, Kazuyuki; Hirose, Shigehisa
2013-01-01
Freshwater (FW) fishes actively absorb salt from their environment to tolerate low salinities. We previously reported that vacuolar-type H+-ATPase/mitochondrion-rich cells (H-MRCs) on the skin epithelium of zebrafish larvae (Danio rerio) are primary sites for Na+ uptake. In this study, in an attempt to clarify the mechanism for the Na+ uptake, we performed a systematic analysis of gene expression patterns of zebrafish carbonic anhydrase (CA) isoforms and found that, of 12 CA isoforms, CA2a and CA15a are highly expressed in H-MRCs at larval stages. The ca2a and ca15a mRNA expression were salinity-dependent; they were upregulated in 0.03 mM Na+ water whereas ca15a but not ca2a was down-regulated in 70 mM Na+ water. Immunohistochemistry demonstrated cytoplasmic distribution of CA2a and apical membrane localization of CA15a. Furthermore, cell surface immunofluorescence staining revealed external surface localization of CA15a. Depletion of either CA2a or CA15a expression by Morpholino antisense oligonucleotides resulted in a significant decrease in Na+ accumulation in H-MRCs. An in situ proximity ligation assay demonstrated a very close association of CA2a, CA15a, Na+/H+ exchanger 3b (Nhe3b), and Rhcg1 ammonia transporter in H-MRC. Our findings suggest that CA2a, CA15a, and Rhcg1 play a key role in Na+uptake under FW conditions by forming a transport metabolon with Nhe3b. PMID:23565095
Energy Technology Data Exchange (ETDEWEB)
Koutsogiannaki, Sophia [Laboratory of Animal Physiology, Zoology Department, School of Biology, Faculty of Science, Aristotle University of Thessaloniki, 54124 Thessaloniki (Greece); Evangelinos, Nikolaos [Laboratory of Animal Physiology, Zoology Department, School of Biology, Faculty of Science, Aristotle University of Thessaloniki, 54124 Thessaloniki (Greece); Koliakos, George [Department of Biological Chemistry, Medical School, Aristotle University of Thessaloniki, P.O. Box 17034, 54124 Thessaloniki (Greece); Kaloyianni, Martha [Laboratory of Animal Physiology, Zoology Department, School of Biology, Faculty of Science, Aristotle University of Thessaloniki, 54124 Thessaloniki (Greece)]. E-mail: kaloyian@bio.auth.gr
2006-07-20
The signaling mechanism induced by cadmium (Cd) and zinc (Zn) in gill cells of Mytilus galloprovincialis was investigated. Both metals cause an increase in {center_dot}O{sub 2} {sup -} production, with Cd to be more potent (216 {+-} 15%) than Zn (150 {+-} 9.5%), in relation to control value (100%). The metals effect was reversed after incubation with the amiloride analogue, EIPA, a selective Na{sup +}/H{sup +} exchanger (NHE) inhibitor as well as in the presence of calphostin C, a protein kinase C (PKC) inhibitor. The heavy metals effect on {center_dot}O{sub 2} {sup -} production was mediated via the interaction of metal ions with {alpha}{sub 1}- and {beta}-adrenergic receptors, as shown after incubation with their respective agonists and antagonists. In addition, both metals caused an increase in intracellular pH (pHi) of gill cells. EIPA together with either metal significantly reduced the effect of each metal treatment on pHi. Incubation of gill cells with the oxidants rotenone, antimycin A and pyruvate caused a significant increase in pHi ({delta}pHi 0.830, 0.272 and 0.610, respectively), while in the presence of the anti-oxidant N-acetyl cysteine (NAC) a decrease in pHi ({delta}pHi -0.090) was measured, indicating that change in reactive oxygen species (ROS) production by heavy metals affects NHE activity. When rosiglitazone was incubated together with either heavy metal a decrease in O{sub 2} {sup -} production was observed. Our results show a key role of NHE in the signal transduction pathway induced by Zn and Cd in gill cells, with the involvement of ROS, PKC, adrenergic and PPAR-{gamma} receptors. In addition, differences between the two metals concerning NHE activation, O{sub 2} {sup -} production and interaction with adrenergic receptors were observed.
DEFF Research Database (Denmark)
Rasmussen, Martin Krøyer; Juel, Carsten; Nordsborg, Nikolai Baastrup
2011-01-01
It is investigated if exercise induced mRNA changes cause similar protein expression changes of Na(+), K(+) pump isoforms (a1, a2, ß1, ß2), FXYD1 and NHE1 in rat skeletal muscle. Expression was evaluated (n=8 per group) in Soleus and EDL after 1 day, 3 days and 3 weeks (5 sessions per week...
Directory of Open Access Journals (Sweden)
Fabrice Lucien
Full Text Available The hypoxic and acidic microenvironments in tumors are strongly associated with malignant progression and metastasis, and have thus become a central issue in tumor physiology and cancer treatment. Despite this, the molecular links between acidic pH- and hypoxia-mediated cell invasion/metastasis remain mostly unresolved. One of the mechanisms that tumor cells use for tissue invasion is the generation of invadopodia, which are actin-rich invasive plasma membrane protrusions that degrade the extracellular matrix. Here, we show that hypoxia stimulates the formation of invadopodia as well as the invasive ability of cancer cells. Inhibition or shRNA-based depletion of the Na(+/H(+ exchanger NHE-1, along with intracellular pH monitoring by live-cell imaging, revealed that invadopodia formation is associated with alterations in cellular pH homeostasis, an event that involves activation of the Na(+/H(+ exchange rate by NHE-1. Further characterization indicates that hypoxia triggered the activation of the p90 ribosomal S6 kinase (p90 RSK, which resulted in invadopodia formation and site-specific phosphorylation and activation of NHE-1. This study reveals an unsuspected role of p90RSK in tumor cell invasion and establishes p90RS kinase as a link between hypoxia and the acidic microenvironment of tumors.
Lu, Zhongyan; Yao, Lei; Jiang, Zhengqian; Aschenbach, Jörg R; Martens, Holger; Shen, Zanming
2016-01-01
Low sodium content in feed and large amounts of salivary sodium secretion are essential requirements to efficient sodium reabsorption in the dairy cow. It is already known that Na(+)/H(+) exchange (NHE) of the ruminal epithelium plays a key role in Na(+) absorption, and its function is influenced by the presence of short-chain fatty acids (SCFA) and mucosal pH. By contrast, the functional role and regulation of NHE in omasal epithelium have not been completely understood. In the present study, we used model studies in small ruminants (sheep and goats) to investigate NHE-mediated Na(+) transport and the effects of pH and SCFA on NHE activity in omasal epithelium and on the expression of NHE isoform in omasal epithelial cells. Conventional Ussing chamber technique, primary cell culture, quantitative PCR, and Western blot were used. In native omasal epithelium of sheep, the Na(+) transport was electroneutral, and it was inhibited by the specific NHE3 inhibitor 3-[2-(3-guanidino-2-methyl-3-oxo-propenyl)-5-methyl-phenyl]-N-isopropylidene-2-methyl-acrylamide dihydrochloride, which decreased mucosal-to-serosal, serosal-to-mucosal, and net flux rates of Na(+) by 80% each. The application of low mucosal pH (6.4 or 5.8) in the presence of SCFA activated the Na(+) transport across omasal epithelium of sheep compared with that at pH 7.4. In cultured omasal epithelial cells of goats, mRNA and protein of NHE1, NHE2, and NHE3 were detected. The application of SCFA increased NHE1 mRNA and protein expression, which was most prominent when the culture medium pH decreased from 7.4 to 6.8. At variance, the mRNA and protein expression of NHE2 and NHE3 were decreased with low pH and SCFA, which was contrary to the published data from ruminal epithelial studies. In conclusion, this paper shows that (1) NHE1, NHE2, and NHE3 are expressed in omasal epithelium; (2) NHE3 mediates the major portion of transepithelial Na(+) transport in omasal epithelium; and (3) SCFA and acidic pH acutely
Hegyi, A; Péter, A; Finni, T; Cronin, N J
2018-03-01
Recent studies suggest region-specific metabolic activity in hamstring muscles during injury prevention exercises, but the neural representation of this phenomenon is unknown. The aim of this study was to examine whether regional differences are evident in the activity of biceps femoris long head (BFlh) and semitendinosus (ST) muscles during two common injury prevention exercises. Twelve male participants without a history of hamstring injury performed the Nordic hamstring exercise (NHE) and stiff-leg deadlift (SDL) while BFlh and ST activities were recorded with high-density electromyography (HD-EMG). Normalized activity was calculated from the distal, middle, and proximal regions in the eccentric phase of each exercise. In NHE, ST overall activity was substantially higher than in BFlh (d = 1.06 ± 0.45), compared to trivial differences between muscles in SDL (d = 0.19 ± 0.34). Regional differences were found in NHE for both muscles, with different proximal-distal patterns: The distal region showed the lowest activity level in ST (regional differences, d range = 0.55-1.41) but the highest activity level in BFlh (regional differences, d range = 0.38-1.25). In SDL, regional differences were smaller in both muscles (d range = 0.29-0.67 and 0.16-0.63 in ST and BFlh, respectively) than in NHE. The use of HD-EMG in hamstrings revealed heterogeneous hamstrings activity during typical injury prevention exercises. High-density EMG might be useful in future studies to provide a comprehensive overview of hamstring muscle activity in other exercises and high-injury risk tasks. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
International Nuclear Information System (INIS)
Dexheimer, Thomas S.; Carey, Steven S.; Zuohe, Song; Gokhale, Vijay M.; Hu, Xiaohui; Murata, Lauren B.; Maes, Estelle M.; Weichsel, Andrzej; Sun, Daekyu; Meuillet, Emmanuelle J.; Montfort, William R.; Hurley, Laurence H.
2009-01-01
The formation of G-quadruplex structures within the nuclease hypersensitive element (NHE) III 1 region of the c-myc promoter and the ability of these structures to repress c-myc transcription have been well established. However, just how these extremely stable DNA secondary structures are transformed to activate c-myc transcription is still unknown. NM23-H2/nucleoside diphosphate kinase B has been recognized as an activator of c-myc transcription via interactions with the NHE III 1 region of the c-myc gene promoter. Through the use of RNA interference, we confirmed the transcriptional regulatory role of NM23-H2. In addition, we find that further purification of NM23-H2 results in loss of the previously identified DNA strand cleavage activity, but retention of its DNA binding activity. NM23-H2 binds to both single-stranded guanine- and cytosine-rich strands of the c-myc NHE III 1 and, to a lesser extent, to a random single-stranded DNA template. However, it does not bind to or cleave the NHE III 1 in duplex form. Significantly, potassium ions and compounds that stabilize the G-quadruplex and i-motif structures have an inhibitory effect on NM23-H2 DNA-binding activity. Mutation of Arg 88 to Ala 88 (R88A) reduced both DNA and nucleotide binding but had minimal effect on the NM23-H2 crystal structure. On the basis of these data and molecular modeling studies, we have proposed a stepwise trapping-out of the NHE III 1 region in a single-stranded form, thus allowing single-stranded transcription factors to bind and activate c-myc transcription. Furthermore, this model provides a rationale for how the stabilization of the G-quadruplex or i-motif structures formed within the c-myc gene promoter region can inhibit NM23-H2 from activating c-myc gene expression.
DEFF Research Database (Denmark)
Damkier, Helle H; Christensen, Henriette L; Christensen, Inga B
2017-01-01
, but the pH value seems nonetheless maintained within narrow limits, even when faced with acid/base challenges. The involvement of choroid plexus acid/base transporters in CSF pH regulation is highlighted by the expression of several acid/base transporters in the epithelium. The aim of the current study...... was to identify novel acid/base transporters expressed in the luminal membrane of the choroid plexus epithelium to pave the way for systematic investigations of each candidate transporter in the regulation of CSF pH. Mass spectrometry analysis of proteins from epithelial cells isolated by fluorescence activated...... cell sorting identified the Cl-/H+ exchangers ClC-3, -4, -5, and -7 in addition to known choroid plexus acid/base transporters. RT-PCR on FACS isolated epithelial cells confirmed the expression of the corresponding mRNAs, as well as NHE6 mRNA. Both NHE6 and ClC-7 were immunolocalized to the luminal...
DEFF Research Database (Denmark)
Cogoi, Susanna; Paramasivam, Manikandan; Filitchev, Vyacheslav Viatcheslav
2009-01-01
A new quadruplex motif located in the promoter of the human KRAS gene, within a nuclease hypersensitive element (NHE), has been characterized. Oligonucleotides mimicking this quadruplex are found to compete with a DNA-protein complex between NHE and a nuclear extract from pancreatic cancer cells........ When modified with (R)-1-O-[4-1-(1-pyrenylethynyl) phenylmethyl]glycerol insertions (TINA), the quadruplex oligonucleotides showed a dramatic increase of the Tm (ΔTm from 22 to 32 °C) and a strong antiproliferative effects in Panc-1 cells....
Evidence that Na+/H+ exchanger 1 is an ATP-binding protein.
Shimada-Shimizu, Naoko; Hisamitsu, Takashi; Nakamura, Tomoe Y; Wakabayashi, Shigeo
2013-03-01
Na(+)/H(+) exchanger (NHE) 1 is a member of the solute carrier superfamily, which regulates intracellular ionic homeostasis. NHE1 is known to require cellular ATP for its activity, despite there being no requirement for energy input from ATP hydrolysis. In this study, we investigated whether NHE1 is an ATP-binding protein. We designed a baculovirus vector carrying both epitope-tagged NHE1 and its cytosolic subunit CHP1, and expressed the functional NHE1-CHP1 complex on the surface of Sf9 insect cells. Using the purified complex protein consisting of NHE1 and CHP1 from Sf9 cells, we examined a photoaffinity labeling reaction with 8-azido-ATP-biotin. UV irradiation promoted the incorporation of 8-azido-ATP into NHE1, but not into CHP1, with an apparent Kd of 29.1 µM in the presence of Mg(2+). The nonlabeled nucleotides ATP, GTP, TTP and CTP all inhibited this crosslinking. However, ATP had the strongest inhibitory effect, with an apparent inhibition constant (IC50) for ATP of 2.2 mM, close to the ATP concentration giving the half-maximal activation of NHE1 activity. Importantly, crosslinking was more strongly inhibited by ATP than by ADP, suggesting that ATP is dissociated from NHE1 upon ATP hydrolysis. Limited proteolysis with thrombin and deletion mutant analysis revealed that the 8-azido-ATP-binding site is within the C-terminal cytoplasmic domain of NHE1. Equilibrium dialysis with NHE1-derived peptides provided evidence that ATP directly binds to the proximal cytoplasmic region (Gly542-Pro598), which is critical for ATP-dependent regulation of NHE1. These findings suggest that NHE1 is an ATP-binding transporter. Thus, ATP may serve as a direct activator of NHE1. © 2013 The Authors Journal compilation © 2013 FEBS.
Directory of Open Access Journals (Sweden)
Xiu L. Chen
2017-11-01
Full Text Available The freshwater climbing perch, Anabas testudineus, is an euryhaline teleost and an obligate air-breather with the ability to actively excrete ammonia. Members of the Na+/H+ exchanger (NHE family help maintain intracellular pH homeostasis and ionic balance through the electroneutral exchange of Na+ and H+. This study aimed to obtain, from the gills of A. testudineus, the full cDNA coding sequence of nhe3, and to determine the effects of exposure to seawater or 100 mmol l−1 of NH4Cl in fresh water on its mRNA and protein expression levels. Efforts were also made to elucidate the type of ionocyte that Nhe3 was associated with in the branchial epithelium of A. testudineus. The transcript level and protein abundance of nhe3/Nhe3 were very low in the gills of freshwater A. testudineus, but they increased significantly in the gills of fish acclimated to seawater. In the gills of fish exposed to seawater, Nhe3 was expressed in two distinct types of seawater-inducible Na+/K+-ATPase (Nka-immunoreactive ionocytes. In Nkaα1b-immunoreactive ionocytes, Nhe3 had an apical localization. As these ionocytes also expressed apical Rhcg1 and basolateral Rhcg2, which are known to transport ammonia, they probably participated in proton-facilitated ammonia excretion in A. testudineus during seawater acclimation. In Nkaα1c-immunoreactive ionocytes, Nhe3 was atypically expressed in the basolateral membrane, and its physiological function is uncertain. For A. testudineus exposed to NH4Cl in fresh water, the transcript and protein expression levels of nhe3/Nhe3 remained low. In conclusion, the branchial Nhe3 of A. testudineus plays a greater physiological role in passive ammonia transport and acid-base balance during seawater acclimation than in active ammonia excretion during environmental ammonia exposure.
Muhle, Rebecca A; Adjalley, Sophie; Falkard, Brie; Nkrumah, Louis J; Muhle, Michael E; Fidock, David A
2009-11-01
Questions surround the mechanism of mutually exclusive expression by which Plasmodium falciparum mediates activation and silencing of var genes. These encode PfEMP1 proteins, which function as cytoadherent and immunomodulatory molecules at the surface of parasitised erythrocytes. Current evidence suggests that promoter silencing by var introns might play a key role in var gene regulation. To evaluate the impact of cis-acting regulatory regions on var silencing, we generated P. falciparum lines in which luciferase was placed under the control of an UpsA var promoter. By utilising the Bxb1 integrase system, these reporter cassettes were targeted to a genomic region that was not in apposition to var subtelomeric domains. This eliminated possible effects from surrounding telomeric elements and removed the variability inherent in episomal systems. Studies with highly synchronised parasites revealed that the UpsA element possessed minimal activity in comparison with a heterologous (hrp3) promoter. This may result from the integrated UpsA promoter being largely silenced by the neighbouring cg6 promoter. Our analyses also revealed that the DownsA 3' untranslated region further decreased the luciferase activity from both cassettes, whereas the var A intron repressed the UpsA promoter specifically. By applying multivariate analysis over the entire cell cycle, we confirmed the significance of these cis-elements and found the parasite stage to be the major factor regulating UpsA-promoter activity. Additionally, we observed that the UpsA promoter was capable of nucleating reversible silencing that spread to a downstream promoter. We believe these studies are the first to analyse promoter activity of Group A var genes, which have been implicated in severe malaria, and support the model that var introns can further suppress var expression. These data also suggest an important suppressive role for the DownsA terminator. Our findings imply the existence of multiple levels of var
Muhle, Rebecca A.; Adjalley, Sophie; Falkard, Brie; Nkrumah, Louis J.; Muhle, Michael E.; Fidock, David A.
2009-01-01
Questions surround the mechanism of mutually exclusive expression by which Plasmodium falciparum mediates activation and silencing of var genes. These encode PfEMP1 proteins, which function as cytoadherent and immunomodulatory molecules at the surface of parasitized erythrocytes. Current evidence suggests that promoter silencing by var introns might play a key role in var gene regulation. To evaluate the impact of cis-acting regulatory regions on var silencing, we generated P. falciparum lines in which luciferase was placed under the control of an UpsA var promoter. By utilizing the Bxb1 integrase system, these reporter cassettes were targeted to a genomic region that was not in apposition to var sub-telomeric domains. This eliminated possible effects from surrounding telomeric elements and removed the variability inherent in episomal systems. Studies with highly synchronized parasites revealed that the UpsA element possessed minimal activity in comparison with a heterologous (hrp3) promoter. This may well result from the integrated UpsA promoter being largely silenced by the neighboring cg6 promoter. Our analyses also revealed that the DownsA 3’ untranslated region further decreased the luciferase activity from both cassettes, whereas the var A intron repressed the UpsA promoter specifically. By applying multivariate analysis over the entire cell cycle, we confirmed the significance of these cis-elements and found the parasite stage to be the major factor regulating UpsA promoter activity. Additionally, we observed that the UpsA promoter was capable of nucleating reversible silencing that spread to a downstream promoter. We believe these studies are the first to analyze promoter activity of Group A var genes which have been implicated in severe malaria, and support the model that var introns can further suppress var expression. These data also suggest an important suppressive role for the DownsA terminator. Our findings imply the existence of multiple levels of
Bacillus cereus Fnr binds a [4Fe-4S] cluster and forms a ternary complex with ResD and PlcR
Directory of Open Access Journals (Sweden)
Esbelin Julia
2012-06-01
Full Text Available Abstract Background Bacillus cereus is a facultative anaerobe that causes diarrheal disease in humans. Diarrheal syndrome may result from the secretion of various virulence factors including hemolysin BL and nonhemolytic enterotoxin Nhe. Expression of genes encoding Hbl and Nhe is regulated by the two redox systems, ResDE and Fnr, and the virulence regulator PlcR. B. cereus Fnr is a member of the Crp/Fnr family of iron-sulfur (Fe-S proteins. Only its apo-form has so far been studied. A major goal in deciphering the Fnr-dependent regulation of enterotoxin genes is thus to obtain and characterize holoFnr. Results Fnr has been subjected to in vitro Fe-S cluster reconstitution under anoxic conditions. UV-visible and EPR spectroscopic analyses together with the chemical estimation of the iron content indicated that Fnr binds one [4Fe-4S]2+ cluster per monomer. Atmospheric O2 causes disassembly of the Fe-S cluster, which exhibited a half-life of 15 min in air. Holo- and apoFnr have similar affinities for the nhe and hbl promoter regions, while holoFnr has a higher affinity for fnr promoter region than apoFnr. Both the apo- and holo-form of Fnr interact with ResD and PlcR to form a ternary complex. Conclusions Overall, this work shows that incorporation of the [4Fe-4S]2+ cluster is not required for DNA binding of Fnr to promoter regions of hbl and nhe enterotoxin genes or for the formation of a ternary complex with ResD and PlcR. This points to some new unusual properties of Fnr that may have physiological relevance in the redox regulation of enterotoxin gene regulation.
Directory of Open Access Journals (Sweden)
Dongkyoon Kim
2017-12-01
Full Text Available Arid3a/Bright/Dril1 is a B cell-specific transactivator that regulates immunoglobulin heavy chain (IgH gene transcription by binding promoter and enhancer-associated matrix attachment regions (MARs within the IgH gene locus. Promoter MAR-mediated Arid3a transactivation is antagonized by direct competition of MAR binding by Cux1/CDP—a ubiquitously expressed repressor originally termed NF-μNR. We report that the NF-μNR complex includes Arid3a in B cells but not in non-B cells through mobility shift assays. The binding activity of NF-μNR and Arid3a in B cells is reciprocally altered during the cell division cycle and by the B cell mitogen lipopolysaccharide LPS. LPS treatment had no effect on Arid3a localization but increased its total abundance within the nucleus and cytoplasm. We show that this increased level of Arid3a is capable of displacing Cux from the MARs to facilitate IgH gene transcription. Finally, we showed that the MARs (termed Bf150 and Tx125 associated with the VH1 rearranged variable region expressed in the S107 murine plasmacytoma, can repress reporter gene transcription in non-B cells and that they can relieve the repression mediated by Eμ enhancer in B cells. These results have significant implications for early human development and demonstrate that MARs in IgH locus, NF-µNR and Arid3a regulate IgH gene expression in a concerted fashion. This paves the way for future studies examining the misregulation of this pathway in pediatric disease.
[Health-Promoting Schools Regional Initiative of the Americas].
Ippolito-Shepherd, Josefa; Cerqueira, Maria Teresa; Ortega, Diana Patricia
2005-01-01
In Latin America, comprehensive health promotion programmes and activities are being implemented in the school setting, which take into account the conceptual framework of the Health-Promoting Schools Regional Initiative of the Pan American Health Organization, Regional office of the World Health Organization (PAHO/WHO). These programmes help to strengthen the working relationships between the health and education sectors. The Health-Promoting Schools Regional Initiative, officially launched by PAHO/WHO in 1995, aims to form future generations to have the knowledge, abilities, and skills necessary for promoting and caring for their health and that of their family and community, as well as to create and maintain healthy environments and communities. The Initiative focuses on three main components: comprehensive health education, the creation and maintenance of healthy physical and psychosocial environments, and the access to health and nutrition services, mental health, and active life. In 2001, PAHO conducted a survey in 19 Latin American countries to assess the status and trends of Health-Promoting Schools in the Region, for the appropriate regional, subregional, and national planning of pertinent health promotion and health education programmes and activities. The results of this survey provided information about policies and national plans, multisectoral coordination mechanisms for the support of health promotion in the school settings, the formation and participation in national and international networks of Health-Promoting Schools and about the level of dissemination of the strategy. For the successful development of Health-Promoting Schools is essential to involve the society as a whole, in order to mobilise human resources and materials necessary for implementing health promotion in the school settings. Thus, the constitution and consolidation of networks has been a facilitating mechanism for the exchange of ideas, resources and experiences to strengthen
Epigenetic transgenerational actions of vinclozolin on promoter regions of the sperm epigenome.
Directory of Open Access Journals (Sweden)
Carlos Guerrero-Bosagna
2010-09-01
Full Text Available Previous observations have demonstrated that embryonic exposure to the endocrine disruptor vinclozolin during gonadal sex determination promotes transgenerational adult onset disease such as male infertility, kidney disease, prostate disease, immune abnormalities and tumor development. The current study investigates genome-wide promoter DNA methylation alterations in the sperm of F3 generation rats whose F0 generation mother was exposed to vinclozolin. A methylated DNA immunoprecipitation with methyl-cytosine antibody followed by a promoter tilling microarray (MeDIP-Chip procedure was used to identify 52 different regions with statistically significant altered methylation in the sperm promoter epigenome. Mass spectrometry bisulfite analysis was used to map the CpG DNA methylation and 16 differential DNA methylation regions were confirmed, while the remainder could not be analyzed due to bisulfite technical limitations. Analysis of these validated regions identified a consensus DNA sequence (motif that associated with 75% of the promoters. Interestingly, only 16.8% of a random set of 125 promoters contained this motif. One candidate promoter (Fam111a was found to be due to a copy number variation (CNV and not a methylation change, suggesting initial alterations in the germline epigenome may promote genetic abnormalities such as induced CNV in later generations. This study identifies differential DNA methylation sites in promoter regions three generations after the initial exposure and identifies common genome features present in these regions. In addition to primary epimutations, a potential indirect genetic abnormality was identified, and both are postulated to be involved in the epigenetic transgenerational inheritance observed. This study confirms that an environmental agent has the ability to induce epigenetic transgenerational changes in the sperm epigenome.
Epigenetic transgenerational actions of vinclozolin on promoter regions of the sperm epigenome.
Guerrero-Bosagna, Carlos; Settles, Matthew; Lucker, Ben; Skinner, Michael K
2010-09-30
Previous observations have demonstrated that embryonic exposure to the endocrine disruptor vinclozolin during gonadal sex determination promotes transgenerational adult onset disease such as male infertility, kidney disease, prostate disease, immune abnormalities and tumor development. The current study investigates genome-wide promoter DNA methylation alterations in the sperm of F3 generation rats whose F0 generation mother was exposed to vinclozolin. A methylated DNA immunoprecipitation with methyl-cytosine antibody followed by a promoter tilling microarray (MeDIP-Chip) procedure was used to identify 52 different regions with statistically significant altered methylation in the sperm promoter epigenome. Mass spectrometry bisulfite analysis was used to map the CpG DNA methylation and 16 differential DNA methylation regions were confirmed, while the remainder could not be analyzed due to bisulfite technical limitations. Analysis of these validated regions identified a consensus DNA sequence (motif) that associated with 75% of the promoters. Interestingly, only 16.8% of a random set of 125 promoters contained this motif. One candidate promoter (Fam111a) was found to be due to a copy number variation (CNV) and not a methylation change, suggesting initial alterations in the germline epigenome may promote genetic abnormalities such as induced CNV in later generations. This study identifies differential DNA methylation sites in promoter regions three generations after the initial exposure and identifies common genome features present in these regions. In addition to primary epimutations, a potential indirect genetic abnormality was identified, and both are postulated to be involved in the epigenetic transgenerational inheritance observed. This study confirms that an environmental agent has the ability to induce epigenetic transgenerational changes in the sperm epigenome.
Uchiyama, M; Komiyama, M; Yoshizawa, H; Shimizu, N; Konno, N; Matsuda, K
2012-05-01
The structure and immunolocalization of the ion transporters Na(+) ,K(+) -ATPase (NKA), Na(+) /H(+) exchanger (NHE3) and vacuolar-type H(+) -ATPase (VHA) were examined in the gills of teleosts of the family Blenniidae, which inhabit rocky shores with vertical zonation in subtropical seas. These features were compared among the following species with different ecologies: the amphibious rockskipper blenny Andamia tetradactylus, the intertidal white-finned blenny Praealticus tanegasimae and the purely marine yaeyama blenny Ecsenius yaeyamaensis. Light and electron microscopic observations indicated that thick gill filaments were arranged close to each other and alternately on two hemibranches of a gill arch in the opercular space of A. tetradactylus. Many mucous cells (MC) and mitochondrion-rich cells (MRC) were present in the interlamellar regions of the gill filament. An immunohistochemical study demonstrated that numerous NKA, NHE3 and some VHA were located predominantly on presumed MRCs of gill filaments and at the base of the lamellae. Analyses using serial (mirror image) sections of the gills indicated that only a few NKA immunoreactive cells (IRC) were colocalized with VHA on some MRCs in the filaments. In the gills of P. tanegasimae, NKA- and NHE3-IRCs were observed in the interlamellar region of the filaments and at the base of the lamellae. VHA-IRCs were located sparsely on the lamellae and filaments. In the gills of E. yaeyamaensis, the lamellae and filaments were thin and straight, respectively. MCs were located at the tip as well as found scattered in the interlamellar region of gill filaments. NKA-, NHE3- and VHA-IRCs were moderately frequently observed in the filaments and rarely on the lamellae. This study shows that the structure and distribution of ion transporters in the gills differ among the three blennid species, presumably reflecting their different ecologies. © 2012 The Authors. Journal of Fish Biology © 2012 The Fisheries Society of the
Ma, Seong Kwon; Bae, Eun Hui; Lee, JongUn; Kim, Sun Young; Kim, Sung Zoo; Choi, Ki Chul
2007-01-01
Metabolic acidosis was shown to correlate with deterioration of renal function in patients with rhabdomyolysis. The present study was aimed to investigate whether the changes of type 3 Na+/H+ exchanger (NHE3), type 1 Na+/HCO3- cotransporter (NBC1), and Na+,K+-ATPase α1 subunit may play a role in the pathogenesis of metabolic acidosis in glycerol-induced experimental rhabdomyolysis. Male Sprague-Dawley rats were deprived of fluid intake for 24 hours, and then were injected with 50% glycerol in normal saline (10 mL/kg, intramuscularly). At 24 hours after the glycerol injection, rats were sacrificed by decapitation. Control rats were injected with normal saline. The protein expression of NHE3, NBC1 and Na+,K+-ATPase α1 subunit was determined in the cortex of the kidney by immunoblotting and immunohistochemistry. Following the treatment of glycerol, creatinine clearance was significantly decreased, and high anion gap metabolic acidosis developed. In the experimental group, the expression of Na+,K+-ATPase α1 subunit was significantly decreased in the cortex of the kidney. On the contrary, the expression of NHE3 and NBC1 was significantly increased. Immunohistochemical analyses confirmed the immunoblotting data. In conclusion, the coordinate up-regulation of NHE3 and NBC1 may play an adaptive role against the metabolic acidosis in glycerol-induced rhabdomyolysis. PMID:24459502
Directory of Open Access Journals (Sweden)
Saroj Yadav
Full Text Available MAP7 domain containing protein 3 (MAP7D3, a newly identified microtubule associated protein, has been shown to promote microtubule assembly and stability. Its microtubule binding region has been reported to consist of two coiled coil motifs located at the N-terminus. It possesses a MAP7 domain near the C-terminus and belongs to the microtubule associated protein 7 (MAP7 family. The MAP7 domain of MAP7 protein has been shown to bind to kinesin-1; however, the role of MAP7 domain in MAP7D3 remains unknown. Based on the bioinformatics analysis of MAP7D3, we hypothesized that the MAP7 domain of MAP7D3 may have microtubule binding activity. Indeed, we found that MAP7 domain of MAP7D3 bound to microtubules as well as enhanced the assembly of microtubules in vitro. Interestingly, a longer fragment MDCT that contained the MAP7 domain (MD with the C-terminal tail (CT of the protein promoted microtubule polymerization to a greater extent than MD and CT individually. MDCT stabilized microtubules against dilution induced disassembly. MDCT bound to reconstituted microtubules with an apparent dissociation constant of 3.0 ± 0.5 µM. An immunostaining experiment showed that MDCT localized along the length of the preassembled microtubules. Competition experiments with tau indicated that MDCT shares its binding site on microtubules with tau. Further, we present evidence indicating that MDCT binds to the C-terminal tail of tubulin. In addition, MDCT could bind to tubulin in HeLa cell extract. Here, we report a microtubule binding region in the C-terminal region of MAP7D3 that may have a role in regulating microtubule assembly dynamics.
Genome-wide analysis of regions similar to promoters of histone genes
Chowdhary, Rajesh
2010-05-28
Background: The purpose of this study is to: i) develop a computational model of promoters of human histone-encoding genes (shortly histone genes), an important class of genes that participate in various critical cellular processes, ii) use the model so developed to identify regions across the human genome that have similar structure as promoters of histone genes; such regions could represent potential genomic regulatory regions, e.g. promoters, of genes that may be coregulated with histone genes, and iii/ identify in this way genes that have high likelihood of being coregulated with the histone genes.Results: We successfully developed a histone promoter model using a comprehensive collection of histone genes. Based on leave-one-out cross-validation test, the model produced good prediction accuracy (94.1% sensitivity, 92.6% specificity, and 92.8% positive predictive value). We used this model to predict across the genome a number of genes that shared similar promoter structures with the histone gene promoters. We thus hypothesize that these predicted genes could be coregulated with histone genes. This hypothesis matches well with the available gene expression, gene ontology, and pathways data. Jointly with promoters of the above-mentioned genes, we found a large number of intergenic regions with similar structure as histone promoters.Conclusions: This study represents one of the most comprehensive computational analyses conducted thus far on a genome-wide scale of promoters of human histone genes. Our analysis suggests a number of other human genes that share a high similarity of promoter structure with the histone genes and thus are highly likely to be coregulated, and consequently coexpressed, with the histone genes. We also found that there are a large number of intergenic regions across the genome with their structures similar to promoters of histone genes. These regions may be promoters of yet unidentified genes, or may represent remote control regions that
International Nuclear Information System (INIS)
Nguyen Thi Ai Nhung; Huynh Thi Phuong Loan; Duong Tuan Quang; Pham Van Tat
2014-01-01
The complexes with ligands carbodiphosphorane-analogues (called tetrylones) [(CO) 5 W-{E(PH 3 ) 2 }] (W5-EP 2 ) and N-heterocyclic carbene-analogues (called tetrylenes) [(CO) 5 W-{NHE Me }] (W5-NHE Me ) when E=C-Pb have been studied using natural bond orbital (NBO) method. The NBO analysis provides a consistent picture of the chemical bonding is two entire families of transition metal complexes of tetrylone and tetrylene ligands in term of donor-acceptor interactions, showing the correlation of these interactions with Wiberg bond indies (WBI), natural partial charges, and the energetically highest lying occupied molecular orbitals for σ and π orbitals of free ligands E(PH 3 ) 2 and NHE Me . Analysis of the bonding situation reveals that in E(PH 3 ) 2 and NHE Me ligands, the energy level of the π orbital rises, whereas that of the σ orbital decreases as atom E becomes heavier. The complexes with head-on-bonded ligands have (CO) 5 W←E donation which comes from the σ-lone-pair orbital of E(PH 3 ) 2 and NHE Me where E=C for tetrylones and E=C, Si, Ge for tetrylenes, whereas the (CO) 5 W←E donation in the side-on bonded complexes when E becomes heavier arises from the π-lone-pair orbital of E(PH 3 ) 2 and NHE Me ligands which is the HOMO of the free ligands. This makes the heavier adducts of tetrylones and tetrylenes become stronger donors than the lighter systems. The NBO analysis suggests that the E(PH 3 ) 2 ligands are strong σ-donors and strong π-acceptors while the NHE Me ligands are strong σ-donors and weak π-acceptors. This is possible for tetrylones that have two lone-pair orbitals available for donation, whereas the tetrylenes have only one lone-pair orbital available for donation. (author)
Restoration of CpG Methylation in The Egf Promoter Region during Rat Liver Regeneration
Deming, Li; Ziwei, Li; Xueqiang, Guo; Cunshuan, Xu
2015-01-01
Epidermal growth factor (EGF) is an important factor for healing after tissue damage in diverse experimental models. It plays an important role in liver regeneration (LR). The objective of this experiment is to investigate the methylation variation of 10 CpG sites in the Egf promoter region and their relevance to Egf expression during rat liver regenera- tion. As a follow up of our previous study, rat liver tissue was collected after rat 2/3 partial hepatectomy (PH) during the re-organization phase (from days 14 to days 28). Liver DNA was extracted and modified by sodium bisulfate. The methylation status of 10 CpG sites in Egf promoter region was determined using bisulfite sequencing polymerase chain reaction (PCR), as BSP method. The results showed that 3 (sites 3, 4 and 9) out of 10 CpG sites have strikingly methylation changes during the re-organization phase compared to the regeneration phase (from 2 hours to 168 hours, P=0.002, 0.048 and 0.018, respectively). Our results showed that methylation modification of CpGs in the Egf promoter region could be restored to the status before PH operation and changes of methylation didn’t affect Egf mRNA expression during the re-organization phase. PMID:26464832
Identification and annotation of promoter regions in microbial
Indian Academy of Sciences (India)
2007-06-15
Jun 15, 2007 ... Analysis of various predicted structural properties of promoter regions in prokaryotic as well as eukaryotic genomes had earlier indicated that they have several common features, such as lower stability, higher curvature and less bendability, when compared with their neighboring regions. Based on the ...
DEFF Research Database (Denmark)
Lauritzen, G; Jensen, M B F; Bødtkjer, Ebbe
2010-01-01
cells to cisplatin-induced programmed cell death (PCD) in a caspase-, cathepsin-, and reactive oxygen species-dependent manner. NHE1 inhibition augmented cisplatin-induced caspase activity and lysosomal membrane permeability followed by cysteine cathepsin release. In contrast, NBCn1 inhibition...
Ion transporters for fluid reabsorption in the rooster (Gallus domesticus) epididymal region.
Bahr, J M; Dalponte, M; Janssen, S; Bunick, D; Nakai, M
2006-10-01
Testicular fluid is highly condensed during its passage through the epididymal region in the avian species. In the present study, major ion transporters that are responsible for condensation mainly by water resorption in the reproductive tract as identified in the mammalian epididymis were localized within the rooster (Gallus domesticus) epididymis by immunohistochemistry. The results show that the efferent ductule epithelium expressed sodium-potassium ATPase (Na(+),K(+)-ATPase), carbonic anhydrase II (CAII) and sodium hydrogen exchanger isoform 3 (NHE3) and that the connecting ductule and epididymal duct epithelia expressed Na(+),K(+)-ATPase and CAII. These data suggest that a model proposed for reabsorption in mammalian efferent ductules can be applied to avian efferent ductules.
Genome-wide function of H2B ubiquitylation in promoter and genic regions.
Batta, Kiran; Zhang, Zhenhai; Yen, Kuangyu; Goffman, David B; Pugh, B Franklin
2011-11-01
Nucleosomal organization in and around genes may contribute substantially to transcriptional regulation. The contribution of histone modifications to genome-wide nucleosomal organization has not been systematically evaluated. In the present study, we examine the role of H2BK123 ubiquitylation, a key regulator of several histone modifications, on nucleosomal organization at promoter, genic, and transcription termination regions in Saccharomyces cerevisiae. Using high-resolution MNase chromatin immunoprecipitation and sequencing (ChIP-seq), we map nucleosome positioning and occupancy in mutants of the H2BK123 ubiquitylation pathway. We found that H2B ubiquitylation-mediated nucleosome formation and/or stability inhibits the assembly of the transcription machinery at normally quiescent promoters, whereas ubiquitylation within highly active gene bodies promotes transcription elongation. This regulation does not proceed through ubiquitylation-regulated histone marks at H3K4, K36, and K79. Our findings suggest that mechanistically similar functions of H2B ubiquitylation (nucleosome assembly) elicit different functional outcomes on genes depending on its positional context in promoters (repressive) versus transcribed regions (activating).
Guan, Xiaolu; Zhang, Yao; Yu, Mengmeng; Ren, Chaoqi; Gao, Yanni; Yun, Bingling; Liu, Yongzhen; Wang, Yongqiang; Qi, Xiaole; Liu, Changjun; Cui, Hongyu; Zhang, Yanping; Gao, Li; Li, Kai; Pan, Qing; Zhang, Baoshan; Wang, Xiaomei; Gao, Yulong
2018-01-01
Chicken Na + /H + exchanger type I (chNHE1), a multispan transmembrane protein, is a cellular receptor of the subgroup J avian leukosis virus (ALV-J). To identify the functional determinants of chNHE1 responsible for the ALV-J receptor activity, a series of chimeric receptors was created by exchanging the extracellular loops (ECL) of human NHE1 (huNHE1) and chNHE1 and by ECL replacement with a hemagglutinin (HA) tag. These chimeric receptors then were used in binding and entry assays to map the minimal ALV-J gp85-binding domain of chNHE1. We show that ECL1 of chNHE1 (chECL1) is the critical functional ECL that interacts directly with ALV-J gp85; ECL3 is also involved in ALV-J gp85 binding. Amino acid residues 28 to 39 of the N-terminal membrane-proximal region of chECL1 constitute the minimal domain required for chNHE1 binding of ALV-J gp85. These residues are sufficient to mediate viral entry into ALV-J nonpermissive cells. Point mutation analysis revealed that A30, V33, W38, and E39 of chECL1 are the key residues mediating the binding between chNHE1 and ALV-J gp85. Further, the replacement of residues 28 to 39 of huNHE1 with the corresponding chNHE1 residues converted the nonfunctional ALV-J receptor huNHE1 to a functional one. Importantly, soluble chECL1 and huECL1 harboring chNHE1 residues 28 to 39 both could effectively block ALV-J infection. Collectively, our findings indicate that residues 28 to 39 of chNHE1 constitute a domain that is critical for receptor function and mediate ALV-J entry. IMPORTANCE chNHE1 is a cellular receptor of ALV-J, a retrovirus that causes infections in chickens and serious economic losses in the poultry industry. Until now, the domains determining the chNHE1 receptor function remained unknown. We demonstrate that chECL1 is critical for receptor function, with residues 28 to 39 constituting the minimal functional domain responsible for chNHE1 binding of ALV-J gp85 and efficiently mediating ALV-J cell entry. These residues are
Discovery and Evaluation of Polymorphisms in the and Promoter Regions for Risk of Korean Lung Cancer
Directory of Open Access Journals (Sweden)
Jae Sook Sung
2012-09-01
Full Text Available AKT is a signal transduction protein that plays a central role in the tumorigenesis. There are 3 mammalian isoforms of this serine/threonine protein kinase-AKT1, AKT2, and AKT3-showing a broad tissue distribution. We first discovered 2 novel polymorphisms (AKT2 -9826 C/G and AKT3 -811 A/G, and we confirmed 6 known polymorphisms (AKT2 -9473 C/T, AKT2 -9151 C/T, AKT2 -9025 C/T, AKT2 -8618G/A, AKT3 -675 A/-, and AKT3 -244 C/T of the AKT2 and AKT3 promoter region in 24 blood samples of Korean lung cancer patients using direct sequencing. To evaluate the role of AKT2 and AKT3 polymorphisms in the risk of Korean lung cancer, genotypes of the AKT2 and AKT3 polymorphisms (AKT2 -9826 C/G, AKT2 -9473 C/T, AKT2 -9151 C/T, AKT2 -9025 C/T, AKT2 -8618G/A, and AKT3 -675 A/- were determined in 360 lung cancer patients and 360 normal controls. Statistical analyses revealed that the genotypes and haplotypes in the AKT2 and AKT3 promoter regions were not significantly associated with the risk of lung cancer in the Korean population. These results suggest that polymorphisms of the AKT2 and AKT3 promoter regions do not contribute to the genetic susceptibility to lung cancer in the Korean population.
Unveiling DNA structural properties of promoter regions of ...
Indian Academy of Sciences (India)
Aditya Kumar
Unveiling DNA structural properties of promoter regions of prokaryotic transcriptome and their role in gene expression. Aditya Kumar. Assistant Professor. Molecular Biology & Biotechnology. Tezpur University. Tezpur – 784028, Assam ...
Social Media Marketing as a tool for promoting the regional investment portals
Directory of Open Access Journals (Sweden)
Alisa Yu. Fadeyeva
2016-01-01
Full Text Available Objective to investigate the potential of Social Media Marketing as a tool for promoting regional investment portals in the information environment to identify the most effective ways of its implementation and to determine the level of mastering of this tool by the Russian regions. Methods general scientific methods observation comparison analysis induction deduction analogy classification. Results the analysis showed that today Social Media Marketing is an essential tool for interaction with the investment community and one of the most effective ways to promote the regional portal which allows to increase the knowledge of and loyalty to the brand to increase the targeted website traffic to increase the awareness of investors about the specific features of the portal and the regional development agenciesrsquo functioning to promptly receive information about the investment environment and to establish contacts with investors. At the same time the study of SMMactivity in the Russian regions revealed a very low level of quality of communication with investors through social networks. Scientific novelty for the first time the article investigates the significance and makes the comparative analysis of the Social Media Marketing channels with regard to investment promotion agencies as well as the results of the regional structures functioning for effective communication through social networks. Practical significance the main results of the research can be used by the regional investment agencies in order to promote their websites increase the quality of communication with investors and promote the investment attractiveness of the region as a whole. nbsp
Kawaguchi, Yuka; Nariki, Hiroaki; Kawamoto, Naoko; Kanehiro, Yuichi; Miyazaki, Satoshi; Suzuki, Mari; Magari, Masaki; Tokumitsu, Hiroshi; Kanayama, Naoki
2017-04-01
Activation-induced cytidine deaminase (AID) is essential for diversification of the Ig variable region (IgV). AID is excluded from the nucleus, where it normally functions. However, the molecular mechanisms responsible for regulating AID localization remain to be elucidated. The SR-protein splicing factor SRSF1 is a nucleocytoplasmic shuttling protein, a splicing isoform of which called SRSF1-3, has previously been shown to contribute to IgV diversification in chicken DT40 cells. In this study, we examined whether SRSF1-3 functions in IgV diversification by promoting nuclear localization of AID. AID expressed alone was localized predominantly in the cytoplasm. In contrast, co-expression of AID with SRSF1-3 led to the nuclear accumulation of both AID and SRSF1-3 and the formation of a protein complex that contained them both, although SRSF1-3 was dispensable for nuclear import of AID. Expression of either SRSF1-3 or a C-terminally-truncated AID mutant increased IgV diversification in DT40 cells. However, overexpression of exogenous SRSF1-3 was unable to further enhance IgV diversification in DT40 cells expressing the truncated AID mutant, although SRSF1-3 was able to form a protein complex with the AID mutant. These results suggest that SRSF1-3 promotes nuclear localization of AID probably by forming a nuclear protein complex, which might stabilize nuclear AID and induce IgV diversification in an AID C-terminus-dependent manner. Copyright © 2017 Elsevier Inc. All rights reserved.
Ambigapathy, Ganesh; Zheng, Zhaoqing; Keifer, Joyce
2014-08-01
Brain-derived neurotrophic factor (BDNF) is an important regulator of neuronal development and synaptic function. The BDNF gene undergoes significant activity-dependent regulation during learning. Here, we identified the BDNF promoter regions, transcription start sites, and potential regulatory sequences for BDNF exons I-III that may contribute to activity-dependent gene and protein expression in the pond turtle Trachemys scripta elegans (tBDNF). By using transfection of BDNF promoter/luciferase plasmid constructs into human neuroblastoma SHSY5Y cells and mouse embryonic fibroblast NIH3T3 cells, we identified the basal regulatory activity of promoter sequences located upstream of each tBDNF exon, designated as pBDNFI-III. Further, through chromatin immunoprecipitation (ChIP) assays, we detected CREB binding directly to exon I and exon III promoters, while BHLHB2, but not CREB, binds within the exon II promoter. Elucidation of the promoter regions and regulatory protein binding sites in the tBDNF gene is essential for understanding the regulatory mechanisms that control tBDNF gene expression.
Identification and annotation of promoter regions in microbial ...
Indian Academy of Sciences (India)
PRAKASH KUMAR
2007-06-15
Jun 15, 2007 ... It remains important, not only to detect rarely expressed genes but also for ... well as in identifying genes associated with rRNA, tRNA and ... DNA stability; free energy calculation; promoter; upstream and downstream region.
Business networking for SMEs as a means to promote regional competitiveness: A Theoretical Framework
Vitor Braga
2004-01-01
The competitiveness of regions, as a means of promoting the competitiveness of a country as a whole, has been one of the main topics on the agenda of policy makers over the last decades. Several attempts at promoting competitiveness have been made with different degrees of success. In most cases, public investment in the regions was perceived as the solution to promote regional competitiveness and top-down policies were implemented. However, competitiveness also has an important dimension tha...
Analysis of tissue-specific region in sericin 1 gene promoter of Bombyx mori
Energy Technology Data Exchange (ETDEWEB)
Yan, Liu [College of Biomedical Engineering and Instrument Science, Zhejiang University, Hangzhou 310027 (China); Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai 200031 (China); Lian, Yu [College of Biomedical Engineering and Instrument Science, Zhejiang University, Hangzhou 310027 (China); Zhejiang Province Key Laboratory of Preventive Veterinary Medicine, Institute of Preventive Veterinary Medicine, Zhejiang University, Hangzhou 310029 (China); Xiuyang, Guo [Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai 200031 (China); Tingqing, Guo [Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai 200031 (China); Shengpeng, Wang [Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai 200031 (China); Changde, Lu [Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai 200031 (China)
2006-03-31
The gene encoding sericin 1 (Ser1) of silkworm (Bombyx mori) is specifically expressed in the middle silk gland cells. To identify element involved in this transcription-dependent spatial restriction, truncation of the 5' terminal from the sericin 1 (Ser1) promoter is studied in vivo. A 209 bp DNA sequence upstream of the transcriptional start site (-586 to -378) is found to be responsible for promoting tissue-specific transcription. Analysis of this 209 bp region by overlapping deletion studies showed that a 25 bp region (-500 to -476) suppresses the ectopic expression of the Ser1 promoter. An unknown factor abundant in fat body nuclear extracts is shown to bind to this 25 bp fragment. These results suggest that this 25 bp region and the unknown factor are necessary for determining the tissue-specificity of the Ser1 promoter.
Perspectives on Promoting Regional Renewable Energy Research and Development
International Nuclear Information System (INIS)
Dresselhaus, M.
2008-01-01
Recent discussions at the Washington International Renewable Energy Conference (WIREC), hosted in March 2008 by the United States Government, with nearly 9000 participants including 103 ministers from 126 countries, concluded that a major acceleration in the adoption of renewable energy technologies was needed by mid-century. Because of different climatic conditions and societal preferences, regional cooperation is expected to play a major role in the efficient adoption of appropriate renewable energy technologies, and countries with special expertise in specific technologies seem eager to collaborate internationally to promote global goals in renewable energy. A review will be given of what we learned from this conference about renewable energy research and development strategies with a special focus given to using this basic knowledge base to promote the development of renewable energy technologies appropriate to specific regions of the world.(author)
Ren, Wenhui; Sun, Donghao; Wang, Chunmei; Li, Nan
2016-10-01
Objective To investigate the role of bromodomain containing 3 (Brd3) in LPS-triggered interleukin-6 (IL-6) production in macrophages and the underlying mechanism. Methods CRISPR-Cas9 technology was used to screen an RAW264.7 cell line with Brd3 knockout (Brd3 -/- ). The Brd3 -/- cells were used as an experimental group, and the parential cells expressing wide-type Brd3 as a control group. The IL-6 level in cell culture supernatant was detected by ELISA after 100 ng/mL LPS challenging. Effect of Brd3 knockout on the expression and activation of signal pathways involved in IL-6 expression, including the NF-κB and mitogen-activated protein kinase (MAPK) pathways were examined by Western blot analysis. Chromatin immunoprecipitation (ChIP) assay was used to evaluate the recruitment of acetylase CREB-binding protein (CBP) to IL6 gene promoter and the acetylation level of histone 3 within IL6 gene promoter. Results LPS treatment significantly downregulated Brd3 expression in mouse peritoneal macrophages. LPS-induced production of IL-6 was significantly inhibited in Brd3 -/- macrophages. The expressions and activation of signal molecules within NF-κB and MAPK pathways were barely affected. Brd3 knockout significantly decreased the recruitment of acetylase CBP to IL6 gene promoter, and the acetylation level of histone3 within IL6 gene promoter was also repressed. Conclusion Brd3 promotes LPS-triggered IL-6 production via promoting the recruitment of CBP to IL6 promoter and enhancing the acetylation level of histone 3 within IL6 promoter.
Fu, Chunli; Xing, Yingqi; Song, Xiaonan
2011-04-01
To investigate the association of single nucleotide polymorphism in the matrix metalloproteinase-3 (MMP3) gene promoter with the susceptibility to the middle cerebral artery stenosis. A case-control study was performed by determining the genotype of MMP3 gene promoter region using polymerase chain reaction-restriction fragment length polymorphism in 119 patients with middle cerebral artery stenosis documented by transcranial Doppler compared to 92 control patients. The frequencies of 5A and 6A alleles in MMP3 promoter region were 16.0 and 84.0% respectively in case group compared to 15.8 and 84.2% in control group with no significant difference between the two groups (P > 0.05). No significant difference was also observed in the distribution of genotypes 5A/5A,5A/6A, and 6A/6A between middle cerebral artery stenosis and control groups. Compared to 5A/5A + 5A/6A genotypes,the 6A/6A genotype did not significantly modify the risk of developing the middle cerebral artery stenosis. The MMP3-1171 dupA promoter polymorphisms are not valuable markers of susceptibility of the middle cerebral artery stenosis in this sample of population studied.
Regional differences in gene expression and promoter usage in aged human brains
Pardo, Luba M.
2013-02-19
To characterize the promoterome of caudate and putamen regions (striatum), frontal and temporal cortices, and hippocampi from aged human brains, we used high-throughput cap analysis of gene expression to profile the transcription start sites and to quantify the differences in gene expression across the 5 brain regions. We also analyzed the extent to which methylation influenced the observed expression profiles. We sequenced more than 71 million cap analysis of gene expression tags corresponding to 70,202 promoter regions and 16,888 genes. More than 7000 transcripts were differentially expressed, mainly because of differential alternative promoter usage. Unexpectedly, 7% of differentially expressed genes were neurodevelopmental transcription factors. Functional pathway analysis on the differentially expressed genes revealed an overrepresentation of several signaling pathways (e.g., fibroblast growth factor and wnt signaling) in hippocampus and striatum. We also found that although 73% of methylation signals mapped within genes, the influence of methylation on the expression profile was small. Our study underscores alternative promoter usage as an important mechanism for determining the regional differences in gene expression at old age.
Growing Significance of EU Institutions in Promotion of Inter-regional policies
Directory of Open Access Journals (Sweden)
Ella V. Ermakova
2014-01-01
Full Text Available The article explores the variety of tools and vehicles applied within the EU to expand the prerogative of the regions of the EU member states. The author uses as an example the inter-regional policies in Belgium in respect of the Flemish Region and the Walloon Region. The author analyzes the mechanisms of promotion of external regional relations in Belgium as a means of addressing different problems both on national and all-European level, supporting the arguments and conclusions by examples of relevant EU initiatives. The article details the activities of the EU Regional Committee (RC, the EU advisory body with the powers of political initiative, upholding the principle ofsubsidarity in the implementation of the EU member states' regional policies. The involvement of the Flemish Region and the Walloon Region in the activities of EU RC is described and summarized. As a case study, the article deals with Belgium's rotating six months presidency in the EUin 2010 when the country, which was going through a severe political crisis with no federal government in place, was represented by the two regions. The special focus of the article is on the strategic EU program "Europe2020" and its implementation by the regions of Belgium. There is an account of the initiatives undertaken by the Flemish Region and the Walloon Region within the framework of this program outlining the interaction of the two regions. The author provides a comprehensive analysis of the involvement of the Flemish Region and the Walloon Region with various EU institutions describing how each party achieves the promotion of its regional interests. Within this context, it is a noteworthy development that the Flemish Region is participating in the international program "Pact 2020" on energy all by its own. The article features quotations by Flemish and Walloon political figures which serve as an illustration of the prevailing attitudes in the Belgian society to the process of
Archer, Simon N; Carpen, Jayshan D; Gibson, Mark; Lim, Gim Hui; Johnston, Jonathan D; Skene, Debra J; von Schantz, Malcolm
2010-05-01
To screen the PER3 promoter for polymorphisms and investigate the phenotypic associations of these polymorphisms with diurnal preference, delayed sleep phase disorder/syndrome (DSPD/DSPS), and their effects on reporter gene expression. Interspecific comparison was used to define the approximate extent of the PER3 promoter as the region between the transcriptional start site and nucleotide position -874. This region was screened in DNA pools using PCR and direct sequencing, which was also used to screen DNA from individual participants. The different promoter alleles were cloned into a luciferase expression vector and a deletion library created. Promoter activation was measured by chemiluminescence. N/A. DNA samples were obtained from volunteers with defined diurnal preference (3 x 80, selected from a pool of 1,590), and DSPD patients (n=23). N/A. We verified three single nucleotide polymorphisms (G -320T, C -319A, G -294A), and found a novel variable number tandem repeat (VNTR) polymorphism (-318 1/2 VNTR). The -320T and -319A alleles occurred more frequently in DSPD compared to morning (P = 0.042 for each) or evening types (P = 0.006 and 0.033). The allele combination TA2G was more prevalent in DSPD compared to morning (P 0.033) or evening types (P = 0.002). Luciferase expression driven by the TA2G combination was greater than for the more common GC2A (P < 0.05) and the rarer TA1G (P < 0.001) combinations. Deletion reporter constructs identified two enhancer regions (-703 to -605, and -283 to -80). Polymorphisms in the PER3 promoter could affect its expression, leading to potential differences in the observed functions of PER3.
International Nuclear Information System (INIS)
Hanafusa, Tadashi; Shinji, Toshiyuki; Shiraha, Hidenori; Nouso, Kazuhiro; Iwasaki, Yoshiaki; Yumoto, Eichiro; Ono, Toshiro; Koide, Norio
2005-01-01
Insulin-like growth factor binding protein (IGFBP)-3 functions as a carrier of insulin-like growth factors (IGFs) in circulation and a mediator of the growth suppression signal in cells. There are two reported p53 regulatory regions in the IGFBP3 gene; one upstream of the promoter and one intronic. We previously reported a hot spot of promoter hypermethylation of IGFBP-3 in human hepatocellular carcinomas and derivative cell lines. As the hot spot locates at the putative upstream p53 consensus sequences, these p53 consensus sequences are really functional is a question to be answered. In this study, we examined the p53 consensus sequences upstream of the IGFBP-3 promoter for the p53 induced expression of IGFBP-3. Deletion, mutagenesis, and methylation constructs of IGFBP-3 promoter were assessed in the human hepatoblastoma cell line HepG2 for promoter activity. Deletions and mutations of these sequences completely abolished the expression of IGFBP-3 in the presence of p53 overexpression. In vitro methylation of these p53 consensus sequences also suppressed IGFBP-3 expression. In contrast, the expression of IGFBP-3 was not affected in the absence of p53 overexpression. Further, we observed by electrophoresis mobility shift assay that p53 binding to the promoter region was diminished when methylated. From these observations, we conclude that four out of eleven p53 consensus sequences upstream of the IGFBP-3 promoter are essential for the p53 induced expression of IGFBP-3, and hypermethylation of these sequences selectively suppresses p53 induced IGFBP-3 expression in HepG2 cells
Denz, Christopher R; Zhang, Chi; Jia, Pingping; Du, Jianfeng; Huang, Xupei; Dube, Syamalima; Thomas, Anish; Poiesz, Bernard J; Dube, Dipak K
2011-09-01
Tropomyosins are a family of actin-binding proteins that show cell-specific diversity by a combination of multiple genes and alternative RNA splicing. Of the 4 different tropomyosin genes, TPM4 plays a pivotal role in myofibrillogenesis as well as cardiac contractility in amphibians. In this study, we amplified and sequenced the upstream regulatory region of the TPM4 gene from both normal and mutant axolotl hearts. To identify the cis-elements that are essential for the expression of the TPM4, we created various deletion mutants of the TPM4 promoter DNA, inserted the deleted segments into PGL3 vector, and performed promoter-reporter assay using luciferase as the reporter gene. Comparison of sequences of the promoter region of the TPM4 gene from normal and mutant axolotl revealed no mutations in the promoter sequence of the mutant TPM4 gene. CArG box elements that are generally involved in controlling the expression of several other muscle-specific gene promoters were not found in the upstream regulatory region of the TPM4 gene. In deletion experiments, loss of activity of the reporter gene was noted upon deletion which was then restored upon further deletion suggesting the presence of both positive and negative cis-elements in the upstream regulatory region of the TPM4 gene. We believe that this is the first axolotl promoter that has ever been cloned and studied with clear evidence that it functions in mammalian cell lines. Although striated muscle-specific cis-acting elements are absent from the promoter region of TPM4 gene, our results suggest the presence of positive and negative cis-elements in the promoter region, which in conjunction with positive and negative trans-elements may be involved in regulating the expression of TPM4 gene in a tissue-specific manner.
International Nuclear Information System (INIS)
Rauscher, Garth H.; Kresovich, Jacob K.; Poulin, Matthew; Yan, Liying; Macias, Virgilia; Mahmoud, Abeer M.; Al-Alem, Umaima; Kajdacsy-Balla, Andre; Wiley, Elizabeth L.; Tonetti, Debra; Ehrlich, Melanie
2015-01-01
Breast cancer formation is associated with frequent changes in DNA methylation but the extent of very early alterations in DNA methylation and the biological significance of cancer-associated epigenetic changes need further elucidation. Pyrosequencing was done on bisulfite-treated DNA from formalin-fixed, paraffin-embedded sections containing invasive tumor and paired samples of histologically normal tissue adjacent to the cancers as well as control reduction mammoplasty samples from unaffected women. The DNA regions studied were promoters (BRCA1, CD44, ESR1, GSTM2, GSTP1, MAGEA1, MSI1, NFE2L3, RASSF1A, RUNX3, SIX3 and TFF1), far-upstream regions (EN1, PAX3, PITX2, and SGK1), introns (APC, EGFR, LHX2, RFX1 and SOX9) and the LINE-1 and satellite 2 DNA repeats. These choices were based upon previous literature or publicly available DNA methylome profiles. The percent methylation was averaged across neighboring CpG sites. Most of the assayed gene regions displayed hypermethylation in cancer vs. adjacent tissue but the TFF1 and MAGEA1 regions were significantly hypomethylated (p ≤0.001). Importantly, six of the 16 regions examined in a large collection of patients (105 – 129) and in 15-18 reduction mammoplasty samples were already aberrantly methylated in adjacent, histologically normal tissue vs. non-cancerous mammoplasty samples (p ≤0.01). In addition, examination of transcriptome and DNA methylation databases indicated that methylation at three non-promoter regions (far-upstream EN1 and PITX2 and intronic LHX2) was associated with higher gene expression, unlike the inverse associations between cancer DNA hypermethylation and cancer-altered gene expression usually reported. These three non-promoter regions also exhibited normal tissue-specific hypermethylation positively associated with differentiation-related gene expression (in muscle progenitor cells vs. many other types of normal cells). The importance of considering the exact DNA region analyzed and the
Directory of Open Access Journals (Sweden)
Sutapa Datta
Full Text Available An important step in understanding gene regulation is to identify the promoter regions where the transcription factor binding takes place. Predicting a promoter region de novo has been a theoretical goal for many researchers for a long time. There exists a number of in silico methods to predict the promoter region de novo but most of these methods are still suffering from various shortcomings, a major one being the selection of appropriate features of promoter region distinguishing them from non-promoters. In this communication, we have proposed a new composite method that predicts promoter sequences based on the interrelationship between structural profiles of DNA and primary sequence elements of the promoter regions. We have shown that a Context Free Grammar (CFG can formalize the relationships between different primary sequence features and by utilizing the CFG, we demonstrate that an efficient parser can be constructed for extracting these relationships from DNA sequences to distinguish the true promoter sequences from non-promoter sequences. Along with CFG, we have extracted the structural features of the promoter region to improve upon the efficiency of our prediction system. Extensive experiments performed on different datasets reveals that our method is effective in predicting promoter sequences on a genome-wide scale and performs satisfactorily as compared to other promoter prediction techniques.
Datta, Sutapa; Mukhopadhyay, Subhasis
2013-01-01
An important step in understanding gene regulation is to identify the promoter regions where the transcription factor binding takes place. Predicting a promoter region de novo has been a theoretical goal for many researchers for a long time. There exists a number of in silico methods to predict the promoter region de novo but most of these methods are still suffering from various shortcomings, a major one being the selection of appropriate features of promoter region distinguishing them from non-promoters. In this communication, we have proposed a new composite method that predicts promoter sequences based on the interrelationship between structural profiles of DNA and primary sequence elements of the promoter regions. We have shown that a Context Free Grammar (CFG) can formalize the relationships between different primary sequence features and by utilizing the CFG, we demonstrate that an efficient parser can be constructed for extracting these relationships from DNA sequences to distinguish the true promoter sequences from non-promoter sequences. Along with CFG, we have extracted the structural features of the promoter region to improve upon the efficiency of our prediction system. Extensive experiments performed on different datasets reveals that our method is effective in predicting promoter sequences on a genome-wide scale and performs satisfactorily as compared to other promoter prediction techniques. PMID:23437045
Genetic recombination is targeted towards gene promoter regions in dogs.
Auton, Adam; Rui Li, Ying; Kidd, Jeffrey; Oliveira, Kyle; Nadel, Julie; Holloway, J Kim; Hayward, Jessica J; Cohen, Paula E; Greally, John M; Wang, Jun; Bustamante, Carlos D; Boyko, Adam R
2013-01-01
The identification of the H3K4 trimethylase, PRDM9, as the gene responsible for recombination hotspot localization has provided considerable insight into the mechanisms by which recombination is initiated in mammals. However, uniquely amongst mammals, canids appear to lack a functional version of PRDM9 and may therefore provide a model for understanding recombination that occurs in the absence of PRDM9, and thus how PRDM9 functions to shape the recombination landscape. We have constructed a fine-scale genetic map from patterns of linkage disequilibrium assessed using high-throughput sequence data from 51 free-ranging dogs, Canis lupus familiaris. While broad-scale properties of recombination appear similar to other mammalian species, our fine-scale estimates indicate that canine highly elevated recombination rates are observed in the vicinity of CpG rich regions including gene promoter regions, but show little association with H3K4 trimethylation marks identified in spermatocytes. By comparison to genomic data from the Andean fox, Lycalopex culpaeus, we show that biased gene conversion is a plausible mechanism by which the high CpG content of the dog genome could have occurred.
DEFF Research Database (Denmark)
Gyan, B A; Goka, B; Cvetkovic, J T
2004-01-01
Immunoglobulin E has been associated with severe malaria suggesting a regulatory role for interleukin (IL)-4 and/or IgE in the pathogenesis of severe malaria. We have investigated possible associations between polymorphisms in the IL-4 repeat region (intron 3) and promoter regions (IL-4 +33CT and...
International Nuclear Information System (INIS)
Shannon, M.F.; Gamble, J.R.; Vadas, M.A.
1988-01-01
The gene for human granulocyte/macrophage colony-stimulating factor (GM-CSF) is expressed in a tissue-specific as well as an activation-dependent manner. The interaction of nuclear proteins with the promoter region of the GM-CSF gene that is likely to be responsible for this pattern of GM-CSF expression was investigated. The authors show that nuclear proteins interact with DNA fragments from the GM-CSF promoter in a cell-specific manner. A region spanning two cytokine-specific sequences, cytokine 1 (CK-1, 5', GAGATTCCAC 3') and cytokine 2 (CK-2, 5' TCAGGTA 3') bound two nuclear proteins from GM-CSF-expressing cells in gel retardation assays. NF-GMb was inducible with phorbol 12-myristate 13-acetate and accompanied induction of GM-CSF message. NF-GMb was absent in cell lines not producing GM-CSF, some of which had other distinct binding proteins. NF-GMa and NF-GMb eluted from a heparin-Sepharose column at 0.3 and 0.6 M KCl, respectively. They hypothesize that the sequences CK-1 and CK-2 bind specific proteins and regulate GM-CSF transcription
Characterization of the promoter region of the human c-erbB-2 protooncogene
International Nuclear Information System (INIS)
Ishii, S.; Imamoto, F.; Yamanashi, Y.; Toyoshima, K.; Yamamoto, T.
1987-01-01
Three overlapping genomic clones that contain the 5'-terminal portion of the human c-erbB-2 gene (ERBB2) were isolated. The promoter region was identified by nuclease S1 mapping with c-erbB-2 mRNA. Seven transcriptional start sites were identified. DNA sequence analysis showed that the promoter region contains a TATA box and a CAAT box about 30 and 80 base pairs (bp), respectively, upstream of the most downstream RNA initiation site. Two putative binding sites for transcription factor Sp1 were identified about 50 and 110 bp upstream of the CAAT box, and six GGA repeats were found between the CAAT box and the TATA box. This region had strong promoter activity when placed upstream of the bacterial chloramphenicol acetyltransferase gene and transfected into monkey CV-1 cells. These data indicate that the promoter of the human c-erbB-2 protooncogene is different from that of the protooncogene c-erbB-1 (epidermal growth factor receptor gene), which does not contain either a TATA box or a CAAT box. Comparison of the promoter sequences and activities of the two protooncogenes should be helpful in analysis of the regulatory mechanism of expression of their gene products, which are growth-factor receptors
Estradiol represses Insulin-like 3 expression and promoter activity in MA-10 Leydig cells
International Nuclear Information System (INIS)
Lague, Eric; Tremblay, Jacques J.
2009-01-01
There are increasing evidence in the literature reporting the detrimental effects of endocrine disruptors on the development and function of the male reproductive system. One example is cryptorchidism, or undescended testis, caused by exposure to excessive estrogens. Estrogens, acting through the estrogen receptor α (ERα), have been shown to repress expression of the gene encoding insulin-like 3 (INSL3), a small peptide produced by testicular Leydig cells that is essential for normal testis descent. The molecular mechanism of estrogen/ER action on Insl3 expression, however, remains poorly understood. Here we report estradiol (E 2 ) represses Insl3 mRNA levels in MA-10 cells, a Leydig cell line model. We also found that E 2 represses the activity of the human and mouse Insl3 promoter in these cells. The E 2 -responsive region of the human INSL3 promoter was located to the proximal INSL3 promoter. This region does not contain a consensus estrogen response element indicating an indirect mechanism of action. In agreement with this, we found that E 2 -responsiveness was lost when two previously characterized binding sites for the nuclear receptors NUR77 and SF1 were mutated. Finally we show that the E 2 repressive effect could be overcome by cotreatment with testosterone, a positive regulator of Insl3 transcription. Collectively our data provide important new insights into the molecular mechanism of estrogen action in Insl3 transcription in Leydig cells
Na{sup +}/H{sup +} exchanger-1 alleles: Strain distribution and correlation with activity
Energy Technology Data Exchange (ETDEWEB)
McClive, P.J.; Morahan, G. [Walter and Eliza Hall Inst. of Medical Research, Parkville, Victoria (Australia); Little, P.J. [Baker Medical Research Inst., Victoria (Australia)
1996-12-31
The Na{sup +}/H{sup +} exchanger-1 molecule (NHE1) regulates intracellular pH, cell volume, and cell growth. NHE1 is a phosphoprotein of approximately M{sub r} 110000 with 10 or 12 transmembrane domains. NHE1 is ubiquitously expressed. Three other family members have been identified which show close similarity to NHE1 but are significantly more restricted in their expression: all are found in the gastrointestinal tract, while NHE2 and NHE3 are also expressed in the kidney. 14 refs., 2 figs.
Energy Technology Data Exchange (ETDEWEB)
Huerta, Araceli M.; Francino, M. Pilar; Morett, Enrique; Collado-Vides, Julio
2006-03-01
The evolutionary processes operating in the DNA regions that participate in the regulation of gene expression are poorly understood. In Escherichia coli, we have established a sequence pattern that distinguishes regulatory from nonregulatory regions. The density of promoter-like sequences, that are recognizable by RNA polymerase and may function as potential promoters, is high within regulatory regions, in contrast to coding regions and regions located between convergently-transcribed genes. Moreover, functional promoter sites identified experimentally are often found in the subregions of highest density of promoter-like signals, even when individual sites with higher binding affinity for RNA polymerase exist elsewhere within the regulatory region. In order to investigate the generality of this pattern, we have used position weight matrices describing the -35 and -10 promoter boxes of E. coli to search for these motifs in 43 additional genomes belonging to most established bacterial phyla, after specific calibration of the matrices according to the base composition of the noncoding regions of each genome. We have found that all bacterial species analyzed contain similar promoter-like motifs, and that, in most cases, these motifs follow the same genomic distribution observed in E. coli. Differential densities between regulatory and nonregulatory regions are detectable in most bacterial genomes, with the exception of those that have experienced evolutionary extreme genome reduction. Thus, the phylogenetic distribution of this pattern mirrors that of genes and other genomic features that require weak selection to be effective in order to persist. On this basis, we suggest that the loss of differential densities in the reduced genomes of host-restricted pathogens and symbionts is the outcome of a process of genome degradation resulting from the decreased efficiency of purifying selection in highly structured small populations. This implies that the differential
Mechanosensitive promoter region in the human HB-GAM gene
DEFF Research Database (Denmark)
Liedert, Astrid; Kassem, Moustapha; Claes, Lutz
2009-01-01
Mechanical loading is essential for maintaining bone mass in the adult skeleton. However, the underlying process of the transfer of the physical stimulus into a biochemical response, which is termed mechanotransduction is poorly understood. Mechanotransduction results in the modulation of gene...... cells. Analysis of the human HB-GAM gene upstream regulatory region with luciferase reporter gene assays revealed that the upregulation of HB-GAM expression occurred at the transcriptional level and was mainly dependent on the HB-GAM promoter region most upstream containing three potential AP-1 binding...
Directory of Open Access Journals (Sweden)
Dina A Moustafa
Full Text Available Brucella neotomae is not known to be associated with clinical disease in any host species. Previous research suggested that B. neotomae might not express detectable levels of Cu/Zn superoxide dismutase (SOD, a periplasmic enzyme known to be involved in protecting Brucella from oxidative bactericidal effects of host phagocytes. This study was undertaken to investigate the genetic basis for the disparity in SOD expression in B. neotomae. Our Western blot and SOD enzyme assay analyses indicated that B. neotomae does express SOD, but at a substantially reduced level. Nucleotide sequence analysis of region upstream to the sodC gene identified a single-nucleotide insertion in the potential promoter region. The same single-nucleotide insertion was also detected in the sodC promoter of B. suis strain Thomsen, belonging to biovar 2 in which SOD expression was undetectable previously. Examination of the sodC promoter activities using translational fusion constructs with E. coli β-galactosidase demonstrated that the B. neotomae and B. suis biovar 2 promoters were very weak in driving gene expression. Site-directed mutation studies indicated that the insertion of A in the B. neotomae sodC promoter reduced the promoter activity. Increasing the level of SOD expression in B. neotomae through complementation with B. abortus sodC gene did not alter the bacterial survival in J774A.1 macrophage-like cells and in tissues of BALB/c and C57BL/6 mice. These results for the first time demonstrate the occurrence of a single-nucleotide polymorphism affecting promoter function and gene expression in Brucella.
Choe, Keith P; Edwards, Susan L; Claiborne, James B; Evans, David H
2007-02-01
We recently cloned an NHE3 orthologue from the gills of the euryhaline Atlantic stingray (Dasyatis sabina), and generated a stingray NHE3 antibody to unequivocally localize the exchanger to the apical side of epithelial cells that are rich with Na(+)/K(+)-ATPase (A MRC). We also demonstrated an increase in NHE3 expression when stingrays are in fresh water, suggesting that NHE3 is responsible for active Na(+) absorption. However, the vast majority of elasmobranchs are only found in marine environments. In the current study, immunohistochemistry with the stingray NHE3 antibody was used to localize the exchanger in the gills of the stenohaline marine spiny dogfish shark (Squalus acanthias). NHE3 immunoreactivity was confined to the apical side of cells with basolateral Na(+)/K(+)-ATPase and was excluded from cells with high levels of vacuolar H(+)-ATPase. Western blots detected a single protein of 88 kDa in dogfish gills, the same size as NHE3 in stingrays and mammals. These immunological data demonstrate that the putative cell type responsible for active Na(+) absorption in euryhaline elasmobranchs is also present in stenohaline marine elasmobranchs, and suggest that the inability of most elasmobranchs to survive in fresh water is not due to a lack of the gill ion transporters for Na(+) absorption.
Directory of Open Access Journals (Sweden)
Sun JX
2014-05-01
Full Text Available Jingxu Sun,1,* Yongxi Song,1,* Zhenning Wang,1 Guoli Wang,2 Peng Gao,1 Xiaowan Chen,1 Zhaohua Gao,1 Huimian Xu1 1Department of Surgical Oncology and General Surgery, First Hospital of China Medical University, Shenyang, People’s Republic of China; 2Department of Biochemistry and Molecular Biology, China Medical University, Shenyang, People’s Republic of China *These authors contributed equally to this work Background: MicroRNAs are associated with tumor genesis and progression in various carcinomas. MicroRNA-148a (miR-148a was reported to have low expression in gastrointestinal cancers, and might be regulated by promoter region DNA methylation. Methods: Bisulfite-modified sequencing was used to determine the promoter region DNA methylation status of human gastrointestinal cancer cell lines. Expression levels of miR-148a in cell lines treated with 5-aza-2′-deoxycytidine were determined by quantitative real-time polymerase chain reaction. Total DNA was extracted from the tissues of 64 patients with gastric cancer and 51 patients with colorectal cancer. Methylation status was determined by methylation-specific polymerase chain reaction. All statistical analyses were performed with SPSS 17.0 software. Results: The promoter regions of genes in human gastrointestinal cancer cell lines were all hypermethylated, except for HT-29, and the expression of miR-148a tended to be higher than in controls after treatment with 5-aza-2′-deoxycytidine. The methylation-specific polymerase chain reaction results showed that 56.25% of gastric cancer tissues and 19.61% of colorectal cancer tissues were hypermethylated. A strong correlation was found between the expression of miR-148a and the methylation status of promoter regions (P<0.001, chi-square test and Pearson’s correlation. Furthermore, promoter region CpG site hypermethylation of miR-148a was correlated with increased tumor size (P=0.01 in gastric cancer after analyzing the correlation between
Brand Products of Regional Cuisine in the Promotion of Tourism in Roztocze
Directory of Open Access Journals (Sweden)
Bekier-Jaworska Ewa
2015-03-01
Full Text Available Introduction. There has been a trend over the last few years of using specialties of regional cuisine as an independent tourist attraction. The creation of local brands is an important element in the promotion of a given region and it also influences the development of culinary tourism. The aim of the studies conducted was to identify regional dishes - a choice of dishes that could be described as 'brand dishes' and the use of those dishes as tourist attractions in Roztocze. Material and methods. Studies were conducted on a group of students studying tourism and recreation at State Higher School of Vocational Education (PWSZ in Zamość using a questionnaire. Results. The questionnaire provided an assessment of the levels of knowledge of regional cuisine among Polish and Ukrainian students, identified the most characteristic dishes and selected brand products, and helped to arrive at a suitable method of promotion. Conclusions. Nationality, family customs and selection of local restaurants highly influence knowledge of regional cuisine. Interviewees decided that the most outstanding products from Roztocze were Zwierzyniec beer, and Biłgoraj pie. Regional products should be used as a tourist attraction in Roztocze.
Directory of Open Access Journals (Sweden)
Isaacs Richard J
2007-05-01
Full Text Available Abstract Background Topoisomerase IIα has been shown to be down-regulated in doxorubicin-resistant cell lines. The specificity proteins Sp1 and Sp3 have been implicated in regulation of topoisomerase IIα transcription, although the mechanism by which they regulate expression is not fully understood. Sp1 has been shown to bind specifically to both proximal and distal GC elements of the human topoisomerase IIα promoter in vitro, while Sp3 binds only to the distal GC element unless additional flanking sequences are included. While Sp1 is thought to be an activator of human topoisomerase IIα, the functional significance of Sp3 binding is not known. Therefore, we sought to determine the functional relationship between Sp1 and Sp3 binding to the topoisomerase IIα promoter in vivo. We investigated endogenous levels of Sp1, Sp3 and topoisomerase IIα as well as binding of both Sp1 and Sp3 to the GC boxes of the topoisomerase IIα promoter in breast cancer cell lines in vivo after short term doxorubicin exposure. Results Functional effects of Sp1 and Sp3 were studied using transient cotransfection assays using a topoisomerase IIα promoter reporter construct. The in vivo interactions of Sp1 and Sp3 with the GC elements of the topoisomerase IIα promoter were studied in doxorubicin-treated breast cancer cell lines using chromatin immunoprecipitation assays. Relative amounts of endogenous proteins were measured using immunoblotting. In vivo DNA looping mediated by proteins bound at the GC1 and GC2 elements was studied using the chromatin conformation capture assay. Both Sp1 and Sp3 bound to the GC1 and GC2 regions. Sp1 and Sp3 were transcriptional activators and repressors respectively, with Sp3 repression being dominant over Sp1-mediated activation. The GC1 and GC2 elements are linked in vivo to form a loop, thus bringing distal regulatory elements and their cognate transcription factors into close proximity with the transcription start site
SNP variation in the promoter of the PRKAG3 gene and association with meat quality traits in pig.
Ryan, Marion T; Hamill, Ruth M; O'Halloran, Aisling M; Davey, Grace C; McBryan, Jean; Mullen, Anne M; McGee, Chris; Gispert, Marina; Southwood, Olwen I; Sweeney, Torres
2012-07-25
The PRKAG3 gene encodes the γ3 subunit of adenosine monophosphate activated protein kinase (AMPK), a protein that plays a key role in energy metabolism in skeletal muscle. Non-synonymous single nucleotide polymorphisms (SNPs) in this gene such as I199V are associated with important pork quality traits. The objective of this study was to investigate the relationship between gene expression of the PRKAG3 gene, SNP variation in the PRKAG3 promoter and meat quality phenotypes in pork. PRKAG3 gene expression was found to correlate with a number of traits relating to glycolytic potential (GP) and intramuscular fat (IMF) in three phenotypically diverse F1 crosses comprising of 31 Large White, 23 Duroc and 32 Pietrain sire breeds. The majority of associations were observed in the Large White cross. There was a significant association between genotype at the g.-311A>G locus and PRKAG3 gene expression in the Large White cross. In the same population, ten novel SNPs were identified within a 1.3 kb region spanning the promoter and from this three major haplotypes were inferred. Two tagging SNPs (g.-995A>G and g.-311A>G) characterised the haplotypes within the promoter region being studied. These two SNPs were subsequently genotyped in larger populations consisting of Large White (n = 98), Duroc (n = 99) and Pietrain (n = 98) purebreds. Four major haplotypes including promoter SNP's g.-995A>G and g.-311A>G and I199V were inferred. In the Large White breed, HAP1 was associated with IMF% in the M. longissmus thoracis et lumborum (LTL) and driploss%. HAP2 was associated with IMFL% GP-influenced traits pH at 24 hr in LTL (pHULT), pH at 45 min in LTL (pH(45)LT) and pH at 45 min in the M. semimembranosus muscle (pH(45)SM). HAP3 was associated with driploss%, pHULT pH(45)LT and b* Minolta. In the Duroc breed, associations were observed between HAP1 and driploss% and pHUSM. No associations were observed with the remaining haplotypes (HAP2, HAP3 and HAP4) in the Duroc breed. The
SNP variation in the promoter of the PRKAG3 gene and association with meat quality traits in pig
Directory of Open Access Journals (Sweden)
Ryan Marion T
2012-07-01
Full Text Available Abstract Background The PRKAG3 gene encodes the γ3 subunit of adenosine monophosphate activated protein kinase (AMPK, a protein that plays a key role in energy metabolism in skeletal muscle. Non-synonymous single nucleotide polymorphisms (SNPs in this gene such as I199V are associated with important pork quality traits. The objective of this study was to investigate the relationship between gene expression of the PRKAG3 gene, SNP variation in the PRKAG3 promoter and meat quality phenotypes in pork. Results PRKAG3 gene expression was found to correlate with a number of traits relating to glycolytic potential (GP and intramuscular fat (IMF in three phenotypically diverse F1 crosses comprising of 31 Large White, 23 Duroc and 32 Pietrain sire breeds. The majority of associations were observed in the Large White cross. There was a significant association between genotype at the g.-311A>G locus and PRKAG3 gene expression in the Large White cross. In the same population, ten novel SNPs were identified within a 1.3 kb region spanning the promoter and from this three major haplotypes were inferred. Two tagging SNPs (g.-995A>G and g.-311A>G characterised the haplotypes within the promoter region being studied. These two SNPs were subsequently genotyped in larger populations consisting of Large White (n = 98, Duroc (n = 99 and Pietrain (n = 98 purebreds. Four major haplotypes including promoter SNP’s g.-995A>G and g.-311A>G and I199V were inferred. In the Large White breed, HAP1 was associated with IMF% in the M. longissmus thoracis et lumborum (LTL and driploss%. HAP2 was associated with IMFL% GP-influenced traits pH at 24 hr in LTL (pHULT, pH at 45 min in LTL (pH45LT and pH at 45 min in the M. semimembranosus muscle (pH45SM. HAP3 was associated with driploss%, pHULT pH45LT and b* Minolta. In the Duroc breed, associations were observed between HAP1 and driploss% and pHUSM. No associations were observed with the remaining haplotypes (HAP2
International Nuclear Information System (INIS)
Kita, Atsushi; Yamasaki, Hironori; Kuwahara, Hironaga; Moriuchi, Akie; Fukushima, Keiko; Kobayashi, Masakazu; Fukushima, Tetsuya; Takahashi, Ryoko; Abiru, Norio; Uotani, Shigeo; Kawasaki, Eiji; Eguchi, Katsumi
2005-01-01
Adiponectin, an adipose tissue-specific plasma protein, is involved in insulin sensitizing and has anti-atherosclerotic properties. Plasma levels of adiponectin are decreased in obese individuals and patients with type 2 diabetes with insulin resistance. Tumor necrosis factor-α (TNF-α) decreases the expression of adiponectin in adipocytes. The aims of the present study were: (1) to identify the promoter region responsible for basal transcription of the human adiponectin gene, and (2) to investigate the mechanism by which adiponectin was regulated by TNF-α. The human adiponectin promoter (2.1 kb) was isolated and used for luciferase reporter analysis by transient transfection into 3T3-L1 adipocytes. Deletion analysis demonstrated that the promoter region from -676 to +41 was sufficient for basal transcriptional activity. Mutation analysis of putative response elements for sterol regulatory element binding protein (SREBP) (-431 to -423) and CCAAT/enhancer binding protein (C/EBP) (-230 to -224) showed that both elements were required for basal promoter activity. Adiponectin transcription was increased 3-fold in cells that over-expressed constitutively active C/EBP-β. Electrophoretic mobility shift assay, using nuclear extract from 3T3-L1 cells and the -258 to -199 region as a probe, demonstrated specific DNA-protein binding, which was abolished by TNF-α treatment. The present data indicate that the putative response elements for SREBP and C/EBP are required for human adiponectin promoter activity, and that suppression by TNF-α may, at least in part, be associated with inactivation of C/EBP-β
Caputi, Francesca Felicia; Palmisano, Martina; Carboni, Lucia; Candeletti, Sanzio; Romualdi, Patrizia
2016-12-01
The recreational drug of abuse 3,4-methylenedioxymethamphetamine (MDMA) has been shown to produce neurotoxic damage and long-lasting changes in several brain areas. In addition to the involvement of serotoninergic and dopaminergic systems, little information exists about the contribution of nociceptin/orphaninFQ (N/OFQ)-NOP and dynorphin (DYN)-KOP systems in neuronal adaptations evoked by MDMA. Here we investigated the behavioral and molecular effects induced by acute (8mg/kg) or repeated (8mg/kg twice daily for seven days) MDMA exposure. MDMA exposure affected body weight gain and induced hyperlocomotion; this latter effect progressively decreased after repeated administration. Gene expression analysis indicated a down-regulation of the N/OFQ system and an up-regulation of the DYN system in the nucleus accumbens (NAc), highlighting an opposite systems regulation in response to MDMA exposure. Since histone modifications have been strongly associated to the addiction-related maladaptive changes, we examined two permissive (acH3K9 and me3H3K4) and two repressive transcription marks (me3H3K27 and me2H3K9) at the pertinent opioid gene promoter regions. Chromatin immunoprecipitation assays revealed that acute MDMA increased me3H3K4 at the pN/OFQ, pDYN and NOP promoters. Following acute and repeated treatment a significant decrease of acH3K9 at the pN/OFQ promoter was observed, which correlated with gene expression results. Acute treatment caused an acH3K9 increase and a me2H3K9 decrease at the pDYN promoter which matched its mRNA up-regulation. Our data indicate that the activation of the DYNergic stress system together with the inactivation of the N/OFQergic anti-stress system contribute to the neuroadaptive actions of MDMA and offer novel epigenetic information associated with MDMA abuse. Copyright © 2016 Elsevier Ltd. All rights reserved.
Identification of functional DNA variants in the constitutive promoter region of MDM2
Directory of Open Access Journals (Sweden)
Lalonde Marie-Eve
2012-09-01
Full Text Available Abstract Although mutations in the oncoprotein murine double minute 2 (MDM2 are rare, MDM2 gene overexpression has been observed in several human tumors. Given that even modest changes in MDM2 levels might influence the p53 tumor suppressor signaling pathway, we postulated that sequence variation in the promoter region of MDM2 could lead to disregulated expression and variation in gene dosage. Two promoters have been reported for MDM2; an internal promoter (P2, which is located near the end of intron 1 and is p53-responsive, and an upstream constitutive promoter (P1, which is p53-independent. Both promoter regions contain DNA variants that could influence the expression levels of MDM2, including the well-studied single nucleotide polymorphism (SNP SNP309, which is located in the promoter P2; i.e., upstream of exon 2. In this report, we screened the promoter P1 for DNA variants and assessed the functional impact of the corresponding SNPs. Using the dbSNP database and genotyping validation in individuals of European descent, we identified three common SNPs (−1494 G > A; indel 40 bp; and −182 C > G. Three major promoter haplotypes were inferred by using these three promoter SNPs together with rs2279744 (SNP309. Following subcloning into a gene reporter system, we found that two of the haplotypes significantly influenced MDM2 promoter activity in a haplotype-specific manner. Site-directed mutagenesis experiments indicated that the 40 bp insertion/deletion variation is causing the observed allelic promoter activity. This study suggests that part of the variability in the MDM2 expression levels could be explained by allelic p53-independent P1 promoter activity.
Sato, Mitsuhiko P; Makino, Takashi; Kawata, Masakado
2016-02-09
Understanding the evolutionary forces that influence variation in gene regulatory regions in natural populations is an important challenge for evolutionary biology because natural selection for such variations could promote adaptive phenotypic evolution. Recently, whole-genome sequence analyses have identified regulatory regions subject to natural selection. However, these studies could not identify the relationship between sequence variation in the detected regions and change in gene expression levels. We analyzed sequence variations in core promoter regions, which are critical regions for gene regulation in higher eukaryotes, in a natural population of Drosophila melanogaster, and identified core promoter sequence variations associated with differences in gene expression levels subjected to natural selection. Among the core promoter regions whose sequence variation could change transcription factor binding sites and explain differences in expression levels, three core promoter regions were detected as candidates associated with purifying selection or selective sweep and seven as candidates associated with balancing selection, excluding the possibility of linkage between these regions and core promoter regions. CHKov1, which confers resistance to the sigma virus and related insecticides, was identified as core promoter regions that has been subject to selective sweep, although it could not be denied that selection for variation in core promoter regions was due to linked single nucleotide polymorphisms in the regulatory region outside core promoter regions. Nucleotide changes in core promoter regions of CHKov1 caused the loss of two basal transcription factor binding sites and acquisition of one transcription factor binding site, resulting in decreased gene expression levels. Of nine core promoter regions regions associated with balancing selection, brat, and CG9044 are associated with neuromuscular junction development, and Nmda1 are associated with learning
Promotion of hydrogen entry into iron from NaOH solution by iron-oxygen species
International Nuclear Information System (INIS)
Flis-Kabulska, I.; Flis, J.; Zakroczymski, T.
2007-01-01
This study was carried out to explain reasons of the enhanced hydrogen entry into iron at low polarisations. Hydrogen permeation rate (HPR) through a 35-μm thick iron membrane was studied with the electrochemical technique in 0.1 M NaOH at 25 o C. A rotating split-ring disk electrode was used to detect soluble Fe(II) species. Enhanced hydrogen entry (HPR peaks) was observed at low cathodic and low anodic polarisations during voltammetric cycling, and also during galvanostatic anodic polarisation applied after cathodic charging. HPR peaks occurred at potentials from about -1.2 to -0.9 V (NHE) which were more cathodic than the potentials of thermodynamic stability of Fe(OH) 2 or Fe 3 O 4 , and of the formation of soluble Fe(II) species. It has been suggested that the enhanced hydrogen entry is associated with the presence of FeOH ad . In this species oxygen is bound with hydrogen (oxo-hydride), hence it can be supposed that the mechanism of its promoting effect can be similar to that of hydrides of other elements of the VIb group
Yin, Tao; Wu, Hanying; Zhang, Shanglong; Lu, Hongyu; Zhang, Lingxiao; Xu, Yong; Chen, Daming; Liu, Jingmei
2009-01-01
A 1.8 kb 5'-flanking region of the large subunit of ADP-glucose pyrophosphorylase, isolated from watermelon (Citrullus vulgaris S.), has fruit-specific promoter activity in transgenic tomato plants. Two negative regulatory regions, from -986 to -959 and from -472 to -424, were identified in this promoter region by fine deletion analyses. Removal of both regions led to constitutive expression in epidermal cells. Gain-of-function experiments showed that these two regions were sufficient to inhibit RFP (red fluorescent protein) expression in transformed epidermal cells when fused to the cauliflower mosaic virus (CaMV) 35S minimal promoter. Gel mobility shift experiments demonstrated the presence of leaf nuclear factors that interact with these two elements. A TCCAAAA motif was identified in these two regions, as well as one in the reverse orientation, which was confirmed to be a novel specific cis-element. A quantitative beta-glucuronidase (GUS) activity assay of stable transgenic tomato plants showed that the activities of chimeric promoters harbouring only one of the two cis-elements, or both, were approximately 10-fold higher in fruits than in leaves. These data confirm that the TCCAAAA motif functions as a fruit-specific element by inhibiting gene expression in leaves.
Directory of Open Access Journals (Sweden)
Stephanie M. Busque
2014-08-01
Full Text Available Background/Aims: Uric acid nephrolithiasis is prevalent among patients with type 2 diabetes and metabolic syndrome; it is correlated with an acidic urine and lower urinary ammonium excretion and is likely associated with insulin resistance. Insulin stimulates ammoniagenesis in renal cell lines via increased phosphate-dependent glutaminase (PDG activity and glutamine metabolism. Ammonium excretion into the proximal tubule is mediated at least in part by the Na+/H+-exchanger NHE3 and in the collecting duct involving the Rhesus protein RhCG. Here we tested, whether obesity and insulin resistance in a diet-induced mouse model could contribute to deranged ammonium excretion. Methods: Obesity was induced by diet in mice and the impact on key molecules of proximal tubular ammoniagenesis and urinary acid excretion tested. Results: Diet-induced obesity was confirmed by pathological intraperitoneal glucose tolerance tests (IPGTT. Three groups of mice were compared: control mice; obese, glucose-intolerant with abnormal IPGTT (O-GI; or moderate weight with normal IPGTT (Non-Responders, NR. Basal urinary ammonium excretion did not differ among groups. However, acid loading increased urinary ammonium excretion in all groups, but to a lesser extent in the O-GI group. SNAT3 mRNA expression was enhanced in both obese groups. PDG expression was elevated only in acid-loaded O-GI mice, whereas PEPCK was enhanced in both O-GI and NR groups given NH4CI. NHE activity in the brush border membrane of the proximal tubule was strongly reduced in the O-GI group whereas RhCG expression was similar. Conclusion: In sum, obesity and glucose intolerance impairs renal ammonium excretion in response to NH4CI feeding most likely through reduced NHE activity. The stimulation of SNAT3 and ammoniagenic enzyme expression may be compensatory but futile.
Bourne, Matthew N; Duhig, Steven J; Timmins, Ryan G; Williams, Morgan D; Opar, David A; Al Najjar, Aiman; Kerr, Graham K; Shield, Anthony J
2017-03-01
The architectural and morphological adaptations of the hamstrings in response to training with different exercises have not been explored. To evaluate changes in biceps femoris long head (BF LH ) fascicle length and hamstring muscle size following 10-weeks of Nordic hamstring exercise (NHE) or hip extension (HE) training. 30 recreationally active male athletes (age, 22.0±3.6 years; height, 180.4±7 cm; weight, 80.8±11.1 kg) were allocated to 1 of 3 groups: (1) HE training (n=10), NHE training (n=10), or no training (control, CON) (n=10). BF LH fascicle length was assessed before, during (Week 5) and after the intervention with a two-dimensional ultrasound. Hamstring muscle size was determined before and after training via MRI. Compared with baseline , BF LH fascicles were lengthened in the NHE and HE groups at mid-training (d=1.12-1.39, p<0.001) and post-training (d=1.77-2.17, p<0.001) and these changes did not differ significantly between exercises (d=0.49-0.80, p=0.279-0.976). BF LH volume increased more for the HE than the NHE (d=1.03, p=0.037) and CON (d=2.24, p<0.001) groups. Compared with the CON group, both exercises induced significant increases in semitendinosus volume (d=2.16-2.50, ≤0.002) and these increases were not significantly different (d=0.69, p=0.239). NHE and HE training both stimulate significant increases in BF LH fascicle length; however, HE training may be more effective for promoting hypertrophy in the BF LH . Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/.
International Nuclear Information System (INIS)
Sakamoto, K; Imamura, T; Yano, M; Yoshida, H; Fujiki, A; Hirashima, Y; Hosoi, H
2014-01-01
All-trans retinoic acid (ATRA) is well established as differentiation therapy for acute promyelocytic leukemia (APL) in which the PML–RARα (promyelocytic leukemia-retinoic acid receptor α) fusion protein causes blockade of the retinoic acid (RA) pathway; however, in types of acute myeloid leukemia (AML) other than APL, the mechanism of RA pathway inactivation is not fully understood. This study revealed the potential mechanism of high ATRA sensitivity of mixed-lineage leukemia (MLL)-AF9-positive AML compared with MLL-AF4/5q31-positive AML. Treatment with ATRA induced significant myeloid differentiation accompanied by upregulation of RARα, C/EBPα, C/EBPε and PU.1 in MLL-AF9-positive but not in MLL-AF4/5q31-positive cells. Combining ATRA with cytarabine had a synergistic antileukemic effect in MLL-AF9-positive cells in vitro. The level of dimethyl histone H3 lysine 4 (H3K4me2) in the RARα gene-promoter region, PU.1 upstream regulatory region (URE) and RUNX1+24/+25 intronic enhancer was higher in MLL-AF9-positive cells than in MLL-AF4-positive cells, and inhibiting lysine-specific demethylase 1, which acts as a histone demethylase inhibitor, reactivated ATRA sensitivity in MLL-AF4-positive cells. These findings suggest that the level of H3K4me2 in the RARα gene-promoter region, PU.1 URE and RUNX1 intronic enhancer is determined by the MLL-fusion partner. Our findings provide insight into the mechanisms of ATRA sensitivity in AML and novel treatment strategies for ATRA-resistant AML
Promoter Hypermethylation of the EMP3 Gene in a Series of 229 Human Gliomas
Directory of Open Access Journals (Sweden)
Marta Mellai
2013-01-01
Full Text Available The epithelial membrane protein 3 (EMP3 is a candidate tumor suppressor gene in the critical region 19q13.3 for several solid tumors, including tumors of the nervous systems. The aim of this study was to investigate the EMP3 promoter hypermethylation status in a series of 229 astrocytic and oligodendroglial tumors and in 16 GBM cell lines. The analysis was performed by methylation-specific PCR and capillary electrophoresis. Furthermore, the EMP3 expression at protein level was evaluated by immunohistochemistry and Western blotting analysis. Associations of EMP3 hypermethylation with total 1p/19q codeletion, MGMT promoter hypermethylation, IDH1/IDH2 and TP53 mutations, and EGFR amplification were studied, as well as its prognostic significance. The EMP3 promoter hypermethylation has been found in 39.5% of gliomas. It prevailed in low-grade tumors, especially in gliomas with an oligodendroglial component, and in sGBMs upon pGBMs. In oligodendroglial tumors, it was strongly associated with both IDH1/IDH2 mutations and total 1p/19q codeletion and inversely with EGFR gene amplification. No association was found with MGMT hypermethylation and TP53 mutations. In the whole series, the EMP3 hypermethylation status correlated with 19q13.3 loss and lack of EMP3 expression at protein level. A favorable prognostic significance on overall survival of the EMP3 promoter hypermethylation was found in patients with oligodendroglial tumors.
Claiborne, James B; Choe, Keith P; Morrison-Shetlar, Alison I; Weakley, Jill C; Havird, Justin; Freiji, Abe; Evans, David H; Edwards, Susan L
2008-03-01
The dogfish (Squalus acanthias) can make rapid adjustments to gill acid-base transfers to compensate for internal acidosis/alkalosis. Branchial Na+/H+ exchange (NHE) has been postulated as one mechanism driving the excretion of H+ following acidosis. We have cloned gill cDNA that includes an open reading frame coding for a 770-residue protein most homologous (approximately 71%) to mammalian NHE2. RT-PCR revealed NHE2 transcripts predominantly in gill, stomach, rectal gland, intestine, and kidney. In situ hybridization with an antisense probe against NHE2 in gill sections revealed a strong mRNA signal from a subset of interlamellar and lamellae cells. We developed dogfish-specific polyclonal antibodies against NHE2 that detected a approximately 70-kDa protein in Western blots and immunologically recognized branchial cells having two patterns of protein expression. Cytoplasmic and apical NHE2 immunoreactivity were observed in cells coexpressing basolateral Na+-K+-ATPase. Other large ovoid cells more generally staining for NHE2 also were strongly positive for basolateral H+-ATPase. Gill mRNA levels for NHE2 and H+-ATPase did not change following systemic acidosis (as measured by quantitative PCR 2 h after a 1- or 2-meq/kg acid infusion). These data indicate that posttranslational adjustments of NHE2 and other transport systems (e.g., NHE3) following acidosis may be of importance in the short-term pH adjustment and net branchial H+ efflux observed in vivo. NHE2 may play multiple roles in the gills, involved with H+ efflux from acid-secreting cells, basolateral H+ reabsorption for pHi regulation, and in parallel with H+-ATPase for the generation of HCO3(-) in base-secreting cells.
CpG promoter methylation of the ALKBH3 alkylation repair gene in breast cancer.
Stefansson, Olafur Andri; Hermanowicz, Stefan; van der Horst, Jasper; Hilmarsdottir, Holmfridur; Staszczak, Zuzanna; Jonasson, Jon Gunnlaugur; Tryggvadottir, Laufey; Gudjonsson, Thorkell; Sigurdsson, Stefan
2017-07-05
DNA repair of alkylation damage is defective in various cancers. This occurs through somatically acquired inactivation of the MGMT gene in various cancer types, including breast cancers. In addition to MGMT, the two E. coli AlkB homologs ALKBH2 and ALKBH3 have also been linked to direct reversal of alkylation damage. However, it is currently unknown whether ALKBH2 or ALKBH3 are found inactivated in cancer. Methylome datasets (GSE52865, GSE20713, GSE69914), available through Omnibus, were used to determine whether ALKBH2 or ALKBH3 are found inactivated by CpG promoter methylation. TCGA dataset enabled us to then assess the impact of CpG promoter methylation on mRNA expression for both ALKBH2 and ALKBH3. DNA methylation analysis for the ALKBH3 promoter region was carried out by pyrosequencing (PyroMark Q24) in 265 primary breast tumours and 30 proximal normal breast tissue samples along with 8 breast-derived cell lines. ALKBH3 mRNA and protein expression were analysed in cell lines using RT-PCR and Western blotting, respectively. DNA alkylation damage assay was carried out in cell lines based on immunofluorescence and confocal imaging. Data on clinical parameters and survival outcomes in patients were obtained and assessed in relation to ALKBH3 promoter methylation. The ALKBH3 gene, but not ALKBH2, undergoes CpG promoter methylation and transcriptional silencing in breast cancer. We developed a quantitative alkylation DNA damage assay based on immunofluorescence and confocal imaging revealing higher levels of alkylation damage in association with epigenetic inactivation of the ALKBH3 gene (P = 0.029). In our cohort of 265 primary breast cancer, we found 72 cases showing aberrantly high CpG promoter methylation over the ALKBH3 promoter (27%; 72 out of 265). We further show that increasingly higher degree of ALKBH3 promoter methylation is associated with reduced breast-cancer specific survival times in patients. In this analysis, ALKBH3 promoter methylation at >20
The promotion of regional integration of electricity markets: Lessons for developing countries
International Nuclear Information System (INIS)
Oseni, Musiliu O.; Pollitt, Michael G.
2016-01-01
This paper focuses on how to promote regional cooperation in electricity. We begin by discussing the theory of international trade cooperation in electricity, with a view to discussing what preconditions might be important in facilitating wide area trading across national borders. We then develop lessons based on the comparison of four case studies. These include three regional developing country power pools – the Southern African Power pool (SAPP), West African Power pool (WAPP) and the Central American Power Market (MER). We contrast these with Northern Europe's Nord Pool. These cases highlight both the potential and difficulty of having cross-jurisdictional power pools. In the light of the theory and evidence we present, we draw key lessons in the areas of: preconditions for trading; necessary institutional arrangements; practicalities of timetabling; reasons to be hopeful about future prospects. - Highlights: • This paper focuses on how to promote regional electricity cooperation. • We develop lessons based on comparison of four international case studies. • The cases highlight both the potential and difficulty of power pools. • We identify preconditions, institutional arrangements and timetabling. • We conclude that the future prospects for regional power pools are good.
International Nuclear Information System (INIS)
Cui Wei; Yin Lingling; Dong Lingyue
2012-01-01
Objective: To clarify the mechanism of immediate early response gene 5 (Ier5) transcription induced by radiation. Methods: Deletant construction, site-specific mutagenesis,electrophoretic mobility shift assay (EMSA) and chromatin immunoprecipitation (ChIP) were used to forecast the promoter region, binding sites and transcription factors of Ier5 gene in HeLa cells. Results: The promoter region of Ier5 gene might be in the region of Ier5 -8 deletant (-408 - -238 bp). The Ier5 gene had two transcription factors of GCF and NFI, and GCF had two binding sites located in the region of -388 - -382 bp and -274 - -270 bp of Ier5 promoter. The binding site of NFI was located in -362 - -357 bp of Ier5 promoter. GCF could inhibit the expression of Ier5 gene and this inhibition was diminished when the radiation dose increased. In contrast, NFI increased the expression of Ier5. Conclusions: The most possible region of Ier5 promoter is from -408 to -238 bp which has two binding sites for the radiosensitivity transcription factors of GCF and NFI that could negatively and positively regulate the expression of Ier5 respectively. (authors)
DNA Methylation Analysis of BRD1 Promoter Regions and the Schizophrenia rs138880 Risk Allele.
Directory of Open Access Journals (Sweden)
Mads Dyrvig
Full Text Available The bromodomain containing 1 gene, BRD1 is essential for embryogenesis and CNS development. It encodes a protein that participates in histone modifying complexes and thereby regulates the expression of a large number of genes. Genetic variants in the BRD1 locus show association with schizophrenia and bipolar disorder and risk alleles in the promoter region correlate with reduced BRD1 expression. Insights into the transcriptional regulation of BRD1 and the pathogenic mechanisms associated with BRD1 risk variants, however, remain sparse. By studying transcripts in human HeLa and SH-SY5Y cells we provide evidence for differences in relative expression of BRD1 transcripts with three alternative 5' UTRs (exon 1C, 1B, and 1A. We further show that expression of these transcript variants covaries negatively with DNA methylation proportions in their upstream promoter regions suggesting that promoter usage might be regulated by DNA methylation. In line with findings that the risk allele of the rs138880 SNP in the BRD1 promoter region correlates with reduced BRD1 expression, we find that it is also associated with moderate regional BRD1 promoter hypermethylation in both adipose tissue and blood. Importantly, we demonstrate by inspecting available DNA methylation and expression data that these regions undergo changes in methylation during fetal brain development and that differences in their methylation proportions in fetal compared to postnatal frontal cortex correlate significantly with BRD1 expression. These findings suggest that BRD1 may be dysregulated in both the developing and mature brain of risk allele carriers. Finally, we demonstrate that commonly used mood stabilizers Lithium, Valproate, and Carbamazepine affect the expression of BRD1 in SH-SY5Y cells. Altogether this study indicates a link between genetic risk and epigenetic dysregulation of BRD1 which raises interesting perspectives for targeting the mechanisms pharmacologically.
Esophageal desalination is mediated by Na⁺, H⁺ exchanger-2 in the gulf toadfish (Opsanus beta).
Esbaugh, Andrew J; Grosell, Martin
2014-05-01
Esophageal desalination is a crucial step in the gastrointestinal water absorption pathway, as this pre-intestinal processing establishes the osmotic conditions necessary for water absorption. Previous work has shown that esophageal Na(+) absorption is amiloride sensitive; however, it is as yet unclear if Na(+), H(+) exchangers (NHE) or Na(+) channels (ENaC) are responsible. The purpose of the current study was therefore to investigate the roles that NHE isoforms may play in this process in a marine teleost, the gulf toadfish (Opsanus beta), as well as what role NHE isoforms may play in the downstream intestinal Na(+) transport. A combination of symmetrical current clamp and asymmetrical voltage clamp experiments showed the esophagus to contain both an ion absorptive current (I(sc)=0.83±0.68) and serosal side negative transepithelial potential (TEP=-4.9±0.6). (22)Na uptake (J(Na)(m→s)) was inhibited by 0.5 mM EIPA, with no effect of 0.1 mM amiloride, 1 mM furosemide or 1 mM thiazide. A Cl(-) free saline reduced J(Na)(m→s) by 40% while also reducing conductance and reversing TEP. These results suggest that both transcellular and paracellular components contribute to esophageal Na(+) transport, with transcellular transport mediated by NHE. The NHE1, NHE2 and NHE3 genes were amplified and tissue distribution analysis by real-time PCR showed high NHE2 expression levels in the esophagus and stomach. Little NHE3 expression was observed throughout the gastrointestinal tract, and NHE2 expression was absent from the intestine. Hypersalinity (60 ppt) had no effect on the expression profile of NHE2, slc4a2, scl26a6, CAc or V-type ATPase (β-subunit), suggesting that esophageal desalination is less flexible in response to osmotic stress than the intestine. Copyright © 2014 Elsevier Inc. All rights reserved.
Packer, Milton
2017-10-17
The mechanisms underlying the progression of diabetes mellitus and heart failure are closely intertwined, such that worsening of one condition is frequently accompanied by worsening of the other; the degree of clinical acceleration is marked when the 2 coexist. Activation of the sodium-hydrogen exchanger in the heart and vasculature (NHE1 isoform) and the kidneys (NHE3 isoform) may serve as a common mechanism that links both disorders and may underlie their interplay. Insulin insensitivity and adipokine abnormalities (the hallmarks of type 2 diabetes mellitus) are characteristic features of heart failure; conversely, neurohormonal systems activated in heart failure (norepinephrine, angiotensin II, aldosterone, and neprilysin) impair insulin sensitivity and contribute to microvascular disease in diabetes mellitus. Each of these neurohormonal derangements may act through increased activity of both NHE1 and NHE3. Drugs used to treat diabetes mellitus may favorably affect the pathophysiological mechanisms of heart failure by inhibiting either or both NHE isoforms, and drugs used to treat heart failure may have beneficial effects on glucose tolerance and the complications of diabetes mellitus by interfering with the actions of NHE1 and NHE3. The efficacy of NHE inhibitors on the risk of cardiovascular events may be enhanced when heart failure and glucose intolerance coexist and may be attenuated when drugs with NHE inhibitory actions are given concomitantly. Therefore, the sodium-hydrogen exchanger may play a central role in the interplay of diabetes mellitus and heart failure, contribute to the physiological and clinical progression of both diseases, and explain certain drug-drug and drug-disease interactions that have been reported in large-scale randomized clinical trials. © 2017 American Heart Association, Inc.
A study of the frequency of methylation of gene promoter regions in ...
Indian Academy of Sciences (India)
2013-04-02
Apr 2, 2013 ... colorectal cancer in the Taiwanese population. CHANG-CHIEH WU1 ... hypermethylation of promoter-region CpG islands is an important ... mismatch repair gene MLH1 plays an important role in dele- ..... Asia Pac. J. Clin.
International Nuclear Information System (INIS)
Sassone-Corsi, P.; Borrelli, E.
1987-01-01
The E1A (early region 1A) oncogene products of adenovirus type 2 trans-activate the other early viral transcription units, as well as some cellular promoters. Using a short-term cotransfection assay in murine NIH 3T3 fibroblasts, we show that c-fos and c-myc promoter activities are stimulated by the E1A proteins, whereas c-Ha-ras transcription is not affected. The product of E1A 13S mRNA is responsible for the trans-activation, whereas the 12S mRNA product has no effect. Analysis of the c-fos promoter sequences required for the E1A stimulation shows that responsive sequences are located between positions -402 and -240 upstream of the transcription initiation site. This same region also contains the c-fos serum-responsive element. Furthermore, transcription of the endogenous c-fos gene in HeLa cells is increased after E1A transfection
Role of regional policies in promoting networking and innovation activity of firms
Kirsi Mukkala; Jari Ritsilä
2004-01-01
The success of firms and regions is increasingly defined by their innovation and learning capabilities. It has been emphasized in several studies that a local operational environment may have a positive impact on innovation activity of firms. From policy point of view, the relationship between firms and their local environment is an important research topic. The purpose of this paper is to explore whether there is a demand for regional policy makers in promoting innovative and networking acti...
Reilly, Beau D; Cramp, Rebecca L; Wilson, Jonathan M; Campbell, Hamish A; Franklin, Craig E
2011-09-01
Bull sharks, Carcharhinus leucas, are one of only a few species of elasmobranchs that live in both marine and freshwater environments. Osmoregulation in euryhaline elasmobranchs is achieved through the control and integration of various organs (kidney, rectal gland and liver) in response to changes in environmental salinity. However, little is known regarding the mechanisms of ion transport in the gills of euryhaline elasmobranchs and how they are affected by osmoregulatory challenges. This study was conducted to gain insight into the branchial ion and acid-base regulatory mechanisms of C. leucas by identifying putative ion transporters and determining whether their expression is influenced by environmental salinity. We hypothesised that expression levels of the Na(+)/K(+)-ATPase (NKA) pump, Na(+)/H(+) exchanger 3 (NHE3), vacuolar-type H(+)-ATPase (VHA) and anion exchanger pendrin (PDN) would be upregulated in freshwater (FW) C. leucas. Immunohistochemistry was used to localise all four ion transporters in gills of bull sharks captured in both FW and estuarine/seawater (EST/SW) environments. NHE3 immunoreactivity occurred in the apical region of cells with basolateral NKA expression whereas PDN was apically expressed in cells that also exhibited basolateral VHA immunoreactivity. In accordance with our hypotheses, quantitative real-time PCR showed that the mRNA expression of NHE3 and NKA was significantly upregulated in gills of FW-captured C. leucas relative to EST/SW-captured animals. These data suggest that NHE3 and NKA together may be important in mediating branchial Na(+) uptake in freshwater environments, whereas PDN and VHA might contribute to Cl(-)/HCO(3)(-) transport in marine and freshwater bull shark gills.
Different natriuretic responses in obese and lean rats in response to nitric oxide reduction.
Ambrozewicz, Marta A; Khraibi, Ali A; Simsek-Duran, Fatma; DeBose, Sophia C; Baydoun, Hind A; Dobrian, Anca D
2011-08-01
Nitric oxide (NO) is an important regulator of renal sodium transport and participates in the control of natriuresis and diuresis. In obesity, the nitric oxide bioavailability was reportedly reduced, which may contribute to the maintenance of hypertension. The aim of this study was to determine the effect of NO depletion on renal sodium handling in a model of diet-induced obesity hypertension. Obese hypertensive (obesity-prone (OP)) and lean normotensive (obesity-resistant (OR)) Sprague-Dawley rats were treated with 1.2 mg/kg/day N(G)-nitro-L-arginine-methyl ester (L-NAME) for 4 weeks to inhibit NO synthesis. Acute pressure natriuresis and diuresis were measured in response to an increase in perfusion pressure. NHE3 and Na(+), K(+)-ATPase protein expression were measured by Western blot and NHE3 activity was determined as the rate of pH change in brush border membrane vesicles. NHE3 membrane localization was determined by confocal microscopy. L-NAME did not significantly attenuate the natriuretic and diuretic responses to increases in renal perfusion pressure (RPP) in OP rats while inducing a significant reduction in OR rats. Following chronic NO inhibition, NHE3 protein expression and activity and Na(+), K(+)-ATPase protein expression were significantly increased in the OR but not in the OP group. Immunofluorescence studies indicated that the increase in NHE3 activity could be, at least in part, due to NHE3 membrane trafficking. Obese hypertensive rats have a weaker natriuretic response in response to NO inhibition compared to lean rats and the mechanism involves different regulation of the apical sodium exchanger NHE3 expression, activity, and trafficking.
DEFF Research Database (Denmark)
Jensen, Anne
Pricing of transport has been part of EU's common transport policy since this gained momentum in the early 1990s. Since then, it has been closely connected to the trans-European transport network (TEN-T) and to rising demands of efficient mobility systems at a local, regional and Community scale....... Development of pricing policies is contested at Community level and has taken place in a clash between different policy rationalities. Significantly though, the effects of the pricing policies are closely related to regional mobility systems, e.g. through financing large trans-border infrastructure projects...... and establishing common technical charging systems thus changing the conditions for regional mobility. This paper explores how policies of infrastructure pricing shape new ways of governing mobility which influences trans-border, regional policy-making. The key findings are that there is a tendency to include...
Structual Dynamics and Function of the Na+/H+ Exchanger 1
DEFF Research Database (Denmark)
Hendus-Altenburger, Ruth
Na+/H+ Exchangers (SLC9As) are of pivotal importance in several physiological processes, and their dysfunction is linked to the pathogenesis of several diseases. The Na+/H+ Exchanger 1 (NHE1) is ubiquitously expressed at the plasma membrane. It contains two domains, the transmembrane ion...... translocation domain and a large cytoplasmic regulatory domain. Despite its physiological and pathophysiological importance, high resolution structural data of NHE1 is missing, and even though several binding partners and phosphorylation sites of the NHE1 regulatory domain are known and many more suggested......, the molecular structures and mechanisms underlying NHE1 regulation and function are still incompletely understood. In this work, in silico analysis revealed two structured and two intrinsically disordered regions in the regulatory domain. A divide-and-conquer approach was used to identify subdomains...
DEFF Research Database (Denmark)
Pedersen, Anna-Kathrine; Mendes Lopes de Melo, Joana; Mørup, Nina
2017-01-01
Background Chronic angiogenesis is a hallmark of most tumors and takes place in a hostile tumor microenvironment (TME) characterized by hypoxia, low nutrient and glucose levels, elevated lactate and low pH. Despite this, most studies addressing angiogenic signaling use hypoxia as a proxy for tumor...... cells, Akt1 most abundantly. Akt1 protein expression was reduced by TME yet unaffected by hypoxia, while Akt phosphorylation was increased by TME. The Akt loss was partly reversed by MCF-7 human breast cancer cell conditioned medium, suggesting that in vivo, the cancer cell secretome may compensate....../inhibition. Conclusions NHE1 and Akt are downregulated by TME conditions, more potently than by hypoxia alone. This inhibits endothelial cell migration and growth in a manner likely modulated by the cancer cell secretome....
Nucleopolis for promoting the nuclear excellence of the Normandy region
International Nuclear Information System (INIS)
2016-01-01
Nucleopolis is the Norman economic pole dedicated to nuclear energy, nuclear medicine and nuclear safety, it gathers about 70 enterprises whatever their sizes, research laboratories and teaching or training units. Nucleopolis was founded in 2009 with the economic development of the region as a unique purpose. Nucleopolis will ease the access of its members to local, national and international markets through actions of networking and by promoting innovations and skill development. Nucleopolis proposes to its members a series of services around 4 departments: Nucleo'Network to promote networking between the members themselves and between the members and major contractors; Nucleo'Business to propose assistance in national and international business; Nucleo'Competence to propose adequate training to its members to upgrade their skills and Nucleo'Innovation to foster collaborative work between its members on innovative projects. (A.C.)
Directory of Open Access Journals (Sweden)
Susanne Helm
Full Text Available During the blood meal of a Plasmodium-infected mosquito, 10 to 100 parasites are inoculated into the skin and a proportion of these migrate via the bloodstream to the liver where they infect hepatocytes. The Plasmodium liver stage, despite its clinical silence, represents a highly promising target for antimalarial drug and vaccine approaches. Successfully invaded parasites undergo a massive proliferation in hepatocytes, producing thousands of merozoites that are transported into a blood vessel to infect red blood cells. To successfully develop from the liver stage into infective merozoites, a tight regulation of gene expression is needed. Although this is a very interesting aspect in the biology of Plasmodium, little is known about gene regulation in Plasmodium parasites in general and in the liver stage in particular. We have functionally analyzed a novel promoter region of the rodent parasite Plasmodium berghei that is exclusively active during the liver stage of the parasite. To prove stage-specific activity of the promoter, GFP and luciferase reporter assays have been successfully established, allowing both qualitative and accurate quantitative analysis. To further characterize the promoter region, the transcription start site was mapped by rapid amplification of cDNA ends (5'-RACE. Using promoter truncation experiments and site-directed mutagenesis within potential transcription factor binding sites, we suggest that the minimal promoter contains more than one binding site for the recently identified parasite-specific ApiAP2 transcription factors. The identification of a liver stage-specific promoter in P. berghei confirms that the parasite is able to tightly regulate gene expression during its life cycle. The identified promoter region might now be used to study the biology of the Plasmodium liver stage, which has thus far proven problematic on a molecular level. Stage-specific expression of dominant-negative mutant proteins and
Hamstring injury prevention in soccer: Before or after training?
Lovell, R; Knox, M; Weston, M; Siegler, J C; Brennan, S; Marshall, P W M
2018-02-01
We examined the effects of a 12-week program of Nordic hamstring exercises (NHE), administered before or after football training, upon eccentric hamstring strength, muscle activity, and architectural adaptations. Amateur soccer players were randomized into three groups. The control group (CON; n=11) undertook core stability exercises, whereas a periodized NHE program was delivered either before (NHE BEF ; n=10) or after (NHE AFT ; n=14) biweekly training sessions. Outcome measures included peak torque and concomitant normalized peak surface electromyography signals (sEMG) of the biceps femoris (BF) and medial hamstring (MH) muscles during knee flexor maximal eccentric contractions, performed at 30°·s -1 . Ultrasonography was used to determine BF muscle thickness, muscle fiber pennation angle, and fascicle length. Performing the NHE derived likely moderate peak torque increases in both NHE BEF (+11.9%; 90% confidence interval: 3.6%-20.9%) and NHE AFT (+11.6%; 2.6%-21.5%) vs CON. Maximum sEMG increases were moderately greater in the BF of both NHE training groups vs CON. There were likely moderate increases in BF muscle thickness (+0.17 cm; 0.05-0.29 cm) and likely small pennation angle increases (+1.03°; -0.08° to 2.14°) in NHE AFT vs CON and NHE BEF . BF fascicle length increases were likely greater in NHE BEF (+1.58 cm; 0.48-2.68 cm; small effect) vs CON and NHE AFT . A 12-week eccentric hamstring strengthening program increased strength and sEMG to a similar magnitude irrespective of its scheduling relative to the football training session. However, architectural adaptations to support the strength gains differed according to the timing of the injury prevention program. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Governmental promotion of the Information Society in the Spanish Region of Valencia
Directory of Open Access Journals (Sweden)
Emilio Feliu-García, Ph.D.
2011-01-01
Full Text Available Regional spheres are considered essential in the governmental promotion of the Information Society at the international level. The regional initiatives in Spain aim to strengthen and complement the initiatives promoted at the national level. This article analyses ICT penetration in the Valencian Community from 1996 to 2008. The objective is to identify which of the actions carried out by the Valencian Regional Government have had a positive effect on its society.The methodology employed in this study is benchmarking. The selection of indicators is based on the policies evaluation model proposed in the Plan Avanza (Spain’s national Information Society strategy. Data were collected from official statistical sources (like Spain’s National Statistics Institute, INE. Three statistical tests were applied to verify the hypotheses (Pearson’s r2, Chi-square and Student’s t.The results indicate that it is not possible to affirm that the actions implemented by the Valencian Regional Government have had a more positive effect on its society than those implemented by the Spanish Central Government. A reason for this may lie in the specific objectives of the political strategy implemented by the Valencian Government, which has focused primarily on e-Government and does not include enough projects centred on the implementation of new technologies in the private sector. Moreover, the integration of new technologies in everyday life is placed in a second level of importance despite citizens are central actors in the international agenda.
Directory of Open Access Journals (Sweden)
Simrén Magnus
2009-11-01
Full Text Available Abstract Background Oxytocin and the oxytocin receptor have been demonstrated in the gastrointestinal (GI tract and have been shown to exert physiological effects on gut motility. The role for oxytocin in the pathophysiology of GI complaints is unknown. The aim of this study was to examine genetic variations or polymorphism of oxytocin (OXT and its receptor (OXTR genes in patients with GI complaints without visible organic abnormalities. Methods Genetic variants in the OXT promoter region, and in the OXTR gene in DNA samples from 131 rigorously evaluated patients with Irritable Bowel Syndrome (IBS, 408 homozygous subjects referred for lactase (LCT-13910 C>T, rs4988235 genotyping, and 299 asymptomatic blood donors were compared. One polymorphism related to the OXT gene (rs6133010 A>G and 4 related to the OXTR gene (rs1465386 G>T, rs3806675 G>A, rs968389 A>G, rs1042778 G>T were selected for genotyping using Applied Biosystems 7900 HT allele discrimination assays. Results There were no statistically significant differences in the genotype or allele frequencies in any of the SNPs when IBS patients were compared to healthy controls. Among subjects referred for lactase genotyping, the rs6133010 A>G OXT promoter A/G genotype tended to be more common in the 154 non-persistent (27.3% subjects than in the 254 lactase persistant (18.1% subjects and in the healthy controls (19.4% (p = 0.08. When direct comparing, the A/G genotype was less common in the OXT promoter region in controls (p = 0.09 and in subjects with lactase persistence (p = 0.03 compared to subjects with lactase non-persistence. When healthy controls were viewed according to their own LCT-13910 genotypes, the C/C lactase non-persistent controls had a higher frequency for the OXT promoter A/G genotype than LCT-13910 T/T lactase persistent controls (41.2% vs 13.1%. No significant differences in frequencies of the investigated OXTR SNPs were noted in this study. Conclusion The results suggest
The relationship between Na+/H+ exchanger expression and tyrosinase activity in human melanocytes
International Nuclear Information System (INIS)
Smith, Dustin R.; Spaulding, Deborah T.; Glenn, Hayden M.; Fuller, Bryan B.
2004-01-01
The activity of melanosome-associated tyrosinase in human melanocytes differs based on racial skin type. In melanocytes from Black skin, tyrosinase activity is high while in White melanocytes the activity of the enzyme is low. Recent studies suggest that low tyrosinase activity in White melanocytes may be due to an acidic pH environment within the melanosome. Because sodium/hydrogen (Na + /H + ) exchangers (NHEs) are known to regulate intracellular pH, melanocytes were treated with NHE inhibitors to determine what effect this inhibition might have on tyrosinase activity. Treatment of Black melanocytes with ethyl-isopropyl amiloride (EIPA) caused a rapid dose-dependent inhibition of tyrosinase activity. This inhibition was not due to either direct enzyme inhibition or to a decrease in tyrosinase abundance. In contrast, treatment of White melanocytes with EIPA, cimetidine, or clonidine resulted in little inhibition of tyrosinase activity. Reverse transcriptase-polymerase chain reaction (RT-PCR) and Western blot analysis showed that both Black and White melanocytes expressed mRNA and protein for NHE-1, NHE-3, NHE-5, NHE-6, and NHE-7. Immunohistochemical analysis showed that NHE-7 and NHE-3 co-localized with the melanosomal protein, Tyrosinase Related Protein-1 (TRP-1). In addition, the vesicular proton pump, vesicular ATPase (V-ATPase), was found to be present in both White and Black melanosomes, indicating that organelles from both racial skin types are capable of being acidified. The results suggest that one or more NHEs may help regulate melanosome pH and tyrosinase activity in human melanocytes
El-Awa, Fatimah M S; El Naga, Randa Abou; Labib, Sahar; Latif, Nisreen Abdel
2018-04-05
Tobacco use and placement of tobacco products in television (TV) productions and movies is a way to promote tobacco use while avoiding tobacco advertising bans that exist in most countries. The fact that such productions are broadcast widely and viewed by millions, including children and young people, is of concern. This paper reviews the evidence on the use of tobacco advertising, promotion and sponsorship (TAPS) in TV and films in the Eastern Mediterranean Region and the ways to combat it. Evidence from Egypt shows considerable and increasing use of tobacco products by actors on screen, including female actors, in programmes aired during Ramadan in 2015-2017. A study of Iranian movies in 2015 showed that tobacco scenes in Iranian movies were increasing. In 2014, the WHO Regional Office for the Eastern Mediterranean held a consultative meeting on TAPS in drama. The consultation recommended regulating the tobacco presence in movies and TV through complete implementation of Article 13 of the WHO FCTC, and raising the issue to the WHO FCTC Conference of the Parties. In 2016, the Conference of the Parties called on parties to consider scaling up the implementation of WHO FCTC Article 13 and monitoring the use of TAPS in entertainment media in accordance with national legislation. A comprehensive approach is essential to end the tobacco industry's use of TV productions and movies to promote their products. Copyright © World Health Organization (WHO) 2018. Some rights reserved. This work is available under the CC BY-NC-SA 3.0 IGO license (https://creativecommons.org/licenses/by-nc-sa/3.0/igo).
Newton, K; Jorgensen, N M; Wallace, A J; Buchanan, D D; Lalloo, F; McMahon, R F T; Hill, J; Evans, D G
2014-12-01
Lynch syndrome (LS) patients have DNA mismatch repair deficiency and up to 80% lifetime risk of colorectal cancer (CRC). Screening of mutation carriers reduces CRC incidence and mortality. Selection for constitutional mutation testing relies on family history (Amsterdam and Bethesda Guidelines) and tumour-derived biomarkers. Initial biomarker analysis uses mismatch repair protein immunohistochemistry and microsatellite instability. Abnormalities in either identify mismatch repair deficiency but do not differentiate sporadic epigenetic defects, due to MLH1 promoter region methylation (13% of CRCs) from LS (4% of CRCs). A diagnostic biomarker capable of making this distinction would be valuable. This study compared two biomarkers in tumours with mismatch repair deficiency; quantification of methylation of the MLH1 promoter region using a novel assay and BRAF c.1799T>A, p.(Val600Glu) mutation status in the identification of constitutional mutations. Tumour DNA was extracted (formalin fixed, paraffin embedded, FFPE tissue) and pyrosequencing used to test for MLH1 promoter methylation and presence of the BRAF c.1799T>A, p.(Val600Glu) mutation 71 CRCs from individuals with pathogenic MLH1 mutations and 73 CRCs with sporadic MLH1 loss. Specificity and sensitivity was compared. Unmethylated MLH1 promoter: sensitivity 94.4% (95% CI 86.2% to 98.4%), specificity 87.7% (95% CI 77.9% to 94.2%), Wild-type BRAF (codon 600): sensitivity 65.8% (95% CI 53.7% to 76.5%), specificity 98.6% (95% CI 92.4% to 100.0%) for the identification of those with pathogenic MLH1 mutations. Quantitative MLH1 promoter region methylation using pyrosequencing is superior to BRAF codon 600 mutation status in identifying constitutional mutations in mismatch repair deficient tumours. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://group.bmj.com/group/rights-licensing/permissions.
Wang, Yajun; Dong, Qing; Ding, Zhaolan; Gai, Kexin; Han, Xiaoyun; Kaleri, Farah Naz; He, Qun; Wang, Ying
2016-10-01
Catalase-3 (CAT-3) constitutes the main catalase activity in growing hyphae of Neurospora crassa, and its activity increases during exponential growth or is induced under different stress conditions. Although extensive progress has been made to identify catalase regulators, the regulation mechanism of CAT-3 at the chromatin level still remains unclear. Here, we aim at investigating the molecular regulation mechanisms of cat-3 at the chromatin level. We found that CAT-3 protein levels increased in mutants defective in proper global heterochromatin formation. Bioinformatics analysis identified a 5-kb AT-rich sequence adjacent to the cat-3 promoter as a heterochromatin region because of its enrichment of H3K9me3 and HP1. Expression of CAT-3 was induced by H 2 O 2 treatment in wild-type and such change occurred along with the accumulation of histone H3 acetylation at 5-kb heterochromatin boundaries and cat-3 locus, but without alteration of its H3K9me3 repressive modification. Moreover, disruption of 5-kb heterochromatin region results in elevated cat-3 expression, and higher levels of cat-3 expression were promoted by the combination with global heterochromatin defective mutants. Interestingly, the molecular weight and activity bands of CAT-3 protein are different in heterochromatin defective mutants compared with those in wild-type, suggesting that its N-terminal processing and modification may be altered. Our study indicates that the local chromatin structure creates a heterochromatin repressive environment to repress nearby gene expression. Copyright © 2016 Elsevier Inc. All rights reserved.
Proximal tubule Na transporter responses are the same during acute and chronic hypertension
DEFF Research Database (Denmark)
Magyar, C E; Zhang, Y; Holstein-Rathlou, N H
2000-01-01
Acute hypertension in Sprague-Dawley rats (SD) provokes a decrease in renal proximal tubule (PT) salt and fluid reabsorption, redistribution of apical Na/H exchanger isoform 3 (NHE3) and Na-P(i) cotransporter type 2 (NaPi2) out of the brush border into higher density membranes, and inhibition...... to persistent adaptive changes in NHE3 and NaPi2 distribution and/or NKA activity. Renal cortex Na transporter protein density distributions and activities were compared by subcellular fractionation in 1) adult SHR with an acute increase or decrease in arterial pressure and 2) young SD (YSD) and young SHR (YSHR......) vs. adult SD and SHR. In adult hypertensive SHR NHE3 was shifted to membranes of higher densities, analogous to SD with acute hypertension, and there were no further changes with a further increase or decrease in arterial pressure. There was no change in total pool size of NHE3 in cortex in YSHR vs...
Cytosine deletion at AP2-box region of HSP70 promoter and its ...
Indian Academy of Sciences (India)
Cytosine deletion at AP2-box region of HSP70 promoter and its influence on semen quality traits in crossbred bulls ... Laboratory, ICAR-Central Institute for Research on Cattle, Meerut 250 001, India; School of Atmospheric Stress Management, ICAR-National Institute of Abiotic Stress Management, Baramati 413 115, India ...
Directory of Open Access Journals (Sweden)
Nelli Babayan
2011-12-01
Full Text Available Building on the model of the enlargement policy, the European Union (EU designed the European Neighbourhood Policy and the Eastern Partnership to further promote its norms and principles. One of the goals of its new policies has been to foster regional cooperation among partner countries and their neighbours. This article specifies the EU’s framework for promoting regional cooperation through the aforementioned policies and discusses its potential impact on the example of the South Caucasus republics of Armenia, Azerbaijan, and Georgia. The South Caucasus has not only been an arena of intraregional conflicts, but has also often been troubled by disputes between its neighbours. This article argues that, due to a lack of proactive and consistent engagement, the EU’s framework risks leaving regional conflicts in the current state of stagnation and without advancement in regional cooperation.
Promoters active in interphase are bookmarked during mitosis by ubiquitination
Arora, Mansi; Zhang, Jie; Heine, George F.; Ozer, Gulcin; Liu, Hui-wen; Huang, Kun; Parvin, Jeffrey D.
2012-01-01
We analyzed modification of chromatin by ubiquitination in human cells and whether this mark changes through the cell cycle. HeLa cells were synchronized at different stages and regions of the genome with ubiquitinated chromatin were identified by affinity purification coupled with next-generation sequencing. During interphase, ubiquitin marked the chromatin on the transcribed regions of ∼70% of highly active genes and deposition of this mark was sensitive to transcriptional inhibition. Promoters of nearly half of the active genes were highly ubiquitinated specifically during mitosis. The ubiquitination at the coding regions in interphase but not at promoters during mitosis was enriched for ubH2B and dependent on the presence of RNF20. Ubiquitin labeling of both promoters during mitosis and transcribed regions during interphase, correlated with active histone marks H3K4me3 and H3K36me3 but not a repressive histone modification, H3K27me3. The high level of ubiquitination at the promoter chromatin during mitosis was transient and was removed within 2 h after the cells exited mitosis and entered the next cell cycle. These results reveal that the ubiquitination of promoter chromatin during mitosis is a bookmark identifying active genes during chromosomal condensation in mitosis, and we suggest that this process facilitates transcriptional reactivation post-mitosis. PMID:22941662
International Nuclear Information System (INIS)
Kiehl, Anita; Huang, Lili; Franchi, David; Anders, David G.
2003-01-01
The human cytomegalovirus (HCMV) UL57 gene lies adjacent to HCMV oriLyt, from which it is separated by an organizationally conserved, mostly noncoding region that is thought to both regulate UL57 expression and activate oriLyt function. However, the UL57 promoter has not been studied. We determined the 5' ends of UL57 transcripts toward an understanding of the potential relationship between UL57 expression and oriLyt activation. The results presented here identified three distinct 5' ends spread over 800 bp, at nt 90302, 90530, and 91138; use of these sites exhibited differential sensitivity to phosphonoformic acid treatment. Interestingly, a 10-kb UL57 transcript accumulated in cycloheximide-treated infected cells, even though other early transcripts were not detectable. However, the 10-kb transcript did not accumulate in cells treated with the more stringent translation inhibitor anisomycin. Consistent with the notion that the identified 5' ends arise from distinct transcription start sites, the sequences upstream of sites I and II functioned as promoters responsive to HCMV infection in transient assays. However, the origin-proximal promoter region III required downstream sequences for transcriptional activity. Mutation of candidate core promoter elements suggested that promoter III is regulated by an initiator region (Inr) and a downstream promoter element. Finally, a 42-bp sequence containing the candidate Inr activated a minimal oriLyt core construct in transient replication assays. Thus, these studies showed that a large, complex promoter region with novel features controls UL57 expression, and identified a sequence that regulates both UL57 transcription and oriLyt activation
Liu, Bao-Qin; Zhang, Song; Li, Si; An, Ming-Xin; Li, Chao; Yan, Jing; Wang, Jia-Mei; Wang, Hua-Qin
2017-07-13
BAG3 is an evolutionarily conserved co-chaperone expressed at high levels and has a prosurvival role in many tumor types. The current study reported that BAG3 was induced under specific floating culture conditions that enrich breast cancer stem cell (BCSC)-like cells in spheres. Ectopic BAG3 overexpression increased CD44 + /CD24 - CSC subpopulations, first-generation and second-generation mammosphere formation, indicating that BAG3 promotes CSC self-renewal and maintenance in breast cancer. We further demonstrated that mechanically, BAG3 upregulated CXCR4 expression at the post-transcriptional level. Further studies showed that BAG3 interacted with CXCR4 mRNA and promoted its expression via its coding and 3'-untranslational regions. BAG3 was also found to be positively correlated with CXCR4 expression and unfavorable prognosis in patients with breast cancer. Taken together, our data demonstrate that BAG3 promotes BCSC-like phenotype through CXCR4 via interaction with its transcript. Therefore, this study establishes BAG3 as a potential adverse prognostic factor and a therapeutic target of breast cancer.
DEFF Research Database (Denmark)
Bjørbaek, C; Echwald, Søren Morgenthaler; Hubricht, P
1994-01-01
To examine the hypothesis that variants in the regulatory or coding regions of the glycogen synthase (GS) and insulin-responsive glucose transporter (GLUT4) genes contribute to insulin-resistant glucose processing of muscle from non-insulin-dependent diabetes mellitus (NIDDM) patients, promoter...... volunteers. By applying inverse polymerase chain reaction and direct DNA sequencing, 532 base pairs (bp) of the GS promoter were identified and the transcriptional start site determined by primer extension. SSCP scanning of the promoter region detected five single nucleotide substitutions, positioned at 42......'-untranslated region, and the coding region of the GLUT4 gene showed four polymorphisms, all single nucleotide substitutions, positioned at -581, 1, 30, and 582. None of the three changes in the regulatory region of the gene had any major influence on expression of the GLUT4 gene in muscle. The variant at 582...
International Nuclear Information System (INIS)
Chattopadhyay, Anasuya; Schmidt, Martin C.; Khan, Saleem A.
2005-01-01
Human papillomaviruses (HPVs) replicate as nuclear plasmids in infected cells. Since the DNA replication machinery is generally conserved between humans and Saccharomyces cerevisiae, we studied whether HPV-1 DNA can replicate in yeast. Plasmids containing a selectable marker (with or without a yeast centromere) and either the full-length HPV-1 genome or various regions of the viral long control region (LCR) and the 3' end of the L1 gene were introduced into S. cerevisiae and their ability to replicate episomally was investigated. Our results show that HPV-1 sequences promote episomal replication of plasmids although the yeast centromere is required for plasmid retention. We have mapped the autonomously replicating sequence activity of HPV-1 DNA to a 450 base-pair sequence (HPV-1 nt 6783-7232) that includes 293 nucleotides from the 5' region of the viral LCR and 157 nucleotides from the 3' end of the L1 gene. The HPV-1 ARS does not include the binding sites for the viral E1 and E2 proteins, and these proteins are dispensable for replication in S. cerevisiae
Directory of Open Access Journals (Sweden)
Hassan A. Aziz
2018-06-01
Full Text Available Tobacco smoking is widespread behavior in Qatar and worldwide and is considered one of the major preventable causes of ill health and death. Nicotine is part of tobacco smoke that causes numerous health risks and is incredibly addictive; it binds to the α7 nicotinic acetylcholine receptor (α7nAChR in the brain. Recent studies showed α7nAChR involvement in the initiation and addiction of smoking. Kynurenic acid (KA, a significant tryptophan metabolite, is an antagonist of α7nAChR. Inhibition of kynurenine 3-monooxygenase enzyme encoded by KMO enhances the KA levels. Modulating KMO gene expression could be a useful tactic for the treatment of tobacco initiation and dependence. Since KMO regulation is still poorly understood, we aimed to investigate the 5′ and 3′-regulatory factors of KMO gene to advance our knowledge to modulate KMO gene expression. In this study, bioinformatics methods were used to identify the regulatory sequences associated with expression of KMO. The displayed differential expression of KMO mRNA in the same tissue and different tissues suggested the specific usage of the KMO multiple alternative promoters. Eleven KMO alternative promoters identified at 5′-regulatory region contain TATA-Box, lack CpG Island (CGI and showed dinucleotide base-stacking energy values specific to transcription factor binding sites (TFBSs. The structural features of regulatory sequences can influence the transcription process and cell type-specific expression. The uncharacterized LOC105373233 locus coding for non-coding RNA (ncRNA located on the reverse strand in a convergent manner at the 3′-side of KMO locus. The two genes likely expressed by a promoter that lacks TATA-Box harbor CGI and two TFBSs linked to the bidirectional transcription, the NRF1, and ZNF14 motifs. We identified two types of microRNA (miR in the uncharacterized LOC105373233 ncRNA, which are like hsa-miR-5096 and hsa-miR-1285-3p and can target the miR recognition
Core Promoter Structure in the Oomycete Phytophthora infestans
McLeod, Adele; Smart, Christine D.; Fry, William E.
2004-01-01
We have investigated the core promoter structure of the oomycete Phytophthora infestans. The transcriptional start sites (TSS) of three previously characterized P. infestans genes, Piexo1, Piexo3, and Piendo1, were determined by primer extension analyses. The TSS regions were homologous to a previously identified 16-nucleotide (nt) core sequence that overlaps the TSS in most oomycete genes. The core promoter regions of Piexo1 and Piendo1 were investigated by using a transient protoplast expression assay and the reporter gene β-glucuronidase. Mutational analyses of the promoters of Piexo1 and Piendo1 showed that there is a putative core promoter element encompassing the TSS (−2 to + 5) that has high sequence and functional homology to a known core promoter element present in other eukaryotes, the initiator element (Inr). Downstream and flanking the Inr is a highly conserved oomycete promoter region (+7 to + 15), hereafter referred to as FPR (flanking promoter region), which is also important for promoter function. The importance of the 19-nt core promoter region (Inr and FPR) in Piexo1 and Piendo1 was further investigated through electrophoretic mobility shift assays (EMSA). The EMSA studies showed that (i) both core promoters were able to specifically bind a protein or protein complex in a P. infestans whole-cell protein extract and (ii) the same mutations that reduced binding of the EMSA complex also reduced β-glucuronidase (GUS) levels in transient expression assays. The consistency of results obtained using two different assays (GUS transient assays [in vivo] and EMSA studies [in vitro]) supports a convergence of inference about the relative importance of specific nucleotides within the 19-nt core promoter region. PMID:14871940
Newton, K; Jorgensen, NM; Wallace, AJ; Buchanan, DD; Lalloo, F; McMahon, RFT; Hill, J; Evans, DG
2016-01-01
Background & Aims Lynch syndrome patients have DNA mismatch repair deficiency and up to 80% life-time risk of colorectal cancer. Screening of mutation carriers reduces colorectal cancer incidence and mortality. Selection for constitutional mutation testing relies on family history (Amsterdam and Bethesda Guidelines) and tumour derived biomarkers. Initial biomarker analysis uses mismatch repair protein immunohistochemistry and microsatellite instability. Abnormalities in either identify mismatch repair deficiency but do not differentiate sporadic epigenetic defects, due to MLH1 promoter region methylation (13% of CRCs) from Lynch Syndrome (4% of CRCs). A diagnostic biomarker capable of making this distinction would be valuable. This study compared two biomarkers in tumours with mismatch repair deficiency; quantification of methylation of the MLH1 promoter region using a novel assay and BRAF c.1799T>A, p.(Val600Glu) mutation status in the identification of constitutional mutations. Methods Tumour DNA was extracted (FFPE tissue) and pyrosequencing used to test for MLH1 promoter methylation and presence of the BRAF c.1799T>A, p.(Val600Glu) mutation 71 CRCs from individuals with pathogenic MLH1 mutations and 73 CRCs with sporadic MLH1 loss. Specificity and sensitivity was compared. Findings Unmethylated MLH1 promoter: sensitivity 94.4% (95% CI 86.2–98.4%), specificity 87.7% (95% CI 77.9–94.2%), Wild-type BRAF (codon 600): sensitivity 65.8% (95% CI 53.7–76.5%), specificity 98.6% (95% CI 92.4–100.0%) for the identification of those with pathogenic MLH1 mutations. Conclusions Quantitative MLH1 promoter region methylation using pyrosequencing is superior to BRAF codon 600 mutation status in identifying constitutional mutations in mismatch repair deficient tumours. PMID:25280751
Zhang, Zhichun; Tian, Hua; Lv, Ping; Wang, Weiping; Jia, Zhuqing; Wang, Sainan; Zhou, Chunyan; Gao, Xuejun
2015-01-01
Mutation of distal-less homeobox 3 (DLX3) is responsible for human tricho-dento-osseous syndrome (TDO) with amelogenesis imperfecta, indicating a crucial role of DLX3 in amelogenesis. However, the expression pattern of DLX3 and its specific function in amelogenesis remain largely unknown. The aim of this study was to investigate the effects of DLX3 on enamel matrix protein (EMP) genes. By immunohistochemistry assays of mouse tooth germs, stronger immunostaining of DLX3 protein was identified in ameloblasts in the secretory stage than in the pre-secretory and maturation stages, and the same pattern was found for Dlx3 mRNA using Realtime PCR. In a mouse ameloblast cell lineage, forced expression of DLX3 up-regulated the expression of the EMP genes Amelx, Enam, Klk4, and Odam, whereas knockdown of DLX3 down-regulated these four EMP genes. Further, bioinformatics, chromatin immunoprecipitation, and luciferase assays revealed that DLX3 transactivated Enam, Amelx, and Odam through direct binding to their enhancer regions. Particularly, over-expression of mutant-DLX3 (c.571_574delGGGG, responsible for TDO) inhibited the activation function of DLX3 on expression levels and promoter activities of the Enam, Amelx, and Odam genes. Together, our data show that DLX3 promotes the expression of the EMP genes Amelx, Enam, Klk4, and Odam in amelogenesis, while mutant-DLX3 disrupts this regulatory function, thus providing insights into the molecular mechanisms underlying the enamel defects of TDO disease.
Carrara, Paola; Antoninetti, Massimo; Bacai, Hina; Basoni, Anna; Bosc, Christelle; Clave, Magali; Cornacchia, Carmela; L'Astorina, Alba; Monbet, Philippe; Mueller, Bastian; Nicolau, Sonia; Pergola, Nicola; Rampini, Anna; Tramutoli, Valerio; Schumacher, Volker; Wells, Alan; Zepeda Juarez, Jesus; Zolotikova, Svetlana
2013-04-01
which have significant impact on the economy, environment and the quality of life of the citizens To this aim since 2011 the system of Regional Contact Offices (RCOs) was promoted by the EU FP7 DORIS_Net (Downsteam Observatory organized by Regions Active in Space - Network, http://www.doris-net.eu/) project as the regional link to the services provided by the European GMES programme. Since then a first nucleus of 12 pilot European Regions were working together establishing 6 first RCOs around Europe. This paper will present RCOs network goals, achievements and perspectives as well as its planned actions devoted to improve quality of Space Technology products from one side, to promote awareness and use of them by potential end-users (and particularly LRAs), from the other side.
Directory of Open Access Journals (Sweden)
Potrich D.P.
2001-01-01
Full Text Available A 40-kb DNA region containing the major cluster of nif genes has been isolated from the Azospirillum brasilense Sp7 genome. In this region three nif operons have been identified: nifHDKorf1Y, nifENXorf3orf5fdxAnifQ and orf2nifUSVorf4. The operons containing nifENX and nifUSV genes are separated from the structural nifHDKorf1Y operon by about 5 kb and 10 kb, respectively. The present study shows the sequence analysis of the 6045-bp DNA region containing the nifENX genes. The deduced amino acid sequences from the open reading frames were compared to the nif gene products of other diazotrophic bacteria and indicate the presence of seven ORFs, all reading in the same direction as that of the nifHDKorf1Y operon. Consensus sigma54 and NifA-binding sites are present only in the promoter region upstream of the nifE gene. This promoter is activated by NifA protein and is approximately two-times less active than the nifH promoter, as indicated by the ß-galactosidase assays. This result suggests the differential expression of the nif genes and their respective products in Azospirillum.
XTACC3-XMAP215 association reveals an asymmetric interaction promoting microtubule elongation
DEFF Research Database (Denmark)
Mortuza, Gulnahar B; Cavazza, Tommaso; Garcia-Mayoral, Maria Flor
2014-01-01
215 (chTOG), dissecting the mechanism by which their interaction promotes microtubule elongation during spindle assembly. Using SAXS, we show that the TACC domain (TD) is an elongated structure that mediates the interaction with the C terminus of XMAP215. Our data suggest that one TD and two XMAP215...... molecules associate to form a four-helix coiled-coil complex. A hybrid methods approach was used to define the precise regions of the TACC heptad repeat and the XMAP215 C terminus required for assembly and functioning of the complex. We show that XTACC3 can induce the recruitment of larger amounts of XMAP...
Directory of Open Access Journals (Sweden)
Mostafa M Abbas
Full Text Available As the number of sequenced bacterial genomes increases, the need for rapid and reliable tools for the annotation of functional elements (e.g., transcriptional regulatory elements becomes more desirable. Promoters are the key regulatory elements, which recruit the transcriptional machinery through binding to a variety of regulatory proteins (known as sigma factors. The identification of the promoter regions is very challenging because these regions do not adhere to specific sequence patterns or motifs and are difficult to determine experimentally. Machine learning represents a promising and cost-effective approach for computational identification of prokaryotic promoter regions. However, the quality of the predictors depends on several factors including: i training data; ii data representation; iii classification algorithms; iv evaluation procedures. In this work, we create several variants of E. coli promoter data sets and utilize them to experimentally examine the effect of these factors on the predictive performance of E. coli σ70 promoter models. Our results suggest that under some combinations of the first three criteria, a prediction model might perform very well on cross-validation experiments while its performance on independent test data is drastically very poor. This emphasizes the importance of evaluating promoter region predictors using independent test data, which corrects for the over-optimistic performance that might be estimated using the cross-validation procedure. Our analysis of the tested models shows that good prediction models often perform well despite how the non-promoter data was obtained. On the other hand, poor prediction models seems to be more sensitive to the choice of non-promoter sequences. Interestingly, the best performing sequence-based classifiers outperform the best performing structure-based classifiers on both cross-validation and independent test performance evaluation experiments. Finally, we propose a
Directory of Open Access Journals (Sweden)
Susanne Schmeier
2009-01-01
Full Text Available The development of international rivers is often perceived as leading to conflicts or even water wars. However, as the development of the Mekong River shows, cooperation has not only prevailed in the last decades, but River Basin Organizations (RBOs, established to mitigate river-related conflicts and/or develop the river basin, have also contributed to the emergence of more general cooperation structures, mainly by creating spill-over effects in other issue-areas, bringing cooperation to policy fields beyond the river itself. This article assesses the contribution of the Mekong River Commission (MRC and the Greater Mekong Sub-Region (GMS to the sustainable development of the Mekong Region as well as to the promotion of regional cooperation in mainland South-East Asia in general. --- Die Entwicklung grenzüberschreitender Flüsse wird oft mit Konflikten oder gar Kriegen um Wasser assoziiert. Wie jedoch die Entwicklung im Mekong-Becken zeigt, waren die vergangenen Jahrzehnte nicht nur von Kooperation gezeichnet, sondern Flussbeckenorganisationen konnten außerdem dazu beitragen, weitreichendere Kooperationsstrukturen zu entwickeln, die sich auf andere Politikfelder ausdehnen. Dieser Artikel beschäftigt sich mit dem Beitrag der Mekong River Commission (MRC und der Greater Mekong Sub-Region (GMS zur nachhaltigen Entwicklung in der Mekong Region sowie zur Förderung allgemeiner regionaler Kooperation im Festländischen Südostasien.
Nitric oxide synthase-3 promotes embryonic development of atrioventricular valves.
Directory of Open Access Journals (Sweden)
Yin Liu
Full Text Available Nitric oxide synthase-3 (NOS3 has recently been shown to promote endothelial-to-mesenchymal transition (EndMT in the developing atrioventricular (AV canal. The present study was aimed to investigate the role of NOS3 in embryonic development of AV valves. We hypothesized that NOS3 promotes embryonic development of AV valves via EndMT. To test this hypothesis, morphological and functional analysis of AV valves were performed in wild-type (WT and NOS3(-/- mice at postnatal day 0. Our data show that the overall size and length of mitral and tricuspid valves were decreased in NOS3(-/- compared with WT mice. Echocardiographic assessment showed significant regurgitation of mitral and tricuspid valves during systole in NOS3(-/- mice. These phenotypes were all rescued by cardiac specific NOS3 overexpression. To assess EndMT, immunostaining of Snail1 was performed in the embryonic heart. Both total mesenchymal and Snail1(+ cells in the AV cushion were decreased in NOS3(-/- compared with WT mice at E10.5 and E12.5, which was completely restored by cardiac specific NOS3 overexpression. In cultured embryonic hearts, NOS3 promoted transforming growth factor (TGFβ, bone morphogenetic protein (BMP2 and Snail1expression through cGMP. Furthermore, mesenchymal cell formation and migration from cultured AV cushion explants were decreased in the NOS3(-/- compared with WT mice. We conclude that NOS3 promotes AV valve formation during embryonic heart development and deficiency in NOS3 results in AV valve insufficiency.
Directory of Open Access Journals (Sweden)
Marcela Vyletělová
2010-01-01
Full Text Available Determination of enterotoxin production, diarrhoeal and emetic gene identification was studied in 41 Bacillus cereus strains isolated from raw cows’ and raw goats’ milk, pasteurized milk, dairy products during technological processing and from dairy plant equipment. Presence of enterotoxins was detected by BCET-RPLA (HBL and ELISA immunoassay (NHE. Gene identification (nheA, nheB, nheC, hblA, hblC, hblD, bceT, cytK-1, cytK-2, entFM and ces was achieved by means of PCR. Enterotoxin HBL was detected in 32 strains, enterotoxin NHE in all 41 strains. Presence of all three genes nheA, nheB and nheC was confirmed in 40 strains and genes hblA, hblC and hblD in 29 strains. Comparison of used methods was as follow: 1 BCET-RPLA (which detects L2 component and PCR (positive or negative all three hblA, hblC and hblD gene detection were identical in 30 (73%; 2 ELISA (NheA and PCR (all three nheC, nheB and nheA gene expression were identical in 40 (98% cases isolated strains.
Directory of Open Access Journals (Sweden)
J Stephen Dumler
2016-09-01
Full Text Available Anaplasma phagocytophilum, an obligate intracellular prokaryote, infects neutrophils and alters cardinal functions via reprogrammed transcription. Large contiguous regions of neutrophil chromosomes are differentially expressed during infection. Secreted A. phagocytophilum effector AnkA transits into the neutrophil or granulocyte nucleus to complex with DNA in heterochromatin across all chromosomes. AnkA binds to gene promoters to dampen cis-transcription and also has features of matrix attachment region (MAR-binding proteins that regulate three-dimensional chromatin architecture and coordinate transcriptional programs encoded in topologically-associated chromatin domains. We hypothesize that identification of additional AnkA binding sites will better delineate how A. phagocytophilum infection results in reprogramming of the neutrophil genome. Using AnkA-binding ChIP-seq, we showed that AnkA binds broadly throughout all chromosomes in a reproducible pattern, especially at: i intergenic regions predicted to be matrix attachment regions (MARs; ii within predicted lamina-associated domains; and iii at promoters ≤3,000 bp upstream of transcriptional start sites. These findings provide genome-wide support for AnkA as a regulator of cis-gene transcription. Moreover, the dominant mark of AnkA in distal intergenic regions known to be AT-enriched, coupled with frequent enrichment in the nuclear lamina, provides strong support for its role as a MAR-binding protein and genome re-organizer. AnkA must be considered a prime candidate to promote neutrophil reprogramming and subsequent functional changes that belie improved microbial fitness and pathogenicity.
Directory of Open Access Journals (Sweden)
Min Ju Yi
2017-03-01
Full Text Available PurposeThe most common single nucleotide polymorphism in the IGFBP3 promoter region occurs at position -202. This polymorphic variation occurs frequently and may influence growth hormone responsiveness and somatic growth. However, the effects of IGFBP3 promoter polymorphism on growth in children are unknown.MethodsRestriction fragment length polymorphism-based genotyping of the -202 single nucleotide polymorphism was performed in 146 Korean girls aged between 15 and 16 years, who were selected randomly from the Seoul School Health Promotion Center. The participants were divided into 3 groups (tall, medium, and short according to the height percentile established from normal reference values for Korean children. The serum levels of insulin-like growth factor I (IGF-I and IGF-binding protein-3 (IGFBP-3 were then compared according to genotype.ResultsThe genotype distribution in the participants was 79 AA (54.1%, 60 AC (41.1%, and 7 CC (4.8%. The C allele frequency at the -202 IGFBP3 position was 25.4% in this group. The mean serum IGFBP-3 concentration in girls with the AA genotype was higher than that in girls with the AC genotype in the medium (P=0.047 and short (P=0.035 groups, respectively. There was no difference in the IGF-I to IGFBP-3 molar ratio between the AA and AC genotype groups (P=0.161.ConclusionIn conclusion, the -202 polymorphism in the IGFBP3 promoter region is assumed to affect the serum concentration of IGFBP-3 in children as well as in adults. However, it is unclear whether this affects physical development according to the concentration of IGFBP-3.
National Research Council Canada - National Science Library
Carpenter, Steven
1997-01-01
This study provides retrospective market research information about the population who enrolled in TRICARE Prime in TRICARE Region 11 and the advertising mediums used to promote enrollment in the TRICARE Prime program...
Directory of Open Access Journals (Sweden)
Zhichun Zhang
Full Text Available Mutation of distal-less homeobox 3 (DLX3 is responsible for human tricho-dento-osseous syndrome (TDO with amelogenesis imperfecta, indicating a crucial role of DLX3 in amelogenesis. However, the expression pattern of DLX3 and its specific function in amelogenesis remain largely unknown. The aim of this study was to investigate the effects of DLX3 on enamel matrix protein (EMP genes. By immunohistochemistry assays of mouse tooth germs, stronger immunostaining of DLX3 protein was identified in ameloblasts in the secretory stage than in the pre-secretory and maturation stages, and the same pattern was found for Dlx3 mRNA using Realtime PCR. In a mouse ameloblast cell lineage, forced expression of DLX3 up-regulated the expression of the EMP genes Amelx, Enam, Klk4, and Odam, whereas knockdown of DLX3 down-regulated these four EMP genes. Further, bioinformatics, chromatin immunoprecipitation, and luciferase assays revealed that DLX3 transactivated Enam, Amelx, and Odam through direct binding to their enhancer regions. Particularly, over-expression of mutant-DLX3 (c.571_574delGGGG, responsible for TDO inhibited the activation function of DLX3 on expression levels and promoter activities of the Enam, Amelx, and Odam genes. Together, our data show that DLX3 promotes the expression of the EMP genes Amelx, Enam, Klk4, and Odam in amelogenesis, while mutant-DLX3 disrupts this regulatory function, thus providing insights into the molecular mechanisms underlying the enamel defects of TDO disease.
Lovell, Ric; Siegler, Jason C; Knox, Michael; Brennan, Scott; Marshall, Paul W M
2016-12-01
The optimal scheduling of Nordic Hamstring exercises (NHEs) relative to football training sessions is unknown. We examined the acute neuromuscular and performance responses to NHE undertaken either before (BT) or after (AT) simulated football training. Twelve amateur players performed six sets of five repetitions of the NHE either before or after 60 min of standardised football-specific exercise (SAFT 60 ). Surface electromyography signals (EMG) of the hamstring muscles were recorded during both the NHE, and maximum eccentric actions of the knee flexors (0.52 rad · s -1 ) performed before and after the NHE programme, and at 15 min intervals during SAFT 60 . Ten-metre sprint times were recorded on three occasions during each 15 min SAFT 60 segment. Greater eccentric hamstring fatigue following the NHE programme was observed in BT versus AT (19.8 %; very likely small effect), which was particularly apparent in the latter range of knee flexion (0-15°; 39.6%; likely moderate effect), and synonymous with hamstring EMG declines (likely small-likely moderate effects). Performing NHE BT attenuated sprint performance declines (2.0-3.2%; likely small effects), but decreased eccentric hamstring peak torque (-14.1 to -18.9%; likely small effects) during football-specific exercise. Performing NHE prior to football training reduces eccentric hamstring strength and may exacerbate hamstring injury risk.
7 CFR 2610.3 - Regional organization.
2010-01-01
... 7 Agriculture 15 2010-01-01 2010-01-01 false Regional organization. 2610.3 Section 2610.3 Agriculture Regulations of the Department of Agriculture (Continued) OFFICE OF INSPECTOR GENERAL, DEPARTMENT OF AGRICULTURE ORGANIZATION, FUNCTIONS, AND DELEGATIONS OF AUTHORITY § 2610.3 Regional organization...
Flow cytometric kinetic assay of the activity of Na+/H+ antiporter in mammalian cells.
Dolz, María; O'Connor, José-Enrique; Lequerica, Juan L
2004-10-01
The Na(+)/H(+) exchanger (NHE) of mammalian cells is an integral membrane protein that extrudes H(+) ion in exchange for extracellular Na(+) and plays a crucial role in the regulation of intracellular pH (pHi). Thus, when pHi is lowered, NHE extrudes protons at a rate depending of pHi that can be expressed as pH units/s. To abolish the activity of other cellular pH-restoring systems, cells were incubated in bicarbonate-free Dulbecco's modified Eagle's medium buffered with HEPES. Flow cytometry was used to determine pHi with 2',7'-bis-(2-carboxyethyl)-5-(and-6)-carboxyfluorescein acetoxymethyl ester or 5-(and-6)-carboxy SNARF-1 acetoxymethyl ester acetate, and the appropriate fluorescence ratios were measured. The calibration of fluorescence ratios versus pHi was established by using ionophore nigericin. The activity of NHE was calculated by a kinetic flow cytometric assay as the slope at time 0 of the best-fit curve of pHi recovery versus time after intracellular acidification with a pulse of exogenous sodium propionate. The kinetic method allowed determination of the pHi-dependent activity of NHE in cell lines and primary cell cultures. NHE activity values were demonstrated to be up to 0.016 pH units/s within the pHi range of 7.3 to 6.3. The inhibition of NHE activity by the specific inhibitor ethyl isopropyl amiloride was easily detected by this method. The assay conditions can be used to relate variations in pHi with the activity of NHE and provide a standardized method to compare between different cells, inhibitors, models of ischemia by acidification, and other relevant experimental or clinical situations.
Banerjee, Joydeep; Sahoo, Dipak Kumar; Dey, Nrisingha; Houtz, Robert L.; Maiti, Indu Bhushan
2013-01-01
On chromosome 4 in the Arabidopsis genome, two neighboring genes (calmodulin methyl transferase At4g35987 and senescence associated gene At4g35985) are located in a head-to-head divergent orientation sharing a putative bidirectional promoter. This 1258 bp intergenic region contains a number of environmental stress responsive and tissue specific cis-regulatory elements. Transcript analysis of At4g35985 and At4g35987 genes by quantitative real time PCR showed tissue specific and stress inducible expression profiles. We tested the bidirectional promoter-function of the intergenic region shared by the divergent genes At4g35985 and At4g35987 using two reporter genes (GFP and GUS) in both orientations in transient tobacco protoplast and Agro-infiltration assays, as well as in stably transformed transgenic Arabidopsis and tobacco plants. In transient assays with GFP and GUS reporter genes the At4g35985 promoter (P85) showed stronger expression (about 3.5 fold) compared to the At4g35987 promoter (P87). The tissue specific as well as stress responsive functional nature of the bidirectional promoter was evaluated in independent transgenic Arabidopsis and tobacco lines. Expression of P85 activity was detected in the midrib of leaves, leaf trichomes, apical meristemic regions, throughout the root, lateral roots and flowers. The expression of P87 was observed in leaf-tip, hydathodes, apical meristem, root tips, emerging lateral root tips, root stele region and in floral tissues. The bidirectional promoter in both orientations shows differential up-regulation (2.5 to 3 fold) under salt stress. Use of such regulatory elements of bidirectional promoters showing spatial and stress inducible promoter-functions in heterologous system might be an important tool for plant biotechnology and gene stacking applications. PMID:24260266
Directory of Open Access Journals (Sweden)
Joydeep Banerjee
Full Text Available On chromosome 4 in the Arabidopsis genome, two neighboring genes (calmodulin methyl transferase At4g35987 and senescence associated gene At4g35985 are located in a head-to-head divergent orientation sharing a putative bidirectional promoter. This 1258 bp intergenic region contains a number of environmental stress responsive and tissue specific cis-regulatory elements. Transcript analysis of At4g35985 and At4g35987 genes by quantitative real time PCR showed tissue specific and stress inducible expression profiles. We tested the bidirectional promoter-function of the intergenic region shared by the divergent genes At4g35985 and At4g35987 using two reporter genes (GFP and GUS in both orientations in transient tobacco protoplast and Agro-infiltration assays, as well as in stably transformed transgenic Arabidopsis and tobacco plants. In transient assays with GFP and GUS reporter genes the At4g35985 promoter (P85 showed stronger expression (about 3.5 fold compared to the At4g35987 promoter (P87. The tissue specific as well as stress responsive functional nature of the bidirectional promoter was evaluated in independent transgenic Arabidopsis and tobacco lines. Expression of P85 activity was detected in the midrib of leaves, leaf trichomes, apical meristemic regions, throughout the root, lateral roots and flowers. The expression of P87 was observed in leaf-tip, hydathodes, apical meristem, root tips, emerging lateral root tips, root stele region and in floral tissues. The bidirectional promoter in both orientations shows differential up-regulation (2.5 to 3 fold under salt stress. Use of such regulatory elements of bidirectional promoters showing spatial and stress inducible promoter-functions in heterologous system might be an important tool for plant biotechnology and gene stacking applications.
Covalent Modifications of Histone H3K9 Promote Binding of CHD3
Directory of Open Access Journals (Sweden)
Adam H. Tencer
2017-10-01
Full Text Available Chromatin remodeling is required for genome function and is facilitated by ATP-dependent complexes, such as nucleosome remodeling and deacetylase (NuRD. Among its core components is the chromodomain helicase DNA binding protein 3 (CHD3 whose functional significance is not well established. Here, we show that CHD3 co-localizes with the other NuRD subunits, including HDAC1, near the H3K9ac-enriched promoters of the NuRD target genes. The tandem PHD fingers of CHD3 bind histone H3 tails and posttranslational modifications that increase hydrophobicity of H3K9—methylation or acetylation (H3K9me3 or H3K9ac—enhance this interaction. Binding of CHD3 PHDs promotes H3K9Cme3-nucleosome unwrapping in vitro and perturbs the pericentric heterochromatin structure in vivo. Methylation or acetylation of H3K9 uniquely alleviates the intra-nucleosomal interaction of histone H3 tails, increasing H3K9 accessibility. Collectively, our data suggest that the targeting of covalently modified H3K9 by CHD3 might be essential in diverse functions of NuRD.
International Nuclear Information System (INIS)
Apostolaki, Angeliki; Kalosakas, George
2011-01-01
We mapped promoter regions of double-stranded DNA with respect to the probabilities of appearance of relatively large bubble openings exclusively due to thermal fluctuations at physiological temperatures. We analyzed five well-studied promoter regions of procaryotic type and found a spatial correlation between the binding sites of transcription factors and the position of peaks in the probability pattern of large thermal openings. Other distinct peaks of the calculated patterns correlate with potential binding sites of DNA-binding proteins. These results suggest that a DNA molecule would more frequently expose the bases that participate in contacts with proteins, which would probably enhance the probability of the latter to reach their targets. It also stands for using this method as a means to analyze DNA sequences based on their intrinsic thermal properties
Cooper, Christopher A.; Wilson, Jonathan M.
2013-01-01
Rhesus (Rh) glycoproteins are ammonia gas (NH3) channels known to be involved in ammonia transport in animals. Because of the different osmoregulatory and ionoregulatory challenges faced by teleost fishes in marine and freshwater (FW) environments, we hypothesized that ammonia excretion strategies would differ between environments. Also, we hypothesized that cutaneous NH3 volatilization in air-acclimated fish is facilitated by base secretion. To test these hypotheses, we used the skin of the euryhaline amphibious mangrove rivulus (Kryptolebias marmoratus). The skin excretes ammonia and expresses Rh glycoproteins. Serosal-to-mucosal cutaneous ammonia flux was saturable (0–16 mmol/l ammonia, Km of 6.42 mmol/l). In FW, ammonia excretion increased in response to low mucosal pH but decreased with pharmacological inhibition of Na+/H+ exchangers (NHE) and H+ ATPase. Conversely, in brackish water (BW), lowering the mucosal pH significantly decreased ammonia excretion. Inhibitors of NHE also decreased ammonia excretion in BW fish. Immunofluorescence microscopy demonstrated that both the Rh isoform, Rhcg1, and NHE3 proteins colocalized in Na+/K+ ATPase expressing mitochondrion-rich cells in the gills, kidney, and skin. We propose that the mechanisms of cutaneous ammonia excretion in FW K. marmoratus are consistent with the model for branchial ammonia excretion in FW teleost fish. NH4+ excretion appeared to play a stronger role in BW. NH4+ excretion in BW may be facilitated by apical NHE and/or diffuse through paracellular pathways. In aerially acclimated fish, inhibition of NHE and H+ ATPase, but not the Cl−/HCO3− exchanger, significantly affected cutaneous surface pH, suggesting that direct base excretion is not critical for NH3 volatilization. Overall, K. marmoratus use different strategies for excreting ammonia in three different environments, FW, BW, and air, and Rh glycoproteins and NHE are integral to all. PMID:23389109
Directory of Open Access Journals (Sweden)
Lu Ying
2004-04-01
Full Text Available Abstract Background TGM1(transglutaminase 1 is an enzyme that crosslinks the cornified envelope of mature keratinocytes. Appropriate expression of the TGM1 gene is crucial for proper keratinocyte function as inactivating mutations lead to the debilitating skin disease, lamellar ichthyosis. TGM1 is also expressed in squamous metaplasia, a consequence in some epithelia of vitamin A deficiency or toxic insult that can lead to neoplasia. An understanding of the regulation of this gene in normal and abnormal differentiation states may contribute to better disease diagnosis and treatment. Methods In vivo requirements for expression of the TGM1 gene were studied by fusing various lengths of promoter DNA to a reporter and injecting the DNA into mouse embryos to generate transgenic animals. Expression of the reporter was ascertained by Western blotting and immunohistochemistry. Further delineation of a transcriptionally important distal region was determined by transfections of progressively shortened or mutated promoter DNA into cultured keratinocytes. Results In vivo analysis of a reporter transgene driven by the TGM1 promoter revealed that 1.6 kilobases, but not 1.1 kilobases, of DNA was sufficient to confer tissue-specific and cell layer-specific expression. This same region was responsible for reporter expression in tissues undergoing squamous metaplasia as a response to vitamin A deprivation. Mutation of a distal promoter AP1 site or proximal promoter CRE site, both identified as important transcriptional elements in transfection assays, did not prevent appropriate expression. Further searching for transcriptional elements using electrophoretic mobility shift (EMSA and transfection assays in cultured keratinocytes identified two Sp1 elements in a transcriptionally active region between -1.6 and -1.4 kilobases. While mutation of either Sp1 site or the AP1 site singly had only a small effect, mutation of all three sites eliminated nearly all the
APOBEC3 cytidine deaminases in double-strand DNA break repair and cancer promotion.
Nowarski, Roni; Kotler, Moshe
2013-06-15
High frequency of cytidine to thymidine conversions was identified in the genome of several types of cancer cells. In breast cancer cells, these mutations are clustered in long DNA regions associated with single-strand DNA (ssDNA), double-strand DNA breaks (DSB), and genomic rearrangements. The observed mutational pattern resembles the deamination signature of cytidine to uridine carried out by members of the APOBEC3 family of cellular deaminases. Consistently, APOBEC3B (A3B) was recently identified as the mutational source in breast cancer cells. A3G is another member of the cytidine deaminases family predominantly expressed in lymphoma cells, where it is involved in mutational DSB repair following ionizing radiation treatments. This activity provides us with a new paradigm for cancer cell survival and tumor promotion and a mechanistic link between ssDNA, DSBs, and clustered mutations. Cancer Res; 73(12); 3494-8. ©2013 AACR. ©2013 AACR.
Stains, Joseph P.; Lecanda, Fernando; Screen, Joanne; Towler, Dwight A.; Civitelli, Roberto
2003-01-01
Loss-of-function mutations of gap junction proteins, connexins, represent a mechanism of disease in a variety of tissues. We have shown that recessive (gene deletion) or dominant (connexin45 overexpression) disruption of connexin43 function results in osteoblast dysfunction and abnormal expression of osteoblast genes, including down-regulation of osteocalcin transcription. To elucidate the molecular mechanisms of gap junction-sensitive transcriptional regulation, we systematically analyzed the rat osteocalcin promoter for sensitivity to gap junctional intercellular communication. We identified an Sp1/Sp3 containing complex that assembles on a minimal element in the -70 to -57 region of the osteocalcin promoter in a gap junction-dependent manner. This CT-rich connexin-response element is necessary and sufficient to confer gap junction sensitivity to the osteocalcin proximal promoter. Repression of osteocalcin transcription occurs as a result of displacement of the stimulatory Sp1 by the inhibitory Sp3 on the promoter when gap junctional communication is perturbed. Modulation of Sp1/Sp3 recruitment also occurs on the collagen Ialpha1 promoter and translates into gap junction-sensitive transcriptional control of collagen Ialpha1 gene expression. Thus, regulation of Sp1/Sp3 recruitment to the promoter may represent a potential general mechanism for transcriptional control of target genes by signals passing through gap junctions.
Directory of Open Access Journals (Sweden)
James Dollman
2016-01-01
Full Text Available Rural Australians are less physically active than their metropolitan counterparts, and yet very little is known of the candidate intervention targets for promoting physical activity in rural populations. As rural regions are economically, socially and environmentally diverse, drivers of regular physical activity are likely to vary between regions. This study explored the region-specific correlates of daily walking among middle age and older adults in rural regions with contrasting dominant primary industries. Participants were recruited through print and electronic media, primary care settings and community organisations. Pedometers were worn by 153 adults for at least four days, including a weekend day. A questionnaire identified potential intra-personal, social and environmental correlates of physical activity, according to a social ecological framework. Regression modelling identified independent correlates of daily walking separately in the two study regions. In one region, there were independent correlates of walking from all levels of the social ecological framework. In the other region, significant correlates of daily walking were almost all demographic (age, education and marital status. Participants living alone were less likely to be physically active regardless of region. This study highlights the importance of considering region-specific factors when designing strategies for promoting regular walking among rural adults.
Viral Vector-Based Dissection of Marmoset GFAP Promoter in Mouse and Marmoset Brains.
Directory of Open Access Journals (Sweden)
Yoichiro Shinohara
Full Text Available Adeno-associated virus (AAV vectors are small in diameter, diffuse easily in the brain, and represent a highly efficient means by which to transfer a transgene to the brain of a large animal. A major demerit of AAV vectors is their limited accommodation capacity for transgenes. Thus, a compact promoter is useful when delivering large transgenes via AAV vectors. In the present study, we aimed to identify the shortest astrocyte-specific GFAP promoter region that could be used for AAV-vector-mediated transgene expression in the marmoset brain. The 2.0-kb promoter region upstream of the GFAP gene was cloned from the marmoset genome, and short promoters (1.6 kb, 1.4 kb, 0.6 kb, 0.3 kb and 0.2 kb were obtained by progressively deleting the original 2.0-kb promoter from the 5' end. The short promoters were screened in the mouse cerebellum in terms of their strength and astrocyte specificity. We found that the 0.3-kb promoter maintained 40% of the strength of the original 2.0-kb promoter, and approximately 90% of its astrocyte specificity. These properties were superior to those of the 1.4-kb, 0.6-kb (20% promoter strength and 0.2-kb (70% astrocyte specificity promoters. Then, we verified whether the 0.3-kb GFAP promoter retained astrocyte specificity in the marmoset cerebral cortex. Injection of viral vectors carrying the 0.3-kb marmoset GFAP promoter specifically transduced astrocytes in both the cerebral cortex and cerebellar cortex of the marmoset. These results suggest that the compact 0.3-kb promoter region serves as an astrocyte-specific promoter in the marmoset brain, which permits us to express a large gene by AAV vectors that have a limited accommodation capacity.
International Nuclear Information System (INIS)
Zhou Meijuan; Zheng Li; Ding Zhenhua
2004-01-01
Objective: To study the effect of natural hot environment (NHE) on survival and peripheral blood lymphocytes in γ-irradiated in mice. Methods: After γ-irradiation at the dosage of 6.5 or 9.0 Gy, the mice were exposed to NHE for 0, 3, 6, 9 h or 30 days. After exposure to NHE, mice of the 6 h and 9 h groups, were then bred at room temperature. The survival and peripheral blood lymphocytes were observed for 30 days. Results: There were obvious differences in survival time between the groups that were exposed to NHE for 9 h and 30 d and that of the 0 h group, the mice of these three groups having been irradiated with 6.5 Gy. For 9.0 Gy-irradiated mice, the survival times of the 6, 9 h and 30 d groups were all significantly shorter than that of the 0 h group. The descending rate of peripheral blood lymphocytes in 0 h group is smaller than that of all NHE groups. There was no lymphocyte fluctuate resuscitation in all NHE groups as seen in the 0 h group. Conclusion: There is a significant decrease of survival indexes and a faster descending rate of peripheral blood lymphocytes in mice exposed to after γ-irradiation. (authors)
Engineered Promoters for Potent Transient Overexpression.
Directory of Open Access Journals (Sweden)
Dan Y Even
Full Text Available The core promoter, which is generally defined as the region to which RNA Polymerase II is recruited to initiate transcription, plays a pivotal role in the regulation of gene expression. The core promoter consists of different combinations of several short DNA sequences, termed core promoter elements or motifs, which confer specific functional properties to each promoter. Earlier studies that examined the ability to modulate gene expression levels via the core promoter, led to the design of strong synthetic core promoters, which combine different core elements into a single core promoter. Here, we designed a new core promoter, termed super core promoter 3 (SCP3, which combines four core promoter elements (the TATA box, Inr, MTE and DPE into a single promoter that drives prolonged and potent gene expression. We analyzed the effect of core promoter architecture on the temporal dynamics of reporter gene expression by engineering EGFP expression vectors that are driven by distinct core promoters. We used live cell imaging and flow cytometric analyses in different human cell lines to demonstrate that SCPs, particularly the novel SCP3, drive unusually strong long-term EGFP expression. Importantly, this is the first demonstration of long-term expression in transiently transfected mammalian cells, indicating that engineered core promoters can provide a novel non-viral strategy for biotechnological as well as gene-therapy-related applications that require potent expression for extended time periods.
Mohammadpur, Ahmad; Rezaei, Mehdi; Sadeghi, Rasoul
2010-05-14
The aim of this qualitative study is to explore the way people using modern health care perceive its consequences in Ouraman-e-Takht region of Iranian Kurdistan. Ouraman-e-Takht is a rural, highly mountainous and dry region located in the southwest Kurdistan province of Iran. Recently, modern health practices have been introduced to the region. The purpose of this study was to investigate, from the Ouramains' point of view, the impact that modern health services and practices have had on the Ouraman traditional way of life. Interview data from respondents were analyzed by using grounded theory. Promoting survival was the core category that explained the impact that modern health practices have had on the Ouraman region. The people of Ouraman interpreted modern health practices as increasing their quality of life and promoting their survival. Results are organized around this core category in a paradigm model consisting of conditions, interactions, and consequences. This model can be used to understand the impact of change from the introduction of modern health on a traditional society.
Mohammadpur, Ahmad; Rezaei, Mehdi; Sadeghi, Rasoul
2010-01-01
The aim of this qualitative study is to explore the way people using modern health care perceive its consequences in Ouraman-e-Takht region of Iranian Kurdistan. Ouraman-e-Takht is a rural, highly mountainous and dry region located in the southwest Kurdistan province of Iran. Recently, modern health practices have been introduced to the region. The purpose of this study was to investigate, from the Ouramains' point of view, the impact that modern health services and practices have had on the Ouraman traditional way of life. Interview data from respondents were analyzed by using grounded theory. Promoting survival was the core category that explained the impact that modern health practices have had on the Ouraman region. The people of Ouraman interpreted modern health practices as increasing their quality of life and promoting their survival. Results are organized around this core category in a paradigm model consisting of conditions, interactions, and consequences. This model can be used to understand the impact of change from the introduction of modern health on a traditional society. PMID:20640020
Gel shift analysis of the empA promoter region in Vibrio anguillarum
Directory of Open Access Journals (Sweden)
Denkin Steven M
2004-10-01
Full Text Available Abstract Background The induction of metalloprotease encoded by empA in Vibrio anguillarum occurs at high cell density in salmon intestinal mucus. Previously we have shown that there are significant differences in empA expression in two strains of V. anguillarum, M93Sm and NB10. It is hypothesized that differences in empA regulation are due to differences in binding of regulatory elements. Results Two strains of V. anguillarum, M93Sm and NB10, were examined and compared for the presence of DNA regulatory proteins that bind to and control the empA promoter region. Gel mobility shift assays, using a digoxigenin (DIG-labeled oligomer containing a lux box-like element and the promoter for empA, were done to demonstrate the presence of a DNA-binding protein. Protein extracts from NB10 cells incubated in Luria Bertani broth + 2% NaCl (LB20, nine salts solution + 200 μg/ml mucus (NSSM, 3M (marine minimal medium, or NSS resulted in a gel mobility shift. No gel mobility shift was seen when protein extracts from either LB20- or NSSM-grown M93Sm cells were mixed with the DIG-labeled empA oligomer. The azocasein assay detected protease activity in all incubation conditions for NB10 culture supernatants. In contrast, protease activity was detected in M93Sm culture supernatants only when incubated in NSSM. Since the luxR homologue in V. anguillarum, vanT, has been cloned, sequenced, and shown to be required for protease activity, we wanted to determine if vanT mutants of NB10 exhibit the same gel shift observed in the wild-type. Site-directed mutagenesis was used to create vanT mutants in V. anguillarum M93Sm and NB10 to test whether VanT is involved with the gel mobility shift. Both vanT mutants, M02 and NB02, did not produce protease activity in any conditions. However, protein extracts from NB02 incubated in each condition still exhibited a gel shift when mixed with the DIG-labeled empA oligomer. Conclusions The data demonstrate that protein extracts of V
Xie, Xing-Bin; Li, Shen; Zhang, Rui-Fen; Zhao, Jing; Chen, Ying-Chun; Zhao, Qiang; Yao, Yu-Xin; You, Chun-Xiang; Zhang, Xian-Sheng; Hao, Yu-Jin
2012-11-01
Low environmental temperatures promote anthocyanin accumulation and fruit colouration by up-regulating the expression of genes involved in anthocyanin biosynthesis and regulation in many fruit trees. However, the molecular mechanism by which fruit trees regulate this process in response to low temperature (LT) remains largely unknown. In this study, the cold-induced bHLH transcription factor gene MdbHLH3 was isolated from an apple tree and was found to interact physically and specifically through two regions (amino acids 1-23 and 186-228) at the N terminus with the MYB partner MdMYB1 (allelic to MdMYB10). Subsequently, MdbHLH3 bound to the promoters of the anthocyanin biosynthesis genes MdDFR and MdUFGT and the regulatory gene MdMYB1 to activate their expression. Furthermore, the MdbHLH3 protein was post-translationally modified, possibly involving phosphorylation following exposure to LTs, which enhanced its promoter-binding capacity and transcription activity. Our results demonstrate the molecular mechanism by which MdbHLH3 regulates LT-induced anthocyanin accumulation and fruit colouration in apple. © 2012 Blackwell Publishing Ltd.
International Nuclear Information System (INIS)
Abe, Hajime; Ogawa, Takashi; Wang, Liyun; Kimura, Masayuki; Tanaka, Takeshi; Morita, Reiko; Yoshida, Toshinori; Shibutani, Makoto
2014-01-01
Thioacetamide (TAA) has been used to develop a rodent model for hepatocarcinogenesis. To determine the genes with epigenetic modifications in early hepatocarcinogenesis, we did a genome-wide scan for hypermethylated promoter regions using CpG island microarrays in TAA-promoted rat liver tissue. Eight genes were selected based on the microarray profile; of these, Yy1 and Wdr45b were confirmed to be hypermethylated by methylation-specific polymerase chain reaction (PCR) and pyrosequencing and downregulated by real-time reverse transcription PCR. Non-neoplastic liver cells had nuclear Yy1 immunoreactivity, while preneoplastic foci with glutathione S-transferase placental form (GST-P) immunoreactivity had decreased Yy1 immunoreactivity. The incidence of these foci was proportional to the dose of TAA administered. Co-expression analysis of gene products downstream of Yy1 revealed increased nuclear phospho-c-Myc + foci as well as nuclear and cytoplasmic p21 Cip1+ foci in Yy1 − or GST-P + foci in response to TAA-promotion dose. Although the absolute number of cells was low, the incidence of death receptor 5 − foci was increased in Yy1 − foci in proportion to the TAA dose. Yy1 − /GST-P + foci revealed a higher number of proliferating cell nuclear antigen (PCNA)-immunoreactive cells than Yy1 + /GST-P + foci, while cleaved caspase-3 + cells were unchanged between Yy1 – /GST-P + and Yy1 + /GST-P + foci. In the case of Wdr45b, most GST-P + foci were Wdr45b – and were not increased by TAA promotion. These results suggest involvement of Yy1 in the epigenetic gene regulation at the early stages of TAA promoted cell proliferation and concomitant cell cycle arrest in preneoplastic lesions. - Highlights: • Epigenetically downregulated genes were searched in TAA-promnoted rat livers. • Yy1 and Wdr45b showed promoter-region hypermethylation and mRNA downregulation. • TAA promoted increase of preneoplastic Yy1 – /GST-P + foci showing high proliferation. • TAA
Rivera-Juarez, Maria de Los Angeles; Rosas-Murrieta, Nora Hilda; Mendieta-Carmona, Victoriano; Hernandez-Pacheco, Raquel Esneidy; Zamora-Ginez, Irma; Rodea-Avila, Carlos; Apresa-Garcia, Teresa; Garay-Villar, Onix; Aguilar-Lemarroy, Adriana; Jave-Suarez, Luis Felipe; Diaz-Orea, Maria Alicia; Milflores-Flores, Lorena; Reyes-Salinas, Juan Salvador; Ceja-Utrera, Francisco Javier; Vazquez-Zamora, Victor Javier; Vargas-Maldonado, Tomas; Reyes-Carmona, Sandra; Sosa-Jurado, Francisca; Santos-Lopez, Gerardo; Reyes-Leyva, Julio; Vallejo-Ruiz, Veronica
2014-01-01
Sialyltransferase gene expression is altered in several cancers, including examples in the cervix. Transcriptional regulation of the responsible genes depends on different promoters. We aimed to determine the association of single-nucleotide polymorphisms in the B3 promoter of the ST3GAL4 gene and the P1 promoter of the ST6GAL1 gene with cervical premalignant lesions or cervical cancer. A blood sample and/or cervical scrapes were obtained from 104 women with normal cytology, 154 with premalignant lesions and 100 with cervical cancer. We also included 119 blood samples of random donors. The polymorphisms were identified by sequencing from PCR products. For the B3 promoter, a fragment of 506 bp (from nucleotide -408 to +98) was analyzed, and for the P1 promoter a 490 bp (-326 to +164) fragment. The polymorphism analysis showed that at SNP rs10893506, genotypes CC and CT of the ST3GAL4 B3 promoter were associated with the presence of premalignant lesions (OR=2.89; 95%CI 1.72-4.85) and cervical cancer (OR=2.23; 95%CI 1.27-3.91). We detected only one allele of each polymorphism in the ST6GAL1 P1 promoter. We did not detect any genetic variability in the P1 promoter region in our study population. Our results suggest that the rs10893506 polymorphism -22C/T may increase susceptibility to premalignant and malignant lesions of the cervix.
Hyder, S M; Stancel, G M; Nawaz, Z; McDonnell, D P; Loose-Mitchell, D S
1992-09-05
We have used transient transfection assays with reporter plasmids expressing chloramphenicol acetyltransferase, linked to regions of mouse c-fos, to identify a specific estrogen response element (ERE) in this protooncogene. This element is located in the untranslated 3'-flanking region of the c-fos gene, 5 kilobases (kb) downstream from the c-fos promoter and 1.5 kb downstream of the poly(A) signal. This element confers estrogen responsiveness to chloramphenicol acetyltransferase reporters linked to both the herpes simplex virus thymidine kinase promoter and the homologous c-fos promoter. Deletion analysis localized the response element to a 200-base pair fragment which contains the element GGTCACCACAGCC that resembles the consensus ERE sequence GGTCACAGTGACC originally identified in Xenopus vitellogenin A2 gene. A synthetic 36-base pair oligodeoxynucleotide containing this c-fos sequence conferred estrogen inducibility to the thymidine kinase promoter. The corresponding sequence also induced reporter activity when present in the c-fos gene fragment 3 kb from the thymidine kinase promoter. Gel-shift experiments demonstrated that synthetic oligonucleotides containing either the consensus ERE or the c-fos element bind human estrogen receptor obtained from a yeast expression system. However, the mobility of the shifted band is faster for the fos-ERE-complex than the consensus ERE complex suggesting that the three-dimensional structure of the protein-DNA complexes is different or that other factors are differentially involved in the two reactions. When the 5'-GGTCA sequence present in the c-fos ERE is mutated to 5'-TTTCA, transcriptional activation and receptor binding activities are both lost. Mutation of the CAGCC-3' element corresponding to the second half-site of the c-fos sequence also led to the loss of receptor binding activity, suggesting that both half-sites of this element are involved in this function. The estrogen induction mediated by either the c-fos or
Energy Technology Data Exchange (ETDEWEB)
Matsui, Keiji; Oda, Kasumi; Mizuta, Shumpei; Ishino, Ruri; Urahama, Norinaga; Hasegawa, Natsumi [Laboratory of Hematology, Division of Medical Biophysics, Kobe University Graduate School of Health Sciences, 7-10-2 Tomogaoka, Suma-ku, Kobe 654-0142 (Japan); Roeder, Robert G. [Laboratory of Biochemistry and Molecular Biology, The Rockefeller University, 1230 York Avenue, New York, NY 10065 (United States); Ito, Mitsuhiro, E-mail: itomi@med.kobe-u.ac.jp [Laboratory of Hematology, Division of Medical Biophysics, Kobe University Graduate School of Health Sciences, 7-10-2 Tomogaoka, Suma-ku, Kobe 654-0142 (Japan); Laboratory of Biochemistry and Molecular Biology, The Rockefeller University, 1230 York Avenue, New York, NY 10065 (United States); Department of Family and Community Medicine, Kobe University Graduate School of Medicine, 7-5-1 Kusunoki-cho, Chuo-ku, Kobe 654-0142 (Japan); Consolidated Research Institute for Advanced Science and Medical Care, Waseda University, 3-4-1 Okubo, Shinjuku-ku, Tokyo 159-8555 (Japan)
2013-10-11
Highlights: •MED1 is a bona fide T3-dependent coactivator on TSHB promoter. •Mice with LxxLL-mutant MED1 have attenuated TSHβ mRNA and thyroid hormone levels. •MED1 activates TSHB promoter T3-dependently in cultured cells. •T3-dependent MED1 action is enhanced when SRC1/SRC2 or HDAC2 is downregulated. •MED1 is also a T3-independent GATA2/Pit1 coactivator on TSHB promoter. -- Abstract: The MED1 subunit of the Mediator transcriptional coregulator complex is a nuclear receptor-specific coactivator. A negative feedback mechanism of thyroid-stimulating hormone (TSH, or thyrotropin) expression in the thyrotroph in the presence of triiodothyronine (T3) is employed by liganded thyroid hormone receptor β (TRβ) on the TSHβ gene promoter, where conventional histone-modifying coactivators act as corepressors. We now provide evidence that MED1 is a ligand-dependent positive cofactor on this promoter. TSHβ gene transcription was attenuated in MED1 mutant mice in which the nuclear receptor-binding ability of MED1 was specifically disrupted. MED1 stimulated GATA2- and Pit1-mediated TSHβ gene promoter activity in a ligand-independent manner in cultured cells. MED1 also stimulated transcription from the TSHβ gene promoter in a T3-dependent manner. The transcription was further enhanced when the T3-dependent corepressors SRC1, SRC2, and HDAC2 were downregulated. Hence, MED1 is a T3-dependent and -independent coactivator on the TSHβ gene promoter.
Rothrauff, Benjamin B; Shimomura, Kazunori; Gottardi, Riccardo; Alexander, Peter G; Tuan, Rocky S
2017-02-01
Extracellular matrix (ECM) derived from decellularized tissues has been found to promote tissue neogenesis, most likely mediated by specific biochemical and physical signaling motifs that promote tissue-specific differentiation of progenitor cells. Decellularized ECM has been suggested to be efficacious for the repair of tissue injuries. However, decellularized meniscus contains a dense collagenous structure, which impedes cell seeding and infiltration and is not readily applicable for meniscus repair. In addition, the meniscus consists of two distinct anatomical regions that differ in vascularity and cellular phenotype. The purpose of this study was to explore the region-specific bioactivity of solubilized ECM derived from the inner and outer meniscal regions as determined in 2D and 3D cultures of adult mesenchymal stem cells (MSCs). When added as a medium supplement to 2D cultures of MSCs, urea-extracted fractions of the inner (imECM) and outer meniscal ECM (omECM) enhanced cell proliferation while imECM most strongly upregulated fibrochondrogenic differentiation on the basis of gene expression profiles. When added to 3D cultures of MSCs seeded in photocrosslinked methacrylated gelatin (GelMA) hydrogels, both ECM fractions upregulated chondrogenic differentiation as determined by gene expression and protein analyses, as well as elevated sulfated glycosaminoglycan sGAG content, compared to ECM-free controls. The chondrogenic effect at day 21 was most pronounced with imECM supplementation, but equivalent between ECM groups by day 42. Despite increased cartilage matrix, imECM and omECM constructs possessed compressive moduli similar to controls. In conclusion, soluble meniscal ECM may be considered for use as a tissue-specific reagent to enhance chondrogenesis for MSC-based 3D cartilage tissue engineering. The inner region of the knee meniscus is frequently injured and possesses a poor intrinsic healing capacity. Solubilized extracellular matrix (ECM) derived from
Parks, Scott K; Cormerais, Yann; Durivault, Jerome; Pouyssegur, Jacques
2017-02-07
Hypoxia and extracellular acidosis are pathophysiological hallmarks of aggressive solid tumors. Regulation of intracellular pH (pHi) is essential for the maintenance of tumor cell metabolism and proliferation in this microenvironment and key proteins involved in pHi regulation are of interest for therapeutic development. Carbonic anhydrase 9 (CA9) is one of the most robustly regulated proteins by the hypoxia inducible factor (HIF) and contributes to pHi regulation. Here, we have investigated for the first time, the role of CA9 via complete genomic knockout (ko) and compared its impact on tumor cell physiology with the essential pHi regulator Na+/H+ exchanger 1 (NHE1). Initially, we established NHE1-ko LS174 cells with inducible CA9 knockdown. While increased sensitivity to acidosis for cell survival in 2-dimensions was not observed, clonogenic proliferation and 3-dimensional spheroid growth in particular were greatly reduced. To avoid potential confounding variables with use of tetracycline-inducible CA9 knockdown, we established CA9-ko and NHE1/CA9-dko cells. NHE1-ko abolished recovery from NH4Cl pre-pulse cellular acid loading while both NHE1 and CA9 knockout reduced resting pHi. NHE1-ko significantly reduced tumor cell proliferation both in normoxia and hypoxia while CA9-ko dramatically reduced growth in hypoxic conditions. Tumor xenografts revealed substantial reductions in tumor growth for both NHE1-ko and CA9-ko. A notable induction of CA12 occurred in NHE1/CA9-dko tumors indicating a potential means to compensate for loss of pH regulating proteins to maintain growth. Overall, these genomic knockout results strengthen the pursuit of targeting tumor cell pH regulation as an effective anti-cancer strategy.
The effect of phenobarbital on the methylation level of the p16 promoter region in rat liver
International Nuclear Information System (INIS)
Kostka, Grazyna; Urbanek, Katarzyna; Ludwicki, Jan K.
2007-01-01
It has been suggested that non-genotoxic carcinogens (NGCs) may cause modification of the DNA methylation status. We studied the effects of phenobarbital (PB) - a non-genotoxic rodent liver carcinogen - on the methylation level of the promoter region of the p16 suppressor gene, as well as on hepatomegaly, DNA synthesis, and DNA-methyltransferase (DNMTs) activity in the rat liver. Male Wistar rats received PB in 1, 3 or 14 daily oral doses (at 24-h intervals), each equivalent to 1/10 of the LD 50 value. The study showed that PB has caused persistent elevation in relative liver weight (RLW) as well as a transient increase in DNA synthesis. This suggests that the PB-induced increase in RLW was due to a combination of both hyperplasia and hypertrophy of liver cells. The effect of PB on DNA synthesis corresponded to an increase in the methylation pattern of the p16 promoter sequence. Methylation of cytosine in the analyzed CpG sites of the p16 gene was found after short exposure of the animals to PB. Treatment of rats with PB for 1 and 3 days also produced an increase in nuclear DNMTs activity. After prolonged administration (14 days), DNA synthesis declined, returning to the control level. No changes in methylation of the p16 gene nor in DNMTs activity were observed. The reversibility of early induced changes in target tissues is a mark characteristic of tumor promoters. Thus, transient changes in methylation of the p16 gene, although their direct role in the mechanisms of PB toxicity, including its carcinogenic action, remains doubtful, may therefore be a significant element of such processes
Energy Technology Data Exchange (ETDEWEB)
Waller, Zoë A.E., E-mail: z.waller@uea.ac.uk; Howell, Lesley A.; MacDonald, Colin J.; O’Connell, Maria A.; Searcey, Mark, E-mail: m.searcey@uea.ac.uk
2014-04-25
Highlights: • Discovery of a G-quadruplex forming sequence in the promoter sequence of Nrf2. • Characterisation of the G-quadruplex by UV, CD and NMR. • Conformational switching of G-quadruplex induced by 9-aminoacridine. - Abstract: The transcription factor nuclear factor (erythroid-derived 2)-like 2 (Nrf2) regulates multiple antioxidants, Phase II detoxification enzymes and other cytoprotective enzymes in cells. Activation of Nrf2 is recognised as being of potential therapeutic benefit in inflammatory-diseases whereas more recently, it has become clear that the inhibition of Nrf2 may have benefit in the alleviation of resistance in some tumour types. A potential G-quadruplex forming sequence was identified in the promoter region of Nrf2, close to a number of putative transcription factor binding sites. Characterisation of the sequence 5’-d[GGGAAGGGAGCAAGGGCGGGAGGG]-3’ using CD spectroscopy, imino proton NMR resonances and UV melting experiments demonstrated the formation of a parallel intramolecular G-quadruplex in the presence of K{sup +} ions. Incubation with 9-aminoacridine ligands induced a switch from antiparallel to parallel forms. The presence of a G-quadruplex forming sequence in the promoter region of Nrf2 suggests an approach to targeting the production of the protein through stabilisation of the structure, thereby avoiding resistance to antitumour drugs.
Directory of Open Access Journals (Sweden)
Maarit Neuvonen
2011-11-01
Full Text Available Among the four non-structural proteins of alphaviruses the function of nsP3 is the least well understood. NsP3 is a component of the viral replication complex, and composed of a conserved aminoterminal macro domain implicated in viral RNA synthesis, and a poorly conserved carboxyterminal region. Despite the lack of overall homology we noted a carboxyterminal proline-rich sequence motif shared by many alphaviral nsP3 proteins, and found it to serve as a preferred target site for the Src-homology 3 (SH3 domains of amphiphysin-1 and -2. Nsp3 proteins of Semliki Forest (SFV, Sindbis (SINV, and Chikungunya viruses all showed avid and SH3-dependent binding to amphiphysins. Upon alphavirus infection the intracellular distribution of amphiphysin was dramatically altered and colocalized with nsP3. Mutations in nsP3 disrupting the amphiphysin SH3 binding motif as well as RNAi-mediated silencing of amphiphysin-2 expression resulted in impaired viral RNA replication in HeLa cells infected with SINV or SFV. Infection of Balb/c mice with SFV carrying an SH3 binding-defective nsP3 was associated with significantly decreased mortality. These data establish SH3 domain-mediated binding of nsP3 with amphiphysin as an important host cell interaction promoting alphavirus replication.
Toxin production ability of Bacillus cereus strains from food product of Ukraine
Directory of Open Access Journals (Sweden)
I. Pylypenko
2017-10-01
Full Text Available Potential pathogens of foodborne toxic infections – bacterial contaminants Bacillus cereus isolated from plant raw materials and food products from the Ukrainian region were investigated. When determining of the proportion of isolated bacilli from the plant samples, it was established that the epidemiologically significant microorganisms of Bacillus cereus as agents of food poisoning are the second largest. The average value of contaminated samples of Ukrainian plant raw materials and processed products with Bacillus cereus is 36,2 %. The ability of Bacillus cereus strains identified by a complex of morphological, tinctorial, cultural and biochemical properties, to produce specific emetic and enterotoxins was studied. Molecular genetic diagnosis and detection of the toxin-producing ability of isolated 42 Bacillus cereus strains showed both the possibility of their rapid identification and the presence of specific toxicity genes. Multiplex polymerase chain reaction (PCR was carried out with specific primers to detect toxicity determined of various bacilli genes: nheA, hblD, cytK, cesВ. The distribution of toxigenic genes is significantly different among the Bacillus cereus isolates from various sources. The nheA, hblD and cytK enterotoxin genes were detected in 100, 83,3 and 61,9 % of the investigated strains of Bacillus cereus, respectively. The cesB gene encoding emetic toxin was detected in 4,8 % of strains. Molecular-genetic PCR-method confirmed that all the isolated strains belong to the Bacillus cereus group, and the ability to produce toxins can be attributed to five groups. The main toxins that produce the investigated Bacillus cereus strains were nhe and hbl enterotoxins encoded by the corresponding genes of nheA and hblD. The enterotoxic type of Bacillus cereus was predominant in Ukrainian region. Studies of domestic plant food raw materials and products have confirmed the need to improve microbiological control of product safety
Active form Notch4 promotes the proliferation and differentiation of 3T3-L1 preadipocytes
Energy Technology Data Exchange (ETDEWEB)
Lai, Peng-Yeh [Institute of Molecular Biology and Department of Life Science, National Chung Cheng University, Chiayi 621, Taiwan, ROC (China); Tsai, Chong-Bin [Institute of Molecular Biology and Department of Life Science, National Chung Cheng University, Chiayi 621, Taiwan, ROC (China); Department of Ophthalmology, Chiayi Christian Hospital, Chiayi 600, Taiwan, ROC (China); Tseng, Min-Jen, E-mail: biomjt@ccu.edu.tw [Institute of Molecular Biology and Department of Life Science, National Chung Cheng University, Chiayi 621, Taiwan, ROC (China)
2013-01-18
Highlights: ► Notch4IC modulates the ERK pathway and cell cycle to promote 3T3-L1 proliferation. ► Notch4IC facilitates 3T3-L1 differentiation by up-regulating proadipogenic genes. ► Notch4IC promotes proliferation during the early stage of 3T3-L1 adipogenesis. ► Notch4IC enhances differentiation during subsequent stages of 3T3-L1 adipogenesis. -- Abstract: Adipose tissue is composed of adipocytes, which differentiate from precursor cells in a process called adipogenesis. Many signal molecules are involved in the transcriptional control of adipogenesis, including the Notch pathway. Previous adipogenic studies of Notch have focused on Notch1 and HES1; however, the role of other Notch receptors in adipogenesis remains unclear. Q-RT-PCR analyses showed that the augmentation of Notch4 expression during the differentiation of 3T3-L1 preadipocytes was comparable to that of Notch1. To elucidate the role of Notch4 in adipogenesis, the human active form Notch4 (N4IC) was transiently transfected into 3T3-L1 cells. The expression of HES1, Hey1, C/EBPδ and PPARγ was up-regulated, and the expression of Pref-1, an adipogenic inhibitor, was down-regulated. To further characterize the effect of N4IC in adipogenesis, stable cells expressing human N4IC were established. The expression of N4IC promoted proliferation and enhanced differentiation of 3T3-L1 cells compared with those of control cells. These data suggest that N4IC promoted proliferation through modulating the ERK pathway and the cell cycle during the early stage of 3T3-L1 adipogenesis and facilitated differentiation through up-regulating adipogenic genes such as C/EBPα, PPARγ, aP2, LPL and HSL during the middle and late stages of 3T3-L1 adipogenesis.
Yang, Chunrong; Shang, Xueying; Cheng, Lei; Yang, Lei; Liu, Xuefei; Bai, Chunling; Wei, Zhuying; Hua, Jinlian; Li, Guangpeng
2017-01-01
Methylation is an important issue in gene expression regulation and also in the fields of genetics and reproduction. In this study, we created fat-1 transgenic sheep, investigated the fine-mapping and the modulatory mechanisms of promoter methylation. Sheep fetal fibroblasts were transfected by pCAG-fat1-IRES-EGFP. Monoclonal cell line was screened as nuclear donor and carried out nuclear transfer (441 transgenic cloned embryos, 52 synchronism recipient sheep). Six offsprings were obtained. Expressions of exogenous genes fat-1 and EGFP were detectable in 10 examined tissues and upregulated omega-3 fatty acid content. Interestingly, more or less EGFP negative cells were detectable in the positive transgenic fetal skin cells. EGFP negative and positive cells were sorted by flow cytometry, and their methylation status in the whole promoter region (1701 nt) were investigated by bisulphate sequencing. The fine-mapping of methylation in CAG promoter were proposed. The results suggested that exogenous gene expression was determined by the methylation status from 721-1346 nt and modulated by methylation levels at 101, 108 and 115 nt sites in CAG promoter. To clarify the regulatory mechanism of methylation, examination of four DNA methyltransferases (DNMTs) demonstrated that hypermethylation of CAG promoter is mainly maintained by DNMT 1 in EGFP negative cells. Furthermore, investigation of the cell surface antigen CD34, CD45 and CD166 indicated that EGFP positive and negative cells belong to different types. The present study systematically clarified methylation status of CAG promoter in transgenic sheep and regulatory mechanism, which will provide research strategies for gene expression regulation in transgenic animals.
Ren, Huixia; Luo, Chuanming; Feng, Yanqing; Yao, Xiaoli; Shi, Zhe; Liang, Fengyin; Kang, Jing X; Wan, Jian-Bo; Pei, Zhong; Su, Huanxing
2017-01-01
Impairment of amyloid-β (Aβ) clearance leads to Aβ accumulation in the brain during the development of Alzheimer's disease (AD). Strategies that can restore or improve the clearance function hold great promise in delaying or preventing the onset of AD. Here, we show that n-3 polyunsaturated fatty acids (PUFAs), by use of fat-1 transgenic mice and oral administration of fish oil, significantly promote interstitial Aβ clearance from the brain and resist Aβ injury. Such beneficial effects were abolished in Aqp4-knockout mice, suggesting that the AQP4-dependent glymphatic system is actively involved in the promoting the effects of n-3 PUFAs on the clearance of extracellular Aβ. Imaging on clarified brain tissues clearly displayed that n-3 PUFAs markedly inhibit the activation of astrocytes and protect the AQP4 polarization in the affected brain region after Aβ injection. The results of the present study prove a novel mechanism by which n-3 PUFAs exert protective roles in reducing Aβ accumulation via mediating the glymphatic system function.-Ren, H., Luo, C., Feng, Y., Yao, X., Shi, Z., Liang, F., Kang, J. X., Wan, J.-B., Pei, Z., Su, H. Omega-3 polyunsaturated fatty acids promote amyloid-β clearance from the brain through mediating the function of the glymphatic system. © FASEB.
Inhibition of renal Na+/H+ exchange in cadmium-intoxicated rats
International Nuclear Information System (INIS)
Ahn, Do Whan; Chung, Jin Mo; Kim, Jee Yeun; Kim, Kyoung Ryong; Park, Yang Saeng
2005-01-01
Chronic exposure to cadmium (Cd) results in bicarbonaturia, leading to metabolic acidosis. To elucidate the mechanism(s) by which renal bicarbonate reabsorption is inhibited, we investigated changes in renal transporters and enzymes associated with bicarbonate reabsorption in Cd-intoxicated rats. Cd intoxication was induced by subcutaneous injections of CdCl 2 (2 mg Cd/kg per day) for 3 weeks. Cd intoxication resulted in a significant reduction in V max of Na + /H + antiport with no changes in K Na in the renal cortical brush-border membrane vesicles (BBMV). Western blotting of BBM proteins and indirect immunohistochemistry in renal tissue sections, using an antibody against Na + /H + exchange-3 (NHE3), showed a diminished expression of NHE3 protein in the BBM. Reverse transcription-polymerase chain reaction (RT-PCR) analysis revealed that NHE3 mRNA expression was reduced in the renal cortex. The activity of carbonic anhydrase IV (CA IV) in BBM was not changed. The protein abundance of Na + -HCO 3 - cotransporter-1 (NBC1) in whole kidney membrane fractions was slightly attenuated, whereas that of the Na + -K + -ATPase α-subunit was markedly elevated in Cd-intoxicated animals. These results indicate that Cd intoxication impairs NHE3 expression in the proximal tubule, thereby reducing the capacity for bicarbonate reabsorption, leading to bicarbonaturia in an intact animal
9 CFR 3.81 - Environment enhancement to promote psychological well-being.
2010-01-01
... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Environment enhancement to promote..., Treatment, and Transportation of Nonhuman Primates 2 Facilities and Operating Standards § 3.81 Environment..., document, and follow an appropriate plan for environment enhancement adequate to promote the psychological...
Directory of Open Access Journals (Sweden)
Aebi Stefan
2008-10-01
Full Text Available Abstract Background The activity of dihydropyrimidine dehydrogenase (DPD, the key enzyme of pyrimidine catabolism, is thought to be an important determinant for the occurrence of severe toxic reactions to 5-fluorouracil (5-FU, which is one of the most commonly prescribed chemotherapeutic agents for the treatment of solid cancers. Genetic variation in the DPD gene (DPYD has been proposed as a main factor for variation in DPD activity in the population. However, only a small proportion of severe toxicities in 5-FU based chemotherapy can be explained with such rare deleterious DPYD mutations resulting in severe enzyme deficiencies. Recently, hypermethylation of the DPYD promoter region has been proposed as an alternative mechanism for DPD deficiency and thus as a major cause of severe 5-FU toxicity. Methods Here, the prognostic significance of this epigenetic marker with respect to severe 5-FU toxicity was assessed in 27 cancer patients receiving 5-FU based chemotherapy, including 17 patients experiencing severe toxic side effects following drug administration, none of which were carriers of a known deleterious DPYD mutation, and ten control patients. The methylation status of the DPYD promoter region in peripheral blood mononuclear cells was evaluated by analysing for each patient between 19 and 30 different clones of a PCR-amplified 209 base pair fragment of the bisulfite-modified DPYD promoter region. The fragments were sequenced to detect bisulfite-induced, methylation-dependent sequence differences. Results No evidence of DPYD promoter methylation was observed in any of the investigated patient samples, whereas in a control experiment, as little as 10% methylated genomic DNA could be detected. Conclusion Our results indicate that DYPD promoter hypermethylation is not of major importance as a prognostic factor for severe toxicity in 5-FU based chemotherapy.
Boundary Dpp promotes growth of medial and lateral regions of the Drosophila wing.
Barrio, Lara; Milán, Marco
2017-07-04
The gradient of Decapentaplegic (Dpp) in the Drosophila wing has served as a paradigm to characterize the role of morphogens in regulating patterning. However, the role of this gradient in regulating tissue size is a topic of intense debate as proliferative growth is homogenous. Here, we combined the Gal4/UAS system and a temperature-sensitive Gal80 molecule to induce RNAi-mediated depletion of dpp and characterise the spatial and temporal requirement of Dpp in promoting growth. We show that Dpp emanating from the AP compartment boundary is required throughout development to promote growth by regulating cell proliferation and tissue size. Dpp regulates growth and proliferation rates equally in central and lateral regions of the developing wing appendage and reduced levels of Dpp affects similarly the width and length of the resulting wing. We also present evidence supporting the proposal that graded activity of Dpp is not an absolute requirement for wing growth.
Identifying Regulatory Patterns at the 3'end Regions of Over-expressed and Under-expressed Genes
Othoum, Ghofran K
2013-05-01
Promoters, neighboring regulatory regions and those extending further upstream of the 5’end of genes, are considered one of the main components affecting the expression status of genes in a specific phenotype. More recently research by Chen et al. (2006, 2012) and Mapendano et al. (2010) demonstrated that the 3’end regulatory regions of genes also influence gene expression. However, the association between the regulatory regions surrounding 3’end of genes and their over- or under-expression status in a particular phenotype has not been systematically studied. The aim of this study is to ascertain if regulatory regions surrounding the 3’end of genes contain sufficient regulatory information to correlate genes with their expression status in a particular phenotype. Over- and under-expressed ovarian cancer (OC) genes were used as a model. Exploratory analysis of the 3’end regions were performed by transforming the annotated regions using principal component analysis (PCA), followed by clustering the transformed data thereby achieving a clear separation of genes with different expression status. Additionally, several classification algorithms such as Naïve Bayes, Random Forest and Support Vector Machine (SVM) were tested with different parameter settings to analyze the discriminatory capacity of the 3’end regions of genes related to their gene expression status. The best performance was achieved using the SVM classification model with 10-fold cross-validation that yielded an accuracy of 98.4%, sensitivity of 99.5% and specificity of 92.5%. For gene expression status for newly available instances, based on information derived from the 3’end regions, an SVM predictive model was developed with 10-fold cross-validation that yielded an accuracy of 67.0%, sensitivity of 73.2% and specificity of 61.0%. Moreover, building an SVM with polynomial kernel model to PCA transformed data yielded an accuracy of 83.1%, sensitivity of 92.5% and specificity of 74.8% using
Identifying Regulatory Patterns at the 3'end Regions of Over-expressed and Under-expressed Genes
Othoum, Ghofran K
2013-01-01
Promoters, neighboring regulatory regions and those extending further upstream of the 5’end of genes, are considered one of the main components affecting the expression status of genes in a specific phenotype. More recently research by Chen et al. (2006, 2012) and Mapendano et al. (2010) demonstrated that the 3’end regulatory regions of genes also influence gene expression. However, the association between the regulatory regions surrounding 3’end of genes and their over- or under-expression status in a particular phenotype has not been systematically studied. The aim of this study is to ascertain if regulatory regions surrounding the 3’end of genes contain sufficient regulatory information to correlate genes with their expression status in a particular phenotype. Over- and under-expressed ovarian cancer (OC) genes were used as a model. Exploratory analysis of the 3’end regions were performed by transforming the annotated regions using principal component analysis (PCA), followed by clustering the transformed data thereby achieving a clear separation of genes with different expression status. Additionally, several classification algorithms such as Naïve Bayes, Random Forest and Support Vector Machine (SVM) were tested with different parameter settings to analyze the discriminatory capacity of the 3’end regions of genes related to their gene expression status. The best performance was achieved using the SVM classification model with 10-fold cross-validation that yielded an accuracy of 98.4%, sensitivity of 99.5% and specificity of 92.5%. For gene expression status for newly available instances, based on information derived from the 3’end regions, an SVM predictive model was developed with 10-fold cross-validation that yielded an accuracy of 67.0%, sensitivity of 73.2% and specificity of 61.0%. Moreover, building an SVM with polynomial kernel model to PCA transformed data yielded an accuracy of 83.1%, sensitivity of 92.5% and specificity of 74.8% using
DEFF Research Database (Denmark)
Jensen, Erik Østergaard; Marcker, Kjeld A; Schell, J
1988-01-01
Nuclear extracts from soybean nodules, leaves and roots were used to investigate protein-DNA interactions in the 5' upstream (promoter) region of the soybean leghaemoglobin lbc(3) gene. Two distinct regions were identified which strongly bind a nodule specific factor. A Bal31 deletion analysis......, but with different affinities. Elements 1 and 2 share a common motif, although their AT-rich DNA sequences differ. Element 2 is highly conserved at an analogous position in other soybean lb gene 5' upstream regions. Udgivelsesdato: 1988-May...
Roles of PucR, G1nR, and TnrA in regulating expression of the Bacillus subtilis ure p3 promoter
DEFF Research Database (Denmark)
Brandenburg, J.L.; Wray, L.V.; Beier, Lars
2002-01-01
consensus GlnR/TnrA binding sites located in the ure P3 promoter region were shown to be required for negative regulation by GlnR. Mutational analysis indicates that a cooperative interaction occurs between GlnR dimers bound at these two sites. B. subtilis is the first example where urease expression...
Kotsaki, Antigoni; Raftogiannis, Maria; Routsi, Christina; Baziaka, Fotini; Kotanidou, Anastasia; Antonopoulou, Anastasia; Orfanos, Stylianos E; Katsenos, Chrisostomos; Koutoukas, Pantelis; Plachouras, Diamantis; Mandragos, Konstantinos; Giamarellos-Bourboulis, Evangelos J
2012-08-01
Debatable findings exist among various studies regarding the impact of single nucleotide polymorphisms (SNPs) within the promoter region of the tumor necrosis factor (TNF) gene for susceptibility to infections. Their impact was investigated in a cohort of mechanically ventilated patients who developed ventilator-associated pneumonia (VAP). Two-hundred and thirteen mechanically ventilated patients who developed VAP were enrolled. Genomic DNA was extracted and SNPs at the -376, -308 and -238 position of the promoter region of the TNF gene were assessed by restriction fragment length polymorphisms. Monocytes were isolated from 47 patients when they developed sepsis and stimulated by bacterial endotoxin for the production of TNFα and of interleukin-6 (IL-6). Patients were divided into two groups; 166 patients bearing only wild-type alleles of all three studied polymorphisms; and 47 patients carrying at least one A allele of the three studied SNPs. Time between start of mechanical ventilation and advent of VAP was significantly shorter in the second group than in the first group (log-rank: 4.416, p: 0.041). When VAP supervened, disease severity did not differ between groups. Stimulation of TNFα and of IL-6 was much greater by monocytes for patients carrying A alleles. Carriage of at least one A allele of the three studied SNPs at the promoter region of the TNF-gene is associated with shorter time to development of VAP but it is not associated with disease severity. Findings may be related with a role of the studied SNPs in the production of pro-inflammatory cytokines. Copyright © 2012 Elsevier Ltd. All rights reserved.
Role of the Na+/H+ exchanger on the development of diabetes mellitus and its chronic complications
International Nuclear Information System (INIS)
Sun, Yan-Ming; Su, Ying; Li, Jia; Tian, Ye; Wang, Lan-Feng
2012-01-01
Highlights: ► NHE protect against intracellular hydrogen overload. ► NHE protect β-cells against strong acidification. ► NHE inhibitors improve myocardial ischemia and reperfusion. -- Abstract: Micro- and macrovascular complications are the main cause of morbidity and mortality in diabetes mellitus. The Na + /H + exchanger (NHE) is a family of proteins which exchange Na + for H + according to their concentration gradients in an electroneutral manner. The exchanger also plays a key role in several other cellular functions including proliferation, differentiation, apoptosis, migration, and cytoskeletal organization. Since not much is known on the relationship between NHE and diabetes mellitus, this review outlines the contribution of NHE to chronic complications of diabetes mellitus, such as diabetic nephropathy; diabetic cardiomyopathy.
South Asia's health promotion kaleidoscope.
Mukhopadhyay, Alok
2007-01-01
South Asia has 22 percent of the world's population but only 1.3 percent of the global income. Consequently 40 percent of the population is living in absolute poverty. However the health transition in some of its countries including India and Sri Lanka is a testimony to the fact that there are proven solutions to the problems of health and development within the region. The countries of the region have much in common, including a democratic political system, four major religions, a vibrant and living tradition of voluntarism and an extensive health infrastructure which is operating well below par. Despite the underlying unity, South Asia enjoys enormous cultural, linguistic and ethnic diversity. In this large, complex and vibrant region, health promotion is a challenging task, but it also holds the key to a dramatic change in the global health situation. Many of these solutions lie in wider areas of socio-political action. There are much needed shifts in the health promotion and development efforts, particularly in the area of poverty and social justice; gender inequity; population stabilisation; health and environment; control of communicable and non-communicable diseases; and urban health strategies. The principle of cooperation, partnership and intersectoral collaboration for health will be explored. Developing an appropriate, sustainable and people centred health and development strategy in the coming decades is an enormous challenge. There has been an attempt to focus on the emerging needs of the region, which call for health promotion, and involvement of civil society, private sector and the governments bestowed with the increased responsibility of ensuring health security for people. Strengthening the existing health systems, allocating adequate resources for health development and ensuring community participation are all prerequisites to the success of health promotion in the region.
Expression of Nanog gene promotes NIH3T3 cell proliferation
International Nuclear Information System (INIS)
Zhang Jingyu; Wang Xia; Chen Bing; Suo Guangli; Zhao Yanhong; Duan Ziyuan; Dai Jianwu
2005-01-01
Cells are the functional elements in tissue engineering and regenerative medicine. A large number of cells are usually needed for these purposes. However, there are numbers of limitations for in vitro cell proliferation. Nanog is an important self-renewal determinant in embryonic stem cells. However, it remains unknown whether Nanog will influence the cell cycle and cell proliferation of mature cells. In this study, we expressed Nanog in NIH3T3 cells and showed that expression of Nanog in NIH3T3 promoted cells to enter into S phase and enhanced cell proliferation. This suggests that Nanog gene might function in a similar fashion in mature cells as in ES cells. In addition, it may provide an approach for in vitro cell expansion
Directory of Open Access Journals (Sweden)
Matsutani Sachiko
2004-08-01
Full Text Available Abstract Background In eukaryotes, RNA polymerase III (RNAP III transcribes the genes for small RNAs like tRNAs, 5S rRNA, and several viral RNAs, and short interspersed repetitive elements (SINEs. The genes for these RNAs and SINEs have internal promoters that consist of two regions. These two regions are called the A and B blocks. The multisubunit transcription factor TFIIIC is required for transcription initiation of RNAP III; in transcription of tRNAs, the B-block binding subunit of TFIIIC recognizes a promoter. Although internal promoter sequences are conserved in eukaryotes, no evidence of homology between the B-block binding subunits of vertebrates and yeasts has been reported previously. Results Here, I reported the results of PSI-BLAST searches using the B-block binding subunits of human and Shizosacchromyces pombe as queries, showing that the same Arabidopsis proteins were hit with low E-values in both searches. Comparison of the convergent iterative alignments obtained by these PSI-BLAST searches revealed that the vertebrate, yeast, and Arabidopsis proteins have similarities in their N-terminal one-third regions. In these regions, there were three domains with conserved sequence similarities, one located in the N-terminal end region. The N-terminal end region of the B-block binding subunit of Saccharomyces cerevisiae is tentatively identified as a HMG box, which is the DNA binding motif. Although I compared the alignment of the N-terminal end regions of the B-block binding subunits, and their homologs, with that of the HMG boxes, it is not clear whether they are related. Conclusion Molecular phylogenetic analyses using the small subunit rRNA and ubiquitous proteins like actin and α-tubulin, show that fungi are more closely related to animals than either is to plants. Interestingly, the results obtained in this study show that, with respect to the B-block binding subunits of TFIIICs, animals appear to be evolutionarily closer to plants
Matsutani, Sachiko
2004-08-09
In eukaryotes, RNA polymerase III (RNAP III) transcribes the genes for small RNAs like tRNAs, 5S rRNA, and several viral RNAs, and short interspersed repetitive elements (SINEs). The genes for these RNAs and SINEs have internal promoters that consist of two regions. These two regions are called the A and B blocks. The multisubunit transcription factor TFIIIC is required for transcription initiation of RNAP III; in transcription of tRNAs, the B-block binding subunit of TFIIIC recognizes a promoter. Although internal promoter sequences are conserved in eukaryotes, no evidence of homology between the B-block binding subunits of vertebrates and yeasts has been reported previously. Here, I reported the results of PSI-BLAST searches using the B-block binding subunits of human and Shizosacchromyces pombe as queries, showing that the same Arabidopsis proteins were hit with low E-values in both searches. Comparison of the convergent iterative alignments obtained by these PSI-BLAST searches revealed that the vertebrate, yeast, and Arabidopsis proteins have similarities in their N-terminal one-third regions. In these regions, there were three domains with conserved sequence similarities, one located in the N-terminal end region. The N-terminal end region of the B-block binding subunit of Saccharomyces cerevisiae is tentatively identified as a HMG box, which is the DNA binding motif. Although I compared the alignment of the N-terminal end regions of the B-block binding subunits, and their homologs, with that of the HMG boxes, it is not clear whether they are related. Molecular phylogenetic analyses using the small subunit rRNA and ubiquitous proteins like actin and alpha-tubulin, show that fungi are more closely related to animals than either is to plants. Interestingly, the results obtained in this study show that, with respect to the B-block binding subunits of TFIIICs, animals appear to be evolutionarily closer to plants than to fungi.
DEFF Research Database (Denmark)
Leong, Patrick K K; Yang, Li E; Lin, Harrison W
2004-01-01
. This study aimed to determine the effects of acute hypotension, induced by aortic clamp or by high-dose PTH (100 microg PTH/kg), on renal hemodynamics and proximal tubule Na/H exchanger isoform 3 (NHE3) and type IIa Na-P(i) cotransporter protein (NaPi2) distribution. Subcellular distribution was analyzed...... clearance. There was, however, no significant change in glomerular filtration rate (GFR) or subcellular distribution of NHE3 and NaPi2. In contrast, high-dose PTH rapidly (
US-India Technical Collaboration to Promote Regional Stability
International Nuclear Information System (INIS)
Killinger, Mark H.; Griggs, James R.; Apt, Kenneth E.; Doyle, James E.
2001-01-01
Two US-India documents were signed in 2000 that provided new impetus for scientific and technical cooperation between the two countries. The first document is the US-India Science and Technology Agreement, which is aimed at 'promoting scientific and technological cooperation between the people of their two countries.' The second is the US-India Joint Statement on Energy and Environment, which states 'the United States and India believe that energy and environment could be one of the most important areas of cooperation between the two countries.' In addition to the work already underway as part of these two agreements, DOE has established a US-India Science and Technology Initiative to utilize the expertise of DOE national laboratories to conduct activities that support US policy objectives in South Asia. PNNL and LANL are working with US agencies and the Indian government and scientific communities to identify appropriate non-sensitive areas for US-Indian technical collaboration. The objectives of such collaboration are to address visible national/international problems, build trust between the United States and India, and contribute to regional stability in South Asia. This paper describes research done on the Indian scientific organization and infrastructure, potential areas for collaboration, the approach for this engagement, and current status of the initiative.
US-INDIA TECHNICAL COLLABORATION TO PROMOTE REGIONAL STABILITY
International Nuclear Information System (INIS)
Killinger, M.H.; Griggs, J.R.; Apt, Kenneth E.; Doyle, J.E.
2001-01-01
Two US-India documents were signed in 2000 that provided new impetus for scientific and technical cooperation between the two countries. The first document is the US-India Science and Technology Agreement, which is aimed at 'promoting scientific and technological cooperation between the people of their two countries.' The second is the US-India Joint Statement on Energy and Environment, which states 'the United States and India believe that energy and environment could be one of the most important areas of cooperation between the two countries.' In addition to the work already underway as part of these two agreements, the US Department of Energy (DOE) has established a US-India Science and Technology Initiative to utilize the expertise of DOE national laboratories to conduct activities that support US policy objectives in South Asia. PNNL and LANL are working with US government agencies to identify appropriate non-sensitive, non-nuclear areas for US-Indian technical collaboration. The objectives of such collaboration are to address visible national and international problems, build trust between the United States and India, and contribute to regional stability in South Asia. This paper describes the approach for this engagement, the Indian scientific organization and infrastructure, potential areas for collaboration, and current status of the initiative.
Barnidge, Ellen K; Baker, Elizabeth A; Estlund, Amy; Motton, Freda; Hipp, Pamela R; Brownson, Ross C
2015-06-11
Rural residents are less likely than urban and suburban residents to meet recommendations for nutrition and physical activity. Interventions at the environmental and policy level create environments that support healthy eating and physical activity. Healthier Missouri Communities (Healthier MO) is a community-based research project conducted by the Prevention Research Center in St. Louis with community partners from 12 counties in rural southeast Missouri. We created a regional partnership to leverage resources and enhance environmental and policy interventions to improve nutrition and physical activity in rural southeast Missouri. Partners were engaged in a participatory action planning process that included prioritizing, implementing, and evaluating promising evidence-based interventions to promote nutrition and physical activity. Group interviews were conducted with Healthier MO community partners post intervention to evaluate resource sharing and sustainability efforts of the regional partnership. Community partners identified the benefits and challenges of resource sharing within the regional partnership as well as the opportunities and threats to long-term partnership sustainability. The partners noted that the regional participatory process was difficult, but the benefits outweighed the challenges. Regional rural partnerships may be an effective way to leverage relationships to increase the capacity of rural communities to implement environmental and policy interventions to promote nutrition and physical activity.
Directory of Open Access Journals (Sweden)
Dobrovic Alexander
2009-09-01
Full Text Available Abstract Background Succinate dehydrogenase (SDH and fumarate hydratase (FH are tricarboxylic acid (TCA cycle enzymes that are also known to act as tumour suppressor genes. Increased succinate or fumarate levels as a consequence of SDH and FH deficiency inhibit hypoxia inducible factor-1α (HIF-1α prolyl hydroxylases leading to sustained HIF-1α expression in tumours. Since HIF-1α is frequently expressed in breast carcinomas, DNA methylation at the promoter regions of the SDHA, SDHB, SDHC and SDHD and FH genes was evaluated as a possible mechanism in silencing of SDH and FH expression in breast carcinomas. Findings No DNA methylation was identified in the promoter regions of the SDHA, SDHB, SDHC, SDHD and FH genes in 72 breast carcinomas and 10 breast cancer cell lines using methylation-sensitive high resolution melting which detects both homogeneous and heterogeneous methylation. Conclusion These results show that inactivation via DNA methylation of the promoter CpG islands of SDH and FH is unlikely to play a major role in sporadic breast carcinomas.
Quantifying Surface Coal-Mining Patterns to Promote Regional Sustainability in Ordos, Inner Mongolia
Directory of Open Access Journals (Sweden)
Xiaoji Zeng
2018-04-01
Full Text Available Ordos became the new “coal capital” of China within a few decades since the country’s economic reform in 1978, as large-scale surface coal mining dramatically propelled its per capita GDP from being one of the lowest to one of the highest in China, exceeding Hong Kong in 2009. Surface coal-mining areas (SCMAs have continued to expand in this region during recent decades, resulting in serious environmental and socioeconomic consequences. To understand these impacts and promote regional sustainability, quantifying the spatiotemporal patterns of SCMAs is urgently needed. Thus, the main objectives of this study were to quantify the spatiotemporal patterns of SCMAs in the Ordos region from 1990 to 2015, and to examine some of the major environmental and socioeconomic impacts in the study region. We extracted the SCMAs using remote-sensing data, and then quantified their spatiotemporal patterns using landscape metrics. The loss of natural habitat and several socioeconomic indicators were examined in relation to surface coal mining. Our results show that the area of SCMAs increased from 7.12 km2 to 355.95 km2, an increase of nearly 49 times from 1990 to 2015 in the Ordos region. The number of SCMAs in this region increased from 82 to 651, a nearly seven-fold increase. In particular, Zhungeer banner (an administrative division, Yijinhuoluo banner, Dongsheng District and Dalate banner in the north-eastern part of the Ordos region had higher growth rates of SCMAs. The income gap between urban and rural residents increased along with the growth in SCMAs, undermining social equity in the Ordos region. Moreover, the rapid increase in SCMAs resulted in natural habitat loss (including grasslands, forests, and deserts across this region. Thus, we suggest that regional sustainability in Ordos needs to emphasize effective measures to curb large-scale surface coal mining in order to reduce the urban–rural income gap, and to restore degraded natural
Abdelazeem, Khalid N M; Singh, Yogesh; Lang, Florian; Salker, Madhuri S
2017-01-01
Key properties of tumor cells include enhanced glycolytic flux with excessive consumption of glucose and formation of lactate. As glycolysis is highly sensitive to cytosolic pH, maintenance of glycolysis requires export of H+ ions, which is in part accomplished by Na+/H+ exchangers, such as NHE1. The carrier is sensitive to oxidative stress. Growth of tumor cells could be suppressed by the polyphenol Ellagic acid, which is found in various fruits and vegetables. An effect of Ellagic acid on transport processes has, however, never been reported. The present study thus elucidated an effect of Ellagic acid on cytosolic pH (pHi), NHE1 transcript levels, NHE1 protein abundance, Na+/H+ exchanger activity, and lactate release. Experiments were performed in Ishikawa cells without or with prior Ellagic acid (20 µM) treatment. NHE1 transcript levels were determined by qRT-PCR, NHE1 protein abundance by Western blotting, pHi utilizing (2',7'-bis-(2-carboxyethyl)-5-(and-6)-carboxyfluorescein [BCECF] fluorescence, Na+/H+ exchanger activity from Na+ dependent realkalinization after an ammonium pulse, cell volume from forward scatter in flow cytometry, reactive oxygen species (ROS) from 2',7'-dichlorodihydrofluorescein fluorescence, glucose uptake utilizing 2-(N-(7-nitrobenz-2-oxa-1,3-diazol-4-yl)amino)-2-deoxyglucose, and lactate concentration in the supernatant utilizing a colorimetric (570 nm)/ fluorometric enzymatic assay. A 48 hour treatment with Ellagic acid (20 µM) significantly decreased NHE1 transcript levels by 75%, NHE1 protein abundance by 95%, pHi from 7.24 ± 0.01 to 7.02 ± 0.01, Na+/H+ exchanger activity by 77%, forward scatter by 10%, ROS by 82%, glucose uptake by 58%, and lactate release by 15%. Ellagic acid (20µM) markedly down-regulates ROS formation and NHE1 expression leading to decreased Na+/H+ exchanger activity, pHi, glucose uptake and lactate release in endometrial cancer cells. Those effects presumably contribute to reprogramming and growth
Directory of Open Access Journals (Sweden)
Khalid N. M. Abdelazeem
2017-04-01
Full Text Available Background/Aims: Key properties of tumor cells include enhanced glycolytic flux with excessive consumption of glucose and formation of lactate. As glycolysis is highly sensitive to cytosolic pH, maintenance of glycolysis requires export of H+ ions, which is in part accomplished by Na+/H+ exchangers, such as NHE1. The carrier is sensitive to oxidative stress. Growth of tumor cells could be suppressed by the polyphenol Ellagic acid, which is found in various fruits and vegetables. An effect of Ellagic acid on transport processes has, however, never been reported. The present study thus elucidated an effect of Ellagic acid on cytosolic pH (pHi, NHE1 transcript levels, NHE1 protein abundance, Na+/H+ exchanger activity, and lactate release. Methods: Experiments were performed in Ishikawa cells without or with prior Ellagic acid (20 µM treatment. NHE1 transcript levels were determined by qRT-PCR, NHE1 protein abundance by Western blotting, pHi utilizing (2',7'-bis-(2-carboxyethyl-5-(and-6-carboxyfluorescein [BCECF] fluorescence, Na+/H+ exchanger activity from Na+ dependent realkalinization after an ammonium pulse, cell volume from forward scatter in flow cytometry, reactive oxygen species (ROS from 2’,7’-dichlorodihydrofluorescein fluorescence, glucose uptake utilizing 2-(N-(7-nitrobenz-2-oxa-1,3-diazol-4-ylamino-2-deoxyglucose, and lactate concentration in the supernatant utilizing a colorimetric (570 nm/ fluorometric enzymatic assay. Results: A 48 hour treatment with Ellagic acid (20 µM significantly decreased NHE1 transcript levels by 75%, NHE1 protein abundance by 95%, pHi from 7.24 ± 0.01 to 7.02 ± 0.01, Na+/H+ exchanger activity by 77%, forward scatter by 10%, ROS by 82%, glucose uptake by 58%, and lactate release by 15%. Conclusion: Ellagic acid (20µM markedly down-regulates ROS formation and NHE1 expression leading to decreased Na+/H+ exchanger activity, pHi, glucose uptake and lactate release in endometrial cancer cells. Those
Kuan, Chee Sian; See Too, Wei Cun; Few, Ling Ling
2016-01-01
Ethanolamine kinase (EK) catalyzes the phosphorylation of ethanolamine, the first step in the CDP-ethanolamine pathway for the biosynthesis of phosphatidylethanolamine (PE). Human EK exists as EK1, EK2α and EK2β isoforms, encoded by two separate genes, named ek1 and ek2. EK activity is stimulated by carcinogens and oncogenes, suggesting the involvement of EK in carcinogenesis. Currently, little is known about EK transcriptional regulation by endogenous or exogenous signals, and the ek gene promoter has never been studied. In this report, we mapped the important regulatory regions in the human ek1 promoter. 5' deletion analysis and site-directed mutagenesis identified a Sp site at position (-40/-31) that was essential for the basal transcription of this gene. Treatment of HCT116 cells with trichostatin A (TSA), a histone deacetylase inhibitor, significantly upregulated the ek1 promoter activity through the Sp(-40/-31) site and increased the endogenous expression of ek1. Chromatin immunoprecipitation assay revealed that TSA increased the binding of Sp1, Sp3 and RNA polymerase II to the ek1 promoter in HCT116 cells. The effect of TSA on ek1 promoter activity was cell-line specific as TSA treatment did not affect ek1 promoter activity in HepG2 cells. In conclusion, we showed that Sp1 and Sp3 are not only essential for the basal transcription of the ek1 gene, their accessibility to the target site on the ek1 promoter is regulated by histone protein modification in a cell line dependent manner.
Rac1 promotes chondrogenesis by regulating STAT3 signaling pathway.
Kim, Hyoin; Sonn, Jong Kyung
2016-09-01
The small GTPase protein Rac1 is involved in a wide range of biological processes including cell differentiation. Previously, Rac1 was shown to promote chondrogenesis in micromass cultures of limb mesenchyme. However, the pathways mediating Rac1's role in chondrogenesis are not fully understood. This study aimed to explore the molecular mechanisms by which Rac1 regulates chondrogenic differentiation. Phosphorylation of signal transducer and activator of transcription 3 (STAT3) was increased as chondrogenesis proceeded in micromass cultures of chick wing bud mesenchyme. Inhibition of Rac1 with NSC23766, janus kinase 2 (JAK2) with AG490, or STAT3 with stattic inhibited chondrogenesis and reduced phosphorylation of STAT3. Conversely, overexpression of constitutively active Rac1 (Rac L61) increased phosphorylation of STAT3. Rac L61 expression resulted in increased expression of interleukin 6 (IL-6), and treatment with IL-6 increased phosphorylation of STAT3. NSC23766, AG490, and stattic prohibited cell aggregation, whereas expression of Rac L61 increased cell aggregation, which was reduced by stattic treatment. Our studies indicate that Rac1 induces STAT3 activation through expression and action of IL-6. Overexpression of Rac L61 increased expression of bone morphogenic protein 4 (BMP4). BMP4 promoted chondrogenesis, which was inhibited by K02288, an activin receptor-like kinase-2 inhibitor, and increased phosphorylation of p38 MAP kinase. Overexpression of Rac L61 also increased phosphorylation of p38 MAPK, which was reduced by K02288. These results suggest that Rac1 activates STAT3 by expression of IL-6, which in turn increases expression and activity of BMP4, leading to the promotion of chondrogenesis. © 2016 International Federation for Cell Biology.
The Role of Training and Promotion to Increase The 3rd Party Funds Indonesian Islamic Banking
Directory of Open Access Journals (Sweden)
Rahmat Hidayat
2014-03-01
Full Text Available Objective – This study aims to determine whether the role of training is much larger than the promotion in raising third-party funds in Islamic banks in Indonesia given the cost of the training is spent is greater than the cost of promotion. This study empirically examines the relationship and impact of training and promotion to raise funds for a 3rd party in Indonesia Islamic banks.Methods – This study uses secondary data Islamic commercial banks in the form of panel (time-series and cross-section of Bank Indonesia data from 2010 until 2012. There are two independent variables training cost (X1 and promotion cost (X2 and one dependent variable is 3rd-party funds (Y. The analysis technique used path analysis to examine the role of training and the promotion of financial performance (The 3rd Party Funds.Result – Simultaneously, training and promotion gives an effect by 52%, and partially or individual training gives an insignificant negative effect, while the promotion has a significant positive impact on financial performance (financial-party funds on Islamic banking.Conclusion – The role of promotion is higher in raising The 3rd Party Funds than training. Keywords : Cost, Training, Promotion, The 3rd Party Funds
Energy Technology Data Exchange (ETDEWEB)
Sun, Yan-Ming [Department of Cardiac Care Unit, The First Affiliated Hospital of Harbin Medical University, Harbin 150001 (China); Su, Ying [Department of Endocrinology, The First Affiliated Hospital of Harbin Medical University, Harbin 150001 (China); Li, Jia; Tian, Ye [Department of Cardiac Care Unit, The First Affiliated Hospital of Harbin Medical University, Harbin 150001 (China); Wang, Lan-Feng, E-mail: wlfccu@126.com [Department of Cardiac Care Unit, The First Affiliated Hospital of Harbin Medical University, Harbin 150001 (China)
2012-10-19
Highlights: Black-Right-Pointing-Pointer NHE protect against intracellular hydrogen overload. Black-Right-Pointing-Pointer NHE protect {beta}-cells against strong acidification. Black-Right-Pointing-Pointer NHE inhibitors improve myocardial ischemia and reperfusion. -- Abstract: Micro- and macrovascular complications are the main cause of morbidity and mortality in diabetes mellitus. The Na{sup +}/H{sup +} exchanger (NHE) is a family of proteins which exchange Na{sup +} for H{sup +} according to their concentration gradients in an electroneutral manner. The exchanger also plays a key role in several other cellular functions including proliferation, differentiation, apoptosis, migration, and cytoskeletal organization. Since not much is known on the relationship between NHE and diabetes mellitus, this review outlines the contribution of NHE to chronic complications of diabetes mellitus, such as diabetic nephropathy; diabetic cardiomyopathy.
Directory of Open Access Journals (Sweden)
Sun Yuping
2016-03-01
Full Text Available Labor resource is the necessary productive factor in regional economic development, and one of important indexes to evaluate regional economic competitiveness. The great economic achievement brought by the 30-year reform and opening up of China is due to the fact that China brought the backward advantage of “demographic dividend” into play, promoted the fast development of industrialization and urbanization, and became the second largest economy in the world. The entity of “demographic dividend” is the non-agricultural migrant population, i.e., migrant workers. The transfer employment of migrant workers has typical regional liquidity, and the imbalance of regional economy causes the flow of many migrant workers. In order to achieve harmonious development and coordinated development, underdeveloped areas must understand the character and regulation, adopt positive industrial policy and supportive policy, guide the reasonable flow of migrant workers, and realize the transfer of local employment and citizenization of migrant workers, which can enhance regional economic competitiveness
Fanconi anemia core complex gene promoters harbor conserved transcription regulatory elements.
Meier, Daniel; Schindler, Detlev
2011-01-01
The Fanconi anemia (FA) gene family is a recent addition to the complex network of proteins that respond to and repair certain types of DNA damage in the human genome. Since little is known about the regulation of this novel group of genes at the DNA level, we characterized the promoters of the eight genes (FANCA, B, C, E, F, G, L and M) that compose the FA core complex. The promoters of these genes show the characteristic attributes of housekeeping genes, such as a high GC content and CpG islands, a lack of TATA boxes and a low conservation. The promoters functioned in a monodirectional way and were, in their most active regions, comparable in strength to the SV40 promoter in our reporter plasmids. They were also marked by a distinctive transcriptional start site (TSS). In the 5' region of each promoter, we identified a region that was able to negatively regulate the promoter activity in HeLa and HEK 293 cells in isolation. The central and 3' regions of the promoter sequences harbor binding sites for several common and rare transcription factors, including STAT, SMAD, E2F, AP1 and YY1, which indicates that there may be cross-connections to several established regulatory pathways. Electrophoretic mobility shift assays and siRNA experiments confirmed the shared regulatory responses between the prominent members of the TGF-β and JAK/STAT pathways and members of the FA core complex. Although the promoters are not well conserved, they share region and sequence specific regulatory motifs and transcription factor binding sites (TBFs), and we identified a bi-partite nature to these promoters. These results support a hypothesis based on the co-evolution of the FA core complex genes that was expanded to include their promoters.
Fanconi anemia core complex gene promoters harbor conserved transcription regulatory elements.
Directory of Open Access Journals (Sweden)
Daniel Meier
Full Text Available The Fanconi anemia (FA gene family is a recent addition to the complex network of proteins that respond to and repair certain types of DNA damage in the human genome. Since little is known about the regulation of this novel group of genes at the DNA level, we characterized the promoters of the eight genes (FANCA, B, C, E, F, G, L and M that compose the FA core complex. The promoters of these genes show the characteristic attributes of housekeeping genes, such as a high GC content and CpG islands, a lack of TATA boxes and a low conservation. The promoters functioned in a monodirectional way and were, in their most active regions, comparable in strength to the SV40 promoter in our reporter plasmids. They were also marked by a distinctive transcriptional start site (TSS. In the 5' region of each promoter, we identified a region that was able to negatively regulate the promoter activity in HeLa and HEK 293 cells in isolation. The central and 3' regions of the promoter sequences harbor binding sites for several common and rare transcription factors, including STAT, SMAD, E2F, AP1 and YY1, which indicates that there may be cross-connections to several established regulatory pathways. Electrophoretic mobility shift assays and siRNA experiments confirmed the shared regulatory responses between the prominent members of the TGF-β and JAK/STAT pathways and members of the FA core complex. Although the promoters are not well conserved, they share region and sequence specific regulatory motifs and transcription factor binding sites (TBFs, and we identified a bi-partite nature to these promoters. These results support a hypothesis based on the co-evolution of the FA core complex genes that was expanded to include their promoters.
Ndika, Joseph D T; Lusink, Vera; Beaubrun, Claudine; Kanhai, Warsha; Martinez-Munoz, Cristina; Jakobs, Cornelis; Salomons, Gajja S
2014-01-10
Interconversion between phosphocreatine and creatine, catalyzed by creatine kinase is crucial in the supply of ATP to tissues with high energy demand. Creatine's importance has been established by its use as an ergogenic aid in sport, as well as the development of intellectual disability in patients with congenital creatine deficiency. Creatine biosynthesis is complemented by dietary creatine uptake. Intracellular transport of creatine is carried out by a creatine transporter protein (CT1/CRT/CRTR) encoded by the SLC6A8 gene. Most tissues express this gene, with highest levels detected in skeletal muscle and kidney. There are lower levels of the gene detected in colon, brain, heart, testis and prostate. The mechanism(s) by which this regulation occurs is still poorly understood. A duplicated unprocessed pseudogene of SLC6A8-SLC6A10P has been mapped to chromosome 16p11.2 (contains the entire SLC6A8 gene, plus 2293 bp of 5'flanking sequence and its entire 3'UTR). Expression of SLC6A10P has so far only been shown in human testis and brain. It is still unclear as to what is the function of SLC6A10P. In a patient with autism, a chromosomal breakpoint that intersects the 5'flanking region of SLC6A10P was identified; suggesting that SLC6A10P is a non-coding RNA involved in autism. Our aim was to investigate the presence of cis-acting factor(s) that regulate expression of the creatine transporter, as well as to determine if these factors are functionally conserved upstream of the creatine transporter pseudogene. Via gene-specific PCR, cloning and functional luciferase assays we identified a 1104 bp sequence proximal to the mRNA start site of the SLC6A8 gene with promoter activity in five cell types. The corresponding 5'flanking sequence (1050 bp) on the pseudogene also had promoter activity in all 5 cell lines. Surprisingly the pseudogene promoter was stronger than that of its parent gene in 4 of the cell lines tested. To the best of our knowledge, this is the first
Indian Academy of Sciences (India)
Iot A a. (1) pH - 108. ------ -----. -200 -800 -400 O - 1200 -800 - 400 0. mV NHE mv NHE. Figure 3. CV of 1 and 2 at pH = 108. The voltammograms of compound 1 and 2 are more complex than, for example, those of methyl viologen. Shoulders, appearing in the CV's of 1 and 2, indicate competing reactions. Rapid reversible or ...
Schaffhauser, Daniel; Fine, Michael; Tabata, Miyuki; Goda, Tatsuro; Miyahara, Yuji
2016-03-30
We present a novel method for the rapid measurement of pH fluxes at close proximity to the surface of the plasma membrane in mammalian cells using an ion-sensitive field-effect transistor (ISFET). In conjuction with an efficient continuous superfusion system, the ISFET sensor was capable of recording rapid changes in pH at the cells' surface induced by intervals of ammonia loading and unloading, even when using highly buffered solutions. Furthermore, the system was able to isolate physiologically relevant signals by not only detecting the transients caused by ammonia loading and unloading, but display steady-state signals as would be expected by a proton transport-mediated influence on the extracellular proton-gradient. Proof of concept was demonstrated through the use of 5-(N-ethyl-N-isopropyl)amiloride (EIPA), a small molecule inhibitor of sodium/hydrogen exchangers (NHE). As the primary transporter responsible for proton balance during cellular regulation of pH, non-electrogenic NHE transport is notoriously difficult to detect with traditional methods. Using the NHE positive cell lines, Chinese hamster ovary (CHO) cells and NHE3-reconstituted mouse skin fibroblasts (MSF), the sensor exhibited a significant response to EIPA inhibition, whereas NHE-deficient MSF cells were unaffected by application of the inhibitor.
Oda, Saori; Yurimoto, Hiroya; Nitta, Nobuhisa; Sakai, Yasuyoshi
2016-05-01
The Hap complex of the methylotrophic yeast Candida boidinii was found to be required for methanol-regulated gene expression. In this study, we performed functional characterization of CbHap3p, one of the Hap complex components in C. boidinii. Sequence alignment of Hap3 proteins revealed the presence of a unique extended C-terminal region, which is not present in Hap3p from Saccharomyces cerevisiae (ScHap3p), but is found in Hap3p proteins of methylotrophic yeasts. Deletion of the C-terminal region of CbHap3p (Δ256-292 or Δ107-237) diminished activation of methanol-regulated genes and abolished the ability to grow on methanol, but did not affect nuclear localization or DNA-binding ability. However, deletion of the N-terminal region of CbHap3p (Δ1-20) led to not only a growth defect on methanol and a decreased level of methanol-regulated gene expression, but also impaired nuclear localization and binding to methanol-regulated gene promoters. We also revealed that CbHap3p could complement the growth defect of the Schap3Δ strain on glycerol, although ScHap3p could not complement the growth defect of a Cbhap3Δ strain on methanol. We conclude that the unique C-terminal region of CbHap3p contributes to maximum activation of methanol-regulated genes, whilst the N-terminal region is required for nuclear localization and binding to DNA.
The role of COMESA in promoting intra-regional agricultural trade: Case study of Sudan
Directory of Open Access Journals (Sweden)
Azharia Abdelbagi Elbushra
2011-06-01
Full Text Available African countries have created many regional trade agreements with the economic objectives of reducing trade barriers and encouraging economic growth. The COMESA is an example of regional integration singed on 1993 by 19 African countries including Sudan. COMESA represents a chance for member countries to enhance their economic and social relations through increasing intra-trade. The objective of this paper is to assess the role of COMESA in promoting intra-regional agricultural trade between Sudan and COMESA countries. A multi-market model with Armington non-linear specification was applied. The paper results showed that there is a great potential for Sudan to increase its agricultural exports to other COMESA countries. The domestic agricultural markets are expected to be hampered by imports surge and increase in competition, while the producers of agricultural export commodities will be better off. In order to compete and benefit from potential in the COMESA markets, the paper recommended improving efficiency in the Sudanese agricultural sector through increasing productivity, lowering cost of production, enhancing marketing services, attaining economies of scale and attracting foreign investment.
Conformity Adequacy Review: Region 3
Resources are for air quality and transportation government and community leaders. Information on the adequacy/inadequacy of state implementation plans (SIPs) in EPA Region 3 (DE, DC, MD, PA, VA, WV) is provided here.
Xu, Meixiang; Nekhayeva, Ilona; Cross, Courtney E; Rondelli, Catherine M; Wickliffe, Jeffrey K; Abdel-Rahman, Sherif Z
2014-03-01
The O6-methylguanine-DNA methyltransferase gene (MGMT) encodes the direct reversal DNA repair protein that removes alkyl adducts from the O6 position of guanine. Several single-nucleotide polymorphisms (SNPs) exist in the MGMT promoter/enhancer (P/E) region. However, the haplotype structure encompassing these SNPs and their functional/biological significance are currently unknown. We hypothesized that MGMT P/E haplotypes, rather than individual SNPs, alter MGMT transcription and can thus alter human sensitivity to alkylating agents. To identify the haplotype structure encompassing the MGMT P/E region SNPs, we sequenced 104 DNA samples from healthy individuals and inferred the haplotypes using the data generated. We identified eight SNPs in this region, namely T7C (rs180989103), T135G (rs1711646), G290A (rs61859810), C485A (rs1625649), C575A (rs113813075), G666A (rs34180180), C777A (rs34138162) and C1099T (rs16906252). Phylogenetics and Sequence Evolution analysis predicted 21 potential haplotypes that encompass these SNPs ranging in frequencies from 0.000048 to 0.39. Of these, 10 were identified in our study population as 20 paired haplotype combinations. To determine the functional significance of these haplotypes, luciferase reporter constructs representing these haplotypes were transfected into glioblastoma cells and their effect on MGMT promoter activity was determined. Compared with the most common (reference) haplotype 1, seven haplotypes significantly upregulated MGMT promoter activity (18-119% increase; P alkylating agents.
Identiifcation and validation of root-speciifc promoters in rice
Institute of Scientific and Technical Information of China (English)
HUANG Li-yu; ZHANG Fan; QIN Qiao; WANG Wen-sheng; ZHANG Ting; FU Bin-ying
2015-01-01
Novel promoters that confer root-speciifc expression would be useful for engineering resistance against problems of nutrient and water absorption by roots. In this study, the reverse transcriptase polymerase chain reaction was used to identify seven genes with root-speciifc expression in rice. The isolation and characterization of upstream promoter regions of ifve selected genes rice root-speciifc promoter (rRSP) 1 to 5 (rRSP1-rRSP5) and A2P (the promoter ofOsAct2) revealed that rRSP1, rRSP3, and rRSP5 are particularly important with respect to root-speciifc activities. Furthermore, rRSP1, rRSP3, and rRSP5 were observed to make different contributions to root activities in various species. These three promoters could be used for root-speciifc enhancement of target gene(s).
Mishra, Sonal; Shukla, Aparna; Upadhyay, Swati; Sanchita; Sharma, Pooja; Singh, Seema; Phukan, Ujjal J; Meena, Abha; Khan, Feroz; Tripathi, Vineeta; Shukla, Rakesh Kumar; Shrama, Ashok
2014-04-01
Plants posses a complex co-regulatory network which helps them to elicit a response under diverse adverse conditions. We used an in silico approach to identify the genes with both DRE and ABRE motifs in their promoter regions in Arabidopsis thaliana. Our results showed that Arabidopsis contains a set of 2,052 genes with ABRE and DRE motifs in their promoter regions. Approximately 72% or more of the total predicted 2,052 genes had a gap distance of less than 400 bp between DRE and ABRE motifs. For positional orientation of the DRE and ABRE motifs, we found that the DR form (one in direct and the other one in reverse orientation) was more prevalent than other forms. These predicted 2,052 genes include 155 transcription factors. Using microarray data from The Arabidopsis Information Resource (TAIR) database, we present 44 transcription factors out of 155 which are upregulated by more than twofold in response to osmotic stress and ABA treatment. Fifty-one transcripts from the one predicted above were validated using semiquantitative expression analysis to support the microarray data in TAIR. Taken together, we report a set of genes containing both DRE and ABRE motifs in their promoter regions in A. thaliana, which can be useful to understand the role of ABA under osmotic stress condition. © 2013 Institute of Botany, Chinese Academy of Sciences.
Kinoshita, Yumiko; Kizaki, Zenro; Ishihara, Yasunori; Nakajima, Hisakazu; Adachi, Shinsuke; Kosaka, Kitaro; Kinugasa, Akihiko; Sugimoto, Tohru
2007-01-01
Evidence is accumulating that the promoter region of the insulin-like growth factor I (IGF-I) gene polymorphism and low levels of IGF-I are associated with type 2 diabetes, cardiovascular disease and birth weight; however, the number of wild-type alleles is different in each country. This study aimed to examine the 737/738 marker, a cytosine-adenine repeat in the promoter region of the IGF-I gene polymorphism, and plasma IGF-I levels in Japanese infants and analyze the genetic background. Data were collected for 15 months in Kyoto Prefectural University of Medicine. The body composition parameters of all infants were determined at birth. At 5 days after birth, we took blood samples to measure the product size of the promoter region of the IGF-I gene polymorphism and plasma IGF-I. In a population-based sample of 160 subjects, 6 different alleles and 16 genotypes were identified in the promoter region of the IGF-I gene polymorphism. The existence of a 196-bp allele has proved to result in a low plasma IGF-I level, a small head and chest circumference (p body composition parameters in Japanese infants. Our results suggest genetical influence on prenatal growth and serum IGF-I levels.
DEFF Research Database (Denmark)
Hernandez Castellano, Lorenzo E; Morales-delaNuez, Antonio; Moreno-Indias, Isabel
2013-01-01
of this study, therefore, was to evaluate local and imported carcasses and meat quality in order to promote the consumption of local breeds, using the Canary Islands (Spain) as a model for other subtropical outermost regions. For this study 20 half-carcasses from Palmera breed and 20 imported half...
Doyle, Joyce; Atkinson-Briggs, Sharon; Atkinson, Petah; Firebrace, Bradley; Calleja, Julie; Reilly, Rachel; Cargo, Margaret; Riley, Therese; Crumpen, Tui; Rowley, Kevin
2016-11-10
Aboriginal Community Controlled Organisations (ACCOs) provide community-focussed and culturally safe services for First Peoples in Australia, including crisis intervention and health promotion activities, in a holistic manner. The ecological model of health promotion goes some way towards describing the complexity of such health programs. The aims of this project were to: 1) identify the aims and purpose of existing health promotion programs conducted by an alliance of ACCOs in northern Victoria, Australia; and 2) evaluate the extent to which these programs are consistent with an ecological model of health promotion, addressing both individual and environmental determinants of health. The project arose from a long history of collaborative research. Three ACCOs and a university formed the Health Promotion Alliance to evaluate their health promotion programs. Local community members were trained in, and contributed to developing culturally sensitive methods for, data collection. Information on the aims and design of 88 health promotion activities making up 12 different programs across the ACCOs was systematically and prospectively collected. There was a wide range of activities addressing environmental and social determinants of health, as well as physical activity, nutrition and weight loss. The design of the great majority of activities had a minimal Western influence and were designed within a local Aboriginal cultural framework. The most common focus of the activities was social connectedness (76 %). Physical activity was represented in two thirds of the activities, and nutrition, weight loss and culture were each a focus of about half of the activities. A modified coding procedure designed to assess the ecological nature of these programs showed that they recruited from multiple settings; targeted a range of individual, social and environmental determinants; and used numerous and innovative strategies to achieve change. First Peoples' health promotion in the
Tissue specific promoters improve the localization of radiation-inducible gene expression
International Nuclear Information System (INIS)
Hallahan, Dennis; Kataoka, Yasushi; Kuchibhotla, Jaya; Virudachalam, Subbu; Weichselbaum, Ralph
1996-01-01
Purpose: Site-specific activation of gene expression can be achieved by the use of a promoter that is induced by physical agents such as x-rays. The purpose of the present study was to determine whether site-specific activation of gene therapy can also be achieved within the vascular endothelium by use of radiation-inducible promoters. We studied induction of promoter-reporter gene constructs using previously identified radiation-promoters from c-jun, c-fos, Egr-1, ICAM-1, ELAM-1 after transfection into in the vascular endothelium. Methods: The following radiation-inducible genetic constructs were created: The ELAM-1 promoter fragment was cloned into pOGH to obtain the pE-sel(-587 +35)GH reporter construct. The ICAM-1 promoter fragment (-1162/+1) was cloned upstream of the CAT coding region of the pCAT-plasmid (Promega) after removal of the SV40 promoter by Bgl2/Stu1 digestion to create the pBS-CAT plasmid. The 132 to +170 bp segment of the 5' untranslated region of the c-jun promoter was cloned to the CAT reporter gene to create the -132/+170 cjun-CAT. The Egr-1 promoter fragment (-425/+75) was cloned upstream of the CAT coding region to create the pE425-CAT plasmid. Tandem repeats of the AP-1 binding site were cloned upstream of the CAT coding region (3 xTRE-CAT). Tandem repeats of the Egr binding site (EBS) were cloned upstream of the CAT coding region (EBS-CAT). Human vascular endothelial cells from both large vessel and small vessel origin (HUVEC and HMEC), as well as human tumor cell lines were transfected with plasmids -132/+170 cjun-CAT, pE425-CAT, 3 xTRE-CAT, EBS-CAT, pE-sel-GH and pBS-CAT by use of liposomes. Humor tumor cell lines included SQ20B (squamous), RIT3 (sarcoma), and HL525 (leukemia). Each plasmid was cotransfected with a plasmid containing a CMV promoter linked to the LacZ gene (1 μg). Transfected cells were treated with mock irradiation or x-rays. Cell extracts were assayed for reporter gene expression. Results: Radiation-induced gene
Geoheritage promotion of Thonon-les-Bains (Fr) region by the development of a geotourism product
Fanguin, Pauline
2014-05-01
Since 2012, the Chablais region (only in France) has acquired the Geopark label. This Geopark contributes to sustainable economic development of the region through geotourism. Moreover, the three Chablais (figure 1) are concerned by an Interreg IV program since 2009 (program of cooperation between European countries). The main objective of this program is to enhance the heritage resources (nature, culture and lifestyle of the region) (www.interreg-francesuisse.org). Therefore, the geotourism offer in this area just waiting to expand. The geodidactics models like the simplification of the scientific content are essential for geoheritage promotion, because this content must be available to a wide audience, allowing thereby the geoheritage recognition. The geotourism permits to apply different models (Cayla et al. 2010, Sellier, 2009) through a wide range of geotourism products, like guide, educational panels, thematic hikes and recently developed, new medias (website, smartphone applications). A geotourism product is based on four areas of questioning and was developed by Martin et al. (2010): (1) site (choice of sites to be valued), (2) public (a family public, good example of heterogeneous public), (3) contents (reasoning on geodidactics models) and (4) support (smartphone application). These four areas are very fundamental before the creation of any geotourism product. These reflexions aim to obtain a mediation product that integrates into geotourism offer of a region and contributes to its development and meets public expectations. New media, such as digital media - smartphone, tablets, website - become geotourism products more and more attractive. In addition, the necessary technologies to develop new media help to integrate a high interactivity potential with the public and thus get their attention. The architecture of this geotourism product is based on the new application developed by the Institute of Geography and sustainability, and the Bureau Relief. One
Verma, Vivek; Singh, Nirmal; Jaggi, Amteshwar Singh
2014-02-01
The involvement of sodium-hydrogen exchangers (NHE) has been described in the pathophysiology of diseases including ischemic heart and brain diseases, cardiomyopathy, congestive heart failure, epilepsy, dementia, and neuropathic pain. Synthetic NHE inhibitors have not achieved much clinical success; therefore, plant-derived phytoconstituents may be explored as NHE inhibitors. In the present study, the NHE inhibitory potential of hydroalcoholic and alkaloidal fractions of Malus domestica, Musa × paradisiaca, Daucus carota, and Symphytum officinale was evaluated. The different concentrations of hydroalcoholic and alkaloidal extracts of the selected plants were evaluated for their NHE inhibitory activity in the platelets using the optical swelling assay. Among the hydroalcoholic extracts, the highest NHE inhibitory activity was shown by M. domestica (IC50=2.350 ± 0.132 μg/mL) followed by Musa × paradisiaca (IC50=7.967 ± 0.451 μg/mL), D. carota (IC50=37.667 ± 2.517 μg/mL), and S. officinale (IC50=249.330 ± 1.155 μg/mL). Among the alkaloidal fractions, the highest NHE inhibitory activity was shown by the alkaloidal fraction of Musa × paradisiacal (IC50=0.010 ± 0.001 μg/mL) followed by D. carota (IC50=0.024 ± 0.002 μg/mL), M. domestica (IC50=0.031 ± 0.005 μg/mL), and S. officinale (IC50=4.233 ± 0.379 μg/mL). The IC50 of alkaloidal fractions was comparable to the IC50 of synthetic NHE inhibitor, EIPA [5-(N-ethyl-N-isopropyl)amiloride] (IC50=0.033 ± 0.004 μg/mL). It may be concluded that the alkaloidal fractions of these plants possess potent NHE inhibitory activity and may be exploited for their therapeutic potential in NHE activation-related pathological complications.
Yan, Jing; Liu, Chuan; Jiang, Jing-Yi; Liu, Hans; Li, Chao; Li, Xin-Yu; Yuan, Ye; Zong, Zhi-Hong; Wang, Hua-Qin
2017-10-01
Bcl-2 associated athanogene 3 (BAG3) contains a modular structure, through which BAG3 interacts with a wide range of proteins, thereby affording its capacity to regulate multifaceted biological processes. BAG3 is often highly expressed and functions as a pro-survival factor in many cancers. However, the oncogenic potential of BAG3 remains not fully understood. The cell cycle regulator, S-phase kinase associated protein 2 (Skp2) is increased in various cancers and plays an important role in tumorigenesis. The current study demonstrated that BAG3 promoted proliferation of ovarian cancer cells via upregulation of Skp2. BAG3 stabilized Skp2 mRNA via its 3'-untranslated region (UTR). The current study demonstrated that BAG3 interacted with Skp2 mRNA. In addition, miR-21-5p suppressed Skp2 expression, which was compromised by forced BAG3 expression. These results indicated that at least some oncogenic functions of BAG3 were mediated through posttranscriptional regulation of Skp2 via antagonizing suppressive action of miR-21-5p in ovarian cancer cells. Copyright © 2017 Elsevier B.V. All rights reserved.
Penta Rao, Tamarba; Rajendra Prasad, P.
2018-04-01
Entry region swirl promoters gain importance in industry because of its effectiveness in augmentation of mass and heat transfer augmentation. Design of equipment needs momentum transfer data along with mass or heat transfer data. Hence an experimental investigation was carried out with coaxially placed entry region spiral coil as turbulence promoters on momentum transfer in forced convection flow of electrolyte in circular conduits. Aqueous solution of sodium hydroxide and 0.01 M equimolal Ferri-ferro cyanide system was chosen for the study. The study covered parameters like effect of pitch of the coil, effect of length of the coil, diameter of the coil, diameter of the coil wire, diameter of the annular rod. The promoter is measured by limiting current technique using diffusion controlled electrochemical reactions. The study comprises of evaluation of momentum transfer rates at the outer wall of the electrochemical cell. Pressure drop measurements were also made to obtain the energy consumption pattern. Within the range of variables covered. The results are correlated by the momentum transfer similarity function. Momentum transfer coefficients were evaluated from measured limiting currents. Effect of each parameter was studied in terms of friction factor. A model was developed for momentum transfer. The experimental data on momentum transfer was modeled in terms of momentum transfer function and Reynolds number, geometric parameters.
Zhang, Honglian; Gan, Haiyun; Wang, Zhiquan; Lee, Jeong-Heon; Zhou, Hui; Ordog, Tamas; Wold, Marc S; Ljungman, Mats; Zhang, Zhiguo
2017-01-19
The histone chaperone HIRA is involved in depositing histone variant H3.3 into distinct genic regions, including promoters, enhancers, and gene bodies. However, how HIRA deposits H3.3 to these regions remains elusive. Through a short hairpin RNA (shRNA) screening, we identified single-stranded DNA binding protein replication protein A (RPA) as a regulator of the deposition of newly synthesized H3.3 into chromatin. We show that RPA physically interacts with HIRA to form RPA-HIRA-H3.3 complexes, and it co-localizes with HIRA and H3.3 at gene promoters and enhancers. Depletion of RPA1, the largest subunit of the RPA complex, dramatically reduces both HIRA association with chromatin and the deposition of newly synthesized H3.3 at promoters and enhancers and leads to altered transcription at gene promoters. These results support a model whereby RPA, best known for its role in DNA replication and repair, recruits HIRA to promoters and enhancers and regulates deposition of newly synthesized H3.3 to these regulatory elements for gene regulation. Copyright © 2017 Elsevier Inc. All rights reserved.
Feng, Ying; Wang, Zheng; Bao, Zhaoshi; Yan, Wei; You, Gan; Wang, Yinyan; Hu, Huimin; Zhang, Wei; Zhang, Quangeng; Jiang, Tao
2014-01-01
Hypermethylation of the suppressor of cytokine signaling 3(SOCS3) promoter has been reported to predict a poor prognosis in several cancers including glioblastoma multiforme (GBM). We explored the function of SOCS3 promoter hypermethylation in GBM cohorts, including analysis of the CpG island methylator phenotype (CIMP), when a large number of gene loci are simultaneously hypermethylated. A whole genome promoter methylation profile was performed in a cohort of 33 GBM samples, with 13 long-term survivors (LTS; overall survival ≥ 18 months) and 20 short-term survivors (STS; overall survival ≤ 9 months). The SOCS3 promoter methylation status was compared between the two groups. In addition, we investigated the relationship of SOCS3 promoter methylation and G-CIMP status. Interestingly, in our present study, we found that SOCS3 promoter methylation was statistically significantly higher in the 13 LTS than that in the 20 STS. Furthermore, high SOCS3 promoter methylation detected via pyro-sequencing predicted a better prognosis in an independent cohort containing 62 GBM patients. This correlation was validated by the dataset from the Cancer Genome Atlas(TCGA) and the Chinese Cancer Genome Atlas(CGGA). In addition, we found that hypermethylation of the SOCS3 promoter was tightly associated with the G-CIMP-positive GBM patients. Using a total of 359 clinical samples, we demonstrate that SOCS3 promoter hypermethylation status has a favorable prognostic value in GBM patients because of whole genome methylation status. Particularly, the hypermethylation of the SOCS3 promoter indicates positive G-CIMP status.
Directory of Open Access Journals (Sweden)
Ying Feng
Full Text Available Hypermethylation of the suppressor of cytokine signaling 3(SOCS3 promoter has been reported to predict a poor prognosis in several cancers including glioblastoma multiforme (GBM. We explored the function of SOCS3 promoter hypermethylation in GBM cohorts, including analysis of the CpG island methylator phenotype (CIMP, when a large number of gene loci are simultaneously hypermethylated.A whole genome promoter methylation profile was performed in a cohort of 33 GBM samples, with 13 long-term survivors (LTS; overall survival ≥ 18 months and 20 short-term survivors (STS; overall survival ≤ 9 months. The SOCS3 promoter methylation status was compared between the two groups. In addition, we investigated the relationship of SOCS3 promoter methylation and G-CIMP status.Interestingly, in our present study, we found that SOCS3 promoter methylation was statistically significantly higher in the 13 LTS than that in the 20 STS. Furthermore, high SOCS3 promoter methylation detected via pyro-sequencing predicted a better prognosis in an independent cohort containing 62 GBM patients. This correlation was validated by the dataset from the Cancer Genome Atlas(TCGA and the Chinese Cancer Genome Atlas(CGGA. In addition, we found that hypermethylation of the SOCS3 promoter was tightly associated with the G-CIMP-positive GBM patients.Using a total of 359 clinical samples, we demonstrate that SOCS3 promoter hypermethylation status has a favorable prognostic value in GBM patients because of whole genome methylation status. Particularly, the hypermethylation of the SOCS3 promoter indicates positive G-CIMP status.
Direct detection of toxigenic Bacillus cereus in dietary complement for children and cassava starch
Directory of Open Access Journals (Sweden)
Jnnifer A. Sánchez
2014-05-01
Full Text Available Bacillus cereus is a food contaminant and a known human pathogen that can cause emetic and diarrheal syndromes. In this study we evaluated the presence of toxigenic B. cereus by multiplex PCR directly in dietary complement for children and cassava starch samples collected on Medellin, Colombia. Of 75 dietary complement for children samples evaluated, 70.7% were contaminated with toxigenic B. cereus and four different toxigenic consortia were detected: I: nheA, hblC, cytK (9.8%, II: nheA, hblC (2%, III: hblC, cytK (41.2%, IV: hblC (47%. Of 75 cassava starch samples, 44% were contaminated with toxigenic B. cereus and four different toxigenic consortia were determined: I: nheA, hblC, cytK (48.5%, II: nheA, hblC, cytK, cesB (3%, III: hblC, cytK (30.3%, IV: hblC (18.2%. In general, in dietary complement for children only enterotoxigenic consortia were detected while in cassava starch the enterotoxigenic consortia predominated over the emetic. Multiplex PCR was useful to detect toxigenic B. cereus contamination allowing direct and imultaneous detection of all toxin genes in foods. This study is the first in Colombia to evaluate toxigenic B. cereus, providing information of importance for microbiological risk evaluation in dried foods.
Huang, Wei; Zhang, Jianshe; Liao, Zhi; Lv, Zhenming; Wu, Huifei; Zhu, Aiyi; Wu, Changwen
2016-01-15
Gonadotropin-releasing hormone III (GnRH3) is considered to be a key neurohormone in fish reproduction control. In the present study, the cDNA and genomic sequences of GnRH3 were cloned and characterized from large yellow croaker Larimichthys crocea. The cDNA encoded a protein of 99 amino acids with four functional motifs. The full-length genome sequence was composed of 3797 nucleotides, including four exons and three introns. Higher identities of amino acid sequences and conserved exon-intron organizations were found between LcGnRH3 and other GnRH3 genes. In addition, some special features of the sequences were detected in partial species. For example, two specific residues (V and A) were found in the family Sciaenidae, and the unique 75-72 bp type of the open reading frame 2 and 3 existed in the family Cyprinidae. Analysis of the 2576 bp promoter fragment of LcGnRH3 showed a number of transcription factor binding sites, such as AP1, CREB, GATA-1, HSF, FOXA2, and FOXL1. Promoter functional analysis using an EGFP reporter fusion in zebrafish larvae presented positive signals in the brain, including the olfactory region, the terminal nerve ganglion, the telencephalon, and the hypothalamus. The expression pattern was generally consistent with the endogenous GnRH3 GFP-expressing transgenic zebrafish lines, but the details were different. These results indicate that the structure and function of LcGnRH3 are generally similar to the other teleost GnRH3 genes, but there exist some distinctions among them. Copyright © 2015 Elsevier B.V. All rights reserved.
Saify, Khyber; Saadat, Iraj; Saadat, Mostafa
2014-11-30
Within the core promoter region of prodynorphin (PDYN), a 68-bp sequence was found to occur as a polymorphism element, either singular or as tandemly repeated two, three or four times. We report the sequence of a novel allele (5-repeats). Our study revealed the existence of an ancestral nucleotide (A) at 29th position of the VNTR in human. In total, 442 heroin addicts and 799 controls were included in this study. The present findings revealed a male-limited association between VNTR polymorphism and heroin dependence risk. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.
CO Reduction to CH3OSiMe3: Electrophile-Promoted Hydride Migration at a Single Fe Site.
Deegan, Meaghan M; Peters, Jonas C
2017-02-22
One of the major challenges associated with developing molecular Fischer-Tropsch catalysts is the design of systems that promote the formation of C-H bonds from H 2 and CO while also facilitating the release of the resulting CO-derived organic products. To this end, we describe the synthesis of reduced iron-hydride/carbonyl complexes that enable an electrophile-promoted hydride migration process, resulting in the reduction of coordinated CO to a siloxymethyl (L n Fe-CH 2 OSiMe 3 ) group. Intramolecular hydride-to-CO migrations are extremely rare, and to our knowledge the system described herein is the first example where such a process can be accessed from a thermally stable M(CO)(H) complex. Further addition of H 2 to L n Fe-CH 2 OSiMe 3 releases CH 3 OSiMe 3 , demonstrating net four-electron reduction of CO to CH 3 OSiMe 3 at a single Fe site.
Concerted action of sphingomyelinase and non-hemolytic enterotoxin in pathogenic Bacillus cereus.
Directory of Open Access Journals (Sweden)
Viktoria M Doll
Full Text Available Bacillus cereus causes food poisoning and serious non-gastrointestinal-tract infections. Non-hemolytic enterotoxin (Nhe, which is present in most B. cereus strains, is considered to be one of the main virulence factors. However, a B. cereus ΔnheBC mutant strain lacking Nhe is still cytotoxic to intestinal epithelial cells. In a screen for additional cytotoxic factors using an in vitro model for polarized colon epithelial cells we identified B. cereus sphingomyelinase (SMase as a strong inducer of epithelial cell death. Using single and double deletion mutants of sph, the gene encoding for SMase, and nheBC in B. cereus we demonstrated that SMase is an important factor for B. cereus cytotoxicity in vitro and pathogenicity in vivo. SMase substantially complemented Nhe induced cytotoxicity in vitro. In addition, SMase but not Nhe contributed significantly to the mortality rate of larvae in vivo in the insect model Galleria mellonella. Our study suggests that the role of B. cereus SMase as a secreted virulence factor for in vivo pathogenesis has been underestimated and that Nhe and SMase complement each other significantly to cause full B. cereus virulence hence disease formation.
Braun, Kathryn L; Nigg, Claudio R; Fialkowski, Marie K; Butel, Jean; Hollyer, James R; Barber, L Robert; Bersamin, Andrea; Coleman, Patricia; Teo-Martin, Ursula; Vargo, Agnes M; Novotny, Rachel
2014-12-01
Almost 40% of children are overweight or obese by age 8 years in the US-Affiliated Pacific, inclusive of the five jurisdictions of Alaska, Hawaii, American Samoa, Guam, and the Commonwealth of the Northern Mariana Islands. This article describes how the Children's Healthy Living (CHL) Program used the ANGELO (Analysis Grid for Environments/Elements Linked to Obesity) model to design a regional intervention to increase fruit and vegetable intake, water consumption, physical activity, and sleep duration and decrease recreational screen time and sugar-sweetened beverage consumption in young children ages 2-8 years. Using the ANGELO model, CHL (1) engaged community to identify preferred intervention strategies, (2) reviewed scientific literature, (3) merged findings from community and literature, and (4) formulated the regional intervention. More than 900 community members across the Pacific helped identify intervention strategies on importance and feasibility. Nine common intervention strategies emerged. Participants supported the idea of a regional intervention while noting that cultural and resource differences would require flexibility in its implementation in the five jurisdictions. Community findings were merged with the effective obesity-reducing strategies identified in the literature, resulting in a regional intervention with four cross-cutting functions: (1) initiate or strengthen school wellness policies; (2) partner and advocate for environmental change; (3) promote CHL messages; and (4) train trainers to promote CHL behavioral objectives for children ages 2-8 years. These broad functions guided intervention activities and allowed communities to tailor activities to maximize intervention fit. Using the ANGELO model assured that the regional intervention was evidence based while recognizing jurisdiction context, which should increase effectiveness and sustainability.
DNMT3B -579 G>T Promoter Polymorphism and the Risk of Gastric Cancer in the West of Iran.
Ahmadi, Kulsom; Soleimani, Azam; Irani, Shiva; Kiani, Aliasghar; Ghanadi, Kourosh; Noormohamadi, Zahra; Sakinejad, Foroozan
2018-06-01
Many studies have suggested that modulation of DNMT3B function caused by single nucleotide polymorphisms of the DNMT3B promoter region may underlie the susceptibility to various cancers such as tumors of the digestive system. The aim of this study was to investigate the effect of -579 G>T polymorphism in the promoter of the DNMT3B gene on risk of gastric cancer in a population from West Iran. We conducted a case-control study in 100 gastric cancer patients and 112 cancer-free controls to assess the correlation between DNMT3B -579 G>T (rs1569686) polymorphism and the risk of gastric cancer. Detection of genotypes of DNMT3B G39179T polymorphism was analyzed by PCR-RFLP. There was no significant difference in the distribution of DNMT3B -579 G>T genotypes between the cases and controls. However, in the stratified analysis by clinicopathological characteristic types, we found that statistically, the risk susceptibility to gastric cancer was significantly associated with tumor grade II and GT/TT genotype of patients, compared to patients having GG genotype, (OR = 5.4737, 95% CI = 1.4746. 20.3184, P = 0.01). Our study suggested that the -579 T allele may increase the relative risk for the progression of clinicopathological characteristic of tumor grade of gastric cancer patients.
Exploring strain-promoted 1,3-dipolar cycloadditions of end functionalized polymers
Ledin, Petr A; Kolishetti, Nagesh; Hudlikar, Manish S; Boons, Geert-Jan
2014-01-01
Strain-promoted 1,3-dipolar cycloaddition of cyclooctynes with 1,3-dipoles such as azides, nitrones, and nitrile oxides, are of interest for the functionalization of polymers. In this study, we have explored the use of a 4-dibenzocyclooctynol (DIBO)-containing chain transfer agent in reversible
Matsutani Sachiko
2004-01-01
Abstract Background In eukaryotes, RNA polymerase III (RNAP III) transcribes the genes for small RNAs like tRNAs, 5S rRNA, and several viral RNAs, and short interspersed repetitive elements (SINEs). The genes for these RNAs and SINEs have internal promoters that consist of two regions. These two regions are called the A and B blocks. The multisubunit transcription factor TFIIIC is required for transcription initiation of RNAP III; in transcription of tRNAs, the B-block binding subunit of TFII...
Histone deacetylase-mediated regulation of endolysosomal pH.
Prasad, Hari; Rao, Rajini
2018-05-04
The pH of the endolysosomal system is tightly regulated by a balance of proton pump and leak mechanisms that are critical for storage, recycling, turnover, and signaling functions in the cell. Dysregulation of endolysosomal pH has been linked to aging, amyloidogenesis, synaptic dysfunction, and various neurodegenerative disorders, including Alzheimer's disease. Therefore, understanding the mechanisms that regulate luminal pH may be key to identifying new targets for managing these disorders. Meta-analysis of yeast microarray databases revealed that nutrient-limiting conditions inhibited the histone deacetylase (HDAC) Rpd3 and thereby up-regulated transcription of the endosomal Na + /H + exchanger Nhx1, resulting in vacuolar alkalinization. Consistent with these findings, Rpd3 inhibition by the HDAC inhibitor and antifungal drug trichostatin A induced Nhx1 expression and vacuolar alkalinization. Bioinformatics analysis of Drosophila and mouse databases revealed that caloric control of the Nhx1 orthologs DmNHE3 and NHE6, respectively, is also mediated by HDACs. We show that NHE6 is a target of the transcription factor cAMP-response element-binding protein (CREB), a known regulator of cellular responses to low-nutrient conditions, providing a molecular mechanism for nutrient- and HDAC-dependent regulation of endosomal pH. Of note, pharmacological targeting of the CREB pathway to increase NHE6 expression helped regulate endosomal pH and correct defective clearance of amyloid Aβ in an apoE4 astrocyte model of Alzheimer's disease. These observations from yeast, fly, mouse, and cell culture models point to an evolutionarily conserved mechanism for HDAC-mediated regulation of endosomal NHE expression. Our insights offer new therapeutic strategies for modulation of endolysosomal pH in fungal infection and human disease. © 2018 Prasad and Rao.
Directory of Open Access Journals (Sweden)
Aaron Goldman
Full Text Available Apoptosis resistance is a hallmark of cancer cells. Typically, bile acids induce apoptosis. However during gastrointestinal (GI tumorigenesis the cancer cells develop resistance to bile acid-induced cell death. To understand how bile acids induce apoptosis resistance we first need to identify the molecular pathways that initiate apoptosis in response to bile acid exposure. In this study we examined the mechanism of deoxycholic acid (DCA-induced apoptosis, specifically the role of Na(+/H(+ exchanger (NHE and Na(+ influx in esophageal cells. In vitro studies revealed that the exposure of esophageal cells (JH-EsoAd1, CP-A to DCA (0.2 mM-0.5 mM caused lysosomal membrane perturbation and transient cytoplasmic acidification. Fluorescence microscopy in conjunction with atomic absorption spectrophotometry demonstrated that this effect on lysosomes correlated with influx of Na(+, subsequent loss of intracellular K(+, an increase of Ca(2+ and apoptosis. However, ethylisopropyl-amiloride (EIPA, a selective inhibitor of NHE, prevented Na(+, K(+ and Ca(2+ changes and caspase 3/7 activation induced by DCA. Ouabain and amphotericin B, two drugs that increase intracellular Na(+ levels, induced similar changes as DCA (ion imbalance, caspase3/7 activation. On the contrary, DCA-induced cell death was inhibited by medium with low a Na(+ concentrations. In the same experiments, we exposed rat ileum ex-vivo to DCA with or without EIPA. Severe tissue damage and caspase-3 activation was observed after DCA treatment, but EIPA almost fully prevented this response. In summary, NHE-mediated Na(+ influx is a critical step leading to DCA-induced apoptosis. Cells tolerate acidification but evade DCA-induced apoptosis if NHE is inhibited. Our data suggests that suppression of NHE by endogenous or exogenous inhibitors may lead to apoptosis resistance during GI tumorigenesis.
FoxO3A promotes metabolic adaptation to hypoxia by antagonizing Myc function
DEFF Research Database (Denmark)
Jensen, Kim Steen; Binderup, Tina; Jensen, Klaus Thorleif
2011-01-01
Exposure of metazoan organisms to hypoxia engages a metabolic switch orchestrated by the hypoxia-inducible factor 1 (HIF-1). HIF-1 mediates induction of glycolysis and active repression of mitochondrial respiration that reduces oxygen consumption and inhibits the production of potentially harmful...... tumour tissue in vivo and that FoxO3A short-hairpin RNA (shRNA)-expressing xenograft tumours are decreased in size and metabolically changed. Our findings define a novel mechanism by which FoxO3A promotes metabolic adaptation and stress resistance in hypoxia....... reactive oxygen species (ROS). Here, we show that FoxO3A is activated in hypoxia downstream of HIF-1 and mediates the hypoxic repression of a set of nuclear-encoded mitochondrial genes. FoxO3A is required for hypoxic suppression of mitochondrial mass, oxygen consumption, and ROS production and promotes...... cell survival in hypoxia. FoxO3A is recruited to the promoters of nuclear-encoded mitochondrial genes where it directly antagonizes c-Myc function via a mechanism that does not require binding to the consensus FoxO recognition element. Furthermore, we show that FoxO3A is activated in human hypoxic...
Comparative analysis of myostatin gene and promoter sequences of Qinchuan and Red Angus cattle.
He, Y L; Wu, Y H; Quan, F S; Liu, Y G; Zhang, Y
2013-09-04
To better understand the function of the myostatin gene and its promoter region in bovine, we amplified and sequenced the myostatin gene and promoter from the blood of Qinchuan and Red Angus cattle by using polymerase chain reaction. The sequences of Qinchuan and Red Angus cattle were compared with those of other cattle breeds available in GenBank. Exon splice sites were confirmed by mRNA sequencing. Compared to the published sequence (GenBank accession No. AF320998), 69 single nucleotide polymorphisms (SNPs) were identified in the Qinchuan myostatin gene, only one of which was an insertion mutation in Qinchuan cattle. There was a 16-bp insertion in the first 705-bp intron in 3 Qinchuan cattle. A total of 7 SNPs were identified in exon 3, in which the mutation occurred in the third base of the codon and was synonymous. On comparing the Qinchuan myostatin gene sequence to that of Red Angus cattle, a total of 50 SNPs were identified in the first and third exons. In addition, there were 18 SNPs identified in the Qinchuan cattle promoter region compared with those of other cattle compared to the Red Angus cattle myostatin promoter region. breeds (GenBank accession No. AF348479), but only 14 SNPs when compared to the Red Angus cattle myostatin promoter region.
Directory of Open Access Journals (Sweden)
Cleidson Nogueira Dias
2014-12-01
Full Text Available This research paper examines the importance of inter-organizational network management as a government policy tool to promote regional development. This pattern requires Federal Government intervention so as to compensate for the imbalance that this causes and to guarantee that economic growth resulting from government actions leads to development in all regions of the country, thereby avoiding the traditional mechanisms of wealth concentration. For this, a methodology of content analysis was used based on a relevant public policy aimed at promoting development within Brazil and by analyzing the data collected in relation to the current theory related to strategy, local development and inter-organizational networks in general. The analysis results show that, when the policy studied in this work, applied in the federal network of professional education, science & technology, was implemented the networks had a positive influence on the outcome of the policy objectives and represented an extremely powerful support tool, being one of the most important factors to boost development.
C3PO, an endoribonuclease that promotes RNAi by facilitating RISC activation.
Liu, Ying; Ye, Xuecheng; Jiang, Feng; Liang, Chunyang; Chen, Dongmei; Peng, Junmin; Kinch, Lisa N; Grishin, Nick V; Liu, Qinghua
2009-08-07
The catalytic engine of RNA interference (RNAi) is the RNA-induced silencing complex (RISC), wherein the endoribonuclease Argonaute and single-stranded small interfering RNA (siRNA) direct target mRNA cleavage. We reconstituted long double-stranded RNA- and duplex siRNA-initiated RISC activities with the use of recombinant Drosophila Dicer-2, R2D2, and Ago2 proteins. We used this core reconstitution system to purify an RNAi regulator that we term C3PO (component 3 promoter of RISC), a complex of Translin and Trax. C3PO is a Mg2+-dependent endoribonuclease that promotes RISC activation by removing siRNA passenger strand cleavage products. These studies establish an in vitro RNAi reconstitution system and identify C3PO as a key activator of the core RNAi machinery.
Role of NH3 and NH4+ transporters in renal acid-base transport.
Weiner, I David; Verlander, Jill W
2011-01-01
Renal ammonia excretion is the predominant component of renal net acid excretion. The majority of ammonia excretion is produced in the kidney and then undergoes regulated transport in a number of renal epithelial segments. Recent findings have substantially altered our understanding of renal ammonia transport. In particular, the classic model of passive, diffusive NH3 movement coupled with NH4+ "trapping" is being replaced by a model in which specific proteins mediate regulated transport of NH3 and NH4+ across plasma membranes. In the proximal tubule, the apical Na+/H+ exchanger, NHE-3, is a major mechanism of preferential NH4+ secretion. In the thick ascending limb of Henle's loop, the apical Na+-K+-2Cl- cotransporter, NKCC2, is a major contributor to ammonia reabsorption and the basolateral Na+/H+ exchanger, NHE-4, appears to be important for basolateral NH4+ exit. The collecting duct is a major site for renal ammonia secretion, involving parallel H+ secretion and NH3 secretion. The Rhesus glycoproteins, Rh B Glycoprotein (Rhbg) and Rh C Glycoprotein (Rhcg), are recently recognized ammonia transporters in the distal tubule and collecting duct. Rhcg is present in both the apical and basolateral plasma membrane, is expressed in parallel with renal ammonia excretion, and mediates a critical role in renal ammonia excretion and collecting duct ammonia transport. Rhbg is expressed specifically in the basolateral plasma membrane, and its role in renal acid-base homeostasis is controversial. In the inner medullary collecting duct (IMCD), basolateral Na+-K+-ATPase enables active basolateral NH4+ uptake. In addition to these proteins, several other proteins also contribute to renal NH3/NH4+ transport. The role and mechanisms of these proteins are discussed in depth in this review.
Mutational analysis of the promoter and the coding region of the 5-HT1A gene
Energy Technology Data Exchange (ETDEWEB)
Erdmann, J.; Noethen, M.M.; Shimron-Abarbanell, D. [Univ. of Bonn (Germany)] [and others
1994-09-01
Disturbances of serotonergic pathways have been implicated in many neuropsychiatric disorders. Serotonin (5HT) receptors can be subdivided into at least three major families (5HT1, 5HT2, and 5HT3). Five human 5HT1 receptor subtypes have been cloned, namely 1A, 1D{alpha}, 1D{beta}, 1E, and 1F. Of these, the 5HT1A receptor is the best characterized subtype. In the present study we sought to identify genetic variation in the 5HT1A receptor gene which through alteration of protein function or level of expression might contribute to the genetics of neuropsychiatric diseases. The coding region and the 5{prime} promoter region of the 5HT1A gene from 159 unrelated subjects (45 schizophrenic, 46 bipolar affective, and 43 patients with Tourette`s syndrome, as well as 25 controls) were analyzed using SSCA. SSCA revealed the presence of two mutations both located in the coding region of the 5HT1A receptor gene. The first mutation is a rare silent C{r_arrow}T substitution at nucleotide position 549. The second mutation is characterized by a base pair substitution (A{r_arrow}G) at the first position of codon 28 and results in an amino acid exchange (Ile{r_arrow}Val). Since Val28 was found only in a single schizophrenic patient and in none of the other patients or controls, we decided to extend our samples and to use a restriction assay for screening a further 74 schizophrenic, 95 bipolar affective, and 49 patients with Tourette`s syndrome, as well as 185 controls, for the presence of the mutation. In total, the mutation was found in 2 schizophrenic patients, in 3 bipolars, in 1 Tourette patient, and in 5 controls. To our knowledge the Ile-28-Val substitution reported here is the first natural occuring molecular variant which has been identified for a serotonin receptor so far.
Directory of Open Access Journals (Sweden)
Cyllene de Matos Ornelas da Cunha Corrêa de Souza
2011-06-01
Full Text Available Coffee is one of the most appreciated drinks in the world. Coffee ground is obtained from the fruit of a small plant that belongs to the genus Coffea. Coffea arabica and Coffea canephora robusta are the two most commercially important species. They are more commonly known as arabica and robusta, respectively. Two-thirds of Coffea arabica plants are grown in South and Central America, and Eastern Africa - the place of origin for this coffee species. Contamination by microorganisms has been a major matter affecting coffee quality in Brazil, mainly due to the harvesting method adopted. Brazilian harvests are based on fruits collected from the ground mixed with those that fall on collection cloths. As the Bacillus cereus bacterium frequently uses the soil as its environmental reservoir, it is easily capable of becoming a contaminant. This study aimed to evaluate the contamination and potential of B. cereus enterotoxin genes encoding the HBL and NHE complexes, which were observed in strains of ground and roasted coffee samples sold in Rio de Janeiro. The PCR (Polymerase Chain Reaction results revealed high potential of enterotoxin production in the samples. The method described by Speck (1984 was used for the isolation of contaminants. The investigation of the potential production of enterotoxins through isolates of the microorganism was performed using the B. cereus enterotoxin Reverse Passive Latex Agglutination test-kit (BCET-RPLA, Oxoid, according to the manufacturer's instructions. The potential of enterotoxin production was investigated using polymerase chain reaction (PCR methods for hblA, hblD and hblC genes (encoding hemolysin HBL and for nheA, nheB and nheC genes (encoding non-hemolytic enterotoxin - NHE. Of all the 17 strains, 100% were positive for at least 1 enterotoxin gene; 52.9% (9/17 were positive for the 3 genes encoding the HBL complex; 35.3% (6/17 were positive for the three NHE encoding genes; and 29.4% (5/17 were positive for
Vargas, Lorena A; Velasquez, Fernanda Carrizo; Alvarez, Bernardo V
2017-03-01
NBC Na + /HCO 3 - cotransporter (NBCn1) and NHE1 Na + /H + exchanger have been associated with cardiac disorders and recently located in coronary endothelial cells (CEC) and cardiomyocytes mitochondria, respectively. Mitochondrial NHE1 blockade delays permeability transition pore (MPTP) opening and reduces superoxide levels, two critical events exacerbated in cells of diseased hearts. Conversely, activation of NBCn1 prevented apoptosis in CEC subjected to ischemic stress. We characterized the role of the NHE1 and NBCn1 transporters in heart mitochondria from hypertrophic (SHR) and control (Wistar) rats. Expression of NHE1 was analyzed in left ventricular mitochondrial lysates (LVML), by immunoblots. NHE1 expression increased by ~40% in SHR compared to control (P < 0.05, n = 4). To examine NHE1-mediated Na + /H + exchange activity in cardiac hypertrophy, mitochondria were loaded with BCECF-AM dye and the maximal rate of pHm change measured after the addition of 50 mM NaCl. SHR mitochondria had greater changes in pHm compared to Wistar, 0.10 ± 0.01 vs. 0.06 ± 0.01, respectively (P < 0.05, n = 5). In addition, mitochondrial suspensions from SHR and control myocardium were exposed to 200 μM CaCl 2 to induce MPTP opening (light-scattering decrease, LSD) and swelling. Surprisingly, SHR rats showed smaller LSD and a reduction in mitochondrial swelling, 67 ± 10% (n = 15), compared to control, 100 ± 8% (n = 13). NBC inhibition with S0859 (1 μM) significantly increased swelling in both control 139 ± 10% (n = 8) and SHR 115 ± 10% (n = 4). Finally, NBCn1 Na + /HCO 3 - cotransporter increased by twofold its expression in SHR LVML, compared to normal (P < 0.05, n = 5). We conclude that increased NBCn1 activity may play a compensatory role in hypertrophic hearts, protecting mitochondria from Ca 2+ -induced MPTP opening and swelling.
Directory of Open Access Journals (Sweden)
Maseapo P. Mthobeni
2013-02-01
Full Text Available South African communities are still greatly affected by the high rate of infection with HIV or who are living with AIDS, mirrored in the 2008 overall national HIV prevalence of 29.3%(UNAIDS 2010:10. In addressing the challenge, the health system is dependent on community care level workers such as caregivers to render health promotion and education in the homes and communities. The caregivers based in the communities are the ones with first-hand information on what is needed for the success of health promotion programmes. This study, aimed at exploring the challenges faced by the health promoters, described their perceptions regarding a health promotion programme for families with adolescents orphaned as a result of AIDS. Data were collected on the purposively selected participants at the rural Hammanskraal region in South Africa and the research question: ‘What is your perception regarding health promotion programmes for families with adolescents orphaned as a result of AIDS’ was asked and discussed by participants in a focus group interview. Data were analysed using the adapted Tesch method to organize and isolate the main categories, sub-categories and themes. The following main categories were isolated: attitudes of adolescents, effectiveness of home visits, need for health education and limited resources. Based on the findings, it was therefore recommended that health care planners assist in the improvement of health promotion and education by using the community and national media, providing information material and providing access to the internet in order to allow more people, including young people, to access the information.Suid-Afrikaanse gemeenskappe word steeds grootliks beïnvloed deur die hoë vlak van MIV en vigs, soos weerspieël in die algehele nasionale MIV-syfer in 2008 van 29.3% (UNAIDS 2010:10. In die aanspreek van hierdie uitdaging is die gesondheidstelsel afhanklik van gemeenskapsorgwerkers om gesondheidsbevordering
Directory of Open Access Journals (Sweden)
Maseapo P. Mthobeni
2013-02-01
Full Text Available South African communities are still greatly affected by the high rate of infection with HIV or who are living with AIDS, mirrored in the 2008 overall national HIV prevalence of 29.3%(UNAIDS 2010:10. In addressing the challenge, the health system is dependent on community care level workers such as caregivers to render health promotion and education in the homes and communities. The caregivers based in the communities are the ones with first-hand information on what is needed for the success of health promotion programmes. This study, aimed at exploring the challenges faced by the health promoters, described their perceptions regarding a health promotion programme for families with adolescents orphaned as a result of AIDS. Data were collected on the purposively selected participants at the rural Hammanskraal region in South Africa and the research question: ‘What is your perception regarding health promotion programmes for families with adolescents orphaned as a result of AIDS’ was asked and discussed by participants in a focus group interview. Data were analysed using the adapted Tesch method to organize and isolate the main categories, sub-categories and themes. The following main categories were isolated: attitudes of adolescents, effectiveness of home visits, need for health education and limited resources. Based on the findings, it was therefore recommended that health care planners assist in the improvement of health promotion and education by using the community and national media, providing information material and providing access to the internet in order to allow more people, including young people, to access the information. Suid-Afrikaanse gemeenskappe word steeds grootliks beïnvloed deur die hoë vlak van MIV en vigs, soos weerspieël in die algehele nasionale MIV-syfer in 2008 van 29.3% (UNAIDS 2010:10. In die aanspreek van hierdie uitdaging is die gesondheidstelsel afhanklik van gemeenskapsorgwerkers om gesondheidsbevordering
3. Promotion of environment protection of sea and near-sea region. Swinoujscie 12-14 October 1994
International Nuclear Information System (INIS)
1994-01-01
The great number of problems connected with environment protection near shore marine zone, beach protection, effluent transport in ground and surface waters in region of North Port of Poland as well as technical solutions of water purification and legal problems have been discussed during the conference. All observations and experimental works have been carried out in that region. Among reported works two of them have been devoted to application of nuclear methods in interesting merit
ABERRANT METHYLATION OF THE PROMOTER OF APC, CDH13 AND MGMT GENES IN COLORECTAL CANCER PATIENTS
Directory of Open Access Journals (Sweden)
O. I. Kit
2016-01-01
Full Text Available Aberrant methylation of gene promoter regions is the main epigenetic change characterizing colorectal cancer. Methylation levels of 42 CpG-sites of promoter regions of the MGMT, APC and CDH13 genes in colorectal cancer were studied in comparison with methylation levels of the adjacent normal tissue in 25 patients. Pyrosequencing showed an increase in methylation levels of promoter regions of the MGMT, APC and CDH13 genes in tumor samples by 3 to 5 times. These tumor samples were screened for activating SNP-mutations in the KRAS (40 %, NRAS (0 % and BRAF (0 % oncogenes. SNP-mutations in the KRAS gene were accompanied by hypermethylation of one or more promoters of the studied genes. Association of this epigenetic index with tumor metastasis was proved. The data on an increase in methylation of the promoter regions of oncosupressor genes can be used as sensitive prognostic markers of progression and metastasis of colorectal cancer.
California Migrant Student Movement Study--Region 3 Analysis.
Davis, Benjamin G.
The five counties of Madera, Merced, Contra Costa, San Joaquin and Stanislaus constitute Region 3 of the California Migrant Education Program. A study to evaluate movement patterns of migrant students from, to and within the state was conducted using data from the Migrant Student Record Transfer System. It indicates that in 1977 Region 3 ranked…
Nishi, Erika E; Martins, Beatriz S; Milanez, Maycon I O; Lopes, Nathalia R; de Melo, Jose F; Pontes, Roberto B; Girardi, Adriana C; Campos, Ruy R; Bergamaschi, Cássia T
2017-05-01
Presympathetic neurons in the rostral ventrolateral medulla (RVLM) including the adrenergic cell groups play a major role in the modulation of several reflexes required for the control of sympathetic vasomotor tone and blood pressure (BP). Moreover, sympathetic vasomotor drive to the kidneys influence natriuresis and diuresis by inhibiting the cAMP/PKA pathway and redistributing the Na + /H + exchanger isoform 3 (NHE3) to the body of the microvilli in the proximal tubules. In this study we aimed to evaluate the effects of renal afferents stimulation on (1) the neurochemical phenotype of Fos expressing neurons in the medulla oblongata and (2) the level of abundance and phosphorylation of NHE3 in the renal cortex. We found that electrical stimulation of renal afferents increased heart rate and BP transiently and caused activation of tyrosine hydroxylase (TH)-containing neurons in the RVLM and non-TH neurons in the NTS. Additionally, activation of the inhibitory renorenal reflex over a 30-min period resulted in increased natriuresis and diuresis associated with increased phosphorylation of NHE3 at serine 552, a surrogate for reduced activity of this exchanger, in the contralateral kidney. This effect was not dependent of BP changes considering that no effects on natriuresis or diuresis were found in the ipsilateral-stimulated kidney. Therefore, our data show that renal afferents leads to activation of catecholaminergic and non-catecholaminergic neurons in the medulla oblongata. When renorenal reflex is induced, NHE3 exchanger activity appears to be decreased, resulting in decreased sodium and water reabsorption in the contralateral kidney. Copyright © 2017 Elsevier B.V. All rights reserved.
Highly frequent promoter methylation and PIK3CA amplification in non-small cell lung cancer (NSCLC)
International Nuclear Information System (INIS)
Ji, Meiju; Guan, Haixia; Gao, Cuixia; Shi, Bingyin; Hou, Peng
2011-01-01
Lung cancer is the leading cause of cancer-related death worldwide. Genetic and epigenetic alterations have been identified frequently in lung cancer, such as promoter methylation, gene mutations and genomic amplification. However, the interaction between genetic and epigenetic events and their significance in lung tumorigenesis remains poorly understood. We determined the promoter methylation of 6 genes and PIK3CA amplification using quantitative methylation-specific PCR (Q-MSP) and real-time quantitative PCR, respectively, and explore the association of promoter methylation with PIK3CA amplification in a large cohort of clinically well-characterized non-small cell lung cancer (NSCLC). Highly frequent promoter methylation was observed in NSCLC. With 100% diagnostic specificity, excellent sensitivity, ranging from 45.8 to 84.1%, was found for each of the 6 genes. The promoter methylation was associated with histologic type. Methylation of CALCA, CDH1, DAPK1, and EVX2 was more common in squamous cell carcinomas (SCC) compared to adenocarcinomas (ADC). Conversely, there was a trend toward a higher frequency of RASSF1A methylation in ADC than SCC. In addition, PIK3CA amplification was frequently found in NSCLC, and was associated with certain clinicopathologic features, such as smoking history, histologic type and pleural indentation. Importantly, aberrant promoter methylation of certain genes was significantly associated with PIK3CA amplification. Our data showed highly frequent promoter methylation and PIK3CA amplification in Chinese NSCLC population, and first demonstrated the associations of gene methylation with PIK3CA amplification, suggesting that these epigenetic events may be a consequence of overactivation of PI3K/Akt pathway
Takahashi, Shigeru; Matsuura, Naomi; Kurokawa, Takako; Takahashi, Yuji; Miura, Takashi
2002-11-01
We reported previously that the 5'-flanking region (nucleotides -1976 to -1655) of the human haem oxygenase-1 ( hHO-1 ) gene enhances hHO-1 promoter activity in human hepatoma HepG2 cells, but not in HeLa cells [Takahashi, Takahashi, Ito, Nagano, Shibahara and Miura (1999) Biochim. Biophys. Acta 1447, 231-235]. To define more precisely the regulatory elements involved, in the present study we have functionally dissected this region and localized the enhancer to a 50 bp fragment (-1793 to -1744). Site-direct mutagenesis analysis revealed that two regions were responsible for this enhancer activity, i.e. a hepatocyte nuclear factor-4 (HNF-4) homologous region and a GC box motif homologous region. Mutation in either region alone moderately decreased enhancer activity. However, mutations in both regions reduced promoter activity to the basal level. Electrophoretic mobility-shift assays demonstrated that the P5-2 fragment (-1793 to -1744) interacted with at least two nuclear factors, i.e. HNF-4 and Sp1/Sp3. Co-transfection experiments using Drosophila SL2 cells revealed that HNF-4 and Sp1/Sp3 synergistically stimulated the enhancer activity of the P5-2 fragment. These results indicate that co-operation of HNF-4 with Sp1 or Sp3 leads to the activation of hHO-1 gene expression in hepatoma cells.
Directory of Open Access Journals (Sweden)
Dan Wu
Full Text Available Abstract This study aimed to explore: 1 DNA methylation in the promoter regions of Wilms tumor gene 1 (WT1, NK6 transcription factor related locus 1 gene (NKX6-1 and Deleted in bladder cancer 1 (DBC1 gene in cervical cancer tissues of Uygur women in Xinjiang, and 2 the correlation of gene methylation with the infection of HPV16/18 viruses. We detected HPV16/18 infection in 43 normal cervical tissues, 30 cervical intraepithelial neoplasia lesions (CIN and 48 cervical cancer tissues with polymerase chain reaction (PCR method. Methylation in the promoter regions of the WT1, NKX6-1 and DBC1 genes in the above-mentioned tissues was measured by methylation-specific PCR (MSP and cloning sequencing. The expression level of these three genes was measured by real-time PCR (qPCR in 10 methylation-positive cervical cancer tissues and 10 methylation-negative normal cervical tissues. We found that the infection of HPV16 in normal cervical tissues, CIN and cervical cancer tissues was 14.0, 36.7 and 66.7%, respectively. The infection of HPV18 was 0, 6.7 and 10.4%, respectively. The methylation rates of WT1, NKX6-1 and DBC1 genes were 7.0, 11.6 and 23.3% in normal cervical tissues, 36.7, 46.7 and 30.0% in CIN tissues, and 89.6, 77.1 and 85.4% in cervical cancer tissues. Furthermore, WT1, NKX6-1 and DBC1 genes were hypermethylated in the high-grade squamous intraepithelial lesion (CIN2, CIN3 and in the cervical cancer tissues with infection of HPV16/18 (both P< 0.05. The expression of WT1, NKX6-1 and DBC1 was significantly lower in the methylation-positive cervical cancer tissues than in methylation-negative normal cervical tissues. Our findings indicated that methylation in the promoter regions of WT1, NKX6-1 and DBC1 is correlated with cervical cancer tumorigenesis in Uygur women. The infection of HPV16/18 might be correlated with methylation in these genes. Gene inactivation caused by methylation might be related to the incidence and development of cervical
Directory of Open Access Journals (Sweden)
Irene Flønes
Full Text Available Biotin-thiamine responsive basal ganglia disease is a severe, but potentially treatable disorder caused by mutations in the SLC19A3 gene. Although the disease is inherited in an autosomal recessive manner, patients with typical phenotypes carrying single heterozygous mutations have been reported. This makes the diagnosis uncertain and may delay treatment.In two siblings with early-onset encephalopathy dystonia and epilepsy, whole-exome sequencing revealed a novel single heterozygous SLC19A3 mutation (c.337T>C. Although Sanger-sequencing and copy-number analysis revealed no other aberrations, RNA-sequencing in brain tissue suggested the second allele was silenced. Whole-genome sequencing resolved the genetic defect by revealing a novel 45,049 bp deletion in the 5'-UTR region of the gene abolishing the promoter. High dose thiamine and biotin therapy was started in the surviving sibling who remains stable. In another patient two novel compound heterozygous SLC19A3 mutations were found. He improved substantially on thiamine and biotin therapy.We show that large genomic deletions occur in the regulatory region of SLC19A3 and should be considered in genetic testing. Moreover, our study highlights the power of whole-genome sequencing as a diagnostic tool for rare genetic disorders across a wide spectrum of mutations including non-coding large genomic rearrangements.
International Nuclear Information System (INIS)
Jaeaeskelaeinen, T.; Huhtakangas, J.; Maeenpaeae, P.H.
2005-01-01
The negative regulation of the human parathyroid hormone (PTH) gene by biologically active vitamin D 3 (1,25-dihydroxyvitamin D 3 ; 1,25(OH) 2 D 3 ) was studied in rat pituitary GH4C1 cells, which express factors needed for the negative regulation. We report here that NF-Y binds to sequences downstream of the site previously reported to bind the vitamin D receptor (VDR). Additional binding sites for NF-Y reside in the near vicinity and were shown to be important for full activity of the PTH gene promoter. VDR and NF-Y were shown to exhibit mutually exclusive binding to the VDRE region. According to our results, sequestration of binding partners for NF-Y by VDR also affects transcription through a NF-Y consensus binding element in GH4C1 but not in ROS17/2.8 cells. These results indicate that 1,25(OH) 2 D 3 may affect transcription of the human PTH gene both by competitive binding of VDR and NF-Y, and by modulating transcriptional activity of NF-Y
Directory of Open Access Journals (Sweden)
Joyce Doyle
2016-11-01
achieve change. Conclusion First Peoples’ health promotion in the Goulburn-Murray Rivers region encompasses a broad range of social, cultural, lifestyle and community development activities, including reclaiming and strengthening cultural identity and social connectedness as a response to colonisation.
Directory of Open Access Journals (Sweden)
Lei Huang
2014-05-01
Full Text Available Insulin resistance is a hallmark of the metabolic syndrome and type 2 diabetes. Dysfunction of PI-3K/Akt signaling was involved in insulin resistance. Glucose transporter 4 (GLUT4 is a key factor for glucose uptake in muscle and adipose tissues, which is closely regulated by PI-3K/Akt signaling in response to insulin treatment. Low-power laser irradiation (LPLI has been shown to regulate various physiological processes and induce the synthesis or release of multiple molecules such as growth factors, which (especially red and near infrared light is mainly through the activation of mitochondrial respiratory chain and the initiation of intracellular signaling pathways. Nevertheless, it is unclear whether LPLI could promote glucose uptake through activation of PI-3K/Akt/GLUT4 signaling in 3T3L-1 adipocytes. In this study, we investigated how LPLI promoted glucose uptake through activation of PI-3K/Akt/GLUT4 signaling pathway. Here, we showed that GLUT4 was localized to the Golgi apparatus and translocated from cytoplasm to cytomembrane upon LPLI treatment in 3T3L-1 adipocytes, which enhanced glucose uptake. Moreover, we found that glucose uptake was mediated by the PI3-K/Akt2 signaling, but not Akt1 upon LPLI treatment with Akt isoforms gene silence and PI3-K/Akt inhibitors. Collectively, our results indicate that PI3-K/Akt2/GLUT4 signaling act as the key regulators for improvement of glucose uptake under LPLI treatment in 3T3L-1 adipocytes. More importantly, our findings suggest that activation of PI3-K/Akt2/GLUT4 signaling by LPLI may provide guidance in practical applications for promotion of glucose uptake in insulin-resistant adipose tissue.
3D Mapping for Urban and Regional Planning
DEFF Research Database (Denmark)
Bodum, Lars
2002-01-01
The process of mapping in 3D for urban and regional planning purposes is not an uncomplicated matter. It involves both the construction of a new data-model and new routines for the geometric modeling of the physical objects. This is due to the fact that most of the documentation until now has been...... registered and georeferenced to the 2D plan. This paper will outline a new method for 3D mapping where new LIDAR (laser-scanning) technology and additional 2D maps with attributes will be combined to create a 3D map of an urban area. The 3D map will afterwards be used in a real-time simulation system (also...... known as Virtual Reality system) for urban and regional planning purposes. This initiative will be implemented in a specific geographic region (North Jutland County in Denmark) by a new research centre at Aalborg University called Centre for 3D GeoInformation. The key question for this research team...
Howard, Timothy D; Giles, Wayne H; Xu, Jianfeng; Wozniak, Marcella A; Malarcher, Ann M; Lange, Leslie A; Macko, Richard F; Basehore, Monica J; Meyers, Deborah A; Cole, John W; Kittner, Steven J
2005-09-01
Endothelial nitric oxide exerts a variety of protective effects on endothelial cells and blood vessels, and therefore the nitric oxide synthase 3 gene (NOS3) is a logical candidate gene for stroke susceptibility. We used the population-based Stroke Prevention in Young Women case-control study to assess the association of five NOS3 polymorphisms in 110 cases (46% black) with ischemic stroke and 206 controls (38% black), 15 to 44 years of age. Polymorphisms included 3 single nucleotide polymorphisms (SNPs) in the promoter region (-1468 T>A, -922 G>A, -786 T>C), 1 SNP in exon 7 (G894T), and 1 insertion/deletion polymorphism within intron 4. Significant associations with both the -922 G>A and -786 T>C SNPs with ischemic stroke were observed in the black, but not the white, population. This association was attributable to an increased prevalence of the -922 A allele (OR=3.0, 95% CI=1.3 to 6.8; P=0.005) and the -786 T allele (OR=2.9, 95% CI=1.3 to 6.4; P=0.005) in cases versus controls. These 2 SNPs were in strong linkage disequilibrium (D'=1.0), making it impossible to determine, within the confines of this genetic study, whether 1 or both of these polymorphisms are functionally related to NOS3 expression. Two sets of haplotypes were also identified, 1 of which may confer an increased susceptibility to stroke in blacks, whereas the other appears to be protective. Promoter variants in NOS3 may be associated with ischemic stroke susceptibility among young black women.
Electrochemical promotion of sulfur dioxide catalytic oxidation
DEFF Research Database (Denmark)
Petrushina, Irina; Bandur, Viktor; Cappeln, Frederik Vilhelm
2000-01-01
investigation was to study a possible non-Faradaic electrochemical promotion of the liquid-phase catalytic reaction. It has been shown that there are two negative potential promotion areas with maximum effects at approximately -0.1 and -0.2 V, and one positive potential promotion area with the maximum effect...... between 0.1 and 0.3 V. There were no Faradaic reactions in the negative polarization region, and there was an anodic current which was less than 16% of the theoretical value for an exclusively Faradaic SO2 oxidation. Therefore the promotion effects at negative polarization are completely non-Faradaic. All...... the promotion effects have been explained as mainly due to charging of the electric double layer at the gold electrode. The effect at -0.2 V also depends on the V2O5 concentration and is more pronounced at higher V2O5 concentrations. This has been ascribed to a destruction of the vanadium polymeric chains...
Omeprazole blocks STAT6 binding to the eotaxin-3 promoter in eosinophilic esophagitis cells.
Directory of Open Access Journals (Sweden)
Xi Zhang
Full Text Available Patients who have esophageal eosinophilia without gastroesophageal reflux disease (GERD nevertheless can respond to proton pump inhibitors (PPIs, which can have anti-inflammatory actions independent of effects on gastric acid secretion. In esophageal cell cultures, omeprazole has been reported to inhibit Th2 cytokine-stimulated expression of eotaxin-3, an eosinophil chemoattractant contributing to esophageal eosinophilia in eosinophilic esophagitis (EoE. The objective of this study was to elucidate molecular mechanisms underlying PPI inhibition of IL-4-stimulated eotaxin-3 production by esophageal cells.Telomerase-immortalized and primary cultures of esophageal squamous cells from EoE patients were treated with IL-4 in the presence or absence of acid-activated omeprazole or lansoprazole. We measured eotaxin-3 protein secretion by ELISA, mRNA expression by PCR, STAT6 phosphorylation and nuclear translocation by Western blotting, eotaxin-3 promoter activation by an exogenous reporter construct, and STAT6, RNA polymerase II, and trimethylated H3K4 binding to the endogenous eotaxin-3 promoter by ChIP assay. Omeprazole in concentrations ≥5 µM significantly decreased IL-4-stimulated eotaxin-3 protein secretion and mRNA expression. Lansoprazole also blocked eotaxin-3 protein secretion. Omeprazole had no effect on eotaxin-3 mRNA stability or on STAT6 phosphorylation and STAT6 nuclear translocation. Rather, omeprazole blocked binding of IL-4-stimulated STAT6, RNA polymerase II, and trimethylated H3K4 to the eotaxin-3 promoter.PPIs, in concentrations achieved in blood with conventional dosing, significantly inhibit IL-4-stimulated eotaxin-3 expression in EoE esophageal cells and block STAT6 binding to the promoter. These findings elucidate molecular mechanisms whereby patients with Th2 cytokine-driven esophageal eosinophilia can respond to PPIs, independent of effects on gastric acid secretion.
Directory of Open Access Journals (Sweden)
Stephanie E Hesselson
2009-09-01
Full Text Available Membrane transporters play crucial roles in the cellular uptake and efflux of an array of small molecules including nutrients, environmental toxins, and many clinically used drugs. We hypothesized that common genetic variation in the proximal promoter regions of transporter genes contribute to observed variation in drug response. A total of 579 polymorphisms were identified in the proximal promoters (-250 to +50 bp and flanking 5' sequence of 107 transporters in the ATP Binding Cassette (ABC and Solute Carrier (SLC superfamilies in 272 DNA samples from ethnically diverse populations. Many transporter promoters contained multiple common polymorphisms. Using a sliding window analysis, we observed that, on average, nucleotide diversity (pi was lowest at approximately 300 bp upstream of the transcription start site, suggesting that this region may harbor important functional elements. The proximal promoters of transporters that were highly expressed in the liver had greater nucleotide diversity than those that were highly expressed in the kidney consistent with greater negative selective pressure on the promoters of kidney transporters. Twenty-one promoters were evaluated for activity using reporter assays. Greater nucleotide diversity was observed in promoters with strong activity compared to promoters with weak activity, suggesting that weak promoters are under more negative selective pressure than promoters with high activity. Collectively, these results suggest that the proximal promoter region of membrane transporters is rich in variation and that variants in these regions may play a role in interindividual variation in drug disposition and response.
Sequence organization and control of transcription in the bacteriophage T4 tRNA region.
Broida, J; Abelson, J
1985-10-05
Bacteriophage T4 contains genes for eight transfer RNAs and two stable RNAs of unknown function. These are found in two clusters at 70 X 10(3) base-pairs on the T4 genetic map. To understand the control of transcription in this region we have completed the sequencing of 5000 base-pairs in this region. The sequence contains a part of gene 3, gene 1, gene 57, internal protein I, the tRNA genes and five open reading frames which most likely code for heretofore unidentified proteins. We have used subclones of the region to investigate the kinetics of transcription in vivo. The results show that transcription in this region consists of overlapping early, middle and late transcripts. Transcription is directed from two early promoters, one or two middle promoters and perhaps two late promoters. This region contains all of the features that are seen in T4 transcription and as such is a good place to study the phenomenon in more detail.
Zong, Haibin; Zhao, Hongxing; Zhao, Yilei; Jia, Jingling; Yang, Libin; Ma, Chao; Zhang, Yang; Dong, Yuzhen
2013-05-15
Schwann cells and neurotrophin-3 play an important role in neural regeneration, but the secretion of neurotrophin-3 from Schwann cells is limited, and exogenous neurotrophin-3 is inactived easily in vivo. In this study, we have transfected neurotrophin-3 into Schwann cells cultured in vitro using nanoparticle liposomes. Results showed that neurotrophin-3 was successfully transfected into Schwann cells, where it was expressed effectively and steadily. A composite of Schwann cells transfected with neurotrophin-3 and poly(lactic-co-glycolic acid) biodegradable conduits was transplanted into rats to repair 10-mm sciatic nerve defects. Transplantation of the composite scaffold could restore the myoelectricity and wave amplitude of the sciatic nerve by electrophysiological examination, promote nerve axonal and myelin regeneration, and delay apoptosis of spinal motor neurons. Experimental findings indicate that neurotrophin-3 transfected Schwann cells combined with bridge grafting can promote neural regeneration and functional recovery after nerve injury.
DEFF Research Database (Denmark)
Sohoni, Sujata Vijay; Fazio, Alessandro; Workman, Christopher
2014-01-01
The objective of this study was the application of the synthetic promoter library (SPL) technology for modulation of actinorhodin production in Streptomyces coelicolor A3(2). The SPL technology was used to optimize the expression of a pathway specific positive transcriptional regulator Actll orf4...... constitutive promoter. ScoSPL20 demonstrated exceptional productivity despite having a comparatively weak expression from the promoter. Interestingly, the ScoSPL20 promoter was activated at a much earlier stage of growth compared to the wild type, demonstrating the advantage of fine-tuning and temporal tuning......, which activates the transcription of the S. coelicolor actinorhodin biosynthetic gene cluster. The native actll orf4 promoter was replaced with synthetic promoters, generating a S. coelicolor library with a broad range of expression levels of actll orf4. The resulting library was screened based...
Kawaguchi, Yuka; Nariki, Hiroaki; Kawamoto, Naoko; Kanehiro, Yuichi; Miyazaki, Satoshi; Suzuki, Mari; Magari, Masaki; Tokumitsu, Hiroshi; Kanayama, Naoki
2017-01-01
Activation-induced cytidine deaminase (AID) is essential for diversification of the Ig variable region (IgV). AID is excluded from the nucleus, where it normally functions. However, the molecular mechanisms responsible for regulating AID localization remain to be elucidated. The SR-protein splicing factor SRSF1 is a nucleocytoplasmic shuttling protein, a splicing isoform of which called SRSF1-3, has previously been shown to contribute to IgV diversification in chicken DT40 cells. In this stu...
Kaatz, Glenn W.; Thyagarajan, Rama V.; Seo, Susan M.
2005-01-01
NorA is a Staphylococcus aureus multidrug transporter that confers resistance to structurally distinct compounds. The MgrA global regulatory protein is reported to augment norA expression when mgrA is overexpressed from an undefined plasmid-based promoter. Further details about norA regulatory mechanisms are scant. A chromosomal norA::lacZ transcriptional fusion was constructed in different S. aureus strains, and allele replacement was used to define the relevance of promoter region sequences...
Directory of Open Access Journals (Sweden)
Liu Wen-Sheng
2010-11-01
Full Text Available Abstract Background The dendritic cell-specific intercellular adhesion molecule 3 grabbing non-integrin (DC-SIGN is an important pathogen recognition receptor of the innate immune system. DC-SIGN promoter variants play important role in the susceptibility to various infectious diseases. Nasopharyngeal carcinoma (NPC is a malignancy that is common in southern China and whether DC-SIGN promoter variants have effects on susceptibility to NPC is still unknown. The aim of this study is to ascertain the potential involvement of DC-SIGN promoter single nucleotide polymorphisms (SNPs in NPC susceptibility. Methods We conducted a case control study based on Cantonese population including 444 NPC patients and 464 controls matched on age and sex. The 1041 bp of DC-SIGN promoter region was directly sequenced for all samples. Sequence alignment and SNP search were inspected using DNAStar analysis programs and haplotype frequencies were estimated in Haploview V 4.0. The associations between the SNPs and the risk of NPC were analyzed using chi-square test and non-conditional logistic regression analysis with SPSS 13.0 software. Results A total of six variants were observed in the DC-SIGN promoter region and DC-SIGN -139 GG and -939 AA were significantly associated with NPC risk with adjusted Odds Ratios (ORs of 2.10 (95% confidence interval [CI] = 1.23-3.59; P = 0.006 and 2.52 (1.29-4.93; P = 0.007 respectively and subjects carrying the risk allele DC-SIGN -871 G had 1.47-fold (95% CI = 1.14-1.90 increased risks of developing NPC (P = 0.003. Haplotype analysis revealed that h1 'AAAG' was significantly associated with protection against NPC (OR = 0.69; P = 0.0002 and the association was still significant when using 1000 permutation test runs (P = 0.001. Conclusions Our study indicated that DC-SIGN promoter variants appear to be involved in the susceptibility to NPC and the detailed mechanism of this effect need further studies.
Porcine MYF6 gene: sequence, homology analysis, and variation in the promoter region.
Wyszyńska-Koko, J; Kurył, J
2004-01-01
MYF6 gene codes for the bHLH transcription factor belonging to MyoD family. Its expression accompanies the processes of differentiation and maturation of myotubes during embriogenesis and continues on a relatively high level after birth, affecting the muscle phenotype. The porcine MYF6 gene was amplified and sequenced and compared with MYF6 gene sequences of other species. The amino acid sequence was deduced and an interspecies homology analysis was performed. Myf-6 protein shows a high conservation among species of 99 and 97% identity when comparing pig with cow and human, respectively, and of 93% when comparing pig with mouse and rat. The single nucleotide polymorphism (SNP) was revealed within the promoter region, which appeared to be T --> C transition recognized by a MspI restriction enzyme.
Chen, Ming-xia; Li, Xiang-guang; Yang, Jun-xian; Gao, Chun-qi; Wang, Bin; Wang, Xiu-qi; Yan, Hui-chao
2015-01-01
The objective of this study was to investigate the relationship between gene expression of nutrient (amino acid, peptide, sodium and proton) transporters in the small intestine and embryonic growth in domestic pigeons (Columba livia). One hundred and twenty-five fertilized eggs were randomly assigned into five groups and were incubated under optimal conditions (temperature of 38.1 °C and relative humidity of 55%). Twenty embryos/birds from each group were sacrificed by cervical dislocation on embryonic day (E) 9, 11, 13, 15 and day of hatch (DOH). The eggs, embryos (without yolk sac), and organs (head, brain, heart, liver, lungs, kidney, gizzard, small intestine, legs, and thorax) were dissected, cleaned, and weighed. Small intestine samples were collected for RNA isolation. The mRNA abundance of intestinal nutrient transporters was evaluated by real-time reverse transcription-polymerase chain reaction (RT-PCR). We classified these ten organs into four types according to the changes in relative weight during embryonic development. In addition, the gene expression of nutrient transporters was differentially regulated by embryonic day. The mRNA abundances of b0,+AT, EAAT3, y+LAT2, PepT1, LAT4, NHE2, and NHE3 increased linearly with age, whereas mRNA abundances of CAT1, CAT2, LAT1, EAAT2, SNAT1, and SNAT2 were increased to higher levels on E9 or E11 and then decreased to lower levels until DOH. The results of correlation analysis showed that the gene expressions of b0,+AT, EAAT3, PepT1, LAT4, NHE2, NHE3, and y+LAT2 had positive correlations with body weight (0.71
Chen, Ming-xia; Li, Xiang-guang; Yang, Jun-xian; Gao, Chun-qi; Wang, Bin; Wang, Xiu-qi; Yan, Hui-chao
2015-06-01
The objective of this study was to investigate the relationship between gene expression of nutrient (amino acid, peptide, sodium and proton) transporters in the small intestine and embryonic growth in domestic pigeons (Columba livia). One hundred and twenty-five fertilized eggs were randomly assigned into five groups and were incubated under optimal conditions (temperature of 38.1 °C and relative humidity of 55%). Twenty embryos/birds from each group were sacrificed by cervical dislocation on embryonic day (E) 9, 11, 13, 15 and day of hatch (DOH). The eggs, embryos (without yolk sac), and organs (head, brain, heart, liver, lungs, kidney, gizzard, small intestine, legs, and thorax) were dissected, cleaned, and weighed. Small intestine samples were collected for RNA isolation. The mRNA abundance of intestinal nutrient transporters was evaluated by real-time reverse transcription-polymerase chain reaction (RT-PCR). We classified these ten organs into four types according to the changes in relative weight during embryonic development. In addition, the gene expression of nutrient transporters was differentially regulated by embryonic day. The mRNA abundances of b(0,+)AT, EAAT3, y(+)LAT2, PepT1, LAT4, NHE2, and NHE3 increased linearly with age, whereas mRNA abundances of CAT1, CAT2, LAT1, EAAT2, SNAT1, and SNAT2 were increased to higher levels on E9 or E11 and then decreased to lower levels until DOH. The results of correlation analysis showed that the gene expressions of b(0,+)AT, EAAT3, PepT1, LAT4, NHE2, NHE3, and y(+)LAT2 had positive correlations with body weight (0.71
Flow around turbulence promoters in parallel channel, 1
International Nuclear Information System (INIS)
Shiina, Yasuaki; Takizuka, Takakazu; Okamoto, Yoshizo
1982-01-01
Flow characteristics in relation to heat transfer characteristics in parallel channel with turbulence promoters were studied experimentally. Flow visualization experiments were made in paralle channel with one or two turbulence promoters for Reynolds number region of 100 lt = Resub(w) lt = 3,600. The vortex patterns behind one promoter were that a steady vortex was formed for low Reynolds number and vortex was shed for high Reynolds number,. For higher Reynolds number, it was observed that shedding vortex caused other vortices or disappeared itself randomly. The results indicate that the shedding vortices will augment heat transfer, whereas the steady vortex will give rise to deterioration in heat transfer. This inference agrees with the experimental results of Hishida et al. The results of two promoters experiment showed that the maximum performance of promoter would be attained at p/d -- 7. This agrees with the results formerly studied by other investigators. (author)
Takawale, Abhijit; Zhang, Pu; Azad, Abul; Wang, Wang; Wang, Xiuhua; Murray, Allan G; Kassiri, Zamaneh
2017-08-01
Myocardial infarction (MI) results in loss of cardiomyocytes, adverse extracellular matrix (ECM) and structural remodeling, and left ventricular (LV) dilation and dysfunction. Tissue inhibitors of metalloproteinase (TIMPs) inhibit matrix metalloproteinases (MMPs), the main regulators of ECM turnover. TIMPs also have MMP-independent functions. TIMP3 levels are reduced in the heart within 24 h of MI in mice. We investigated if overexpression of TIMP3 post-MI limits adverse remodeling and LV dilation and dysfunction. MI was induced by left anterior descending coronary artery ligation in 10- to 12-wk-old male C57BL/6J mice, and adenoviral constructs expressing human (h)TIMP3 (Ad-hTIMP3) or no TIMP (Ad-Null) were injected in the peri-infarct zone (5.4 × 10 7 plaque-forming units/heart, 5 injections/heart). Cardiac function assessed by echocardiography showed improved LV physiology and reduced LV dilation after TIMP3 overexpression compared with the Ad-Null-MI group. Post-MI adverse remodeling was attenuated in the Ad-hTIMP3-MI group, as assessed by greater cardiomyocyte density, less infarct expansion, and ECM disruption. TIMP3 overexpression blunted the early rise in proteolytic activities post-MI. A higher density of coronary arteries and a greater number of proliferating endothelial cells were detected in the infarct and peri-infarct regions in the Ad-hTIMP3-MI group compared with the Ad-Null-MI group. In vitro three-dimensional angiogenesis assay confirmed that recombinant TIMP3 promotes angiogenesis in human endothelial cells, although biphasically and in a dose-dependent manner. Intriguingly, overexpression of Ad-hTIMP3 at 10-fold higher concentration had no beneficial effects, consistent with antiangiogenic effects of TIMP3 at higher doses. In conclusion, optimal overexpression of TIMP3 can be a promising therapeutic approach to limit adverse post-MI remodeling by dually inhibiting early proteolysis and promoting angiogenesis. NEW & NOTEWORTHY Here, we report
Directory of Open Access Journals (Sweden)
Xuenan Chen
2017-07-01
Conclusion: Our studies suggest that GTP promoted proliferation and secretion of collagen in NIH/3T3 cells by activating the ERK signal pathway, which shed light on a potential function of GTP in promoting wound healing.
An Inside Job: How Endosomal Na+/H+ Exchangers Link to Autism and Neurological Disease
Directory of Open Access Journals (Sweden)
Kalyan C. Kondapalli
2014-06-01
Full Text Available Autism imposes a major impediment to childhood development and a huge emotional and financial burden on society. In recent years, there has been rapidly accumulating genetic evidence that links the eNHE, a subset of Na+/H+ exchangers that localize to intracellular vesicles, to a variety of neurological conditions including autism, attention deficit hyperactivity disorder, intellectual disability and epilepsy. By providing a leak pathway for protons pumped by the V-ATPase, eNHE determine luminal pH and regulate cation (Na+, K+ content in early and recycling endosomal compartments. Loss-of-function mutations in eNHE cause hyperacidification of endosomal lumen, as a result of imbalance in pump and leak pathways. Two isoforms, NHE6 and NHE9 are highly expressed in brain, including hippocampus and cortex. Here, we summarize evidence for the importance of luminal cation content and pH on processing, delivery and fate of cargo and on the surface expression and function of membrane receptors and neurotransmitter transporters, drawing upon insights from model organisms and mammalian cells. These studies lead to cellular models of eNHE activity in pre- and post-synaptic neurons and astrocytes, where they could impact synapse development and plasticity. The study of eNHE has provided new insight on the mechanism of autism and other debilitating neurological disorders and opened up new possibilities for therapeutic intervention.
Martelli, Luisa; Venegoni, Mauro
2013-06-01
Italian Regions and the Italian regulatory agency share a common interest in promoting the appropriateness of drug use, containing drug expenditure and acquiring additional evidence on the effectiveness and safety of drugs. Drug registries can help attaining these objectives. Specifically, the registries implemented in Italy were able to cover the first two objectives, whereas some critical issues were raised on the third one. For instance, the data recorded in the registries are not available at regional level to conduct safety and effectiveness investigations. This is a paradox, when considering that drugs included in the registries have a risk-benefit profile that is only partially defined at the moment of marketing. Currently, researchers and regions can conduct epidemiological research (cohort and case control studies), on the basis of record-linkage procedures, on all drugs prescribed in general practice (which are older drugs with a better defined risk-benefit profile). The expected outcomes of registries should be more clearly defined: when the main aim is to promote appropriateness, the recording of only a very limited amount of data should be required (to avoid a bureaucratic burden on clinicians).The Italian centers of the ENCePP network might play an important role in planning and conducting drug registries: through the presence in the steering committees of the registries, and in conducting epidemiological studies that make the most of this powerful instrument.
Directory of Open Access Journals (Sweden)
Xinshen Li
2018-03-01
Full Text Available COG1410, a mimetic peptide derived from the apolipoprotein E (apoE receptor binding region, exerts positive effect on neurological deficits in early brain injury (EBI after experimental subarachnoid hemorrhage (SAH. Currently the neuroprotective effect of COG1410 includes inhibiting BBB disruption, reducing neuronal apoptosis, and neuroinflammation. However, the effect and mechanism of COG1410 to subcellular organelles disorder have not been fully investigated. As the main pathway for recycling long-lived proteins and damaged organelles, neuronal autophagy is activated in SAH and exhibits neuroprotective effects by reducing the insults of EBI. Pharmacologically elevated autophagy usually contributes to alleviated brain injury, while few of the agents achieved clinical transformation. In this study, we explored the activation of autophagy during EBI by measuring the Beclin-1 and LC3B-II protein levels. Administration of COG1410 notably elevated the autophagic markers expression in neurons, simultaneously reversed the neurological deficits. Furthermore, the up-regulated autophagy by COG1410 was further promoted by p-GSK-3β agonist, whereas decreased by p-GSK-3β inhibitor. Taken together, these data suggest that the COG1410 might be a promising therapeutic strategy for EBI via promoting autophagy in SAH.
Functional Analysis of Promoter Region from Eel Cytochrome P450 1A1 Gene in Transgenic Medaka.
Ogino; Itakura; Kato; Aoki; Sato
1999-07-01
: Transcription of the CYP1A1 genes in mammals and fish is stimulated by polyaromatic hydrocarbons. DNA sequencing analysis revealed that CYP1A1 gene in eel (Anguilla japonica) contains two kinds of putative cis-acting regulatory elements, XRE (xenobiotic-responsive element) and ERE (estrogen-responsive element). XRE is known as the enhancer that is responsible for the inducibility of the genes of CYP1A1 and some other drug-metabolizing enzymes. In the eel CYP1A1 gene, XRE motifs are distributed as follows: five times in the region from -2136 to -1125 bp, XRE(-6) to (-2); once in the proximal basal promoter region, XRE(-1); and once in the first intron, XRE(+1). The region between XRE(-2) and XRE(-1) contains three ERE motifs. To investigate the function of the cis-acting regulatory elements in the eel CYP1A1 gene, recombinant plasmids prepared with its 5' upstream sequence and the structural gene for luciferase were microinjected into fertilized eggs of medaka at the one-cell stage. Hatched fry were treated with 3-methylcholanthrene, and the transcription efficiency was assayed using competitive polymerase chain reaction analysis. Deletion of the region containing the five XREs, XRE(-6) to XRE(-2), and the point mutation of XRE(-1) reduced the inducible expressions by 75% and 56%, respectively, showing apparent dependency of the drug induction on the XREs. Constitutive expression, however, was not significantly affected by deletion or disruption of the XREs. When the region between XRE(-2) and XRE(-1) containing no XREs but three ERE motifs was internally deleted, the inducible expression and the constitutive expression were reduced by 88% and 75%, respectively. Replacement of this region with a partial fragment of eel CYP1A1 complementary DNA, with slight alteration of the distance between the five XREs and XRE(-1), reduced the inducible expression and the constitutive expression by 91% and 60%, respectively. These results strongly suggest that not only XRE but
Shen, Lei; Zeng, Wen; Wu, Yang-Xiao; Hou, Chun-Li; Chen, Wen; Yang, Ming-Can; Li, Li; Zhang, Ya-Fang; Zhu, Chu-Hong
2013-01-01
Angiogenesis is a major obstacle for wound healing in patients with diabetic foot wounds. Mesenchymal stem cells (MSCs) have an important function in wound repair, and neurotrophin-3 (NT-3) can promote nerve regeneration and angiogenesis. We investigated the effect of NT-3 on accelerating wound healing in the diabetic foot by improving human bone marrow MSC (hMSC) activation. In vitro, NT-3 significantly promoted VEGF, NGF, and BDNF secretion in hMSCs. NT-3 improved activation of the hMSC conditioned medium, promoted human umbilical vein endothelial cell (HUVEC) proliferation and migration, and significantly improved the closure rate of HUVEC scratches. In addition, we produced nanofiber mesh biological tissue materials through the electrospinning technique using polylactic acid, mixed silk, and collagen. The hMSCs stimulated by NT-3 were implanted into the material. Compared with the control group, the NT-3-stimulated hMSCs in the biological tissue material significantly promoted angiogenesis in the feet of diabetic C57BL/6J mice and accelerated diabetic foot wound healing. These results suggest that NT-3 significantly promotes hMSC secretion of VEGF, NGF, and other vasoactive factors and that it accelerates wound healing by inducing angiogenesis through improved activation of vascular endothelial cells. The hMSCs stimulated by NT-3 can produce materials that accelerate wound healing in the diabetic foot and other ischemic ulcers.
Funata, Sayaka; Matsusaka, Keisuke; Yamanaka, Ryota; Yamamoto, Shogo; Okabe, Atsushi; Fukuyo, Masaki; Aburatani, Hiroyuki; Fukayama, Masashi; Kaneda, Atsushi
2017-08-15
Aberrant DNA hypermethylation is a major epigenetic mechanism to inactivate tumor suppressor genes in cancer. Epstein-Barr virus positive gastric cancer is the most frequently hypermethylated tumor among human malignancies. Herein, we performed comprehensive analysis of epigenomic alteration during EBV infection, by Infinium HumanMethylation 450K BeadChip for DNA methylation and ChIP-sequencing for histone modification alteration during EBV infection into gastric cancer cell line MKN7. Among 7,775 genes with increased DNA methylation in promoter regions, roughly half were "DNA methylation-sensitive" genes, which acquired DNA methylation in the whole promoter regions and thus were repressed. These included anti-oncogenic genes, e.g. CDKN2A . The other half were "DNA methylation-resistant" genes, where DNA methylation is acquired in the surrounding of promoter regions, but unmethylated status is protected in the vicinity of transcription start site. These genes thereby retained gene expression, and included DNA repair genes. Histone modification was altered dynamically and coordinately with DNA methylation alteration. DNA methylation-sensitive genes significantly correlated with loss of H3K27me3 pre-marks or decrease of active histone marks, H3K4me3 and H3K27ac. Apoptosis-related genes were significantly enriched in these epigenetically repressed genes. Gain of active histone marks significantly correlated with DNA methylation-resistant genes. Genes related to mitotic cell cycle and DNA repair were significantly enriched in these epigenetically activated genes. Our data show that orchestrated epigenetic alterations are important in gene regulation during EBV infection, and histone modification status in promoter regions significantly associated with acquisition of de novo DNA methylation or protection of unmethylated status at transcription start site.
International Nuclear Information System (INIS)
Li Tingqiang; Yang Xiaoe; Lu Lingli; Islam, Ejazul; He Zhenli
2009-01-01
Effects of zinc (Zn) and cadmium (Cd) interactions on root morphology and metal translocation in the hyperaccumulating ecotype (HE) and non-hyperaccumulating ecotype (NHE) of S. alfredii were investigated under hydroponic conditions. Specific root lengths (SRL), specific root surface areas (SRA) and specific root volumes (SRV) of the HE increased significantly when plant were treated with 500 μM Zn or 100 μM Cd + 500 μM Zn, whereas these root parameters were significantly decreased for the NHE when plant were treated with 100 μM Cd, 500 μM Zn or 100 μM Cd + 500 μM Zn. SRL and SRA of the HE were mainly constituted by roots with diameter between 0.2-0.4 mm (diameter class 3 and 4) which were significantly increased in treatment of 500 μM Zn or 100 μM Cd + 500 μM Zn, whereas in the NHE, metal treatments caused a significant decrease in SRL and SRA of the finest diameter class root (diameter between 0.1-0.3 mm). The HE of S. alfredii could maintain a fine, widely branched root system under contaminated conditions compared with the NHE. Relative root growth, net Cd uptake and translocation rate in the HE were significantly increased by adding 500 μM Zn, as compared with the second growth period, where 100 μM Cd was supplied alone. Cadmium and Zn concentrations in the shoots of the HE were 12-16 times and 22-27 times higher than those of the NHE under 100 μM Cd + 500 μM Zn combined treatment. These results indicate strong positive interactions of Zn and Cd occurred in the HE under 100 μM Cd + 500 μM Zn treatment and Cd uptake and translocation was enhanced by adding 500 μM Zn.
Energy Technology Data Exchange (ETDEWEB)
Li Tingqiang, E-mail: litq@zju.edu.cn [Ministry of Education Key Laboratory of Environmental Remediation and Ecosystem Health, College of Environmental and Resource Sciences, Zhejiang University, Hangzhou 310029 (China); Yang Xiaoe; Lu Lingli [Ministry of Education Key Laboratory of Environmental Remediation and Ecosystem Health, College of Environmental and Resource Sciences, Zhejiang University, Hangzhou 310029 (China); Islam, Ejazul [Nuclear Institute of Agriculture, Tandojam, 48800 Hyderabad (Pakistan); He Zhenli [University of Florida, Institute of Food and Agricultural Sciences, Indian River Research and Education Center, Fort Pierce, Florida 34945 (United States)
2009-09-30
Effects of zinc (Zn) and cadmium (Cd) interactions on root morphology and metal translocation in the hyperaccumulating ecotype (HE) and non-hyperaccumulating ecotype (NHE) of S. alfredii were investigated under hydroponic conditions. Specific root lengths (SRL), specific root surface areas (SRA) and specific root volumes (SRV) of the HE increased significantly when plant were treated with 500 {mu}M Zn or 100 {mu}M Cd + 500 {mu}M Zn, whereas these root parameters were significantly decreased for the NHE when plant were treated with 100 {mu}M Cd, 500 {mu}M Zn or 100 {mu}M Cd + 500 {mu}M Zn. SRL and SRA of the HE were mainly constituted by roots with diameter between 0.2-0.4 mm (diameter class 3 and 4) which were significantly increased in treatment of 500 {mu}M Zn or 100 {mu}M Cd + 500 {mu}M Zn, whereas in the NHE, metal treatments caused a significant decrease in SRL and SRA of the finest diameter class root (diameter between 0.1-0.3 mm). The HE of S. alfredii could maintain a fine, widely branched root system under contaminated conditions compared with the NHE. Relative root growth, net Cd uptake and translocation rate in the HE were significantly increased by adding 500 {mu}M Zn, as compared with the second growth period, where 100 {mu}M Cd was supplied alone. Cadmium and Zn concentrations in the shoots of the HE were 12-16 times and 22-27 times higher than those of the NHE under 100 {mu}M Cd + 500 {mu}M Zn combined treatment. These results indicate strong positive interactions of Zn and Cd occurred in the HE under 100 {mu}M Cd + 500 {mu}M Zn treatment and Cd uptake and translocation was enhanced by adding 500 {mu}M Zn.
International Nuclear Information System (INIS)
Gillen, V.A.
1990-09-01
The Regional Co-operative Arrangement for the Promotion of Nuclear Science and Technology in Latin America, ARCAL, has completed its first five-year phase (1985-1989). This booklet summarizes the first phase of the ARCAL programme and contains descriptions of projects in the fields of agriculture, medicine, industry and energy
DEFF Research Database (Denmark)
Pansoy, Andrea; Ahmed, Shaimaa; Valen, Eivind
2010-01-01
responsive element. Conventional ChIP confirmed recruitment of AHR to 26 regions with target gene responses to 3MC varying from activation to inhibition to having no effect. A comparison of identified AHR-3MC bound regions with AHR-TCDD bound regions in from our previous study (Ahmed, S., Valen, E., Sandelin...
Naghitorabi, Mojgan; Mir Mohammad Sadeghi, Hamid; Mohammadi Asl, Javad; Rabbani, Mohammad; Jafarian-Dehkordi, Abbas
2017-01-01
Promoter methylation is one of the main epigenetic mechanisms that leads to the inactivation of tumor suppressor genes during carcinogenesis. Due to the reversible nature of DNA methylation, many studies have been performed to correct theses epigenetic defects by inhibiting DNA methyltransferases (DNMTs). In this case novel therapeutics especially siRNA oligonucleotides have been used to specifically knock down the DNMTs at mRNA level. Also many studies have focused on transcriptional gene silencing in mammalian cells via siRNA mediated promoter methylation. The present study was designed to assess the role of siRNA mediated promoter methylation in DNMT3B knockdown and alteration of promoter methylation of Cadherin-1 (CDH1), Glutathione S-Transferase Pi 1(GSTP1), and DNMT3B genes in MDA-MB-453 cell line. MDA-MB-453 cells were transfected with siDNMT targeting DNMT3B promoter and harvested at 24 and 48 h post transfection to monitor gene silencing and promoter methylation respectively. DNMT3B expression was monitored by quantitative RT-PCR method. Promoter methylation was quantitatively evaluated using differential high resolution melting analysis. A non-significant 20% reduction in DNMT3B mRNA level was shown only after first transfection with siDNMT, which was not reproducible. Promoter methylation levels of DNMT3B, CDH1, and GSTP1 were detected at about 15%, 70% and 10% respectively, in the MDA-MB-453 cell line, with no significant change after transfection. Our results indicated that siDNMT sequence were not able to affect promoter methylation and silencing of DNMT3B in MDA-MB-453 cells. However, quantitation of methylation confirmed a hypermethylated phenotype at CDH1 and GSTP1 promoters as well as a differential methylation pattern at DNMT3B promoter in breast cancer.
Yan, Zhi Shuo; Long, Ji Ying; Gong, Yun; Lin, Jian Hua
2018-05-01
Based on 4-(4-oxopyridin-1(4H)-yl) phthalic acid (H2L1) and 3-(4-oxopyridin-1(4H)-yl) phthalic acid (H2L2), two novel Pb(II) coordination polymers (CPs) formulated as [Pb4Cl4·(L1)2·H2O]n (CP 1), [Pb3Cl4·L2·H2O]n (CP 2) were solvothermally synthesized and characterized by single-crystal X-ray diffraction. The two novel Pb(II) CPs (CPs 1 and 2) possessed different structures. Density functional theory (DFT) calculations revealed the two CPs had different band structures yet the characteristic of semiconductors in common. Their valence band (VB) and conduction band (CB) positions were determined by Mott-Schottky and UV-visible diffuse reflectance analyses. The photoelectrocatalytic performance of the two CPs towards CO2 reduction were tested by photocurrent responses at various applied potentials. And the E =-1.4 V vs SCE (-0.74 V vs NHE) was selected as the required potential according to the regulation of photocurrent responses at various tested potentials in CO2-saturated system. The photoelectrocatalytic performance of CP 2 was superior to that of CP 1 owing to the well-matched CB position of CP 2 and CO2 reduction potentials at the required potential of -1.4 V vs SCE (-0.74 V vs NHE). In addition, the photoelectrolytic experiment were performed 1 h in the CO2-saturated 0.2 M Na2SO4 solution at the required potential of -1.4 V vs SCE (-0.74 V vs NHE) with and without illumination, and we initially demonstrated the influence of visible light in the CO2-saturated photoelectrocatalytic measurement system and the reason of stability in 1 h chronoamperometry.
Directory of Open Access Journals (Sweden)
Sarah Jamali
Full Text Available BACKGROUND: Human mesial temporal lobe epilepsies (MTLE represent the most frequent form of partial epilepsies and are frequently preceded by febrile seizures (FS in infancy and early childhood. Genetic associations of several complement genes including its central component C3 with disorders of the central nervous system, and the existence of C3 dysregulation in the epilepsies and in the MTLE particularly, make it the C3 gene a good candidate for human MTLE. METHODOLOGY/PRINCIPAL FINDINGS: A case-control association study of the C3 gene was performed in a first series of 122 patients with MTLE and 196 controls. Four haplotypes (HAP1 to 4 comprising GF100472, a newly discovered dinucleotide repeat polymorphism [(CA8 to (CA15] in the C3 promoter region showed significant association after Bonferroni correction, in the subgroup of MTLE patients having a personal history of FS (MTLE-FS+. Replication analysis in independent patients and controls confirmed that the rare HAP4 haplotype comprising the minimal length allele of GF100472 [(CA8], protected against MTLE-FS+. A fifth haplotype (HAP5 with medium-size (CA11 allele of GF100472 displayed four times higher frequency in controls than in the first cohort of MTLE-FS+ and showed a protective effect against FS through a high statistical significance in an independent population of 97 pure FS. Consistently, (CA11 allele by its own protected against pure FS in a second group of 148 FS patients. Reporter gene assays showed that GF100472 significantly influenced C3 promoter activity (the higher the number of repeats, the lower the transcriptional activity. Taken together, the consistent genetic data and the functional analysis presented here indicate that a newly-identified and functional polymorphism in the promoter of the complement C3 gene might participate in the genetic susceptibility to human MTLE with a history of FS, and to pure FS. CONCLUSIONS/SIGNIFICANCE: The present study provides important
J.A.J.B.M. Maas (Janneke); D.O. Mook-Kanamori (Dennis); L. Ay (Lamise); R.P.M. Steegers-Theunissen (Régine); P. Tikka-Kleemola (Päivi); A. Hofman (Albert); A.C.S. Hokken-Koelega (Anita); V.W.V. Jaddoe (Vincent)
2010-01-01
textabstractObjective: The objective of this study was to examine the associations between insulin gene variable number of tandem repeats (INS VNTR) and insulin-like growth factor 1 (IGF1) gene promoter region polymorphisms with body composition in early childhood. Methods: This study was embedded
2010-07-01
... 36 Parks, Forests, and Public Property 2 2010-07-01 2010-07-01 false Regulations applicable to Region 3, Southwestern Region, as defined in § 200.2. [Reserved] 261.73 Section 261.73 Parks, Forests... § 261.73 Regulations applicable to Region 3, Southwestern Region, as defined in § 200.2. [Reserved] ...
Schausi, Diane; Tiffoche, Christophe; Thieulant, Marie-Lise
2003-07-01
We have characterized the intronic promoter of the rat estrogen receptor (ER) alpha gene, responsible for the lactotrope-specific truncated ER product (TERP)-1 isoform expression. Transcriptional regulation was investigated by transient transfections using 5'-deletion constructs. TERP promoter constructs were highly active in MMQ cells, a pure lactotrope cell line, whereas a low basal activity was detected in alphaT3-1 gonadotrope cells or in COS-7 monkey kidney cells. Serial deletion analysis revealed that 1) a minimal -693-bp region encompassing the TATA box is sufficient to allow lactotrope-specific expression; 2) the promoter contains strong positive cis-acting elements both in the distal and proximal regions, and 3) the region spanning the -1698/-1194 region includes repressor elements. Transient transfection studies, EMSAs, and gel shifts demonstrated that estrogen activates the TERP promoter via an estrogen-responsive element (ERE1) located within the proximal region. Mutation of ERE1 site completely abolishes the estradiol-dependent transcription, indicating that ERE1 site is sufficient to confer estrogen responsiveness to TERP promoter. In addition, ERalpha action was synergized by transfection of the pituitary-specific factor Pit-1. EMSAs showed that a single Pit-1 DNA binding element in the vicinity of the TATA box is sufficient to confer response by the TERP promoter. In conclusion, we demonstrated, for the first time, that TERP promoter regulation involves ERE and Pit-1 cis-elements and corresponding trans-acting factors, which could play a role in the physiological changes that occur in TERP-1 transcription in lactotrope cells.
Energy Technology Data Exchange (ETDEWEB)
Rasi, S.; Havukainen, J.; Uusitalo, V.; Andersson, R.; Manninen, K.; Aro-Heinilae, E.; Rintala, J.
2012-11-01
The main objective of the project was to promote biogas production and its use as transport fuel. The aims in the four Finnish and two Estonian case areas were to reduce the amount and improve the sustainable use of waste and sludge, to promote biogas production, to start biogas use as transport fuel and to provide tools for implementing the aims. The total biomethane potential in the Helsinki region corresponds to approximately 450 GWh/a. The most potential user for biomethane is public transport. The total amount of biomethane would suffice for 80% of the busses operating in the Helsinki region. Using biogas as a transport fuel instead of energy production in the Helsinki region would result in emission reductions (13 000 t{sub CO2,eq}/a). However if the fuel replacing biogas in energy production would be renewable, the emission reductions would be significantly greater. The economical assessment indicates that the production of biogas is economically feasible if all the produced gas can be sold. Biogas produced near the natural gas grid can also be transported to the Helsinki region where there are better possibilities to find uses for it. In this way, for example, gas that is produced in Kymenlaakso but is not consumed there can be transported via the natural gas grid, assuming that the production plant is reasonably close to the grid. (orig.)
Delahunt, Eamonn; McGroarty, Mark; De Vito, Giuseppe; Ditroilo, Massimiliano
2016-04-01
To investigate the kinematic and muscle activation adaptations during performance of the Nordic hamstring exercise (NHE) to a 6-week eccentric hamstring training programme using the NHE as the sole mode of exercise. Twenty-nine healthy males were randomly allocated to a control (CG) or intervention (IG) group. The IG participated in a 6-week eccentric hamstring exercise programme using the NHE. The findings of the present study were that a 6-week eccentric hamstring training programme improved eccentric hamstring muscle strength (202.4 vs. 177.4 nm, p = 0.0002, Cohen's d = 0.97) and optimized kinematic (longer control of the forward fall component of the NHE, 68.1° vs. 73.7°, p = 0.022, Cohen's d = 0.90) and neuromuscular parameters (increased electromyographic activity of the hamstrings, 83.2 vs. 56.6 % and 92.0 vs. 54.2 %, p 1.25) associated with NHE performance. This study provides some insight into potential mechanisms by which an eccentric hamstring exercise programme utilizing the NHE as the mode of exercise may result in an improvement in hamstring muscle control during eccentric contractions.
Saadat, Mostafa; Pashaei, Samira; Amerizade, Foroozan
2015-07-01
The genes encoding X-ray repair cross-complementing group 4 (XRCC4; OMIM: 194363) and 5 (XRCC5; OMIM: 194364) are involved in repair of DNA double-strand breaks. To investigating the associations between polymorphisms of Insertion/Deletion (I/D, rs28360071) in the intron 3 of the XRCC4 and VNTR in the promoter region of the XRCC5 and risk of gastric cancer, the present study was carried out. We included 159 (56 females, 103 males) with gastric cancer and 242 (75 females, 167 males) healthy blood donors frequency matched for age and gender. Using PCR-based methods, the genotypes of the study polymorphisms were determined. The alleles of VNTR XRCC5 polymorphism divided into two groups: L (0 and 1 repeats) and H (2 and 3 repeats) alleles. For the I/D XRCC4 polymorphism, after stratification of the subjects according to their family history (FH) of cancer, either the ID (OR = 3.19, 95%CI: 1.35-7.50, P = 0.008) or the DD genotypes (OR = 4.62, 95%CI: 1.63-13.0, P = 0.004) among positive FH persons, increased the risk of gastric cancer compared with the reference group (persons who have negative FH and II genotype). For the VNTR XRCC5 polymorphism, the LH + HH genotypes among positive FH persons, increased the risk of gastric cancer compared with the reference group (persons who have negative FH and LL genotype) (OR = 2.88, 95%CI: 1.34-6.18, P = 0.006). Sensitivity analysis showed that the above mentioned associations were not occurred due to the maldistribution of the genotypes among missing data. The present study suggests that both polymorphisms of the XRCC4 and XRCC5 might be risk factors for gastric cancer development especially among persons with positive FH.
Hirosaki, T; Mizushima, H; Tsubota, Y; Moriyama, K; Miyazaki, K
2000-07-21
The basement membrane protein laminin-5, a heterotrimer of laminin alpha3, beta3, and gamma2 chains, potently promotes cellular adhesion and motility. It has been supposed that the carboxyl-terminal globular region of the alpha3 chain consisting of five distinct domains (G1 to G5) is important for its interaction with integrins. To clarify the function of each G domain, we transfected cDNAs for the full-length (wild type (WT)) and five deletion derivatives (DeltaGs) of the alpha3 chain into human fibrosarcoma cell line HT1080, which expressed and secreted the laminin beta3 and gamma2 chains but not the alpha3 chain. The transfectants with the alpha3 chain cDNAs lacking G5 (DeltaG(5)), G4-5 (DeltaG(4-5)), G3-5 (DeltaG(3-5)), and G2-5 (DeltaG(2-5)) secreted laminin-5 variants at levels comparable to that with WT cDNA. However, the transfectant with the cDNA without any G domains (DeltaG(1-5)) secreted little laminin-5, suggesting that the G domains are essential for the efficient assembly and secretion of the heterotrimer alpha3beta3gamma2. The transfectants with WT, DeltaG(5), and DeltaG(4-5) cDNAs survived in serum-free medium longer than those with DeltaG(3-5), DeltaG(2-5), and DeltaG(1-5) cDNAs. The transfectants with WT, DeltaG(5), and DeltaG(4-5) cDNAs secreted apparently the same size of laminin-5, which lacked G4 and G5 due to proteolytic cleavage between G3 and G4, and these laminin-5 forms potently promoted integrin alpha(3)beta(1)-dependent cell adhesion and migration. However, the laminin-5 forms of DeltaG(3-5) and DeltaG(2-5) hardly promoted the cell adhesion and motility. These findings demonstrate that the G3 domain, but not the G4 and G5 domains, of the alpha3 chain is essential for the potent promotion of cell adhesion and motility by laminin-5.
Promoters of Escherichia coli versus promoter islands: function and structure comparison.
Directory of Open Access Journals (Sweden)
Valeriy V Panyukov
Full Text Available Expression of bacterial genes takes place under the control of RNA polymerase with exchangeable σ-subunits and multiple transcription factors. A typical promoter region contains one or several overlapping promoters. In the latter case promoters have the same or different σ-specificity and are often subjected to different regulatory stimuli. Genes, transcribed from multiple promoters, have on average higher expression levels. However, recently in the genome of Escherichia coli we found 78 regions with an extremely large number of potential transcription start points (promoter islands, PIs. It was shown that all PIs interact with RNA polymerase in vivo and are able to form transcriptionally competent open complexes both in vitro and in vivo but their transcriptional activity measured by oligonucleotide microarrays was very low, if any. Here we confirmed transcriptional defectiveness of PIs by analyzing the 5'-end specific RNA-seq data, but showed their ability to produce short oligos (9-14 bases. This combination of functional properties indicated a deliberate suppression of transcriptional activity within PIs. According to our data this suppression may be due to a specific conformation of the DNA double helix, which provides an ideal platform for interaction with both RNA polymerase and the histone-like nucleoid protein H-NS. The genomic DNA of E.coli contains therefore several dozen sites optimized by evolution for staying in a heterochromatin-like state. Since almost all promoter islands are associated with horizontally acquired genes, we offer them as specific components of bacterial evolution involved in acquisition of foreign genetic material by turning off the expression of toxic or useless aliens or by providing optimal promoter for beneficial genes. The putative molecular mechanism underlying the appearance of promoter islands within recipient genomes is discussed.
Systematic search for the Cra-binding promoters using genomic SELEX system.
Shimada, Tomohiro; Fujita, Nobuyuki; Maeda, Michihisa; Ishihama, Akira
2005-09-01
Cra (or FruR), a global transcription factor with both repression and activation activities, controls a large number of the genes for glycolysis and gluconeogenesis. To get insights into the entire network of transcription regulation of the E. coli genome by Cra, we isolated a set of Cra-binding sequences using an improved method of genomic SELEX. From the DNA sequences of 97 independently isolated DNA fragments by SELEX, the Cra-binding sequences were identified in a total of ten regions on the E. coli genome, including promoters of six known genes and four hitherto-unidentified genes. All six known promoters are repressed by Cra, but none of the activation-type promoters were cloned after two cyles of SELEX, because the Cra-binding affinity to the repression-type promoters is higher than the activation-type promoters, as determined by the quantitative gel shift assay. Of a total of four newly identified Cra-binding sequences, two are associated with promoter regions of the gapA (glyceraldehyde 3-phosphate dehydrogenase) and eno (enolase) genes, both involved in sugar metabolism. The regulation of newly identified genes by Cra was confirmed by the in vivo promoter strength assay using a newly developed TFP (two-fluorescent protein) vector for promoter assay or by in vitro transcription assay in the presence of Cra protein.
Directory of Open Access Journals (Sweden)
Shan Xin
Full Text Available Apoplastic ascorbate oxidase (AO plays significant roles in plant cell growth. However, the mechanism of underlying the transcriptional regulation of AO in Gossypium hirsutum remains unclear. Here, we obtained a 1,920-bp promoter sequence from the Gossypium hirsutum ascorbate oxidase (GhAO1 gene, and this GhAO1 promoter included a number of known cis-elements. Promoter activity analysis in overexpressing pGhAO1::GFP-GUS tobacco (Nicotiana benthamiana showed that the GhAO1 promoter exhibited high activity, driving strong reporter gene expression in tobacco trichomes, leaves and roots. Promoter 5'-deletion analysis demonstrated that truncated GhAO1 promoters with serial 5'-end deletions had different GUS activities. A 360-bp fragment was sufficient to activate GUS expression. The P-1040 region had less GUS activity than the P-720 region, suggesting that the 320-bp region from nucleotide -720 to -1040 might include a cis-element acting as a silencer. Interestingly, an auxin-responsive cis-acting element (TGA-element was uncovered in the promoter. To analyze the function of the TGA-element, tobacco leaves transformed with promoters with different 5' truncations were treated with indole-3-acetic acid (IAA. Tobacco leaves transformed with the promoter regions containing the TGA-element showed significantly increased GUS activity after IAA treatment, implying that the fragment spanning nucleotides -1760 to -1600 (which includes the TGA-element might be a key component for IAA responsiveness. Analyses of the AO promoter region and AO expression pattern in Gossypium arboreum (Ga, diploid cotton with an AA genome, Gossypium raimondii (Gr, diploid cotton with a DD genome and Gossypium hirsutum (Gh, tetraploid cotton with an AADD genome indicated that AO promoter activation and AO transcription were detected together only in D genome/sub-genome (Gr and Gh cotton. Taken together, these results suggest that the 1,920-bp GhAO1 promoter is a functional sequence
Xin, Shan; Tao, Chengcheng; Li, Hongbin
2016-01-01
Apoplastic ascorbate oxidase (AO) plays significant roles in plant cell growth. However, the mechanism of underlying the transcriptional regulation of AO in Gossypium hirsutum remains unclear. Here, we obtained a 1,920-bp promoter sequence from the Gossypium hirsutum ascorbate oxidase (GhAO1) gene, and this GhAO1 promoter included a number of known cis-elements. Promoter activity analysis in overexpressing pGhAO1::GFP-GUS tobacco (Nicotiana benthamiana) showed that the GhAO1 promoter exhibited high activity, driving strong reporter gene expression in tobacco trichomes, leaves and roots. Promoter 5'-deletion analysis demonstrated that truncated GhAO1 promoters with serial 5'-end deletions had different GUS activities. A 360-bp fragment was sufficient to activate GUS expression. The P-1040 region had less GUS activity than the P-720 region, suggesting that the 320-bp region from nucleotide -720 to -1040 might include a cis-element acting as a silencer. Interestingly, an auxin-responsive cis-acting element (TGA-element) was uncovered in the promoter. To analyze the function of the TGA-element, tobacco leaves transformed with promoters with different 5' truncations were treated with indole-3-acetic acid (IAA). Tobacco leaves transformed with the promoter regions containing the TGA-element showed significantly increased GUS activity after IAA treatment, implying that the fragment spanning nucleotides -1760 to -1600 (which includes the TGA-element) might be a key component for IAA responsiveness. Analyses of the AO promoter region and AO expression pattern in Gossypium arboreum (Ga, diploid cotton with an AA genome), Gossypium raimondii (Gr, diploid cotton with a DD genome) and Gossypium hirsutum (Gh, tetraploid cotton with an AADD genome) indicated that AO promoter activation and AO transcription were detected together only in D genome/sub-genome (Gr and Gh) cotton. Taken together, these results suggest that the 1,920-bp GhAO1 promoter is a functional sequence with a
AKT increases VEGF expression in tumor cells by transactivating the proximal VEGF promoter
International Nuclear Information System (INIS)
Pore, N.; Bernhard, E.J.; Shu, H.-K.; Li, B.; O'Rourke, D.M.; Maity, A.; Haas-Kogan, D.
2003-01-01
Vascular endothelial growth factor (VEGF) is overexpressed in many cancers including glioblastomas and may contribute to their growth. Epidermal growth factor receptor (EGFR) amplification and loss of PTEN, commonly found in glioblastomas leading to increase phosphatidylinositol-3-kinase (PI3K) activity and VEGF expression. In the current study we show that AKT, which is downstream of PI3K, regulates VEGF expression. U87MG human glioblastoma cells lack wildtype PTEN and express high levels of phosphorylated AKT. Over expression of AKT either by stable expression in immortalized human astrocytes or by transduction with adenovirus containing activated myristoylated AKT in SF188 glioblastoma cells increases VEGF expression. Moreover the elevation of angiogenesis by constitutively expressed AKT is further confirmed by in vivo matrigel plug assay in nude mice. The upregulation of VEGF by AKT is mediated through a region in the proximal promoter located between -88 and -70 (+1 is transcription start site). In transient transfection activity of a luciferase reporter containing the -88/+54 region of the VEGF promoter is increased by cotransfection with myristoylated AKT and downregulated by a dominant negative AKT expression vector. Mutation of the putative Sp1 binding sites located in the -88/-70 region we show that AKT acts through Sp1 to transactivate the VEGF promoter. Cotransfection of the VEGF promoter reporter with both Sp1 and myristoylated AKT expression vectors increases promoter activity to a greater extent than either Sp1 or Akt by itself. In vivo phosphate labeling of proteins reveals that AKT leads to increased Sp1 phosphorylation. Gel shift assays using a radio labeled probe corresponding to nucleotides -88 through -66 in the promoter show increased binding with nuclear extracts from cells transduced with adenovirus expressing myristoylated AKT. In conclusion, our results suggest that loss of PTEN leads to increased VEGF expression by increasing AKT
Deletion analysis of susy-sl promoter for the identification of optimal promoter sequence
International Nuclear Information System (INIS)
Bacha, S.; Khatoon, A.; Asif, M.; Bshir, A.
2015-01-01
The promoter region of sucrose synthase (susy-Sl) was identified and isolated from tomato. The 5? deletion analysis was carried out for the identification of minimum optimal promoter. Transgenic lines of Arabidopsis thaliana were developed by floral dip method incorporating various promoter deletion cassettes controlling GUS reporter gene. GUS assay of transgenic tissues indicated that full length susy-Sl promoter and its deletion mutants were constitutively expressed in vegetative and floral tissues of A. thaliana. The expression was observed in roots, shoots and flowers of A. thaliana. Analysis of 5? deletion series of susy-Sl promoter showed that a minimum of 679 bp fragment of the promoter was sufficient to drive expression of GUS reporter gene in the major tissues of transgenic A. thaliana. (author)
Directory of Open Access Journals (Sweden)
Nandini V L Hayes
Full Text Available Phosducin-like protein 3 (PhLP3 forms a ternary complex with the ATP-dependent molecular chaperone CCT and its folding client tubulin. In vitro studies suggest PhLP3 plays an inhibitory role in β-tubulin folding while conversely in vivo genetic studies suggest PhLP3 is required for the correct folding of β-tubulin. We have a particular interest in the cytoskeleton, its chaperones and their role in determining cellular phenotypes associated with high level recombinant protein expression from mammalian cell expression systems.As studies into PhLP3 function have been largely carried out in non mammalian systems, we examined the effect of human PhLP3 over-expression and siRNA silencing using a single murine siRNA on both tubulin and actin systems in mammalian Chinese hamster ovary (CHO cell lines. We show that over-expression of PhLP3 promotes an imbalance of α and β tubulin subunits, microtubule disassembly and cell death. In contrast, β-actin levels are not obviously perturbed. On-the-other-hand, RNA silencing of PhLP3 increases RhoA-dependent actin filament formation and focal adhesion formation and promotes a dramatic elongated fibroblast-like change in morphology. This was accompanied by an increase in phosphorylated MAPK which has been associated with promoting focal adhesion assembly and maturation. Transient overexpression of PhLP3 in knockdown experiments rescues cells from the morphological change observed during PhLP3 silencing but mitosis is perturbed, probably reflecting a tipping back of the balance of PhLP3 levels towards the overexpression state.Our results support the hypothesis that PhLP3 is important for the maintenance of β-tubulin levels in mammalian cells but also that its modulation can promote actin-based cytoskeletal remodelling by a mechanism linked with MAPK phosphorylation and RhoA-dependent changes. PhLP3 levels in mammalian cells are thus finely poised and represents a novel target for engineering industrially
Intracellular pH regulation by acid-base transporters in mammalian neurons
Ruffin, Vernon A.; Salameh, Ahlam I.; Boron, Walter F.; Parker, Mark D.
2014-01-01
Intracellular pH (pHi) regulation in the brain is important in both physiological and physiopathological conditions because changes in pHi generally result in altered neuronal excitability. In this review, we will cover 4 major areas: (1) The effect of pHi on cellular processes in the brain, including channel activity and neuronal excitability. (2) pHi homeostasis and how it is determined by the balance between rates of acid loading (JL) and extrusion (JE). The balance between JE and JL determine steady-state pHi, as well as the ability of the cell to defend pHi in the face of extracellular acid-base disturbances (e.g., metabolic acidosis). (3) The properties and importance of members of the SLC4 and SLC9 families of acid-base transporters expressed in the brain that contribute to JL (namely the Cl-HCO3 exchanger AE3) and JE (the Na-H exchangers NHE1, NHE3, and NHE5 as well as the Na+- coupled HCO3− transporters NBCe1, NBCn1, NDCBE, and NBCn2). (4) The effect of acid-base disturbances on neuronal function and the roles of acid-base transporters in defending neuronal pHi under physiopathologic conditions. PMID:24592239
FoxO3A promotes metabolic adaptation to hypoxia by antagonizing Myc function
Jensen, Kim Steen; Binderup, Tina; Jensen, Klaus Thorleif; Therkelsen, Ib; Borup, Rehannah; Nilsson, Elise; Multhaupt, Hinke; Bouchard, Caroline; Quistorff, Bjørn; Kjær, Andreas; Landberg, Göran; Staller, Peter
2011-01-01
This paper characterizes FoxO3A as required for hypoxic suppression of mitochondrial mass, oxygen consumption, and ROS production. Mechanistically, FoxO3A is shown to promote hypoxic cell survival by directly antagonizing c-Myc at nuclear encoded mitochondrial genes.
DEFF Research Database (Denmark)
Malinda, Raj Rajeshwar
pathway. Pancreatic ductal adenocarcinoma (PDAC) is one of the most deadly cancer types globally, is characterized by high levels of Transforming growth factor (TGF)β signaling and epithelial-tomesenchymal (EMT). In paper II, I show that TGFβ signaling elicits EMT in SMAD4-positive Panc-1 PDAC cells......, as judged by the downregulation of E-cadherin and upregulation of α- smooth muscle actin (α-SMA) and connective tissue growth factor (CTGF). A modest induction of EMT was also observed in the SMAD-deficient BxPc-3 cells. TGFβ treatment increased Panc- 1 cell invasiveness about 5-fold, and significantly......, knockdown of NHE1 increased TGFβ-induced Panc-1 cell invasiveness, yet the invasiveness induced by merlin knockdown was abolished by knockdown of either NHE1 or NBCn1. Furthermore, TGFβ treatment increased proliferation in Panc-1 cells in a partially NHE1 dependent manner. In conclusion, the findings...
Directory of Open Access Journals (Sweden)
Qiang Sun
Full Text Available IgA nephropathy (IgAN is one of the most common glomerular diseases leading to end-stage renal failure. Elevation of aberrantly glycosylated IgA1 is a key feature of it. The expression of the specific molecular chaperone of core1ß1, 3galactosyl transferase (Cosmc is known to be reduced in IgAN. We aimed to investigate whether the methylation of CpG islands of Cosmc gene promoter region could act as a possible mechanism responsible for down-regulation of Cosmc and related higher secretion of aberrantly glycosylated IgA1in lymphocytes from children with IgA nephropathy. Three groups were included: IgAN children (n = 26, other renal diseases (n = 11 and healthy children (n = 13. B-lymphocytes were isolated and cultured, treated or not with IL-4 or 5-Aza-2'-deoxycytidine (AZA. The levels of DNA methylation of Cosmc promotor region were not significantly different between the lymphocytes of the three children populations (P = 0.113, but there were significant differences between IgAN lymphocytes and lymphocytes of the other two children populations after IL-4 (P<0.0001 or AZA (P<0.0001. Cosmc mRNA expression was low in IgAN lymphocytes compared to the other two groups (P<0.0001. The level of aberrantly glycosylated IgA1 was markedly higher in IgAN group compared to the other groups (P<0.0001. After treatment with IL-4, the levels of Cosmc DNA methylation and aberrantly glycosylated IgA1 in IgAN lymphocytes were remarkably higher than the other two groups (P<0.0001 with more markedly decreased Cosmc mRNA content (P<0.0001. After treatment with AZA, the levels in IgAN lymphocytes were decreased, but was still remarkably higher than the other two groups (P<0.0001, while Cosmc mRNA content in IgAN lymphocytes were more markedly increased than the other two groups (P<0.0001. The alteration of DNA methylation by IL-4 or AZA specifically correlates in IgAN lymphocytes with alterations in Cosmc mRNA expression and with the level of aberrantly glycosylated
Health promotion and schools: how to move forward
Directory of Open Access Journals (Sweden)
Daniela Gardano Bucharles Mont’Alverne
2013-09-01
Full Text Available The health promotion action means, described by the 1986 Ottawa Charter, highlights the creation of supportive environments for health(1. Following this line of reasoning, several strategies have been adopted for implementing health promotion policies, including the Health Promoting School. In 1995, the Pan American Health Organization / Regional Office for the Americas of the World Health Organization (PAHO/WHO officially launched the Regional Health Promoting School Initiative. Since then, all the countries in Latin America and the Caribbean have strengthened school health promotion actions, rethinking school health activities(2. To become a Health Promoting School, the institution must take a comprehensive view of human beings – especially children and adolescents – in their familiar, community and social environment. It must provide a healthy environment, building constructive and harmonious relationships and hence being able to awaken skills and attitudes within participants, fostering autonomy, creativity and participation of students and also the whole school community(3. Never before has so much been said about health and health promotion as today, i.e., there is a need for promoting health at school as an element for changing reality. The school plays an important political role within this context for being a place where ideology can be constructed, destroyed or perpetuated through the transmission of values and beliefs, besides being an environment that favors the development of health education actions. Childhood is the defining moment for the construction and solidification of habits and attitudes, hence the importance of school as an environment that enhances the development of a targeted, systematized and permanent work. “Through the Health Promoting School Initiative, school health has a chance to move forward and expand its conception and practices with a comprehensive and interdisciplinary view of the human being within a
Health promotion and schools: how to move forward
Directory of Open Access Journals (Sweden)
Daniela Gardano Bucharles Mont'Alverne
2014-05-01
Full Text Available The health promotion action means, described by the 1986 Ottawa Charter, highlights the creation of supportive environments for health(1. Following this line of reasoning, several strategies have been adopted for implementing health promotion policies, including the Health Promoting School. In 1995, the Pan American Health Organization / Regional Office for the Americas of the World Health Organization (PAHO/WHO officially launched the Regional Health Promoting School Initiative. Since then, all the countries in Latin America and the Caribbean have strengthened school health promotion actions, rethinking school health activities(2. To become a Health Promoting School, the institution must take a comprehensive view of human beings – especially children and adolescents – in their familiar, community and social environment. It must provide a healthy environment, building constructive and harmonious relationships and hence being able to awaken skills and attitudes within participants, fostering autonomy, creativity and participation of students and also the whole school community(3. Never before has so much been said about health and health promotion as today, i.e., there is a need for promoting health at school as an element for changing reality. The school plays an important political role within this context for being a place where ideology can be constructed, destroyed or perpetuated through the transmission of values and beliefs, besides being an environment that favors the development of health education actions. Childhood is the defining moment for the construction and solidification of habits and attitudes, hence the importance of school as an environment that enhances the development of a targeted, systematized and permanent work. “Through the Health Promoting School Initiative, school health has a chance to move forward and expand its conception and practices with a comprehensive and interdisciplinary view of the human being within a
Promoting regional energy co-operation in South Asia
International Nuclear Information System (INIS)
Srivastava, Leena; Misra, Neha
2007-01-01
Energy is a key ingredient of the socio-economic development of any region. South Asia is not only one of the fastest growing regions in the world; it is also one of the poorest, which thus puts energy at the very heart of the development process in the region. This paper looks at the challenges faced by the South Asia sub-region for economic co-operation (SASEC) comprised of Bangladesh, Bhutan, India and Nepal, and also at the role of greater regional energy co-operation therein. The region is characterized by pressures of growing economies and increasing population. While the per capita energy consumption is one of the lowest in the world, energy intensity continues to be very high. A large portion of the population lacks access to modern sources of energy and depends on traditional sources that are not only inefficient but also have severe health and environmental problems associated with them. Increasing oil import dependency and huge investment needs for energy market development pose a further challenge. The region has a good resource potential and tremendous scope for energy co-operation, which can play a key role in addressing many of these energy security concerns and in putting it on the path of sustainable development. It is ironic that the record in the area has been so limited and that too in the most basic form of co-operation, i.e. bilateral arrangements between countries. This paper puts forth a multi-pronged strategy for sub-regional energy co-operation encompassing softer options aimed at confidence building to more substantial and larger scale co-operation efforts. Delays in decision making to ensure stronger and mutually beneficial co-operation efforts are associated with high costs not only to the energy sector but also for the entire development agenda. With the precarious energy situation in the region and unprecedented increases in international oil prices seen in recent times, it is high time for policy makers, financing institutions, NGOs
The ubiquitin ligase SCFFBXW7α promotes GATA3 degradation.
Song, Nan; Cao, Cheng; Tang, Yiman; Bi, Liyuan; Jiang, Yong; Zhou, Yongsheng; Song, Xin; Liu, Ling; Ge, Wenshu
2018-03-01
GATA3 is a key transcription factor in cell fate determination and its dysregulation has been implicated in various types of malignancies. However, how the abundance and function of GATA3 are regulated remains unclear. Here, we report that GATA3 is physically associated with FBXW7α, and FBXW7α destabilizes GATA3 through assembly of a SKP1-CUL1-F-box E3 ligase complex. Importantly, we showed that FBXW7α promotes GATA3 ubiquitination and degradation in a GSK3 dependent manner. Furthermore, we demonstrated that FBXW7α inhibits breast cancer cells survival through destabilizing GATA3, and the expression level of FBXW7α is negatively correlated with that of GATA3 in breast cancer samples. This study indicated that FBXW7α is a critical negative regulator of GATA3 and revealed a pathway for the maintenance of GATA3 abundance in breast cancer cells. © 2017 Wiley Periodicals, Inc.
Characteristics of NaNO3-Promoted CdO as a Midtemperature CO2 Absorbent.
Kim, Kang-Yeong; Kwak, Jin-Su; An, Young-In; Oh, Kyung-Ryul; Kwon, Young-Uk
2017-06-28
In this study, we explored the reaction system CdO(s) + CO 2 (g) ⇄ CdCO 3 (s) as a model system for CO 2 capture agent in the intermediate temperature range of 300-400 °C. While pure CdO does not react with CO 2 at all up to 500 °C, CdO mixed with an appropriate amount of NaNO 3 (optimal molar ratio NaNO 3 /CdO = 0.14) greatly enhances the conversion of CdO into CdCO 3 up to ∼80% (5.68 mmol/g). These NaNO 3 -promoted CdO absorbents can undergo many cycles of absorption and desorption by temperature swing between 300 and 370 °C under a 100% CO 2 condition. Details of how NaNO 3 promotes the CO 2 absorption of CdO have been delineated through various techniques using thermogravimetry, coupled with X-ray diffraction and electron microscopy. On the basis of the observed data, we propose a mechanism of CO 2 absorption and desorption of NaNO 3 -promoted CdO. The absorption proceeds through a sequence of events of CO 2 adsorption on the CdO surface covered by NaNO 3 , dissolution of so-formed CdCO 3 , and precipitation of CdCO 3 particles in the NaNO 3 medium. The desorption occurs through the decomposition of CdCO 3 in the dissolved state in the NaNO 3 medium where CdO nanoparticles are formed dispersed in the NaNO 3 medium. The CdO nanoparticles are aggregated into micrometer-large particles with smooth surfaces and regular shapes.
Directory of Open Access Journals (Sweden)
Tsung-I Chen
2016-10-01
Full Text Available Purpose: To investigate the role of sodium–hydrogen exchanger-1 (NHE-1 and exercise training on intermittent hypoxia-induced cardiac fibrosis in obstructive sleep apnea (OSA, using an animal model mimicking the intermittent hypoxia of OSA. Methods: Eight-week-old male Sprague–Dawley rats were randomly assigned to control (CON, intermittent hypoxia (IH, exercise (EXE or IH combined with exercise (IHEXE groups. These groups were randomly assigned to subgroups receiving either a vehicle or the NHE-1 inhibitor cariporide. The EXE and IHEXE rats underwent exercise training on an animal treadmill for 10 weeks (5 days/week, 60 minutes/day, 24–30 m/minute, 2–10% grade. The IH and IHEXE rats were exposed to 14 days of IH (30 seconds of hypoxia - nadir of 2-6% O2 - followed by 45 seconds of normoxia for 8 hours/day. At the end of 10 weeks, rats were sacrificed and then hearts were removed to determine the myocardial levels of fibrosis index, oxidative stress, antioxidant capacity and NHE-1 activation. Results: Compared to the CON rats, IH induced higher cardiac fibrosis, lower myocardial catalase and superoxidative dismutase activities, higher myocardial lipid and protein peroxidation and higher NHE-1 activation (p < 0.05 for each, which were all abolished by cariporide. Compared to the IH rats, lower cardiac fibrosis, higher myocardial antioxidant capacity, lower myocardial lipid and protein peroxidation and lower NHE-1 activation were found in the IHEXE rats (p < 0.05 for each. Conclusion: IH-induced cardiac fibrosis was associated with NHE-1 hyperactivity. However, exercise training and cariporide exerted an inhibitory effect to prevent myocardial NHE-1 hyperactivity, which contributed to reduced IH-induced cardiac fibrosis. Therefore, NHE-1 plays a critical role in the effect of exercise on IH-induced increased cardiac fibrosis.
International Nuclear Information System (INIS)
Deng, San-Ming; Yan, Xian-Chun; Liang, Liang; Wang, Li; Liu, Yuan; Duan, Juan-Li; Yang, Zi-Yan; Chang, Tian-Fang; Ruan, Bai; Zheng, Qi-Jun; Han, Hua
2017-01-01
Although it has been suggested that Dll3, one of the Notch ligands, promotes the proliferation and inhibits the apoptosis of cancer cells, the role of Dll3 in cancers remains unclear. In this study, we found that in the murine Lewis lung carcinoma (LLC) cells, the level of Dll3 mRNA changed upon tumor microenvironment (TME) stimulation, namely, decreased under hypoxia or stimulated with tumor necrosis factor (TNF)-α. Dll3 was also expressed at higher level in human lung carcinoma tissues than in the para-carcinoma tissues. Overexpression of Dll3 in LLC cells promoted cell proliferation and reduced apoptosis in vitro, and enhanced tumor growth when inoculated in vivo in mice. The Dll3-mediated proliferation could be due to increased Akt phosphorylation in LLC cells, because an Akt inhibitor counteracted Dll3-induced proliferation. Moreover, Dll3 overexpression promoted PI3K/Akt signaling through inhibiting Notch signaling. - Highlights: • The level of Dll3 in Lewis lung carcinoma changed upon tumor microenvironment (TME) stimulation, namely, decreased under hypoxia or stimulated with TNF-α. • The Dll3 was rarely detectable in the para-carcinoma tissues, but positive in 82.1% of NSCLC tissues from 84 patients. • Overexpression of Dll3 in LLC cells promoted tumor growth but did not remarkably alter TME after inoculated in mice. • Overexpression of Dll3 in LLC cells promoted cell proliferation and reduced apoptosis in vitro in an Akt-dependent way. • Dll3 overexpression promoted PI3K/Akt signaling through inhibiting Notch signaling.
An, Ming-Xin; Li, Si; Yao, Han-Bing; Li, Chao; Wang, Jia-Mei; Sun, Jia; Li, Xin-Yu; Meng, Xiao-Na; Wang, Hua-Qin
2017-12-04
Aerobic glycolysis, a phenomenon known historically as the Warburg effect, is one of the hallmarks of cancer cells. In this study, we characterized the role of BAG3 in aerobic glycolysis of pancreatic ductal adenocarcinoma (PDAC) and its molecular mechanisms. Our data show that aberrant expression of BAG3 significantly contributes to the reprogramming of glucose metabolism in PDAC cells. Mechanistically, BAG3 increased Hexokinase 2 (HK2) expression, the first key enzyme involved in glycolysis, at the posttranscriptional level. BAG3 interacted with HK2 mRNA, and the degree of BAG3 expression altered recruitment of the RNA-binding proteins Roquin and IMP3 to the HK2 mRNA. BAG3 knockdown destabilized HK2 mRNA via promotion of Roquin recruitment, whereas BAG3 overexpression stabilized HK2 mRNA via promotion of IMP3 recruitment. Collectively, our results show that BAG3 promotes reprogramming of glucose metabolism via interaction with HK2 mRNA in PDAC cells, suggesting that BAG3 may be a potential target in the aerobic glycolysis pathway for developing novel anticancer agents. © 2017 An et al.
Glucocorticoid receptor gene expression and promoter CpG modifications throughout the human brain.
Cao-Lei, Lei; Suwansirikul, Songkiet; Jutavijittum, Prapan; Mériaux, Sophie B; Turner, Jonathan D; Muller, Claude P
2013-11-01
Glucocorticoids and the glucocorticoid (GR) and mineralocorticoid (MR) receptors have been implicated in many processes, particularly in negative feedback regulation of the hypothalamic-pituitary-adrenal axis. Epigenetically programmed GR alternative promoter usage underlies transcriptional control of GR levels, generation of GR 3' splice variants, and the overall GC response in the brain. No detailed analysis of GR first exons or GR transcript variants throughout the human brain has been reported. Therefore we investigated post mortem tissues from 28 brain regions of 5 individuals. GR first exons were expressed throughout the healthy human brain with no region-specific usage patterns. First exon levels were highly inter-correlated suggesting that they are co-regulated. GR 3' splice variants (GRα and GR-P) were equally distributed in all regions, and GRβ expression was always low. GR/MR ratios showed significant differences between the 28 tissues with the highest ratio in the pituitary gland. Modification levels of individual CpG dinucleotides, including 5-mC and 5-hmC, in promoters 1D, 1E, 1F, and 1H were low, and diffusely clustered; despite significant heterogeneity between the donors. In agreement with this clustering, sum modification levels rather than individual CpG modifications correlated with GR expression. Two-way ANOVA showed that this sum modification was both promoter and brain region specific, but that there was however no promoter*tissue interaction. The heterogeneity between donors may however hide such an interaction. In both promoters 1F and 1H modification levels correlated with GRα expression suggesting that 5-mC and 5-hmC play an important role in fine tuning GR expression levels throughout the brain. Copyright © 2013 Elsevier Ltd. All rights reserved.
Fazio, Elena N; Young, Claire C; Toma, Jelena; Levy, Michael; Berger, Kurt R; Johnson, Charis L; Mehmood, Rashid; Swan, Patrick; Chu, Alphonse; Cregan, Sean P; Dilworth, F Jeffrey; Howlett, Christopher J; Pin, Christopher L
2017-09-01
Pancreatitis is a debilitating disease of the exocrine pancreas that, under chronic conditions, is a major susceptibility factor for pancreatic ductal adenocarcinoma (PDAC). Although down-regulation of genes that promote the mature acinar cell fate is required to reduce injury associated with pancreatitis, the factors that promote this repression are unknown. Activating transcription factor 3 (ATF3) is a key mediator of the unfolded protein response, a pathway rapidly activated during pancreatic insult. Using chromatin immunoprecipitation followed by next-generation sequencing, we show that ATF3 is bound to the transcriptional regulatory regions of >30% of differentially expressed genes during the initiation of pancreatitis. Of importance, ATF3-dependent regulation of these genes was observed only upon induction of pancreatitis, with pathways involved in inflammation, acinar cell differentiation, and cell junctions being specifically targeted. Characterizing expression of transcription factors that affect acinar cell differentiation suggested that acinar cells lacking ATF3 maintain a mature cell phenotype during pancreatitis, a finding supported by maintenance of junctional proteins and polarity markers. As a result, Atf3 -/- pancreatic tissue displayed increased tissue damage and inflammatory cell infiltration at early time points during injury but, at later time points, showed reduced acinar-to-duct cell metaplasia. Thus our results reveal a critical role for ATF3 as a key regulator of the acinar cell transcriptional response during injury and may provide a link between chronic pancreatitis and PDAC. © 2017 Fazio et al. This article is distributed by The American Society for Cell Biology under license from the author(s). Two months after publication it is available to the public under an Attribution–Noncommercial–Share Alike 3.0 Unported Creative Commons License (http://creativecommons.org/licenses/by-nc-sa/3.0).
Lin, Chih-Yang; Wang, Shih-Wei; Chen, Yen-Ling; Chou, Wen-Yi; Lin, Ting-Yi; Chen, Wei-Cheng; Yang, Chen-Yu; Liu, Shih-Chia; Hsieh, Chia-Chu; Fong, Yi-Chin; Wang, Po-Chuan; Tang, Chih-Hsin
2017-08-03
Chondrosarcoma is the second most common primary malignancy of bone, and one of the most difficult bone tumors to diagnose and treat. It is well known that increased levels of vascular endothelial growth factor-C (VEGF-C) promote active tumor lymphangiogenesis and lymphatic tumor spread to regional lymph nodes. Brain-derived neurotrophic factor (BDNF) is known to promote metastasis in human chondrosarcoma cells. Knowing more about the mechanism of BDNF in VEGF-C expression and lymphangiogenesis in human chondrosarcoma would improve our understanding as how to prevent chondrosarcoma angiogenesis and metastasis, which currently lacks effective adjuvant treatment. Here, we found that BDNF expression was at least 2.5-fold higher in the highly migratory JJ012(S10) cell line as compared with the primordial cell line (JJ012). In addition, VEGF-C expression and secretion was markedly increased in JJ012(S10) cells. Conditioned medium from JJ012(S10) cells significantly promoted migration and tube formation of human lymphatic endothelial cells (LECs), whereas knockdown of BDNF attenuated LEC migration and tube formation by suppressing VEGF-C production in JJ012(S10) cells. Mechanistic investigations indicated that BDNF facilitated VEGF-C-dependent lymphangiogenesis through the MEK/ERK/mTOR signaling pathway. We also showed that microRNA (miR)-624-3p expression was negatively regulated by BDNF via the MEK/ERK/mTOR cascade. Importantly, BDNF knockdown profoundly inhibited tumor-associated lymphangiogenesis in vivo. Further analyses identified that BDNF promoted tumor lymphangiogenesis by downregulating miR-624-3p in human chondrosarcoma tissues. In conclusion, this study is the first to reveal the mechanism underlying BDNF-induced lymphangiogenesis. We suggest that BDNF may serve as a promising therapeutic target for the restriction of VEGF-C-mediated tumor lymphangiogenesis and lymphatic metastasis.
Janssen, Paddy K C; Zwinderman, Aeilko H; Olivier, Berend; Waldinger, Marcel D
PURPOSE: To investigate the association between the 5-HT-transporter-gene-linked promoter region (5-HTTLPR) polymorphism and 20-mg paroxetine-induced ejaculation delay in men with lifelong premature ejaculation (LPE). MATERIALS AND METHODS: This was a prospective study of 10 weeks of paroxetine
A single-copy galK promoter cloning vector suitable for cloning strong promoters
DEFF Research Database (Denmark)
Dandanell, Gert; Court, Donald L.; Hammer, Karin
1986-01-01
We report the construction of lambda galK promoter cloning vectors for cloning and characterization of strong promoters. This phage, which contains a unique HindIII cloning site, was applied to the cloning and analysis of transcription initiations of the regulatory region of the deo-operon of...
Geng, Y; Tsai-Morris, C H; Zhang, Y; Dufau, M L
1999-09-24
To understand the transcriptional mechanism(s) of human LH receptor (LHR) gene expression, we have identified the dominant functional cis-elements that regulate the activity of the promoter domain (-1 to -176 bp from ATG). Mutagenesis demonstrated that the promoter activity was dependent on two Sp1 domains (-79 bp, -120 bp) in a transformed normal placental cell (PLC) and the choriocarcinoma JAR cell. Both elements interacted with endogenous Sp1 and Sp3 factors but not with Sp2 or Sp4. In Drosophila SL2 cells, the promoter was activated by either Sp1 or Sp3. An ERE half-site (EREhs) at -174 bp was inhibitory (by 100%), but was unresponsive to estradiol and did not bind the estrogen receptor or orphan receptors ERR1 and SF-1. The 5' upstream sequence (-177 to -2056 bp) inhibited promoter activity in PLC by 60%, but only minimally in JAR cells. Activation of the human LHR promoter through Sp1/3 factors is negatively regulated through EREhs and upstream sequences to exert control of gene expression. Copyright 1999 Academic Press.
DEFF Research Database (Denmark)
Nørgaard, Maibritt; Haldrup, Christa; Storebjerg, Tine Maj
2017-01-01
Overdiagnosis and overtreatment of clinically insignificant tumors remains a major problem in prostate cancer (PC) due to suboptimal diagnostic and prognostic tools. Thus, novel biomarkers are urgently needed. In this study, we investigated the biomarker potential of Trefoil factor 3 (TFF3......) promoter methylation and RNA expression levels for PC. Initially, by quantitative methylation specific PCR (qMSP) analysis of a large radical prostatectomy (RP) cohort (n = 292), we found that the TFF3 promoter was significantly hypomethylated in PC compared to non-malignant (NM) prostate tissue samples (p....... 67 NM) analyzed by Illumina 450K DNA methylation arrays and/or RNA sequencing. TFF3 promoter methylation and transcriptional expression levels were inversely correlated, suggesting that epigenetic mechanisms contribute to the regulation of gene activity. Furthermore, low TFF3 expression...
Directory of Open Access Journals (Sweden)
Enrique Yamil Alul González
2010-12-01
Full Text Available The Regional Productive Development Agencies implemented in Chile in 2006, were developed as a way to answer the longing desire to territorially decentralize, and that the own Regions be whom define their future. The Agencies have the responsibility to develop innovation and productive development Agendas in participative processes, which means with public, academic and private actors. Also, the Agencies have the mission to implement Competitive Improvement Plans-PMC (clusters in prioritized economic sectors by the own region. These PMC are leaded by private actors in each sector.
Identification and characterization of the human SOX6 promoter
International Nuclear Information System (INIS)
Ikeda, Toshiyuki; Saito, Taku; Ushita, Masahiro; Yano, Fumiko; Kan, Akinori; Itaka, Keiji; Moro, Toru; Nakamura, Kozo; Kawaguchi, Hiroshi; Chung, Ung-il
2007-01-01
The present study attempted to identify and characterize the embryonic promoter of Sox6, a determinant regulator of chondrogenic differentiation. A common transcription start region for human and mouse Sox6 was initially identified, which contained a highly conserved sequence, A-box. Tandem repeats of A-box had a strong transcriptional activity both at the basal level and in response to Sox9. Cells carrying the 4xA-box-DsRed2 reporter fluoresced only upon chondrogenic differentiation. The 46-bp core enhancer region (CES6) was then identified in the 3' half of A-box, within which a C/EBP-binding motif was identified. Overexpressed C/EBPβ activated the Sox6 promoter, and mutant 4xCES6 constructs lacking the C/EBP motif lost their basal activity. CES6 and nuclear extracts formed a specific complex, which was supershifted by anti-C/EBPβ antibody, and in vitro translated C/EBPβ specifically bound to CES6. Thus, we successfully identified the Sox6 promoter and its core enhancer and characterized the interactions with regulatory transcription factors
DEFF Research Database (Denmark)
Hansen, Martin A; Nielsen, John E; Retelska, Dorota
2008-01-01
, sequences corresponding to the shared promoter region of the CYPT family were identified at 39 loci. Most loci were located immediately upstream of genes belonging to the VCX/Y, SPANX, or CSAG gene families. Sequence comparison of the loci revealed a conserved CYPT promoter-like (CPL) element featuring TATA...... cell types. The genomic regions harboring the gene families were rich in direct and inverted segmental duplications (SD), which may facilitate gene conversion and rapid evolution. The conserved CPL and the common expression profiles suggest that the human VCX/Y, SPANX, and CSAG2 gene families together......Many testis-specific genes from the sex chromosomes are subject to rapid evolution, which can make it difficult to identify murine genes in the human genome. The murine CYPT gene family includes 15 members, but orthologs were undetectable in the human genome. However, using refined homology search...
Tsai, P-C; Chen, C-J; Lai, H-M; Chang, S-J
2008-01-01
To explore the associations between the polymorphisms and protein levels of interleukin-6 (IL-6) gene and gout disease. A total of 120 male gout patients and 184 healthy controls were enrolled. Each patient was matched with 1-2 gout-free controls by age within three years. Four polymorphisms in the promoter of IL-6 gene, including -597G/A, -572C/G, -373A(m)T(n), and -174G/C, and the IL-6 levels were analyzed. The clinical characteristics and biochemical markers in plasma were measured, including age of gout onset, duration of gout history, tophus number, gout attack frequency, uric acid, total cholesterol, triglycerides and creatinine. The mean IL-6 level for gout patients was 9.80 (+/-11.76 pg/ml) which showed no significant difference from the controls (7.06+/-7.58 pg/ml, p=0.230). When the IL-6 levels were dichotomized according to the median value (5 pg/ml), there were significantly higher proportions of the gout patients (59.66%) than controls (44%) with high IL-6 levels (OR=1.88, 95% CI=1.17-3.02, p=0.008). Unique genotype was found at polymorphisms -174G/C and -597G/A. Neither the polymorphisms -572C/G nor -373A(m)T(n) in the genotype or allele distributions showed a significant association related to clinical characteristics, biochemical markers, IL-6 levels or gout disease (all p>0.05). Those with gout disease have greater proportions of high IL-6 levels in plasma than controls, and there is no significant association between the four polymorphisms in the promoter region of IL-6 gene and gout disease.
International Nuclear Information System (INIS)
Paradiso, Angelo; Cardone, Rosa Angela; Bellizzi, Antonia; Bagorda, Anna; Guerra, Lorenzo; Tommasino, Massimo; Casavola, Valeria; Reshkin, Stephan J
2004-01-01
An increasing body of evidence shows that the tumour microenvironment is essential in driving neoplastic progression. The low serum component of this microenvironment stimulates motility/invasion in human breast cancer cells via activation of the Na + –H + exchanger (NHE) isoform 1, but the signal transduction systems that underlie this process are still poorly understood. We undertook the present study to elucidate the role and pattern of regulation by the Rho GTPases of this serum deprivation-dependent activation of both NHE1 and subsequent invasive characteristics, such as pseudopodia and invadiopodia protrusion, directed cell motility and penetration of normal tissues. The present study was performed in a well characterized human mammary epithelial cell line representing late stage metastatic progression, MDA-MB-435. The activity of RhoA and Rac1 was modified using their dominant negative and constitutively active mutants and the activity of NHE1, cell motility/invasion, F-actin content and cell shape were measured. We show for the first time that serum deprivation induces NHE1-dependent morphological and cytoskeletal changes in metastatic cells via a reciprocal interaction of RhoA and Rac1, resulting in increased chemotaxis and invasion. Deprivation changed cell shape by reducing the amount of F-actin and inducing the formation of leading edge pseudopodia. Serum deprivation inhibited RhoA activity and stimulated Rac1 activity. Rac1 and RhoA were antagonistic regulators of both basal and stimulated tumour cell NHE1 activity. The regulation of NHE1 activity by RhoA and Rac1 in both conditions was mediated by an alteration in intracellular proton affinity of the exchanger. Interestingly, the role of each of these G-proteins was reversed during serum deprivation; basal NHE1 activity was regulated positively by RhoA and negatively by Rac1, whereas RhoA negatively and Rac1 positively directed the stimulation of NHE1 during serum deprivation. Importantly, the same
EB1 and EB3 promote cilia biogenesis by several centrosome-related mechanisms
DEFF Research Database (Denmark)
Schrøder, Jacob M; Larsen, Jesper; Komarova, Yulia
2011-01-01
surrounded by vesicles. Further, GST pull-down assays, mass spectrometry and immunoprecipitation indicated that EB1 and EB3 interact with proteins implicated in MT minus-end anchoring or vesicular trafficking to the cilia base, suggesting that EB1 and EB3 promote ciliogenesis by facilitating such trafficking...
'Nordic' Hamstrings Exercise - Engagement Characteristics and Training Responses
Iga, J; Fruer, C S; Deighan, Martine A; De Ste Croix, Mark B; James, David V
2012-01-01
The present study examined the neuromuscular activation characteristics of the hamstrings during the 'Nordic' hamstrings exercise (NHE) and changes in the eccentric strength of the knee flexors with NHE training. Initially, the normalised root mean square electromyographic (EMG) activity of the hamstrings of both limbs during various phases (90-61 degrees, 60-31 degrees and 30-0 degrees of knee extension) of the NHE were determined in 18 soccer players. Subsequently participants were randomly...
Janssen, Paddy K. C.; Zwinderman, Aeilko H.; Olivier, Berend; Waldinger, Marcel D.
2014-01-01
To investigate the association between the 5-HT-transporter-gene-linked promoter region (5-HTTLPR) polymorphism and 20-mg paroxetine-induced ejaculation delay in men with lifelong premature ejaculation (LPE). This was a prospective study of 10 weeks of paroxetine treatment in 54 men with LPE.
Energy Technology Data Exchange (ETDEWEB)
NONE
2001-01-01
A comprehensive analysis was conducted into the results of a survey on the state of existence of geothermal energy resources in the Musadake region, Shibetsu-gun, Hokkaido. The region was volcanically active in the period from the Neogene period into the quaternary, with some volcanos still active even today. The geological structure on the whole is characterized by the Musadake/Mt. Shitabanupuri fault which is the major structure running NNE-SSW and having a folding structure. It is inferred that Musadake is the heat source responsible for the underground temperature distribution in this region. The maximum temperature of 274 degrees C is recorded at borehole N11-MD-3 in the northeastern part of Musadake, and the temperature falls rapidly as the distance from the borehole increases. Ejection of geothermal fluids is observed at boreholes N11-MD-3 and N11-MD-4. It is inferred that the deep-seated geothermal water is of the neutral Cl type with Cl concentration estimated at approximately 12,000 mg/liter. Steam composition is characterized by a gas concentration level that is as high as 3-4 vol.%. The gas is composedly mainly of CO2 and contains some hydrocarbons. Fluids in this region are classified into water mixing into deep-seated geothermal water and groundwater originating in meteoric water. (NEDO)
Directory of Open Access Journals (Sweden)
Hastie C James
2006-01-01
Full Text Available Abstract Background Pim-1, 2 and 3 are a group of enzymes related to the calcium calmodulin family of protein kinases. Over-expression of Pim-1 and Pim-2 in mice promotes the development of lymphomas, and up-regulation of Pim expression has been observed in several human cancers. Results Here we show that the pim kinases are constitutively active when expressed in HEK-293 cells and are able to phosphorylate the Bcl-2 family member Bad on three residues, Ser112, Ser136 and Ser155 in vitro and in cells. In vitro mapping showed that Pim-2 predominantly phosphorylated Ser112, while Pim-1 phosphorylated Ser112, but also Ser136 and Ser155 at a reduced rate compared to Ser112. Pim-3 was found to be the least specific for Ser112, and the most effective at phosphorylating Ser136 and Ser155. Pim-3 was also able to phosphorylate other sites in Bad in vitro, including Ser170, another potential in vivo site. Mutation of Ser136 to alanine prevented the phosphorylation of Ser112 and Ser155 by Pim kinases in HEK-293 cells, suggesting that this site must be phosphorylated first in order to make the other sites accessible. Pim phosphorylation of Bad was also found to promote the 14-3-3 binding of Bad and block its association with Bcl-XL. Conclusion All three Pim kinase family members predominantly phosphorylate Bad on Ser112 and in addition are capable of phosphorylating Bad on multiple sites associated with the inhibition of the pro-apoptotic function of Bad in HEK-293 cells. This would be consistent with the proposed function of Pim kinases in promoting cell proliferation and preventing cell death.
Effective Feature Selection for Classification of Promoter Sequences.
Directory of Open Access Journals (Sweden)
Kouser K
Full Text Available Exploring novel computational methods in making sense of biological data has not only been a necessity, but also productive. A part of this trend is the search for more efficient in silico methods/tools for analysis of promoters, which are parts of DNA sequences that are involved in regulation of expression of genes into other functional molecules. Promoter regions vary greatly in their function based on the sequence of nucleotides and the arrangement of protein-binding short-regions called motifs. In fact, the regulatory nature of the promoters seems to be largely driven by the selective presence and/or the arrangement of these motifs. Here, we explore computational classification of promoter sequences based on the pattern of motif distributions, as such classification can pave a new way of functional analysis of promoters and to discover the functionally crucial motifs. We make use of Position Specific Motif Matrix (PSMM features for exploring the possibility of accurately classifying promoter sequences using some of the popular classification techniques. The classification results on the complete feature set are low, perhaps due to the huge number of features. We propose two ways of reducing features. Our test results show improvement in the classification output after the reduction of features. The results also show that decision trees outperform SVM (Support Vector Machine, KNN (K Nearest Neighbor and ensemble classifier LibD3C, particularly with reduced features. The proposed feature selection methods outperform some of the popular feature transformation methods such as PCA and SVD. Also, the methods proposed are as accurate as MRMR (feature selection method but much faster than MRMR. Such methods could be useful to categorize new promoters and explore regulatory mechanisms of gene expressions in complex eukaryotic species.
Directory of Open Access Journals (Sweden)
Shyama Majumdar
2013-07-01
Full Text Available Urothelial carcinoma (UC causes substantial morbidity and mortality worldwide. However, the molecular mechanisms underlying urothelial cancer development and tumor progression are still largely unknown. Using informatics analysis, we identified Sh3gl2 (endophilin A1 as a bladder urothelium-enriched transcript. The gene encoding Sh3gl2 is located on chromosome 9p, a region frequently altered in UC. Sh3gl2 is known to regulate endocytosis of receptor tyrosine kinases implicated in oncogenesis, such as the epidermal growth factor receptor (EGFR and c-Met. However, its role in UC pathogenesis is unknown. Informatics analysis of expression profiles as well as immunohistochemical staining of tissue microarrays revealed Sh3gl2 expression to be decreased in UC specimens compared to nontumor tissues. Loss of Sh3gl2 was associated with increasing tumor grade and with muscle invasion, which is a reliable predictor of metastatic disease and cancer-derived mortality. Sh3gl2 expression was undetectable in 19 of 20 human UC cell lines but preserved in the low-grade cell line RT4. Stable silencing of Sh3gl2 in RT4 cells by RNA interference 1 enhanced proliferation and colony formation in vitro, 2 inhibited EGF-induced EGFR internalization and increased EGFR activation, 3 stimulated phosphorylation of Src family kinases and STAT3, and 4 promoted growth of RT4 xenografts in subrenal capsule tissue recombination experiments. Conversely, forced re-expression of Sh3gl2 in T24 cells and silenced RT4 clones attenuated oncogenic behaviors, including growth and migration. Together, these findings identify loss of Sh3gl2 as a frequent event in UC development that promotes disease progression.
Esrrb directly binds to Gata6 promoter and regulates its expression with Dax1 and Ncoa3
International Nuclear Information System (INIS)
Uranishi, Kousuke; Akagi, Tadayuki; Koide, Hiroshi; Yokota, Takashi
2016-01-01
Estrogen-related receptor beta (Esrrb) is expressed in embryonic stem (ES) cells and is involved in self-renewal ability and pluripotency. Previously, we found that Dax1 is associated with Esrrb and represses its transcriptional activity. Further, the disruption of the Dax1–Esrrb interaction increases the expression of the extra-embryonic endoderm marker Gata6 in ES cells. Here, we investigated the influences of Esrrb and Dax1 on Gata6 expression. Esrrb overexpression in ES cells induced endogenous Gata6 mRNA and Gata6 promoter activity. In addition, the Gata6 promoter was found to contain the Esrrb recognition motifs ERRE1 and ERRE2, and the latter was the responsive element of Esrrb. Associations between ERRE2 and Esrrb were then confirmed by biotin DNA pulldown and chromatin immunoprecipitation assays. Subsequently, we showed that Esrrb activity at the Gata6 promoter was repressed by Dax1, and although Dax1 did not bind to ERRE2, it was associated with Esrrb, which directly binds to ERRE2. In addition, the transcriptional activity of Esrrb was enhanced by nuclear receptor co-activator 3 (Ncoa3), which has recently been shown to be a binding partner of Esrrb. Finally, we showed that Dax1 was associated with Ncoa3 and repressed its transcriptional activity. Taken together, the present study indicates that the Gata6 promoter is activated by Esrrb in association with Ncoa3, and Dax1 inhibited activities of Esrrb and Ncoa3, resulting maintenance of the undifferentiated status of ES cells. - Highlights: • Esrrb induced Gata6 expression in ES cells. • Gata6 promoter activity was enhanced by Esrrb, which was repressed by Dax1. • Dax1 associated with the Gata6 promoter via Esrrb. • Dax1 associated with Ncoa3 and repressed its transcriptional activity.
Geometric Structure of 3D Spinal Curves: Plane Regions and Connecting Zones
Berthonnaud, E.; Hilmi, R.; Dimnet, J.
2012-01-01
This paper presents a new study of the geometric structure of 3D spinal curves. The spine is considered as an heterogeneous beam, compound of vertebrae and intervertebral discs. The spine is modeled as a deformable wire along which vertebrae are beads rotating about the wire. 3D spinal curves are compound of plane regions connected together by zones of transition. The 3D spinal curve is uniquely flexed along the plane regions. The angular offsets between adjacent regions are concentrated at level of the middle zones of transition, so illustrating the heterogeneity of the spinal geometric structure. The plane regions along the 3D spinal curve must satisfy two criteria: (i) a criterion of minimum distance between the curve and the regional plane and (ii) a criterion controlling that the curve is continuously plane at the level of the region. The geometric structure of each 3D spinal curve is characterized by the sizes and orientations of regional planes, by the parameters representing flexed regions and by the sizes and functions of zones of transition. Spinal curves of asymptomatic subjects show three plane regions corresponding to spinal curvatures: lumbar, thoracic and cervical curvatures. In some scoliotic spines, four plane regions may be detected. PMID:25031873
Promoting International Energy Security. Volume 3: Sea-Lanes to Asia
2012-01-01
set off tsunamis, as occurred in the Indian Ocean on December 26, 2004, when an earthquake and tsunami killed over 225,000 people. Natural events...in Somalia, the ability to counter the menagerie of gangs that currently plough the seas off the Horn of Africa will be minimal. Further, the...Promoting International Energy Security: Volume 3, Sea-Lanes to Asia sunk several Vietnamese ships, killing 70 Vietnamese sailors (EIA, 2008b). As states
Raijmakers, MTM; Jansen, PLM; Steegers, EAP; Peters, WHM
Background/Aims: Gilbert's syndrome is a benign form of a deficiency in bilirubin glucuronidation. It is associated with a homozygous polymorphism, A(TA)(7)TAA instead of A(TA)(6)TAA, in the TATA-box of the promoter region of the bilirubin UDP-glucuronyltransferase gene. In this study the
Effect of gamma-ray irradiated natural herbal extracts on NF-kB activation in HMC-1 cells
International Nuclear Information System (INIS)
Kim, Yong Soo; Lim, Youn Mook; Gwon, Hui Jeong; Choi, Bo Ram; Nho, Young Chang
2009-01-01
Recently, studies have documented various health benefits of some natural herbal extracts (NHE) such as Houttuynia cordata (H), Centella asiatica (C), Plantago asiatica (P), Morus alba L. (M), and Ulmus davidiana (U). The aim of the present study was to demonstrate the radiation effect on NF-kB activation of the NHE in the human mast cell line (HMC-1). The HMC-1 cells were stimulated with phorbol 12-myristate 13-acetate (PMA) plus A23187. Both non-and irradiated NHE also significantly inhibited the PMA plus A23187-induced nuclear factor NF-kB activation and also suppressed the expression of activation of NF-kB. These results indicated that the NHE exerted a regulatory effect on inflammatory reactions mediated by mast cells
Effect of gamma-ray irradiated natural herbal extracts on NF-kB activation in HMC-1 cells
Energy Technology Data Exchange (ETDEWEB)
Kim, Yong Soo; Lim, Youn Mook; Gwon, Hui Jeong; Choi, Bo Ram; Nho, Young Chang [Korea Atomic Energy Research Institute, Jeongeup (Korea, Republic of)
2009-12-15
Recently, studies have documented various health benefits of some natural herbal extracts (NHE) such as Houttuynia cordata (H), Centella asiatica (C), Plantago asiatica (P), Morus alba L. (M), and Ulmus davidiana (U). The aim of the present study was to demonstrate the radiation effect on NF-kB activation of the NHE in the human mast cell line (HMC-1). The HMC-1 cells were stimulated with phorbol 12-myristate 13-acetate (PMA) plus A23187. Both non-and irradiated NHE also significantly inhibited the PMA plus A23187-induced nuclear factor NF-kB activation and also suppressed the expression of activation of NF-kB. These results indicated that the NHE exerted a regulatory effect on inflammatory reactions mediated by mast cells.
Endogenous neurotrophin-3 promotes neuronal sprouting from dorsal root ganglia.
Wang, Xu-Yang; Gu, Pei-Yuan; Chen, Shi-Wen; Gao, Wen-Wei; Tian, Heng-Li; Lu, Xiang-He; Zheng, Wei-Ming; Zhuge, Qi-Chuan; Hu, Wei-Xing
2015-11-01
In the present study, we investigated the role of endogenous neurotrophin-3 in nerve terminal sprouting 2 months after spinal cord dorsal root rhizotomy. The left L1-5 and L7-S2 dorsal root ganglia in adult cats were exposed and removed, preserving the L6 dorsal root ganglia. Neurotrophin-3 was mainly expressed in large neurons in the dorsal root ganglia and in some neurons in spinal lamina II. Two months after rhizotomy, the number of neurotrophin-3-positive neurons in the spared dorsal root ganglia and the density of neurite sprouts emerging from these ganglia were increased. Intraperitoneal injection of an antibody against neurotrophin-3 decreased the density of neurite sprouts. These findings suggest that endogenous neurotrophin-3 is involved in spinal cord plasticity and regeneration, and that it promotes axonal sprouting from the dorsal root ganglia after spinal cord dorsal root rhizotomy.
High genetic diversity in the coat protein and 3' untranslated regions
Indian Academy of Sciences (India)
The 3′ terminal region consisting of the coat protein (CP) coding sequence and 3′ untranslated region (3′UTR) was cloned and sequenced from seven isolates. Sequence comparisons revealed considerable genetic diversity among the isolates in their CP and 3′UTR, making CdMV one of the highly variable members ...
Chen, Yuan; Liu, Qing; Lin, Han; Yan, Xiaohong
2018-05-01
According to the spectral distribution of solar radiation at the earth's surface, under the excitation region of 1150 to 1350 nm, the up-conversion luminescence of Tm 3+ ions was investigated. The emission bands were matched well with the spectral response region of silicon solar cells, achieved by Tm 3+ ions single-doped yttrium fluoride (YF 3 ) phosphor, which was different from the conventional Tm 3+ /Yb 3+ ion couple co-doped materials. Additionally, the similar emission bands of Tm 3+ ions were achieved under excitation in the ultraviolet region. It is expected that via up-conversion and down-conversion routes, Tm 3+ -sensitized materials could convert photons to the desired wavelengths in order to reduce the energy loss of silicon solar cells, thereby enhancing the photovoltaic efficiency. Copyright © 2018 John Wiley & Sons, Ltd.
Timmer, T; Terpstra, P; van den Berg, Anke; Veldhuis, PMJF; Ter Elst, A; van der Veen, AY; Kok, K; Naylor, SL; Buys, CHCM
1999-01-01
In searching for a tumor suppressor gene in the 3p21.3 region, we isolated two genes, RBM5 and RBM6. Sequence analysis indicated that these genes share similarity. RBM5 and-to a lesser extent-RBM6 also have similarity to DXS8237E at Xp11.3-11.23, which maps less than 20 kb upstream of UBE1. A
Directory of Open Access Journals (Sweden)
L. Minieri
2010-04-01
Full Text Available A region of glucokinase (GCK gene was sequenced in 14 horses of 14 different breeds. The resulting GCK nucleotide sequence (GenBank number EF136885 showed 77% homology with human GCK gene portion containing the upstream promoter region and the corresponding 5’ UTR of the exon 1. Conserved regulatory sequences near the putative transcriptional start site were identified. The obtained sequences were aligned to detect polymorphism. A new C>T transition within the 5’ UTR of exon 1 was found. Allele frequencies of this polymorphism were studied by PCR-RFLP in 193 horses of 14 breeds (Bardigiano, 21; Esperia Pony, 5; Haflinger, 10; Italian Heavy Draught Horse, 28; Italian Saddle, 25; Italian Trotter, 16; Lipizzan, 12; Maremmano, 15; Murgese, 14; Norico, 10; Salernitano, 12; Thoroughbred, 10; Tolfetano, 7 and Ventasso Horse, 8. The polymorphism was found in all breeds and differences in allelic frequencies among the breeds were observed. The new SNP identified within a regulative region of GCK gene, which plays an important role in insulin secretion and feeding behaviour, could be used for association studies with performance traits of the horses.
2011-11-16
The U.S. Fish and Wildlife Service (FWS) and the U.S. Department of Transportation (DOT) Volpe Center (Volpe Center) conducted a regional alternative transportation evaluation (RATE) in Region 3, which is comprised of Illinois, Indiana, Iowa, Michiga...
A new diarylheptanoid from Alpinia officinarum promotes the differentiation of 3T3-L1 preadipocytes.
Zhang, Xuguang; Zhang, Xiaopo; Wang, Yong; Chen, Feng; Li, Youbin; Li, Yonghui; Tan, Yinfeng; Gong, Jingwen; Zhong, Xia; Li, Hailong; Zhang, Junqing
2018-03-01
A new diarylheptanoid, namely trans-(4R,5S)-epoxy-1,7-diphenyl-3-heptanone (1), and a new natural product, 7-(4″-hydroxy-3″-methoxyphenyl)-1-phenyl-hepta-4E,6E-dien-3-one (2), were obtained from the aqueous extract of Alpinia officinarum Hance, together with three other diarylheptanoids, 5-hydroxy-1,7-diphenyl-3-heptanone (3), 1,7-diphenyl-4E-en-3-heptanone (4) and 5-methoxy-1,7-diphenyl-3-heptanone (5). The structures were characterised mainly by analysing their physical data including IR, NMR and HRMS. This study highlights that the 4,5-epoxy moiety in 1 is rarely seen in diarylheptanoids. In addition, the five isolates were tested for their differentiation activity of 3T3-L1 preadipocytes. The results showed that these compounds could dose-dependently promote adipocyte differentiation without cytotoxicity (IC 50 > 100 μM).
Anti-diarrheal constituents of Alpinia oxyphylla.
Zhang, Junqing; Wang, Sheng; Li, Yonghui; Xu, Peng; Chen, Feng; Tan, Yinfeng; Duan, Jinao
2013-09-01
Isolation, screening and in vivo assays have been used for evaluating anti-diarrhea bioactive of Alpinia oxyphylla. Preliminary experimental results showed that 95% ethanol extract and 90% ethanol elution significantly extended the onset time of diarrhea and reduced the wet feces proportion, however 50% ethanol election had no effect on diarrhea. Chemical analysis results displayed that Nootkatone, Tectochrysin and yakuchinone A may be bioactive ingredients for curing diarrhea. Duodenum in vitro experiment showed that Tectochrysin 50, 100 μM reduces carbachol-induced contraction, while yakuchinone A and Nootkatone had no effect. Bioinformatic computational method as molecular docking has been complementary to experimentally work to explore the potential mechanism. The study of pathogenesis of diarrhea in humans and animal models suggested that Na(+)/H(+) exchanger3 (NHE3) and aquaporin4 (AQP4) are causative agents of diarrhea. The analysis was done on the basis of scoring and binding ability and the docking analysis showed that Tectochrysin has maximum potential against NHE3 (PDB ID: 2OCS) and AQP4 (PDB ID: 3GD8). Tectochrysin indicated minimum energy score and the highest number of interactions with active site residues. These results suggested that A. oxyphylla might exhibit its anti-diarrhea effect partially by affecting the proteins of NHE3 and AQP4 with its active ingredient Tectochrysin. Copyright © 2013. Published by Elsevier B.V.
Features of cryptic promoters and their varied reliance on bromodomain-containing factors.
Directory of Open Access Journals (Sweden)
Samantha G Pattenden
Full Text Available The Set2-Rpd3S pathway is important for the control of transcription memory. Mutation of components of this pathway results in cryptic transcription initiation within the coding region of approximately 30% of yeast genes. Specifically, deletion of the Set2 histone methyltransferase or Rco1, a component of the Rpd3S histone deacetylase complex leads to hyperacetylation of certain open reading frames (ORFs. We used this mutant as a system to study the role of histone modifications and co-activator recruitment in preinitiation complex (PIC formation. Specifically, we looked at the dependence of promoters on the bromodomain-containing RSC complex and the Bdf1 protein. We found that the dependence of cryptic promoters for these proteins varied. Overall, our data indicate that cryptic promoters are independently regulated, and their activation is dependent on factors that govern gene activation at canonical promoters.
Chen, Xiang; Liu, Xuexiang; Wei, Xiaomou; Meng, Yuming; Liu, Limin; Qin, Shini; Liu, Yanyu; Dai, Shengming
2016-12-01
To comprehensively examine the MICB gene polymorphism and identify its differences in Chinese Yao population from other ethnic groups, we investigated the polymorphism in the 5'-upstream regulation region (5'-URR), coding region (exons 2-4), and the 3'-untranslated region (3'-UTR) of MICB gene by using PCR-SBT method in 125 healthy unrelated Yao individuals in Guangxi Zhuang Autonomous Region. Higher polymorphism was observed in the 5'-URR, nine single nucleotide polymorphisms (SNPs) and a two base pairs deletion at position -139/-138 were found in our study. Only five different variation sites, however, were detected in exons 2-4 and three were observed in the 3'-UTR. The minor allele frequencies of all variants were greater than 5%, except for rs3828916, rs3131639, rs45627734, rs113620316, rs779737471, and the variation at position +11803 in the 3'-UTR. The first nine SNPs of 5'-URR and rs1065075, rs1051788 of the coding region showed significant linkage disequilibrium with each other. Ten different MICB extended haplotypes (EH) encompassing the 5'-URR, exons 2-4, and 3'-UTR were found in this population, and the most frequent was EH1 (23.2%). We provided several evidences for balancing selection effect on the 5'-URR of MICB gene in Yao population. Copyright © 2016 American Society for Histocompatibility and Immunogenetics. Published by Elsevier Inc. All rights reserved.
Viggiano, Davide; Vallone, Daniela; Welzl, Hans; Sadile, Adolfo G
2002-09-01
The Naples High- (NHE) and Low-Excitability (NLE) rat lines have been selected since 1976 on the basis of behavioral arousal to novelty (Làt-maze). Selective breeding has been conducted under continuous genetic pressure, with no brother-sister mating. The behavioral analyses presented here deal with (1) activity in environments of different complexity, i.e., holeboard and Làt maze; (2) maze learning in hexagonal tunnel, Olton, and Morris water mazes and; (3) two-way active avoidance and conditioned taste aversion tests. Morphometric analyses deal with central dopaminergic systems at their origin and target sites, as well as the density of dopamine transporter immunoreactivity. Molecular biology analyses are also presented, dealing with recent experiments on the prefrontal cortex (PFc), cloning and identifying differentially expressed genes using subtractive libraries and RNAase protection. The divergence between NLE and NHE rats varies as a function of the complexity level of the environment, with an impaired working and reference memory in both lines compared to random bred (NRB) controls. Moreover, data from the PFc of NHE rats show a hyperdopaminergic innervation, with overexpression of mRNA species involved in basal metabolism, and down-regulation of dopamine D1 receptors. Altogether, the evidence gathered so far supports a hyperfunctioning mesocorticolimbic system that makes NHE rats a useful tool for the study of hyperactivity and attention deficit, learning and memory disabilities, and drug abuse.
Intracellular sodium hydrogen exchange inhibition and clinical myocardial protection.
Mentzer, Robert M; Lasley, Robert D; Jessel, Andreas; Karmazyn, Morris
2003-02-01
Although the mechanisms underlying ischemia/reperfusion injury remain elusive, evidence supports the etiologic role of intracellular calcium overload and oxidative stress induced by reactive oxygen species. Activation of the sodium hydrogen exchanger (NHE) is associated with intracellular calcium accumulation. Inhibition of the NHE-1 isoform may attenuate the consequences of this injury. Although there is strong preclinical and early clinical evidence that NHE inhibitors may be cardioprotective, definitive proof of this concept in humans awaits the results of ongoing clinical trials.
Energy Technology Data Exchange (ETDEWEB)
Salker, Madhuri S.; Zhou, Yuetao; Singh, Yogesh [Department of Physiology, University of Tuebingen, 72076 Tuebingen (Germany); Brosens, Jan [Division of Reproductive Health, Warwick Medical School, Clinical Sciences Research Laboratories, University Hospital, Coventry CV2 2DX (United Kingdom); Lang, Florian, E-mail: florian.lang@uni-tuebingen.de [Department of Physiology, University of Tuebingen, 72076 Tuebingen (Germany)
2015-05-08
Objective: LeftyA, a powerful regulator of stemness, embryonic differentiation, and reprogramming of cancer cells, counteracts cell proliferation and tumor growth. Key properties of tumor cells include enhanced glycolytic flux, which is highly sensitive to cytosolic pH and thus requires export of H{sup +} and lactate. H{sup +} extrusion is in part accomplished by Na{sup +}/H{sup +} exchangers, such as NHE1. An effect of LeftyA on transport processes has, however, never been reported. The present study thus explored whether LeftyA modifies regulation of cytosolic pH (pHi) in Ishikawa cells, a well differentiated endometrial carcinoma cell model. Methods: NHE1 transcript levels were determined by qRT-PCR, NHE1 protein abundance quantified by Western blotting, pH{sub i} estimated utilizing (2',7'-bis-(2-carboxyethyl)-5-(and-6)-carboxyfluorescein [BCECF] fluorescence, Na{sup +}/H{sup +} exchanger activity from Na{sup +} dependent realkalinization after an ammonium pulse, and lactate concentration in the supernatant utilizing an enzymatic assay and subsequent colorimetry. Results: A 2 h treatment with LeftyA (8 ng/ml) significantly decreased NHE1 transcript levels (by 99.6%), NHE1 protein abundance (by 71%), Na{sup +}/H{sup +} exchanger activity (by 55%), pHi (from 7.22 ± 0.02 to 7.05 ± 0.02), and lactate release (by 41%). Conclusions: LeftyA markedly down-regulates NHE1 expression, Na{sup +}/H{sup +} exchanger activity, pHi, and lactate release in Ishikawa cells. Those effects presumably contribute to cellular reprogramming and growth inhibition. - Highlights: • LeftyA, an inhibitor of tumor growth, reduces Na{sup +}/H{sup +}-exchanger activity by 55%. • LeftyA decreases NHE1 transcripts by 99.6% and NHE1 protein by 71%. • LeftyA decreases cytosolic pH from 7.22 ± 0.02 to 7.05 ± 0.02. • Cytosolic acidification by Lefty A decreases glycolysis by 41%. • Cytosolic acidification by Lefty A compromises energy production of tumor cells.
Zampino, Rosa; Marrone, Aldo; Karayiannis, Peter; Cirillo, Grazia; del Giudice, Emanuele Miraglia; Rania, Giovanni; Utili, Riccardo; Ruggiero, Giuseppe
2002-09-01
In this study, we aimed to evaluate the persistence of hepatitis B virus (HBV) DNA and the role of HBV core promoter and precore region mutations in 28 young cancer survivor patients with HBV or HBV and hepatitis C virus (HCV) infections, and persistently normal ALT levels, after spontaneous or interferon (IFN)-induced anti-hepatitis B e (HBe) seroconversion. Sera from 15 patients with HBV and 13 with dual HBV-HCV infection were analyzed for the presence of HBV-DNA and HCV-RNA by polymerase chain reaction 3 yr after anti-HBe seroconversion. A total of 21 patients had seroconverted spontaneously and seven did so after IFN treatment. The core promoter and the precore regions were amplified sequenced directly. Among patients with HBV infection, HBV-DNA was detected in five of nine (55%) with spontaneous anti-HBe and in all six treated patients (p = 0.092). In the coinfected patients, four had cleared both HBV-DNA and HCV-RNA, five were HBV-DNA negative/HCV-RNA positive and four had the reverse viral pattern. Among the 15 patients with persistence of HBV-DNA, a 7-base pair nucleotide deletion in the core promoter (1757-1763) was present in seven of 10 patients with spontaneous and in one of five patients with IFN-induced seroconversion (p = 0.033). The G1896A precore stop codon mutation was never observed. HBV-DNA levels were significantly lower in patients with the core promoter deletion (p = 0.011). The 7-base pair deletion generated a truncated X protein at amino-acid position 132. A core promoter deletion after anti-HBe seroconversion was associated with low HBV-DNA levels, probably because of downregulation of pregenomic RNA production and truncation of the X protein. HBV-DNA persistence was a frequent event, even in the absence of active liver disease.
International Nuclear Information System (INIS)
Ornskov, Dorthe; Nexo, Ebba; Sorensen, Boe S.
2007-01-01
Previously we have shown that insulin-stimulation of RT4 bladder cancer cells leads to increased proliferation, which require HER1 activation, and is accompanied by increased mRNA expression of the EGF-ligands heparin-binding EGF-like growth factor (HB-EGF), amphiregulin (AR), and epiregulin (EPI) [D. Ornskov, E. Nexo, B.S. Sorensen, Insulin-induced proliferation of bladder cancer cells is mediated through activation of the epidermal growth factor system, FEBS J. 273 (2006) 5479-5489]. In the present paper, we have investigated the molecular mechanism leading to this insulin-induced expression. We monitored the decay of mRNA after inhibiting transcription with Actinomycin D and demonstrated that the insulin-mediated increase was not caused by enhanced mRNA stability. In untreated cells, HB-EGF mRNA was the least stable, whereas AR and EPI mRNA decayed with slower kinetics. However, promoter analysis of HB-EGF and EPI demonstrated that insulin stimulated transcription. Studies on the EPI promoter identified the insulin-responsive element to be located in the region -564 to -365 bp. This region contains potential binding sites for the transcription factors SP1, AP1, and NF-κB. Interestingly, all three transcription factors can be activated by PI3K. We demonstrate that the insulin-induced expression of HB-EGF, AR, and EPI mRNA is completely prevented by the specific PI3K inhibitor Wortmannin, suggesting an involvement of the PI3K
Localization and regulation of bacteriophage Mu promoters
International Nuclear Information System (INIS)
Stoddard, S.F.; Howe, M.M.
1989-01-01
Mu promoters active during the lytic cycle were located by isolating RNA at various times after induction of Mu prophages, radiolabeling it by capping in vitro, and hybridizing it to Mu DNA fragments on Southern blots. Signals were detected from four new promoters in addition to the previously characterized P e (early), P cM (repressor), and P mom (late) promoters. A major signal upstream of C was first observed at 12 min and intensified thereafter with RNA from cts and C amber but not replication-defective prophages; these characteristics indicate that this signal arises from a middle promoter, which we designate P m . With 20- and 40-min RNA, four additional major signals originated in the C-lys, F-G-I, N-P, and com-mom regions. These signals were missing with RNA from C amber and replication-defective prophages and therefore reflected the activity of late promoters, one of which we presume was P mom . Uninduced lysogens showed weak signals from five regions, one from the early regulatory region, three between genes B and lys, and one near the late genes K, L, and M. The first of these probably resulted from P cM activity; the others remain to be identified
Simulation and modeling CO2 absorption in biogas with DEA promoted K2CO3 solution in packed column
Nurkhamidah, Siti; Altway, Ali; Airlangga, Bramantyo; Emilia, Dwi Putri
2017-05-01
Absorption of carbon dioxide (CO2) using potassium carbonate (K2CO3) is one of biogas purification method. However, K2CO3 have slow mass transfer in liquid phase. So it is necessary to eliminate the disadvantage of CO2 absorption using K2CO3 by adding promotor (activator). Diethanol amine (DEA) is one of promotor which can increase its reaction rate. Simulation and modeling research of the CO2 absorption from biogas with DEA promoted K2CO3 solution has not been conducted. Thus, the main goal of this research is create model and simulation for the CO2 absorption from biogas with DEA promoted K2CO3 solution, then observe the influence of promoter concentration. DEA concentration varies between 1-5 %wt. From the simulation, we concluded that the CO2 removal rise with the increasing of promoter concentration. The highest CO2 removal is 54.5318 % at 5 % wt DEA concentration.
The altered promoter methylation of oxytocin receptor gene in autism.
Elagoz Yuksel, Mine; Yuceturk, Betul; Karatas, Omer Faruk; Ozen, Mustafa; Dogangun, Burak
Autism spectrum disorder (ASD) is one of the lifelong existing disorders. Abnormal methylation status of gene promoters of oxytonergic system has been implicated as among the etiologic factors of ASDs. We, therefore, investigated the methylation frequency of oxytocin receptor gene (OXTR) promoter from peripheral blood samples of children with autistic features. Our sample includes 66 children in total (22-94 months); 27 children with ASDs according to the DSM-IV-TR and the Childhood Autism Rating Scale (CARS) and 39 children who do not have any autistic like symptoms as the healthy control group. We investigated the DNA methylation status of OXTR promoter by methylation specific enzymatic digestion of genomic DNA and polymerase chain reaction. A significant relationship has been found between ASDs and healthy controls for the reduction of methylation frequency of the regions MT1 and MT3 of OXTR. We could not find any association in the methylation frequency of MT2 and MT4 regions of OXTR. Although our findings indicate high frequency of OXTR promoter hypomethylation in ASDs, there is need for independent replication of the results for a bigger sample set. We expect that future studies with the inclusion of larger, more homogeneous samples will attempt to disentangle the causes of ASDs.
Chang, Yung-Hsien; Yang, Jai-Sing; Yang, Jiun-Long; Wu, Chang-Lin; Chang, Shu-Jen; Lu, Kung-Wen; Lin, Jen-Jyh; Hsia, Te-Chun; Lin, Yi-Ting; Ho, Chin-Chih; Wood, W Gibson; Chung, Jing-Gung
2009-12-01
Ganoderma lucidum (G. lucidum) is a medicinal mushroom having biological effects such as immunomodulation and anti-tumor actions. In China and many other Asian countries, G. lucidum is used as a folk remedy to promote health and longevity. Although many studies have shown that G. lucidum modulates the immune system, including, for example, antigen-presenting cells, natural killer (NK) cells, and the T and B lymphocytes, the effects of G. lucidum on the WEHI-3 leukemic BALB/c mice are unclear. We attempted to determine whether G. lucidum would promote immune responses in BALB/c mice injected with WEHI-3 leukemia cells. The effects of G. lucidum on the survival rate of WEHI-3 leukemia cells injected into BALB/c mice were examined. It increased the percentages of CD3 and CD19, but decreased the percentages of Mac-3 and CD11b markers, suggesting that differentiation of the precursor of T and B cells was promoted but macrophages were inhibited. It decreased the weight of spleens as compared with control mice. It also promoted phagocytosis by macrophage from peripheral blood mononuclear cell (PBMC) and it also promoted natural killer cell activity. It decreased the percentage of leukemia cells in the spleens of mice before they were injected with WEHI-3 cells. Apparently, G. lucidum affects murine leukemia WEHI-3 cells in vivo.
BAG3 promoted starvation-induced apoptosis of thyroid cancer cells via attenuation of autophagy.
Li, Si; Zhang, Hai-Yan; Wang, Tian; Meng, Xin; Zong, Zhi-Hong; Kong, De-Hui; Wang, Hua-Qin; Du, Zhen-Xian
2014-11-01
BAG3 plays a regulatory role in a number of cellular processes. Recent studies have attracted much attention on its role in activation of selective autophagy. In addition, we have very recently reported that BAG3 is implicated in a BECN1-independent autophagy, namely noncanonical autophagy. The current study aimed to investigate the potential involvement of BAG3 in canonical autophagy triggered by Earle's Balanced Salt Solution (EBSS) starvation. Replacement of complete medium with EBSS was used to trigger canonical autophagy. BAG3 expression was measured using real-time RT-PCR and Western blot. Autophagy was monitored using LC3-II transition and p62/SQSTM1 accumulation by Western blot, as well as punctate distribution of LC3 by immunofluorescence staining. Cell growth and apoptotic cell death was investigated using real-time cell analyzer and flowcytometry, respectively. BAG3 expression was potently reduced by EBSS starvation. Forced expression of BAG3 suppressed autophagy and promoted apoptotic cell death of thyroid cancer cells elicited by starvation. In addition, in the presence of autophagy inhibitor, the enhancing effect of BAG3 on apoptotic cell death was attenuated. These results suggest that BAG3 promotes apoptotic cell death in starved thyroid cancer cells, at least in part by autophagy attenuation.
Coherent photoproduction of π+ on 3He in the (3,3) resonance region
International Nuclear Information System (INIS)
Boyard, J.-L.
1975-01-01
An experimental study of the 3 He(γ,π + ) 3 H reaction has been performed in the (3,3) resonance region with a bremsstrahlung photon beam and a liquid 3 He target. A magnetic spectrometer followed by a wire chamber analyzed the momentum of the outgoing pions and defined their emission angle. The tritons were detected in coincidence with the pions by two methods: a telescope of thin plastic scintillators below 40MeV; or a magnetic spectrometer followed by a series of plastic scintillators for higher energies. The experiment shows two main features: at a fixed four-momentum transfer q 2 , the resonance is shifted towards lower energies, this shift increasing with q 2 ; at a fixed angle, but variable q 2 , the minimum of the charge form factor observed in the elastic scattering of electrons on 3 He does not appear. Calculations explain partly these two effects [fr
Han, Songyan; Lu, Jun; Zhang, Yu; Cheng, Cao; Li, Lin; Han, Liping; Huang, Baiqu
2007-02-15
The expression of IL-5 correlated tightly with the maturation and differentiation of eosinophils, and is considered as a cytokine responsible for allergic inflammation. We report here that inhibition of HDAC activity by Trichostatin A (TSA) and sodium butyrate (NaBu), the two specific HDAC inhibitors, resulted in the elevation of both endogenous and exogenous activity of IL-5 promoter. We demonstrated that both the mRNA expression and protein production of IL-5 were stimulated by TSA and NaBu treatments. ChIP assays showed that treatments of TSA and NaBu caused hyperacetylation of histones H3 and H4 on IL-5 promoter in Jurkat cells, which consequently promoted the exogenous luciferase activity driven by this promoter. Moreover, site-directed mutagenesis studies showed that the binding sites for transcription factors NFAT, GATA3 and YY1 on IL-5 promoter were critical for the effects of TSA and NaBu, suggesting that the transcriptional activation of IL-5 gene by these inhibitors was achieved by affecting HDAC function on IL-5 promoter via transcription factors. These data will contribute to elucidating the unique mechanism of IL-5 transcriptional control and to the therapy of allergic disorders related to IL-5.
The Relationship between FHIT Gene Promoter Methylation and Lung Cancer Risk: a Meta-analysis
Directory of Open Access Journals (Sweden)
Yichang SUN
2014-03-01
Full Text Available Background and objective Tumor-suppressor gene promoter DNA methylation in tumor cells is associated with its reduced expression. FHIT (fragile histindine triad was one of the important tumor suppressor genes which was found hypermethylated in the promoter region in most of tumors. The aim of this study is to evaluate the relationship between FIHT gene promother methylation and lung cancer risk by meta-analysis. Methods By searching Pubmed, CNKI and Wanfang, the open published articles related to FHIT gene promoter methylation and lung carcinoma risk were collected. The odds ratio (OR and range of FHIT gene of cancer tissue of lung cancer patients compared with normal lung tissue, plasma and the bronchial lavage fluid were pooled by statistical software Stata 11.0. Results Eleven studies were finally included in this meta-analysis. The median methylation rate were Pmedian=40.0% (0-68.3%, Pmedian=8.7% (0-35.0%, Pmedian=33.3% (17.1%-38.3% and Pmedian=35.9% (31.1%-50.8% in cancer tissue, NLT, BALF and plasm respectively. The pooled results showed the methylation rate in tumor tissue was much higer than that of NLT OR=5.82 (95%CI: 3.74-9.06, P0.05 and plasma OR=1.41 (95%CI: 0.90-2.20, P>0.05. Conclusion Hypermethylation of FHIT gene promoter region was found more frequent in cancer tissue than that of NLT which may demonstrated association between lung cancer risk and FHIT gene promoter methylation.
Chen, Gunng-Shinng; Lee, Shiao-Pieng; Huang, Shu-Fu; Chao, Shih-Chi; Chang, Chung-Yi; Wu, Gwo-Jang; Li, Chung-Hsing; Loh, Shih-Hurng
2018-06-01
Homeostasis of intracellular pH (pH i ) plays vital roles in many cell functions, such as proliferation, apoptosis, differentiation and metastasis. Thus far, Na + -H + exchanger (NHE), Na + -HCO 3 - co-transporter (NBC), Cl - /HCO 3 - exchanger (AE) and Cl - /OH - exchanger (CHE) have been identified to co-regulate pH i homeostasis. However, functional and biological pH i -regulators in human dental pulp stem cells (hDPSCs) have yet to be identified. Microspectrofluorimetry technique with pH-sensitive fluorescent dye, BCECF, was used to detect pH i changes. NH 4 Cl and Na + -acetate pre-pulse were used to induce intracellular acidosis and alkalosis, respectively. Isoforms of pH i -regulators were detected by Western blot technique. The resting pH i was no significant difference between that in HEPES-buffered (nominal HCO 3 - -free) solution or CO 2 /HCO 3 -buffered system (7.42 and 7.46, respectively). The pH i recovery following the induced-intracellular acidosis was blocked completely by removing [Na + ] o , while only slowed (-63%) by adding HOE694 (a NHE1 specific inhibitor) in HEPES-buffered solution. The pH i recovery was inhibited entirely by removing [Na + ] o , while adding HOE 694 pulse DIDS (an anion-transporter inhibitor) only slowed (-55%) the acid extrusion. Both in HEPES-buffered and CO 2 /HCO 3 -buffered system solution, the pH i recovery after induced-intracellular alkalosis was entirely blocked by removing [Cl - ] o . Western blot analysis showed the isoforms of pH i regulators, including NHE1/2, NBCe1/n1, AE1/2/3/4 and CHE in the hDPSCs. We demonstrate for the first time that resting pH i is significantly higher than 7.2 and meditates functionally by two Na + -dependent acid extruders (NHE and NBC), two Cl - -dependent acid loaders (CHE and AE) and one Na + -independent acid extruder(s) in hDPSCs. These findings provide novel insight for basic and clinical treatment of dentistry. Copyright © 2018 Elsevier Ltd. All rights reserved.
BAG3 promotes the phenotypic transformation of primary rat vascular smooth muscle cells via TRAIL.
Fu, Yao; Chang, Ye; Chen, Shuang; Li, Yuan; Chen, Yintao; Sun, Guozhe; Yu, Shasha; Ye, Ning; Li, Chao; Sun, Yingxian
2018-05-01
Under normal physiological condition, the mature vascular smooth muscle cells (VSMCs) show differentiated phenotype. In response to various environmental stimuluses, VSMCs convert from the differentiated phenotype to dedifferentiated phenotype characterized by the increased ability of proliferation/migration and the reduction of contractile ability. The phenotypic transformation of VSMCs played an important role in atherosclerosis. Both Bcl-2-associated athanogene 3 (BAG3) and tumor necrosis factor-related apopt-osis inducing ligand (TRAIL) involved in apoptosis. The relationship between BAG3 and TRAIL and their effects the proliferation and migration in VSMCs are rarely reported. This study investigated the effects of BAG3 on the phenotypic modulation and the potential underlying mechanisms in primary rat VSMCs. Primary rat VSMCs were extracted and cultured in vitro. Cell proliferation was detected by cell counting, real-time cell analyzer (RTCA) and EdU incorporation. Cell migration was detected by wound healing, Transwell and RTCA. BAG3 and TRAIL were detected using real-time PCR and western blotting and the secreted proteins in the cultured media by dot blot. The expression of BAG3 increased with continued passages in cultured primary VSMCs. BAG3 promoted the proliferation and migration of primary rat VSMC in a time-dependent manner. BAG3 significantly increased the expression of TRAIL while had no effects on its receptors. TRAIL knockdown or blocking by neutralizing antibody inhibited the proliferation of VSMCs induced by BAG3. TRAIL knockdown exerted no obvious influence on the migration of VSMCs. Based on this study, we report for the first time that BAG3 was expressed in cultured primary rat VSMCs and the expression of BAG3 increased with continued passages. Furthermore, BAG3 promoted the proliferation of VSMCs via increasing the expression of TRAIL. In addition, we also demonstrated that BAG3 promoted the migration of VSMCs independent of TRAIL
The regional climate model RegCM3 performances over several regions and climate regimes
Coppola, E.; Rauscher, S.; Gao, X.; Giorgi, F.; Im, E. S.; Mariotti, L.; Seth, A.; Sylla, M. B.
2009-04-01
Regional Climate models are more and more needed to provide high resolution regional climate information in climate impact studies. Water availability in a future scenario is the main request of policy makers for adaptation and mitigation purposes. However precipitation changes are unlikely to be as spatially coherent as temperature changes and they are closely related to the regional model itself. In addition model skill varies regionally. An example of several ICTP regional climate model (RegCM3) simulations is reported over China, Korea, Africa, Central and Southern America, Europe and Australia. Over China, Australia, and Korea the regional model improves the simulation compared to the driving GCM when compared with CRU observations. In China, for example, the higher resolution of the regional model inhibits the penetration of the monsoon precipitation front from the southern slope of the Himalaya onto the Tibetan Plateau. In Korea the nested domain simulation (20 km) shows an encouraging performance with regard to capturing extreme precipitation episodes and the finer spatial distribution reflects the detailed geography of the Korean Peninsula. Over South America, RegCM captures the annual cycle of precipitation over Northeast Brazil and the South American Monsoon region, although the monsoon onset occurs too early in the model. Precipitation over the Amazon is not well captured, with too little precipitation associated with weak easterlies and reduced moisture transport into the interior of the continent. RegCM simulates the annual cycle of precipitation over Central America and the Caribbean fairly well; in particular, the complex spatial distribution of the Mid-Summer Drought, a decrease in precipitation that occurs during the middle of the rainy season in July and August, is better captured by RegCM than by the GCM. In addition, RegCM simulates the strength and position of the Caribbean low level jet, a mesoscale feature related to precipitation anomalies
Basal transcription of APOBEC3G is regulated by USF1 gene in hepatocyte
Energy Technology Data Exchange (ETDEWEB)
Zeng, Yanli [Department of Infectious Diseases, Zhengzhou University People' s Hospital (Henan Provincial People' s Hospital), Zhengzhou, 450003 (China); Li, Hui [The Central Hospital of Wuhan, Tongji Medical College Huazhong University of Science Technology, Wuhan, 430000 (China); Zhang, Xiaoju [Department of Respiratory Medicine, Zhengzhou University People' s Hospital (Henan Provincial People' s Hospital), Zhengzhou, 450003 (China); Shang, Jia [Department of Infectious Diseases, Zhengzhou University People' s Hospital (Henan Provincial People' s Hospital), Zhengzhou, 450003 (China); Kang, Yi, E-mail: kykangyi@163.com [Department of Infectious Diseases, Zhengzhou University People' s Hospital (Henan Provincial People' s Hospital), Zhengzhou, 450003 (China)
2016-01-29
Apolipoprotein B mRNA-editing enzyme catalytic polypeptide-like 3G (APOBEC3G, A3G) exert antiviral defense as an important factor of innate immunity. A variety of cytokines such as IFN-γ,IL2,IL15,IL7 could induce the transcription of A3G. However, the regulation of other nuclear factor on the transcription of A3G have not been reported at the present. To gain new insights into the transcriptional regulation of this restriction factor, we cloned and characterized the promoter region of A3G and investigate the modulation of USF1 gene on the transcription of A3G. We identified a 232 bp region that was sufficient to regulate the activity of full promoter. Transcriptional start sites (TSS) were identified by the luciferase reporter assays of plasmids containing full or shorter fragments of the A3G promoter. The results demonstrated that the core promoter of A3G is located within the region -159/-84 relative to the TSS. Transcriptional activity of A3G core promoter regulated by USF1 was dependent on an E-box (located at position -91/-86 relative to the major TSS) and was abolished after mutation of this DNA element. USF1 gene can take part in basal transcription regulation of the human A3G gene in hepatocyte, and the identified E-box represented a binding site for the USF1. - Highlights: • The core promoter of A3G is located within the region −159/−84 relative to the TSS. • Transcriptional activity of A3G core promoter regulated by USF1 was dependent on an E-box (located at position −91/−86 relative to the major TSS). • USF1 gene can take part in basal transcription regulation of the human A3G gene in hepatocyte.
Basal transcription of APOBEC3G is regulated by USF1 gene in hepatocyte
International Nuclear Information System (INIS)
Zeng, Yanli; Li, Hui; Zhang, Xiaoju; Shang, Jia; Kang, Yi
2016-01-01
Apolipoprotein B mRNA-editing enzyme catalytic polypeptide-like 3G (APOBEC3G, A3G) exert antiviral defense as an important factor of innate immunity. A variety of cytokines such as IFN-γ,IL2,IL15,IL7 could induce the transcription of A3G. However, the regulation of other nuclear factor on the transcription of A3G have not been reported at the present. To gain new insights into the transcriptional regulation of this restriction factor, we cloned and characterized the promoter region of A3G and investigate the modulation of USF1 gene on the transcription of A3G. We identified a 232 bp region that was sufficient to regulate the activity of full promoter. Transcriptional start sites (TSS) were identified by the luciferase reporter assays of plasmids containing full or shorter fragments of the A3G promoter. The results demonstrated that the core promoter of A3G is located within the region -159/-84 relative to the TSS. Transcriptional activity of A3G core promoter regulated by USF1 was dependent on an E-box (located at position -91/-86 relative to the major TSS) and was abolished after mutation of this DNA element. USF1 gene can take part in basal transcription regulation of the human A3G gene in hepatocyte, and the identified E-box represented a binding site for the USF1. - Highlights: • The core promoter of A3G is located within the region −159/−84 relative to the TSS. • Transcriptional activity of A3G core promoter regulated by USF1 was dependent on an E-box (located at position −91/−86 relative to the major TSS). • USF1 gene can take part in basal transcription regulation of the human A3G gene in hepatocyte.
International Nuclear Information System (INIS)
Zheng, Rui; Zhang, Zhong-Hao; Chen, Chen; Chen, Yao; Jia, Shi-Zheng; Liu, Qiong; Ni, Jia-Zuan; Song, Guo-Li
2017-01-01
The maintenance of neural system integrity and function is the ultimate goal for the treatment of neurodegenerative disease such as Alzheimer's disease (AD). Neurogenesis plays an integral role in the maintenance of neural and cognitive functions, and its dysfunction is regarded as a major cause of cognitive impairment in AD. Moreover, the induction of neurogenesis by targeting endogenous neural stem cells (NSCs) is considered as one of the most promising treatment strategies. Our previous studies demonstrated that selenomethionine (Se-Met) was able to reduce β-amyloid peptide (Aβ) deposition, decrease Tau protein hyperphosphorylation and markedly improve cognitive functions in triple transgenic (3xTg) AD mice. In this study, we reported that the therapeutic effect of Se-Met on AD could also be due to neurogenesis modulation. By using the cultured hippocampal NSCs from 3xTg AD mice, we discovered that Se-Met (1–10 μM) with low concentration could promote NSC proliferation, while the one with a high concentration (50,100 μM) inhibiting proliferation. In subsequent studies, we also found that Se-Met activated the signaling pathway of PI3K/Akt, and thereby inhibited the GSK3β activity, which would further activated the β-catenin/Cyclin-D signaling pathway and promote NSC proliferation. Besides, after the induction of Se-Met, the number of neurons differentiated from NSCs significantly increased, and the number of astrocytes decreased. After a 90-day treatment with Se-Met (6 μg/mL), the number of hippocampal neurons in 4-month-old AD mice increased significantly, while the one of astrocyte saw a sharp drop. Thus, Se-Met treatment promoted NSCs differentiation into neurons, and subsequently repaired damaged neural systems in AD mice. Being consistent with our in vitro studies, Se-Met acts through the PI3K-Akt- GSK3β-Wnt signaling pathway in vivo. This study provides an unparalleled evidence that selenium (Se) compounds are, to some extent, effective
MicroRNA-2400 promotes bovine preadipocyte proliferation
International Nuclear Information System (INIS)
Wei, Yao; Cui, Ya Feng; Tong, Hui Li; Zhang, Wei Wei; Yan, Yun Qin
2016-01-01
MicroRNAs (miRNAs) play critical roles in the proliferation of bovine preadipocytes. miR-2400 is a novel and unique miRNA from bovines. In the present study, we separated and identified preadipocytes from bovine samples. miR-2400 overexpression increased the rate of preadipocyte proliferation, which was analyzed with a combination of EdU and flow cytometry. Simultaneously, functional genes related to proliferation (PCNA, CCND2, CCNB1) were also increased, which was detected by real-time PCR. Furthermore, luciferase reporter assays showed that miR-2400 bound directly to the 3'untranslated regions (3′UTRs) of PRDM11 mRNA. These data suggested that miR-2400 could promote preadipocyte proliferation by targeting PRDM11. - Highlights: • miRNAs are important in bovine preadipocyte proliferation. • miR-2400 is a novel miRNA from bovines. • miR-2400 overexpression increased preadipocyte proliferation. • Functional genes related to preadipocyte proliferation were upregulated. • Preadipocyte proliferation was promoted by targeting PRDM11.
HOX Gene Promoter Prediction and Inter-genomic Comparison: An Evo-Devo Study
Directory of Open Access Journals (Sweden)
Marla A. Endriga
2010-10-01
Full Text Available Homeobox genes direct the anterior-posterior axis of the body plan in eukaryotic organisms. Promoter regions upstream of the Hox genes jumpstart the transcription process. CpG islands found within the promoter regions can cause silencing of these promoters. The locations of the promoter regions and the CpG islands of Homeo sapiens sapiens (human, Pan troglodytes (chimpanzee, Mus musculus (mouse, and Rattus norvegicus (brown rat are compared and related to the possible influence on the specification of the mammalian body plan. The sequence of each gene in Hox clusters A-D of the mammals considered were retrieved from Ensembl and locations of promoter regions and CpG islands predicted using Exon Finder. The predicted promoter sequences were confirmed via BLAST and verified against the Eukaryotic Promoter Database. The significance of the locations was determined using the Kruskal-Wallis test. Among the four clusters, only promoter locations in cluster B showed significant difference. HOX B genes have been linked with the control of genes that direct the development of axial morphology, particularly of the vertebral column bones. The magnitude of variation among the body plans of closely-related species can thus be partially attributed to the promoter kind, location and number, and gene inactivation via CpG methylation.
The Digital North Denmark Programme -Promoting Regional Change?
DEFF Research Database (Denmark)
Østergaard, Christian Richter
2007-01-01
The Digital North Denmark (DDN) was an IT programme running from 2000 to 2003 in the North Jutland County in Denmark with national government support of € 23 million. The Danish government initiated the programme with the aim of further strengthening regions with an already proven ICT capability...... (Dybkjær and Lindegaard, 1999, p.96-100). The declared approach was to build on the existing competencies in industry as well as at universities. The national government chose two regions – Ørestaden, a new concentration of knowledge-based institutions near Copenhagen Airport, and North Jutland......-offers within four themes. The participants - meant to be project consortia of ideally private firms, public or private organisations as well as regional and municipal government bodies - could get a maximum national government support of one third of the total project sum.This chapter investigates how...
ING3 promotes prostate cancer growth by activating the androgen receptor.
Nabbi, Arash; McClurg, Urszula L; Thalappilly, Subhash; Almami, Amal; Mobahat, Mahsa; Bismar, Tarek A; Binda, Olivier; Riabowol, Karl T
2017-05-16
The androgen receptor (AR) is a major driver of prostate cancer, and increased AR levels and co-activators of the receptor promote the development of prostate cancer. INhibitor of Growth (ING) proteins target lysine acetyltransferase or lysine deacetylase complexes to the histone H3K4Me3 mark of active transcription, to affect chromatin structure and gene expression. ING3 is a stoichiometric member of the TIP60 lysine acetyltransferase complex implicated in prostate cancer development. Biopsies of 265 patients with prostate cancer were stained for ING3, pan-cytokeratin, and DNA. LNCaP and C4-2 androgen-responsive cells were used for in vitro assays including immunoprecipitation, western blotting, Luciferase reporter assay and quantitative polymerase chain reaction. Cell viability and migration assays were performed in prostate cancer cell lines using scrambled siRNA or siRNA targeting ING3. We find that ING3 levels and AR activity positively correlate in prostate cancer. ING3 potentiates androgen effects, increasing expression of androgen-regulated genes and androgen response element-driven reporters to promote growth and anchorage-independent growth. Conversely, ING3 knockdown inhibits prostate cancer cell growth and invasion. ING3 activates the AR by serving as a scaffold to increase interaction between TIP60 and the AR in the cytoplasm, enhancing receptor acetylation and translocation to the nucleus. Activation is independent of ING3's ability to target the TIP60 complex to H3K4Me3, identifying a previously unknown chromatin-independent cytoplasmic activity for ING3. In agreement with in vitro observations, analysis of The Cancer Genome Atlas (TCGA) data (n = 498) and a prostate cancer tissue microarray (n = 256) show that ING3 levels are higher in aggressive prostate cancers, with high levels of ING3 predicting shorter patient survival in a low AR subgroup. Including ING3 levels with currently used indicators such as the Gleason score provides more
DEFF Research Database (Denmark)
Herrmann, Susan; Seidelin, Michel; Bisgaard, Hanne Cathrine
2002-01-01
Indole-3-carbinol (I3C) is a naturally occurring substance that shows anti-carcinogenic properties in animal models. Besides its clear anti-carcinogenic effects, some studies indicate that I3C may sometimes act as a tumor promoter. Indolo[3,2-b]carbazole (ICZ), which is formed in the acidic...... environment of the stomach after intake of I3C, has a similar structure to, and shares biological effects with, the well-known tumor promoter 2,3,7,8-tetrachlorodibenzo-pdioxin (TCDD). Therefore, we hypothesized that ICZ could be responsible for the potential tumor-promoting activity of I3C. The aim...
Ju, Xiang-Chun; Hou, Qiong-Qiong; Sheng, Ai-Li; Wu, Kong-Yan; Zhou, Yang; Jin, Ying; Wen, Tieqiao; Yang, Zhengang; Wang, Xiaoqun; Luo, Zhen-Ge
2016-01-01
Cortical expansion and folding are often linked to the evolution of higher intelligence, but molecular and cellular mechanisms underlying cortical folding remain poorly understood. The hominoid-specific gene TBC1D3 undergoes segmental duplications during hominoid evolution, but its role in brain development has not been explored. Here, we found that expression of TBC1D3 in ventricular cortical progenitors of mice via in utero electroporation caused delamination of ventricular radial glia cells (vRGs) and promoted generation of self-renewing basal progenitors with typical morphology of outer radial glia (oRG), which are most abundant in primates. Furthermore, down-regulation of TBC1D3 in cultured human brain slices decreased generation of oRGs. Interestingly, localized oRG proliferation resulting from either in utero electroporation or transgenic expression of TBC1D3, was often found to underlie cortical regions exhibiting folding. Thus, we have identified a hominoid gene that is required for oRG generation in regulating the cortical expansion and folding. DOI: http://dx.doi.org/10.7554/eLife.18197.001 PMID:27504805
Directory of Open Access Journals (Sweden)
Tiantian Gao
2018-03-01
Full Text Available Bacillus cereus is a common and important food-borne pathogen that can be found in various food products. Due to low-temperature sterilization for a short period of time, pasteurization is not sufficient for complete elimination of B. cereus in milk, thereby cause severe economic loss and food safety problems. It is therefore of paramount importance to perform risk assessment of B. cereus in pasteurized milk. In this study, we isolated B. cereus from pasteurized milk samples in different regions of China, and evaluated the contamination situation, existence of virulence genes, antibiotic resistance profile and genetic polymorphism of B. cereus isolates. Intriguingly, 70 samples (27% were found to be contaminated by B. cereus and the average contamination level was 111 MPN/g. The distribution of virulence genes was assessed toward 10 enterotoxigenic genes (hblA, hblC, hblD, nheA, nheB, nheC, cytK, entFM, bceT, and hlyII and one emetic gene (cesB. Forty five percent strains harbored enterotoxigenic genes hblACD and 93% isolates contained nheABC gene cluster. The positive rate of cytK, entFM, bceT, hlyII, and cesB genes were 73, 96, 75, 54, and 5%, respectively. Antibiotic susceptibility assessment showed that most of the isolates were resistant to β-lactam antibiotics and rifampicin, but susceptible to other antibiotics such as ciprofloxacin, gentamicin and chloramphenicol. Total multidrug-resistant population was about 34%. In addition, B. cereus isolates in pasteurized milk showed a high genetic diversity. In conclusion, our findings provide the first reference on the prevalence, contamination level and characteristics of B. cereus isolated from pasteurized milk in China, suggesting a potential high risk of B. cereus to public health and dairy industry.
Hip and trunk muscles activity during nordic hamstring exercise
Narouei, Shideh; Imai, Atsushi; Akuzawa, Hiroshi; Hasebe, Kiyotaka; Kaneoka, Koji
2018-01-01
The nordic hamstring exercise (NHE) is a dynamic lengthening hamstring exercise that requires trunk and hip muscles activation. Thigh muscles activation, specifically hamstring/quadriceps contractions has been previously examined during NHE. Trunk and hip muscles activity have not been enough studied. The aim of this study was to analyze of hip and trunk muscles activity during NHE. Surface electromyography (EMG) and kinematic data were collected during NHE. Ten healthy men with the age range of 21–36 years performed two sets of two repetitions with downward and upward motions each of NHE. EMG activity of fifteen trunk and hip muscles and knee kinematic data were collected. Muscle activity levels were calculated through repeated measure analysis of variance in downward and upward motions, through Paired t-test between downward and upward motions and gluteus maximus to erector spine activity ratio (Gmax/ES ratio) using Pearson correlation analyses were evaluated. Semitendinosus and biceps femoris muscles activity levels were the greatest in both motions and back extensors and internal oblique muscles activity were greater than other muscles (Phamstrings contractions. It could be important for early assessment of subjects with hamstring injury risk. PMID:29740557
Hip and trunk muscles activity during nordic hamstring exercise.
Narouei, Shideh; Imai, Atsushi; Akuzawa, Hiroshi; Hasebe, Kiyotaka; Kaneoka, Koji
2018-04-01
The nordic hamstring exercise (NHE) is a dynamic lengthening hamstring exercise that requires trunk and hip muscles activation. Thigh muscles activation, specifically hamstring/quadriceps contractions has been previously examined during NHE. Trunk and hip muscles activity have not been enough studied. The aim of this study was to analyze of hip and trunk muscles activity during NHE. Surface electromyography (EMG) and kinematic data were collected during NHE. Ten healthy men with the age range of 21-36 years performed two sets of two repetitions with downward and upward motions each of NHE. EMG activity of fifteen trunk and hip muscles and knee kinematic data were collected. Muscle activity levels were calculated through repeated measure analysis of variance in downward and upward motions, through Paired t -test between downward and upward motions and gluteus maximus to erector spine activity ratio (Gmax/ES ratio) using Pearson correlation analyses were evaluated. Semitendinosus and biceps femoris muscles activity levels were the greatest in both motions and back extensors and internal oblique muscles activity were greater than other muscles ( P hamstrings contractions. It could be important for early assessment of subjects with hamstring injury risk.
Redox reactions of 2-hydroxy-3-methoxybenzaldehyde (o-vanillin) in aqueous solution
International Nuclear Information System (INIS)
Barik, A.; Priyadarsini, K.I.; Mohan, Hari
2004-01-01
Pulse radiolysis technique has been employed to study the reactions of oxidizing ( · OH, N 3 · ) and reducing radicals (e - aq , CO 2 ·- , acetone ketyl radical) with 2-hydroxy-3-methoxybenzaldehyde (o-vanillin) at different pH. Hydroxyl radicals react mostly by addition reaction forming radical adducts (λ max =420 nm) and the oxidation is only a minor process even in the alkaline region. The reaction with azide radicals produced phenoxyl radicals (λ max =340 nm), which are formed on fast deprotonation of solute radical cation. Using PMZ ·+ /PMZ and ABTS ·- /ABTS 2- as the reference couple, different methods are employed to determine the one-electron reduction potential of o-vanillin and the average value is estimated to be 1.076±0.004 V vs. NHE at pH 6. The phenoxyl radicals of o-vanillin were able to oxidize ABTS 2- quantitatively. The e aq - is observed to react with o-vanillin with rate constant value of 2x10 10 dm 3 mol -1 s -1 . CO 2 ·- and acetone ketyl radical are also observed to react with o-vanillin by electron transfer mechanism and showed the formation of transient absorption bands with λ max at 350 and 390 nm at pH 4.5 and 9.7, respectively. The pK a of the one-electron reduced species was determined to be 8.1. The results indicate that the aldehydic group is the most preferred site for electron addition
Energy Technology Data Exchange (ETDEWEB)
Boone, Lindsey R.; Niesen, Melissa I. [Department of Molecular Medicine, College of Medicine, University of South Florida, Tampa, FL (United States); Jaroszeski, Mark [Department of Chemical and Biomedical Engineering, College of Engineering, University of South Florida, Tampa, FL (United States); Ness, Gene C., E-mail: gness@hsc.usf.edu [Department of Molecular Medicine, College of Medicine, University of South Florida, Tampa, FL (United States)
2009-07-31
The promoter elements and transcription factors necessary for triiodothyronine (T{sub 3}) induction of hepatic HMG-CoA reductase (HMGR) were investigated by transfecting rat livers with wild type and mutant HMGR promoter-luciferase constructs using in vivo electroporation. Mutations in the sterol response element (SRE), nuclear factor-y (NF-Y) site, and the newly identified upstream transcription factor-2 (USF-2) site essentially abolished the T{sub 3} response. Chromatin immunoprecipitation (ChIP) analysis demonstrated that T{sub 3} treatment caused a 4-fold increase in in vivo binding of USF-2 to the HMGR promoter. Co-transfection of the wild type HMGR promoter with siRNAs to USF-2, SREBP-2, or NF-Y nearly abolished the T{sub 3} induction, as measured by promoter activity. These data provide in vivo evidence for functional roles for USF-2, SREBP-2, and NF-Y in mediating the T{sub 3}-induction of hepatic HMGR transcription.
Directory of Open Access Journals (Sweden)
Gian Luigi Corinto
2016-05-01
The paper analyzes the case study of the Tuscan Region which in 2007 has charged the Sistema Toscana Foundation to strategically control all the territorial marketing activities, even including those of the regional film commission and the promotional tourist web site. The aim is to analyze the specific promotional model for enogastronomy and film tourism, as in the peculiar combination of the Tuscan case. The findings are that enongatronomy and tourism have been promoted in combination but only referring to 'minor' tuscan destinations, different from the crowded regional capital or other cultural sites. This choice has been determined by the strategic market positioning of the entire regional tourism supply, effectively integrating local vocations in the web communications. The task of the Foundation in promoting the whole territory and even the minor destinations must be considered as substantially successful, mainly because it has increased the visibility of the Tuscan region by conveniently using all the old and new media tools.
Directory of Open Access Journals (Sweden)
Li Mei-zhi
2010-10-01
Full Text Available Abstract Background Recent research shows that polycystic ovary syndrome (PCOS may have an association with low-grade chronic inflammation, and that PCOS may induce an increase in serum interleukin-18 (IL-18 levels. Methods To investigate the polymorphisms of the IL-18 gene promoters with PCOS, two single nucleotide polymorphisms (SNPs in the promoter of the IL-18 gene (at positions -607C/A and -137G/C in 118 Chinese women with PCOS and 79 controls were evaluated using polymerase chain reaction (PCR. Results No significant differences were found in the genotype distribution, allele frequency and haplotype frequency between the PCOS and control groups. Further analysis demonstrated a relationship between IL-18 gene promoter polymorphisms and PCOS insulin resistance (IR. Regarding the -137 allele frequency, G and C allele frequencies were 93.5% and 6.5%, respectively, in the PCOS with IR patients; G and C allele frequencies were 85.4% and 14.6%, respectively, in PCOS patients without IR (chi2 = 3.601, P = 0.048. Conclusions The presence of a polymorphism in the IL-18 gene was found to have no correlation with the occurrence of PCOS. Carriage of the C allele at position -137 in the promoter of the IL-18 gene may play a protective role from the development of PCOS IR.
Tang, Hui; Zhang, Jianwen; Yu, Zhenyu; Ye, Linsen; Li, Kun; Ding, Fan; Feng, Xiao
2017-01-01
Purpose: We proposed to investigate the effects of miR-452-3p on the proliferation and mobility of hepatocellular carcinoma (HCC) cells by targeting cytoplasmic polyadenylation element binding protein 3/estimated glomerular filtration rate (CPEB3/EGFR) axis. Methods: Quantitative real-time polymerase chain reaction (qRT-PCR) was used to detect miR-452-3p expression in 84 pairs of HCC tissues and adjacent tissues. Luciferase reporter assay was employed to examine the relationship between miR-452-3p and CPEB3. Microculture tetrazolium (MTT) assay, colony formation assay, flow cytometry detection, wound healing assay, and transwell assay were used to detect cell proliferation, cycle arrest, apoptosis, and mobility, respectively, in HCC, HepG2, and Huh-7. Western blot was used to detect protein expression levels in EGFR signaling pathway. Kaplan-Meier survival analysis was conducted to analyze the correlation between the miR-452-3p and CPEB3 expression levels and the survival of patients with HCC. Results: MiRNA-452-3p was found significantly upregulated in 84 human HCC sample tissues and cells in comparison with adjacent tissues and normal liver epithelial cells (P < .01). Luciferase reporter assay demonstrated that CPEB3 was a direct target of miR-452-3p. Overexpression of miR-452-3p promoted cell proliferation and mobility and suppressed apoptosis. MiR-452-3p enhanced EGFR and phosphorylated AKT (pAKT) expression but inhibited p21 expression level. Conclusion: MiR-452-3p promoted HCC cell proliferation and mobility by directly targeting the CPEB3/EGFR axis. PMID:29332449
International Nuclear Information System (INIS)
Liu, Baohui; Lin, Xi; Yang, Xiangsheng; Dong, Huimin; Yue, Xiaojing; Andrade, Kelsey C; Guo, Zhentao; Yang, Jian; Wu, Liquan; Zhu, Xiaonan; Zhang, Shenqi; Tian, Daofeng; Wang, Junmin; Cai, Qiang; Chen, Qizuan; Mao, Shanping; Chen, Qianxue; Chang, Jiang
2015-01-01
Activation of Notch signaling contributes to glioblastoma multiform (GBM) tumorigenesis. However, the molecular mechanism that promotes the Notch signaling augmentation during GBM genesis remains largely unknown. Identification of new factors that regulate Notch signaling is critical for tumor treatment. The expression levels of RND3 and its clinical implication were analyzed in GBM patients. Identification of RND3 as a novel factor in GBM genesis was demonstrated in vitro by cell experiments and in vivo by a GBM xenograft model. We found that RND3 expression was significantly decreased in human glioblastoma. The levels of RND3 expression were inversely correlated with Notch activity, tumor size, and tumor cell proliferation, and positively correlated with patient survival time. We demonstrated that RND3 functioned as an endogenous repressor of the Notch transcriptional complex. RND3 physically interacted with NICD, CSL, and MAML1, the Notch transcriptional complex factors, promoted NICD ubiquitination, and facilitated the degradation of these cofactor proteins. We further revealed that RND3 facilitated the binding of NICD to FBW7, a ubiquitin ligase, and consequently enhanced NICD protein degradation. Therefore, Notch transcriptional activity was inhibited. Forced expression of RND3 repressed Notch signaling, which led to the inhibition of glioblastoma cell proliferation in vitro and tumor growth in the xenograft mice in vivo. Downregulation of RND3, however, enhanced Notch signaling activity, and subsequently promoted glioma cell proliferation. Inhibition of Notch activity abolished RND3 deficiency-mediated GBM cell proliferation. We conclude that downregulation of RND3 is responsible for the enhancement of Notch activity that promotes glioblastoma genesis
Directory of Open Access Journals (Sweden)
Lu Zheng
2009-09-01
Full Text Available Lu Zheng1, Guanghua Luo1, Xiaoying Zhang1, Jun Zhang1, Jiang Zhu1, Jiang Wei1, Qinfeng Mu1, Lujun Chen1, Peter Nilsson-Ehle2, Ning Xu21Comprehensive Laboratory, The Third Affiliated Hospital, Suzhou University, Changzhou China; 2Division of Clinical Chemistry and Pharmacology, Department of Laboratory Medicine, Lund University, Lund, SwedenObjective: It has been reported that single-nucleotide polymorphism (SNP in the proximal promoter region of apolipoprotein M (apoM gene may confer the risk in the development of type 2 diabetes (T2D and coronary artery disease (CAD in the Han Chinese. However, in a recent study demonstrated that plasma apoM level did not correlated to the coronary heart disease. In the present studies, we investigated the SNP T-778C of apoM gene in CAD patients and controls in the Han Chinese population. Moreover we examined whether serum apoM levels could be influenced by this promoter mutation.Material and methods: One hundred twenty-six CAD patients and 118 non-CAD patients were subjected in the present study. All patients were confirmed by the angiography. The genotyping of polymorphisms T-778C in apoM promoter was determined by real-time polymerase chain reaction. Serum apoM levels were semi-quantitatively determined by the dot-blotting analysis. Results: Distribution of apoM T-778C genotype in non-CAD patients was as following: 84.7% were T/T, 15.3% were T/C and 0.0% was C/C. T allele frequencies were 92.4% and C allele, 7.6%. In the CAD patients, 99 patients (78.6% had the T/T genotype, 25 patients (19.8% with T/C genotype and 2 patients (1.6% with C/C genotype. The allele frequency was 88.5% for the T allele and 11.5% for the C allele. There was no statistical significant difference of serum apoM levels found in these three genotypes.Conclusions: There was no significant difference in allele or genotype frequencies between CAD patients and non-CAD patients. Binary logistic regression analysis with adjustments for age
Reversible effects of acute hypertension on proximal tubule sodium transporters
DEFF Research Database (Denmark)
Zhang, Y; Magyar, C E; Norian, J M
1998-01-01
Acute hypertension provokes a rapid decrease in proximal tubule sodium reabsorption with a decrease in basolateral membrane sodium-potassium-ATPase activity and an increase in the density of membranes containing apical membrane sodium/hydrogen exchangers (NHE3) [Y. Zhang, A. K. Mircheff, C. B....... Renal cortex lysate was fractionated on sorbitol gradients. Basolateral membrane sodium-potassium-ATPase activity (but not subunit immunoreactivity) decreased one-third to one-half after BP was elevated and recovered after BP was normalized. After BP was elevated, 55% of the apical NHE3 immunoreactivity......, smaller fractions of sodium-phosphate cotransporter immunoreactivity, and apical alkaline phosphatase and dipeptidyl-peptidase redistributed to membranes of higher density enriched in markers of the intermicrovillar cleft (megalin) and endosomes (Rab 4 and Rab 5), whereas density distributions...
Smolikov, Sarit; Schild-Prüfert, Kristina; Colaiácovo, Mónica P
2008-06-06
The synaptonemal complex (SC), a tripartite proteinaceous structure that forms between homologous chromosomes during meiosis, is crucial for faithful chromosome segregation. Here we identify CRA-1, a novel and conserved protein that is required for the assembly of the central region of the SC during C. elegans meiosis. In the absence of CRA-1, central region components fail to extensively localize onto chromosomes at early prophase and instead mostly surround the chromatin at this stage. Later in prophase, central region proteins polymerize along chromosome axes, but for the most part fail to connect the axes of paired homologous chromosomes. This defect results in an inability to stabilize homologous pairing interactions, altered double-strand break (DSB) repair progression, and a lack of chiasmata. Surprisingly, DSB formation and repair are required to promote the polymerization of the central region components along meiotic chromosome axes in cra-1 mutants. In the absence of both CRA-1 and any one of the C. elegans homologs of SPO11, MRE11, RAD51, or MSH5, the polymerization observed along chromosome axes is perturbed, resulting in the formation of aggregates of the SC central region proteins. While radiation-induced DSBs rescue this polymerization in cra-1; spo-11 mutants, they fail to do so in cra-1; mre-11, cra-1; rad-51, and cra-1; msh-5 mutants. Taken together, our studies place CRA-1 as a key component in promoting the assembly of a tripartite SC structure. Moreover, they reveal a scenario in which DSB formation and repair can drive the polymerization of SC components along chromosome axes in C. elegans.
International Nuclear Information System (INIS)
Kimira, Yoshifumi; Ogura, Kana; Taniuchi, Yuri; Kataoka, Aya; Inoue, Naoki; Sugihara, Fumihito; Nakatani, Sachie; Shimizu, Jun; Wada, Masahiro; Mano, Hiroshi
2014-01-01
Highlights: • Pro-Hyp did not affect MC3T3-E1 cell proliferation and matrix mineralization. • Pro-Hyp significantly increased alkaline phosphatase activity. • Pro-Hyp significantly upregulated gene expression of Runx2, Osterix, and Col1α1. - Abstract: Prolyl-hydroxyproline (Pro-Hyp) is one of the major constituents of collagen-derived dipeptides. The objective of this study was to investigate the effects of Pro-Hyp on the proliferation and differentiation of MC3T3-E1 osteoblastic cells. Addition of Pro-Hyp did not affect MC3T3-E1 cell proliferation and matrix mineralization but alkaline phosphatase activity was significantly increased. Furthermore, cells treated with Pro-Hyp significantly upregulated gene expression of Runx2, Osterix, and Col1α1. These results indicate that Pro-Hyp promotes osteoblast differentiation. This study demonstrates for the first time that Pro-Hyp has a positive effect on osteoblast differentiation with upregulation of Runx2, Osterix, and Collα1 gene expression
Sohoni, Sujata Vijay; Fazio, Alessandro; Workman, Christopher T.; Mijakovic, Ivan; Lantz, Anna Eliasson
2014-01-01
The objective of this study was the application of the synthetic promoter library (SPL) technology for modulation of actinorhodin production in Streptomyces coelicolor A3(2). The SPL technology was used to optimize the expression of a pathway specific positive transcriptional regulator ActII orf4, which activates the transcription of the S. coelicolor actinorhodin biosynthetic gene cluster. The native actII orf4 promoter was replaced with synthetic promoters, generating a S. coelicolor library with a broad range of expression levels of actII orf4. The resulting library was screened based on the yield of actinorhodin. Selected strains were further physiologically characterized. One of the strains from the library, ScoSPL20, showed considerably higher yield of actinorhodin and final actinorhodin titer, compared to S. coelicolor wild type and S. coelicolor with actII orf4 expressed from a strong constitutive promoter. ScoSPL20 demonstrated exceptional productivity despite having a comparatively weak expression from the promoter. Interestingly, the ScoSPL20 promoter was activated at a much earlier stage of growth compared to the wild type, demonstrating the advantage of fine-tuning and temporal tuning of gene expression in metabolic engineering. Transcriptome studies were performed in exponential and actinorhodin-producing phase of growth to compare gene expression between ScoSPL20 and the wild type. To our knowledge, this is the first successful application of the SPL technology for secondary metabolite production in filamentous bacteria. PMID:24963940
Directory of Open Access Journals (Sweden)
Walker Angela M
2009-04-01
Full Text Available Abstract Background The Pregnancy-associated glycoproteins (PAGs belong to a large family of aspartic peptidases expressed exclusively in the placenta of species in the Artiodactyla order. In cattle, the PAG gene family is comprised of at least 22 transcribed genes, as well as some variants. Phylogenetic analyses have shown that the PAG family segregates into 'ancient' and 'modern' groupings. Along with sequence differences between family members, there are clear distinctions in their spatio-temporal distribution and in their relative level of expression. In this report, 1 we performed an in silico analysis of the bovine genome to further characterize the PAG gene family, 2 we scrutinized proximal promoter sequences of the PAG genes to evaluate the evolution pressures operating on them and to identify putative regulatory regions, 3 we determined relative transcript abundance of selected PAGs during pregnancy and, 4 we performed preliminary characterization of the putative regulatory elements for one of the candidate PAGs, bovine (bo PAG-2. Results From our analysis of the bovine genome, we identified 18 distinct PAG genes and 14 pseudogenes. We observed that the first 500 base pairs upstream of the translational start site contained multiple regions that are conserved among all boPAGs. However, a preponderance of conserved regions, that harbor recognition sites for putative transcriptional factors (TFs, were found to be unique to the modern boPAG grouping, but not the ancient boPAGs. We gathered evidence by means of Q-PCR and screening of EST databases to show that boPAG-2 is the most abundant of all boPAG transcripts. Finally, we provided preliminary evidence for the role of ETS- and DDVL-related TFs in the regulation of the boPAG-2 gene. Conclusion PAGs represent a relatively large gene family in the bovine genome. The proximal promoter regions of these genes display differences in putative TF binding sites, likely contributing to observed
Properties of promoters cloned randomly from the Saccharomyces cerevisiae genome.
Santangelo, G M; Tornow, J; McLaughlin, C S; Moldave, K
1988-01-01
Promoters were isolated at random from the genome of Saccharomyces cerevisiae by using a plasmid that contains a divergently arrayed pair of promoterless reporter genes. A comprehensive library was constructed by inserting random (DNase I-generated) fragments into the intergenic region upstream from the reporter genes. Simple in vivo assays for either reporter gene product (alcohol dehydrogenase or beta-galactosidase) allowed the rapid identification of promoters from among these random fragments. Poly(dA-dT) homopolymer tracts were present in three of five randomly cloned promoters. With two exceptions, each RNA start site detected was 40 to 100 base pairs downstream from a TATA element. All of the randomly cloned promoters were capable of activating reporter gene transcription bidirectionally. Interestingly, one of the promoter fragments originated in a region of the S. cerevisiae rDNA spacer; regulated divergent transcription (presumably by RNA polymerase II) initiated in the same region. Images PMID:2847031
Clem, Brian F; Hudson, Elizabeth A; Clark, Barbara J
2005-03-01
Steroidogenic acute regulatory protein (StAR) transcription is regulated through cAMP-protein kinase A-dependent mechanisms that involve multiple transcription factors including the cAMP-responsive element binding protein (CREB) family members. Classically, binding of phosphorylated CREB to cis-acting cAMP-responsive elements (5'-TGACGTCA-3') within target gene promoters leads to recruitment of the coactivator CREB binding protein (CBP). Herein we examined the extent of CREB family member phosphorylation on protein-DNA interactions and CBP recruitment with the StAR promoter. Immunoblot analysis revealed that CREB, cAMP-responsive element modulator (CREM), and activating transcription factor (ATF)-1 are expressed in MA-10 mouse Leydig tumor cells, yet only CREB and ATF-1 are phosphorylated. (Bu)2cAMP treatment of MA-10 cells increased CREB phosphorylation approximately 2.3-fold within 30 min but did not change total nuclear CREB expression levels. Using DNA-affinity chromatography, we now show that CREB and ATF-1, but not CREM, interact with the StAR promoter, and this interaction is dependent on the activator protein-1 (AP-1) cis-acting element within the cAMP-responsive region. In addition, (Bu)2cAMP-treatment increased phosphorylated CREB (P-CREB) association with the StAR promoter but did not influence total CREB interaction. In vivo chromatin immunoprecipitation assays demonstrated CREB binding to the StAR proximal promoter is independent of (Bu)2cAMP-treatment, confirming our in vitro analysis. However, (Bu)2cAMP-treatment increased P-CREB and CBP interaction with the StAR promoter, demonstrating for the first time the physical role of P-CREB:DNA interactions in CBP recruitment to the StAR proximal promoter.
Compilation and analysis of Escherichia coli promoter DNA sequences.
Hawley, D K; McClure, W R
1983-01-01
The DNA sequence of 168 promoter regions (-50 to +10) for Escherichia coli RNA polymerase were compiled. The complete listing was divided into two groups depending upon whether or not the promoter had been defined by genetic (promoter mutations) or biochemical (5' end determination) criteria. A consensus promoter sequence based on homologies among 112 well-defined promoters was determined that was in substantial agreement with previous compilations. In addition, we have tabulated 98 promoter ...
Benferhat, Rima; Josse, Thibaut; Albaud, Benoit; Gentien, David; Mansuroglu, Zeyni; Marcato, Vasco; Souès, Sylvie; Le Bonniec, Bernard; Bouloy, Michèle; Bonnefoy, Eliette
2012-10-01
Rift Valley fever virus (RVFV) is a highly pathogenic Phlebovirus that infects humans and ruminants. Initially confined to Africa, RVFV has spread outside Africa and presently represents a high risk to other geographic regions. It is responsible for high fatality rates in sheep and cattle. In humans, RVFV can induce hepatitis, encephalitis, retinitis, or fatal hemorrhagic fever. The nonstructural NSs protein that is the major virulence factor is found in the nuclei of infected cells where it associates with cellular transcription factors and cofactors. In previous work, we have shown that NSs interacts with the promoter region of the beta interferon gene abnormally maintaining the promoter in a repressed state. In this work, we performed a genome-wide analysis of the interactions between NSs and the host genome using a genome-wide chromatin immunoprecipitation combined with promoter sequence microarray, the ChIP-on-chip technique. Several cellular promoter regions were identified as significantly interacting with NSs, and the establishment of NSs interactions with these regions was often found linked to deregulation of expression of the corresponding genes. Among annotated NSs-interacting genes were present not only genes regulating innate immunity and inflammation but also genes regulating cellular pathways that have not yet been identified as targeted by RVFV. Several of these pathways, such as cell adhesion, axonal guidance, development, and coagulation were closely related to RVFV-induced disorders. In particular, we show in this work that NSs targeted and modified the expression of genes coding for coagulation factors, demonstrating for the first time that this hemorrhagic virus impairs the host coagulation cascade at the transcriptional level.
Dynamic nucleosome organization at hox promoters during zebrafish embryogenesis.
Directory of Open Access Journals (Sweden)
Steven E Weicksel
Full Text Available Nucleosome organization at promoter regions plays an important role in regulating gene activity. Genome-wide studies in yeast, flies, worms, mammalian embryonic stem cells and transformed cell lines have found well-positioned nucleosomes flanking a nucleosome depleted region (NDR at transcription start sites. This nucleosome arrangement depends on DNA sequence (cis-elements as well as DNA binding factors and ATP-dependent chromatin modifiers (trans-factors. However, little is understood about how the nascent embryonic genome positions nucleosomes during development. This is particularly intriguing since the embryonic genome must undergo a broad reprogramming event upon fusion of sperm and oocyte. Using four stages of early embryonic zebrafish development, we map nucleosome positions at the promoter region of 37 zebrafish hox genes. We find that nucleosome arrangement at the hox promoters is a progressive process that takes place over several stages. At stages immediately after fertilization, nucleosomes appear to be largely disordered at hox promoter regions. At stages after activation of the embryonic genome, nucleosomes are detectable at hox promoters, with positions becoming more uniform and more highly occupied. Since the genomic sequence is invariant during embryogenesis, this progressive change in nucleosome arrangement suggests that trans-factors play an important role in organizing nucleosomes during embryogenesis. Separating hox genes into expressed and non-expressed groups shows that expressed promoters have better positioned and occupied nucleosomes, as well as distinct NDRs, than non-expressed promoters. Finally, by blocking the retinoic acid-signaling pathway, we disrupt early hox gene transcription, but observe no effect on nucleosome positions, suggesting that active hox transcription is not a driving force behind the arrangement of nucleosomes at the promoters of hox genes during early development.
Directory of Open Access Journals (Sweden)
Hye-Min Kim
2016-12-01
Full Text Available Bone homeostasis is tightly regulated to balance bone formation and bone resorption. Many anabolic drugs are used as bone-targeted therapeutic agents for the promotion of osteoblast-mediated bone formation or inhibition of osteoclast-mediated bone resorption. Previous studies showed that ginsenoside Re has the effect of the suppression of osteoclast differentiation in mouse bone-marrow derived macrophages and zebrafish. Herein, we investigated whether ginsenoside Re affects osteoblast differentiation and mineralization in in vitro and in vivo models. Mouse osteoblast precursor MC3T3-E1 cells were used to investigate cell viability, alkaline phosphatase (ALP activity, and mineralization. In addition, we examined osteoblastic signaling pathways. Ginsenoside Re affected ALP activity without cytotoxicity, and we also observed the stimulation of osteoblast differentiation through the activation of osteoblast markers including runt-related transcription factor 2, type 1 collagen, ALP, and osteocalcin in MC3T3-E1 cells. Moreover, Alizarin red S staining indicated that ginsenoside Re increased osteoblast mineralization in MC3T3-E1 cells and zebrafish scales compared to controls. These results suggest that ginsenoside Re promotes osteoblast differentiation as well as inhibits osteoclast differentiation, and it could be a potential therapeutic agent for bone diseases.
3D intrathoracic region definition and its application to PET-CT analysis
Cheirsilp, Ronnarit; Bascom, Rebecca; Allen, Thomas W.; Higgins, William E.
2014-03-01
Recently developed integrated PET-CT scanners give co-registered multimodal data sets that offer complementary three-dimensional (3D) digital images of the chest. PET (positron emission tomography) imaging gives highly specific functional information of suspect cancer sites, while CT (X-ray computed tomography) gives associated anatomical detail. Because the 3D CT and PET scans generally span the body from the eyes to the knees, accurate definition of the intrathoracic region is vital for focusing attention to the central-chest region. In this way, diagnostically important regions of interest (ROIs), such as central-chest lymph nodes and cancer nodules, can be more efficiently isolated. We propose a method for automatic segmentation of the intrathoracic region from a given co-registered 3D PET-CT study. Using the 3D CT scan as input, the method begins by finding an initial intrathoracic region boundary for a given 2D CT section. Next, active contour analysis, driven by a cost function depending on local image gradient, gradient-direction, and contour shape features, iteratively estimates the contours spanning the intrathoracic region on neighboring 2D CT sections. This process continues until the complete region is defined. We next present an interactive system that employs the segmentation method for focused 3D PET-CT chest image analysis. A validation study over a series of PET-CT studies reveals that the segmentation method gives a Dice index accuracy of less than 98%. In addition, further results demonstrate the utility of the method for focused 3D PET-CT chest image analysis, ROI definition, and visualization.
Synthetic promoter libraries for Corynebacterium glutamicum
DEFF Research Database (Denmark)
Rytter, Jakob Vang; Helmark, Søren; Chen, Jun
2014-01-01
The ability to modulate gene expression is an important genetic tool in systems biology and biotechnology. Here, we demonstrate that a previously published easy and fast PCR-based method for modulating gene expression in lactic acid bacteria is also applicable to Corynebacterium glutamicum. We co...... promoter library (SPL) technology is convenient for modulating gene expression in C. glutamicum and should have many future applications, within basic research as well as for optimizing industrial production organisms....... constructed constitutive promoter libraries based on various combinations of a previously reported C. glutamicum -10 consensus sequence (gngnTA(c/t)aaTgg) and the Escherichia coli -35 consensus, either with or without an AT-rich region upstream. A promoter library based on consensus sequences frequently found...... in low-GC Gram-positive microorganisms was also included. The strongest promoters were found in the library with a -35 region and a C. glutamicum -10 consensus, and this library also represents the largest activity span. Using the alternative -10 consensus TATAAT, which can be found in many other...
2-HG Inhibits Necroptosis by Stimulating DNMT1-Dependent Hypermethylation of the RIP3 Promoter
Directory of Open Access Journals (Sweden)
Zhentao Yang
2017-05-01
Full Text Available 2-hydroxyglutarate-(2-HG-mediated inhibition of TET2 activity influences DNA hypermethylation in cells harboring mutations of isocitrate dehydrogenases 1 and 2 (IDH1/2. Here, we show that 2-HG also regulates DNA methylation mediated by DNA methyltransferase 1 (DNMT1. DNMT1-dependent hypermethylation of the RIP3 promoter occurred in both IDH1 R132Q knockin mutant mouse embryonic fibroblast (MEFs and 2-HG-treated wild-type (WT MEFs. We found that 2-HG bound to DNMT1 and stimulated its association with the RIP3 promoter, inducing hypermethylation that reduces RIP3 protein and consequently impaired RIP3-dependent necroptosis. In human glioma samples, RIP3 protein levels correlated negatively with IDH1 R132H levels. Furthermore, ectopic expression of RIP3 in transformed IDH1-mutated MEFs inhibited the growth of tumors derived from these cells following transplantation into nude mice. Thus, our research sheds light on a mechanism of 2-HG-induced DNA hypermethylation and suggests that impaired necroptosis contributes to the tumorigenesis driven by IDH1/2 mutations.
Ellerström, M; Stålberg, K; Ezcurra, I; Rask, L
1996-12-01
The promoter region (-309 to +44) of the Brassica napus storage protein gene napA was studied in transgenic tobacco by successive 5' as well as internal deletions fused to the reporter gene GUS (beta-glucuronidase). The expression in the two main tissues of the seed, the endosperm and the embryo, was shown to be differentially regulated. This tissue-specific regulation within the seed was found to affect the developmental expression during seed development. The region between -309 to -152, which has a large effect on quantitative expression, was shown to harbour four elements regulating embryo and one regulating endosperm expression. This region also displayed enhancer activity. Deletion of eight bp from position -152 to position -144 totally abolished the activity of the napA promoter. This deletion disrupted a cis element with similarity to an ABA-responsive element (ABRE) overlapping with an E-box, demonstrating its crucial importance for quantitative expression. An internal deletion of the region -133 to -120, resulted in increased activity in both leaves and endosperm and a decreased activity in the embryo. Within this region, a cis element similar to the (CA)n element, found in other storage protein promoters, was identified. This suggest that the (CA)n element is important for conferring seed specificity by serving both as an activator and a repressor element.
Tian, Ying; Wang, Genjie; Hu, Qingzhu; Xiao, Xichun; Chen, Shuxia
2018-04-01
The AML1/ETO onco-fusion protein is crucial for the genesis of t(8;21) acute myeloid leukemia (AML) and is well documented as a transcriptional repressor through dominant-negative effect. However, little is known about the transactivation mechanism of AML1/ETO. Through large cohort of patient's expression level data analysis and a series of experimental validation, we report here that AML1/ETO transactivates c-KIT expression through directly binding to and mediating the long-range interaction between the promoter and intronic enhancer regions of c-KIT. Gene expression analyses verify that c-KIT expression is significantly high in t(8;21) AML. Further ChIP-seq analysis and motif scanning identify two regulatory regions located in the promoter and intronic enhancer region of c-KIT, respectively. Both regions are enriched by co-factors of AML1/ETO, such as AML1, CEBPe, c-Jun, and c-Fos. Further luciferase reporter assays show that AML1/ETO trans-activates c-KIT promoter activity through directly recognizing the AML1 motif and the co-existence of co-factors. The induction of c-KIT promoter activity is reinforced with the existence of intronic enhancer region. Furthermore, ChIP-3C-qPCR assays verify that AML1/ETO mediates the formation of DNA-looping between the c-KIT promoter and intronic enhancer region through the long-range interaction. Collectively, our data uncover a novel transcriptional activity mechanism of AML1/ETO and enrich our knowledge of the onco-fusion protein mediated transcription regulation. © 2017 Wiley Periodicals, Inc.
Directory of Open Access Journals (Sweden)
Christopher A Lavender
2016-08-01
Full Text Available Antisense transcription is a prevalent feature at mammalian promoters. Previous studies have primarily focused on antisense transcription initiating upstream of genes. Here, we characterize promoter-proximal antisense transcription downstream of gene transcription starts sites in human breast cancer cells, investigating the genomic context of downstream antisense transcription. We find extensive correlations between antisense transcription and features associated with the chromatin environment at gene promoters. Antisense transcription downstream of promoters is widespread, with antisense transcription initiation observed within 2 kb of 28% of gene transcription start sites. Antisense transcription initiates between nucleosomes regularly positioned downstream of these promoters. The nucleosomes between gene and downstream antisense transcription start sites carry histone modifications associated with active promoters, such as H3K4me3 and H3K27ac. This region is bound by chromatin remodeling and histone modifying complexes including SWI/SNF subunits and HDACs, suggesting that antisense transcription or resulting RNA transcripts contribute to the creation and maintenance of a promoter-associated chromatin environment. Downstream antisense transcription overlays additional regulatory features, such as transcription factor binding, DNA accessibility, and the downstream edge of promoter-associated CpG islands. These features suggest an important role for antisense transcription in the regulation of gene expression and the maintenance of a promoter-associated chromatin environment.
Regional differences in gender promotion and scholarly productivity in otolaryngology.
Eloy, Jean Anderson; Mady, Leila J; Svider, Peter F; Mauro, Kevin M; Kalyoussef, Evelyne; Setzen, Michael; Baredes, Soly; Chandrasekhar, Sujana S
2014-03-01
To identify whether regional differences exist in gender disparities in scholarly productivity and faculty rank among academic otolaryngologists. Academic otolaryngologists' bibliometric data analyses. Online faculty listings from 98 otolaryngology departments were organized by gender, academic rank, fellowship training status, and institutional location. The Scopus database was used to assess bibliometrics of these otolaryngologists, including the h-index, number of publications, and publication experience. Analysis included 1127 otolaryngologists, 916 men (81.3%) and 211 women (18.7%). Female faculty comprised 15.4% in the Midwest, 18.8% in the Northeast, 21.3% in the South, and 19.0% in the West (P = .44). Overall, men obtained significantly higher senior academic ranks (associate professor or professor) compared to women (59.8% vs. 40.2%, P .05). Gender disparities in academic rank and scholarly productivity exist most notably in the Northeast, where women in otolaryngology are most underrepresented relative to men at senior academic ranks and in scholarly productivity.
Ligand-Promoted C(sp(3) )-H Olefination en Route to Multi-functionalized Pyrazoles.
Yang, Weibo; Ye, Shengqing; Schmidt, Yvonne; Stamos, Dean; Yu, Jin-Quan
2016-05-17
A Pd-catalyzed/N-heterocycle-directed C(sp(3) )-H olefination has been developed. The monoprotected amino acid ligand (MPAA) is found to significantly promote Pd-catalyzed C(sp(3) )-H olefination for the first time. Cu(OAc)2 instead of Ag(+) salts are used as the terminal oxidant. This reaction provides a useful method for the synthesis of alkylated pyrazoles. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Basu, Amitava; Dasari, Vasanthi; Mishra, Rakesh K; Khosla, Sanjeev
2014-01-01
DNMT3L, a member of DNA methyltransferases family, is present only in mammals. As it provides specificity to the action of de novo methyltransferases, DNMT3A and DNMT3B and interacts with histone H3, DNMT3L has been invoked as the molecule that can read the histone code and translate it into DNA methylation. It plays an important role in the initiation of genomic imprints during gametogenesis and in nuclear reprogramming. With important functions attributed to it, it is imperative that the DNMT3L expression is tightly controlled. Previously, we had identified a CpG island within the human DNMT3L promoter and first exon that showed loss of DNA methylation in cancer samples. Here we show that this Differentially Methylated CpG island within DNMT3L (DNMT3L DMC) acts to repress transcription, is a Polycomb/Trithorax Response Element (PRE) and interacts with both PRC1 and PRC2 Polycomb repressive complexes. In addition, it adopts inactive chromatin conformation and is associated with other inactive chromatin-specific proteins like SUV39H1 and HP1. The presence of DNMT3L DMC also influences the adjacent promoter to adopt repressive histone post-translational modifications. Due to its association with multiple layers of repressive epigenetic modifications, we believe that PRE within the DNMT3L DMC is responsible for the tight regulation of DNMT3L expression and the aberrant epigenetic modifications of this region leading to DNMT3L overexpression could be the reason of nuclear programming during carcinogenesis.
Directory of Open Access Journals (Sweden)
Amitava Basu
Full Text Available DNMT3L, a member of DNA methyltransferases family, is present only in mammals. As it provides specificity to the action of de novo methyltransferases, DNMT3A and DNMT3B and interacts with histone H3, DNMT3L has been invoked as the molecule that can read the histone code and translate it into DNA methylation. It plays an important role in the initiation of genomic imprints during gametogenesis and in nuclear reprogramming. With important functions attributed to it, it is imperative that the DNMT3L expression is tightly controlled. Previously, we had identified a CpG island within the human DNMT3L promoter and first exon that showed loss of DNA methylation in cancer samples. Here we show that this Differentially Methylated CpG island within DNMT3L (DNMT3L DMC acts to repress transcription, is a Polycomb/Trithorax Response Element (PRE and interacts with both PRC1 and PRC2 Polycomb repressive complexes. In addition, it adopts inactive chromatin conformation and is associated with other inactive chromatin-specific proteins like SUV39H1 and HP1. The presence of DNMT3L DMC also influences the adjacent promoter to adopt repressive histone post-translational modifications. Due to its association with multiple layers of repressive epigenetic modifications, we believe that PRE within the DNMT3L DMC is responsible for the tight regulation of DNMT3L expression and the aberrant epigenetic modifications of this region leading to DNMT3L overexpression could be the reason of nuclear programming during carcinogenesis.
Directory of Open Access Journals (Sweden)
Yin Weilun
2010-01-01
Full Text Available Abstract Background CBL1 is a calcium sensor that regulates drought, cold and salt signals in Arabidopsis. Overexpression of CBL1 gene in Arabidopsis and in Ammopiptanthus mongolicus showed different tolerant activities. We are interested in understanding the molecular mechanism of the upstream region of the CBL1 gene of A. mongolicus (AmCBL1. We investigated and characterized the promoter of the AmCBL1 gene, for promoters play a very important role in regulating gene expression in eukaryotes. Results A 1683-bp 5' flanking region was isolated from A. mongolicus. The sequence was identified as AmCBL1 promoter. Analysis of the promoter sequence indicated a 690-bp intron and some basic cis-acting elements were related to various environmental stresses and plant hormones. To identify the functional region of the AmCBL1 promoter, five plant expression vectors fused with the GUS (β-glucuronidase gene, driven by series deleted fragments of AmCBL1 promoter at different lengths from -1659, -1414, -1048, -296 to -167 bp relative to the transcriptional start site were constructed and transformed into Nicotiana tabacum L. cv. 89. Functional properties of each promoter segment were examined by GUS staining and fluorescence quantitative analyses using at least three single-copy PCR-positive plants of transgenic tobacco, treated with various environmental stresses and plant hormones for different times. We demonstrated that the AmCBL1 promoter was a vascular-specific and multiple-stress-inducible promoter. Our results further imply that the promoter fragment B1S3 possessed sufficient essential cis-acting elements, accounting for vascular-specific and stress-induced expression patterns. It may also indicate that for response to some stresses certain cis-elements are required in tissues outside the region of the B1S3 construct. Conclusions To help resolve uncertainties about the upstream regulatory mechanism of the CBL1 gene in desert plants, we suggest that
Combgap Promotes Ovarian Niche Development and Chromatin Association of EcR-Binding Regions in BR-C.
Hitrik, Anna; Popliker, Malka; Gancz, Dana; Mukamel, Zohar; Lifshitz, Aviezer; Schwartzman, Omer; Tanay, Amos; Gilboa, Lilach
2016-11-01
The development of niches for tissue-specific stem cells is an important aspect of stem cell biology. Determination of niche size and niche numbers during organogenesis involves precise control of gene expression. How this is achieved in the context of a complex chromatin landscape is largely unknown. Here we show that the nuclear protein Combgap (Cg) supports correct ovarian niche formation in Drosophila by controlling ecdysone-Receptor (EcR)- mediated transcription and long-range chromatin contacts in the broad locus (BR-C). Both cg and BR-C promote ovarian growth and the development of niches for germ line stem cells. BR-C levels were lower when Combgap was either reduced or over-expressed, indicating an intricate regulation of the BR-C locus by Combgap. Polytene chromosome stains showed that Cg co-localizes with EcR, the major regulator of BR-C, at the BR-C locus and that EcR binding to chromatin was sensitive to changes in Cg levels. Proximity ligation assay indicated that the two proteins could reside in the same complex. Finally, chromatin conformation analysis revealed that EcR-bound regions within BR-C, which span ~30 KBs, contacted each other. Significantly, these contacts were stabilized in an ecdysone- and Combgap-dependent manner. Together, these results highlight Combgap as a novel regulator of chromatin structure that promotes transcription of ecdysone target genes and ovarian niche formation.
Ultrasound promoted and SiO2/CCl3COOH mediated synthesis of 2 ...
Indian Academy of Sciences (India)
First one-pot synthesis of 2-aryl-1-arylmethyl-1H- benzimidazole derivatives from ... to promote chemical reactions is called sonochemistry .... −1): 1615, 2845, 2980, 3036, 3067; 1H NMR (500MHz,. CDCl3):δ 5.38 (s, 2H, CH2), 6.65 (d, J = 8.0 ...
DOF-binding sites additively contribute to guard cell-specificity of AtMYB60 promoter
Directory of Open Access Journals (Sweden)
Cominelli Eleonora
2011-11-01
Full Text Available Abstract Background We previously demonstrated that the Arabidopsis thaliana AtMYB60 protein is an R2R3MYB transcription factor required for stomatal opening. AtMYB60 is specifically expressed in guard cells and down-regulated at the transcriptional levels by the phytohormone ABA. Results To investigate the molecular mechanisms governing AtMYB60 expression, its promoter was dissected through deletion and mutagenesis analyses. By studying different versions of AtMYB60 promoter::GUS reporter fusions in transgenic plants we were able to demonstrate a modular organization for the AtMYB60 promoter. Particularly we defined: a minimal promoter sufficient to confer guard cell-specific activity to the reporter gene; the distinct roles of different DOF-binding sites organised in a cluster in the minimal promoter in determining guard cell-specific expression; the promoter regions responsible for the enhancement of activity in guard cells; a promoter region responsible for the negative transcriptional regulation by ABA. Moreover from the analysis of single and multiple mutants we could rule out the involvement of a group of DOF proteins, known as CDFs, already characterised for their involvement in flowering time, in the regulation of AtMYB60 expression. Conclusions These findings shed light on the regulation of gene expression in guard cells and provide new promoter modules as useful tools for manipulating gene expression in guard cells, both for physiological studies and future biotechnological applications.
Energy Technology Data Exchange (ETDEWEB)
Ohashi, Koji [Department of Clinical Biochemistry, Fujita Health University School of Health Sciences, Toyoake (Japan); Munetsuna, Eiji [Department of Biochemistry, Fujita Health University School of Medicine, Toyoake (Japan); Yamada, Hiroya, E-mail: hyamada@fujita-hu.ac.jp [Department of Hygiene, Fujita Health University School of Medicine, Toyoake (Japan); Ando, Yoshitaka [Department of Joint Research Laboratory of Clinical Medicine, Fujita Health University Hospital, Toyoake (Japan); Yamazaki, Mirai; Taromaru, Nao; Nagura, Ayuri; Ishikawa, Hiroaki [Department of Clinical Biochemistry, Fujita Health University School of Health Sciences, Toyoake (Japan); Suzuki, Koji [Department of Public Health, Fujita Health University School of Health Sciences, Toyoake (Japan); Teradaira, Ryoji [Department of Clinical Biochemistry, Fujita Health University School of Health Sciences, Toyoake (Japan); Hashimoto, Shuji [Department of Hygiene, Fujita Health University School of Medicine, Toyoake (Japan)
2015-12-04
DNA methylation status is affected by environmental factors, including nutrition. Fructose consumption is considered a risk factor for the conditions that make up metabolic syndrome such as dyslipidemia. However, the pathogenetic mechanism by which fructose consumption leads to metabolic syndrome is unclear. Based on observations that epigenetic modifications are closely related to induction of metabolic syndrome, we hypothesized that fructose-induced metabolic syndrome is caused by epigenetic alterations. Male SD rats were designated to receive water or 20% fructose solution for 14 weeks. mRNA levels for peroxisome proliferator-activated receptor alpha (PPARα) and carnitine palmitoyltransferase 1A (CPT1A) was analyzed using Real-time PCR. Restriction digestion and real-time PCR (qAMP) was used for the analysis of DNA methylation status. Hepatic lipid accumulation was also observed by fructose intake. Fructose feeding also significantly decreased mRNA levels for PPARα and CPT1A. qAMP analysis demonstrated the hypermethylation of promoter regions of PPARα and CTP1A genes. Fructose-mediated attenuated gene expression may be mediated by alterations of DNA methylation status, and pathogenesis of metabolic syndrome induced by fructose relates to DNA methylation status. - Highlights: • No general consensus has been reached regarding the molecular mechanisms of the pathogenesis of fructose-induced diseases. • Significant increase in hepatic total methylation level was observed after fructose-supplemented feeding. • Fructose feeding significantly decreased mRNA levels for PPARα and CPT1A. • qAMP analysis demonstrated the hypermethylation of promoter regions of PPARα and CTP1A genes. • Fructose-mediated attenuated gene expression may be mediated by alterations of DNA methylation status in rat liver.
International Nuclear Information System (INIS)
Ohashi, Koji; Munetsuna, Eiji; Yamada, Hiroya; Ando, Yoshitaka; Yamazaki, Mirai; Taromaru, Nao; Nagura, Ayuri; Ishikawa, Hiroaki; Suzuki, Koji; Teradaira, Ryoji; Hashimoto, Shuji
2015-01-01
DNA methylation status is affected by environmental factors, including nutrition. Fructose consumption is considered a risk factor for the conditions that make up metabolic syndrome such as dyslipidemia. However, the pathogenetic mechanism by which fructose consumption leads to metabolic syndrome is unclear. Based on observations that epigenetic modifications are closely related to induction of metabolic syndrome, we hypothesized that fructose-induced metabolic syndrome is caused by epigenetic alterations. Male SD rats were designated to receive water or 20% fructose solution for 14 weeks. mRNA levels for peroxisome proliferator-activated receptor alpha (PPARα) and carnitine palmitoyltransferase 1A (CPT1A) was analyzed using Real-time PCR. Restriction digestion and real-time PCR (qAMP) was used for the analysis of DNA methylation status. Hepatic lipid accumulation was also observed by fructose intake. Fructose feeding also significantly decreased mRNA levels for PPARα and CPT1A. qAMP analysis demonstrated the hypermethylation of promoter regions of PPARα and CTP1A genes. Fructose-mediated attenuated gene expression may be mediated by alterations of DNA methylation status, and pathogenesis of metabolic syndrome induced by fructose relates to DNA methylation status. - Highlights: • No general consensus has been reached regarding the molecular mechanisms of the pathogenesis of fructose-induced diseases. • Significant increase in hepatic total methylation level was observed after fructose-supplemented feeding. • Fructose feeding significantly decreased mRNA levels for PPARα and CPT1A. • qAMP analysis demonstrated the hypermethylation of promoter regions of PPARα and CTP1A genes. • Fructose-mediated attenuated gene expression may be mediated by alterations of DNA methylation status in rat liver.
International Nuclear Information System (INIS)
Piette, J.; Decuyper-Debergh, D.; Gamper, H.
1985-01-01
Double-stranded M13 phage DNA (M13 mp10 replicative form) was photoreacted with 4'-hydroxymethyl-4,5',8-trimethylpsoralen, using light of wavelength greater than 320 nm or greater than 390 nm to generate predominantly crosslinks or monoadducts, respectively. The damaged DNAs were scored for inactivation and mutagenesis after transfection into Escherichia coli. The appearance of light-blue or colorless plaques on indicator medium showed that mutation had occurred in the lac insert of the viral DNA. A comparison of the consequences of the two phototreatments with psoralen supports the idea that crosslinks are both more lethal and more mutagenic than monoadducts. Numerous mutant clones partially or totally deficient in beta-galactosidase were plaque-purified and amplified. The viral DNA of each clone was sequenced by the dideoxy chain-terminating procedure. All of the observed base-pair changes were mapped to the lac promoter region and consisted of 3 transition, 14 transversion, and 6 single base-pair frame-shift mutations. The predominant mutation was a T.A----G.C transversion
Evaluation of methylation pattern in promoter region of E-cadherin ...
African Journals Online (AJOL)
user
2011-03-07
Mar 7, 2011 ... promoter methylation in CDH1 gene inactivation in breast cancer, the CpG methylation status of E- ..... 5'CpG island of CDH1 in prostate, lung, liver, bladder, .... and estrogen receptor alpha from Sp1 sites to induce cell cycle.
MicroRNA-24 promotes 3T3-L1 adipocyte differentiation by directly targeting the MAPK7 signaling
Energy Technology Data Exchange (ETDEWEB)
Jin, Min, E-mail: min_jin@zju.edu.cn [Division of Reproductive Medicine & Infertility, The Second Affiliated Hospital, School of Medicine, Zhejiang University, 88#, Jiefang Rd., Hangzhou, Zhejiang, 310009 (China); Wu, Yutao; Wang, Jing [School of Medicine, Zhejiang University, 288# Yuhangtang Rd, Hangzhou, Zhejiang, 310003 (China); Chen, Jian; Huang, Yiting; Rao, Jinpeng; Feng, Chun [Division of Reproductive Medicine & Infertility, The Second Affiliated Hospital, School of Medicine, Zhejiang University, 88#, Jiefang Rd., Hangzhou, Zhejiang, 310009 (China)
2016-05-20
Over the past years, MicroRNAs (miRNAs) act as a vital role in harmony with gene regulation and maintaining cellular homeostasis. It is well testified that miRNAshave been involved in numerous physiological and pathological processes, including embryogenesis, cell fate decision, and cellular differentiation. Adipogenesis is an organized process of cellular differentiation by which pre-adipocytes differentiate towards mature adipocytes, and it is tightly modulated by a series of transcription factors such as peroxisome proliferator-activated receptor γ (PPAR-γ) and sterol regulatory-element binding proteins 1 (SREBP1). However, the molecular mechanisms underlying the connection between miRNAs and adipogenesis-related transcription factors remain obscure. In this study, we unveiled that miR- 24 was remarkably upregulated during 3T3-L1 adipogenesis. Overexpression of miR-24 significantly promoted 3T3-L1 adipogenesis, as evidenced by its ability to increase the expression of PPAR-γ and SREBP1, lipid droplet formation and triglyceride (TG) accumulation. Furthermore, we found that neither ectopic expression of miR-24nor miR-24 inhibitor affect cell proliferation and cell cycle progression. Finally, we demonstrated that miR-24 plays the modulational role by directly repressing MAPK7, a key number in the MAPK signaling pathway. These data indicate that miR-24 is a novel positive regulator of adipocyte differentiation by targeting MAPK7, which provides new insights into the molecular mechanism of miRNA-mediated cellular differentiation. -- Highlights: •We firstly found miR-24 was upregulated in 3T3-L1 pre-adipocytes differentiation. •miR-24 promoted 3T3-L1 pre-adipocytes differentiation while silencing the expression of miR-24 had an opposite function. •miR-24 regulated 3T3-L1 differentiation by directly targeting MAPK7 signaling pathway. •miR-24did not affect 3T3-L1 pre-adipocytes cellular proliferation.
Song, Hongwei; Yang, Minghui; Guo, Hua
2016-10-01
Vibrational excitations of reactants sometimes promote reactions more effectively than the same amount of translational energy. Such mode specificity provides insights into the transition-state modulation of reactivity and might be used to control chemical reactions. We report here a state-of-the-art full-dimensional quantum dynamical study of the hydrogen abstraction reaction H + NH3 → H2 + NH2 on an accurate ab initio based global potential energy surface. This reaction serves as an ideal candidate to study the relative efficacies of symmetric and degenerate antisymmetric stretching modes. Strong mode specificity, particularly for the NH3 stretching modes, is demonstrated. It is further shown that nearly identical efficacies of the symmetric and antisymmetric stretching modes of NH3 in promoting the reaction can be understood in terms of local-mode stretching vibrations of the reactant molecule.
Choi, Jee-Hye; Min, Na Young; Park, Jina; Kim, Jin Hong; Park, Soo Hyun; Ko, Young Jong; Kang, Yoonsung; Moon, Young Joon; Rhee, Sangmyung; Ham, Seung Wook; Park, Ae Ja; Lee, Kwang-Ho
2010-01-01
Trichostatin A (TSA), an inhibitor of histone deacetylase, is a well-known antitumor agent that effectively and selectively induces tumor growth arrest and apoptosis. Recently, it was reported that hTERT is one of the primary targets for TSA-induced apoptosis in cancer cells but the mechanism of which has not yet been elucidated. In the present study, to better understand the epigenetic regulation mechanism responsible for the repression of hTERT by TSA, we examined expression of hTERT in the HCT116 colon cancer cell line after treatment with TSA and performed site-specific CpG methylation analysis of the hTERT promoter. We found that TSA-induced the demethylation of site-specific CpGs on the promoter of hTERT, which was caused by down-regulation of DNA methyltransferase 1 (DNMT1). Among the demethylated region, the 31st-33rd CpGs contained a binding site for CTCF, an inhibitor of hTERT transcription. ChIP analysis revealed that TSA-induced demethylation of the 31st-33rd CpGs promoted CTCF binding on hTERT promoter, leading to repression of hTERT. Taken together, down-regulation of DNMT1 by TSA caused demethylation of a CTCF binding site on the hTERT promoter, the result of which was repression of hTERT via recruitment of CTCF to the promoter. Copyright 2009 Elsevier Inc. All rights reserved.
Toro, Carlos A; Wright, Hollis; Aylwin, Carlos F; Ojeda, Sergio R; Lomniczi, Alejandro
2018-01-04
Polycomb group (PcG) proteins control the timing of puberty by repressing the Kiss1 gene in hypothalamic arcuate nucleus (ARC) neurons. Here we identify two members of the Trithorax group (TrxG) of modifiers, mixed-lineage leukemia 1 (MLL1), and 3 (MLL3), as central components of an activating epigenetic machinery that dynamically counteracts PcG repression. Preceding puberty, MLL1 changes the chromatin configuration at the promoters of Kiss1 and Tac3, two genes required for puberty to occur, from repressive to permissive. Concomitantly, MLL3 institutes a chromatin structure that changes the functional status of a Kiss1 enhancer from poised to active. RNAi-mediated, ARC-specific Mll1 knockdown reduced Kiss1 and Tac3 expression, whereas CRISPR-Cas9-directed epigenome silencing of the Kiss1 enhancer selectively reduced Kiss1 activity. Both interventions delay puberty and disrupt reproductive cyclicity. Our results demonstrate that an epigenetic switch from transcriptional repression to activation is crucial to the regulatory mechanism controlling the timing of mammalian puberty.
Light response and potential interacting proteins of a grape flavonoid 3'-hydroxylase gene promoter.
Sun, Run-Ze; Pan, Qiu-Hong; Duan, Chang-Qing; Wang, Jun
2015-12-01
Flavonoid 3'-hydroxylase (F3'H), a member of cytochrome P450 protein family, introduces B-ring hydroxyl group in the 3' position of the flavonoid. In this study, the cDNA sequence of a F3'H gene (VviF3'H), which contains an open reading frame of 1530 bp encoding a polypeptide of 509 amino acids, was cloned and characterized from Vitis vinifera L. cv. Cabernet Sauvignon. VviF3'H showed high homology to known F3'H genes, especially F3'Hs from the V. vinifera reference genome (Pinot Noir) and lotus. Expression profiling analysis using real-time PCR revealed that VviF3'H was ubiquitously expressed in all tested tissues including berries, leaves, flowers, roots, stems and tendrils, suggesting its important physiological role in plant growth and development. Moreover, the transcript level of VviF3'H gene in grape berries was relatively higher at early developmental stages and gradually decreased during véraison, and then increased in the mature phase. In addition, the promoter of VviF3'H was isolated by using TAIL-PCR. Yeast one-hybrid screening of the Cabernet Sauvignon cDNA library and subsequent in vivo/vitro validations revealed the interaction between VviF3'H promoter and several transcription factors, including members of HD-Zip, NAC, MYB and EIN families. A transcriptional regulation mechanism of VviF3'H expression is proposed for the first time. Copyright © 2015 Elsevier Masson SAS. All rights reserved.
Directory of Open Access Journals (Sweden)
Vassilis MONASTIRIOTIS
2010-12-01
Full Text Available Studies on the productivity spillovers of FDI have concentrated on the nationalsectoral level. As a result, little is known about the impact of FDI on absolute and relative regional economic performance. In this paper we examine this issue by relying on a unique dataset of over 20,000 Greek firms for the period 2002-2006 covering all sectors of economic activity. We examine the spatial distribution of foreign-owned firms in the country and analyse the effect that their presence – at the local, regional and national levels – has on the productivity of domestic firms. We find strong evidence suggesting that foreignowned firms self-select into regions and sectors of high productivity. Net of this selection effect, the impact of foreign presence on domestic productivity is negative – although at the very local level some positive spillover effects are identifiable. The bulk of the effects concentrate in non-manufacturing activities, high-tech sectors, and medium-sized high-productivity firms. Importantly, this effect is not constant across space however. Productivity spillovers tend to be negative in the regions hosting the main urban areas in the country but positive in smaller and more peripheral regions. In this way, despite the tendency of FDI to concentrate in a limited number of areas within the country – those of the highest level of development – the externalities that FDI activity generates to the local economies appear to be of a rather equilibrating character.
Mint3 in bone marrow-derived cells promotes lung metastasis in breast cancer model mice.
Hara, Toshiro; Murakami, Yoshinori; Seiki, Motoharu; Sakamoto, Takeharu
2017-08-26
Breast cancer is one of the most common cancers in women in the world. Although breast cancer is well treatable at the early stage, patients with distant metastases show a poor prognosis. Data from recent studies using transplantation models indicate that Mint3/APBA3 might promote breast cancer malignancy. However, whether Mint3 indeed contributes to tumor development, progression, or metastasis in vivo remains unclear. To address this, here we examined whether Mint3 depletion affects tumor malignancy in MMTV-PyMT breast cancer model mice. In MMTV-PyMT mice, Mint3 depletion did not affect tumor onset and tumor growth, but attenuated lung metastases. Experimental lung metastasis of breast cancer Met-1 cells derived from MMTV-PyMT mice also decreased in Mint3-depleted mice, indicating that host Mint3 expression affected lung metastasis of MMTV-PyMT-derived breast cancer cells. Further bone marrow transplant experiments revealed that Mint3 in bone marrow-derived cells promoted lung metastasis in MMTV-PyMT mice. Thus, targeting Mint3 in bone marrow-derived cells might be a good strategy for preventing metastasis and improving the prognosis of breast cancer patients. Copyright © 2017 Elsevier Inc. All rights reserved.
ClC-3 Promotes Osteogenic Differentiation in MC3T3-E1 Cell After Dynamic Compression.
Wang, Dawei; Wang, Hao; Gao, Feng; Wang, Kun; Dong, Fusheng
2017-06-01
ClC-3 chloride channel has been proved to have a relationship with the expression of osteogenic markers during osteogenesis, persistent static compression can upregulate the expression of ClC-3 and regulate osteodifferentiation in osteoblasts. However, there was no study about the relationship between the expression of ClC-3 and osteodifferentiation after dynamic compression. In this study, we applied dynamic compression on MC3T3-E1 cells to detect the expression of ClC-3, runt-related transcription factor 2 (Runx2), bone morphogenic protein-2 (BMP-2), osteopontin (OPN), nuclear-associated antigen Ki67 (Ki67), and proliferating cell nuclear antigen (PCNA) in biopress system, then we investigated the expression of these genes after dynamic compression with Chlorotoxin (specific ClC-3 chloride channel inhibitor) added. Under transmission electron microscopy, there were more cell surface protrusions, rough surfaced endoplasmic reticulum, mitochondria, Golgi apparatus, abundant glycogen, and lysosomes scattered in the cytoplasm in MC3T3-E1 cells after dynamic compression. The nucleolus was more obvious. We found that ClC-3 was significantly up-regulated after dynamic compression. The compressive force also up-regulated Runx2, BMP-2, and OPN after dynamic compression for 2, 4 and 8 h. The proliferation gene Ki67 and PCNA did not show significantly change after dynamic compression for 8 h. Chlorotoxin did not change the expression of ClC-3 but reduced the expression of Runx2, BMP-2, and OPN after dynamic compression compared with the group without Cltx added. The data from the current study suggested that ClC-3 may promotes osteogenic differentiation in MC3T3-E1 cell after dynamic compression. J. Cell. Biochem. 118: 1606-1613, 2017. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.
Constructing a State Policy To Promote Regionalism in School Government.
Zukowsky, Jerome; And Others.
This paper defines regionalism, sets some tentative directions for the concept, and raises difficult questions related to its application in New York State. Regionalism, which offers an alternative to a State-local school governing system, is used to decentralize the planning and management of public services. A regional unit permits district…
Identification of cis-acting regulatory elements in the human oxytocin gene promoter.
Richard, S; Zingg, H H
1991-12-01
The expression of hormone-inducible genes is determined by the interaction of trans-acting factors with hormone-inducible elements and elements mediating basal and cell-specific expression. We have shown earlier that the gene encoding the hypothalamic nonapeptide oxytocin (OT) is under the control of an estrogen response element (ERE). The present study was aimed at identifying cis-acting elements mediating basal expression of the OT gene. A construct containing sequences -381 to +36 of the human OT gene was linked to a reporter gene and transiently transfected into a series of neuronal and nonneuronal cell lines. Expression of this construct was cell specific: it was highest in the neuroblastoma-derived cell line, Neuro-2a, and lowest in NIH 3T3 and JEG-3 cells. By 5' deletion analysis, we determined that a segment from -49 to +36 was capable of mediating cells-pecific promoter activity. Within this segment, we identified three proximal promoter elements (PPE-1, PPE-2, and PPE-3) that are each required for promoter activity. Most notably, mutation of a conserved purine-rich element (GAGAGA) contained within PPE-2 leads to a 10-fold decrease in promoter strength. Gel mobility shift analysis with three different double-stranded oligonucleotides demonstrated that each proximal promoter element binds distinct nuclear factors. In each case, only the homologous oligonucleotide, but neither of the oligonucleotides corresponding to adjacent elements, was able to act as a competitor. Thus, a different set of factors appears to bind independently to each element. By reinserting the homologous ERE or a heterologous glucocorticoid response element upstream of intact or altered proximal promoter segments we determined that removal or mutation of proximal promoter elements decreases basal expression, but does not abrogate the hormone responsiveness of the promoter. In conclusion, these results indicate that an important component of the transcriptional activity of the OT
Energy Technology Data Exchange (ETDEWEB)
Yanagawa, H.; Nishio, H.; Takeshima, Y. [Kobe Univ. School of Medicine (Japan)] [and others
1994-09-01
The dystrophin gene, which is muted in patients with Duchenne and Becker muscular dystrophies, is the largest known human gene. Five alternative promoters have been characterized until now. Here we show that a novel dystrophin isoform with a different first exon can be produced through transcription initiation at a previously-unidentified alternative promoter. The case study presented is that of patient with Duchenne muscular dystrophy who had a deletion extending from 5{prime} end of the dystrophin gene to exon 2, including all promoters previously mapped in the 5{prime} part of the gene. Transcripts from lymphoblastoid cells were found to contain sequences corresponding to exon 3, indicating the presence of new promoter upstream of this exon. The nucleotide sequence of amplified cDNA corresponding to the 5{prime} end of the new transcript indicated that the 5{prime} end of exon 3 was extended by 9 codons, only the last (most 3{prime}) of which codes for methionine. The genomic nucleotide sequence upstream from the new exon, as determined using inverse polymerase chain reaction, revealed the presence of sequences similar to a TATA box, an octamer motif and an MEF-2 element. The identified promoter/exon did not map to intron 2, as might have been expected, but to a position more than 500 kb upstream of the most 5{prime} of the previously-identified promoters, thereby adding 500 kb to the dystrophin gene. The sequence of part of the new promoter region is very similar to that of certain medium reiteration frequency repetitive sequences. These findings may help us understand the molecular evolution of the dystrophin gene.
Enhancement of RNA synthesis by promoter duplication in tombusviruses
International Nuclear Information System (INIS)
Panavas, T.; Panaviene, Z.; Pogany, J.; Nagy, P.D.
2003-01-01
Replication of tombusviruses, small plus-strand RNA viruses of plants, is regulated by cis-acting elements present in the viral RNA. The role of cis-acting elements can be studied in vitro by using a partially purified RNA-dependent RNA polymerase (RdRp) preparation obtained from tombusvirus-infected plants , Virology 276, 279- 288). Here, we demonstrate that the minus-strand RNA of tombusviruses contains, in addition to the 3'-terminal minimal plus-strand initiation promoter, a second cis-acting element, termed the promoter proximal enhancer (PPE). The PPE element enhanced RNA synthesis by almost threefold from the adjacent minimal promoter in the in vitro assay. The sequence of the PPE element is 70% similar to the minimal promoter, suggesting that sequence duplication of the minimal promoter may have been the mechanism leading to the generation of the PPE. Consistent with this proposal, replacement of the PPE element with the minimal promoter, which resulted in a perfectly duplicated promoter region, preserved its enhancer-like function. In contrast, mutagenesis of the PPE element or its replacement with an artificial G/C-rich sequence abolished its stimulative effect on initiation of RNA synthesis in vitro. In vivo experiments are also consistent with the role of the PPE element in enhancement of tombusvirus replication. Sequence comparison of several tombusviruses and related carmoviruses further supports the finding that duplication of minimal promoter sequences may have been an important mechanism during the evolution of cis-acting elements in tombusviruses and related RNA viruses
Zheng, Rui; Zhang, Zhong-Hao; Chen, Chen; Chen, Yao; Jia, Shi-Zheng; Liu, Qiong; Ni, Jia-Zuan; Song, Guo-Li
2017-03-25
The maintenance of neural system integrity and function is the ultimate goal for the treatment of neurodegenerative disease such as Alzheimer's disease (AD). Neurogenesis plays an integral role in the maintenance of neural and cognitive functions, and its dysfunction is regarded as a major cause of cognitive impairment in AD. Moreover, the induction of neurogenesis by targeting endogenous neural stem cells (NSCs) is considered as one of the most promising treatment strategies. Our previous studies demonstrated that selenomethionine (Se-Met) was able to reduce β-amyloid peptide (Aβ) deposition, decrease Tau protein hyperphosphorylation and markedly improve cognitive functions in triple transgenic (3xTg) AD mice. In this study, we reported that the therapeutic effect of Se-Met on AD could also be due to neurogenesis modulation. By using the cultured hippocampal NSCs from 3xTg AD mice, we discovered that Se-Met (1-10 μM) with low concentration could promote NSC proliferation, while the one with a high concentration (50,100 μM) inhibiting proliferation. In subsequent studies, we also found that Se-Met activated the signaling pathway of PI3K/Akt, and thereby inhibited the GSK3β activity, which would further activated the β-catenin/Cyclin-D signaling pathway and promote NSC proliferation. Besides, after the induction of Se-Met, the number of neurons differentiated from NSCs significantly increased, and the number of astrocytes decreased. After a 90-day treatment with Se-Met (6 μg/mL), the number of hippocampal neurons in 4-month-old AD mice increased significantly, while the one of astrocyte saw a sharp drop. Thus, Se-Met treatment promoted NSCs differentiation into neurons, and subsequently repaired damaged neural systems in AD mice. Being consistent with our in vitro studies, Se-Met acts through the PI3K-Akt- GSK3β-Wnt signaling pathway in vivo. This study provides an unparalleled evidence that selenium (Se) compounds are, to some extent, effective in
DEFF Research Database (Denmark)
Skov, J.; Gaudin, M.; Podbevsek, P.
2012-01-01
In brome mosaic virus, both the replication of the genomic (+)-RNA strands and the transcription of the subgenomic RNA are carried out by the viral replicase. The production of (-)-RNA strands is dependent on the formation of an AUA triloop in the stem-loop C (SLC) hairpin in the 3'-untranslated...... region of the (+)-RNA strands. Two alternate hypotheses have been put forward for the mechanism of subgenomic RNA transcription. One posits that transcription commences by recognition of at least four key nucleotides in the subgenomic promoter by the replicase. The other posits that subgenomic...... transcription starts by binding of the replicase to a hairpin formed by the subgenomic promoter that resembles the minus strand promoter hairpin SLC. In this study, we have determined the three-dimensional structure of the subgenomic promoter hairpin using NMR spectroscopy. The data show that the hairpin...
Osman, Toba A M; Olsthoorn, René C L; Livieratos, Ioannis C
2014-09-22
Pepino mosaic virus (PepMV) is a mechanically-transmitted positive-strand RNA potexvirus, with a 6410 nt long single-stranded (ss) RNA genome flanked by a 5'-methylguanosine cap and a 3' poly-A tail. Computer-assisted folding of the 64 nt long PepMV 3'-untranslated region (UTR) resulted in the prediction of three stem-loop structures (hp1, hp2, and hp3 in the 3'-5' direction). The importance of these structures and/or sequences for promotion of negative-strand RNA synthesis and binding to the RNA dependent RNA polymerase (RdRp) was tested in vitro using a specific RdRp assay. Hp1, which is highly variable among different PepMV isolates, appeared dispensable for negative-strand synthesis. Hp2, which is characterized by a large U-rich loop, tolerated base-pair changes in its stem as long as they maintained the stem integrity but was very sensitive to changes in the U-rich loop. Hp3, which harbours the conserved potexvirus ACUUAA hexamer motif, was essential for template activity. Template-RNA polymerase binding competition experiments showed that the ACUUAA sequence represents a high-affinity RdRp binding element. Copyright © 2014 Elsevier B.V. All rights reserved.
Ignatieva, Elena V; Levitsky, Victor G; Yudin, Nikolay S; Moshkin, Mikhail P; Kolchanov, Nikolay A
2014-01-01
The molecular mechanism of olfactory cognition is very complicated. Olfactory cognition is initiated by olfactory receptor proteins (odorant receptors), which are activated by olfactory stimuli (ligands). Olfactory receptors are the initial player in the signal transduction cascade producing a nerve impulse, which is transmitted to the brain. The sensitivity to a particular ligand depends on the expression level of multiple proteins involved in the process of olfactory cognition: olfactory receptor proteins, proteins that participate in signal transduction cascade, etc. The expression level of each gene is controlled by its regulatory regions, and especially, by the promoter [a region of DNA about 100-1000 base pairs long located upstream of the transcription start site (TSS)]. We analyzed single nucleotide polymorphisms using human whole-genome data from the 1000 Genomes Project and revealed an extremely high level of single nucleotide polymorphisms in promoter regions of olfactory receptor genes and HLA genes. We hypothesized that the high level of polymorphisms in olfactory receptor promoters was responsible for the diversity in regulatory mechanisms controlling the expression levels of olfactory receptor proteins. Such diversity of regulatory mechanisms may cause the great variability of olfactory cognition of numerous environmental olfactory stimuli perceived by human beings (air pollutants, human body odors, odors in culinary etc.). In turn, this variability may provide a wide range of emotional and behavioral reactions related to the vast variety of olfactory stimuli.
Regulatory elements in the promoter region of the rat gene encoding the acyl-CoA-binding protein
DEFF Research Database (Denmark)
Elholm, M; Bjerking, G; Knudsen, J
1996-01-01
for the ACBP DR-1 element. Addition of peroxisome proliferators (PP) to H4IIEC3 rat hepatoma cells led to an increase in the ACBP mRNA level, indicating that the DR-1 element could be a functional peroxisome proliferator responsive element (PPRE). Analysis of the ACBP promoter by transient transfection showed...
International Nuclear Information System (INIS)
Filippov, G.F.; Vasilevsky, V.S.; Kovalenko, T.P.
1984-01-01
The reaction of 4 He electrodisintegration at small momenta transfered to the nucleus by electrons is considered on the basis of an algebraic version of the resonating group method. The calculated matrix element of the monopole transition from the ground state of 4 He into the O + -resonance state and the calculated monopole energy weighted sum rules confirm the assumption on the cluster nature of O + -resonance. In the dipole approximation the photonuclear reaction of 4 He(γ, n)He 3 at small energies of γ-quanta is studied. The obtained values of the electric dipole transition probabilities and the effective cross sections reveal a good agreement with experimental data
Song, Shaoqing; Meng, Aiyun; Jiang, Shujuan; Cheng, Bei
2018-06-01
The effective transport of photo-induced carriers over semiconductor photocatalyst is critical for enhancing the photocatalytic performance under light excitation. Although oxidized graphene (GO) and/or reduced graphene oxide (rGO) has been used as cocatalyst to promote the transfer and utilization of electrons, however, random diffusion and transfer of photo-induced charges are inevitable from all sides over these actual graphene owing to the limitation of the preparation process and theory. Herein, we utilized three-dimensional hollow carbon graphene (HCG) to promote the efficient electron transfer of Ag3PO4 in the photocatalytic process. Owing to the confinement-induced electron field of HCG, the constructed HCG-Ag3PO4 photocatalytic system demonstrated the enhanced visible-light adsorption, improved transfer of photo-induced charges, and suitable redox potentials as revealed by transient photo-current spectroscopic, surface photovoltage spectroscopy, and electron paramagnetic resonance (EPR). EPR spectra of oxygen species and gas chromatography-mass spectra exhibited high efficiency activity over HCG-Ag3PO4 with Z-scheme photocatalytic mechanism for phenol decomposition by reaction between hexanoic acid and radOH and radO2-. It is noteworthy that photocatalytic performance over optimal HCG-Ag3PO4 is 6, 3.43, 1.92 times of pristine Ag3PO4, GO-Ag3PO4, and rGO-Ag3PO4, respectively. The results may supply a novel perspective to enhance transfer of photo-induced charges for the promotion of photocatalytic technology.
Effect of span length and temperature on the 3-D confined flow around a vortex promoter
International Nuclear Information System (INIS)
Martin, E.; Velazquez, A.
2011-01-01
Highlights: ► The article deals with study of vortex promoter flow in a 3-D micro-channel. ► Aspects studied are: channel aspect ratio and prism surface temperature. ► Flow is classified into three different regimes depending on different parameters. ► Results could be used for practical engineering design purposes. - Abstract: This article presents a numerical study on the influence of span length and wall temperature on the 3-D flow pattern around a square section vortex promoter located inside a micro-channel in the low Reynolds number regime. The first objective of the work is to quantify the critical Reynolds number that defines the onset of vortex shedding and to identify the different regimes that appear as a function of the channel aspect ratio (span to height ratio). We found that the critical Reynolds number for the onset of the Karman street regime increases as the aspect ratio decreases. In particular, for the aspect ratio of 1/2 the critical Reynolds number is nearly six times the critical Reynolds number of the 2-D problem. An intermediate oscillating regime between the steady and the Karman street solutions was also found to exist within a rather wide range of Reynolds numbers for small channel aspect ratios. The second objective was to investigate the influence of the vortex promoter wall temperature on both vortex shedding and flow pattern. This has practical engineering implications because the working fluid considered in the article is water that has a viscosity that depends significantly on temperature and promotes a strong coupling between the momentum and energy equations that influences the system behaviour. Results indicate that high surface temperature on the prism promotes the onset of the Karman street, suggesting design guidelines for micro-channel based heat sinks that make use of vortex promoters.
Directory of Open Access Journals (Sweden)
Marwa H. Saied
2018-04-01
Full Text Available Background: DNA methylation is the commonest known epigenetic change that results in silencing of tumor suppressor genes. Promoter methylation of tumor suppressor genes has the potential for early detection of breast cancer. Aim: Aim is to examine the potential usefulness of blood based methylation specific polymerase chain reaction (MSP of methylated DKK3 and RASSF1A genes in early detection of breast cancer. Method: Methylation status of DKK3 and RASSF1 was investigated in forty breast cancer patients, twenty fibroadenoma patients and twenty healthy ladies as control group using MSP. Results: Methylation of DKK3 promoter was found in 22.5% of breast cancer patients, while DKK3 methylation was absent in both fibroadenoma patients and control group. Similarly, methylation of RASSF1 promoter was found in 17.5% of breast cancer patients and in none of fibroadenoma and control group. Conclusion: Promoter methylation of DKK3 and RASSF1 was found in breast cancer patients while absent in control group suggesting that tumorspecific methylation of the two genes (DKK3 and RASSF1A might be a valuable biomarker for the early detection of breast cancer. Keywords: DNA methylation, Breast cancer, DKK3, RASSF1
Overexpression of p42.3 promotes cell growth and tumorigenicity in hepatocellular carcinoma
Sun, Wei; Dong, Wei-Wei; Mao, Lin-Lin; Li, Wen-Mei; Cui, Jian-Tao; Xing, Rui; Lu, You-Yong
2013-01-01
AIM: To investigate the association of p42.3 expression with clinicopathological characteristics and the biological function of p42.3 in human hepatocellular carcinoma (HCC). METHODS: We used reverse transcription-polymerase chain reaction (RT-PCR), quantitative real-time RT-PCR and western blotting to detect p42.3 mRNA and protein expression in hepatic cell lines. We examined primary HCC samples and matched adjacent normal tissue by immunohistochemistry to investigate the correlation between p42.3 expression and clinicopathological features. HepG2 cells were transfected with a pIRES2-EGFP-p42.3 expression vector to examine the function of the p42.3 gene. Transfected cells were analyzed for their viability and malignant transformation abilities by 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide assay, colony formation assay, and tumorigenicity assay in nude mice. RESULTS: p42.3 is differentially expressed in primary HCC tumors and cell lines. Approximately 69.6% (96/138) of cells were p42.3-positive in hepatic tumor tissues, while 30.7% (35/114) were p42.3-positive in tumor-adjacent normal tissues. Clinicopathological characteristics of the HCC specimens revealed a significant correlation between p42.3 expression and tumor differentiation (P = 0.031). However, p42.3 positivity was not related to tumor tumor-node-metastasis classification, hepatitis B virus status, or hepatoma type. Regarding p42.3 overexpression in stably transfected HepG2 cells, we discovered significant enhancement of cancer cell growth and colony formation in vitro, and significantly enhanced tumorigenicity in nude mice. Western blot analysis of cell cycle proteins revealed that enhanced p42.3 levels promote upregulation of proliferating cell nuclear antigen, cyclin B1 and mitotic arrest deficient 2. CONCLUSION: p42.3 promotes tumorigenicity and tumor growth in HCC and may be a potential target for future clinical cancer therapeutics. PMID:23704824
Directory of Open Access Journals (Sweden)
Devita Kusdianingrum
2014-10-01
Full Text Available ABSTRAK: Sekitar 8-20% isolate M. tuberculosis yang resisten terhadap isoniazid diketahui telah mengalami mutasi pada posisi regio promoter inhA [1]. Untuk memperoleh titik mutasi pada regio promoter, maka amplifikasi fragmen target perlu untuk dilakukan. Tujuan dilakukannya penelitian ini adalah untuk mengamplifikasi regio promoter inhA, mengetahui ada tidaknya mutasi dan jenis mutasi pada isolat 134 MDR-TB. Tahap isolasi DNA dilakukan menggunakan metode Boom yang telah dimodifikasi. Fragmen target diamplifikasi dengan teknik PCR menggunakan sepasang primer (forward primer 5’ ACATACCTGCTGCGCAAT 3’ dan reverse primer 5’ CTCCGGTAACCAGGACT GAA 3’. Amplikon disekuensing secara satu arah menggunakan forward primer. Analisis homologi dilakukan menggunakan program online BLASTn, sementara identifikasi mutasi dilakukan menggunakan software MEGA4. Hasil penelitian menunjukkan bahwa analisis homologi isolate 134 terhadap M. tuberculosis H37Rv adalah sebesar 99%. Tahap analisis mutasi menemukan terjadinya perubahan sitosin menjadi timin (CàT pada posisi -15 isolat 134 MDR-TB ABSTRACT: Approximately 8-20% M. tuberculosis isolates that are resistant to isoniazid habe been known to have a mutation in inhA promoter region [1]. To find the mutation in inhA promoter region, it is necessary to carry out the amplification of the target fragment. The purpose of this research were to amplify the inhA promoter region and to find out if there is a mutation and type of mutation at MDR-TB isolate. DNA isolation was done by a modified Boom method. Target fragment was amplified by a pair primer (forward primer 5’ ACATACCTGCTGCGCAAT 3’ and reverse primer 5’ CTCCGGTAACCAGGACT GAA 3’ using Polymerase Chain Reaction (PCR technique. Amplicon was sequenced in one forward direction. Homology analysis was conducted by online BLASTn program, while the mutation was identified by MEGA4. The result of this research showed that homology analysis of 134 was homolog
ID4 promotes AR expression and blocks tumorigenicity of PC3 prostate cancer cells
International Nuclear Information System (INIS)
Komaragiri, Shravan Kumar; Bostanthirige, Dhanushka H.; Morton, Derrick J.; Patel, Divya; Joshi, Jugal; Upadhyay, Sunil; Chaudhary, Jaideep
2016-01-01
Deregulation of tumor suppressor genes is associated with tumorigenesis and the development of cancer. In prostate cancer, ID4 is epigenetically silenced and acts as a tumor suppressor. In normal prostate epithelial cells, ID4 collaborates with androgen receptor (AR) and p53 to exert its tumor suppressor activity. Previous studies have shown that ID4 promotes tumor suppressive function of AR whereas loss of ID4 results in tumor promoter activity of AR. Previous study from our lab showed that ectopic ID4 expression in DU145 attenuates proliferation and promotes AR expression suggesting that ID4 dependent AR activity is tumor suppressive. In this study, we examined the effect of ectopic expression of ID4 on highly malignant prostate cancer cell, PC3. Here we show that stable overexpression of ID4 in PC3 cells leads to increased apoptosis and decreased cell proliferation and migration. In addition, in vivo studies showed a decrease in tumor size and volume of ID4 overexpressing PC3 cells, in nude mice. At the molecular level, these changes were associated with increased androgen receptor (AR), p21, and AR dependent FKBP51 expression. At the mechanistic level, ID4 may regulate the expression or function of AR through specific but yet unknown AR co-regulators that may determine the final outcome of AR function. - Highlights: • ID4 expression induces AR expression in PC3 cells, which generally lack AR. • ID4 expression increased apoptosis and decreased cell proliferation and invasion. • Overexpression of ID4 reduces tumor growth of subcutaneous xenografts in vivo. • ID4 induces p21 and FKBP51 expression- co-factors of AR tumor suppressor activity.
ID4 promotes AR expression and blocks tumorigenicity of PC3 prostate cancer cells
Energy Technology Data Exchange (ETDEWEB)
Komaragiri, Shravan Kumar; Bostanthirige, Dhanushka H.; Morton, Derrick J.; Patel, Divya; Joshi, Jugal; Upadhyay, Sunil; Chaudhary, Jaideep, E-mail: jchaudhary@cau.edu
2016-09-09
Deregulation of tumor suppressor genes is associated with tumorigenesis and the development of cancer. In prostate cancer, ID4 is epigenetically silenced and acts as a tumor suppressor. In normal prostate epithelial cells, ID4 collaborates with androgen receptor (AR) and p53 to exert its tumor suppressor activity. Previous studies have shown that ID4 promotes tumor suppressive function of AR whereas loss of ID4 results in tumor promoter activity of AR. Previous study from our lab showed that ectopic ID4 expression in DU145 attenuates proliferation and promotes AR expression suggesting that ID4 dependent AR activity is tumor suppressive. In this study, we examined the effect of ectopic expression of ID4 on highly malignant prostate cancer cell, PC3. Here we show that stable overexpression of ID4 in PC3 cells leads to increased apoptosis and decreased cell proliferation and migration. In addition, in vivo studies showed a decrease in tumor size and volume of ID4 overexpressing PC3 cells, in nude mice. At the molecular level, these changes were associated with increased androgen receptor (AR), p21, and AR dependent FKBP51 expression. At the mechanistic level, ID4 may regulate the expression or function of AR through specific but yet unknown AR co-regulators that may determine the final outcome of AR function. - Highlights: • ID4 expression induces AR expression in PC3 cells, which generally lack AR. • ID4 expression increased apoptosis and decreased cell proliferation and invasion. • Overexpression of ID4 reduces tumor growth of subcutaneous xenografts in vivo. • ID4 induces p21 and FKBP51 expression- co-factors of AR tumor suppressor activity.
Alterations in HIV-1 LTR promoter activity during AIDS progression
International Nuclear Information System (INIS)
Hiebenthal-Millow, Kirsten; Greenough, Thomas C.; Bretttler, Doreen B.; Schindler, Michael; Wildum, Steffen; Sullivan, John L.; Kirchhoff, Frank
2003-01-01
HIV-1 variants evolving in AIDS patients frequently show increased replicative capacity compared to those present during early asymptomatic infection. It is known that late stage HIV-1 variants often show an expanded coreceptor tropism and altered Nef function. In the present study we investigated whether enhanced HIV-1 LTR promoter activity might also evolve during disease progression. Our results demonstrate increased LTR promoter activity after AIDS progression in 3 of 12 HIV-1-infected individuals studied. Further analysis revealed that multiple alterations in the U3 core-enhancer and in the transactivation-response (TAR) region seem to be responsible for the enhanced functional activity. Our findings show that in a subset of HIV-1-infected individuals enhanced LTR transcription contributes to the increased replicative potential of late stage virus isolates and might accelerate disease progression
Evaluation of Inland Maritime Use of LNG in UTC Region 3
2015-07-31
This work assesses the characteristics of the market for natural gas and alternative vehicles within Region 3 and explores applications to inland maritime within the region. This work includes a summary of existing research outlining the market condi...
Coxsackievirus B3 2A protease promotes encephalomyocarditis virus replication.
Song, Qin-Qin; Lu, Ming-Zhi; Song, Juan; Chi, Miao-Miao; Sheng, Lin-Jun; Yu, Jie; Luo, Xiao-Nuan; Zhang, Lu; Yao, Hai-Lan; Han, Jun
2015-10-02
To determine whether 2A protease of the enterovirus genus with type I internal ribosome entry site (IRES) effect on the viral replication of type II IRES, coxsackievirus B3(CVB3)-encoded protease 2A and encephalomyocarditis virus (EMCV) IRES (Type II)-dependent or cap-dependent report gene were transiently co-expressed in eukaryotic cells. We found that CVB3 2A protease not only inhibited translation of cap-dependent reporter genes through the cleavage of eIF4GI, but also conferred high EMCV IRES-dependent translation ability and promoted EMCV replication. Moreover, deletions of short motif (aa13-18 RVVNRH, aa65-70 KNKHYP, or aa88-93 PRRYQSH) resembling the nuclear localization signals (NLS) or COOH-terminal acidic amino acid motif (aa133-147 DIRDLLWLEDDAMEQ) of CVB3 2A protease decreased both its EMCV IRES-dependent translation efficiency and destroy its cleavage on eukaryotic initiation factor 4G (eIF4G) I. Our results may provide better understanding into more effective interventions and treatments for co-infection of viral diseases. Copyright © 2015 Elsevier B.V. All rights reserved.
DNA methylation of PTEN gene promoter region is not correlated ...
African Journals Online (AJOL)
Tumor suppressor gene PTEN plays an important role in cell cycle. Disorder of PTEN protein can cause cell growth and division in an uncontrolled way, which can lead to the formation of tumors. It has been proven that epigenetic mechanisms, such as promoter hypermethylation, may account for inactivation of PTEN in a ...
Yang, Xiyue; Wang, Jing; Zhou, Zewei; Jiang, Rong; Huang, Jie; Chen, Lulu; Cao, Zhouli; Chu, Han; Han, Bing; Cheng, Yusi; Chao, Jie
2018-01-22
Phagocytosis of silicon dioxide (SiO 2 ) into lung cells causes an inflammatory cascade that results in fibroblast proliferation and migration, followed by fibrosis. Circular RNAs (circRNAs) are a subclass of noncoding RNAs that are present within mammalian cells; however, researchers have not determined whether circRNAs are involved in the pathophysiologic process of silicosis. To elucidate the role of these RNAs in SiO 2 -induced inflammation in pulmonary macrophages, we investigated the upstream molecular mechanisms and functional effects of circRNAs on cell apoptosis, proliferation, and migration. Primary cultures of alveolar macrophages from healthy donors and from patients and the RAW264.7 macrophage cell line were used to explore the functions of circZC3H4 RNA in macrophage activation. The experimental results indicated the following: 1) SiO 2 concomitantly increased circZC3H4 RNA expression and increased ZC3H4 protein levels; 2) circular ZC3H4 (circZC3H4) RNA and ZC3H4 protein participated in SiO 2 -induced macrophage activation; and 3) SiO 2 -activated macrophages promoted fibroblast proliferation and migration via the circZC3H4 RNA/ZC3H4 pathway. The up-regulation of the ZC3H4 protein was confirmed in tissue samples from patients with silicosis. Our study elucidates a link between SiO 2 -induced macrophage activation and the circZC3H4 RNA/ZC3H4 pathway, thereby providing novel insight into the potential use of ZC3H4 to develop novel therapeutic strategies for silicosis.-Yang, X., Wang, J., Zhou, Z., Jiang, R., Huang, J., Chen, L., Cao, Z., Chu, H., Han, B., Cheng, Y., Chao, J. Silica-induced initiation of circular ZC3H4 RNA/ZC3H4 pathway promotes the pulmonary macrophage activation.
Directory of Open Access Journals (Sweden)
Pekevski Siniša
2008-01-01
Full Text Available Taking an attention to promotion as operational variable in marketing effort, author focused on so called ways of creating national images. As a case of very interesting activity paper discuss an experience of regional chamber of Croatia with activities in upgrading international recognition of national products as well as country as destination in such context.
South Asia Water Resources Workshop: An effort to promote water quality data sharing in South Asia
Energy Technology Data Exchange (ETDEWEB)
RAJEN,GAURAV; BIRINGER,KENT L.; BETSILL,J. DAVID
2000-04-01
To promote cooperation in South Asia on environmental research, an international working group comprised of participants from Bangladesh, India, Nepal, Pakistan, Sri Lanka, and the US convened at the Soaltee Hotel in Kathmandu, Nepal, September 12 to 14, 1999. The workshop was sponsored in part by the Cooperative Monitoring Center (CMC) at Sandia National Laboratories in Albuquerque, New Mexico, through funding provided by the Department of Energy (DOE) Office of Nonproliferation and National Security. The CMC promotes collaborations among scientists and researchers in regions throughout the world as a means of achieving common regional security objectives. In the long term, the workshop organizers and participants are interested in the significance of regional information sharing as a means to build confidence and reduce conflict. The intermediate interests of the group focus on activities that might eventually foster regional management of some aspects of water resources utilization. The immediate purpose of the workshop was to begin the implementation phase of a project to collect and share water quality information at a number of river and coastal estuary locations throughout the region. The workshop participants achieved four objectives: (1) gaining a better understanding of the partner organizations involved; (2) garnering the support of existing regional organizations promoting environmental cooperation in South Asia; (3) identifying sites within the region at which data is to be collected; and (4) instituting a data and information collection and sharing process.
Efficient 3D multi-region prostate MRI segmentation using dual optimization.
Qiu, Wu; Yuan, Jing; Ukwatta, Eranga; Sun, Yue; Rajchl, Martin; Fenster, Aaron
2013-01-01
Efficient and accurate extraction of the prostate, in particular its clinically meaningful sub-regions from 3D MR images, is of great interest in image-guided prostate interventions and diagnosis of prostate cancer. In this work, we propose a novel multi-region segmentation approach to simultaneously locating the boundaries of the prostate and its two major sub-regions: the central gland and the peripheral zone. The proposed method utilizes the prior knowledge of the spatial region consistency and employs a customized prostate appearance model to simultaneously segment multiple clinically meaningful regions. We solve the resulted challenging combinatorial optimization problem by means of convex relaxation, for which we introduce a novel spatially continuous flow-maximization model and demonstrate its duality to the investigated convex relaxed optimization problem with the region consistency constraint. Moreover, the proposed continuous max-flow model naturally leads to a new and efficient continuous max-flow based algorithm, which enjoys great advantages in numerics and can be readily implemented on GPUs. Experiments using 15 T2-weighted 3D prostate MR images, by inter- and intra-operator variability, demonstrate the promising performance of the proposed approach.
Smith, Alias J; Chudnovsky, Lorissa; Simoes-Barbosa, Augusto; Delgadillo-Correa, Maria G; Jonsson, Zophonias O; Wohlschlegel, James A; Johnson, Patricia J
2011-04-01
A highly conserved DNA initiator (Inr) element has been the only core promoter element described in the divergent unicellular eukaryote Trichomonas vaginalis, although genome analyses reveal that only ∼75% of protein-coding genes appear to contain an Inr. In search of another core promoter element(s), a nonredundant database containing 5' untranslated regions of expressed T. vaginalis genes was searched for overrepresented DNA motifs and known eukaryotic core promoter elements. In addition to identifying the Inr, two elements that lack sequence similarity to the known protein-coding gene core promoter, motif 3 (M3) and motif 5 (M5), were identified. Mutational and functional analyses demonstrate that both are novel core promoter elements. M3 [(A/G/T)(A/G)C(G/C)G(T/C)T(T/A/G)] resembles a Myb recognition element (MRE) and is bound specifically by a unique protein with a Myb-like DNA binding domain. The M5 element (CCTTT) overlaps the transcription start site and replaces the Inr as an alternative, gene-specific initiator element. Transcription specifically initiates at the second cytosine within M5, in contrast to characteristic initiation by RNA polymerase II at an adenosine. In promoters that combine M3 with either M5 or Inr, transcription initiation is regulated by the M3 motif.
Smith, Alias J.; Chudnovsky, Lorissa; Simoes-Barbosa, Augusto; Delgadillo-Correa, Maria G.; Jonsson, Zophonias O.; Wohlschlegel, James A.; Johnson, Patricia J.
2011-01-01
A highly conserved DNA initiator (Inr) element has been the only core promoter element described in the divergent unicellular eukaryote Trichomonas vaginalis, although genome analyses reveal that only ∼75% of protein-coding genes appear to contain an Inr. In search of another core promoter element(s), a nonredundant database containing 5′ untranslated regions of expressed T. vaginalis genes was searched for overrepresented DNA motifs and known eukaryotic core promoter elements. In addition to identifying the Inr, two elements that lack sequence similarity to the known protein-coding gene core promoter, motif 3 (M3) and motif 5 (M5), were identified. Mutational and functional analyses demonstrate that both are novel core promoter elements. M3 [(A/G/T)(A/G)C(G/C)G(T/C)T(T/A/G)] resembles a Myb recognition element (MRE) and is bound specifically by a unique protein with a Myb-like DNA binding domain. The M5 element (CCTTT) overlaps the transcription start site and replaces the Inr as an alternative, gene-specific initiator element. Transcription specifically initiates at the second cytosine within M5, in contrast to characteristic initiation by RNA polymerase II at an adenosine. In promoters that combine M3 with either M5 or Inr, transcription initiation is regulated by the M3 motif. PMID:21245378
Oct3/4 directly regulates expression of E2F3a in mouse embryonic stem cells
International Nuclear Information System (INIS)
Kanai, Dai; Ueda, Atsushi; Akagi, Tadayuki; Yokota, Takashi; Koide, Hiroshi
2015-01-01
Embryonic stem (ES) cells, derived from the inner cell mass of blastocysts, have a characteristic cell cycle with truncated G1 and G2 phases. Recent findings that suppression of Oct3/4 expression results in a reduced proliferation rate of ES cells suggest the involvement of Oct3/4 in the regulation of ES cell growth, although the underlying molecular mechanism remains unclear. In the present study, we identified E2F3a as a direct target gene of Oct3/4 in ES cells. Oct3/4 directly bound to the promoter region of the E2F3a gene and positively regulated expression of E2F3a in mouse ES cells. Suppression of E2F3a activity by E2F6 overexpression led to the reduced proliferation in ES cells, which was relieved by co-expression of E2F3a. Furthermore, cell growth retardation caused by loss of Oct3/4 was rescued by E2F3a expression. These results suggest that Oct3/4 upregulates E2F3a expression to promote ES cell growth. - Highlights: • Oct3/4 positively regulates E2F3a expression in ES cells. • Oct3/4 binds to the promoter region of the E2F3a gene. • Overexpression of E2F6, an inhibitor of E2F3a, reduces ES cell growth. • E2F3a recovers growth retardation of ES cells caused by Oct3/4 reduction
Oct3/4 directly regulates expression of E2F3a in mouse embryonic stem cells
Energy Technology Data Exchange (ETDEWEB)
Kanai, Dai; Ueda, Atsushi; Akagi, Tadayuki; Yokota, Takashi; Koide, Hiroshi, E-mail: hkoide@med.kanazawa-u.ac.jp
2015-04-10
Embryonic stem (ES) cells, derived from the inner cell mass of blastocysts, have a characteristic cell cycle with truncated G1 and G2 phases. Recent findings that suppression of Oct3/4 expression results in a reduced proliferation rate of ES cells suggest the involvement of Oct3/4 in the regulation of ES cell growth, although the underlying molecular mechanism remains unclear. In the present study, we identified E2F3a as a direct target gene of Oct3/4 in ES cells. Oct3/4 directly bound to the promoter region of the E2F3a gene and positively regulated expression of E2F3a in mouse ES cells. Suppression of E2F3a activity by E2F6 overexpression led to the reduced proliferation in ES cells, which was relieved by co-expression of E2F3a. Furthermore, cell growth retardation caused by loss of Oct3/4 was rescued by E2F3a expression. These results suggest that Oct3/4 upregulates E2F3a expression to promote ES cell growth. - Highlights: • Oct3/4 positively regulates E2F3a expression in ES cells. • Oct3/4 binds to the promoter region of the E2F3a gene. • Overexpression of E2F6, an inhibitor of E2F3a, reduces ES cell growth. • E2F3a recovers growth retardation of ES cells caused by Oct3/4 reduction.
Comparative analyses of bidirectional promoters in vertebrates
Directory of Open Access Journals (Sweden)
Taylor James
2008-05-01
Full Text Available Abstract Background Orthologous genes with deep phylogenetic histories are likely to retain similar regulatory features. In this report we utilize orthology assignments for pairs of genes co-regulated by bidirectional promoters to map the ancestral history of the promoter regions. Results Our mapping of bidirectional promoters from humans to fish shows that many such promoters emerged after the divergence of chickens and fish. Furthermore, annotations of promoters in deep phylogenies enable detection of missing data or assembly problems present in higher vertebrates. The functional importance of bidirectional promoters is indicated by selective pressure to maintain the arrangement of genes regulated by the promoter over long evolutionary time spans. Characteristics unique to bidirectional promoters are further elucidated using a technique for unsupervised classification, known as ESPERR. Conclusion Results of these analyses will aid in our understanding of the evolution of bidirectional promoters, including whether the regulation of two genes evolved as a consequence of their proximity or if function dictated their co-regulation.
Umarov, Ramzan
2017-02-03
Accurate computational identification of promoters remains a challenge as these key DNA regulatory regions have variable structures composed of functional motifs that provide gene-specific initiation of transcription. In this paper we utilize Convolutional Neural Networks (CNN) to analyze sequence characteristics of prokaryotic and eukaryotic promoters and build their predictive models. We trained a similar CNN architecture on promoters of five distant organisms: human, mouse, plant (Arabidopsis), and two bacteria (Escherichia coli and Bacillus subtilis). We found that CNN trained on sigma70 subclass of Escherichia coli promoter gives an excellent classification of promoters and non-promoter sequences (Sn = 0.90, Sp = 0.96, CC = 0.84). The Bacillus subtilis promoters identification CNN model achieves Sn = 0.91, Sp = 0.95, and CC = 0.86. For human, mouse and Arabidopsis promoters we employed CNNs for identification of two well-known promoter classes (TATA and non-TATA promoters). CNN models nicely recognize these complex functional regions. For human promoters Sn/Sp/CC accuracy of prediction reached 0.95/0.98/0,90 on TATA and 0.90/0.98/0.89 for non-TATA promoter sequences, respectively. For Arabidopsis we observed Sn/Sp/CC 0.95/0.97/0.91 (TATA) and 0.94/0.94/0.86 (non-TATA) promoters. Thus, the developed CNN models, implemented in CNNProm program, demonstrated the ability of deep learning approach to grasp complex promoter sequence characteristics and achieve significantly higher accuracy compared to the previously developed promoter prediction programs. We also propose random substitution procedure to discover positionally conserved promoter functional elements. As the suggested approach does not require knowledge of any specific promoter features, it can be easily extended to identify promoters and other complex functional regions in sequences of many other and especially newly sequenced genomes. The CNNProm program is available to run at web server http://www.softberry.com.
Genome-wide analysis of promoter architecture in Drosophila melanogaster
Energy Technology Data Exchange (ETDEWEB)
Hoskins, Roger A.; Landolin, Jane M.; Brown, James B.; Sandler, Jeremy E.; Takahashi, Hazuki; Lassmann, Timo; Yu, Charles; Booth, Benjamin W.; Zhang, Dayu; Wan, Kenneth H.; Yang, Li; Boley, Nathan; Andrews, Justen; Kaufman, Thomas C.; Graveley, Brenton R.; Bickel, Peter J.; Carninci, Piero; Carlson, Joseph W.; Celniker, Susan E.
2010-10-20
Core promoters are critical regions for gene regulation in higher eukaryotes. However, the boundaries of promoter regions, the relative rates of initiation at the transcription start sites (TSSs) distributed within them, and the functional significance of promoter architecture remain poorly understood. We produced a high-resolution map of promoters active in the Drosophila melanogaster embryo by integrating data from three independent and complementary methods: 21 million cap analysis of gene expression (CAGE) tags, 1.2 million RNA ligase mediated rapid amplification of cDNA ends (RLMRACE) reads, and 50,000 cap-trapped expressed sequence tags (ESTs). We defined 12,454 promoters of 8037 genes. Our analysis indicates that, due to non-promoter-associated RNA background signal, previous studies have likely overestimated the number of promoter-associated CAGE clusters by fivefold. We show that TSS distributions form a complex continuum of shapes, and that promoters active in the embryo and adult have highly similar shapes in 95% of cases. This suggests that these distributions are generally determined by static elements such as local DNA sequence and are not modulated by dynamic signals such as histone modifications. Transcription factor binding motifs are differentially enriched as a function of promoter shape, and peaked promoter shape is correlated with both temporal and spatial regulation of gene expression. Our results contribute to the emerging view that core promoters are functionally diverse and control patterning of gene expression in Drosophila and mammals.
Characterization and sequence analysis of the F2 promoter from corynephage BFK20
International Nuclear Information System (INIS)
Koptides, M.; Ugorcakova, J.; Baloghova, E.; Bukovska, G.; Timko, J.
1994-01-01
F2 promoter from corynephage BFK20 was isolated and characterized. It was functional in Escherichia coli and Corynebacterium glutamicum. Cloning of the F2 promoter into the pJUP05 promoter probe vector caused an increase of the neomycin phosphotransferase II specific activity. According to the Northern blot hybridization the nptII gene was expressed from the cloned F2 promoter. The apparent transcription start point in E. coli and C. glutamicum was determined. The-35 region of F2 promoter showed high similarity to that of E. coli promoter consensus sequence, but its - 10 region was G+C rich and had no significant homology to that. (author)
Energy Technology Data Exchange (ETDEWEB)
Bizer, Kilian; Bossmeyer, Christoph
2012-07-01
Actually, there is a controversial public discussion on the exploitation of conventional natural gas by means of hydraulic fracturing (Fracking). The contribution under consideration examines the geologic, toxicological or technical as well as legal points of contact with respect to the different effects for the actor groups. Based on the existing scientific realizations, the regional economic effects of the fracking technology and the subsequent promotion of unconventional natural gas deposits have to be worked out.
International Nuclear Information System (INIS)
Ove, R.; Swift, A.; Kransnykh, V.N.; Nettelbeck, D.M.; Yamamato, M.; Curiel, D.T.
2003-01-01
CRAds are currently being evaluated for possible use with concurrent prostate radiotherapy/brachytherapy. Viruses with tissue specific promoters governing the viral E1A region exist for Cox-2 [Yamamato] and Flt-1 Tyr[Nettelbeck], and a PSMA (prostate specific membrane antigen) promoter and promoter/enhancer CRAd is being developed. PSMA is promising in that it is very specific to prostate cancer. We evaluated replication deficient Cox-2 and PSMA luciferase reporter viruses (Ad-Cox2-luc and Ad-PSMA-luc/ RGD) with and without 3Gy radiation. The Ad-PSMA-luc/RGD genome contains an RGD fiber knob modification, to allow infection via integrin interaction (bypassing CAR). Cell lines used were the prostate cell lines PC3 (PSMA-) and LNCaP (PSMA+), the breast line BT474 (Cox2-), and immortalized human hepatocytes (THLE-3). Cells were radiated 1 hour before viral infection, and assayed 48-hours after infection. Luciferase activity was assayed per total cellular protein of the surviving cells. Ad-PSMA-luc was negative in BT474, THLE3, and PC3, but showed increased expression in LNCaP. Radiation moderately increased expression. Ad-Cox2-luc was positive in all four lines. Radiation led to slightly lower promoter activity in BT474 and PC3, 2-fold lower expression in LNCaP, and a slight increase in THLE3. A control reporter virus (Ad-CMV-luc) was strongly positive for all lines except BT474, which was negative. Radiation had no affect on CMV promoter activity. Comparison PSMA promoter and PSMA promoter/enhancer plasmids showed a 60-fold increase with the addition of the enhancer (50 times the SV40 promoter/enhancer). The enhancer led to only 2-fold increase in Du145 (PSMA-). The PSMA reporter virus (Ad-PSMA-luc) showed selective activity in PSMA positive cells. Moderate enhancement is seen with low dose radiation, but not with Ad-Cox2-luc. The PSMA promoter and promoter/enhancer are promising in the CRAd context. Timing and dose of irradiation needs to be explored further
Directory of Open Access Journals (Sweden)
Eva\tDHIMITRI
2015-12-01
Full Text Available Local governance is a broad concept and is defined as the formulation and execution of collective action at the local level. The purpose of local government is to ensure effective and efficient use of public resources and service delivery at the level closest to citizens. Regional development is a new concept that aims to stimulate and diversify the economic activity of a country (region, to encourage investment in the private sector, to create a new jobs vacancy and improves living standards of the country. Regional development policies are a number of measures designed and promoted by the central and local administration, but the cooperation undertaken at the actors are in a different one, which included the private sector and civil society. At the center of these regional policies or practices is the use of efficient potential of each region, being particularly focused on business, means promoting the development of the new enterprises, promoting labor market and investment, improve the quality of environment, health , education and culture. Traditional objective of regional development policies is the reduction of territorial disparities for achieving a relative balance between economic and social levels of development in different areas in the national territory. Regional development is the actual task of local government units in Albania, and is one of the tasks and challenges of the future. Currently it takes a special importance in the context of European Union integration. Reforms have begun to change the system in 1990 in order to implement local democracy and decentralization principles that are present today. Inequalities that exist within the region and between them indicate that in some regions the economic potential is not being fully utilized, and that it reduces the overall performance in national level.
Bongiorni, Silvia; Tilesi, Francesca; Bicorgna, Silvia; Iacoponi, Francesca; Willems, Daniela; Gargani, Maria; D'Andrea, MariaSilvia; Pilla, Fabio; Valentini, Alessio
2014-11-07
Success of meat production and selection for improvement of meat quality is among the primary aims in animal production. Meat quality traits are economically important in swine; however, the underlying genetic nature is very complex. Therefore, an improved pork production strongly depends on identifying and studying how genetic variations contribute to modulate gene expression. Promoters are key regions in gene modulation as they harbour several binding motifs to transcription regulatory factors. Therefore, polymorphisms in these regions are likely to deeply affect RNA levels and consequently protein synthesis. In this study, we report the identification of single nucleotide polymorphisms (SNPs) in promoter regions of candidate genes involved in development, cellular differentiation and muscle growth in Sus scrofa. We identified SNPs in the promoter regions of genes belonging to the Myogenic Regulatory Factors (MRF) gene family (the Myogenic Differentiation gene, MYOD1) and to Growth and Differentiation Factors (GDF) gene family (Myostatin gene, MSTN, GDF8), in Casertana and Large White breeds. The purpose of this study was to investigate if polymorphisms in the promoters could affect the transcriptional activity of these genes. With this aim, we evaluated in vitro the functional activity of the luciferase reporter gene luc2 activity, driven by two constructs carrying different promoter haplotypes. We tested the effects of the G302A (U12574) transition on the promoter efficiency in MYOD1 gene. We ascertained a difference in transcription efficiency for the two variants. A stronger activity of the A-carrying construct is more evident in C2C12. The luciferase expression driven by the MYOD1-A allelic variant displayed a 3.8-fold increased transcriptional activity. We investigated the activity of two haplotype variants (AY527152) in the promoter of GDF8 gene. The haploptype-1 (A435-A447-A879) up-regulated the expression of the reporter gene by a two-fold increase, and
SNAP-25 in hippocampal CA3 region is required for long-term memory formation
International Nuclear Information System (INIS)
Hou Qiuling; Gao Xiang; Lu Qi; Zhang Xuehan; Tu Yanyang; Jin Meilei; Zhao Guoping; Yu Lei; Jing Naihe; Li Baoming
2006-01-01
SNAP-25 is a synaptosomal protein of 25 kDa, a key component of synaptic vesicle-docking/fusion machinery, and plays a critical role in exocytosis and neurotransmitter release. We previously reported that SNAP-25 in the hippocampal CA1 region is involved in consolidation of contextual fear memory and water-maze spatial memory (Hou et al. European J Neuroscience, 20: 1593-1603, 2004). SNAP-25 is expressed not only in the CA1 region, but also in the CA3 region, and the SNAP-25 mRNA level in the CA3 region is higher than in the CA1 region. Here, we provide evidence that SNAP-25 in the CA3 region is also involved in learning/memory. Intra-CA3 infusion of SNAP-25 antisense oligonucleotide impaired both long-term contextual fear memory and water-maze spatial memory, with short-term memory intact. Furthermore, the SNAP-25 antisense oligonucleotide suppressed the long-term potentiation (LTP) of field excitatory post-synaptic potential (fEPSP) in the mossy-fiber pathway (DG-CA3 pathway), with no effect on paired-pulse facilitation of the fEPSP. These results are consistent with the notion that SNAP-25 in the hippocampal CA3 region is required for long-term memory formation
C-peptide prevents SMAD3 binding to alpha promoters to inhibit collagen type IV synthesis.
Li, Yanning; Zhong, Yan; Gong, Wenjian; Gao, Xuehan; Qi, Huanli; Liu, Kun; Qi, Jinsheng
2018-07-01
Activation of transforming growth factor β1 (TGFB1)/SMAD3 signaling may lead to additional synthesis of collagen type IV (COL4), which is a major contributor to extracellular matrix (ECM) accumulation in diabetic nephropathy (DN). C-peptide can attenuate fibrosis to have unique beneficial effects in DN. However, whether and how C-peptide affects TGFB1/SMAD3-activated COL4 synthesis is unclear. In this study, pathological changes, expression of COL4 a1-a5 chains ( Col4a1-a5 ), COL4 distribution and protein and TGFB1 and SMAD3 protein were first assessed in a rat model of diabetes. Then, rat mesangial cells were treated with high glucose (HG) and/or C-peptide to investigate the underlying mechanism. Col4a1-a5 expression, COL4 protein and secretion, TGFB1 protein, SMAD3 nuclear translocation and binding of SMAD3 to its cognate sites in the promoters of Col4a1a2 , Col4a3a4 and Col4a5 were measured. It was found that C-peptide attenuated glomerular pathological changes and suppressed renal Col4a1 -a5 mRNA expression, COL4 protein content and TGFB1 protein content. C-peptide had a dose-dependent effect to inhibit Col4a1-a5 mRNA expression, COL4 protein content and secretion, in HG-stimulated mesangial cells. In addition, the HG-induced increase in TGFB1 protein content was significantly reduced by C-peptide. Although not apparently affecting SMAD3 nuclear translocation, C-peptide prevented SMAD3 from binding to its sites in the Col4a1a2 , Col4a3a4 and Col4a5 promoters in HG-stimulated mesangial cells. In conclusion, C-peptide could prevent SMAD3 from binding to its sites in the Col4a1a2 , Col4a3a4 and Col4a5 promoters, to inhibit COL4 generation. These results may provide a mechanism for the alleviation of fibrosis in DN by C-peptide. © 2018 Society for Endocrinology.
Wang, Jianru; Tian, Ye; Phillips, Kate L.E.; Chiverton, Neil; Haddock, Gail; Bunning, Rowena A.; Cross, Alison K.; Shapiro, Irving M.; LeMaitre, Christine L.; Risbud, Makarand V.
2012-01-01
Objective To investigate TNF-α and IL-1β regulation of CCL3 expression in nucleus pulposus (NP) cells and in macrophage migration. Methods qRT-PCR and immunohistochemistry were used to measure CCL3 expression in NP cells. Transfections were used to determine the role of NF-κB, C/EBP-β and MAPK on cytokine mediated CCL3 promoter activity. Effect of NP-conditioned medium on macrophage migration was measured using a transwell system. Results An increase in CCL3 expression and promoter activity was observed in NP cells after TNF-α or IL-1β treatment. Treatment of cells with NF-κB and MAPK inhibitors abolished the effect of the cytokines on CCL3 expression. The inductive effect of p65 and C/EBP-β on CCL3 promoter was confirmed through gain- and loss-of-function studies. Noteworthy, co-transfection of p50 completely blocked cytokine and p65 dependent induction. In contrast, c-Rel and RelB had little effect on promoter activity. Lentiviral transduction with Sh-p65 and Sh-Ikkβ significantly decreased TNF-α dependent increase in CCL3 expression. Analysis of degenerate human NP tissues showed that CCL3, but not CCL4 expression correlated positively with the grade of tissue degeneration. Importantly, treatment of macrophages with conditioned medium of NP cells treated with TNF-α or IL-1β promoted their migration; pretreatment of macrophages with antagonist to CCR1, primary receptor for CCL3 and CCL4, blocked cytokine mediated migration. Conclusions By controlling the activation of MAPK, NF-κB and C/EBPβ signaling, TNF-α and IL-1β modulate the expression of CCL3 in NP cells. The CCL3-CCR1 axis may play an important role in promoting macrophage infiltration in degenerate, herniated discs. PMID:23233369
Genomic organization and promoter cloning of the human X11α gene APBA1.
LENUS (Irish Health Repository)
Chai, Ka-Ho
2012-05-01
X11α is a brain specific multi-modular protein that interacts with the Alzheimer\\'s disease amyloid precursor protein (APP). Aggregation of amyloid-β peptide (Aβ), an APP cleavage product, is believed to be central to the pathogenesis of Alzheimer\\'s disease. Recently, overexpression of X11α has been shown to reduce Aβ generation and to ameliorate memory deficit in a transgenic mouse model of Alzheimer\\'s disease. Therefore, manipulating the expression level of X11α may provide a novel route for the treatment of Alzheimer\\'s disease. Human X11α is encoded by the gene APBA1. As evidence suggests that X11α expression can be regulated at transcription level, we have determined the gene structure and cloned the promoter of APBA1. APBA1 spans over 244 kb on chromosome 9 and is composed of 13 exons and has multiple transcription start sites. A putative APBA1 promoter has been identified upstream of exon 1 and functional analysis revealed that this is highly active in neurons. By deletion analysis, the minimal promoter was found to be located between -224 and +14, a GC-rich region that contains a functional Sp3 binding site. In neurons, overexpression of Sp3 stimulates the APBA1 promoter while an Sp3 inhibitor suppresses the promoter activity. Moreover, inhibition of Sp3 reduces endogenous X11α expression and promotes the generation of Aβ. Our findings reveal that Sp3 play an essential role in APBA1 transcription.
Promoted V2O5/TiO2 catalysts for selective catalytic reduction of NO with NH3 at low temperatures
DEFF Research Database (Denmark)
Putluru, Siva Sankar Reddy; Schill, Leonhard; Godiksen, Anita
2016-01-01
characterized by N2 physisorption, XRPD, NH3-TPD, H2-TPR, Raman, FTIR and EPR spectroscopy to investigate the properties of the catalysts. XRPD, Raman and FTIR showed that promotion with 15 wt.% HPA does not cause V2O5 to be present in crystalline form, also at a loading of 5 wt.% V2O5. Hence, use of HPAs does......The influence of varying the V2O5 content (3–6 wt.%) was studied for the selective catalytic reduction (SCR) of nitrogen oxides by ammonia on heteropoly acid (HPA)- and tungsten oxide (WO3)-promoted V2O5/TiO2 catalysts. The SCR activity and alkali deactivation resistance of HPA-promoted V2O5/TiO2...... catalysts was found to be much higher than for WO3-promoted catalysts. By increasing the vanadium content from 3 to 5 wt.% the catalysts displayed a two fold increase in activity at 225 °C and retained their initial activity after alkali doping at a molar K/V ratio of 0.181. Furthermore, the catalysts were...
Yang, Jiading; Worley, Eric
2014-01-01
Chlorophyll degradation is an important part of leaf senescence, but the underlying regulatory mechanisms are largely unknown. Excised leaves of an Arabidopsis thaliana NAC-LIKE, ACTIVATED BY AP3/PI (NAP) transcription factor mutant (nap) exhibited lower transcript levels of known chlorophyll degradation genes, STAY-GREEN1 (SGR1), NON-YELLOW COLORING1 (NYC1), PHEOPHYTINASE (PPH), and PHEIDE a OXYGENASE (PaO), and higher chlorophyll retention than the wild type during dark-induced senescence. Transcriptome coexpression analysis revealed that abscisic acid (ABA) metabolism/signaling genes were disproportionately represented among those positively correlated with NAP expression. ABA levels were abnormally low in nap leaves during extended darkness. The ABA biosynthetic genes 9-CIS-EPOXYCAROTENOID DIOXYGENASE2, ABA DEFICIENT3, and ABSCISIC ALDEHYDE OXIDASE3 (AAO3) exhibited abnormally low transcript levels in dark-treated nap leaves. NAP transactivated the promoter of AAO3 in mesophyll cell protoplasts, and electrophoretic mobility shift assays showed that NAP can bind directly to a segment (−196 to −162 relative to the ATG start codon) of the AAO3 promoter. Exogenous application of ABA increased the transcript levels of SGR1, NYC1, PPH, and PaO and suppressed the stay-green phenotype of nap leaves during extended darkness. Overexpression of AAO3 in nap leaves also suppressed the stay-green phenotype under extended darkness. Collectively, the results show that NAP promotes chlorophyll degradation by enhancing transcription of AAO3, which leads to increased levels of the senescence-inducing hormone ABA. PMID:25516602
Embryogenesis-promoting factors in rat serum.
Katoh, M; Kimura, R; Shoji, R
1998-06-15
Regarding whole rat embryo cultures in vitro, rat serum as a culture medium is known to support the normal growth of rat embryos in the organogenesis phase. The purpose of the present study was to isolate the embryogenesis-promoting factors from rat serum as a first step in the development of a defined serum-free medium for a whole embryo culture system. Pooled rat serum after heat inactivation was fractionated into three major peaks (frA, containing a region of void volume, frB, and frC) by gel filtration. The 9.5-day rat embryos that were cultivated for 48 hr in essential salt medium containing frB (with a molecular size range of 100-500 kDa) revealed normal growth. Three proteins (27 kDa, 76 kDa, and 190 kDa) that had the embryogenesis-promoting effects were isolated from 3-hr delayed centrifuged rat serum by the ion exchange chromatography. The 76-kDa protein was found to be rat transferrin by immunoblotting. The 27-kDa protein was identified as apo-AI (the major apoprotein of high-density lipoprotein) by immunoblotting. High-density lipoprotein obtained from pooled rat serum by a NaBr density gradient ultracentrifugation was found to have a positive effect on embryogenesis. The 10-kDa protein was also identified as alpha 1-inhibitor 3 by immunoblotting. In addition, the embryogenesis-promoting effect of the fraction containing 27-kDa and 190-kDa proteins declined within a short period of storage at -20 degrees C. This decrease was countered by supplementing its fraction (D-2) with albumin isolated from rat serum. These results in the present study suggest that transferrin, high-density lipoprotein, and alpha 1-inhibitor 3 in rat serum may be embryogenesis-promoting factors, and that albumin appeared to play a role in the embryogenesis of rat embryos in whole embryo cultures.
Wang, Chung-Chieh; Huang, Chao-Yuan; Jhuang, Yu-Lin; Chen, Chih-Chi; Jeng, Yung-Ming
2018-04-01
Mutations in FGFR3 and the promoter region of the telomerase reverse transcriptase (TERT) gene have been found frequently in urothelial carcinoma of the urinary bladder. However, related data for papillary urothelial neoplasm of low malignant potential (PUNLMP) are limited. In this study, we investigated the mutation status of the TERT promoter, FGFR3 and HRAS in low-grade papillary urothelial neoplasms and evaluated their prognostic significance. The cases included in this study comprised 21 inverted papillomas, 30 PUNLMPs and 34 low-grade non-invasive papillary urothelial carcinomas (NIPUCs). TERT promoter mutations were observed in 10 (33%) PUNLMPs and 17 (50%) low-grade NIPUCs, but not in any inverted papilloma. FGFR3 mutations were observed more frequently in PUNLMP and low-grade NIPUC than in inverted papillomas (P = 0.009), whereas the opposite trend was noted for HRAS mutations (P low-grade NIPUC (P = 0.530). Notably, PUNLMP cases with TERT promoter mutations had a similar recurrence rate to that in low-grade NIPUC cases (P = 0.487). Our results suggest that the status of the TERT promoter mutation may serve as a biomarker of prognostic stratification in patients with PUNLMP. © 2017 John Wiley & Sons Ltd.
Structure of the gene for human β2-adrenergic receptor: expression and promoter characterization
International Nuclear Information System (INIS)
Emorine, L.J.; Marullo, S.; Delavier-Klutchko, C.; Kaveri, S.V.; Durieu-Trautmann, O.; Strosberg, A.D.
1987-01-01
The genomic gene coding for the human β 2 -adrenergic receptor (β 2 AR) from A431 epidermoid cells has been isolated. Transfection of the gene into eukaryotic cells restores a fully active receptor/GTP-binding protein/adenylate cyclase complex with β 2 AR properties. Southern blot analyses with β 2 AR-specific probes show that a single β 2 AR gene is common to various human tissues and that its flanking sequences are highly conserved among humans and between man and rabbit, mouse, and hamster. Functional significance of these regions is supported by the presence of a promoter region (including mRNA cap sites, two TATA boxes, a CAAT box, and three G + C-rich regions that resemble binding sites for transcription factor Sp1) 200-300 base pairs 5' to the translation initiation codon. In the 3' flanking region, sequences homologous to glucocorticoid-response elements might be responsible for the increased expression of the β 2 AR gene observed after treatment of the transfected cells with hydrocortisone. In addition, 5' to the promoter region, an open reading frame encodes a 251-residue polypeptide that displays striking homologies with protein kinases and other nucleotide-binding proteins