WorldWideScience

Sample records for nf b-mediated inflammatory

  1. Fidaxomicin and OP-1118 Inhibit Clostridium difficile Toxin A- and B-Mediated Inflammatory Responses via Inhibition of NF-κB Activity.

    Science.gov (United States)

    Koon, Hon Wai; Wang, Jiani; Mussatto, Caroline C; Ortiz, Christina; Lee, Elaine C; Tran, Diana Hoang-Ngoc; Chen, Xinhua; Kelly, Ciaran P; Pothoulakis, Charalabos

    2018-01-01

    Clostridium difficile causes diarrhea and colitis by releasing toxin A and toxin B. In the human colon, both toxins cause intestinal inflammation and stimulate tumor necrosis factor alpha (TNF-α) expression via the activation of NF-κB. It is well established that the macrolide antibiotic fidaxomicin is associated with reduced relapses of C. difficile infection. We showed that fidaxomicin and its primary metabolite OP-1118 significantly inhibited toxin A-mediated intestinal inflammation in mice in vivo and toxin A-induced cell rounding in vitro We aim to determine whether fidaxomicin and OP-1118 possess anti-inflammatory effects against toxin A and toxin B in the human colon and examine the mechanism of this response. We used fresh human colonic explants, NCM460 human colonic epithelial cells, and RAW264.7 mouse macrophages to study the mechanism of the activity of fidaxomicin and OP-1118 against toxin A- and B-mediated cytokine expression and apoptosis. Fidaxomicin and OP-1118 dose-dependently inhibited toxin A- and B-induced TNF-α and interleukin-1β (IL-1β) mRNA expression and histological damage in human colonic explants. Fidaxomicin and OP-1118 inhibited toxin A-mediated NF-κB phosphorylation in human and mouse intestinal mucosae. Fidaxomicin and OP-1118 also inhibited toxin A-mediated NF-κB phosphorylation and TNF-α expression in macrophages, which was reversed by the NF-κB activator phorbol myristate acetate (PMA). Fidaxomicin and OP-1118 prevented toxin A- and B-mediated apoptosis in NCM460 cells, which was reversed by the addition of PMA. PMA reversed the cytoprotective effect of fidaxomicin and OP-1118 in toxin-exposed human colonic explants. Fidaxomicin and OP-1118 inhibit C. difficile toxin A- and B-mediated inflammatory responses, NF-κB phosphorylation, and tissue damage in the human colon. Copyright © 2017 American Society for Microbiology.

  2. 4-Isopropyl-2,6-bis(1-phenylethylaniline 1, an Analogue of KTH-13 Isolated from Cordyceps bassiana, Inhibits the NF-κB-Mediated Inflammatory Response

    Directory of Open Access Journals (Sweden)

    Woo Seok Yang

    2015-01-01

    Full Text Available The Cordyceps species has been a good source of compounds with anticancer and anti-inflammatory activities. Recently, we reported a novel compound (4-isopropyl-2,6-bis(1-phenylethylphenol, KTH-13 with anticancer activity isolated from Cordyceps bassiana and created several derivatives to increase its pharmacological activity. In this study, we tested one of the KTH-013 derivatives, 4-isopropyl-2,6-bis(1-phenylethylaniline 1 (KTH-13-AD1, with regard to anti-inflammatory activity under macrophage-mediated inflammatory conditions. KTH-13-AD1 clearly suppressed the production of nitric oxide (NO and reactive oxygen species (ROS in lipopolysaccharide (LPS and sodium nitroprusside- (SNP- treated macrophage-like cells (RAW264.7 cells. Similarly, this compound also reduced mRNA expression of inducible NO synthase (iNOS and tumor necrosis factor-α (TNF-α, as analyzed by RT-PCR and real-time PCR. Interestingly, KTH-13-AD1 strongly diminished NF-κB-mediated luciferase activities and nuclear translocation of NF-κB family proteins. In accordance, KTH-13-AD1 suppressed the upstream signaling pathway of NF-κB activation, including IκBα, IKKα/β, AKT, p85/PI3K, and Src in a time- and dose-dependent manner. The autophosphorylation of Src and NF-κB observed during the overexpression of Src was also suppressed by KTH-13-AD1. These results strongly suggest that KTH-13-AD1 has strong anti-inflammatory features mediated by suppression of the Src/NF-κB regulatory loop.

  3. IL-33 Provides Neuroprotection through Suppressing Apoptotic, Autophagic and NF-κB-Mediated Inflammatory Pathways in a Rat Model of Recurrent Neonatal Seizure

    Directory of Open Access Journals (Sweden)

    Yuan Gao

    2017-12-01

    Full Text Available Interleukin-33 (IL-33 is a novel identified chromatin-associated cytokine of IL-1 family cytokines. It signals through a heterodimer comprised of ST2L and IL-1RAcp, and plays a crucial role in many diseases. However, very little is known about the role and underlying intricate mechanisms of IL-33 in recurrent neonatal seizure (RNS. To determine whether IL-33 plays an important regulatory role, we established a neonatal seizure model in this study. Rats were subjected to recurrent seizures induced by inhaling volatile flurothyl. Recombinant IL-33 or PBS were also administered by intraperitoneally (IP before surgery, respectively. Here, our current results indicated that RNS contributed to a significant reduction in IL-33 and its specific receptor (ST2L expressions in cortex. While, in hippocampus, RNS induced an increase in IL-33 and ST2L evidently, compared with Sham group. After injection with IL-33, however, a remarkable increase in total IL-33 was detected both in brain cortex and hippocampus. In addition, IL-33 was mainly co-localized in the nuclear of GFAP+ astrocytes and the cytoplasm of the Iba-1+ microglia and IL-33+/NeuN+ merged cells. In parallel, ST2L was expressed mainly in the membrane of GFAP+ astrocytes, Iba-1+ microglia and NeuN+ neurons, respectively. Furthermore, administration of IL-33 improved RNS-induced behavioral deficits, promoted bodyweight gain, and ameliorated spatial learning and memory ability. Moreover, IL-33 pretreatment blocked the activation of NF-κB, resisted inflammatory cytokines IL-1β and TNF-α increase, as well as suppressed apoptosis and autophagy activation after RNS. Collectively, IL-33 provides potential neuroprotection through suppressing apoptosis, autophagy and at least in part by NF-κB-mediated inflammatory pathways after RNS.

  4. Agmatine Protects against Zymosan-Induced Acute Lung Injury in Mice by Inhibiting NF-κB-Mediated Inflammatory Response

    Directory of Open Access Journals (Sweden)

    Xuanfei Li

    2014-01-01

    Full Text Available Acute lung injury (ALI is characterized by overwhelming lung inflammation and anti-inflammation treatment is proposed to be a therapeutic strategy for ALI. Agmatine, a cationic polyamine formed by decarboxylation of L-arginine, is an endogenous neuromodulator that plays protective roles in diverse central nervous system (CNS disorders. Consistent with its neuromodulatory and neuroprotective properties, agmatine has been reported to have beneficial effects on depression, anxiety, hypoxic ischemia, Parkinson’s disease, and gastric disorder. In this study, we tested the effect of agmatine on the lung inflammation induced by Zymosan (ZYM challenge in mice. We found that agmatine treatment relieved ZYM-induced acute lung injury, as evidenced by the reduced histological scores, wet/dry weight ratio, and myeloperoxidase activity in the lung tissue. This was accompanied by reduced levels of TNF-α, IL-1β, and IL-6 in lung and bronchoalveolar lavage fluid and decreased iNOS expression in lung. Furthermore, agmatine inhibited the phosphorylation and degradation of IκB and subsequently blocked the activation of nuclear factor (NF-κB induced by Zymosan. Taken together, our results showed that agmatine treatment inhibited NF-κB signaling in lungs and protected mice against ALI induced by Zymosan, suggesting agmatine may be a potential safe and effective approach for the treatment of ALI.

  5. Calcineurin inhibitors recruit protein kinases JAK2 and JNK, TLR signaling and the UPR to activate NF-κB-mediated inflammatory responses in kidney tubular cells

    International Nuclear Information System (INIS)

    González-Guerrero, Cristian; Ocaña-Salceda, Carlos; Berzal, Sergio; Carrasco, Susana; Fernández-Fernández, Beatriz

    2013-01-01

    The calcineurin inhibitors (CNIs) cyclosporine (CsA) and tacrolimus are key drugs in current immunosuppressive regimes for solid organ transplantation. However, they are nephrotoxic and promote death and profibrotic responses in tubular cells. Moreover, renal inflammation is observed in CNI nephrotoxicity but the mechanisms are poorly understood. We have now studied molecular pathways leading to inflammation elicited by the CNIs in cultured and kidney tubular cells. Both CsA and tacrolimus elicited a proinflammatory response in tubular cells as evidenced by a transcriptomics approach. Transcriptomics also suggested several potential pathways leading to expression of proinflammatory genes. Validation and functional studies disclosed that in tubular cells, CNIs activated protein kinases such as the JAK2/STAT3 and TAK1/JNK/AP-1 pathways, TLR4/Myd88/IRAK signaling and the Unfolded Protein Response (UPR) to promote NF-κB activation and proinflammatory gene expression. CNIs also activated an Nrf2/HO-1-dependent compensatory response and the Nrf2 activator sulforaphane inhibited JAK2 and JNK activation and inflammation. A murine model of CsA nephrotoxicity corroborated activation of the proinflammatory pathways identified in cell cultures. Human CNIs nephrotoxicity was also associated with NF-κB, STAT3 and IRE1α activation. In conclusion, CNIs recruit several intracellular pathways leading to previously non-described proinflammatory actions in renal tubular cells. Identification of these pathways provides novel clues for therapeutic intervention to limit CNIs nephrotoxicity. - Highlights: • Molecular mechanisms modulating CNI renal inflammation were investigated. • Kinases, immune receptors and ER stress mediate the inflammatory response to CNIs. • Several intracellular pathways activate NF-κB in CNIs-treated tubular cells. • A NF-κB-dependent cytokine profile characterizes CNIs-induced inflammation. • CNI nephrotoxicity was associated to inflammatory

  6. Calcineurin inhibitors recruit protein kinases JAK2 and JNK, TLR signaling and the UPR to activate NF-κB-mediated inflammatory responses in kidney tubular cells

    Energy Technology Data Exchange (ETDEWEB)

    González-Guerrero, Cristian, E-mail: cristian.gonzalez@fjd.es [Renal and Vascular Pathology Laboratory, Instituto de Investigación Sanitaria-Fundación Jiménez Díaz (IIS-FJD), Av. Reyes Católicos 2, 28040 Madrid (Spain); Ocaña-Salceda, Carlos, E-mail: carlos.ocana@fjd.es [Renal and Vascular Pathology Laboratory, Instituto de Investigación Sanitaria-Fundación Jiménez Díaz (IIS-FJD), Av. Reyes Católicos 2, 28040 Madrid (Spain); Berzal, Sergio, E-mail: sberzal@fjd.es [Renal and Vascular Pathology Laboratory, Instituto de Investigación Sanitaria-Fundación Jiménez Díaz (IIS-FJD), Av. Reyes Católicos 2, 28040 Madrid (Spain); Carrasco, Susana, E-mail: scarrasco@fjd.es [Renal and Vascular Pathology Laboratory, Instituto de Investigación Sanitaria-Fundación Jiménez Díaz (IIS-FJD), Av. Reyes Católicos 2, 28040 Madrid (Spain); Fernández-Fernández, Beatriz, E-mail: bfernandez@fjd.es [Nephrology, Instituto de Investigación Sanitaria-Fundación Jiménez Díaz (IIS-FJD), Av. Reyes Católicos 2, 28040 Madrid (Spain); and others

    2013-11-01

    The calcineurin inhibitors (CNIs) cyclosporine (CsA) and tacrolimus are key drugs in current immunosuppressive regimes for solid organ transplantation. However, they are nephrotoxic and promote death and profibrotic responses in tubular cells. Moreover, renal inflammation is observed in CNI nephrotoxicity but the mechanisms are poorly understood. We have now studied molecular pathways leading to inflammation elicited by the CNIs in cultured and kidney tubular cells. Both CsA and tacrolimus elicited a proinflammatory response in tubular cells as evidenced by a transcriptomics approach. Transcriptomics also suggested several potential pathways leading to expression of proinflammatory genes. Validation and functional studies disclosed that in tubular cells, CNIs activated protein kinases such as the JAK2/STAT3 and TAK1/JNK/AP-1 pathways, TLR4/Myd88/IRAK signaling and the Unfolded Protein Response (UPR) to promote NF-κB activation and proinflammatory gene expression. CNIs also activated an Nrf2/HO-1-dependent compensatory response and the Nrf2 activator sulforaphane inhibited JAK2 and JNK activation and inflammation. A murine model of CsA nephrotoxicity corroborated activation of the proinflammatory pathways identified in cell cultures. Human CNIs nephrotoxicity was also associated with NF-κB, STAT3 and IRE1α activation. In conclusion, CNIs recruit several intracellular pathways leading to previously non-described proinflammatory actions in renal tubular cells. Identification of these pathways provides novel clues for therapeutic intervention to limit CNIs nephrotoxicity. - Highlights: • Molecular mechanisms modulating CNI renal inflammation were investigated. • Kinases, immune receptors and ER stress mediate the inflammatory response to CNIs. • Several intracellular pathways activate NF-κB in CNIs-treated tubular cells. • A NF-κB-dependent cytokine profile characterizes CNIs-induced inflammation. • CNI nephrotoxicity was associated to inflammatory

  7. Leishmania donovani Activates Hypoxia Inducible Factor-1α and miR-210 for Survival in Macrophages by Downregulation of NF-κB Mediated Pro-inflammatory Immune Response

    Directory of Open Access Journals (Sweden)

    Vinod Kumar

    2018-03-01

    Full Text Available Micro RNAs (miRNAs have emerged as a critical regulator of several biological processes in both animals and plants. They have also been associated with regulation of immune responses in many human diseases during recent years. Visceral leishmaniasis (VL is the most severe form of leishmaniasis, which is characterized by impairment of both innate and adaptive immune responses. In the present study, we observed that Leishmania establishes hypoxic environment in host macrophages that induces the expression of hypoxia inducible factor-1α (HIF-1α and miRNA-210. Further, the expression of miRNA-210 was found to be dependent on activation of HIF-1α expression. The HIF-1α silencing by siRNA resulted in significantly (p < 0.001 decreased expression of miR-210 in parasites infected macrophages. We also observed that in siHIF-1α or antagomir-210 treated L. donovani infected macrophages, the parasitic load and percentage infectivity were significantly (p < 0.001 decreased. Furthermore, we found that inhibition of miR-210 leads to activation of NF-κB subunit p50, and it forms heterodimer with p65 and translocates into the nucleus from the cytoplasm. This significantly (p < 0.05 induced the transcription of pro-inflammatory cytokines genes such as TNF-α and IL-12 in miRNA-210 inhibited macrophages compared to uninhibited macrophages whereas the level of IL-10, an anti-inflammatory cytokine, was found to be significantly decreased (p < 0.001. These findings suggested that L. donovani infection induces hypoxic environment inside the macrophages that activates HIF-1α. Further, HIF-1α upregulates miR-210, which eventually establishes a suitable environment for the survival of parasite inside the host macrophages by downregulating NF-κB mediated pro-inflammatory immune responses.

  8. KLF2 in Regulation of NF-κB-Mediated Immune Cell Function and Inflammation

    Directory of Open Access Journals (Sweden)

    Prerana Jha

    2017-11-01

    Full Text Available KLF2 (Kruppel-like factor 2 is a member of the zinc finger transcription factor family, which critically regulates embryonic lung development, function of endothelial cells and maintenance of quiescence in T-cells and monocytes. It is expressed in naïve T-cells and monocytes, however its level of expression decreases during activation and differentiation. KLF2 also plays critical regulatory role in various inflammatory diseases and their pathogenesis. Nuclear factor-kappaB (NF-κB is an important inducer of inflammation and the inflammation is mediated through the transcription of several proinflammatory cytokines, chemokines and adhesion molecules. So, both transcriptional factors KLF2 and NF-κB are being associated with the similar cellular functions and their maintenance. It was shown that KLF2 regulates most of the NF-κB-mediated activities. In this review, we focused on emphasizing the involvement of KLF2 in health and disease states and how they interact with transcriptional master regulator NF-κB.

  9. Pro-inflammatory cytokine/chemokine production by reovirus treated melanoma cells is PKR/NF-κB mediated and supports innate and adaptive anti-tumour immune priming

    Directory of Open Access Journals (Sweden)

    Coffey Matt

    2011-02-01

    Full Text Available Abstract Background As well as inducing direct oncolysis, reovirus treatment of melanoma is associated with activation of innate and adaptive anti-tumour immune responses. Results Here we characterise the effects of conditioned media from reovirus-infected, dying human melanoma cells (reoTCM, in the absence of live virus, to address the immune bystander potential of reovirus therapy. In addition to RANTES, IL-8, MIP-1α and MIP-1β, reovirus-infected melanoma cells secreted eotaxin, IP-10 and the type 1 interferon IFN-β. To address the mechanisms responsible for the inflammatory composition of reoTCM, we show that IL-8 and IFN-β secretion by reovirus-infected melanoma cells was associated with activation of NF-κB and decreased by pre-treatment with small molecule inhibitors of NF-κB and PKR; specific siRNA-mediated knockdown further confirmed a role for PKR. This pro-inflammatory milieu induced a chemotactic response in isolated natural killer (NK cells, dendritic cells (DC and anti-melanoma cytotoxic T cells (CTL. Following culture in reoTCM, NK cells upregulated CD69 expression and acquired greater lytic potential against tumour targets. Furthermore, melanoma cell-loaded DC cultured in reoTCM were more effective at priming adaptive anti-tumour immunity. Conclusions These data demonstrate that the PKR- and NF-κB-dependent induction of pro-inflammatory molecules that accompanies reovirus-mediated killing can recruit and activate innate and adaptive effector cells, thus potentially altering the tumour microenvironment to support bystander immune-mediated therapy as well as direct viral oncolysis.

  10. A novel role of sesamol in inhibiting NF-κB-mediated signaling in platelet activation

    Directory of Open Access Journals (Sweden)

    Chang Chao-Chien

    2011-12-01

    Full Text Available Abstract Background Platelet activation is relevant to a variety of coronary heart diseases. Our previous studies revealed that sesamol possesses potent antiplatelet activity through increasing cyclic AMP formation. Although platelets are anucleated cells, they also express the transcription factor, NF-κB, that may exert non-genomic functions in platelet activation. Therefore, we further investigated the inhibitory roles of sesamol in NF-κB-mediated platelet function. Methods Platelet aggregation, Fura 2-AM fluorescence, and immunoblotting analysis were used in this study. Results NF-κB signaling events, including IKKβ phosphorylation, IκBα degradation, and p65 phosphorylation, were markedly activated by collagen (1 μg/ml in washed human platelets, and these signaling events were attenuated by sesamol (2.5~25 μM. Furthermore, SQ22536 and ODQ, inhibitors of adenylate cyclase and guanylate cyclase, respectively, strongly reversed the sesamol (25 μM-mediated inhibitory effects of IKKβ phosphorylation, IκBα degradation, and p65 phosphorylation stimulated by collagen. The protein kinase A (PKA inhibitor, H89, also reversed sesamol-mediated inhibition of IκBα degradation. Moreover, BAY11-7082, an NF-κB inhibitor, abolished IκBα degradation, phospholipase C (PLCγ2 phosphorylation, protein kinase C (PKC activation, [Ca2+]i mobilization, and platelet aggregation stimulated by collagen. Preincubation of platelets with the inhibitors, SQ22536 and H89, both strongly reversed sesamol-mediated inhibition of platelet aggregation and [Ca2+]i mobilization. Conclusions Sesamol activates cAMP-PKA signaling, followed by inhibition of the NF-κB-PLC-PKC cascade, thereby leading to inhibition of [Ca2+]i mobilization and platelet aggregation. Because platelet activation is not only linked to hemostasis, but also has a relevant role in inflammation and metastasis, our data demonstrating that inhibition of NF-κB interferes with platelet function may

  11. TRIM45 negatively regulates NF-κB-mediated transcription and suppresses cell proliferation

    International Nuclear Information System (INIS)

    Shibata, Mio; Sato, Tomonobu; Nukiwa, Ryota; Ariga, Tadashi; Hatakeyama, Shigetsugu

    2012-01-01

    Highlights: ► NF-κB plays an important role in cell survival and carcinogenesis. ► TRIM45 negatively regulates TNFα-induced NF-κB-mediated transcription. ► TRIM45 overexpression suppresses cell growth. ► TRIM45 acts as a repressor for the NF-κB signal and regulates cell growth. -- Abstract: The NF-κB signaling pathway plays an important role in cell survival, immunity, inflammation, carcinogenesis, and organogenesis. Activation of NF-κB is regulated by several posttranslational modifications including phosphorylation, neddylation and ubiquitination. The NF-κB signaling pathway is activated by two distinct signaling mechanisms and is strictly modulated by the ubiquitin–proteasome system. It has been reported that overexpression of TRIM45, one of the TRIM family ubiquitin ligases, suppresses transcriptional activities of Elk-1 and AP-1, which are targets of the MAPK signaling pathway. In this study, we showed that TRIM45 also negatively regulates TNFα-induced NF-κB-mediated transcription by a luciferase reporter assay and that TRIM45 lacking a RING domain also has an activity to inhibit the NF-κB signal. Moreover, we found that TRIM45 overexpression suppresses cell growth. These findings suggest that TRIM45 acts as a repressor for the NF-κB signal and regulates cell growth.

  12. NF-κB-mediated inflammation correlates with calcium overload under arsenic trioxide-induced myocardial damage in Gallus gallus.

    Science.gov (United States)

    Li, Siwen; Wang, Yu; Zhao, Hongjing; He, Ying; Li, Jinglun; Jiang, Guangshun; Xing, Mingwei

    2017-10-01

    Arsenic is a known environmental pollutant and highly hazardous toxin to human health. Due to the biological accumulation, arsenic produces a variety of cardiovascular diseases. However, the exact mechanism is still unclear. Here, our objective was to evaluate myocardial damage and determine the potential mechanism under arsenic exposure in chickens. Arsenic trioxide (As 2 O 3 ) (1.25 mg/kg BW, corresponding 15 mg/kg feed) was administered as basal diet to male Hy-line chickens (one-day-old) for 4, 8 and 12 weeks. The results showed that As 2 O 3 -induced histological and ultrastructural damage in heart accompanied with significantly Ca 2+ overload and increased the activities of myocardial enzymes. Moreover, As 2 O 3 exposure significantly increased (P CACNA1S and interleukin-10 were decreased (P < 0.05) by As 2 O 3 exposure at 4, 8 and 12 weeks as compared with the corresponding control group. Western blot results showed that As 2 O 3 exposure decreased the expression of SERCA and SLC8A1 protein, while the expression of TNF-α, NF-κB, iNOS and PMCA1 increased compared with the corresponding control group. Additionally, correlation analysis and protein-protein interaction prediction shown that NF-κB-mediated inflammatory response have a function correlation with calcium (Ca) regulation-related genes. In conclusion, this study indicated that As 2 O 3 -induced inflammatory response might dependent on Ca overload in myocardial damage of chickens. Our work has implications for the development of potential therapeutic approaches by resisting Ca overload for arsenic-induced myocardial damage. Copyright © 2017 Elsevier Ltd. All rights reserved.

  13. Diesel exhaust particles increase IL-1β-induced human β-defensin expression via NF-κB-mediated pathway in human lung epithelial cells

    Directory of Open Access Journals (Sweden)

    Lee Chun

    2006-05-01

    Full Text Available Abstract Background Human β-defensin (hBD-2, antimicrobial peptide primarily induced in epithelial cells, is a key factor in the innate immune response of the respiratory tract. Several studies showed increased defensin levels in both inflammatory lung diseases, such as cystic fibrosis, diffuse panbronchiolitis, idiopathic pulmonary fibrosis and acute respiratory distress syndrome, and infectious diseases. Recently, epidemiologic studies have demonstrated acute and serious adverse effects of particulate air pollution on respiratory health, especially in people with pre-existing inflammatory lung disease. To elucidate the effect of diesel exhaust particles (DEP on pulmonary innate immune response, we investigated the hBD-2 and interleukin-8 (IL-8 expression to DEP exposure in interleukin-1 beta (IL-1β-stimulated A549 cells. Results IL-1β markedly up-regulated the hBD-2 promoter activity, and the subsequent DEP exposure increased dose-dependently the expression of hBD-2 and inflammatory cytokine IL-8 at the transcriptional level. In addition, DEP further induced the NF-κB activation in IL-1β-stimulated A549 cells more rapidly than in unstimulated control cells, which was showed by nuclear translocation of p65 NF-κB and degradation of IκB-α. The experiment using two NF-κB inhibitors, PDTC and MG132, confirmed that this increase of hBD-2 expression following DEP exposure was regulated through NF-κB-mediated pathway. Conclusion These results demonstrated that DEP exposure increases the expression of antimicrobial peptide and inflammatory cytokine at the transcriptional level in IL-1β-primed A549 epithelial cells and suggested that the increase is mediated at least partially through NF-κB activation. Therefore, DEP exposure may contribute to enhance the airway-responsiveness especially on the patients suffering from chronic respiratory disease.

  14. Apocynin attenuates cholesterol oxidation product-induced programmed cell death by suppressing NF-κB-mediated cell death process in differentiated PC12 cells.

    Science.gov (United States)

    Lee, Da Hee; Nam, Yoon Jeong; Lee, Chung Soo

    2015-10-01

    Cholesterol oxidation products are suggested to be involved in neuronal degeneration. Apocynin has demonstrated to have anti-inflammatory and anti-oxidant effects. We assessed the effect of apocynin on the cholesterol oxidation product-induced programmed cell death in neuronal cells using differentiated PC12 cells in relation to NF-κB-mediated cell death process. 7-Ketocholesterol and 25-hydroxycholesterol decreased the levels of Bid and Bcl-2, increased the levels of Bax and p53, and induced loss of the mitochondrial transmembrane potential, release of cytochrome c and activation of caspases (-8, -9 and -3). 7-Ketocholesterol caused an increase in the levels of cytosolic and nuclear NF-κB p65, cytosolic NF-κB p50 and cytosolic phospho-IκB-α, which was inhibited by the addition of 0.5 μM Bay11-7085 (an inhibitor of NF-κB activation). Apocynin attenuated the cholesterol oxidation product-induced changes in the programmed cell death-related protein levels, NF-κB activation, production of reactive oxygen species, and depletion of GSH. The results show that apocynin appears to attenuate the cholesterol oxidation product-induced programmed cell death in PC12 cells by suppressing the activation of the mitochondrial pathway and the caspase-8- and Bid-dependent pathways that are mediated by NF-κB activation. The preventive effect appears to be associated with the inhibitory effect on the production of reactive oxygen species and depletion of GSH. Copyright © 2015 Elsevier Ltd. All rights reserved.

  15. Interferon-γ and NF-κB mediate nitric oxide production by mesenchymal stromal cells

    International Nuclear Information System (INIS)

    Oh, I.; Ozaki, K.; Sato, K.; Meguro, A.; Tatara, R.; Hatanaka, K.; Nagai, T.; Muroi, K.; Ozawa, K.

    2007-01-01

    Mesenchymal stromal cells (MSCs) have been shown to have an immunosuppressive effect. Previously, we demonstrated that nitric oxide (NO) is one of the immunomodulatory mediators of MSCs. We herein show that primary mouse bone marrow MSCs and three cell lines that mimic MSCs suppress both differentiation and proliferation in Th1 condition, whereas the suppression in Th2 condition is mild. NO production is inversely correlated with T cell proliferation in Th1 and Th2 conditions. NO is highly induced in Th1 and minimally induced in Th2. Moreover, an inhibitor of NO synthase restores both proliferation and interferon-γ (IFN-γ) production in Th1 condition. Furthermore, an anti-IFN-γ antibody strongly inhibits NO production and an inhibitor of NF-κB reduces the level of induction of inducible NO synthase (iNOS) in MSCs. Taken together, our results suggest that NO plays a significant role in the modification of Th1 and Th2 differentiation by MSCs, and that both IFN-γ and NF-κB are critical for NO production by MSCs

  16. LPS Induced Acute Lung Injury Involves the NF-κB-mediated Downregulation of SOX18.

    Science.gov (United States)

    Gross, Christine M; Kellner, Manuela; Wang, Ting; Lu, Qing; Sun, Xutong; Zemskov, Evgeny A; Noonepalle, Satish; Kangath, Archana; Kumar, Sanjiv; Gonzalez-Garay, Manuel; Desai, Ankit A; Aggarwal, Saurabh; Gorshkov, Boris; Klinger, Christina; Verin, Alexander D; Catravas, John D; Jacobson, Jeffrey R; Yuan, Jason X-J; Rafikov, Ruslan; Garcia, Joe G N; Black, Stephen M

    2017-11-08

    One of the early events in the progression of lipopolysaccharide (LPS)-mediated acute lung injury (ALI) in mice is the disruption of the pulmonary endothelial barrier resulting in lung edema. However, the molecular mechanisms by which the endothelial barrier becomes compromised remain unresolved. The SRY-related High Mobility Group box (Sox) group-F family member, Sox18, is a barrier- protective protein through its ability to increase the expression of the tight junction protein, Claudin-5. Thus, the purpose of this study was to determine if down-regulation of the Sox18-Claudin-5 axis plays a role in the pulmonary endothelial barrier disruption associated with LPS exposure. Our data indicate that both Sox18 and Claudin-5 expression is decreased in two models of in vivo LPS exposure (intraperitoneal, intratracheal). A similar down-regulation was observed in cultured human lung microvascular endothelial cells (HLMVECs) exposed to LPS. Sox18 over-expression in HLMVECs or in the mouse lung attenuated the LPS-mediated vascular barrier disruption. Conversely, reduced Claudin-5 expression (siRNA) reduced the HLMVEC barrier protective effects of Sox18 over-expression. The mechanism by which LPS decreases Sox18 expression was identified as transcriptional repression through binding of p65 NF-kB to a Sox18 promoter sequence located between -1082 and -1073 bp with peroxynitrite contributing to LPS-mediated NF-kB activation. We conclude that NFkB-dependent decreases in the Sox18-Claudin 5 axis is essentially involved in the disruption of human EC barrier integrity associated with LPS-mediated ALI.

  17. The Role of Chalcones in Suppression of NF-κB-Mediated Inflammation and Cancer

    Science.gov (United States)

    Yadav, Vivek R.; Prasad, Sahdeo; Sung, Bokyung; Aggarwal, Bharat B.

    2010-01-01

    Although consumption of fruits, vegetables, spices, cereals and pulses has been associated with lower incidence of cancer and other chronic diseases, how these dietary agents and their active ingredients minimize these diseases, is not fully understood. Whether it is oranges, kawa, hops, water-lilly, locorice, wax apple or mulberry, they are all connected by a group of aromatic ketones, called chalcones (1,3-diaryl-2-propen-1-ones). Some of the most significant chalcones identified from these plants include flavokawin, butein, xanthoangelol, 4-hydroxyderricin, cardamonin, 2′,4′-dihydroxychalcone, isoliquiritigenin, isosalipurposide, and naringenin. These chalcones have been linked with immunomodulation, antibacterial, antifungal, antiviral, anti-inflammatory, antioxidant, anticancer, and antidiabetic activities. The current review, however, deals with the role of various chalcones in inflammation that controls both the immune system and tumorigenesis. Inflammatory pathways have been shown to mediate the survival, proliferation, invasion, angiogenesis and metastasis of tumors. How these chalcones modulate inflammatory pathways, tumorigenesis and immune system is the focus of this review. PMID:21184860

  18. Cerium oxide nanoparticles inhibit lipopolysaccharide induced MAP kinase/NF-kB mediated severe sepsis

    Directory of Open Access Journals (Sweden)

    Vellaisamy Selvaraj

    2015-09-01

    Full Text Available The life threatening disease of sepsis is associated with high mortality. Septic patient survivability with currently available treatments has failed to improve. The purpose of this study was to evaluate whether lipopolysaccharide (LPS induced sepsis mortality and associated hepatic dysfunction can be prevented by cerium oxide nanoparticles (CeO2NPs treatment in male Sprague Dawley rats. Here we provide the information about the methods processing of raw data related to our study published in Biomaterials (Selvaraj et al., Biomaterials, 2015, In press and Data in Brief (Selvaraj et al., Data in Brief, 2015, In Press. The data present here provides confirmation of cerium oxide nanoparticle treatments ability to prevent the LPS induced sepsis associated changes in physiological, blood cell count, inflammatory protein and growth factors in vivo. In vitro assays investigation the treated of macrophages cells with different concentrations of cerium oxide nanoparticle demonstrate that concentration of cerium oxide nanoparticles below 1 µg/ml did not significantly influence cell survival as determined by the MTT assay.

  19. Osthole inhibits the invasive ability of human lung adenocarcinoma cells via suppression of NF-κB-mediated matrix metalloproteinase-9 expression

    Energy Technology Data Exchange (ETDEWEB)

    Kao, Shang-Jyh [Department of Chest Medicine, Shin-Kong Wu Ho-Su Memorial Hospital, Taipei, Taiwan (China); School of Respiratory Therapy, Taipei Medical University, Taipei Taiwan (China); Su, Jen-Liang [Graduate Institute of Cancer Biology, College of Medicine, China Medical University, Taichung, Taiwan (China); Center for Molecular Medicine, China Medical University Hospital, Taichung, Taiwan (China); Department of Biotechnology, Asia University, Taichung, Taiwan (China); Chen, Chi-Kuan [Graduate Institute of Toxicology, College of Medicine, National Taiwan University, Taipei, Taiwan (China); Yu, Ming-Chih; Bai, Kuan-Jen; Chang, Jer-Hua [Division of Pulmonary Medicine, Department of Internal Medicine, Taipei Medical University-Wan Fang Hospital, Taipei, Taiwan (China); Bien, Mauo-Ying [School of Respiratory Therapy, Taipei Medical University, Taipei Taiwan (China); Division of Pulmonary Medicine, Department of Internal Medicine, Taipei Medical University-Wan Fang Hospital, Taipei, Taiwan (China); Yang, Shun-Fa [Institute of Medicine, Chung Shan Medical University, Taichung, Taiwan (China); Department of Medical Research, Chung Shan Medical University Hospital, Taichung, Taiwan (China); Chien, Ming-Hsien, E-mail: mhchien1976@gmail.com [Graduate Institute of Clinical Medicine, Taipei Medical University, Taipei, Taiwan (China)

    2012-05-15

    The induction of matrix metalloproteinase (MMP)-9 is particularly important for the invasiveness of various cancer cells. Osthole, a natural coumarin derivative extracted from traditional Chinese medicines, is known to inhibit the proliferation of a variety of tumor cells, but the effect of osthole on the invasiveness of tumor cells is largely unknown. This study determines whether and by what mechanism osthole inhibits invasion in CL1-5 human lung adenocarcinoma cells. Herein, we found that osthole effectively inhibited the migratory and invasive abilities of CL1-5 cells. A zymographic assay showed that osthole inhibited the proteolytic activity of MMP-9 in CL1-5 cells. Inhibition of migration, invasion, and MMP2 and/or MMP-9 proteolytic activities was also observed in other lung adenocarcinoma cell lines (H1299 and A549). We further found that osthole inhibited MMP-9 expression at the messenger RNA and protein levels. Moreover, a chromatin immunoprecipitation assay showed that osthole inhibited the transcriptional activity of MMP-9 by suppressing the DNA binding activity of nuclear factor (NF)-κB in the MMP-9 promoter. Using reporter assays with point-mutated promoter constructs further confirmed that the inhibitory effect of osthole requires an NF-κB binding site on the MMP-9 promoter. Western blot and immunofluorescence assays demonstrated that osthole inhibited NF-κB activity by inhibiting IκB-α degradation and NF-κB p65 nuclear translocation. In conclusion, we demonstrated that osthole inhibits NF-κB-mediated MMP-9 expression, resulting in suppression of lung cancer cell invasion and migration, and osthole might be a potential agent for preventing the invasion and metastasis of lung cancer. -- Highlights: ► Osthole treatment inhibits lung adenocarcinoma cells migration and invasion. ► Osthole reduces the expression and proteolytic activity of MMP-9. ► Osthole inhibits MMP-9 transcription via suppression of NF-κB binding activity. ► Osthole

  20. NF-κB-mediated inverse regulation of fractalkine and CX3CR1 during CLP-induced sepsis.

    Science.gov (United States)

    Raspé, C; Höcherl, K; Rath, S; Sauvant, C; Bucher, M

    2013-01-01

    Fractalkine is a unique member of the CX3C chemokine family by unfolding its potential through the chemokine (C-X3-C motif) receptor 1 (CX3CR1) with dual function acting both as an adhesion molecule and a soluble chemokine. The regulation of this chemokine is still not clear. Therefore, we were interested in the regulation of fractalkine and of CX3CR1 in experimental sepsis. In addition, we investigated the role of NF-κB for the regulation of fractalkine and of CX3CR1. Using a mouse model of cecal ligation and puncture (CLP)-induced sepsis, we found elevated fractalkine mRNA levels in the heart, lung, kidney, and liver, as well as increased plasma levels 24 and 48h after CLP, respectively. In parallel, CLP resulted in a significant downregulation of CX3CR1 mRNA receptor expression in all investigated murine tissues. Septic mice that were pretreated with the selective NF-κB inhibitor pyrrolidine dithiocarbamate (PDTC) were found to have a decreased liberation of proinflammtory cytokines such as TNF-α, IL-1β, IL-6, or IFN-γ. Further PDTC pretreatment attenuated CLP-induced downregulation of CX3CR1 mRNA as well as CLP-induced upregulation of fractalkine mRNA expression in the heart, lung, kidney, liver, and the increase in fractalkine plasma levels of septic mice. In addition, CLP-induced downregulation of renal CX3CR1 protein expression was inhibited by PDTC-pretreatment. Taken together, our data indicate a CLP-induced inverse regulation of the expression between the relating ligand and the receptor with an upregulation of fractalkine and downregulation of CX3CR1, which seems to be mediated by the transcripting factor NF-κB likely via reduced liberation of proinflammtory cytokines in the whole murine organism. Crown Copyright © 2012. Published by Elsevier Ltd. All rights reserved.

  1. Histone deacetylase 3 (HDAC 3) as emerging drug target in NF-kappa B-mediated inflammation

    NARCIS (Netherlands)

    Leus, Niek G. J.; Zwinderman, Martijn R. H.; Dekker, Frank J.

    Activation of inflammatory gene expression is regulated, among other factors, by post-translational modifications of histone proteins. The most investigated type of histone modifications is lysine acetylations. Histone deacetylases (HDACs) remove acetylations from lysines, thereby influencing

  2. Hyperbaric Oxygen Intervention Modulates Early Brain Injury after Experimental Subarachnoid Hemorrhage in Rats: Possible Involvement of TLR4/NFB-Mediated Signaling Pathway

    Directory of Open Access Journals (Sweden)

    Hao Liu

    2016-05-01

    Full Text Available Background/Aims: Previous studies have proved that the activation of TLR4/NF-κ B signaling pathway is involved in inflammatory processes in early brain injury (EBI after subarachnoid hemorrhage (SAH. Hyperbaric oxygen (HBO intervention has successfully been used to treat several animal models of tissue injury via its anti-inflammation property. This study was undertaken to investigate the influence of HBO administration on the TLR4/NF-κ B signaling pathway in rats at the early stage of SAH. Methods: Male Sprague-Dawley rats (n = 150 were randomly divided into 5 groups: the sham, the sham + 2.8 atmospheres absolute (ATA HBO group, the SAH group, the SAH + 2.0ATA HBO group, the SAH + 2.8ATA HBO group. Each group (n = 30 was randomly subdivided into three subgroups that were examined at the following time points: 24 h, 48 h and 72 h post-injury. HBO (100% O2, 2.0ATA or 2.8ATA for 90mins was initiated 12 h after injury. Neurological deficit, brain edema and blood-brain barrier (BBB permeability were assessed to evaluate the development of EBI. The expressions of TLR4, NF-κ B and pro-inflammatory cytokines in the cortical were determined by real time polymerase chain reaction (RT-PCR, western blot, immunohistochemistry, or enzyme-linked immunosorbent assay (ELISA. Results: Our study showed that treatment with HBO significantly decreased the expressions of TLR4, NF-κ B and the downstream inflammatory agents, such as TNF-α, IL-6, IL-1β and ICAM-1, and also improved brain edema, blood-brain barrier permeability and neurologic function. Conclusions: These findings indicate that HBO treatment may result in abatement of the development of EBI after SAH, possibly through suppression of TLR4/NF-κ B signaling pathway.

  3. NF-κB Mediated Regulation of Adult Hippocampal Neurogenesis: Relevance to Mood Disorders and Antidepressant Activity

    Directory of Open Access Journals (Sweden)

    Valeria Bortolotto

    2014-01-01

    Full Text Available Adult hippocampal neurogenesis is a peculiar form of process of neuroplasticity that in recent years has gained great attention for its potential implication in cognition and in emotional behavior in physiological conditions. Moreover, a vast array of experimental studies suggested that adult hippocampal neurogenesis may be altered in various neuropsychiatric disorders, including major depression, where its disregulation may contribute to cognitive impairment and/or emotional aspects associated with those diseases. An intriguing area of interest is the potential influence of drugs on adult neurogenesis. In particular, several psychoactive drugs, including antidepressants, were shown to positively modulate adult hippocampal neurogenesis. Among molecules which could regulate adult hippocampal neurogenesis the NF-κB family of transcription factors has been receiving particular attention from our and other laboratories. Herein we review recent data supporting the involvement of NF-κB signaling pathways in the regulation of adult neurogenesis and in the effects of drugs that are endowed with proneurogenic and antidepressant activity. The potential implications of these findings on our current understanding of the process of adult neurogenesis in physiological and pathological conditions and on the search for novel antidepressants are also discussed.

  4. Mitochondrial proteins NIP-SNAP-1 and -2 are a target for the immunomodulatory activity of clarithromycin, which involves NF-κB-mediated cytokine production.

    Science.gov (United States)

    Yamamoto, Soh; Ogasawara, Noriko; Yamamoto, Keisuke; Uemura, Chika; Takaya, Yoshiaki; Shiraishi, Tsukasa; Sato, Toyotaka; Hashimoto, Shin; Tsutsumi, Hiroyuki; Takano, Kenichi; Himi, Tetsuo; Yokota, Shin-Ichi

    2017-02-12

    Macrolide antibiotics have immunomodulatory activities, including suppression of cytokine production, cell adhesion molecule expression, and mucin production. These immunomodulatory activities improve the symptoms of respiratory diseases associated with chronic inflammation. However, the underlying molecular mechanism(s) is not well understood yet. To address this, we prepared clarithromycin (CAM)-conjugated Sepharose and examined bound cellular proteins by proteome analysis. We identified mitochondrial proteins 4-nitrophenylphosphatase domain and non-neuronal synaptosomal associated protein 25-like protein homolog (NIP-SNAP)-1 and -2 and very long-chain acyl-CoA dehydrogenase (VLCAD) as CAM-binding proteins. Production of proinflammatory cytokines (IL-8 and IL-6) induced by lipopolysaccharides (LPSs) and Pam 3 -CSK 4 in human epithelial cell lines BEAS-2B and T24 were suppressed by knockdown of NIP-SNAP-1 or -2, and partly by knockdown of VLCAD. Also, knockdown of NIP-SNAP-1 or -2 in various cell lines suppressed LPS-induced expression of IL-8 and IL-6 mRNA and NF-κB activity. Thus, CAM suppresses NF-κB-mediated proinflammatory cytokine production by interacting with mitochondrial proteins, NIP-SNAP-1 and -2. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

  5. Innate Immune Molecule Surfactant Protein D Attenuates Sepsis-induced Acute Pancreatic Injury through Modulating Apoptosis and NF-κB-mediated Inflammation.

    Science.gov (United States)

    Liu, Zhiyong; Shi, Qiao; Liu, Jiao; Abdel-Razek, Osama; Xu, Yongan; Cooney, Robert N; Wang, Guirong

    2015-12-04

    Sepsis causes multiple-organ dysfunction including pancreatic injury, thus resulting in high mortality. Innate immune molecule surfactant protein D (SP-D) plays a critical role in host defense and regulating inflammation of infectious diseases. In this study we investigated SP-D functions in the acute pancreatic injury (API) with C57BL/6 Wild-type (WT) and SP-D knockout (KO) mice in cecal ligation and puncture (CLP) model. Our results confirm SP-D expression in pancreatic islets and intercalated ducts and are the first to explore the role of pancreatic SP-D in sepsis. CLP decreased pancreatic SP-D levels and caused severe pancreatic injury with higher serum amylase 24 h after CLP. Apoptosis and neutrophil infiltration were increased in the pancreas of septic KO mice (p < 0.05, vs septic WT mice), with lower Bcl-2 and higher caspase-3 levels in septic KO mice (p < 0.05). Molecular analysis revealed increased NF-κB-p65 and phosphorylated IκB-α levels along with higher serum levels of TNF-α and IL-6 in septic KO mice compared to septic WT mice (p < 0.01). Furthermore, in vitro islet cultures stimulated with LPS produced higher TNF-α and IL-6 (p < 0.05) from KO mice compared to WT mice. Collectively, these results demonstrate SP-D plays protective roles by inhibiting apoptosis and modulating NF-κB-mediated inflammation in CLP-induced API.

  6. Anti-Inflammatory Effects of Ginsenoside Rg3 via NF-κB Pathway in A549 Cells and Human Asthmatic Lung Tissue

    Directory of Open Access Journals (Sweden)

    In-Seung Lee

    2016-01-01

    Full Text Available Objective. There is limited information of the anti-inflammatory effects of Rg3 on inflamed lung cells and tissues. Therefore, we confirmed the anti-inflammatory mechanism of ginsenoside Rg3 in inflamed human airway epithelial cells (A549 and tissues whether Rg3 regulates nuclear factor kappa B (NF-κB activity. Methods. To induce the inflammation, IL-1β (10 ng/ml was treated to A549 cells for 4 h. The effects of Rg3 on NF-κB activity and COX-2 expression were evaluated by western blotting analysis in both IL-1β-induced inflamed A549 cell and human asthmatic airway epithelial tissues. Using multiplex cytokines assay, the secretion levels of NF-κB-mediated cytokines/chemokines were measured. Result. Rg3 showed the significant inhibition of NF-κB activity thereby reduced COX-2 expression was determined in both IL-1β-induced inflamed A549 cell and human asthmatic airway epithelial tissues. In addition, among NF-κB-mediated cytokines, the secretion levels of IL-4, TNF-α, and eotaxin were significantly decreased by Rg3 in asthma tissues. Even though there was no significant difference, IL-6, IL-9, and IL-13 secretion showed a lower tendency compared to saline-treated human asthmatic airway epithelial tissues. Conclusion. The results from this study demonstrate the potential of Rg3 as an anti-inflammatory agent through regulating NF-κB activity and reducing the secretion of NF-κB-mediated cytokines/chemokines.

  7. ANKRD1 modulates inflammatory responses in C2C12 myoblasts through feedback inhibition of NF-κB signaling activity

    International Nuclear Information System (INIS)

    Liu, Xin-Hua; Bauman, William A.; Cardozo, Christopher

    2015-01-01

    Transcription factors of the nuclear factor-kappa B (NF-κB) family play a pivotal role in inflammation, immunity and cell survival responses. Recent studies revealed that NF-κB also regulates the processes of muscle atrophy. NF-κB activity is regulated by various factors, including ankyrin repeat domain 2 (AnkrD2), which belongs to the muscle ankyrin repeat protein family. Another member of this family, AnkrD1 is also a transcriptional effector. The expression levels of AnkrD1 are highly upregulated in denervated skeletal muscle, suggesting an involvement of AnkrD1 in NF-κB mediated cellular responses to paralysis. However, the molecular mechanism underlying the interactive role of AnkrD1 in NF-κB mediated cellular responses is not well understood. In the current study, we examined the effect of AnkrD1 on NF-κB activity and determined the interactions between AnkrD1 expression and NF-κB signaling induced by TNFα in differentiating C2C12 myoblasts. TNFα upregulated AnkrD1 mRNA and protein levels. AnkrD1-siRNA significantly increased TNFα-induced transcriptional activation of NF-κB, whereas overexpression of AnkrD1 inhibited TNFα-induced NF-κB activity. Co-immunoprecipitation studies demonstrated that AnkrD1 was able to bind p50 subunit of NF-κB and vice versa. Finally, CHIP assays revealed that AnkrD1 bound chromatin at a NF-κB binding site in the AnrkD2 promoter and required NF-κB to do so. These results provide evidence of signaling integration between AnkrD1 and NF-κB pathways, and suggest a novel anti-inflammatory role of AnkrD1 through feedback inhibition of NF-κB transcriptional activity by which AnkrD1 modulates the balance between physiological and pathological inflammatory responses in skeletal muscle. - Highlights: • AnkrD1 is upregulated by TNFα and represses NF-κB-induced transcriptional activity. • AnkrD1 binds to p50 subunit of NF-κB and is recruited to NF-κB bound to chromatin. • AnkrD1 mediates a feed-back inhibitory loop

  8. ANKRD1 modulates inflammatory responses in C2C12 myoblasts through feedback inhibition of NF-κB signaling activity

    Energy Technology Data Exchange (ETDEWEB)

    Liu, Xin-Hua [National Center of Excellence for the Medical Consequences of Spinal Cord Injury, James J. Peter VA Medical Center, Bronx, NY 10468 (United States); Department of Medicine, Icahn School of Medicine at Mount Sinai, New York, NY 10029 (United States); Bauman, William A. [National Center of Excellence for the Medical Consequences of Spinal Cord Injury, James J. Peter VA Medical Center, Bronx, NY 10468 (United States); Department of Medicine, Icahn School of Medicine at Mount Sinai, New York, NY 10029 (United States); Department of Rehabilitation Medicine, Icahn School of Medicine at Mount Sinai, New York, NY 10029 (United States); Cardozo, Christopher, E-mail: chris.cardozo@va.gov [National Center of Excellence for the Medical Consequences of Spinal Cord Injury, James J. Peter VA Medical Center, Bronx, NY 10468 (United States); Department of Medicine, Icahn School of Medicine at Mount Sinai, New York, NY 10029 (United States); Department of Rehabilitation Medicine, Icahn School of Medicine at Mount Sinai, New York, NY 10029 (United States); Department of Pharmacology and Systems Therapeutics, Icahn School of Medicine at Mount Sinai, New York, NY 10029 (United States)

    2015-08-14

    Transcription factors of the nuclear factor-kappa B (NF-κB) family play a pivotal role in inflammation, immunity and cell survival responses. Recent studies revealed that NF-κB also regulates the processes of muscle atrophy. NF-κB activity is regulated by various factors, including ankyrin repeat domain 2 (AnkrD2), which belongs to the muscle ankyrin repeat protein family. Another member of this family, AnkrD1 is also a transcriptional effector. The expression levels of AnkrD1 are highly upregulated in denervated skeletal muscle, suggesting an involvement of AnkrD1 in NF-κB mediated cellular responses to paralysis. However, the molecular mechanism underlying the interactive role of AnkrD1 in NF-κB mediated cellular responses is not well understood. In the current study, we examined the effect of AnkrD1 on NF-κB activity and determined the interactions between AnkrD1 expression and NF-κB signaling induced by TNFα in differentiating C2C12 myoblasts. TNFα upregulated AnkrD1 mRNA and protein levels. AnkrD1-siRNA significantly increased TNFα-induced transcriptional activation of NF-κB, whereas overexpression of AnkrD1 inhibited TNFα-induced NF-κB activity. Co-immunoprecipitation studies demonstrated that AnkrD1 was able to bind p50 subunit of NF-κB and vice versa. Finally, CHIP assays revealed that AnkrD1 bound chromatin at a NF-κB binding site in the AnrkD2 promoter and required NF-κB to do so. These results provide evidence of signaling integration between AnkrD1 and NF-κB pathways, and suggest a novel anti-inflammatory role of AnkrD1 through feedback inhibition of NF-κB transcriptional activity by which AnkrD1 modulates the balance between physiological and pathological inflammatory responses in skeletal muscle. - Highlights: • AnkrD1 is upregulated by TNFα and represses NF-κB-induced transcriptional activity. • AnkrD1 binds to p50 subunit of NF-κB and is recruited to NF-κB bound to chromatin. • AnkrD1 mediates a feed-back inhibitory loop

  9. U-Bang-Haequi Tang: A Herbal Prescription that Prevents Acute Inflammation through Inhibition of NF-κB-Mediated Inducible Nitric Oxide Synthase

    Directory of Open Access Journals (Sweden)

    Min Hwangbo

    2014-01-01

    Full Text Available Since antiquity, medical herbs have been prescribed for both treatment and preventative purposes. Herbal formulas are used to reduce toxicity as well as increase efficacy in traditional Korean medicine. U-bang-haequi tang (UBT is a herbal prescription containing Arctii fructus and Forsythia suspensa as its main components and has treated many human diseases in traditional Korean medicine. This research investigated the effects of UBT against an acute phase of inflammation. For this, we measured induction of nitric oxide (NO and related proteins in macrophage cell line stimulated by lipopolysaccharide (LPS. Further, paw swelling was measured in carrageenan-treated rats. Carrageenan significantly induced activation of inflammatory cells and increases in paw volume, whereas oral administration of 0.3 or 1 g/kg/day of UBT inhibited the acute inflammatory response. In RAW264.7 cells, UBT inhibited mRNA and protein expression levels of iNOS. UBT treatment also blocked elevation of NO production, nuclear translocation of NF-κB, phosphorylation of Iκ-Bα induced by LPS. Moreover, UBT treatment significantly blocked the phosphorylation of p38 and c-Jun NH2-terminal kinases by LPS. In conclusion, UBT prevented both acute inflammation in rats as well as LPS-induced NO and iNOS gene expression through inhibition of NF-κB in RAW264.7 cells.

  10. Bergenin, Acting as an Agonist of PPARγ, Ameliorates Experimental Colitis in Mice through Improving Expression of SIRT1, and Therefore Inhibiting NF-κB-Mediated Macrophage Activation

    Directory of Open Access Journals (Sweden)

    Kai Wang

    2018-01-01

    Full Text Available Bergenin, isolated from the herb of Saxifraga stolonifera Curt. (Hu-Er-Cao, has anti-inflammatory, antitussive and wound healing activities. The aim of the present study was to identify the effect of bergenin on experimental colitis, and explored the related mechanisms. Our results showed that oral administration of bergenin remarkably alleviated disease symptoms of mice with dextran sulfate sodium (DSS-induced colitis, evidenced by reduced DAI scores, shortening of colon length, MPO activity and pathologic abnormalities in colons. Bergenin obviously inhibited the mRNA and protein expressions of IL-6 and TNF-α in colon tissues, but not that of mucosal barrier-associated proteins occludin, E-cadherin and MUC-2. In vitro, bergenin significantly inhibited the expressions of IL-6 and TNF-α as well as nuclear translocation and DNA binding activity of NF-κB-p65 in lipopolysaccharide (LPS-stimulated peritoneal macrophages and RAW264.7 cells, which was almost reversed by addition of PPARγ antagonist GW9662 and siPPARγ. Subsequently, bergenin was identified as a PPARγ agonist. It could enter into macrophages, bind with PPARγ, promote nuclear translocation and transcriptional activity of PPARγ, and increase mRNA expressions of CD36, LPL and ap2. In addition, bergenin significantly up-regulated expression of SIRT1, inhibited acetylation of NF-κB-p65 and increased association NF-κB-p65 and IκBα. Finally, the correlation between activation of PPARγ and attenuation of colitis, inhibition of IL-6 and TNF-α expressions, NF-κB-p65 acetylation and nuclear translocation, and up-regulation of SIRT1 expression by bergenin was validated in mice with DSS-induced colitis and/or LPS-stimulated macrophages. In summary, bergenin could ameliorate colitis in mice through inhibiting the activation of macrophages via regulating PPARγ/SIRT1/NF-κB-p65 pathway. The findings can provide evidence for the further development of bergenin as an anti-UC drug, and

  11. Different effects of antisense RelA p65 and NF-κB1 p50 oligonucleotides on the nuclear factor-κB mediated expression of ICAM-1 in human coronary endothelial and smooth muscle cells

    Directory of Open Access Journals (Sweden)

    Both Anton

    2001-08-01

    Full Text Available Abstract Background Activation of nuclear factor-κB (NF-κB is one of the key events in early atherosclerosis and restenosis. We hypothesized that tumor necrosis factor-α (TNF-α induced and NF-κB mediated expression of intercellular adhesion molecule-1 (ICAM-1 can be inhibited by antisense RelA p65 and NF-κB1 p50 oligonucleotides (RelA p65 and NF-κB1 p50. Results Smooth muscle cells (SMC from human coronary plaque material (HCPSMC, plaque material of 52 patients, SMC from the human coronary media (HCMSMC, human endothelial cells (EC from umbilical veins (HUVEC, and human coronary EC (HCAEC were successfully isolated (HCPSMC, HUVEC, identified and cultured (HCPSMC, HCMSMC, HUVEC, HCAEC. 12 hrs prior to TNF-α stimulus (20 ng/mL, 6 hrs RelA p65 and NF-κB1 p50 (1, 2, 4, 10, 20, and 30 μM and controls were added for a period of 18 hrs. In HUVEC and HCAEC there was a dose dependent inhibition of ICAM-1 expression after adding of both RelA p65 and NF-κB1 p50. No inhibitory effect was seen after incubation of HCMSMC with RelA p65 and NF-κB1 p50. A moderate inhibition of ICAM-1 expression was found after simultaneous addition of RelA p65 and NF-κB1 p50 to HCPSMC, no inhibitory effect was detected after individual addition of RelA p65 and NF-κB1 p50. Conclusions The data point out that differences exist in the NF-κB mediated expression of ICAM-1 between EC and SMC. Experimental antisense strategies directed against RelA p65 and NF-κB1 p50 in early atherosclerosis and restenosis are promising in HCAEC but will be confronted with redundant pathways in HCMSMC and HCPSMC.

  12. Diclofenac pretreatment effects on the toll-like receptor 4/nuclear factor kappa B-mediated inflammatory response to eccentric exercise in rat liver.

    Science.gov (United States)

    Barcelos, Rômulo Pillon; Bresciani, Guilherme; Rodriguez-Miguelez, Paula; Cuevas, Maria José; Soares, Félix Alexandre Antunes; Barbosa, Nilda Vargas; González-Gallego, Javier

    2016-03-01

    Acute exercise is a stress stimulus that may cause cell damage through the activation of the toll-like receptor (TLR)4 pathway, resulting in the translocation of nuclear factor kappa B (NF-κB) into the cell nucleus and the upregulation of inflammatory genes. Nonsteroidal anti-inflammatory drugs, such as diclofenac, are often prescribed to counteract exercise-induced inflammation. This study analyzed effects of diclofenac pretreatment on the TLR4/NF-κB pathway in rat liver after an acute eccentric exercise. Twenty male Wistar rats were divided in four groups: control-saline, control-diclofenac, exercise-saline and exercise-diclofenac. The rats received saline or diclofenac (10mg/kg) for 7days prior to an eccentric exercise bout. After exercise there was an increase in TLR4, myeloid differentiation primary response gene 88 (MyD88), TIR domain-containing adaptor inducing interferon (TRIF) and p65 NF-κB subunit protein levels. Exercise also resulted in increased mRNA and protein expression of interleukin (IL)-6, inducible nitric oxide synthase (iNOS) and tumor necrosis factor (TNF)-α. Proinflammatory effects of exercise were prevented by the administration of diclofenac, which blunted the activation of the TLR4/NF-κB pathway and the inflammatory response in the liver of exercised rats. Results from the present study highlight the role of TLR4 as a target for anti-inflammatory interventions. Copyright © 2016 Elsevier Inc. All rights reserved.

  13. Anti-inflammatory effects of escin are correlated with the glucocorticoid receptor/NF-κB signaling pathway, but not the COX/PGF2α signaling pathway.

    Science.gov (United States)

    Wang, Hongsheng; Zhang, Leiming; Jiang, Na; Wang, Zhenhua; Chong, Yating; Fu, Fenghua

    2013-08-01

    In China, escin has been widely used in the clinic as a potent anti-inflammatory drug. Previous studies have indicated that escin exerts its anti-inflammatory effect by enhancing the release of glucocorticoids (GCs) and prostaglandin-F2α (PGF2α), and this has been documented in the drug description. However, our previous studies demonstrated that escin did not increase the secretion of GCs, but instead elevated the protein expression of the GC receptor (GR), which may have repressed nuclear factor (NF)-κB-mediated gene expression. The aim of this study was to determine the functions of NF-κB and PGF2α with regard to the anti-inflammatory effect of escin. We investigated the anti-inflammatory effects of dexamethasone, diclofenac and escin against carrageenan-induced paw edema in rats, and observed that escin exerted a GC-like anti-inflammatory effect. In addition, we studied the role of PGF2α in the anti-inflammatory effect exerted by escin in an acetic acid-induced capillary permeability model in mice. The results revealed that the coadministration of escin and diclofenac, a potent prostaglandin-synthesis inhibitor, did not affect the anti-inflammatory effect of escin. Furthermore, we investigated the function of NF-κB with regard to the anti-inflammatory effect exerted by escin in lipopolysaccharide (LPS)-treated mice, and demonstrated that escin significantly inhibited the expression of NF-κB. These results suggest that escin has a GC-like anti-inflammatory effect, and that its mechanisms may be correlated with the GC receptor/NF-κB signaling pathway, but not the COX/PGF2α signaling pathway.

  14. Insights into iron and nuclear factor-kappa B (NF-kappaB) involvement in chronic inflammatory processes in peritoneal endometriosis.

    Science.gov (United States)

    Defrère, Sylvie; González-Ramos, Reinaldo; Lousse, Jean-Christophe; Colette, Sébastien; Donnez, Olivier; Donnez, Jacques; Van Langendonckt, Anne

    2011-08-01

    Endometriosis is a chronic pelvic inflammatory process. Local inflammation is known to play a role in pain and infertility associated with the disease, and may be extensively involved in molecular and cellular processes leading to endometriosis development. In this review, we focus on two inflammatory mediators clearly implicated in the pathogenesis of endometriosis, iron and NF-kappaB, and their potential association. Iron is essential for all living organisms, but excess iron results in toxicity and is linked to pathological disorders. In endometriosis patients, iron overload has been demonstrated in the different compartments of the peritoneal cavity (peritoneal fluid, endometriotic lesions, peritoneum and macrophages). This iron overload affects numerous mechanisms involved in endometriosis development. Moreover, iron can generate free radical species able to react with a wide range of cellular constituents, inducing cellular damage. Overproduction of reactive oxygen species also impairs cellular function by altering gene expression via regulation of redox-sensitive transcription factors such as NF-kappaB, which is clearly implicated in endometriosis. Indeed, NF-kappaB is activated in endometriotic lesions and peritoneal macrophages of endometriosis patients, which stimulates synthesis of proinflammatory cytokines, generating a positive feedback loop in the NF-kappaB pathway. NF-kappaB-mediated gene transcription promotes a variety of processes, including endometriotic lesion establishment, maintenance and development. In conclusion, iron and NF-kappaB appear to be linked and both are clearly involved in endometriosis development, making these pathways an attractive target for future treatment and prevention of this disease.

  15. Nuclear factor kappaB-mediated down-regulation of adhesion molecules: possible mechanism for inhibitory activity of bigelovin against inflammatory monocytes adhesion to endothelial cells.

    Science.gov (United States)

    Nam, Kung-Woo; Oh, Goo Taeg; Seo, Eun-Kyoung; Kim, Kyeong Ho; Koo, Uk; Lee, Sung-Jin; Mar, Woongchon

    2009-06-22

    The flowers of Inula britannica L. var. chinensis (Rupr.) Reg. (Compositae) are used in traditional medicine to treat asthma, chronic bronchitis, and acute pleurisy in China and Korea. However, the pharmacological actions of Inula britannica L. var. chinensis on endothelial cells and inflammatory monocytes are not clear. In this study, we investigated whether bigelovin, a sesquiterpene lactone isolated from the flowers of Inula britannica L. var. chinensis, inhibits monocyte adhesion and adhesion molecule expression in brain endothelial cells. We measured tumor necrosis factor-alpha (TNF-alpha)-enhanced Raw264.7 monocyte binding to brain endothelial cells and the levels of cell adhesion molecules, including vascular adhesion molecule-1 (VCAM-1), intracellular adhesion molecule-1 (ICAM-1), and endothelial-selectin (E-selectin) on the surface of brain endothelial cells. Bigelovin significantly inhibited these in a dose-dependent manner without affecting cell viability. Furthermore, bigelovin suppressed the nuclear factor kappaB (NF-kappaB) promoter-driven luciferase activity, NF-kappaB activation, and degradation of NF-kappaB inhibitor protein alpha (IkappaBalpha). These results indicate that bigelovin inhibits inflammatory monocyte adhesion to endothelial cells and the expression of VCAM-1, ICAM-1, and E-selectin by blocking IkappaBalpha degradation and NF-kappaB activation.

  16. IFN-γ sensitizes MIN6N8 insulinoma cells to TNF-α-induced apoptosis by inhibiting NF-κB-mediated XIAP upregulation

    International Nuclear Information System (INIS)

    Kim, Hun Sik; Kim, Sunshin; Lee, Myung-Shik

    2005-01-01

    Although X-linked inhibitor of apoptosis protein (XIAP) is an important intracellular suppressor of apoptosis in a variety of cell types, its role in cytokine-induced pancreatic β-cell apoptosis remains unclear. Here, we found that: (i) XIAP level was inversely correlated with tumor necrosis factor (TNF)-α-induced apoptosis in MIN6N8 insulinoma cells; (ii) adenoviral XIAP overexpression abrogated the TNF-α-induced apoptosis through inhibition of caspase activity; (iii) downregulation of XIAP by antisense oligonucleotide or Smac peptide sensitized MIN6N8 cells to TNF-α-induced apoptosis; (iv) XIAP expression was induced by TNF-α through a nuclear factor-κB (NF-κB)-dependent pathway, and interferon (IFN)-γ prevented such an induction in a manner independent of NF-κB, which presents a potential mechanism underlying cytotoxic IFN-γ/TNF-α synergism. Taken together, our results suggest that XIAP is an important modulator of TNF-α-induced apoptosis of MIN6N8 cells, and XIAP regulation in pancreatic β-cells might play an important role in pancreatic β-cell apoptosis and in the pathogenesis of type 1 diabetes

  17. Helicobacter pylori antigen HP0986 (TieA) interacts with cultured gastric epithelial cells and induces IL8 secretion via NF-κB mediated pathway.

    Science.gov (United States)

    Devi, Savita; Ansari, Suhail A; Vadivelu, Jamuna; Mégraud, Francis; Tenguria, Shivendra; Ahmed, Niyaz

    2014-02-01

    The envisaged roles and partly understood functional properties of Helicobacter pylori protein HP0986 are significant in the context of proinflammatory and or proapoptotic activities, the two important facilitators of pathogen survival and persistence. In addition, sequence analysis of this gene predicts a restriction endonuclease function which remained unknown thus far. To evaluate the role of HP0986 in gastric inflammation, we studied its expression profile using a large number of clinical isolates but a limited number of biopsies and patient sera. Also, we studied antigenic role of HP0986 in altering cytokine responses of human gastric epithelial (AGS) cells including its interaction with and localization within the AGS cells. For in vitro expression study of HP0986, 110 H. pylori clinical isolates were cultured from patients with functional dyspepsia. For expression analysis by qRT PCR of HP0986, 10 gastric biopsy specimens were studied. HP0986 was also used to detect antibodies in patient sera. AGS cells were incubated with recombinant HP0986 to determine cytokine response and NF-κB activation. Transient transfection with HP0986 cloned in pEGFPN1 was used to study its subcellular localization or homing in AGS cells. Out of 110 cultured H. pylori strains, 34 (31%) were positive for HP0986 and this observation was correlated with in vitro expression profiles. HP0986 mRNA was detected in 7 of the 10 biopsy specimens. Further, HP0986 induced IL-8 secretion in gastric epithelial cells in a dose and time-dependent manner via NF-κB pathway. Serum antibodies against HP0986 were positively associated with H. pylori positive patients. Transient transfection of AGS cells revealed both cytoplasmic and nuclear localization of HP0986. HP0986 was moderately prevalent in clinical isolates and its expression profile in cultures and gastric biopsies points to its being naturally expressed. Collective observations including the induction of IL-8 via TNFR1 and NF

  18. An NF-κB-microRNA regulatory network tunes macrophage inflammatory responses.

    Science.gov (United States)

    Mann, Mati; Mehta, Arnav; Zhao, Jimmy L; Lee, Kevin; Marinov, Georgi K; Garcia-Flores, Yvette; Baltimore, David

    2017-10-11

    The innate inflammatory response must be tightly regulated to ensure effective immune protection. NF-κB is a key mediator of the inflammatory response, and its dysregulation has been associated with immune-related malignancies. Here, we describe a miRNA-based regulatory network that enables precise NF-κB activity in mouse macrophages. Elevated miR-155 expression potentiates NF-κB activity in miR-146a-deficient mice, leading to both an overactive acute inflammatory response and chronic inflammation. Enforced miR-155 expression overrides miR-146a-mediated repression of NF-κB activation, thus emphasizing the dominant function of miR-155 in promoting inflammation. Moreover, miR-155-deficient macrophages exhibit a suboptimal inflammatory response when exposed to low levels of inflammatory stimuli. Importantly, we demonstrate a temporal asymmetry between miR-155 and miR-146a expression during macrophage activation, which creates a combined positive and negative feedback network controlling NF-κB activity. This miRNA-based regulatory network enables a robust yet time-limited inflammatory response essential for functional immunity.MicroRNAs (miR) are important regulators of gene transcription, with miR-155 and miR-146a both implicated in macrophage activation. Here the authors show that NF-κB signalling, miR-155 and miR-146a form a complex network of cross-regulations to control gene transcription in macrophages for modulating inflammatory responses.

  19. Rho iso-alpha acids from hops inhibit the GSK-3/NF-κB pathway and reduce inflammatory markers associated with bone and cartilage degradation

    Directory of Open Access Journals (Sweden)

    Bland Jeffrey S

    2009-08-01

    Full Text Available Abstract Background Rho iso-alpha acids (RIAA from hops have been shown to have anti-inflammatory properties. To understand the mechanisms, we evaluated the effect of RIAA in cell signaling pathways and inflammatory markers using various in vitro models. We also investigated their therapeutic effect in mice with collagen-induced arthritis. Methods The LPS-stimulated RAW 264.7 macrophages were used to evaluate the effect of RIAA on the NF-κB and MAPK signaling pathways; phosphorylation of ERK1/2, p38 and JNK was assessed by western blotting and NF-κB binding by electrophoretic mobility shift assays. Effect on the NF-κB activity was evaluated by the luciferase reporter assays in LPS-stimulated RAW 264.7 cells. GSK-3α/β kinase activity was measured in cell-free assays. The inhibitory effect of RIAA on inflammatory markers was assessed by measuring nitric oxide in LPS-stimulated RAW 264.7 cells, RANKL-mediated TRAP activity in transformed osteoclasts, and TNF-α/IL-1β-mediated MMP-13 expression in SW1353 cells. Mice with collagen-induced arthritis were fed with RIAA for 2 weeks. Symptoms of joint swelling, arthritic index and joint damage were assessed. Results RIAA selectively inhibited the NF-κB pathway while having no effect on ERK1/2, p38 and JNK phosphorylation in LPS-stimulated RAW 264.7 cells. RIAA also inhibited GSK-3α/β kinase activity and GSK-3β dependent phosphorylation of β-catenin in RAW 264.7 cells. In addition, RIAA inhibited NF-κB-mediated inflammatory markers in various cell models, including nitric oxide in LPS-stimulated RAW 264.7 cells, RANKL-mediated TRAP activity in transformed osteoclasts, and TNF-α/IL-1β-mediated MMP-13 expression in SW1353 human chondrosarcoma cells. Finally, in a mouse model of collagen-induced arthritis, RIAA ameliorated joint damage as evidenced by significant reduction of the arthritis index and histology score; at 250 mg/kg-body weight, RIAA had efficacy similar to that of 20 mg

  20. Potent anti-inflammatory activity of ursolic acid, a triterpenoid antioxidant, is mediated through suppression of NF-κB, AP-1 and NF-AT.

    Directory of Open Access Journals (Sweden)

    Rahul Checker

    Full Text Available BACKGROUND: Ursolic acid (UA, a pentacyclic triterpenoid carboxylic acid, is the major component of many plants including apples, basil, cranberries, peppermint, rosemary, oregano and prunes and has been reported to possess antioxidant and anti-tumor properties. These properties of UA have been attributed to its ability to suppress NF-κB (nuclear factor kappa B activation. Since NF-κB, in co-ordination with NF-AT (nuclear factor of activated T cells and AP-1(activator protein-1, is known to regulate inflammatory genes, we hypothesized that UA might exhibit potent anti-inflammatory effects. METHODOLOGY/PRINCIPAL FINDINGS: The anti-inflammatory effects of UA were assessed in activated T cells, B cells and macrophages. Effects of UA on ERK, JNK, NF-κB, AP-1 and NF-AT were studied to elucidate its mechanism of action. In vivo efficacy of UA was studied using mouse model of graft-versus-host disease. UA inhibited activation, proliferation and cytokine secretion in T cells, B cells and macrophages. UA inhibited mitogen-induced up-regulation of activation markers and co-stimulatory molecules in T and B cells. It inhibited mitogen-induced phosphorylation of ERK and JNK and suppressed the activation of immunoregulatory transcription factors NF-κB, NF-AT and AP-1 in lymphocytes. Treatment of cells with UA prior to allogenic transplantation significantly delayed induction of acute graft-versus-host disease in mice and also significantly reduced the serum levels of pro-inflammatory cytokines IL-6 and IFN-γ. UA treatment inhibited T cell activation even when added post-mitogenic stimulation demonstrating its therapeutic utility as an anti-inflammatory agent. CONCLUSIONS/SIGNIFICANCE: The present study describes the detailed mechanism of anti-inflammatory activity of UA. Further, UA may find application in the treatment of inflammatory disorders.

  1. Ubiquitination regulation of inflammatory responses through NF-κB pathway.

    Science.gov (United States)

    Wu, Yunbing; Kang, Jingjing; Zhang, Lu; Liang, Zhaofeng; Tang, Xudong; Yan, Yongmin; Qian, Hui; Zhang, Xu; Xu, Wenrong; Mao, Fei

    2018-01-01

    The development of inflammation is mutually affected with damaged DNA and the abnormal expression of protein modification. Ubiquitination, a way of protein modification, plays a key role in regulating various biological functions including inflammation responses. The ubiquitin enzymes and deubiquitinating enzymes (DUBs) jointly control the ubiquitination. The fact that various ubiquitin linkage chains control the fate of the substrate suggests that the regulatory mechanisms of ubiquitin enzymes are central for ubiquitination. In inflammation diseases, the pro-inflammatory transcription factor NF-κB regulates transcription of pro-labour mediators in response to inflammatory stimuli and expression of numerous genes that control inflammation which is associated with ubiquitination. The ubiquitination regulates NF-κB signaling pathway with many receptor families, including NOD-like receptors (NLR), Toll-like receptors (TLR) and RIG-I-like receptors (RLR), mainly by K63-linked polyubiquitin chains. In this review, we highlight the study of ubiquitination in the inflammatory signaling pathway including NF-κB signaling regulated by ubiquitin enzymes and DUBs. Furthermore, it is emphasized that the interaction of ubiquitin-mediated inflammatory signaling system accurately regulates the inflammatory responses.

  2. Histamine Induces Bovine Rumen Epithelial Cell Inflammatory Response via NF-κB Pathway.

    Science.gov (United States)

    Sun, Xudong; Yuan, Xue; Chen, Liang; Wang, Tingting; Wang, Zhe; Sun, Guoquan; Li, Xiaobing; Li, Xinwei; Liu, Guowen

    2017-01-01

    Subacute ruminal acidosis (SARA) is a common disease in high-producing lactating cows. Rumenitis is the initial insult of SARA and is associated with the high concentrations of histamine produced in the rumen of dairy cows during SARA. However, the exact mechanism remains unclear. The objective of the current study is to investigate whether histamine induces inflammation of rumen epithelial cells and the underlying mechanism of this process. Bovine rumen epithelial cells were cultured and treated with different concentrations of histamine and pyrrolidine dithiocarbamate (PDTC, an NF-κB inhibitor) cultured in different pH medium (pH 7.2 or 5.5). qRT-PCR, Western-blotting, ELISA and immunocytofluorescence were used to evaluate whether histamine activated the NF-κB pathway and inflammatory cytokines. The results showed that histamine significantly increased the activity of IKK β and the phosphorylation levels of IκB α, as well as upregulated the mRNA and protein expression levels of NF-κB p65 in the rumen epithelial cells cultured in neutral (pH=7.2) and acidic (pH=5.5) medium. Furthermore, histamine treatment also significantly increased the transcriptional activity of NF-κB p65. High expression and transcriptional activity of NF-κB p65 significantly increased the mRNA expressions and concentrations of inflammatory cytokines, tumor necrosis factor alpha (TNF-α), interleukin 6 (IL-6) and interleukin 1 beta (IL-1β), thereby inducing the inflammatory response in bovine rumen epithelial cells. However, inhibition of NF-κB p65 by PDTC significantly decreased the expressions and concentrations of the inflammatory cytokines induced by histamine in the rumen epithelial cells cultured in the neutral and acidic medium. The present data indicate that histamine induces the inflammatory response of bovine rumen epithelial cells through the NF-κB pathway. © 2017 The Author(s). Published by S. Karger AG, Basel.

  3. Metalloprotease NleC suppresses host NF-κB/inflammatory responses by cleaving p65 and interfering with the p65/RPS3 interaction.

    Directory of Open Access Journals (Sweden)

    Andrea Hodgson

    2015-03-01

    Full Text Available Attaching/Effacing (A/E pathogens including enteropathogenic Escherichia coli (EPEC, enterohemorrhagic E. coli (EHEC and the rodent equivalent Citrobacter rodentium are important causative agents of foodborne diseases. Upon infection, a myriad of virulence proteins (effectors encoded by A/E pathogens are injected through their conserved type III secretion systems (T3SS into host cells where they interfere with cell signaling cascades, in particular the nuclear factor kappaB (NF-κB signaling pathway that orchestrates both innate and adaptive immune responses for host defense. Among the T3SS-secreted non-LEE-encoded (Nle effectors, NleC, a metalloprotease, has been recently elucidated to modulate host NF-κB signaling by cleaving NF-κB Rel subunits. However, it remains elusive how NleC recognizes NF-κB Rel subunits and how the NleC-mediated cleavage impacts on host immune responses in infected cells and animals. In this study, we show that NleC specifically targets p65/RelA through an interaction with a unique N-terminal sequence in p65. NleC cleaves p65 in intestinal epithelial cells, albeit a small percentage of the molecule, to generate the p65¹⁻³⁸ fragment during C. rodentium infection in cultured cells. Moreover, the NleC-mediated p65 cleavage substantially affects the expression of a subset of NF-κB target genes encoding proinflammatory cytokines/chemokines, immune cell infiltration in the colon, and tissue injury in C. rodentium-infected mice. Mechanistically, the NleC cleavage-generated p65¹⁻³⁸ fragment interferes with the interaction between p65 and ribosomal protein S3 (RPS3, a 'specifier' subunit of NF-κB that confers a subset of proinflammatory gene transcription, which amplifies the effect of cleaving only a small percentage of p65 to modulate NF-κB-mediated gene expression. Thus, our results reveal a novel mechanism for A/E pathogens to specifically block NF-κB signaling and inflammatory responses by cleaving a

  4. Roles of Pannexin-1 Channels in Inflammatory Response through the TLRs/NF-Kappa B Signaling Pathway Following Experimental Subarachnoid Hemorrhage in Rats

    Directory of Open Access Journals (Sweden)

    Ling-Yun Wu

    2017-06-01

    Full Text Available Background: Accumulating evidence suggests that neuroinflammation plays a critical role in early brain injury after subarachnoid hemorrhage (SAH. Pannexin-1 channels, as a member of gap junction proteins located on the plasma membrane, releases ATP, ions, second messengers, neurotransmitters, and molecules up to 1 kD into the extracellular space, when activated. Previous studies identified that the opening of Pannexin-1 channels is essential for cellular migration, apoptosis and especially inflammation, but its effects on inflammatory response in SAH model have not been explored yet.Methods: Adult male Sprague-Dawley rats were divided into six groups: sham group (n = 20, SAH group (n = 20, SAH + LV-Scramble-ShRNA group (n = 20, SAH + LV-ShRNA-Panx1 group (n = 20, SAH + LV-NC group (n = 20, and SAH + LV-Panx1-EGFP group (n = 20. The rat SAH model was induced by injection of 0.3 ml fresh arterial, non-heparinized blood into the prechiasmatic cistern in 20 s. In SAH + LV-ShRNA-Panx1 group and SAH + LV-Panx1-EGFP group, lentivirus was administered via intracerebroventricular injection (i.c.v. at 72 h before the induction of SAH. The Quantitative real-time polymerase chain reaction, electrophoretic mobility shift assay, enzyme-linked immunosorbent assay, immunofluorescence staining, and western blotting were performed to explore the potential interactive mechanism between Pannexin-1 channels and TLR2/TLR4/NF-κB-mediated signaling pathway. Cognitive and memory changes were investigated by the Morris water maze test.Results: Administration with LV-ShRNA-Panx1 markedly decreased the expression levels of TLR2/4/NF-κB pathway-related agents in the brain cortex and significantly ameliorated neurological cognitive and memory deficits in this SAH model. On the contrary, administration of LV-Panx1-EGFP elevated the expressions of TLR2/4/NF-κB pathway-related agents, which correlated with augmented neuronal apoptosis.Conclusion: Pannexin-1 channels may

  5. Inflammatory and catabolic signalling in intervertebral discs: The roles of NF-B and MAP Kinases

    OpenAIRE

    K Wuertz; N Vo; D Kletsas; N Boos

    2012-01-01

    Painful intervertebral disc disease is characterised not only by an imbalance between anabolic (i.e., matrix synthesis) and catabolic (i.e., matrix degradation) processes, but also by inflammatory mechanisms. The increased expression and synthesis of matrix metalloproteinases and inflammatory factors is mediated by specific signal transduction, in particular the nuclear factor-kappaB (NF-kB) and mitogen-activated protein kinase (MAPK)-mediated pathways. NF-kB and MAPK have been identified as ...

  6. Nuclear factor kB (NF-KB): signalosoma and its importance in cancer and inflammatories diseases

    International Nuclear Information System (INIS)

    Echeverri, Nancy P; Mockus, Ismena S

    2008-01-01

    The nuclear factor B (NF- B) is a dimer conformed by Rel family. NF- B is found in cytoplasm bound to inhibitor proteins (I B). I B are phosphorylated by different kinases who are part of signalosome as IeB kinases (IKK , IKK and NF- B essential modulator or NEMO), the mitogenic activated protein kinase (MAPK or p38) and NF-eB inducer kinase (NIK). These kinases are activated by different cytokines and ultraviolet light, I B phosphorylated induce their ubiquitination and proteosome degradation subsequently NF- B release and nucleus translocation. Nowadays, the NF- B activation by oxidative stress, genotoxic stress and DNA damage pathways. In contrast with the classical pathway, in this pathway there are a SUMOilation and nuclear translocation of NEMO. In nucleus NEMO interact with ataxia telangiectasia muted which is activated by chromatin changes and DNA damage. The complex ATM/NEMO is later translocated to cytoplasm where IKK is phosphorylated by ATM bringing to ubiquitination and thus NF- B releasing which is translocated to nucleus. NF- B induces survival rising antioxidants enzymes as superoxide dismutase, catalase and glutathione. These enzymes act in the control of oxidative species levels in the cell. NF- B over expression is related with inflammation and cancer. Nowadays, is development a pharmacological search which can act inhibiting NF- B signalosome molecules, not only to inflammatory disease whereas to radiotherapy and chemotherapy cancer resistance.

  7. A novel macrolide solithromycin exerts superior anti-inflammatory effect via NF-κB inhibition.

    Science.gov (United States)

    Kobayashi, Yoshiki; Wada, Hiroo; Rossios, Christos; Takagi, Dai; Higaki, Manabu; Mikura, Shin'ichiro; Goto, Hajime; Barnes, Peter J; Ito, Kazuhiro

    2013-04-01

    Macrolides are reported to reduce exacerbation of chronic inflammatory respiratory disease, such as chronic obstructive pulmonary disease (COPD), and also show anti-inflammatory effects in vitro and in vivo. However the anti-inflammatory efficacies of current macrolides are relatively weak. Here we found that a novel macrolide/fluoroketolide solithromycin (CEM-101) showed superior anti-inflammatory effects to macrolides in current clinical use. The effects of solithromycin (SOL) on lipopolysaccharide-induced TNFα (tumor necrosis factor α) and/or CXCL8 (C-X-C motif chemokine ligand 8; interleukin-8) release, phorbol 12-myristate 13-acetate-induced MMP9 (matrix metalloproteinase 9) activity and NF-κB (nuclear factor-κB) activity under conditions of oxidative stress have been evaluated and compared with the effects of erythromycin, clarithromycin, azithromycin, and telithromycin in macrophage-like PMA-differentiated U937 cells and peripheral blood mononuclear cells (PBMC) obtained from COPD patients. We also examined effect of SOL on cigarette smoke-induced airway inflammation in mice. SOL exerted superior inhibitory effects on TNFα/CXCL8 production and MMP9 activity in monocytic U937 cells. In addition, SOL suppressed TNFα release and MMP9 activity in PBMC from COPD patients at 10 µM, which is 10 times more potent than the other macrolides tested. Activated NF-κB by oxidative stress was completely reversed by SOL. SOL also inhibited cigarette smoke-induced neutrophilia and pro-MMP9 production in vivo, although erythromycin did not inhibit them. Thus, SOL showed better anti-inflammatory profiles compared with macrolides currently used in the clinic and may be a promising anti-inflammatory and antimicrobial macrolide for the treatment of COPD in future.

  8. Dexmedetomidine Inhibits Inflammatory Reaction in Lung Tissues of Septic Rats by Suppressing TLR4/NF-κB Pathway

    Directory of Open Access Journals (Sweden)

    Yuqing Wu

    2013-01-01

    and 20 μg/kg significantly decreased mortality and pulmonary inflammation of septic rats, as well as suppressed CLP-induced elevation of TNF-α and IL-6 and inhibited TLR4/MyD88 expression and NF-κB activation. These results suggest that dexmedetomidine may decrease mortality and inhibit inflammatory reaction in lung tissues of septic rats by suppressing TLR4/MyD88/NF-κB pathway.

  9. Mechanisms of anti-inflammatory property of Anacardium occidentale stem bark: inhibition of NF-κB and MAPK signalling in the microglia.

    Science.gov (United States)

    Olajide, Olumayokun A; Aderogba, Mutalib A; Fiebich, Bernd L

    2013-01-09

    Anacardium occidentale is used in traditional African medicine for the treatment of arthritis, fever, aches, pains, and inflammation of the extremities. In this study, we investigated the molecular mechanisms responsible for anti-inflammatory effects of a stem bark extract of A. occidentale (ANE) in LPS-stimulated microglia. Nitric oxide (NO), prostaglandin E(2) and cytokine (TNFα and IL-6) production were evaluated in supernatants from LPS-stimulated BV-2 cells. Cyclooxygenase-2 (COX-2), inducible nitric oxide synthase (iNOS) and microsomal prostaglandin E2 synthase (mPGES-1) protein expressions in rat primary microglia were measured using western blot. The effects of ANE on NF-κB activation and nuclear translocation were evaluated in the luciferase reporter gene assay and ELISA, while ability of ANE to influence IκB phosphorylation was determined using ELISA specific for phospho-IκB. The involvement of MAPK phosphorylation in the anti-inflammatory actions of ANE was evaluated using specific ELISA for phospho-p38, phospho-p42/44 and phospho-JNK. The MTT assay was used to determine the effect of ANE on BV-2 microglia viability. ANE (25-100 μg/ml) produced significant (p<0.05) reduction in the production of NO, PGE(2), TNFα and IL-6 in BV-2 microglia stimulated with LPS for 24h. Pre-treatment with ANE caused a significant (p<0.05) inhibition of COX-2, iNOS and mPGES-1 protein expressions in the rat primary microglia. Further experiments showed that ANE inhibited COX-2 and iNOS protein expression via IκB-mediated nuclear translocation and transactivation of NF-κB. Our studies also revealed that ANE produced significant (p<0.05) and dose-dependent inhibition of p38, p42/44 and JNK MAPK phosphorylation in LPS-activated BV-2 microglia. We conclude that ANE has an anti-inflammatory property related to inhibition of inflammation-associated cytokine production as well as iNOS and COX-2 gene expression by blocking NF-κB and MAPK pathways in the microglia. It is

  10. Glutathione S-transferase pi modulates NF-κB activation and pro-inflammatory responses in lung epithelial cells

    Directory of Open Access Journals (Sweden)

    Jane T. Jones

    2016-08-01

    Full Text Available Nuclear Factor kappa B (NF-κB is a transcription factor family critical in the activation of pro- inflammatory responses. The NF-κB pathway is regulated by oxidant-induced post-translational modifications. Protein S-glutathionylation, or the conjugation of the antioxidant molecule, glutathione to reactive cysteines inhibits the activity of inhibitory kappa B kinase beta (IKKβ, among other NF-κB proteins. Glutathione S-transferase Pi (GSTP is an enzyme that has been shown to catalyze protein S-glutathionylation (PSSG under conditions of oxidative stress. The objective of the present study was to determine whether GSTP regulates NF-κB signaling, S-glutathionylation of IKK, and subsequent pro-inflammatory signaling. We demonstrated that, in unstimulated cells, GSTP associated with the inhibitor of NF-κB, IκBα. However, exposure to LPS resulted in a rapid loss of association between IκBα and GSTP, and instead led to a protracted association between IKKβ and GSTP. LPS exposure also led to increases in the S-glutathionylation of IKKβ. SiRNA-mediated knockdown of GSTP decreased IKKβ-SSG, and enhanced NF-κB nuclear translocation, transcriptional activity, and pro-inflammatory cytokine production in response to lipopolysaccharide (LPS. TLK117, an isotype-selective inhibitor of GSTP, also enhanced LPS-induced NF-κB transcriptional activity and pro-inflammatory cytokine production, suggesting that the catalytic activity of GSTP is important in repressing NF-κB activation. Expression of both wild-type and catalytically-inactive Y7F mutant GSTP significantly attenuated LPS- or IKKβ-induced production of GM-CSF. These studies indicate a complex role for GSTP in modulating NF-κB, which may involve S-glutathionylation of IKK proteins, and interaction with NF-κB family members. Our findings suggest that targeting GSTP is a potential avenue for regulating the activity of this prominent pro-inflammatory and immunomodulatory transcription factor.

  11. Polymorphisms in NF-kappa B, PXR, LXR, PPAR gamma and risk of inflammatory bowel disease

    DEFF Research Database (Denmark)

    Andersen, Vibeke; Christensen, Jane; Ernst, Anja

    2011-01-01

    AIM: To investigate the contribution of polymorphisms in nuclear receptors to risk of inflammatory bowel disease (IBD). METHODS: Genotypes of nuclear factor (NF)-kappa B (NFKB1) NF kappa B -94ins/del (rs28362491); peroxisome proliferator-activated receptor (PPAR)-gamma (PPAR gamma) PPAR gamma Pro12......Ala (rs 1801282) and C1431T (rs 3856806); pregnane X receptor (PXR) (NR1I2) PXR A-24381C (rs1523127), C8055T (2276707), and A7635G (rs 6785049); and liver X receptor (LXR) (NR1H2) LXR T-rs1405655-C and T-rs2695121-C were assessed in a Danish case-control study of 327 Crohn's disease patients, 495...... and with a higher risk of extensive disease (OR: 1.34, 95% CI: 1.03-1.75 and OR: 2.49, 95% CI: 1.24-5.03, respectively). CONCLUSION: Common PXR and LXR polymorphisms may contribute to risk of IBD, especially among never smokers. (C) 2011 Baishideng. All rights reserved....

  12. Inflammatory cause of metabolic syndrome via brain stress and NF-κB

    Science.gov (United States)

    Cai, Dongsheng; Liu, Tiewen

    2012-01-01

    Metabolic syndrome, a network of medical disorders that greatly increase the risk for developing metabolic and cardiovascular diseases, has reached epidemic levels in many areas of today's world. Despite this alarming medicare situation, scientific understandings on the root mechanisms of metabolic syndrome are still limited, and such insufficient knowledge contributes to the relative lack of effective treatments or preventions for related diseases. Recent interdisciplinary studies from neuroendocrinology and neuroimmunology fields have revealed that overnutrition can trigger intracellular stresses to cause inflammatory changes mediated by molecules that control innate immunity. This type of nutrition-related molecular inflammation in the central nervous system, particularly in the hypothalamus, can form a common pathogenic basis for the induction of various metabolic syndrome components such as obesity, insulin resistance, and hypertension. Proinflammatory NF-κB pathway has been revealed as a key molecular system for pathologic induction of brain inflammation, which translates overnutrition and resulting intracellular stresses into central neuroendocrine and neural dysregulations of energy, glucose, and cardiovascular homeostasis, collectively leading to metabolic syndrome. This article reviews recent research advances in the neural mechanisms of metabolic syndrome and related diseases from the perspective of pathogenic induction by intracellular stresses and NF-κB pathway of the brain. PMID:22328600

  13. Human adipocytes are highly sensitive to intermittent hypoxia induced NF-kappaB activity and subsequent inflammatory gene expression

    Energy Technology Data Exchange (ETDEWEB)

    Taylor, Cormac T. [School of Medicine and Medical Science, The Conway Institute, University College Dublin (Ireland); Kent, Brian D.; Crinion, Sophie J.; McNicholas, Walter T. [School of Medicine and Medical Science, The Conway Institute, University College Dublin (Ireland); Pulmonary and Sleep Disorders Unit, St. Vincent’s University Hospital, Dublin (Ireland); Ryan, Silke, E-mail: silke.ryan@ucd.ie [School of Medicine and Medical Science, The Conway Institute, University College Dublin (Ireland); Pulmonary and Sleep Disorders Unit, St. Vincent’s University Hospital, Dublin (Ireland)

    2014-05-16

    Highlights: • Intermittent hypoxia (IH) leads to NF-κB activation in human primary adipocytes. • Adipocytes bear higher pro-inflammatory potential than other human primary cells. • IH leads to upregulation of multiple pro-inflammatory genes in human adipocytes. - Abstract: Introduction: Intermittent hypoxia (IH)-induced activation of pro-inflammatory pathways is a major contributing factor to the cardiovascular pathophysiology associated with obstructive sleep apnea (OSA). Obesity is commonly associated with OSA although it remains unknown whether adipose tissue is a major source of inflammatory mediators in response to IH. The aim of this study was to test the hypothesis that IH leads to augmented inflammatory responses in human adipocytes when compared to cells of non-adipocyte lineages. Methods and results: Human primary subcutaneous and visceral adipocytes, human primary microvascular pulmonary endothelial cells (HUMEC-L) and human primary small airway epithelial cells (SAEC) were exposed to 0, 6 or 12 cycles of IH or stimulated with tumor necrosis factor (TNF)-α. IH led to a robust increase in NF-κB DNA-binding activity in adipocytes compared with normoxic controls regardless of whether the source of adipocytes was visceral or subcutaneous. Notably, the NF-κB response of adipocytes to both IH and TNF-α was significantly greater than that in HUMEC-L and SAEC. Western blotting confirmed enhanced nuclear translocation of p65 in adipocytes in response to IH, accompanied by phosphorylation of I-κB. Parallel to p65 activation, we observed a significant increase in secretion of the adipokines interleukin (IL)-8, IL-6 and TNF-α with IH in adipocytes accompanied by significant upregulation of mRNA expression. PCR-array suggested profound influence of IH on pro-inflammatory gene expression in adipocytes. Conclusion: Human adipocytes demonstrate strong sensitivity to inflammatory gene expression in response to acute IH and hence, adipose tissue may be a key

  14. Human adipocytes are highly sensitive to intermittent hypoxia induced NF-kappaB activity and subsequent inflammatory gene expression

    International Nuclear Information System (INIS)

    Taylor, Cormac T.; Kent, Brian D.; Crinion, Sophie J.; McNicholas, Walter T.; Ryan, Silke

    2014-01-01

    Highlights: • Intermittent hypoxia (IH) leads to NF-κB activation in human primary adipocytes. • Adipocytes bear higher pro-inflammatory potential than other human primary cells. • IH leads to upregulation of multiple pro-inflammatory genes in human adipocytes. - Abstract: Introduction: Intermittent hypoxia (IH)-induced activation of pro-inflammatory pathways is a major contributing factor to the cardiovascular pathophysiology associated with obstructive sleep apnea (OSA). Obesity is commonly associated with OSA although it remains unknown whether adipose tissue is a major source of inflammatory mediators in response to IH. The aim of this study was to test the hypothesis that IH leads to augmented inflammatory responses in human adipocytes when compared to cells of non-adipocyte lineages. Methods and results: Human primary subcutaneous and visceral adipocytes, human primary microvascular pulmonary endothelial cells (HUMEC-L) and human primary small airway epithelial cells (SAEC) were exposed to 0, 6 or 12 cycles of IH or stimulated with tumor necrosis factor (TNF)-α. IH led to a robust increase in NF-κB DNA-binding activity in adipocytes compared with normoxic controls regardless of whether the source of adipocytes was visceral or subcutaneous. Notably, the NF-κB response of adipocytes to both IH and TNF-α was significantly greater than that in HUMEC-L and SAEC. Western blotting confirmed enhanced nuclear translocation of p65 in adipocytes in response to IH, accompanied by phosphorylation of I-κB. Parallel to p65 activation, we observed a significant increase in secretion of the adipokines interleukin (IL)-8, IL-6 and TNF-α with IH in adipocytes accompanied by significant upregulation of mRNA expression. PCR-array suggested profound influence of IH on pro-inflammatory gene expression in adipocytes. Conclusion: Human adipocytes demonstrate strong sensitivity to inflammatory gene expression in response to acute IH and hence, adipose tissue may be a key

  15. Calcitonin protects chondrocytes from lipopolysaccharide-induced apoptosis and inflammatory response through MAPK/Wnt/NF-κB pathways.

    Science.gov (United States)

    Zhang, Lai-Bo; Man, Zhen-Tao; Li, Wei; Zhang, Wei; Wang, Xian-Quan; Sun, Shui

    2017-07-01

    Calcitonin (CT) is an anti-absorbent, which has long been used for treatment of osteoporosis. However, little information is available about the effects of CT on osteoarthritis (OA). This study was mainly aimed to explore the effects of CT on the treatment of OA, as well as the underlying mechanisms. Chondrocytes were isolated from immature mice and then were incubated with lipopolysaccharide (LPS), CT, small interfering (si) RNA against bone morphogenetic protein (BMP)-2, and/or the inhibitors of MAPK/Wnt/NF-κB pathway. Thereafter, cell viability, apoptosis, nitric oxide (NO) and inflammatory factors productions, and expression levels of cartilage synthesis protein key factors, cartilage-derived morphogenetic protein (CDMP) 1, SRY (sex-determining region Y)-box 9 protein (SOX9), and MAPK/Wnt/NF-κB pathways key factors were determined. CT significantly reversed LPS-induced cell viability decrease, apoptosis increase, the inflammatory factors and NO secretion, the abnormally expression of cartilage synthesis proteins and the activation of MAPK/Wnt/NF-κB pathways (Ppathways statistically further increased the levels of CDMP1 and SOX9 (Ppathways, and could partially abolish CT-modulated the expression changes in CDMP1 and SOX9, and MAPK/Wnt/NF-κB pathways key factors (Ppathways. Copyright © 2017 Elsevier Ltd. All rights reserved.

  16. Kaempferol modulates pro-inflammatory NF-κB activation by suppressing advanced glycation endproducts-induced NADPH oxidase

    Science.gov (United States)

    Kim, Ji Min; Lee, Eun Kyeong; Kim, Dae Hyun; Yu, Byung Pal

    2010-01-01

    Advanced glycation endproducts (AGE) are oxidative products formed from the reaction between carbohydrates and a free amino group of proteins that are provoked by reactive species (RS). It is also known that AGE enhance the generation of RS and that the binding of AGE to a specific AGE receptor (RAGE) induces the activation of the redox-sensitive, pro-inflammatory transcription factor, nuclear factor-kappa B (NF-ĸB). In this current study, we investigated the anti-oxidative effects of short-term kaempferol supplementation on the age-related formation of AGE and the binding activity of RAGE in aged rat kidney. We further investigated the suppressive action of kaempferol against AGE's ability to stimulate activation of pro-inflammatory NF-ĸB and its molecular mechanisms. For this study, we utilized young (6 months old), old (24 months old), and kaempferol-fed (2 and 4 mg/kg/day for 10 days) old rats. In addition, for the molecular work, the rat endothelial cell line, YPEN-1 was used. The results show that AGE and RAGE were increased during aging and that these increases were blunted by kaempferol. In addition, dietary kaempferol reduced age-related increases in NF-κB activity and NF-ĸB-dependant pro-inflammatory gene activity. The most significant new finding from this study is that kaempferol supplementation prevented age-related NF-κB activation by suppressing AGE-induced nicotinamide adenine dinucleotide phosphate oxidase (NADPH oxidase). Taken together, our results demonstrated that dietary kaempferol exerts its anti-oxidative and anti-inflammatory actions by modulating the age-related NF-κB signaling cascade and its pro-inflammatory genes by suppressing AGE-induced NADPH oxidase activation. Based on these data, dietary kaempferol is proposed as a possible anti-AGE agent that may have the potential for use in anti-inflammation therapies. PMID:20431987

  17. Inhibition of inflammatory mediators contributes to the anti-inflammatory activity of KYKZL-1 via MAPK and NF-κB pathway

    International Nuclear Information System (INIS)

    Xu, Guang-Lin; Du, Yi-Fang; Cheng, Jing; Huan, Lin; Chen, Shi-Cui; Wei, Shao-Hua; Gong, Zhu-Nan; Cai, Jie; Qiu, Ting; Wu, Hao; Sun, Ting; Ao, Gui-Zhen

    2013-01-01

    KYKZL-1, a newly synthesized compound with COX/5-LOX dual inhibition, was subjected to the anti-inflammatory activity test focusing on its modulation of inflammatory mediators as well as intracellular MAPK and NF-κB signaling pathways. In acute ear edema model, pretreatment with KYKZL-1 (p.o.) dose-dependently inhibited the xylene-induced ear edema in mice with a higher inhibition than diclofenac. In a three-day TPA-induced inflammation, KYKZL-1 also showed significant anti-inflammatory activity with inhibition ranging between 20% and 64%. In gastric lesion test, KYKZL-1 elicited markedly fewer stomach lesions with a low index of ulcer as compared to diclofenac in rats. In further studies, KYKZL-1 was found to significantly inhibit the production of NO, PGE 2 , LTB 4 in LPS challenged RAW264.7, which is parallel to its attenuation of the expression of iNOS, COX-2, 5-LOX mRNAs or proteins and inhibition of phosphorylation of p38 and ERK MAPKs and activation of NF-κB. Taken together, our data indicate that KYKZL-1 comprises dual inhibition of COX and 5-LOX and exerts an obvious anti-inflammatory activity with an enhanced gastric safety profile via simultaneous inhibition of phosphorylation of p38 and ERK MAPKs and activation of NF-κB. - Highlights: • KYKZL-1 is designed to exhibit COX/5-LOX dual inhibition. • KYKZL-1 inhibits NO, PGE 2 and LTB 4 and iNOS, COX-2 and 5-LOX mRNAs and MAPKs. • KYKZL-1 inhibits phosphorylation of MAPKs. • KYKZL-1 inactivates NF-κB pathway

  18. Inhibition of inflammatory mediators contributes to the anti-inflammatory activity of KYKZL-1 via MAPK and NF-κB pathway

    Energy Technology Data Exchange (ETDEWEB)

    Xu, Guang-Lin [Jiangsu Key Laboratory for Molecular and Medical Biotechnology, College of Life Science, Nanjing Normal University, Nanjing (China); Department of Pharmacology, University of Michigan, Ann Arbor (United States); Du, Yi-Fang; Cheng, Jing; Huan, Lin [Jiangsu Key Laboratory for Molecular and Medical Biotechnology, College of Life Science, Nanjing Normal University, Nanjing (China); Chen, Shi-Cui [Jinhu Food and Drug Administration, Jiangsu (China); Wei, Shao-Hua [College of Chemistry and Materials Science, Nanjing Normal University, Nanjing (China); Gong, Zhu-Nan, E-mail: biopharmacology@126.com [Jiangsu Key Laboratory for Molecular and Medical Biotechnology, College of Life Science, Nanjing Normal University, Nanjing (China); Cai, Jie; Qiu, Ting; Wu, Hao; Sun, Ting [Jiangsu Key Laboratory for Molecular and Medical Biotechnology, College of Life Science, Nanjing Normal University, Nanjing (China); Ao, Gui-Zhen [Department of Medicinal Chemistry, School of Pharmacy, Soochow University, Jiangsu (China)

    2013-10-01

    KYKZL-1, a newly synthesized compound with COX/5-LOX dual inhibition, was subjected to the anti-inflammatory activity test focusing on its modulation of inflammatory mediators as well as intracellular MAPK and NF-κB signaling pathways. In acute ear edema model, pretreatment with KYKZL-1 (p.o.) dose-dependently inhibited the xylene-induced ear edema in mice with a higher inhibition than diclofenac. In a three-day TPA-induced inflammation, KYKZL-1 also showed significant anti-inflammatory activity with inhibition ranging between 20% and 64%. In gastric lesion test, KYKZL-1 elicited markedly fewer stomach lesions with a low index of ulcer as compared to diclofenac in rats. In further studies, KYKZL-1 was found to significantly inhibit the production of NO, PGE{sub 2}, LTB{sub 4} in LPS challenged RAW264.7, which is parallel to its attenuation of the expression of iNOS, COX-2, 5-LOX mRNAs or proteins and inhibition of phosphorylation of p38 and ERK MAPKs and activation of NF-κB. Taken together, our data indicate that KYKZL-1 comprises dual inhibition of COX and 5-LOX and exerts an obvious anti-inflammatory activity with an enhanced gastric safety profile via simultaneous inhibition of phosphorylation of p38 and ERK MAPKs and activation of NF-κB. - Highlights: • KYKZL-1 is designed to exhibit COX/5-LOX dual inhibition. • KYKZL-1 inhibits NO, PGE{sub 2} and LTB{sub 4} and iNOS, COX-2 and 5-LOX mRNAs and MAPKs. • KYKZL-1 inhibits phosphorylation of MAPKs. • KYKZL-1 inactivates NF-κB pathway.

  19. JNK pathway is involved in the inhibition of inflammatory target gene expression and NF-kappaB activation by melittin

    Directory of Open Access Journals (Sweden)

    Han Sang

    2008-05-01

    Full Text Available Abstract Background Bee venom therapy has been used to treat inflammatory diseases including rheumatoid arthritis in humans and in experimental animals. We previously found that bee venom and melittin (a major component of bee venom have anti-inflammatory effect by reacting with the sulfhydryl group of p50 of nuclear factor-kappa B (NF-κB and IκB kinases (IKKs. Since mitogen activated protein (MAP kinase family is implicated in the NF-κB activation and inflammatory reaction, we further investigated whether activation of MAP kinase may be also involved in the anti-inflammatory effect of melittin and bee venom. Methods The anti-inflammatory effects of melittin and bee venom were investigated in cultured Raw 264.7 cells, THP-1 human monocytic cells and Synoviocytes. The activation of NF-κB was investigated by electrophoretic mobility shift assay. Nitric oxide (NO and prostaglandin E2 (PGE2 were determined either by Enzyme Linked Immuno Sorbent Assay or by biochemical assay. Expression of IκB, p50, p65, inducible nitric oxide synthetase (iNOS, cyclooxygenase-2 (COX-2 as well as phosphorylation of MAP kinase family was determined by Western blot. Results Melittin (0.5–5 μg/ml and bee venom (5 and 10 μg/ml inhibited lipopolysaccharide (LPS, 1 μg/ml and sodium nitroprusside (SNP, 200 μM-induced activation of c-Jun NH2-terminal kinase (JNK in RAW 264.7 cells in a dose dependent manner. However, JNK inhibitor, anthra [1,9-cd]pyrazole-6 (2H-one (SP600215, 10–50 μM dose dependently suppressed the inhibitory effects of melittin and bee venom on NF-κB dependent luciferase and DNA binding activity via suppression of the inhibitory effect of melittin and bee venom on the LPS and SNP-induced translocation of p65 and p50 into nucleus as well as cytosolic release of IκB. Moreover, JNK inhibitor suppressed the inhibitory effects of melittin and bee venom on iNOS and COX-2 expression, and on NO and PGE2 generation. Conclusion These data show that

  20. Andrographolide induces apoptosis in B16F-10 melanoma cells by inhibiting NF-κB-mediated bcl-2 activation and modulating p53-induced caspase-3 gene expression.

    Science.gov (United States)

    Pratheeshkumar, P; Sheeja, K; Kuttan, Girija

    2012-02-01

    Cancer is a disorder characterized by uncontrolled proliferation and reduced apoptosis. Inducing apoptosis is an efficient method of treating cancers. In this study, we investigated the effect of andrographolide on the induction of apoptosis as well as its regulatory effect on the activation of transcription factors in B16F-10 melanoma cells. Treatment of B16F-10 cells with nontoxic concentration of andrographolide showed the presence of apoptotic bodies and induced DNA fragmentation in a dose-dependent manner. Cell cycle analysis and terminal deoxynucleotidyl transferase dUTP nick-end labeling (TUNEL) assays also confirmed the observation. The proapoptotic genes p53, Bax, caspase-9, and caspase-3 were found upregulated in andrographolide-treated cells, whereas the antiapoptotic gene bcl-2 was downregulated. This study also reveals that andrographolide treatment could alter the production and expression of proinflammatory cytokines and could inhibit the activation and nuclear translocation of p65, p50, and c-Rel subunits of nuclear factor-κB (NF-κB), and other transcription factors such as c-fos, activated transcription factor-2, and cyclic adenosine monophosphate response element-binding protein in B16F-10 melanoma cells. These results suggest that andrographolide induces apoptosis via inhibiting NF-κB-induced bcl-2-mediated survival signaling and modulating p53-induced caspase-3-mediated proapoptotic signaling.

  1. Depurinized milk downregulates rat thymus MyD88/Akt/p38 function, NF-κB-mediated inflammation, caspase-1 activity but not the endonuclease pathway: in vitro/in vivo study

    Science.gov (United States)

    Kocic, Gordana; Veljkovic, Andrej; Kocic, Hristina; Colic, Miodrag; Mihajlovic, Dusan; Tomovic, Katarina; Stojanovic, Svetlana; Smelcerovic, Andrija

    2017-01-01

    The aim of this study was the evaluation of 15 days dietary regimen of depurinized (DP) milk (obtained using our patented technological procedures) or 1.5% fat UHT milk instead of standard chow diet, on rat thymus and bone marrow MyD88/Akt/p38, NF-κB, caspase-1 and endonuclease pathways, in relation to peripheral blood cell composition. To determine whether the reduced mass of the thymus is a consequence of the direct effect of DP/UHT milk on apoptosis of thymocytes, in vitro Annexin-V-FITC/PI assay was performed. Significant decreases in the thymus wet weight, thymocyte MyD88, Akt-1/phospho-Akt-1 kinase, p38/phospho-p38, NF-κB, caspase-1 activity and CD4+/CD8+ antigen expression were obtained, especially in the DP milk group. The activity of thymocyte alkaline and acid DNase increased in the DP but not in the UHT milk group. The level of IL-6 significantly decreased in DP milk treated group, while the level of total TGF-β and IL-6 increased in UHT milk group. Significant differences in hematological parameters were obtained in commercial milk fed group. Observed results about prevention of experimental diabetes in DP pretreated groups may suggest that purine compounds, uric acid and other volatile toxic compounds of commercial milk may suppress oral tolerance, probably via IL-6 and TGF-β cytokine effects. PMID:28176796

  2. Bilberry juice modulates plasma concentration of NF-kappaB related inflammatory markers in subjects at increased risk of CVD.

    Science.gov (United States)

    Karlsen, Anette; Paur, Ingvild; Bøhn, Siv K; Sakhi, Amrit K; Borge, Grethe I; Serafini, Mauro; Erlund, Iris; Laake, Petter; Tonstad, Serena; Blomhoff, Rune

    2010-09-01

    Bilberries are abundant in polyphenols. Dietary polyphenols have been associated with strategies for prevention and treatment of chronic inflammatory diseases. We investigated the effect of bilberry juice on serum and plasma biomarkers of inflammation and antioxidant status in subjects with elevated levels of at least one risk factor for cardiovascular disease (CVD). In a randomized controlled trial, participants consumed either bilberry juice (n = 31) or water (n = 31) for 4 weeks. Supplementation with bilberry juice resulted in significant decreases in plasma concentrations of C-reactive protein (CRP), interleukin (IL)-6, IL-15, and monokine induced by INF-gamma (MIG). Unexpectedly, an increase in the plasma concentration of tumor nuclear factor-alpha (TNF-alpha) was observed in the bilberry group. CRP, IL-6, IL15, MIG, and TNF-alpha are all target genes of nuclear factor- kappa B (NF-kappaB), -a transcription factor that is crucial in orchestrating inflammatory responses. Plasma quercetin and p-coumaric acid increased in the bilberry group, otherwise no differences were observed for clinical parameters, oxidative stress or antioxidant status. Furthermore, we studied the effect of polyphenols from bilberries on lipopolysaccharide (LPS)-induced NF-kappaB activation in a monocytic cell line. We observed that quercetin, epicatechin, and resveratrol inhibited NF-kappaB activation. These findings suggest that supplementation with bilberry polyphenols may modulate the inflammation processes. Further testing of bilberry supplementation as a potential strategy in prevention and treatment of chronic inflammatory diseases is warranted.

  3. Proinflammatory and Anti-Inflammatory Cytokines Mediated by NF-κB Factor as Prognostic Markers in Mammary Tumors

    Directory of Open Access Journals (Sweden)

    Gustavo Rodrigues Martins

    2016-01-01

    Full Text Available Inflammation results in the production of cytokines, such as interleukin- (IL- 4 and IL-10 with immunosuppressive properties or IL-6 and TNF-α with procarcinogenic activity. Furthermore, NF-κB is the major link between inflammation and tumorigenesis. This study verified the interaction between active inflammatory cytokines in the tumor microenvironment and serum of female dogs with mammary tumors and their correlation with the clinicopathological characteristics and overall survival. Measurement of gene expression was performed by qPCR and protein levels by ELISA/Luminex. High gene and protein expression levels of NF-κB, IL-6, and TNF-α were found in association with characteristics that reflect worse prognosis and a negative correlation between TNF-α protein expression and survival time was observed (p<0.05. In contrast, high gene and protein expression levels of IL-4 and IL-10 were associated with characteristics of better prognosis and an increased level of IL-4 and a longer survival time of animals were obtained (p<0.05. In addition, there was a positive correlation between TNF-α and IL-6 expression in association with NF-κB. The results show a significant correlation of these cytokines with tumor development, associated with NF-κB expression and cytokines promodulation, showing that these biological factors could be used as predictive and prognostic markers in breast cancer.

  4. Aloin Suppresses Lipopolysaccharide-Induced Inflammatory Response and Apoptosis by Inhibiting the Activation of NF-κB

    Directory of Open Access Journals (Sweden)

    Xuan Luo

    2018-02-01

    Full Text Available Numerous herbal-derived natural products are excellent anti-inflammatory agents. Several studies have reported that aloin, the major anthraquinone glycoside obtained from the Aloe species, exhibits anti-inflammatory activity. However, the molecular mechanism of this activity is not well understood. In this report, we found that aloin suppresses lipopolysaccharide-induced pro-inflammatory cytokine secretion and nitric oxide production, and downregulates the expression of tumor necrosis factor alpha (TNF-α, interleukin 6 (IL-6, inducible nitric oxide synthase (iNOS, and cyclooxygenase-2 (COX-2. Aloin inhibits the phosphorylation and acetylation of the NF-κB p65 subunit by suppressing the upstream kinases p38 and Msk1, preventing LPS-induced p65 translocation to the nucleus. We have also shown that aloin inhibits LPS-induced caspase-3 activation and apoptotic cell death. Collectively, these findings suggest that aloin effectively suppresses the inflammatory response, primarily through the inhibition of NF-κB signaling.

  5. Aloin Suppresses Lipopolysaccharide-Induced Inflammatory Response and Apoptosis by Inhibiting the Activation of NF-κB.

    Science.gov (United States)

    Luo, Xuan; Zhang, Haowei; Wei, Xiduan; Shi, Mengjuan; Fan, Ping; Xie, Weidong; Zhang, Yaou; Xu, Naihan

    2018-02-26

    Numerous herbal-derived natural products are excellent anti-inflammatory agents. Several studies have reported that aloin, the major anthraquinone glycoside obtained from the Aloe species, exhibits anti-inflammatory activity. However, the molecular mechanism of this activity is not well understood. In this report, we found that aloin suppresses lipopolysaccharide-induced pro-inflammatory cytokine secretion and nitric oxide production, and downregulates the expression of tumor necrosis factor alpha (TNF-α), interleukin 6 (IL-6), inducible nitric oxide synthase (iNOS), and cyclooxygenase-2 (COX-2). Aloin inhibits the phosphorylation and acetylation of the NF-κB p65 subunit by suppressing the upstream kinases p38 and Msk1, preventing LPS-induced p65 translocation to the nucleus. We have also shown that aloin inhibits LPS-induced caspase-3 activation and apoptotic cell death. Collectively, these findings suggest that aloin effectively suppresses the inflammatory response, primarily through the inhibition of NF-κB signaling.

  6. The anti-inflammatory effect of Andrographis paniculata (Burm. f.) Nees on pelvic inflammatory disease in rats through down-regulation of the NF-κB pathway.

    Science.gov (United States)

    Zou, Wei; Xiao, Zuoqi; Wen, Xiaoke; Luo, Jieying; Chen, Shuqiong; Cheng, Zeneng; Xiang, Daxiong; Hu, Jian; He, Jingyu

    2016-11-25

    Andrographis paniculata (Burm. f.) Nees (APN), a principal constituent of a famous traditional Chinese medicine Fukeqianjin tablet which is used for the treatment of pelvic inflammatory disease (PID), has been reported to have anti-inflammatory effect in vitro. However, whether it has pharmacological effect on PID in vivo is unclear. Therefore, the aim of this study is to test the anti-inflammatory effect of APN and illuminate a potential mechanism. Thirty-six female specific pathogen-free SD rats were randomly divided into control group, PID group, APN1 group, APN2 group, APN3 group and prednisone group. Pathogen-induced PID rats were constructed. The APN1, APN2 and APN3 group rats were orally administrated with APN extract at different levels. The prednisone group rats were administrated with prednisone. Eight days after the first infection, the histological examination of upper genital tract was carried out, and enzyme-linked immunosorbent assay (ELISA) was carried out using homogenate of the uterus and fallopian tube. Furthermore, immunohistochemical evaluations of NF-κB p65 and IκB-α in uterus was conducted. APN obviously suppressed the infiltrations of neutrophils and lymphocytes, and it could significantly reduce the excessive production of cytokines and chemokines including IL-1β, IL-6, CXCL-1, MCP-1 and RANTES in a dose-dependent manner. Furthermore, APN could block the pathogen-induced activation of NF-κB pathway. APN showed potent anti-inflammatory effect on pathogen-induced PID in rats, with a potential mechanism of inhibiting the NF-κB signal pathway.

  7. Cheongsangbangpung-tang ameliorated the acute inflammatory response via the inhibition of NF-κB activation and MAPK phosphorylation.

    Science.gov (United States)

    Kim, Seon Young; Park, Sang Mi; Hwangbo, Min; Lee, Jong Rok; Byun, Sung Hui; Ku, Sae Kwang; Cho, Il Je; Kim, Sang Chan; Jee, Seon Young; Park, Sook Jahr

    2017-01-13

    Cheongsangbangpung-tang (CBT) is a traditional herbal formula used in Eastern Asia to treat heat-related diseases and swellings in the skin. The present study was conducted to evaluate the anti-inflammatory effects of cheongsangbangpung-tang extract (CBTE) both in vitro and in vivo. The in vitro effects of CBTE on the lipopolysaccharide (LPS)-induced production of inflammation-related proteins were examined in RAW 264.7 cells. The levels of nitric oxide (NO) were measured with the Griess reagent. Inflammatory cytokines and prostaglandin E 2 (PGE 2 ) were detected using the enzyme-linked immunosorbent assay (ELISA) method. Inflammation-related proteins were detected by Western blot. The effect of CBTE on acute inflammation in vivo was evaluated using carrageenan (CA)-induced paw oedema. To evaluate the anti-inflammatory effect, paw oedema volume, thickness of the dorsum and ventrum pedis skin, number of infiltrated inflammatory cells, and number of COX-2-, iNOS-immunoreactive cells were measured. In an in vitro study, CBTE inhibited the production of NO and PGE 2 and also decreased the expression of inducible nitric oxide synthase (iNOS), cyclooxygenase-2 (COX-2) activity, interleukin (IL)-1β, IL-6 and tumuor necrosis factor-α. In LPS-activated macrophages, nuclear factor-kappaB (NF-κB) and mitogen-activated protein kinase (MAPK) signalling is a pivotal pathway in the inflammatory process. These plausible molecular mechanisms increased the phosphorylation of I-κBα, while the activation of NF-κB and the phosphorylation of MAPK by LPS were blocked by CBTE treatment. In our in vivo study, a CA-induced acute oedematous paw inflammation rat model was used to evaluate the anti-inflammatory effect of CBTE. CBTE significantly reduced the increases in paw swelling, skin thicknesses, infiltrated inflammatory cells and iNOS-, COX-2 positive cells induced by CA injection. Based on these results, CBTE should favourably inhibit the acute inflammatory response through

  8. Anti-inflammatory mechanisms of resveratrol in activated HMC-1 cells: pivotal roles of NF-kappaB and MAPK.

    Science.gov (United States)

    Kang, Ok-Hwa; Jang, Hye-Jin; Chae, Hee-Sung; Oh, You-Chang; Choi, Jang-Gi; Lee, Young-Seob; Kim, Jong-Hak; Kim, Youn Chul; Sohn, Dong Hwan; Park, Hyun; Kwon, Dong-Yeul

    2009-05-01

    Resveratrol is a phytoalexin polyphenolic compound found in various plants, including grapes, berries, and peanuts. Recently, studies have documented various health benefits of resveratrol including cardiovascular and cancer-chemopreventive properties. The aim of the present study was to demonstrate the effects of resveratrol on the expression of pro-inflammatory cytokines, as well as to elucidate its mechanism of action in the human mast cell line (HMC-1). Cells were stimulated with phorbol 12-myristate 13-acetate (PMA) plus A23187 in the presence or absence of resveratrol. To study the possible effects of resveratrol, ELISA, RT-PCR, real-time RT-PCR, Western blot analysis, fluorescence, and luciferase activity assays were used in this study. Resveratrol significantly inhibited the PMA plus A23187-induction of inflammatory cytokines such as tumour necrosis factor (TNF)-alpha, interleukin (IL)-6 and IL-8. Moreover, resveratrol attenuated cyclooxygenase (COX)-2 expression and intracellular Ca2+ levels. In activated HMC-1 cells, phosphorylation of extra-signal response kinase (ERK) 1/2 decreased after treatment with resveratrol. Resveratrol inhibited PMA plus A23187-induced nuclear factor (NF)-kappaB activation, IkappaB degradation, and luciferase activity. Resveratrol suppressed the expression of TNF-alpha, IL-6, IL-8 and COX-2 through a decrease in the intracellular levels of Ca2+ and ERK 1/2, as well as activation of NF-kappaB. These results indicated that resveratrol exerted a regulatory effect on inflammatory reactions mediated by mast cells.

  9. Apigenin inhibits release of inflammatory mediators by blocking the NF-κB activation pathways in the HMC-1 cells.

    Science.gov (United States)

    Kang, Ok-Hwa; Lee, John-Hwa; Kwon, Dong-Yeul

    2011-09-01

    Apigenin is a plant flavonoid and a pharmacologically active agent that has been isolated from several plant species. However, the molecular mechanism of apigenin-mediated immune modulation has not been fully understood. One of the possible mechanisms of its protective effects is the down-regulation of inflammatory responses. In this study, we used cells from the human mast cell line (HMC-1) to investigate this effect. Apigenin significantly inhibits the inductive effect of phorbol 12-myristate 13-acetate (PMA) plus A23187 on the production of inflammatory cytokines such as tumor necrosis factor (TNF)-α, interleukin (IL)-8, IL-6, and granulocyte-macrophage colony-stimulating factor (GM-CSF). Moreover, apigenin attenuated the cyclooxygenase (COX)-2 expression and intracellular Ca(2+) level. In activated HMC-1 cells, apigenin inhibited the PMA plus A23187-induced activation of nuclear factor (NF)-κB, IκB degradation, and luciferase activity. Furthermore, apigenin suppressed the expression of TNF-α, IL-8, IL-6, GM-CSF, and COX-2 by decreasing the intracellular Ca(2+) level and inhibiting NF-κB activation. These results indicate that apigenin has a potential regulatory effect on inflammatory reactions that are mediated by mast cells.

  10. Asatone Prevents Acute Lung Injury by Reducing Expressions of NF-[Formula: see text]B, MAPK and Inflammatory Cytokines.

    Science.gov (United States)

    Chang, Heng-Yuan; Chen, Yi-Chuan; Lin, Jaung-Geng; Lin, I-Hsin; Huang, Hui-Fen; Yeh, Chia-Chou; Chen, Jian-Jung; Huang, Guan-Jhong

    2018-03-29

    Asatone is an active component extracted from the Chinese herb Radix et Rhizoma Asari. Our preliminary studies have indicated that asatone has an anti-inflammatory effect on RAW 264.7 culture cells challenged with lipopolysaccharide (LPS). Acute lung injury (ALI) has high morbidity and mortality rates due to the onset of serious lung inflammation and edema. Whether asatone prevents ALI LPS-induced requires further investigation. In vitro studies revealed that asatone at concentrations of 2.5-20[Formula: see text][Formula: see text]g/mL drastically prevented cytotoxicity and concentration-dependently reduced NO production in the LPS-challenged macrophages. In an in vivo study, the intratracheal administration of LPS increased the lung wet/dry ratio, myeloperoxidase activity, total cell counts, white blood cell counts, NO, iNOS, COX, TNF-[Formula: see text], IL-1[Formula: see text], and IL-6 in the bronchoalveolar lavage fluid as well as mitogen-activated protein kinases in the lung tissues. Pretreatment with asatone could reverse all of these effects. Asatone markedly reduced the levels of TNF-[Formula: see text] and IL-6 in the lung and liver, but not in the kidney of mice. By contrast, LPS reduced anti-oxidative enzymes and inhibited NF-[Formula: see text]B activations, whereas asatone increased anti-oxidative enzymes in the bronchoalveolar lavage fluid and NF-[Formula: see text]B activations in the lung tissues. Conclusively, asatone can prevent ALI through various anti-inflammatory modalities, including the major anti-inflammatory pathways of NF-[Formula: see text]B and mitogen-activated protein kinases. These findings suggest that asatone can be applied in the treatment of ALI.

  11. Ceftiofur impairs pro-inflammatory cytokine secretion through the inhibition of the activation of NF-κB and MAPK

    International Nuclear Information System (INIS)

    Ci Xinxin; Song Yu; Zeng Fanqin; Zhang Xuemei; Li Hongyu; Wang Xinrui; Cui Junqing; Deng Xuming

    2008-01-01

    Ceftiofur is a new broad-spectrum, third-generation cephalosporin antibiotic for veterinary use. Immunopharmacological studies can provide new information on the immunomodulatory activities of some drugs, including their effect on cytokine productions. For this reason, we investigated the effect of ceftiofur on cytokine productions in vitro. We found that ceftiofur can downregulate tumor necrosis factor-α (TNF-α), interleukin-1β (IL-1β), and interleukin-6 (IL-6), but did not affect interleukin-10 (IL-10) production. We further investigated signal transduction mechanisms to determine how ceftiofur affects. RAW 264.7 cells were pretreated with 1, 5, or 10 mg/L of ceftiofur 1 h prior to treatment with 1 mg/L of LPS. Thirty minutes later, cells were harvested and mitogen activated protein kinases (MAPKs) activation was measured by Western blot. Alternatively, cells were fixed and nuclear factor-κB (NF-κB) activation was measured using immunocytochemical analysis. Signal transduction studies showed that ceftiofur significantly inhibited extracellular signal-regulated kinase (ERK), p38, and c-jun NH 2 -terminal kinase (JNK) phosphorylation protein expression. Ceftiofur also inhibited p65-NF-κB translocation into the nucleus. Therefore, ceftiofur may inhibit LPS-induced production of inflammatory cytokines by blocking NF-κB and MAPKs signaling in RAW264.7 cells

  12. Anti-Inflammatory and Gastroprotective Roles of Rabdosia inflexa through Downregulation of Pro-Inflammatory Cytokines and MAPK/NF-κB Signaling Pathways

    Directory of Open Access Journals (Sweden)

    Md Rashedunnabi Akanda

    2018-02-01

    Full Text Available Globally, gastric ulcer is a vital health hazard for a human. Rabdosia inflexa (RI has been used in traditional medicine for inflammatory diseases. The present study aimed to investigate the protective effect and related molecular mechanism of RI using lipopolysaccharide (LPS-induced inflammation in RAW 246.7 cells and HCl/EtOH-induced gastric ulcer in mice. We applied 3-(4,5-dimethyl-thiazol-2-yl-2,5-diphenyltetrazolium bromide (MTT, nitric oxide (NO, reactive oxygen species (ROS, histopathology, malondialdehyde (MDA, quantitative real-time polymerase chain reaction (qPCR, immunohistochemistry (IHC, and Western blot analyses to evaluate the protective role of RI. Study revealed that RI effectively attenuated LPS-promoted NO and ROS production in RAW 246.7 cells. In addition, RI mitigated gastric oxidative stress by inhibiting lipid peroxidation, elevating NO, and decreasing gastric inflammation. RI significantly halted elevated gene expression of pro-inflammatory cytokines such as tumor necrosis factor-α (TNF-α, interleukin-1β (IL-1β, interleukin-6 (IL-6, inducible nitric oxide synthetase (iNOS, and cyclooxygenase-2 (COX-2 in gastric tissue. Likewise, RI markedly attenuated the mitogen-activated protein kinases (MAPKs phosphorylation, COX-2 expression, phosphorylation and degradation of inhibitor kappa B (IκBα and activation of nuclear factor kappa B (NF-κB. Thus, experimental findings suggested that the anti-inflammatory and gastroprotective activities of RI might contribute to regulating pro-inflammatory cytokines and MAPK/NF-κB signaling pathways.

  13. Astragaloside IV Inhibits NF-κB Activation and Inflammatory Gene Expression in LPS-Treated Mice

    Directory of Open Access Journals (Sweden)

    Wei-Jian Zhang

    2015-01-01

    Full Text Available In this study we investigated the role of astragaloside IV (AS-IV, one of the major active constituents purified from the Chinese medicinal herb Astragalus membranaceus, in LPS-induced acute inflammatory responses in mice in vivo and examined possible underlying mechanisms. Mice were assigned to four groups: vehicle-treated control animals; AS-IV-treated animals (10 mg/kg b.w. AS-IV daily i.p. injection for 6 days; LPS-treated animals; and AS-IV plus LPS-treated animals. We found that AS-IV treatment significantly inhibited LPS-induced increases in serum levels of MCP-1 and TNF by 82% and 49%, respectively. AS-IV also inhibited LPS-induced upregulation of inflammatory gene expression in different organs. Lung mRNA levels of cellular adhesion molecules, MCP-1, TNFα, IL-6, and TLR4 were significantly attenuated, and lung neutrophil infiltration and activation were strongly inhibited, as reflected by decreased myeloperoxidase content, when the mice were pretreated with AS-IV. Similar results were observed in heart, aorta, kidney, and liver. Furthermore, AS-IV significantly suppressed LPS-induced NF-κB and AP-1 DNA-binding activities in lung and heart. In conclusion, our data provide new in vivo evidence that AS-IV effectively inhibits LPS-induced acute inflammatory responses by modulating NF-κB and AP-1 signaling pathways. Our results suggest that AS-IV may be useful for the prevention or treatment of inflammatory diseases.

  14. Molecular Interactions between NR4A Orphan Nuclear Receptors and NF-κB Are Required for Appropriate Inflammatory Responses and Immune Cell Homeostasis.

    Science.gov (United States)

    Murphy, Evelyn P; Crean, Daniel

    2015-06-29

    Appropriate innate and adaptive immune responses are essential for protection and resolution against chemical, physical or biological insults. Immune cell polarization is fundamental in orchestrating distinct phases of inflammation, specifically acute phase responses followed by resolution and tissue repair. Dysregulation of immune cell and inflammatory responses is a hallmark of multiple diseases encompassing atherosclerosis, rheumatoid arthritis, psoriasis and metabolic syndromes. A master transcriptional mediator of diverse inflammatory signaling and immune cell function is NF-κB, and altered control of this key regulator can lead to an effective switch from acute to chronic inflammatory responses. Members of the nuclear receptor (NR) superfamily of ligand-dependent transcription factors crosstalk with NF-κB to regulate immune cell function(s). Within the NR superfamily the NR4A1-3 orphan receptors have emerged as important regulators of immune cell polarization and NF-κB signaling. NR4A receptors modulate NF-κB activity in a dynamic fashion, either repressing or enhancing target gene expression leading to altered inflammatory outcome. Here we will discuss the pivotal role NR4A's receptors play in orchestrating immune cell homeostasis through molecular crosstalk with NF-κB. Specifically, we will examine such NR4A/NF-κB interactions within the context of distinct cell phenotypes, including monocyte, macrophage, T cells, endothelial, and mesenchymal cells, which play a role in inflammation-associated disease. Finally, we review the therapeutic potential of altering NR4A/NF-κB interactions to limit hyper-inflammatory responses in vivo.

  15. Effects of consumption of whole grape powder on basal NF-κB signaling and inflammatory cytokine secretion in a mouse model of inflammation

    Directory of Open Access Journals (Sweden)

    Sonni-Ali Miller

    2018-03-01

    Full Text Available Dietary consumption of polyphenol-rich fruits, such as grapes, may reduce inflammation and potentially prevent diseases linked to inflammation. Here, we used a genetically engineered murine model to measure Nuclear Factor kappa-light-chain-enhancer of activated B cells (NF-κB activity and pro-inflammatory cytokine secretion to test the hypothesis that oral consumption of whole grape formulation reduces inflammatory signaling in the body. NF-κB luciferase reporter mice were divided into two groups, one which was fed an experimental diet formulated with 4% (w/w whole grape powder (WGP or another which was fed a control diet formulated with 3.6% glucose/fructose (w/w combination. Simulated inflammation was induced in the mice by intraperitoneal injection of lipopolysaccharide (LPS. In vivo imaging was used to determine the effect of each diet on NF-κB activity. We found that there were no significant differences in weight gain between the WGP and control diet groups. However, there was a statistically significant (p < 0.0001 difference in the progression of basal levels of NF-κB signaling between mice fed on control or WGP diet. There were no significant differences in NF-κB reporter indices between WGP- and control-diet groups after either acute or repeated inflammatory challenge. However, terminal blood collection revealed significantly (p < 0.01 lower serum concentrations of the inflammatory cytokines Interleukin-6 (IL-6 and Tumor Necrosis Factor alpha (TNFα only among WGP diet mice subjected to acute inflammatory challenge. Overall, these data suggest that while diets supplemented with WGP may suppress steady-state low levels of inflammatory signaling, such a supplementation may not alleviate exogenously induced massive NF-κB activation.

  16. Resistin Enhances Inflammatory Cytokine Production in Coronary Artery Tissues by Activating the NF-κB Signaling

    Directory of Open Access Journals (Sweden)

    Fang Gao

    2016-01-01

    Full Text Available Purpose. Kawasaki disease (KD is a systemic vasculitis and is a leading cause of coronary artery lesions (CALs in childhood. Our previous study has shown higher levels of serum Resistin in KD patients with coronary aneurysm. This study aimed at examining the association of Resistin with inflammatory cytokine expression in mouse model of coronary arteritis and determining the potential mechanisms. Methods. C57BL/6 mice were injected with Lactobacillus cell wall extract (LCWE to induce coronary arteritis. The relative levels of Resistin, TNF-α, IL-1β, and MMP-9 expression and inflammatory infiltrates in the coronary arteries were determined longitudinally by quantitative RT-PCR, ELISA, and histology. The effect of TLR4 and NF-κB activation on Resistin-induced TNF-α and IL-1β expression in human coronary artery endothelium cells (HCAECs was examined by quantitative RT-PCR. Results. Higher levels of Resistin, TNF-α, IL-1β, and MMP-9 expression were associated with the degrees of inflammatory infiltrates in the coronary artery walls of the LCWE-injected mice. Resistin enhanced TNF-α and IL-1β expression in HCAECs at 18 or 24 hours after stimulation. Pretreatment with anti-TLR4 attenuated Resistin-enhanced IL-1β, but not TNF-α, expression and pretreatment with parthenolide or QNZ demolished Resistin-enhanced TNF-α expression in HACECs. Pretreatment with parthenolide, but not QNZ, blocked Resistin-enhanced IL-1β expression in HCAECs. Conclusion. Resistin may enhance inflammation by cross-talking with TLR4/NF-κB signaling during the development of coronary arteritis in mice.

  17. Turmeric (Curcuma longa) inhibits inflammatory nuclear factor (NF)-κB and NF-κB-regulated gene products and induces death receptors leading to suppressed proliferation, induced chemosensitization, and suppressed osteoclastogenesis.

    Science.gov (United States)

    Kim, Ji H; Gupta, Subash C; Park, Byoungduck; Yadav, Vivek R; Aggarwal, Bharat B

    2012-03-01

    The incidence of cancer is significantly lower in regions where turmeric is heavily consumed. Whether lower cancer incidence is due to turmeric was investigated by examining its effects on tumor cell proliferation, on pro-inflammatory transcription factors NF-κB and STAT3, and on associated gene products. Cell proliferation and cell cytotoxicity were measured by the MTT method, NF-κB activity by EMSA, protein expression by Western blot analysis, ROS generation by FACS analysis, and osteoclastogenesis by TRAP assay. Turmeric inhibited NF-κB activation and down-regulated NF-κB-regulated gene products linked to survival (Bcl-2, cFLIP, XIAP, and cIAP1), proliferation (cyclin D1 and c-Myc), and metastasis (CXCR4) of cancer cells. The spice suppressed the activation of STAT3, and induced the death receptors (DR)4 and DR5. Turmeric enhanced the production of ROS, and suppressed the growth of tumor cell lines. Furthermore, turmeric sensitized the tumor cells to chemotherapeutic agents capecitabine and taxol. Turmeric was found to be more potent than pure curcumin for cell growth inhibition. Turmeric also inhibited NF-κB activation induced by RANKL that correlated with the suppression of osteoclastogenesis. Our results indicate that turmeric can effectively block the proliferation of tumor cells through the suppression of NF-κB and STAT3 pathways. Copyright © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  18. Experimental evidence of heparanase, Hsp70 and NF-κB gene expression on the response of anti-inflammatory drugs in TNBS-induced colonic inflammation.

    Science.gov (United States)

    Quaglio, Ana E V; Castilho, Anthony C S; Di Stasi, Luiz C

    2015-11-15

    Etiopathogenesis of inflammatory bowel disease is unclear and results from a complex interplay of genetic, microbial, environmental and immune factors. Elucidating the mechanisms that drive IBD depends on the detailed characterization of human inflammatory mediators in animal models. Therefore, we studied how intestinal inflammation affects heparanase, NF-κB and Hsp70 gene expression in rats, and if current intestinal anti-inflammatory drugs (sulphasalazine, prednisolone and azathioprine) act on these expressions. Moreover, we investigated the relationships among these genes with colonic cytokines levels (IL-1β, TNF-α, IL-6, INF-γ and IL-10) and oxidative stress that have fundamental role in IBD. Macroscopic parameters (diarrhea, extension of lesion, colonic weight/length ratio and damage score), biochemical markers (myeloperoxidase and alkaline phosphatase activities, and glutathione, IL-1β, TNF-α, IL-6, INF-γ and IL-10 levels), gene expressions (heparanase, NF-κB and Hsp70), and microscopic evaluations (optic, electronic scanning and transmission microscopic) were performed in rats. Expression of heparanase, Hsp70 and NF-κB and oxidative stress were increased by inflammatory process and differentially modulated by sulphasalazine, prednisolone and azathioprine treatments. Protective effects of drugs were also related to differential modulation of cytokine changes induced by inflammatory process, showing different mechanisms to control inflammation. Heparanase, NF-κB and Hsp70 gene expression participate in the inflammatory response induced by TNBS and represent pharmacological targets of the intestinal anti-inflammatory drugs. In addition, current drugs used to treat IBD (sulphasalazine, prednisolone and azathioprine) differentially modulate heparanase, NF-κB and Hsp70 gene expression, cytokine production and oxidative stress.

  19. Lyn regulates inflammatory responses in Klebsiella pneumoniae infection via the p38/NF-κB pathway.

    Science.gov (United States)

    Li, Xuefeng; Zhou, Xikun; Ye, Yan; Li, Yi; Li, Jiaxin; Privratsky, Breanna; Wu, Erxi; Gao, Hongwei; Huang, Canhua; Wu, Min

    2014-03-01

    Klebsiella pneumoniae (Kp) is one of the most common pathogens in nosocomial infections and is becoming increasingly multidrug resistant. However, the underlying molecular pathogenesis of this bacterium remains elusive, limiting the therapeutic options. Understanding the mechanism of its pathogenesis may facilitate the development of anti-bacterial therapeutics. Here, we show that Lyn, a pleiotropic Src tyrosine kinase, is involved in host defense against Kp by regulating phagocytosis process and simultaneously downregulating inflammatory responses. Using acute infection mouse models, we observed that lyn(-/-) mice were more susceptible to Kp with increased mortality and severe lung injury compared with WT mice. Kp infected-lyn(-/-) mice exhibited elevated inflammatory cytokines (IL-6 and TNF-α), and increased superoxide in the lung and other organs. In addition, the phosphorylation of p38 and NF-κB p65 subunit increased markedly in response to Kp infection in lyn(-/-) mice. We also demonstrated that the translocation of p65 from cytoplasm to nuclei increased in cultured murine lung epithelial cells by Lyn siRNA knockdown. Furthermore, lipid rafts clustered with activated Lyn and accumulated in the site of Kp invasion. Taken together, these findings revealed that Lyn may participate in host defense against Kp infection through the negative modulation of inflammatory cytokines. © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  20. Zhen-wu-tang attenuates cationic bovine serum albumin-induced inflammatory response in membranous glomerulonephritis rat through inhibiting AGEs/RAGE/NF-κB pathway activation.

    Science.gov (United States)

    Wu, Junbiao; Liu, Bihao; Liang, Chunling; Ouyang, Hui; Lin, Jin; Zhong, Yanchun; He, Yu; Zhou, Jie; Zhou, Yuan; Zhou, Jiuyao

    2016-04-01

    Zhen-wu-tang (ZWT), a traditional Chinese compound formula recorded in the Treatise on Febrile Diseases, has significant inhibitory effects on inflammatory damage and oxidative lesions in rats, but its mechanism of action remains unclear. The aim of the present study was to explore whether the anti-inflammatory and anti-oxidative effects of ZWT were mediated by the AGEs/RAGE/NF-κB signaling pathway in rats with cationic bovine serum albumin (C-BSA)-induced membranous glomerulonephritis (MGN). We found that ZWT significantly reduced the production of malondialdehyde (MDA), but enhanced the superoxide dismutase (SOD) activity. The ELISA results showed that ZWT not only reduced the serum levels of AGEs but also decreased the release of inflammatory mediators (TNF-α, IL-1β, and IL-6). Meanwhile, HE staining showed that pathological kidney injury was alleviated by ZWT. In addition, ZWT suppressed the expression of RAGE1 and NF-κB p65, as well as the nuclear translocation of NF-κB p65. The accumulation of AGEs, oxidative lesions and inflammation damage were reduced by an AGE inhibitor. Thus, the present study demonstrates that AGEs play a role in the pathogenesis of MGN and that AGE inhibition could reduce the inflammatory reactions and oxidative lesions in MGN. In general, ZWT attenuated MGN, in part, by inhibiting the AGEs/RAGE/NF-κB pathway. Copyright © 2016 Elsevier B.V. All rights reserved.

  1. Turkish Scorzonera Species Extracts Attenuate Cytokine Secretion via Inhibition of NF-kappa B Activation, Showing Anti-Inflammatory Effect in Vitro

    Czech Academy of Sciences Publication Activity Database

    Acikara, O. B.; Hošek, J.; Babula, P.; Cvačka, Josef; Buděšínský, Miloš; Dračínský, Martin; Iscan, G. S.; Kadlecová, D.; Ballová, L.; Šmejkal, K.

    2016-01-01

    Roč. 21, č. 1 (2016), č. článku 43. ISSN 1420-3049 Institutional support: RVO:61388963 Keywords : anti-inflammatory activity * IL-1 beta * NF-kappa B * Scorzonera * phenolic * TNF-alpha * triterpen Subject RIV: CC - Organic Chemistry Impact factor: 2.861, year: 2016 http://www.mdpi.com/1420-3049/21/1/43/htm

  2. Bee Venom Inhibits Porphyromonas gingivalis Lipopolysaccharides-Induced Pro-Inflammatory Cytokines through Suppression of NF-κB and AP-1 Signaling Pathways

    Directory of Open Access Journals (Sweden)

    Woon-Hae Kim

    2016-11-01

    Full Text Available Periodontitis is a chronic inflammatory disease that leads to destruction of tooth supporting tissues. Porphyromonas gingivalis (P. gingivalis, especially its lipopolysaccharides (LPS, is one of major pathogens that cause periodontitis. Bee venom (BV has been widely used as a traditional medicine for various diseases. Previous studies have demonstrated the anti-inflammatory, anti-bacterial effects of BV. However, a direct role and cellular mechanism of BV on periodontitis-like human keratinocytes have not been explored. Therefore, we investigated the anti-inflammatory mechanism of BV against P. gingivalis LPS (PgLPS-induced HaCaT human keratinocyte cell line. The anti-inflammatory effect of BV was demonstrated by various molecular biological methods. The results showed that PgLPS increased the expression of Toll-like receptor (TLR-4 and pro-inflammatory cytokines, such as tumor necrosis factor (TNF-α, interleukin (IL-1β, IL-6, IL-8, and interferon (IFN-γ. In addition, PgLPS induced activation of the signaling pathways of inflammatory cytokines-related transcription factors, nuclear factor kappa-light-chain-enhancer of activated B cells (NF-κB and activator protein 1 (AP-1. BV effectively inhibited those pro-inflammatory cytokines through suppression of NF-κB and AP-1 signaling pathways. These results suggest that administration of BV attenuates PgLPS-induced inflammatory responses. Furthermore, BV may be a useful treatment to anti-inflammatory therapy for periodontitis.

  3. Bee Venom Inhibits Porphyromonas gingivalis Lipopolysaccharides-Induced Pro-Inflammatory Cytokines through Suppression of NF-κB and AP-1 Signaling Pathways.

    Science.gov (United States)

    Kim, Woon-Hae; An, Hyun-Jin; Kim, Jung-Yeon; Gwon, Mi-Gyeong; Gu, Hyemin; Park, Jae-Bok; Sung, Woo Jung; Kwon, Yong-Chul; Park, Kyung-Duck; Han, Sang Mi; Park, Kwan-Kyu

    2016-11-10

    Periodontitis is a chronic inflammatory disease that leads to destruction of tooth supporting tissues. Porphyromonas gingivalis ( P. gingivalis ), especially its lipopolysaccharides (LPS), is one of major pathogens that cause periodontitis. Bee venom (BV) has been widely used as a traditional medicine for various diseases. Previous studies have demonstrated the anti-inflammatory, anti-bacterial effects of BV. However, a direct role and cellular mechanism of BV on periodontitis-like human keratinocytes have not been explored. Therefore, we investigated the anti-inflammatory mechanism of BV against P. gingivalis LPS (PgLPS)-induced HaCaT human keratinocyte cell line. The anti-inflammatory effect of BV was demonstrated by various molecular biological methods. The results showed that PgLPS increased the expression of Toll-like receptor (TLR)-4 and pro-inflammatory cytokines, such as tumor necrosis factor (TNF)-α, interleukin (IL)-1β, IL-6, IL-8, and interferon (IFN)-γ. In addition, PgLPS induced activation of the signaling pathways of inflammatory cytokines-related transcription factors, nuclear factor kappa-light-chain-enhancer of activated B cells (NF-κB) and activator protein 1 (AP-1). BV effectively inhibited those pro-inflammatory cytokines through suppression of NF-κB and AP-1 signaling pathways. These results suggest that administration of BV attenuates PgLPS-induced inflammatory responses. Furthermore, BV may be a useful treatment to anti-inflammatory therapy for periodontitis.

  4. ß-Hydroxybutyrate Activates the NF-κB Signaling Pathway to Promote the Expression of Pro-Inflammatory Factors in Calf Hepatocytes

    Directory of Open Access Journals (Sweden)

    Xiaoxia Shi

    2014-01-01

    Full Text Available Background/Aims: ß-hydroxybutyrate (BHBA is the major component of ketone bodies in ketosis. Dairy cows with ketosis often undergo oxidative stress. BHBA is related to the inflammation involved in other diseases of dairy cattle. However, whether BHBA can induce inflammatory injury in dairy cow hepatocytes and the potential mechanism of this induction are not clear. The NF-κB pathway plays a vital role in the inflammatory response. Methods: Therefore, this study evaluated the oxidative stress, pro-inflammatory factors and NF-κB pathway in cultured calf hepatocytes treated with different concentrations of BHBA, pyrrolidine dithiocarbamate (PDTC, an NF-κB pathway inhibitor and N-acetylcysteine (NAC, antioxidant. Results: The results showed that BHBA could significantly increase the levels of oxidation indicators (MDA, NO and iNOS, whereas the levels of antioxidation indicators (GSH-Px, CAT and SOD were markedly decreased in hepatocytes. The IKKß activity and phospho-IκBa (p-IκBa contents were increased in BHBA-treated hepatocytes. This increase was accompanied by the increased expression level and transcription activity of p65. The expression levels of NF-κB-regulated inflammatory cytokines, namely TNF-a, IL-6 and IL-1ß, were markedly increased after BHBA treatment, while significantly decreased after NAC treatment. However, the p-IκBa level and the expression and activity of p65 and its target genes were markedly decreased in the PDTC + BHBA group compared with the BHBA (1.8 mM group. Moreover, immunocytofluorescence of p65 showed a similar trend. Conclusion: The present data indicate that higher concentrations of BHBA can induce cattle hepatocyte inflammatory injury through the NF-κB signaling pathway, which may be activated by oxidative stress.

  5. Total glucosides of paeony (TGP) inhibits the production of inflammatory cytokines in oral lichen planus by suppressing the NF-κB signaling pathway.

    Science.gov (United States)

    Wang, Yanni; Zhang, Han; Du, Guanhuan; Wang, Yufeng; Cao, Tianyi; Luo, Qingqiong; Chen, Junjun; Chen, Fuxiang; Tang, Guoyao

    2016-07-01

    Total glucosides of paeony (TGP) is a bioactive compound extracted from paeony roots and has been widely used to ameliorate inflammation in several autoimmune and inflammatory diseases. However, the anti-inflammatory effect of TGP on oral lichen planus (OLP), a chronic inflammatory oral condition characterized by T-cell infiltration and abnormal epithelial keratinization cycle remains unclear. In this study, we found that TLR4 was highly expressed and activation of the NF-κB signaling pathway was obviously observed in the OLP tissues. Moreover, there was significant higher mRNA expression of inflammatory cytokines interleukin-6 (IL-6) and tumor necrosis factor-α (TNF-α) in OLP keratinocytes than normal oral epithelial keratinocytes. With the help of the cell culture model by stimulating the keratinocyte HaCaT cells with lipopolysaccharides (LPS), we mimicked the local inflammatory environment of OLP. And we further confirmed that TGP could inhibit LPS-induced production of IL-6 and TNF-α in HaCaT cells via a dose-dependent manner. TGP treatment decreased the phosphorylation of IκBα and NF-κB p65 proteins, thus leading to less nuclear translocation of NF-κB p65 in HaCaT cells. Therefore, our data suggested that TGP may be a new potential candidate for the therapy of OLP. Copyright © 2016 Elsevier B.V. All rights reserved.

  6. Delphinidin, a specific inhibitor of histone acetyltransferase, suppresses inflammatory signaling via prevention of NF-κB acetylation in fibroblast-like synoviocyte MH7A cells

    International Nuclear Information System (INIS)

    Seong, Ah-Reum; Yoo, Jung-Yoon; Choi, KyungChul; Lee, Mee-Hee; Lee, Yoo-Hyun; Lee, Jeongmin; Jun, Woojin; Kim, Sunoh; Yoon, Ho-Geun

    2011-01-01

    Highlights: → Delphinidin is a novel inhibitor of p300/CBP histone acetyltransferase. → Delphinidin prevents the hyperacetylation of p65 by inhibiting the HAT activity of p300/CBP. → Delphinidin efficiently suppresses the expression of inflammatory cytokines in MH7A cells via hypoacetylation of NF-κB. → Delphinidin inhibits cytokine release in the Jurkat T lymphocyte cell line. -- Abstract: Histone acetyltransferase (HAT) inhibitors (HATi) isolated from dietary compounds have been shown to suppress inflammatory signaling, which contributes to rheumatoid arthritis. Here, we identified a novel HATi in Punica granatum L. known as delphinidin (DP). DP did not affect the activity of other epigenetic enzymes (histone deacetylase, histone methyltransferase, or sirtuin1). DP specifically inhibited the HAT activities of p300/CBP. It also inhibited p65 acetylation in MH7A cells, a human rheumatoid arthritis synovial cell line. DP-induced hypoacetylation was accompanied by cytosolic accumulation of p65 and nuclear localization of IKBα. Accordingly, DP treatment inhibited TNFα-stimulated increases in NF-κB function and expression of NF-κB target genes in these cells. Importantly, DP suppressed lipopolysaccharide-induced pro-inflammatory cytokine expression in Jurkat T lymphocytes, demonstrating that HATi efficiently suppresses cytokine-mediated immune responses. Together, these results show that the HATi activity of DP counters anti-inflammatory signaling by blocking p65 acetylation and that this compound may be useful in preventing inflammatory arthritis.

  7. Delphinidin, a specific inhibitor of histone acetyltransferase, suppresses inflammatory signaling via prevention of NF-{kappa}B acetylation in fibroblast-like synoviocyte MH7A cells

    Energy Technology Data Exchange (ETDEWEB)

    Seong, Ah-Reum; Yoo, Jung-Yoon; Choi, KyungChul [Department of Biochemistry and Molecular Biology, Center for Chronic Metabolic Disease Research, College of Medicine, Yonsei University, Seoul (Korea, Republic of); Lee, Mee-Hee [Department of Biochemistry and Molecular Biology, Center for Chronic Metabolic Disease Research, College of Medicine, Yonsei University, Seoul (Korea, Republic of); Brain Korea 21 Project for Medical Sciences, Yonsei University, College of Medicine, Seoul (Korea, Republic of); Lee, Yoo-Hyun [Department of Food Science and Nutrition, The University of Suwon, Kyunggi-do (Korea, Republic of); Lee, Jeongmin [Department of Medical Nutrition, Kyung Hee University, Kyunggi-do (Korea, Republic of); Jun, Woojin [Department of Food and Nutrition, Chonnam National University, Gwangju (Korea, Republic of); Kim, Sunoh, E-mail: sunoh@korea.ac.kr [Jeollanamdo Institute of Natural Resources Research, Jeonnam (Korea, Republic of); Yoon, Ho-Geun, E-mail: yhgeun@yuhs.ac [Department of Biochemistry and Molecular Biology, Center for Chronic Metabolic Disease Research, College of Medicine, Yonsei University, Seoul (Korea, Republic of); Brain Korea 21 Project for Medical Sciences, Yonsei University, College of Medicine, Seoul (Korea, Republic of)

    2011-07-08

    Highlights: {yields} Delphinidin is a novel inhibitor of p300/CBP histone acetyltransferase. {yields} Delphinidin prevents the hyperacetylation of p65 by inhibiting the HAT activity of p300/CBP. {yields} Delphinidin efficiently suppresses the expression of inflammatory cytokines in MH7A cells via hypoacetylation of NF-{kappa}B. {yields} Delphinidin inhibits cytokine release in the Jurkat T lymphocyte cell line. -- Abstract: Histone acetyltransferase (HAT) inhibitors (HATi) isolated from dietary compounds have been shown to suppress inflammatory signaling, which contributes to rheumatoid arthritis. Here, we identified a novel HATi in Punica granatum L. known as delphinidin (DP). DP did not affect the activity of other epigenetic enzymes (histone deacetylase, histone methyltransferase, or sirtuin1). DP specifically inhibited the HAT activities of p300/CBP. It also inhibited p65 acetylation in MH7A cells, a human rheumatoid arthritis synovial cell line. DP-induced hypoacetylation was accompanied by cytosolic accumulation of p65 and nuclear localization of IKB{alpha}. Accordingly, DP treatment inhibited TNF{alpha}-stimulated increases in NF-{kappa}B function and expression of NF-{kappa}B target genes in these cells. Importantly, DP suppressed lipopolysaccharide-induced pro-inflammatory cytokine expression in Jurkat T lymphocytes, demonstrating that HATi efficiently suppresses cytokine-mediated immune responses. Together, these results show that the HATi activity of DP counters anti-inflammatory signaling by blocking p65 acetylation and that this compound may be useful in preventing inflammatory arthritis.

  8. Anti-Inflammatory Potential of Ethyl Acetate Fraction of Moringa oleifera in Downregulating the NF-κB Signaling Pathway in Lipopolysaccharide-Stimulated Macrophages

    Directory of Open Access Journals (Sweden)

    Palanisamy Arulselvan

    2016-10-01

    Full Text Available In the present investigation, we prepared four different solvent fractions (chloroform, hexane, butanol, and ethyl acetate of Moringa oleifera extract to evaluate its anti-inflammatory potential and cellular mechanism of action in lipopolysaccharide (LPS-induced RAW264.7 cells. Cell cytotoxicity assay suggested that the solvent fractions were not cytotoxic to macrophages at concentrations up to 200 µg/mL. The ethyl acetate fraction suppressed LPS-induced production of nitric oxide and proinflammatory cytokines in macrophages in a concentration-dependent manner and was more effective than the other fractions. Immunoblot observations revealed that the ethyl acetate fraction effectively inhibited the expression of inflammatory mediators including cyclooxygenase-2, inducible nitric oxide synthase, and nuclear factor (NF-κB p65 through suppression of the NF-κB signaling pathway. Furthermore, it upregulated the expression of the inhibitor of κB (IκBα and blocked the nuclear translocation of NF-κB. These findings indicated that the ethyl acetate fraction of M. oleifera exhibited potent anti-inflammatory activity in LPS-stimulated macrophages via suppression of the NF-κB signaling pathway.

  9. Anti-Inflammatory Potential of Ethyl Acetate Fraction of Moringa oleifera in Downregulating the NF-κB Signaling Pathway in Lipopolysaccharide-Stimulated Macrophages.

    Science.gov (United States)

    Arulselvan, Palanisamy; Tan, Woan Sean; Gothai, Sivapragasam; Muniandy, Katyakyini; Fakurazi, Sharida; Esa, Norhaizan Mohd; Alarfaj, Abdullah A; Kumar, S Suresh

    2016-10-31

    In the present investigation, we prepared four different solvent fractions (chloroform, hexane, butanol, and ethyl acetate) of Moringa oleifera extract to evaluate its anti-inflammatory potential and cellular mechanism of action in lipopolysaccharide (LPS)-induced RAW264.7 cells. Cell cytotoxicity assay suggested that the solvent fractions were not cytotoxic to macrophages at concentrations up to 200 µg/mL. The ethyl acetate fraction suppressed LPS-induced production of nitric oxide and proinflammatory cytokines in macrophages in a concentration-dependent manner and was more effective than the other fractions. Immunoblot observations revealed that the ethyl acetate fraction effectively inhibited the expression of inflammatory mediators including cyclooxygenase-2, inducible nitric oxide synthase, and nuclear factor (NF)-κB p65 through suppression of the NF-κB signaling pathway. Furthermore, it upregulated the expression of the inhibitor of κB (IκBα) and blocked the nuclear translocation of NF-κB. These findings indicated that the ethyl acetate fraction of M. oleifera exhibited potent anti-inflammatory activity in LPS-stimulated macrophages via suppression of the NF-κB signaling pathway.

  10. Silibinin inhibits the production of pro-inflammatory cytokines through inhibition of NF-κB signaling pathway in HMC-1 human mast cells.

    Science.gov (United States)

    Kim, Beom-Rak; Seo, Hye-Sook; Ku, Jin-Mo; Kim, Gyung-Jun; Jeon, Chan Yong; Park, Jong Hyeong; Jang, Bo-Hyoung; Park, Sun-Ju; Shin, Yong-Cheol; Ko, Seong-Gyu

    2013-11-01

    Silibinin is the major active molecule of silymarin, the mixture of flavonolignans extracted from Cirsium japonicum. It has been used for the treatment of hepatitis and inflammation-related diseases. In the present study, the effects of silibinin on allergic inflammation and its signaling were investigated in the induced human mast cells. Cell growth inhibition induced by silibinin was measured by MTS assay. Histamine release was measured by enzyme immunoassay. The tumor necrosis factor-α (TNF-α), interleukin-6 (IL-6), and interleukin-8 (IL-8) secreted protein levels and mRNA levels were measured by the ELISA assay and RT-PCR, respectively. The NF-κB promoter activity was examined by a luciferase assay. Silibinin suppressed the growth of HMC-1 cells and also reduced the production and mRNA expression of pro-inflammatory cytokines such as TNF-α, IL-6, and IL-8. Moreover, silibinin inhibited the nuclear translocation of nuclear factor (NF)-κB through inhibition of the phosphorylation of IκBα and suppressed NF-κB transcriptional activity in stimulated HMC-1 cells. Taken together, these results indicate that silibinin inhibits the production of pro-inflammatory cytokines through inhibition of NF-κB signaling pathway in HMC-1 human mast cells, suggesting that silibinin could be used for the treatment of mast cell-derived allergic inflammatory diseases.

  11. Baicalein inhibits IL-1β- and TNF-α-induced inflammatory cytokine production from human mast cells via regulation of the NF-κB pathway

    Directory of Open Access Journals (Sweden)

    Krishnaswamy Guha

    2007-11-01

    Full Text Available Abstract Background Human mast cells are multifunctional cells capable of a wide variety of inflammatory responses. Baicalein (BAI, isolated from the traditional Chinese herbal medicine Huangqin (Scutellaria baicalensis Georgi, has been shown to have anti-inflammatory effects. We examined its effects and mechanisms on the expression of inflammatory cytokines in an IL-1β- and TNF-α-activated human mast cell line, HMC-1. Methods HMC-1 cells were stimulated either with IL-1β (10 ng/ml or TNF-α (100 U/ml in the presence or absence of BAI. We assessed the expression of IL-6, IL-8, and MCP-1 by ELISA and RT-PCR, NF-κB activation by electrophoretic mobility shift assay (EMSA, and IκBα activation by Western blot. Results BAI (1.8 to 30 μM significantly inhibited production of IL-6, IL-8, and MCP-1 in a dose-dependent manner in IL-1β-activated HMC-1. BAI (30 μM also significantly inhibited production of IL-6, IL-8, and MCP-1 in TNF-α-activated HMC-1. Inhibitory effects appear to involve the NF-κB pathway. BAI inhibited NF-κB activation in IL-1β- and TNF-α-activated HMC-1. Furthermore, BAI increased cytoplasmic IκBα proteins in IL-1β- and TNF-α-activated HMC-1. Conclusion Our results showed that BAI inhibited the production of inflammatory cytokines through inhibition of NF-κB activation and IκBα phosphorylation and degradation in human mast cells. This inhibitory effect of BAI on the expression of inflammatory cytokines suggests its usefulness in the development of novel anti-inflammatory therapies.

  12. Angiotensin II modulates interleukin-1β-induced inflammatory gene expression in vascular smooth muscle cells via interfering with ERK-NF-κB crosstalk

    International Nuclear Information System (INIS)

    Xu, Shanqin; Zhi, Hui; Hou, Xiuyun; Jiang, Bingbing

    2011-01-01

    Highlights: → We examine how angiotensin II modulates ERK-NF-κB crosstalk and gene expression. → Angiotensin II suppresses IL-1β-induced prolonged ERK and NF-κB activation. → ERK-RSK1 signaling is required for IL-1β-induced prolonged NF-κB activation. → Angiotensin II modulates NF-κB responsive genes via regulating ERK-NF-κB crosstalk. → ERK-NF-κB crosstalk is a novel mechanism regulating inflammatory gene expression. -- Abstract: Angiotensin II is implicated in cardiovascular diseases, which is associated with a role in increasing vascular inflammation. The present study investigated how angiotensin II modulates vascular inflammatory signaling and expression of inducible nitric oxide synthase (iNOS) and vascular cell adhesion molecule (VCAM)-1. In cultured rat aortic vascular smooth muscle cells (VSMCs), angiotensin II suppressed interleukin-1β-induced prolonged phosphorylation of extracellular signal-regulated kinase (ERK) and ribosomal S6 kinase (RSK)-1, and nuclear translocation of nuclear factor (NF)-κB, leading to decreased iNOS but enhanced VCAM-1 expression, associated with an up-regulation of mitogen-activated protein kinase phosphatase-1 expression. Knock-down of RSK1 selectively down regulated interleukin-1β-induced iNOS expression without influencing VCAM-1 expression. In vivo experiments showed that interleukin-1β, iNOS, and VCAM-1 expression were detectable in the aortic arches of both wild-type and apolipoprotein E-deficient (ApoE -/- ) mice. VCAM-1 and iNOS expression were higher in ApoE -/- than in wild type mouse aortic arches. Angiotensin II infusion (3.2 mg/kg/day, for 6 days, via subcutaneous osmotic pump) in ApoE -/- mice enhanced endothelial and adventitial VCAM-1 and iNOS expression, but reduced medial smooth muscle iNOS expression associated with reduced phosphorylation of ERK and RSK-1. These results indicate that angiotensin II can differentially modulate inflammatory gene expression in aortic smooth muscle cells

  13. Angiotensin II modulates interleukin-1{beta}-induced inflammatory gene expression in vascular smooth muscle cells via interfering with ERK-NF-{kappa}B crosstalk

    Energy Technology Data Exchange (ETDEWEB)

    Xu, Shanqin [Vascular Biology Unit, Whitaker Cardiovascular Institute, Boston University School of Medicine, Boston, MA (United States); Zhi, Hui [Cardiovascular Division, Department of Medicine, Brigham and Women' s Hospital, Harvard Medical School, Boston, MA (United States); Hou, Xiuyun [Vascular Biology Unit, Whitaker Cardiovascular Institute, Boston University School of Medicine, Boston, MA (United States); Jiang, Bingbing, E-mail: bjiang1@rics.bwh.harvard.edu [Vascular Biology Unit, Whitaker Cardiovascular Institute, Boston University School of Medicine, Boston, MA (United States); Cardiovascular Division, Department of Medicine, Brigham and Women' s Hospital, Harvard Medical School, Boston, MA (United States)

    2011-07-08

    Highlights: {yields} We examine how angiotensin II modulates ERK-NF-{kappa}B crosstalk and gene expression. {yields} Angiotensin II suppresses IL-1{beta}-induced prolonged ERK and NF-{kappa}B activation. {yields} ERK-RSK1 signaling is required for IL-1{beta}-induced prolonged NF-{kappa}B activation. {yields} Angiotensin II modulates NF-{kappa}B responsive genes via regulating ERK-NF-{kappa}B crosstalk. {yields} ERK-NF-{kappa}B crosstalk is a novel mechanism regulating inflammatory gene expression. -- Abstract: Angiotensin II is implicated in cardiovascular diseases, which is associated with a role in increasing vascular inflammation. The present study investigated how angiotensin II modulates vascular inflammatory signaling and expression of inducible nitric oxide synthase (iNOS) and vascular cell adhesion molecule (VCAM)-1. In cultured rat aortic vascular smooth muscle cells (VSMCs), angiotensin II suppressed interleukin-1{beta}-induced prolonged phosphorylation of extracellular signal-regulated kinase (ERK) and ribosomal S6 kinase (RSK)-1, and nuclear translocation of nuclear factor (NF)-{kappa}B, leading to decreased iNOS but enhanced VCAM-1 expression, associated with an up-regulation of mitogen-activated protein kinase phosphatase-1 expression. Knock-down of RSK1 selectively down regulated interleukin-1{beta}-induced iNOS expression without influencing VCAM-1 expression. In vivo experiments showed that interleukin-1{beta}, iNOS, and VCAM-1 expression were detectable in the aortic arches of both wild-type and apolipoprotein E-deficient (ApoE{sup -/-}) mice. VCAM-1 and iNOS expression were higher in ApoE{sup -/-} than in wild type mouse aortic arches. Angiotensin II infusion (3.2 mg/kg/day, for 6 days, via subcutaneous osmotic pump) in ApoE{sup -/-} mice enhanced endothelial and adventitial VCAM-1 and iNOS expression, but reduced medial smooth muscle iNOS expression associated with reduced phosphorylation of ERK and RSK-1. These results indicate that angiotensin

  14. Opposite effect of oxidative stress on inducible nitric oxide synthase and haem oxygenase-1 expression in intestinal inflammation: anti-inflammatory effect of carbon monoxide

    NARCIS (Netherlands)

    Dijkstra, Gerard; Blokzijl, Hans; Bok, Lisette; Homan, Manon; van Goor, Harry; Faber, Klaas Nico; Jansen, Peter L. M.; Moshage, Han

    2004-01-01

    Inducible nitric oxide synthase (iNOS) is expressed in intestinal epithelial cells (IEC) of patients with active inflammatory bowel disease (IBD) and in IEC of endotoxaemic rats. The induction of iNOS in IEC is an element of the NF-kappaB-mediated survival pathway. Haem oxygenase-1 (HO-1) is an

  15. LPS induces pro-inflammatory response in mastitis mice and mammary epithelial cells: Possible involvement of NF-κB signaling and OPN.

    Science.gov (United States)

    Xiao, H-B; Wang, C-R; Liu, Z-K; Wang, J-Y

    2015-02-01

    Lipopolysaccharide (LPS) has pro-inflammatory properties. This study was conducted to determine whether the LPS induced pro-inflammatory response in a model of mastitis and in mouse mammary epithelial cells (MEC). To investigate the effects of LPS in vivo, 50 μL of a solution of LPS (20 ng/μL) were infused into the mammary glands of mice. To study the effects of LPS in vitro, MEC were exposed to LPS (20 μg/mL) for 24h. Activation of nuclear factor kB (NF-κB) and myeloperoxidase (MPO) were studied. Production of pro-inflammatory cytokines (interleukin-6 [IL-6], tumor necrosis factor-alpha [TNF-alpha], interleukin-1 beta [IL-1 beta]) and expression of osteopontin (OPN) were also evaluated. After LPS administration, route of NF-κB signaling is activated and the activity of MPO is increased. Furthermore, LPS increases the expression of OPN and production of TNF-alpha, IL-6 and IL-1 beta. Present results demonstrate that LPS induces a pro-inflammatory response in a murine model of mastitis and suggest the involvement of the NF-κB pathway and OPN. Copyright © 2014 Elsevier Masson SAS. All rights reserved.

  16. Celastrol ameliorates HIV-1 Tat-induced inflammatory responses via NF-kappaB and AP-1 inhibition and heme oxygenase-1 induction in astrocytes

    International Nuclear Information System (INIS)

    Youn, Gi Soo; Kwon, Dong-Joo; Ju, Sung Mi; Rhim, Hyangshuk; Bae, Yong Soo; Choi, Soo Young; Park, Jinseu

    2014-01-01

    HIV-1 Tat causes extensive neuroinflammation that may progress to AIDS-related encephalitis and dementia. Celastrol possesses various biological activities such as anti-oxidant, anti-tumor, and anti-inflammatory activities. In this study, we investigated the modulatory effects of celastrol on HIV-1 Tat-induced inflammatory responses and the molecular mechanisms underlying its action in astrocytes. Pre-treatment of CRT-MG human astroglioma cells with celastrol significantly inhibited HIV-1 Tat-induced expression of ICAM-1/VCAM-1 and subsequent monocyte adhesiveness in CRT-MG cells. In addition, celastrol suppressed HIV-1 Tat-induced expression of pro-inflammatory chemokines, such as CXCL10, IL-8, and MCP-1. Celastrol decreased HIV-1 Tat-induced activation of JNK MAPK, AP-1, and NF-κB. Furthermore, celastrol induced mRNA and protein expression of HO-1 as well as Nrf2 activation. Blockage of HO-1 expression using siRNA reversed the inhibitory effect of celastrol on HIV-1 Tat-induced inflammatory responses. These results suggest that celastrol has regulatory effects on HIV-1 Tat-induced inflammatory responses by blocking the JNK MAPK-AP-1/NF-κB signaling pathways and inducing HO-1 expression in astrocytes. - Highlights: • Celastrol suppressed HIV-1 Tat-induced expression of pro-inflammatory genes. • Celastrol inhibited HIV-1 Tat -induced activation of JNK MAPK. • Celastrol inhibited HIV-1 Tat-induced activation of both NF-κB and AP-1. • Celastrol inhibited HIV-1 Tat-induced inflammatory responses via HO-1 induction

  17. Hexane fraction from Laminaria japonica exerts anti-inflammatory effects on lipopolysaccharide-stimulated RAW 264.7 macrophages via inhibiting NF-kappaB pathway.

    Science.gov (United States)

    Lee, Ji-Young; Lee, Min-Sup; Choi, Hee-Jeon; Choi, Ji-Woong; Shin, Taisun; Woo, Hee-Chul; Kim, Jae-Il; Kim, Hyeung-Rak

    2013-02-01

    Laminaria japonica is a representative marine brown alga used as a culinary item in East Asia. L. japonica extract was shown to exert various biological activities; however, its anti-inflammatory activity has not been reported. The aim of this study is to investigate the molecular mechanisms underlying its anti-inflammatory action. Anti-inflammatory mechanisms of L. japonica n-hexane fraction (LHF) were assessed using lipopolysaccharide (LPS)-stimulated RAW 264.7 macrophages. An anti-inflammatory compound isolated from LHF by reverse-phase chromatography was identified using nuclear magnetic resonance (NMR) spectroscopy. Our results indicate that LHF significantly inhibited LPS-stimulated nitric oxide (NO) and prostaglandin E(2) (PGE(2)) secretion in a dose-dependent manner and suppressed the expression of inducible nitric oxide synthase (iNOS) and cyclooxygenase-2 (COX-2) with no cytotoxicity. As results, levels of pro-inflammatory cytokines were significantly reduced by pretreatment of LHF in LPS-stimulated RAW 264.7 cells. Treatment of LHF strongly suppressed nuclear factor-κB (NF-κB) promoter-driven expression and nuclear translocation of NF-κB by preventing proteolytic degradation of inhibitor of κB (IκB)-α in LPS-stimulated RAW 264.7 cells. Moreover, LHF inhibited the phosphorylation of Akt and mitogen-activated protein kinase (MAPK) in LPS-stimulated RAW 264.7 cells. One of the anti-inflammatory compounds was isolated from LHF and identified as fucoxanthin. These results indicate that the LHF-mediated inhibition of NO and PGE(2) secretion in LPS-stimulated macrophages is regulated by NF-κB inactivation through inhibition of IκB-α, MAPKs, and Akt phosphorylation. LHF may be considered as a functional food candidate for the prevention or treatment of inflammatory diseases.

  18. Tat-CBR1 inhibits inflammatory responses through the suppressions of NF-κB and MAPK activation in macrophages and TPA-induced ear edema in mice

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Young Nam [Department of Biomedical Science and Research Institute of Bioscience and Biotechnology, Hallym University, Chunchon 200-702 (Korea, Republic of); Kim, Dae Won [Department of Biochemistry and Molecular Biology, Research Institute of Oral Sciences, College of Dentistry, Kangnung-Wonju National University, Kangneung 210-702 (Korea, Republic of); Jo, Hyo Sang; Shin, Min Jea; Ahn, Eun Hee; Ryu, Eun Ji; Yong, Ji In; Cha, Hyun Ju; Kim, Sang Jin; Yeo, Hyeon Ji; Youn, Jong Kyu; Hwang, Jae Hyeok [Department of Biomedical Science and Research Institute of Bioscience and Biotechnology, Hallym University, Chunchon 200-702 (Korea, Republic of); Jeong, Ji-Heon; Kim, Duk-Soo [Department of Anatomy, College of Medicine, Soonchunhyang University, Cheonan-Si 330-090 (Korea, Republic of); Cho, Sung-Woo [Department of Biochemistry and Molecular Biology, University of Ulsan College of Medicine, Seoul 138-736 (Korea, Republic of); Park, Jinseu [Department of Biomedical Science and Research Institute of Bioscience and Biotechnology, Hallym University, Chunchon 200-702 (Korea, Republic of); Eum, Won Sik, E-mail: wseum@hallym.ac.kr [Department of Biomedical Science and Research Institute of Bioscience and Biotechnology, Hallym University, Chunchon 200-702 (Korea, Republic of); Choi, Soo Young, E-mail: sychoi@hallym.ac.kr [Department of Biomedical Science and Research Institute of Bioscience and Biotechnology, Hallym University, Chunchon 200-702 (Korea, Republic of)

    2015-07-15

    Human carbonyl reductase 1 (CBR1) plays a crucial role in cell survival and protects against oxidative stress response. However, its anti-inflammatory effects are not yet clearly understood. In this study, we examined whether CBR1 protects against inflammatory responses in macrophages and mice using a Tat-CBR1 protein which is able to penetrate into cells. The results revealed that purified Tat-CBR1 protein efficiently transduced into Raw 264.7 cells and inhibited lipopolysaccharide (LPS)-induced cyclooxygenase-2 (COX-2), nitric oxide (NO) and prostaglandin E{sub 2} (PGE{sub 2}) expression levels. In addition, Tat-CBR1 protein leads to decreased pro-inflammatory cytokine expression through suppression of nuclear transcription factor-kappaB (NF-κB) and mitogen activated protein kinase (MAPK) activation. Furthermore, Tat-CBR1 protein inhibited inflammatory responses in 12-O-tetradecanoylphorbol-13-acetate (TPA)-induced skin inflammation when applied topically. These findings indicate that Tat-CBR1 protein has anti-inflammatory properties in vitro and in vivo through inhibition of NF-κB and MAPK activation, suggesting that Tat-CBR1 protein may have potential as a therapeutic agent against inflammatory diseases. - Highlights: • Transduced Tat-CBR1 reduces LPS-induced inflammatory mediators and cytokines. • Tat-CBR1 inhibits MAPK and NF-κB activation. • Tat-CBR1 ameliorates inflammation response in vitro and in vivo. • Tat-CBR1 may be useful as potential therapeutic agent for inflammation.

  19. Celastrol ameliorates HIV-1 Tat-induced inflammatory responses via NF-kappaB and AP-1 inhibition and heme oxygenase-1 induction in astrocytes

    Energy Technology Data Exchange (ETDEWEB)

    Youn, Gi Soo; Kwon, Dong-Joo; Ju, Sung Mi [Department of Biomedical Science and Research Institute for Bioscience and Biotechnology, Hallym University, Chunchon 200-702 (Korea, Republic of); Rhim, Hyangshuk [Department of Biomedical Sciences, Department of Medical Life Sciences, College of Medicine, the Catholic University of Korea, Seoul 137-701 (Korea, Republic of); Bae, Yong Soo [Department of Biological Science, College of Natural Sciences, Sungkyunkwan University, Suwon 440-746 (Korea, Republic of); Choi, Soo Young [Department of Biomedical Science and Research Institute for Bioscience and Biotechnology, Hallym University, Chunchon 200-702 (Korea, Republic of); Park, Jinseu, E-mail: jinpark@hallym.ac.kr [Department of Biomedical Science and Research Institute for Bioscience and Biotechnology, Hallym University, Chunchon 200-702 (Korea, Republic of)

    2014-10-01

    HIV-1 Tat causes extensive neuroinflammation that may progress to AIDS-related encephalitis and dementia. Celastrol possesses various biological activities such as anti-oxidant, anti-tumor, and anti-inflammatory activities. In this study, we investigated the modulatory effects of celastrol on HIV-1 Tat-induced inflammatory responses and the molecular mechanisms underlying its action in astrocytes. Pre-treatment of CRT-MG human astroglioma cells with celastrol significantly inhibited HIV-1 Tat-induced expression of ICAM-1/VCAM-1 and subsequent monocyte adhesiveness in CRT-MG cells. In addition, celastrol suppressed HIV-1 Tat-induced expression of pro-inflammatory chemokines, such as CXCL10, IL-8, and MCP-1. Celastrol decreased HIV-1 Tat-induced activation of JNK MAPK, AP-1, and NF-κB. Furthermore, celastrol induced mRNA and protein expression of HO-1 as well as Nrf2 activation. Blockage of HO-1 expression using siRNA reversed the inhibitory effect of celastrol on HIV-1 Tat-induced inflammatory responses. These results suggest that celastrol has regulatory effects on HIV-1 Tat-induced inflammatory responses by blocking the JNK MAPK-AP-1/NF-κB signaling pathways and inducing HO-1 expression in astrocytes. - Highlights: • Celastrol suppressed HIV-1 Tat-induced expression of pro-inflammatory genes. • Celastrol inhibited HIV-1 Tat -induced activation of JNK MAPK. • Celastrol inhibited HIV-1 Tat-induced activation of both NF-κB and AP-1. • Celastrol inhibited HIV-1 Tat-induced inflammatory responses via HO-1 induction.

  20. Andrographolide Inhibits Inflammatory Cytokines Secretion in LPS-Stimulated RAW264.7 Cells through Suppression of NF-κB/MAPK Signaling Pathway

    Directory of Open Access Journals (Sweden)

    Yu Li

    2017-01-01

    Full Text Available Andrographolide, the main active component extracted from Andrographis paniculata (Burm.f. Wall. ex Nees, exerts anti-inflammatory effects; however, the principal molecular mechanisms remain unclear. The objective of this study was to investigate the molecular mechanisms of Andrographolide in modifying lipopolysaccharide- (LPS- induced signaling pathway in RAW264.7 cells. An in vitro model of inflammation was induced by LPS in mouse RAW264.7 cells in the presence of Andrographolide. The concentration and expression levels of proinflammatory cytokines were determined by an enzyme-linked immunosorbent assay (ELISA and quantitative real-time polymerase chain reaction (qRT-PCR, respectively. The nuclear level of NF-κB was measured by an electrophoretic mobility shift assay (EMSA. The expression levels of NF-κB, p38, ERK, and JNK were determined by western blot. Andrographolide dose-dependently inhibited the release and mRNA expression of TNF-α, IL-6, and IL-1β in LPS-stimulated RAW264.7 cells. The nuclear level of p65 protein was decreased in Andrographolide treatment group. Western blot analysis showed that Andrographolide suppressed LPS-induced NF-κB activation and the phosphorylation of IkBa, ERK1/2, JNK, and p38. These results suggest that Andrographolide exerts an anti-inflammatory effect by inhibiting the activation of NF-κB/MAPK signaling pathway and the induction of proinflammatory cytokines.

  1. Andrographolide Inhibits Inflammatory Cytokines Secretion in LPS-Stimulated RAW264.7 Cells through Suppression of NF-κB/MAPK Signaling Pathway.

    Science.gov (United States)

    Li, Yu; He, Shengnan; Tang, Jishun; Ding, Nana; Chu, Xiaoyan; Cheng, Lianping; Ding, Xuedong; Liang, Ting; Feng, Shibin; Rahman, Sajid Ur; Wang, Xichun; Wu, Jinjie

    2017-01-01

    Andrographolide, the main active component extracted from Andrographis paniculata (Burm.f.) Wall. ex Nees, exerts anti-inflammatory effects; however, the principal molecular mechanisms remain unclear. The objective of this study was to investigate the molecular mechanisms of Andrographolide in modifying lipopolysaccharide- (LPS-) induced signaling pathway in RAW264.7 cells. An in vitro model of inflammation was induced by LPS in mouse RAW264.7 cells in the presence of Andrographolide. The concentration and expression levels of proinflammatory cytokines were determined by an enzyme-linked immunosorbent assay (ELISA) and quantitative real-time polymerase chain reaction (qRT-PCR), respectively. The nuclear level of NF- κ B was measured by an electrophoretic mobility shift assay (EMSA). The expression levels of NF- κ B, p38, ERK, and JNK were determined by western blot. Andrographolide dose-dependently inhibited the release and mRNA expression of TNF- α , IL-6, and IL-1 β in LPS-stimulated RAW264.7 cells. The nuclear level of p65 protein was decreased in Andrographolide treatment group. Western blot analysis showed that Andrographolide suppressed LPS-induced NF- κ B activation and the phosphorylation of IkBa, ERK1/2, JNK, and p38. These results suggest that Andrographolide exerts an anti-inflammatory effect by inhibiting the activation of NF- κ B/MAPK signaling pathway and the induction of proinflammatory cytokines.

  2. Nickel(II) Complex of Polyhydroxybenzaldehyde N4-Thiosemicarbazone Exhibits Anti-Inflammatory Activity by Inhibiting NF-κB Transactivation

    Science.gov (United States)

    Loh, Sheng Wei; Looi, Chung Yeng; Hassandarvish, Pouya; Phan, Alicia Yi Ling; Wong, Won Fen; Wang, Hao; Paterson, Ian C.; Ea, Chee Kwee; Mustafa, Mohd Rais; Maah, Mohd Jamil

    2014-01-01

    Background The biological properties of thiosemicarbazone have been widely reported. The incorporation of some transition metals such as Fe, Ni and Cu to thiosemicarbazone complexes is known to enhance its biological effects. In this study, we incorporated nickel(II) ions into thiosemicarbazone with N4-substitution groups H3L (H; H3L1, CH3; H3L2, C6H5; H3L3 and C2H5; H3L4) and examined its potential anti-inflammatory activity. Methodology/Principal Findings Four ligands (1–4) and their respective nickel-containing complexes (5–8) were synthesized and characterized. The compounds synthesized were tested for their effects on NF-κB nuclear translocation, pro-inflammatory cytokines secretion and NF-κB transactivation activity. The active compound was further evaluated on its ability to suppress carrageenan-induced acute inflammation in vivo. A potential binding target of the active compound was also predicted by molecular docking analysis. Conclusions/Significance Among all synthesized compounds tested, we found that complex [Ni(H2L1)(PPh3)]Cl (5) (complex 5), potently inhibited IκBα degradation and NF-κB p65 nuclear translocation in LPS-stimulated RAW264.7 cells as well as TNFα-stimulated HeLa S3 cells. In addition, complex 5 significantly down-regulated LPS- or TNFα-induced transcription of NF-κB target genes, including genes that encode the pro-inflammatory cytokines TNFα, IFNβ and IL6. Luciferase reporter assays confirmed that complex 5 inhibited the transactivation activity of NF-κB. Furthermore, the anti-inflammatory effect of complex 5 was also supported by its suppressive effect on carrageenan-induced paw edema formation in wild type C57BL/6 mice. Interestingly, molecular docking study showed that complex 5 potentially interact with the active site of IKKβ. Taken together, we suggest complex 5 as a novel NF-κB inhibitor with potent anti-inflammatory effects. PMID:24977407

  3. Shigella flexneri T3SS effector IpaH4.5 modulates the host inflammatory response via interaction with NF-κB p65 protein.

    Science.gov (United States)

    Wang, Fang; Jiang, Zheng; Li, Yan; He, Xiang; Zhao, Jiangli; Yang, Xinlong; Zhu, Li; Yin, Zhitao; Li, Xuelian; Wang, Xuesong; Liu, Wei; Shang, Wei; Yang, Zhan; Wang, Simiao; Zhen, Qing; Zhang, Zhuangnian; Yu, Yaqin; Zhong, Hui; Ye, Qinong; Huang, Liuyu; Yuan, Jing

    2013-03-01

    Shigella species possess a type III secretion system (T3SS), which is required for human infection and that delivers effector proteins into target host cells. Here, we show that the effector, IpaH4.5 dampens the pro-inflammatory cytokine response. In both the Sereny test and a murine lung infection model, the Shigella ΔipaH4.5 mutant strain caused more severe inflammatory responses and significantly induced higher pro-inflammatory cytokine levels (MIP-2 and TNF-α) in the lung homogenates of wild type-infected mice. Moreover, there was a threefold decrease in bacterial colonization of the mutant compared with the WT and ΔipaH4.5/ipaH4.5-rescued strains. Yeast two-hybrid screening showed that IpaH4.5 specifically interacts with the p65 subunit of NF-κB. Ten truncated versions of IpaH4.5 and p65 spanning different regions were constructed and expressed to further map the IpaH binding sites with p65. The results revealed thatthe p65 region spanning amino acids 1-190 of p65 interacted with the IpaH4.5/1-293 N-terminal region. In vitro, IpaH4.5 displayed ubiquitin ligase activity towards ubiquitin and p65. Furthermore, the transcriptional activity of NF-κB was shown to be inhibited by IpaH4.5 utilizing a dual-luciferase reporter gene detection system containing NF-κB promoter response elements. Thus, we conclude that the IpaH4.5 protein is an E3 ubiquitin ligase capable of directly regulating the host inflammatory response by inhibiting the NF-κB signalling pathway. © 2012 Blackwell Publishing Ltd.

  4. Vinpocetine reduces carrageenan-induced inflammatory hyperalgesia in mice by inhibiting oxidative stress, cytokine production and NF-κB activation in the paw and spinal cord.

    Directory of Open Access Journals (Sweden)

    Kenji W Ruiz-Miyazawa

    Full Text Available Vinpocetine is a safe nootropic agent used for neurological and cerebrovascular diseases. The anti-inflammatory activity of vinpocetine has been shown in cell based assays and animal models, leading to suggestions as to its utility in analgesia. However, the mechanisms regarding its efficacy in inflammatory pain treatment are still not completely understood. Herein, the analgesic effect of vinpocetine and its anti-inflammatory and antioxidant mechanisms were addressed in murine inflammatory pain models. Firstly, we investigated the protective effects of vinpocetine in overt pain-like behavior induced by acetic acid, phenyl-p-benzoquinone (PBQ and formalin. The intraplantar injection of carrageenan was then used to induce inflammatory hyperalgesia. Mechanical and thermal hyperalgesia were evaluated using the electronic von Frey and the hot plate tests, respectively, with neutrophil recruitment to the paw assessed by a myeloperoxidase activity assay. A number of factors were assessed, both peripherally and in the spinal cord, including: antioxidant capacity, reduced glutathione (GSH levels, superoxide anion, tumor necrosis factor alpha (TNF-α and interleukin 1 beta (IL-1β levels, as well as nuclear factor kappa B (NF-κB activation. Vinpocetine inhibited the overt pain-like behavior induced by acetic acid, PBQ and formalin (at both phases, as well as the carrageenan-induced mechanical and thermal hyperalgesia and associated neutrophil recruitment. Both peripherally and in the spinal cord, vinpocetine also inhibited: antioxidant capacity and GSH depletion; increased superoxide anion; IL-1β and TNF-α levels; and NF-κB activation. As such, vinpocetine significantly reduces inflammatory pain by targeting oxidative stress, cytokine production and NF-κB activation at both peripheral and spinal cord levels.

  5. NF-κB signaling at the crossroads of inflammation and atherogenesis: searching for new therapeutic links.

    Science.gov (United States)

    Pateras, Ioannis; Giaginis, Constantinos; Tsigris, Christos; Patsouris, Efstratios; Theocharis, Stamatios

    2014-09-01

    NF-κB is a protein complex acting as a primary transcription factor and fast messenger to harmful cellular stimuli, including inflammation. Carotid atherosclerosis is an inflammatory process leading to atheroma formation and ultimately complicating the patient's condition. This review aims to critically summarize the role of NF-κB in atheroma formation and evolution, also highlighting its potential therapeutic utility. This literature review presents the most recent data in terms of NF-κB, atherosclerosis and implicating factors, with special focus on the carotid artery setting. Results are categorized according to atheroma stage and are discussed for each one respectively, forming an NF-κB mediated atherosclerosis evolvement model per stage. Targeting NF-κB by inhibitors or enhancers and their potential effectiveness are also discussed. The current data suggest that NF-κB plays a critical role in all stages of plaque evolution toward complexity, implicating genes, membrane and cellular proteins, polypeptides, chemokines and hormones. It also seems capable of assisting several pharmaceutical agents, unfolding either directly or indirectly their anti-inflammatory/anti-atherogenic properties. Targeting NF-κB signaling by specific inhibitors or enhancers may provide new therapeutic strategies against atherogenic inflammatory process.

  6. Anthocyanins Downregulate Lipopolysaccharide-Induced Inflammatory Responses in BV2 Microglial Cells by Suppressing the NF-κB and Akt/MAPKs Signaling Pathways

    Directory of Open Access Journals (Sweden)

    Yung Hyun Choi

    2013-01-01

    Full Text Available Anthocyanins are naturally occurring polyphenols that impart bright color to fruits, vegetables and plants and have a variety of protective properties, which have generally been attributed to their antioxidant capacity. However, little is known about the molecular mechanisms underlying anti-inflammatory effects of anthocyanins related to neurodegenerative diseases. Therefore, we determined whether anthocyanins isolated from black soybean seed coats would inhibit pro-inflammatory mediators and cytokines in lipopolysaccharide (LPS-stimulated murine BV2 microglial cells. Our results showed that anthocyanins significantly inhibited LPS-induced pro-inflammatory mediators, such as nitric oxide (NO and prostaglandin E2, and pro-inflammatory cytokines including tumor necrosis factor (TNF-α and interleukin (IL-1β, without significant cytotoxicity. Anthocyanins also downregulated excessive expression of inducible NO synthase, cyclooxygenase-2, TNF-α, and IL-1β in LPS-stimulated BV2 cells. Moreover, anthocyanins inhibited nuclear translocation of nuclear factor-kappa B (NF-κB by reducing inhibitor of NF-κB alpha degradation as well as phosphorylating extracellular signal-regulated kinase, c-Jun N-terminal kinase, p38 mitogen-activated protein kinase, and Akt. These findings suggest that anthocyanins may offer substantial therapeutic potential for treating inflammatory and neurodegenerative diseases accompanied by microglial activation.

  7. Human resistin stimulates the pro-inflammatory cytokines TNF-α and IL-12 in macrophages by NF-κB-dependent pathway

    International Nuclear Information System (INIS)

    Silswal, Nirupama; Singh, Anil K.; Aruna, Battu; Mukhopadhyay, Sangita; Ghosh, Sudip; Ehtesham, Nasreen Z.

    2005-01-01

    Resistin, a recently discovered 92 amino acid protein involved in the development of insulin resistance, has been associated with obesity and type 2 diabetes. The elevated serum resistin in human diabetes is often associated with a pro-inflammatory milieu. However, the role of resistin in the development of inflammation is not well understood. Addition of recombinant human resistin protein (hResistin) to macrophages (both murine and human) resulted in enhanced secretion of pro-inflammatory cytokines, TNF-α and IL-12, similar to that obtained using 5 μg/ml lipopolysaccharide. Both oligomeric and dimeric forms of hResistin were able to activate these cytokines suggesting that the inflammatory action of resistin is independent of its conformation. Heat denatured hResistin abrogated cytokine induction while treatment of recombinant resistin with polymyxin B agarose beads had no effect thereby ruling out the role of endotoxin in the recombinant hResistin mediated cytokine induction. The pro-inflammatory nature of hResistin was further evident from the ability of this protein to induce the nuclear translocation of NF-κB transcription factor as seen from electrophoretic mobility shift assays. Induction of TNF-α in U937 cells by hResistin was markedly reduced in the presence of either dominant negative IκBα plasmid or PDTC, a pharmacological inhibitor of NF-κB. A protein involved in conferring insulin resistance is also a pro-inflammatory molecule that has important implications

  8. Inhibitory Effects of Palmultang on Inflammatory Mediator Production Related to Suppression of NF-κB and MAPK Pathways and Induction of HO-1 Expression in Macrophages

    Directory of Open Access Journals (Sweden)

    You-Chang Oh

    2014-05-01

    Full Text Available Palmultang (PM is an herbal decoction that has been used to treat anorexia, anemia, general prostration, and weakness due to chronic illness since medieval times in Korea, China, and Japan. The present study focused on the inhibitory effects of PM on the production of inflammatory factors and on the activation of mechanisms in murine macrophages. PM suppressed the expression of nitric oxide (NO, inflammatory cytokines and inflammatory proteins by inhibiting nuclear factor (NF-κB and mitogen-activated protein kinase (MAPK signaling pathways and by inducing heme oxygenase (HO-1 expression. Collectively, our results explain the anti-inflammatory effect and inhibitory mechanism of PM in macrophages stimulated with lipopolysaccharide (LPS.

  9. Anti-Inflammatory Activity of Bee Venom in BV2 Microglial Cells: Mediation of MyD88-Dependent NF-κB Signaling Pathway.

    Science.gov (United States)

    Im, Eun Ju; Kim, Su Jung; Hong, Seung Bok; Park, Jin-Kyu; Rhee, Man Hee

    2016-01-01

    Bee venom has long been used as a traditional folk medicine in Korea. It has been reportedly used for the treatment of arthritis, cancer, and inflammation. Although its anti-inflammatory activity in lipopolysaccharide- (LPS-) stimulated inflammatory cells has been reported, the exact mechanism of its anti-inflammatory action has not been fully elucidated. Therefore, the aim of this study was to investigate the anti-inflammatory mechanism of bee venom in BV2 microglial cells. We first investigated whether NO production in LPS-activated BV2 cells was inhibited by bee venom, and further iNOS mRNA and protein expressions were determined. The mRNA and protein levels of proinflammatory cytokines were examined using semiquantitative RT-PCR and immunoblotting, respectively. Moreover, modulation of the transcription factor NF-κB by bee venom was also investigated using a luciferase assay. LPS-induced NO production in BV2 microglial cells was significantly inhibited in a concentration-dependent manner upon pretreatment with bee venom. Bee venom markedly reduced the mRNA expression of COX-2, TNF-α, IL-1β, and IL-6 and suppressed LPS-induced activation of MyD88 and IRAK1 and phosphorylation of TAK1. Moreover, NF-κB translocation by IKKα/β phosphorylation and subsequent IκB-α degradation were also attenuated. Thus, collectively, these results indicate that bee venom exerts its anti-inflammatory activity via the IRAK1/TAK1/NF-κB signaling pathway.

  10. Ulinastatin Protects Against LPS-Induced Acute Lung Injury by Attenuating TLR4/NF-κB Pathway Activation and Reducing Inflammatory Mediators.

    Science.gov (United States)

    Cao, Chao; Yin, Chengfen; Shou, Songtao; Wang, Jun; Yu, Lechang; Li, Xuening; Chai, Yanfen

    2018-01-10

    Acute lung injury (ALI) and its severe form, acute respiratory distress syndrome (ARDS), remain the leading causes of morbidity and mortality in intensive care units. Ulinastatin (UTI), a serine protease inhibitor, possesses anti-inflammatory properties and has been suggested to modulate lipopolysaccharide (LPS)-induced sepsis; thus, it is now widely used in the treatment of pancreatitis, sepsis, and septic shock. Toll-like receptor 4 (TLR4), an essential LPS signaling receptor, plays a critical role in the activation of innate immunity. The aim of this study was to investigate whether UTI alleviates ALI by attenuating TLR4 expression and to explore the underlying molecular mechanisms involved. Male C56BL/6 mice were administered UTI intravenously 1 h before and 6 h after exposure to LPS by intra-tracheal instillation. Human lung epithelial (BEAS-2B) cells were incubated with LPS in the presence or absence of UTI. An enzyme-linked immunosorbent assay was used to detect levels of inflammatory cytokines. Western blot analysis was performed to detect changes in TLR4 expression and nuclear factor-κB (NF-κB) activation. UTI significantly protected animals from LPS-induced ALI, decreasing the lung wet/dry weight ratio, ALI score, total cells, neutrophils, macrophages, myeloperoxidase activity, and malondialdehyde content, factors associated with lung histological damage. UTI treatment also markedly attenuated levels of TLR4 and other pro-inflammatory cytokines. Furthermore, UTI significantly attenuated LPS-induced increases in TLR4 protein expression and NF-κB activation in lung tissues. Similarly, UTI markedly attenuated TLR4 expression and NF-κB activation in LPS-stimulated BEAS-2B cells. These findings indicate that UTI ameliorates LPS-induced ALI by attenuating the TLR4/NF-κB pathway activation.

  11. Mineralocorticoid and glucocorticoid receptors differentially regulate NF-kappaB activity and pro-inflammatory cytokine production in murine BV-2 microglial cells

    Directory of Open Access Journals (Sweden)

    Chantong Boonrat

    2012-11-01

    -κB translocation Cay-10512. Moreover, an increased expression of TNFR2 was observed upon treatment with 11-dehydrocorticosterone and aldosterone, which was reversed by 11β-HSD1 inhibitors and/or spironolactone and Cay-10512. Conclusions A tightly coordinated GR and MR activity regulates the NF-κB pathway and the control of inflammatory mediators in microglia cells. The balance of GR and MR activity is locally modulated by the action of 11β-HSD1, which is upregulated by pro-inflammatory mediators and may represent an important feedback mechanism involved in resolution of inflammation.

  12. Astragalin suppresses inflammatory responses via down-regulation of NF-κB signaling pathway in lipopolysaccharide-induced mastitis in a murine model.

    Science.gov (United States)

    Li, Fengyang; Liang, Dejie; Yang, Zhengtao; Wang, Tiancheng; Wang, Wei; Song, Xiaojing; Guo, Mengyao; Zhou, Ershun; Li, Depeng; Cao, Yongguo; Zhang, Naisheng

    2013-10-01

    Mastitis is a prevalent and economic disease around the world and defined as infection and inflammation of the mammary gland. Astragalin, a bioactive component isolated from persimmon or Rosa agrestis, has been reported to have anti-inflammatory properties. To investigate the potential therapeutic effect of astragalin in mastitis, a murine model of mastitis was induced by administration of LPS in mammary gland. Astragalin was applied 1h before and 12h after LPS treatment. The results showed that astragalin attenuated the infiltration of inflammatory cells, the activity of myeloperoxidase (MPO) and the expression of tumor necrosis factor-α (TNF-α), interleukin-6 (IL-6) and interleukin-1β (IL-1β) in a dose-dependent manner. Additionally, Western blotting results showed that astragalin efficiently blunt decreased nuclear factor-kappaB (NF-κB) activation by inhibiting the degradation and phosphorylation of IκBα and the nuclear translocation of p65. These results suggested that astragalin exerts anti-inflammatory properties in LPS-mediated mastitis, possibly through inhibiting inhibition of the NF-κB signaling pathway, which mediates the expression of pro-inflammatory cytokines. Astragalin may be a potential therapeutic agent against mastitis. © 2013.

  13. Mineral trioxide aggregate enhances the odonto/osteogenic capacity of stem cells from inflammatory dental pulps via NF-κB pathway.

    Science.gov (United States)

    Wang, Y; Yan, M; Fan, Z; Ma, L; Yu, Y; Yu, J

    2014-10-01

    This study was designed to investigate the effects of mineral trioxide aggregate (MTA) on the osteo/odontogenic differentiation of inflammatory dental pulp stem cells (iDPSCs). inflammatory DPSCs were isolated from the inflammatory pulps of rat incisors and cocultured with MTA-conditioned medium. MTT assay and flow cytometry were performed to evaluate the proliferation of iDPSCs. Alkaline phosphatase (ALP) activity, alizarin red staining, real-time RT-PCR, and Western blot assay were used to investigate the differentiation capacity as well as the involvement of NF-κB pathway in iDPSCs. Mineral trioxide aggregate-treated iDPSCs demonstrated the higher ALP activity and formed more mineralized nodules than the untreated group. The odonto/osteoblastic markers (Alp, Runx2/RUNX2, Osx/OSX, Ocn/OCN, and Dspp/DSP, respectively) in MTA-treated iDPSCs were significantly upregulated as compared with untreated iDPSCs. Mechanistically, cytoplastic phos-P65 and nuclear P65 in MTA-treated iDPSCs were significantly increased in a time-dependent manner. Moreover, the inhibition of NF-κB pathway suppressed the MTA-induced odonto/osteoblastic differentiation of iDPSCs, as indicated by decreased ALP levels, weakened mineralization capacity and downregulated levels of odonto/osteoblastic genes (Osx, Ocn, and Dspp). Mineral trioxide aggregate enhances the odonto/osteogenic capacity of DPSCs from inflammatory sites via activating the NF-κB pathway. © 2013 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  14. Quercetin inhibits expression of inflammatory cytokines through attenuation of NF-kappaB and p38 MAPK in HMC-1 human mast cell line.

    Science.gov (United States)

    Min, Y-D; Choi, C-H; Bark, H; Son, H-Y; Park, H-H; Lee, S; Park, J-W; Park, E-K; Shin, H-I; Kim, S-H

    2007-05-01

    Mast cell-mediated allergic inflammation is involved in many diseases such as asthma, sinusitis, and rheumatoid arthritis. Mast cells induce production of pro-inflammatory cytokines with immune regulatory properties. We investigated the effect of quercetin on the expression of pro-inflammatory cytokines in human mast cell line, HMC-1. HMC-1 cells were stimulated with phorbol 12-myristate 13-acetate (PMA) and calcium ionophore A23187 (PMACI). Quercetin decreased the gene expression and production of tumor necrosis factor (TNF)-alpha, interleukin (IL)-1beta, IL-6, and IL-8 in PMACI-stimulated HMC-1 cells. Quercetin attenuated PMACI-induced activation of NF-kappaB and p38 mitogen-activated protein kinase. Our study provides evidence that quercetin may suitable for the treatment of mast cell-derived allergic inflammatory diseases.

  15. Flavonoids Identified from Korean Scutellaria baicalensis Georgi Inhibit Inflammatory Signaling by Suppressing Activation of NF-κB and MAPK in RAW 264.7 Cells

    Directory of Open Access Journals (Sweden)

    Gyeong-Eun Hong

    2013-01-01

    Full Text Available Scutellaria baicalensis Georgi has been used as traditional medicine for treating inflammatory diseases, hepatitis, tumors, and diarrhea in Asia. Hence, we investigated the anti-inflammatory effect and determined the molecular mechanism of action of flavonoids isolated from Korean S. baicalensis G. in lipopolysaccharide- (LPS- stimulated RAW 264.7 macrophages. A 3-(4,5-dimethylthiazol-2-yl-2,5-diphenyltetrazolium bromide assay was performed to examine cytotoxicity of the flavonoids at various concentrations of 10, 40, 70, and 100 µg/mL. No cytotoxicity was observed in RAW 264.7 cells at these concentrations. Furthermore, the flavonoids decreased production of inflammatory mediators such as inducible nitric oxide synthase, cyclooxygenase-2, interleukin-6, and tumor necrosis factor-alpha and inhibited phosphorylation of nuclear factor-kappa B (NF-κB and mitogen-activated protein kinases (MAPKs in LPS-induced RAW 264.7 cells. Moreover, to identify the differentially expressed proteins in RAW 264.7 cells of the control, LPS-treated, and flavonoid-treated groups, two-dimensional gel electrophoresis and mass spectrometry were conducted. The identified proteins were involved in the inflammatory response and included PRKA anchor protein and heat shock protein 70 kD. These findings suggest that the flavonoids isolated from S. baicalensis G. might have anti-inflammatory effects that regulate the expression of inflammatory mediators by inhibiting the NF-κB signaling pathway via the MAPK signaling pathway in RAW 264.7 cells.

  16. NF-κB/AP-1-Targeted Inhibition of Macrophage-Mediated Inflammatory Responses by Depigmenting Compound AP736 Derived from Natural 1,3-Diphenylpropane Skeleton

    Directory of Open Access Journals (Sweden)

    Van Thai Ha

    2014-01-01

    Full Text Available AP736 was identified as an antimelanogenic drug that can be used for the prevention of melasma, freckles, and dark spots in skin by acting as a suppressor of melanin synthesis and tyrosinase expression. Since macrophage-mediated inflammatory responses are critical for skin health, here we investigated the potential anti-inflammatory activity of AP736. The effects of AP736 on various inflammatory events such as nitric oxide (NO/prostaglandin (PG E2 production, inflammatory gene expression, phagocytic uptake, and morphological changes were examined in RAW264.7 cells. AP736 was found to strongly inhibit the production of both NO and PGE2 in lipopolysaccharide- (LPS- treated RAW264.7 cells. In addition, AP736 strongly inhibited both LPS-induced morphological changes and FITC-dextran-induced phagocytic uptake. Furthermore, AP736 also downregulated the expression of multiple inflammatory genes, such as inducible NO synthase (iNOS, cyclooxygenase- (COX- 2, and interleukin- (IL- 1β in LPS-treated RAW264.7 cells. Transcription factor analysis, including upstream signalling events, revealed that both NF-κB and AP-1 were targeted by AP736 via inhibition of the IKK/IκBα and IRAK1/TAK1 pathways. Therefore, our results strongly suggest that AP736 is a potential anti-inflammatory drug due to its suppression of NF-κB-IKK/IκBα and AP-1-IRAK1/TAK1 signalling, which may make AP736 useful for the treatment of macrophage-mediated skin inflammation.

  17. SIRT6 Acts as a Negative Regulator in Dengue Virus-Induced Inflammatory Response by Targeting the DNA Binding Domain of NF-κB p65

    Directory of Open Access Journals (Sweden)

    Pengcheng Li

    2018-04-01

    Full Text Available Dengue virus (DENV is a mosquito-borne single-stranded RNA virus causing human disease with variable severity. The production of massive inflammatory cytokines in dengue patients has been associated with dengue disease severity. However, the regulation of these inflammatory responses remains unclear. In this study, we report that SIRT6 is a negative regulator of innate immune responses during DENV infection. Silencing of Sirt6 enhances DENV-induced proinflammatory cytokine and chemokine production. Overexpression of SIRT6 inhibits RIG-I-like receptor (RLR and Toll-like receptor 3 (TLR3 mediated NF-κB activation. The sirtuin core domain of SIRT6 is required for the inhibition of NF-κB p65 function. SIRT6 interacts with the DNA binding domain of p65 and competes with p65 to occupy the Il6 promoter during DENV infection. Collectively, our study demonstrates that SIRT6 negatively regulates DENV-induced inflammatory response via RLR and TLR3 signaling pathways.

  18. Anti-inflammatory properties of clovamide and Theobroma cacao phenolic extracts in human monocytes: evaluation of respiratory burst, cytokine release, NF-κB activation, and PPARγ modulation.

    Science.gov (United States)

    Zeng, Huawu; Locatelli, Monica; Bardelli, Claudio; Amoruso, Angela; Coisson, Jean Daniel; Travaglia, Fabiano; Arlorio, Marco; Brunelleschi, Sandra

    2011-05-25

    There is a great interest in the potential health benefits of biologically active phenolic compounds in cocoa (Theobroma cacao) and dark chocolate. We investigated the anti-inflammatory potential of clovamide (a N-phenylpropenoyl-L-amino acid amide present in cocoa beans) and two phenolic extracts from unroasted and roasted cocoa beans, by evaluating superoxide anion (O(2)(-)) production, cytokine release, and NF-κB activation in human monocytes stimulated by phorbol 12-myristate 13-acetate (PMA). The effects of rosmarinic acid are shown for comparison. Clovamide and rosmarinic acid inhibited PMA-induced O(2)(-) production and cytokine release (with a bell-shaped curve and maximal inhibition at 10-100 nM), as well as PMA-induced NF-κB activation; the two cocoa extracts were less effective. In all tests, clovamide was the most potent compound and also enhanced peroxisome proliferator-activated receptor-γ (PPARγ) activity, which may exert anti-inflammatory effects. These findings indicate clovamide as a possible bioactive compound with anti-inflammatory activity in human cells.

  19. Curcumin attenuates inflammatory responses by suppressing TLR4-mediated NF-κB signaling pathway in lipopolysaccharide-induced mastitis in mice.

    Science.gov (United States)

    Fu, Yunhe; Gao, Ruifeng; Cao, Yongguo; Guo, Mengyao; Wei, Zhengkai; Zhou, Ershun; Li, Yimeng; Yao, Minjun; Yang, Zhengtao; Zhang, Naisheng

    2014-05-01

    Curcumin, the main constituent of the spice turmeric, has been reported to have potent anti-inflammatory properties. However, the effect of curcumin on lipopolysaccharide (LPS)-induced mice mastitis has not been investigated. The aim of this study was to investigate whether curcumin could ameliorate the inflammation response in LPS-induced mice mastitis and to clarify the possible mechanism. The mouse model of mastitis was induced by injection of LPS through the duct of the mammary gland. Curcumin was applied 1h before and 12h after LPS treatment. The results showed that curcumin attenuated the infiltration of inflammatory cells, the activity of myeloperoxidase (MPO), and the expression of tumor necrosis factor-α (TNF-α), interleukin-6 (IL-6) and interleukin-1β (IL-1β) in a dose-dependent manner. Additionally, Western blotting results showed that curcumin inhibited the phosphorylation of IκB-α and NF-κB p65 and the expression of TLR4. These results indicated that curcumin has protective effect on mice mastitis and the anti-inflammatory mechanism of curcumin on LPS-induced mastitis in mice may be due to its ability to inhibit TLR4-mediated NF-κB signaling pathways. Curcumin may be a potential therapeutic agent against mastitis. Copyright © 2014 Elsevier B.V. All rights reserved.

  20. Grape seed proanthocyanidin inhibits inflammatory responses in hepatic stellate cells by modulating the MAPK, Akt and NF-κB signaling pathways.

    Science.gov (United States)

    Lee, Jin-Woo; Kim, Young Il; Kim, Youngchul; Choi, Minji; Min, Seoyeon; Joo, Yong Hoon; Yim, Sung-Vin; Chung, Namhyun

    2017-07-01

    In the present study, we aimed to investigate the molecular mechanisms and prophylactic effects of grape seed proanthocyanidin (GSP) on lipopolysaccharide (LPS)-stimulated human hepatic stellate cells (HSCs). Cell counting and MTT assays were used to assess cell viability in the absence or presence of GSP. Reverse transcription-quantitative PCR (RT-qPCR) was performed for several inflammation-related genes (NOD1, NOD2, TLR2, TLR4, IL-1 β, IL-6, IL-8, iNOS and COX-2). The expression of anti-inflammatory cell signaling molecules, including c-Jun N-terminal kinase (JNK), p38, extracellular signal regulated kinase (ERK), Akt, nuclear factor-κB (NF-κB), inhibitory-κBα (IκBα), iNOS and COX-2, was evaluated by western blot analysis. Finally, IL-8 levels in the culture supernatant of HSCs were measured by ELISA. Pretreatment with GSP before LPS treatment significantly suppressed the mRNA expression of pro-inflammatory cytokines such as IL-1β, IL-6 and IL-8. GSP inhibited mRNA expression of LPS-induced TLR4, NOD2 and COX-2, in addition to inhibiting the expression of iNOS. GSP also inhibited LPS-induced NF-κB activation and IκBα phosphorylation. Concomitantly, GSP dose-dependently suppressed the activation of MAP kinases (JNK, ERK and p38) and Akt in LPS-stimulated HSCs. These data suggest that GSP inhibits inflammatory responses in HSCs by inactivating the NF-κB signaling pathway via MAP kinases. Thus, GSP may be considered as a novel drug for the treatment of hepatic inflammation, infectious diseases and fibrosis.

  1. Characterization of NF-κB Reporter U937 Cells and Their Application for the Detection of Inflammatory Immune-Complexes.

    Directory of Open Access Journals (Sweden)

    Csilla Kecse-Nagy

    Full Text Available Our study tested the hypothesis that immunoglobulins differ in their ability to activate the nuclear factor-κB pathway mediated cellular responses. These responses are modulated by several properties of the immune complex, including the ratio of antibody isotypes binding to antigen. Immunoassays allow the measurement of antigen specific antibodies belonging to distinct immunoglobulin classes and subclasses but not the net biological effect of the combination of these antibodies. We set out to develop a biosensor that is suitable for the detection and characterization of antigen specific serum antibodies. We genetically modified the monocytoid U937 cell line carrying Fc receptors with a plasmid encoding NF-κB promoter-driven GFP. This clone, U937-NF-κB, was characterized with respect to FcR expression and response to solid-phase immunoglobulins. Human IgG3, IgG4 and IgG1 induced GFP production in a time- and dose-dependent manner, in this order of efficacy, while IgG2 triggered no activation at the concentrations tested. IgA elicited no response alone but showed significant synergism with IgG3 and IgG4. We confirmed the importance of activation via FcγRI by direct stimulation with monoclonal antibody and by competition assays. We used citrullinated peptides and serum from rheumatoid arthritis patients to generate immune complexes and to study the activation of U937-NF-κB, observing again a synergistic effect between IgG and IgA. Our results show that immunoglobulins have distinct pro-inflammatory potential, and that U937-NF-κB is suitable for the estimation of biological effects of immune-complexes, offering insight into monocyte activation and pathogenesis of antibody mediated diseases.

  2. The inflammatory/cancer-related IL-6/STAT3/NF-κB positive feedback loop includes AUF1 and maintains the active state of breast myofibroblasts.

    Science.gov (United States)

    Hendrayani, Siti-Fauziah; Al-Harbi, Bothaina; Al-Ansari, Mysoon M; Silva, Gabriela; Aboussekhra, Abdelilah

    2016-07-05

    The IL-6/STAT3/NF-κB positive feedback loop links inflammation to cancer and maintains cells at a transformed state. Similarly, cancer-associated myofibroblats remains active even in absence of cancer cells. However, the molecular basis of this sustained active state remains elusive. We have shown here that breast cancer cells and IL-6 persistently activate breast stromal fibroblasts through the stimulation of the positive IL-6/STAT3/NF-κB feedback loop. Transient neutralization of IL-6 in culture inhibited this signaling circuit and reverted myofibrobalsts to a normalized state, suggesting the implication of the IL-6 autocrine feedback loop as well. Importantly, the IL-6/STAT3/NF-κB pro-inflammatory circuit was also active in cancer-associated fibroblasts isolated from breast cancer patients. Transient inhibition of STAT3 by specific siRNA in active fibroblasts persistently reduced the level of the RNA binding protein AUF1, blocked the loop and normalized these cells. Moreover, we present clear evidence that AUF1 is also part of this positive feedback loop. Interestingly, treatment of breast myofibroblasts with caffeine, which has been previously shown to persistently inhibit active breast stromal fibroblasts, blocked the positive feedback loop through potent and sustained inhibition of STAT3, AKT, lin28B and AUF1. These results indicate that the IL-6/STAT3/NF-κB positive feedback loop includes AUF1 and is responsible for the sustained active status of cancer-associated fibroblasts. We have also shown that normalizing myofibroblasts, which could be of great therapeutic value, is possible through the inhibition of this procarcinogenic circuit.

  3. Effects of different doses of atorvastatin on NF-κB, inflammatory factors and insulin resistance in elderly patients with early diabetic nephropathy

    Directory of Open Access Journals (Sweden)

    Ying Liu

    2016-01-01

    Full Text Available Objective: To explore the effects of different doses of atorvastatin on NF-κB, inflammatory factors and insulin resistance in elderly patients with early diabetic nephropathy. Methods: A total of 150 cases with elderly early diabetic nephropathy were randomly divided into two groups according to the random number table method. Group A (n=75 was treated with atorvastatin tablets at a dose of 10 mg/d, while group B (n=75 was treated at a dose of 20 mg/d. The NF-κB, inflammatory factors and insulin resistance were detected and compared between the two groups. Results: After treatment, UAER (52.87±7.78 μg/min, SCr (70.43±6.76 μmol/L and BUN (4.04±0.40 mmol/L of group B were significantly decreased compared with before treatment and post-treated group A (P<0.05; phosphorylation level of NF-κB p65 after treatment was (0.80±0.17 μg/min in the peripheral blood of patients from group B, which was significantly reduced compared with before treatment and post-treated group A (P<0.05; inflammatory factors including TNF-α (52.80±7.78 ng/L, IL-6 (70.43±6.76 ng/L and Hs-CRP (4.04±0.40 mg/L of group B after treatment also declined significantly compared with before treatment and post-treated group A (P<0.05; while HbAlc and FBG were not significantly changed after treatment in both groups, and there was no significant difference in each group before and after treatment; FINS (9.88±0.85 mU/L and HOMA-IR (3.36±0.33 of group B after treatment were significantly lowered compared with before treatment and posttreated group A (P<0.05. Conclusions: High dose atorvastatin can inhibit the activity of NF- κB p65 and levels of inflammation, and improve renal function and insulin resistance in elderly patients with early diabetic nephropathy, making it a promising means for clinical application.

  4. Anti-inflammatory activities of inotilone from Phellinus linteus through the inhibition of MMP-9, NF-κB, and MAPK activation in vitro and in vivo.

    Directory of Open Access Journals (Sweden)

    Guan-Jhong Huang

    Full Text Available Inotilone was isolated from Phellinus linteus. The anti-inflammatory effects of inotilone were studied by using lipopolysaccharide (LPS-stimulated mouse macrophage RAW264.7 cells and λ-carrageenan (Carr-induced hind mouse paw edema model. Inotilone was tested for its ability to reduce nitric oxide (NO production, and the inducible nitric oxide synthase (iNOS expression. Inotilone was tested in the inhibitor of mitogen-activated protein kinase (MAPK [extracellular signal-regulated protein kinase (ERK, c-Jun NH(2-terminal kinase (JNK, p38], and nuclear factor-κB (NF-κB, matrix-metalloproteinase (MMP-9 protein expressions in LPS-stimulated RAW264.7 cells. When RAW264.7 macrophages were treated with inotilone together with LPS, a significant concentration-dependent inhibition of NO production was detected. Western blotting revealed that inotilone blocked the protein expression of iNOS, NF-κB, and MMP-9 in LPS-stimulated RAW264.7 macrophages, significantly. Inotilone also inhibited LPS-induced ERK, JNK, and p38 phosphorylation. In in vivo tests, inotilone decreased the paw edema at the 4(th and the 5(th h after Carr administration, and it increased the activities of catalase (CAT, superoxide dismutase (SOD, and glutathione peroxidase (GPx. We also demonstrated that inotilone significantly attenuated the malondialdehyde (MDA level in the edema paw at the 5(th h after Carr injection. Inotilone decreased the NO and tumor necrosis factor (TNF-α levels on serum at the 5(th h after Carr injection. Western blotting revealed that inotilone decreased Carr-induced iNOS, cyclooxygenase-2 (COX-2, NF-κB, and MMP-9 expressions at the 5(th h in the edema paw. An intraperitoneal (i.p. injection treatment with inotilone diminished neutrophil infiltration into sites of inflammation, as did indomethacin (Indo. The anti-inflammatory activities of inotilone might be related to decrease the levels of MDA, iNOS, COX-2, NF-κB, and MMP-9 and increase the activities

  5. Moringa oleifera Flower Extract Suppresses the Activation of Inflammatory Mediators in Lipopolysaccharide-Stimulated RAW 264.7 Macrophages via NF-κB Pathway

    Science.gov (United States)

    Tan, Woan Sean; Arulselvan, Palanisamy; Karthivashan, Govindarajan; Fakurazi, Sharida

    2015-01-01

    Aim of Study. Moringa oleifera Lam. (M. oleifera) possess highest concentration of antioxidant bioactive compounds and is anticipated to be used as an alternative medicine for inflammation. In the present study, we investigated the anti-inflammatory activity of 80% hydroethanolic extract of M. oleifera flower on proinflammatory mediators and cytokines produced in lipopolysaccharide- (LPS-) induced RAW 264.7 macrophages. Materials and Methods. Cell cytotoxicity was conducted by 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay. Nitric oxide (NO) production was quantified through Griess reaction while proinflammatory cytokines and other key inflammatory markers were assessed through enzyme-linked immunosorbent assay (ELISA) and immunoblotting. Results. Hydroethanolic extract of M. oleifera flower significantly suppressed the secretion and expression of NO, prostaglandin E2 (PGE2), interleukin- (IL-) 6, IL-1β, tumor necrosis factor-alpha (TNF-α), nuclear factor-kappa B (NF-κB), inducible NO synthase (iNOS), and cyclooxygenase-2 (COX-2). However, it significantly increased the production of IL-10 and IκB-α (inhibitor of κB) in a concentration dependent manner (100 μg/mL and 200 μg/mL). Conclusion. These results suggest that 80% hydroethanolic extract of M. oleifera flower has anti-inflammatory action related to its inhibition of NO, PGE2, proinflammatory cytokines, and inflammatory mediator's production in LPS-stimulated macrophages through preventing degradation of IκB-α in NF-κB signaling pathway. PMID:26609199

  6. Moringa oleifera Flower Extract Suppresses the Activation of Inflammatory Mediators in Lipopolysaccharide-Stimulated RAW 264.7 Macrophages via NF-κB Pathway

    Directory of Open Access Journals (Sweden)

    Woan Sean Tan

    2015-01-01

    Full Text Available Aim of Study. Moringa oleifera Lam. (M. oleifera possess highest concentration of antioxidant bioactive compounds and is anticipated to be used as an alternative medicine for inflammation. In the present study, we investigated the anti-inflammatory activity of 80% hydroethanolic extract of M. oleifera flower on proinflammatory mediators and cytokines produced in lipopolysaccharide- (LPS- induced RAW 264.7 macrophages. Materials and Methods. Cell cytotoxicity was conducted by 3-(4,5-dimethylthiazol-2-yl-2,5-diphenyltetrazolium bromide (MTT assay. Nitric oxide (NO production was quantified through Griess reaction while proinflammatory cytokines and other key inflammatory markers were assessed through enzyme-linked immunosorbent assay (ELISA and immunoblotting. Results. Hydroethanolic extract of M. oleifera flower significantly suppressed the secretion and expression of NO, prostaglandin E2 (PGE2, interleukin- (IL- 6, IL-1β, tumor necrosis factor-alpha (TNF-α, nuclear factor-kappa B (NF-κB, inducible NO synthase (iNOS, and cyclooxygenase-2 (COX-2. However, it significantly increased the production of IL-10 and IκB-α (inhibitor of κB in a concentration dependent manner (100 μg/mL and 200 μg/mL. Conclusion. These results suggest that 80% hydroethanolic extract of M. oleifera flower has anti-inflammatory action related to its inhibition of NO, PGE2, proinflammatory cytokines, and inflammatory mediator’s production in LPS-stimulated macrophages through preventing degradation of IκB-α in NF-κB signaling pathway.

  7. Luteolin isolated from the flowers of Lonicera japonica suppresses inflammatory mediator release by blocking NF-kappaB and MAPKs activation pathways in HMC-1 cells.

    Science.gov (United States)

    Kang, Ok-Hwa; Choi, Jang-Gi; Lee, John-Hwa; Kwon, Dong-Yeul

    2010-01-18

    Luteolin (3',4',5,7-tetrahydroxylflavone) is a plant flavonoid and pharmacologically active agent that has been isolated from several plant species. In the present study, the effect of luteolin from the flowers of Lonicera japonica on phorbol 12-myristate 13-acetate (PMA) plus A23187-induced mast cell activation was examined. Luteolin significantly inhibited the induction of inflammatory cytokines such as tumor necrosis factor (TNF)-alpha, interleukin (IL)-8, IL-6 and granulocyte-macrophage colony-stimulating factor (GM-CSF) by PMA plus A23187. Moreover, luteolin attenuated cyclooxygenase (COX)-2 expression and intracellular Ca2+ levels. In activated HMC-1 cells, the phosphorylation of extra-signal response kinase (ERK 1/2) and c-jun N-terminal Kinase (JNK 1/2), but not p38 mitogen-activated protein kinase (p38 MAPK) were decreased by treatment of the cells with luteolin. Luteolin inhibited PMA plus A23187-induced nuclear factor (NF)-kappaB activation, IkappaB degradation, and luciferase activity. Furthermore, luteolin suppressed the expression of TNF-alpha, IL-8, IL-6, GM-CSF, and COX-2 through a decrease in the intracellular Ca2+ levels, and also showed a suppression of the ERK 1/2, JNK 1/2, and NF-kappaB activation. These results indicated that luteolin from the flowers of Lonicera japonica exerted a regulatory effect on mast cell-mediated inflammatory diseases, such as RA, allergy disease and IBD.

  8. Bergenin Plays an Anti-Inflammatory Role via the Modulation of MAPK and NF-κB Signaling Pathways in a Mouse Model of LPS-Induced Mastitis.

    Science.gov (United States)

    Gao, Xue-jiao; Guo, Meng-yao; Zhang, Ze-cai; Wang, Tian-cheng; Cao, Yong-guo; Zhang, Nai-sheng

    2015-01-01

    Mastitis is a major disease in humans and other animals and is characterized by mammary gland inflammation. It is a major disease of the dairy industry. Bergenin is an active constituent of the plants of genus Bergenia. Research indicates that bergenin has multiple biological activities, including anti-inflammatory and immunomodulatory properties. The objective of this study was to evaluate the protective effects and mechanism of bergenin on the mammary glands during lipopolysaccharide (LPS)-induced mastitis. In this study, mice were treated with LPS to induce mammary gland mastitis as a model for the disease. Bergenin treatment was initiated after LPS stimulation for 24 h. The results indicated that bergenin attenuated inflammatory cell infiltration and decreased the concentration of NO, TNF-α, IL-1β, and IL-6, which were increased in LPS-induced mouse mastitis. Furthermore, bergenin downregulated the phosphorylation of nuclear factor-kappaB (NF-κB) and mitogen-activated protein kinases (MAPK) signaling pathway proteins in mammary glands with mastitis. In conclusion, bergenin reduced the expression of NO, TNF-α, IL-1β, and IL-6 proinflammatory cytokines by inhibiting the activation of the NF-κB and MAPKs signaling pathways, and it may represent a novel treatment strategy for mastitis.

  9. Ginkgo biloba extracts attenuate lipopolysaccharide-induced inflammatory responses in acute lung injury by inhibiting the COX-2 and NF-κB pathways.

    Science.gov (United States)

    Yao, Xin; Chen, Nan; Ma, Chun-Hua; Tao, Jing; Bao, Jian-An; Zong-Qi, Cheng; Chen, Zu-Tao; Miao, Li-Yan

    2015-01-01

    In the present study, we analyzed the role of Ginkgo biloba extract in lipopolysaccharide(LPS)-induced acute lung injury (ALI). ALI was induced in mice by intratracheal instillation of LPS. G. biloba extract (12 and 24 mg·kg(-1)) and dexamethasone (2 mg·kg(-1)), as a positive control, were given by i.p. injection. The cells in the bronchoalveolar lavage fluid (BALF) were counted. The degree of animal lung edema was evaluated by measuring the wet/dry weight ratio. The superoxidase dismutase (SOD) and myeloperoxidase (MPO) activities were assayed by SOD and MPO kits, respectively. The levels of inflammatory mediators, tumor necrosis factor-a, interleukin-1b, and interleukin-6, were assayed by enzyme-linked immunosorbent assay. Pathological changes of lung tissues were observed by H&E staining. The levels of NF-κB p65 and COX-2 expression were detected by Western blotting. Compared to the LPS group, the treatment with the G. biloba extract at 12 and 24 mg·kg(-1) markedly attenuated the inflammatory cell numbers in the BALF, decreased NF-κB p65 and COX-2 expression, and improved SOD activity, and inhibited MPO activity. The histological changes of the lungs were also significantly improved. The results indicated that G. biloba extract has a protective effect on LPS-induced acute lung injury in mice. The protective mechanism of G. biloba extract may be partly attributed to the inhibition of NF-κB p65 and COX-2 activation. Copyright © 2015 China Pharmaceutical University. Published by Elsevier B.V. All rights reserved.

  10. Endogenous Nampt upregulation is associated with diabetic nephropathy inflammatory-fibrosis through the NF-κB p65 and Sirt1 pathway; NMN alleviates diabetic nephropathy inflammatory-fibrosis by inhibiting endogenous Nampt

    Science.gov (United States)

    Chen, Ye; Liang, Yuzhen; Hu, Tingting; Wei, Riming; Cai, Congjie; Wang, Ping; Wang, Lingyu; Qiao, Wei; Feng, Leping

    2017-01-01

    Nicotinamide phosphoribosyltransferase (Nampt) is a key enzyme in the nicotinamide adenine dinucleotide (NAD+) biosynthetic pathway. Exogenous extra cellular Nampt has been reported to increase the synthesis of pro-fibrotic molecules in various types of renal cells. However, the role of endogenous Namptenzymatic activity in diabetic renal cells, particularly those associated with inflammation and fibrosis through the nuclear factor (NF)-κB p65 and sirtuin 1 (Sirt1) pathway is still unknown. In the present study, a possible mechanism by which endogenous Nampt upregulation affects the expression of pro-inflammatory and pro-fibrotic cytokines in vivo and in vitro, is reported. The present results demonstrate that the expression of vimentin and fibronectin was directly implicated in endogenous Nampt upregulation. The expression levels of Poly(ADP-ribose) polymerase-1, NF-κB p65, forkhead box protein O1 and B-cell lymphoma 2-like protein 4 were also significantly increased at 96 h compared with control group (P<0.01) respectively in response to endogenous Nampt upregulation. Furthermore, the expression level of Sirt1 was significantly reduced (P<0.05), and the NAD and NADH levels, and the NAD/NADH ratio are significantly altered in STZ-induced diabetic rats (P<0.01). Treatment with FK866 and nicotinamide mononucleotide (NMN) led to downregulation of vimentin and fibronectin, respectively. These results suggest a novel role of Nampt as a pro-inflammatory cytokine of mesangial fibrotic signaling. The Nampt-NF-κB p65 and Sirt1 signaling pathway serves a pivotal role in affecting the expression of fibrosis factors in diabetic nephropathy (DN) glomerular fibrosis processing. It is also suggested that prevention of endogenous Nampt upregulation may be critical in the treatment of DN pro-inflammatory fibrosis and NMN is likely to be a potential pharmacological agent for the treatment of resistant DN nephritic fibrosis. PMID:29104634

  11. Potent anti-inflammatory effect of a novel furan-2,5-dione derivative, BPD, mediated by dual suppression of COX-2 activity and LPS-induced inflammatory gene expression via NF-κB inactivation.

    Science.gov (United States)

    Shin, Ji-Sun; Park, Seung-Jae; Ryu, Suran; Kang, Han Byul; Kim, Tae Woo; Choi, Jung-Hye; Lee, Jae-Yeol; Cho, Young-Wuk; Lee, Kyung-Tae

    2012-03-01

    We previously reported that 3-(benzo[d]-1,3-dioxol-5-yl)-4-phenylfuran-2,5-dione (BPD) showed strong inhibitory effects on PGE(2) production. However, the exact mechanism for the anti-inflammatory effect of BPD is not completely understood. In this study, we investigated the molecular mechanism involved in the effects of BPD on inflammatory mediators in LPS-stimulated macrophages and animal models of inflammation. The expressions of COX-2, inducible NOS (iNOS), TNF-α, IL-6 and IL-1β, in LPS-stimulated RAW 264.7 cells and murine peritoneal macrophages, were determined by Western blot and/or qRT-PCR, respectively. NF-κB activation was investigated by EMSA, reporter gene assay and Western blotting. Anti-inflammatory effects of BPD were evaluated in vivo in carrageenan-induced paw oedema in rats and LPS-induced septic shock in mice. BPD not only inhibited COX-2 activity but also reduced the expression of COX-2. In addition, BPD inhibited the expression of iNOS, TNF-α, IL-6 and IL-1β at the transcriptional level. BPD attenuated LPS-induced DNA-binding activity and the transcription activity of NF-κB; this was associated with a decrease in the phosphorylation level of inhibitory κB-α (IκB-α) and reduced nuclear translocation of NF-κB. Furthermore, BPD suppressed the formation of TGF-β-activated kinase-1 (TAK1)/TAK-binding protein1 (TAB1), which was accompanied by a parallel reduction of phosphorylation of TAK1 and IκB kinase (IKK). Pretreatment with BPD inhibited carrageenan-induced paw oedema and LPS-induced septic death. Taken together, our data indicate that BPD is involved in the dual inhibition of COX-2 activity and TAK1-NF-κB pathway, providing a molecular basis for the anti-inflammatory properties of BPD. © 2011 The Authors. British Journal of Pharmacology © 2011 The British Pharmacological Society.

  12. Endogenous Nampt upregulation is associated with diabetic nephropathy inflammatory-fibrosis through the NF-κB p65 and Sirt1 pathway; NMN alleviates diabetic nephropathy inflammatory-fibrosis by inhibiting endogenous Nampt.

    Science.gov (United States)

    Chen, Ye; Liang, Yuzhen; Hu, Tingting; Wei, Riming; Cai, Congjie; Wang, Ping; Wang, Lingyu; Qiao, Wei; Feng, Leping

    2017-11-01

    Nicotinamide phosphoribosyltransferase (Nampt) is a key enzyme in the nicotinamide adenine dinucleotide (NAD + ) biosynthetic pathway. Exogenous extra cellular Nampt has been reported to increase the synthesis of pro-fibrotic molecules in various types of renal cells. However, the role of endogenous Namptenzymatic activity in diabetic renal cells, particularly those associated with inflammation and fibrosis through the nuclear factor (NF)-κB p65 and sirtuin 1 (Sirt1) pathway is still unknown. In the present study, a possible mechanism by which endogenous Nampt upregulation affects the expression of pro-inflammatory and pro-fibrotic cytokines in vivo and in vitro , is reported. The present results demonstrate that the expression of vimentin and fibronectin was directly implicated in endogenous Nampt upregulation. The expression levels of Poly(ADP-ribose) polymerase-1, NF-κB p65, forkhead box protein O1 and B-cell lymphoma 2-like protein 4 were also significantly increased at 96 h compared with control group (Pendogenous Nampt upregulation. Furthermore, the expression level of Sirt1 was significantly reduced (Pendogenous Nampt upregulation may be critical in the treatment of DN pro-inflammatory fibrosis and NMN is likely to be a potential pharmacological agent for the treatment of resistant DN nephritic fibrosis.

  13. Acrylamide-induced oxidative stress and inflammatory response are alleviated by N-acetylcysteine in PC12 cells: Involvement of the crosstalk between Nrf2 and NF-κB pathways regulated by MAPKs.

    Science.gov (United States)

    Pan, Xiaoqi; Wu, Xu; Yan, Dandan; Peng, Cheng; Rao, Chaolong; Yan, Hong

    2018-05-15

    Acrylamide (ACR) is a classic neurotoxin in animals and humans. However, the mechanism underlying ACR neurotoxicity remains controversial, and effective prevention and treatment measures against this condition are scarce. This study focused on clarifying the crosstalk between the involved signaling pathways in ACR-induced oxidative stress and inflammatory response and investigating the protective effect of antioxidant N-acetylcysteine (NAC) against ACR in PC12 cells. Results revealed that ACR exposure led to oxidative stress characterized by significant increase in reactive oxygen species (ROS) and malondialdehyde (MDA) levels and glutathione (GSH) consumption. Inflammatory response was observed based on the dose-dependently increased levels of pro-inflammatory cytokines tumor necrosis factor-α (TNF-α) and interleukin 6 (IL-6). NAC attenuated ACR-induced enhancement of MDA and ROS levels and TNF-α generation. In addition, ACR activated nuclear transcription factor E2-related factor 2 (Nrf2) and nuclear factor-κB (NF-κB) signaling pathways. Knockdown of Nrf2 by siRNA significantly blocked the increased NF-κB p65 protein expression in ACR-treated PC12 cells. Down-regulation of NF-κB by specific inhibitor BAY11-7082 similarly reduced ACR-induced increase in Nrf2 protein expression. NAC treatment increased Nrf2 expression and suppressed NF-κB p65 expression to ameliorate oxidative stress and inflammatory response caused by ACR. Further results showed that mitogen-activated protein kinases (MAPKs) pathway was activated prior to the activation of Nrf2 and NF-κB pathways. Inhibition of MAPKs blocked Nrf2 and NF-κB pathways. Collectively, ACR activated Nrf2 and NF-κB pathways which were regulated by MAPKs. A crosstalk between Nrf2 and NF-κB pathways existed in ACR-induced cell damage. NAC protected against oxidative damage and inflammatory response induced by ACR by activating Nrf2 and inhibiting NF-κB pathways in PC12 cells. Copyright © 2018 Elsevier B

  14. Baicalein attenuates inflammatory responses by suppressing TLR4 mediated NF-κB and MAPK signaling pathways in LPS-induced mastitis in mice.

    Science.gov (United States)

    He, Xuexiu; Wei, Zhengkai; Zhou, Ershun; Chen, Libin; Kou, Jinhua; Wang, Jingjing; Yang, Zhengtao

    2015-09-01

    Baicalein is a phenolic flavonoid presented in the dry roots of Scutellaria baicalensis Georgi. It has been reported that baicalein possesses a number of biological properties, such as antiviral, antioxidative, anti-inflammatory, antithrombotic, and anticancer properties. However, the effect of baicalein on mastitis has not yet been reported. This research aims to detect the effect of baicalein on lipopolysaccharide (LPS)-induced mastitis in mice and to investigate the molecular mechanisms. Baicalein was administered intraperitoneally 1h before and 12h after LPS treatment. The results indicated that baicalein treatment markedly attenuated the damage of the mammary gland induced by LPS, suppressed the activity of myeloperoxidase (MPO) and the levels of tumor necrosis factor (TNF-α) and interleukin (IL-1β) in mice with LPS-induced mastitis. Besides, baicalein blocked the expression of Toll-like receptor 4 (TLR4) and then suppressed the phosphorylation of nuclear transcription factor-kappaB (NF-κB) p65 and degradation inhibitor of NF-κBα (IκBα) and, and inhibited the phosphorylation of p38, extracellular signal-regulated kinase (ERK) and c-jun NH2-terminal kinase (JNK) in mitogen-activated protein kinase (MAPK) signal pathway. These findings suggested that baicalein may have a potential prospect against mastitis. Copyright © 2015. Published by Elsevier B.V.

  15. Anti-inflammatory effects of aromatic-turmerone through blocking of NF-κB, JNK, and p38 MAPK signaling pathways in amyloid β-stimulated microglia.

    Science.gov (United States)

    Park, Sun Young; Jin, Mei Ling; Kim, Young Hun; Kim, YoungHee; Lee, Sang Joon

    2012-09-01

    Amyloid β (Aβ) induces the production of neuroinflammatory molecules, which may contribute to the pathogenesis of numerous neurodegenerative diseases. Therefore, suppression of neuroinflammatory molecules could be developed as a therapeutic method. Aromatic (ar)-turmerone, turmeric oil isolated from Curcuma longa, has long been used in Southeast Asia as both a remedy and a food. In this study, we investigated the anti-inflammatory effects of ar-turmerone in BV2 microglial cells. Aβ-stimulated microglial cells were tested for the expression and activation of MMP-9, iNOS, and COX-2, the production of proinflammatory cytokines, chemokines, and ROS, as well as the underlying signaling pathways. Ar-turmerone significantly suppressed Aβ-induced expression and activation of MMP-9, iNOS, and COX-2, but not MMP-2. Ar-turmerone also reduced TNF-α, IL-1β, IL-6, and MCP-1 production in Aβ-stimulated microglial cells. Further, ar-turmerone markedly inhibited the production of ROS. Impaired translocation and activation of NF-κB were observed in Aβ-stimulated microglial cells exposed to ar-turmerone. Furthermore, ar-turmerone inhibited the phosphorylation and degradation of IκB-α as well as the phosphorylation of JNK and p38 MAPK. These results suggest that ar-turmerone impaired the Aβ-induced inflammatory response of microglial cells by inhibiting the NF-κB, JNK, and p38 MAPK signaling pathways. Lastly, ar-turmerone protected hippocampal HT-22 cells from indirect neuronal toxicity induced by activated microglial cells. These novel findings provide new insights into the development of ar-turmerone as a therapeutic agent for the treatment of neurodegenerative disorders. Copyright © 2012 Elsevier B.V. All rights reserved.

  16. Regulation Of Nf=kb And Mnsod In Low Dose Radiation Induced Adaptive Protection Of Mouse And Human Skin Cells

    Energy Technology Data Exchange (ETDEWEB)

    Jian Li

    2012-11-07

    A sampling of publications resulting from this grant is provided. One is on the subject of NF-κB-Mediated HER2 Overexpression in Radiation-Adaptive Resistance. Another is on NF-κB-mediated adaptive resistance to ionizing radiation.

  17. Anti-inflammatory effects of embelin in A549 cells and human asthmatic airway epithelial tissues.

    Science.gov (United States)

    Lee, In-Seung; Cho, Dong-Hyuk; Kim, Ki-Suk; Kim, Kang-Hoon; Park, Jiyoung; Kim, Yumi; Jung, Ji Hoon; Kim, Kwanil; Jung, Hee-Jae; Jang, Hyeung-Jin

    2018-02-01

    Allergic asthma is the most common type in asthma, which is defined as a chronic inflammatory disease of the lung. In this study, we investigated whether embelin (Emb), the major component of Ardisia japonica BL. (AJB), exhibits anti-inflammatory effects on allergic asthma via inhibition of NF-κB activity using A549 cells and asthmatic airway epithelial tissues. Inflammation was induced in A549 cells, a human airway epithelial cell line, by IL-1β (10 ng/ml) treatment for 4 h. The effects of Emb on NF-κB activity and COX-2 protein expression in inflamed airway epithelial cells and human asthmatic airway epithelial tissues were analyzed via western blot. The secretion levels of NF-κB-mediated cytokines/chemokines, including IL-4, 6, 9, 13, TNF-α and eotaxin, were measured by a multiplex assay. Emb significantly blocked NF-κB activity in IL-1β-treated A549 cells and human asthmatic airway epithelial tissues. COX-2 expression was also reduced in both IL-1β-treated A549 cells and asthmatic tissues Emb application. Emb significantly reduced the secretion of IL-4, IL-6 and eotaxin in human asthmatic airway epithelial tissues by inhibiting activity of NF-κB. The results of this study suggest that Emb may be used as an anti-inflammatory agent via inhibition of NF-κB and related cytokines.

  18. Endotoxin-Binding Peptides Derived from Casein Glycomacropeptide Inhibit Lipopolysaccharide-Stimulated Inflammatory Responses via Blockade of NF-κB activation in macrophages

    Directory of Open Access Journals (Sweden)

    Xue Cheng

    2015-04-01

    Full Text Available Systemic low-grade inflammation and increased circulating lipopolysaccharide (LPS contribute to metabolic dysfunction. The inhibitory effects and underlying molecular mechanisms of casein glycomacropeptide (GMP hydrolysate on the inflammatory response of LPS-stimulated macrophages were investigated. Results showed that the inhibitory effect of GMP hydrolysates obtained with papain on nitric oxide (NO production were obviously higher than that of GMP hydrolysates obtained with pepsin, alcalase and trypsin (p < 0.05, and the hydrolysate obtained with papain for 1 h hydrolysis (GHP exhibited the highest inhibitory effect. Compared with native GMP, GHP markedly inhibited LPS-induced NO production in a dose-dependent manner with decreased mRNA level of inducible nitric oxide synthase (iNOS. GHP blocked toll-like receptor 4 (TLR4/myeloid differentiation primary response 88 (MyD88/nuclear factor-κB (NF-κB signaling pathway activation, accompanied by downregulation of LPS-triggered significant upregulation of tumor necrosis factor (TNF-α and interleukin (IL-1β gene expression. Furthermore, GHP could neutralize LPS not only by direct binding to LPS, but also by inhibiting the engagement of LPS with the TLR4/MD2 complex, making it a potential LPS inhibitor. In conclusion, these findings suggest that GHP negatively regulates TLR4-mediated inflammatory response in LPS-stimulated RAW264.7 cells, and therefore may hold potential to ameliorate inflammation-related issues.

  19. Microbial Anti-Inflammatory Molecule (MAM) from Faecalibacterium prausnitzii Shows a Protective Effect on DNBS and DSS-Induced Colitis Model in Mice through Inhibition of NF-κB Pathway.

    Science.gov (United States)

    Breyner, Natalia M; Michon, Cristophe; de Sousa, Cassiana S; Vilas Boas, Priscilla B; Chain, Florian; Azevedo, Vasco A; Langella, Philippe; Chatel, Jean M

    2017-01-01

    Faecalibacterium prausnitzii and its supernatant showed protective effects in different chemically-induced colitis models in mice. Recently, we described 7 peptides found in the F. prausnitzii supernatant, all belonging to a protein called Microbial Anti-inflammatory Molecule (MAM). These peptides were able to inhibit NF-κB pathway in vitro and showed anti-inflammatory properties in vivo in a DiNitroBenzene Sulfate (DNBS)-induced colitis model. In this current proof we tested MAM effect on NF-κB pathway in vivo , using a transgenic model of mice producing luciferase under the control of NF-κB promoter. Moreover, we tested this protein on Dextran Sodium Sulfate (DSS)-induced colitis in mice. To study the effect of MAM we orally administered to the mice a Lactococcus lactis strain carrying a plasmid containing the cDNA of MAM under the control of a eukaryotic promoter. L. lactis delivered plasmids in epithelial cells of the intestinal membrane allowing thus the production of MAM directly by host. We showed that MAM administration inhibits NF-κB pathway in vivo . We confirmed the anti-inflammatory properties of MAM in DNBS-induced colitis but also in DSS model. In DSS model MAM was able to inhibit Th1 and Th17 immune response while in DNBS model MAM reduced Th1, Th2, and Th17 immune response and increased TGFβ production.

  20. Triptolide-Assisted Phosphorylation of p53 Suppresses Inflammation-Induced NF-κB Survival Pathways in Cancer Cells

    Science.gov (United States)

    Zheng, Li; Jia, Jia; Dai, Huifang; Wan, Lei; Liu, Jian; Hu, Lin; Zhou, Mian; Qiu, Michael; Chen, Xufeng; Chang, Lufen; Kim, Jae Y.; Reckamp, Karen; Raz, Dan J.; Xia, Zongping

    2017-01-01

    ABSTRACT Chronic inflammation plays important roles in cancer initiation and progression. Resolving chronic inflammation or blocking inflammatory signal transduction may prevent cancer development. Here, we report that the combined low-dose use of two anti-inflammatory drugs, aspirin and triptolide, reduces spontaneous lung cancer incidence from 70% to 10% in a mouse model. Subsequent studies reveal that such treatment has little effect on resolving chronic inflammatory conditions in the lung, but it significantly blocks the NF-κB-mediated expression of proliferation and survival genes in cancer cells. Furthermore, triptolide and aspirin induce distinct mechanisms to potentiate each other to block NF-κB nuclear localization stimulated by inflammatory cytokines. While aspirin directly inhibits IκB kinases (IKKs) to phosphorylate IκBα for NF-κB activation, triptolide does not directly target IKKs or other factors that mediate IKK activation. Instead, it requires p53 to inhibit IκBα phosphorylation and degradation. Triptolide binds to and activates p38α and extracellular signal-regulated kinase 1/2 (ERK1/2), which phosphorylate and stabilize p53. Subsequently, p53 competes with IκBα for substrate binding to IKKβ and thereby blocks IκBα phosphorylation and NF-κB nuclear translocation. Inhibition of p38α and ERK1/2 or p53 mutations could abolish the inhibitory effects of triptolide on NF-κB. Our study defines a new p53-dependent mechanism for blocking NF-κB survival pathways in cancer cells. PMID:28533220

  1. Anti-inflammatory activity of edible oyster mushroom is mediated through the inhibition of NF-κB and AP-1 signaling

    Directory of Open Access Journals (Sweden)

    Simon James

    2011-05-01

    Full Text Available Abstract Background Mushrooms are well recognized for their culinary properties as well as for their potency to enhance immune response. In the present study, we evaluated anti-inflammatory properties of an edible oyster mushroom (Pleurotus ostreatus in vitro and in vivo. Methods RAW264.7 murine macrophage cell line and murine splenocytes were incubated with the oyster mushroom concentrate (OMC, 0-100 μg/ml in the absence or presence of lipopolysacharide (LPS or concanavalin A (ConA, respectively. Cell proliferation was determined by MTT assay. Expression of cytokines and proteins was measured by ELISA assay and Western blot analysis, respectively. DNA-binding activity was assayed by the gel-shift analysis. Inflammation in mice was induced by intraperitoneal injection of LPS. Results OMC suppressed LPS-induced secretion of tumor necrosis factor-α (TNF-α, interleukin-6 (IL-6, and IL-12p40 from RAW264.7 macrophages. OMC inhibited LPS-induced production of prostaglandin E2 (PGE2 and nitric oxide (NO through the down-regulation of expression of COX-2 and iNOS, respectively. OMC also inhibited LPS-dependent DNA-binding activity of AP-1 and NF-κB in RAW264.7 cells. Oral administration of OMC markedly suppressed secretion of TNF-α and IL-6 in mice challenged with LPS in vivo. Anti-inflammatory activity of OMC was confirmed by the inhibition of proliferation and secretion of interferon-γ (IFN-γ, IL-2, and IL-6 from concanavalin A (ConA-stimulated mouse splenocytes. Conclusions Our study suggests that oyster mushroom possesses anti-inflammatory activities and could be considered a dietary agent against inflammation. The health benefits of the oyster mushroom warrant further clinical studies.

  2. Anti-inflammatory activity of edible oyster mushroom is mediated through the inhibition of NF-κB and AP-1 signaling

    Science.gov (United States)

    2011-01-01

    Background Mushrooms are well recognized for their culinary properties as well as for their potency to enhance immune response. In the present study, we evaluated anti-inflammatory properties of an edible oyster mushroom (Pleurotus ostreatus) in vitro and in vivo. Methods RAW264.7 murine macrophage cell line and murine splenocytes were incubated with the oyster mushroom concentrate (OMC, 0-100 μg/ml) in the absence or presence of lipopolysacharide (LPS) or concanavalin A (ConA), respectively. Cell proliferation was determined by MTT assay. Expression of cytokines and proteins was measured by ELISA assay and Western blot analysis, respectively. DNA-binding activity was assayed by the gel-shift analysis. Inflammation in mice was induced by intraperitoneal injection of LPS. Results OMC suppressed LPS-induced secretion of tumor necrosis factor-α (TNF-α, interleukin-6 (IL-6), and IL-12p40 from RAW264.7 macrophages. OMC inhibited LPS-induced production of prostaglandin E2 (PGE2) and nitric oxide (NO) through the down-regulation of expression of COX-2 and iNOS, respectively. OMC also inhibited LPS-dependent DNA-binding activity of AP-1 and NF-κB in RAW264.7 cells. Oral administration of OMC markedly suppressed secretion of TNF-α and IL-6 in mice challenged with LPS in vivo. Anti-inflammatory activity of OMC was confirmed by the inhibition of proliferation and secretion of interferon-γ (IFN-γ), IL-2, and IL-6 from concanavalin A (ConA)-stimulated mouse splenocytes. Conclusions Our study suggests that oyster mushroom possesses anti-inflammatory activities and could be considered a dietary agent against inflammation. The health benefits of the oyster mushroom warrant further clinical studies. PMID:21575254

  3. Methanol Extract of Artemisia apiacea Hance Attenuates the Expression of Inflammatory Mediators via NF-κB Inactivation

    Directory of Open Access Journals (Sweden)

    Ji Choul Ryu

    2013-01-01

    Full Text Available Artemisia apiacea Hance is one of the most widely used herbs for the treatment of malaria, jaundice, and dyspeptic complaint in oriental medicine. This study investigated the effects of methanol extracts of A. apiacea Hance (MEAH on the induction of inducible nitric oxide synthase (iNOS and proinflammatory mediators by lipopolysaccharide (LPS in Raw264.7 macrophage cells and also evaluated the in vivo effect of MEAH on carrageenan-induced paw edema in rats. MEAH treatment in Raw264.7 cells significantly decreased LPS-inducible nitric oxide production and the expression of iNOS in a concentration-dependent manner, while MEAH (up to 100 μg/mL had no cytotoxic activity. Results from immunoblot analyses and ELISA revealed that MEAH significantly inhibited the expression of cyclooxygenase-2, tumor necrosis factor-α, interleukin-1β, and interleukin-6 in LPS-activated cells. As a plausible molecular mechanism, increased degradation and phosphorylation of inhibitory-κBα and nuclear factor-κB accumulation in the nucleus by LPS were partly blocked by MEAH treatment. Finally, MEAH treatment decreased the carrageenan-induced formation of paw edema and infiltration of inflammatory cells in rats. These results demonstrate that MEAH has an anti-inflammatory therapeutic potential that may result from the inhibition of nuclear factor-κB activation, subsequently decreasing the expression of proinflammatory mediators.

  4. Antihyperalgesic Properties of Honokiol in Inflammatory Pain Models by Targeting of NF-κB and Nrf2 Signaling

    Directory of Open Access Journals (Sweden)

    Sidra Khalid

    2018-03-01

    Full Text Available The present study investigates the possible anti-nociceptive effect of intraperitoneal (i.p. honokiol: a phenolic compound originally isolated from Magnolia officinalis, in acute and chronic inflammatory pain models. Doses of 0.1, 5, and 10 mg/kg honokiol were administered in carrageenan induced pain and the dose (honokiol 10 mg/kg i.p. with most significant response among behavioral tests was selected for further experiments. The i.p. administration of honokiol inhibits mechanical hyperalgesia, mechanical allodynia, and thermal hyperalgesia, without causing any apparent toxicity. To elucidate the effect of honokiol on various cytokines and antioxidant enzymes, quantitative real-time-PCR was performed to determine the expression levels of pro-inflammatory cytokines and antioxidant enzymes. It is demonstrated that honokiol significantly reduced the expression levels of tumor necrosis factor (TNF-α, interleukin-1β (IL-1β, interleukin-6 (IL-6, and vascular endothelial growth factor (VEGF. Similarly, honokiol was also found to potentiate the expression of nuclear factor erythroid 2–related factor 2 (Nrf2, superoxide dismutase 2 (SOD2, and heme oxygenase-1 (HO-1 levels. Additionally, honokiol significantly reduced plasma nitrite levels as compared to complete Freund’s adjuvant (CFA induced group. X-ray analysis and hematoxylin and eosin (H&E staining of inflamed and treated paws showed that honokiol reduced the inflammation with significantly less leukocyte infiltration and soft tissue inflammation. In order to explore the possible mechanism of action of honokiol, agonists [piroxicam (5 mg/kg, tramadol (50 mg/kg, and gabapentin (5 mg/kg i.p.] as well as antagonists [naloxone (4 mg/kg, olanzapine (10 mg/kg, and flumazenil (0.2 mg/kg i.p.] were used to study involvement of various receptors on the anti-nociceptive effect of honokiol. The potential side effects of honokiol on muscle activity were assessed. An adverse effect testing of honokiol by

  5. 8,8'-Bieckol, isolated from edible brown algae, exerts its anti-inflammatory effects through inhibition of NF-κB signaling and ROS production in LPS-stimulated macrophages.

    Science.gov (United States)

    Yang, Yeong-In; Jung, Seung-Hyun; Lee, Kyung-Tae; Choi, Jung-Hye

    2014-12-01

    Ecklonia cava (E. cava) is an abundant brown alga that contains high levels of phlorotannins, which are unique marine polyphenolic compounds. It has been suggested that E. cava phlorotannins exert anti-inflammatory effects. However, the anti-inflammatory effects and underlying molecular mechanism exerted by 8,8'-bieckol isolated from E. cava have not been reported. Thus, in this study, we examined the anti-inflammatory effects of 8,8'-bieckol on lipopolysaccharide (LPS)-stimulated primary macrophages and RAW 264.7 macrophages. We found that 8,8'-bieckol suppressed key inflammatory mediator [i.e., nitric oxide (NO) and prostaglandin E2 (PGE2)] production in both primary and RAW 264.7 macrophages. 8,8'-Bieckol inhibited NO by suppressing LPS-induced expression of inducible nitric oxide synthase (iNOS) at the mRNA and protein levels in primary macrophages and RAW 264.7 cells. In addition, 8,8'-bieckol decreased the production and mRNA expression of the inflammatory cytokine interleukin-6 (IL-6), but not tumor necrosis factor (TNF)-α, in RAW 264.7 cells. Moreover, 8,8'-bieckol treatment diminished transactivation of nuclear factor-kappa B (NF-κB) and nuclear translocation of the NF-κB p65 subunit and suppressed LPS-induced intracellular reactive oxygen species (ROS) production in macrophages. Furthermore, 8,8'-bieckol markedly reduced mortality in LPS-induced septic mice. Taken together, these data indicate that the anti-inflammatory properties of 8,8'-bieckol are associated with the suppression of NO, PGE2, and IL-6 via negative regulation of the NF-κB pathway and ROS production in LPS-stimulated RAW 264.7 cells. Moreover, 8,8'-bieckol protects mice from endotoxin shock. Copyright © 2014 Elsevier B.V. All rights reserved.

  6. The anti-inflammatory activities of Ainsliaea fragrans Champ. extract and its components in lipopolysaccharide-stimulated RAW264.7 macrophages through inhibition of NF-κB pathway.

    Science.gov (United States)

    Chen, Xin; Miao, Jingshan; Wang, Hao; Zhao, Fang; Hu, Jie; Gao, Peng; Wang, Yue; Zhang, Luyong; Yan, Ming

    2015-07-21

    Ainsliaea fragrans Champ. (A. fragrans) is a traditional Chinese herbal that contains components like 3,5-dicaffeoylquinic acid and 4,5-dicaffeoylquinic acid. It exhibits anti-inflammatory activities which has been used for the treatment of gynecological diseases for many years in China. The aims of the present study were to investigate the anti-inflammatory activities of A. fragrans and elucidate the underlying mechanisms with regard to its molecular basis of action for the best component. The anti-inflammatory effects of A. fragrans were studied by using lipopolysaccharide (LPS)-stimulated activation of nitric oxide (NO) in mouse RAW264.7 macrophages. Expression of inducible NO synthase (iNOS) and pro-inflammatory cytokines, inhibitory κBα (IκBα) degradation and nuclear translocation of NF-κB p65 were further investigated. The present study demonstrated that A. fragrans could suppress the production of NO in LPS-stimulated RAW264.7 macrophages. Further investigations showed A. fragrans could suppress iNOS expression. A. fragrans also inhibited the expression of tumor necrosis factor-alpha and interleukin-6. A. fragrans significantly decreased the degradation of IκBα, reduced the level of nuclear translocation of p65. All these results suggested the inhibitory effects of A. fragrans on the production of inflammatory mediators through the inhibition of the NF-κB activation pathway. Our results indicated that A. fragrans inhibited inflammatory events and iNOS expression in LPS-stimulated RAW264.7 cells through the inactivation of NF-κB pathway. This study gives scientific evidence that validate the use of A. fragrans in treatment of patients with gynecological diseases in clinical practice in traditional Chinese medicine. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  7. Ganoderma lucidum ethanol extract inhibits the inflammatory response by suppressing the NF-κB and toll-like receptor pathways in lipopolysaccharide-stimulated BV2 microglial cells.

    Science.gov (United States)

    Yoon, Hyun-Min; Jang, Kyung-Jun; Han, Min Seok; Jeong, Jin-Woo; Kim, Gi Young; Lee, Jai-Heon; Choi, Yung Hyun

    2013-03-01

    Ganoderma lucidum is a traditional Oriental medicine that has been widely used as a tonic to promote longevity and health in Korea and other Asian countries. Although a great deal of work has been carried out on the therapeutic potential of this mushroom, the pharmacological mechanisms of its anti-inflammatory actions remain unclear. In this study, we evaluated the inhibitory effects of G. lucidum ethanol extract (EGL) on the production of inflammatory mediators and cytokines in lipopolysaccharide (LPS)-stimulated murine BV2 microglia. We also investigated the effects of EGL on the LPS-induced activation of nuclear factor kappaB (NF-κB) and upregulation of toll-like receptor 4 (TLR4) and myeloid differentiation factor 88 (MyD88). Elevated levels of nitric oxide (NO), prostaglandin E(2) (PGE(2)) and pro-inflammatory cytokine production were detected in BV2 microglia following LPS stimulation. We identifed that EGL significantly inhibits the excessive production of NO, PGE(2) and pro-inflammatory cytokines, including interleukin (IL)-1β and tumor necrosis factor-α in a concentration-dependent manner without causing cytotoxicity. In addition, EGL suppressed NF-κB translocation and transcriptional activity by blocking IκB degradation and inhibiting TLR4 and MyD88 expression in LPS-stimulated BV2 cells. Our results indicate that the inhibitory effects of EGL on LPS-stimulated inflammatory responses in BV2 microglia are associated with the suppression of the NF-κB and TLR signaling pathways. Therefore, EGL may be useful in the treatment of neurodegenerative diseases by inhibiting inflammatory mediator responses in activated microglia.

  8. Andrographolide acts as an anti-inflammatory agent in LPS-stimulated RAW264.7 macrophages by inhibiting STAT3-mediated suppression of the NF-κB pathway.

    Science.gov (United States)

    Lee, Ko-Chen; Chang, Hen-Hong; Chung, Ying-Hui; Lee, Tzung-Yan

    2011-06-01

    Inflammation is involved in numerous diseases, such as chronic inflammatory disease and cancer. Many plant products exhibit useful biological activities, including antifungal, antibacterial, and anti-inflammatory actions. However, our understanding of the anti-inflammatory effects of andrographolide is limited. We use lipopolysaccharide (LPS)-stimulated macrophages as a model of inflammation to investigate the anti-inflammatory effects of andrographolide, which contains polyphenolic structures. We found that andrographolide exhibited a potent anti-inflammatory effect. In this study, we investigated the inhibitory effects of andrographolide on the induction of nitric oxide synthase (NOS) and cyclooxygenase-2 (COX-2) as well as their respective downstream products, NO and PGE2, in RAW264.7 cells treated with LPS. Treatment with andrographolide also reduced nuclear factor-κB (NF-κB) and activation protein-1 (AP-1) DNA-binding activity. Western blot analysis showed that andrographolide significantly inhibited the phosphorylation of signal transducer and activator of transcription-3 (STAT3) and the protein expression of CCAAT/enhancer-binding protein δ (C/EBPδ). We also found that andrographolide suppressed LPS-induced suppressor of cytokine signalling 1 and 3 (SOCS1 and 3) mRNA expression, which, in turn, inhibited apoptosis signalling and mitochondria membrane potential activation. Our results demonstrate that andrographolide downregulates inflammatory iNOS and COX-2 gene expression by inhibiting the activation of NF-κB and STAT3 by interfering with the expression of SOCS1 and SOCS3 signalling. Therefore, andrographolide exerts a potent anti-inflammatory effect and could potentially be developed as a useful agent for the chemoprevention of cancer or inflammatory diseases. Copyright © 2011 Elsevier Ireland Ltd. All rights reserved.

  9. Indicaxanthin inhibits NADPH oxidase (NOX)-1 activation and NF-κB-dependent release of inflammatory mediators and prevents the increase of epithelial permeability in IL-1β-exposed Caco-2 cells.

    Science.gov (United States)

    Tesoriere, L; Attanzio, A; Allegra, M; Gentile, C; Livrea, M A

    2014-02-01

    Dietary redox-active/antioxidant phytochemicals may help control or mitigate the inflammatory response in chronic inflammatory bowel disease (IBD). In the present study, the anti-inflammatory activity of indicaxanthin (Ind), a pigment from the edible fruit of cactus pear (Opuntia ficus-indica, L.), was shown in an IBD model consisting of a human intestinal epithelial cell line (Caco-2 cells) stimulated by IL-1β, a cytokine known to play a major role in the initiation and amplification of inflammatory activity in IBD. The exposure of Caco-2 cells to IL-1β brought about the activation of NADPH oxidase (NOX-1) and the generation of reactive oxygen species (ROS) to activate intracellular signalling leading to the activation of NF-κB, with the over-expression of inflammatory enzymes and release of pro-inflammatory mediators. The co-incubation of the cells with Ind, at a nutritionally relevant concentration (5-25 μM), and IL-1β prevented the release of the pro-inflammatory cytokines IL-6 and IL-8, PGE2 and NO, the formation of ROS and the loss of thiols in a dose-dependent manner. The co-incubation of the cells with Ind and IL-1β also prevented the IL-1β-induced increase of epithelial permeability. It was also shown that the activation of NOX-1 and NF-κB was prevented by Ind and the expression of COX-2 and inducible NO synthase was reduced. The uptake of Ind in Caco-2 cell monolayers appeared to be unaffected by the inflamed state of the cells. In conclusion, our findings suggest that the dietary pigment Ind may have the potential to modulate inflammatory processes at the intestinal level.

  10. Omega-3 polyunsaturated fatty acid attenuates the inflammatory response by modulating microglia polarization through SIRT1-mediated deacetylation of the HMGB1/NF-κB pathway following experimental traumatic brain injury.

    Science.gov (United States)

    Chen, Xiangrong; Chen, Chunnuan; Fan, Sining; Wu, Shukai; Yang, Fuxing; Fang, Zhongning; Fu, Huangde; Li, Yasong

    2018-04-20

    Microglial polarization and the subsequent neuroinflammatory response are contributing factors for traumatic brain injury (TBI)-induced secondary injury. High mobile group box 1 (HMGB1) mediates the activation of the NF-κB pathway, and it is considered to be pivotal in the late neuroinflammatory response. Activation of the HMGB1/NF-κB pathway is closely related to HMGB1 acetylation, which is regulated by the sirtuin (SIRT) family of proteins. Omega-3 polyunsaturated fatty acids (ω-3 PUFA) are known to have antioxidative and anti-inflammatory effects. We previously demonstrated that ω-3 PUFA inhibited TBI-induced microglial activation and the subsequent neuroinflammatory response by regulating the HMGB1/NF-κB signaling pathway. However, no studies have elucidated if ω-3 PUFA affects the HMGB1/NF-κB pathway in a HMGB1 deacetylation of dependent SIRT1 manner, thus regulating microglial polarization and the subsequent neuroinflammatory response. The Feeney DM TBI model was adopted to induce brain injury in rats. Modified neurological severity scores, rotarod test, brain water content, and Nissl staining were employed to determine the neuroprotective effects of ω-3 PUFA supplementation. Assessment of microglia polarization and pro-inflammatory markers, such as tumor necrosis factor (TNF)-α, interleukin (IL)-1β, IL-6, and HMGB1, were used to evaluate the neuroinflammatory responses and the anti-inflammatory effects of ω-3 PUFA supplementation. Immunofluorescent staining and western blot analysis were used to detect HMGB1 nuclear translocation, secretion, and HMGB1/NF-κB signaling pathway activation to evaluate the effects of ω-3 PUFA supplementation. The impact of SIRT1 deacetylase activity on HMGB1 acetylation and the interaction between HMGB1 and SIRT1 were assessed to evaluate anti-inflammation effects of ω-3 PUFAs, and also, whether these effects were dependent on a SIRT1-HMGB1/NF-κB axis to gain further insight into the mechanisms underlying the

  11. Hypoxia-increased RAGE expression regulates chemotaxis and pro-inflammatory cytokines release through nuclear translocation of NF-κ B and HIF1α in THP-1 cells.

    Science.gov (United States)

    Bai, Wei; Zhou, Jing; Zhou, Na; Liu, Qin; Cui, Jian; Zou, Wei; Zhang, Wei

    2018-01-15

    The potential role of hypoxia in mediating the receptor for advanced glycation end products (RAGE) expression deserves to be confirmed. And the role of RAGE in hypoxia-induced chemotaxis and inflammation is still unclear. In present study, THP-1 cells were pretreated with siRNA to block HIF1α, NF-κ B, or RAGE, followed by exposed to hypoxia (combined with H 2 O 2 or SNP), and then RAGE expression, nuclear translocation of HIF1α and NF-κ B, release of TNF-α and IL-1β, as well as expression of MCP-1 and CCR2 were measured. The results revealed that RAGE mRNA and protein in THP-1 cells were significantly increased after exposed into hypoxia atmosphere, especially into the solution containing SNP or H 2 O 2 . Moreover, SNP or H 2 O 2 exposure could further amplify hypoxia-induced nuclear translocation of HIF-1α and NF-κ B. Knockdown HIF-1α or NF-κ B by siRNAs could reduce hypoxia- and oxidative stress-induced RAGE hyper-expression. And pretreatment THP-1 cells with RAGE siRNA or NF-κ B siRNA could reduce hypoxia- and oxidative stress-induced expression of MCP-1 and CCR2, and release of TNF-α and IL-1β. Thus, hypoxia not only increases RAGE expression in THP-1 cells by promoting nuclear translocation of NF-κ B and HIF1α, but also regulates chemotaxis and pro-inflammatory cytokines release, which may be partially mediated through upregulation of RAGE expression. Copyright © 2017 Elsevier Inc. All rights reserved.

  12. TOP 1 and 2, polysaccharides from Taraxacum officinale, inhibit NFκB-mediated inflammation and accelerate Nrf2-induced antioxidative potential through the modulation of PI3K-Akt signaling pathway in RAW 264.7 cells.

    Science.gov (United States)

    Park, Chung Mu; Cho, Chung Won; Song, Young Sun

    2014-04-01

    Anti-inflammatory and anti-oxidative activities of polysaccharides from Taraxacum officinale (TOP 1 and 2) were analyzed in RAW 264.7 cells. First, lipopolysaccharide (LPS) was applied to identify anti-inflammatory activity of TOPs, which reduced expression of inducible nitric oxide synthase (iNOS) and tumor necrosis factor (TNF)-α. TOPs treatment inhibited phosphorylation of inflammatory transcription factor, nuclear factor (NF)κB, and its upstream signaling molecule, PI3K/Akt. Second, cytoprotective potential of TOPs against oxidative stress was investigated via heme oxygenase (HO)-1 induction. HO-1, one of phase II enzymes shows antioxidative activity, was potently induced by TOPs treatment, which was in accordance with the nuclear translocation of nuclear factor-erythroid 2 p45-related factor 2 (Nrf2). In addition, TOPs treatment phosphorylated PI3K/Akt with slight activation of c-Jun NH2-terminal kinase (JNK). TOPs-mediated HO-1 induction protected macrophage cells from oxidative stress-induced cell death, which was confirmed by SnPP and CoPP (HO-1 inhibitor and inducer, respectively). Consequently, TOPs potently inhibited NFκB-mediated inflammation and accelerated Nrf2-mediated antioxidative potential through the modulation of PI3K/Akt pathway, which would contribute to their promising strategy for novel anti-inflammatory and anti-oxidative agents. Copyright © 2014. Published by Elsevier Ltd.

  13. Caffeic acid phenethyl ester promotes anti-inflammatory effects by inhibiting MAPK and NF-κB signaling in activated HMC-1 human mast cells.

    Science.gov (United States)

    Cho, Mi Suk; Park, Won Sun; Jung, Won-Kyo; Qian, Zhong-Ji; Lee, Dae-Sung; Choi, Jung-Sik; Lee, Da-Young; Park, Sae-Gwang; Seo, Su-Kil; Kim, Hak-Ju; Won, Jun Yeon; Yu, Byeng Chul; Choi, Il-Whan

    2014-07-01

    Caffeic acid phenethyl ester (CAPE), an active component of honeybee propolis, is known to have antioxidant, anti-inflammatory, and other beneficial medicinal properties. However, the molecular mechanisms underlying its anti-allergic effects in mast cells are unknown. The purpose of the present study was to examine whether CAPE modulates the immunoglobulin E (IgE)-mediated local allergic reaction in animals, as well as to elucidate the effects of CAPE on mast cells in vitro. To investigate the bioactive potential of CAPE (10 or 20 µM), HMC-1 cells were stimulated with phorbol 12-myristate 13-acetate plus calcium ionophore A23187 (PMACI) for 24 h in the presence or absence of CAPE. To study the pharmacological effects of CAPE, enzyme-linked immunosorbent assays (ELISAs), RT-PCR, Western blot analysis, electrophoretic mobility shift assays (EMSAs), and fluorescence assays were used. CAPE (10 mg/kg) inhibited local IgE-mediated allergic reactions (0.164 versus 0.065 O.D.) in a mouse model. Additionally, CAPE (20 µM) attenuated PMACI-stimulated histamine release (3146.42 versus 2564.83 pg/ml) and the production of inflammatory cytokines, such as interleukin (IL)-1β (4.775 versus 0.713 pg/ml, IC50 = 6.67 µM), IL-6 (4771.5 versus 449.1 pg/ml, IC50 = 5.25 µM), and IL-8 (5991.7 versus 2213.1 pg/ml, IC50 = 9.95 µM) in HMC-1 cells. In activated HMC-1 cells, pretreatment with CAPE decreased the phosphorylation of c-Jun N-terminal kinase. In addition, CAPE inhibited PMACI-induced nuclear factor (NF)-κB activation by suppressing IκBα phosphorylation and its degradation. Our results indicated that CAPE can modulate mast cell-mediated allergic disease.

  14. Anti-Inflammatory Effect of Methylpenicinoline from a Marine Isolate of Penicillium sp. (SF-5995: Inhibition of NF-κB and MAPK Pathways in Lipopolysaccharide-Induced RAW264.7 Macrophages and BV2 Microglia

    Directory of Open Access Journals (Sweden)

    Dong-Cheol Kim

    2014-11-01

    Full Text Available In the course of a search for anti-inflammatory metabolites from marine-derived fungi, methylpenicinoline (1 was isolated from a marine isolate of Penicillin sp. Compound 1 inhibited lipopolysaccharide (LPS-stimulated nitric oxide (NO production by suppressing the expression of inducible NO synthase (iNOS in RAW264.7 macrophages and BV2 microglia. It also attenuated prostaglandin E2 (PGE2 production by suppressing cyclooxygenase-2 (COX-2 expression in a concentration-dependent manner (from 10 μM to 80 μM without affecting cell viability. In addition, compound 1 reduced the production of the pro-inflammatory cytokine interleukin-1β (IL-1β. In a further study designed to elucidate the mechanism of its anti-inflammatory effects, compound 1 was shown to block nuclear factor-kappa B (NF-κB activation in LPS-induced RAW264.7 macrophages and BV2 microglia by inhibiting the phosphorylation of inhibitor kappa B-α (IκB-α, thereby suppressing the nuclear translocation of NF-κB dimers, namely p50 and p65, that are known to be crucial molecules associated with iNOS and COX-2 expression. In addition, compound 1 inhibited the activation of mitogen-activated protein kinase (MAPK pathways. Taken together, the results suggest that compound 1 might be a valuable therapeutic agent for the treatment of anti-inflammatory and anti-neuroinflammatory diseases.

  15. Sophora flavescens Aiton inhibits the production of pro-inflammatory cytokines through inhibition of the NF kappaB/IkappaB signal pathway in human mast cell line (HMC-1).

    Science.gov (United States)

    Hong, Myung Hee; Lee, Ji Young; Jung, Hee; Jin, Dong-Hoon; Go, Ho Yeon; Kim, Ji Hye; Jang, Bo-Hyoung; Shin, Yong-Cheol; Ko, Seong-Gyu

    2009-03-01

    The dried roots of Sophora flavescens Aiton (SFA) has been used in traditional medicine for treatment of inflammation, gastrointestinal hemorrhage, diarrhea, and asthma. In the present study, we investigated the effect of SFA on the inflammatory allergic reaction using human mast cell-1 (HMC-1). SFA (200mg/kg) inhibited the mast cell-mediated passive cutaneous anaphylaxis reaction in vivo and the release of histamine from rat peritoneal mast cells by compound 48/80. In addition, the expression levels of phorbol 12-myristate 13-acetate (PMA) and calcium ionophore A23187-stimulated TNF-alpha, IL-6, and IL-8 were also decreased by SFA treatment. In molecular mechanism level, this study showed that SFA inhibited the nuclear translocation of nuclear factor (NF) kappaB through inhibition of the phosphorylation and degradation of IkappaB-alpha, which is an inhibitor of NF kappaB. Moreover, SFA suppressed PMA plus A23187-induced phosphorylation of the mitogen-activated protein kinase p38 and c-jun N-terminal kinase. The inhibited induction of NF kappaB promoter by SFA was determined using luciferase activity. These results suggest that SFA could be used as a treatment for mast cell-derived allergic inflammatory diseases.

  16. Cynatratoside-C from Cynanchum atratum displays anti-inflammatory effect via suppressing TLR4 mediated NF-κB and MAPK signaling pathways in LPS-induced mastitis in mice.

    Science.gov (United States)

    Hu, Ge; Hong, Dong; Zhang, Tao; Duan, Huiqin; Wei, Panying; Guo, Xinxin; Mu, Xiang

    2018-01-05

    The present study was conducted to isolate anti-inflammatory compound from Cynanchum atratum and investigate the molecular mechanisms of active compound against lipopolysaccharide (LPS)-induced mastitis in mice. Bioassay-guided fractionations and isolation (via ex vivo tests) of compounds with anti-inflammatory activity were performed on roots of C. atratum yielding a pure bioactive compound: Cynatratoside-C, identified by comparing spectral data (EI-MS, 1 H NMR and 13 C NMR) with literature values. Ex vivo tests showed that Cynatratoside-C inhibited the expression of TLR4 and pro-inflammatory cytokine (TNF-α, IL-6 and IL-1β) production in LPS-stimulated primary mouse mammary epithelial cells. In vivo results indicated that Cynatratoside-C markedly attenuated LPS-induced mammary histopathologic changes and mammary oxidative stress (MDA, SOD, GPx) activity. Besides, Cynatratoside-C blocked the expression of Toll-like receptor 4 (TLR4) and then suppressed the phosphorylation of nuclear transcription factor-kappa B (NF-κB) p65 and degradation inhibitor of NF-κBα (IκBα). Further study showed that Cynatratoside-C could suppress the phosphorylation of p38, extracellular signal-regulated kinase (ERK) and c-jun NH2-terminal kinase (JNK) in mitogen-activated protein kinase (MAPK) signal pathway. In conclusion, our results suggest that Cynatratoside-C played an anti-inflammatory role in LPS-induced mastitis by regulating TLR4 and the NF-κB and MAPK signaling pathways in mammary gland tissues. Cynatratoside-C may be a promising potential therapeutic reagent for the treatment of mastitis. Copyright © 2017. Published by Elsevier B.V.

  17. Wogonin improves histological and functional outcomes, and reduces activation of TLR4/NF-κB signaling after experimental traumatic brain injury.

    Directory of Open Access Journals (Sweden)

    Chien-Cheng Chen

    Full Text Available Traumatic brain injury (TBI initiates a neuroinflammatory cascade that contributes to neuronal damage and behavioral impairment. This study was undertaken to investigate the effects of wogonin, a flavonoid with potent anti-inflammatory properties, on functional and histological outcomes, brain edema, and toll-like receptor 4 (TLR4- and nuclear factor kappa B (NF-κB-related signaling pathways in mice following TBI.Mice subjected to controlled cortical impact injury were injected with wogonin (20, 40, or 50 mg·kg(-1 or vehicle 10 min after injury. Behavioral studies, histology analysis, and measurement of blood-brain barrier (BBB permeability and brain water content were carried out to assess the effects of wogonin. Levels of TLR4/NF-κB-related inflammatory mediators were also examined. Treatment with 40 mg·kg(-1 wogonin significantly improved functional recovery and reduced contusion volumes up to post-injury day 28. Wogonin also significantly reduced neuronal death, BBB permeability, and brain edema beginning at day 1. These changes were associated with a marked reduction in leukocyte infiltration, microglial activation, TLR4 expression, NF-κB translocation to nucleus and its DNA binding activity, matrix metalloproteinase-9 activity, and expression of inflammatory mediators, including interleukin-1β, interleukin-6, macrophage inflammatory protein-2, and cyclooxygenase-2.Our results show that post-injury wogonin treatment improved long-term functional and histological outcomes, reduced brain edema, and attenuated the TLR4/NF-κB-mediated inflammatory response in mouse TBI. The neuroprotective effects of wogonin may be related to modulation of the TLR4/NF-κB signaling pathway.

  18. Haemophilus influenzae induces steroid-resistant inflammatory responses in COPD.

    Science.gov (United States)

    Cosío, Borja G; Jahn, Andreas; Iglesias, Amanda; Shafiek, Hanaa; Busquets, Xavier; Agustí, Alvar

    2015-12-07

    Chronic obstructive pulmonary disease (COPD) is an inflammatory disorder partially resistant to glucocorticoids. A reduced histone deacetylase (HDAC) activity has been proposed to explain this resistance. Haemophilus influenzae frequently colonizes the airways of COPD patients, where it enhances inflammation. The effects of Haemophilus influenzae on HDAC activity have not been investigated before. The effects of the presence or absence of Haemophilus influenzae ex-vivo and in vitro were studied. To this end, we determined: (1) cytokine release in alveolar macrophages (AM) from 7 patients with COPD, 5 healthy smokers, 6 healthy non-smokers and (2) HDAC activity, nuclear factor kappa B (NF-κB) activation in a macrophage-like cell line (PMA-transformed U937 cells) co-cultured with epithelial cells. Experiments were repeated with dexamethasone (1 μM) and/or the HDAC enhancer theophylline (10 μM). Haemophilus influenzae induced a steroid-resistant inflammatory response in AM from COPD and controls and decreased HDAC activity, activated NF-κB and induced the secretion of several cytokines (IL-6, IL-8, IL-1β, IL-10 and TNF-α) (p Haemophilus influenzae reduces HDAC activity and induces a NF-κB mediated inflammatory response that is only partially suppressed by glucocorticoids irrespective of having COPD. Yet, the latter can be fully restored by targeting HDAC activity.

  19. Cleome rutidosperma and Euphorbia thymifolia Suppress Inflammatory Response via Upregulation of Phase II Enzymes and Modulation of NF-κB and JNK Activation in LPS-Stimulated BV2 Microglia

    Directory of Open Access Journals (Sweden)

    Hsiou-Yu Ding

    2016-08-01

    Full Text Available Cleome rutidosperma DC. and Euphorbia thymifolia L. are herbal medicines used in traditional Indian and Chinese medicine to treat various illnesses. Reports document that they have antioxidant and anti-inflammatory activities; nonetheless, the molecular mechanisms involved in their anti-inflammatory actions have not yet been elucidated. The anti-neuroinflammatory activities and underlying mechanisms of ethanol extracts of Cleome rutidosperma (CR and Euphorbia thymifolia (ET were studied using lipopolysaccharide (LPS-stimulated microglial cell line BV2. The morphology changes and production of pro-inflammatory mediators were assayed. Gene expression of inflammatory genes such as inducible nitric oxide synthase (iNOS, cyclooxygenase (COX-2, interleukin (IL-1β, and CC chemokine ligand (CCL-2, as well as phase II enzymes such as heme oxygenase (HO-1, the modifier subunit of glutamate cysteine ligase (GCLM and NAD(PH quinone dehydrogenase 1 (NQO1, were further investigated using reverse transcription quantitative-PCR (RT-Q-PCR and Western blotting. The effects of CR and ET on mitogen activated protein kinases (MAPKs and nuclear factor (NF-κB signaling pathways were examined using Western blotting and specific inhibitors. CR and ET suppressed BV2 activation, down-regulated iNOS and COX-2 expression and inhibited nitric oxide (NO overproduction without affecting cell viability. They reduced LPS-mediated tumor necrosis factor (TNF and IL-6 production, attenuated IL-1β and CCL2 expression, but upregulated HO-1, GCLM and NQO1 expression. They also inhibited p65 NF-κB phosphorylation and modulated Jun-N terminal kinase (JNK activation in BV2 cells. SP600125, the JNK inhibitor, significantly augmented the anti-IL-6 activity of ET. NF-κB inhibitor, Bay 11-7082, enhanced the anti-IL-6 effects of both CR and ET. Znpp, a competitive inhibitor of HO-1, attenuated the anti-NO effects of CR and ET. Our results show that CR and ET exhibit anti

  20. Aspirin-triggered lipoxin A4 attenuates LPS-induced pro-inflammatory responses by inhibiting activation of NF-κB and MAPKs in BV-2 microglial cells

    Directory of Open Access Journals (Sweden)

    Yuan Shi-Ying

    2011-08-01

    Full Text Available Abstract Background Microglial activation plays an important role in neurodegenerative diseases through production of nitric oxide (NO and several pro-inflammatory cytokines. Lipoxins (LXs and aspirin-triggered LXs (ATLs are considered to act as 'braking signals' in inflammation. In the present study, we investigated the effect of aspirin-triggered LXA4 (ATL on infiammatory responses induced by lipopolysaccharide (LPS in murine microglial BV-2 cells. Methods BV-2 cells were treated with ATL prior to LPS exposure, and the effects of such treatment production of nitric oxide (NO, inducible nitric oxide synthase (iNOS, interleukin-1β (IL-1β and tumour necrosis factor-α (TNF-α were analysed by Griess reaction, ELISA, western blotting and quantitative RT-PCR. Moreover, we investigated the effects of ATL on LPS-induced nuclear factor-κB (NF-κB activation, phosphorylation of mitogen-activated protein kinases (MAPKs and activator protein-1 (AP-1 activation. Results ATL inhibited LPS-induced production of NO, IL-1β and TNF-α in a concentration-dependent manner. mRNA expressions for iNOS, IL-1β and TNF-α in response to LPS were also decreased by ATL. These effects were inhibited by Boc-2 (a LXA4 receptor antagonist. ATL significantly reduced nuclear translocation of NF-κB p65, degradation of the inhibitor IκB-α, and phosphorylation of extracellular signal-regulated kinase (ERK and p38 MAPK in BV-2 cells activated with LPS. Furthermore, the DNA binding activity of NF-κB and AP-1 was blocked by ATL. Conclusions This study indicates that ATL inhibits NO and pro-inflammatory cytokine production at least in part via NF-κB, ERK, p38 MAPK and AP-1 signaling pathways in LPS-activated microglia. Therefore, ATL may have therapeutic potential for various neurodegenerative diseases.

  1. AKT-targeted anti-inflammatory activity of the methanol extract of Chrysanthemum indicum var. albescens.

    Science.gov (United States)

    Yang, Woo Seok; Kim, Donghyun; Yi, Young-Su; Kim, Ji Hye; Jeong, Hye Yoon; Hwang, Kyeonghwan; Kim, Jong-Hoon; Park, Junseong; Cho, Jae Youl

    2017-04-06

    Wild chrysanthemum (Chrysanthemum indicum) is one of well-known medicinal plants traditionally used in Korea and China. As a variant of wild chrysanthemum, white wild chrysanthemum (Chrysanthemum indicum var. albescens) is also ethnopharmacologically applied to treat various symptoms such as inflammatory diseases. Although the anti-inflammatory activity of Chrysanthemum indicum has been reported, the anti-inflammatory activity and underlying molecular mechanism of white wild chrysanthemum are poorly understood. The effects of Chrysanthemum indicum var. albescens methanol extract (Civ-ME) on the production of inflammatory mediators, expression of pro-inflammatory genes, cell viability, and the activities of intracellular signaling molecules and transcription factors were investigated in lipopolysaccharide (LPS)-stimulated RAW264.7 cells. Civ-ME suppressed the production of both nitric oxide (NO) and prostaglandin E 2 (PGE 2 ) without cytotoxicity in LPS-stimulated RAW264.7 cells. Civ-ME was found to reduce the mRNA levels of inflammatory genes such as inducible NO synthase (iNOS) and tumor necrosis factor (TNF)-α and reduced NF-κB-mediated transcriptional activation. Civ-ME inhibited the nuclear translocation of NF-κB (p65 and p50), and its upstream signaling composed of IκBα and IKKα/β. An NF-κB luciferase reporter gene assay and an in vitro kinase assay confirmed that AKT1 and AKT2 might be direct pharmacological targets of Civ-ME. In addition, luteolin was identified by HPLC analysis as the main active pharmacological components of Civ-ME. Civ-ME exerts an anti-inflammatory effect by targeting AKT1 and AKT2 in the NF-κB signaling pathway in macrophage-mediated inflammatory responses. Copyright © 2017 Elsevier Ireland Ltd. All rights reserved.

  2. 21-O-Angeloyltheasapogenol E3, a Novel Triterpenoid Saponin from the Seeds of Tea Plants, Inhibits Macrophage-Mediated Inflammatory Responses in a NF-κB-Dependent Manner

    Directory of Open Access Journals (Sweden)

    Woo Seok Yang

    2014-01-01

    Full Text Available 21-O-Angeloyltheasapogenol E3 (ATS-E3 is a triterpenoid saponin recently isolated from the seeds of the tea tree Camellia sinensis (L. O. Kuntze. ATS-E3 has several beneficial properties including anti-inflammatory, antidiabetic, antiatherosclerotic, and anticancer effects. Unlike other phenolic compounds isolated from tea plants, there are no studies reporting the pharmacological action of ATS-E3. In this study, we therefore aimed to explore the cellular and molecular inhibitory activities of ATS-E3 in macrophage-mediated inflammatory responses. ATS-E3 remarkably diminished cellular responses of macrophages such as FITC-dextran-induced phagocytic uptake, sodium nitroprusside- (SNP- induced radical generation, and LPS-induced nitric oxide (NO production. Analysis of its molecular activity showed that this compound significantly suppressed the expression of inducible NO synthase (iNOS, nuclear translocation of nuclear factor- (NF- κB subunits (p50 and p65, phosphorylation of inhibitor of κB kinase (IKK, and the enzyme activity of AKT1. Taken together, the novel triterpenoid saponin compound ATS-E3 contributes to the beneficial effects of tea plants by exerting anti-inflammatory and antioxidative activities in an AKT/IKK/NF-κB-dependent manner.

  3. α-Solanine Isolated From Solanum Tuberosum L. cv Jayoung Abrogates LPS-Induced Inflammatory Responses Via NF-κB Inactivation in RAW 264.7 Macrophages and Endotoxin-Induced Shock Model in Mice.

    Science.gov (United States)

    Shin, Ji-Sun; Lee, Kyoung-Goo; Lee, Hwi-Ho; Lee, Hae Jun; An, Hyo-Jin; Nam, Jung-Hwan; Jang, Dae Sik; Lee, Kyung-Tae

    2016-10-01

    α-Solanine, a trisaccharide glycoalkaloid, has been reported to possess anti-cancer effects. In this study, we investigated the anti-inflammatory effects of α-solanine isolated from "Jayoung" a dark purple-fleshed potato by examining its in vitro inhibitory effects on inducible nitric-oxide synthase (iNOS), cyclooxygenase-2 (COX-2), and pro-inflammatory cytokines in LPS-induced RAW 264.7 macrophages and its in vivo effects on LPS-induced septic shock in a mouse model. α-Solanine suppressed the expression of iNOS and COX-2 both at protein and mRNA levels and consequently inhibited nitric oxide (NO) and prostaglandin E2 (PGE2 ) production in LPS-induced RAW 264.7 macrophages. α-Solanine also reduced the production and mRNA expression of interleukin-6 (IL-6), tumor necrosis factor-α (TNF-α), and interleukin-1β (IL-1β) induced by LPS. Furthermore, molecular mechanism studies indicated that α-solanine inhibited LPS-induced activation of nuclear factor-κB (NF-κB) by reducing nuclear translocation of p65, degradation of inhibitory κBα (IκBα), and phosphorylation of IκB kinaseα/β (IKKα/β). In an in vivo experiment of LPS-induced endotoxemia, treatment with α-solanine suppressed mRNA expressions of iNOS, COX-2, IL-6, TNF-α, and IL-1β, and the activation of NF-κB in liver. Importantly, α-solanine increased the survival rate of mice in LPS-induced endotoxemia and polymicrobial sepsis models. Taken together, our data suggest that the α-solanine may be a promising therapeutic against inflammatory diseases by inhibiting the NF-κB signaling pathway. J. Cell. Biochem. 117: 2327-2339, 2016. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  4. Inhibitor of Tec kinase, LFM-A13, decreases pro-inflammatory mediators production in LPS-stimulated RAW264.7 macrophages via NF-κB pathway.

    Science.gov (United States)

    Wang, Fei; Zhang, Wei; Wang, Chao; Fang, Xu; Cheng, Hao; Liu, Sheng; Chen, Xu-Lin

    2017-05-23

    Tec kinase, a prototypical member of the Tec tyrosine kinases family, was shown to mainly govern lymphocyte proliferation. In the present study, we investigated the role of Tec kinase in acute inflammatory response in lipopolysaccharide (LPS) challenge. First, we demonstrate that Tec kinase activity was observed in RAW264.7 macrophages exposed to LPS. Tec and phosphorylated Tec expression were upregulated in a dose- and time-dependent manner after LPS stimulation. LPS increased monocyte chemotactic protein (MCP)-1 secretion and intercellular adhesion molecule (ICAM)-1 expression, and increasing mRNA expression was consistently observed. LPS also induced IκBα phoshporylaytion and its degradation, increased NF-κB p65 phoshporylaytion and translocation to nuclei in RAW264.7 cells. Pretreatment with LFM-A13 decreased LPS-induced cytokines and chemokines production and mRNA levels, blocked NF-κB transactivation. These effects of LPS were also prevented by Tec-siRNA. Additionally, LFM-A13 or Tec-siRNA obviously inhibited LPS-induced TGFβ-activated kinase 1(TAK1) phosphorylation. Taken together, our results suggest that Tec kinase involves in acute inflammation process in LPS-stimulated RAW264.7 cells, at least mediated by activating TAK1/ NF-κB signal pathway.

  5. N(6)-(2-Hydroxyethyl)adenosine in the Medicinal Mushroom Cordyceps cicadae Attenuates Lipopolysaccharide-Stimulated Pro-inflammatory Responses by Suppressing TLR4-Mediated NF-κB Signaling Pathways.

    Science.gov (United States)

    Lu, Meng-Ying; Chen, Chin-Chu; Lee, Li-Ya; Lin, Ting-Wei; Kuo, Chia-Feng

    2015-10-23

    Natural products play an important role in promoting health with relation to the prevention of chronic inflammation. N(6)-(2-Hydroxyethyl)adenosine (HEA), a physiologically active compound in the medicinal mushroom Cordyceps cicadae, has been identified as a Ca(2+) antagonist and shown to control circulation and possess sedative activity in pharmacological tests. The fruiting body of C. cicadae has been widely applied in Chinese medicine. However, neither the anti-inflammatory activities of HEA nor the fruiting bodies of C. cicadae have been carefully examined. In this study, we first cultured the fruiting bodies of C. cicadae and then investigated the anti-inflammatory activities of water and methanol extracts of wild and artificially cultured C. cicadae fruiting bodies. Next, we determined the amount of three bioactive compounds, adenosine, cordycepin, and HEA, in the extracts and evaluated their synergistic anti-inflammatory effects. Moreover, the possible mechanism involved in anti-inflammatory action of HEA isolated from C. cicadae was investigated. The results indicate that cordycepin is more potent than adenosine and HEA in suppressing the lipopolysaccharide (LPS)-stimulated release of pro-inflammatory cytokines by RAW 264.7 macrophages; however, no synergistic effect was observed with these three compounds. HEA attenuated the LPS-induced pro-inflammatory responses by suppressing the toll-like receptor (TLR)4-mediated nuclear factor-κB (NF-κB) signaling pathway. This result will support the use of HEA as an anti-inflammatory agent and C. cicadae fruiting bodies as an anti-inflammatory mushroom.

  6. Anti-inflammatory effect of unsaturated fatty acids and Ergosta-7,22-dien-3-ol from Marthasterias glacialis: prevention of CHOP-mediated ER-stress and NF-κB activation.

    Directory of Open Access Journals (Sweden)

    David M Pereira

    Full Text Available There has been increasing awareness to the potential interest of drug discovery from marine natural products to treat several pathological conditions, including inflammation. In this work we describe the anti-inflammatory activity of several compounds present in the echinoderm Marthasterias glacialis (spiny sea-star, using the inflammatory model RAW 264.7 cells challenged with LPS. Lipidomic profiling of the organism revealed two major classes of compounds: fatty acids and sterols. Among these, the predominant compounds cis 11-eicosenoic and cis 11,14 eicosadienoic acids and the unsaturated sterol ergosta-7,22-dien-3-ol were evaluated. The mechanism of action of the compounds was distinct as they modulated different levels of the inflammation pathway. Classical inflammatory markers, such as COX-2, iNOS, IL-6 and NF-κB, were evaluated. We also studied the contribution of the CHOP pathway-mediated ER-stress to the inflammatory process. Overall, the sterol ergosta-7,22-dien-3-ol was the most active compound, however maximum activity was obtained when all compounds were tested in combination, thus suggesting a potentially synergistic activity of both classes of metabolites. This work establishes the echinoderm M. glacialis as an interesting source of anti-inflammatory molecules.

  7. Anti-inflammatory effects of shea butter through inhibition of iNOS, COX-2, and cytokines via the Nf-κB pathway in LPS-activated J774 macrophage cells.

    Science.gov (United States)

    Verma, Nandini; Chakrabarti, Rina; Das, Rakha H; Gautam, Hemant K

    2012-01-12

    Shea butter is traditionally used in Africa for its anti-inflammatory and analgesic effects. In this study we explored the anti-inflammatory activities of the methanolic extract of shea butter (SBE) using lipopolysaccharide (LPS)-induced murine macrophage cell line J774. It was observed that SBE significantly reduced the levels of LPS-induced nitric oxide, Tumor necrosis factor-α (TNF-α), interleukins, 1β (IL-1β), and -12 (IL-12) in the culture supernatants in a dose dependent manner. Expression of pro-inflammatory enzymes, inducible nitric oxide synthase (iNOS), and cyclooxygenase-2 (COX-2) were also inhibited by SBE. These anti-inflammatory effects were due to an inhibitory action of SBE on LPS-induced iNOS, COX-2, TNF-α, IL-1β, and IL-12 mRNA expressions. Moreover, SBE efficiently suppressed IκB phosphorylation and NF-κB nuclear translocation induced by LPS. These findings explain the molecular bases of shea butter's bioactivity against various inflammatory conditions and substantiate it as a latent source of novel therapeutic agents.

  8. 14-3-3γ Regulates Lipopolysaccharide-Induced Inflammatory Responses and Lactation in Dairy Cow Mammary Epithelial Cells by Inhibiting NF-κB and MAPKs and Up-Regulating mTOR Signaling

    Science.gov (United States)

    Liu, Lixin; Lin, Ye; Liu, Lili; Bian, Yanjie; Zhang, Li; Gao, Xuejun; Li, Qingzhang

    2015-01-01

    As a protective factor for lipopolysaccharide (LPS)-induced injury, 14-3-3γ has been the subject of recent research. Nevertheless, whether 14-3-3γ can regulate lactation in dairy cow mammary epithelial cells (DCMECs) induced by LPS remains unknown. Here, the anti-inflammatory effect and lactation regulating ability of 14-3-3γ in LPS-induced DCMECs are investigated for the first time, and the molecular mechanisms responsible for their effects are explored. The results of qRT-PCR showed that 14-3-3γ overexpression significantly inhibited the mRNA expression of tumor necrosis factor-α (TNF-α), interleukin-6 (IL-6), interleukin-1β (IL-1β) and inducible nitric oxide synthase (iNOS). Enzyme-linked immunosorbent assay (ELISA) analysis revealed that 14-3-3γ overexpression also suppressed the production of TNF-α and IL-6 in cell culture supernatants. Meanwhile, CASY-TT Analyser System showed that 14-3-3γ overexpression clearly increased the viability and proliferation of cells. The results of kit methods and western blot analysis showed that 14-3-3γ overexpression promoted the secretion of triglycerides and lactose and the synthesis of β-casein. Furthermore, the expression of genes relevant to nuclear factor-κB (NF-κB) and mitogen-activated protein kinase (MAPKs) and lactation-associated proteins were assessed by western blot, and the results suggested that 14-3-3γ overexpression inactivated the NF-κB and MAPK signaling pathways by down-regulating extracellular signal regulated protein kinase (ERK), p38 mitogen-activated protein kinase (p38MAPK) and inhibitor of NF-κB (IκB) phosphorylation levels, as well as by inhibiting NF-κB translocation. Meanwhile, 14-3-3γ overexpression enhanced the expression levels of β-casein, mammalian target of rapamycin (mTOR), ribosomal protein S6 kinase 1 (S6K1), serine/threonine protein kinase Akt 1 (AKT1), sterol regulatory element binding protein 1 (SREBP1) and peroxisome proliferator-activated receptor gamma (PPAR

  9. Synergistic effect of baicalein, wogonin and oroxylin A mixture: multistep inhibition of the NF-κB signalling pathway contributes to an anti-inflammatory effect of Scutellaria root flavonoids.

    Science.gov (United States)

    Shimizu, Tomofumi; Shibuya, Nobuhiko; Narukawa, Yuji; Oshima, Naohiro; Hada, Noriyasu; Kiuchi, Fumiyuki

    2018-01-01

    Scutellaria root, the root of Scutellaria baicalensis Georgi, is a crude drug used for inflammatory diseases. In our previous report, the combination of flavonoids contained in Scutellaria root have been found to inhibit PGE 2 production more strongly than individual flavonoids. Here, to investigate the mechanism of the synergistic effect, we examined the effects of an equimolar mixture (F-mix) of baicalein (1), wogonin (2) and oroxylin A (3) on the production of PGE 2 in LPS-treated J774.1 cells. Although 1 and 3 inhibited COX-2 activity, the F-mix showed no synergistic effect on COX-2 inhibition. Therefore, we investigated the steps leading to the activation of COX-2 protein. Compounds 1-3 and F-mix inhibited the expression of COX-2 protein. However, only 2 inhibited the expression of COX-2 mRNA among the flavonoids, and the F-mix showed no synergistic effect. Only 1 inhibited NF-κB translocation into the nucleus, and the F-mix showed no synergistic effect. Although 2 did not affect NF-κB translocation, it strongly inhibited NF-κB-dependent transcriptional activity, and the F-mix inhibited the activity slightly more than 2. Compounds 1-3 also inhibited NO production, and the F-mix showed a synergistic effect. However, the effects of each flavonoid on the expression of iNOS mRNA were not consistent with those on COX-2 mRNA. Because the flavonoids inhibit different steps in the production of PGE 2 and NO, and their mixture did not show apparent synergistic effects in each step, we conclude that the synergistic effect of the flavonoid mixture reflects the total effect of the flavonoids inhibiting different steps in the NF-κB signalling pathway.

  10. Bioassay-Guided Isolation of Anti-Inflammatory Components from the Bulbs of Lilium brownii var. viridulum and Identifying the Underlying Mechanism through Acting on the NF-κB/MAPKs Pathway.

    Science.gov (United States)

    Ma, Ting; Wang, Zhen; Zhang, Yang-Mei; Luo, Jian-Guang; Kong, Ling-Yi

    2017-03-23

    The bulbs of Lilium brownii var. viridulum (LB) are commonly used as both traditional Chinese medicines and popular functional food for many centuries in China. Previous studies reported that the extract of lily bulbs exhibited anti-inflammatory activity both in vivo and in vitro, but its active components and associated molecular mechanisms remain elusive. In the present study, using bioassay-guided isolation method, two phenylpropenoid acylglycerols, 1- O -feruloyl-2- O - p -coumaroylglycerol ( 1 ) and 1,3- O -diferuloylglycerol ( 2 ), were obtained and identified from the chloroform fraction of LB. Both compounds 1 and 2 significantly decreased the production of nitrite oxide (NO) in lipopolysaccharide (LPS)-stimulated mouse macrophage RAW264.7 cells in a dose-dependent manner with half maximal inhibitory concentration (IC 50 ) values of 9.12 ± 0.72 μM and 12.01 ± 1.07 μM, respectively. They also inhibited the production of prostaglandin E2 (PGE2) and several other pro-inflammatory cytokines, such as interleukin-1β (IL-1β), interleukin-6 (IL-6), and tumor necrosis factor-α (TNF-α). Furthermore, compounds 1 and 2 downregulated the protein levels of inducible nitric oxide synthase (iNOS) and cyclooxygenase-2 (COX-2). They also inhibited the nuclear translocation of nuclear factor-κB (NF-κB) p65 subunit and suppressed mitogen-activated protein kinases (MAPKs) pathway. Taken these data together, compounds 1 and 2 exhibited anti-inflammatory activities through acting on the NF-κB and MAPKs pathway. This research provides the first evidence on the major bioactive constituents and related molecular mechanisms of LB as an anti-inflammatory agent. Our findings also advanced the understanding of LB as a traditional herbal medicine for the prevention and treatment of inflammation.

  11. Identification and comparison of anti-inflammatory ingredients from different organs of Lotus nelumbo by UPLC/Q-TOF and PCA coupled with a NF-κB reporter gene assay.

    Directory of Open Access Journals (Sweden)

    Mengge Zhou

    Full Text Available Lotus nelumbo (LN (Nelumbo nucifera Gaertn. is an aquatic crop that is widely distributed throughout Asia and India, and various parts of this plant are edible and medicinal. It is noteworthy that different organs of this plant are used in traditional herbal medicine or folk recipes to cure different diseases and to relieve their corresponding symptoms. The compounds that are contained in each organ, which are named based on their chemical compositions, have led to their respective usages. In this work, a strategy was used to identify the difference ingredients and screen for Nuclear-factor-kappaB (NF-κB inhibitors with anti-inflammatory ability in LN. Seventeen main difference ingredients were compared and identified from 64 samples of 4 different organs by ultra-performance liquid chromatography that was coupled with quadrupole/time of flight mass spectrometry (UPLC/Q-TOF-MS with principal component analysis (PCA. A luciferase reporter assay system combined with the UPLC/Q-TOF-MS information was applied to screen biologically active substances. Ten NF-κB inhibitors from Lotus plumule (LP extracts, most of which were isoquinoline alkaloids or flavone C-glycosides, were screened. Heat map results showed that eight of these compounds were abundant in the LP. In conclusion, the LP extracts were considered to have the best anti-inflammatory ability of the four LN organs, and the chemical material basis (CMB of this biological activity was successfully validated by multivariate statistical analysis and biological research methods.

  12. Anti-inflammatory effects of cordycepin in lipopolysaccharide-stimulated RAW 264.7 macrophages through Toll-like receptor 4-mediated suppression of mitogen-activated protein kinases and NF-κB signaling pathways

    Directory of Open Access Journals (Sweden)

    Choi YH

    2014-10-01

    Full Text Available Yung Hyun Choi,1,2 Gi-Young Kim,3 Hye Hyeon Lee4 1Department of Biochemistry, Dongeui University College of Korean Medicine, Busan, 2Anti-Aging Research Center and Blue-Bio Industry RIC, Dongeui University, Busan, 3Laboratory of Immunobiology, Department of Marine Life Sciences, Jeju National University, Jeju, 4Daegu Gyeongbuk Institute of Science and Technology, Daegu, Republic of Korea Abstract: Cordycepin is the main functional component of the Cordyceps species, which has been widely used in traditional Oriental medicine. This compound possesses many pharmacological properties, such as an ability to enhance immune function, as well as antioxidant, antiaging, and anticancer effects. In the present study, we investigated the anti-inflammatory effects of cordycepin using a murine macrophage RAW 264.7 cell model. Our data demonstrated that cordycepin suppressed production of proinflammatory mediators such as nitric oxide (NO and prostaglandin E2 by inhibiting inducible NO synthase and cyclooxygenase-2 gene expression. Cordycepin also inhibited the release of proinflammatory cytokines, including tumor necrosis factor-alpha and interleukin-1-beta, through downregulation of respective mRNA expression. In addition, pretreatment with cordycepin significantly inhibited lipopolysaccharide (LPS-induced phosphorylation of mitogen-activating protein kinases and attenuated nuclear translocation of NF-κB by LPS, which was associated with abrogation of inhibitor kappa B-alpha degradation. Furthermore, cordycepin potently inhibited the binding of LPS to macrophages and LPS-induced Toll-like receptor 4 and myeloid differentiation factor 88 expression. Taken together, the results suggest that the inhibitory effects of cordycepin on LPS-stimulated inflammatory responses in RAW 264.7 macrophages are associated with suppression of mitogen-activating protein kinases and activation of NF-κB by inhibition of the Toll-like receptor 4 signaling pathway. Keywords

  13. Anti-inflammatory salicylate beneficially modulates pre-existing atherosclerosis through quenching of NF-κB activity and lowering of cholesterol

    NARCIS (Netherlands)

    Vries-van der Weij, J. de; Toet, K.; Zadelaar, A.S.M.; Wielinga, P.Y.; Kleemann, R.; Rensen, P.C.N.; Kooistra, T.

    2010-01-01

    Objective: Inflammation plays an important role in all stages of atherosclerosis, but little is known about the therapeutic effects of quenching inflammation in already existing atherosclerotic lesions. Putative beneficial effects of salicylate, an inhibitor of NF-κB activation, were studied in mice

  14. Regulation of NF-{kappa}B activity in astrocytes: effects of flavonoids at dietary-relevant concentrations

    Energy Technology Data Exchange (ETDEWEB)

    Spilsbury, Alison [Reading School of Pharmacy, University of Reading, Reading RG6 6UB (United Kingdom); Vauzour, David; Spencer, Jeremy P.E. [Molecular Nutrition Group, Centre for Integrative Neuroscience and Neurodynamics, School of Chemistry, Food and Pharmacy, University of Reading, Reading RG6 6AP (United Kingdom); Rattray, Marcus, E-mail: m.a.n.rattray@reading.ac.uk [Reading School of Pharmacy, University of Reading, Reading RG6 6UB (United Kingdom)

    2012-02-17

    Highlights: Black-Right-Pointing-Pointer We tested the hypothesis that low concentrations of flavonoids inhibit NF-{kappa}B in astrocytes. Black-Right-Pointing-Pointer Primary cultured astrocytes possess a functional {kappa}B-system, measured using luciferase assays. Black-Right-Pointing-Pointer Seven flavonoids (100 nM-1 {mu}M) failed to reduce NF-{kappa}B activity in astrocytes. Black-Right-Pointing-Pointer Four flavonoids (100 nM-1 {mu}M) failed to reduce TNFa-stimulated NF-{kappa}B activity in astrocytes. Black-Right-Pointing-Pointer (-)-Epicatechin did not regulate nuclear translocation of the NF-{kappa}B subunit, p65. -- Abstract: Neuroinflammation plays an important role in the progression of neurodegenerative disorders such as Alzheimer's disease and Parkinson's disease. Sustained activation of nuclear transcription factor {kappa}B (NF-{kappa}B) is thought to play an important role in the pathogenesis of neurodegenerative disorders. Flavonoids have been shown to possess antioxidant and anti-inflammatory properties and we investigated whether flavonoids, at submicromolar concentrations relevant to their bioavailability from the diet, were able to modulate NF-{kappa}B signalling in astrocytes. Using luciferase reporter assays, we found that tumour necrosis factor (TNF{alpha}, 150 ng/ml) increased NF-{kappa}B-mediated transcription in primary cultures of mouse cortical astrocytes, which was abolished on co-transfection of a dominant-negative I{kappa}B{alpha} construct. In addition, TNF{alpha} increased nuclear localisation of p65 as shown by immunocytochemistry. To investigate potential flavonoid modulation of NF-{kappa}B activity, astrocytes were treated with flavonoids from different classes; flavan-3-ols ((-)-epicatechin and (+)-catechin), flavones (luteolin and chrysin), a flavonol (kaempferol) or the flavanones (naringenin and hesperetin) at dietary-relevant concentrations (0.1-1 {mu}M) for 18 h. None of the flavonoids modulated constitutive or

  15. Regulation of NF-κB activity in astrocytes: effects of flavonoids at dietary-relevant concentrations

    International Nuclear Information System (INIS)

    Spilsbury, Alison; Vauzour, David; Spencer, Jeremy P.E.; Rattray, Marcus

    2012-01-01

    Highlights: ► We tested the hypothesis that low concentrations of flavonoids inhibit NF-κB in astrocytes. ► Primary cultured astrocytes possess a functional κB-system, measured using luciferase assays. ► Seven flavonoids (100 nM–1 μM) failed to reduce NF-κB activity in astrocytes. ► Four flavonoids (100 nM–1 μM) failed to reduce TNFa-stimulated NF-κB activity in astrocytes. ► (−)-Epicatechin did not regulate nuclear translocation of the NF-κB subunit, p65. -- Abstract: Neuroinflammation plays an important role in the progression of neurodegenerative disorders such as Alzheimer’s disease and Parkinson’s disease. Sustained activation of nuclear transcription factor κB (NF-κB) is thought to play an important role in the pathogenesis of neurodegenerative disorders. Flavonoids have been shown to possess antioxidant and anti-inflammatory properties and we investigated whether flavonoids, at submicromolar concentrations relevant to their bioavailability from the diet, were able to modulate NF-κB signalling in astrocytes. Using luciferase reporter assays, we found that tumour necrosis factor (TNFα, 150 ng/ml) increased NF-κB-mediated transcription in primary cultures of mouse cortical astrocytes, which was abolished on co-transfection of a dominant-negative IκBα construct. In addition, TNFα increased nuclear localisation of p65 as shown by immunocytochemistry. To investigate potential flavonoid modulation of NF-κB activity, astrocytes were treated with flavonoids from different classes; flavan-3-ols ((−)-epicatechin and (+)-catechin), flavones (luteolin and chrysin), a flavonol (kaempferol) or the flavanones (naringenin and hesperetin) at dietary-relevant concentrations (0.1–1 μM) for 18 h. None of the flavonoids modulated constitutive or TNFα-induced NF-κB activity. Therefore, we conclude that NF-κB signalling in astrocytes is not a major target for flavonoids.

  16. Loss of BMI-1 dampens migration and EMT of colorectal cancer in inflammatory microenvironment through TLR4/MD-2/MyD88-mediated NF-κB signaling.

    Science.gov (United States)

    Ye, Kai; Chen, Qi-Wei; Sun, Ya-Feng; Lin, Jian-An; Xu, Jian-Hua

    2018-02-01

    Increasing evidence from various clinical and experimental studies has demonstrated that the inflammatory microenvironment created by immune cells facilitates tumor migration. Epithelial-mesenchymal transition (EMT) is involved in the progression of cancer invasion and metastasis in an inflammatory microenvironment. B-lymphoma Moloney murine leukemia virus insertion region 1 (BMI-1) acts as an oncogene in various tumors. Ectopic expression of Bmi-1 have an effect on EMT and invasiveness. The purpose of this study was to investigate the efficacy of BMI-1 on inflammation-induced tumor migration and EMT and the underlying mechanism. We observed that the expression of BMI-1, TNF-α, and IL-1β was significantly increased in HT29 and HCT116 cells after THP-1 Conditioned-Medium (THP-1-CM) stimulation. Additionally, inhibition of BMI-1 impeded cell invasion induced by THP-1-CM-stimulation in both HT29 and HCT116 cells. BMI-1 knockdown remarkably repressed THP-1-CM-induced EMT by regulating the expression of EMT biomarkers with an increase in E-cadherin accompanied by decrease in N-cadherin and vimentin. Furthermore, downregulation of BMI-1 dramatically impeded THP-1-CM-triggered Toll-like receptor 4(TLR4)/myeloid differentiation protein 2(MD-2)/myeloid differentiation factor 88(MyD88) activity by repressing the expression of the TLR4/MD-2 complex and MyD88. Further data demonstrated that knockout of BMI-1 also dampened NF-κB THP-1-CM-triggered activity. Taken all data together, our findings established that BMI-1 modulated TLR4/MD-2/MyD88 complex-mediated NF-κB signaling involved in inflammation-induced cancer cells invasion and EMT, and therefore, could be a potential chemopreventive agent against inflammation-associated colorectal cancer. Establishment of an inflammatory microenvironment. Suppression of BMI-1 reverses THP-1-CM-induced inflammatory cytokine production in CRC. Loss of BMI-1 suppressed TLR4/MD-2/MyD88 complex-mediated NF-κB signaling. © 2017 Wiley

  17. CXC195 suppresses proliferation and inflammatory response in LPS-induced human hepatocellular carcinoma cells via regulating TLR4-MyD88-TAK1-mediated NF-κB and MAPK pathway

    International Nuclear Information System (INIS)

    Wang, Yiting; Tu, Qunfei; Yan, Wei; Xiao, Dan; Zeng, Zhimin; Ouyang, Yuming; Huang, Long; Cai, Jing; Zeng, Xiaoli; Chen, Ya-Jie; Liu, Anwen

    2015-01-01

    Highlights: • CXC195 exhibited significant anti-proliferative effect and induced cell cycle arrest in LPS-induced HepG2 cells. • CXC195 suppressed the release of pro-inflammatory mediators in LPS-induced HepG2 cells. • CXC195 regulated TLR4-MyD88-TAK1-mediated NF-κB and MAPK pathway in LPS-induced HepG2 cells. - Abstract: CXC195 showed strong protective effects in neuronal apoptosis by exerting its antioxidant activity. However, the anti-cancer effects of CXC195 is still with limited acquaintance. Here, we investigated the role of CXC195 in lipopolysaccharide (LPS)-induced human hepatocellular carcinoma (HCC) cells lines (HepG2) and the possible signaling pathways. CXC195 exhibited significant anti-proliferative effect and induced cell cycle arrest in LPS-induced HepG2 cells. In addition, CXC195 suppressed the release of pro-inflammatory mediators in LPS-induced HepG2 cells, including TNF-α, iNOS, IL-1β, IL-6, CC chemokine ligand (CCL)-2, CCL-22 and epidermal growth factor receptor (EGFR). Moreover, CXC195 inhibited the expressions and interactions of TLR4, MyD88 and TAK1, NF-κB translocation to nucleus and its DNA binding activity, phosphorylation of ERK1/2, p38 and JNK. Our results suggested that treatment with CXC195 could attenuate the TLR4-mediated proliferation and inflammatory response in LPS-induced HepG2 cells, thus might be beneficial for the treatment of HCC

  18. Tetra- and penta-acylated lipid A structures of Porphyromonas gingivalis LPS differentially activate TLR4-mediated NF-κB signal transduction cascade and immuno-inflammatory response in human gingival fibroblasts.

    Directory of Open Access Journals (Sweden)

    Thanuja D K Herath

    Full Text Available Porphyromonas gingivalis is a major pathogen of periodontal disease that affects a majority of adults worldwide. Increasing evidence shows that periodontal disease is linked to various systemic diseases like diabetes and cardiovascular disease, by contributing to increased systemic levels of inflammation. Lipopolysaccharides (LPS, as a key virulent attribute of P. gingivalis, possesses significant amount of lipid A heterogeneity containing tetra- (LPS1435/1449 and penta-acylated (LPS1690 structures. Hitherto, the exact molecular mechanism of P. gingivalis LPS involved in periodontal pathogenesis remains unclear, due to limited understanding of the specific receptors and signaling pathways involved in LPS-host cell interactions.This study systematically investigated the effects of P. gingivalis LPS1435/1449 and LPS1690 on the expression of TLR2 and TLR4 signal transduction and the activation of pro-inflammatory cytokines IL-6 and IL-8 in human gingival fibroblasts (HGFs. We found that LPS1435/1449 and LPS1690 differentially modulated TLR2 and TLR4 expression. NF-κB pathway was significantly activated by LPS1690 but not by LPS1435/1449. In addition, LPS1690 induced significant expression of NF-κB and p38 MPAK pathways-related genes, such as NFKBIA, NFKB1, IKBKB, MAP2K4 and MAPK8. Notably, the pro-inflammatory genes including GM-CSF, CXCL10, G-CSF, IL-6, IL-8 and CCL2 were significantly upregulated by LPS1690 while down-regulated by LPS1435/1449. Blocking assays confirmed that TLR4-mediated NF-κB signaling was vital in LPS1690-induced expression of IL-6 and IL-8 in HGFs.The present study suggests that the tetra- and penta-acylated lipid A structures of P. gingivalis LPS differentially activate TLR4-mediated NF-κB signaling pathway, and significantly modulate the expression of IL-6 and IL-8 in HGFs. The ability to alter the lipid A structure of LPS could be one of the strategies carried-out by P. gingivalis to evade innate host defense in

  19. Evaluation of potential antioxidant and anti-inflammatory effects of Antrodia cinnamomea powder and the underlying molecular mechanisms via Nrf2- and NF-κB-dominated pathways in broiler chickens.

    Science.gov (United States)

    Lee, M T; Lin, W C; Wang, S Y; Lin, L J; Yu, B; Lee, T T

    2018-04-17

    Antrodia cinnamomea, a precious and unique medical fungus existing exclusively in Taiwan, exhibits antioxidant and immunomodulatory properties. This study was conducted to evaluate the beneficial effects of A. cinnamomea powder (ACP) and to further illuminate its underlying antioxidant and immunomodulation molecular mechanisms in broilers. The functional compounds of ACP-crude triterpenoids, crude polysaccharides, and total phenolic content-were assayed, respectively. Two-hundred-forty one-day-old broilers (Ross 308) were assigned to 4 treatment groups receiving dietary supplementation with ACP at 0, 0.1, 0.2, and 0.4% for 35 days. Each group had 4 replicate pens, with 15 birds per pen. During 1 to 21- and 22 to 35-day periods, chickens on ACP-supplemented diet demonstrated increased body weight gain, compared to those on the control diet, resulting in increased weight gain throughout the entire experimental period with an increased tendency in feed consumption yet no significant difference in FCR. Blood antioxidant potentiality, superoxide dismutase (SOD), increased in birds fed the supplemented diet at both 21 and 35 d, accompanied by higher catalase (CAT) activity at 21 days. In vivo peripheral blood mononuclear cells (PBMC) exposed to lipopolysaccharide (LPS) and 2,2΄-Azobis(2-amidinopropane) dihydrochloride (AAPH) capability showed that the diminished cell viability caused by both challenge factors was improved in ACP-supplemented groups. Antioxidant genes dominated by Nrf2 genes, such as HO-1 and GCLC, were up-regulated in 35-day-old birds. Inflammatory-related genes, such as IL-1β and IL-6, ruled mainly by NF-κB, were rather down-regulated by 0.2% ACP addition at 21 and 35 days. Protein expression of Nrf2 and NF-κB in the liver supported the mRNA results, demonstrating that all ACP-supplemented groups showed significantly higher Nrf2 expression, whereas the NF-κB was inhibited. In conclusion, preferable microbial balance may putatively indicate the

  20. 3-Hydroxy-4,7-megastigmadien-9-one, isolated from Ulva pertusa, attenuates TLR9-mediated inflammatory response by down-regulating mitogen-activated protein kinase and NF-κB pathways.

    Science.gov (United States)

    Ali, Irshad; Manzoor, Zahid; Koo, Jung-Eun; Kim, Jung-Eun; Byeon, Sang-Hee; Yoo, Eun-Sook; Kang, Hee-Kyoung; Hyun, Jin-Won; Lee, Nam-Ho; Koh, Young-Sang

    2017-12-01

    Seaweeds are rich in bioactive compounds in the form of vitamins, phycobilins, polyphenols, carotenoids, phycocyanins and polysaccharides; many of these are known to have advantageous applications in human health. 3-Hydroxy-4,7-megastigmadien-9-one (comp) was isolated from Ulva pertusa (U. pertusa) Kjellman (Ulvaceae), which is a familiar edible green seaweed. This study evaluates the anti-inflammatory activity of comp in CpG DNA-stimulated bone marrow-derived dendritic cells (BMDCs). For evaluating the effect of comp on cytokines production, BMDCs were treated with doses of comp (0, 0.5, 1, 2, 5, 10, 25 and 50 μM) for 1 h before stimulation with CpG DNA (1 μM). Cytokine production was measured by ELISA. Western blotting was conducted for evaluating effect of comp (50 μM) on MAPKs and NF-κB pathways. Luciferase reporter gene assay was conducted for effect of comp (0, 5, 10 and 25 μM) on transcriptional activity of AP-1 and NF-κB. Comp exhibited strong inhibition of interleukin (IL)-12 p40, IL-6 and TNF-α cytokine production with IC 50 values of 6.02 ± 0.35, 27.14 ± 0.73, and 7.56 ± 0.21 μM, respectively. It blocked MAPKs and NF-κB pathways by inhibiting the phosphorylation of ERK1/2, JNK1/2, p38 and IκBα. In addition, it strongly inhibited the transcriptional activity of AP-1 and NF-κB with IC 50 values of 8.74 ± 0.31 and 12.08 ± 0.24 μM, respectively. Taken together, these data suggest that comp has a significant anti-inflammatory property and warrants further studies concerning the potential of comp for medicinal use.

  1. Lutein suppresses inflammatory responses through Nrf2 activation and NF-κB inactivation in lipopolysaccharide-stimulated BV-2 microglia.

    Science.gov (United States)

    Wu, Wanqiang; Li, Yuelian; Wu, Yue; Zhang, Yawen; Wang, Zhen; Liu, Xuebo

    2015-09-01

    In this study, the effects of lutein on neuroinflammation in lipopolysaccharide (LPS)-activated BV-2 microglia were investigated. The production of proinflammatory cytokines tumor necrosis factor-α, interleukin-1β, and nitric oxide was measured in culture medium using enzyme immunoassay and Griess reagent, respectively. The expression of proteins was determined using Western blot. Pretreatment with lutein (50 μM) prior to LPS (1 μg/mL, 12 h) stimulation resulted in a significant inhibition of inducible nitric oxide synthase and cyclooxygenase-2 expression, as well as tumor necrosis factor-α, interleukin-1β, and nitric oxide production (p lutein suppressed LPS-induced NF-κB activation by inhibiting the phosphorylation of p38 kinase, c-Jun N-terminal kinase (JNK), and Akt kinase (p lutein markedly quenched reactive oxygen species and promoted antioxidant protein expression including heme oxygenase-1 and quinone oxidoreductase by enhancing the phosphorylation of extracellular signal-regulated kinase 1/2 (ERK1/2) mediated NF-E2-related factor 2 (Nrf2) activation (p lutein attenuates neuroinflammation in LPS-activated BV-2 microglia partly through inhibiting p38-, JNK-, and Akt-stimulated NF-κB activation and promoting ERK-induced Nrf2 activation, suggesting that lutein has great potential as a nutritional preventive strategy in inflammation-related neurodegenerative disorders. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  2. Fumaric Acid Esters Do Not Reduce Inflammatory NF-κB/p65 Nuclear Translocation, ICAM-1 Expression and T-Cell Adhesiveness of Human Brain Microvascular Endothelial Cells

    Directory of Open Access Journals (Sweden)

    Axel Haarmann

    2015-08-01

    Full Text Available Dimethyl fumarate (DMF is approved for disease-modifying treatment of patients with relapsing-remitting multiple sclerosis. Animal experiments suggested that part of its therapeutic effect is due to a reduction of T-cell infiltration of the central nervous system (CNS by uncertain mechanisms. Here we evaluated whether DMF and its primary metabolite monomethyl fumarate (MMF modulate pro-inflammatory intracellular signaling and T-cell adhesiveness of nonimmortalized single donor human brain microvascular endothelial cells at low passages. Neither DMF nor MMF at concentrations of 10 or 50 µM blocked the IL-1β-induced nuclear translocation of NF-κB/p65, whereas the higher concentration of DMF inhibited the nuclear entry of p65 in human umbilical vein endothelium cultured in parallel. DMF and MMF also did not alter the IL-1β-stimulated activation of p38 MAPK in brain endothelium. Furthermore, neither DMF nor MMF reduced the basal or IL-1β-inducible expression of ICAM-1. In accordance, both fumaric acid esters did not reduce the adhesion of activated Jurkat T cells to brain endothelium under basal or inflammatory conditions. Therefore, brain endothelial cells probably do not directly mediate a potential blocking effect of fumaric acid esters on the inflammatory infiltration of the CNS by T cells.

  3. Rosiglitazone inhibits chlorpyrifos-induced apoptosis via modulation of the oxidative stress and inflammatory response in SH-SY5Y cells

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Jeong Eun [Department of Pharmacology, College of Medicine, Hanyang University, Seoul (Korea, Republic of); Hanyang Biomedical Research Institute, Seoul (Korea, Republic of); Park, Jae Hyeon; Jang, Sea Jeong [Hanyang Biomedical Research Institute, Seoul (Korea, Republic of); Graduate School of Biomedical Science and Engineering, Hanyang University, Seoul (Korea, Republic of); Koh, Hyun Chul, E-mail: hckoh@hanyang.ac.kr [Department of Pharmacology, College of Medicine, Hanyang University, Seoul (Korea, Republic of); Hanyang Biomedical Research Institute, Seoul (Korea, Republic of); Graduate School of Biomedical Science and Engineering, Hanyang University, Seoul (Korea, Republic of)

    2014-07-15

    Oxidative stress can lead to expression of inflammatory transcription factors, which are important regulatory elements in the induction of inflammatory responses. One of the transcription factors, nuclear transcription factor kappa-B (NF-κB) plays a significant role in the inflammation regulatory process. Inflammatory cell death has been implicated in neuronal cell death in some neurodegenerative disorders such as Parkinson's disease (PD). In this study, we investigated the molecular mechanisms underlying apoptosis initiated by chlorpyrifos (CPF)-mediated oxidative stress. Based on the cytotoxic mechanism of CPF, we examined the neuroprotective effects of rosiglitazone (RGZ), a peroxisome proliferator-activated receptor gamma (PPAR-γ) agonist, against CPF-induced neuronal cell death. The treatment of SH-SY5Y cells with CPF induced oxidative stress. In addition, CPF activated the p38, JNK and ERK mitogen-activated protein kinases (MAPKs), and induced increases in the inflammatory genes such as COX-2 and TNF-α. CPF also induced nuclear translocation of NF-κB and inhibitors of NF-κB abolished the CPF-induced COX-2 expression. Pretreatment with RGZ significantly reduced ROS generation and enhanced HO-1 expression in CPF-exposed cells. RGZ blocked the activation of both p38 and JNK signaling, while ERK activation was strengthened. RGZ also attenuated CPF-induced cell death through the reduction of NF-κB-mediated proinflammatory factors. Results from this study suggest that RGZ may exert an anti-apoptotic effect against CPF-induced cytotoxicity by attenuation of oxidative stress as well as inhibition of the inflammatory cascade via inactivation of signaling by p38 and JNK, and NF-κB. - Highlights: • CPF induces apoptotic cell death in SH-SY5Y cells • ROS involved in CPF-mediated apoptotic cell death • Inflammation involved in CPF-mediated apoptotic cell death • Rosiglitazone modulates ROS and inflammatory response in CPF-treated cells.

  4. Anti-inflammatory effects of escin are correlated with the glucocorticoid receptor/NF-?B signaling pathway, but not the COX/PGF2? signaling pathway

    OpenAIRE

    WANG, HONGSHENG; ZHANG, LEIMING; JIANG, NA; WANG, ZHENHUA; CHONG, YATING; FU, FENGHUA

    2013-01-01

    In China, escin has been widely used in the clinic as a potent anti-inflammatory drug. Previous studies have indicated that escin exerts its anti-inflammatory effect by enhancing the release of glucocorticoids (GCs) and prostaglandin-F2? (PGF2?), and this has been documented in the drug description. However, our previous studies demonstrated that escin did not increase the secretion of GCs, but instead elevated the protein expression of the GC receptor (GR), which may have repressed nuclear f...

  5. Extracellular HSP70 Activates ERK1/2, NF-kB and Pro-Inflammatory Gene Transcription Through Binding with RAGE in A549 Human Lung Cancer Cells.

    Science.gov (United States)

    Somensi, Nauana; Brum, Pedro Ozorio; de Miranda Ramos, Vitor; Gasparotto, Juciano; Zanotto-Filho, Alfeu; Rostirolla, Diana Carolina; da Silva Morrone, Maurilio; Moreira, José Claudio Fonseca; Pens Gelain, Daniel

    2017-01-01

    Heat shock protein 70 (HSP70) has been recently described with extracellular actions, where it is actively released in inflammatory conditions. Acting as DAMPs (damage associated molecular pattern), extracellular HSP70 (eHSP70) interacts with membrane receptors and activates inflammatory pathways. At this context, the receptor for advanced glycation endproducts (RAGE) emerges as a possible candidate for interaction with eHSP70. RAGE is a pattern-recognition receptor and its expression is increased in several diseases related to a chronic pro-inflammatory state. One of the main consequences of RAGE ligand-binding is the ERK1/2 (extracellular signal-regulated kinases)-dependent activation of NF-kB (nuclear factor kappa B), which leads to expression of TNF-α (tumor necrosis factor alpha) and other cytokines. The purpose of this work is to elucidate if eHSP70 is able to evoke RAGE-dependent signaling using A549 human lung cancer cells, which constitutively express RAGE. Immunoprecipitation and protein proximity assay were utilized to demonstrate the linkage between RAGE and eHSP70. To investigate RAGE relevance on cell response to eHSP70, siRNA was used to knockdown the receptor expression. Signaling pathways activation were evaluated by western blotting, gene reporter luciferase and real time quantitative PCR. Protein eHSP70 shown to be interacting physically with the receptor RAGE in our cell model. Treatment with eHSP70 caused ERK1/2 activation and NF-κB transactivation impaired by RAGE knockdown. Moreover, the stimulation of pro-inflammatory cytokines expression by eHSP70 was inhibited in RAGE-silenced cells. Finally, conditioned medium of eHSP70-treated A549 cells caused differential effects in monocytes cytokine expression when A549 RAGE expression is inhibited. Our results evidence eHSP70 as a novel RAGE agonist capable of influence the cross-talk between cancer and immune system cells. © 2017 The Author(s). Published by S. Karger AG, Basel.

  6. NF-κB suppresses HIF-1α response by competing for P300 binding

    International Nuclear Information System (INIS)

    Mendonca, Daniela B.S.; Mendonca, Gustavo; Aragao, Francisco J.L.; Cooper, Lyndon F.

    2011-01-01

    Research highlights: → p65 completely blocked HIF-1α activity at the HRE on different cell lines. → p65 caused minor changes in HIF-1α and HIF-1α target genes mRNA expression. → p65 reduced transcription of VEGF promoter. → p65 competes with HIF-1α for p300. -- Abstract: Hypoxia has emerged as a key determinant of osteogenesis. HIF-1α is the transcription factor mediating hypoxia responses that include induction of VEGF and related bone induction. Inflammatory signals antagonize bone repair via the NF-κB pathway. The present investigation explored the functional relationship of hypoxia (HIF-1α function) and inflammatory signaling (NF-κB) in stem like and osteoprogenitor cell lines. The potential interaction between HIF-1α and NF-κB signaling was explored by co-transfection studies in hFOB with p65, HIF-1α and 9x-HRE-luc or HIF-1α target genes reporter plasmids. Nuclear cross-talk was directly tested using the mammalian Gal4/VP16 two-hybrid, and confirmed by co-immunoprecipitation/western blotting assays. The results show that inflammatory stimulation (TNF-α treatment) causes a marked inhibition of HIF-1α function at the HRE in all cell lines studied. Also, co-transfection with p65 expression vector leads to reduced hVEGFp transcription after DFO-induced hypoxia. However, TNF-α treatment had little effect on HIF-1α mRNA levels. The functional interaction of Gal4-HIF-1α and VP16-p300 fusion proteins is effectively blocked by expression of p65 in a dose dependent manner. It was concluded that NF-κB-mediated inflammatory signaling is able to block HIF-1α transactivation at HRE-encoding genes by direct competition for p300 binding at the promoter. Inflammation may influence the stem cell niche and tissue regeneration by influencing cellular responses to hypoxia.

  7. 1-(2,3-Dibenzimidazol-2-ylpropyl-2-methoxybenzene Is a Syk Inhibitor with Anti-Inflammatory Properties

    Directory of Open Access Journals (Sweden)

    Eunji Kim

    2016-04-01

    Full Text Available Inflammation is the protective action of our bodies against external pathogens by recognition of pathogen-associated molecular patterns (PAMPs via pattern recognition receptors (PRRs. Proper regulation of inflammatory responses is required to maintain our body’s homeostasis, as well as there are demands to develop proper acute or chronic inflammation. In this study, we elucidated the regulatory mechanism of NF-κB-mediated inflammatory responses by a novel compound, 1-(2,3-dibenzimidazol-2-ylpropyl-2-methoxybenzene (DBMB. We found that DBMB suppressed inflammatory mediators, nitric oxide (NO and prostaglandin E2 (PGE2, reacted to exposure to a number of toll like receptor (TLR ligands. Such observations occurred following to decreased mRNA expression of several pro-inflammatory mediators, and such diminished mRNA levels were caused by inhibited transcriptional factor nuclear factor (NF-κB, as evaluated by luciferase reporter assay and molecular biological approaches. To find the potential targets of DBMB, we screened phosphorylated forms of NF-κB signal molecules: inhibitor of κBα (IκBα, IκB kinase (IKKα/β, Akt, 3-phosphoinositide dependent protein kinase-1 (PDK1, p85, and spleen tyrosine kinase (Syk. We found that DBMB treatment could suppress signal transduction through these molecules. Additionally, we conducted in vitro kinase assays using immunoprecipitated Syk and its substrate, p85. Consequently, we could say that DBMB clearly suppressed the kinase activity of Syk kinase activity. Together, our results demonstrate that synthetic DBMB has an effect on the inflammatory NF-κB signaling pathway and suggest the potential for clinical use in the treatment of inflammatory diseases.

  8. Anti-inflammatory effects of novel polygonum multiflorum compound via inhibiting NF-κB/MAPK and upregulating the Nrf2 pathways in LPS-stimulated microglia.

    Science.gov (United States)

    Park, Sun Young; Jin, Mei Ling; Kang, Nam Jun; Park, Geuntae; Choi, Young-Whan

    2017-06-09

    The incorporation of Polygonum multiflorum into the diet can result in anti-aging effects owing to its wide range of biological and pharmaceutical properties. We investigated the anti-neuroinflammatory properties of CRPE56IGIH isolated from P. multiflorum by focusing on its role in the induction of phase II antioxidant enzymes and the modulation of upstream signaling pathways. In microglia, CRPE56IGIH significantly inhibited lipopolysaccharide (LPS)-stimulated nitric oxide and prostaglandin E 2 production with nonspecific cytotoxicity. CRPE56IGIH also markedly inhibited LPS-inducible nitric oxide synthase (iNOS) and cyclooxygenase-2 protein and mRNA expression in the same manner as it inhibited nitric oxide and prostaglandin E 2 production. In the control cells, NF-κB transactivation and nuclear translocation occurred at a baseline level, which was significantly increased in response to LPS. However, pretreatment with CRPE56IGIH concentration-dependently inhibited the LPS-induced NF-κB transactivation and nuclear translocation. The phosphorylation of Janus kinase-signal transducers and activators of transcription and mitogen-activated protein kinases was markedly upregulated by LPS, but considerably and dose-dependently inhibited by pretreatment with CRPE56IGIH. Furthermore, CRPE56IGIH induced the expression of phase II antioxidant enzymes, including heme oxygenase-1 (HO-1) and NADPH dehydrogenase quinone-1 (NQO-1). The activation of upstream signaling pathways, such as the Nrf2 pathway, was significantly increased following CRPE56IGIH treatment. Furthermore, the anti-neuroinflammatory effect of CRPE56IGIH was reversed by transfection of Nrf2, HO-1, and NQO-1 siRNA. Our results indicated that CRPE56IGIH isolated from P. multiflorum could be used as a natural anti-neuroinflammatory agent that induces phase II antioxidant enzymes via Nrf2 signaling. Copyright © 2017 Elsevier B.V. All rights reserved.

  9. Blueberries reduce pro-inflammatory cytokine TNF-alpha and IL-6 production in mouse macrophages by inhibiting NF Kappa B activation and the MAPK pathway

    Science.gov (United States)

    Blueberries (BB) have been reported to attenuate atherosclerosis in apoE deficient (ApoE-/-) mice. The aim of this study was to evaluate the effects of BB in reducing pro-inflammatory cytokine production in mouse macrophages. ApoE-/- mice were fed AIN-93G diet (CD) or CD formulated to contain 1% fre...

  10. Decreasing NF-κB expression enhances odontoblastic differentiation and collagen expression in dental pulp stem cells exposed to inflammatory cytokines.

    Directory of Open Access Journals (Sweden)

    Neda S T Hozhabri

    Full Text Available Inflammatory response in the dental pulp can alter the collagen matrix formation by dental pulp stem cells and lead to a delay or poor healing of the pulp. This inflammatory response is mediated by cytokines, including interleukin-1β and tumor necrosis factor-α. In this study, it is hypothesized that suppressing the actions of these inflammatory cytokines by knocking down the activity of transcription factor Nuclear Factor-κB will lead to dental pulp stem cell differentiation into odontoblasts and the production of collagen. Here, the role of Nuclear Factor-κB signaling and its reduction was examined during odontogenic behavior in the presence of these cytokines. The results showed a significant increase in Nuclear Factor-κB gene expression and p65 protein expression by interleukin-1β and tumor necrosis factor-α. Nuclear Factor-κB activation in the presence of these cytokines decreased significantly in a dose-dependent manner by a Nuclear Factor-κB inhibitor (MG132 and p65 siRNA. Down-regulation of Nuclear Factor-κB activity also enhanced the gene expression of the odontoblastic markers (dentin sialophosphoprotein, Nestin, and alkaline phosphatase and displayed an odontoblastic cell morphology indicating the promotion of odontogenic differentiation of dental pulp stem cells. Finally, dental pulp stem cells exposed to reduced Nuclear Factor-κB activity resulted in a significant increase in collagen (I-α1 expression in the presence of these cytokines. In conclusion, a decrease in Nuclear Factor-κB in dental pulp stem cells in the presence of inflammatory cytokines enhanced odontoblastic differentiation and collagen matrix formation.

  11. Selenium Supplementation of Amaranth Sprouts Influences Betacyanin Content and Improves Anti-Inflammatory Properties via NF?B in Murine RAW 264.7 Macrophages

    OpenAIRE

    Tyszka-Czochara, Malgorzata; Pasko, Pawel; Zagrodzki, Pawel; Gajdzik, Ewelina; Wietecha-Posluszny, Renata; Gorinstein, Shela

    2015-01-01

    Sprouts contain potent compounds which while influencing crucial transduction pathways in cell reveal anti-inflammatory and anticancer activities. In this study, we report the biological activity for seeds and colourful sprouts of four types of edible amaranth, as amaranth has recently attracted interest due to its appreciable nutritional value. MTT assay conducted for the amaranth seeds and sprouts did not show any adverse effect on the viability of murine RAW 264.7 cells. As amaranth accumu...

  12. NF-κB is activated in CD4+ iNKT cells by sickle cell disease and mediates rapid induction of adenosine A2A receptors.

    Directory of Open Access Journals (Sweden)

    Gene Lin

    Full Text Available Reperfusion injury following tissue ischemia occurs as a consequence of vaso-occlusion that is initiated by activation of invariant natural killer T (iNKT cells. Sickle cell disease (SDC results in widely disseminated microvascular ischemia and reperfusion injury as a result of vaso-occlusion by rigid and adhesive sickle red blood cells. In mice, iNKT cell activation requires NF-κB signaling and can be inhibited by the activation of anti-inflammatory adenosine A2A receptors (A2ARs. Human iNKT cells are divided into subsets of CD4+ and CD4- cells. In this study we found that human CD4+ iNKT cells, but not CD4- cells undergo rapid NF-κB activation (phosphorylation of NF-κB on p65 and induction of A2ARs (detected with a monoclonal antibody 7F6-G5-A2 during SCD painful vaso-occlusive crises. These findings indicate that SCD primarily activates the CD4+ subset of iNKT cells. Activation of NF-κB and induction of A2ARs is concordant, i.e. only CD4+ iNKT cells with activated NF-κB expressed high levels of A2ARs. iNKT cells that are not activated during pVOC express low levels of A2AR immunoreactivity. These finding suggest that A2AR transcription may be induced in CD4+ iNKT cells as a result of NF-κB activation in SCD. In order to test this hypothesis further we examined cultured human iNKT cells. In cultured cells, blockade of NF-κB with Bay 11-7082 or IKK inhibitor VII prevented rapid induction of A2AR mRNA and protein upon iNKT activation. In conclusion, NF-κB-mediated induction of A2ARs in iNKT cells may serve as a counter-regulatory mechanism to limit the extent and duration of inflammatory immune responses. As activated iNKT cells express high levels of A2ARs following their activation, they may become highly sensitive to inhibition by A2AR agonists.

  13. DC-SIGN reacts with TLR-4 and regulates inflammatory cytokine expression via NF-κB activation in renal tubular epithelial cells during acute renal injury.

    Science.gov (United States)

    Feng, D; Wang, Y; Liu, Y; Wu, L; Li, X; Chen, Y; Chen, Y; Chen, Y; Xu, C; Yang, K; Zhou, T

    2018-01-01

    In the pathological process of acute kidney injury (AKI), innate immune receptors are essential in inflammatory response modulation; however, the precise molecular mechanisms are still unclear. Our study sought to demonstrate the inflammatory response mechanisms in renal tubular epithelial cells via Toll-like receptor-4 (TLR-4) and dendritic cell-specific intercellular adhesion molecule 3-grabbing non-integrin 1 (DC-SIGN) signalling. We found that DC-SIGN exhibited strong expression in renal tubular epithelial cells of human acute renal injury tissues. DC-SIGN protein expression was increased significantly when renal tubular epithelial cells were exposed to lipopolysaccharide (LPS) for a short period. Furthermore, DC-SIGN was involved in the activation of p65 by TLR-4, which excluded p38 and c-Jun N-terminal kinases (JNK). Interleukin (IL)-6 and tumour necrosis factor (TNF)-α expression was decreased after DC-SIGN knock-down, and LPS induced endogenous interactions and plasma membrane co-expression between TLR-4 and DC-SIGN. These results show that DC-SIGN and TLR-4 interactions regulate inflammatory responses in renal tubular epithelial cells and participate in AKI pathogenesis. © 2017 British Society for Immunology.

  14. 6-OHDA-induced apoptosis and mitochondrial dysfunction are mediated by early modulation of intracellular signals and interaction of Nrf2 and NF-κB factors

    International Nuclear Information System (INIS)

    Tobón-Velasco, Julio C.; Limón-Pacheco, Jorge H.; Orozco-Ibarra, Marisol; Macías-Silva, Marina; Vázquez-Victorio, Genaro; Cuevas, Elvis; Ali, Syed F.

    2013-01-01

    6-Hydroxydopamine (6-OHDA) is a neurotoxin that generates an experimental model of Parkinson's disease in rodents and is commonly employed to induce a lesion in dopaminergic pathways. The characterization of those molecular mechanisms linked to 6-OHDA-induced early toxicity is needed to better understand the cellular events further leading to neurodegeneration. The present work explored how 6-OHDA triggers early downstream signaling pathways that activate neurotoxicity in the rat striatum. Mitochondrial function, caspases-dependent apoptosis, kinases signaling (Akt, ERK 1/2, SAP/JNK and p38) and crosstalk between nuclear factor kappa B (NF-κB) and nuclear factor-erythroid-2-related factor 2 (Nrf2) were evaluated at early times post-lesion. We found that 6-OHDA initiates cell damage via mitochondrial complex I inhibition, cytochrome c and apoptosis-inducing factor (AIF) release, as well as activation of caspases 9 and 3 to induce apoptosis, kinase signaling modulation and NF-κB-mediated inflammatory responses, accompanied by inhibition of antioxidant systems regulated by the Nrf2 pathway. Our results suggest that kinases SAP/JNK and p38 up-regulation may play a role in the early stages of 6-OHDA toxicity to trigger intrinsic pathways for apoptosis and enhanced NF-κB activation. In turn, these cellular events inhibit the activation of cytoprotective mechanisms, thereby leading to a condition of general damage

  15. Wnt5a Promotes Inflammatory Responses via Nuclear Factor κB (NF-κB) and Mitogen-activated Protein Kinase (MAPK) Pathways in Human Dental Pulp Cells*

    Science.gov (United States)

    Zhao, Yuan; Wang, Chen-Lin; Li, Rui-Min; Hui, Tian-Qian; Su, Ying-Ying; Yuan, Quan; Zhou, Xue-Dong; Ye, Ling

    2014-01-01

    Wnt5a has been found recently to be involved in inflammation regulation through a mechanism that remains unclear. Immunohistochemical staining of infected human dental pulp and tissue from experimental dental pulpitis in rats showed that Wnt5a levels were increased. In vitro, Wnt5a was increased 8-fold in human dental pulp cells (HDPCs) after TNF-α stimulation compared with control cells. We then investigated the role of Wnt5a in HDPCs. In the presence of TNF-α, Wnt5a further increased the production of cytokines/chemokines, whereas Wnt5a knockdown markedly reduced cytokine/chemokine production induced by TNF-α. In addition, in HDPCs, Wnt5a efficiently induced cytokine/chemokine expression and, in particular, expression of IL-8 (14.5-fold) and CCL2 (25.5-fold), as assessed by a Luminex assay. The cytokine subsets regulated by Wnt5a overlap partially with those induced by TNF-α. However, no TNF-α and IL-1β was detected after Wnt5a treatment. We then found that Wnt5a alone and the supernatants of Wnt5a-treated HDPCs significantly increased macrophage migration, which supports a role for Wnt5a in macrophage recruitment and as an inflammatory mediator in human dental pulp inflammation. Finally, Wnt5a participates in dental pulp inflammation in a MAPK-dependent (p38-, JNK-, and ERK-dependent) and NF-κB-dependent manner. Our data suggest that Wnt5a, as an inflammatory mediator that drives the integration of cytokines and chemokines, acts downstream of TNF-α. PMID:24891513

  16. D-Saccharic acid 1,4-lactone protects diabetic rat kidney by ameliorating hyperglycemia-mediated oxidative stress and renal inflammatory cytokines via NF-κB and PKC signaling

    Energy Technology Data Exchange (ETDEWEB)

    Bhattacharya, Semantee [Department of Life Sciences and Biotechnology, Jadavpur University, 188, Raja S C Mullick Road, Kolkata 700 032 (India); Manna, Prasenjit [Division of Molecular Medicine, Bose Institute, P-1/12, CIT Scheme VII M, Kolkata-700054 (India); Gachhui, Ratan [Department of Life Sciences and Biotechnology, Jadavpur University, 188, Raja S C Mullick Road, Kolkata 700 032 (India); Sil, Parames C., E-mail: parames@bosemain.boseinst.ac.in [Division of Molecular Medicine, Bose Institute, P-1/12, CIT Scheme VII M, Kolkata-700054 (India)

    2013-02-15

    Increasing evidence suggests that oxidative stress is involved in the pathogenesis of diabetic nephropathy (DN) and this can be attenuated by antioxidants. D-Saccharic acid 1,4-lactone (DSL) is known for its detoxifying and antioxidant properties. Our early investigation showed that DSL can ameliorate alloxan (ALX) induced diabetes mellitus and oxidative stress in rats by inhibiting pancreatic β-cell apoptosis. In the present study we, therefore, investigated the protective role of DSL against renal injury in ALX induced diabetic rats. ALX exposure (at a dose of 120 mg/kg body weight, i. p., once) elevated the blood glucose level, serum markers related to renal injury, the production of reactive oxygen species (ROS), and disturbed the intra-cellular antioxidant machineries. Oral administration of DSL (80 mg/kg body weight) restored all these alterations close to normal. In addition, DSL could also normalize the aldose reductase activity which was found to increase in the diabetic rats. Investigating the mechanism of its protective activity, we observed the activation of different isoforms of PKC along with the accumulation of matrix proteins like collagen and fibronectin. The diabetic rats also showed nuclear translocation of NF-κB and increase in the concentration of inflammatory cytokines in the renal tissue. The activation of mitochondria dependent apoptotic pathway was observed in the diabetic rat kidneys. However, treatment of diabetic rats with DSL counteracted all these changes. These findings, for the first time, demonstrated that DSL could ameliorate renal dysfunction in diabetic rats by suppressing the oxidative stress related signalling pathways. - Highlights: ► Sustained hyperglycemia and oxidative stress lead to diabetic renal injury. ► D-saccharic acid 1,4-lactone prevents renal damage in alloxan-induced diabetes. ► It restores intra-cellular antioxidant machineries and kidney apoptosis. ► DSL reduces hyperglycemia-mediated oxidative stress

  17. The Regulation of NF-κB Subunits by Phosphorylation

    Directory of Open Access Journals (Sweden)

    Frank Christian

    2016-03-01

    Full Text Available The NF-κB transcription factor is the master regulator of the inflammatory response and is essential for the homeostasis of the immune system. NF-κB regulates the transcription of genes that control inflammation, immune cell development, cell cycle, proliferation, and cell death. The fundamental role that NF-κB plays in key physiological processes makes it an important factor in determining health and disease. The importance of NF-κB in tissue homeostasis and immunity has frustrated therapeutic approaches aimed at inhibiting NF-κB activation. However, significant research efforts have revealed the crucial contribution of NF-κB phosphorylation to controlling NF-κB directed transactivation. Importantly, NF-κB phosphorylation controls transcription in a gene-specific manner, offering new opportunities to selectively target NF-κB for therapeutic benefit. This review will focus on the phosphorylation of the NF-κB subunits and the impact on NF-κB function.

  18. Effects of cranberry extracts and ursolic acid derivatives on P-fimbriated Escherichia coli, COX-2 activity, pro-inflammatory cytokine release and the NF-κβ transcriptional response in vitro

    Science.gov (United States)

    Huang, Yue; Nikolic, Dejan; Pendland, Susan; Doyle, Brian J.; Locklear, Tracie D.; Mahady, Gail B.

    2010-01-01

    Cranberry, the fresh or dried ripe fruit of Vaccinium macrocarpon Ait. (Ericaceae), is currently used as adjunct therapy for the prevention and symptomatic treatment of urinary tract infections. Data from clinical trials suggest that extracts of cranberry or cranberry juice reduce the bacterial load of E. coli and also suppress the inflammatory symptoms induced by E. coli infections. A methanol extract prepared from 10 kg of dehydrated cranberries did not directly inhibit the growth of E coli strains ATCC 700336 or ATCC 25922 in concentrations up to 256 μg/mL in vitro. However, the methanol extract (CR-ME) inhibited the activity of cyclooxygenase-2, with an IC50 of 12.8 μg/mL. Moreover, CR-ME also inhibited the NF-κβ transcriptional activation in human T lymphocytes with an IC50 of 19.4 μg/mL, and significantly (p < 0.01) inhibited the release of interleukin (IL)-1β, IL-6, IL-8 and tumor necrosis factor-α from E. coli lipopolysaccharide (LPS)-stimulated human peripheral blood mononuclear cells in vitro, at a concentration of 50 μg/mL. The extract had no effect on inducible nitric oxide synthase activity in the murine macrophage cell line RAW 264.7. The compounds responsible for this activity were identified using a novel LC-MS based assay as ursolic acid and ursolic acid derivatives. Taken together, these data suggest CR-ME and its constituent chemical compounds target specific pathways involved in E. coli-induced inflammation. PMID:20376297

  19. Kaempferol and Kaempferol Rhamnosides with Depigmenting and Anti-Inflammatory Properties

    Directory of Open Access Journals (Sweden)

    Jae Youl Cho

    2011-04-01

    Full Text Available The objective of this study was to examine the biological activity of kaempferol and its rhamnosides. We isolated kaempferol (1, a-rhamnoisorobin (2, afzelin (3, and kaempferitrin (4 as pure compounds by far-infrared (FIR irradiation of kenaf (Hibiscus cannabinus L. leaves. The depigmenting and anti-inflammatory activity of the compounds was evaluated by analyzing their structure-activity relationships. The order of the inhibitory activity with regard to depigmentation and nitric oxide (NO production was kaempferol (1 > a-rhamnoisorobin (2 > afzelin (3 > kaempferitrin (4. However, a-rhamnoisorobin (2 was more potent than kaempferol (1 in NF-kB-mediated luciferase assays. From these results, we conclude that the 3-hydroxyl group of kaempferol is an important pharmacophore and that additional rhamnose moieties affect the biological activity negatively.

  20. Vitamin E γ-Tocotrienol Inhibits Cytokine-Stimulated NF-κB Activation by Induction of Anti-Inflammatory A20 via Stress Adaptive Response Due to Modulation of Sphingolipids.

    Science.gov (United States)

    Wang, Yun; Park, Na-Young; Jang, Yumi; Ma, Averil; Jiang, Qing

    2015-07-01

    NF-κB plays a central role in pathogenesis of inflammation and cancer. Many phytochemicals, including γ-tocotrienol (γTE), a natural form of vitamin E, have been shown to inhibit NF-κB activation, but the underlying mechanism has not been identified. In this study, we show that γTE inhibited cytokine-triggered activation of NF-κB and its upstream regulator TGF-β-activated kinase-1 in murine RAW 264.7 macrophages and primary bone marrow-derived macrophages. In these cells, γTE induced upregulation of A20, an inhibitor of NF-κB. Knockout of A20 partially diminished γTE's anti-NF-κB effect, but γTE increased another NF-κB inhibitor, Cezanne, in A20(-/-) cells. In search of the reason for A20 upregulation, we found that γTE treatment increased phosphorylation of translation initiation factor 2, IκBα, and JNK, indicating induction of endoplasmic reticulum stress. Liquid chromatography-tandem mass spectrometry analyses revealed that γTE modulated sphingolipids, including enhancement of intracellular dihydroceramides, sphingoid bases in de novo synthesis of the sphingolipid pathway. Chemical inhibition of de novo sphingolipid synthesis partially reversed γTE's induction of A20 and the anti-NF-κB effect. The importance of dihydroceramide increase is further supported by the observation that C8-dihydroceramide mimicked γTE in upregulating A20, enhancing endoplasmic reticulum stress, and attenuating TNF-triggered NF-κB activation. Our study identifies a novel anti-NF-κB mechanism where A20 is induced by stress-induced adaptive response as a result of modulation of sphingolipids, and it demonstrates an immunomodulatory role of dihydrocermides. Copyright © 2015 by The American Association of Immunologists, Inc.

  1. TNF-α expression, not iNOS expression, is correlated with NF-κB ...

    African Journals Online (AJOL)

    Jane

    2011-07-11

    Jul 11, 2011 ... Previous studies have shown that pro-inflammatory cytokines were involved in the genesis and persistence of neuropathic pain. Nuclear factor kappa B (NF-κB) plays a crucial role in regulating pro- inflammatory cytokine gene expression. In this study, we examined the hypothesis that NF-κB would regulate ...

  2. MicroRNA-27b Modulates Inflammatory Response and Apoptosis during Mycobacterium tuberculosis Infection.

    Science.gov (United States)

    Liang, Shuxin; Song, Zhigang; Wu, Yongyan; Gao, Yuanpeng; Gao, Mingqing; Liu, Fayang; Wang, Fengyu; Zhang, Yong

    2018-04-16

    Mycobacterium tuberculosis poses a significant global health threat. MicroRNAs play an important role in regulating host anti-mycobacterial defense; however, their role in apoptosis-mediated mycobacterial elimination and inflammatory response remains unclear. In this study, we explored the role of microRNA-27b (miR-27b) in murine macrophage responses to M. tuberculosis infection. We uncovered that the TLR-2/MyD88/NF-κB signaling pathway induced the expression of miR-27b and miR-27b suppressed the production of proinflammatory factors and the activity of NF-κB, thereby avoiding an excessive inflammation during M. tuberculosis infection. Luciferase reporter assay and Western blotting showed that miR-27b directly targeted Bcl-2-associated athanogene 2 (Bag2) in macrophages. Overexpression of Bag2 reversed miR-27b-mediated inhibition of the production of proinflammatory factors. In addition, miR-27b increased p53-dependent cell apoptosis and the production of reactive oxygen species and decreased the bacterial burden. We also showed that Bag2 interacts with p53 and negatively regulates its activity, thereby controlling cell apoptosis and facilitating bacterial survival. In summary, we revealed a novel role of the miR-27b/Bag2 axis in the regulation of inflammatory response and apoptosis and provide a potential molecular host defense mechanism against mycobacteria. Copyright © 2018 by The American Association of Immunologists, Inc.

  3. Renoprotective effect of paricalcitol via a modulation of the TLR4-NF-κB pathway in ischemia/reperfusion-induced acute kidney injury

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Jae-Won, E-mail: maestro97@hanmail.net; Kim, Sun Chul, E-mail: linefe99@hanmail.net; Ko, Yoon Sook, E-mail: rainboweyes@hanmail.net; Lee, Hee Young, E-mail: cell1023@hanmail.net; Cho, Eunjung, E-mail: icdej@naver.com; Kim, Myung-Gyu, E-mail: gyu219@hanmail.net; Jo, Sang-Kyung, E-mail: sang-kyung@korea.ac.kr; Cho, Won Yong, E-mail: wonyong@korea.ac.kr; Kim, Hyoung Kyu, E-mail: hyoung@korea.ac.kr

    2014-02-07

    Highlights: • Paricalcitol. • Attenuation of renal inflammation. • Modulation of TLR4-NF-κB signaling. - Abstract: Background: The pathophysiology of ischemic acute kidney injury (AKI) is thought to include a complex interplay between vascular endothelial cell dysfunction, inflammation, and tubular cell damage. Several lines of evidence suggest a potential anti-inflammatory effect of vitamin D in various kidney injury models. In this study, we investigated the effect of paricalcitol, a synthetic vitamin D analog, on renal inflammation in a mouse model of ischemia/reperfusion (I/R) induced acute kidney injury (AKI). Methods: Paricalcitol was administered via intraperitoneal (IP) injection at 24 h before ischemia, and then I/R was performed through bilateral clamping of the renal pedicles. Twenty-four hours after I/R, mice were sacrificed for the evaluation of injury and inflammation. Additionally, an in vitro experiment using HK-2 cells was also performed to examine the direct effect of paricalcitol on tubular cells. Results: Pre-treatment with paricalcitol attenuated functional deterioration and histological damage in I/R induced AKI, and significantly decreased tissue neutrophil and macrophage infiltration and the levels of chemokines, the pro-inflammatory cytokine interleukin-6 (IL-6), and monocyte chemoattractant protein-1 (MCP-1). It also decreased IR-induced upregulation of Toll-like receptor 4 (TLR4), and nuclear translocation of p65 subunit of NF-κB. Results from the in vitro study showed pre-treatment with paricalcitol suppressed the TNF-α-induced depletion of cytosolic IκB in HK-2 cells. Conclusion: These results demonstrate that pre-treatment with paricalcitol has a renoprotective effect in ischemic AKI, possibly by suppressing TLR4-NF-κB mediated inflammation.

  4. Inhibitory effect of a tyrosine-fructose Maillard reaction product, 2,4-bis(p-hydroxyphenyl-2-butenal on amyloid-β generation and inflammatory reactions via inhibition of NF-κB and STAT3 activation in cultured astrocytes and microglial BV-2 cells

    Directory of Open Access Journals (Sweden)

    Choi Im Seup

    2011-10-01

    Full Text Available Abstract Background Amyloidogenesis is linked to neuroinflammation. The tyrosine-fructose Maillard reaction product, 2,4-bis(p-hydroxyphenyl-2-butenal, possesses anti-inflammatory properties in cultured macrophages, and in an arthritis animal model. Because astrocytes and microglia are responsible for amyloidogenesis and inflammatory reactions in the brain, we investigated the anti-inflammatory and anti-amyloidogenic effects of 2,4-bis(p-hydroxyphenyl-2-butenal in lipopolysaccharide (LPS-stimulated astrocytes and microglial BV-2 cells. Methods Cultured astrocytes and microglial BV-2 cells were treated with LPS (1 μg/ml for 24 h, in the presence (1, 2, 5 μM or absence of 2,4-bis(p-hydroxyphenyl-2-butenal, and harvested. We performed molecular biological analyses to determine the levels of inflammatory and amyloid-related proteins and molecules, cytokines, Aβ, and secretases activity. Nuclear factor-kappa B (NF-κB DNA binding activity was determined using gel mobility shift assays. Results We found that 2,4-bis(p-hydroxyphenyl-2-butenal (1, 2, 5 μM suppresses the expression of inducible nitric oxide synthase (iNOS and cyclooxygenase-2 (COX-2 as well as the production of nitric oxide (NO, reactive oxygen species (ROS, tumor necrosis factor-α (TNF-α, and interleukin-1β (IL-1β in LPS (1 μg/ml-stimulated astrocytes and microglial BV-2 cells. Further, 2,4-bis(p-hydroxyphenyl-2-butenal inhibited the transcriptional and DNA binding activity of NF-κB--a transcription factor that regulates genes involved in neuroinflammation and amyloidogenesis via inhibition of IκB degradation as well as nuclear translocation of p50 and p65. Consistent with the inhibitory effect on inflammatory reactions, 2,4-bis(p-hydroxyphenyl-2-butenal inhibited LPS-elevated Aβ42 levels through attenuation of β- and γ-secretase activities. Moreover, studies using signal transducer and activator of transcription 3 (STAT3 siRNA and a pharmacological inhibitor showed that 2

  5. Antioxidant and Anti-Inflammatory Effects of Rhei Rhizoma and Coptidis Rhizoma Mixture on Reflux Esophagitis in Rats

    Directory of Open Access Journals (Sweden)

    O Jun Kwon

    2016-01-01

    Full Text Available The purpose of this study was to investigate the antioxidant and anti-inflammatory effects of the combined extract of Rhei rhizoma and Coptidis rhizoma (RC-mix in experimental model of acute reflux esophagitis. The antioxidant activity was assessed by in vitro 2,2-diphenyl-1-picrylhydrazyl (DPPH and 2,2′-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid (ABTS assays. RC-mix was given at 100, 200, and 400 mg/kg body weight 2 h prior to induction of reflux esophagitis (RE. After 5 h, the effects of RC-mix treated rats were compared with those of normal and control rats. The representative flavonoid contents of RC-mix, such as sennoside A, epiberberine, coptisine, palmatine, and berberine, were detected using HPLC. The elevated esophageal mucosa damage was markedly ameliorated by RC-mix treatment in a dose-dependent manner. Furthermore, the administration of RC-mix reduced the increase of serum reactive oxygen species (ROS and peroxynitrite (ONOO−. The improvement of superoxide dismutase (SOD and heme oxygenase-1 (HO-1 levels were marked in the group given RC-mix. Moreover, the elevation of inflammatory mediators and cytokines by nuclear factor-kappa B (NF-κB activation in control rats decreased by RC-mix pretreatment. These results indicate that RC-mix treatment reduces the pathological states of esophagitis via regulating NF-κB mediated inflammation related to oxidative stress.

  6. Transcriptional control by NF-κB: elongation in focus.

    Science.gov (United States)

    Diamant, Gil; Dikstein, Rivka

    2013-09-01

    The NF-κB family of transcription factors governs the cellular reaction to a variety of extracellular signals. Following stimulation, NF-κB activates genes involved in inflammation, cell survival, cell cycle, immune cell homeostasis and more. This review focuses on studies of the past decade that uncover the transcription elongation process as a key regulatory stage in the activation pathway of NF-κB. Of interest are studies that point to the elongation phase as central to the selectivity of target gene activation by NF-κB. Particularly, the cascade leading to phosphorylation and acetylation of the NF-κB subunit p65 on serine 276 and lysine 310, respectively, was shown to mediate the recruitment of Brd4 and P-TEFb to many pro-inflammatory target genes, which in turn facilitate elongation and mRNA processing. On the other hand, some anti-inflammatory genes are refractory to this pathway and are dependent on the elongation factor DSIF for efficient elongation and mRNA processing. While these studies have advanced our knowledge of NF-κB transcriptional activity, they have also raised unresolved issues regarding the specific genomic and physiological contexts by which NF-κB utilizes different mechanisms for activation. Copyright © 2013 Elsevier B.V. All rights reserved.

  7. Curcumin protects intestinal mucosal barrier function of rat enteritis via activation of MKP-1 and attenuation of p38 and NF-κB activation.

    Directory of Open Access Journals (Sweden)

    Wei-Bing Song

    Full Text Available BACKGROUND: Intestinal mucosa barrier (IMB dysfunction results in many notorious diseases for which there are currently few effective treatments. We studied curcumin's protective effect on IMB and examined its mechanism by using methotrexate (MTX induced rat enteritis model and lipopolysaccharide (LPS treated cell death model. METHODOLOGY/PRINCIPAL FINDINGS: Curcumin was intragastrically administrated from the first day, models were made for 7 days. Cells were treated with curcumin for 30 min before exposure to LPS. Rat intestinal mucosa was collected for evaluation of pathological changes. We detected the activities of D-lactate and diamine oxidase (DAO according to previous research and measured the levels of myeloperoxidase (MPO and superoxide dismutase (SOD by colorimetric method. Intercellular adhesion molecule-1 (ICAM-1, tumor necrosis factor α (TNF-α and interleukin 1β (IL-1β were determined by RT-PCR and IL-10 production was determined by ELISA. We found Curcumin decreased the levels of D-lactate, DAO, MPO, ICAM-1, IL-1β and TNF-α, but increased the levels of IL-10 and SOD in rat models. We further confirmed mitogen-activated protein kinase phosphatase-1 (MKP-1 was activated but phospho-p38 was inhibited by curcumin by western blot assay. Finally, NF-κB translocation was monitored by immunofluorescent staining. We showed that curcumin repressed I-κB and interfered with the translocation of NF-κB into nucleus. CONCLUSIONS/SIGNIFICANCE: The effect of curcumin is mediated by the MKP-1-dependent inactivation of p38 and inhibition of NF-κB-mediated transcription. Curcumin, with anti-inflammatory and anti-oxidant activities may be used as an effective reagent for protecting intestinal mucosa barrier and other related intestinal diseases.

  8. Kaempferol 7-O-β-D-glucoside isolated from the leaves of Cudrania tricuspidata inhibits LPS-induced expression of pro-inflammatory mediators through inactivation of NF-κB, AP-1, and JAK-STAT in RAW 264.7 macrophages.

    Science.gov (United States)

    Lee, Seung-Bin; Shin, Ji-Sun; Han, Hee-Soo; Lee, Hwi-Ho; Park, Jong Cheol; Lee, Kyung-Tae

    2018-03-25

    Kaempferol 7-O-β-D-glucoside (KPG), a natural flavonol isolated from Cudrania tricuspidata, has been reported to exert anti-cancer effects; however, its anti-inflammatory effects have not yet been reported. In this study, we demonstrate the suppressive effect of KPG on the production of nitric oxide (NO), prostaglandin E 2 (PGE 2 ), tumor necrosis factor-α (TNF-α), interleukin-1β (IL-1β), and interleukin-6 (IL-6) in lipopolysaccharide (LPS)-induced RAW 264.7 macrophages and mouse bone marrow-derived macrophages. KPG downregulated the expression of inducible nitric oxide synthase (iNOS) and cyclooxygenase-2 (COX-2) at the protein level and iNOS, COX-2, TNF-α, IL-1β, and IL-6 at the mRNA level in LPS-treated RAW 264.7 macrophages. Moreover, we elucidated the underlying molecular mechanism, demonstrating that KPG attenuated LPS-induced nuclear factor-κB (NF-κB) activation by decreasing p65 nuclear translocation, inhibiting κBα (IκBα) phosphorylation/degradation and IκB kinaseα/β (IKKα/β) phosphorylation. KPG additionally reduced LPS-induced activator protein-1 (AP-1) activity by inhibiting c-Fos expression in the nucleus, though c-Jun was not affected. Furthermore, we revealed that KPG significantly abrogated the LPS-induced phosphorylation of signal transducer and activator of transcription (STAT) 1 (Ser 727, Tyr 701) and STAT3 (Tyr 705) through inhibiting the phosphorylation of Janus kinase (JAK) 1 and JAK2, its upstream activating proteins. Taken together, our data suggest that KPG induces anti-inflammatory activity by blocking NF-κB, AP-1, and JAK-STAT signaling pathways in LPS-treated RAW 264.7 macrophages, thus suppressing inflammatory mediators. Copyright © 2018 Elsevier B.V. All rights reserved.

  9. Caffeic Acid Phenethyl Ester (Propolis Extract) Ameliorates Insulin Resistance by Inhibiting JNK and NF-κB Inflammatory Pathways in Diabetic Mice and HepG2 Cell Models.

    Science.gov (United States)

    Nie, Jiarui; Chang, Yaning; Li, Yujia; Zhou, Yingjun; Qin, Jiawen; Sun, Zhen; Li, Haibin

    2017-10-18

    Caffeic acid phenethyl ester (CAPE), extracted from propolis, was evaluated for the ameliorative effects on insulin resistance and the mechanisms were identified, using non-insulin-dependent diabetes mellitus (NIDDM) model mice and insulin resistance (IR) model cells. After 5 weeks of CAPE supplementation, insulin sensitivity, hyperlipidemia, and peroxisome proliferator-activated receptor-α (PPAR-α) levels were improved in mice. Proinflammatory cytokines in serum and the expressions of tumor necrosis factor-alpha (TNF-α) mRNA in tissues were markedly downregulated from CAPE-treated mice. In vitro, CAPE supplement significantly improved glucose consumption, glucose uptake, glycogen content, and oxidative stress and decreased expression of glucose-6-phosphatase (G6Pase) mRNA in cells. Both in vivo and in vitro, CAPE enhanced p-Akt (Ser473) and p-insulin receptor substrate (IRS)-1 (Tyr612), but inhibited p-JNK (Thr183/Tyr185), p-NF-κB p65 (Ser536), and nuclear translocation of p-NF-κB p65 (Ser536). In summary, CAPE can ameliorate insulin resistance through modulation of JNK and NF-κB signaling pathway in mice and HepG2 cells.

  10. Regulation of Fn14 Receptor and NF-κB Underlies Inflammation in Meniere’s Disease

    Directory of Open Access Journals (Sweden)

    Lidia Frejo

    2017-12-01

    Full Text Available Meniere’s disease (MD is a rare disorder characterized by episodic vertigo, sensorineural hearing loss, tinnitus, and aural fullness. It is associated with a fluid imbalance between the secretion of endolymph in the cochlear duct and its reabsorption into the subarachnoid space, leading to an accumulation of endolymph in the inner ear. Epidemiological evidence, including familial aggregation, indicates a genetic contribution and a consistent association with autoimmune diseases (AD. We conducted a case–control study in two phases using an immune genotyping array in a total of 420 patients with bilateral MD and 1,630 controls. We have identified the first locus, at 6p21.33, suggesting an association with bilateral MD [meta-analysis leading signal rs4947296, OR = 2.089 (1.661–2.627; p = 1.39 × 10−09]. Gene expression profiles of homozygous genotype-selected peripheral blood mononuclear cells (PBMCs demonstrated that this region is a trans-expression quantitative trait locus (eQTL in PBMCs. Signaling analysis predicted several tumor necrosis factor-related pathways, the TWEAK/Fn14 pathway being the top candidate (p = 2.42 × 10−11. This pathway is involved in the modulation of inflammation in several human AD, including multiple sclerosis, systemic lupus erythematosus, or rheumatoid arthritis. In vitro studies with genotype-selected lymphoblastoid cells from patients with MD suggest that this trans-eQTL may regulate cellular proliferation in lymphoid cells through the TWEAK/Fn14 pathway by increasing the translation of NF-κB. Taken together; these findings suggest that the carriers of the risk genotype may develop an NF-κB-mediated inflammatory response in MD.

  11. A role for host cell exocytosis in InlB-mediated internalisation of Listeria monocytogenes.

    Science.gov (United States)

    Van Ngo, Hoan; Bhalla, Manmeet; Chen, Da-Yuan; Ireton, Keith

    2017-11-01

    The bacterial surface protein InlB mediates internalisation of Listeria monocytogenes into human cells through interaction with the host receptor tyrosine kinase, Met. InlB-mediated entry requires localised polymerisation of the host actin cytoskeleton. Apart from actin polymerisation, roles for other host processes in Listeria entry are unknown. Here, we demonstrate that exocytosis in the human cell promotes InlB-dependent internalisation. Using a probe consisting of VAMP3 with an exofacial green fluorescent protein tag, focal exocytosis was detected during InlB-mediated entry. Exocytosis was dependent on Met tyrosine kinase activity and the GTPase RalA. Depletion of SNARE proteins by small interfering RNA demonstrated an important role for exocytosis in Listeria internalisation. Depletion of SNARE proteins failed to affect actin filaments during internalisation, suggesting that actin polymerisation and exocytosis are separable host responses. SNARE proteins were required for delivery of the human GTPase Dynamin 2, which promotes InlB-mediated entry. Our results identify exocytosis as a novel host process exploited by Listeria for infection. © 2017 John Wiley & Sons Ltd.

  12. Inflammatory factor TNF-α promotes the growth of breast cancer via the positive feedback loop of TNFR1/NF-κB (and/or p38)/p-STAT3/HBXIP/TNFR1.

    Science.gov (United States)

    Cai, Xiaoli; Cao, Can; Li, Jiong; Chen, Fuquan; Zhang, Shuqin; Liu, Bowen; Zhang, Weiying; Zhang, Xiaodong; Ye, Lihong

    2017-08-29

    In the connection between inflammation and cancer development, tumor necrosis factor-alpha (TNF-α) contributes to the tumorigenesis. However, the underlying mechanism remains poorly understood. In this study, we report that TNF-α enhances the growth of breast cancer through up-regulation of oncoprotein hepatitis B X-interacting protein (HBXIP). Our data showed that the levels of TNF-α were positively related to those of HBXIP in clinical breast cancer tissues. Moreover, TNF-α could up-regulate HBXIP in breast cancer cells. Interestingly, silencing of TNF-α receptor 1 (TNFR1) blocked the effect of TNF-α on HBXIP. Mechanistically, we revealed that TNF-α could increase the activities of HBXIP promoter through activating transcriptional factor signal transducer and activator of transcription 3 (STAT3). In addition, nuclear factor kappa B (NF-κB) and/or p38 signaling increased the levels of p-STAT3 in the cells. Strikingly, HBXIP could also up-regulate TNFR1, forming a positive feedback loop of TNFR1/NF-κB (and/or p38)/p-STAT3/HBXIP/TNFR1. Notably, TNF-α was able to up-regulate TNFR1 through driving the loop. In function, we demonstrated that the knockdown of HBXIP remarkably abolished the growth of breast cancer mediated by TNF-α in vitro and in vivo . Thus, we conclude that TNF-α promotes the growth of breast cancer through the positive feedback loop of TNFR1/NF-κB (and/or p38)/p-STAT3/HBXIP/TNFR1.Our finding provides new insights into the mechanism by which TNF-α drives oncoprotein HBXIP in the development of breast cancer.

  13. Neurofascin (NF155- and NF186-Specific T Cell Response in a Patient Developing a Central Pontocerebellar Demyelination after 10 Years of CIDP

    Directory of Open Access Journals (Sweden)

    Juliane Klehmet

    2017-12-01

    Full Text Available BackgroundInformation and pathobiological understanding about central demyelinating manifestation in patients, who primarily suffer from chronic inflammatory demyelinating polyneuropathy (CIDP, are scarce.MethodsIFN-γ-response as well as antibodies against the (paranodal antigens neurofascin (NF155 and NF 186 had been tested by Elispot assay and ELISA before clinical manifestation and at follow-up.Case description and resultsThe patient described here developed a subacute brainstem syndrome more than 10 years after diagnosis of CIDP under low-dose maintenance treatment of intravenous immunoglobulins (IVIG. MRI revealed enhancing right-sided pontocerebellar lesion. CSF examination showed mild pleocytosis and elevated protein, and negative oligoclonal bands. Further diagnostics exclude differential diagnoses such as tuberculoma, sarcoidosis, or metastasis. Specific IFN-γ response against NF155 and NF186 as measured by Elispot assay was elevated before clinical manifestation. NF155 and NF186 antibodies were negative. Escalation of IVIG treatment at 2 g/kg BW followed by 1.4 g/kg BW led to clinical remission albeit to a new asymptomatic central lesion. Follow-up NF155 and NF186-Elispot turned negative.ConclusionThe case reported here with a delayed central manifestation after an initially typical CIDP and NF155 and NF186 T cell responses does not resemble described cases of combined central and peripheral demyelination but may reflect a novel subtype within the great clinical heterogeneity of CIDP.

  14. Anti-Inflammatory Effects of Flavonoids: Genistein, Kaempferol, Quercetin, and Daidzein Inhibit STAT-1 and NF-κB Activations, Whereas Flavone, Isorhamnetin, Naringenin, and Pelargonidin Inhibit only NF-κB Activation along with Their Inhibitory Effect on iNOS Expression and NO Production in Activated Macrophages

    Directory of Open Access Journals (Sweden)

    Mari Hämäläinen

    2007-01-01

    The present study characterises the effects and mechanisms of naturally occurring phenolic compounds on iNOS expression and NO production in activated macrophages. The results partially explain the pharmacological efficacy of flavonoids as anti-inflammatory compounds.

  15. Acute desensitization of presynaptic GABA(B)-mediated inhibition and induction of epileptiform discharges in the neonatal rat hippocampus

    NARCIS (Netherlands)

    Tosetti, P; Bakels, R; Colin-Le Brun, [No Value; Ferrand, N; Gaiarsa, JL; Caillard, O

    The consequences of sustained activation of GABA(B) receptors on GABA(B)-mediated inhibition and network activity were investigated in the neonatal rat hippocampus using whole-cell and extracellular field recordings. GABA(B)-mediated presynaptic control of gamma-aminobutyric acid (GABA) release

  16. Post-Translational Modifications of RelB NF-κB Subunit and Associated Functions

    Directory of Open Access Journals (Sweden)

    Véronique Baud

    2016-05-01

    Full Text Available The family of NF-κB transcription factors plays a key role in diverse biological processes, such as inflammatory and immune responses, cell survival and tumor development. Beyond the classical NF-κB activation pathway, a second NF-κB pathway has more recently been uncovered, the so-called alternative NF-κB activation pathway. It has been shown that this pathway mainly controls the activity of RelB, a member of the NF-κB family. Post-translational modifications, such as phosphorylation, acetylation, methylation, ubiquitination and SUMOylation, have recently emerged as a strategy for the fine-tuned regulation of NF-κB. Our review discusses recent progress in the understanding of RelB regulation by post-translational modifications and the associated functions in normal and pathological conditions.

  17. Subversion of innate immune responses by bacterial hindrance of NF-κB pathway.

    Science.gov (United States)

    Le Negrate, Gaëlle

    2012-02-01

    Bacterial infections cause substantial mortality and burden of disease globally. Induction of a strong innate inflammatory response is the first common host mechanism required for elimination of the invading pathogens. The host transcription factor, nuclear factor kappa B (NF-κB) is essential for immune activation. Conversely, bacterial pathogens have evolved strategies to interfere directly with host cell signalling by regulating or mimicking host proteins. Given the key role of NF-κB in the host inflammatory response, bacteria have expectedly developed virulence effectors interfering with NF-κB signalling pathways. In this review, we explore the bacterial mechanisms utilized to prevent effective NF-κB signalling, which in turn usurp the host inflammatory response. © 2011 Blackwell Publishing Ltd.

  18. Dynamic protein complexes regulate NF-kappaB signaling.

    Science.gov (United States)

    Wegener, E; Krappmann, D

    2008-01-01

    NF-kappaB is a major regulator of the first-line defense against invading pathogens, antigen-specific adaptive immune responses or chemical stress. Stimulation either by extracellular ligands (e.g., inflammatory cytokines, microbial pathogens, peptide antigens) or by intracellular Stressors (e.g., genotoxic drugs) initiates signal-specific pathways that all converge at the IkappaB kinase (IKK) complex, the gatekeeper for NF-kappaB activation. During recent years, considerable progress has been made in understanding the function of NF-kappaB in the regulation of cell growth, survival and apoptosis. In this review, we will focus on the regulation of large signaling complexes on the route to NF-kappaB. Recently published data demonstrate that the assembly, maintenance and activity of the IKK complex determine downstream activation of NF-kappaB. In addition, dynamic complexes upstream of IKK are formed in response to tumor necrosis factor (TNF), antigenic peptides or DNA-damaging agents. Clustering of signaling adaptors promotes the association and activation of ubiquitin ligases that trigger the conjugation of regulatory ubiquitin to target proteins. Ubiquitination serves as a platform to recruit the IKK complex and potentially other protein kinases to trigger IKK activation. These findings support a concept whereby protein complex assembly induces regulatory ubiquitination, which in turn recruits and activates protein kinases. Notably, the great interest in a detailed description of the mechanisms that regulate NF-kappaB activity stems from many observations that link dysregulated NF-kappaB signaling with the onset or progression of various diseases, including cancer, chronic inflammation, cardiovascular disorders and neurodegenerative diseases. Thus, the formation of large signaling clusters and regulatory ubiquitin chains represents promising targets for pharmacological intervention to modulate NF-kappaB signal transduction in disease.

  19. Bio modulation of transcriptional factor NF-kB by ionizing radiation; Biomodulation du facteur de transcription NF-kB par les radiations ionisantes

    Energy Technology Data Exchange (ETDEWEB)

    Magne, N.; Van Houtte, P. [Institut Jules-Bordet, Dept. de Radiotherapie, Bruxelles (Belgium); Mange, N.; Toillon, R.A. [Institut Jules-Bordet, Lab. de Cancerologie Mammaire, Bruxelles (Belgium); Didelot, C. [Universite Libre de Bruxelles, Lab. de Virologie Moleculaire (Belgium); Peyron, J.F. [Faculte de Medecine, INSERM U526, 06 - Nice (France)

    2004-10-01

    NF-{kappa}B (Nuclear Factor -{kappa}B) was described for the first time in 1986 as a nuclear protein binding to the kappa immunoglobulin-light chain enhancer. Since then, NF-{kappa}B has emerged as an ubiquitous factor involved in the regulation of numerous important processes as diverse as immune and inflammatory responses, apoptosis and cell proliferation. These last two properties explain the implication of NF-{kappa}B in the tumorigenic process as well as the promise of a targeted therapeutic intervention. This review focuses on the current knowledge on NF-{kappa}B regulation and discusses the therapeutic potential of targeting NF-{kappa}B in cancer in particular during radiotherapy. (authors)

  20. Mycobacterium tuberculosis Rv3402c enhances mycobacterial survival within macrophages and modulates the host pro-inflammatory cytokines production via NF-kappa B/ERK/p38 signaling.

    Directory of Open Access Journals (Sweden)

    Wu Li

    Full Text Available Intracellular survival plays a central role in the pathogenesis of Mycobacterium tuberculosis, a process which depends on an array of virulence factors to colonize and replicate within the host. The M. tuberculosis iron regulated open reading frame (ORF rv3402c, encoding a conserved hypothetical protein, was shown to be up-regulated upon infection in both human and mice macrophages. To explore the function of this ORF, we heterologously expressed the rv3402c gene in the non-pathogenic fast-growing Mycobacterium smegmatis strain, and demonstrated that Rv3402c, a cell envelope-associated protein, was able to enhance the intracellular survival of recombinant M. smegmatis. Enhanced growth was not found to be the result of an increased resistance to intracellular stresses, as growth of the Rv3402c expressing strain was unaffected by iron depletion, H2O2 exposure, or acidic conditions. Colonization of macrophages by M. smegmatis expressing Rv3402c was associated with substantial cell death and significantly greater amount of TNF-α and IL-1β compared with controls. Rv3402c-induced TNF-α and IL-1β production was found to be mediated by NF-κB, ERK and p38 pathway in macrophages. In summary, our study suggests that Rv3402c delivered in a live M. smegmatis vehicle can modify the cytokines profile of macrophage, promote host cell death and enhance the persistence of mycobacterium within host cells.

  1. The involvement of NF-κB in PDT-induced death of crayfish glial and nerve cells

    Science.gov (United States)

    Berezhnaya, E. V.; Neginskaya, M. A.; Kovaleva, V. D.; Rudkovskii, M. V.; Uzdensky, A. B.

    2015-03-01

    Photodynamic therapy (PDT) is used for selective destruction of cells, in particular, for treatment of brain tumors. However, photodynamic treatment damages not only tumor cells, but also healthy neurons and glial cells. To study the possible role of NF-κB in photodynamic injury of neurons and glial cells, we investigated the combined effect of photodynamic treatment and NF-κB modulators: activator betulinic acid, or inhibitors parthenolide and CAPE on an isolated crayfish stretch receptor consisting of a single neuron surrounded by glial cells. A laser diode (670 nm, 0.4 W/cm2) was used as a light source. The inhibition of NF-κB during PDT increased the duration of neuron firing and glial necrosis and decreased neuron necrosis and glial apoptosis. The activation of NF-κB during PDT increased neuron necrosis and glial apoptosis and decreased glial necrosis. The difference between the effects of NF-κB modulators on photosensitized neurons and glial cells indicates the difference in NF-κB-mediated signaling pathways in these cell types. Thus, NF-κB is involved in PDT-induced shortening of neuron firing, neuronal and glial necrosis, and apoptosis of glial cells.

  2. Evolutionary conserved regulation of HIF-1β by NF-κB.

    Directory of Open Access Journals (Sweden)

    Patrick van Uden

    2011-01-01

    Full Text Available Hypoxia Inducible Factor-1 (HIF-1 is essential for mammalian development and is the principal transcription factor activated by low oxygen tensions. HIF-α subunit quantities and their associated activity are regulated in a post-translational manner, through the concerted action of a class of enzymes called Prolyl Hydroxylases (PHDs and Factor Inhibiting HIF (FIH respectively. However, alternative modes of HIF-α regulation such as translation or transcription are under-investigated, and their importance has not been firmly established. Here, we demonstrate that NF-κB regulates the HIF pathway in a significant and evolutionary conserved manner. We demonstrate that NF-κB directly regulates HIF-1β mRNA and protein. In addition, we found that NF-κB-mediated changes in HIF-1β result in modulation of HIF-2α protein. HIF-1β overexpression can rescue HIF-2α protein levels following NF-κB depletion. Significantly, NF-κB regulates HIF-1β (tango and HIF-α (sima levels and activity (Hph/fatiga, ImpL3/ldha in Drosophila, both in normoxia and hypoxia, indicating an evolutionary conserved mode of regulation. These results reveal a novel mechanism of HIF regulation, with impact in the development of novel therapeutic strategies for HIF-related pathologies including ageing, ischemia, and cancer.

  3. Evolutionary conserved regulation of HIF-1β by NF-κB.

    Science.gov (United States)

    van Uden, Patrick; Kenneth, Niall S; Webster, Ryan; Müller, H Arno; Mudie, Sharon; Rocha, Sonia

    2011-01-27

    Hypoxia Inducible Factor-1 (HIF-1) is essential for mammalian development and is the principal transcription factor activated by low oxygen tensions. HIF-α subunit quantities and their associated activity are regulated in a post-translational manner, through the concerted action of a class of enzymes called Prolyl Hydroxylases (PHDs) and Factor Inhibiting HIF (FIH) respectively. However, alternative modes of HIF-α regulation such as translation or transcription are under-investigated, and their importance has not been firmly established. Here, we demonstrate that NF-κB regulates the HIF pathway in a significant and evolutionary conserved manner. We demonstrate that NF-κB directly regulates HIF-1β mRNA and protein. In addition, we found that NF-κB-mediated changes in HIF-1β result in modulation of HIF-2α protein. HIF-1β overexpression can rescue HIF-2α protein levels following NF-κB depletion. Significantly, NF-κB regulates HIF-1β (tango) and HIF-α (sima) levels and activity (Hph/fatiga, ImpL3/ldha) in Drosophila, both in normoxia and hypoxia, indicating an evolutionary conserved mode of regulation. These results reveal a novel mechanism of HIF regulation, with impact in the development of novel therapeutic strategies for HIF-related pathologies including ageing, ischemia, and cancer.

  4. Andrographolide Activates Keap1/Nrf2/ARE/HO-1 Pathway in HT22 Cells and Suppresses Microglial Activation by Aβ42 through Nrf2-Related Inflammatory Response.

    Science.gov (United States)

    Seo, Ji Yeon; Pyo, Euisun; An, Jin-Pyo; Kim, Jinwoong; Sung, Sang Hyun; Oh, Won Keun

    2017-01-01

    Therapeutic approach of Alzheimer's disease (AD) has been gradually diversified. We examined the therapeutic and preventive potential of andrographolide, which is a lactone diterpenoid from Andrographis paniculata , and focused on the Kelch-like ECH-associated protein 1 (Keap1)/nuclear factor (erythroid-derived 2)-like 2 (Nrf2)-mediated heme oxygenase (HO)-1-inducing effects and the inhibitory activity of amyloid beta (A β ) 42 -induced microglial activation related to Nrf2 and nuclear factor κ B (NF- κ B)-mediated inflammatory responses. Andrographolide induced the expression and translocation of Nrf2 from the cytoplasm to the nucleus, thereby activating antioxidant response element (ARE) gene transcription and HO-1 expression in murine hippocampal HT22 cells. Andrographolide eliminated intracellular A β 42 in BV-2 cells and decreased the production of interleukin (IL)-6, IL-1 β , prostaglandin (PG)E 2 , and nitric oxide (NO) because of artificial phagocytic A β 42 . It decreased pNF- κ B accumulation in the nucleus and the expression of inducible nitric oxide synthase (i-NOS) and cyclooxygenase II (COX-II) in the microglial BV-2 cell line. In summary, andrographolide activates Nrf2-mediated HO-1 expression and inhibits A β 42 -overexpressed microglial BV-2 cell activation. These results suggested that andrographolide might have the potential for further examination of the therapeutics of AD.

  5. Andrographolide Activates Keap1/Nrf2/ARE/HO-1 Pathway in HT22 Cells and Suppresses Microglial Activation by Aβ42 through Nrf2-Related Inflammatory Response

    Directory of Open Access Journals (Sweden)

    Ji Yeon Seo

    2017-01-01

    Full Text Available Therapeutic approach of Alzheimer’s disease (AD has been gradually diversified. We examined the therapeutic and preventive potential of andrographolide, which is a lactone diterpenoid from Andrographis paniculata, and focused on the Kelch-like ECH-associated protein 1 (Keap1/nuclear factor (erythroid-derived 2-like 2 (Nrf2-mediated heme oxygenase (HO-1-inducing effects and the inhibitory activity of amyloid beta (Aβ42-induced microglial activation related to Nrf2 and nuclear factor κB (NF-κB-mediated inflammatory responses. Andrographolide induced the expression and translocation of Nrf2 from the cytoplasm to the nucleus, thereby activating antioxidant response element (ARE gene transcription and HO-1 expression in murine hippocampal HT22 cells. Andrographolide eliminated intracellular Aβ42 in BV-2 cells and decreased the production of interleukin (IL-6, IL-1β, prostaglandin (PGE2, and nitric oxide (NO because of artificial phagocytic Aβ42. It decreased pNF-κB accumulation in the nucleus and the expression of inducible nitric oxide synthase (i-NOS and cyclooxygenase II (COX-II in the microglial BV-2 cell line. In summary, andrographolide activates Nrf2-mediated HO-1 expression and inhibits Aβ42-overexpressed microglial BV-2 cell activation. These results suggested that andrographolide might have the potential for further examination of the therapeutics of AD.

  6. Bee venom ameliorates lipopolysaccharide-induced memory loss by preventing NF-kappaB pathway

    OpenAIRE

    Gu, Sun Mi; Park, Mi Hee; Hwang, Chul Ju; Song, Ho Sueb; Lee, Ung Soo; Han, Sang Bae; Oh, Ki Wan; Ham, Young Wan; Song, Min Jong; Son, Dong Ju; Hong, Jin Tae

    2015-01-01

    Background Accumulation of beta-amyloid and neuroinflammation trigger Alzheimer?s disease. We previously found that lipopolysaccharide (LPS) caused neuroinflammation with concomitant accumulation of beta-amyloid peptides leading to memory loss. A variety of anti-inflammatory compounds inhibiting nuclear factor kappaB (NF-?B) activation have showed efficacy to hinder neuroinflammation and amyloidogenesis. We also found that bee venom (BV) inhibits NF-?B. Methods A mouse model of LPS-induced me...

  7. Modulation of the NF-kappaB pathway by Bordetella pertussis filamentous hemagglutinin.

    Directory of Open Access Journals (Sweden)

    Tzvia Abramson

    Full Text Available Filamentous hemagglutinin (FHA is a cell-associated and secreted adhesin produced by Bordetella pertussis with pro-apoptotic and pro-inflammatory activity in host cells. Given the importance of the NF-kappaB transcription factor family in these host cell responses, we examined the effect of FHA on NF-kappaB activation in macrophages and bronchial epithelial cells, both of which are relevant cell types during natural infection.Exposure to FHA of primary human monocytes and transformed U-937 macrophages, but not BEAS-2B epithelial cells, resulted in early activation of the NF-kappaB pathway, as manifested by the degradation of cytosolic IkappaB alpha, by NF-kappaB DNA binding, and by the subsequent secretion of NF-kappaB-regulated inflammatory cytokines. However, exposure of macrophages and human monocytes to FHA for two hours or more resulted in the accumulation of cytosolic IkappaB alpha, and the failure of TNF-alpha to activate NF-kappaB. Proteasome activity was attenuated following exposure of cells to FHA for 2 hours, as was the nuclear translocation of RelA in BEAS-2B cells.These results reveal a complex temporal dynamic, and suggest that despite short term effects to the contrary, longer exposures of host cells to this secreted adhesin may block NF-kappaB activation, and perhaps lead to a compromised immune response to this bacterial pathogen.

  8. Neuronal RING finger protein 11 (RNF11 regulates canonical NF-κB signaling

    Directory of Open Access Journals (Sweden)

    Pranski Elaine L

    2012-04-01

    Full Text Available Abstract Background The RING domain-containing protein RING finger protein 11 (RNF11 is a member of the A20 ubiquitin-editing protein complex and modulates peripheral NF-κB signaling. RNF11 is robustly expressed in neurons and colocalizes with a population of α-synuclein-positive Lewy bodies and neurites in Parkinson disease patients. The NF-κB pathway has an important role in the vertebrate nervous system, where the absence of NF-κB activity during development can result in learning and memory deficits, whereas chronic NF-κB activation is associated with persistent neuroinflammation. We examined the functional role of RNF11 with respect to canonical NF-κB signaling in neurons to gain understanding of the tight association of inflammatory pathways, including NF-κB, with the pathogenesis of neurodegenerative diseases. Methods and results Luciferase assays were employed to assess NF-κB activity under targeted short hairpin RNA (shRNA knockdown of RNF11 in human neuroblastoma cells and murine primary neurons, which suggested that RNF11 acts as a negative regulator of canonical neuronal NF-κB signaling. These results were further supported by analyses of p65 translocation to the nucleus following depletion of RNF11. Coimmunoprecipitation experiments indicated that RNF11 associates with members of the A20 ubiquitin-editing protein complex in neurons. Site-directed mutagenesis of the myristoylation domain, which is necessary for endosomal targeting of RNF11, altered the impact of RNF11 on NF-κB signaling and abrogated RNF11’s association with the A20 ubiquitin-editing protein complex. A partial effect on canonical NF-κB signaling and an association with the A20 ubiquitin-editing protein complex was observed with mutagenesis of the PPxY motif, a proline-rich region involved in Nedd4-like protein interactions. Last, shRNA-mediated reduction of RNF11 in neurons and neuronal cell lines elevated levels of monocyte chemoattractant protein 1 and

  9. Sequestration of NF-kappaB signaling complexes in lipid rafts contributes to repression of NF-kappaB in T lymphocytes under hyperthermia stress.

    Science.gov (United States)

    Yan, Guang; Huang, Jiannan; Jarbadan, Nancy Ruth; Jiang, Yixing; Cheng, Hua

    2008-05-02

    Sepsis causes extensive apoptosis of lymphocytes, a pathological condition that is frequently associated with hyperthermia. Heat stress has been implicated to repress the activation of an inflammatory mediator, nuclear factor of kappaB (NF-kappaB), which sensitizes cells to apoptosis mediated by inflammatory cytokine, tumor necrosis factor alpha. However, the molecular mechanism of hyperthermia-associated loss of T cells remains unclear. We show that hyperthermia causes rapid translocation of IkappaB kinase (IKK) and NF-kappaB complexes into the plasma membrane-associated lipid rafts in T cells. Heat stress induces aggregation of Carma1 in lipid rafts, which in turn recruits protein kinase C theta (PKC theta) and Bcl10 to the microdomains, causing subsequent membrane translocation of the IKK and NF-kappaB signalosomes. Depletion of Carma1 and inhibition of PKC theta impair accumulation of NF-kappaB complexes in lipid rafts. Heat stress prohibits IkappaB kinase activity by sequestrating the IKK and NF-kappaB complexes in lipid rafts and by segregating the chaperone protein Hsp90, an essential cofactor for IKK, from the IKK complex. This process ultimately results in functional deficiency of NF-kappaB and renders T cells resistant to tumor necrosis factor alpha-induced activation of IKK, thereby contributing to the apoptotic loss of T lymphocytes in sepsis-associated hyperthermia.

  10. Vinpocetine Ameliorates Acetic Acid-Induced Colitis by Inhibiting NF-κB Activation in Mice.

    Science.gov (United States)

    Colombo, Bárbara B; Fattori, Victor; Guazelli, Carla F S; Zaninelli, Tiago H; Carvalho, Thacyana T; Ferraz, Camila R; Bussmann, Allan J C; Ruiz-Miyazawa, Kenji W; Baracat, Marcela M; Casagrande, Rúbia; Verri, Waldiceu A

    2018-04-10

    The idiopathic inflammatory bowel diseases (IBD) comprise two types of chronic intestinal disorders: Crohn's disease and ulcerative colitis. Recruited neutrophils and macrophages contribute to intestinal tissue damage via production of ROS and NF-κB-dependent pro-inflammatory cytokines. The introduction of anti-TNF-α therapies in the treatment of IBD patients was a seminal advance. This therapy is often limited by a loss of efficacy due to the development of adaptive immune response, underscoring the need for novel therapies targeting similar pathways. Vinpocetine is a nootropic drug and in addition to its antioxidant effect, it is known to have anti-inflammatory and analgesic properties, partly by inhibition of NF-κB and downstream cytokines. Therefore, the present study evaluated the effect of the vinpocetine in a model of acid acetic-induced colitis in mice. Treatment with vinpocetine reduced edema, MPO activity, microscopic score and macroscopic damage, and visceral mechanical hyperalgesia. Vinpocetine prevented the reduction of colonic levels of GSH, ABTS radical scavenging ability, and normalized levels of anti-inflammatory cytokine IL-10. Moreover, vinpocetine reduced NF-κB activation and thereby NF-κB-dependent pro-inflammatory cytokines IL-1β, TNF-α, and IL-33 in the colon. Thus, we demonstrate for the first time that vinpocetine has anti-inflammatory, antioxidant, and analgesic effects in a model of acid acetic-induced colitis in mice and deserves further screening to address its suitability as an approach for the treatment of IBD.

  11. Gelam Honey Attenuates Carrageenan-Induced Rat Paw Inflammation via NF-κB Pathway

    Science.gov (United States)

    Hussein, Saba Zuhair; Mohd Yusoff, Kamaruddin; Makpol, Suzana; Mohd Yusof, Yasmin Anum

    2013-01-01

    The activation of nuclear factor kappa B (NF-κB) plays a major role in the pathogenesis of a number of inflammatory diseases. In this study, we investigated the anti-inflammatory mechanism of Gelam honey in inflammation induced rats via NF-κB signalling pathway. Rats paw edema was induced by subplantar injection of 1% carrageenan into the right hind paw. Rats were pre-treated with Gelam honey at different doses (1 or 2 g/kg, p.o.) and NSAID Indomethacin (10 mg/kg, p.o.), in two time points (1 and 7 days). Our results showed that Gelam honey at both concentrations suppressed the gene expressions of NF-κB (p65 & p50) and IκBα in inflamed rats paw tissues. In addition, Gelam honey inhibited the nuclear translocation and activation of NF-κB and decreased the cytosolic degradation of IκBα dose dependently in inflamed rats paw tissues. The immunohistochemical expressions of pro-inflammatory mediators COX-2 and TNF-α were also decreased in inflamed rats paw tissues when treated with Gelam honey. The results of our findings suggest that Gelam honey exhibits its inhibitory effects by attenuating NF-κB translocation to the nucleus and inhibiting IκBα degradation, with subsequent decrease of inflammatory mediators COX-2 and TNF-α. PMID:24015236

  12. NF-κB regulates protein quality control after heat stress through modulation of the BAG3-HspB8 complex.

    Science.gov (United States)

    Nivon, Mathieu; Abou-Samra, Michel; Richet, Emma; Guyot, Boris; Arrigo, André-Patrick; Kretz-Remy, Carole

    2012-03-01

    We previously found that the NF-κB transcription factor is activated during the recovery period after heat shock; moreover, we demonstrated that NF-κB is essential for cell survival after heat shock by activating autophagy, a mechanism that probably helps the cell to cope with hyperthermic stress through clearance of damaged proteins. In this study, we analyze the involvement of NF-κB in basal and heat-stress-induced protein quality control, by comparing the level of multiubiquitylated and/or aggregated proteins, and proteasome and autophagic activity in NF-κB-competent and NF-κB-incompetent cells. We show that NF-κB has only a minor role in basal protein quality control, where it modulates autophagosome maturation. By contrast, NF-κB is shown to be a key player in protein quality control after hyperthermia. Indeed, NF-κB-incompetent cells show highly increased levels of multiubiquitylated and/or aggregated proteins and aggresome clearance defects; a phenotype that disappears when NF-κB activity is restored to normal. We demonstrate that during heat shock recovery NF-κB activates selective removal of misfolded or aggregated proteins--a process also called 'aggrephagy'--by controlling the expression of BAG3 and HSPB8 and by modulating the level of the BAG3-HspB8 complex. Thus NF-κB-mediated increase in the level of the BAG3-HspB8 complex leads to upregulation of aggrephagy and clearance of irreversibly damaged proteins and might increase cell survival in conditions of hyperthermia.

  13. Colorectal cancer: can nutrients modulate NF-kappaB and apoptosis?

    Science.gov (United States)

    Ravasco, Paula; Aranha, Márcia M; Borralho, Pedro M; Moreira da Silva, Isabel B; Correia, Luís; Fernandes, Afonso; Rodrigues, Cecília M P; Camilo, Maria

    2010-02-01

    NF-kappaB may promote carcinogenesis by altering cell cycle, inflammatory responses and apoptosis-related gene expression, though cell mechanisms relating diet and colorectal cancer (CRC) remain unveiled in humans. This study in patients with CRC aimed to explore potential interactions between the dietary pattern, nutrient intake, expression of NF-kappaB, apoptosis and tumour histological aggressiveness. Usual diet was assessed by diet history; nutrient composition was determined by DIETPLAN software. Histologically classified patient tissue samples (adenoma, adenocarcinoma and normal surrounding mucosa) were obtained via biopsies during colonoscopy (n=16) or surgery (n=8). NF-kappaB expression was determined by immunohistochemistry and apoptosis by TUNEL assay. NF-kappaB expression and apoptosis were higher in tumours (p<0.01), greater along with histological aggressiveness (p<0.01). Highest intake terciles of animal protein, refined carbohydrates, saturated fat, n-6 fatty acids and alcohol were associated with higher NF-kappaB, apoptosis and histological aggressiveness (p<0.01); the opposite tissue characteristics were associated with highest intake terciles of n-3 fatty acids, fibre, vitamin E, flavonoids, isoflavones, beta-carotene and selenium (p<0.002). Additionally, higher n-6:n-3 fatty acids ratio (median 26:1) was associated with higher NF-kappaB (p<0.006) and apoptosis (p<0.01), and more aggressive histology (p<0.01). Conversely, lower n-6:n-3 fatty acids ratio (median 6:1) was associated with lower NF-kappaB (p<0.002) and apoptosis (p<0.002), and less aggressive histology (p<0.002). NF-kappaB expression and apoptosis increased from adenoma to poorly differentiated adenocarcinoma. This degenerative transition, recognized as key in carcinogenesis, appear to have been influenced by a diet promoting a pro-inflammatory milieu that can trigger NF-kappaB. Copyright 2009 Elsevier Ltd and European Society for Clinical Nutrition and Metabolism. All rights reserved.

  14. Emodin attenuates high glucose-induced TGF-β1 and fibronectin expression in mesangial cells through inhibition of NF-κB pathway

    Energy Technology Data Exchange (ETDEWEB)

    Yang, Jie [Department of Pharmacology, School of Pharmacy, Guangxi Medical University, Nanning, Guangxi (China); Zeng, Zhi [Department of Physiology, School of Basic Courses, Guangdong Pharmaceutical University, Guangzhou, Guangdong (China); Wu, Teng [Vascular Biology Research Institute, Guangdong Pharmaceutical University, Guangzhou (China); Yang, Zhicheng [Department of Pharmacology, School of Pharmaceutical Science, Guangdong Pharmaceutical University, Guangzhou, Guangdong (China); Liu, Bing, E-mail: liubing52000@163.com [Department of Pharmacology, School of Pharmaceutical Science, Guangdong Pharmaceutical University, Guangzhou, Guangdong (China); Lan, Tian, E-mail: lantiansci@yahoo.com [Vascular Biology Research Institute, Guangdong Pharmaceutical University, Guangzhou (China)

    2013-12-10

    The activation of nuclear factor-κB (NF-κB) and the subsequent overexpression of its downstream targets transforming growth factor-β1 (TGF-β1) and fibronectin (FN) are among the hallmarks for the progressive diabetic nephropathy. Our previous studies demonstrated that emodin ameliorated renal injury and inhibited extracellular matrix accumulation in kidney and mesangial cells under diabetic condition. However, the molecular mechanism has not been fully elucidated. Here, we showed that emodin significantly attenuated high glucose-induced NF-κB nuclear translocation in mesangial cells. Interestingly, emodin also inhibited the DNA-binding activity and transcriptional activity of NF-κB. Furthermore, NF-κB-mediated TGF-β1 and FN expression was significantly decreased by emodin. These results demonstrated that emodin suppressed TGF-β1 and FN overexpression through inhibition of NF-κB activation, suggesting that emodin-mediated inhibition of the NF-κB pathway could protect against diabetic nephropathy. - Highlights: • Emodin decreased high glucose-induced p65 phosphorylation in MCs. • Emodin decreased high glucose-induced IκB-α degradation in MCs. • Emodin decreased high glucose-induced p65 translocation in MCs. • Emodin blocked high glucose-induced NF-κB activity. • Emodin blocked high glucose-induced the expression of TGF-β1 and FN.

  15. NF-kappaB modulation and ionizing radiation: mechanisms and future directions for cancer treatment.

    Science.gov (United States)

    Magné, Nicolas; Toillon, Robert-Alain; Bottero, Virginie; Didelot, Céline; Houtte, Paul Van; Gérard, Jean-Pierre; Peyron, Jean-François

    2006-01-18

    NF-kappaB transcription factor regulates important cellular processes ranging from establishment of the immune and inflammatory responses to regulation of cell proliferation or apoptosis, through the induction of a large array of target genes. NF-kappaB is now considered as an important actor in the tumorigenic process mainly because it exerts strong anti-apoptotic functions in cancer cells. NF-kappaB is triggered by chimio- and radio-therapeutic strategies that are intended to eliminate cancerous cells through induction of apoptosis. Numerous studies have demonstrated that inhibition of NF-kappaB by different means increased sensitivity of cancer cells to the apoptotic action of diverses effectors such as TNFalpha or chemo- or radio-therapies. From these studies as emerged the concept that NF-kappaB blockade could be associated to conventional therapies in order to increase their efficiency. This review focuses on the current knowledge on NF-kappaB regulation and discusses the therapeutic potential of targeting NF-kappaB in cancer in particular during radiotherapy.

  16. IKKε modulates RSV-induced NF-κB-dependent gene transcription

    International Nuclear Information System (INIS)

    Bao Xiaoyong; Indukuri, Hemalatha; Liu Tianshuang; Liao Suiling; Tian, Bing; Brasier, Allan R.; Garofalo, Roberto P.; Casola, Antonella

    2010-01-01

    Respiratory syncytial virus (RSV), a negative-strand RNA virus, is the most common cause of epidemic respiratory disease in infants and young children. RSV infection of airway epithelial cells induces the expression of immune/inflammatory genes through the activation of a subset of transcription factors, including Nuclear Factor-κB (NF-κB). In this study we have investigated the role of the non canonical IκB kinase (IKK)ε in modulating RSV-induced NF-κB activation. Our results show that inhibition of IKKε activation results in significant impairment of viral-induced NF-κB-dependent gene expression, through a reduction in NF-κB transcriptional activity, without changes in nuclear translocation or DNA-binding activity. Absence of IKKε results in a significant decrease of RSV-induced NF-κB phosphorylation on serine 536, a post-translational modification important for RSV-induced NF-κB-dependent gene expression, known to regulate NF-κB transcriptional activity without affecting nuclear translocation. This study identifies a novel mechanism by which IKKε regulates viral-induced cellular signaling.

  17. Conventional kinesin KIF5B mediates adiponectin secretion in 3T3-L1 adipocytes

    Energy Technology Data Exchange (ETDEWEB)

    Cui, Ju, E-mail: juzi.cui@gmail.com [The Key Laboratory of Geriatrics, Beijing Hospital and Beijing Institute of Geriatrics, Beijing (China); Pang, Jing; Lin, Ya-Jun; Jiang, Ping; Gong, Huan [The Key Laboratory of Geriatrics, Beijing Hospital and Beijing Institute of Geriatrics, Beijing (China); Wang, Zai [Institute of Clinical Medical Sciences, China-Japan Friendship Hospital, Beijing (China); Li, Jian; Cai, Jian-Ping [The Key Laboratory of Geriatrics, Beijing Hospital and Beijing Institute of Geriatrics, Beijing (China); Huang, Jian-Dong, E-mail: jdhuang@hku.hk [School of Biomedical Sciences and Shenzhen Institute of Research and Innovation, The University of Hong Kong, Pokfulam (Hong Kong); The Centre for Synthetic Biology Engineering Research, Shenzhen Institutes of Advanced Technology, Shenzhen (China); Zhang, Tie-Mei, E-mail: tmzhang126@126.com [The Key Laboratory of Geriatrics, Beijing Hospital and Beijing Institute of Geriatrics, Beijing (China)

    2016-08-05

    Insulin stimulates adiponectin secretion and glucose transporter type 4 (GLUT4) translocation in adipocyte to regulate metabolism homeostasis. Similar to GLUT4 translocation, intracellular trafficking and release of adiponectin in adipocytes relies on the trans-Golgi network and endosomal system. Recent studies show that the heavy chain of conventional kinesin (KIF5B) mediates GLUT4 translocation in murine 3T3-L1 adipocytes, however, the motor machinery involved in mediating intracellular trafficking and release of adiponectin is unknown. Here, we examined the role of KIF5B in the regulation of adiponectin secretion. The KIF5B level was up-regulated during 3T3-L1 adipogenesis. This increase in cytosolic KIF5B was synchronized with the induction of adiponectin. Endogenous KIF5B and adiponectin were partially colocalized at the peri-nuclear and cytosolic regions. In addition, adiponectin-containing vesicles were co-immunoprecipitated with KIF5B. Knockdown of KIF5B resulted in a marked inhibition of adiponectin secretion and overexpression of KIF5B enhanced adiponectin release, whereas leptin secretion was not affected by changes in KIF5B expression. These data suggest that the secretion of adiponectin, but not leptin, is dependent on functional KIF5B. - Highlights: • The KIF5B level was up regulated during 3T3-L1 adipogenesis. • Endogenous KIF5B and adiponectin were partially colicalized. • Adiponectin-containing vesicles were co-immunoprecipitated with KIF5B. • The secretion of adiponectin, but not leptin, is dependent on functional KIF5B.

  18. 1,8-Cineol inhibits nuclear translocation of NF-κB p65 and NF-κB-dependent transcriptional activity.

    Science.gov (United States)

    Greiner, Johannes F-W; Müller, Janine; Zeuner, Marie-Theres; Hauser, Stefan; Seidel, Thorsten; Klenke, Christin; Grunwald, Lena-Marie; Schomann, Timo; Widera, Darius; Sudhoff, Holger; Kaltschmidt, Barbara; Kaltschmidt, Christian

    2013-12-01

    Natural plant-derived products are commonly applied to treat a broad range of human diseases, including cancer as well as chronic and acute airway inflammation. In this regard, the monoterpene oxide 1,8-cineol, the active ingredient of the clinically approved drug Soledum®, is well-established for the therapy of airway diseases, such as chronic sinusitis and bronchitis, chronic obstructive pulmonary disease and bronchial asthma. Although clinical trials underline the beneficial effects of 1,8-cineol in treating inflammatory diseases, the molecular mode of action still remains unclear. Here, we demonstrate for the first time a 1,8-cineol-depending reduction of NF-κB-activity in human cell lines U373 and HeLa upon stimulation using lipopolysaccharides (LPS). Immunocytochemistry further revealed a reduced nuclear translocation of NF-κB p65, while qPCR and western blot analyses showed strongly attenuated expression of NF-κB target genes. Treatment with 1,8-cineol further led to increased protein levels of IκBα in an IKK-independent matter, while FRET-analyses showed restoring of LPS-associated loss of interaction between NF-κB p65 and IκBα. We likewise observed reduced amounts of phosphorylated c-Jun N-terminal kinase 1/2 protein in U373 cells after exposure to 1,8-cineol. In addition, 1,8-cineol led to decreased amount of nuclear NF-κB p65 and reduction of its target gene IκBα at protein level in human peripheral blood mononuclear cells. Our findings suggest a novel mode of action of 1,8-cineol through inhibition of nuclear NF-κB p65 translocation via IκBα resulting in decreased levels of proinflammatory NF-κB target genes and may therefore broaden the field of clinical application of this natural drug for treating inflammatory diseases. © 2013.

  19. Uncaria tomentosa acts as a potent TNF-alpha inhibitor through NF-kappaB.

    Science.gov (United States)

    Allen-Hall, Lisa; Arnason, John T; Cano, Pablo; Lafrenie, Robert M

    2010-02-17

    Uncaria tomentosa, commonly known as Cat's Claw or Uña de gato, is a medicinal plant that has been shown to have effective anti-inflammatory activities. We have previously shown that treatment of monocyte-like THP-1 cells with Uncaria tomentosa inhibits the production of the pro-inflammatory cytokine TNF-alpha while augmenting the production of IL-1beta. Since TNF-alpha and IL-1beta are usually regulated similarly and share a number of common promoter elements, including NF-kappaB and AP-1, the ability of Uncaria tomentosa to differentially regulate these inflammatory cytokines is of particular interest. To determine the mechanism of action of Uncaria tomentosa, we investigated the effects of specific inhibitors of NF-kappaB on cellular responses including transcription factor activation using TransAM assays, the expression of cytokines as measured by ELISA, and cell survival as measured by changes in cell number following treatment. Treatment with Uncaria tomentosa inhibited the LPS-dependent activation of specific NF-kappaB and AP-1 components. In addition, treatment with Uncaria tomentosa enhanced cell death when NF-kappaB was inhibited. The ability of Uncaria tomentosa to inhibit TNF-alpha production was diminished when NF-kappaB activation was prevented by drugs that mask NF-kappaB subunit nuclear localization signals, while IL-1beta expression was unchanged. These results demonstrate that Uncaria tomentosa is able to elicit a response via an NF-kappaB-dependent mechanism. Further studies to characterize the mechanism by which Uncaria tomentosa can affect this pathway could provide a means to develop anti-TNF-alpha therapies. Copyright 2009 Elsevier Ireland Ltd. All rights reserved.

  20. Vitamin D in inflammatory diseases

    Directory of Open Access Journals (Sweden)

    Thea K Wöbke

    2014-07-01

    Full Text Available Changes in vitamin D serum levels have been associated with inflammatory diseases, such as inflammatory bowel disease, rheumatoid arthritis, systemic lupus erythematosus, multiple sclerosis, atherosclerosis or asthma. Genome- and transcriptome-wide studies indicate that vitamin D signalling modulates many inflammatory responses on several levels. This includes i the regulation of the expression of genes which generate pro-inflammatory mediators, such as cyclooxygenases or 5-lipoxygenase, ii the interference with transcription factors, such as NF-kB, which regulate the expression of inflammatory genes and iii the activation of signalling cascades, such as MAP kinases which mediate inflammatory responses. Vitamin D targets various tissues and cell types, a number of which belong to the immune system, such as monocytes/macrophages, dendritic cells as well as B- and T cells, leading to individual responses of each cell type. One hallmark of these specific vitamin D effects is the cell-type specific regulation of genes involved in the regulation of inflammatory processes and the interplay between vitamin D signalling and other signalling cascades involved in inflammation.An important task in the near future will be the elucidation of the regulatory mechanisms that are involved in the regulation of inflammatory responses by vitamin D on the molecular level by the use of techniques such as chromatin immunoprecipitation (ChIP, ChIP-seq and FAIRE-seq.

  1. Endothelial cell-specific NF-kappaB inhibition protects mice from atherosclerosis

    NARCIS (Netherlands)

    Gareus, Ralph; Kotsaki, Elena; Xanthoulea, Sofia; van der Made, Ingeborg; Gijbels, Marion J. J.; Kardakaris, Rozina; Polykratis, Apostolos; Kollias, George; de Winther, Menno P. J.; Pasparakis, Manolis

    2008-01-01

    Atherosclerosis is a progressive disorder of the arterial wall and the underlying cause of cardiovascular diseases such as heart attack and stroke. Today, atherosclerosis is recognized as a complex disease with a strong inflammatory component. The nuclear factor-kappaB (NF-kappaB) signaling pathway

  2. Granzyme B mediates both direct and indirect cleavage of extracellular matrix in skin after chronic low-dose ultraviolet light irradiation.

    Science.gov (United States)

    Parkinson, Leigh G; Toro, Ana; Zhao, Hongyan; Brown, Keddie; Tebbutt, Scott J; Granville, David J

    2015-02-01

    Extracellular matrix (ECM) degradation is a hallmark of many chronic inflammatory diseases that can lead to a loss of function, aging, and disease progression. Ultraviolet light (UV) irradiation from the sun is widely considered as the major cause of visible human skin aging, causing increased inflammation and enhanced ECM degradation. Granzyme B (GzmB), a serine protease that is expressed by a variety of cells, accumulates in the extracellular milieu during chronic inflammation and cleaves a number of ECM proteins. We hypothesized that GzmB contributes to ECM degradation in the skin after UV irradiation through both direct cleavage of ECM proteins and indirectly through the induction of other proteinases. Wild-type and GzmB-knockout mice were repeatedly exposed to minimal erythemal doses of solar-simulated UV irradiation for 20 weeks. GzmB expression was significantly increased in wild-type treated skin compared to nonirradiated controls, colocalizing to keratinocytes and to an increased mast cell population. GzmB deficiency significantly protected against the formation of wrinkles and the loss of dermal collagen density, which was related to the cleavage of decorin, an abundant proteoglycan involved in collagen fibrillogenesis and integrity. GzmB also cleaved fibronectin, and GzmB-mediated fibronectin fragments increased the expression of collagen-degrading matrix metalloproteinase-1 (MMP-1) in fibroblasts. Collectively, these findings indicate a significant role for GzmB in ECM degradation that may have implications in many age-related chronic inflammatory diseases. © 2014 The Authors. Aging Cell published by the Anatomical Society and John Wiley & Sons Ltd.

  3. Genistein inhibited ammonia induced astrocyte swelling by inhibiting NF-κB activation-mediated nitric oxide formation.

    Science.gov (United States)

    Dai, Hongliang; Jia, Guizhi; Wang, Wei; Liang, Chunguang; Han, Siyu; Chu, Minghui; Mei, Xifan

    2017-06-01

    Our previous study has indicated the involvement of epidermal growth factor receptor (EGFR) transactivation in ammonia-induced astrocyte swelling, which represents a major pathogenesis of brain edema in hepatic encephalopathy. In this study, we examined the effect of genistein, a naturally occurred broad-spectrum protein tyrosine kinase (PTK) inhibitor, on ammonia-induced cell swelling. We found that genistein pretreatment significantly prevented ammonia-induced astrocyte swelling. Mechanistically, ammonia triggered EGFR/extracellular signal-regulated kinase (ERK) association and subsequent ERK phosphorylation were alleviated by genistein pretreatment. Moreover, ammonia-induced NF-κB nuclear location, iNOS expression, and consequent NO production were all prevented by AG1478 and genistein pretreatment. This study suggested that genistein could alleviate ammonia-induced astrocyte swelling, which may be, at least partly, related to its PTK-inhibiting activity and repression of NF-κB mediated iNOS-derived NO accumulation.

  4. Wnt1 Participates in Inflammation Induced by Lipopolysaccharide Through Upregulating Scavenger Receptor A and NF-kB.

    Science.gov (United States)

    Zhao, Wenting; Sun, Zewei; Wang, Shuai; Li, Zhenwei; Zheng, Liangrong

    2015-08-01

    The study investigated the role of wnt1 in the inflammatory response initiated by lipolysaccharide (LPS), and analyzed the association between wnt1, NF-KB, and inflammatory factors. THP-1 cells were activated with phorbol-12-myristate-13-acetate (PMA) and treated with LPS to induce inflammation. THP-1 cells were transfected with wnt1siRNA and overexpression plasmid to explore the relationship among wnt1, SRA, and NF-KB. Inhibitor of β-catenin and siRNA of FZD1were used to investigate the signaling events involved in SRA activation induced by wnt1. Levels of NF-kB protein and inflammatory cytokines were assessed followingwnt1 siRNA and LPS treatment. PMA activation and LPS treatment of THP-1 cells increased wnt1 protein levels. Wnt1 promoted SRA expression through activation of canonical wnt pathway. Wnt1 increased NF-kB protein levels and enhanced the secretion of IL-6, TNF-α, and iNOS through binding to SRA. These findings suggest that wnt1 increased SRA and NF-kB protein levels and participated in the inflammatory response.

  5. Chronic Normobaric Hypoxia Induces Pulmonary Hypertension in Rats: Role of NF-κB.

    Science.gov (United States)

    Fan, Junming; Fan, Xiaofang; Li, Yang; Ding, Lu; Zheng, Qingqing; Guo, Jinbin; Xia, Dongmei; Xue, Feng; Wang, Yongyu; Liu, Shufang; Gong, Yongsheng

    2016-03-01

    To investigate whether nuclear factor-kappa B (NF-κB) activation is involved in chronic normobaric hypoxia-induced pulmonary hypertension (PH), rats were treated with saline or an NF-κB inhibitor, pyrrolidine dithiocarbamate (PDTC, 150 mg/kg, sc, twice daily), and exposed to normoxia or chronic normobaric hypoxia with a fraction of inspired oxygen of ∼0.1 for 14 days. Lung tissue levels of NF-κB activity, and interleukin (IL)-1β, IL-6, and cyclooxygenase-2 mRNAs, were determined, and mean pulmonary arterial pressure, right ventricular hypertrophy, and right heart function were evaluated. Compared to the normoxia exposure group, rats exposed to chronic normobaric hypoxia showed an increased NF-κB activity, measured by increased nuclear translocation of p50 and p65 proteins, an increased inflammatory gene expression in the lungs, elevated mean pulmonary arterial blood pressure and mean right ventricular pressure, right ventricular hypertrophy, as assessed by right ventricle-to-left ventricle plus septum weight ratio, and right heart dysfunction. Treatment of hypoxia-exposed rats with PDTC inhibited NF-κB activity, decreased pulmonary arterial blood pressure and right ventricular pressure, and ameliorated right ventricular hypertrophy and right heart dysfunction. Hypoxia exposure increased protein kinase C activity and promoted pulmonary artery smooth muscle cell proliferation in vitro. Our data suggest that NF-κB activation may contribute to chronic normobaric hypoxia-induced PH.

  6. A systematic survey of the response of a model NF-κB signalling pathway to TNFα stimulation.

    Science.gov (United States)

    Wang, Yunjiao; Paszek, Pawel; Horton, Caroline A; Yue, Hong; White, Michael R H; Kell, Douglas B; Muldoon, Mark R; Broomhead, David S

    2012-03-21

    White's lab established that strong, continuous stimulation with tumour necrosis factor-α (TNFα) can induce sustained oscillations in the subcellular localisation of the transcription factor nuclear factor κB (NF-κB). But the intensity of the TNFα signal varies substantially, from picomolar in the blood plasma of healthy organisms to nanomolar in diseased states. We report on a systematic survey using computational bifurcation theory to explore the relationship between the intensity of TNFα stimulation and the existence of sustained NF-κB oscillations. Using a deterministic model developed by Ashall et al. in 2009, we find that the system's responses to TNFα are characterised by a supercritical Hopf bifurcation point: above a critical intensity of TNFα the system exhibits sustained oscillations in NF-kB localisation. For TNFα below this critical value, damped oscillations are observed. This picture depends, however, on the values of the model's other parameters. When the values of certain reaction rates are altered the response of the signalling pathway to TNFα stimulation changes: in addition to the sustained oscillations induced by high-dose stimulation, a second oscillatory regime appears at much lower doses. Finally, we define scores to quantify the sensitivity of the dynamics of the system to variation in its parameters and use these scores to establish that the qualitative dynamics are most sensitive to the details of NF-κB mediated gene transcription. Copyright © 2011 Elsevier Ltd. All rights reserved.

  7. A RIPK2 inhibitor delays NOD signalling events yet prevents inflammatory cytokine production

    DEFF Research Database (Denmark)

    Nachbur, Ueli; Stafford, Che A; Bankovacki, Aleksandra

    2015-01-01

    Intracellular nucleotide binding and oligomerization domain (NOD) receptors recognize antigens including bacterial peptidoglycans and initiate immune responses by triggering the production of pro-inflammatory cytokines through activating NF-κB and MAP kinases. Receptor interacting protein kinase 2...

  8. NF-κB in Hematological Malignancies

    Directory of Open Access Journals (Sweden)

    Véronique Imbert

    2017-05-01

    Full Text Available NF-κB (Nuclear Factor Κ-light-chain-enhancer of activated B cells transcription factors are critical regulators of immunity, stress response, apoptosis, and differentiation. Molecular defects promoting the constitutive activation of canonical and non-canonical NF-κB signaling pathways contribute to many diseases, including cancer, diabetes, chronic inflammation, and autoimmunity. In the present review, we focus our attention on the mechanisms of NF-κB deregulation in hematological malignancies. Key positive regulators of NF-κB signaling can act as oncogenes that are often prone to chromosomal translocation, amplifications, or activating mutations. Negative regulators of NF-κB have tumor suppressor functions, and are frequently inactivated either by genomic deletions or point mutations. NF-κB activation in tumoral cells is also driven by the microenvironment or chronic signaling that does not rely on genetic alterations.

  9. NF-κB in Hematological Malignancies.

    Science.gov (United States)

    Imbert, Véronique; Peyron, Jean-François

    2017-05-31

    NF-κB (Nuclear Factor Κ-light-chain-enhancer of activated B cells) transcription factors are critical regulators of immunity, stress response, apoptosis, and differentiation. Molecular defects promoting the constitutive activation of canonical and non-canonical NF-κB signaling pathways contribute to many diseases, including cancer, diabetes, chronic inflammation, and autoimmunity. In the present review, we focus our attention on the mechanisms of NF-κB deregulation in hematological malignancies. Key positive regulators of NF-κB signaling can act as oncogenes that are often prone to chromosomal translocation, amplifications, or activating mutations. Negative regulators of NF-κB have tumor suppressor functions, and are frequently inactivated either by genomic deletions or point mutations. NF-κB activation in tumoral cells is also driven by the microenvironment or chronic signaling that does not rely on genetic alterations.

  10. Interleukin-6 upregulates paraoxonase 1 gene expression via an AKT/NF-κB-dependent pathway

    Energy Technology Data Exchange (ETDEWEB)

    Cheng, Chi-Chih [Department of Research, Taichung Veterans General Hospital, Taichung, Taiwan (China); Hsueh, Chi-Mei [Department of Life Sciences, National Chung Hsing University, Taichung, Taiwan (China); Chen, Chiu-Yuan [Graduate Institute of Natural Healing Sciences, Nanhua University, Chiayi, Taiwan (China); Chen, Tzu-Hsiu, E-mail: hsiu@mail.chna.edu.tw [Department of Health and Nutrition, Chia Nan University of Pharmacy and Science, Tainan, Taiwan (China); Hsu, Shih-Lan, E-mail: h2326@vghtc.gov.tw [Department of Research, Taichung Veterans General Hospital, Taichung, Taiwan (China); Department of Applied Chemistry, National Chi Nan University, Puli, Nantou, Taiwan (China)

    2013-07-19

    Highlights: •IL-6 could induce PON1 gene expression. •IL-6 increased NF-κB protein expression and NF-κB-p50 and -p65 subunits nuclear translocation. •IL-6-induced PON1 up-regulation was through an AKT/NF-κB pathway. -- Abstract: The aim of this study is to investigate the relationship between paraoxonase 1 (PON1) and atherosclerosis-related inflammation. In this study, human hepatoma HepG2 cell line was used as a hepatocyte model to examine the effects of the pro-inflammatory cytokines on PON1 expression. The results showed that IL-6, but not TNF-α and IL-1β, significantly increased both the function and protein level of PON1; data from real-time RT-PCR analysis revealed that the IL-6-induced PON1 expression occurred at the transcriptional level. Increase of IκB kinase activity and IκB phosphorylation, and reduction of IκB protein level were also observed in IL-6-treated HepG2 cells compared with untreated culture. This event was accompanied by increase of NF-κB-p50 and -p65 nuclear translocation. Moreover, treatment with IL-6 augmented the DNA binding activity of NF-κB. Furthermore, pharmacological inhibition of NF-κB activation by PDTC and BAY 11-7082, markedly suppressed the IL-6-mediated PON1 expression. In addition, IL-6 increased the levels of phosphorylated protein kinase B (PKB, AKT). An AKT inhibitor LY294002 effectively suppressed IKK/IκB/NF-κB signaling and PON1 gene expression induced by IL-6. Our findings demonstrate that IL-6 upregulates PON1 gene expression through an AKT/NF-κB signaling axis in human hepatocyte-derived HepG2 cell line.

  11. Automated analysis of NF-κB nuclear translocation kinetics in high-throughput screening.

    Directory of Open Access Journals (Sweden)

    Zi Di

    Full Text Available Nuclear entry and exit of the NF-κB family of dimeric transcription factors plays an essential role in regulating cellular responses to inflammatory stress. The dynamics of this nuclear translocation can vary significantly within a cell population and may dramatically change e.g. upon drug exposure. Furthermore, there is significant heterogeneity in individual cell response upon stress signaling. In order to systematically determine factors that define NF-κB translocation dynamics, high-throughput screens that enable the analysis of dynamic NF-κB responses in individual cells in real time are essential. Thus far, only NF-κB downstream signaling responses of whole cell populations at the transcriptional level are in high-throughput mode. In this study, we developed a fully automated image analysis method to determine the time-course of NF-κB translocation in individual cells, suitable for high-throughput screenings in the context of compound screening and functional genomics. Two novel segmentation methods were used for defining the individual nuclear and cytoplasmic regions: watershed masked clustering (WMC and best-fit ellipse of Voronoi cell (BEVC. The dynamic NFκB oscillatory response at the single cell and population level was coupled to automated extraction of 26 analogue translocation parameters including number of peaks, time to reach each peak, and amplitude of each peak. Our automated image analysis method was validated through a series of statistical tests demonstrating computational efficient and accurate NF-κB translocation dynamics quantification of our algorithm. Both pharmacological inhibition of NF-κB and short interfering RNAs targeting the inhibitor of NFκB, IκBα, demonstrated the ability of our method to identify compounds and genetic players that interfere with the nuclear transition of NF-κB.

  12. Effects of protein-energy malnutrition on NF-kappaB signalling in murine peritoneal macrophages.

    Science.gov (United States)

    Fock, Ricardo Ambrósio; Rogero, Marcelo Macedo; Vinolo, Marco Aurélio Ramirez; Curi, Rui; Borges, Maria Carolina; Borelli, Primavera

    2010-04-01

    Protein-energy malnutrition (PEM) is an important public health problem affecting millions of people worldwide. PEM decreases resistance to infection, impairing a number of physiological processes. In unstimulated cells, NF-kappaB is kept from binding to its consensus sequence by the inhibitor I kappaB alpha, which retains NF-kappaB in the cytoplasm. Upon various signals, such as lipopolysaccharide (LPS), I kappaB alpha is rapidly degraded and NF-kappaB is induced to translocate into the nucleus, where it activates expression of various genes that participate in the inflammatory response, including those involved in the synthesis of TNF-alpha. TRAF-6 is a cytoplasmic adapter protein that links the stimulatory signal from Toll like receptor-4 to NF-kappaB. The aim of this study was to evaluate the effect of malnutrition on induction of TNF-alpha by LPS in murine peritoneal macrophages. We evaluated peritoneal cellularity, the expression of MyD88, TRAF-6, IKK, I kappaB alpha and NF-kappaB, NF-kappaB activation and TNF-alpha mRNA and protein synthesis in macrophages. Two-month-old male BALB/C mice were submitted to PEM with a low-protein diet that contained 2% protein, compared to 12% protein in the control diet. When the experimental group had lost about 20% of the original body weight, it was used in the subsequent experiments. Malnourished animals presented anemia, leucopenia and severe reduction in peritoneal cavity cellularity. TNF-alpha mRNA and protein levels of macrophages stimulated with LPS were significantly lower in malnourished animals. PEM also decreased TRAF-6 expression and NF-kappaB activation after LPS stimulation. These results led us to conclude that PEM changes NF-kB signalling pathway in macrophages to LPS stimulus.

  13. 1,25-dihydroxyvitamin D3 impairs NF-κB activation in human naive B cells

    International Nuclear Information System (INIS)

    Geldmeyer-Hilt, Kerstin; Heine, Guido; Hartmann, Bjoern; Baumgrass, Ria; Radbruch, Andreas; Worm, Margitta

    2011-01-01

    Highlights: → In naive B cells, VDR activation by calcitriol results in reduced NF-κB p105 and p50 protein expression. → Ligating the VDR with calcitriol causes reduced nuclear translocation of NF-κB p65. → Reduced nuclear amount of p65 after calcitriol incubation results in reduced binding of p65 on the p105 promoter. → Thus, vitamin D receptor signaling may reduce or prevent activation of B cells and unwanted immune responses, e.g. in IgE dependent diseases such as allergic asthma. -- Abstract: 1α,25-dihydroxyvitamin D 3 (calcitriol), the bioactive metabolite of vitamin D, modulates the activation and inhibits IgE production of anti-CD40 and IL-4 stimulated human peripheral B cells. Engagement of CD40 results in NF-κB p50 activation, which is essential for the class switch to IgE. Herein, we investigated by which mechanism calcitriol modulates NF-κB mediated activation of human naive B cells. Naive B cells were predominantly targeted by calcitriol in comparison with memory B cells as shown by pronounced induction of the VDR target gene cyp24a1. Vitamin D receptor activation resulted in a strongly reduced p105/p50 protein and mRNA expression in human naive B cells. This effect is mediated by impaired nuclear translocation of p65 and consequently reduced binding of p65 to its binding site in the p105 promoter. Our data indicate that the vitamin D receptor reduces NF-κB activation by interference with NF-κB p65 and p105. Thus, the vitamin D receptor inhibits costimulatory signal transduction in naive B cells, namely by reducing CD40 signaling.

  14. Fungal-induced cell cycle impairment, chromosome instability and apoptosis via differential activation of NF-κB.

    Directory of Open Access Journals (Sweden)

    Mariem Ben-Abdallah

    Full Text Available Microbial pathogens have developed efficient strategies to compromise host immune responses. Cryptococcus neoformans is a facultative intracellular pathogen, recognised as the most common cause of systemic fungal infections leading to severe meningoencephalitis, mainly in immunocompromised patients. This yeast is characterized by a polysaccharide capsule, which inhibits its phagocytosis. Whereas phagocytosis escape and macrophage intracellular survival have been intensively studied, extracellular survival of this yeast and restraint of host innate immune response are still poorly understood. In this study, we have investigated whether C. neoformans affected macrophage cell viability and whether NF-κB (nuclear factor-κB, a key regulator of cell growth, apoptosis and inflammation, was involved. Using wild-type (WT as well as mutant strains of C. neoformans for the pathogen side, and WT and mutant cell lines with altered NF-κB activity or signalling as well as primary macrophages for the host side, we show that C. neoformans manipulated NF-κB-mediated signalling in a unique way to regulate macrophage cell fate and viability. On the one hand, serotype A strains reduced macrophage proliferation in a capsule-independent fashion. This growth decrease, which required a critical dosage of NF-κB activity, was caused by cell cycle disruption and aneuploidy, relying on fungal-induced modification of expression of several cell cycle checkpoint regulators in S and G2/M phases. On the other hand, C. neoformans infection induced macrophage apoptosis in a capsule-dependent manner with a differential requirement of the classical and alternative NF-κB signalling pathways, the latter one being essential. Together, these findings shed new light on fungal strategies to subvert host response through uncoupling of NF-κB activity in pathogen-controlled apoptosis and impairment of cell cycle progression. They also provide the first demonstration of induction of

  15. Synergistic activation of NF-κB by nontypeable H. influenzae and S. pneumoniae is mediated by CK2, IKKβ-IκBα, and p38 MAPK

    International Nuclear Information System (INIS)

    Kweon, Soo-Mi; Wang, Beinan; Rixter, Davida; Lim, Jae Hyang; Koga, Tomoaki; Ishinaga, Hajime; Chen, L.-F.; Jono, Hirofumi; Xu Haidong; Li, J.-D.

    2006-01-01

    In review of the past studies on NF-κB regulation, most of them have focused on investigating how NF-κB is activated by a single inducer at a time. Given the fact that, in mixed bacterial infections in vivo, multiple inflammation inducers, including both nontypeable Haemophilus influenzae (NTHi) and Streptococcus pneumoniae, are present simultaneously, a key issue that has yet to be addressed is whether NTHi and S. pneumoniae simultaneously activate NF-κB and the subsequent inflammatory response in a synergistic manner. Here, we show that NTHi and S. pneumoniae synergistically induce NF-κB-dependent inflammatory response via activation of multiple signaling pathways in vitro and in vivo. The classical IKKβ-IκBα and p38 MAPK pathways are involved in synergistic activation of NF-κB via two distinct mechanisms, p65 nuclear translocation-dependent and -independent mechanisms. Moreover, casein kinase 2 (CK2) is involved in synergistic induction of NF-κB via a mechanism dependent on phosphorylation of p65 at both Ser536 and Ser276 sites. These studies bring new insights into the molecular mechanisms underlying the NF-κB-dependent inflammatory response in polymicrobial infections and may lead to development of novel therapeutic strategies for modulating inflammation in mixed infections for patients with otitis media and chronic obstructive pulmonary diseases

  16. Methyl (E)-(3,4-dihydroxyphenyl)acryloyl)tryptophanate can suppress MCP-1 expression by inhibiting p38 MAP kinase and NF-kB in LPS-stimulated differentiated THP-1 cells

    Science.gov (United States)

    The p38 MAP kinase and NF-kB play significant roles in regulating the production of proinflammatory cytokines including monocyte chemotactic factor-1 (MCP-1). Therefore, potent inhibitors to suppress p38 kinase and NF-kB activities have been explored as anti-inflammatory agents. In this study, a nov...

  17. Torilin Inhibits Inflammation by Limiting TAK1-Mediated MAP Kinase and NF-κB Activation

    Directory of Open Access Journals (Sweden)

    Mehari Endale

    2017-01-01

    Full Text Available Torilin, a sesquiterpene isolated from the fruits of Torilis japonica, has shown antimicrobial, anticancer, and anti-inflammatory properties. However, data on the mechanism of torilin action against inflammation is limited. This study aimed at determining the anti-inflammatory property of torilin in LPS-induced inflammation using in vitro model of inflammation. We examined torilin’s effect on expression levels of inflammatory mediators and cytokines in LPS-stimulated RAW 264.7 macrophages. The involvement of NF-kB and AP-1, MAP kinases, and adaptor proteins were assessed. Torilin strongly inhibited LPS-induced NO release, iNOS, PGE2, COX-2, NF-α, IL-1β, IL-6, and GM-CSF gene and protein expressions. In addition, MAPKs were also suppressed by torilin pretreatment. Involvement of ERK1/2, P38MAPK, and JNK1/2 was further confirmed by PD98059, SB203580, and SP600125 mediated suppression of iNOS and COX-2 proteins. Furthermore, torilin attenuated NF-kB and AP-1 translocation, DNA binding, and reporter gene transcription. Interestingly, torilin inhibited TAK1 kinase activation with the subsequent suppression of MAPK-mediated JNK, p38, ERK1/2, and AP-1 (ATF-2 and c-jun activation and IKK-mediated I-κBα degradation, p65/p50 activation, and translocation. Together, the results revealed the suppression of NF-κB and AP-1 regulated inflammatory mediator and cytokine expressions, suggesting the test compound’s potential as a candidate anti-inflammatory agent.

  18. Effects of returning NF concentrate on the MBR-NF process treating antibiotic production wastewater.

    Science.gov (United States)

    Li, Kun; Cheng, Yutao; Wang, Jianxing; Zhang, Junya; Liu, Jibao; Yu, Dawei; Li, Mingyue; Wei, Yuansong

    2016-07-01

    The optimization of the nanofiltration (NF) concentrate backflow ratio (R cb) and the influence of the NF concentrate on the performance of membrane bioreactor-nanofiltration (MBR-NF) process treating antibiotic production wastewater were investigated on a laboratory scale. The R cb was optimized at 60 % based on the removal rates of chemical oxygen demand (COD) and NH4 (+)-N by MBR. Data analyses indicated that salinity brought by NF concentrate is the major driver leading to the decrease of sludge activity, especially at a high R cb. EPS analysis showed that electric conductivity (EC), proteins in soluble microbial products (SMP), and SMP brought by NF concentrate are the dominant factors causing the severe membrane fouling in MBR. Furthermore, undegradable substances including fulvic acid-like and humic acid-like compounds accumulated in NF concentrate showed significant influence on fouling of NF. MBR could well degrade small MW compounds in NF concentrate, which confirmed the enhancement of organic removal efficiency by recycling the NF concentrate to MBR. The MBR-NF process showed a relatively stable performance at the R cb of 60 % (volume reduction factor (VRF) = 5), and the NF permeate could satisfy the water quality standard for fermentation process with a water recovery rate of 90.9 %.

  19. NF45 and NF90 Bind HIV-1 RNA and Modulate HIV Gene Expression

    Directory of Open Access Journals (Sweden)

    Yan Li

    2016-02-01

    Full Text Available A previous proteomic screen in our laboratory identified nuclear factor 45 (NF45 and nuclear factor 90 (NF90 as potential cellular factors involved in human immunodeficiency virus type 1 (HIV-1 replication. Both are RNA binding proteins that regulate gene expression; and NF90 has been shown to regulate the expression of cyclin T1 which is required for Tat-dependent trans-activation of viral gene expression. In this study the roles of NF45 and NF90 in HIV replication were investigated through overexpression studies. Ectopic expression of either factor potentiated HIV infection, gene expression, and virus production. Deletion of the RNA binding domains of NF45 and NF90 diminished the enhancement of HIV infection and gene expression. Both proteins were found to interact with the HIV RNA. RNA decay assays demonstrated that NF90, but not NF45, increased the half-life of the HIV RNA. Overall, these studies indicate that both NF45 and NF90 potentiate HIV infection through their RNA binding domains.

  20. Gadd153 and NF-κB crosstalk regulates 27-hydroxycholesterol-induced increase in BACE1 and β-amyloid production in human neuroblastoma SH-SY5Y cells.

    Directory of Open Access Journals (Sweden)

    Gurdeep Marwarha

    Full Text Available β-amyloid (Aβ peptide, accumulation of which is a culprit for Alzheimer's disease (AD, is derived from the initial cleavage of amyloid precursor protein by the aspartyl protease BACE1. Identification of cellular mechanisms that regulate BACE1 production is of high relevance to the search for potential disease-modifying therapies that inhibit BACE1 to reduce Aβ accumulation and AD progression. In the present study, we show that the cholesterol oxidation product 27-hydroxycholesterol (27-OHC increases BACE1 and Aβ levels in human neuroblastoma SH-SY5Y cells. This increase in BACE1 involves a crosstalk between the two transcription factors NF-κB and the endoplasmic reticulum stress marker, the growth arrest and DNA damage induced gene-153 (gadd153, also called CHOP. We specifically show that 27-OHC induces a substantial increase in NF-κB binding to the BACE1 promoter and subsequent increase in BACE1 transcription and Aβ production. The NF-κB inhibitor, sc514, significantly attenuated the 27-OHC-induced increase in NF-κB-mediated BACE1 expression and Aβ genesis. We further show that the 27-OHC-induced NF-κB activation and increased NF-κB-mediated BACE1 expression is contingent on the increased activation of gadd153. Silencing gadd153 expression with siRNA alleviated the 27-OHC-induced increase in NF-κB activation, NF-κB binding to the BACE1 promoter, and subsequent increase in BACE1 transcription and Aβ production. We also show that increased levels of BACE1 in the triple transgenic mouse model for AD is preceded by gadd153 and NF-κB activation. In summary, our study demonstrates that gadd153 and NF-κB work in concert to regulate BACE1 expression. Agents that inhibit gadd153 activation and subsequent interaction with NF-κB might be promising targets to reduce BACE1 and Aβ overproduction and may ultimately serve as disease-modifying treatments for AD.

  1. Shigella dysenteriae infection activates proinflammatory response through β-catenin/NF-κB signaling pathway.

    Directory of Open Access Journals (Sweden)

    Ashidha Gopal

    Full Text Available Shigella dysenteriae (S.dysenteriae the causative agent of bacillary dysentery invades the human colonic epithelium resulting in severe intestinal inflammatory response and epithelial destruction. However, the mechanism by which S.dysenteriae infection regulates proinflammatory cytokines during intestinal inflammation is still obscure. In this study, we evaluated whether the interaction of β-catenin and NF-κB regulates proinflammatory cytokines TNF-α and IL-8 by modulating GSK-3β activity during S.dysenteriae infection in rat ileal loop model. Here we demonstrated that S.dysenteriae infection stimulate β-catenin degradation which in turn decreased the association between NF-κB and β-catenin. Also, we showed that S.dysenteriae infection increased GSK-3β kinase activity which in turn phosphorylates β-catenin for its degradation by ubiquitination and upregulates IL-8 through NF-κB activation thereby leading to inflammation. Thus these findings revealed the role of β-catenin/ NF-κB and GSK-3β in modulating the inflammatory response during bacterial infection and also showed that β-catenin acts as a critical regulator of inflammation.

  2. Andrographolide inhibits multiple myeloma cells by inhibiting the TLR4/NF-κB signaling pathway.

    Science.gov (United States)

    Gao, Hui; Wang, Jianrong

    2016-02-01

    Andrographolide is an active component from the extract of Andrographis paniculata [(Burm.f) Nees], a medicinal plant from the Acanthaceae family. Pharmacological studies have revealed that andrographolide possesses anti-bacterial, anti-inflammatory, anti-viral, immune regulatory and hepatoprotective properties, and is efficacious in the treatment of cardiovascular diseases, while exhibiting low toxicity and low cost. The present study aimed to determine the inhibitory effects of andrographolide on the growth of multiple myeloma (MM) cells and its possible impact on the Toll-like receptor (TLR)4/nuclear factor (NF)-κB signaling pathway. Cell proliferation was detected using an MTT assay, cellular apoptosis was measured using flow cytometry, and caspase-9/3 activation were assessed using colorimetric assay kits. Furthermore, TLR4 and NF-κB protein expression was determined by western blot analysis. The results revealed that andrographolide reduced the proliferation, while increasing cellular apoptosis and caspase-9/3 activation of MM cells, in addition to downregulating the expression of TLR4 and NF-κB protein. Of note, TLR4- or NF-κB-targeting small-interfering (si)RNA enhanced the andrographolide-induced inhibition of cell proliferation and induction of apoptosis of MM cells. The results of the present study therefore suggested that andrographolide inhibited multiple myeloma cells via the TLR4/NF-κB signaling pathway.

  3. Galangin Abrogates Ovalbumin-Induced Airway Inflammation via Negative Regulation of NF-κB

    Directory of Open Access Journals (Sweden)

    Wang-Jian Zha

    2013-01-01

    Full Text Available Persistent activation of nuclear factor κB (NF-κB has been associated with the development of asthma. Galangin, the active pharmacological ingredient from Alpinia galanga, is reported to have a variety of anti-inflammatory properties in vitro via negative regulation of NF-κB. This study aimed to investigate whether galangin can abrogate ovalbumin- (OVA- induced airway inflammation by negative regulation of NF-κB. BALB/c mice sensitized and challenged with OVA developed airway hyperresponsiveness (AHR and inflammation. Galangin dose dependently inhibited OVA-induced increases in total cell counts, eosinophil counts, and interleukin-(IL- 4, IL-5, and IL-13 levels in bronchoalveolar lavage fluid, and reduced serum level of OVA-specific IgE. Galangin also attenuated AHR, reduced eosinophil infiltration and goblet cell hyperplasia, and reduced expression of inducible nitric oxide synthase and vascular cell adhesion protein-1 (VCAM-1 levels in lung tissue. Additionally, galangin blocked inhibitor of κB degradation, phosphorylation of the p65 subunit of NF-κB, and p65 nuclear translocation from lung tissues of OVA-sensitized mice. Similarly, in normal human airway smooth muscle cells, galangin blocked tumor necrosis factor-α induced p65 nuclear translocation and expression of monocyte chemoattractant protein-1, eotaxin, CXCL10, and VCAM-1. These results suggest that galangin can attenuate ovalbumin-induced airway inflammation by inhibiting the NF-κB pathway.

  4. NF-κB expression and its association with nutritional status in hemodialysis patients.

    Science.gov (United States)

    Farage, Najla E; Stockler-Pinto, Milena B; Leal, Viviane O; Cardozo, Ludmila Lmf; Carraro-Eduardo, José Carlos; Fouque, Denis; Mafra, Denise

    2016-12-01

    This study aimed to evaluate the association among the expressions of pro- and anti-inflammatory nuclear factors (nuclear factor-kappaB, NF-κB and nuclear erythroid 2-related factor 2, Nrf2) and nutritional status in HD patients. This cross-sectional study included eighty-three HD patients. The peripheral blood mononuclear cells were isolated and processed for the evaluation of NF-κB and Nrf2 RNAm expression by quantitative real-time polymerase chain reaction. Muscle mass was estimated by creatinine index (CI) and percentage of body fat (%BF) by anthropometry. Seven-point subjective global assessment was also used to evaluate the nutritional status. The NF-κB expression was negatively correlated with CI (r = -0.54, p = 0.0001), serum albumin (r = -0.32, p = 0.02) and %BF (r = -0.61, p = 0.001). Multiple linear regression analysis revealed that NF-κB expression was independently associated with CI (β: -0.8, p = 0.013) and %BF (β: -0.42, p = 0.04). There was no correlation among Nrf2 and anthropometric and biochemical variables. The classical NF-κB activation seems to be associated with poor nutritional status in HD patients; however, the exact underlying mechanisms deserve further studies.

  5. Anesthetic propofol reduces endotoxic inflammation by inhibiting reactive oxygen species-regulated Akt/IKKβ/NF-κB signaling.

    Directory of Open Access Journals (Sweden)

    Chung-Hsi Hsing

    Full Text Available BACKGROUND: Anesthetic propofol has immunomodulatory effects, particularly in the area of anti-inflammation. Bacterial endotoxin lipopolysaccharide (LPS induces inflammation through toll-like receptor (TLR 4 signaling. We investigated the molecular actions of propofol against LPS/TLR4-induced inflammatory activation in murine RAW264.7 macrophages. METHODOLOGY/PRINCIPAL FINDINGS: Non-cytotoxic levels of propofol reduced LPS-induced inducible nitric oxide synthase (iNOS and NO as determined by western blotting and the Griess reaction, respectively. Propofol also reduced the production of tumor necrosis factor-α (TNF-α, interleukin (IL-6, and IL-10 as detected by enzyme-linked immunosorbent assays. Western blot analysis showed propofol inhibited LPS-induced activation and phosphorylation of IKKβ (Ser180 and nuclear factor (NF-κB (Ser536; the subsequent nuclear translocation of NF-κB p65 was also reduced. Additionally, propofol inhibited LPS-induced Akt activation and phosphorylation (Ser473 partly by reducing reactive oxygen species (ROS generation; inter-regulation that ROS regulated Akt followed by NF-κB activation was found to be crucial for LPS-induced inflammatory responses in macrophages. An in vivo study using C57BL/6 mice also demonstrated the anti-inflammatory properties against LPS in peritoneal macrophages. CONCLUSIONS/SIGNIFICANCE: These results suggest that propofol reduces LPS-induced inflammatory responses in macrophages by inhibiting the interconnected ROS/Akt/IKKβ/NF-κB signaling pathways.

  6. CARMA3 is overexpressed in colon cancer and regulates NF-{kappa}B activity and cyclin D1 expression

    Energy Technology Data Exchange (ETDEWEB)

    Miao, Zhifeng; Zhao, Tingting; Wang, Zhenning; Xu, Yingying; Song, Yongxi; Wu, Jianhua [Department of General Surgery, First Affiliated Hospital of China Medical University, Shenyang (China); Xu, Huimian, E-mail: xuhuimianpaper@yahoo.com.cn [Department of General Surgery, First Affiliated Hospital of China Medical University, Shenyang (China)

    2012-09-07

    Highlights: Black-Right-Pointing-Pointer CARMA3 expression is elevated in colon cancers. Black-Right-Pointing-Pointer CARMA3 promotes proliferation and cell cycle progression in colon cancer cells. Black-Right-Pointing-Pointer CARMA3 upregulates cyclinD1 through NF-{kappa}B activation. -- Abstract: CARMA3 was recently reported to be overexpressed in cancers and associated with the malignant behavior of cancer cells. However, the expression of CARMA3 and its biological roles in colon cancer have not been reported. In the present study, we analyzed the expression pattern of CARMA3 in colon cancer tissues and found that CARMA3 was overexpressed in 30.8% of colon cancer specimens. There was a significant association between CARMA3 overexpression and TNM stage (p = 0.0383), lymph node metastasis (p = 0.0091) and Ki67 proliferation index (p = 0.0035). Furthermore, knockdown of CARMA3 expression in HT29 and HCT116 cells with high endogenous expression decreased cell proliferation and cell cycle progression while overexpression of CARMA3 in LoVo cell line promoted cell proliferation and facilitated cell cycle transition. Further analysis showed that CARMA3 knockdown downregulated and its overexpression upregulated cyclin D1 expression and phospho-Rb levels. In addition, we found that CARMA3 depletion inhibited p-I{kappa}B levels and NF-{kappa}B activity and its overexpression increased p-I{kappa}B expression and NF-{kappa}B activity. NF-{kappa}B inhibitor BAY 11-7082 reversed the role of CARMA3 on cyclin D1 upregulation. In conclusion, our study found that CARMA3 is overexpressed in colon cancers and contributes to malignant cell growth by facilitating cell cycle progression through NF-{kappa}B mediated upregulation of cyclin D1.

  7. CARMA3 is overexpressed in colon cancer and regulates NF-κB activity and cyclin D1 expression

    International Nuclear Information System (INIS)

    Miao, Zhifeng; Zhao, Tingting; Wang, Zhenning; Xu, Yingying; Song, Yongxi; Wu, Jianhua; Xu, Huimian

    2012-01-01

    Highlights: ► CARMA3 expression is elevated in colon cancers. ► CARMA3 promotes proliferation and cell cycle progression in colon cancer cells. ► CARMA3 upregulates cyclinD1 through NF-κB activation. -- Abstract: CARMA3 was recently reported to be overexpressed in cancers and associated with the malignant behavior of cancer cells. However, the expression of CARMA3 and its biological roles in colon cancer have not been reported. In the present study, we analyzed the expression pattern of CARMA3 in colon cancer tissues and found that CARMA3 was overexpressed in 30.8% of colon cancer specimens. There was a significant association between CARMA3 overexpression and TNM stage (p = 0.0383), lymph node metastasis (p = 0.0091) and Ki67 proliferation index (p = 0.0035). Furthermore, knockdown of CARMA3 expression in HT29 and HCT116 cells with high endogenous expression decreased cell proliferation and cell cycle progression while overexpression of CARMA3 in LoVo cell line promoted cell proliferation and facilitated cell cycle transition. Further analysis showed that CARMA3 knockdown downregulated and its overexpression upregulated cyclin D1 expression and phospho-Rb levels. In addition, we found that CARMA3 depletion inhibited p-IκB levels and NF-κB activity and its overexpression increased p-IκB expression and NF-κB activity. NF-κB inhibitor BAY 11-7082 reversed the role of CARMA3 on cyclin D1 upregulation. In conclusion, our study found that CARMA3 is overexpressed in colon cancers and contributes to malignant cell growth by facilitating cell cycle progression through NF-κB mediated upregulation of cyclin D1.

  8. EBV induces persistent NF-κB activation and contributes to survival of EBV-positive neoplastic T- or NK-cells.

    Directory of Open Access Journals (Sweden)

    Honami Takada

    Full Text Available Epstein-Barr virus (EBV has been detected in several T- and NK-cell neoplasms such as extranodal NK/T-cell lymphoma nasal type, aggressive NK-cell leukemia, EBV-positive peripheral T-cell lymphoma, systemic EBV-positive T-cell lymphoma of childhood, and chronic active EBV infection (CAEBV. However, how this virus contributes to lymphomagenesis in T or NK cells remains largely unknown. Here, we examined NF-κB activation in EBV-positive T or NK cell lines, SNT8, SNT15, SNT16, SNK6, and primary EBV-positive and clonally proliferating T/NK cells obtained from the peripheral blood of patients with CAEBV. Western blotting, electrophoretic mobility shift assays, and immunofluorescent staining revealed persistent NF-κB activation in EBV-infected cell lines and primary cells from patients. Furthermore, we investigated the role of EBV in infected T cells. We performed an in vitro infection assay using MOLT4 cells infected with EBV. The infection directly induced NF-κB activation, promoted survival, and inhibited etoposide-induced apoptosis in MOLT4 cells. The luciferase assay suggested that LMP1 mediated NF-κB activation in MOLT4 cells. IMD-0354, a specific inhibitor of NF-κB that suppresses NF-κB activation in cell lines, inhibited cell survival and induced apoptosis. These results indicate that EBV induces NF-κB-mediated survival signals in T and NK cells, and therefore, may contribute to the lymphomagenesis of these cells.

  9. Delta FosB mediates epigenetic desensitization of the c-fos gene after chronic amphetamine exposure.

    Science.gov (United States)

    Renthal, William; Carle, Tiffany L; Maze, Ian; Covington, Herbert E; Truong, Hoang-Trang; Alibhai, Imran; Kumar, Arvind; Montgomery, Rusty L; Olson, Eric N; Nestler, Eric J

    2008-07-16

    The molecular mechanisms underlying the transition from recreational drug use to chronic addiction remain poorly understood. One molecule implicated in this process is DeltaFosB, a transcription factor that accumulates in striatum after repeated drug exposure and mediates sensitized behavioral responses to psychostimulants and other drugs of abuse. The downstream transcriptional mechanisms by which DeltaFosB regulates drug-induced behaviors are incompletely understood. We reported previously the chromatin remodeling mechanisms by which DeltaFosB activates the expression of certain genes; however, the mechanisms underlying DeltaFosB-mediated gene repression remain unknown. Here, we identify c-fos, an immediate early gene rapidly induced in striatum after acute psychostimulant exposure, as a novel downstream target that is repressed chronically by DeltaFosB. We show that accumulation of DeltaFosB in striatum after chronic amphetamine treatment desensitizes c-fos mRNA induction to a subsequent drug dose. DeltaFosB desensitizes c-fos expression by recruiting histone deacetylase 1 (HDAC1) to the c-fos gene promoter, which, in turn, deacetylates surrounding histones and attenuates gene activity. Accordingly, local knock-out of HDAC1 in striatum abolishes amphetamine-induced desensitization of the c-fos gene. In concert, chronic amphetamine increases histone H3 methylation on the c-fos promoter, a chromatin modification also known to repress gene activity, as well as expression levels of the H3 histone methyltransferase, KMT1A (lysine methyltransferase 1A, formerly SUV39H1). This study reveals a novel epigenetic pathway through which DeltaFosB mediates distinct transcriptional programs that may ultimately alter behavioral plasticity to chronic amphetamine exposure.

  10. Transglutaminase 2 gene ablation protects against renal ischemic injury by blocking constant NF-κB activation

    International Nuclear Information System (INIS)

    Kim, Dae-Seok; Kim, Bora; Tahk, Hongmin; Kim, Dong-Hyun; Ahn, Eu-Ree; Choi, Changsun; Jeon, Yoon; Park, Seo Young; Lee, Ho; Oh, Seung Hyun; Kim, Soo-Youl

    2010-01-01

    Research highlights: → No acute renal tubular necrotic lesions were found in TGase2 -/- mice with ischemic kidney injury. → NF-κB activation is reduced in TGase2 -/- mice with ischemic kidney injury. → Hypoxic stress did not increase NF-κB activity in MEFs from TGase2 -/- mice. → COX-2 induction is suppressed in TGase2 -/- mice with ischemic kidney injury. -- Abstract: Transglutaminase 2 knockout (TGase2 -/- ) mice show significantly reduced inflammation with decreased myofibroblasts in a unilateral ureteral obstruction (UUO) model, but the mechanism remains to be clarified. Nuclear factor-κB (NF-κB) activation plays a major role in the progression of inflammation in an obstructive nephropathy model. However, the key factors extending the duration of NF-κB activation in UUO are not known. In several inflammatory diseases, we and others recently found that TGase 2 plays a key role in extending NF-κB activation, which contributes to the pathogenesis of disease. In the current study, we found that NF-κB activity in mouse embryogenic fibroblasts (MEFs) from TGase2 -/- mice remained at the control level while the NF-κB activity of wild-type (WT) MEFs was highly increased under hypoxic stress. Using the obstructive nephropathy model, we found that NF-κB activity remained at the control level in TGase2 -/- mouse kidney tissues, as measured by COX-2 expression, but was highly increased in WT tissues. We conclude that TGase 2 gene ablation reduces the duration of NF-κB activation in ischemic injury.

  11. Mechanisms of the noxious inflammatory cycle in cystic fibrosis

    Directory of Open Access Journals (Sweden)

    Freyssinet Jean-Marie

    2009-03-01

    Full Text Available Abstract Multiple evidences indicate that inflammation is an event occurring prior to infection in patients with cystic fibrosis. The self-perpetuating inflammatory cycle may play a pathogenic part in this disease. The role of the NF-κB pathway in enhanced production of inflammatory mediators is well documented. The pathophysiologic mechanisms through which the intrinsic inflammatory response develops remain unclear. The unfolded mutated protein cystic fibrosis transmembrane conductance regulator (CFTRΔF508, accounting for this pathology, is retained in the endoplasmic reticulum (ER, induces a stress, and modifies calcium homeostasis. Furthermore, CFTR is implicated in the transport of glutathione, the major antioxidant element in cells. CFTR mutations can alter redox homeostasis and induce an oxidative stress. The disturbance of the redox balance may evoke NF-κB activation and, in addition, promote apoptosis. In this review, we examine the hypotheses of the integrated pathogenic processes leading to the intrinsic inflammatory response in cystic fibrosis.

  12. Functional conservation of rice OsNF-YB/YC and Arabidopsis AtNF-YB/YC proteins in the regulation of flowering time

    KAUST Repository

    Hwang, Yoon-Hyung

    2016-01-11

    Plant NUCLEAR FACTOR Y (NF-Y) transcription factors play important roles in plant development and abiotic stress. In Arabidopsis thaliana, two NF-YB (AtNF-YB2 and AtNF-YB3) and five NF-YC (AtNF-YC1, AtNF-YC2, AtNF-YC3, AtNF-YC4, and AtNF-YC9) genes regulate photoperiodic flowering by interacting with other AtNF-Y subunit proteins. Three rice NF-YB (OsNF-YB8, OsNF-YB10, and OsNF-YB11) and five rice OsNF-YC (OsNF-YC1, OsNF-YC2, OsNF-YC4, OsNF-YC6, and OsNF-YC7) genes are clustered with two AtNF-YB and five AtNF-YC genes, respectively. To investigate the functional conservation of these NF-YB and NF-YC genes in rice and Arabidopsis, we analyzed the flowering phenotypes of transgenic plants overexpressing the respective OsNF-YB and OsNF-YC genes in Arabidopsis mutants. Overexpression of OsNF-YB8/10/11 and OsNF-YC2 complemented the late flowering phenotype of Arabidopsis nf-yb2 nf-yb3 and nf-yc3 nf-yc4 nf-yc9 mutants, respectively. The rescued phenotype of 35S::OsNF-YC2 nf-yc3 nf-yc4 nf-yc9 plants was attributed to the upregulation of FLOWERING LOCUS T (FT) and SUPPRESSOR OF OVEREXPRESSION OF CONSTANS 1 (SOC1). In vitro and in planta protein–protein analyses revealed that OsNF-YB8/10/11 and OsNF-YC1/2/4/6/7 interact with AtNF-YC3/4/9 and AtNF-YB2/3, respectively. Our data indicate that some OsNF-YB and OsNF-YC genes are functional equivalents of AtNF-YB2/3 and AtNF-YC3/4/9 genes, respectively, and suggest functional conservation of Arabidopsis and rice NF-Y genes in the control of flowering time.

  13. Dynamic activity of NF-κB in multiple trauma patients and protective effects of ulinastain

    Directory of Open Access Journals (Sweden)

    LI Jun

    2012-02-01

    Full Text Available 【Abstract】Objective: To investigate the dynamic activity of NF-κB at the early stage of injury in multiple trauma patients and the protective effects of ulinastain. Methods: From January 2008 to May 2010, patients with multiple traumas admitted to our emergency department were enrolled in this study. Their age varied from 20-55 years. All enrolled patients were assigned randomly into control group (26 cases of multiple injury without ulinastain treatment, ulinastain group (25 cases of multiple injury with ulinastain treatment, and mild injury group (20 cases for basic control. The inclusion criteria for mild injury group were AIS-2005≤3, single wound, previously healthy inhospital patients without the history of surgical intervention. In addition to routine treatment, patients in ulinastain group were intravenously injected 200 000 IU of ulinastain dissolved in 100 ml of normal saline within 12 hours after injury and subsequently injected at the interval of every 8 hours for 7 days. NF-κB activity in monocytes and the level of TNF? IL-1, IL? in serum on admission (day 0, day 1, 2, 3, 4, and 7 were measured. Data were compared and analyzed between different groups. Results: NF-κB activity in monocytes and TNF? IL-1 and IL? of these patients reached peak levels at 24 hour after trauma, with gradual decrease to normal at 72 hour after trauma. NF-κB activity and levels of TNF? IL-1 and IL? were lower in ulinastain group than control one, without any significant difference between the two groups. The mean duration for systemic inflammatory response syndrome and multiple organ dysfunction syndrome was 7 d?.1 d and 10 d?.5 d in ulinastain group and control group respectively, and showed a significant difference. Conclusions: NF-κB activity in monocytes and the levels of inflammatory cytokines in multiply injured patients increased transiently at the early stage of trauma. Ulinastain may shorten the duration of systemic inflammatory

  14. Prenatal inflammation-induced NF-κB dyshomeostasis contributes to renin-angiotensin system over-activity resulting in prenatally programmed hypertension in offspring

    Science.gov (United States)

    Deng, Youcai; Deng, Yafei; He, Xiaoyan; Chu, Jianhong; Zhou, Jianzhi; Zhang, Qi; Guo, Wei; Huang, Pei; Guan, Xiao; Tang, Yuan; Wei, Yanling; Zhao, Shanyu; Zhang, Xingxing; Wei, Chiming; Namaka, Michael; Yi, Ping; Yu, Jianhua; Li, Xiaohui

    2016-01-01

    Studies involving the use of prenatally programmed hypertension have been shown to potentially contribute to prevention of essential hypertension (EH). Our previous research has demonstrated that prenatal inflammatory stimulation leads to offspring’s aortic dysfunction and hypertension in pregnant Sprague-Dawley rats challenged with lipopolysaccharide (LPS). The present study found that prenatal LPS exposure led to NF-κB dyshomeostasis from fetus to adult, which was characterized by PI3K-Akt activation mediated degradation of IκBα protein and impaired NF-κB self-negative feedback loop mediated less newly synthesis of IκBα mRNA in thoracic aortas (gestational day 20, postnatal week 7 and 16). Prenatal or postnatal exposure of the IκBα degradation inhibitor, pyrollidine dithiocarbamate, effectively blocked NF-κB activation, endothelium dysfunction, and renin-angiotensin system (RAS) over-activity in thoracic aortas, resulting in reduced blood pressure in offspring that received prenatal exposure to LPS. Surprisingly, NF-κB dyshomeostasis and RAS over-activity were only found in thoracic aortas but not in superior mesenteric arteries. Collectively, our data demonstrate that the early life NF-κB dyshomeostasis induced by prenatal inflammatory exposure plays an essential role in the development of EH through triggering RAS over-activity. We conclude that early life NF-κB dyshomeostasis is a key predictor of EH, and thus, NF-κB inhibition represents an effective interventional strategy for EH prevention. PMID:26877256

  15. Prenatal inflammation-induced NF-κB dyshomeostasis contributes to renin-angiotensin system over-activity resulting in prenatally programmed hypertension in offspring.

    Science.gov (United States)

    Deng, Youcai; Deng, Yafei; He, Xiaoyan; Chu, Jianhong; Zhou, Jianzhi; Zhang, Qi; Guo, Wei; Huang, Pei; Guan, Xiao; Tang, Yuan; Wei, Yanling; Zhao, Shanyu; Zhang, Xingxing; Wei, Chiming; Namaka, Michael; Yi, Ping; Yu, Jianhua; Li, Xiaohui

    2016-02-15

    Studies involving the use of prenatally programmed hypertension have been shown to potentially contribute to prevention of essential hypertension (EH). Our previous research has demonstrated that prenatal inflammatory stimulation leads to offspring's aortic dysfunction and hypertension in pregnant Sprague-Dawley rats challenged with lipopolysaccharide (LPS). The present study found that prenatal LPS exposure led to NF-κB dyshomeostasis from fetus to adult, which was characterized by PI3K-Akt activation mediated degradation of IκBα protein and impaired NF-κB self-negative feedback loop mediated less newly synthesis of IκBα mRNA in thoracic aortas (gestational day 20, postnatal week 7 and 16). Prenatal or postnatal exposure of the IκBα degradation inhibitor, pyrollidine dithiocarbamate, effectively blocked NF-κB activation, endothelium dysfunction, and renin-angiotensin system (RAS) over-activity in thoracic aortas, resulting in reduced blood pressure in offspring that received prenatal exposure to LPS. Surprisingly, NF-κB dyshomeostasis and RAS over-activity were only found in thoracic aortas but not in superior mesenteric arteries. Collectively, our data demonstrate that the early life NF-κB dyshomeostasis induced by prenatal inflammatory exposure plays an essential role in the development of EH through triggering RAS over-activity. We conclude that early life NF-κB dyshomeostasis is a key predictor of EH, and thus, NF-κB inhibition represents an effective interventional strategy for EH prevention.

  16. In vivo anti-inflammatory activity of Liquidambar formosana Hance ...

    African Journals Online (AJOL)

    serum decreased and the levels of anti-inflammatory cytokine IL-10 increased (p < 0.01). In addition,. ELF treatment resulted in decrease of COX-2 (p < 0.01), iNOS (p < 0.01) and NF-κB p65 (p < 0.01) expressions in Wistar rats. Conclusion: The results reveal that ELF possesses significant anti-inflammatory effect in vivo.

  17. Functional Analysis of Drosophila NF1

    National Research Council Canada - National Science Library

    Bernards, Andre

    2005-01-01

    ...) for Ras, yet homozygous loss of a highly conserved Drosophila NF1 ortholog results in several phenotypes that are insensitive to manipulating Ras signal transduction, but rescued by increasing...

  18. Anti-inflammatory glucocorticoids: changing concepts.

    Science.gov (United States)

    Newton, Robert

    2014-02-05

    Despite being the most effective anti-inflammatory treatment for chronic inflammatory diseases, the mechanisms by which glucocorticoids (corticosteroids) effect repression of inflammatory gene expression remain incompletely understood. Direct interaction of the glucocorticoid receptor (NR3C1) with inflammatory transcription factors to repress transcriptional activity, i.e. transrepression, represents one mechanism of action. However, transcriptional activation, or transactivation, by NR3C1 also represents an important mechanism of glucocorticoid action. Glucocorticoids rapidly and profoundly increase expression of multiple genes, many with properties consistent with the repression of inflammatory gene expression. For example: the dual specificity phosphatase, DUSP1, reduces activation of mitogen-activated protein kinases; glucocorticoid-induced leucine zipper (TSC22D3) represses nuclear factor-κB (NF-κB) and activator protein 1 (AP-1) transcriptional responses; inhibitor of κBα (NFKBIA) inhibits NF-κB; tristraprolin (ZFP36) destabilises and translationally represses inflammatory mRNAs; CDKN1C, a cell cycle regulator, may attenuate JUN N-terminal kinase signalling; and regulator of G-protein signalling 2 (RGS2), by reducing signalling from Gαq-linked G protein-coupled receptors (GPCRs), is bronchoprotective. While glucocorticoid-dependent transrepression can co-exist with transactivation, transactivation may account for the greatest level and most potent repression of inflammatory genes. Equally, NR3C1 transactivation is enhanced by β2-adrenoceptor agonists and may explain the enhanced clinical efficacy of β2-adrenoceptor/glucocorticoid combination therapies in asthma and chronic obstructive pulmonary disease. Finally, NR3C1 transactivation is reduced by inflammatory stimuli, including respiratory syncytial virus and human rhinovirus. This provides an explanation for glucocorticoid resistance. Continuing efforts to understand roles for glucocorticoid

  19. NF1 Signal Transduction and Vascular Dysfunction

    Science.gov (United States)

    2014-05-01

    the effects of losing a second allele of NF1 in the vascular endothelium of the adult mouse. This will be the first model of NF1 loss in the... adult endothelium and can serve as a model system for investigation of both cardiovascular effects and the tumor microenvironment. Body: Aim 1...would be to try and determine if there were defects in TGF-b signaling (Smad activation/EndMT) prior to doing a wholesale catalog of all the

  20. TLR4 activates NF-{kappa}B in human ovarian granulosa tumor cells

    Energy Technology Data Exchange (ETDEWEB)

    Woods, Dori C., E-mail: dwoods2@partners.org [Vincent Center for Reproductive Biology, Vincent Obstetrics and Gynecology Service, Massachusetts General Hospital/Harvard Medical School, Boston, MA 02114 (United States); White, Yvonne A.R. [Vincent Center for Reproductive Biology, Vincent Obstetrics and Gynecology Service, Massachusetts General Hospital/Harvard Medical School, Boston, MA 02114 (United States); Dau, Caroline [University of California, San Francisco, School of Dentistry, San Francisco, CA 94143 (United States); Johnson, A.L. [Center for Reproductive Biology and Health, The Pennsylvania State University, University Park, PA 16802 (United States)

    2011-06-17

    Highlights: {yields} TLR4 is expressed in human ovarian granulosa tumor cells. {yields} Acting through TLR4, LPS and HSP60 induce a NF{kappa}B signaling cascade in human ovarian granulosa tumor cells. {yields} NF{kappa}B activation or inhibition did not alter chemosensitivity to TRAIL or cisplatin. -- Abstract: Previous studies have demonstrated expression of Toll-like receptors (TLRs) in the surface epithelium of normal ovaries (OSE) and in epithelial ovarian tumors. Most notably, OSE-derived cancers express TLR4, which activates the nuclear factor-kappa B (NF-{kappa}B) signaling cascade as a mediator of inflammatory response. Currently, there is considerable interest in elucidating the role of TLR-mediated signaling in cancers. Nevertheless, the expression of TLRs in granulosa cell tumors (GCTs) of the ovary, and the extent to which GCT expression of TLRs may influence cell-signaling pathways and/or modulate the efficacy of chemotherapeutics, has yet to be determined. In the present study, human GCT lines (COV434 and KGN) were utilized to evaluate expression of functional TLR4. TLR4 is expressed in GCT cell lines and ligation of TLR4 with bacterial lipopolysaccharide (LPS) led to I{kappa}B degradation and activation of NF-{kappa}B. NF-{kappa}B activation was confirmed by nuclear localization of NF-{kappa}B p65 following treatment with LPS and the naturally occurring ligand, HSP60. Notably, immunoneutralization of TLR4 blocked nuclear localization, and inhibition of NF-{kappa}B signaling attenuated LPS-induced TNF{alpha} plus increased doubling time in both cell lines. Contradictory to reports using human OSE cell lines, inhibition of NF-{kappa}B signaling failed to sensitize GCT lines to TRAIL or cisplatin. In summary, findings herein are the first to demonstrate a functional TLR-signaling pathway specifically in GCTs, and indicate that in contrast to OSE-derived cancers, inhibition of NF-{kappa}B does not sensitize GCTs to TRAIL or cisplatin.

  1. Classical NF-κB activation impairs skeletal muscle oxidative phenotype by reducing IKK-α expression.

    Science.gov (United States)

    Remels, A H V; Gosker, H R; Langen, R C; Polkey, M; Sliwinski, P; Galdiz, J; van den Borst, B; Pansters, N A; Schols, A M W J

    2014-02-01

    Loss of quadriceps muscle oxidative phenotype (OXPHEN) is an evident and debilitating feature of chronic obstructive pulmonary disease (COPD). We recently demonstrated involvement of the inflammatory classical NF-κB pathway in inflammation-induced impairments in muscle OXPHEN. The exact underlying mechanisms however are unclear. Interestingly, IκB kinase α (IKK-α: a key kinase in the alternative NF-κB pathway) was recently identified as a novel positive regulator of skeletal muscle OXPHEN. We hypothesised that inflammation-induced classical NF-κB activation contributes to loss of muscle OXPHEN in COPD by reducing IKK-α expression. Classical NF-κB signalling was activated (molecularly or by tumour necrosis factor α: TNF-α) in cultured myotubes and the impact on muscle OXPHEN and IKK-α levels was investigated. Moreover, the alternative NF-κB pathway was modulated to investigate the impact on muscle OXPHEN in absence or presence of an inflammatory stimulus. As a proof of concept, quadriceps muscle biopsies of COPD patients and healthy controls were analysed for expression levels of IKK-α, OXPHEN markers and TNF-α. IKK-α knock-down in cultured myotubes decreased expression of OXPHEN markers and key OXPHEN regulators. Moreover, classical NF-κB activation (both by TNF-α and IKK-β over-expression) reduced IKK-α levels and IKK-α over-expression prevented TNF-α-induced impairments in muscle OXPHEN. Importantly, muscle IKK-α protein abundance and OXPHEN was reduced in COPD patients compared to controls, which was more pronounced in patients with increased muscle TNF-α mRNA levels. Classical NF-κB activation impairs skeletal muscle OXPHEN by reducing IKK-α expression. TNF-α-induced reductions in muscle IKK-α may accelerate muscle OXPHEN deterioration in COPD. Copyright © 2013 Elsevier B.V. All rights reserved.

  2. Nuclear IL-33 is a transcriptional regulator of NF-κB p65 and induces endothelial cell activation

    International Nuclear Information System (INIS)

    Choi, Yeon-Sook; Park, Jeong Ae; Kim, Jihye; Rho, Seung-Sik; Park, Hyojin; Kim, Young-Myeong; Kwon, Young-Guen

    2012-01-01

    Highlights: ► IL-33 as nuclear factor regulated expression of ICAM-1 and VCAM-1. ► Nuclear IL-33 increased the transcription of NF-κB p65 by binding to the p65 promoter. ► Nuclear IL-33 controls NF-κB-dependent inflammatory responses. -- Abstract: Interleukin (IL)-33, an IL-1 family member, acts as an extracellular cytokine by binding its cognate receptor, ST2. IL-33 is also a chromatin-binding transcriptional regulator highly expressed in the nuclei of endothelial cells. However, the function of IL-33 as a nuclear factor is poorly defined. Here, we show that IL-33 is a novel transcriptional regulator of the p65 subunit of the NF-κB complex and is involved in endothelial cell activation. Quantitative reverse transcriptase PCR and Western blot analyses indicated that IL-33 mediates the expression of intercellular adhesion molecule (ICAM)-1 and vascular cell adhesion molecule (VCAM)-1 in endothelial cells basally and in response to tumor necrosis factor-α-treatment. IL-33-induced ICAM-1/VCAM-1 expression was dependent on the regulatory effect of IL-33 on the nuclear factor (NF)-κB pathway; NF-κB p65 expression was enhanced by IL-33 overexpression and, conversely, reduced by IL-33 knockdown. Moreover, NF-κB p65 promoter activity and chromatin immunoprecipitation analysis revealed that IL-33 binds to the p65 promoter region in the nucleus. Our data provide the first evidence that IL-33 in the nucleus of endothelial cells participates in inflammatory reactions as a transcriptional regulator of NF-κB p65.

  3. In silico analysis of compounds characterized from ethanolic extract of Cucurbita pepo with NF-κB-inhibitory potential

    Directory of Open Access Journals (Sweden)

    Solomon O. Rotimi

    2014-12-01

    Full Text Available NF-κB controls cellular growth properties of cells and its regulation is key to the management of disease like cancer. Although plant-derived bioactives have been reported to inhibit NF-κB, there is limited knowledge on the interactions between the phytochemicals and NF-κB. In this study, we identified the phytochemicals in ethanolic extract of Cucurbita pepo using Gas Chromatography-Mass Spectroscopy technique and used in silico approach to understand the interaction between the identified phytochemicals and NF-κB using Molegro Virtual Docker. The docking algorithm showed that nine phytochemicals fit well into the pocket on NF-κB. Our analysis showed that Lys144 is a prominent residue by involving in the binding of 9-octadecenoic acid (Z-, methyl ester, hexadecanoic acid, methyl ester and octadecanoic acid, methyl ester with the moldock score of -55.5264, -57.4634 and -61.1258 respectively. Hence, the binding of these phytochemicals to NF-κB could be responsible for the anti-inflammatory and anti-cancer property of C. pepo.

  4. TAK1 regulates NF-ΚB and AP-1 activation in airway epithelial cells following RSV infection

    International Nuclear Information System (INIS)

    Dey, Nilay; Liu Tianshuang; Garofalo, Roberto P.; Casola, Antonella

    2011-01-01

    Respiratory syncytial virus (RSV) is the most common cause of epidemic respiratory diseases in infants and young children. RSV infection of airway epithelial cells induces the expression of immune/inflammatory genes through the activation of a subset of transcription factors, including Nuclear Factor-κB (NF-κB) and AP-1. In this study, we have investigated the signaling pathway leading to activation of these two transcription factors in response to RSV infection. Our results show that IKKβ plays a key role in viral-induced NF-κB activation, while JNK regulates AP-1-dependent gene transcription, as demonstrated by using kinase inactive proteins and chemical inhibitors of the two kinases. Inhibition of TAK1 activation, by overexpression of kinase inactive TAK1 or using cells lacking TAK1 expression, significantly reduced RSV-induced NF-κB and AP-1 nuclear translocation and DNA-binding activity, as well as NF-κB-dependent gene expression, identifying TAK1 as an important upstream signaling molecule regulating RSV-induced NF-κB and AP-1 activation. - Highlights: → IKKβ is a major kinase involved in RSV-induced NF-κB activation. → JNK regulates AP-1-dependent gene transcription in RSV infection. → TAK1 is a critical upstream signaling molecule for both pathways in infected cells.

  5. Canonical and Non-Canonical NF-κB Signaling Promotes Breast Cancer Tumor-Initiating Cells

    Science.gov (United States)

    Kendellen, Megan F.; Bradford, Jennifer W.; Lawrence, Cortney L.; Clark, Kelly S.; Baldwin, Albert S.

    2014-01-01

    Tumor-initiating cells (TICs) are a sub-population of cells that exhibit a robust ability to self-renew and contribute to the formation of primary tumors, the relapse of previously treated tumors, and the development of metastases. TICs have been identified in various tumors, including those of the breast, and are particularly enriched in the basal-like and claudin-low subtypes of breast cancer. The signaling pathways that contribute to the function and maintenance of TICs are under intense study. We explored the potential involvement of the NF-κB family of transcription factors in TICs in cell lines that are representative of basal-like and claudin-low breast cancer. NF-κB was found to be activated in breast cancer cells that form tumorspheres efficiently. Moreover, both canonical and non-canonical NF-κB signaling is required for these cells to self-renew in vitro and to form xenograft tumors efficiently in vivo using limiting dilutions of cells. Consistent with this, canonical and non-canonical NF-κB signaling is activated in TICs isolated from breast cancer cell lines. Experimental results indicate that NF-κB promotes the function of TICs by stimulating epithelial-to-mesenchymal transition (EMT) and by upregulating the expression of the inflammatory cytokines IL-1β and IL-6. The results suggest the use of NF-κB inhibitors for clinical therapy of certain breast cancers. PMID:23474754

  6. Inhibition of NF-κB activity by the porcine epidemic diarrhea virus nonstructural protein 1 for innate immune evasion.

    Science.gov (United States)

    Zhang, Qingzhan; Ma, Jinyou; Yoo, Dongwan

    2017-10-01

    Porcine epidemic diarrhea virus emerged in the US is known to suppress the type I interferons response during infection. In the present study using porcine epithelial cells, we showed that PEDV inhibited both NF-κB and proinflammatory cytokines. PEDV blocked the p65 activation in infected cells and suppressed the PRD II-mediated NF-κB activity. Of the total of 22 viral proteins, nine proteins were identified as NF-κB antagonists, and nsp1 was the most potent suppressor of proinflammatory cytokines. Nsp1 interfered the phosphorylation and degradation of IκBα, and thus blocked the p65 activation. Mutational studies demonstrated the essential requirements of the conserved residues of nsp1 for NF-κB suppression. Our study showed that PEDV inhibited NF-κB activity and nsp1 was a potent NF-κB antagonist for suppression of both IFN and early production of pro-inflammatory cytokines. Copyright © 2017 Elsevier Inc. All rights reserved.

  7. Andrographolide protects against LPS-induced acute lung injury by inactivation of NF-κB.

    Directory of Open Access Journals (Sweden)

    Tao Zhu

    Full Text Available Nuclear factor-κB (NF-κB is a central transcriptional factor and a pleiotropic regulator of many genes involved in acute lung injury. Andrographolide is found in the plant of Andrographis paniculata and widely used in Traditional Chinese Medicine, exhibiting potently anti-inflammatory property by inhibiting NF-κB activity. The purpose of our investigation was designed to reveal the effect of andrographolide on various aspects of LPS induced inflammation in vivo and in vitro.In vivo, BALB/C mice were subjected to LPS injection with or without andrographolide treatments to induce ALI model. In vitro, MLE-12 cells were stimulated with LPS in the presence and absence of andrographolide. In vivo, pulmonary inflammation, pulmonary edema, ultrastructure changes of type II alveolar epithelial cells, MPO activity, total cells, neutrophils, macrophages, TNF-α, IL-6 and IL-1β in BALF, along with the expression of VCAM-1 and VEGF were dose-dependently attenuated by andrographolide. Meanwhile, in vitro, the expression of VCAM-1 and VEGF was also reduced by andrographolide. Moreover, our data showed that andrographolide significantly inhibited the ratios of phospho-IKKβ/total IKKβ, phospho-IκBα/total IκBα and phospho-NF-κB p65/total NF-κB p65, and NF-κB p65 DNA binding activities, both in vivo and in vitro.These results indicate that andrographolide dose-dependently suppressed the severity of LPS-induced ALI, more likely by virtue of andrographolide-mediated NF-κB inhibition at the level of IKKβ activation. These results suggest andrographolide may be considered as an effective and safe drug for the potential treatment of ALI.

  8. Andrographolide Protects against LPS-Induced Acute Lung Injury by Inactivation of NF-κB

    Science.gov (United States)

    Zhu, Tao; Wang, Dao-xin; Zhang, Wei; Liao, Xiu-qing; Guan, Xian; Bo, Hong; Sun, Jia-yang; Huang, Ni-wen; He, Jing; Zhang, Yun-kun; Tong, Jing; Li, Chang-yi

    2013-01-01

    Background Nuclear factor-κB (NF-κB) is a central transcriptional factor and a pleiotropic regulator of many genes involved in acute lung injury. Andrographolide is found in the plant of Andrographis paniculata and widely used in Traditional Chinese Medicine, exhibiting potently anti-inflammatory property by inhibiting NF-κB activity. The purpose of our investigation was designed to reveal the effect of andrographolide on various aspects of LPS induced inflammation in vivo and in vitro. Methods and Results In vivo, BALB/C mice were subjected to LPS injection with or without andrographolide treatments to induce ALI model. In vitro, MLE-12 cells were stimulated with LPS in the presence and absence of andrographolide. In vivo, pulmonary inflammation, pulmonary edema, ultrastructure changes of type II alveolar epithelial cells, MPO activity, total cells, neutrophils, macrophages, TNF-α, IL-6 and IL-1β in BALF, along with the expression of VCAM-1 and VEGF were dose-dependently attenuated by andrographolide. Meanwhile, in vitro, the expression of VCAM-1 and VEGF was also reduced by andrographolide. Moreover, our data showed that andrographolide significantly inhibited the ratios of phospho-IKKβ/total IKKβ, phospho-IκBα/total IκBα and phospho-NF-κB p65/total NF-κB p65, and NF-κB p65 DNA binding activities, both in vivo and in vitro. Conclusions These results indicate that andrographolide dose-dependently suppressed the severity of LPS-induced ALI, more likely by virtue of andrographolide-mediated NF-κB inhibition at the level of IKKβ activation. These results suggest andrographolide may be considered as an effective and safe drug for the potential treatment of ALI. PMID:23437127

  9. Sustained, neuron-specific IKK/NF-κB activation generates a selective neuroinflammatory response promoting local neurodegeneration with aging.

    Science.gov (United States)

    Maqbool, Ayesha; Lattke, Michael; Wirth, Thomas; Baumann, Bernd

    2013-10-12

    Increasing evidence indicates that neuroinflammation is a critical factor contributing to the progression of various neurodegenerative diseases. The IKK/NF-κB signalling system is a central regulator of inflammation, but it also affects neuronal survival and differentiation. A complex interplay between different CNS resident cells and infiltrating immune cells, which produce and respond to various inflammatory mediators, determines whether neuroinflammation is beneficial or detrimental. The IKK/NF-κB system is involved in both production of and responses to these mediators, although the precise contribution depends on the cell type as well as the cellular context, and is only partially understood. Here we investigated the specific contribution of neuronal IKK/NF-κB signalling on the regulation of neuroinflammatory processes and its consequences. To address this issue, we established and analysed a conditional gain-of-function mouse model that expresses a constitutively active allele of IKK2 in principal forebrain neurons (IKK2nCA). Proinflammatory gene and growth factor expression, histopathology, microgliosis, astrogliosis, immune cell infiltration and spatial learning were assessed at different timepoints after persistent canonical IKK2/NF-κB activation. In contrast to other cell types and organ systems, chronic IKK2/NF-κB signalling in forebrain neurons of adult IKK2nCA animals did not cause a full-blown inflammatory response including infiltration of immune cells. Instead, we found a selective inflammatory response in the dentate gyrus characterized by astrogliosis, microgliosis and Tnf-α upregulation. Furthermore, downregulation of the neurotrophic factor Bdnf correlated with a selective and progressive atrophy of the dentate gyrus and a decline in hippocampus-dependent spatial learning. Neuronal degeneration was associated with increased Fluoro-jade staining, but lacked activation of apoptosis. Remarkably, neuronal loss could be partially reversed when

  10. Mir-29b Mediates the Neural Tube versus Neural Crest Fate Decision during Embryonic Stem Cell Neural Differentiation.

    Science.gov (United States)

    Xi, Jiajie; Wu, Yukang; Li, Guoping; Ma, Li; Feng, Ke; Guo, Xudong; Jia, Wenwen; Wang, Guiying; Yang, Guang; Li, Ping; Kang, Jiuhong

    2017-08-08

    During gastrulation, the neuroectoderm cells form the neural tube and neural crest. The nervous system contains significantly more microRNAs than other tissues, but the role of microRNAs in controlling the differentiation of neuroectodermal cells into neural tube epithelial (NTE) cells and neural crest cells (NCCs) remains unknown. Using embryonic stem cell (ESC) neural differentiation systems, we found that miR-29b was upregulated in NTE cells and downregulated in NCCs. MiR-29b promoted the differentiation of ESCs into NTE cells and inhibited their differentiation into NCCs. Accordingly, the inhibition of miR-29b significantly inhibited the differentiation of NTE cells. A mechanistic study revealed that miR-29b targets DNA methyltransferase 3a (Dnmt3a) to regulate neural differentiation. Moreover, miR-29b mediated the function of Pou3f1, a critical neural transcription factor. Therefore, our study showed that the Pou3f1-miR-29b-Dnmt3a regulatory axis was active at the initial stage of neural differentiation and regulated the determination of cell fate. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

  11. 20-Hydroxycholecalciferol, product of vitamin D3 hydroxylation by P450scc, decreases NF-kappaB activity by increasing IkappaB alpha levels in human keratinocytes.

    Directory of Open Access Journals (Sweden)

    Zorica Janjetovic

    Full Text Available The side chain of vitamin D3 is hydroxylated in a sequential manner by cytochrome P450scc (CYP11A1 to form 20-hydroxycholecalciferol, which can induce growth arrest and differentiation of both primary and immortalized epidermal keratinocytes. Since nuclear factor-kappaB (NF-kappaB plays a pivotal role in the regulation of cell proliferation, differentiation and apoptosis, we examined the capability of 20-hydroxycholecalciferol to modulate the activity of NF-kappaB, using 1,25-dihydroxycholecalciferol (calcitriol as a positive control. 20-hydroxycholecalciferol inhibits the activation of NFkappaB DNA binding activity as well as NF-kappaB-driven reporter gene activity in keratinocytes. Also, 20-hydroxycholecalciferol induced significant increases in the mRNA and protein levels of the NF-kappaB inhibitor protein, IkappaB alpha, in a time dependent manner, while no changes in total NF-kappaB-p65 mRNA or protein levels were observed. Another measure of NF-kappaB activity, p65 translocation from the cytoplasm into the nucleus was also inhibited in extracts of 20-hydroxycholecalciferol treated keratinocytes. Increased IkappaB alpha was concomitantly observed in cytosolic extracts of 20-hydroxycholecalciferol treated keratinocytes, as determined by immunoblotting and immunofluorescent staining. In keratinocytes lacking vitamin D receptor (VDR, 20-hydroxycholecalciferol did not affect IkappaB alpha mRNA levels, indicating that it requires VDR for its action on NF-kappaB activity. Comparison of the effects of calcitrol, hormonally active form of vitamin D3, with 20-hydrocholecalciferol show that both agents have a similar potency in inhibiting NF-kappaB. Since NF-kappaB is a major transcription factor for the induction of inflammatory mediators, our findings indicate that 20-hydroxycholecalciferol may be an effective therapeutic agent for inflammatory and hyperproliferative skin diseases.

  12. Hepatitis B virus polymerase suppresses NF-κB signaling by inhibiting the activity of IKKs via interaction with Hsp90β.

    Directory of Open Access Journals (Sweden)

    Dan Liu

    Full Text Available Nuclear factor-κB (NF-κB plays a central role in the regulation of diverse biological processes, including immune responses, development, cell growth, and cell survival. To establish persistent infection, many viruses have evolved strategies to evade the host's antiviral immune defenses. In the case of hepatitis B virus (HBV, which can cause chronic infection in the liver, immune evasion strategies used by the virus are not fully understood. It has recently been reported that the polymerase of HBV (Pol inhibits interferon-β (IFN-β activity by disrupting the interaction between IKKε and the DDX3. In the current study, we found that HBV Pol suppressed NF-κB signaling, which can also contribute to IFN-β production. HBV Pol did not alter the level of NF-κB expression, but it prevented NF-κB subunits involved in both the canonical and non-canonical NF-κB pathways from entering the nucleus. Further experiments demonstrated that HBV Pol preferentially suppressed the activity of the IκB kinase (IKK complex by disrupting the association of IKK/NEMO with Cdc37/Hsp90, which is critical for the assembly of the IKK complex and recruitment of the IKK complex to the tumor necrosis factor type 1 receptor (TNF-R1. Furthermore, we found that HBV Pol inhibited the NF-κB-mediated transcription of target genes. Taken together, it is suggested that HBV Pol could counteract host innate immune responses by interfering with two distinct signaling pathways required for IFN-β activation. Our studies therefore shed light on a potential therapeutic target for persistent infection with HBV.

  13. Uric Acid Induces Renal Inflammation via Activating Tubular NF-κB Signaling Pathway

    Science.gov (United States)

    Zhou, Yang; Fang, Li; Jiang, Lei; Wen, Ping; Cao, Hongdi; He, Weichun; Dai, Chunsun; Yang, Junwei

    2012-01-01

    Inflammation is a pathologic feature of hyperuricemia in clinical settings. However, the underlying mechanism remains unknown. Here, infiltration of T cells and macrophages were significantly increased in hyperuricemia mice kidneys. This infiltration of inflammatory cells was accompanied by an up-regulation of TNF-α, MCP-1 and RANTES expression. Further, infiltration was largely located in tubular interstitial spaces, suggesting a role for tubular cells in hyperuricemia-induced inflammation. In cultured tubular epithelial cells (NRK-52E), uric acid, probably transported via urate transporter, induced TNF-α, MCP-1 and RANTES mRNA as well as RANTES protein expression. Culture media of NRK-52E cells incubated with uric acid showed a chemo-attractive ability to recruit macrophage. Moreover uric acid activated NF-κB signaling. The uric acid-induced up-regulation of RANTES was blocked by SN 50, a specific NF-κB inhibitor. Activation of NF-κB signaling was also observed in tubule of hyperuricemia mice. These results suggest that uric acid induces renal inflammation via activation of NF-κB signaling. PMID:22761883

  14. Short communication: molecular characterization of dog and cat p65 subunits of NF-kappaB.

    Science.gov (United States)

    Ishikawa, Shingo; Takemitsu, Hiroshi; Li, Gebin; Mori, Nobuko; Yamamoto, Ichiro; Arai, Toshiro

    2015-04-01

    Nuclear factor kappa B (NF-κB) plays an important role in the immune system. The p65 subunit is an important part of NF-κB unit, and studies of dog and cat p65 subunits of NF-κB (dp65 and cp65) are important in understanding their immune function. In this study, we described the molecular characterization of dp65 and cp65. The dp65 and cp65 complementary DNA encoded 542 and 555 amino acids, respectively, showing a high sequence homology with the mammalian p65 subunit (>87.5%). Quantitative polymerase chain reaction revealed that the p65 messenger RNA is highly expressed in the dog stomach and cat heart and adipose tissue. Functional NF-κB promoter-luciferase reporter vectors revealed that our isolated dp65 and cp65 cDNA encodes a functionally active protein. Transiently expressed dp65 and cp65 up-regulated pro-inflammatory cytokine expression levels in dog and cat, respectively. These findings suggest that dp65 and cp65 play important roles in regulating immune function. Copyright © 2015 Elsevier Ltd. All rights reserved.

  15. Chicoric acid suppresses BAFF expression in B lymphocytes by inhibiting NF-κB activity.

    Science.gov (United States)

    Chen, Lingxi; Huang, Gang; Gao, Min; Shen, Xiaodong; Gong, Wei; Xu, Zhizhen; Zeng, Yijun; He, Fengtian

    2017-03-01

    B cell activating factor belonging to the TNF family (BAFF) plays a critical role in the pathogenesis of autoimmune diseases. The inhibition of BAFF expression is an emerging therapeutic approach for these disorders. Chicoric acid (CA), a bioactive phytochemical found in several widely used traditional medicinal plants, has significant anti-inflammatory activity and anti-arthritic effects. However, the role of CA in modulation of BAFF expression remains unknown. In this study, we demonstrated that CA reduced BAFF expression in human B lymphocyte cell lines and decreased the DNA-binding activity of nuclear factor-κB (NF-κB) in the BAFF promoter region. Furthermore, CA inhibited both the nuclear translocation of p65 (the subunit of NF-κB) and the phosphorylation of IκBα (inhibitor of NF-κB). These results suggest that CA suppresses BAFF expression by inhibiting NF-κB activity, and CA may serve as a novel therapeutic agent to down-regulate excessive BAFF expression in autoimmune diseases. Copyright © 2017 Elsevier B.V. All rights reserved.

  16. Dusuqing granules (DSQ) suppress inflammation in Klebsiella pneumonia rat via NF-κB/MAPK signaling.

    Science.gov (United States)

    Mei, Xue; Wang, Hao-Xun; Li, Jian-Sheng; Liu, Xiao-Hui; Lu, Xiao-Fan; Li, Ya; Zhang, Wei-Yu; Tian, Yan-Ge

    2017-04-17

    Dusuqing granules (DSQ) have been used in the treatment of bacterial pneumonia clinically, with remarkable benefits. This study was initiated to explore the effects of DSQ on pulmonary inflammation by regulating nuclear factor (NF)-κB/mitogen-activated protein kinase (MAPK) signaling in bacterial pneumonia rats. Rat model was duplicated with Klebsiella pneumonia by a one-time intratracheal injection. Rats were randomized into control, model, DSQ and levofloxacin (LVX) groups. After administrated with appropriate medicines for 7 days, lung tissues were harvested and prepared for pathological analysis, and interleukin (IL)-1, IL-6, monocyte chemotactic protein (MCP)-1and macrophage inflammatory protein (MIP)-2 detections. NF-κB mRNA was measured by real-time qPCR, and the phosphorylation and total proteins of P38MAPK, JNK46/54, ERK42/44 were determined by Western blotting. Marked pathological impairments were observed in model rats, whereas were improved in DSQ group. The cytokines levels, NF-κB mRNA expression and the phosphorylation of P38MAPK, JNK46/54 and ERK42/44 proteins were significantly higher in model group, and were significantly depressed in DSQ group. The protective effects of DSQ on Klebsiella pneumonia might be attributed to its inactivative effects of NF-κB/ MAPK pathway.

  17. Squid Giant Axons Synthesize NF Proteins.

    Science.gov (United States)

    Crispino, Marianna; Chun, Jong Tai; Giuditta, Antonio

    2018-04-01

    Squid giant axon has been an excellent model system for studying fundamental topics in neurobiology such as neuronal signaling. It has been also useful in addressing the questions of local protein synthesis in the axons. Incubation of isolated squid giant axons with [ 35 S]methionine followed by immunoprecipitation with a rabbit antibody against all squid neurofilament (NF) proteins demonstrates the local synthesis of a major 180 kDa NF protein and of several NF proteins of lower molecular weights. Their identification as NF proteins is based on their absence in the preimmune precipitates. Immunoprecipitates washed with more stringent buffers confirmed these results. Our data are at variance with a recent study based on the same experimental procedure that failed to visualize the local synthesis of NF proteins by the giant axon and thereby suggested their exclusive derivation from nerve cell bodies (as reported by Gainer et al. in Cell Mol Neurobiol 37:475-486, 2017). By reviewing the pertinent literature, we confute the claims that mRNA translation is absent in mature axons because of a putative translation block and that most proteins of mature axons are synthesized in the surrounding glial cells. Given the intrinsic axonal capacity to synthesize proteins, we stress the glial derivation of axonal and presynaptic RNAs and the related proposal that these neuronal domains are endowed with largely independent gene expression systems (as reported by Giuditta et al. in Physiol Rev 88:515-555, 2008).

  18. Cervical neurofibromas in children with NF-1

    International Nuclear Information System (INIS)

    Chung, C.J.; Mukherji, S.K.; Fordham, L.A.; Armfield, K.B.; Krause, W.L.

    1999-01-01

    Background. Children with neurofibromatosis type 1 (NF1) are at increased risk of developing plexiform neurofibroma throughout the body, including the cervical soft tissues. However, the incidence of cervical soft tissue tumors and the value of screening MR for children with NF1 are not known. Purpose. The purposes of this study were to determine the incidence and clinical significance of cervical tumors seen on MR imaging in children with NF1. Materials and methods. A retrospective review of the brain and orbit MR with cervical images obtained on 95 children who meet the NIH consensus criteria for NF1 and who are followed at our neurofibromatosis clinic was carried out. Results. Cervical tumors were found on MR imaging in 21 of 95 (22 %) children. Of 21 children with cervical tumors, 14 children were determined to be surgical candidates. In nine children, MR imaging altered the clinical management by demonstrating tumors for which surgery was indicated, but the tumors were not suspected prior to MR imaging. Conclusion. Cervical tumors are commonly seen in children with NF1. MR imaging may demonstrate a significant number of tumors that require surgery, but were not suspected prior to MR imaging. (orig.)

  19. Linalool inhibits cigarette smoke-induced lung inflammation by inhibiting NF-κB activation.

    Science.gov (United States)

    Ma, Jianqun; Xu, Hai; Wu, Jun; Qu, Changfa; Sun, Fenglin; Xu, Shidong

    2015-12-01

    Linalool, a natural compound that exists in the essential oils of several aromatic plants species, has been reported to have anti-inflammatory effects. However, the effects of linalool on cigarette smoke (CS)-induced acute lung inflammation have not been reported. In the present study, we investigated the protective effects of linalool on CS-induced acute lung inflammation in mice. Linalool was given i.p. to mice 2h before CS exposure daily for five consecutive days. The numbers of macrophages and neutrophils in bronchoalveolar lavage fluid (BALF) were measured. The production of TNF-α, IL-6, IL-1β, IL-8 and MCP-1 were detected by ELISA. The expression of NF-κB was detected by Western blotting. Our results showed that treatment of linalool significantly attenuated CS-induced lung inflammation, coupled with inhibited the infiltration of inflammatory cells and TNF-α, IL-6, IL-1β, IL-8 and MCP-1 production. Meanwhile, treatment of linalool inhibited CS-induced lung MPO activity and pathological changes. Furthermore, linalool suppressed CS-induced NF-κB activation in a dose-dependent manner. In conclusion, our results demonstrated that linalool protected against CS-induced lung inflammation through inhibiting CS-induced NF-κB activation. Copyright © 2015 Elsevier B.V. All rights reserved.

  20. The effect of intracellular delivery of catalase and antisense oligonucleotides to NF-kappaB using albumin microcapsules in the endotoxic shock model.

    Science.gov (United States)

    Siwale, Rodney C; Oettinger, Carl W; Addo, Richard; Siddig, Aladin; D'Souza, Martin J

    2009-11-01

    Microencapsulated (MC) catalase has been shown to inhibit H(2)O(2) and tumor necrosis factor (TNF) in vitro after endotoxin stimulation. It is the purpose of this study to determine whether MC catalase improves pro-inflammatory cytokine inhibition and mortality in an endotoxic shock model in vivo. We also examined whether MC catalase and antisense oligonucleotides (ASO) to nuclear factor kappaB (NF-kappaB) together improved survival by inhibiting pro-inflammatory cytokines using different mechanisms. Albumin microcapsules containing catalase and ASO to NF-kappaB were prepared 2-7 microm in size by using a Büchi spray dryer. Progressively increasing doses of MC catalase, MC ASO to NF-kappaB, and the combination were given to rats before the administration of Escherichia coli endotoxin. Results demonstrated 60% survival in rats given 15 mg/kg MC catalase, 70% survival with 20 mg/kg MC ASO NF-kappaB, and 80% survival with the combination. TNF was inhibited by 53% in the MC catalase group 4 h after endotoxin administration, 43% in the ASO NF-kappaB group, and 78% in the combination group compared to controls. In conclusion, this study demonstrates the effectiveness of MC intracellular delivery of the naturally occurring antioxidant catalase in improving animal survival. The addition of ASO to NF-kappaB improved both cytokine inhibition and animal survival in endotoxic shock.

  1. A triacylated lipoprotein from Mycoplasma genitalium activates NF-kappaB through Toll-like receptor 1 (TLR1) and TLR2.

    Science.gov (United States)

    Shimizu, Takashi; Kida, Yutaka; Kuwano, Koichi

    2008-08-01

    Mycoplasma genitalium is a sexually transmitted bacterial pathogen that causes nongonococcal chlamydia-negative urethritis, mucopurulent cervicitis, endometritis, pelvic inflammatory disease, and tubal factor infertility in humans. However, pathogenic agents that induce inflammatory responses have not been identified in M. genitalium. In this study, we examined the involvement of Toll-like receptors (TLRs) in activation of the immune response by a lipoprotein from M. genitalium and their active component responsible for NF-kappaB activation. The Triton X-114 detergent phase of M. genitalium was found to induce NF-kappaB through TLR2. The active component of the Triton X-114 detergent phase was a lipoprotein precursor, MG149. The activation of NF-kappaB by MG149 was inhibited by a dominant negative (DN) construct of TLR1 but not by a DN construct of TLR6. These results indicate that the activation of NF-kappaB by MG149 is dependent on TLR1 and TLR2. A synthetic lipopeptide derived from MG149 containing three acyl chains also induced NF-kappaB through TLR1 and TLR2. Thus, the results show that MG149, a triacylated lipoprotein from M. genitalium, activates NF-kappaB through TLR1 and TLR2.

  2. Modafinil attenuates inflammation via inhibiting Akt/NF-κB pathway in apoE-deficient mouse model of atherosclerosis.

    Science.gov (United States)

    Han, Jinxia; Chen, Dongwei; Liu, Dayi; Zhu, Yanan

    2018-04-01

    Modafinil, an FDA approved wakefulness drug prescribed to narcolepsy patients, has recently been shown to have anti-inflammatory effects and provides protection against neuroinflammation. It is unknown if modafinil can also protect against atherosclerosis, pathogenesis of which implicates inflammation. Using an apoE-deficient mouse model, we tried to elucidate the effects of modafinil treatment on the development of atherosclerosis. We tested serum levels of cytokines. We isolated mouse bone marrow-derived macrophages (BMDMs), detected effect of modafinil on the viability and proliferation of BMDMs, and on oxidized low-density lipoprotein-induced IL-6 and TNF-α, and supernatant level of IFN-γ as well as NF-κB activity in BMDMs. Modafinil inhibited the development of atherosclerosis in apoE -/- mice. Modafinil suppressed the secretion of pro-inflammatory cytokines IL-6, TNF and IFN-γ, and promoted secretion of anti-inflammatory cytokines IL-4 and IL-10. Modafinil inhibited viability and proliferation of macrophages by negatively regulating levels of pro-inflammatory cytokines, p-Akt, p-IKBα and NF-κB activity in macrophages. Modafinil mitigates inflammation in apoE -/- atherosclerosis mice via inhibiting NF-κB activity in macrophages, and could potentially serve as a therapeutic agent for atherosclerosis.

  3. Pancreatic acinar cells-derived cyclophilin A promotes pancreatic damage by activating NF-κB pathway in experimental pancreatitis

    Energy Technology Data Exchange (ETDEWEB)

    Yu, Ge [Department of Gastroenterology, Shanghai Tenth People’s Hospital, Tongji University School of Medicine, Shanghai (China); Wan, Rong [Department of Gastroenterology, Shanghai First People’s Hospital, Shanghai Jiaotong University School of Medicine, Shanghai (China); Hu, Yanling [Department of Gastroenterology, Shanghai Tenth People’s Hospital, Tongji University School of Medicine, Shanghai (China); Ni, Jianbo [Department of Gastroenterology, Shanghai First People’s Hospital, Shanghai Jiaotong University School of Medicine, Shanghai (China); Yin, Guojian; Xing, Miao [Department of Gastroenterology, Shanghai Tenth People’s Hospital, Tongji University School of Medicine, Shanghai (China); Shen, Jie [Department of Gastroenterology, Shanghai First People’s Hospital, Shanghai Jiaotong University School of Medicine, Shanghai (China); Tang, Maochun [Department of Gastroenterology, Shanghai Tenth People’s Hospital, Tongji University School of Medicine, Shanghai (China); Chen, Congying [Department of Gastroenterology, Shanghai First People’s Hospital, Shanghai Jiaotong University School of Medicine, Shanghai (China); Fan, Yuting; Xiao, Wenqin; Zhao, Yan [Department of Gastroenterology, Shanghai Tenth People’s Hospital, Tongji University School of Medicine, Shanghai (China); Wang, Xingpeng, E-mail: wangxingpeng@hotmail.com [Department of Gastroenterology, Shanghai Tenth People’s Hospital, Tongji University School of Medicine, Shanghai (China); Department of Gastroenterology, Shanghai First People’s Hospital, Shanghai Jiaotong University School of Medicine, Shanghai (China); and others

    2014-01-31

    Highlights: • CypA is upregulated in experimental pancreatitis. • CCK induces expression and release of CypA in acinar cell in vitro. • rCypA aggravates CCK-induced acinar cell death and inflammatory cytokine production. • rCypA activates the NF-κB pathway in acinar cells in vitro. - Abstract: Inflammation triggered by necrotic acinar cells contributes to the pathophysiology of acute pancreatitis (AP), but its precise mechanism remains unclear. Recent studies have shown that Cyclophilin A (CypA) released from necrotic cells is involved in the pathogenesis of several inflammatory diseases. We therefore investigated the role of CypA in experimental AP induced by administration of sodium taurocholate (STC). CypA was markedly upregulated and widely expressed in disrupted acinar cells, infiltrated inflammatory cells, and tubular complexes. In vitro, it was released from damaged acinar cells by cholecystokinin (CCK) induction. rCypA (recombinant CypA) aggravated CCK-induced acinar cell necrosis, promoted nuclear factor (NF)-κB p65 activation, and increased cytokine production. In conclusion, CypA promotes pancreatic damage by upregulating expression of inflammatory cytokines of acinar cells via the NF-κB pathway.

  4. Effect of gamma-ray irradiated natural herbal extracts on NF-kB activation in HMC-1 cells

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Yong Soo; Lim, Youn Mook; Gwon, Hui Jeong; Choi, Bo Ram; Nho, Young Chang [Korea Atomic Energy Research Institute, Jeongeup (Korea, Republic of)

    2009-12-15

    Recently, studies have documented various health benefits of some natural herbal extracts (NHE) such as Houttuynia cordata (H), Centella asiatica (C), Plantago asiatica (P), Morus alba L. (M), and Ulmus davidiana (U). The aim of the present study was to demonstrate the radiation effect on NF-kB activation of the NHE in the human mast cell line (HMC-1). The HMC-1 cells were stimulated with phorbol 12-myristate 13-acetate (PMA) plus A23187. Both non-and irradiated NHE also significantly inhibited the PMA plus A23187-induced nuclear factor NF-kB activation and also suppressed the expression of activation of NF-kB. These results indicated that the NHE exerted a regulatory effect on inflammatory reactions mediated by mast cells.

  5. Pelvic Inflammatory Disease (PID)

    Science.gov (United States)

    ... FAQs Pelvic Inflammatory Disease (PID) Page Navigation ▼ ACOG Pregnancy Book Pelvic Inflammatory Disease (PID) Patient Education FAQs Pelvic Inflammatory Disease (PID) Patient Education Pamphlets - ...

  6. Splenectomy following MCAO inhibits the TLR4-NF-κB signaling pathway and protects the brain from neurodegeneration in rats.

    Science.gov (United States)

    Belinga, Victor Fabrice; Wu, Guan-Jin; Yan, Fu-Ling; Limbenga, Erica Audrey

    2016-04-15

    The Toll-like receptor 4(TLR4)/nuclear factor kappa B NF-κB inflammatory pathway contributes to secondary inflammation in many diseases including stroke. Moreover, the neuroprotective effect of splenectomy in stroke is supported by a vast body of experimental evidence. Nevertheless, the underlying mechanism(s) by which splenectomy enhance neuroprotection in stroke is still poorly understood. Our study aimed to investigate whether post-ischemic splenectomy modulate the TLR4/NF-κB inflammatory pathway in stroke. Immunohistochemistry was used to evaluate the levels of TLR4 and NF-κB expression in brain areas (parietal lobe, hippocampus and striatum) of rats that underwent: MCAO-splenectomy surgery (MS ); MCAO surgery without splenectomy (MCAO control or MC); Sham MCAO and splenectomy surgery (sham control group or SC group respectively. Apoptosis in these areas was assessed by TUNEL detection technique. The levels of TLR4 and NF-κB expression were significantly reduced in splenectomized rats relative to the MS group (Psplenectomy in ischemic stroke. Our results suggest that such an effect might be due to the inhibition of theTLR4/NF-κB inflammatory pathway. Copyright © 2016 Elsevier B.V. All rights reserved.

  7. Generation and quenching of NF(a) and NF(b) molecules

    International Nuclear Information System (INIS)

    Setser, D.W.; Cha, H.; Quinones, E.; Du, K.

    1987-01-01

    The Ar( 3 Po,2) + NF 2 and 2F + HN 3 reactions have been developed as sources of NF(b 1 Σ + ) and NF(a 1 Δ) molecules, respectively, in a flow reactor. The decay kinetics for these molecules in the presence of added reagent can be studied using standard flow reactor techniques. Room temperature quenching rate constants for both molecules are reported for several reagents and compared to results for the isoelectronic O 2 (a) and O 2 (b) molecules

  8. Aberrant activation of NF-κB signaling in mammary epithelium leads to abnormal growth and ductal carcinoma in situ

    International Nuclear Information System (INIS)

    Barham, Whitney; Chen, Lianyi; Tikhomirov, Oleg; Onishko, Halina; Gleaves, Linda; Stricker, Thomas P.; Blackwell, Timothy S.; Yull, Fiona E.

    2015-01-01

    Approximately 1 in 5 women diagnosed with breast cancer are considered to have in situ disease, most often termed ductal carcinoma in situ (DCIS). Though recognized as a risk factor for the development of more invasive cancer, it remains unclear what factors contribute to DCIS development. It has been shown that inflammation contributes to the progression of a variety of tumor types, and nuclear factor kappa B (NF-κB) is recognized as a master-regulator of inflammatory signaling. However, the contributions of NF-κB signaling to tumor initiation are less well understood. Aberrant up-regulation of NF-κB activity, either systemically or locally within the breast, could occur due to a variety of commonly experienced stimuli such as acute infection, obesity, or psychological stress. In this study, we seek to determine if activation of NF-κB in mammary epithelium could play a role in the formation of hyperplastic ductal lesions. Our studies utilize a doxycycline-inducible transgenic mouse model in which constitutively active IKKβ is expressed specifically in mammary epithelium. All previously published models of NF-κB modulation in the virgin mammary gland have been constitutive models, with transgene or knock-out present throughout the life and development of the animal. For the first time, we will induce activation at later time points after normal ducts have formed, thus being able to determine if NF-κB activation can promote pre-malignant changes in previously normal mammary epithelium. We found that even a short pulse of NF-κB activation could induce profound remodeling of mammary ductal structures. Short-term activation created hyperproliferative, enlarged ducts with filled lumens. Increased expression of inflammatory markers was concurrent with the down-regulation of hormone receptors and markers of epithelial differentiation. Furthermore, the oncoprotein mucin 1, known to be up-regulated in human and mouse DCIS, was over-expressed and mislocalized in the

  9. A Functional Genomic Analysis of NF1-Associated Learning Disabilities

    National Research Council Canada - National Science Library

    Tang, Shao-Jun

    2008-01-01

    Learning disabilities severely deteriorate the life of many NF1 patients. However, the pathogenic process for NF1-associated learning disabilities has not been fully understood and an effective therapy is not available...

  10. A Functional Genomic Analysis of NF1-Associated Learning Disabilities

    National Research Council Canada - National Science Library

    Tang, Shao-Jun

    2007-01-01

    Learning disabilities severely deteriorate the life of many NF1 patients. However, the pathogenic process for NF1-associated learning disabilities has not been fully understood and an effective therapy is not available...

  11. Targeting Coronaviral Replication and Cellular JAK2 Mediated Dominant NF-κB Activation for Comprehensive and Ultimate Inhibition of Coronaviral Activity.

    Science.gov (United States)

    Yang, Cheng-Wei; Lee, Yue-Zhi; Hsu, Hsing-Yu; Shih, Chuan; Chao, Yu-Sheng; Chang, Hwan-You; Lee, Shiow-Ju

    2017-06-22

    Tylophorine-based compounds exert broad spectral, potent inhibition of coronaviruses. NF-κB activation is a common pro-inflammatory response of host cells to viral infection. The aims of this study were to (i) find an effective combination treatment for coronaviral infections through targeting of the virus per se and cellular NF-κB activity; and (ii) to study the underling mechanisms. We found that tylophorine-based compounds target the TGEV viral RNA and effectively inhibit TGEV replication. NF-κB inhibition also leads to anti-TGEV replication. NF-κB activation induced by TGEV infection was found to be associated with two convergent pathways, IKK-2_IκBα/p65 and JAK2 mediated p65 phosphorylation, in swine testicular cells. JAK2 inhibition either by CYT387 (a JAK family inhibitor) or by silencing JAK2-expression revealed a dominant JAK2 mediated p65 phosphorylation pathway for NF-κB activation and resulted in NF-κB inhibition, which overrode the IκBα regulation via the IKK-2. Finally, tylophorine-based compounds work cooperatively with CYT387 to impart comprehensive anti-TGEV activities. The combination treatment, wherein a tylophorine compound targets TGEV and a JAK2 inhibitor blocks the alternative dominant NF-κB activation mediated by JAK2, is more effective and comprehensive than either one alone and constitutes a feasible approach for the treatment of SARS-CoV or MERS-CoV.

  12. NF-κB dependent and independent mechanisms of quartz-induced proinflammatory activation of lung epithelial cells

    Science.gov (United States)

    2010-01-01

    In the initiation and progression of pulmonary inflammation, macrophages have classically been considered as a crucial cell type. However, evidence for the role of epithelial type II cells in pulmonary inflammation has been accumulating. In the current study, a combined in vivo and in vitro approach has been employed to investigate the mechanisms of quartz-induced proinflammatory activation of lung epithelial cells. In vivo, enhanced expression of the inflammation- and oxidative stress-related genes HO-1 and iNOS was found on the mRNA level in rat lungs after instillation with DQ12 respirable quartz. Activation of the classical NF-κB pathway in macrophages and type II pneumocytes was indicated by enhanced immunostaining of phospho-IκBα in these specific lung cell types. In vitro, the direct, particle-mediated effect on proinflammatory signalling in a rat lung epithelial (RLE) cell line was compared to the indirect, macrophage product-mediated effect. Treatment with quartz particles induced HO-1 and COX-2 mRNA expression in RLE cells in an NF-κB independent manner. Supernatant from quartz-treated macrophages rapidly activated the NF-κB signalling pathway in RLE cells and markedly induced iNOS mRNA expression up to 2000-fold compared to non-treated control cells. Neutralisation of TNFα and IL-1β in macrophage supernatant did not reduce its ability to elicit NF-κB activation of RLE cells. In addition the effect was not modified by depletion or supplementation of intracellular glutathione. The results from the current work suggest that although both oxidative stress and NF-κB are likely involved in the inflammatory effects of toxic respirable particles, these phenomena can operate independently on the cellular level. This might have consequences for in vitro particle hazard testing, since by focusing on NF-κB signalling one might neglect alternative inflammatory pathways. PMID:20492675

  13. NF-κB dependent and independent mechanisms of quartz-induced proinflammatory activation of lung epithelial cells

    Directory of Open Access Journals (Sweden)

    Schins Roel PF

    2010-05-01

    Full Text Available Abstract In the initiation and progression of pulmonary inflammation, macrophages have classically been considered as a crucial cell type. However, evidence for the role of epithelial type II cells in pulmonary inflammation has been accumulating. In the current study, a combined in vivo and in vitro approach has been employed to investigate the mechanisms of quartz-induced proinflammatory activation of lung epithelial cells. In vivo, enhanced expression of the inflammation- and oxidative stress-related genes HO-1 and iNOS was found on the mRNA level in rat lungs after instillation with DQ12 respirable quartz. Activation of the classical NF-κB pathway in macrophages and type II pneumocytes was indicated by enhanced immunostaining of phospho-IκBα in these specific lung cell types. In vitro, the direct, particle-mediated effect on proinflammatory signalling in a rat lung epithelial (RLE cell line was compared to the indirect, macrophage product-mediated effect. Treatment with quartz particles induced HO-1 and COX-2 mRNA expression in RLE cells in an NF-κB independent manner. Supernatant from quartz-treated macrophages rapidly activated the NF-κB signalling pathway in RLE cells and markedly induced iNOS mRNA expression up to 2000-fold compared to non-treated control cells. Neutralisation of TNFα and IL-1β in macrophage supernatant did not reduce its ability to elicit NF-κB activation of RLE cells. In addition the effect was not modified by depletion or supplementation of intracellular glutathione. The results from the current work suggest that although both oxidative stress and NF-κB are likely involved in the inflammatory effects of toxic respirable particles, these phenomena can operate independently on the cellular level. This might have consequences for in vitro particle hazard testing, since by focusing on NF-κB signalling one might neglect alternative inflammatory pathways.

  14. Spironolactone induces apoptosis and inhibits NF-kappaB independent of the mineralocorticoid receptor

    DEFF Research Database (Denmark)

    Sønder, Søren Ulrik Salling; Woetmann, Anders; Odum, Niels

    2006-01-01

    mononuclear cells (MNC). To elucidate the mechanism behind SPIR's apoptotic effect, we investigated the relation between apoptosis and cytokine suppression for SPIR along with the apoptosis-inducing and antiinflammatory drug sulfasalazine (SFZ). Using human MNC, we found that SPIR and SFZ, at concentrations...... 10 and 1000 muM, respectively, significantly increased both apoptosis and cell death. Production of inflammatory cytokines was significantly reduced by 3 to 30 muM SPIR and by 300 to 1000 muM SFZ. We also found that 0.4 muM SPIR and 300 muM SFZ significantly reduced the activity of NF......-kappaB, a transcription factor involved in both apoptosis and immunoinflammation. ALDO, the MR antagonist, eplerenone, and the SPIR metabolite, 7alpha-thiomethyl-spironolactone, slightly reduced NF-kappaB activity, but they did not interfere with SPIR's effect, showing that MR binding is not involved in SPIR...

  15. Characterizing Myeloid Cell Activation in NF1 Vasculopathy

    Science.gov (United States)

    2016-07-01

    mechanistic insight and develop therapeutic targets for the prevention/ treatment of neurofibromatosis type 1 (NF1) related cardiovascular disease...effectors of NF1 arterial stenosis, and that pharmacologic inhibition of CCR2 activation is a viable therapeutic option for the prevention and/or treatment ...formation in Nf1 heterozygous mice. 15. SUBJECT TERMS neurofibromatosis, NF1, aneurysm, stenosis, smooth muscle, macrophages, MCP1, CCR2, ROS 16. SECURITY

  16. miR-339-5p inhibits alcohol-induced brain inflammation through regulating NF-κB pathway

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Yu [Department of Neurology, The First Affiliated School of Harbin Medical University, Harbin 150001 (China); Wei, Guangkuan [Department of Neurology, Heilongjiang Provincial Hospital, Harbin 150036 (China); Di, Zhiyong [Department of Laboratory, Heilongjiang Provincial Hospital, Harbin 150036 (China); Zhao, Qingjie, E-mail: zhaoqingjie2013@163.com [Department of Neurology, The First Affiliated School of Harbin Medical University, Harbin 150001 (China)

    2014-09-26

    Graphical abstract: - Highlights: • Alcohol upregulates miR-339-5p expression. • miR-339-5p inhibits the NF-kB pathway. • miR-339-5p interacts with and blocks activity of IKK-beat and IKK-epsilon. • miR-339-5p modulates IL-1β, IL-6 and TNF-α. - Abstract: Alcohol-induced neuroinflammation is mediated by the innate immunesystem. Pro-inflammatory responses to alcohol are modulated by miRNAs. The miRNA miR-339-5p has previously been found to be upregulated in alcohol-induced neuroinflammation. However, little has been elucidated on the regulatory functions of this miRNA in alcohol-induced neuroinflammation. We investigated the function of miR-339-5p in alcohol exposed brain tissue and isolated microglial cells using ex vivo and in vitro techniques. Our results show that alcohol induces transcription of miR 339-5p, IL-6, IL-1β and TNF-α in mouse brain tissue and isolated microglial cells by activating NF-κB. Alcohol activation of NF-κB allows for nuclear translocation of the NF-κB subunit p65 and expression of pro-inflammatory mediators. miR-339-5p inhibited expression of these pro-inflammatory factors through the NF-κB pathway by abolishing IKK-β and IKK-ε activity.

  17. miR-339-5p inhibits alcohol-induced brain inflammation through regulating NF-κB pathway

    International Nuclear Information System (INIS)

    Zhang, Yu; Wei, Guangkuan; Di, Zhiyong; Zhao, Qingjie

    2014-01-01

    Graphical abstract: - Highlights: • Alcohol upregulates miR-339-5p expression. • miR-339-5p inhibits the NF-kB pathway. • miR-339-5p interacts with and blocks activity of IKK-beat and IKK-epsilon. • miR-339-5p modulates IL-1β, IL-6 and TNF-α. - Abstract: Alcohol-induced neuroinflammation is mediated by the innate immunesystem. Pro-inflammatory responses to alcohol are modulated by miRNAs. The miRNA miR-339-5p has previously been found to be upregulated in alcohol-induced neuroinflammation. However, little has been elucidated on the regulatory functions of this miRNA in alcohol-induced neuroinflammation. We investigated the function of miR-339-5p in alcohol exposed brain tissue and isolated microglial cells using ex vivo and in vitro techniques. Our results show that alcohol induces transcription of miR 339-5p, IL-6, IL-1β and TNF-α in mouse brain tissue and isolated microglial cells by activating NF-κB. Alcohol activation of NF-κB allows for nuclear translocation of the NF-κB subunit p65 and expression of pro-inflammatory mediators. miR-339-5p inhibited expression of these pro-inflammatory factors through the NF-κB pathway by abolishing IKK-β and IKK-ε activity

  18. Curcumolide, a unique sesquiterpenoid with anti-inflammatory properties from Curcuma wenyujin.

    Science.gov (United States)

    Dong, Jianyong; Shao, Weiwei; Yan, Pengcheng; Cai, Xiaoqing; Fang, Lianglian; Zhao, Xiaowei; Lin, Weiwei; Cai, Yuan

    2015-01-15

    Curcumolide, a novel sesquiterpenoid with a unique 5/6/5 tricyclic skeleton, was isolated from Curcuma wenyujin. The structure and absolute configuration were elucidated by extensive NMR, ECD data analysis, and a single-crystal X-ray study. This molecule exhibited significant anti-inflammatory effects in LPS-induced RAW 264.7 macrophages. It suppressed LPS-induced NF-κB activation, including the nuclear translocation and DNA binding activity of NF-κB, and decreased tumor necrosis factor-α (TNF-α), interleukin-6 (IL-6), interleukin-1β (IL-1β), nitric oxide (NO) and reactive oxygen species (ROS) production. Therefore, Curcumolide may have therapeutic potential for treating inflammatory diseases by inhibiting NF-κB activation and pro-inflammatory mediator production. Copyright © 2014 Elsevier Ltd. All rights reserved.

  19. Natural chalcones as dual inhibitors of HDACs and NF-κB

    Science.gov (United States)

    ORLIKOVA, B.; SCHNEKENBURGER, M.; ZLOH, M.; GOLAIS, F.; DIEDERICH, M.; TASDEMIR, D.

    2012-01-01

    Histone deacetylase enzymes (HDACs) are emerging as a promising biological target for cancer and inflammation. Using a fluorescence assay, we tested the in vitro HDAC inhibitory activity of twenty-one natural chalcones, a widespread group of natural products with well-known anti-inflammatory and antitumor effects. Since HDACs regulate the expression of the transcription factor NF-κB, we also evaluated the inhibitory potential of the compounds on NF-κB activation. Only four chalcones, isoliquiritigenin (no. 10), butein (no. 12), homobutein (no. 15) and the glycoside marein (no. 21) showed HDAC inhibitory activity with IC50 values of 60–190 μM, whereas a number of compounds inhibited TNFα-induced NF-κB activation with IC50 values in the range of 8–41 μM. Interestingly, three chalcones (nos. 10, 12 and 15) inhibited both TNFα-induced NF-κB activity and total HDAC activity of classes I, II and IV. Molecular modeling and docking studies were performed to shed light into dual activity and to draw structure-activity relationships among chalcones (nos. 1–21). To the best of our knowledge this is the first study that provides evidence for HDACs as potential drug targets for natural chalcones. The dual inhibitory potential of the selected chalcones on NF-κB and HDACs was investigated for the first time. This study demonstrates that chalcones can serve as lead compounds in the development of dual inhibitors against both targets in the treatment of inflammation and cancer. PMID:22710558

  20. SIRT1 overexpression decreases cisplatin-induced acetylation of NF-κB p65 subunit and cytotoxicity in renal proximal tubule cells

    International Nuclear Information System (INIS)

    Jung, Yu Jin; Lee, Jung Eun; Lee, Ae Sin; Kang, Kyung Pyo; Lee, Sik; Park, Sung Kwang; Lee, Sang Yong; Han, Myung Kwan; Kim, Duk Hoon; Kim, Won

    2012-01-01

    Highlights: ► Cisplatin increases acetylation of NF-κB p65 subunit in HK2 cells. ► SIRT1 overexpression decreases cisplatin-induced p65 acetylation and -cytotoxicity. ► Resveratrol decreased cisplatin-induced cell viability through deacetylation of p65. -- Abstract: As the increased acetylation of p65 is linked to nuclear factor-κB (NF-κB) activation, the regulation of p65 acetylation can be a potential target for the treatment of inflammatory injury. Cisplatin-induced nephrotoxicity is an important issue in chemotherapy of cancer patients. SIRT1, nicotinamide adenine dinucleotide (NAD + )-dependent protein deacetylase, has been implicated in a variety of cellular processes such as inflammatory injury and the control of multidrug resistance in cancer. However, there is no report on the effect of SIRT1 overexpression on cisplatin-induced acetylation of p65 subunit of NF-κB and cell injury. To investigate the effect of SIRT1 in on cisplatin-induced acetylation of p65 subunit of NF-κB and cell injury, HK2 cells were exposed with SIRT1 overexpression, LacZ adenovirus or dominant negative adenovirus after treatment with cisplatin. While protein expression of SIRT1 was decreased by cisplatin treatment compared with control buffer treatment, acetylation of NF-κB p65 subunit was significantly increased after treatment with cisplatin. Overexpression of SIRT1 ameliorated the increased acetylation of p65 of NF-κB during cisplatin treatment and cisplatin-induced cytotoxicity. Further, treatment of cisplatin-treated HK2 cells with resveratrol, a SIRT1 activator, also decreased acetylation of NF-κB p65 subunit and cisplatin-induced increase of the cell viability in HK2 cells. Our findings suggests that the regulation of acetylation of p65 of NF-κB through SIRT1 can be a possible target to attenuate cisplatin-induced renal cell damage.

  1. Chemopreventive action of non-steroidal anti-inflammatory drugs on the inflammatory pathways in colon cancer.

    Science.gov (United States)

    Ghanghas, Preety; Jain, Shelly; Rana, Chandan; Sanyal, S N

    2016-03-01

    Non-steroidal anti-inflammatory drugs (NSAIDs) are emerging as novel chemopreventive agents against a variety of cancers owing to their capability in blocking the tumor development by cellular proliferation and by promoting apoptosis. Inflammation is principal cause of colon carcinogenesis. A missing link between inflammation and cancer could be the activation of NF-κB, which is a hallmark of inflammatory response, and is commonly detected in malignant tumors. Therefore, targeting pro-inflammatory cyclooxygenase enzymes and transcription factors will be profitable as a mechanism to inhibit tumor growth. In the present study, we have studied the role of various pro-inflammatory enzymes and transcription factors in the development of the 1,2-dimethylhydrazine dihydrochloride (DMH)-induced colorectal cancer and also observed the role of three NSAIDs, viz., Celecoxib, Etoricoxib and Diclofenac. Carcinogenic changes were observed in morphological and histopathological studies, whereas protein regulations of various biomolecules were identified by immunofluorescence analysis. Apoptotic studies was done by TUNEL assay and Hoechst/PI co-staining of the isolated colonocytes. It was found that DMH-treated animals were having an over-expression of pro-inflammatory enzymes, aberrant nuclear localization of activated cell survival transcription factor, NF-κB and suppression of anti-inflammatory transcription factor PPAR-γ, thereby suggesting a marked role of inflammation in the tumor progression. However, co-administration of NSAIDs has significantly reduced the inflammatory potential of the growing neoplasm. Copyright © 2016 Elsevier Masson SAS. All rights reserved.

  2. NF1 Signal Transduction and Vascular Dysfunction

    Science.gov (United States)

    2015-05-01

    malformations, aneurysms, and hypertension . Consequently there is a markedly elevated risk of cerbrovascular accidents(Friedman et al., 2002). NF1...the endothelium seems to trigger a rapid leukemic crisis . This observation is quite unexpected but consistent with the notion that the endothelial

  3. Identification of angular naphthopyrones from the Philippine echinoderm Comanthus species as inhibitors of the NF-κB signaling pathway.

    Science.gov (United States)

    Chovolou, Yvonni; Ebada, Sherif Saeed; Wätjen, Wim; Proksch, Peter

    2011-04-25

    The redox-sensitive nuclear factor kappa-B (NF-κB) signaling pathway is an important cellular pathway often misregulated in various cancer cells. Therefore, blockade of NF-κB signaling in cancer cells presents a promising strategy and enormous effort has been invested to identify potent and specific inhibitors. The aim of this study was the identification of new compounds derived from marine organisms that act as NF-κB inhibitors and to identify their mechanism of action. In the present work a bioassay-guided investigation of a Philippine specimen of the marine echinoderm Comanthus sp. yielded ten compounds evenly divided into anthraquinones and naphthopyrones. From these compounds only two naphthopyrones, comaparvin and 6-methoxycomaparvin exhibited noteworthy inhibitory activity against tumor necrosis factor-alpha (TNF-α) induced NF-κB activation in rat hepatoma cells and human breast cancer cells. Comaparvin at concentrations between 50μM and 100μM reduces chymotrypsin-like proteasomal activity, blocks nuclear translocation of NF-κB and effectively inhibits TNF-α induced IκB phosphorylation suggesting a role of this compound in targeting IκB kinase (IKK). Furthermore, comaparvin sensitized cancer cells to apoptotic effects mediated by the pro-inflammatory cytokine TNF-α. These results correlate with downregulation of TNF-α induced expression of protective NF-κB target genes like MnSOD, XIAP or A20. In conclusion we identified the naphthopyrone comaparvin isolated from the marine echinoderm Comanthus sp. as a new inhibitor of the NF-κB signaling pathway acting by targeting both proteasome function and IκB phosphorylation likely by direct inhibitory effect on IKKβ activity. Copyright © 2011 Elsevier B.V. All rights reserved.

  4. Picroside II Shows Protective Functions for Severe Acute Pancreatitis in Rats by Preventing NF-κB-Dependent Autophagy

    Directory of Open Access Journals (Sweden)

    Xuehua Piao

    2017-01-01

    Full Text Available Picroside II, from the herb Picrorhiza scrophulariiflora Pennell, has antioxidant and anti-inflammatory activities. However, its function on severe acute pancreatitis (SAP and molecular mechanism remains unknown. The effects of picroside II on the SAP induced by cerulean were investigated. SAP rats were treated with picroside II (25 mg/kg. The severity of SAP was evaluated by using biochemical and histological analyses. Pancreatic cancer cell PANC-1 was transfected with ptfLC3 (an indicator of autophagic activity, pcDNA3.1-NF-κB (nuclear factor kappa B, and pTZU6+1-NF-κB-shRNA and then treated with picroside II. Relative molecules related with NF-κB-dependent autophagy were detected by using Western blot. Autophagic activities were observed by phase-contrast and fluorescent microscopes. Acetylated LC3 was detected by immunoprecipitation. The results showed that picroside II treatment reduced the level of ALT, AST, NF-κB, IL-1β, IL-6, TNF-α, and SIRT1 (NAD+-dependent deacetylase and increased the level of SOD and GSH. The autophagic activity was reduced when NF-κB was silenced, and the levels of TNF-α and SIRT1 were reduced. In contrast, the overexpression of NF-κB increased autophagic activity and the level of TNF-α, which activated SIRT1. SIRT1 deacetylated LC3 and increased autophagic activities. Picroside II ameliorates SAP by improving antioxidant and anti-inflammtory activities of SAP models via NF-κB-dependent autophagy.

  5. Arsenic trioxide, a potent inhibitor of NF-κB, abrogates allergen-induced airway hyperresponsiveness and inflammation

    Directory of Open Access Journals (Sweden)

    Xie Wei-Ping

    2006-12-01

    Full Text Available Abstract Background Overactivation of nuclear factor κB (NF-κB orchestrates airway eosinophilia, but does not dampen airway hyperresponsiveness in asthma. NF-κB repression by arsenic trioxide (As2O3 contributes to apoptosis of eosinophils (EOS in airways. Here we provide evidence that As2O3 abrogates allergen (OVA-induced airway eosinophilia by modulating the expression of IκBα, an NF-κB inhibitory protein, and decreases the airway hyperresponsiveness. Methods Using a murine model of asthma, the airway hyperresponsiveness was conducted by barometric whole-body plethysmography. Airway eosinophilia, OVA-specific IgE in serum, and chemokine eotaxin and RANTES (regulated upon activation, normal T cell expressed and secreted in bronchoalveolar lavage fluid were measured by lung histology, Diff-Quick staining, and ELISA. Chemokine-induced EOS chemotactic activity was evaluated using EOS chemotaxis assay. Electrophoretic mobility shift assay and Western blot analysis were performed to assess pulmonary NF-κB activation and IκBα expression, respectively. Results As2O3 attenuated the allergen-induced serum IgE, chemokine expression of eotaxin and RANTES, and the EOS recruitment in bronchoalveolar lavage fluid, which is associated with an increased IκBα expression as well as a decreased NF-κB activation. Also, As2O3 suppressed the chemotaxis of EOS dose-dependently in vitro. Additionally, As2O3 significantly ameliorated the allergen-driven airway hyperresponsiveness, the cardinal feature underlying asthma. Conclusion These findings demonstrate an essential role of NF-κB in airway eosinophilia, and illustrate a potential dissociation between airway inflammation and hyperresponsiveness. As2O3 likely exerts its broad anti-inflammatory effects by suppression of NF-κB activation through augmentation of IκBα expression in asthma.

  6. Specific recognition of linear polyubiquitin by A20 zinc finger 7 is involved in NF-κB regulation

    Science.gov (United States)

    Tokunaga, Fuminori; Nishimasu, Hiroshi; Ishitani, Ryuichiro; Goto, Eiji; Noguchi, Takuya; Mio, Kazuhiro; Kamei, Kiyoko; Ma, Averil; Iwai, Kazuhiro; Nureki, Osamu

    2012-01-01

    LUBAC (linear ubiquitin chain assembly complex) activates the canonical NF-κB pathway through linear polyubiquitination of NEMO (NF-κB essential modulator, also known as IKKγ) and RIP1. However, the regulatory mechanism of LUBAC-mediated NF-κB activation remains elusive. Here, we show that A20 suppresses LUBAC-mediated NF-κB activation by binding linear polyubiquitin via the C-terminal seventh zinc finger (ZF7), whereas CYLD suppresses it through deubiquitinase (DUB) activity. We determined the crystal structures of A20 ZF7 in complex with linear diubiquitin at 1.70–1.98 Å resolutions. The crystal structures revealed that A20 ZF7 simultaneously recognizes the Met1-linked proximal and distal ubiquitins, and that genetic mutations associated with B cell lymphomas map to the ubiquitin-binding sites. Our functional analysis indicated that the binding of A20 ZF7 to linear polyubiquitin contributes to the recruitment of A20 into a TNF receptor (TNFR) signalling complex containing LUBAC and IκB kinase (IKK), which results in NF-κB suppression. These findings provide new insight into the regulation of immune and inflammatory responses. PMID:23032187

  7. NFAT5 participates in seawater inhalation-induced acute lung injury via modulation of NF-κB activity

    Science.gov (United States)

    Li, Congcong; Liu, Manling; Bo, Liyan; Liu, Wei; Liu, Qingqing; Chen, Xiangjun; Xu, Dunquan; Li, Zhichao; Jin, Faguang

    2016-01-01

    Nuclear factor of activated T cells 5 (NFAT5) is a transcription factor that can be activated by extracellular tonicity. It has been reported that NFAT5 may increase the transcription of certain osmoprotective genes in the renal system, and the aim of the current study was to explore the role of NFAT5 in seawater inhalation-induced acute lung injury. Though establishing the model of seawater inhalation-induced acute lung injury, it was demonstrated that seawater inhalation enhanced the transcription and protein expression of NFAT5 (evaluated by reverse transcription-polymerase chain reaction, immunohistochemistry stain and western blotting) and activation of nuclear factor (NF)-κB (evaluated by western blotting and mRNA expression levels of three NF-κB-dependent genes) both in lung tissue and rat alveolar macrophage cells (NR8383 cells). When expression of NFAT5 was reduced in NR8383 cells using an siRNA targeted to NFAT5, the phosphorylation of NF-κB and transcription of NF-κB-dependent genes were significantly reduced. In addition, the elevated content of certain inflammatory cytokines [tumor necrosis factor α, interleukin (IL)-1 and IL-8] were markedly reduced. In conclusion, NFAT5 serves an important pathophysiological role in seawater inhalation-induced acute lung injury by modulating NF-κB activity, and these data suggest that NFAT5 may be a promising therapeutic target. PMID:27779669

  8. Melatonin inhibits Prevotella intermedia lipopolysaccharide-induced production of nitric oxide and interleukin-6 in murine macrophages by suppressing NF-κB and STAT1 activity.

    Science.gov (United States)

    Choi, Eun-Young; Jin, Ji-Young; Lee, Ju-Youn; Choi, Jeom-Il; Choi, In Soon; Kim, Sung-Jo

    2011-03-01

    Although a range of biological and pharmacological activities of melatonin have been reported, little is known about its potential anti-inflammatory efficacy in periodontal disease. In this study, we investigated the effects of melatonin on the production of inflammatory mediators by murine macrophages stimulated with lipopolysaccharide (LPS) from Prevotella intermedia, a major cause of inflammatory reactions in the periodontium, and sought to determine the underlying mechanisms of action. Melatonin suppressed the production of nitric oxide (NO) and interleukin-6 (IL-6) at both gene transcription and translation levels in P. intermedia LPS-activated RAW264.7 cells. P. intermedia LPS-induced NF-κB-dependent luciferase activity was significantly inhibited by melatonin. Melatonin did not reduce NF-κB transcriptional activity at the level of IκB-α degradation. Melatonin blocked NF-κB signaling through the inhibition of nuclear translocation and DNA-binding activity of NF-κB p50 subunit and suppressed STAT1 signaling. Although further research is required to clarify the detailed mechanism of action, we conclude that melatonin may contribute to blockade of the host-destructive processes mediated by these two proinflammatory mediators and could be a highly efficient modulator of host response in the treatment of inflammatory periodontal disease. © 2010 The Authors. Journal of Pineal Research © 2010 John Wiley & Sons A/S.

  9. Inflammatory Modulation Effect of Glycopeptide from Ganoderma capense (Lloyd) Teng

    Science.gov (United States)

    Zhou, Yan; Chen, Song; Yao, Wenbing; Gao, Xiangdong

    2014-01-01

    Glycopeptide from Ganoderma capense (Lloyd) Teng (GCGP) injection is widely used in kinds of immune disorders, but little is known about the molecular mechanisms of how GCGP could interfere with immune cell function. In the present study, we have found that GCGP had inflammatory modulation effects on macrophage cells to maintain NO production and iNOS expression at the normal level. Furthermore, western blot analysis showed that the underlying mechanism of immunomodulatory effect of GCGP involved NF-κB p65 translation, IκB phosphorylation, and degradation; NF-κB inhibitor assays also confirmed the results. In addition, competition study showed that GCGP could inhibit LPS from binding to macrophage cells. Our data indicates that GCGP, which may share the same receptor(s) expressed by macrophage cells with LPS, exerted immunomodulatory effect in a NF-κB-dependent signaling pathway in macrophages. PMID:24966469

  10. Inflammatory Modulation Effect of Glycopeptide from Ganoderma capense (Lloyd Teng

    Directory of Open Access Journals (Sweden)

    Yan Zhou

    2014-01-01

    Full Text Available Glycopeptide from Ganoderma capense (Lloyd Teng (GCGP injection is widely used in kinds of immune disorders, but little is known about the molecular mechanisms of how GCGP could interfere with immune cell function. In the present study, we have found that GCGP had inflammatory modulation effects on macrophage cells to maintain NO production and iNOS expression at the normal level. Furthermore, western blot analysis showed that the underlying mechanism of immunomodulatory effect of GCGP involved NF-κB p65 translation, IκB phosphorylation, and degradation; NF-κB inhibitor assays also confirmed the results. In addition, competition study showed that GCGP could inhibit LPS from binding to macrophage cells. Our data indicates that GCGP, which may share the same receptor(s expressed by macrophage cells with LPS, exerted immunomodulatory effect in a NF-κB-dependent signaling pathway in macrophages.

  11. Mangiferin inhibits mastitis induced by LPS via suppressing NF-ĸB and NLRP3 signaling pathways.

    Science.gov (United States)

    Qu, Shihui; Wang, Wenqing; Li, Depeng; Li, Shumin; Zhang, Like; Fu, Yunhe; Zhang, Naisheng

    2017-02-01

    During the past era, small molecules derived from various plants have attracted extensive attention for their versatile medicinal benefits. Among these, one organic molecule called mangiferin from certain plant species including mangoes and honey bush tea is widely used in treating inflammation. In this study, a LPS-induced mastitis model in mouse is established to investigate the anti-inflammatory effects and mechanism of mangiferin. The result shows that mangiferin significantly alleviates LPS-induced histopathology, meanwhile, also decreases LPS-induced MPO activity. Furthermore, mangiferin treatment remarkably impeded the expression of pro-inflammatory cytokines TNF-α, IL-1β, and IL-6. In addition, mangiferin was found to inhibit LPS-induced NF-ĸB and NLRP3 inflammasome activation. In conclusion, these results suggested that LPS-induced mastitis can be abated by mangiferin through inhibiting NF-ĸB and NLRP3 signaling pathways. Copyright © 2016 Elsevier B.V. All rights reserved.

  12. Anti-inflammatory effects of Zea mays L. husk extracts.

    Science.gov (United States)

    Roh, Kyung-Baeg; Kim, Hyoyoung; Shin, Seungwoo; Kim, Young-Soo; Lee, Jung-A; Kim, Mi Ok; Jung, Eunsun; Lee, Jongsung; Park, Deokhoon

    2016-08-19

    Zea mays L. (Z. mays) has been used for human consumption in the various forms of meal, cooking oil, thickener in sauces and puddings, sweetener in processed food and beverage products, bio-disel. However, especially, in case of husk extract of Z. mays, little is known about its anti-inflammatory effects. Therefore, in this study, the anti-inflammatory effects of Z. mays husk extract (ZMHE) and its mechanisms of action were investigated. The husks of Z. Mays were harvested in kangwondo, Korea. To assess the anti-inflammatory activities of ZMHE, we examined effects of ZMHE on nitric oxide (NO) production, and release of soluble intercellular adhesion molecule-1 (sICAM-1) and eotaxin-1. The expression level of inducible nitric oxide synthase (iNOS) gene was also determined by Western blot and luciferase reporter assays. To determine its mechanisms of action, a luciferase reporter assay for nuclear factor kappa B (NF-kB) and activator protein-1 (AP-1) was introduced. ZMHE inhibited lipopolysaccharide (LPS)-induced production of NO in RAW264.7 cells. In addition, expression of iNOS gene was reduced, as confirmed by Western blot and luciferase reporter assays. Effects of ZMHE on the AP-1 and NF-kB promoters were examined to elucidate the mechanism of its anti-inflammatory activity. Activation of AP-1 and NF-kB promoters induced by LPS was significantly reduced by ZMHE treatment. In addition, LPS-induced production of sICAM-1 and IL-4-induced production of eotaxin-1 were all reduced by ZMHE. Our results indicate that ZMHE has anti-inflammatory effects by downregulating the expression of iNOS gene and its downregulation is mediated by inhibiting NF-kB and AP-1 signaling.

  13. Endothelial glutathione-S-transferase A4-4 protects against oxidative stress and modulates iNOS expression through NF-κB translocation

    International Nuclear Information System (INIS)

    Yang Yongzhen; Yang Yusong; Xu Ya; Lick, Scott D.; Awasthi, Yogesh C.; Boor, Paul J.

    2008-01-01

    Our recent work in endothelial cells and human atherosclerotic plaque showed that overexpression of glutathione-S-tranferases (GSTs) in endothelium protects against oxidative damage from aldehydes such as 4-HNE. Nuclear factor (NF)-κB plays a crucial role during inflammation and immune responses by regulating the expression of inducible genes such as inducible nitric oxide synthase (iNOS). 4-HNE induces apoptosis and affects NF-κB mediated gene expression, but conflicting results on 4-HNE's effect on NF-κB have been reported. We compared the effect of 4-HNE on iNOS and the NF-κB pathway in control mouse pancreatic islet endothelial (MS1) cells and those transfected with mGSTA4, a α-class GST with highest activity toward 4-HNE. When treated with 4-HNE, mGSTA4-transfected cells showed significant upregulation of iNOS and nitric oxide (NO) through (NF)-κB (p65) translocation in comparison with wild-type or vector-transfected cells. Immunohistochemical studies of early human plaques showed lower 4-HNE content and upregulation of iNOS, which we take to indicate that GSTA4-4 induction acts as an enzymatic defense against high levels of 4-HNE, since 4-HNE accumulated in more advanced plaques, when detoxification and exocytotic mechanisms are likely to be overwhelmed. These studies suggest that GSTA4-4 may play an important defensive role against atherogenesis through detoxification of 4-HNE and upregulation of iNOS

  14. Subanesthetic Isoflurane Reduces Zymosan-Induced Inflammation in Murine Kupffer Cells by Inhibiting ROS-Activated p38 MAPK/NF-κB Signaling

    Directory of Open Access Journals (Sweden)

    Hui Wang

    2014-01-01

    Full Text Available Volatile anesthetic isoflurane (ISO has immunomodulatory effects. The fungal component zymosan (ZY induces inflammation through toll-like receptor 2 or dectin-1 signaling. We investigated the molecular actions of subanesthetic (0.7% ISO against ZY-induced inflammatory activation in murine Kupffer cells (KCs, which are known as the resident macrophages within the liver. We observed that ISO reduced ZY-induced cyclooxygenase 2 upregulation and prostaglandin E2 release, as determined by western blot and radioimmunoassay, respectively. ISO also reduced the production of tumor necrosis factor-α, interleukin-1β, IL-6, high-mobility group box-1, macrophage inflammatory protein-1α, macrophage inflammatory protein-2, and monocyte chemoattractant protein-1 as assessed by enzyme-linked immunosorbent assays. ISO blocked the ZY-induced nuclear translocation and DNA-binding activity of nuclear factor- (NF-κB p65. Moreover, ISO attenuated ZY-induced p38 mitogen-activated protein kinase (MAPK activation partly by scavenging reactive oxygen species (ROS; the interregulation that ROS activated p38 MAPK followed by NF-κB activation was crucial for the ZY-induced inflammatory responses in KCs. An in vivo study by peritoneal injection of ZY into BALB/C mice confirmed the anti-inflammatory properties of 0.7% ISO against ZY in KCs. These results suggest that ISO ameliorates ZY-induced inflammatory responses in murine KCs by inhibiting the interconnected ROS/p38 MAPK/NF-κB signaling pathways.

  15. NF-κB activation fails to protect cells to TNFα-induced apoptosis in the absence of Bcl-xL, but not Mcl-1, Bcl-2 or Bcl-w.

    Science.gov (United States)

    Casanelles, Elisenda; Gozzelino, Raffaella; Marqués-Fernández, Fernando; Iglesias-Guimarais, Victoria; Garcia-Belinchón, Mercè; Sánchez-Osuna, María; Solé, Carme; Moubarak, Rana S; Comella, Joan X; Yuste, Victor J

    2013-05-01

    TNFα can promote either cell survival or cell death. The activation of NF-κB plays a central role in cell survival while its inhibition makes TNFα-triggered cytotoxicity possible. Here, we report that the overexpression of a non-degradable mutant of the inhibitor of NF-κB (super-repressor (SR)-IκBα) sensitizes HeLa cells towards TNFα-induced apoptosis, involving caspases activation and cytocrome C release from the mitochondria. Interestingly, we describe that the specific knockdown of Bcl-xL, but not that of Bcl-2, Bcl-w or Mcl-1, renders cells sensitive to TNFα-induced apoptosis. This cytotoxic effect occurs without altering the activation of NF-κB. Then, the activation of the NF-κB pathway is not sufficient to protect Bcl-xL-downregulated cells from TNFα-induced cell death, meaning that TNFα is not able to promote cell survival in the absence of Bcl-xL. In addition, Bcl-xL silencing does not potentiate the cytotoxicity afforded by the cytokine in SR-IκBα-overexpressing cells. This indicates that TNFα-induced apoptosis in SR-IκBα-overexpressing cells relies on the protein levels of Bcl-xL. We have corroborated these findings using RD and DU-145 cells, which also become sensitive to TNFα-induced apoptosis after Bcl-xL knockdown despite that NF-κB remains activated. Altogether, our results point out that the impairment of the anti-apoptotic function of Bcl-xL should make cells sensitive towards external insults circumventing the TNFα-triggered NF-κB-mediated cytoprotective effect. Hence, the specific inhibition of Bcl-xL could be envisaged as a promising alternative strategy against NF-κB-dependent highly chemoresistant proliferative malignancies. Copyright © 2013 Elsevier B.V. All rights reserved.

  16. Naringin attenuates diabetic retinopathy by inhibiting inflammation, oxidative stress and NF-κB activation in vivo and in vitro

    Directory of Open Access Journals (Sweden)

    Lihua Liu

    2017-07-01

    Full Text Available Objective(s: Naringin, an essential flavonoid, inhibits inflammatory response and oxidative stress in diabetes. However, whether naringin has beneficial effects on diabetic retinopathy (DR remains unknown. Materials and Methods: Streptozotocin (STZ, 65 mg/kg was intraperitoneally injected into male rats (8 weeks old weighting 200-250 g to establish diabetic model, then naringin (20, 40 or 80 mg/kg/day was intraperitoneally injected into the diabetic rats for twelve weeks. Glial fibrillary acidic protein (GFAP level, thickness of ganglion cell layer (GCL and ganglion cell counts were assessed in diabetic retina in vivo. Naringin (50 μM that significantly inhibited high glucose (HG, 25 mM-induced cell proliferation was used to treat rat Muller cell line (rMC1 in vitro. Inflammatory response, oxidative stress and activation of nuclear factor kappa B (NF-κB p65 were evaluated in retina in vivo and in rMC1 cells in vitro. Results: Naringin alleviated DR symptoms as evidenced by the increased retinal ganglion cells and decreased GFAP level in rat retina. Naringin exhibited anti-inflammatory and antioxidative effects as confirmed by the down-regulated pro-inflammatory cytokines, tumor necrosis factor alpha (TNF-α, interleukin-1β (IL-1β and interleukin-6 (IL-6, and the up-regulated antioxidants, glutathione (GSH, superoxide dismutase (SOD and catalase (CAT in DR rats. Moreover, we found that naringin inhibited HG-induced proliferation, abnormal inflammatory response and oxidative stress in rMC1 cells. In addition, the enhanced nuclear translocation of NF-κB p65 in diabetic rat retina and HG-induced rMC1 cells was suppressed by naringin. Conclusion: Naringin attenuates inflammatory response, oxidative stress and NF-κB activation in experimental models of DR.

  17. Curcumin attenuates oxidative stress induced NFκB mediated inflammation and endoplasmic reticulum dependent apoptosis of splenocytes in diabetes.

    Science.gov (United States)

    Rashid, Kahkashan; Chowdhury, Sayantani; Ghosh, Sumit; Sil, Parames C

    2017-11-01

    The present study was aimed to determine the curative role of curcumin against diabetes induced oxidative stress and its associated splenic complications. Diabetes was induced in the experimental rats via the intraperitoneal administration of a single dose of STZ (65mgkg -1 body weight). Increased blood glucose and intracellular ROS levels along with decreased body weight, the activity of cellular antioxidant enzymes and GSH/GSSG ratio were observed in the diabetic animals. Histological assessment showed white pulp depletion and damaged spleen anatomy in these animals. Oral administration of curcumin at a dose of 100mgkg -1 body weight daily for 8weeks, however, restored these alterations. Investigation of the mechanism of hyperglycemia induced oxidative stress mediated inflammation showed upregulation of inflammatory cytokines, chemokines, adhesion molecules and increased translocation of NFκB into the nucleus. Moreover, ER stress dependent cell death showed induction of eIF2α and CHOP mediated signalling pathways as well as increment in the expression of GRP78, Caspase-12, Calpain-1, phospho JNK, phospho p38 and phospho p53 in the diabetic group. Alteration of Bax/Bcl-2 ratio; disruption of mitochondrial membrane potential, release of cytochrome-C from mitochondria and upregulation of caspase 3 along with the formation of characteristic DNA ladder in the diabetic animals suggest the involvement of mitochondria dependent apoptotic pathway in the splenic cells. Treatment with curcumin could, however, protect cells from inflammatory damage and ER as well as mitochondrial apoptotic death by restoring the alterations of these parameters. Our results suggest that curcumin has the potential to act as an anti-diabetic, anti-oxidant, anti-inflammatory and anti-apoptotic therapeutic against diabetes mediated splenic damage. Copyright © 2017 Elsevier Inc. All rights reserved.

  18. RAGE Expression and NF-κB Activation Attenuated by Extracellular Domain of RAGE in Human Salivary Gland Cell Line

    OpenAIRE

    Chuong, Christopher; Katz, Joseph; Pauley, Kaleb M.; Bulosan, Marievic; Cha, Seunghee

    2009-01-01

    The receptor for advanced-glycation-end-products (RAGE) has been implicated as a pro-inflammatory factor in chronic inflammatory conditions such as diabetes mellitus and rheumatoid arthritis. The aim of this study was to investigate the inhibitory effect of the soluble-RAGE (sRAGE), the extracellular domain of RAGE, on RAGE expression and NF-κB translocation in human-salivary gland-cell-lines (HSG). Cells were stimulated with agonist S100A4, fusion protein of RAGE encompassing the extracellul...

  19. Chlamydia pneumoniae activates IKK/I kappa B-mediated signaling, which is inhibited by 4-HNE and following primary exposure.

    Science.gov (United States)

    Donath, Bernadette; Fischer, Claudia; Page, Sharon; Prebeck, Sigrid; Jilg, Nikolaus; Weber, Marion; da Costa, Clarissa; Neumeier, Dieter; Miethke, Thomas; Brand, Korbinian

    2002-11-01

    Chlamydia pneumoniae may be involved in atherosclerosis by inducing inflammation as well as LDL oxidation. The transcription factor NF-kappa B is found in an active state in atherosclerotic lesions. This study examined the effect of C. pneumoniae exposure on the NF-kappa B system in human monocytic lineage cells. Short exposure to C. pneumoniae as well as chlamydial heat shock protein 60 activated NF-kappa B, accompanied by increased cytokine production. Incubation with C. pneumoniae-induced depletion of I kappa B-alpha and later I kappa B-epsilon which was preceded by I kappa B kinase complex activation. 4-Hydroxynonenal, an aldehyde LDL oxidation product, was shown to inhibit C. pneumoniae induced NF-kappa B activation by preventing I kappa B phosphorylation/proteolysis. During long-term incubation with C. pneumoniae I kappa B-alpha returned to baseline, whereas the levels of I kappa B-epsilon and p65 were upregulated. Interestingly, long-term preincubation with C. pneumoniae selectively prevented restimulation by this microorganism, which appears to be at least partly facilitated by inhibition of I kappa B proteolysis. C. pneumoniae-induced NF-kappa B activation as well as the inhibition of that effect under certain conditions may contribute to chronic inflammation with potential relevance to vascular disease.

  20. Perilipin 1 Mediates Lipid Metabolism Homeostasis and Inhibits Inflammatory Cytokine Synthesis in Bovine Adipocytes

    Directory of Open Access Journals (Sweden)

    Shiqi Zhang

    2018-03-01

    Full Text Available Dairy cows with ketosis displayed lipid metabolic disorder and high inflammatory levels. Adipose tissue is an active lipid metabolism and endocrine tissue and is closely related to lipid metabolism homeostasis and inflammation. Perilipin 1 (PLIN1, an adipocyte-specific lipid-coated protein, may be involved in the above physiological function. The aim of this study is to investigate the role of PLIN1 in lipid metabolism regulation and inflammatory factor synthesis in cow adipocytes. The results showed that PLIN1 overexpression upregulated the expression of fatty acid and triglyceride (TAG synthesis molecule sterol regulator element-binding protein-1c (SREBP-1c and its target genes, diacylglycerol acyltransferase (DGAT 1, and DGAT2, but inhibited the expression of lipolysis enzymes hormone-sensitive lipase (HSL and CGI-58 for adipose triglyceride lipase (ATGL, thus augmenting the fatty acids and TAG synthesis and inhibiting lipolysis. Importantly, PLIN1 overexpression inhibited the activation of the NF-κB inflammatory pathway and decreased the expression and content of tumor necrosis factor alpha (TNF-α, interleukin 1 beta (IL-1β, and interleukin 6 (IL-6 induced by lipopolysaccharide. Conversely, PLIN1 silencing inhibited TAG synthesis, promoted lipolysis, and overinduced the activation of the NF-κB inflammatory pathway in cow adipocytes. In ketotic cows, the expression of PLIN1 was markedly decreased, whereas lipid mobilization, NF-κB pathway, and downstream inflammatory cytokines were overinduced in adipose tissue. Taken together, these results indicate that PLIN1 can maintain lipid metabolism homeostasis and inhibit the NF-κB inflammatory pathway in adipocytes. However, low levels of PLIN1 reduced the inhibitory effect on fat mobilization, NF-κB pathway, and inflammatory cytokine synthesis in ketotic cows.

  1. A Bio-Guided Fractionation to Assess the Inhibitory Activity of Calendula officinalis L. on the NF-κB Driven Transcription in Human Gastric Epithelial Cells.

    Science.gov (United States)

    Colombo, Elisa; Sangiovanni, Enrico; D'Ambrosio, Michele; Bosisio, Enrica; Ciocarlan, Alexandru; Fumagalli, Marco; Guerriero, Antonio; Harghel, Petru; Dell'Agli, Mario

    2015-01-01

    Calendula officinalis L. has been largely known for its topical anti-inflammatory properties; however, there are no experimental evidences about its antiphlogistic effect at the gastric level. To investigate whether marigold might exert an activity against gastric inflammation, a CH2Cl2 extract obtained from C. officinalis flowers was evaluated in vitro on the NF-κB pathway. The lipophilic extract demonstrated a significant inhibitory effect on the NF-κB driven transcription. The identification of active compounds was conducted by a bio-guided fractionation of the extract that afforded 16 fractions. Fraction J exhibited a concentration-dependent inhibitory activity on the NF-κB driven transcription and significantly contributed to the antiphlogistic effect showed by CH2Cl2 extract. The main components of fraction J were loliolide and the fucoside acetates of β-eudesmol and viridiflorol. HPLC analysis of fractions D and E led to the identification and isolation of triterpene esters that showed a concentration-dependent inhibition of the NF-κB driven transcription, with faradiol-3-myristate and the corresponding aglycone being the most active compounds. The present study provides some experimental evidences that Calendula officinalis L. may exert an anti-inflammatory activity on the gastric district by the inhibition of the NF-κB system, identifying the compounds responsible, at least in part, for the observed effect.

  2. A Bio-Guided Fractionation to Assess the Inhibitory Activity of Calendula officinalis L. on the NF-κB Driven Transcription in Human Gastric Epithelial Cells

    Directory of Open Access Journals (Sweden)

    Elisa Colombo

    2015-01-01

    Full Text Available Calendula officinalis L. has been largely known for its topical anti-inflammatory properties; however, there are no experimental evidences about its antiphlogistic effect at the gastric level. To investigate whether marigold might exert an activity against gastric inflammation, a CH2Cl2 extract obtained from C. officinalis flowers was evaluated in vitro on the NF-κB pathway. The lipophilic extract demonstrated a significant inhibitory effect on the NF-κB driven transcription. The identification of active compounds was conducted by a bio-guided fractionation of the extract that afforded 16 fractions. Fraction J exhibited a concentration-dependent inhibitory activity on the NF-κB driven transcription and significantly contributed to the antiphlogistic effect showed by CH2Cl2 extract. The main components of fraction J were loliolide and the fucoside acetates of β-eudesmol and viridiflorol. HPLC analysis of fractions D and E led to the identification and isolation of triterpene esters that showed a concentration-dependent inhibition of the NF-κB driven transcription, with faradiol-3-myristate and the corresponding aglycone being the most active compounds. The present study provides some experimental evidences that Calendula officinalis L. may exert an anti-inflammatory activity on the gastric district by the inhibition of the NF-κB system, identifying the compounds responsible, at least in part, for the observed effect.

  3. Prevention of Asthma Exacerbation in a Mouse Model by Simultaneous Inhibition of NF-κB and STAT6 Activation Using a Chimeric Decoy Strategy

    Directory of Open Access Journals (Sweden)

    Tetsuo Miyake

    2018-03-01

    Full Text Available Transactivation of inflammatory and immune mediators in asthma is tightly regulated by nuclear factor κB (NF-κB and signal transducer and activator of transcription 6 (STAT6. Therefore, we investigated the efficacy of simultaneous inhibition of NF-κB and STAT6 using a chimeric decoy strategy to prevent asthma exacerbation. The effects of decoy oligodeoxynucleotides were evaluated using an ovalbumin-induced mouse asthma model. Ovalbumin-sensitized mice received intratracheal administration of decoy oligodeoxynucleotides 3 days before ovalbumin challenge. Fluorescent-dye-labeled decoy oligodeoxynucleotides could be detected in lymphocytes and macrophages in the lung, and activation of NF-κB and STAT6 was inhibited by chimeric decoy oligodeoxynucleotide transfer. Consequently, treatment with chimeric or NF-κB decoy oligodeoxynucleotides protected against methacholine-induced airway hyperresponsiveness, whereas the effect of chimeric decoy oligodeoxynucleotides was significantly greater than that of NF-κB decoy oligodeoxynucleotides. Treatment with chimeric decoy oligodeoxynucleotides suppressed airway inflammation through inhibition of overexpression of interleukin-4 (IL-4, IL-5, and IL-13 and inflammatory infiltrates. Histamine levels in the lung were reduced via suppression of mast cell accumulation. A significant reduction in mucin secretion was observed due to suppression of MUC5AC gene expression. Interestingly, the inhibitory effects on IL-5, IL-13, and histamine secretion were achieved by transfer of chimeric decoy oligodeoxynucleotides only. This novel therapeutic approach could be useful to treat patients with various types of asthma.

  4. Amelioration of Mitochondrial Dysfunction-Induced Insulin Resistance in Differentiated 3T3-L1 Adipocytes via Inhibition of NF-κB Pathways

    Directory of Open Access Journals (Sweden)

    Mohamad Hafizi Abu Bakar

    2014-12-01

    Full Text Available A growing body of evidence suggests that activation of nuclear factor kappa B (NF-κB signaling pathways is among the inflammatory mechanism involved in the development of insulin resistance and chronic low-grade inflammation in adipose tissues derived from obese animal and human subjects. Nevertheless, little is known about the roles of NF-κB pathways in regulating mitochondrial function of the adipose tissues. In the present study, we sought to investigate the direct effects of celastrol (potent NF-κB inhibitor upon mitochondrial dysfunction-induced insulin resistance in 3T3-L1 adipocytes. Celastrol ameliorates mitochondrial dysfunction by altering mitochondrial fusion and fission in adipocytes. The levels of oxidative DNA damage, protein carbonylation and lipid peroxidation were down-regulated. Further, the morphology and quantification of intracellular lipid droplets revealed the decrease of intracellular lipid accumulation with reduced lipolysis. Moreover, massive production of the pro-inflammatory mediators tumor necrosis factor-α (TNF-α and interleukin-1β (IL-1β were markedly depleted. Insulin-stimulated glucose uptake activity was restored with the enhancement of insulin signaling pathways. This study signified that the treatments modulated towards knockdown of NF-κB transcription factor may counteract these metabolic insults exacerbated in our model of synergy between mitochondrial dysfunction and inflammation. These results demonstrate for the first time that NF-κB inhibition modulates mitochondrial dysfunction induced insulin resistance in 3T3-L1 adipocytes.

  5. Protection by the gross saponins of Tribulus terrestris against cerebral ischemic injury in rats involves the NF-κB pathway

    Directory of Open Access Journals (Sweden)

    En-ping Jiang

    2011-06-01

    Full Text Available The aim of this study was to investigate whether the gross saponins of Tribulus terrestris (GSTT, a traditional Chinese herbal medicine, have neuroprotective effects on rats subjected to middle cerebral artery occlusion (MCAO, through nuclear factor-κB (NF-κB pathway and inflammatory mediators. Cerebral ischemia was produced by MCAO in either untreated (control or GSTT-pretreated rats, and the animals were examined for infarct volume, cerebral edema, neuro-behavioral abnormality and pathological changes. Meanwhile, the expression of NF-κB protein in brain tissue was analyzed on Western blots and the serum levels of TNF-α and IL-1 were determined by ELISA. The experimental results demonstrated that, compared with the control MCAO group, GSTT-pretreated MCAO group had significantly reduced infarct volume, brain edema and neuro-behavioral abnormality, and lesser degree of pathologic changes in the brain, as well as had lower levels of serum TNF-α and IL-1β, and higher levels of brain NF-κB (P<0.05. Furthermore, treatment with an NF-κB inhibitor pyrrolidine dithiocarbamate (PDTC abolished the protective effects of GSTT against MCAO-induced cerebral ischemic injury. These results indicated that GSTT's ability to protect against cerebral ischemic injury was mediated through the NF-κB signaling pathway, and that GSTT may act through inhibition of the production of inflammatory mediators.

  6. Transmissible gastroenteritis virus infection induces NF-κB activation through RLR-mediated signaling.

    Science.gov (United States)

    Ding, Zhen; An, Kang; Xie, Lilan; Wu, Wei; Zhang, Ruoxi; Wang, Dang; Fang, Ying; Chen, Huanchun; Xiao, Shaobo; Fang, Liurong

    2017-07-01

    Transmissible gastroenteritis virus (TGEV) is a porcine enteric coronavirus which causes lethal severe watery diarrhea in piglets. The pathogenesis of TGEV is strongly associated with inflammation. In this study, we found that TGEV infection activates transcription factors NF-κB, IRF3 and AP-1 in a time- and dose-dependent manner in porcine kidney cells. Treatment with the NF-κB-specific inhibitor BAY11-7082 significantly decreased TGEV-induced proinflammatory cytokine production, but did not affect virus replication. Phosphorylation of NF-κB subunit p65 and proinflammatory cytokine production were greatly decreased after knockdown of retinoic acid-inducible gene I (RIG-I)-like receptors (RLRs) or its adaptors MAVS and STING, while only slight reduction was observed in cells following silencing of Toll-like receptor adaptors, MyD88 and TRIF. Furthermore, TGEV infection significantly upregulated mRNA expression of RIG-I and MDA5. Taken together, our results indicate that the RLR signaling pathway is involved in TGEV-induced inflammatory responses. Copyright © 2017 Elsevier Inc. All rights reserved.

  7. Bupleurum chinense Roots: a Bioactivity-Guided Approach toward Saponin-Type NF-κB Inhibitors.

    Science.gov (United States)

    Liu, Xin; Latkolik, Simone; Atanasov, Atanas G; Kunert, Olaf; Pferschy-Wenzig, Eva-Maria; Heiss, Elke H; Malainer, Clemens; Schinkovitz, Andreas; Kollroser, Manfred; Dirsch, Verena M; Bauer, Rudolf

    2017-10-01

    The roots of Bupleurum chinense have a long history in traditional medicine to treat infectious diseases and inflammatory disorders. Two major compounds, saikosaponins A and D, were reported to exert potent anti-inflammatory activity by inhibiting NF- κ B. In the present study, we isolated new saikosaponin analogues from the roots of B. chinese interfering with NF- κ B activity in vitro . The methanol-soluble fraction of the dichloromethane extract of Radix Bupleuri was subjected to activity-guided isolation yielding 18 compounds, including triterpenoids and polyacetylenes. Their structures were determined by spectroscopic methods as saikogenin D ( 1 ), prosaikogenin D ( 2 ), saikosaponins B 2 ( 3 ), W ( 4 ), B 1 ( 5 ), Y ( 6 ), D ( 7 ), A ( 8 ), E ( 9 ), B 4 ( 10 ), B 3 ( 11 ), and T ( 12 ), saikodiyne A ( 13 ), D ( 14 ), E ( 15 ) and F ( 16 ), falcarindiol ( 17 ), and 1-linoleoyl-sn-glycero-3-phosphorylcholine ( 18 ). Among them, 4, 15 , and 16 are new compounds, whereas 6, previously described as a semi-synthetic compound, is isolated from a natural source for the first time, and 13 - 17 are the first reports of polyacetylenes from this plant. Nine saponins/triterpenoids were tested for inhibition of NF- κ B signaling in a cell-based NF- κ B-dependent luciferase reporter gene model in vitro . Five of them ( 1, 2, 4, 6 , and 8 ) showed strong (> 50%, at 30 µM) NF- κ B inhibition, but also varying degrees of cytotoxicity, with compounds 1 and 4 (showing no significant cytotoxicity) presenting IC 50 values of 14.0 µM and 14.1 µM in the cell-based assay, respectively. Georg Thieme Verlag KG Stuttgart · New York.

  8. NLRP3 inflammasome activation regulated by NF-κB and DAPK contributed to paraquat-induced acute kidney injury.

    Science.gov (United States)

    Liu, Zhenning; Wang, Xiaokai; Wang, Yu; Zhao, Min

    2017-06-01

    Paraquat can result in dysfunction of multiple organs after ingestion in human. However, the mechanisms of nucleotide-binding domain and leucine-rich repeat containing protein 3 (NLRP3) inflammasome activation in acute kidney injury have not been clearly demonstrated. The aim of this study was to determine the effect of NLRP3 inflammasome activation and its regulation by nuclear factor-kappa B (NF-κB) and death-associated protein kinase (DAPK). Male Wistar rats were treated with intraperitoneal injection of paraquat at 20 mg/kg, and NF-κB inhibitor BAY 11-7082 was pretreated at 10 mg/kg 1 h before paraquat exposure. Additionally, rat renal tubular epithelial cells (NRK-52E) were transfected with small interfering RNA (siRNA) against DAPK to evaluate its role in NLRP3 inflammasome activation. DAPK and NLRP3 inflammasome were evaluated by immunohistochemistry staining or Western blot; the pro-inflammatory cytokines including tumor necrosis factor α (TNF-α), interleukin-1β (IL-1β), and interleukin-18 (IL-18) were measured via ELISA. The results showed that NF-κB, DAPK, and NLRP3 inflammasome were activated in paraquat (PQ)-treated rat kidney; the secretion of pro-inflammatory cytokines was significantly increased. These toxic effects were attenuated by NF-κB inhibitor. Besides, the activation of NLRP3 inflammasome and secretion of IL-1β and IL-18 in paraquat-treated rat renal tubular epithelial cells were inhibited by siRNA against DAPK. In conclusion, NLRP3 inflammasome activation regulated by NF-κB and DAPK played an important role in paraquat-induced acute kidney injury.

  9. Celastrol, an NF-κB inhibitor, improves insulin resistance and attenuates renal injury in db/db mice.

    Directory of Open Access Journals (Sweden)

    Jung Eun Kim

    Full Text Available The NF-κB pathway plays an important role in chronic inflammatory and autoimmune diseases. Recently, NF-κB has also been suggested as an important mechanism linking obesity, inflammation, and metabolic disorders. However, there is no current evidence regarding the mechanism of action of NF-κB inhibition in insulin resistance and diabetic nephropathy in type 2 diabetic animal models. We investigated the effects of the NF-κB inhibitor celastrol in db/db mice. The treatment with celastrol for 2 months significantly lowered fasting plasma glucose (FPG, HbA1C and homeostasis model assessment index (HOMA-IR levels. Celastrol also exhibited significant decreases in body weight, kidney/body weight and adiposity. Celastrol reduced insulin resistance and lipid abnormalities and led to higher plasma adiponectin levels. Celastrol treatment also significantly mitigated lipid accumulation and oxidative stress in organs including the kidney, liver and adipose tissue. The treated group also exhibited significantly lower creatinine levels and urinary albumin excretion was markedly reduced. Celastrol treatment significantly lowered mesangial expansion and suppressed type IV collagen, PAI-1 and TGFβ1 expressions in renal tissues. Celastrol also improved abnormal lipid metabolism, oxidative stress and proinflammatory cytokine activity in the kidney. In cultured podocytes, celastrol treatment abolished saturated fatty acid-induced proinflammatory cytokine synthesis. Taken together, celastrol treatment not only improved insulin resistance, glycemic control and oxidative stress, but also improved renal functional and structural changes through both metabolic and anti-inflammatory effects in the kidney. These results suggest that targeted therapy for NF-κB may be a useful new therapeutic approach for the management of type II diabetes and diabetic nephropathy.

  10. The reciprocal interaction of sympathetic nervous system and cAMP-PKA-NF-kB pathway in immune suppression after experimental stroke.

    Science.gov (United States)

    Zuo, Lei; Shi, Luhang; Yan, Fuling

    2016-08-03

    Sympathetic nervous system(SNS) is involved in the mechanism of immune suppression after stroke. Furthermore, as the pro-inflammatory effect of nuclear factor kappa B(NF-kB) is inhibited after stroke, which is regulated by cyclic adenosine monophosphate(cAMP) and proteinkinase A(PKA). The cAMP-PKA-NF-kB pathway might play an important role in noradrenergic-mediated immune dysfunction. The purpose of our research is to analyze how SNS interfere with the immune system after acute stroke and the underlying mechanism of cAMP-PKA-NF-kB pathway in regulating the inflammation. 32 healthy male Sprague-Dawley rats were divided into 4 groups equally and randomly (1) Sham operation group; (2) middle cerebral artery occlusion; (MCAO) control group; (3) propranolol MCAO group; (4) isopropylarterenol sham group. 72h later after MCAO or sham operation, tumor necrosis factor-α(TNF-α)and interleukine-10(IL-10) in serum as well as cAMP, PKA and NF-kB in spleen cells were tested. TNF-α decreased while IL-10 increased in serum after acute ischemia stroke (pPKA in spleen both increased in MCAO model while the expression of NF-kB was inhibited (pPKA. Therefore, the level of nuclear factor NF-kB is down-regulated. Since the pro-inflammatory effect of NF-kB slacked, the immune system may be inhibited after stroke. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  11. High Phosphate-Induced Calcification of Vascular Smooth Muscle Cells is Associated with the TLR4/NF-κb Signaling Pathway

    Directory of Open Access Journals (Sweden)

    Daohai Zhang

    2017-12-01

    Full Text Available Background/Aims: Hyperphosphatemia is one of the most notable features of chronic kidney disease (CKD. Numerous epidemiological and clinical studies have found that high serum phosphate concentrations are associated with calcification in the coronary arteries. However, the mechanisms underlying the vascular calcification induced by high phosphate have not been understood fully. Methods: Vascular smooth muscle cells (VSMCs were cultured in high-phosphate media to induce vascular calcification, which was detected by Alizarin red S staining. Gene expression and protein levels of differentiation markers were determined by real-time RT-PCR and western blotting, respectively. Protein levels of phosphorylated NF-κB and TLR4 were detected by western blotting, and the role of NF-κB/TLR4 was further confirmed by using an NF-κB inhibitor or TLR4 siRNA. Results: Our results showed that high-phosphate media induced obvious calcification of VSMCs. Simultaneously, VSMC differentiation was confirmed by the increased expression of bone morphogenetic protein-2 and Runt-related transcription factor 2 and decreased expression of the VSMC-specific marker SM22α, which was accompanied by the increased expression of inflammatory cytokines. Moreover, a significant upregulation of TLR4 and phosphorylated NF-κB was also detected in VSMCs with high-phosphate media. In contrast, VSMC calcification and the increased expression of inflammatory cytokines were markedly attenuated by pretreatment with TLR4 siRNA and pyrrolidine dithiocarbamic acid, an NF-κB inhibitor. Conclusion: These data suggest that high-phosphate conditions directly induce vascular calcification via the activation of TLR4/NF-κB signaling in VSMCs. Moreover, inhibition of the TLR4/NF-κB signaling pathway might be a key intervention to prevent vascular calcification in patients with CKD.

  12. Pyrrolidine dithiocarbamate inhibits superoxide anion-induced pain and inflammation in the paw skin and spinal cord by targeting NF-κB and oxidative stress.

    Science.gov (United States)

    Pinho-Ribeiro, Felipe A; Fattori, Victor; Zarpelon, Ana C; Borghi, Sergio M; Staurengo-Ferrari, Larissa; Carvalho, Thacyana T; Alves-Filho, Jose C; Cunha, Fernando Q; Cunha, Thiago M; Casagrande, Rubia; Verri, Waldiceu A

    2016-06-01

    We evaluated the effect of pyrrolidine dithiocarbamate (PDTC) in superoxide anion-induced inflammatory pain. Male Swiss mice were treated with PDTC and stimulated with an intraplantar or intraperitoneal injection of potassium superoxide, a superoxide anion donor. Subcutaneous PDTC treatment attenuated mechanical hyperalgesia, thermal hyperalgesia, paw oedema and leukocyte recruitment (neutrophils and macrophages). Intraplantar injection of superoxide anion activated NF-κB and increased cytokine production (IL-1β, TNF-α and IL-10) and oxidative stress (nitrite and lipid peroxidation levels) at the primary inflammatory foci and in the spinal cord (L4-L6). PDTC treatment inhibited superoxide anion-induced NF-κB activation, cytokine production and oxidative stress in the paw and spinal cord. Furthermore, intrathecal administration of PDTC successfully inhibited superoxide anion-induced mechanical hyperalgesia, thermal hyperalgesia and inflammatory response in peripheral foci (paw). These results suggest that peripheral stimulus with superoxide anion activates the local and spinal cord oxidative- and NF-κB-dependent inflammatory nociceptive mechanisms. PDTC targets these events, therefore, inhibiting superoxide anion-induced inflammatory pain in mice.

  13. Phytochemicals and botanical extracts regulate NF-κB and Nrf2/ARE reporter activities in DI TNC1 astrocytes.

    Science.gov (United States)

    Ajit, Deepa; Simonyi, Agnes; Li, Runting; Chen, Zihong; Hannink, Mark; Fritsche, Kevin L; Mossine, Valeri V; Smith, Robert E; Dobbs, Thomas K; Luo, Rensheng; Folk, William R; Gu, Zezong; Lubahn, Dennis B; Weisman, Gary A; Sun, Grace Y

    2016-07-01

    The increase in oxidative stress and inflammatory responses associated with neurodegenerative diseases has drawn considerable attention towards understanding the transcriptional signaling pathways involving NF-κB (nuclear factor kappa-light-chain-enhancer of activated B cells) and Nrf2 (Nuclear Factor Erythroid 2-like 2). Our recent studies with immortalized murine microglial cells (BV-2) demonstrated effects of botanical polyphenols to inhibit lipopolysaccharide (LPS)-induced nitric oxide (NO) and enhance Nrf2-mediated antioxidant responses (Sun et al., 2015). In this study, an immortalized rat astrocyte (DI TNC1) cell line expressing a luciferase reporter driven by the NF-κB or the Nrf2/Antioxidant Response Element (ARE) promoter was used to assess regulation of these two pathways by phytochemicals such as quercetin, rutin, cyanidin, cyanidin-3-O-glucoside, as well as botanical extracts from Withania somnifera (Ashwagandha), Sutherlandia frutescens (Sutherlandia) and Euterpe oleracea (Açaí). Quercetin effectively inhibited LPS-induced NF-κB reporter activity and stimulated Nrf2/ARE reporter activity in DI TNC1 astrocytes. Cyanidin and the glycosides showed similar effects but only at much higher concentrations. All three botanical extracts effectively inhibited LPS-induced NF-κB reporter activity. These extracts were capable of enhancing ARE activity by themselves and further enhanced ARE activity in the presence of LPS. Quercetin and botanical extracts induced Nrf2 and HO-1 protein expression. Interestingly, Ashwagandha extract was more active in inducing Nrf2 and HO-1 expression in DI TNC1 astrocytes as compared to Sutherlandia and Açaí extracts. In summary, this study demonstrated NF-kB and Nrf2/ARE promoter activities in DI TNC1 astrocytes, and further showed differences in ability for specific botanical polyphenols and extracts to down-regulate LPS-induced NF-kB and up-regulate the NRF2/ARE activities in these cells. Copyright © 2016 Elsevier Ltd

  14. Effects of sevoflurane on NF-кB and TNF-α expression in renal ischemia-reperfusion diabetic rats.

    Science.gov (United States)

    Zhang, Yu; Hu, Fang; Wen, Jianghua; Wei, Xiaohong; Zeng, Yingjuan; Sun, Ying; Luo, Shunkui; Sun, Liao

    2017-10-01

    Ischemia-reperfusion (I/R) injury is the main reason of acute renal failure. However, inflammatory response and cell apoptosis are important mechanisms implicated in I/R injury. Recent studies indicated that nuclear factor kappa B (NF-кB) and tumor necrosis factor α (TNF-α) are both involved in these mechanisms. Sevoflurane reduces NF-кB and TNF-α expression in rats' heart and decreases their renal I/R injury. However, few studies are available regarding the effect of sevoflurane on kidney of diabetic rats. Therefore, the aim of this study was to evaluate sevoflurane effect on NF-кB and TNF-α expression in diabetic rats to decrease renal I/R injury. Male Sprague-Dawley rats were divided into five groups: Group A, non-diabetic rats underwent sham operation; Group B, non-diabetic rats with renal I/R injury; Group C, diabetic rats underwent sham operation; Group D, diabetic rats with renal I/R injury; Group E, diabetic rats with renal I/R injury after sevoflurane pretreatment. Rats of Group E were exposed to 2.5% sevoflurane for 30 min. After 24 h, creatinine (Cr), blood urea nitrogen (BUN), renal cell apoptosis, and NF-кB and TNF-α expression in kidney were assessed. Renal cell apoptosis, NF-кB, and TNF-α expression were significantly higher in diabetic rats with renal I/R injury group compared to diabetic rats that underwent sham operation (P renal injury by lowering the expression of NF-кB and TNF-α in renal I/R diabetic rats.

  15. miR-16 targets transcriptional corepressor SMRT and modulates NF-kappaB-regulated transactivation of interleukin-8 gene.

    Directory of Open Access Journals (Sweden)

    Rui Zhou

    Full Text Available The signaling pathways associated with the Toll-like receptors (TLRs and nuclear factor-kappaB (NF-κB are essential to pro-inflammatory cytokine and chemokine expression, as well as initiating innate epithelial immune responses. The TLR/NF-κB signaling pathways must be stringently controlled through an intricate network of positive and negative regulatory elements. MicroRNAs (miRNAs are non-coding small RNAs that regulate the stability and/or translation of protein-coding mRNAs. Herein we report that miR-16 promotes NF-κB-regulated transactivation of the IL-8 gene by suppression of the silencing mediator for retinoid and thyroid hormone receptor (SMRT. LPS stimulation activated miR-16 gene transcription in human monocytes (U937 and biliary epithelial cells (H69 through MAPK-dependent mechanisms. Transfection of cells with the miR-16 precursor promoted LPS-induced production of IL-8, IL-6, and IL-1α, without a significant effect on their RNA stability. Instead, an increase in NF-κB-regulated transactivation of the IL-8 gene was confirmed in cells following transfection of miR-16 precursor. Importantly, miR-16 targeted the 3'-untranslated region of SMRT and caused translational suppression of SMRT. LPS decreased SMRT expression via upregulation of miR-16. Moreover, functional manipulation of SMRT altered NF-κB-regulated transactivation of LPS-induced IL-8 expression. These data suggest that miR-16 targets SMRT and modulates NF-κB-regulated transactivation of the IL-8 gene.

  16. Ubiquitination and sumoylation of the HTLV-2 Tax-2B protein regulate its NF-κB activity: a comparative study with the HTLV-1 Tax-1 protein

    Science.gov (United States)

    2012-01-01

    Background Retroviruses HTLV-1 and HTLV-2 have homologous genomic structures but differ significantly in pathogenicity. HTLV-1 is associated with Adult T cell Leukemia (ATL), whereas infection by HTLV-2 has no association with neoplasia. Transformation of T lymphocytes by HTLV-1 is linked to the capacity of its oncoprotein Tax-1 to alter cell survival and cell cycle control mechanisms. Among these functions, Tax-1-mediated activation of cellular gene expression via the NF-κB pathway depends on Tax-1 post-translational modifications by ubiquitination and sumoylation. The Tax-2 protein of HTLV-2B (Tax-2B) is also modified by ubiquitination and sumoylation and activates the NF-κB pathway to a level similar to that of Tax-1. The present study aims to understand whether ubiquitination and sumoylation modifications are involved in Tax-2B-mediated activation of the NF-κB pathway. Results The comparison of Tax-1 and Tax-2B lysine to arginine substitution mutants revealed conserved patterns and levels of ubiquitination with notable difference in the lysine usage for sumoylation. Neither Tax-1 nor Tax-2B ubiquitination and sumoylation deficient mutants could activate the NF-κB pathway and fusion of ubiquitin or SUMO-1 to the C-terminus of the ubiquitination and sumoylation deficient Tax-2B mutant strikingly restored transcriptional activity. In addition, ubiquitinated forms of Tax-2B colocalized with RelA and IKKγ in prominent cytoplasmic structures associated with the Golgi apparatus, whereas colocalization of Tax-2B with the RelA subunit of NF-κB and the transcriptional coactivator p300 in punctate nuclear structures was dependent on Tax-2B sumoylation, as previously observed for Tax-1. Conclusions Both Tax-1 and Tax-2 activate the NF-κB pathway via similar mechanisms involving ubiquitination and sumoylation. Therefore, the different transforming potential of HTLV-1 and HTLV-2 is unlikely to be related to different modes of activation of the canonical NF-κB pathway

  17. Oridonin attenuates Aβ1-42-induced neuroinflammation and inhibits NF-κB pathway.

    Directory of Open Access Journals (Sweden)

    Sulei Wang

    Full Text Available Neuroinflammation induced by beta-amyloid (Aβ plays a critical role in the pathogenesis of Alzheimer's disease (AD, and inhibiting Aβ-induced neuroinflammation serves as a potential strategy for the treatment of AD. Oridonin (Ori, a compound of Rabdosia rubescens, has been shown to exert anti-inflammatory effects. In this study, we demonstrated that Ori inhibited glial activation and decreased the release of inflammatory cytokines in the hippocampus of Aβ1-42-induced AD mice. In addition, Ori inhibited the NF-κB pathway and Aβ1-42-induced apoptosis. Furthermore, Ori could attenuate memory deficits in Aβ1-42-induced AD mice. In conclusion, our study demonstrated that Ori inhibited the neuroinflammation and attenuated memory deficits induced by Aβ1-42, suggesting that Ori might be a promising candidate for AD treatment.

  18. Quercetin ameliorates imiquimod-induced psoriasis-like skin inflammation in mice via the NF-κB pathway.

    Science.gov (United States)

    Chen, Haiming; Lu, Chuanjian; Liu, Huazhen; Wang, Maojie; Zhao, Hui; Yan, Yuhong; Han, Ling

    2017-07-01

    Quercetin (QC) is a dietary flavonoid abundant in many natural plants. A series of studies have shown that it has been shown to exhibit several biological properties, including anti-inflammatory, anti-oxidant, cardio-protective, vasodilatory, liver-protective and anti-cancer activities. However, so far the possible therapeutic effect of QC on psoriasis has not been reported. The present study was undertaken to evaluate the potential beneficial effect of QC in psoriasis using a generated imiquimod (IMQ)-induced psoriasis-like mouse model, and to further elucidate its underlying mechanisms of action. Effects of QC on PASI scores, back temperature, histopathological changes, oxidative/anti-oxidative indexes, pro-inflammatory cytokines and NF-κB pathway in IMQ-induced mice were investigated. Our results showed that QC could significantly reduce the PASI scores, decrease the temperature of the psoriasis-like lesions, and ameliorate the deteriorating histopathology in IMQ-induced mice. Moreover, QC effectively attenuated levels of TNF-α, IL-6 and IL-17 in serum, increased activities of GSH, CAT and SOD, and decreased the accumulation of MDA in skin tissue induced by IMQ in mice. The mechanism may be associated with the down-regulation of NF-κB, IKKα, NIK and RelB expression and up-regulation of TRAF3, which were critically involved in the non-canonical NF-κB pathway. In conclusion, our present study demonstrated that QC had appreciable anti-psoriasis effects in IMQ-induced mice, and the underlying mechanism may involve the improvement of antioxidant and anti-inflammatory status and inhibition on the activation of the NF-κB signaling. Hence, QC, a naturally occurring flavone with potent anti-psoriatic effects, has the potential for further development as a candidate for psoriasis treatment. Copyright © 2017 Elsevier B.V. All rights reserved.

  19. Inhibition of NF-κB activity in the hypothalamic paraventricular nucleus attenuates hypertension and cardiac hypertrophy by modulating cytokines and attenuating oxidative stress

    Energy Technology Data Exchange (ETDEWEB)

    Yu, Xiao-Jing [Department of Physiology and Pathophysiology, Xi' an Jiaotong University School of Basic Medical Sciences, Xi' an Jiaotong University Cardiovascular Research Center, Xi' an Jiaotong University Health Science Center, Xi' an 710061 (China); Zhang, Dong-Mei [Department of Physiology, Dalian Medical University, Dalian 116044 (China); Jia, Lin-Lin; Qi, Jie; Song, Xin-Ai; Tan, Hong [Department of Physiology and Pathophysiology, Xi' an Jiaotong University School of Basic Medical Sciences, Xi' an Jiaotong University Cardiovascular Research Center, Xi' an Jiaotong University Health Science Center, Xi' an 710061 (China); Cui, Wei [Department of Endocrinology and Metabolism, First Affiliated Hospital of Xi' an Jiaotong University, Xi' an Jiaotong University Health Science Center, Xi' an 710061 (China); Chen, Wensheng [Department of Cardiovascular Surgery, Xijing Hospital, Fourth Military Medical University, Xi' an 710032 (China); Zhu, Guo-Qing [Key Laboratory of Cardiovascular Disease and Molecular Intervention, Department of Physiology, Nanjing Medical University, Nanjing 210029 (China); Qin, Da-Nian, E-mail: dnqin@stu.edu.cn [Department of Physiology, Shantou University Medical College, Shantou 515041 (China); Kang, Yu-Ming, E-mail: ykang@mail.xjtu.edu.cn [Department of Physiology and Pathophysiology, Xi' an Jiaotong University School of Basic Medical Sciences, Xi' an Jiaotong University Cardiovascular Research Center, Xi' an Jiaotong University Health Science Center, Xi' an 710061 (China)

    2015-05-01

    We hypothesized that chronic inhibition of NF-κB activity in the hypothalamic paraventricular nucleus (PVN) delays the progression of hypertension and attenuates cardiac hypertrophy by up-regulating anti-inflammatory cytokines, reducing pro-inflammatory cytokines (PICs), attenuating nuclear factor-κB (NF-κB) p65 and NAD(P)H oxidase in the PVN of young spontaneously hypertensive rats (SHR). Young normotensive Wistar–Kyoto (WKY) and SHR rats received bilateral PVN infusions with NF–κB inhibitor pyrrolidine dithiocarbamate (PDTC) or vehicle for 4 weeks. SHR rats had higher mean arterial pressure and cardiac hypertrophy as indicated by increased whole heart weight/body weight ratio, whole heart weight/tibia length ratio, left ventricular weight/tibia length ratio, cardiomyocyte diameters of the left cardiac ventricle, and mRNA expressions of cardiac atrial natriuretic peptide (ANP) and beta-myosin heavy chain (β-MHC). These SHR rats had higher PVN levels of proinflammatory cytokines (PICs), reactive oxygen species (ROS), the chemokine monocyte chemoattractant protein-1 (MCP-1), NAD(P)H oxidase activity, mRNA expression of NOX-2 and NOX-4, and lower PVN IL-10, and higher plasma levels of PICs and NE, and lower plasma IL-10. PVN infusion of NF-κB inhibitor PDTC attenuated all these changes. These findings suggest that NF-κB activation in the PVN increases sympathoexcitation and hypertensive response, which are associated with the increases of PICs and oxidative stress in the PVN; PVN inhibition of NF-κB activity attenuates PICs and oxidative stress in the PVN, thereby attenuates hypertension and cardiac hypertrophy. - Highlights: • Spontaneously hypertensive rats exhibit neurohormonal excitation in the PVN. • PVN inhibition of NF-κB attenuates hypertension-induced cardiac hypertrophy. • PVN inhibition of NF-κB attenuates hypertension-induced neurohormonal excitation. • PVN inhibition of NF-κB attenuates hypertension-induced imbalance of cytokines

  20. Functional Analysis of Human NF1 in Drosophila

    Science.gov (United States)

    2007-01-01

    Stratagene Chameleon kit with a pBSK-specific phosphorylated selection primer (50 pCCGCCACCGCGATGTAGCTCCAATTCGC 30) and mutation -specific mutagenesis...identified by examining the phenotypes of mutated human gene expressed in Drosophila NF1 null mutants. We also propose that Gsα/NF1-activated AC...With this paradigm established, we further tested the effects of different hNF1 deletion mutations our lab created have on the stimulation event. We

  1. Characterizing Myeloid Cell Activation in NF1 Vasculopathy

    Science.gov (United States)

    2017-07-01

    recruited by the Indiana University NF1 Clinic at Riley Hospital for Children . All patients received a physical examination and a medical history was taken...Cerebrovascular abnormalities in a population of children with neurofibromatosis type 1, Neurology 64 (3) (2005) 553–555. [7] S.A. Rasmussen, J.M. Friedman, NF1...to oxidant species underlie NF1 arterial stenosis and provide a platform for designing novels therapies and interventions. & 2016 Elsevier Inc. All

  2. The methanol-ethyl acetate partitioned fraction from Chinese olive fruits inhibits cancer cell proliferation and tumor growth by promoting apoptosis through the suppression of the NF-κB signaling pathway.

    Science.gov (United States)

    Hsieh, Shu-Chen; Hsieh, Wang-Ju; Chiang, An-Na; Su, Nan-Wei; Yeh, Yu-Te; Liao, Yi-Chun

    2016-12-07

    Chinese olives (Canarium album L.) have historically been used for medicinal purposes rather than commercially for oil. In this report, we reveal that the methanol-ethyl acetate partitioned fraction from Chinese olive fruits (MEO), of which ellagic acid accounted for 12%, exhibited profound anti-proliferative activities in the human colon cancer cell line, HCT116. Additionally, oral administration of MEO remarkably inhibited the tumor growth of subcutaneously implanted CT26 cells, a mouse colon carcinoma cell line, in BALB/c mice. Treatment with MEO induced a significant increase in the percentage of apoptotic cells and resulted in poly(ADP-ribose) polymerase (PARP) cleavage, suggesting that MEO inhibits cancer cell proliferation by promoting apoptosis. Our study also showed that MEO exerted the most potent effect on the inhibition of NF-κB-mediated signaling among the partitioned fractions from Chinese olives. This process employed the use of reporter-based bio-platforms that are capable of detecting the activation of NF-κB. In addition, phosphorylation of NF-κB signaling-associated proteins, IKKα/β, IκBα, and p65, was reduced in MEO-incubated cancer cells, indicating that MEO suppresses NF-κB activation. Moreover, MEO treatment significantly suppressed lipopolysaccharide (LPS)-induced cancer cell proliferation, demonstrating that MEO promotes cancer cell apoptosis through the inhibition of the NF-κB signaling pathway. In summary, our findings demonstrate that the methanol-ethyl acetate partitioned fraction from Chinese olive fruits inhibits cancer cell proliferation and tumor growth by promoting apoptosis through the suppression of NF-κB signaling. Therefore, the Chinese olive fruit has promising potential in cancer treatment.

  3. Saikosaponin a inhibits RANKL-induced osteoclastogenesis by suppressing NF-κB and MAPK pathways.

    Science.gov (United States)

    Zhou, Chi; Liu, Wengang; He, Wei; Wang, Haibin; Chen, Qunqun; Song, Houpan

    2015-03-01

    Inflammatory cytokines play an important role in osteoclastogenesis. Saikosaponin a (SSa) possesses anti-inflammatory activity. However, the role of SSa in osteoporosis is still unclear. Therefore, the objective of this study was to investigate the effects of SSa on receptor activator of the nuclear factor-κB ligand (RANKL)-induced osteoclastogenesis and signaling pathway by in vitro assay. In mouse bone marrow monocytes (BMMs), SSa suppressed RANKL plus macrophage colony-stimulating factor (M-CSF)-induced osteoclast differentiation in a dose-dependent manner. Moreover, SSa decreased osteoclastogenesis-related marker proteins expression, including NFATc1, c-fos and cathepsin K. At molecular levels, SSa inhibited RANKL-induced IκBα phosphorylation, p65 phosphorylation and NF-κB luciferase activity in RAW264.7 cells. And SSa also suppressed RANKL-induced p-38, extracellular signal-regulated kinase (ERK), c-Jun N-terminal kinase (JNK) phosphorylation. Taken together, these findings suggest that SSa suppresses osteoclastogenesis through inhibiting RANKL-induced p-38, ERK, JNK and NF-κB activation. SSa is a novel agent in the treatment of osteoclast-related diseases, such as osteoporosis. Copyright © 2015 Elsevier B.V. All rights reserved.

  4. Diarctigenin, a lignan constituent from Arctium lappa, down-regulated zymosan-induced transcription of inflammatory genes through suppression of DNA binding ability of nuclear factor-kappaB in macrophages.

    Science.gov (United States)

    Kim, Byung Hak; Hong, Seong Su; Kwon, Soon Woo; Lee, Hwa Young; Sung, Hyeran; Lee, In-Jeong; Hwang, Bang Yeon; Song, Sukgil; Lee, Chong-Kil; Chung, Daehyun; Ahn, Byeongwoo; Nam, Sang-Yoon; Han, Sang-Bae; Kim, Youngsoo

    2008-11-01

    Diarctigenin was previously isolated as an inhibitor of nitric oxide (NO) production in macrophages from the seeds of Arctium lappa used as an alternative medicine for the treatment of inflammatory disorders. However, little is known about the molecular basis of these effects. Here, we demonstrated that diarctigenin inhibited the production of NO, prostaglandin E(2), tumor necrosis factor-alpha, and interleukin (IL)-1beta and IL-6 with IC(50) values of 6 to 12 miciroM in zymosan- or lipopolysaccharide-(LPS) activated macrophages. Diarctigenin attenuated zymosan-induced mRNA synthesis of inducible NO synthase (iNOS) and also inhibited promoter activities of iNOS and cytokine genes in the cells. Because nuclear factor (NF)-kappaB plays a pivotal role in inflammatory gene transcription, we next investigated the effect of diarctigenin on NF-kappaB activation. Diarctigenin inhibited the transcriptional activity and DNA binding ability of NF-kappaB in zymosan-activated macrophages but did not affect the degradation and phosphorylation of inhibitory kappaB (IkappaB) proteins. Moreover, diarctigenin suppressed expression vector NF-kappaB p65-elicited NF-kappaB activation and also iNOS promoter activity, indicating that the compound could directly target an NF-kappa-activating signal cascade downstream of IkappaB degradation and inhibit NF-kappaB-regulated iNOS expression. Diarctigenin also inhibited the in vitro DNA binding ability of NF-kappaB but did not affect the nuclear import of NF-kappaB p65 in the cells. Taken together, diarctigenin down-regulated zymosan- or LPS-induced inflammatory gene transcription in macrophages, which was due to direct inhibition of the DNA binding ability of NF-kappaB. Finally, this study provides a pharmacological potential of diarctigenin in the NF-kappaB-associated inflammatory disorders.

  5. NleC, a type III secretion protease, compromises NF-κB activation by targeting p65/RelA.

    Directory of Open Access Journals (Sweden)

    Hilo Yen

    Full Text Available The NF-κB signaling pathway is central to the innate and adaptive immune responses. Upon their detection of pathogen-associated molecular patterns, Toll-like receptors on the cell surface initiate signal transduction and activate the NF-κB pathway, leading to the production of a wide array of inflammatory cytokines, in attempt to eradicate the invaders. As a countermeasure, pathogens have evolved ways to subvert and manipulate this system to their advantage. Enteropathogenic and enterohemorrhagic Escherichia coli (EPEC and EHEC are closely related bacteria responsible for major food-borne diseases worldwide. Via a needle-like protein complex called the type three secretion system (T3SS, these pathogens deliver virulence factors directly to host cells and modify cellular functions, including by suppressing the inflammatory response. Using gain- and loss-of-function screenings, we identified two bacterial effectors, NleC and NleE, that down-regulate the NF-κB signal upon being injected into a host cell via the T3SS. A recent report showed that NleE inhibits NF-κB activation, although an NleE-deficient pathogen was still immune-suppressive, indicating that other anti-inflammatory effectors are involved. In agreement, our present results showed that NleC was also required to inhibit inflammation. We found that NleC is a zinc protease that disrupts NF-κB activation by the direct cleavage of NF-κB's p65 subunit in the cytoplasm, thereby decreasing the available p65 and reducing the total nuclear entry of active p65. More importantly, we showed that a mutant EPEC/EHEC lacking both NleC and NleE (ΔnleC ΔnleE caused greater inflammatory response than bacteria carrying ΔnleC or ΔnleE alone. This effect was similar to that of a T3SS-defective mutant. In conclusion, we found that NleC is an anti-inflammatory bacterial zinc protease, and that the cooperative function of NleE and NleC disrupts the NF-κB pathway and accounts for most of the immune

  6. 6-Gingerol inhibits ROS and iNOS through the suppression of PKC-{alpha} and NF-{kappa}B pathways in lipopolysaccharide-stimulated mouse macrophages

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Tzung-Yan, E-mail: joyamen@mail.cgu.edu.tw [Graduate Institute of Traditional Chinese Medicine, Chang Gung University, No. 259, Wen-Hwa 1st Road, Kwei-Shan Tao-Yuan 333, Taiwan (China); Lee, Ko-Chen [School of Traditional Chinese Medicine, Chang Gung University, Taiwan (China); Center for Traditional Chinese Medicine, Chang Gung Memorial Hospital, Taoyuan, Taiwan (China); Chen, Shih-Yuan [Graduate Institute of Traditional Chinese Medicine, Chang Gung University, No. 259, Wen-Hwa 1st Road, Kwei-Shan Tao-Yuan 333, Taiwan (China); Chang, Hen-Hong [Graduate Institute of Traditional Chinese Medicine, Chang Gung University, No. 259, Wen-Hwa 1st Road, Kwei-Shan Tao-Yuan 333, Taiwan (China); Center for Traditional Chinese Medicine, Chang Gung Memorial Hospital, Taoyuan, Taiwan (China)

    2009-04-24

    Inflammation is involved in numerous diseases, including chronic inflammatory diseases and the development of cancer. Many plants possess a variety of biological activities, including antifungal, antibacterial and anti-inflammatory activities. However, our understanding of the anti-inflammatory effects of 6-gingerol is very limited. We used lipopolysaccharide (LPS)-stimulated macrophages as a model of inflammation to investigate the anti-inflammatory effects of 6-gingerol, which contains phenolic structure. We found that 6-gingerol exhibited an anti-inflammatory effect. 6-Gingerol could decrease inducible nitric oxide synthase and TNF-{alpha} expression through suppression of I-{kappa}B{alpha} phosphorylation, NF-{kappa}B nuclear activation and PKC-{alpha} translocation, which in turn inhibits Ca{sup 2+} mobilization and disruption of mitochondrial membrane potential in LPS-stimulated macrophages. Here, we demonstrate that 6-gingerol acts as an anti-inflammatory agent by blocking NF-{kappa}B and PKC signaling, and may be developed as a useful agent for the chemoprevention of cancer or inflammatory diseases.

  7. 6-Gingerol inhibits ROS and iNOS through the suppression of PKC-α and NF-κB pathways in lipopolysaccharide-stimulated mouse macrophages

    International Nuclear Information System (INIS)

    Lee, Tzung-Yan; Lee, Ko-Chen; Chen, Shih-Yuan; Chang, Hen-Hong

    2009-01-01

    Inflammation is involved in numerous diseases, including chronic inflammatory diseases and the development of cancer. Many plants possess a variety of biological activities, including antifungal, antibacterial and anti-inflammatory activities. However, our understanding of the anti-inflammatory effects of 6-gingerol is very limited. We used lipopolysaccharide (LPS)-stimulated macrophages as a model of inflammation to investigate the anti-inflammatory effects of 6-gingerol, which contains phenolic structure. We found that 6-gingerol exhibited an anti-inflammatory effect. 6-Gingerol could decrease inducible nitric oxide synthase and TNF-α expression through suppression of I-κBα phosphorylation, NF-κB nuclear activation and PKC-α translocation, which in turn inhibits Ca 2+ mobilization and disruption of mitochondrial membrane potential in LPS-stimulated macrophages. Here, we demonstrate that 6-gingerol acts as an anti-inflammatory agent by blocking NF-κB and PKC signaling, and may be developed as a useful agent for the chemoprevention of cancer or inflammatory diseases.

  8. Effects of andrographolide on postoperative cognitive dysfunction and the association with NF-κB/MAPK pathway.

    Science.gov (United States)

    Ding, Yongbo; Shi, Cunxian; Chen, Linjing; Ma, Piliang; Li, Kezhong; Jin, Jin; Zhang, Qingfeng; Li, Aizhi

    2017-12-01

    The present study investigated the effects of andrographolide on postoperative cognitive dysfunction (POCD) in aged rats to gain insight of the underlying mechanism, which may provide theoretical basis for the clinical application of andrographolide to prevent POCD in older patients. Thirty aged male rats were randomly assigned to 3 groups: Control, model and andrographolide groups. The Morris water maze test was used to examine the spatial memory and learning ability of the rats postoperatively. The histological alterations of neuronal cells in the hippocampus were visualized by H&E staining. The serum levels of neuron-specific enolase (NSE), human soluble protein-100β (S-100β) and the inflammation factors of interluekin (IL)-1β, IL-6 and TNF-α involved in the nuclear factor κB (NF-κB)/mitogen-activated protein kinase (MAPK) signaling pathway were detected by ELISA. The NF-κB/MAPK signaling pathway-associated proteins in rat serum were detected by western blotting. Following andrographolide treatment, the rats significantly gained learning ability after surgery. Is it ameliorated hippocampal neuronal injury in rats following surgery. Andrographolide decreased NSE, S-100β, and the inflammation factors, IL-6, IL-1β and TNF-α in serum. Andrographolide reduced NF-κB/MAPK pathway-associated protein expression. Andrographolide ameliorated POCD in aged rats following surgery. The underlying mechanism may be associated with the downregulation the inflammatory factors and NF-κB/MAPK-associated protein expression.

  9. Homeostatic NF-κB Signaling in Steady-State Migratory Dendritic Cells Regulates Immune Homeostasis and Tolerance.

    Science.gov (United States)

    Baratin, Myriam; Foray, Chloe; Demaria, Olivier; Habbeddine, Mohamed; Pollet, Emeline; Maurizio, Julien; Verthuy, Christophe; Davanture, Suzel; Azukizawa, Hiroaki; Flores-Langarica, Adriana; Dalod, Marc; Lawrence, Toby

    2015-04-21

    Migratory non-lymphoid tissue dendritic cells (NLT-DCs) transport antigens to lymph nodes (LNs) and are required for protective immune responses in the context of inflammation and to promote tolerance to self-antigens in steady-state. However, the molecular mechanisms that elicit steady-state NLT-DC maturation and migration are unknown. By comparing the transcriptome of NLT-DCs in the skin with their migratory counterparts in draining LNs, we have identified a novel NF-κB-regulated gene network specific to migratory DCs. We show that targeted deletion of IKKβ in DCs, a major activator of NF-κB, prevents NLT-DC accumulation in LNs and compromises regulatory T cell conversion in vivo. This was associated with impaired tolerance and autoimmunity. NF-κB is generally considered the prototypical pro-inflammatory transcription factor, but this study describes a role for NF-κB signaling in DCs for immune homeostasis and tolerance that could have implications in autoimmune diseases and immunity. Copyright © 2015 Elsevier Inc. All rights reserved.

  10. Gastrodin stimulates anticancer immune response and represses transplanted H22 hepatic ascitic tumor cell growth: Involvement of NF-κB signaling activation in CD4 + T cells

    Energy Technology Data Exchange (ETDEWEB)

    Shu, Guangwen; Yang, Tianming [College of Pharmacy, South-Central University for Nationalities, Wuhan (China); Wang, Chaoyuan [College of Life Science, South-Central University for Nationalities, Wuhan (China); Su, Hanwen, E-mail: suhanwen-1@163.com [Renmin Hospital of Wuhan University, Wuhan (China); Xiang, Meixian, E-mail: xiangmeixian99@163.com [College of Pharmacy, South-Central University for Nationalities, Wuhan (China)

    2013-06-15

    Gastrodia elata Blume (G. elata) is a famous restorative food in East Asia. It can be used as an auxiliary reagent in hepatocellular carcinoma (HCC) treatment. Previous studies unveiled that G. elata exhibited immunomodulatory activities. To explore the active ingredients contributing to its immunomodulatory activities, gastrodin, vanillin, and parishin B were purified from G. elata and their anti-HCC effects were assessed in vivo. Among these compounds, only gastrodin was capable of repressing transplanted H22 ascitic hepatic tumor cell growth in vivo with low toxicity. Further investigations were designed to explore the effects of gastrodin on the immune system of tumor-bearing mice and potential molecular mechanisms underlying these effects. Our data showed that gastrodin ameliorated tumor cell transplantation-induced activation of endogenous pro-apoptotic pathway in CD4 + T cells and abnormalities in serum cytokine profiles in host animals. These events enhanced cytotoxic activities of natural killer and CD8 + T cells against H22 hepatic cancer cells. Gastrodin administration specifically upregulated mRNA levels of several nuclear factor κB (NF-κB) responsive genes in CD4 + T cells but not in CD8 + T cells. Chromatin immunoprecipitation assay showed that gastrodin increased the association of NF-κB p65 subunit to the promoter regions of IL-2 and Bcl-2 encoding genes in CD4 + T cells. Our investigations demonstrated that gastrodin is the main active ingredient contributing to the anticancer immunomodulatory properties of G. elata. Promoting NF-κB-mediated gene transcription in CD4 + T cells is implicated in its immunomodulatory activity. - Highlights: • Gastrodin stimulates anticancer immune response. • Gastrodin represses tumor transplantation-induced CD4 + T cell apoptosis. • Gastrodin activates NF-κB activity in CD4 + T cells.

  11. Arsenic affects inflammatory cytokine expression in Gallus gallus brain tissues.

    Science.gov (United States)

    Sun, Xiao; He, Ying; Guo, Ying; Li, Siwen; Zhao, Hongjing; Wang, Yu; Zhang, Jingyu; Xing, Mingwei

    2017-06-05

    The heavy metal arsenic is widely distributed in nature and posses a serious threat to organism's health. However, little is known about the arsenic-induced inflammatory response in the brain tissues of birds and the relationship and mechanism of the inflammatory response. The purpose of this study was to explore the effects of dietary arsenic on the expression of inflammatory cytokines in the brains of Gallus gallus. Seventy-two 1-day-old male Hy-line chickens were divided into a control group, a low arsenic trioxide (As 2 O 3 )-treated (7.5 mg/kg) group, a middle As 2 O 3 -treated (15 mg/kg) group, and a high As 2 O 3 -treated (30 mg/kg) group. Arsenic exposure caused obvious ultrastructural changes. The mRNA levels of the transcription factor nuclear factor-κB (NF-κB) and of pro-inflammatory cytokines, including inducible NO synthase (iNOS), cyclooxygenase-2 (COX-2), and prostaglandin E synthase (PTGEs), in chicken brain tissues (cerebrum, cerebellum, thalamus, brainstem and myelencephalon) on days 30, 60 and 90, respectively, were measured by real-time PCR. The protein expression of iNOS was detected by western blot. The results showed that after being treated with As 2 O 3, the levels of inflammatory-related factor NF-κB and pro-inflammatory cytokines in chicken brain tissues increased (P Arsenic exposure in the chickens triggered host defence and induced an inflammatory response by regulating the expression of inflammatory-related genes in the cerebrum, cerebellum, thalamus, brainstem and myelencephalon. These data form a foundation for further research on arsenic-induced neurotoxicity in Gallus gallus.

  12. Transcriptional Activation of Inflammatory Genes: Mechanistic Insight into Selectivity and Diversity

    Directory of Open Access Journals (Sweden)

    Afsar U. Ahmed

    2015-11-01

    Full Text Available Acute inflammation, an integral part of host defence and immunity, is a highly conserved cellular response to pathogens and other harmful stimuli. An inflammatory stimulation triggers transcriptional activation of selective pro-inflammatory genes that carry out specific functions such as anti-microbial activity or tissue healing. Based on the nature of inflammatory stimuli, an extensive exploitation of selective transcriptional activations of pro-inflammatory genes is performed by the host to ensure a defined inflammatory response. Inflammatory signal transductions are initiated by the recognition of inflammatory stimuli by transmembrane receptors, followed by the transmission of the signals to the nucleus for differential gene activations. The differential transcriptional activation of pro-inflammatory genes is precisely controlled by the selective binding of transcription factors to the promoters of these genes. Among a number of transcription factors identified to date, NF-κB still remains the most prominent and studied factor for its diverse range of selective transcriptional activities. Differential transcriptional activities of NF-κB are dictated by post-translational modifications, specificities in dimer formation, and variability in activation kinetics. Apart from the differential functions of transcription factors, the transcriptional activation of selective pro-inflammatory genes is also governed by chromatin structures, epigenetic markers, and other regulators as the field is continuously expanding.

  13. Anti-inflammatory properties of culinary herbs and spices that ameliorate the effects of metabolic syndrome.

    Science.gov (United States)

    Jungbauer, Alois; Medjakovic, Svjetlana

    2012-03-01

    Obesity and metabolic syndrome are increasing global health problems. In addition to the malnutrition of a sedentary lifestyle, high calorie intake leads to obesity with many negative health consequences. Macrophages infiltrate adipose tissue and induce chronic inflammation by secreting pro-inflammatory cytokines, including COX-2 and iNOS, among other mediators of inflammation. Free fatty acids mediate adipose tissue signalling through toll-like receptor 4 and the expression of these pro-inflammatory mediators via NF-κB or JNK. PPAR γ activators can inhibit the activation of NF-κB, down-regulating the expression of pro-inflammatory cytokines. Here we provide an overview of how different culinary herbs and spices exert anti-inflammatory activities and the extent to which they activate PPAR α and PPAR γ, inhibit the activation of NF-κB, and enhance expression of anti-inflammatory cytokines. Spices can play essential roles as anti-inflammatory agents in our diet, acting as pan PPAR activators and improving insulin sensitivity, counteracting dyslipidaemia and weight gain. The effects of chronic inflammation caused by obesity are counteracted and, consequently, the progression of diseases associated with chronic inflammation slowed. Copyright © 2011 Elsevier Ireland Ltd. All rights reserved.

  14. Looped limulus anti-lipopolysaccharide derived peptide CLP-19 induces endotoxin tolerance involved inhibition of NF-κB activation.

    Science.gov (United States)

    Yang, Ya; Li, Di; Tian, Zhiqiang; Lv, Jun; Sun, Fengjun; Wang, Qian; Liu, Yao; Xia, Peiyuan

    2016-11-18

    Endotoxin tolerance (ET) is a complex protective mechanism against endotoxin shock. The looped CLP-19 peptide derived from Limulus anti-LPS peptide induced the ET phenomenon but the molecular mechanism has yet to be fully elucidated. Here, we confirmed that CLP-19 attenuated upon LPS stimulated pro-inflammatory factor secretion of TNF-α and IL-6 but increased anti-inflammatory factor production of IL-10 in dose- and time-dependent manners. CLP-19 also inhibited subsequent LPS stimulated expression of TLR4 on the cell membrane. Moreover, the CLP-19 inhibited degradation of the inhibitor of NF-κB (IκBα and IκBβ) and reduced LPS induced NF-κB activity, but not of effects on expression of MyD88 and TRAF-6. Finally CLP-19 significantly increased survival of lethal LPS shock mouse models with significantly less pathological injury to lung. These findings collectively suggest that CLP-19 induces ET phenomenon involved inhibition of NF-κB activation. In conclusion, this study has revealed a novel function of CLP-19 that appears to represent a potential therapeutic agent for clinical treatment of septic shock. Copyright © 2016 Elsevier Inc. All rights reserved.

  15. The acetyltransferase HAT1 moderates the NF-κB response by regulating the transcription factor PLZF.

    Science.gov (United States)

    Sadler, Anthony J; Suliman, Bandar A; Yu, Liang; Yuan, Xiangliang; Wang, Die; Irving, Aaron T; Sarvestani, Soroush T; Banerjee, Ashish; Mansell, Ashley S; Liu, Jun-Ping; Gerondakis, Steve; Williams, Bryan R G; Xu, Dakang

    2015-04-13

    To date, the activities of protein kinases have formed the core of our understanding of cell signal transduction. Comprehension of the extent of protein acetylation has raised expectations that this alternate post-transcriptional modification will be shown to rival phosphorylation in its importance in mediating cellular responses. However, limited instances have been identified. Here we show that signalling from Toll-like or TNF-α receptors triggers the calcium/calmodulin-dependent protein kinase (CaMK2) to activate histone acetyltransferase-1 (HAT1), which then acetylates the transcriptional regulator PLZF. Acetylation of PLZF promotes the assembly of a repressor complex incorporating HDAC3 and the NF-κB p50 subunit that limits the NF-κB response. Accordingly, diminishing the activity of CaMK2, the expression levels of PLZF or HAT1, or mutating key residues that are covalently modified in PLZF and HAT1, curtails control of the production of inflammatory cytokines. These results identify a central role for acetylation in controlling the inflammatory NF-κB transcriptional programme.

  16. CTF Meeting 2012: Translation of the Basic Understanding of the Biology and Genetics of NF1, NF2, and Schwannomatosis Toward the Development of Effective Therapies

    Science.gov (United States)

    Widemann, Brigitte C.; Acosta, Maria T.; Ammoun, Sylvia; Belzberg, Allan J.; Bernards, Andre; Blakeley, Jaishri; Bretscher, Antony; Cichowski, Karen; Clapp, D. Wade; Dombi, Eva; Evans, Gareth D.; Ferner, Rosalie; Fernandez-Valle, Cristina; Fisher, Michael J.; Giovannini, Marco; Gutmann, David H.; Hanemann, C. Oliver; Hennigan, Robert; Huson, Susan; Ingram, David; Kissil, Joe; Korf, Bruce R.; Legius, Eric; Packer, Roger J.; McClatchey, Andrea I; McCormick, Frank; North, Kathryn; Pehrsson, Minja; Plotkin, Scott R.; Ramesh, Vijaya; Ratner, Nancy; Schirmer, Susann; Sherman, Larry; Schorry, Elizabeth; Stevenson, David; Stewart, Douglas R.; Ullrich, Nicole; Bakker, Annette C.; Morrison, Helen

    2014-01-01

    The neurofibromatoses (NF) are autosomal dominant genetic disorders that encompass the rare diseases NF1, NF2, and schwannomatosis. The NFs affect more people worldwide than Duchenne muscular dystrophy and Huntington's disease combined. NF1 and NF2 are caused by mutations of known tumor suppressor genes (NF1 and NF2, respectively). For schwannomatosis, although mutations in SMARCB1 were identified in a subpopulation of schwannomatosis patients, additional causative gene mutations are still to be discovered. Individuals with NF1 may demonstrate manifestations in multiple organ systems, including tumors of the nervous system, learning disabilities, and physical disfigurement. NF2 ultimately can cause deafness, cranial nerve deficits, and additional severe morbidities caused by tumors of the nervous system. Unmanageable pain is a key finding in patients with schwannomatosis. Although today there is no marketed treatment for NF-related tumors, a significant number of clinical trials have become available. In addition, significant preclinical efforts have led to a more rational selection of potential drug candidates for NF trials. An important element in fueling this progress is the sharing of knowledge. For over 20 years the Children's Tumor Foundation has convened an annual NF Conference, bringing together NF professionals to share novel findings, ideas, and build collaborations. The 2012 NF Conference held in New Orleans hosted over 350 NF researchers and clinicians. This article provides a synthesis of the highlights presented at the conference and as such, is a “state-of-the-field” for NF research in 2012. PMID:24443315

  17. Intranuclear interactomic inhibition of NF-κB suppresses LPS-induced severe sepsis

    Energy Technology Data Exchange (ETDEWEB)

    Park, Sung-Dong [Translational Research Center for Protein Function Control, College of Life Science and Biotechnology, Yonsei University, Seoul 120-749 (Korea, Republic of); Department of Biotechnology, College of Life Science and Biotechnology, Yonsei University, Seoul 120-749 (Korea, Republic of); Cheon, So Yeong [Department of Anesthesiology and Pain Medicine, Anesthesia and Pain Research Institute, Yonsei University College of Medicine, Seoul 120-752 (Korea, Republic of); Park, Tae-Yoon; Shin, Bo-Young [Translational Research Center for Protein Function Control, College of Life Science and Biotechnology, Yonsei University, Seoul 120-749 (Korea, Republic of); Department of Biotechnology, College of Life Science and Biotechnology, Yonsei University, Seoul 120-749 (Korea, Republic of); Oh, Hyunju; Ghosh, Sankar [Department of Microbiology and Immunology, College of Physicians and Surgeons, Columbia University, New York, NY 10032 (United States); Koo, Bon-Nyeo, E-mail: koobn@yuhs.ac [Department of Anesthesiology and Pain Medicine, Anesthesia and Pain Research Institute, Yonsei University College of Medicine, Seoul 120-752 (Korea, Republic of); Lee, Sang-Kyou, E-mail: sjrlee@yonsei.ac.kr [Translational Research Center for Protein Function Control, College of Life Science and Biotechnology, Yonsei University, Seoul 120-749 (Korea, Republic of); Department of Biotechnology, College of Life Science and Biotechnology, Yonsei University, Seoul 120-749 (Korea, Republic of)

    2015-08-28

    Suppression of nuclear factor-κB (NF-κB) activation, which is best known as a major regulator of innate and adaptive immune responses, is a potent strategy for the treatment of endotoxic sepsis. To inhibit NF-κB functions, we designed the intra-nuclear transducible form of transcription modulation domain (TMD) of RelA (p65), called nt-p65-TMD, which can be delivered effectively into the nucleus without influencing the cell viability, and work as interactomic inhibitors via disruption of the endogenous p65-mediated transcription complex. nt-p65-TMD effectively inhibited the secretion of pro-inflammatory cytokines, including TNF-α, IL-1β, or IL-6 from BV2 microglia cells stimulated by lipopolysaccharide (LPS). nt-p65-TMD did not inhibit tyrosine phosphorylation of signaling mediators such as ZAP-70, p38, JNK, or ERK involved in T cell activation, but was capable of suppressing the transcriptional activity of NF-κB without the functional effect on that of NFAT upon T-cell receptor (TCR) stimulation. The transduced nt-p65-TMD in T cell did not affect the expression of CD69, however significantly inhibited the secretion of T cell-specific cytokines such as IL-2, IFN-γ, IL-4, IL-17A, or IL-10. Systemic administration of nt-p65-TMD showed a significant therapeutic effect on LPS-induced sepsis model by inhibiting pro-inflammatory cytokines secretion. Therefore, nt-p65-TMD can be a novel therapeutics for the treatment of various inflammatory diseases, including sepsis, where a transcription factor has a key role in pathogenesis, and further allows us to discover new functions of p65 under normal physiological condition without genetic alteration. - Highlights: • The nt-p65-TMD is intra-nuclear interactomic inhibitor of endogenous p65. • The nt-p65-TMD effectively inhibited the secretion of pro-inflammatory cytokines. • The excellent therapeutic potential of nt-p65-TMD was confirmed in sepsis model.

  18. Bifidobacterium animalis AHC7 protects against pathogen-induced NF-kappaB activation in vivo

    LENUS (Irish Health Repository)

    O'Mahony, David

    2010-12-22

    Abstract Background Bifidobacteria and lactobacilli are among the early and important colonizers of the gastrointestinal tract and are generally considered to be part of a normal, healthy microbiota. It is believed that specific strains within the microbiota can influence host immune-reactivity and may play a role in protection from infection and aberrant inflammatory activity. One such strain, Bifidobacterium animalis AHC7, has been previously shown to protect against Salmonella typhimurium infection in mice and helps resolve acute idiopathic diarrhea in dogs. The aim of this study was to investigate the potential molecular and cellular mechanisms underpinning the Bifidobacterium animalis AHC7 protective effect. Results Following 4 hours of infection with Salmonella typhimurium, NF-κB activation was significantly elevated in vivo in placebo and Enterococcus faecium-fed animals while Bifidobacterium animalis AHC7 consumption significantly attenuated the NF-κB response. In vitro anti-CD3\\/CD28 stimulated Peyer\\'s patch cells secreted significantly less TNF-α and IFN-γ following Bifidobacterium animalis AHC7 consumption. Stimulated cells released more IL-12p70 but this difference did not reach statistical significance. No alteration in mucosal IL-6, IL-10 or MCP-1 levels were observed. No statistically significant change in the cytokine profile of mesenteric lymph node cells was noted. In vitro, Bifidobacterium animalis AHC7 was bound by dendritic cells and induced secretion of both IL-10 and IL-12p70. In addition, co-culture of CD4+ T cells with Bifidobacterium animalis AHC7-stimulated dendritic cells resulted in a significant increase in CD25+Foxp3+ T cell numbers. Conclusion Bifidobacterium animalis AHC7 exerts an anti-inflammatory effect via the attenuation of pro-inflammatory transcription factor activation in response to an infectious insult associated with modulation of pro-inflammatory cytokine production within the mucosa. The cellular mechanism

  19. Intranuclear interactomic inhibition of NF-κB suppresses LPS-induced severe sepsis

    International Nuclear Information System (INIS)

    Park, Sung-Dong; Cheon, So Yeong; Park, Tae-Yoon; Shin, Bo-Young; Oh, Hyunju; Ghosh, Sankar; Koo, Bon-Nyeo; Lee, Sang-Kyou

    2015-01-01

    Suppression of nuclear factor-κB (NF-κB) activation, which is best known as a major regulator of innate and adaptive immune responses, is a potent strategy for the treatment of endotoxic sepsis. To inhibit NF-κB functions, we designed the intra-nuclear transducible form of transcription modulation domain (TMD) of RelA (p65), called nt-p65-TMD, which can be delivered effectively into the nucleus without influencing the cell viability, and work as interactomic inhibitors via disruption of the endogenous p65-mediated transcription complex. nt-p65-TMD effectively inhibited the secretion of pro-inflammatory cytokines, including TNF-α, IL-1β, or IL-6 from BV2 microglia cells stimulated by lipopolysaccharide (LPS). nt-p65-TMD did not inhibit tyrosine phosphorylation of signaling mediators such as ZAP-70, p38, JNK, or ERK involved in T cell activation, but was capable of suppressing the transcriptional activity of NF-κB without the functional effect on that of NFAT upon T-cell receptor (TCR) stimulation. The transduced nt-p65-TMD in T cell did not affect the expression of CD69, however significantly inhibited the secretion of T cell-specific cytokines such as IL-2, IFN-γ, IL-4, IL-17A, or IL-10. Systemic administration of nt-p65-TMD showed a significant therapeutic effect on LPS-induced sepsis model by inhibiting pro-inflammatory cytokines secretion. Therefore, nt-p65-TMD can be a novel therapeutics for the treatment of various inflammatory diseases, including sepsis, where a transcription factor has a key role in pathogenesis, and further allows us to discover new functions of p65 under normal physiological condition without genetic alteration. - Highlights: • The nt-p65-TMD is intra-nuclear interactomic inhibitor of endogenous p65. • The nt-p65-TMD effectively inhibited the secretion of pro-inflammatory cytokines. • The excellent therapeutic potential of nt-p65-TMD was confirmed in sepsis model

  20. Utilization of IκB–EGFP Chimeric Gene as an Indicator to Identify Microbial Metabolites with NF-κB Inhibitor Activity

    Directory of Open Access Journals (Sweden)

    Lin Yu-Ling

    2010-10-01

    Full Text Available Abstract NF-κB regulates several important expressions, such as cytokine release, anti-apoptosis, adhesion molecule expression, and cell cycle processing. Several NF-κB inhibitors have been discovered as an anti-tumor or anti-inflammatory drug. The activity of NF-κB transcription factor is negatively regulated by IκB binding. In this study, IκB assay system was established and IκB–EGFP fusion protein was used as an indicator to monitor the effects of substances on the IκB degradation. The results indicated that the chosen hydroquinone could inhibit the IκB degradation and cause the cell de-attachment from the bottom of culture plate. In addition, this system could also monitor the IκB degradation of microbial metabolite of natural mixtures of propolis. Thus, the IκB assay system may be a good system for drug discovery related to microbial metabolite.

  1. Utilization of IκB–EGFP Chimeric Gene as an Indicator to Identify Microbial Metabolites with NF-κB Inhibitor Activity

    Directory of Open Access Journals (Sweden)

    Chen Yen-Shun

    2010-01-01

    Full Text Available Abstract NF-κB regulates several important expressions, such as cytokine release, anti-apoptosis, adhesion molecule expression, and cell cycle processing. Several NF-κB inhibitors have been discovered as an anti-tumor or anti-inflammatory drug. The activity of NF-κB transcription factor is negatively regulated by IκB binding. In this study, IκB assay system was established and IκB–EGFP fusion protein was used as an indicator to monitor the effects of substances on the IκB degradation. The results indicated that the chosen hydroquinone could inhibit the IκB degradation and cause the cell de-attachment from the bottom of culture plate. In addition, this system could also monitor the IκB degradation of microbial metabolite of natural mixtures of propolis. Thus, the IκB assay system may be a good system for drug discovery related to microbial metabolite.

  2. WNT/β-catenin pathway modulates the TNF-α-induced inflammatory response in bronchial epithelial cells.

    Science.gov (United States)

    Jang, Jaewoong; Jung, Yoonju; Chae, Seyeon; Chung, Sang-In; Kim, Seok-Min; Yoon, Yoosik

    2017-03-04

    In this study, TNF-α was found to activate the WNT/β-catenin pathway in BEAS-2B human bronchial epithelial cells. Levels of phospho-LRP6, Dvl-2, and phospho-GSK-3β were elevated, while that of Axin was reduced by TNF-α treatment. Nuclear translocation of β-catenin and the reporter activity of a β-catenin-responsive promoter were increased by TNF-α treatment. Under the same experimental conditions, TNF-α activated the NF-κB signaling, which includes the phosphorylation and degradation of IκB and nuclear translocation and target DNA binding of NF-κB, and it was found that an inhibitor of NF-κB activation, JSH-23, inhibited TNF-α-induced Wnt signaling as well as NF-κB signaling. It was also found that recombinant Wnt proteins induced NF-κB nuclear translocations and its target DNA binding, suggesting that Wnt signaling and NF-κB signaling were inter-connected. TNF-α-induced modulations of IκB and NF-κB as well as pro-inflammatory cytokine expression were significantly suppressed by the transfection of β-catenin siRNA compared to that of control siRNA. Transfection of a β-catenin expression plasmid augmented the TNF-α-induced modulations of IκB and NF-κB as well as pro-inflammatory cytokine expression. These results clearly demonstrated that the WNT/β-catenin pathway modulates the inflammatory response induced by TNF-α, suggesting that this pathway may be a useful target for the effective treatment of bronchial inflammation. Copyright © 2017. Published by Elsevier Inc.

  3. Asterias rubens: Evidence of NF-kappa B genes.

    Science.gov (United States)

    Leclerc, Michel; Kresdorn, Nicolas; Horres, Ralf

    2016-06-01

    In the present paper we show a survey of the Asterias rubens sea star genome for genes associated with NF-kappa-B proteins implied in the immune response. The NF-kappa B gene, into 2 subunits, was found in this invertebrate.

  4. Early inflammatory changes in radiation-induced oral mucositis. Effect of pentoxifylline in a mouse model

    Energy Technology Data Exchange (ETDEWEB)

    Gruber, Sylvia; Bozsaky, Eva; Roitinger, Eva; Schwarz, Karoline [Medical University/AKH Vienna, Applied and Translational Radiobiology, Dept. Radiation Oncology/CD Lab. Med. Radiation Research for Radiation Oncology, Vienna (Austria); Schmidt, Margret [Technische Universitaet Dresden, Dept. Radiation Oncology, Faculty of Medicine and University Hospital Carl Gustav Carus, Dresden (Germany); Technische Universitaet Dresden, Helmholtz-Zentrum Dresden - Rossendorf, OncoRay - National Center for Radiation Research in Oncology, Faculty of Medicine and University Hospital Carl Gustav Carus, Dresden (Germany); Doerr, Wolfgang [Medical University/AKH Vienna, Applied and Translational Radiobiology, Dept. Radiation Oncology/CD Lab. Med. Radiation Research for Radiation Oncology, Vienna (Austria); Technische Universitaet Dresden, Dept. Radiation Oncology, Faculty of Medicine and University Hospital Carl Gustav Carus, Dresden (Germany); Technische Universitaet Dresden, Helmholtz-Zentrum Dresden - Rossendorf, OncoRay - National Center for Radiation Research in Oncology, Faculty of Medicine and University Hospital Carl Gustav Carus, Dresden (Germany)

    2017-06-15

    Early inflammation is a major factor of mucosal reactions to radiotherapy. Pentoxifylline administration resulted in a significant amelioration of radiation-induced oral mucositis in the mouse tongue model. The underlying mechanisms may be related to the immunomodulatory properties of the drug. The present study hence focuses on the manifestation of early inflammatory changes in mouse tongue during daily fractionated irradiation and their potential modulation by pentoxifylline. Daily fractionated irradiation with 5 fractions of 3 Gy/week (days 0-4, 7-11) was given to the snouts of mice. Groups of 3 animals per day were euthanized every second day between day 0 and 14. Pentoxifylline (15 mg/kg, s. c.) was administered daily from day 5 to the day before sacrifice. The expression of the inflammatory proteins TNFα, NF-κB, and IL-1β were analysed. Fractionated irradiation increased the expression of all inflammatory markers. Pentoxifylline significantly reduced the expression of TNFα and IL-1β, but not NF-κB. Early inflammation, as indicated by the expression of the inflammatory markers TNFα, NF-κB, and IL-1β, is an essential component of early radiogenic oral mucositis. Pentoxifylline differentially modulated the expression of different inflammatory markers. The mucoprotective effect of pentoxifylline does not appear to be based on modulation of NF-κB-associated inflammation. (orig.) [German] Fruehe entzuendliche Veraenderungen sind ein bedeutender Faktor waehrend der Strahlenreaktion der Schleimhaut. Die Behandlung mit Pentoxifyllin erzielte eine signifikante Minderung strahleninduzierter oraler Mukositis im Mauszungenmodel. Die zugrundeliegenden Mechanismen sind potenziell auf die immunomodulatorischen Eigenschaften des Wirkstoffs zurueckzufuehren. Die vorliegenden Untersuchungen fokussieren daher auf die Manifestation frueher entzuendlicher Veraenderungen in der Mauszunge waehrend taeglich fraktionierter Bestrahlung und deren potenzieller Modifikation

  5. Carbon dioxide-dependent regulation of NF-κB family members RelB and p100 gives molecular insight into CO2-dependent immune regulation.

    Science.gov (United States)

    Keogh, Ciara E; Scholz, Carsten C; Rodriguez, Javier; Selfridge, Andrew C; von Kriegsheim, Alexander; Cummins, Eoin P

    2017-07-07

    CO 2 is a physiological gas normally produced in the body during aerobic respiration. Hypercapnia (elevated blood pCO 2 >≈50 mm Hg) is a feature of several lung pathologies, e.g. chronic obstructive pulmonary disease. Hypercapnia is associated with increased susceptibility to bacterial infections and suppression of inflammatory signaling. The NF-κB pathway has been implicated in these effects; however, the molecular mechanisms underpinning cellular sensitivity of the NF-κB pathway to CO 2 are not fully elucidated. Here, we identify several novel CO 2 -dependent changes in the NF-κB pathway. NF-κB family members p100 and RelB translocate to the nucleus in response to CO 2 A cohort of RelB protein-protein interactions ( e.g. with Raf-1 and IκBα) are altered by CO 2 exposure, although others are maintained ( e.g. with p100). RelB is processed by CO 2 in a manner dependent on a key C-terminal domain located in its transactivation domain. Loss of the RelB transactivation domain alters NF-κB-dependent transcriptional activity, and loss of p100 alters sensitivity of RelB to CO 2 Thus, we provide molecular insight into the CO 2 sensitivity of the NF-κB pathway and implicate altered RelB/p100-dependent signaling in the CO 2 -dependent regulation of inflammatory signaling. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  6. Black tea extract prevents lipopolysaccharide-induced NF-κB signaling and attenuates dextran sulfate sodium-induced experimental colitis

    Directory of Open Access Journals (Sweden)

    Cho Sung-Bum

    2011-10-01

    Full Text Available Abstract Background Black tea has been shown to elicit anti-oxidant, anti-carcinogenic, anti-inflammatory and anti-mutagenic properties. In this study, we investigated the impact of black tea extract (BTE on lipopolysaccharide (LPS-induced NF-κB signaling in bone marrow derived-macrophages (BMM and determined the therapeutic efficacy of this extract on colon inflammation. Methods The effect of BTE on LPS-induced NF-κB signaling and pro-inflammatory gene expression was evaluated by RT-PCR, Western blotting, immunofluorescence and electrophoretic mobility shift assay (EMSA. The in vivo efficacy of BTE was assessed in mice with 3% dextran sulfate sodium (DSS-induced colitis. The severity of colitis was measured by weight loss, colon length and histologic scores. Results LPS-induced IL-12p40, IL-23p19, IL-6 and IL-1β mRNA expressions were inhibited by BTE. LPS-induced IκBα phosphorylation/degradation and nuclear translocation of NF-κB/p65 were blocked by BTE. BTE treatment blocked LPS-induced DNA-binding activity of NF-κB. BTE-fed, DSS-exposed mice showed the less weight loss, longer colon length and lower histologic score compared to control diet-fed, DSS-exposed mice. DSS-induced IκBα phosphorylation/degradation and phosphorylation of NF-κB/p65 were blocked by BTE. An increase of cleaved caspase-3 and poly (ADP-ribose polymerase (PARP in DSS-exposed mice was blocked by BTE. Conclusions These results indicate that BTE attenuates colon inflammation through the blockage of NF-κB signaling and apoptosis in DSS-induced experimental colitis model.

  7. The Arabidopsis NF-YA3 and NF-YA8 genes are functionally redundant and are required in early embryogenesis.

    Directory of Open Access Journals (Sweden)

    Monica Fornari

    Full Text Available Nuclear factor Y (NF-Y is a trimeric transcription factor composed of three distinct subunits called NF-YA, NF-YB and NF-YC. In Arabidopsis thaliana, NF-Y subunits are known to play roles in many processes, such as gametogenesis, embryogenesis, seed development, drought resistance, ABA signaling, flowering time, primary root elongation, Endoplasmic Reticulum (ER stress response and blue light responses. Here, we report that the closely related NF-YA3 and NF-YA8 genes control early embryogenesis. Detailed GUS and in situ analyses showed that NF-YA3 and NF-YA8 are expressed in vegetative and reproductive tissues with the highest expression being during embryo development from the globular to the torpedo embryo stage. Plants from the nf-ya3 and nf-ya8 single mutants do not display any obvious phenotypic alteration, whereas nf-ya3 nf-ya8 double mutants are embryo lethal. Morphological analyses showed that the nf-ya3 nf-ya8 embryos fail to undergo to the heart stage and develop into abnormal globular embryos with both proembryo and suspensor characterized by a disordered cell cluster with an irregular shape, suggesting defects in embryo development. The suppression of both NF-YA3 and NF-YA8 gene expression by RNAi experiments resulted in defective embryos that phenocopied the nf-ya3 nf-ya8 double mutants, whereas complementation experiments partially rescued the abnormal globular nf-ya3 nf-ya8 embryos, confirming that NF-YA3 and NF-YA8 are required in early embryogenesis. Finally, the lack of GFP expression of the auxin responsive DR5rev::GFP marker line in double mutant embryos suggested that mutations in both NF-YA3 and NF-YA8 affect auxin response in early developing embryos. Our findings indicate that NF-YA3 and NF-YA8 are functionally redundant genes required in early embryogenesis of Arabidopsis thaliana.

  8. The C-terminal domains of NF-H and NF-M subunits maintain axonal neurofilament content by blocking turnover of the stationary neurofilament network.

    Directory of Open Access Journals (Sweden)

    Mala V Rao

    Full Text Available Newly synthesized neurofilaments or protofilaments are incorporated into a highly stable stationary cytoskeleton network as they are transported along axons. Although the heavily phosphorylated carboxyl-terminal tail domains of the heavy and medium neurofilament (NF subunits have been proposed to contribute to this process and particularly to stability of this structure, their function is still obscure. Here we show in NF-H/M tail deletion [NF-(H/M(tailΔ] mice that the deletion of both of these domains selectively lowers NF levels 3-6 fold along optic axons without altering either rates of subunit synthesis or the rate of slow axonal transport of NF. Pulse labeling studies carried out over 90 days revealed a significantly faster rate of disappearance of NF from the stationary NF network of optic axons in NF-(H/M(tailΔ mice. Faster NF disappearance was accompanied by elevated levels of NF-L proteolytic fragments in NF-(H/M(tailΔ axons. We conclude that NF-H and NF-M C-terminal domains do not normally regulate NF transport rates as previously proposed, but instead increase the proteolytic resistance of NF, thereby stabilizing the stationary neurofilament cytoskeleton along axons.

  9. The type III secretion effector NleF of enteropathogenic Escherichia coli activates NF-κB early during infection.

    Science.gov (United States)

    Pallett, Mitchell A; Berger, Cedric N; Pearson, Jaclyn S; Hartland, Elizabeth L; Frankel, Gad

    2014-11-01

    The enteric pathogens enteropathogenic Escherichia coli (EPEC) and enterohemorrhagic E. coli employ a type 3 secretion system (T3SS) to manipulate the host inflammatory response during infection. Previously, it has been reported that EPEC, in a T3SS-dependent manner, induces an early proinflammatory response through activation of NF-κB via extracellular signal-regulated kinases 1 and 2 (ERK1/2) and protein kinase Cζ (PKCζ). However, the activation of NF-κB during infection has not yet been attributed to an effector. At later time points postinfection, NF-κB signaling is inhibited through the translocation of multiple effectors, including NleE and NleC. Here we report that the highly conserved non-LEE (locus of enterocyte effacement)-encoded effector F (NleF) shows both diffuse and mitochondrial localization during ectopic expression. Moreover, NleF induces the nuclear translocation of NF-κB p65 and the expression of interleukin 8 (IL-8) following ectopic expression and during EPEC infection. Furthermore, the proinflammatory activity and localization of NleF were dependent on the C-terminal amino acids LQCG. While the C-terminal domain of NleF has previously been shown to be essential for interaction with caspase-4, caspase-8, and caspase-9, the proinflammatory activity of NleF was independent of interaction with caspase-4, -8, or -9. In conclusion, EPEC, through the T3SS-dependent translocation of NleF, induces a proinflammatory response in an NF-κB-dependent manner in the early stages of infection. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

  10. Analysis of IL-6, IL-10 and NF-κB Gene Polymorphisms in Aggressive and Chronic Periodontitis.

    Science.gov (United States)

    Toker, Hülya; Görgün, Emine Pirim; Korkmaz, Ertan Mahir

    2017-06-01

    Pro-inflammatory cytokines, interleukin-6 (IL-6), demonstrated to be suppressed by interleukin-10 (IL-10) are known to be regulated by the transcription factor nuclear factor-κB(NF-κB). The aim of this study was to ascertain the association between genetic polymorphism of these genes (IL-6(-174), IL-10(-597) and NF-κB1-94ins/del)) and chronic/aggressive periodontitis. Forty-five patients with chronic periodontitis (CP), 58 patients with aggressive periodontitis (AP) and 38 periodontally healthy subjects were included in this study. Genomic DNA was isolated from whole blood samples. The NF-κB, IL-6, and IL-10 polymorphisms were determined by the polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) method. Among subjects for the ins/ins genotypes of NF-κB1 gene, the AA genotypes of IL-10 presented a higher frequency in chronic periodontitis group than in healthy controls (p=0.023). A statistically significant difference in genotyping frequencies between AP group and healthy controls was observed for the IL-6 gene. The AA genotype of IL-10 was overrepresented in CP and AP groups compared to healthy controls (OR=9.93, 95% CI: 2.11-46.7, OR=5.7, 95% CI: 1.22-26.89, respectively). Within the limits of this study, it can be concluded that the IL-10 (-597) AA genotype is associated with susceptibility to chronic/aggressive periodontitis and IL-6 (-174) GG genotypes and G allele seems to be associated with aggressive periodontitis. Clinical relevance: The results of the current study indicate that IL-6 and IL-10 genotypes seem to be associated with aggressive periodontitis. Also, the AA genotypes of IL-10 presented a higher frequency in chronic periodontitis subjects with carrying NF-κB1 ins/ins genotypes. Copyright© by the National Institute of Public Health, Prague 2017

  11. Commensal-induced regulatory T cells mediate protection against pathogen-stimulated NF-kappaB activation.

    Directory of Open Access Journals (Sweden)

    Caitlin O'Mahony

    Full Text Available Host defence against infection requires a range of innate and adaptive immune responses that may lead to tissue damage. Such immune-mediated pathologies can be controlled with appropriate T regulatory (Treg activity. The aim of the present study was to determine the influence of gut microbiota composition on Treg cellular activity and NF-kappaB activation associated with infection. Mice consumed the commensal microbe Bifidobacterium infantis 35624 followed by infection with Salmonella typhimurium or injection with LPS. In vivo NF-kappaB activation was quantified using biophotonic imaging. CD4+CD25+Foxp3+ T cell phenotypes and cytokine levels were assessed using flow cytometry while CD4+ T cells were isolated using magnetic beads for adoptive transfer to naïve animals. In vivo imaging revealed profound inhibition of infection and LPS induced NF-kappaB activity that preceded a reduction in S. typhimurium numbers and murine sickness behaviour scores in B. infantis-fed mice. In addition, pro-inflammatory cytokine secretion, T cell proliferation, and dendritic cell co-stimulatory molecule expression were significantly reduced. In contrast, CD4+CD25+Foxp3+ T cell numbers were significantly increased in the mucosa and spleen of mice fed B. infantis. Adoptive transfer of CD4+CD25+ T cells transferred the NF-kappaB inhibitory activity. Consumption of a single commensal micro-organism drives the generation and function of Treg cells which control excessive NF-kappaB activation in vivo. These cellular interactions provide the basis for a more complete understanding of the commensal-host-pathogen trilogue that contribute to host homeostatic mechanisms underpinning protection against aberrant activation of the innate immune system in response to a translocating pathogen or systemic LPS.

  12. Effusanin E suppresses nasopharyngeal carcinoma cell growth by inhibiting NF-κB and COX-2 signaling.

    Directory of Open Access Journals (Sweden)

    Mingzhu Zhuang

    Full Text Available Rabdosia serra is well known for its antibacterial, anti-inflammatory and antitumor activities, but no information has been available for the active compounds derived from this plant in inhibiting human nasopharyngeal carcinoma (NPC cell growth. In this study, we isolated and purified a natural diterpenoid from Rabdosia serra and identified its chemical structure as effusanin E and elucidated its underlying mechanism of action in inhibiting NPC cell growth. Effusanin E significantly inhibited cell proliferation and induced apoptosis in NPC cells. Effusanin E also induced the cleavage of PARP, caspase-3 and -9 proteins and inhibited the nuclear translocation of p65 NF-κB proteins. Moreover, effusanin E abrogated the binding of NF-κB to the COX-2 promoter, thereby inhibiting the expression and promoter activity of COX-2. Pretreatment with a COX-2 or NF-κB-selective inhibitor (celecoxib or ammonium pyrrolidinedithiocarbamate had an additive effect on the effusanin E-mediated inhibition of proliferation, while pretreatment with an activator of NF-κB/COX-2 (lipopolysaccharides abrogated the effusanin E-mediated inhibition of proliferation. Effusanin E also significantly suppressed tumor growth in a xenograft mouse model without obvious toxicity, furthermore, the expression of p50 NF-κB and COX-2 were down-regulated in the tumors of nude mice. These data suggest that effusanin E suppresses p50/p65 proteins to down-regulate COX-2 expression, thereby inhibiting NPC cell growth. Our findings provide new insights into exploring effusanin E as a potential therapeutic compound for the treatment of human nasopharyngeal carcinoma.

  13. STAT3 and NF-κB are common targets for kaempferol-mediated attenuation of COX-2 expression in IL-6-induced macrophages and carrageenan-induced mouse paw edema

    Directory of Open Access Journals (Sweden)

    Anandita Basu

    2017-12-01

    Full Text Available Cycloxygenase-2 (COX-2 is the inducible isoform of cycloxygenase enzyme family that catalyzes synthesis of inflammatory mediators, prostanoids and prostaglandins, and therefore, can be targeted by anti-inflammatory drugs. Here, we showed a plant polyphenol, kaempferol, attenuated IL-6-induced COX-2 expression in human monocytic THP-1 cells suggesting its beneficial role in chronic inflammation. Kaempferol deactivated and prevented nuclear localization of two major transcription factors STAT3 and NF-κB, mutually responsible for COX-2 induction in response to IL-6. Moreover, STAT3 and NF-κB were simultaneously deactivated by kaempferol in acute inflammation, as shown by carrageenan-induced mouse paw edema model. The concomitant reduction in COX-2 expression in paw tissues suggested kaempferol’s role in mitigation of inflammation by targeting STAT3 and NF-κB.

  14. NF kappaB expression increases and CFTR and MUC1 expression decreases in the endometrium of infertile patients with hydrosalpinx: a comparative study

    Directory of Open Access Journals (Sweden)

    Song Yong

    2012-10-01

    Full Text Available Abstract Background Hydrosalpinx are associated with infertility, due to reduced rates of implantation and increased abortion rates. The aims of this study were to investigate the expression of cystic fibrosis transmembrane conductance regulator (CFTR, nuclear factor kappa B (NF KappaB and mucin-1 (MUC-1, and analyze the correlation between the expression of CFTR and NF KappaB or MUC1, in the endometrium of infertile women with and without hydrosalpinx. Methods Thirty-one infertile women with laparoscopy-confirmed unilateral or bilateral hydrosalpinx and 20 infertile women without hydrosalpinx or pelvic inflammatory disease (control group were recruited. Endometrial biopsy samples were collected and the expression of CFTR, NF KappaB and MUC1 were analyzed using immunohistochemistry and quantitative real-time PCR. Results CFTR, NF KappaB and MUC1 mRNA and protein expression tended to increase in the secretory phase compared to the proliferative phase in both groups; however, these differences were not significantly different. The endometrium of infertile patients with hydrosalpinx had significantly higher NF KappaB mRNA and protein expression, and significantly lower CFTR and MUC1 mRNA and protein expression, compared to control infertile patients. A positive correlation was observed between CFTR and MUC1 mRNA expression (r = 0.65, P CFTR mRNA and NF KappaB mRNA expression (r = −0.59, P Conclusions Increased NF KappaB expression and decreased CFTR and MUC1 expression in the endometrium of infertile patients with hydrosalpinx reinforce the involvement of a molecular mechanism in the regulation of endometrial receptivity.

  15. 1,5-Anhydro-D-fructose attenuates lipopolysaccharide-induced cytokine release via suppression of NF-κB p65 phosphorylation

    International Nuclear Information System (INIS)

    Meng Xiaojie; Kawahara, Ko-ichi; Nawa, Yuko; Miura, Naoki; Shrestha, Binita; Tancharoen, Salunya; Sameshima, Hisayo; Hashiguchi, Teruto; Maruyama, Ikuro

    2009-01-01

    Lipopolysaccharide (LPS) stimulates macrophages by activating NF-κB, which contributes to the release of tumor necrosis factor (TNF)-α and interleukin (IL)-6. 1,5-anhydro-D-fructose (1,5-AF), a monosaccharide formed from starch and glycogen, exhibits anti-oxidant activity and enhances insulin secretion. This study examined the effects of 1,5-AF on LPS-induced inflammatory reactions and elucidated its molecular mechanisms. Before LPS challenge, mice were pretreated with 1,5-AF (38.5 mg/kg). We found that 1,5-AF pretreatment attenuated cytokine release into the serum, including TNF-α, IL-6 and macrophage chemoattractant protein (MCP)-1. Furthermore, pretreatment with 1,5-AF (500 μg/ml) attenuated cytokine release, and 1,5-AF directly inhibited the nuclear translocalization of the NF-κB p65 subunit in LPS-stimulated murine macrophage-like RAW264.7 cells. This inhibition was responsible for decreased LPS-induced phosphorylation on Ser536 of the NF-κB p65 subunit, which is a posttranslational modification involved in the non-canonical pathway. Collectively, these findings indicate that the anti-inflammatory activity of 1,5-AF occurs via inactivation of NF-κB.

  16. Targeting NF-kB signaling with polymeric hybrid micelles that co-deliver siRNA and dexamethasone for arthritis therapy.

    Science.gov (United States)

    Wang, Qin; Jiang, Hao; Li, Yan; Chen, Wenfei; Li, Hanmei; Peng, Ke; Zhang, Zhirong; Sun, Xun

    2017-04-01

    The transcription factor NF-kB plays a pivotal role in the pathogenesis of rheumatoid arthritis. Here we attempt to slow arthritis progression by co-delivering the glucocorticoid dexamethasone (Dex) and small-interfering RNA targeting NF-kB p65 using our previously developed polymeric hybrid micelle system. These micelles contain two similar amphiphilic copolymers: polycaprolactone-polyethylenimine (PCL-PEI) and polycaprolactone-polyethyleneglycol (PCL-PEG). The hybrid micelles loaded with Dex and siRNA effectively inhibited NF-kB signaling in murine macrophages more efficiently than micelles containing either Dex or siRNA on their own. In addition, the co-delivery system was able to switch macrophages from the M1 to M2 state. Injecting hybrid micelles containing Dex and siRNA into mice with collagen-induced arthritis led the therapeutic agents to accumulate in inflamed joints and reduce inflammation, without damaging renal or liver function. Thus, blocking NF-kB activation in inflammatory tissue using micelle-based co-delivery may provide a new approach for treating inflammatory disease. Copyright © 2017 Elsevier Ltd. All rights reserved.

  17. Excretory and Secretory Proteins of Naegleria fowleri Induce Inflammatory Responses in BV-2 Microglial Cells.

    Science.gov (United States)

    Lee, Jinyoung; Kang, Jung-Mi; Kim, Tae Im; Kim, Jong-Hyun; Sohn, Hae-Jin; Na, Byoung-Kuk; Shin, Ho-Joon

    2017-03-01

    Naegleria fowleri, a free-living amoeba that is found in diverse environmental habitats, can cause a type of fulminating hemorrhagic meningoencephalitis, primary amoebic meningoencephalitis (PAM), in humans. The pathogenesis of PAM is not fully understood, but it is likely to be primarily caused by disruption of the host's nervous system via a direct phagocytic mechanism by the amoeba. Naegleria fowleri trophozoites are known to secrete diverse proteins that may indirectly contribute to the pathogenic function of the amoeba, but this factor is not clearly understood. In this study, we analyzed the inflammatory responses in BV-2 microglial cells induced by excretory and secretory proteins of N. fowleri (NfESP). Treatment of BV-2 cells with NfESP induced the expression of various cytokines and chemokines, including the proinflammatory cytokines IL-1α and TNF-α. NfESP-induced IL-1α and TNF-α expression in BV-2 cells were regulated by p38, JNK, and ERK MAPKs. NfESP-induced IL-1α and TNF-α production in BV-2 cells were effectively downregulated by inhibition of NF-kB and AP-1. These results collectively suggest that NfESP stimulates BV-2 cells to release IL-1α and TNF-α via NF-kB- and AP-1-dependent MAPK signaling pathways. The released cytokines may contribute to inflammatory responses in microglia and other cell types in the brain during N. fowleri infection. © 2016 The Author(s) Journal of Eukaryotic Microbiology © 2016 International Society of Protistologists.

  18. GeNF - experimental report 2003

    Energy Technology Data Exchange (ETDEWEB)

    Schreyer, A.; Vollbrandt, J.; Willumeit, R. (eds.) [GKSS-Forschungszentrum Geesthacht GmbH (Germany). Inst. for Materials Research

    2004-07-01

    At the Geesthacht Neutron Facility GeNF about 210 experiments were performed in 2003 by GKSS and by or for external users, partners or contractors. In most cases the measurements were performed and analysed in cooperation by the guest and by the GKSS staff or by the permanent external user group staff. The activities, which are based on a proposal procedure and on the in house R and D program, are reported in 76 contributions in the present annual experimental report for the year 2003. The contributions may contain one or also several combined experiments. During 2003 the GKSS research reactor FRG-1 achieved an operation time of 252 days at the full 5 MW reactor power providing a neutron flux of ca. 1,4 x 10{sup 14} thermal neutrons / cm{sup 2} s. The cold neutron source was available during the complete operation time. The focus of the in house R and D work at GeNF instruments was the characterisation of metal alloys, the analysis of stresses in welds and technical structures at ARES, FSS, DCD and SANS-2, the structural investigation of hydrogen containing substances such as polymers, colloids and biological macromolecules at SANS-1 as well as the characterisation of magnetic thin films at PNR and ROeDI. The reflectomer TOREMA was thoroughly upgraded to the instrument NeRo and now offers new measurement possibilities. In the appendices the progress of the project REFSANS at FRM-II is reported as well as the experimental activities of the newly installed GKSS outstation HARWI-II at DESY. (orig.)

  19. GeNF - Experimental report 2006

    International Nuclear Information System (INIS)

    Pranzas, P.K.; Schreyer, A.; Willumeit, R.

    2007-01-01

    At the Geesthacht Neutron Facility GeNF about 212 experiments were performed in 2006 by GKSS and by or for external users, partners or contractors. In most cases the measurements were performed and analysed in cooperation by the guests and by the GKSS staff or by the permanent external user group staff. The activities, which are based on a proposal procedure and on the in house R and D program, are reported in 71 contributions in the present annual experimental report for the year 2006. The contributions may contain one or also several combined experiments. During 2006 the GKSS research reactor FRG-1 achieved an operation time of 197 days at the full 5 MW reactor power providing a neutron flux of ca. 1.4 x 10 14 thermal neutrons/cm 2 s. The cold neutron source was available during the complete operation time. The focus of the in house R and D work at GeNF instruments was the characterisation of nanostructures in engineering materials, the analysis of stresses and textures in welds and technical structures at ARES-2, TEX-2, DCD and SANS-2, the structural investigation of hydrogen containing substances such as polymers, colloids and biological macromolecules at SANS-1 as well as the characterisation of magnetic thin films at PNR, NeRo, POLDI and ROeDI. The thoroughly upgraded residual stress diffractomer ARES-2 went in full operation in spring 2006 as well as the new neutron tomography device at GENRA-3. The installation of modern experiment control hardware and software based on LabView was completed on all designated instruments. In the appendices I and II the experimental reports of REFSANS at FRM II are attached as well as of the GKSS outstation HARWI-II at DESY. Both instruments started full operation in 2006. (orig.)

  20. GeNF - experimental report 2003

    International Nuclear Information System (INIS)

    Schreyer, A.; Vollbrandt, J.; Willumeit, R.

    2004-01-01

    At the Geesthacht Neutron Facility GeNF about 210 experiments were performed in 2003 by GKSS and by or for external users, partners or contractors. In most cases the measurements were performed and analysed in cooperation by the guest and by the GKSS staff or by the permanent external user group staff. The activities, which are based on a proposal procedure and on the in house R and D program, are reported in 76 contributions in the present annual experimental report for the year 2003. The contributions may contain one or also several combined experiments. During 2003 the GKSS research reactor FRG-1 achieved an operation time of 252 days at the full 5 MW reactor power providing a neutron flux of ca. 1,4 x 10 14 thermal neutrons / cm 2 s. The cold neutron source was available during the complete operation time. The focus of the in house R and D work at GeNF instruments was the characterisation of metal alloys, the analysis of stresses in welds and technical structures at ARES, FSS, DCD and SANS-2, the structural investigation of hydrogen containing substances such as polymers, colloids and biological macromolecules at SANS-1 as well as the characterisation of magnetic thin films at PNR and ROeDI. The reflectomer TOREMA was thoroughly upgraded to the instrument NeRo and now offers new measurement possibilities. In the appendices the progress of the project REFSANS at FRM-II is reported as well as the experimental activities of the newly installed GKSS outstation HARWI-II at DESY. (orig.)

  1. GeNF - Experimental report 2006

    Energy Technology Data Exchange (ETDEWEB)

    Pranzas, P.K.; Schreyer, A.; Willumeit, R. (eds.) [GKSS-Forschungszentrum Geesthacht GmbH (Germany). Inst. of Materials Research

    2007-07-01

    At the Geesthacht Neutron Facility GeNF about 212 experiments were performed in 2006 by GKSS and by or for external users, partners or contractors. In most cases the measurements were performed and analysed in cooperation by the guests and by the GKSS staff or by the permanent external user group staff. The activities, which are based on a proposal procedure and on the in house R and D program, are reported in 71 contributions in the present annual experimental report for the year 2006. The contributions may contain one or also several combined experiments. During 2006 the GKSS research reactor FRG-1 achieved an operation time of 197 days at the full 5 MW reactor power providing a neutron flux of ca. 1.4 x 10{sup 14} thermal neutrons/cm{sup 2}s. The cold neutron source was available during the complete operation time. The focus of the in house R and D work at GeNF instruments was the characterisation of nanostructures in engineering materials, the analysis of stresses and textures in welds and technical structures at ARES-2, TEX-2, DCD and SANS-2, the structural investigation of hydrogen containing substances such as polymers, colloids and biological macromolecules at SANS-1 as well as the characterisation of magnetic thin films at PNR, NeRo, POLDI and ROeDI. The thoroughly upgraded residual stress diffractomer ARES-2 went in full operation in spring 2006 as well as the new neutron tomography device at GENRA-3. The installation of modern experiment control hardware and software based on LabView was completed on all designated instruments. In the appendices I and II the experimental reports of REFSANS at FRM II are attached as well as of the GKSS outstation HARWI-II at DESY. Both instruments started full operation in 2006. (orig.)

  2. Syk/Src Pathway-Targeted Inhibition of Skin Inflammatory Responses by Carnosic Acid

    Directory of Open Access Journals (Sweden)

    Jueun Oh

    2012-01-01

    Full Text Available Carnosic acid (CA is a diterpene compound exhibiting antioxidative, anticancer, anti-angiogenic, anti-inflammatory, anti-metabolic disorder, and hepatoprotective and neuroprotective activities. In this study, the effect of CA on various skin inflammatory responses and its inhibitory mechanism were examined. CA strongly suppressed the production of IL-6, IL-8, and MCP-1 from keratinocyte HaCaT cells stimulated with sodium lauryl sulfate (SLS and retinoic acid (RA. In addition, CA blocked the release of nitric oxide (NO, tumor necrosis factor (TNF-α, and prostaglandin E2 (PGE2 from RAW264.7 cells activated by the toll-like receptor (TLR-2 ligands, Gram-positive bacterium-derived peptidoglycan (PGN and pam3CSK, and the TLR4 ligand, Gram-negative bacterium-derived lipopolysaccharide (LPS. CA arrested the growth of dermatitis-inducing Gram-positive and Gram-negative microorganisms such Propionibacterium acnes, Pseudomonas aeruginosa, and Staphylococcus aureus. CA also blocked the nuclear translocation of nuclear factor (NF-κB and its upstream signaling including Syk/Src, phosphoinositide 3-kinase (PI3K, Akt, inhibitor of κBα (IκBα kinase (IKK, and IκBα for NF-κB activation. Kinase assays revealed that Syk could be direct enzymatic target of CA in its anti-inflammatory action. Therefore, our data strongly suggest the potential of CA as an anti-inflammatory drug against skin inflammatory responses with Src/NF-κB inhibitory properties.

  3. Modulation of inflammatory mediators by Opuntia ficus-indica and Prunus avium bioproducts using an in vitro cell-based model of intestinal inflammation

    OpenAIRE

    Nunes, Sara Alexandra Luis

    2011-01-01

    Dissertation to obtain a Master Degree in Biotechnology Inflammatory Bowel Diseases, namely Ulcerative colitis and Crohn’s disease, are chronic intestinal inflammatory disorders characterized by an excessive release of pro-inflammatory mediators, intestinal barrier dysfunction and altered permeability and excessive activation of NF-κB cascade that can lead to development of colon cancer. IBD conventional therapy involves multiple medications and long-term up to life-long treatments. Furthe...

  4. OsNF-YC2 and OsNF-YC4 proteins inhibit flowering under long-day conditions in rice

    KAUST Repository

    Kim, SoonKap

    2015-11-05

    OsNF-YC2 and OsNF-YC4 proteins regulate the photoperiodic flowering response through the modulation of three flowering-time genes ( Ehd1, Hd3a , and RFT1 ) in rice. Plant NUCLEAR FACTOR Y (NF-Y) transcription factors control numerous developmental processes by forming heterotrimeric complexes, but little is known about their roles in flowering in rice. In this study, it is shown that some subunits of OsNF-YB and OsNF-YC interact with each other, and among them, OsNF-YC2 and OsNF-YC4 proteins regulate the photoperiodic flowering response of rice. Protein interaction studies showed that the physical interactions occurred between the three OsNF-YC proteins (OsNF-YC2, OsNF-YC4 and OsNF-YC6) and three OsNF-YB proteins (OsNF-YB8, OsNF-YB10 and OsNF-YB11). Repression and overexpression of the OsNF-YC2 and OsNF-YC4 genes revealed that they act as inhibitors of flowering only under long-day (LD) conditions. Overexpression of OsNF-YC6, however, promoted flowering only under LD conditions, suggesting it could function as a flowering promoter. These phenotypes correlated with the changes in the expression of three rice flowering-time genes [Early heading date 1 (Ehd1), Heading date 3a (Hd3a) and RICE FLOWERING LOCUS T1 (RFT1)]. The diurnal and tissue-specific expression patterns of the subsets of OsNF-YB and OsNF-YC genes were similar to those of CCT domain encoding genes such as OsCO3, Heading date 1 (Hd1) and Ghd7. We propose that OsNF-YC2 and OsNF-YC4 proteins regulate the photoperiodic flowering response by interacting directly with OsNF-YB8, OsNF-YB10 or OsNF-YB11 proteins in rice.

  5. Melatonin alleviates inflammasome-induced pyroptosis through inhibiting NF-κB/GSDMD signal in mice adipose tissue.

    Science.gov (United States)

    Liu, Zhenjiang; Gan, Lu; Xu, Yatao; Luo, Dan; Ren, Qian; Wu, Song; Sun, Chao

    2017-08-01

    Pyroptosis is a proinflammatory form of cell death that is associated with pathogenesis of many chronic inflammatory diseases. Melatonin is substantially reported to possess anti-inflammatory properties by inhibiting inflammasome activation. However, the effects of melatonin on inflammasome-induced pyroptosis in adipocytes remain elusive. Here, we demonstrated that melatonin alleviated lipopolysaccharides (LPS)-induced inflammation and NLRP3 inflammasome formation in mice adipose tissue. The NLRP3 inflammasome-mediated pyroptosis was also inhibited by melatonin in adipocytes. Further analysis revealed that gasdermin D (GSDMD), the key executioner of pyroptosis, was the target for melatonin inhibition of adipocyte pyroptosis. Importantly, we determined that nuclear factor κB (NF-κB) signal was required for the GSDMD-mediated pyroptosis in adipocytes. We also confirmed that melatonin alleviated adipocyte pyroptosis by transcriptional suppression of GSDMD. Moreover, GSDMD physically interacted with interferon regulatory factor 7 (IRF7) and subsequently formed a complex to promote adipocyte pyroptosis. Melatonin also attenuated NLRP3 inflammasome activation and pyroptosis, which was induced by LPS or obesity. In summary, our results demonstrate that melatonin alleviates inflammasome-induced pyroptosis by blocking NF-κB/GSDMD signal in mice adipose tissue. Our data reveal a novel function of melatonin on adipocyte pyroptosis, suggesting a new potential therapy for melatonin to prevent and treat obesity caused systemic inflammatory response. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  6. Kaempferol alleviates insulin resistance via hepatic IKK/NF-κB signal in type 2 diabetic rats.

    Science.gov (United States)

    Luo, Cheng; Yang, Hui; Tang, Chengyong; Yao, Gaoqiong; Kong, Lingxi; He, Haixia; Zhou, Yuanda

    2015-09-01

    Recent studies show that inflammation underlies the metabolic disorders of insulin resistance and type 2 diabetes mellitus. Since kaempferol, a naturally occurring flavonoid, has been described to have potent anti-inflammatory properties, we investigated whether kaempferol could ameliorate insulin resistance through inhibiting inflammatory responses. The model of diabetic rat was induced by 6-week high-fat diet plus streptozotocin. Animals were orally treated with kaempferol (50 or 150 mg/kg) and aspirin (100mg/kg) for 10 weeks. The results showed that kaempferol ameliorated blood lipids and insulin in an dose-dependent manner. Kaempferol effectively restored insulin resistance induced alteration of glucose disposal by using an insulin tolerance test and the euglycemic-hyperinsulinemic clamp method. Western blotting results showed that KPF inhibited the phosphorylation of insulin receptor substrate-1 (IRS-1), IkB kinase α (IKKα) and IkB kinase β (IKKβ). These effects were accompanied with reduction in nucleic and cytosol levels of nuclear factor kappa-β (NF-κB), and further tumor necrosis factor-α (TNF-α) and interleukin-6 (IL-6) levels. Aspirin had similar effects. These results provide in vivo evidence that kaempferol-mediated down-regulation of IKK and subsequent inhibition of NF-κB pathway activation may be associated with the reduction of hepatic inflammatory lesions, which is contributing to the improvement of insulin signaling defect in diabetes. Copyright © 2015 Elsevier B.V. All rights reserved.

  7. Inhibition of the lncRNA Mirt1 Attenuates Acute Myocardial Infarction by Suppressing NF-κB Activation.

    Science.gov (United States)

    Li, Xiangrao; Zhou, Jian; Huang, Kai

    2017-01-01

    The expression of a novel lncRNA, myocardial infarction associated transcript 1(Mirt1), has been shown to be upregulated in acute myocardial infarction (AMI). However, the role of Mirt1 in AMI is not clear. In this study, we analyzed the level of Mirt1 in cardiomyocytes and cardiac fibroblasts in AMI mice. Moreover, adenovirus mediated knockdown of Mirt1 was employed to clarify its roles in AMI mice or cultured cardiac fibroblasts. The cardiac functions and infarct size of AMI mice were examined, and tissues and cultured cells were collected and processed for histology and biochemical examination. We demonstrated that Mirt1 was mainly expressed in cardiac fibroblasts, and that knockdown of Mirt1 improved cardiac functions, decreased cardiomyocytes apoptosis and attenuated inflammatory cell infiltration in vivo. Furthermore, knockdown of Mirt1 in cardiac fibroblasts not only attenuated the apoptosis of cardiomyocytes, but also suppressed the migration of macrophages under hypoxia in vitro. NF-κB signaling pathway, activated under hypoxia, was also inhibited by Mirt1 knockdown in fibroblasts. Knockdown of Mirt1 attenuates AMI injury presumably by decreasing cardiomyocytes apoptosis and reducing inflammatory cell infiltration. These effects could be attributed, at least partly, to inhibition of the NF-κB pathway, resulting in decreased expression of inflammatory factors. © 2017 The Author(s). Published by S. Karger AG, Basel.

  8. Isoalantolactone inhibits LPS-induced inflammation via NF-κB inactivation in peritoneal macrophages and improves survival in sepsis.

    Science.gov (United States)

    He, Guodong; Zhang, Xu; Chen, Yanhua; Chen, Jing; Li, Li; Xie, Yubo

    2017-06-01

    Sepsis, a clinical syndrome occurring in patients following infection or injury, is a leading cause of mortality worldwide. It involves uncontrolled inflammatory response resulting in multi-organ failure and even death. Isoalantolactone (IAL), a sesquiterpene lactone, is known for its anti-cancer effects. Nevertheless, little is known about the anti-inflammatory effects of IAL, and the role of IAL in sepsis is unclear. In this study, we demonstrated that IAL decreased lipopolysaccharide (LPS)-mediated production of nitric oxide, PEG 2 and cytokines (IL-6, TNF-α) in peritoneal macrophages and RAW 264.7 macrophages. Moreover, molecular mechanism studies indicated that IAL plays an anti-inflammatory role by inhibiting LPS-induced activation of NF-κB pathway in peritoneal macrophages. In vivo, IAL reduced the secretion of IL-6 and TNF-α in serum, and increased the survival rate of mice with LPS-induced sepsis. In addition, IAL attenuated the activation of NF-κB pathway in liver. Taken together, our data suggest that IAL may represent a potentially new drug candidate for the treatment of sepsis. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

  9. Exploring the anti-inflammatory activity of a novel 2-phenylquinazoline analog with protection against inflammatory injury

    International Nuclear Information System (INIS)

    Chatterjee, Nabanita; Das, Subhadip; Bose, Dipayan; Banerjee, Somenath; Das, Sujata; Chattopadhyay, Debprasad; Saha, Krishna Das

    2012-01-01

    Inflammation is a protective immune response against harmful stimuli whose long time continuation results in host disease. Quinazolinones are nitrogen containing heterocyclic compounds with wide spectrum of biological activities. The anticancer effect of a 3-(arylideneamino)‐phenylquinazoline-4(3H)-one derivative was reported earlier. The anti-inflammatory effect of these quinazolinone derivatives has now been examined in endotoxin stimulated macrophages and in different in vivo models of inflammation by measuring the proinflammatory cytokines (TNF-α, IL-1β and IL-6), mediators NO and NF-κB (by ELISA and western blot), and translocation of the nuclear factor kB (by immunocytochemical analysis). To elucidate the in vivo effect, mice endotoxin model was and the various levels of edema, inflammatory pain and vascular permeability were studied. One of the quinazolinone derivatives showed significant anti-inflammatory activity in stimulated macrophage cells by inhibiting the expression of TNF-α, IL-1β, IL-6, iNOS, COX-2, p-IκB and NF-κBp65. Significant (P < 0.01) improvement was observed in the mortality of endotoxemic mice. The carrageenan and formalin-induced paw edema thicknesses were found to be reduced significantly (P < 0.01) along with the reduction of pain, vascular permeability and edema induced by complete Freund's adjuvant (P < 0.01). These findings indicate that 3-(arylideneamino)‐phenylquinazoline-4(3H)-one derivative as a potential anti-inflammatory agent. -- Highlights: ► 2-phenylquinazoline analog suppresses the cytokines in stimulated macrophages. ► 2-phenylquinazoline analog down regulated NF-kB P65 translocation. ► Role of 2-phenylquinazoline analog in endotoximia and peripheral inflammations.

  10. TRAF Family Member-associated NF-κB Activator (TANK) Inhibits Genotoxic Nuclear Factor κB Activation by Facilitating Deubiquitinase USP10-dependent Deubiquitination of TRAF6 Ligase.

    Science.gov (United States)

    Wang, Wei; Huang, Xuan; Xin, Hong-Bo; Fu, Mingui; Xue, Aimin; Wu, Zhao-Hui

    2015-05-22

    DNA damage-induced NF-κB activation plays a critical role in regulating cellular response to genotoxic stress. However, the molecular mechanisms controlling the magnitude and duration of this genotoxic NF-κB signaling cascade are poorly understood. We recently demonstrated that genotoxic NF-κB activation is regulated by reversible ubiquitination of several essential mediators involved in this signaling pathway. Here we show that TRAF family member-associated NF-κB activator (TANK) negatively regulates NF-κB activation by DNA damage via inhibiting ubiquitination of TRAF6. Despite the lack of a deubiquitination enzyme domain, TANK has been shown to negatively regulate the ubiquitination of TRAF proteins. We found TANK formed a complex with MCPIP1 (also known as ZC3H12A) and a deubiquitinase, USP10, which was essential for the USP10-dependent deubiquitination of TRAF6 and the resolution of genotoxic NF-κB activation upon DNA damage. Clustered regularly interspaced short palindromic repeats (CRISPR)/Cas9-mediated deletion of TANK in human cells significantly enhanced NF-κB activation by genotoxic treatment, resulting in enhanced cell survival and increased inflammatory cytokine production. Furthermore, we found that the TANK-MCPIP1-USP10 complex also decreased TRAF6 ubiquitination in cells treated with IL-1β or LPS. In accordance, depletion of USP10 enhanced NF-κB activation induced by IL-1β or LPS. Collectively, our data demonstrate that TANK serves as an important negative regulator of NF-κB signaling cascades induced by genotoxic stress and IL-1R/Toll-like receptor stimulation in a manner dependent on MCPIP1/USP10-mediated TRAF6 deubiquitination. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  11. Evidence that TNF-β (lymphotoxin α) can activate the inflammatory environment in human chondrocytes

    Science.gov (United States)

    2013-01-01

    Introduction Inflammatory cytokines play a key role in the pathogenesis of joint diseases such as rheumatoid arthritis (RA). Current therapies target mainly tumor necrosis factor α (TNF-α) as this has proven benefits. However, a large number of patients do not respond to or become resistant to anti-TNF-α therapy. While the role of TNF-α in RA is quite evident, the role of TNF-β, also called lymphotoxin-α (LT-α), is unclear. In this study we investigated whether TNF-β and its receptor play a role in chondrocytes in the inflammatory environment. Methods An in vitro model of primary human chondrocytes was used to study TNF-β-mediated inflammatory signaling. Results Cytokine-induced inflammation enhances TNF-β and TNF-β-receptor expression in primary human chondrocytes accompanied by the up-regulation of inflammatory (cyclooxygenase-2), matrix degrading (matrix metalloproteinase-9 and -13) and apoptotic (p53, cleaved caspase-3) signaling pathways, all known to be regulated by NF-κB. In contrast, anti-TNF-β, similar to the natural NF-κB inhibitor (curcumin, diferuloylmethane) or the knockdown of NF-κB by using antisense oligonucleotides (ASO), suppressed IL-1β-induced NF-κB activation and its translocation to the nucleus, and abolished the pro-inflammatory and apoptotic effects of IL-1β. This highlights, at least in part, the crucial role of NF-κB in TNF-β-induced-inflammation in cartilage, similar to that expected for TNF-α. Finally, the adhesiveness between TNF-β-expressing T-lymphocytes and the responding chondrocytes was significantly enhanced through a TNF-β-induced inflammatory microenvironment. Conclusions These results suggest for the first time that TNF-β is involved in microenvironment inflammation in chondrocytes during RA parallel to TNF-α, resulting in the up-regulation of NF-κB signaling and activation of pro-inflammatory activity. PMID:24283517

  12. Andrographolide suppresses proliferation of human colon cancer SW620 cells through the TLR4/NF-κB/MMP-9 signaling pathway

    OpenAIRE

    Zhang, Rui; Zhao, Jian; Xu, Jian; Jiao, De-Xin; Wang, Jian; Gong, Zhi-Qiang; Jia, Jian-Hui

    2017-01-01

    Modern pharmacological research has revealed that andrographolide has various functions, including anti-bacterial, anti-inflammatory and anti-viral effects, immunoregulation, treating cardiovascular and cerebrovascular diseases, and prevention and treatment of alcoholic liver injury. The present study investigated whether andrographolide suppresses the proliferation of human colon cancer cell through the Toll-like receptor 4 (TLR4)/nuclear factor (NF)-κB/matrix metalloproteinase-9 (MMP-9) sig...

  13. Peimine Inhibits the Production of Proinflammatory Cytokines Through Regulation of the Phosphorylation of NF-κB and MAPKs in HMC-1 Cells.

    Science.gov (United States)

    Park, Ji Hye; Lee, Bina; Kim, Hyun Kab; Kim, Eun-Young; Kim, Jae-Hyun; Min, Ju-Hee; Kim, Sunkook; Sohn, Youngjoo; Jung, Hyuk-Sang

    2017-07-01

    Peimine is a major biologically active component of Fritillaria ussuriensis . Peimine was investigated in chronic inflammation response, but it has not been studied in mast cell-related immediate allergic reaction. The present study aimed to evaluate anti-allergic effect of peimine in human mast cell (HMC-1). The effect of peimine on cell viability was measured by MTS assay in HMC-1. Histamine release was investigated in rat peritoneal mast cells (RPMCs). Interleukin (IL)-6, IL-8, and tumor necrosis factor-α (TNF-α) expressions were measured by ELISA assay and reverse transcription-polymerase chain reaction. Mitogen-activated protein kinases (MAPKs) and nuclear factor-kappaB (NF-κB) were examined by Western blot. Passive cutaneous anaphylaxis (PCA) reactions were evaluated using Sprague-Dawley (SD) rats. Peimine inhibited the production of pro-inflammatory cytokines, such as IL-6, IL-8, and TNF-α. Moreover, peimine reduced MAPKs phosphorylation and the nuclear NF-κB expression in PMACI-induced HMC-1. Peimine decreased PCA reactions in rats as well. Our study proved that peimine might be suitable for the treatment of mast cell-derived allergic inflammatory reactions. Peimine inhibited the production of pro-inflammatory cytokines, such as IL-6, IL-8, and TNF-αPeimine reduced MAPKs phosphorylation and the nuclear NF-κB expression in PMACI-induced HMC-1Peimine decreased PCA reactions in ratsPeimine has anti-allergic effect through regulation of pro-inflammatory mechanism on mast cell. Abbreviations used: HMC-1: Human mast cell, MTS: 3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium, RPMCs: Rat peritoneal mast cells. IL-6: Interleukin 6, IL-8: Interleukin 8, TNF-α: Tumor necrosis factor-α, MAPKs: Mitogen-activated protein kinases; NF-κB: Nuclear factor-kappaB, PCA: Passive cutaneous anaphylaxis reactions, SD: Sprague-Dawley.

  14. SLPI and inflammatory lung disease in females.

    LENUS (Irish Health Repository)

    McKiernan, Paul J

    2012-02-01

    During the course of certain inflammatory lung diseases, SLPI (secretory leucoprotease inhibitor) plays a number of important roles. As a serine antiprotease it functions to protect the airways from proteolytic damage due to neutrophil and other immune cell-derived serine proteases. With respect to infection it has known antimicrobial and anti-viral properties that are likely to contribute to host defence. Another of its properties is the ability to control inflammation within the lung where it can interfere with the transcriptional induction of pro-inflammatory gene expression induced by NF-kappaB (nuclear factor kappaB). Thus, factors that regulate the expression of SLPI in the airways can impact on disease severity and outcome. Gender represents once such idiosyncratic factor. In females with CF (cystic fibrosis), it is now thought that circulating oestrogen contributes, in part, to the observed gender gap whereby females have worse disease and poorer prognosis than males. Conversely, in asthma, sufferers who are females have more frequent exacerbations at times of low-circulating oestrogen. In the present paper, we discuss how SLPI participates in these events and speculate on whether regulatory mechanisms such as post-transcriptional modulation by miRNAs (microRNAs) are important in the control of SLPI expression in inflammatory lung disease.

  15. Kaempferol Alleviates the Interleukin-1β-Induced Inflammation in Rat Osteoarthritis Chondrocytes via Suppression of NF-κB.

    Science.gov (United States)

    Zhuang, Zhengling; Ye, Guangqun; Huang, Bin

    2017-08-14

    BACKGROUND This study was designed to examine the anti-inflammatory and anti-osteoarthritis (OA) effects of kaempferol in rat articular chondrocytes stimulated with interleukin-1β. MATERIAL AND METHODS Rat articular chondrocytes cultures were treated with interleukin-1β alone or with kaempferol (25, 50, 100, and 200 μM) and interleukin-1β. The effect of kaempferol on chondrocyte cells viability was measured by MTT assay. The effect on prostaglandin E2 (PGE2) and nitric oxide (NO) level were also assessed using the ELISA and Griess reagent, respectively, for kaempferol activity. Moreover, the expression of iNOS, Cox-2 and activation of NF-κB under influence of kaempferol was also assessed by Western blot. RESULTS Kaempferol treatment (up to 100 μM) in a concentration-dependent way caused reduction in the interleukin-1b-stimulated formations of PGE2 and NO. Kaempferol also upregulated the expression of iNOS and Cox-2 in interleukin-1β-stimulated rat OA chondrocytes. Additionally, kaempferol was found to inhibit the IkBa degradation and NF-κB activation in rat chondrocytes stimulated with interleukin-1β. CONCLUSIONS Kaempferol significantly caused reduction in interleukin-1β-stimulated pro-inflammatory mediators in rat OA chondrocytes by inhibiting the NF-κB pathway. These results suggest that kaempferol had significant anti-inflammatory and anti-arthritis effects. Thus, kaempferol, as a novel therapeutic active agent, may prevent, stop, or retard the progression of OA.

  16. Quince (Cydonia oblonga Miller) peel polyphenols modulate LPS-induced inflammation in human THP-1-derived macrophages through NF-κB, p38MAPK and Akt inhibition

    International Nuclear Information System (INIS)

    Essafi-Benkhadir, Khadija; Refai, Amira; Riahi, Ichrak; Fattouch, Sami; Karoui, Habib; Essafi, Makram

    2012-01-01

    Highlights: ► Quince peel polyphenols inhibit LPS-induced secretion of TNF-α and IL-8. ► Quince peel polyphenols augment LPS-induced secretion of IL-10 and IL-6. ► Quince peel polyphenols-mediated inhibition of LPS-induced secretion of TNF-α is partially mediated by IL-6. ► The anti-inflammatory effects of quince polyphenols pass through NF-κB, p38MAPK and Akt inhibition. -- Abstract: Chronic inflammation is a hallmark of several pathologies, such as rheumatoid arthritis, gastritis, inflammatory bowel disease, atherosclerosis and cancer. A wide range of anti-inflammatory chemicals have been used to treat such diseases while presenting high toxicity and numerous side effects. Here, we report the anti-inflammatory effect of a non-toxic, cost-effective natural agent, polyphenolic extract from the Tunisian quince Cydonia oblonga Miller. Lipopolysaccharide (LPS) treatment of human THP-1-derived macrophages induced the secretion of high levels of the pro-inflammatory cytokine TNF-α and the chemokine IL-8, which was inhibited by quince peel polyphenolic extract in a dose-dependent manner. Concomitantly, quince polyphenols enhanced the level of the anti-inflammatory cytokine IL-10 secreted by LPS-treated macrophages. We further demonstrated that the unexpected increase in IL-6 secretion that occurred when quince polyphenols were associated with LPS treatment was partially responsible for the polyphenols-mediated inhibition of TNF-α secretion. Biochemical analysis showed that quince polyphenols extract inhibited the LPS-mediated activation of three major cellular pro-inflammatory effectors, nuclear factor-kappa B (NF-κB), p38MAPK and Akt. Overall, our data indicate that quince peel polyphenolic extract induces a potent anti-inflammatory effect that may prove useful for the treatment of inflammatory diseases and that a quince-rich regimen may help to prevent and improve the treatment of such diseases.

  17. Lipopolysaccharide promotes lipid accumulation in human adventitial fibroblasts via TLR4-NF-κB pathway

    Directory of Open Access Journals (Sweden)

    Wang Jun

    2012-10-01

    Full Text Available Abstract Background Atherosclerosis is a chronic degenerative disease of the arteries and is thoug