Westinghouse Hanford Company plan for certifying newly generated contact-handled transuranic waste for emplacement in the Waste Isolation Pilot Plant

International Nuclear Information System (INIS)

Lipinski, R.M.; Sheehan, J.S.

1992-07-01

Westinghouse Hanford Company (Westinghouse Hanford) currently manages an interim storage site for Westinghouse Hanford and non-Westinghouse Hanford-generated transuranic (TRU) waste and operates TRU waste generating facilities within the Hanford Site in Washington State. Approval has been received from the Waste Acceptance Criteria Certification Committee (WACCC) and Westinghouse Hanford TRU waste generating facilities to certify newly generated contact-handled TRU (CH-TRU) solid waste to meet the Waste Acceptance Criteria (WAC). This document describes the plan for certifying newly generated CH-TRU solid waste to meet the WAC requirements for storage at the Waste Isolation Pilot Plant (WIPP) site. Attached to this document are facility-specific certification plans for the Westinghouse Hanford TRU waste generators that have received WACCC approval. The certification plans describe operations that generate CH-TRU solid waste and the specific procedures by which these wastes will be certified and segregated from uncertified wastes at the generating facilities. All newly generated CH-TRU solid waste is being transferred to the Transuranic Storage and Assay Facility (TRUSAF) and/or a controlled storage facility. These facilities will store the waste until the certified TRU waste can be sent to the WIPP site and the non-certified TRU waste can be sent to the Waste Receiving and Processing Facility. All non-certifiable TRU waste will be segregated and clearly identified

Restriction fragment polymorphism (RFLP) of a "new" HLA-DP specificity, CDP-HEI

DEFF Research Database (Denmark)

Hyldig-Nielsen, J J; Ødum, Niels; Morling, Niels

1988-01-01

Southern blotting with a DP beta cDNA probe of MspI digested DNA from 83 healthy unrelated individuals revealed a 1.8 kb fragment present in all four individuals (and no others) possessing the newly determined DP specificity, CDP-HEI.......Southern blotting with a DP beta cDNA probe of MspI digested DNA from 83 healthy unrelated individuals revealed a 1.8 kb fragment present in all four individuals (and no others) possessing the newly determined DP specificity, CDP-HEI....

Impaired mastication reduced newly generated neurons at the accessory olfactory bulb and pheromonal responses in mice.

Science.gov (United States)

Utsugi, Chizuru; Miyazono, Sadaharu; Osada, Kazumi; Matsuda, Mitsuyoshi; Kashiwayanagi, Makoto

2014-12-01

A large number of neurons are generated at the subventricular zone (SVZ) even during adulthood. In a previous study, we have shown that a reduced mastication impairs both neurogenesis in the SVZ and olfactory functions. Pheromonal signals, which are received by the vomeronasal organ, provide information about reproductive and social states. Vomeronasal sensory neurons project to the accessory olfactory bulb (AOB) located on the dorso-caudal surface of the main olfactory bulb. Newly generated neurons at the SVZ migrate to the AOB and differentiate into granule cells and periglomerular cells. This study aimed to explore the effects of changes in mastication on newly generated neurons and pheromonal responses. Bromodeoxyuridine-immunoreactive (BrdU-ir; a marker of DNA synthesis) and Fos-ir (a marker of neurons excited) structures in sagittal sections of the AOB after exposure to urinary odours were compared between the mice fed soft and hard diets. The density of BrdU-ir cells in the AOB in the soft-diet-fed mice after 1 month was essentially similar to that of the hard-diet-fed mice, while that was lower in the soft-diet-fed mice for 3 or 6 months than in the hard-diet-fed mice. The density of Fos-ir cells in the soft-diet-fed mice after 2 months was essentially similar to that in the hard-diet-fed mice, while that was lower in the soft-diet-fed mice for 4 months than in the hard-diet-fed mice. The present results suggest that impaired mastication reduces newly generated neurons at the AOB, which in turn impairs olfactory function at the AOB. Copyright © 2014 Elsevier Ltd. All rights reserved.

Fragment capture device

Science.gov (United States)

Payne, Lloyd R.; Cole, David L.

2010-03-30

A fragment capture device for use in explosive containment. The device comprises an assembly of at least two rows of bars positioned to eliminate line-of-sight trajectories between the generation point of fragments and a surrounding containment vessel or asset. The device comprises an array of at least two rows of bars, wherein each row is staggered with respect to the adjacent row, and wherein a lateral dimension of each bar and a relative position of each bar in combination provides blockage of a straight-line passage of a solid fragment through the adjacent rows of bars, wherein a generation point of the solid fragment is located within a cavity at least partially enclosed by the array of bars.

[Fragment-based drug discovery: concept and aim].

Science.gov (United States)

Tanaka, Daisuke

2010-03-01

Fragment-Based Drug Discovery (FBDD) has been recognized as a newly emerging lead discovery methodology that involves biophysical fragment screening and chemistry-driven fragment-to-lead stages. Although fragments, defined as structurally simple and small compounds (typically FBDD primarily turns our attention to weakly but specifically binding fragments (hit fragments) as the starting point of medicinal chemistry. Hit fragments are then promoted to more potent lead compounds through linking or merging with another hit fragment and/or attaching functional groups. Another positive aspect of FBDD is ligand efficiency. Ligand efficiency is a useful guide in screening hit selection and hit-to-lead phases to achieve lead-likeness. Owing to these features, a number of successful applications of FBDD to "undruggable targets" (where HTS and other lead identification methods failed to identify useful lead compounds) have been reported. As a result, FBDD is now expected to complement more conventional methodologies. This review, as an introduction of the following articles, will summarize the fundamental concepts of FBDD and will discuss its advantages over other conventional drug discovery approaches.

Savannah River Certification Plan for newly generated, contact-handled transuranic waste

International Nuclear Information System (INIS)

Wierzbicki, K.S.

1986-01-01

This Certification Plan document describes the necessary processes and methods for certifying unclassified, newly generated, contact-handled solid transuranic (TRU) waste at the Savannah River Plant and Laboratory (SRP, SRL) to comply with the Waste Isolation Pilot Plant Waste Acceptance Criteria (WIPP-WAC). Section 2 contains the organizational structure as related to waste certification including a summary of functional responsibilities, levels of authority, and lines of communication of the various organizations involved in certification activities. Section 3 describes general plant operations and TRU waste generation. Included is a description of the TRU Waste classification system. Section 4 contains the SR site TRU Waste Quality Assurance Program Plan. Section 5 describes waste container procurement, inspection, and certification prior to being loaded with TRU waste. Certification of waste packages, after package closure in the waste generating areas, is described in Section 6. The packaging and certification of individual waste forms is described in Attachments 1-5. Included in each attachment is a description of controls used to ensure that waste packages meet all applicable waste form compliance requirements for shipment to the WIPP. 3 figs., 3 tabs

SPR-based fragment screening with neurotensin receptor 1 generates novel small molecule ligands

Science.gov (United States)

Huber, Sylwia; Casagrande, Fabio; Hug, Melanie N.; Wang, Lisha; Heine, Philipp; Kummer, Lutz; Plückthun, Andreas; Hennig, Michael

2017-01-01

The neurotensin receptor 1 represents an important drug target involved in various diseases of the central nervous system. So far, the full exploitation of potential therapeutic activities has been compromised by the lack of compounds with favorable physicochemical and pharmacokinetic properties which efficiently penetrate the blood-brain barrier. Recent progress in the generation of stabilized variants of solubilized neurotensin receptor 1 and its subsequent purification and successful structure determination presents a solid starting point to apply the approach of fragment-based screening to extend the chemical space of known neurotensin receptor 1 ligands. In this report, surface plasmon resonance was used as primary method to screen 6369 compounds. Thereby 44 hits were identified and confirmed in competition as well as dose-response experiments. Furthermore, 4 out of 8 selected hits were validated using nuclear magnetic resonance spectroscopy as orthogonal biophysical method. Computational analysis of the compound structures, taking the known crystal structure of the endogenous peptide agonist into consideration, gave insight into the potential fragment-binding location and interactions and inspires chemistry efforts for further exploration of the fragments. PMID:28510609

General-purpose heat source: Research and development program, radioisotope thermoelectric generator/thin fragment impact test

International Nuclear Information System (INIS)

Reimus, M.A.H.; Hinckley, J.E.

1996-11-01

The general-purpose heat source provides power for space missions by transmitting the heat of 238 Pu decay to an array of thermoelectric elements in a radioisotope thermoelectric generator (RTG). Because the potential for a launch abort or return from orbit exists for any space mission, the heat source response to credible accident scenarios is being evaluated. This test was designed to provide information on the response of a loaded RTG to impact by a fragment similar to the type of fragment produced by breakup of the spacecraft propulsion module system. The results of this test indicated that impact by a thin aluminum fragment traveling at 306 m/s may result in significant damage to the converter housing, failure of one fueled clad, and release of a small quantity of fuel

Mechanisms of fragmentation and microstructure of debris generated during explosive testing of Al-W granular composite rings

International Nuclear Information System (INIS)

Chiu, Po-Hsun; Nesterenko, V F; Olney, K L; Braithwaite, C; Jardine, A; Collins, A; Benson, D J

2014-01-01

Highly heterogeneous materials comprised of elements with drastically different densities and shock impedances (e.g., Al and W) may provide additional mesoscale fragmentation mechanisms reducing the characteristic fragment size in comparison with solid materials with similar density (e.g., Stainless Steel 304). Explosively driven expanding ring experiments were conducted with Al-W granular composite rings, processed using hot and cold isostatic pressing, with different morphologies (W polyhedral particles or W rods with high aspect ratio and bonded/unbonded Al spherical particles with different sizes). In comparison to homogeneous samples with a similar density, these granular/porous composites generated fragments with a significantly smaller characteristic size. Scanning Electron Microscopy revealed that fragments had a propensity to be composed of clustered Al and W particles. Finite element simulations were conducted to gain an insight into the mesoscale fragmentation mechanisms and the clustering behavior observed in the experiments. Understanding the mesoscale mechanisms of explosively driven pulverization is important for tailoring the size of the fragments through the alteration of mesostructural properties.

Complications Associated with Long-Term Disposition of Newly-Generated Transuranic Waste: A National Laboratory Perspective

International Nuclear Information System (INIS)

Orchard, B.J.; Harvego, L.A.; Carlson, T.L.; Grant, R.P.

2009-01-01

The Idaho National Laboratory (INL) is a multipurpose national laboratory delivering specialized science and engineering solutions for the U.S. Department of Energy (DOE). Sponsorship of INL was formally transferred to the DOE Office of Nuclear Energy, Science and Technology (NE) by Secretary Spencer Abraham in July 2002. The move to NE, and designation as the DOE lead nuclear energy laboratory for reactor technology, supports the nation's expanding nuclear energy initiatives, placing INL at the center of work to develop advanced Generation IV nuclear energy systems; nuclear energy/hydrogen coproduction technology; advanced nuclear energy fuel cycle technologies; and providing national security answers to national infrastructure needs. As a result of the Laboratory's NE mission, INL generates both contact-handled and remote-handled transuranic (TRU) waste from ongoing operations. Generation rates are relatively small and fluctuate based on specific programs and project activities being conducted; however, the Laboratory will continue to generate TRU waste well into the future in association with the NE mission. Currently, plans and capabilities are being established to transfer INL's contact-handled TRU waste to the Advanced Mixed Waste Treatment Plant (AMWTP) for certification and disposal to the Waste Isolation Pilot Plant (WIPP). Remote-handled TRU waste is currently placed in storage at the Materials and Fuels Complex (MFC). In an effort to minimize future liabilities associated with the INL NE mission, INL is evaluating and assessing options for the management and disposition of all its TRU waste on a real-time basis at time of generation. This paper summarizes near-term activities to minimize future re handling of INL's TRU waste, as well as, potential complications associated with the long-term disposition of newly-generated TRU waste. Potential complications impacting the disposition of INL newly-generated TRU waste include, but are not limited to: (1

Comparison of Monte Carlo generator predictions for bottom and charm hadrons in the decays of top quarks and the fragmentation of high pT jets

CERN Document Server

The ATLAS collaboration

2014-01-01

Modeling of the fragmentation and decay of heavy flavor hadrons is compared for four Monte Carlo generators: Pythia8, Pythia6, Herwig ++ and Herwig. Heavy flavor hadron production fractions and fragmentation functions are studied using top-quark pair and high transverse momentum jet samples generated for pp collisions at $\\sqrt{s} = 8$ TeV. The performance of the generators for heavy flavor fragmentation is also validated using e+e− annihilation events generated at $\\sqrt{s} = 91.2$ GeV (for $b$-quarks) and $\\sqrt{s} = 10.53$GeV (for $c$-quarks). In addition, bottom and charm hadron decays for the four generators are compared both to results with EvtGen Monte Carlo model and to experimental measurements.

Dynamical fragmentation and very high speed projection of micro-particulates with a pulsed electrons generator

International Nuclear Information System (INIS)

Cassany, B.; Courchinoux, R.; Bertron, I.; Malaise, F.; Hebert, D.

2003-01-01

This paper shows how to use a pulsed electrons beam to simulate the dynamical fragmentation of copper sheets and to eject diamond, tantalum and tungsten micro-particulates at very high speed (∼1000 m/s). These experiments were performed with the electrons generator CESAR of CEA/CESTA (France). (J.S.)

Effects of landscape fragmentation on genetic diversity of Stipa ...

African Journals Online (AJOL)

STORAGESEVER

2009-08-04

Aug 4, 2009 ... Effects of landscape fragmentation on genetic diversity of Stipa krylovii ..... nation plant tends to anemophily, this pollination mode enable it to have the .... sity on newly isolated tropical islands: a test of a null hypothesis and.

Virtual fragment preparation for computational fragment-based drug design.

Science.gov (United States)

Ludington, Jennifer L

2015-01-01

Fragment-based drug design (FBDD) has become an important component of the drug discovery process. The use of fragments can accelerate both the search for a hit molecule and the development of that hit into a lead molecule for clinical testing. In addition to experimental methodologies for FBDD such as NMR and X-ray Crystallography screens, computational techniques are playing an increasingly important role. The success of the computational simulations is due in large part to how the database of virtual fragments is prepared. In order to prepare the fragments appropriately it is necessary to understand how FBDD differs from other approaches and the issues inherent in building up molecules from smaller fragment pieces. The ultimate goal of these calculations is to link two or more simulated fragments into a molecule that has an experimental binding affinity consistent with the additive predicted binding affinities of the virtual fragments. Computationally predicting binding affinities is a complex process, with many opportunities for introducing error. Therefore, care should be taken with the fragment preparation procedure to avoid introducing additional inaccuracies.This chapter is focused on the preparation process used to create a virtual fragment database. Several key issues of fragment preparation which affect the accuracy of binding affinity predictions are discussed. The first issue is the selection of the two-dimensional atomic structure of the virtual fragment. Although the particular usage of the fragment can affect this choice (i.e., whether the fragment will be used for calibration, binding site characterization, hit identification, or lead optimization), general factors such as synthetic accessibility, size, and flexibility are major considerations in selecting the 2D structure. Other aspects of preparing the virtual fragments for simulation are the generation of three-dimensional conformations and the assignment of the associated atomic point charges.

Idaho Nuclear Technology and Engineering Center Newly Generated Liquid Waste Demonstration Project Feasibility Study

International Nuclear Information System (INIS)

Herbst, A.K.

2000-01-01

A research, development, and demonstration project for the grouting of newly generated liquid waste (NGLW) at the Idaho Nuclear Technology and Engineering Center is considered feasible. NGLW is expected from process equipment waste, decontamination waste, analytical laboratory waste, fuel storage basin waste water, and high-level liquid waste evaporator condensate. The potential grouted waste would be classed as mixed low-level waste, stabilized and immobilized to meet RCRA LDR disposal in a grouting process in the CPP-604 facility, and then transported to the state

Westinghouse Hanford Company plan for certifying newly generated contact -- handled transuranic waste. Revision 1

International Nuclear Information System (INIS)

Lipinski, R.M.; Backlund, E.G.

1995-09-01

All transuranic (TRU) waste generators are required by US Department of Energy (DOE) Order 5820.2A to package their TRU waste in order to comply wit the Waste Isolation Pilot Plant (WIPP) -- Waste Acceptance Criteria (WAC) or keep non-certifiable containers segregated. The Westinghouse Hanford Company (WHC) Transuranic Waste Certification Plan was developed to ensure that TRU newly generated waste at WHC meets the DOE Order 5820.2A and the WHC-WAC which includes the State of Washington Department of Ecology -- Washington Administrative Code (DOE-WAC). The metho used at WHC to package TRU waste are described in sufficient detail to meet the regulations. This document is organized to provide a brief overview of waste generation operations at WHC. The methods used to implement this plan are discussed briefly along with the responsibilities and authorities of applicable organizations. This plan describes how WHC complies with all applicable regulations and requirements set forth in the latest approved revision of WHC-EP-0063-4

Controlled fragmentation

International Nuclear Information System (INIS)

Arnold, Werner

2002-01-01

Contrary to natural fragmentation, controlled fragmentation offers the possibility to adapt fragment parameters like size and mass to the performance requirements in a very flexible way. Known mechanisms like grooves inside the casing, weaken the structure. This is, however, excluded for applications with high accelerations during launch or piercing requirements for example on a semi armor piercing penetrator. Another method to achieve controlled fragmentation with an additional grid layer is presented with which the required grooves are produced 'just in time' inside the casing during detonation of the high explosive. The process of generating the grooves aided by the grid layer was studied using the hydrocode HULL with respect to varying grid designs and material combinations. Subsequent to this, a large range of these theoretically investigated combinations was contemplated in substantial experimental tests. With an optimised grid design and a suitable material selection, the controlled fragment admits a very flexible adaptation to the set requirements. Additional advantages like the increase of perforation performance or incendiary amplification can be realized with the grid layer

The importance of hydration thermodynamics in fragment-to-lead optimization.

Science.gov (United States)

Ichihara, Osamu; Shimada, Yuzo; Yoshidome, Daisuke

2014-12-01

Using a computational approach to assess changes in solvation thermodynamics upon ligand binding, we investigated the effects of water molecules on the binding energetics of over 20 fragment hits and their corresponding optimized lead compounds. Binding activity and X-ray crystallographic data of published fragment-to-lead optimization studies from various therapeutically relevant targets were studied. The analysis reveals a distinct difference between the thermodynamic profile of water molecules displaced by fragment hits and those displaced by the corresponding optimized lead compounds. Specifically, fragment hits tend to displace water molecules with notably unfavorable excess entropies-configurationally constrained water molecules-relative to those displaced by the newly added moieties of the lead compound during the course of fragment-to-lead optimization. Herein we describe the details of this analysis with the goal of providing practical guidelines for exploiting thermodynamic signatures of binding site water molecules in the context of fragment-to-lead optimization. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

When fragments link: a bibliometric perspective on the development of fragment-based drug discovery.

Science.gov (United States)

Romasanta, Angelo K S; van der Sijde, Peter; Hellsten, Iina; Hubbard, Roderick E; Keseru, Gyorgy M; van Muijlwijk-Koezen, Jacqueline; de Esch, Iwan J P

2018-05-05

Fragment-based drug discovery (FBDD) is a highly interdisciplinary field, rich in ideas integrated from pharmaceutical sciences, chemistry, biology, and physics, among others. To enrich our understanding of the development of the field, we used bibliometric techniques to analyze 3642 publications in FBDD, complementing accounts by key practitioners. Mapping its core papers, we found the transfer of knowledge from academia to industry. Co-authorship analysis showed that university-industry collaboration has grown over time. Moreover, we show how ideas from other scientific disciplines have been integrated into the FBDD paradigm. Keyword analysis showed that the field is organized into four interconnected practices: library design, fragment screening, computational methods, and optimization. This study highlights the importance of interactions among various individuals and institutions from diverse disciplines in newly emerging scientific fields. Copyright © 2018. Published by Elsevier Ltd.

Segmentation and fragmentation of melt jets due to generation of large-scale structures. Observation in low subcooling conditions

International Nuclear Information System (INIS)

Sugiyama, Ken-ichiro; Yamada, Tsuyoshi

1999-01-01

In order to clarify a mechanism of melt-jet breakup and fragmentation entirely different from the mechanism of stripping, a series of experiments were carried out by using molten tin jets of 100 grams with initial temperatures from 250degC to 900degC. Molten tin jets with a small kinematic viscosity and a large thermal diffusivity were used to observe breakup and fragmentation of melt jets enhanced thermally and hydrodynamically. We observed jet columns with second-stage large-scale structures generated by the coalescence of large-scale structures recognized in the field of fluid mechanics. At a greater depth, the segmentation of jet columns between second-stage large-scale structures and the fragmentation of the segmented jet columns were observed. It is reasonable to consider that the segmentation and the fragmentation of jet columns are caused by the boiling of water hydrodynamically entrained within second-stage large-scale structures. (author)

Fragmentation Pathways of Lithiated Hexose Monosaccharides

Science.gov (United States)

Abutokaikah, Maha T.; Frye, Joseph W.; Tschampel, John; Rabus, Jordan M.; Bythell, Benjamin J.

2018-05-01

We characterize the primary fragmentation reactions of three isomeric lithiated D-hexose sugars (glucose, galactose, and mannose) utilizing tandem mass spectrometry, regiospecific labeling, and theory. We provide evidence that these three isomers populate similar fragmentation pathways to produce the abundant cross-ring cleavage peaks (0,2A1 and 0,3A1). These pathways are highly consistent with the prior literature (Hofmeister et al. J. Am. Chem. Soc. 113, 5964-5970, 1991, Bythell et al. J. Am. Soc. Mass Spectrom. 28, 688-703, 2017, Rabus et al. Phys. Chem. Chem. Phys. 19, 25643-25652, 2017) and the present labeling data. However, the structure-specific energetics and rate-determining steps of these reactions differ as a function of precursor sugar and anomeric configuration. The lowest energy water loss pathways involve loss of the anomeric oxygen to furnish B1 ions. For glucose and galactose, the lithiated α-anomers generate ketone structures at C2 in a concerted reaction involving a 1,2-migration of the C2-H to the anomeric carbon (C1). In contrast, the β-anomers are predicted to form 1,3-anhydroglucose/galactose B1 ion structures. Initiation of the water loss reactions from each anomeric configuration requires distinct reactive conformers, resulting in different product ion structures. Inversion of the stereochemistry at C2 has marked consequences. Both lithiated mannose forms expel water to form 1,2-anhydromannose B1 ions with the newly formed epoxide group above the ring. Additionally, provided water loss is not instantaneous, the α-anomer can also isomerize to generate a ketone structure at C2 in a concerted reaction involving a 1,2-migration of the C2-H to C1. This product is indistinguishable to that from α-glucose. The energetics and interplay of these pathways are discussed. [Figure not available: see fulltext.

Universality of fragment shapes.

Science.gov (United States)

Domokos, Gábor; Kun, Ferenc; Sipos, András Árpád; Szabó, Tímea

2015-03-16

The shape of fragments generated by the breakup of solids is central to a wide variety of problems ranging from the geomorphic evolution of boulders to the accumulation of space debris orbiting Earth. Although the statistics of the mass of fragments has been found to show a universal scaling behavior, the comprehensive characterization of fragment shapes still remained a fundamental challenge. We performed a thorough experimental study of the problem fragmenting various types of materials by slowly proceeding weathering and by rapid breakup due to explosion and hammering. We demonstrate that the shape of fragments obeys an astonishing universality having the same generic evolution with the fragment size irrespective of materials details and loading conditions. There exists a cutoff size below which fragments have an isotropic shape, however, as the size increases an exponential convergence is obtained to a unique elongated form. We show that a discrete stochastic model of fragmentation reproduces both the size and shape of fragments tuning only a single parameter which strengthens the general validity of the scaling laws. The dependence of the probability of the crack plan orientation on the linear extension of fragments proved to be essential for the shape selection mechanism.

Next-generation sequencing of multiple individuals per barcoded library by deconvolution of sequenced amplicons using endonuclease fragment analysis

DEFF Research Database (Denmark)

Andersen, Jeppe D; Pereira, Vania; Pietroni, Carlotta

2014-01-01

The simultaneous sequencing of samples from multiple individuals increases the efficiency of next-generation sequencing (NGS) while also reducing costs. Here we describe a novel and simple approach for sequencing DNA from multiple individuals per barcode. Our strategy relies on the endonuclease...... digestion of PCR amplicons prior to library preparation, creating a specific fragment pattern for each individual that can be resolved after sequencing. By using both barcodes and restriction fragment patterns, we demonstrate the ability to sequence the human melanocortin 1 receptor (MC1R) genes from 72...... individuals using only 24 barcoded libraries....

Charged-particle spectroscopy in the microsecond range following projectile fragmentation

CERN Document Server

Pfützner, M; Grzywacz, R; Janas, Z; Momayezi, M; Bingham, C; Blank, B; Chartier, M; Geissel, H; Giovinazzo, J; Hellström, M; Kurcewicz, J; Lalleman, A S; Mazzocchi, C; Mukha, I; Plettner, C; Roeckl, E; Rykaczewski, K; Schmidt, K; Simon, R S; Stanoiu, M; Thomas, J C

2002-01-01

We present a new approach to charged-particle spectroscopy of short-lived nuclei produced by relativistic projectile fragmentation. The system based on digital DGF-4C CAMAC modules and newly developed fast-reset preamplifiers was tested at the Fragment Separator of GSI. We were able to detect low-energy (approx 1 MeV) decay signals occurring a few microseconds after a heavy-ion implantation accompanied by a release of approx 1 GeV energy. Applications for the study of one- and two-proton radioactivity are discussed.

Fragment-based drug discovery using rational design.

Science.gov (United States)

Jhoti, H

2007-01-01

Fragment-based drug discovery (FBDD) is established as an alternative approach to high-throughput screening for generating novel small molecule drug candidates. In FBDD, relatively small libraries of low molecular weight compounds (or fragments) are screened using sensitive biophysical techniques to detect their binding to the target protein. A lower absolute affinity of binding is expected from fragments, compared to much higher molecular weight hits detected by high-throughput screening, due to their reduced size and complexity. Through the use of iterative cycles of medicinal chemistry, ideally guided by three-dimensional structural data, it is often then relatively straightforward to optimize these weak binding fragment hits into potent and selective lead compounds. As with most other lead discovery methods there are two key components of FBDD; the detection technology and the compound library. In this review I outline the two main approaches used for detecting the binding of low affinity fragments and also some of the key principles that are used to generate a fragment library. In addition, I describe an example of how FBDD has led to the generation of a drug candidate that is now being tested in clinical trials for the treatment of cancer.

Stroma-induced Jagged1 expression drives PC3 prostate cancer cell migration; disparate effects of RIP-generated proteolytic fragments on cell behaviour and Notch signaling

Energy Technology Data Exchange (ETDEWEB)

Delury, Craig, E-mail: c.delury@lancaster.ac.uk [Division of Biomedical and Life Sciences, Faculty of Health and Medicine, Lancaster University, Lancaster, LA1 4YQ (United Kingdom); Hart, Claire, E-mail: claire.hart@manchester.ac.uk [Genito Urinary Cancer Research Group, Institute of Cancer Sciences, Paterson Building, The University of Manchester, Manchester Academic Health Science Centre, Wilmslow Road, Manchester, M20 4BX (United Kingdom); Brown, Mick, E-mail: michael.brown@ics.manchester.ac.uk [Genito Urinary Cancer Research Group, Institute of Cancer Sciences, Paterson Building, The University of Manchester, Manchester Academic Health Science Centre, Wilmslow Road, Manchester, M20 4BX (United Kingdom); Clarke, Noel, E-mail: noel.clarke@christie.nhs.uk [Genito Urinary Cancer Research Group, Institute of Cancer Sciences, Paterson Building, The University of Manchester, Manchester Academic Health Science Centre, Wilmslow Road, Manchester, M20 4BX (United Kingdom); Parkin, Edward, E-mail: e.parkin@lancaster.ac.uk [Division of Biomedical and Life Sciences, Faculty of Health and Medicine, Lancaster University, Lancaster, LA1 4YQ (United Kingdom)

2016-03-25

The Notch ligand Jagged1 is subject to regulated intramembrane proteolysis (RIP) which yields a soluble ectodomain (sJag) and a soluble Jagged1 intracellular domain (JICD). The full-length Jagged1 protein enhances prostate cancer (PCa) cell proliferation and is highly expressed in metastatic cells. However, little is known regarding the mechanisms by which Jagged1 or its RIP-generated fragments might promote PCa bone metastasis. In the current study we show that bone marrow stroma (BMS) induces Jagged1 expression in bone metastatic prostate cancer PC3 cells and that this enhanced expression is mechanistically linked to the promotion of cell migration. We also show that RIP-generated Jagged1 fragments exert disparate effects on PC3 cell behaviour and Notch signaling. In conclusion, the expression of both the full-length ligand and its RIP-generated fragments must be considered in tandem when attempting to regulate Jagged1 as a possible PCa therapy. - Highlights: • Bone marrow stroma induces Jagged1 expression in prostate cancer (PCa) PC3 cells. • This enhanced expression of full-length Jagged1 is required for PC3 cell migration. • Proteolytic fragments of Jagged1 exert disparate effects on PC3 cell behaviour. • Effects of fragments on cell behaviour do not correlate with Notch signaling. • Effects of Jagged1 and its fragments on PCa metastasis likely to be complex.

Assessment of fragment projection hazard: probability distributions for the initial direction of fragments.

Science.gov (United States)

Tugnoli, Alessandro; Gubinelli, Gianfilippo; Landucci, Gabriele; Cozzani, Valerio

2014-08-30

The evaluation of the initial direction and velocity of the fragments generated in the fragmentation of a vessel due to internal pressure is an important information in the assessment of damage caused by fragments, in particular within the quantitative risk assessment (QRA) of chemical and process plants. In the present study an approach is proposed to the identification and validation of probability density functions (pdfs) for the initial direction of the fragments. A detailed review of a large number of past accidents provided the background information for the validation procedure. A specific method was developed for the validation of the proposed pdfs. Validated pdfs were obtained for both the vertical and horizontal angles of projection and for the initial velocity of the fragments. Copyright © 2014 Elsevier B.V. All rights reserved.

Hypervelocity Impact Test Fragment Modeling: Modifications to the Fragment Rotation Analysis and Lightcurve Code

Science.gov (United States)

Gouge, Michael F.

2011-01-01

Hypervelocity impact tests on test satellites are performed by members of the orbital debris scientific community in order to understand and typify the on-orbit collision breakup process. By analysis of these test satellite fragments, the fragment size and mass distributions are derived and incorporated into various orbital debris models. These same fragments are currently being put to new use using emerging technologies. Digital models of these fragments are created using a laser scanner. A group of computer programs referred to as the Fragment Rotation Analysis and Lightcurve code uses these digital representations in a multitude of ways that describe, measure, and model on-orbit fragments and fragment behavior. The Dynamic Rotation subroutine generates all of the possible reflected intensities from a scanned fragment as if it were observed to rotate dynamically while in orbit about the Earth. This calls an additional subroutine that graphically displays the intensities and the resulting frequency of those intensities as a range of solar phase angles in a Probability Density Function plot. This document reports the additions and modifications to the subset of the Fragment Rotation Analysis and Lightcurve concerned with the Dynamic Rotation and Probability Density Function plotting subroutines.

Restriction fragment polymorphism (RFLP) of a "new" HLA-DP specificity, CDP-HEI

DEFF Research Database (Denmark)

Hyldig-Nielsen, J J; Ødum, Niels; Morling, Niels

1988-01-01

Southern blotting with a DP beta cDNA probe of MspI digested DNA from 83 healthy unrelated individuals revealed a 1.8 kb fragment present in all four individuals (and no others) possessing the newly determined DP specificity, CDP-HEI....

A powerful transgenic tool for fate mapping and functional analysis of newly generated neurons

Directory of Open Access Journals (Sweden)

Vogt Weisenhorn Daniela M

2010-12-01

Full Text Available Abstract Background Lack of appropriate tools and techniques to study fate and functional integration of newly generated neurons has so far hindered understanding of neurogenesis' relevance under physiological and pathological conditions. Current analyses are either dependent on mitotic labeling, for example BrdU-incorporation or retroviral infection, or on the detection of transient immature neuronal markers. Here, we report a transgenic mouse model (DCX-CreERT2 for time-resolved fate analysis of newly generated neurons. This model is based on the expression of a tamoxifen-inducible Cre recombinase under the control of a doublecortin (DCX promoter, which is specific for immature neuronal cells in the CNS. Results In the DCX-CreERT2 transgenic mice, expression of CreERT2 was restricted to DCX+ cells. In the CNS of transgenic embryos and adult DCX-CreERT2 mice, tamoxifen administration caused the transient translocation of CreERT2 to the nucleus, allowing for the recombination of loxP-flanked sequences. In our system, tamoxifen administration at E14.5 resulted in reporter gene activation throughout the developing CNS of transgenic embryos. In the adult CNS, neurogenic regions were the primary sites of tamoxifen-induced reporter gene activation. In addition, reporter expression could also be detected outside of neurogenic regions in cells physiologically expressing DCX (e.g. piriform cortex, corpus callosum, hypothalamus. Four weeks after recombination, the vast majority of reporter-expressing cells were found to co-express NeuN, revealing the neuronal fate of DCX+ cells upon maturation. Conclusions This first validation demonstrates that our new DCX-CreERT2 transgenic mouse model constitutes a powerful tool to investigate neurogenesis, migration and their long-term fate of neuronal precursors. Moreover, it allows for a targeted activation or deletion of specific genes in neuronal precursors and will thereby contribute to unravel the molecular

In-situ measurements of a highly fragmented comet: WIND STICS Measurements

Science.gov (United States)

Lepri, S. T.; Gilbert, J. A.; Gruesbeck, J. R.; Rubin, M.; Gershman, D. J.; Zurbuchen, T.

2013-12-01

In this paper, we present in-situ observations of cometary fragments associated with Comet 73P/Schwassmann-Wachmann as it passed very close to the Earth (<0.07AU) in 2006. We examine the spatial distribution of the fragments and the characteristics of the picked up ion velocity distributions. Comet 73P started to disintegrate in 1995, two major components B and C were recovered in 2001, and it burst into more than 36 pieces during its passage near the Earth in 2006. Distant fragmentation members, well-separated from the major identified fragments, passed between the Earth and Sun so that cometary pickup ions and possibly recombined solar wind minor ions convected past the WIND spacecraft in late May 2006. The Suprathermal Ion Composition Spectrometer on WIND provides a rare and detailed 3D glimpse of the newly picked up ion properties.

Effects of clonal fragmentation on intraspecific competition of a stoloniferous floating plant.

Science.gov (United States)

Wang, P; Xu, Y-S; Dong, B-C; Xue, W; Yu, F-H

2014-11-01

Disturbance is common and can fragment clones of plants. Clonal fragmentation may affect the density and growth of ramets so that it could alter intraspecific competition. To test this hypothesis, we grew one (low density), five (medium density) or nine (high density) parent ramets of the floating invasive plant Pistia stratiotes in buckets, and newly produced offspring ramets were either severed (with fragmentation) or remained connected to parent ramets (no fragmentation). Increasing density reduced biomass of the whole clone (i.e. parent ramet plus its offspring ramets), showing intense intraspecific competition. Fragmentation decreased biomass of offspring ramets, but increased biomass of parent ramets and the whole clone, suggesting significant resource translocation from parent to offspring ramets when clones were not fragmented. There was no interaction effect of density x fragmentation on biomass of the whole clone, and fragmentation did not affect competition intensity index. We conclude that clonal fragmentation does not alter intraspecific competition between clones of P. stratiotes, but increases biomass production of the whole clone. Thus, fragmentation may contribute to its interspecific competitive ability and invasiveness, and intentional fragmentation should not be recommended as a measure to stop the rapid growth of this invasive species. © 2014 German Botanical Society and The Royal Botanical Society of the Netherlands.

Discovery of potent, reversible MetAP2 inhibitors via fragment based drug discovery and structure based drug design-Part 2.

Science.gov (United States)

McBride, Christopher; Cheruvallath, Zacharia; Komandla, Mallareddy; Tang, Mingnam; Farrell, Pamela; Lawson, J David; Vanderpool, Darin; Wu, Yiqin; Dougan, Douglas R; Plonowski, Artur; Holub, Corine; Larson, Chris

2016-06-15

Methionine aminopeptidase-2 (MetAP2) is an enzyme that cleaves an N-terminal methionine residue from a number of newly synthesized proteins. This step is required before they will fold or function correctly. Pre-clinical and clinical studies with a MetAP2 inhibitor suggest that they could be used as a novel treatment for obesity. Herein we describe the discovery of a series of pyrazolo[4,3-b]indoles as reversible MetAP2 inhibitors. A fragment-based drug discovery (FBDD) approach was used, beginning with the screening of fragment libraries to generate hits with high ligand-efficiency (LE). An indazole core was selected for further elaboration, guided by structural information. SAR from the indazole series led to the design of a pyrazolo[4,3-b]indole core and accelerated knowledge-based fragment growth resulted in potent and efficient MetAP2 inhibitors, which have shown robust and sustainable body weight loss in DIO mice when dosed orally. Copyright © 2016 Elsevier Ltd. All rights reserved.

Cells with dysfunctional telomeres are susceptible to reactive oxygen species hydrogen peroxide via generation of multichromosomal fusions and chromosomal fragments bearing telomeres

Energy Technology Data Exchange (ETDEWEB)

Woo, Seon Rang [Division of Radiation Cancer Research, Korea Institute of Radiological and Medical Sciences, Seoul 139-706 (Korea, Republic of); Department of Biochemistry, College of Medicine, Korea University, Seoul 136-705 (Korea, Republic of); Park, Jeong-Eun; Juhn, Kyoung-Mi; Ju, Yeun-Jin; Jeong, Jaemin [Division of Radiation Cancer Research, Korea Institute of Radiological and Medical Sciences, Seoul 139-706 (Korea, Republic of); Kang, Chang-Mo; Yun, Hyun Jin [Division of Radiation Effect, Korea Institute of Radiological and Medical Sciences, Seoul 139-706 (Korea, Republic of); Yun, Mi Yong; Shin, Hyun-Jin; Joo, Hyun-Yoo; Park, Eun-Ran; Park, In-Chul; Hong, Sung Hee; Hwang, Sang-Gu [Division of Radiation Cancer Research, Korea Institute of Radiological and Medical Sciences, Seoul 139-706 (Korea, Republic of); Kim, Haekwon [Department of Biotechnology, Seoul Woman' s University, Seoul 139-774 (Korea, Republic of); Cho, Myung-Haing [Laboratory of Toxicology, College of Veterinary Medicine, Seoul National University, Seoul 151-742 (Korea, Republic of); Kim, Sang Hoon [Department of Biology, Kyung Hee University, Seoul 130-701 (Korea, Republic of); Park, Gil Hong [Department of Biochemistry, College of Medicine, Korea University, Seoul 136-705 (Korea, Republic of); Lee, Kee-Ho, E-mail: khlee@kirams.re.kr [Division of Radiation Cancer Research, Korea Institute of Radiological and Medical Sciences, Seoul 139-706 (Korea, Republic of)

2012-01-06

Highlights: Black-Right-Pointing-Pointer Under conditions of telomere erosion, cells become extremely sensitive to H{sub 2}O{sub 2}. Black-Right-Pointing-Pointer Chromosomal regions adjacent to telomeres are cleaved by H{sub 2}O{sub 2} under such conditions. Black-Right-Pointing-Pointer H{sub 2}O{sub 2} thus causes multichromosomal fusions and generation of small chromosomal fragments. Black-Right-Pointing-Pointer N-acetylcysteine prevents H{sub 2}O{sub 2}-induced chromosomal aberrations. -- Abstract: During genotoxic stress, reactive oxygen species hydrogen peroxide (H{sub 2}O{sub 2}) is a prime mediator of the DNA damage response. Telomeres function both to assist in DNA damage repair and to inhibit chromosomal end-to-end fusion. Here, we show that telomere dysfunction renders cells susceptible to H{sub 2}O{sub 2}, via generation of multichromosomal fusion and chromosomal fragments. H{sub 2}O{sub 2} caused formation of multichromosomal end-to-end fusions involving more than three chromosomes, preferentially when telomeres were erosive. Interestingly, extensive chromosomal fragmentation (yielding small-sized fragments) occurred only in cells exhibiting such multichromosomal fusions. Telomeres were absent from fusion points, being rather present in the small fragments, indicating that H{sub 2}O{sub 2} cleaves chromosomal regions adjacent to telomeres. Restoration of telomere function or addition of the antioxidant N-acetylcysteine prevented development of chromosomal aberrations and rescued the observed hypersensitivity to H{sub 2}O{sub 2}. Thus, chromosomal regions adjacent to telomeres become sensitive to reactive oxygen species hydrogen peroxide when telomeres are dysfunctional, and are cleaved to produce multichromosomal fusions and small chromosomal fragments bearing the telomeres.

Analysis of proteolytic processes and enzymatic activities in the generation of huntingtin n-terminal fragments in an HEK293 cell model.

Directory of Open Access Journals (Sweden)

Andrew T N Tebbenkamp

Full Text Available N-terminal fragments of mutant huntingtin (htt that terminate between residues 90-115, termed cleavage product A or 1 (cp-A/1, form intracellular and intranuclear inclusion bodies in the brains of patients with Huntington's disease (HD. These fragments appear to be proteolytic products of the full-length protein. Here, we use an HEK293 cell culture model to investigate huntingtin proteolytic processing; previous studies of these cells have demonstrated cleavage of htt to cp-A/1 like htt fragments.Recombinant N-terminal htt fragments, terminating at residue 171 (also referred to as cp-B/2 like, were efficiently cleaved to produce cp-A/1 whereas fragments representing endogenous caspase, calpain, and metalloproteinase cleavage products, terminating between residues 400-600, were inefficiently cleaved. Using cysteine-labeling techniques and antibody binding mapping, we localized the C-terminus of the cp-A/1 fragments produced by HEK293 cells to sequences minimally limited by cysteine 105 and an antibody epitope composed of residues 115-124. A combination of genetic and pharmacologic approaches to inhibit potential proteases, including γ-secretase and calpain, proved ineffective in preventing production of cp-A/1.Our findings indicate that HEK293 cells express a protease that is capable of efficiently cleaving cp-B/2 like fragments of htt with normal or expanded glutamine repeats. For reasons that remain unclear, this protease cleaves longer htt fragments, with normal or expanded glutamine expansions, much less efficiently. The protease in HEK293 cells that is capable of generating a cp-A/1 like htt fragment may be a novel protease with a high preference for a cp-B/2-like htt fragment as substrate.

Fragment-based approaches to TB drugs.

Science.gov (United States)

Marchetti, Chiara; Chan, Daniel S H; Coyne, Anthony G; Abell, Chris

2018-02-01

Tuberculosis is an infectious disease associated with significant mortality and morbidity worldwide, particularly in developing countries. The rise of antibiotic resistance in Mycobacterium tuberculosis (Mtb) urgently demands the development of new drug leads to tackle resistant strains. Fragment-based methods have recently emerged at the forefront of pharmaceutical development as a means to generate more effective lead structures, via the identification of fragment molecules that form weak but high quality interactions with the target biomolecule and subsequent fragment optimization. This review highlights a number of novel inhibitors of Mtb targets that have been developed through fragment-based approaches in recent years.

Process of Fragment-Based Lead Discovery—A Perspective from NMR

Directory of Open Access Journals (Sweden)

Rongsheng Ma

2016-07-01

Full Text Available Fragment-based lead discovery (FBLD has proven fruitful during the past two decades for a variety of targets, even challenging protein–protein interaction (PPI systems. Nuclear magnetic resonance (NMR spectroscopy plays a vital role, from initial fragment-based screening to lead generation, because of its power to probe the intrinsically weak interactions between targets and low-molecular-weight fragments. Here, we review the NMR FBLD process from initial library construction to lead generation. We describe technical aspects regarding fragment library design, ligand- and protein-observed screening, and protein–ligand structure model generation. For weak binders, the initial hit-to-lead evolution can be guided by structural information retrieved from NMR spectroscopy, including chemical shift perturbation, transferred pseudocontact shifts, and paramagnetic relaxation enhancement. This perspective examines structure-guided optimization from weak fragment screening hits to potent leads for challenging PPI targets.

SCEDS: protein fragments for molecular replacement in Phaser

Energy Technology Data Exchange (ETDEWEB)

McCoy, Airlie J., E-mail: ajm201@cam.ac.uk [University of Cambridge, Hills Road, Cambridge CB2 0XY (United Kingdom); Nicholls, Robert A. [MRC Laboratory of Molecular Biology, Francis Crick Avenue, Cambridge Biomedical Campus, Cambridge CB2 0QH (United Kingdom); Schneider, Thomas R. [Hamburg Unit c/o DESY, Notkestrasse 85, 22603 Hamburg (Germany); University of Cambridge, Hills Road, Cambridge CB2 0XY (United Kingdom)

2013-11-01

Protein fragments suitable for use in molecular replacement can be generated by normal-mode perturbation, analysis of the difference distance matrix of the original versus normal-mode perturbed structures, and SCEDS, a score that measures the sphericity, continuity, equality and density of the resulting fragments. A method is described for generating protein fragments suitable for use as molecular-replacement (MR) template models. The template model for a protein suspected to undergo a conformational change is perturbed along combinations of low-frequency normal modes of the elastic network model. The unperturbed structure is then compared with each perturbed structure in turn and the structurally invariant regions are identified by analysing the difference distance matrix. These fragments are scored with SCEDS, which is a combined measure of the sphericity of the fragments, the continuity of the fragments with respect to the polypeptide chain, the equality in number of atoms in the fragments and the density of C{sup α} atoms in the triaxial ellipsoid of the fragment extents. The fragment divisions with the highest SCEDS are then used as separate template models for MR. Test cases show that where the protein contains fragments that undergo a change in juxtaposition between template model and target, SCEDS can identify fragments that lead to a lower R factor after ten cycles of all-atom refinement with REFMAC5 than the original template structure. The method has been implemented in the software Phaser.

SCEDS: protein fragments for molecular replacement in Phaser

International Nuclear Information System (INIS)

McCoy, Airlie J.; Nicholls, Robert A.; Schneider, Thomas R.

2013-01-01

Protein fragments suitable for use in molecular replacement can be generated by normal-mode perturbation, analysis of the difference distance matrix of the original versus normal-mode perturbed structures, and SCEDS, a score that measures the sphericity, continuity, equality and density of the resulting fragments. A method is described for generating protein fragments suitable for use as molecular-replacement (MR) template models. The template model for a protein suspected to undergo a conformational change is perturbed along combinations of low-frequency normal modes of the elastic network model. The unperturbed structure is then compared with each perturbed structure in turn and the structurally invariant regions are identified by analysing the difference distance matrix. These fragments are scored with SCEDS, which is a combined measure of the sphericity of the fragments, the continuity of the fragments with respect to the polypeptide chain, the equality in number of atoms in the fragments and the density of C α atoms in the triaxial ellipsoid of the fragment extents. The fragment divisions with the highest SCEDS are then used as separate template models for MR. Test cases show that where the protein contains fragments that undergo a change in juxtaposition between template model and target, SCEDS can identify fragments that lead to a lower R factor after ten cycles of all-atom refinement with REFMAC5 than the original template structure. The method has been implemented in the software Phaser

FIRST experiment: Fragmentation of Ions Relevant for Space and Therapy

International Nuclear Information System (INIS)

Agodi, C; Bondì, M; Cavallaro, M; Carbone, D; Cirrone, G A P; Cuttone, G; Abou-Haidar, Z; Alvarez, M A G; Bocci, A; Aumann, T; Durante, M; Balestra, F; Battistoni, G; Bohlen, T T; Boudard, A; Brunetti, A; Carpinelli, M; Cappuzzello, F; Cortes-Giraldo, M A; Napoli, M De

2013-01-01

Nuclear fragmentation processes are relevant in different fields of basic research and applied physics and are of particular interest for tumor therapy and for space radiation protection applications. The FIRST (Fragmentation of Ions Relevant for Space and Therapy) experiment at SIS accelerator of GSI laboratory in Darmstadt, has been designed for the measurement of different ions fragmentation cross sections at different energies between 100 and 1000 MeV/nucleon. The experiment is performed by an international collaboration made of institutions from Germany, France, Italy and Spain. The experimental apparatus is partly based on an already existing setup made of the ALADIN magnet, the MUSIC IV TPC, the LAND2 neutron detector and the TOFWALL scintillator TOF system, integrated with newly designed detectors in the interaction Region (IR) around the carbon removable target: a scintillator Start Counter, a Beam Monitor drift chamber, a silicon Vertex Detector and a Proton Tagger for detection of light fragments emitted at large angles (KENTROS). The scientific program of the FIRST experiment started on summer 2011 with the study of the 400 MeV/nucleon 12C beam fragmentation on thin (8 mm) carbon target.

FIRST experiment: Fragmentation of Ions Relevant for Space and Therapy

Science.gov (United States)

Agodi, C.; Abou-Haidar, Z.; Alvarez, M. A. G.; Aumann, T.; Balestra, F.; Battistoni, G.; Bocci, A.; Bohlen, T. T.; Bondì, M.; Boudard, A.; Brunetti, A.; Carpinelli, M.; Cappuzzello, F.; Cavallaro, M.; Carbone, D.; Cirrone, G. A. P.; Cortes-Giraldo, M. A.; Cuttone, G.; De Napoli, M.; Durante, M.; Fernandez-Garcia, J. P.; Finck, C.; Foti, A.; Gallardo, M. I.; Golosio, B.; Iarocci, E.; Iazzi, F.; Ickert, G.; Introzzi, R.; Juliani, D.; Krimmer, J.; Kurz, N.; Labalme, M.; Lavagno, A.; Leifels, Y.; Le Fevre, A.; Leray, S.; Marchetto, F.; Monaco, V.; Morone, M. C.; Nicolosi, D.; Oliva, P.; Paoloni, A.; Patera, V.; Piersanti, L.; Pleskac, R.; Quesada, J. M.; Randazzo, N.; Romano, F.; Rossi, D.; Rosso, V.; Rousseau, M.; Sacchi, R.; Sala, P.; Sarti, A.; Scheidenberger, C.; Schuy, C.; Sciubba, A.; Sfienti, C.; Simon, H.; Sipala, V.; Spiriti, E.; Stuttge, L.; Tropea, S.; Younis, H.

2013-03-01

Nuclear fragmentation processes are relevant in different fields of basic research and applied physics and are of particular interest for tumor therapy and for space radiation protection applications. The FIRST (Fragmentation of Ions Relevant for Space and Therapy) experiment at SIS accelerator of GSI laboratory in Darmstadt, has been designed for the measurement of different ions fragmentation cross sections at different energies between 100 and 1000 MeV/nucleon. The experiment is performed by an international collaboration made of institutions from Germany, France, Italy and Spain. The experimental apparatus is partly based on an already existing setup made of the ALADIN magnet, the MUSIC IV TPC, the LAND2 neutron detector and the TOFWALL scintillator TOF system, integrated with newly designed detectors in the interaction Region (IR) around the carbon removable target: a scintillator Start Counter, a Beam Monitor drift chamber, a silicon Vertex Detector and a Proton Tagger for detection of light fragments emitted at large angles (KENTROS). The scientific program of the FIRST experiment started on summer 2011 with the study of the 400 MeV/nucleon 12C beam fragmentation on thin (8mm) carbon target.

Fragment informatics and computational fragment-based drug design: an overview and update.

Science.gov (United States)

Sheng, Chunquan; Zhang, Wannian

2013-05-01

Fragment-based drug design (FBDD) is a promising approach for the discovery and optimization of lead compounds. Despite its successes, FBDD also faces some internal limitations and challenges. FBDD requires a high quality of target protein and good solubility of fragments. Biophysical techniques for fragment screening necessitate expensive detection equipment and the strategies for evolving fragment hits to leads remain to be improved. Regardless, FBDD is necessary for investigating larger chemical space and can be applied to challenging biological targets. In this scenario, cheminformatics and computational chemistry can be used as alternative approaches that can significantly improve the efficiency and success rate of lead discovery and optimization. Cheminformatics and computational tools assist FBDD in a very flexible manner. Computational FBDD can be used independently or in parallel with experimental FBDD for efficiently generating and optimizing leads. Computational FBDD can also be integrated into each step of experimental FBDD and help to play a synergistic role by maximizing its performance. This review will provide critical analysis of the complementarity between computational and experimental FBDD and highlight recent advances in new algorithms and successful examples of their applications. In particular, fragment-based cheminformatics tools, high-throughput fragment docking, and fragment-based de novo drug design will provide the focus of this review. We will also discuss the advantages and limitations of different methods and the trends in new developments that should inspire future research. © 2012 Wiley Periodicals, Inc.

Simple idea to generate fragment and pharmacophore descriptors and their implications in chemical informatics.

Science.gov (United States)

Catana, Cornel

2009-03-01

Using a well-defined set of fragments/pharmacophores, a new methodology to calculate fragment/ pharmacophore descriptors for any molecule onto which at least one fragment/pharmacophore can be mapped is presented. To each fragment/pharmacophore present in a molecule, we attach a descriptor that is calculated by identifying the molecule's atoms onto which it maps and summing over its constituent atomic descriptors. The attached descriptors are named C-fragment/pharmacophore descriptors, and this methodology can be applied to any descriptors defined at the atomic level, such as the partition coefficient, molar refractivity, electrotopological state, etc. By using this methodology, the same fragment/pharmacophore can be shown to have different values in different molecules resulting in better discrimination power. As we know, fragment and pharmacophore fingerprints have a lot of applications in chemical informatics. This study has attempted to find the impact of replacing the traditional value of "1" in a fingerprint with real numbers derived form C-fragment/pharmacophore descriptors. One way to do this is to assess the utility of C-fragment/ pharmacophore descriptors in modeling different end points. Here, we exemplify with data from CYP and hERG. The fact that, in many cases, the obtained models were fairly successful and C-fragment descriptors were ranked among the top ones supports the idea that they play an important role in correlation. When we modeled hERG with C-pharmacophore descriptors, however, the model performances decreased slightly, and we attribute this, mainly to the fact that there is no technique capable of handling multiple instances (states). We hope this will open new research, especially in the emerging field of machine learning. Further research is needed to see the impact of C-fragment/pharmacophore descriptors in similarity/dissimilarity applications.

Knowledge-based Fragment Binding Prediction

Science.gov (United States)

Tang, Grace W.; Altman, Russ B.

2014-01-01

Target-based drug discovery must assess many drug-like compounds for potential activity. Focusing on low-molecular-weight compounds (fragments) can dramatically reduce the chemical search space. However, approaches for determining protein-fragment interactions have limitations. Experimental assays are time-consuming, expensive, and not always applicable. At the same time, computational approaches using physics-based methods have limited accuracy. With increasing high-resolution structural data for protein-ligand complexes, there is now an opportunity for data-driven approaches to fragment binding prediction. We present FragFEATURE, a machine learning approach to predict small molecule fragments preferred by a target protein structure. We first create a knowledge base of protein structural environments annotated with the small molecule substructures they bind. These substructures have low-molecular weight and serve as a proxy for fragments. FragFEATURE then compares the structural environments within a target protein to those in the knowledge base to retrieve statistically preferred fragments. It merges information across diverse ligands with shared substructures to generate predictions. Our results demonstrate FragFEATURE's ability to rediscover fragments corresponding to the ligand bound with 74% precision and 82% recall on average. For many protein targets, it identifies high scoring fragments that are substructures of known inhibitors. FragFEATURE thus predicts fragments that can serve as inputs to fragment-based drug design or serve as refinement criteria for creating target-specific compound libraries for experimental or computational screening. PMID:24762971

Generation of Urinary Albumin Fragments Does Not Require Proximal Tubular Uptake

OpenAIRE

Weyer, K.; Nielsen, R.; Christensen, E. I.; Birn, H.

2012-01-01

Urinary albumin excretion is an important diagnostic and prognostic marker of renal function. Both animal and human urine contain large amounts of albumin fragments, but whether these fragments originate from renal tubular degradation of filtered albumin is unknown. Here, we used mice with kidneys lacking megalin and cubilin, the coreceptors that mediate proximal tubular endocytosis of albumin, to determine whether proximal tubular degradation of albumin forms the detectable urinary albumin f...

Current fragmentation in deep inelastic scattering

International Nuclear Information System (INIS)

Hamer, C.J.

1975-04-01

It is argued that the current fragmentation products in deep inelastic electron scattering will not be distributed in a 'one-dimensional' rapidity plateau as in the parton model picture of Feynman and Bjorken. A reaction mechanism with a multiperipheral topology, but which the above configuration might have been achieved, does not in fact populate the current fragmentation plateau; and unless partons are actually observed in the final state, it cannot lead to Bjorken scaling. The basic reason for this failure is shown to be the fact that when a particle is produced in the current fragmentation plateau, the adjacent momentum transfer in the multiperipheral chain becomes large and negative: such processes are inevitably suppressed. Instead, the current fragmentation products are likely to be generated by a fragmentation, or sequential decay process. (author)

Fragmentation Energy-Saving Theory of Full Face Rock Tunnel Boring Machine Disc Cutters

Science.gov (United States)

Zhang, Zhao-Huang; Gong, Guo-Fang; Gao, Qing-Feng; Sun, Fei

2017-07-01

Attempts to minimize energy consumption of a tunnel boring machine disc cutter during the process of fragmentation have largely focused on optimizing disc-cutter spacing, as determined by the minimum specific energy required for fragmentation; however, indentation tests showed that rock deforms plastically beneath the cutters. Equations for thrust were developed for both the traditional, popularly employed disc cutter and anew design based on three-dimensional theory. The respective energy consumption for penetration, rolling, and side-slip fragmentations were obtained. A change in disc-cutter fragmentation angles resulted in a change in the nature of the interaction between the cutter and rock, which lowered the specific energy of fragmentation. During actual field excavations to the same penetration length, the combined energy consumption for fragmentation using the newly designed cutters was 15% lower than that when using the traditional design. This paper presents a theory for energy saving in tunnel boring machines. Investigation results showed that the disc cutters designed using this theory were more durable than traditional designs, and effectively lowered the energy consumption.

Heart Rate Fragmentation: A Symbolic Dynamical Approach

Directory of Open Access Journals (Sweden)

Madalena D. Costa

2017-11-01

deceleration and vice versa, termed “hard” inflection points. Compared to healthy subjects, patients with CAD had significantly higher percentages of soft and hard inflection points, an increased percentage of words with a high degree of fragmentation and a decreased percentage of words with a lower degree of fragmentation.Conclusion: The symbolic dynamical method employed here was useful to probe the newly recognized property of heart rate fragmentation. The findings from these cross-sectional studies confirm that CAD and older age are associated with higher levels of heart rate fragmentation. Furthermore, fragmentation with healthy aging appears to be phenotypically different from fragmentation in the context of CAD.

The activity of the anti-apoptotic fragment generated by the caspase-3/p120 RasGAP stress-sensing module displays strict Akt isoform specificity.

Science.gov (United States)

Vanli, Güliz; Peltzer, Nieves; Dubuis, Gilles; Widmann, Christian

2014-12-01

The caspase-3/p120 RasGAP module acts as a stress sensor that promotes pro-survival or pro-death signaling depending on the intensity and the duration of the stressful stimuli. Partial cleavage of p120 RasGAP generates a fragment, called fragment N, which protects stressed cells by activating Akt signaling. Akt family members regulate many cellular processes including proliferation, inhibition of apoptosis and metabolism. These cellular processes are regulated by three distinct Akt isoforms: Akt1, Akt2 and Akt3. However, which of these isoforms are required for fragment N mediated protection have not been defined. In this study, we investigated the individual contribution of each isoform in fragment N-mediated cell protection against Fas ligand induced cell death. To this end, DLD1 and HCT116 isogenic cell lines lacking specific Akt isoforms were used. It was found that fragment N could activate Akt1 and Akt2 but that only the former could mediate the protective activity of the RasGAP-derived fragment. Even overexpression of Akt2 or Akt3 could not rescue the inability of fragment N to protect cells lacking Akt1. These results demonstrate a strict Akt isoform requirement for the anti-apoptotic activity of fragment N. Copyright © 2014 Elsevier Inc. All rights reserved.

Searching Fragment Spaces with feature trees.

Science.gov (United States)

Lessel, Uta; Wellenzohn, Bernd; Lilienthal, Markus; Claussen, Holger

2009-02-01

Virtual combinatorial chemistry easily produces billions of compounds, for which conventional virtual screening cannot be performed even with the fastest methods available. An efficient solution for such a scenario is the generation of Fragment Spaces, which encode huge numbers of virtual compounds by their fragments/reagents and rules of how to combine them. Similarity-based searches can be performed in such spaces without ever fully enumerating all virtual products. Here we describe the generation of a huge Fragment Space encoding about 5 * 10(11) compounds based on established in-house synthesis protocols for combinatorial libraries, i.e., we encode practically evaluated combinatorial chemistry protocols in a machine readable form, rendering them accessible to in silico search methods. We show how such searches in this Fragment Space can be integrated as a first step in an overall workflow. It reduces the extremely huge number of virtual products by several orders of magnitude so that the resulting list of molecules becomes more manageable for further more elaborated and time-consuming analysis steps. Results of a case study are presented and discussed, which lead to some general conclusions for an efficient expansion of the chemical space to be screened in pharmaceutical companies.

Fragman: an R package for fragment analysis.

Science.gov (United States)

Covarrubias-Pazaran, Giovanny; Diaz-Garcia, Luis; Schlautman, Brandon; Salazar, Walter; Zalapa, Juan

2016-04-21

Determination of microsatellite lengths or other DNA fragment types is an important initial component of many genetic studies such as mutation detection, linkage and quantitative trait loci (QTL) mapping, genetic diversity, pedigree analysis, and detection of heterozygosity. A handful of commercial and freely available software programs exist for fragment analysis; however, most of them are platform dependent and lack high-throughput applicability. We present the R package Fragman to serve as a freely available and platform independent resource for automatic scoring of DNA fragment lengths diversity panels and biparental populations. The program analyzes DNA fragment lengths generated in Applied Biosystems® (ABI) either manually or automatically by providing panels or bins. The package contains additional tools for converting the allele calls to GenAlEx, JoinMap® and OneMap software formats mainly used for genetic diversity and generating linkage maps in plant and animal populations. Easy plotting functions and multiplexing friendly capabilities are some of the strengths of this R package. Fragment analysis using a unique set of cranberry (Vaccinium macrocarpon) genotypes based on microsatellite markers is used to highlight the capabilities of Fragman. Fragman is a valuable new tool for genetic analysis. The package produces equivalent results to other popular software for fragment analysis while possessing unique advantages and the possibility of automation for high-throughput experiments by exploiting the power of R.

Advances in fragment-based drug discovery platforms.

Science.gov (United States)

Orita, Masaya; Warizaya, Masaichi; Amano, Yasushi; Ohno, Kazuki; Niimi, Tatsuya

2009-11-01

Fragment-based drug discovery (FBDD) has been established as a powerful alternative and complement to traditional high-throughput screening techniques for identifying drug leads. At present, this technique is widely used among academic groups as well as small biotech and large pharmaceutical companies. In recent years, > 10 new compounds developed with FBDD have entered clinical development, and more and more attention in the drug discovery field is being focused on this technique. Under the FBDD approach, a fragment library of relatively small compounds (molecular mass = 100 - 300 Da) is screened by various methods and the identified fragment hits which normally weakly bind to the target are used as starting points to generate more potent drug leads. Because FBDD is still a relatively new drug discovery technology, further developments and optimizations in screening platforms and fragment exploitation can be expected. This review summarizes recent advances in FBDD platforms and discusses the factors important for the successful application of this technique. Under the FBDD approach, both identifying the starting fragment hit to be developed and generating the drug lead from that starting fragment hit are important. Integration of various techniques, such as computational technology, X-ray crystallography, NMR, surface plasmon resonance, isothermal titration calorimetry, mass spectrometry and high-concentration screening, must be applied in a situation-appropriate manner.

Fragment formation in GeV-energy proton and light heavy-ion induced reactions

International Nuclear Information System (INIS)

Murakami, T.; Haga, M.; Haseno, M.

2002-01-01

We have investigated similarities and differences among the fragment formation processes in GeV-energy light-ion and light heavy-ion induced reactions. We have newly measured inclusive and exclusive energy spectra of intermediate mass fragments (3 ≤ Z ≤ 30; IMFs) for 8-GeV 16 O and 20 Ne and 12-GeV 20 Ne induced target multifragmentations (TMFs) in order to compare them with those previously measured for 8- and 12-GeV proton induced TMFs. We fond noticeable difference in their spectrum shapes and magnitudes but all of them clearly indicate the existence of sideward-peaked components, indicating fragment formations are mainly dictated not by a incident energy per nucleon but by a total energy of the projectile. (author)

High Efficiency Hydrodynamic DNA Fragmentation in a Bubbling System.

Science.gov (United States)

Li, Lanhui; Jin, Mingliang; Sun, Chenglong; Wang, Xiaoxue; Xie, Shuting; Zhou, Guofu; van den Berg, Albert; Eijkel, Jan C T; Shui, Lingling

2017-01-18

DNA fragmentation down to a precise fragment size is important for biomedical applications, disease determination, gene therapy and shotgun sequencing. In this work, a cheap, easy to operate and high efficiency DNA fragmentation method is demonstrated based on hydrodynamic shearing in a bubbling system. We expect that hydrodynamic forces generated during the bubbling process shear the DNA molecules, extending and breaking them at the points where shearing forces are larger than the strength of the phosphate backbone. Factors of applied pressure, bubbling time and temperature have been investigated. Genomic DNA could be fragmented down to controllable 1-10 Kbp fragment lengths with a yield of 75.30-91.60%. We demonstrate that the ends of the genomic DNAs generated from hydrodynamic shearing can be ligated by T4 ligase and the fragmented DNAs can be used as templates for polymerase chain reaction. Therefore, in the bubbling system, DNAs could be hydrodynamically sheared to achieve smaller pieces in dsDNAs available for further processes. It could potentially serve as a DNA sample pretreatment technique in the future.

Sizing Performance of the Newly Developed Eddy Current System

Energy Technology Data Exchange (ETDEWEB)

Cho, Chan Hee; Lee, Hee Jong; Yoo, Hyun Ju; Moon, Gyoon Young; Lee, Tae Hoon [Korea Hydro and Nuclear Power Co., Ltd., Daejeon (Korea, Republic of)

2013-10-15

This paper describes the comparison results of sizing performance for two systems. The KHNP developed a new eddy current testing system for the inspection of steam generator tubing in domestic nuclear power plants. The equivalency assessment of the newly developed system with the EPRI-qualified system was already carried out. In this paper, the comparisons of depth-sizing performance for the artificial flaws between two systems were performed. The results show that the newly developed system is in good agreement with the qualified system. Therefore, it is expected that the newly developed eddy current system can be used for the inspection of steam generator tubing in nuclear power plants. There are some non-destructive examination (NDE) methods for the inspection of components in nuclear power plants, such as ultrasonic, radiographic, eddy current testing, etc. The eddy current testing is widely used for the inspection of steam generator (SG) tubing because it offers a relatively low cost approach for high speed, large scale testing of metallic materials in high pressure and temperature engineering systems. The Korea Hydro and Nuclear Power Co., Ltd. (KHNP) developed an eddy current testing system for the inspection of steam generator tubing in nuclear power plants. This system includes not only hardware but software such as the frequency generator and data acquisition-analysis program. The foreign eddy current system developed by ZETEC is currently used for the inspection of steam generator tubing in domestic nuclear power plants. The equivalency assessment between two systems was already carried out in accordance with the EPRI steam generator examination guidelines.

Fragment-based discovery of a potent NAMPT inhibitor.

Science.gov (United States)

Korepanova, Alla; Longenecker, Kenton L; Pratt, Steve D; Panchal, Sanjay C; Clark, Richard F; Lake, Marc; Gopalakrishnan, Sujatha M; Raich, Diana; Sun, Chaohong; Petros, Andrew M

2017-12-12

NAMPT expression is elevated in many cancers, making this protein a potential target for anticancer therapy. We have carried out both NMR based and TR-FRET based fragment screens against human NAMPT and identified six novel binders with a range of potencies. Co-crystal structures were obtained for two of the fragments bound to NAMPT while for the other four fragments force-field driven docking was employed to generate a bound pose. Based on structural insights arising from comparison of the bound fragment poses to that of bound FK866 we were able to synthetically elaborate one of the fragments into a potent NAMPT inhibitor. Copyright © 2017 Elsevier Ltd. All rights reserved.

Residue preference mapping of ligand fragments in the Protein Data Bank.

Science.gov (United States)

Wang, Lirong; Xie, Zhaojun; Wipf, Peter; Xie, Xiang-Qun

2011-04-25

The interaction between small molecules and proteins is one of the major concerns for structure-based drug design because the principles of protein-ligand interactions and molecular recognition are not thoroughly understood. Fortunately, the analysis of protein-ligand complexes in the Protein Data Bank (PDB) enables unprecedented possibilities for new insights. Herein, we applied molecule-fragmentation algorithms to split the ligands extracted from PDB crystal structures into small fragments. Subsequently, we have developed a ligand fragment and residue preference mapping (LigFrag-RPM) algorithm to map the profiles of the interactions between these fragments and the 20 proteinogenic amino acid residues. A total of 4032 fragments were generated from 71 798 PDB ligands by a ring cleavage (RC) algorithm. Among these ligand fragments, 315 unique fragments were characterized with the corresponding fragment-residue interaction profiles by counting residues close to these fragments. The interaction profiles revealed that these fragments have specific preferences for certain types of residues. The applications of these interaction profiles were also explored and evaluated in case studies, showing great potential for the study of protein-ligand interactions and drug design. Our studies demonstrated that the fragment-residue interaction profiles generated from the PDB ligand fragments can be used to detect whether these fragments are in their favorable or unfavorable environments. The algorithm for a ligand fragment and residue preference mapping (LigFrag-RPM) developed here also has the potential to guide lead chemistry modifications as well as binding residues predictions.

Building a better fragment library for de novo protein structure prediction.

Directory of Open Access Journals (Sweden)

Saulo H P de Oliveira

Full Text Available Fragment-based approaches are the current standard for de novo protein structure prediction. These approaches rely on accurate and reliable fragment libraries to generate good structural models. In this work, we describe a novel method for structure fragment library generation and its application in fragment-based de novo protein structure prediction. The importance of correct testing procedures in assessing the quality of fragment libraries is demonstrated. In particular, the exclusion of homologs to the target from the libraries to correctly simulate a de novo protein structure prediction scenario, something which surprisingly is not always done. We demonstrate that fragments presenting different predominant predicted secondary structures should be treated differently during the fragment library generation step and that exhaustive and random search strategies should both be used. This information was used to develop a novel method, Flib. On a validation set of 41 structurally diverse proteins, Flib libraries presents both a higher precision and coverage than two of the state-of-the-art methods, NNMake and HHFrag. Flib also achieves better precision and coverage on the set of 275 protein domains used in the two previous experiments of the the Critical Assessment of Structure Prediction (CASP9 and CASP10. We compared Flib libraries against NNMake libraries in a structure prediction context. Of the 13 cases in which a correct answer was generated, Flib models were more accurate than NNMake models for 10. "Flib is available for download at: http://www.stats.ox.ac.uk/research/proteins/resources".

Building a Better Fragment Library for De Novo Protein Structure Prediction

Science.gov (United States)

de Oliveira, Saulo H. P.; Shi, Jiye; Deane, Charlotte M.

2015-01-01

Fragment-based approaches are the current standard for de novo protein structure prediction. These approaches rely on accurate and reliable fragment libraries to generate good structural models. In this work, we describe a novel method for structure fragment library generation and its application in fragment-based de novo protein structure prediction. The importance of correct testing procedures in assessing the quality of fragment libraries is demonstrated. In particular, the exclusion of homologs to the target from the libraries to correctly simulate a de novo protein structure prediction scenario, something which surprisingly is not always done. We demonstrate that fragments presenting different predominant predicted secondary structures should be treated differently during the fragment library generation step and that exhaustive and random search strategies should both be used. This information was used to develop a novel method, Flib. On a validation set of 41 structurally diverse proteins, Flib libraries presents both a higher precision and coverage than two of the state-of-the-art methods, NNMake and HHFrag. Flib also achieves better precision and coverage on the set of 275 protein domains used in the two previous experiments of the the Critical Assessment of Structure Prediction (CASP9 and CASP10). We compared Flib libraries against NNMake libraries in a structure prediction context. Of the 13 cases in which a correct answer was generated, Flib models were more accurate than NNMake models for 10. “Flib is available for download at: http://www.stats.ox.ac.uk/research/proteins/resources”. PMID:25901595

Codon-Precise, Synthetic, Antibody Fragment Libraries Built Using Automated Hexamer Codon Additions and Validated through Next Generation Sequencing

Directory of Open Access Journals (Sweden)

Laura Frigotto

2015-05-01

Full Text Available We have previously described ProxiMAX, a technology that enables the fabrication of precise, combinatorial gene libraries via codon-by-codon saturation mutagenesis. ProxiMAX was originally performed using manual, enzymatic transfer of codons via blunt-end ligation. Here we present Colibra™: an automated, proprietary version of ProxiMAX used specifically for antibody library generation, in which double-codon hexamers are transferred during the saturation cycling process. The reduction in process complexity, resulting library quality and an unprecedented saturation of up to 24 contiguous codons are described. Utility of the method is demonstrated via fabrication of complementarity determining regions (CDR in antibody fragment libraries and next generation sequencing (NGS analysis of their quality and diversity.

Three-body fragmentation of methane dications produced by slow A r8 + -ion impact

Science.gov (United States)

Zhang, Y.; Jiang, T.; Wei, L.; Luo, D.; Wang, X.; Yu, W.; Hutton, R.; Zou, Y.; Wei, B.

2018-02-01

The three-body fragmentation dynamics of CH4 2 + dications induced by single-electron capture of slow (3-keV/u) A r8 + ions is investigated. The experiment is performed on a newly built, highly charged ion collision platform which consists of an electron cyclotron resonance ion source and a cold target recoil ion momentum spectroscopy (COLTRIMS) setup. Using the COLTRIMS methodology, the complete kinematical information is determined for two three-body breakup channels, CH4 2 +→H++CH2 ++H and CH4 2 +→H2 ++C H++H . Then analyzing the complete kinematics with the Dalitz plot, very different fragmentation mechanisms (e.g., sequential and/or concerted pathway) are clearly identified for the two channels. To confirm the existence of some possible fragmentation pathways, we also simulate corresponding Dalitz plots employing a simple classical mechanical model. For the H++CH2 ++H channel, the dependence of the fragmentation pathway on its kinetic energy release is studied, which reflects the different nature of the corresponding states of CH4 2 + dications. Furthermore, the kinetic energy ratio of two ionic fragments is analyzed to infer the three-body fragmentation mechanism of CH4 2 + dications.

Transplantation of storm-generated coral fragments to enhance Caribbean coral reefs: A successful method but not a solution

Directory of Open Access Journals (Sweden)

Virginia H. Garrison

2012-03-01

Full Text Available In response to dramatic losses of reef-building corals and ongoing lack of recovery, a small-scale coral transplant project was initiated in the Caribbean (U.S. Virgin Islands in 1999 and was followed for 12 years. The primary objectives were to (1 identify a source of coral colonies for transplantation that would not result in damage to reefs, (2 test the feasibility of transplanting storm-generated coral fragments, and (3 develop a simple, inexpensive method for transplanting fragments that could be conducted by the local community. The ultimate goal was to enhance abundance of threatened reef-building species on local reefs. Storm-produced coral fragments of two threatened reef-building species [Acropora palmata and A. cervicornis (Acroporidae] and another fast-growing species [Porites porites (Poritidae] were collected from environments hostile to coral fragment survival and transplanted to degraded reefs. Inert nylon cable ties were used to attach transplanted coral fragments to dead coral substrate. Survival of 75 reference colonies and 60 transplants was assessed over 12 years. Only 9% of colonies were alive after 12 years: no A. cervicornis; 3% of A. palmata transplants and 18% of reference colonies; and 13% of P. porites transplants and 7% of reference colonies. Mortality rates for all species were high and were similar for transplant and reference colonies. Physical dislodgement resulted in the loss of 56% of colonies, whereas 35% died in place. Only A. palmata showed a difference between transplant and reference colony survival and that was in the first year only. Location was a factor in survival only for A. palmata reference colonies and after year 10. Even though the tested methods and concepts were proven effective in the field over the 12-year study, they do not present a solution. No coral conservation strategy will be effective until underlying intrinsic and/or extrinsic factors driving high mortality rates are understood and

Fragment-assisted hit investigation involving integrated HTS and fragment screening: Application to the identification of phosphodiesterase 10A (PDE10A) inhibitors.

Science.gov (United States)

Varnes, Jeffrey G; Geschwindner, Stefan; Holmquist, Christopher R; Forst, Janet; Wang, Xia; Dekker, Niek; Scott, Clay W; Tian, Gaochao; Wood, Michael W; Albert, Jeffrey S

2016-01-01

Fragment-based drug design (FBDD) relies on direct elaboration of fragment hits and typically requires high resolution structural information to guide optimization. In fragment-assisted drug discovery (FADD), fragments provide information to guide selection and design but do not serve as starting points for elaboration. We describe FADD and high-throughput screening (HTS) campaign strategies conducted in parallel against PDE10A where fragment hit co-crystallography was not available. The fragment screen led to prioritized fragment hits (IC50's ∼500μM), which were used to generate a hypothetical core scaffold. Application of this scaffold as a filter to HTS output afforded a 4μM hit, which, after preparation of a small number of analogs, was elaborated into a 16nM lead. This approach highlights the strength of FADD, as fragment methods were applied despite the absence of co-crystallographical information to efficiently identify a lead compound for further optimization. Copyright © 2015 Elsevier Ltd. All rights reserved.

DNA fragments assembly based on nicking enzyme system.

Directory of Open Access Journals (Sweden)

Rui-Yan Wang

Full Text Available A couple of DNA ligation-independent cloning (LIC methods have been reported to meet various requirements in metabolic engineering and synthetic biology. The principle of LIC is the assembly of multiple overlapping DNA fragments by single-stranded (ss DNA overlaps annealing. Here we present a method to generate single-stranded DNA overlaps based on Nicking Endonucleases (NEases for LIC, the method was termed NE-LIC. Factors related to cloning efficiency were optimized in this study. This NE-LIC allows generating 3'-end or 5'-end ss DNA overlaps of various lengths for fragments assembly. We demonstrated that the 10 bp/15 bp overlaps had the highest DNA fragments assembling efficiency, while 5 bp/10 bp overlaps showed the highest efficiency when T4 DNA ligase was added. Its advantage over Sequence and Ligation Independent Cloning (SLIC and Uracil-Specific Excision Reagent (USER was obvious. The mechanism can be applied to many other LIC strategies. Finally, the NEases based LIC (NE-LIC was successfully applied to assemble a pathway of six gene fragments responsible for synthesizing microbial poly-3-hydroxybutyrate (PHB.

Multi-fragment visibility determination in the context of order-independent transparency rendering

OpenAIRE

Marilena Maule

2015-01-01

Multi-fragment effects, in the computer-generated imagery context, are effects that determine pixel color based on information computed from more than one fragment. In such effects, the contribution of each fragment is extracted from its visibility with respect to a point of view. Seen through a pixel’s point of view, the visibility of one fragment depends on its spatial relationship with other fragments. This relationship can be reduced to the problem of sorting multiple fragments. Therefore...

Controlled isotropic fission fragment sources on the base of nuclear-physical facilities

International Nuclear Information System (INIS)

Sevast'yanov, V.D.; Maslov, G.N.

1995-01-01

Isotropic fission fragment sources (IFFS) are developed on the base of a neutron generator and pulse fast reactor. IFFS permit to calibrate fission fragment detectors. The IFFS consist of radiators with 235 U. The radiators are placed in a thermal neutron field of the neutron generator or in the reactor core center. The fragment activity is controlled by indications of an α-particle counter or by indications of a monitor of energy release in the core. 14 refs.; 1 fig.; 1 tab

Direct access to dithiobenzoate RAFT agent fragmentation rate coefficients by ESR spin-trapping.

Science.gov (United States)

Ranieri, Kayte; Delaittre, Guillaume; Barner-Kowollik, Christopher; Junkers, Thomas

2014-12-01

The β-scission rate coefficient of tert-butyl radicals fragmenting off the intermediate resulting from their addition to tert-butyl dithiobenzoate-a reversible addition-fragmentation chain transfer (RAFT) agent-is estimated via the recently introduced electron spin resonance (ESR)-trapping methodology as a function of temperature. The newly introduced ESR-trapping methodology is critically evaluated and found to be reliable. At 20 °C, a fragmentation rate coefficient of close to 0.042 s(-1) is observed, whereas the activation parameters for the fragmentation reaction-determined for the first time-read EA = 82 ± 13.3 kJ mol(-1) and A = (1.4 ± 0.25) × 10(13) s(-1) . The ESR spin-trapping methodology thus efficiently probes the stability of the RAFT adduct radical under conditions relevant for the pre-equilibrium of the RAFT process. It particularly indicates that stable RAFT adduct radicals are indeed formed in early stages of the RAFT poly-merization, at least when dithiobenzoates are employed as controlling agents as stipulated by the so-called slow fragmentation theory. By design of the methodology, the obtained fragmentation rate coefficients represent an upper limit. The ESR spin-trapping methodology is thus seen as a suitable tool for evaluating the fragmentation rate coefficients of a wide range of RAFT adduct radicals. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Detection of titin fragments in urine in response to exercise-induced muscle damage.

Directory of Open Access Journals (Sweden)

Kazue Kanda

Full Text Available Many studies have attempted to determine the associations between blood biomarkers and exercise-induced muscle damage. However, poor correlations between the changes in biomarker levels and the magnitude of muscle symptoms have been reported. Recent advances in proteomic tools offer a strategy for the comprehensive analysis of protein expression, which can be used to identify biomarkers. Here, we used a proteomic analysis to identify urinary proteins that appear in response to a calf-raise exercise, including repetitive eccentric muscle contractions, and found that a titin (also known as connectin N-terminal fragment molecule appears in the urine after eccentric exercise. We measured the titin fragment in urine samples from nine individuals before and after eccentric exercise using a newly-established enzyme-linked immunosorbent assay and found that the titin fragment excretion rate increased 96 h after the exercise (5.1 to 77.6 pg/min, p <0.01. The changes in the titin fragment excretion rate were correlated strongly with blood markers of muscle damage and with muscle symptoms. These findings suggest that the urinary titin fragment is potentially a noninvasive biomarker of muscle damage.

Generating "fragment-based virtual library" using pocket similarity search of ligand-receptor complexes.

Science.gov (United States)

Khashan, Raed S

2015-01-01

As the number of available ligand-receptor complexes is increasing, researchers are becoming more dedicated to mine these complexes to aid in the drug design and development process. We present free software which is developed as a tool for performing similarity search across ligand-receptor complexes for identifying binding pockets which are similar to that of a target receptor. The search is based on 3D-geometric and chemical similarity of the atoms forming the binding pocket. For each match identified, the ligand's fragment(s) corresponding to that binding pocket are extracted, thus forming a virtual library of fragments (FragVLib) that is useful for structure-based drug design. The program provides a very useful tool to explore available databases.

Introduction to fragment-based drug discovery.

Science.gov (United States)

Erlanson, Daniel A

2012-01-01

Fragment-based drug discovery (FBDD) has emerged in the past decade as a powerful tool for discovering drug leads. The approach first identifies starting points: very small molecules (fragments) that are about half the size of typical drugs. These fragments are then expanded or linked together to generate drug leads. Although the origins of the technique date back some 30 years, it was only in the mid-1990s that experimental techniques became sufficiently sensitive and rapid for the concept to be become practical. Since that time, the field has exploded: FBDD has played a role in discovery of at least 18 drugs that have entered the clinic, and practitioners of FBDD can be found throughout the world in both academia and industry. Literally dozens of reviews have been published on various aspects of FBDD or on the field as a whole, as have three books (Jahnke and Erlanson, Fragment-based approaches in drug discovery, 2006; Zartler and Shapiro, Fragment-based drug discovery: a practical approach, 2008; Kuo, Fragment based drug design: tools, practical approaches, and examples, 2011). However, this chapter will assume that the reader is approaching the field with little prior knowledge. It will introduce some of the key concepts, set the stage for the chapters to follow, and demonstrate how X-ray crystallography plays a central role in fragment identification and advancement.

Fragmentation of percolation cluster perimeters

Science.gov (United States)

Debierre, Jean-Marc; Bradley, R. Mark

1996-05-01

We introduce a model for the fragmentation of porous random solids under the action of an external agent. In our model, the solid is represented by a bond percolation cluster on the square lattice and bonds are removed only at the external perimeter (or `hull') of the cluster. This model is shown to be related to the self-avoiding walk on the Manhattan lattice and to the disconnection events at a diffusion front. These correspondences are used to predict the leading and the first correction-to-scaling exponents for several quantities defined for hull fragmentation. Our numerical results support these predictions. In addition, the algorithm used to construct the perimeters reveals itself to be a very efficient tool for detecting subtle correlations in the pseudo-random number generator used. We present a quantitative test of two generators which supports recent results reported in more systematic studies.

Seed-dispersal distributions by trumpeter hornbills in fragmented landscapes

Science.gov (United States)

Lenz, Johanna; Fiedler, Wolfgang; Caprano, Tanja; Friedrichs, Wolfgang; Gaese, Bernhard H.; Wikelski, Martin; Böhning-Gaese, Katrin

2011-01-01

Frugivorous birds provide important ecosystem services by transporting seeds of fleshy fruited plants. It has been assumed that seed-dispersal kernels generated by these animals are generally leptokurtic, resulting in little dispersal among habitat fragments. However, little is known about the seed-dispersal distribution generated by large frugivorous birds in fragmented landscapes. We investigated movement and seed-dispersal patterns of trumpeter hornbills (Bycanistes bucinator) in a fragmented landscape in South Africa. Novel GPS loggers provide high-quality location data without bias against recording long-distance movements. We found a very weakly bimodal seed-dispersal distribution with potential dispersal distances up to 14.5 km. Within forest, the seed-dispersal distribution was unimodal with an expected dispersal distance of 86 m. In the fragmented agricultural landscape, the distribution was strongly bimodal with peaks at 18 and 512 m. Our results demonstrate that seed-dispersal distributions differed when birds moved in different habitat types. Seed-dispersal distances in fragmented landscapes show that transport among habitat patches is more frequent than previously assumed, allowing plants to disperse among habitat patches and to track the changing climatic conditions. PMID:21177686

MaRaCluster: A Fragment Rarity Metric for Clustering Fragment Spectra in Shotgun Proteomics.

Science.gov (United States)

The, Matthew; Käll, Lukas

2016-03-04

Shotgun proteomics experiments generate large amounts of fragment spectra as primary data, normally with high redundancy between and within experiments. Here, we have devised a clustering technique to identify fragment spectra stemming from the same species of peptide. This is a powerful alternative method to traditional search engines for analyzing spectra, specifically useful for larger scale mass spectrometry studies. As an aid in this process, we propose a distance calculation relying on the rarity of experimental fragment peaks, following the intuition that peaks shared by only a few spectra offer more evidence than peaks shared by a large number of spectra. We used this distance calculation and a complete-linkage scheme to cluster data from a recent large-scale mass spectrometry-based study. The clusterings produced by our method have up to 40% more identified peptides for their consensus spectra compared to those produced by the previous state-of-the-art method. We see that our method would advance the construction of spectral libraries as well as serve as a tool for mining large sets of fragment spectra. The source code and Ubuntu binary packages are available at https://github.com/statisticalbiotechnology/maracluster (under an Apache 2.0 license).

An Imaging System for Automated Characteristic Length Measurement of Debrisat Fragments

Science.gov (United States)

Moraguez, Mathew; Patankar, Kunal; Fitz-Coy, Norman; Liou, J.-C.; Sorge, Marlon; Cowardin, Heather; Opiela, John; Krisko, Paula H.

2015-01-01

The debris fragments generated by DebriSat's hypervelocity impact test are currently being processed and characterized through an effort of NASA and USAF. The debris characteristics will be used to update satellite breakup models. In particular, the physical dimensions of the debris fragments must be measured to provide characteristic lengths for use in these models. Calipers and commercial 3D scanners were considered as measurement options, but an automated imaging system was ultimately developed to measure debris fragments. By automating the entire process, the measurement results are made repeatable and the human factor associated with calipers and 3D scanning is eliminated. Unlike using calipers to measure, the imaging system obtains non-contact measurements to avoid damaging delicate fragments. Furthermore, this fully automated measurement system minimizes fragment handling, which reduces the potential for fragment damage during the characterization process. In addition, the imaging system reduces the time required to determine the characteristic length of the debris fragment. In this way, the imaging system can measure the tens of thousands of DebriSat fragments at a rate of about six minutes per fragment, compared to hours per fragment in NASA's current 3D scanning measurement approach. The imaging system utilizes a space carving algorithm to generate a 3D point cloud of the article being measured and a custom developed algorithm then extracts the characteristic length from the point cloud. This paper describes the measurement process, results, challenges, and future work of the imaging system used for automated characteristic length measurement of DebriSat fragments.

Recombinant Kinase Production and Fragment Screening by NMR Spectroscopy.

Science.gov (United States)

Han, Byeonggu; Ahn, Hee-Chul

2016-01-01

During the past decade fragment-based drug discovery (FBDD) has rapidly evolved and several drugs or drug candidates developed by FBDD approach are clinically in use or in clinical trials. For example, vemurafenib, a V600E mutated BRAF inhibitor, was developed by utilizing FBDD approach and approved by FDA in 2011. In FBDD, screening of fragments is the starting step for identification of hits and lead generation. Fragment screening usually relies on biophysical techniques by which the protein-bound small molecules can be detected. NMR spectroscopy has been extensively used to study the molecular interaction between the protein and the ligand, and has many advantages in fragment screening over other biophysical techniques. This chapter describes the practical aspects of fragment screening by saturation transfer difference NMR.

An improved algorithm for MFR fragment assembly

International Nuclear Information System (INIS)

Kontaxis, Georg

2012-01-01

A method for generating protein backbone models from backbone only NMR data is presented, which is based on molecular fragment replacement (MFR). In a first step, the PDB database is mined for homologous peptide fragments using experimental backbone-only data i.e. backbone chemical shifts (CS) and residual dipolar couplings (RDC). Second, this fragment library is refined against the experimental restraints. Finally, the fragments are assembled into a protein backbone fold using a rigid body docking algorithm using the RDCs as restraints. For improved performance, backbone nuclear Overhauser effects (NOEs) may be included at that stage. Compared to previous implementations of MFR-derived structure determination protocols this model-building algorithm offers improved stability and reliability. Furthermore, relative to CS-ROSETTA based methods, it provides faster performance and straightforward implementation with the option to easily include further types of restraints and additional energy terms.

Fragment approaches in structure-based drug discovery

International Nuclear Information System (INIS)

Hubbard, Roderick E.

2008-01-01

Fragment-based methods are successfully generating novel and selective drug-like inhibitors of protein targets, with a number of groups reporting compounds entering clinical trials. This paper summarizes the key features of the approach as one of the tools in structure-guided drug discovery. There has been considerable interest recently in what is known as 'fragment-based lead discovery'. The novel feature of the approach is to begin with small low-affinity compounds. The main advantage is that a larger potential chemical diversity can be sampled with fewer compounds, which is particularly important for new target classes. The approach relies on careful design of the fragment library, a method that can detect binding of the fragment to the protein target, determination of the structure of the fragment bound to the target, and the conventional use of structural information to guide compound optimization. In this article the methods are reviewed, and experiences in fragment-based discovery of lead series of compounds against kinases such as PDK1 and ATPases such as Hsp90 are discussed. The examples illustrate some of the key benefits and issues of the approach and also provide anecdotal examples of the patterns seen in selectivity and the binding mode of fragments across different protein targets

Timing of revenue streams from newly recruited faculty: implications for faculty retention.

Science.gov (United States)

Joiner, Keith A; Hiteman, Sarah; Wormsley, Steven; St Germain, Patricia

2007-12-01

To determine the timing and magnitude of revenues generated by newly recruited faculty, to facilitate configuration of recruitment packages appropriately matched to expected financial returns. The aggregate of all positive cash flows to central college of medicine administration -- from research, clinical care, tuition, philanthropy, and royalties and patents, from all faculty newly recruited to the University of Arizona College of Medicine between 1998 and 2004 -- was quantified using the net present value (npv) methodology, which incorporates the time value of money. Tenure-track faculty and, in particular, those with laboratory research programs, generated the highest positive central cash flows. The npv for positive cash flows (npv[+]) during 6 and 10 years for newly recruited assistant professors with laboratory research programs were $118,600 and $255,400, respectively, and, for professors with laboratory research programs, $172,600 and $298,000, respectively (associate professors were not analyzed because of limited numbers). Faculty whose appointments at the University of Arizona College of Medicine exceeded 15 years in duration were the most productive in central revenue generation, far in excess of their numbers proportionate to the total. The results emphasize the critical importance of faculty retention, because even those newly recruited faculty who are most successful in central revenue generation (tenure track with laboratory research programs) must be retained for periods well in excess of 10 years to recoup the initial central investment required for their recruitment.

The event generator SIMON

International Nuclear Information System (INIS)

Durand, D.; Lopez, O.; Nguyen, A.D.

1997-01-01

The utilization and development of SIMON generator work was conducted at LPC.This generator was conceived for simple and versatile simulations of different processes occurring in the nuclear collisions at Fermi Energies. At present it is utilized in a large number of French foreign laboratories. Particularly, certain analyses of INDRA data have been done by use of this generator: estimation of collective energy in the Xe + Sn and Gd + U central collisions; shape and space-time correlation analysis in fragment-fragment and particle-fragment output of the same system; calorimetric study of the Xe + Sn and Ar + Ni system; study of the vaporization for the Ar + Ni system. Recently a number of items were improved or modified, among which: the initial configuration was allowed to be non-spherical what permits the analysis of the semi-central collisions; a so-called pre-fragmentation emission may be included to estimate different time constants implied in the fragmentation process

Transplantation of storm-generated coral fragments to enhance Caribbean coral reefs: A successful method but not a solution

Science.gov (United States)

Garrison, Virginia H.; Ward, Greg A.

2012-01-01

In response to dramatic losses of reef-building corals and ongoing lack of recovery, a small-scale coral transplant project was initiated in the Caribbean (U.S. Virgin Islands) in 1999 and was followed for 12 years. The primary objectives were to (1) identify a source of coral colonies for transplantation that would not result in damage to reefs, (2) test the feasibility of transplanting storm-generated coral fragments, and (3) develop a simple, inexpensive method for transplanting fragments that could be conducted by the local community.  The ultimate goal was to enhance abundance of threatened reef-building species on local reefs.  Storm-produced coral fragments of two threatened reef-building species [Acropora palmata and A. cervicornis (Acroporidae)] and another fast-growing species [Porites porites (Poritidae)] were collected from environments hostile to coral fragment survival and transplanted to degraded reefs.  Inert nylon cable ties were used to attach transplanted coral fragments to dead coral substrate.  Survival of 75 reference colonies and 60 transplants was assessed over 12 years. Only 9% of colonies were alive after 12 years: no A. cervicornis; 3% of A. palmata transplants and 18% of reference colonies; and 13% of P. porites transplants and 7% of reference colonies. Mortality rates for all species were high and were similar for transplant and reference colonies. Physical dislodgement resulted in the loss of 56% of colonies, whereas 35% died in place.  Only A. palmata showed a difference between transplant and reference colony survival and that was in the first year only.  Location was a factor in survival only for A. palmata reference colonies and after year 10.  Even though the tested methods and concepts were proven effective in the field over the 12-year study, they do not present a solution. No coral conservation strategy will be effective until underlying intrinsic and/or extrinsic factors driving high mortality rates are

Gene Prediction in Metagenomic Fragments with Deep Learning

Directory of Open Access Journals (Sweden)

Shao-Wu Zhang

2017-01-01

Full Text Available Next generation sequencing technologies used in metagenomics yield numerous sequencing fragments which come from thousands of different species. Accurately identifying genes from metagenomics fragments is one of the most fundamental issues in metagenomics. In this article, by fusing multifeatures (i.e., monocodon usage, monoamino acid usage, ORF length coverage, and Z-curve features and using deep stacking networks learning model, we present a novel method (called Meta-MFDL to predict the metagenomic genes. The results with 10 CV and independent tests show that Meta-MFDL is a powerful tool for identifying genes from metagenomic fragments.

Limestone fragmentation and attrition during fluidized bed oxyfiring

Energy Technology Data Exchange (ETDEWEB)

Fabrizio Scala; Piero Salatino [Istituto di Ricerche sulla Combustione - CNR, Napoli (Italy)

2010-04-15

Attrition/fragmentation of limestone under simulated fluidized bed oxyfiring conditions was investigated by means of an experimental protocol that had been previously developed for characterization of attrition/fragmentation of sorbents in air-blown atmospheric fluidized bed combustors. The protocol was based on the use of different and mutually complementary techniques. The extent and pattern of attrition by surface wear in the dense phase of a fluidized bed were assessed in experiments carried out with a bench scale fluidized bed combustor under simulated oxyfiring conditions. Sorbent samples generated during simulated oxyfiring tests were further characterized from the standpoint of fragmentation upon high velocity impact by means of a purposely designed particle impactor. Results showed that under calcination-hindered conditions attrition and fragmentation patterns are much different from those occurring under air-blown atmospheric combustion conditions. Noteworthy, attrition/fragmentation enhanced particle sulfation by continuously regenerating the exposed particle surface. 13 refs., 8 figs.

Route to three-dimensional fragments using diversity-oriented synthesis.

Science.gov (United States)

Hung, Alvin W; Ramek, Alex; Wang, Yikai; Kaya, Taner; Wilson, J Anthony; Clemons, Paul A; Young, Damian W

2011-04-26

Fragment-based drug discovery (FBDD) has proven to be an effective means of producing high-quality chemical ligands as starting points for drug-discovery pursuits. The increasing number of clinical candidate drugs developed using FBDD approaches is a testament of the efficacy of this approach. The success of fragment-based methods is highly dependent on the identity of the fragment library used for screening. The vast majority of FBDD has centered on the use of sp(2)-rich aromatic compounds. An expanded set of fragments that possess more 3D character would provide access to a larger chemical space of fragments than those currently used. Diversity-oriented synthesis (DOS) aims to efficiently generate a set of molecules diverse in skeletal and stereochemical properties. Molecules derived from DOS have also displayed significant success in the modulation of function of various "difficult" targets. Herein, we describe the application of DOS toward the construction of a unique set of fragments containing highly sp(3)-rich skeletons for fragment-based screening. Using cheminformatic analysis, we quantified the shapes and physical properties of the new 3D fragments and compared them with a database containing known fragment-like molecules.

Generation of human antibody fragments against Streptococcus mutans using a phage display chain shuffling approach

Directory of Open Access Journals (Sweden)

Barth Stefan

2005-01-01

Full Text Available Abstract Background Common oral diseases and dental caries can be prevented effectively by passive immunization. In humans, passive immunotherapy may require the use of humanized or human antibodies to prevent adverse immune responses against murine epitopes. Therefore we generated human single chain and diabody antibody derivatives based on the binding characteristics of the murine monoclonal antibody Guy's 13. The murine form of this antibody has been used successfully to prevent Streptococcus mutans colonization and the development of dental caries in non-human primates, and to prevent bacterial colonization in human clinical trials. Results The antibody derivatives were generated using a chain-shuffling approach based on human antibody variable gene phage-display libraries. Like the parent antibody, these derivatives bound specifically to SAI/II, the surface adhesin of the oral pathogen S. mutans. Conclusions Humanization of murine antibodies can be easily achieved using phage display libraries. The human antibody fragments bind the antigen as well as the causative agent of dental caries. In addition the human diabody derivative is capable of aggregating S. mutans in vitro, making it a useful candidate passive immunotherapeutic agent for oral diseases.

Baculovirus display of functional antibody Fab fragments.

Science.gov (United States)

Takada, Shinya; Ogawa, Takafumi; Matsui, Kazusa; Suzuki, Tasuku; Katsuda, Tomohisa; Yamaji, Hideki

2015-08-01

The generation of a recombinant baculovirus that displays antibody Fab fragments on the surface was investigated. A recombinant baculovirus was engineered so that the heavy chain (Hc; Fd fragment) of a mouse Fab fragment was expressed as a fusion to the N-terminus of baculovirus gp64, while the light chain of the Fab fragment was simultaneously expressed as a secretory protein. Following infection of Sf9 insect cells with the recombinant baculovirus, the culture supernatant was analyzed by enzyme-linked immunosorbent assay using antigen-coated microplates and either an anti-mouse IgG or an anti-gp64 antibody. A relatively strong signal was obtained in each case, showing antigen-binding activity in the culture supernatant. In western blot analysis of the culture supernatant using the anti-gp64 antibody, specific protein bands were detected at an electrophoretic mobility that coincided with the molecular weight of the Hc-gp64 fusion protein as well as that of gp64. Flow cytometry using a fluorescein isothiocyanate-conjugated antibody specific to mouse IgG successfully detected the Fab fragments on the surface of the Sf9 cells. These results suggest that immunologically functional antibody Fab fragments can be displayed on the surface of baculovirus particles, and that a fluorescence-activated cell sorter with a fluorescence-labeled antigen can isolate baculoviruses displaying specific Fab fragments. This successful baculovirus display of antibody Fab fragments may offer a novel approach for the efficient selection of specific antibodies.

Molecular markers. Amplified fragment length polymorphism

Directory of Open Access Journals (Sweden)

Pržulj Novo

2005-01-01

Full Text Available Amplified Fragment Length Polymorphism molecular markers (AFLPs has been developed combining procedures of RFLPs and RAPDs molekular markers, i.e. the first step is restriction digestion of the genomic DNA that is followed by selective amplification of the restricted fragments. The advantage of the AFLP technique is that it allows rapid generation of a large number of reproducible markers. The reproducibility of AFLPs markers is assured by the use of restriction site-specific adapters and adapter-specific primers for PCR reaction. Only fragments containing the restriction site sequence plus the additional nucleotides will be amplified and the more selected nucleotides added on the primer sequence the fewer the number of fragments amplified by PCR. The amplified products are normally separated on a sequencing gel and visualized after exposure to X-ray film or by using fluorescent labeled primers. AFLP shave proven to be extremely proficient in revealing diversity at below the species level. A disadvantage of AFLP technique is that AFLPs are essentially a dominant marker system and not able to identify heterozygotes.

Nonlinear transient responses of beams and rings to impulse loading or fragment impact

International Nuclear Information System (INIS)

Witmer, E.A.; Stagliano, T.R.; Rodal, J.J.A.

1977-01-01

Nuclear power plant protective structures may be subjected to various external missiles such as aircraft and tornado-generated missiles: telephone poles, planks, pipes, rods, automobiles, and other blown vehicles. Also, 'internally-generated missiles' such as fragments from powerplant rotors and aircraft engine rotors may impact protective structures. The present paper is concerned with a very limited part of the cited fragment threat; namely, fragments from high speed rotating machinery such as (1) aircraft engine rotors and (2) stationary power plant turbine rotors. Further, it is assumed that the structures intended to contain or control these fragments consist of initially-isotopic elastic-plastic metals. Certain potential containment/control (C/C) structures behave in a planar (or two-dimensional) fashion while other fragment-attacked C/C structures will undergo general three-dimensional deformations. Predictions for only the former category of fragment-attacked structures are discussed in the present paper. Pertinent experimental data discussed on fragment-attacked structures include (a) steel-sphere impact data involving beam targets and (b) engine rotor fragment impact against a steel containment ring. In all of these cases large-deflection, elastic-plastic transient structural responses occur. (Auth.)

Scission configurations and their implication in fission-fragment angular momenta

International Nuclear Information System (INIS)

Bonneau, L.; Quentin, P.; Mikhailov, I. N.

2007-01-01

The generation of sizable angular momenta in fragments formed in low-energy nuclear fission is described microscopically within the general quantum-mechanical framework of orientation pumping due to the Heisenberg uncertainty principle. Within this framework, we make use of the results of Skyrme-Hartree-Fock plus BCS-pairing calculations of fragment deformabilities to deduce a distribution of fission-fragment spins as a function of the fragment total excitation energy. We consider a fragmentation corresponding to a pair of deformed fragments and for which fission data are available. The properties of the scission configurations determine to a large extent the fission-fragment spins. This is why we pay particular attention to quantitatively defining the scission configurations and to studying the various implications of such a specific choice. A fair qualitative agreement with data is demonstrated and discussed within the limits of the simple scission-configuration model used here

Ternary-fragmentation-driving potential energies of 252Cf

Science.gov (United States)

Karthikraj, C.; Ren, Zhongzhou

2017-12-01

Within the framework of a simple macroscopic model, the ternary-fragmentation-driving potential energies of 252Cf are studied. In this work, all possible ternary-fragment combinations of 252Cf are generated by the use of atomic mass evaluation-2016 (AME2016) data and these combinations are minimized by using a two-dimensional minimization approach. This minimization process can be done in two ways: (i) with respect to proton numbers (Z1, Z2, Z3) and (ii) with respect to neutron numbers (N1, N2, N3) of the ternary fragments. In this paper, the driving potential energies for the ternary breakup of 252Cf are presented for both the spherical and deformed as well as the proton-minimized and neutron-minimized ternary fragments. From the proton-minimized spherical ternary fragments, we have obtained different possible ternary configurations with a minimum driving potential, in particular, the experimental expectation of Sn + Ni + Ca ternary fragmentation. However, the neutron-minimized ternary fragments exhibit a driving potential minimum in the true-ternary-fission (TTF) region as well. Further, the Q -value energy systematics of the neutron-minimized ternary fragments show larger values for the TTF fragments. From this, we have concluded that the TTF region fragments with the least driving potential and high Q values have a strong possibility in the ternary fragmentation of 252Cf. Further, the role of ground-state deformations (β2, β3, β4, and β6) in the ternary breakup of 252Cf is also studied. The deformed ternary fragmentation, which involves Z3=12 -19 fragments, possesses the driving potential minimum due to the larger oblate deformations. We also found that the ground-state deformations, particularly β2, strongly influence the driving potential energies and play a major role in determining the most probable fragment combinations in the ternary breakup of 252Cf.

The power to detect recent fragmentation events using genetic differentiation methods.

Directory of Open Access Journals (Sweden)

Michael W Lloyd

Full Text Available Habitat loss and fragmentation are imminent threats to biological diversity worldwide and thus are fundamental issues in conservation biology. Increased isolation alone has been implicated as a driver of negative impacts in populations associated with fragmented landscapes. Genetic monitoring and the use of measures of genetic divergence have been proposed as means to detect changes in landscape connectivity. Our goal was to evaluate the sensitivity of Wright's F st, Hedrick' G'st , Sherwin's MI, and Jost's D to recent fragmentation events across a range of population sizes and sampling regimes. We constructed an individual-based model, which used a factorial design to compare effects of varying population size, presence or absence of overlapping generations, and presence or absence of population sub-structuring. Increases in population size, overlapping generations, and population sub-structuring each reduced F st, G'st , MI, and D. The signal of fragmentation was detected within two generations for all metrics. However, the magnitude of the change in each was small in all cases, and when N e was >100 individuals it was extremely small. Multi-generational sampling and population estimates are required to differentiate the signal of background divergence from changes in Fst , G'st , MI, and D associated with fragmentation. Finally, the window during which rapid change in Fst , G'st , MI, and D between generations occurs can be small, and if missed would lead to inconclusive results. For these reasons, use of F st, G'st , MI, or D for detecting and monitoring changes in connectivity is likely to prove difficult in real-world scenarios. We advocate use of genetic monitoring only in conjunction with estimates of actual movement among patches such that one could compare current movement with the genetic signature of past movement to determine there has been a change.

Fragment-to-Lead Medicinal Chemistry Publications in 2015.

Science.gov (United States)

Johnson, Christopher N; Erlanson, Daniel A; Murray, Christopher W; Rees, David C

2017-01-12

Fragment-based drug discovery (FBDD) is now well-established as a technology for generating new chemical leads and drugs. This Miniperspective provides a tabulated overview of the fragment-to-lead literature published in the year 2015, together with a commentary on trends observed across the FBDD field during this time. It is hoped that this tabulated summary will provide a useful point of reference for both FBDD practitioners and the wider medicinal chemistry community.

Virtual screening filters for the design of type II p38 MAP kinase inhibitors: a fragment based library generation approach.

Science.gov (United States)

Badrinarayan, Preethi; Sastry, G Narahari

2012-04-01

In this work, we introduce the development and application of a three-step scoring and filtering procedure for the design of type II p38 MAP kinase leads using allosteric fragments extracted from virtual screening hits. The design of the virtual screening filters is based on a thorough evaluation of docking methods, DFG-loop conformation, binding interactions and chemotype specificity of the 138 p38 MAP kinase inhibitors from Protein Data Bank bound to DFG-in and DFG-out conformations using Glide, GOLD and CDOCKER. A 40 ns molecular dynamics simulation with the apo, type I with DFG-in and type II with DFG-out forms was carried out to delineate the effects of structural variations on inhibitor binding. The designed docking-score and sub-structure filters were first tested on a dataset of 249 potent p38 MAP kinase inhibitors from seven diverse series and 18,842 kinase inhibitors from PDB, to gauge their capacity to discriminate between kinase and non-kinase inhibitors and likewise to selectively filter-in target-specific inhibitors. The designed filters were then applied in the virtual screening of a database of ten million (10⁷) compounds resulting in the identification of 100 hits. Based on their binding modes, 98 allosteric fragments were extracted from the hits and a fragment library was generated. New type II p38 MAP kinase leads were designed by tailoring the existing type I ATP site binders with allosteric fragments using a common urea linker. Target specific virtual screening filters can thus be easily developed for other kinases based on this strategy to retrieve target selective compounds. Copyright © 2012 Elsevier Inc. All rights reserved.

Timeframe Dependent Fragment Ions Observed in In-Source Decay Experiments with β-Casein Using MALDI MS.

Science.gov (United States)

Sekiya, Sadanori; Nagoshi, Keishiro; Iwamoto, Shinichi; Tanaka, Koichi; Takayama, Mitsuo

2015-09-01

The fragment ions observed with time-of-flight (TOF) and quadrupole ion trap (QIT) TOF mass spectrometers (MS) combined with matrix-assisted laser desorption/ionization in-source decay (MALDI-ISD) experiments of phosphorylated analytes β-casein and its model peptide were compared from the standpoint of the residence timeframe of analyte and fragment ions in the MALDI ion source and QIT cell. The QIT-TOF MS gave fragment c-, z'-, z-ANL, y-, and b-ions, and further degraded fragments originating from the loss of neutrals such as H(2)O, NH(3), CH(2)O (from serine), C2H4O (from threonine), and H(3)PO(4), whereas the TOF MS merely showed MALDI source-generated fragment c-, z'-, z-ANL, y-, and w-ions. The fragment ions observed in the QIT-TOF MS could be explained by the injection of the source-generated ions into the QIT cell or a cooperative effect of a little internal energy deposition, a long residence timeframe (140 ms) in the QIT cell, and specific amino acid effects on low-energy CID, whereas the source-generated fragments (c-, z'-, z-ANL, y-, and w-ions) could be a result of prompt radical-initiated fragmentation of hydrogen-abundant radical ions [M + H + H](+) and [M + H - H](-) within the 53 ns timeframe, which corresponds to the delayed extraction time. The further degraded fragment b/y-ions produced in the QIT cell were confirmed by positive- and negative-ion low-energy CID experiments performed on the source-generated ions (c-, z'-, and y-ions). The loss of phosphoric acid (98 u) from analyte and fragment ions can be explained by a slow ergodic fragmentation independent of positive and negative charges.

Timeframe Dependent Fragment Ions Observed in In-Source Decay Experiments with β-Casein Using MALDI MS

Science.gov (United States)

Sekiya, Sadanori; Nagoshi, Keishiro; Iwamoto, Shinichi; Tanaka, Koichi; Takayama, Mitsuo

2015-09-01

The fragment ions observed with time-of-flight (TOF) and quadrupole ion trap (QIT) TOF mass spectrometers (MS) combined with matrix-assisted laser desorption/ionization in-source decay (MALDI-ISD) experiments of phosphorylated analytes β-casein and its model peptide were compared from the standpoint of the residence timeframe of analyte and fragment ions in the MALDI ion source and QIT cell. The QIT-TOF MS gave fragment c-, z'-, z-ANL, y-, and b-ions, and further degraded fragments originating from the loss of neutrals such as H2O, NH3, CH2O (from serine), C2H4O (from threonine), and H3PO4, whereas the TOF MS merely showed MALDI source-generated fragment c-, z'-, z-ANL, y-, and w-ions. The fragment ions observed in the QIT-TOF MS could be explained by the injection of the source-generated ions into the QIT cell or a cooperative effect of a little internal energy deposition, a long residence timeframe (140 ms) in the QIT cell, and specific amino acid effects on low-energy CID, whereas the source-generated fragments (c-, z'-, z-ANL, y-, and w-ions) could be a result of prompt radical-initiated fragmentation of hydrogen-abundant radical ions [M + H + H]+ and [M + H - H]- within the 53 ns timeframe, which corresponds to the delayed extraction time. The further degraded fragment b/y-ions produced in the QIT cell were confirmed by positive- and negative-ion low-energy CID experiments performed on the source-generated ions (c-, z'-, and y-ions). The loss of phosphoric acid (98 u) from analyte and fragment ions can be explained by a slow ergodic fragmentation independent of positive and negative charges.

Fuel fragmentation data review and separate effects testing

International Nuclear Information System (INIS)

Yueh, Ken. H.; Snis, N.; Mitchell, D.; Munoz-Reja, C.

2014-01-01

A simple alternative test has been developed to study the fuel fragmentation process at loss of coolant accident (LOCA) temperatures. The new test heats a short section of fuel, approximately two pellets worth of material, in a tube furnace open to air. An axial slit is cut in the test sample cladding to reduce radial restraint and to simulate ballooned condition. The tube furnace allows the fuel fragmentation process be observed during the experiment. The test was developed as a simple alternative so large number of tests could be conducted quickly and efficiently to identify key variables that influence fuel fragmentation and to zeroing on the fuel fragmentation burn-up threshold. Several tests were conducted, using fuel materials from fuel rods that were used in earlier integral tests to benchmark and validate the test technique. High burn-up fuel materials known to be above the fragmentation threshold was used to evaluate the fragmentation process as a function of temperature. Even with an axial slit and both ends open, no significant fuel detachment/release was detected until above 750°C. Additional tests were conducted with fuel materials at burn-ups closer to the fuel fragmentation burn-up threshold. Results from these tests indicate a minor power history effect on the fuel fragmentation burn-up threshold. An evaluation of available literature and data generated from this work suggest a fuel fragmentation burn-up threshold between 70 and 75 GWd/MTU. (author)

Experiences in fragment-based drug discovery.

Science.gov (United States)

Murray, Christopher W; Verdonk, Marcel L; Rees, David C

2012-05-01

Fragment-based drug discovery (FBDD) has become established in both industry and academia as an alternative approach to high-throughput screening for the generation of chemical leads for drug targets. In FBDD, specialised detection methods are used to identify small chemical compounds (fragments) that bind to the drug target, and structural biology is usually employed to establish their binding mode and to facilitate their optimisation. In this article, we present three recent and successful case histories in FBDD. We then re-examine the key concepts and challenges of FBDD with particular emphasis on recent literature and our own experience from a substantial number of FBDD applications. Our opinion is that careful application of FBDD is living up to its promise of delivering high quality leads with good physical properties and that in future many drug molecules will be derived from fragment-based approaches. Copyright © 2012 Elsevier Ltd. All rights reserved.

A linear relationship between crystal size and fragment binding time observed crystallographically: implications for fragment library screening using acoustic droplet ejection.

Directory of Open Access Journals (Sweden)

Krystal Cole

Full Text Available High throughput screening technologies such as acoustic droplet ejection (ADE greatly increase the rate at which X-ray diffraction data can be acquired from crystals. One promising high throughput screening application of ADE is to rapidly combine protein crystals with fragment libraries. In this approach, each fragment soaks into a protein crystal either directly on data collection media or on a moving conveyor belt which then delivers the crystals to the X-ray beam. By simultaneously handling multiple crystals combined with fragment specimens, these techniques relax the automounter duty-cycle bottleneck that currently prevents optimal exploitation of third generation synchrotrons. Two factors limit the speed and scope of projects that are suitable for fragment screening using techniques such as ADE. Firstly, in applications where the high throughput screening apparatus is located inside the X-ray station (such as the conveyor belt system described above, the speed of data acquisition is limited by the time required for each fragment to soak into its protein crystal. Secondly, in applications where crystals are combined with fragments directly on data acquisition media (including both of the ADE methods described above, the maximum time that fragments have to soak into crystals is limited by evaporative dehydration of the protein crystals during the fragment soak. Here we demonstrate that both of these problems can be minimized by using small crystals, because the soak time required for a fragment hit to attain high occupancy depends approximately linearly on crystal size.

A probabilistic fragment-based protein structure prediction algorithm.

Directory of Open Access Journals (Sweden)

David Simoncini

Full Text Available Conformational sampling is one of the bottlenecks in fragment-based protein structure prediction approaches. They generally start with a coarse-grained optimization where mainchain atoms and centroids of side chains are considered, followed by a fine-grained optimization with an all-atom representation of proteins. It is during this coarse-grained phase that fragment-based methods sample intensely the conformational space. If the native-like region is sampled more, the accuracy of the final all-atom predictions may be improved accordingly. In this work we present EdaFold, a new method for fragment-based protein structure prediction based on an Estimation of Distribution Algorithm. Fragment-based approaches build protein models by assembling short fragments from known protein structures. Whereas the probability mass functions over the fragment libraries are uniform in the usual case, we propose an algorithm that learns from previously generated decoys and steers the search toward native-like regions. A comparison with Rosetta AbInitio protocol shows that EdaFold is able to generate models with lower energies and to enhance the percentage of near-native coarse-grained decoys on a benchmark of [Formula: see text] proteins. The best coarse-grained models produced by both methods were refined into all-atom models and used in molecular replacement. All atom decoys produced out of EdaFold's decoy set reach high enough accuracy to solve the crystallographic phase problem by molecular replacement for some test proteins. EdaFold showed a higher success rate in molecular replacement when compared to Rosetta. Our study suggests that improving low resolution coarse-grained decoys allows computational methods to avoid subsequent sampling issues during all-atom refinement and to produce better all-atom models. EdaFold can be downloaded from http://www.riken.jp/zhangiru/software.html [corrected].

Critical Features of Fragment Libraries for Protein Structure Prediction.

Science.gov (United States)

Trevizani, Raphael; Custódio, Fábio Lima; Dos Santos, Karina Baptista; Dardenne, Laurent Emmanuel

2017-01-01

The use of fragment libraries is a popular approach among protein structure prediction methods and has proven to substantially improve the quality of predicted structures. However, some vital aspects of a fragment library that influence the accuracy of modeling a native structure remain to be determined. This study investigates some of these features. Particularly, we analyze the effect of using secondary structure prediction guiding fragments selection, different fragments sizes and the effect of structural clustering of fragments within libraries. To have a clearer view of how these factors affect protein structure prediction, we isolated the process of model building by fragment assembly from some common limitations associated with prediction methods, e.g., imprecise energy functions and optimization algorithms, by employing an exact structure-based objective function under a greedy algorithm. Our results indicate that shorter fragments reproduce the native structure more accurately than the longer. Libraries composed of multiple fragment lengths generate even better structures, where longer fragments show to be more useful at the beginning of the simulations. The use of many different fragment sizes shows little improvement when compared to predictions carried out with libraries that comprise only three different fragment sizes. Models obtained from libraries built using only sequence similarity are, on average, better than those built with a secondary structure prediction bias. However, we found that the use of secondary structure prediction allows greater reduction of the search space, which is invaluable for prediction methods. The results of this study can be critical guidelines for the use of fragment libraries in protein structure prediction.

Sideward peak of intermediate mass fragments in high energy proton induced reactions

International Nuclear Information System (INIS)

Ohnishi, A.; Hirata, Y.; Otuka, N.; Nara, Y.; Kido, T.; Maruyama, T.; Takada, H.; Chiba, S.

2002-01-01

We study the sideward enhanced IMF emission mechanism by using a combined framework of a transport model (JAM/MF) and a newly developed Non-Equilibrium Percolation (NEP) model. We find that the sideward enhancement may emerge if the fragmentation takes place within a short time scale around 20 fm/c. Within this short time period, the un-heated part of the residual nucleus is kept to have doughnut shape, then the Coulomb repulsion from this shape strengthens the sideward emission of IMFs. (author)

ACFIS: a web server for fragment-based drug discovery

Science.gov (United States)

Hao, Ge-Fei; Jiang, Wen; Ye, Yuan-Nong; Wu, Feng-Xu; Zhu, Xiao-Lei; Guo, Feng-Biao; Yang, Guang-Fu

2016-01-01

In order to foster innovation and improve the effectiveness of drug discovery, there is a considerable interest in exploring unknown ‘chemical space’ to identify new bioactive compounds with novel and diverse scaffolds. Hence, fragment-based drug discovery (FBDD) was developed rapidly due to its advanced expansive search for ‘chemical space’, which can lead to a higher hit rate and ligand efficiency (LE). However, computational screening of fragments is always hampered by the promiscuous binding model. In this study, we developed a new web server Auto Core Fragment in silico Screening (ACFIS). It includes three computational modules, PARA_GEN, CORE_GEN and CAND_GEN. ACFIS can generate core fragment structure from the active molecule using fragment deconstruction analysis and perform in silico screening by growing fragments to the junction of core fragment structure. An integrated energy calculation rapidly identifies which fragments fit the binding site of a protein. We constructed a simple interface to enable users to view top-ranking molecules in 2D and the binding mode in 3D for further experimental exploration. This makes the ACFIS a highly valuable tool for drug discovery. The ACFIS web server is free and open to all users at http://chemyang.ccnu.edu.cn/ccb/server/ACFIS/. PMID:27150808

Fragment-based approaches to the discovery of kinase inhibitors.

Science.gov (United States)

Mortenson, Paul N; Berdini, Valerio; O'Reilly, Marc

2014-01-01

Protein kinases are one of the most important families of drug targets, and aberrant kinase activity has been linked to a large number of disease areas. Although eminently targetable using small molecules, kinases present a number of challenges as drug targets, not least obtaining selectivity across such a large and relatively closely related target family. Fragment-based drug discovery involves screening simple, low-molecular weight compounds to generate initial hits against a target. These hits are then optimized to more potent compounds via medicinal chemistry, usually facilitated by structural biology. Here, we will present a number of recent examples of fragment-based approaches to the discovery of kinase inhibitors, detailing the construction of fragment-screening libraries, the identification and validation of fragment hits, and their optimization into potent and selective lead compounds. The advantages of fragment-based methodologies will be discussed, along with some of the challenges associated with using this route. Finally, we will present a number of key lessons derived both from our own experience running fragment screens against kinases and from a large number of published studies.

Effective progression of nuclear magnetic resonance-detected fragment hits.

Science.gov (United States)

Eaton, Hugh L; Wyss, Daniel F

2011-01-01

Fragment-based drug discovery (FBDD) has become increasingly popular over the last decade as an alternate lead generation tool to HTS approaches. Several compounds have now progressed into the clinic which originated from a fragment-based approach, demonstrating the utility of this emerging field. While fragment hit identification has become much more routine and may involve different screening approaches, the efficient progression of fragment hits into quality lead series may still present a major bottleneck for the broadly successful application of FBDD. In our laboratory, we have extensive experience in fragment-based NMR screening (SbN) and the subsequent iterative progression of fragment hits using structure-assisted chemistry. To maximize impact, we have applied this approach strategically to early- and high-priority targets, and those struggling for leads. Its application has yielded a clinical candidate for BACE1 and lead series in about one third of the SbN/FBDD projects. In this chapter, we will give an overview of our strategy and focus our discussion on NMR-based FBDD approaches. Copyright © 2011 Elsevier Inc. All rights reserved.

Computational Fragment-Based Drug Design: Current Trends, Strategies, and Applications.

Science.gov (United States)

Bian, Yuemin; Xie, Xiang-Qun Sean

2018-04-09

Fragment-based drug design (FBDD) has become an effective methodology for drug development for decades. Successful applications of this strategy brought both opportunities and challenges to the field of Pharmaceutical Science. Recent progress in the computational fragment-based drug design provide an additional approach for future research in a time- and labor-efficient manner. Combining multiple in silico methodologies, computational FBDD possesses flexibilities on fragment library selection, protein model generation, and fragments/compounds docking mode prediction. These characteristics provide computational FBDD superiority in designing novel and potential compounds for a certain target. The purpose of this review is to discuss the latest advances, ranging from commonly used strategies to novel concepts and technologies in computational fragment-based drug design. Particularly, in this review, specifications and advantages are compared between experimental and computational FBDD, and additionally, limitations and future prospective are discussed and emphasized.

Discovery of potent, reversible MetAP2 inhibitors via fragment based drug discovery and structure based drug design-Part 1.

Science.gov (United States)

Cheruvallath, Zacharia; Tang, Mingnam; McBride, Christopher; Komandla, Mallareddy; Miura, Joanne; Ton-Nu, Thu; Erikson, Phil; Feng, Jun; Farrell, Pamela; Lawson, J David; Vanderpool, Darin; Wu, Yiqin; Dougan, Douglas R; Plonowski, Artur; Holub, Corine; Larson, Chris

2016-06-15

Methionine aminopeptidase 2 (MetAP2) is an enzyme that cleaves an N-terminal methionine residue from a number of newly synthesized proteins. Pre-clinical and clinical studies suggest that MetAP2 inhibitors could be used as a novel treatment for obesity. Herein we describe our use of fragment screening methods and structural biology to quickly identify and elaborate an indazole fragment into a series of reversible MetAP2 inhibitors with <10nM potency, excellent selectivity, and favorable in vitro safety profiles. Copyright © 2016 Elsevier Ltd. All rights reserved.

Competition and fragmentation: a simple model generating lognormal-like distributions

International Nuclear Information System (INIS)

Schwaemmle, V; Queiros, S M D; Brigatti, E; Tchumatchenko, T

2009-01-01

The current distribution of language size in terms of speaker population is generally described using a lognormal distribution. Analyzing the original real data we show how the double-Pareto lognormal distribution can give an alternative fit that indicates the existence of a power law tail. A simple Monte Carlo model is constructed based on the processes of competition and fragmentation. The results reproduce the power law tails of the real distribution well and give better results for a poorly connected topology of interactions.

ACFIS: a web server for fragment-based drug discovery.

Science.gov (United States)

Hao, Ge-Fei; Jiang, Wen; Ye, Yuan-Nong; Wu, Feng-Xu; Zhu, Xiao-Lei; Guo, Feng-Biao; Yang, Guang-Fu

2016-07-08

In order to foster innovation and improve the effectiveness of drug discovery, there is a considerable interest in exploring unknown 'chemical space' to identify new bioactive compounds with novel and diverse scaffolds. Hence, fragment-based drug discovery (FBDD) was developed rapidly due to its advanced expansive search for 'chemical space', which can lead to a higher hit rate and ligand efficiency (LE). However, computational screening of fragments is always hampered by the promiscuous binding model. In this study, we developed a new web server Auto Core Fragment in silico Screening (ACFIS). It includes three computational modules, PARA_GEN, CORE_GEN and CAND_GEN. ACFIS can generate core fragment structure from the active molecule using fragment deconstruction analysis and perform in silico screening by growing fragments to the junction of core fragment structure. An integrated energy calculation rapidly identifies which fragments fit the binding site of a protein. We constructed a simple interface to enable users to view top-ranking molecules in 2D and the binding mode in 3D for further experimental exploration. This makes the ACFIS a highly valuable tool for drug discovery. The ACFIS web server is free and open to all users at http://chemyang.ccnu.edu.cn/ccb/server/ACFIS/. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

Novel fragmentation model for pulverized coal particles gasification in low temperature air thermal plasma

Directory of Open Access Journals (Sweden)

Jovanović Rastko D.

2016-01-01

Full Text Available New system for start-up and flame support based on coal gasification by low temperature air thermal plasma is planned to supplement current heavy oil system in Serbian thermal power plants in order to decrease air pollutions emission and operational costs. Locally introduced plasma thermal energy heats up and ignites entrained coal particles, thus starting chain process which releases heat energy from gasified coal particles inside burner channel. Important stages during particle combustion, such as particle devolatilisation and char combustion, are described with satisfying accuracy in existing commercial CFD codes that are extensively used as powerful tool for pulverized coal combustion and gasification modeling. However, during plasma coal gasification, high plasma temperature induces strong thermal stresses inside interacting coal particles. These stresses lead to “thermal shock” and extensive particle fragmentation during which coal particles with initial size of 50-100 m disintegrate into fragments of at most 5-10 m. This intensifies volatile release by a factor 3-4 and substantially accelerates the oxidation of combustible matter. Particle fragmentation, due to its small size and thus limited influence on combustion process is commonly neglected in modelling. The main focus of this work is to suggest novel approach to pulverized coal gasification under high temperature conditions and to implement it into commercial comprehensive code ANSYS FLUENT 14.0. Proposed model was validated against experimental data obtained in newly built pilot scale D.C plasma burner test facility. Newly developed model showed very good agreement with experimental results with relative error less than 10%, while the standard built-in gasification model had error up to 25%.

Evolutions in fragment-based drug design: the deconstruction–reconstruction approach

Science.gov (United States)

Chen, Haijun; Zhou, Xiaobin; Wang, Ailan; Zheng, Yunquan; Gao, Yu; Zhou, Jia

2014-01-01

Recent advances in the understanding of molecular recognition and protein–ligand interactions have facilitated rapid development of potent and selective ligands for therapeutically relevant targets. Over the past two decades, a variety of useful approaches and emerging techniques have been developed to promote the identification and optimization of leads that have high potential for generating new therapeutic agents. Intriguingly, the innovation of a fragment-based drug design (FBDD) approach has enabled rapid and efficient progress in drug discovery. In this critical review, we focus on the construction of fragment libraries and the advantages and disadvantages of various fragment-based screening (FBS) for constructing such libraries. We also highlight the deconstruction–reconstruction strategy by utilizing privileged fragments of reported ligands. PMID:25263697

Storm-generated coral fragments - A viable source of transplants for reef rehabilitation

Science.gov (United States)

Garrison, V.; Ward, G.

2008-01-01

Coral reefs throughout the world have been damaged by storms, diseases, coral predators, temperature anomalies, and human activities. During the past three decades, recovery has been limited and patchy. Although a damaged coral reef cannot be restored to its original condition, interest in reef restoration is increasing. In a pilot project in the Caribbean (US Virgin Islands), storm-produced fragments of Acropora palmata, A. cervicornis, and Porites porites were collected from donor reefs and transplanted to nearby degraded reefs. Sixty coral fragments were attached to dead-coral substrate (usually A. palmata skeletons), at similar depths from which they had been collected (1-3.5 m), using nylon cable ties. Seventy-five intact colonies were designated as controls. Study colonies were assessed at 6-month intervals for 2 years (1999-2001) and annually thereafter (through 2004). One-fourth of the 135 colonies and fragments monitored were alive at the conclusion of the 5-year study. Survival of control and transplanted A. cervicornis and P. porites was very low (median survival 2.4 and 1.8 years, respectively), with no significant differences between transplant and control colonies. Site and depth did not contribute significantly to A. palmata colony survival, but colony size and transplant/control status did. Probability of survival increased with colony size. Median survival for A. palmata was 1.3 years for transplant and 4.3 years for natural colonies when not controlled for size. A. palmata was the only viable candidate for reef rehabilitation. Storm swells were the primary cause of mortality.

Jet fragmentation

International Nuclear Information System (INIS)

Saxon, D.H.

1985-10-01

The paper reviews studies on jet fragmentation. The subject is discussed under the topic headings: fragmentation models, charged particle multiplicity, bose-einstein correlations, identified hadrons in jets, heavy quark fragmentation, baryon production, gluon and quark jets compared, the string effect, and two successful models. (U.K.)

Efficient Double Fragmentation ChIP-seq Provides Nucleotide Resolution Protein-DNA Binding Profiles

NARCIS (Netherlands)

Mokry, Michal; Hatzis, Pantelis; de Bruijn, Ewart; Koster, Jan; Versteeg, Rogier; Schuijers, Jurian; van de Wetering, Marc; Guryev, Victor; Clevers, Hans; Cuppen, Edwin

2010-01-01

Immunoprecipitated crosslinked protein-DNA fragments typically range in size from several hundred to several thousand base pairs, with a significant part of chromatin being much longer than the optimal length for next-generation sequencing (NGS) procedures. Because these larger fragments may be

Newly synthesized bis-benzimidazole compound 8 induces apoptosis, autophagy and reactive oxygen species generation in HeLa cells.

Science.gov (United States)

Chu, Naying; Yao, Guodong; Liu, Yuan; Cheng, Maosheng; Ikejima, Takashi

2016-09-01

Compound 8 (C8) is a newly synthesized bis-benzimidazole derivative and exerts significant anti-tumor activity in vitro. Previous studies demonstrated that C8 induced apoptosis and autophagy in human promyelocytic leukemia HL60 cells. However, cytotoxicity study on human peripheral blood mononuclear cells (hPBMC) showed that C8 exhibited less toxicity in normal cells. In this study, the molecular mechanism of C8 on human cervical carcinoma HeLa cells was investigated. The results showed that C8 inhibited the growth of HeLa cells and triggered both apoptotic and autophagic cell death. Subsequent experiment also indicated that reactive oxygen species (ROS) generation was induced in C8-treated HeLa cells. Since ROS scavenger decreased the ratio of apoptotic and autophagic cells, ROS generation contributed to C8-induced apoptosis and autophagy. Furthermore, inhibitors of apoptosis and autophagy also reduced ROS generation, respectively. Autophagy inhibition increased cell growth compared to C8-treated group and attenuated apoptotic cell death, indicating that C8-induced autophagy promoted apoptosis for cell death. However, the percentage of autophagic cells was enhanced when limiting apoptosis process. Taken together, C8 induced ROS-mediated apoptosis and autophagy in HeLa cells, autophagy promoted apoptosis but the former was antagonized by the latter. The data also gave us a new perspective on the anti-tumor effect of C8. Copyright © 2016 Elsevier Ltd. All rights reserved.

Missing Fragments: Detecting Cooperative Binding in Fragment-Based Drug Design

Science.gov (United States)

2012-01-01

The aim of fragment-based drug design (FBDD) is to identify molecular fragments that bind to alternate subsites within a given binding pocket leading to cooperative binding when linked. In this study, the binding of fragments to human phenylethanolamine N-methyltransferase is used to illustrate how (a) current protocols may fail to detect fragments that bind cooperatively, (b) theoretical approaches can be used to validate potential hits, and (c) apparent false positives obtained when screening against cocktails of fragments may in fact indicate promising leads. PMID:24900472

PCNA acts as a stationary loading platform for transiently interacting Okazaki fragment maturation proteins

Science.gov (United States)

Sporbert, Anje; Domaing, Petra; Leonhardt, Heinrich; Cardoso, M. Cristina

2005-01-01

In DNA replication, the leading strand is synthesized continuously, but lagging strand synthesis requires the complex, discontinuous synthesis of Okazaki fragments, and their subsequent joining. We have used a combination of in situ extraction and dual color photobleaching to compare the dynamic properties of three proteins essential for lagging strand synthesis: the polymerase clamp proliferating cell nuclear antigen (PCNA) and two proteins that bind to it, DNA Ligase I and Fen1. All three proteins are localized at replication foci (RF), but in contrast to PCNA, Ligase and Fen1 were readily extracted. Dual photobleaching combined with time overlays revealed a rapid exchange of Ligase and Fen1 at RF, which is consistent with de novo loading at every Okazaki fragment, while the slow recovery of PCNA mostly occurred at adjacent, newly assembled RF. These data indicate that PCNA works as a stationary loading platform that is reused for multiple Okazaki fragments, while PCNA binding proteins only transiently associate and are not stable components of the replication machinery. PMID:15972794

Mass distribution law of systems of protocluster fragments

Energy Technology Data Exchange (ETDEWEB)

Ferraioli, F; Virgopia, N [Rome Univ. (Italy). Ist. di Matematica

1979-02-01

Starting from the hypothesis of coalescence through inelastic collisions of small fast moving interstellar gas clouds, an attempt has been made to study the evolutionary mass distribution of a system of fragments simulating a protocluster. The assumption of a mass spectrum with a continuous injection of newly formed entities into the primeval system, and the condition of gravitational reduction of the impact cross-section, have been considered. Comparisons of numerical experiments with the mass spectrum in some well-known young galactic clusters, confirm the mass distribution power-law already obtained by other authors. The empirical Schmidt's law concerning the rate of star formation is also confirmed. The hypothesis of the universal validity of the luminosity function, should not be 'a priori' rejected.

Fragmentation characteristics of the unstable [CH3 CO][radical sign] radicals generated by neutralization of [CH3CO]+ cations

Science.gov (United States)

Hop, C. E. C. A.; Holmes, J. L.

1991-03-01

The stability and fragmentation characteristics of [CH3 CO][radical sign] radicals, generated by vertical charge exchange between acetyl cations and permanent gases or metal vapours (He, Xe, NO, Cd, Na and K), were examined mass spectrometrically. Two dissociation reactions were observed, the losses of CH[radical sign]3 and H[radical sign]. The H[radical sign] loss reaction, the higher energy dissociation, became of greater importance as the exothermicity of the charge exchange was increased. Based on the analysis of the kinetic energy releases it was concluded that these decompositions arose from the population of two excited states of the [CH3 CO][radical sign] radical.

Sub-fragmentation of structural-reactive-material casings under explosion

Science.gov (United States)

Zhang, Fan

2015-06-01

The sub-fragmentation of structural reactive material (SRM) thick-casings is to generate fine fragments during casing fragmentation under explosive loading for their efficient energy release to enhance air blast. This has been investigated using a cylindrical casing made from either rich Al-MoO3 or Al-W-based granular composites. The former composite was to study the concept of reactive hot spots where the reaction of reactive particles, which were distributed into base SRM in a fuel-rich equivalence ratio, created heat and gas products during SRM fragmentation. The expansion of these distributed hot spots initiated local fractures of the casing, leading to fine fragments. The Al-W-based composite investigated the concept of impedance mismatch, where shock dynamics at the interfaces of different impedance ingredients resulted in non-uniform, high local temperatures and stresses and late in times the dissimilar inertia resulted in different accelerations, leading to material separation and fine fragments. The casings were manufactured through both hot iso-static pressing and cold gas dynamic spray deposition. Explosion experiments were conducted in a 3 m diameter, 23 m3 cylindrical chamber for these cased charges in a casing-to-explosive mass ratio of 1.75. The results demonstrated the presence of fine fragments and more efficient fragment combustion, compared with previous results, and indicated the effectiveness of both concepts. This work was jointly funded by Defence R&D Canada and the Advanced Energetics Program of DTRA (Dr. William H. Wilson).

Fast and Efficient Fragment-Based Lead Generation by Fully Automated Processing and Analysis of Ligand-Observed NMR Binding Data.

Science.gov (United States)

Peng, Chen; Frommlet, Alexandra; Perez, Manuel; Cobas, Carlos; Blechschmidt, Anke; Dominguez, Santiago; Lingel, Andreas

2016-04-14

NMR binding assays are routinely applied in hit finding and validation during early stages of drug discovery, particularly for fragment-based lead generation. To this end, compound libraries are screened by ligand-observed NMR experiments such as STD, T1ρ, and CPMG to identify molecules interacting with a target. The analysis of a high number of complex spectra is performed largely manually and therefore represents a limiting step in hit generation campaigns. Here we report a novel integrated computational procedure that processes and analyzes ligand-observed proton and fluorine NMR binding data in a fully automated fashion. A performance evaluation comparing automated and manual analysis results on (19)F- and (1)H-detected data sets shows that the program delivers robust, high-confidence hit lists in a fraction of the time needed for manual analysis and greatly facilitates visual inspection of the associated NMR spectra. These features enable considerably higher throughput, the assessment of larger libraries, and shorter turn-around times.

Structures of endothiapepsin-fragment complexes from crystallographic fragment screening using a novel, diverse and affordable 96-compound fragment library.

Science.gov (United States)

Huschmann, Franziska U; Linnik, Janina; Sparta, Karine; Ühlein, Monika; Wang, Xiaojie; Metz, Alexander; Schiebel, Johannes; Heine, Andreas; Klebe, Gerhard; Weiss, Manfred S; Mueller, Uwe

2016-05-01

Crystallographic screening of the binding of small organic compounds (termed fragments) to proteins is increasingly important for medicinal chemistry-oriented drug discovery. To enable such experiments in a widespread manner, an affordable 96-compound library has been assembled for fragment screening in both academia and industry. The library is selected from already existing protein-ligand structures and is characterized by a broad ligand diversity, including buffer ingredients, carbohydrates, nucleotides, amino acids, peptide-like fragments and various drug-like organic compounds. When applied to the model protease endothiapepsin in a crystallographic screening experiment, a hit rate of nearly 10% was obtained. In comparison to other fragment libraries and considering that no pre-screening was performed, this hit rate is remarkably high. This demonstrates the general suitability of the selected compounds for an initial fragment-screening campaign. The library composition, experimental considerations and time requirements for a complete crystallographic fragment-screening campaign are discussed as well as the nine fully refined obtained endothiapepsin-fragment structures. While most of the fragments bind close to the catalytic centre of endothiapepsin in poses that have been observed previously, two fragments address new sites on the protein surface. ITC measurements show that the fragments bind to endothiapepsin with millimolar affinity.

Structures of endothiapepsin–fragment complexes from crystallographic fragment screening using a novel, diverse and affordable 96-compound fragment library

Science.gov (United States)

Huschmann, Franziska U.; Linnik, Janina; Sparta, Karine; Ühlein, Monika; Wang, Xiaojie; Metz, Alexander; Schiebel, Johannes; Heine, Andreas; Klebe, Gerhard; Weiss, Manfred S.; Mueller, Uwe

2016-01-01

Crystallographic screening of the binding of small organic compounds (termed fragments) to proteins is increasingly important for medicinal chemistry-oriented drug discovery. To enable such experiments in a widespread manner, an affordable 96-compound library has been assembled for fragment screening in both academia and industry. The library is selected from already existing protein–ligand structures and is characterized by a broad ligand diversity, including buffer ingredients, carbohydrates, nucleotides, amino acids, peptide-like fragments and various drug-like organic compounds. When applied to the model protease endothiapepsin in a crystallographic screening experiment, a hit rate of nearly 10% was obtained. In comparison to other fragment libraries and considering that no pre-screening was performed, this hit rate is remarkably high. This demonstrates the general suitability of the selected compounds for an initial fragment-screening campaign. The library composition, experimental considerations and time requirements for a complete crystallographic fragment-screening campaign are discussed as well as the nine fully refined obtained endothiapepsin–fragment structures. While most of the fragments bind close to the catalytic centre of endothiapepsin in poses that have been observed previously, two fragments address new sites on the protein surface. ITC measurements show that the fragments bind to endothiapepsin with millimolar affinity. PMID:27139825

Newly-graduated midwives transcending barriers: a grounded theory study.

Science.gov (United States)

Barry, Michele J; Hauck, Yvonne L; O'Donoghue, Thomas; Clarke, Simon

2013-12-01

Midwifery has developed its own philosophy to formalise its unique identity as a profession. Newly-graduated midwives are taught, and ideally embrace, this philosophy during their education. However, embarking in their career within a predominantly institutionalised and the medically focused health-care model may challenge this application. The research question guiding this study was as follows: 'How do newly graduated midwives deal with applying the philosophy of midwifery in their first six months of practice?' The aim was to generate a grounded theory around this social process. This Western Australian grounded theory study is conceptualised within the social theory of symbolic interactionism. Data were collected by means of in-depth, semi-structured interviews with 11 recent midwifery graduates. Participant and interviewer's journals provided supplementary data. The 'constant comparison' approach was used for data analysis. The substantive theory of transcending barriers was generated. Three stages in transcending barriers were identified: Addressing personal attributes, Understanding the 'bigger picture', and finally, 'Evaluating, planning and acting' to provide woman-centred care. An overview of these three stages provides the focus of this article. The theory of transcending barriers provides a new perspective on how newly-graduated midwives deal with applying the philosophy of midwifery in their first six months of practice. A number of implications for pre and post registration midwifery education and policy development are suggested, as well as recommendations for future research. Copyright © 2013 Elsevier Ltd. All rights reserved.

Towards a population synthesis model of self-gravitating disc fragmentation and tidal downsizing II: the effect of fragment-fragment interactions

Science.gov (United States)

Forgan, D. H.; Hall, C.; Meru, F.; Rice, W. K. M.

2018-03-01

It is likely that most protostellar systems undergo a brief phase where the protostellar disc is self-gravitating. If these discs are prone to fragmentation, then they are able to rapidly form objects that are initially of several Jupiter masses and larger. The fate of these disc fragments (and the fate of planetary bodies formed afterwards via core accretion) depends sensitively not only on the fragment's interaction with the disc, but also with its neighbouring fragments. We return to and revise our population synthesis model of self-gravitating disc fragmentation and tidal downsizing. Amongst other improvements, the model now directly incorporates fragment-fragment interactions while the disc is still present. We find that fragment-fragment scattering dominates the orbital evolution, even when we enforce rapid migration and inefficient gap formation. Compared to our previous model, we see a small increase in the number of terrestrial-type objects being formed, although their survival under tidal evolution is at best unclear. We also see evidence for disrupted fragments with evolved grain populations - this is circumstantial evidence for the formation of planetesimal belts, a phenomenon not seen in runs where fragment-fragment interactions are ignored. In spite of intense dynamical evolution, our population is dominated by massive giant planets and brown dwarfs at large semimajor axis, which direct imaging surveys should, but only rarely, detect. Finally, disc fragmentation is shown to be an efficient manufacturer of free-floating planetary mass objects, and the typical multiplicity of systems formed via gravitational instability will be low.

General-Purpose Heat Source development: Safety Verification Test Program. Bullet/fragment test series

Energy Technology Data Exchange (ETDEWEB)

George, T.G.; Tate, R.E.; Axler, K.M.

1985-05-01

The radioisotope thermoelectric generator (RTG) that will provide power for space missions contains 18 General-Purpose Heat Source (GPHS) modules. Each module contains four /sup 238/PuO/sub 2/-fueled clads and generates 250 W/sub (t)/. Because a launch-pad or post-launch explosion is always possible, we need to determine the ability of GPHS fueled clads within a module to survive fragment impact. The bullet/fragment test series, part of the Safety Verification Test Plan, was designed to provide information on clad response to impact by a compact, high-energy, aluminum-alloy fragment and to establish a threshold value of fragment energy required to breach the iridium cladding. Test results show that a velocity of 555 m/s (1820 ft/s) with an 18-g bullet is at or near the threshold value of fragment velocity that will cause a clad breach. Results also show that an exothermic Ir/Al reaction occurs if aluminum and hot iridium are in contact, a contact that is possible and most damaging to the clad within a narrow velocity range. The observed reactions between the iridium and the aluminum were studied in the laboratory and are reported in the Appendix.

Study of the dynamic fragmentation of laser shock-loaded metallic target

International Nuclear Information System (INIS)

Lescoute, E.

2010-01-01

The irradiation of a metallic target by a high power laser pulse induces a shock wave in the material. Under some conditions, it leads to the production of high velocity ejecta which can damage the optical environment (lenses, mirrors, windows, etc.). With the ongoing development of high energy laser facilities designed to achieve inertial confinement fusion, such as the Laser MegaJoule in France or the National Ignition Facility in the USA, the question of debris ejection from metallic samples subjected to intense laser irradiation has become a key issue. It is necessary to understand fragmentation processes induced by laser shock, and to anticipate and quantify generated fragments, in order to design suitable protections and experiments, and to preserve laser facilities. The main fragmentation processes which can occur in a laser-shock-loaded metallic target and generate high velocity ejecta are: (i) micro-jetting, which occurs upon reflection of the incident compressive front from the free surface, (ii) spallation, which is due to the later interaction of the release wave reflected from that surface with the incident unloading wave and (iii) dynamic punching of thin targets. Experimental campaigns have been performed on high energy laser facilities in the Centre d'Etudes Scientifiques et Techniques d'Aquitaine (CESTA, CEA, Alise facility) and in the Laboratoire pour l'Utilisation des Lasers Intenses (LULI, Ecole Polytechnique, LULI 2000 facility). Gold and aluminium have been mainly studied because they are the two main metallic components of the target which will be used to achieved the inertial confinement fusion. Specific diagnostics have been developed and used during these experiments to study the dynamic fragmentation: transverse shadowgraphy, free surface velocity measurement and recovery of generated fragments. Experimental results have been compared with numerical predictions obtained with a bi-dimensional hydrodynamic code, where a specific numerical

Universal elements of fragmentation

International Nuclear Information System (INIS)

Yanovsky, V. V.; Tur, A. V.; Kuklina, O. V.

2010-01-01

A fragmentation theory is proposed that explains the universal asymptotic behavior of the fragment-size distribution in the large-size range, based on simple physical principles. The basic principles of the theory are the total mass conservation in a fragmentation process and a balance condition for the energy expended in increasing the surface of fragments during their breakup. A flux-based approach is used that makes it possible to supplement the basic principles and develop a minimal theory of fragmentation. Such a supplementary principle is that of decreasing fragment-volume flux with increasing energy expended in fragmentation. It is shown that the behavior of the decreasing flux is directly related to the form of a power-law fragment-size distribution. The minimal theory is used to find universal asymptotic fragment-size distributions and to develop a natural physical classification of fragmentation models. A more general, nonlinear theory of strong fragmentation is also developed. It is demonstrated that solutions to a nonlinear kinetic equation consistent with both basic principles approach a universal asymptotic size distribution. Agreement between the predicted asymptotic fragment-size distributions and experimental observations is discussed.

Newly graduated nurses' use of knowledge sources: a meta-ethnography.

Science.gov (United States)

Voldbjerg, Siri Lygum; Grønkjaer, Mette; Sørensen, Erik Elgaard; Hall, Elisabeth O C

2016-08-01

To advance evidence on newly graduated nurses' use of knowledge sources. Clinical decisions need to be evidence-based and understanding the knowledge sources that newly graduated nurses use will inform both education and practice. Qualitative studies on newly graduated nurses' use of knowledge sources are increasing though generated from scattered healthcare contexts. Therefore, a metasynthesis of qualitative research on what knowledge sources new graduates use in decision-making was conducted. Meta-ethnography. Nineteen reports, representing 17 studies, published from 2000-2014 were identified from iterative searches in relevant databases from May 2013-May 2014. Included reports were appraised for quality and Noblit and Hare's meta-ethnography guided the interpretation and synthesis of data. Newly graduated nurses' use of knowledge sources during their first 2-year postgraduation were interpreted in the main theme 'self and others as knowledge sources,' with two subthemes 'doing and following' and 'knowing and doing,' each with several elucidating categories. The metasynthesis revealed a line of argument among the report findings underscoring progression in knowledge use and perception of competence and confidence among newly graduated nurses. The transition phase, feeling of confidence and ability to use critical thinking and reflection, has a great impact on knowledge sources incorporated in clinical decisions. The synthesis accentuates that for use of newly graduated nurses' qualifications and skills in evidence-based practice, clinical practice needs to provide a supportive environment which nurtures critical thinking and questions and articulates use of multiple knowledge sources. © 2016 John Wiley & Sons Ltd.

High dispersal in a frog species suggests that it is vulnerable to habitat fragmentation

OpenAIRE

Funk, W. Chris; Greene, Allison E; Corn, Paul Stephen; Allendorf, Fred W

2005-01-01

Global losses of amphibian populations are a major conservation concern and their causes have generated substantial debate. Habitat fragmentation is considered one important cause of amphibian decline. However, if fragmentation is to be invoked as a mechanism of amphibian decline, it must first be established that dispersal is prevalent among contiguous amphibian populations using formal movement estimators. In contrast, if dispersal is naturally low in amphibians, fragmentation can be disreg...

Gas-phase structure and fragmentation pathways of singly protonated peptides with N-terminal arginine.

Science.gov (United States)

Bythell, Benjamin J; Csonka, István P; Suhai, Sándor; Barofsky, Douglas F; Paizs, Béla

2010-11-25

The gas-phase structures and fragmentation pathways of the singly protonated peptide arginylglycylaspartic acid (RGD) are investigated by means of collision-induced-dissociation (CID) and detailed molecular mechanics and density functional theory (DFT) calculations. It is demonstrated that despite the ionizing proton being strongly sequestered at the guanidine group, protonated RGD can easily be fragmented on charge directed fragmentation pathways. This is due to facile mobilization of the C-terminal or aspartic acid COOH protons thereby generating salt-bridge (SB) stabilized structures. These SB intermediates can directly fragment to generate b(2) ions or facilely rearrange to form anhydrides from which both b(2) and b(2)+H(2)O fragments can be formed. The salt-bridge stabilized and anhydride transition structures (TSs) necessary to form b(2) and b(2)+H(2)O are much lower in energy than their traditional charge solvated counterparts. These mechanisms provide compelling evidence of the role of SB and anhydride structures in protonated peptide fragmentation which complements and supports our recent findings for tryptic systems (Bythell, B. J.; Suhai, S.; Somogyi, A.; Paizs, B. J. Am. Chem. Soc. 2009, 131, 14057-14065.). In addition to these findings we also report on the mechanisms for the formation of the b(1) ion, neutral loss (H(2)O, NH(3), guanidine) fragment ions, and the d(3) ion.

Fragmentation of random trees

International Nuclear Information System (INIS)

Kalay, Z; Ben-Naim, E

2015-01-01

We study fragmentation of a random recursive tree into a forest by repeated removal of nodes. The initial tree consists of N nodes and it is generated by sequential addition of nodes with each new node attaching to a randomly-selected existing node. As nodes are removed from the tree, one at a time, the tree dissolves into an ensemble of separate trees, namely, a forest. We study statistical properties of trees and nodes in this heterogeneous forest, and find that the fraction of remaining nodes m characterizes the system in the limit N→∞. We obtain analytically the size density ϕ s of trees of size s. The size density has power-law tail ϕ s ∼s −α with exponent α=1+(1/m). Therefore, the tail becomes steeper as further nodes are removed, and the fragmentation process is unusual in that exponent α increases continuously with time. We also extend our analysis to the case where nodes are added as well as removed, and obtain the asymptotic size density for growing trees. (paper)

Incidence of cavitation in the fragmentation process of extracorporeal shock wave lithotriptors

Science.gov (United States)

Rink, K.; Delacrétaz, G.; Pittomvils, G.; Boving, R.; Lafaut, J. P.

1994-05-01

The fragmentation mechanism occurring in extracorporeal shock wave lithotripsy (ESWL) is investigated using a fiber optic stress sensing technique. With our technique, we demonstrate that cavitation is a major cause of fragmentation in ESWL procedures. When a target is placed in the operating area of the lithotriptor, two shock waves are detected. The first detected shock wave corresponds to the incoming shock wave generated by the lithotriptor. The second shock wave, detected some hundreds of microseconds later, is generated in situ. It results from the collapse of a cavitation bubble, formed by the reflection of the incoming shock wave at the target boundary. This cavitation induced shock wave generates the largest stress in the target area according to our stress sensing measurements.

Metagenome Fragment Classification Using -Mer Frequency Profiles

Directory of Open Access Journals (Sweden)

Gail Rosen

2008-01-01

Full Text Available A vast amount of microbial sequencing data is being generated through large-scale projects in ecology, agriculture, and human health. Efficient high-throughput methods are needed to analyze the mass amounts of metagenomic data, all DNA present in an environmental sample. A major obstacle in metagenomics is the inability to obtain accuracy using technology that yields short reads. We construct the unique -mer frequency profiles of 635 microbial genomes publicly available as of February 2008. These profiles are used to train a naive Bayes classifier (NBC that can be used to identify the genome of any fragment. We show that our method is comparable to BLAST for small 25 bp fragments but does not have the ambiguity of BLAST's tied top scores. We demonstrate that this approach is scalable to identify any fragment from hundreds of genomes. It also performs quite well at the strain, species, and genera levels and achieves strain resolution despite classifying ubiquitous genomic fragments (gene and nongene regions. Cross-validation analysis demonstrates that species-accuracy achieves 90% for highly-represented species containing an average of 8 strains. We demonstrate that such a tool can be used on the Sargasso Sea dataset, and our analysis shows that NBC can be further enhanced.

Influence of Pore Characteristics on the Fate and Distribution of Newly Added Carbon

Directory of Open Access Journals (Sweden)

Michelle Y. Quigley

2018-06-01

Full Text Available Pores create a transportation network within a soil matrix, which controls the flow of air, water, and movement of microorganisms. The flow of air, water, and movement of microbes, in turn, control soil carbon dynamics. Computed microtomography (μCT allows for the visualization of pore structure at micron scale, but quantitative information on contribution of pores to the fate and protection of soil carbon, essential for modeling, is still lacking. This study uses the natural difference between carbon isotopes of C3 and C4 plants to determine how the presence of pores of different sizes affects spatial distribution patterns of newly added carbon immediately after plant termination and then after 1-month incubation. We considered two contrasting soil structure scenarios: soil with the structure kept intact and soil for which the structure was destroyed via sieving. For the experiment, soil was collected from 0–15 cm depth at a 20-year continuous maize (Zea mays L., C4 plant experiment into which cereal rye (Secale cereale L., C3 plant was planted. Intact soil fragments (5–6 mm were procured after 3 months rye growth in a greenhouse. Pore characteristics of the fragments were determined through μCT imaging. Each fragment was sectioned and total carbon, total nitrogen, δ13C, and δ15N were measured. The results indicate that, prior to incubation, greater presence of 40–90 μm pores was associated with higher levels of C3 carbon, pointing to the positive role of these pores in transport of new C inputs. Nevertheless, after incubation, the association became negative, indicating greater losses of newly added C in such pores. These trends were statistically significant in destroyed-structure soil and numerical in intact-structure soil. In soils of intact-structures, after incubation, higher levels of total carbon were associated with greater abundance of 6.5–15 and 15–40 μm pores, indicating a lower carbon loss associated with these

Detection of secondary binding sites in proteins using fragment screening.

Science.gov (United States)

Ludlow, R Frederick; Verdonk, Marcel L; Saini, Harpreet K; Tickle, Ian J; Jhoti, Harren

2015-12-29

Proteins need to be tightly regulated as they control biological processes in most normal cellular functions. The precise mechanisms of regulation are rarely completely understood but can involve binding of endogenous ligands and/or partner proteins at specific locations on a protein that can modulate function. Often, these additional secondary binding sites appear separate to the primary binding site, which, for example for an enzyme, may bind a substrate. In previous work, we have uncovered several examples in which secondary binding sites were discovered on proteins using fragment screening approaches. In each case, we were able to establish that the newly identified secondary binding site was biologically relevant as it was able to modulate function by the binding of a small molecule. In this study, we investigate how often secondary binding sites are located on proteins by analyzing 24 protein targets for which we have performed a fragment screen using X-ray crystallography. Our analysis shows that, surprisingly, the majority of proteins contain secondary binding sites based on their ability to bind fragments. Furthermore, sequence analysis of these previously unknown sites indicate high conservation, which suggests that they may have a biological function, perhaps via an allosteric mechanism. Comparing the physicochemical properties of the secondary sites with known primary ligand binding sites also shows broad similarities indicating that many of the secondary sites may be druggable in nature with small molecules that could provide new opportunities to modulate potential therapeutic targets.

Detection of prosecretory mitogen lacritin in nonprimate tears primarily as a C-terminal-like fragment.

Science.gov (United States)

Laurie, Diane E; Splan, Rebecca K; Green, Kari; Still, Katherine M; McKown, Robert L; Laurie, Gordon W

2012-09-12

Lacritin is a human tear glycoprotein that promotes basal tear protein secretion in cultured rat lacrimal acinar cells and proliferation of subconfluent human corneal epithelial cells. When topically added to rabbit eyes, lacritin promotes basal tearing. Despite these activities on several species, lacritin's presence in nonprimate tears or other tissues has not been explored. Here we probed for lacritin in normal horse tears. Sequences were collected from the Ensembl genomic alignment of human LACRT gene with high-quality draft horse genome (EquCab2.0) and analyzed. Normal horse tears were collected and assayed by Western blotting, ELISA, and mass spectrometry. Newly generated rabbit antibodies, respectively, against N- and C-terminal regions of human lacritin were employed. Identity was 75% and 45%, respectively, at nucleotide and protein levels. Structural features were conserved, including a C-terminal amphipathic α-helix. Anti-C-terminal antibodies strongly detected a ∼13 kDa band in horse tears that was validated by mass spectrometry. In human tears, the same antibody detected uncleaved lacritin (∼24 kDa) strongly and C-terminal fragments of ∼13 and ∼11 kDa weakly. Anti-N-terminal antibodies were slightly reactive with a ∼24 kDa horse antigen and showed no reaction with the anti-C-terminal-reactive ∼13 kDa species. Similar respective levels of horse C-terminal versus N-terminal immunoreactivity were apparent by ELISA. Lacritin is present in horse tears, largely as a C-terminal fragment homologous to the mitogenic and bactericidal region in human lacritin, suggesting potential benefit in corneal wound repair.

Fragment growing and linking lead to novel nanomolar lactate dehydrogenase inhibitors.

Science.gov (United States)

Kohlmann, Anna; Zech, Stephan G; Li, Feng; Zhou, Tianjun; Squillace, Rachel M; Commodore, Lois; Greenfield, Matthew T; Lu, Xiaohui; Miller, David P; Huang, Wei-Sheng; Qi, Jiwei; Thomas, R Mathew; Wang, Yihan; Zhang, Sen; Dodd, Rory; Liu, Shuangying; Xu, Rongsong; Xu, Yongjin; Miret, Juan J; Rivera, Victor; Clackson, Tim; Shakespeare, William C; Zhu, Xiaotian; Dalgarno, David C

2013-02-14

Lactate dehydrogenase A (LDH-A) catalyzes the interconversion of lactate and pyruvate in the glycolysis pathway. Cancer cells rely heavily on glycolysis instead of oxidative phosphorylation to generate ATP, a phenomenon known as the Warburg effect. The inhibition of LDH-A by small molecules is therefore of interest for potential cancer treatments. We describe the identification and optimization of LDH-A inhibitors by fragment-based drug discovery. We applied ligand based NMR screening to identify low affinity fragments binding to LDH-A. The dissociation constants (K(d)) and enzyme inhibition (IC(50)) of fragment hits were measured by surface plasmon resonance (SPR) and enzyme assays, respectively. The binding modes of selected fragments were investigated by X-ray crystallography. Fragment growing and linking, followed by chemical optimization, resulted in nanomolar LDH-A inhibitors that demonstrated stoichiometric binding to LDH-A. Selected molecules inhibited lactate production in cells, suggesting target-specific inhibition in cancer cell lines.

Metastable decay of photoionized niobium clusters: Evaporation vs fission fragmentation

International Nuclear Information System (INIS)

Cole, S.K.; Liu, K.; Riley, S.J.

1986-01-01

The metastable decay of photoionized niobium clusters (Nb/sub n/ + ) has been observed in a newly constructed cluster beam machine. The decay manifests itself in the time-of-flight (TOF) mass spectrum as an asymmetric broadening of daughter ion peaks. Pulsed ion extraction has been used to measure the decay rate constants and to establish the mechanism of the fragmentation, evaporation and/or fission of the photoionized clusters. It is found that within the experimental time window evaporation dominates for the smaller clusters (n 6 sec -1 . The average kinetic energy release is also determined and is found to be on the order of 5 MeV. 8 refs., 3 figs., 1 tab

Fragmentation cross sections outside the limiting-fragmentation regime

CERN Document Server

Sümmerer, K

2003-01-01

The empirical parametrization of fragmentation cross sections, EPAX, has been successfully applied to estimate fragment production cross sections in reactions of heavy ions at high incident energies. It is checked whether a similar parametrization can be found for proton-induced spallation around 1 GeV, the range of interest for ISOL-type RIB facilities. The validity of EPAX for medium-energy heavy-ion induced reactions is also checked. Only a few datasets are available, but in general EPAX predicts the cross sections rather well, except for fragments close to the projectile, where the experimental cross sections are found to be larger.

Commissioning the A1900 projectile fragment separator

CERN Document Server

Morrissey, D J; Steiner, M; Stolz, A; Wiedenhöver, I

2003-01-01

An important part of the recent upgrade of the NSCL facility is the replacement of the A1200 fragment separator with a new high acceptance device called the A1900. The design of the A1900 device represents a third generation projectile fragment separator (relative to the early work at LBL) as it is situated immediately after the primary accelerator, has a very large acceptance, a bending power significantly larger than that of the cyclotron and is constructed from large superconducting magnets (quadrupoles with 20 and 40 cm diameter warm bores). The A1900 can accept over 90% of a large range of projectile fragmentation products produced at the NSCL, leading to large gains in the intensity of the secondary beams. The results of initial tests of the system with a restricted momentum acceptance (+-0.5%) indicate that the A1900 is performing up to specifications. Further large gains in the intensities of primary beams, typically two or three orders of magnitude, will be possible as the many facets of high current...

Anomalous nuclear fragments

International Nuclear Information System (INIS)

Karmanov, V.A.

1983-01-01

Experimental data are given, the status of anomalon problem is discussed, theoretical approaches to this problem are outlined. Anomalons are exotic objects formed following fragmentation of nuclei-targets under the effect of nuclei - a beam at the energy of several GeV/nucleon. These nuclear fragments have an anomalously large cross section of interaction and respectively, small free path, considerably shorter than primary nuclei have. The experimental daa are obtained in accelerators following irradiation of nuclear emulsions by 16 O, 56 Fe, 40 Ar beams, as well as propane by 12 C beams. The experimental data testify to dependence of fragment free path on the distance L from the point of the fragment formation. A decrease in the fragment free path is established more reliably than its dependence on L. The problem of the anomalon existence cannot be yet considered resolved. Theoretical models suggested for explanation of anomalously large cross sections of nuclear fragment interaction are variable and rather speculative

Neutronics and radiation field studies for the RIA fragmentation target area

Energy Technology Data Exchange (ETDEWEB)

Reyes, Susana [Lawrence Livermore National Laboratory, P.O. Box 808, L-446, Livermore, CA 94550 (United States)]. E-mail: reyes20@llnl.gov; Boles, Jason L. [Lawrence Livermore National Laboratory, P.O. Box 808, L-446, Livermore, CA 94550 (United States); Ahle, Larry E. [Lawrence Livermore National Laboratory, P.O. Box 808, L-446, Livermore, CA 94550 (United States); Stein, Werner [Lawrence Livermore National Laboratory, P.O. Box 808, L-446, Livermore, CA 94550 (United States)

2006-06-23

Neutronics simulations and activation evaluations are currently in progress as part of the pre-conceptual research and development effort for the Rare Isotope Accelerator (RIA). The RIA project involves generating heavy element ion beams with powers up to 400 kw for use in a fragmentation target line to produce selected ion beams for physics research experiments. Designing a fragmentation beam dump for RIA is one of the most critical challenges for such a facility. Here, we present the results from neutronics and radiation field assessments for various beam dump concepts that can meet requirements for the RIA fragmentation line. Preliminary results from heavy ion transport including radiation damage evaluations for the RIA fragmentation beam dump are also presented. Initial neutronics and activation studies will be incorporated with other target area considerations to identify important challenges and explore possible solutions.

Neutronics and radiation field studies for the RIA fragmentation target area

Science.gov (United States)

Reyes, Susana; Boles, Jason L.; Ahle, Larry E.; Stein, Werner

2006-06-01

Neutronics simulations and activation evaluations are currently in progress as part of the pre-conceptual research and development effort for the Rare Isotope Accelerator (RIA). The RIA project involves generating heavy element ion beams with powers up to 400 kW for use in a fragmentation target line to produce selected ion beams for physics research experiments. Designing a fragmentation beam dump for RIA is one of the most critical challenges for such a facility. Here, we present the results from neutronics and radiation field assessments for various beam dump concepts that can meet requirements for the RIA fragmentation line. Preliminary results from heavy ion transport including radiation damage evaluations for the RIA fragmentation beam dump are also presented. Initial neutronics and activation studies will be incorporated with other target area considerations to identify important challenges and explore possible solutions.

Mechanics of fragmentation of crocodile skin and other thin films

Science.gov (United States)

Qin, Zhao; Pugno, Nicola M.; Buehler, Markus J.

2014-01-01

Fragmentation of thin layers of materials is mediated by a network of cracks on its surface. It is commonly seen in dehydrated paintings or asphalt pavements and even in graphene or other two-dimensional materials, but is also observed in the characteristic polygonal pattern on a crocodile's head. Here, we build a simple mechanical model of a thin film and investigate the generation and development of fragmentation patterns as the material is exposed to various modes of deformation. We find that the characteristic size of fragmentation, defined by the mean diameter of polygons, is strictly governed by mechanical properties of the film material. Our result demonstrates that skin fragmentation on the head of crocodiles is dominated by that it features a small ratio between the fracture energy and Young's modulus, and the patterns agree well with experimental observations. Understanding this mechanics-driven process could be applied to improve the lifetime and reliability of thin film coatings by mimicking crocodile skin. PMID:24862190

Mechanics of fragmentation of crocodile skin and other thin films

Science.gov (United States)

Qin, Zhao; Pugno, Nicola M.; Buehler, Markus J.

2014-05-01

Fragmentation of thin layers of materials is mediated by a network of cracks on its surface. It is commonly seen in dehydrated paintings or asphalt pavements and even in graphene or other two-dimensional materials, but is also observed in the characteristic polygonal pattern on a crocodile's head. Here, we build a simple mechanical model of a thin film and investigate the generation and development of fragmentation patterns as the material is exposed to various modes of deformation. We find that the characteristic size of fragmentation, defined by the mean diameter of polygons, is strictly governed by mechanical properties of the film material. Our result demonstrates that skin fragmentation on the head of crocodiles is dominated by that it features a small ratio between the fracture energy and Young's modulus, and the patterns agree well with experimental observations. Understanding this mechanics-driven process could be applied to improve the lifetime and reliability of thin film coatings by mimicking crocodile skin.

The dynamical fate of self-gravitating disc fragments after tidal downsizing

Science.gov (United States)

Forgan, Duncan; Parker, Richard J.; Rice, Ken

2015-02-01

The gravitational instability model of planet/brown dwarf formation proposes that protostellar discs can fragment into objects with masses above a few Jupiter masses at large semimajor axis. Tidal downsizing may reduce both the object mass and semimajor axis. However, most studies of tidal downsizing end when the protostellar disc disperses, while the system is embedded in its parent star-forming region. To compare disc fragment descendants with exoplanet and brown dwarf observations, the subsequent dynamical evolution must be explored. We carry out N-body integrations of fragment-fragment scattering in multi-object star systems, and star systems embedded in substructured clusters. In both cases, we use initial conditions generated by population synthesis models of tidal downsizing. The scattering simulations produce a wide range of eccentricities. The ejection rate is around 25 per cent. The ejecta mass distribution is similar to that for all objects, with a velocity dispersion consistent with those produced by full hydrodynamic simulations. The semimajor axis distribution after scattering extends to parsec scales. In the cluster simulations, 13 per cent of the objects are ejected from their planetary system, and around 10 per cent experience significant orbit modification. A small number of objects are recaptured on high-eccentricity, high-inclination orbits. The velocity distribution of ejecta is similar to that produced by fragment-fragment scattering. If fragment-fragment scattering and cluster stripping act together, then disc fragmentation should be efficient at producing free-floating substellar objects, and hence characterizing the free-floating planet population will provide strong constraints on the frequency of disc fragmentation.

Correlations of intermediate mass fragments from Fe+Ta, Au, and Th collisions

International Nuclear Information System (INIS)

Sangster, T.C.; Begemann-Blaich, M.; Blaich, T.; Britt, H.C.; Hansen, L.F.; Namboodiri, M.N.; Peilert, G.

1995-01-01

Charge, velocity, and angular correlations between intermediate mass fragments (IMF) are presented for 50 and 100 MeV/nucleon Fe bombardments of Ta, Au, and Th targets. Correlation functions generated as a function of the relative velocity and the opening angle between two IMF's are qualitatively independent of the projectile energy and target mass and show a suppression at small relative velocities and opening angles due to the Coulomb repulsion between the fragments. The correlations are consistent with IMF's emitted primarily from a highly excited target residue following a rapid preequilibrium cascade. The correlation data are compared to model calculations using the event generator MENEKA and the quantum molecular dynamics (QMD) code with a statistical deexcitation of residual fragments utilizing the multifragmentation code SMM. All data are consistent with a simultaneous multifragmentation at a freeze-out density of 0.1--0.3 times normal nuclear matter density or a more sequential emission with time constant τ≤500 fm/c

De novo protein structure prediction by dynamic fragment assembly and conformational space annealing.

Science.gov (United States)

Lee, Juyong; Lee, Jinhyuk; Sasaki, Takeshi N; Sasai, Masaki; Seok, Chaok; Lee, Jooyoung

2011-08-01

Ab initio protein structure prediction is a challenging problem that requires both an accurate energetic representation of a protein structure and an efficient conformational sampling method for successful protein modeling. In this article, we present an ab initio structure prediction method which combines a recently suggested novel way of fragment assembly, dynamic fragment assembly (DFA) and conformational space annealing (CSA) algorithm. In DFA, model structures are scored by continuous functions constructed based on short- and long-range structural restraint information from a fragment library. Here, DFA is represented by the full-atom model by CHARMM with the addition of the empirical potential of DFIRE. The relative contributions between various energy terms are optimized using linear programming. The conformational sampling was carried out with CSA algorithm, which can find low energy conformations more efficiently than simulated annealing used in the existing DFA study. The newly introduced DFA energy function and CSA sampling algorithm are implemented into CHARMM. Test results on 30 small single-domain proteins and 13 template-free modeling targets of the 8th Critical Assessment of protein Structure Prediction show that the current method provides comparable and complementary prediction results to existing top methods. Copyright © 2011 Wiley-Liss, Inc.

Investigation on energetics of ex-vessel vapor explosion based on spontaneous nucleation fragmentation

International Nuclear Information System (INIS)

Liu, Jie; Koshizuka, Seiichi; Oka, Yoshiaki

2002-01-01

A computer code PROVER-I is developed for propagation phase of vapor explosion. A new thermal fragmentation model is proposed with three kinds of time scale for modeling instant fragmentation, spontaneous nucleation fragmentation and normal boiling fragmentation. The energetics of ex-vessel vapor explosion is investigated based on different fragmentation models. A higher pressure peak and a larger mechanical energy conversion ratio are obtained by spontaneous nucleation fragmentation. A smaller energy conversion ratio results from normal boiling fragmentation. When the delay time in thermal fragmentation model is near 0.0 ms, the pressure propagation behavior tends to be analogous with that in hydrodynamic fragmentation. If the delay time is longer, pressure attenuation occurs at the shock front. The high energy conversion ratio (>4%) is obtained in a small vapor volume fraction together with spontaneous nucleation fragmentation. These results are consistent with fuel-coolant interaction experiments with alumina melt. However, in larger vapor volume fraction conditions (α υ >0.3), the vapor explosion is weak. For corium melt, a coarse mixture with void fraction of more than 30% can be generated in the pre-mixing process because of its physical properties. In the mixture with such a high void fraction the energetic vapor explosion hardly takes place. (author)

Neo-Epitopes—Fragments of Cartilage and Connective Tissue Degradation in Early Rheumatoid Arthritis and Unclassified Arthritis

DEFF Research Database (Denmark)

Maijer, Karen I; Gudmann, Natasja Stæhr; Karsdal, Morten Asser

2016-01-01

Objective: Tissue destruction in rheumatoid arthritis (RA) is predominantly mediated by matrix metalloproteinases (MMPs), thereby generating protein fragments. Previous studies have revealed that these fragments include MMP-mediated collagen type I, II, and III degradation, citrullinated and MMP...

Generation of a panel of somatic cell hybrids containing unselected fragments of human chromosome 10 by X-ray irradiation and cell fusion: Application to isolating the MEN2A region in hybrid cells

International Nuclear Information System (INIS)

Goodfellow, P.J.; Povey, S.; Nevanlinna, H.A.; Goodfellow, P.N.

1990-01-01

We have used X-ray irradiation and cell fusion to generate somatic cell hybrids containing fragments of human chromosome 10. Our experiments were directed towards isolating the region of the MEN2A gene in hybrids and to use those as the source of DNA for cloning and mapping new markers from near the MEN2A locus. A number of hybrid clones containing human sequences that are tightly linked to the MEN2A gene were identified. Some 25% of our hybrids, however, proved to contain more than one human chromosome 10-derived fragment or showed evidence of deletions and/or rearrangements. A detailed analysis of the human content of X-ray irradiation hybrids is required to assess the integrity and number of human fragments retained. Despite retention of multiple human-derived fragments, these hybrids will prove useful as cloning and mapping resources

An Efficient Genome Fragment Assembling Using GA with Neighborhood Aware Fitness Function

Directory of Open Access Journals (Sweden)

Satoko Kikuchi

2012-01-01

Full Text Available To decode a long genome sequence, shotgun sequencing is the state-of-the-art technique. It needs to properly sequence a very large number, sometimes as large as millions, of short partially readable strings (fragments. Arranging those fragments in correct sequence is known as fragment assembling, which is an NP-problem. Presently used methods require enormous computational cost. In this work, we have shown how our modified genetic algorithm (GA could solve this problem efficiently. In the proposed GA, the length of the chromosome, which represents the volume of the search space, is reduced with advancing generations, and thereby improves search efficiency. We also introduced a greedy mutation, by swapping nearby fragments using some heuristics, to improve the fitness of chromosomes. We compared results with Parsons’ algorithm which is based on GA too. We used fragments with partial reads on both sides, mimicking fragments in real genome assembling process. In Parsons’ work base-pair array of the whole fragment is known. Even then, we could obtain much better results, and we succeeded in restructuring contigs covering 100% of the genome sequences.

Nuclear fragmentation

International Nuclear Information System (INIS)

Chung, K.C.

1989-01-01

An introduction to nuclear fragmentation, with emphasis in percolation ideas, is presented. The main theoretical models are discussed and as an application, the uniform expansion approximation is presented and the statistical multifragmentation model is used to calculate the fragment energy spectra. (L.C.)

Fragmentation of organic ions bearing fixed multiple charges observed in MALDI MS.

Science.gov (United States)

Lou, Xianwen; Li, Bao; de Waal, Bas F M; Schill, Jurgen; Baker, Matthew B; Bovee, Ralf A A; van Dongen, Joost L J; Milroy, Lech-Gustav; Meijer, E W

2018-01-01

Matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI TOF MS) was used to analyze a series of synthetic organic ions bearing fixed multiple charges. Despite the multiple intrinsic charges, only singly charged ions were recorded in each case. In addition to the pseudo-molecular ions formed by counterion adduction, deprotonation and electron capture, a number of fragment ions were also observed. Charge splitting by fragmentation was found to be a viable route for charge reduction leading to the formation of the observed singly charged fragment ions. Unlike multivalent metal ions, organic ions can rearrange and/or fragment during charge reduction. This fragmentation process will evidently complicate the interpretation of the MALDI MS spectrum. Because MALDI MS is usually considered as a soft ionization technique, the fragment ion peaks can easily be erroneously interpreted as impurities. Therefore, the awareness and understanding of the underlying MALDI-induced fragmentation pathways is essential for a proper interpretation of the corresponding mass spectra. Due to the fragment ions generated during charge reduction, special care should be taken in the MALDI MS analysis of multiply charged ions. In this work, the possible mechanisms by which the organic ions bearing fixed multiple charges fragment are investigated. With an improved understanding of the fragmentation mechanisms, MALDI TOF MS should still be a useful technique for the characterization of organic ions with fixed multiple charges. Copyright © 2017 John Wiley & Sons, Ltd.

Generation of “LYmph Node Derived Antibody Libraries” (LYNDAL) for selecting fully human antibody fragments with therapeutic potential.

Science.gov (United States)

Diebolder, Philipp; Keller, Armin; Haase, Stephanie; Schlegelmilch, Anne; Kiefer, Jonathan D; Karimi, Tamana; Weber, Tobias; Moldenhauer, Gerhard; Kehm, Roland; Eis-Hübinger, Anna M; Jäger, Dirk; Federspil, Philippe A; Herold-Mende, Christel; Dyckhoff, Gerhard; Kontermann, Roland E; Arndt, Michaela A E; Krauss, Jürgen

2014-01-01

The development of efficient strategies for generating fully human monoclonal antibodies with unique functional properties that are exploitable for tailored therapeutic interventions remains a major challenge in the antibody technology field. Here, we present a methodology for recovering such antibodies from antigen-encountered human B cell repertoires. As the source for variable antibody genes, we cloned immunoglobulin G (IgG)-derived B cell repertoires from lymph nodes of 20 individuals undergoing surgery for head and neck cancer. Sequence analysis of unselected “LYmph Node Derived Antibody Libraries” (LYNDAL) revealed a naturally occurring distribution pattern of rearranged antibody sequences, representing all known variable gene families and most functional germline sequences. To demonstrate the feasibility for selecting antibodies with therapeutic potential from these repertoires, seven LYNDAL from donors with high serum titers against herpes simplex virus (HSV) were panned on recombinant glycoprotein B of HSV-1. Screening for specific binders delivered 34 single-chain variable fragments (scFvs) with unique sequences. Sequence analysis revealed extensive somatic hypermutation of enriched clones as a result of affinity maturation. Binding of scFvs to common glycoprotein B variants from HSV-1 and HSV-2 strains was highly specific, and the majority of analyzed antibody fragments bound to the target antigen with nanomolar affinity. From eight scFvs with HSV-neutralizing capacity in vitro,the most potent antibody neutralized 50% HSV-2 at 4.5 nM as a dimeric (scFv)2. We anticipate our approach to be useful for recovering fully human antibodies with therapeutic potential.

Fission fragment simulation of fusion neutron radiation effects on bulk mechanical properties

International Nuclear Information System (INIS)

Van Konynenburg, R.A.; Mitchell, J.B.; Guinan, M.W.; Stuart, R.N.; Borg, R.J.

1976-01-01

This research demonstrates the feasibility of using homogeneously-generated fission fragments to simulate high-fluence fusion neutron damage in niobium tensile specimens. This technique makes it possible to measure radiation effects on bulk mechanical properties at high damage states, using conveniently short irradiation times. The primary knock-on spectrum for a fusion reactor is very similar to that produced by fission fragments, and nearly the same ratio of gas atoms to displaced atoms is produced in niobium. The damage from fission fragments is compared to that from fusion neutrons and fission reactor neutrons in terms of experimentally measured yield strength increase, transmission electron microscopy (TEM) observations, and calculated damage energies

Antipsychotic medications and dental caries in newly diagnosed schizophrenia: A nationwide cohort study.

Science.gov (United States)

Hu, Kai-Fang; Chou, Yu-Hsiang; Wen, Yen-Hsia; Hsieh, Kun-Pin; Tsai, Jui-Hsiu; Yang, Pinchen; Yang, Yi-Hsin; Lin, Chun-Hung Richard

2016-11-30

We investigated the association between antipsychotic medications and the risk of dental caries in patients with schizophrenia. We enroled a nationwide cohort of patients with newly diagnosed schizophrenia within 1 year of dental caries development. Exposure to antipsychotics and other medications was categorised according to their type and duration, and the association between exposure and dental caries was assessed through logistic regressions. Of the 3610 patients with newly diagnosed schizophrenia, 2149 (59.5%) exhibited an incidence of treated dental caries. Logistic regression analysis identified a younger age, female sex, high income, a 2-year history of dental caries, and exposure to first-generation antipsychotics, and antihypertensives as independent risk factors for treated dental caries in patients with schizophrenia. Hyposalivation, the adverse effect of first-generation antipsychotics and antihypertensives, was associated with an increased risk of treated dental caries. However, hypersalivation from first-generation antipsychotics for dental caries was associated with a protective factor. These findings suggest that clinicians should pay attention to the aforementioned risk factors for dental caries in patients with schizophrenia, particularly while prescribing first-generation antipsychotics and antihypertensives to such patients. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

String fragmentation; La fragmentation des cordes

Energy Technology Data Exchange (ETDEWEB)

Drescher, H.J.; Werner, K. [Laboratoire de Physique Subatomique et des Technologies Associees - SUBATECH, Centre National de la Recherche Scientifique, 44 - Nantes (France)

1997-10-01

The classical string model is used in VENUS as a fragmentation model. For the soft domain simple 2-parton strings were sufficient, whereas for higher energies up to LHC, the perturbative regime of the QCD gives additional soft gluons, which are mapped on the string as so called kinks, energy singularities between the leading partons. The kinky string model is chosen to handle fragmentation of these strings by application of the Lorentz invariant area law. The `kinky strings` model, corresponding to the perturbative gluons coming from pQCD, takes into consideration this effect by treating the partons and gluons on the same footing. The decay law is always the Artru-Menessier area law which is the most realistic since it is invariant to the Lorentz and gauge transformations. For low mass strings a manipulation of the rupture point is necessary if the string corresponds already to an elementary particle determined by the mass and the flavor content. By means of the fragmentation model it will be possible to simulate the data from future experiments at LHC and RHIC 3 refs.

Dissociation and Memory Fragmentation in Posttraumatic Stress Disorder: An Evaluation of the Dissociative Encoding Hypothesis

Science.gov (United States)

Bedard-Gilligan, Michele; Zoellner, Lori A.

2012-01-01

Several prominent theories of posttraumatic stress disorder (PTSD) posit that peritraumatic dissociation results in insufficient encoding of the trauma memory and that persistent dissociation prevents memory elaboration, resulting in memory fragmentation and PTSD. In this review, we summarize the empirical literature on peritraumatic and trait dissociation and trauma narrative fragmentation as measured by meta-memory and rater/objective coding. Across 16 studies to date, the association between dissociation and fragmentation was most prominent when examining peritraumatic dissociation and patient's own ratings of memory fragmentation. This relationship did not hold when examining trait dissociation or rater-coded or computer-generated measures of fragmentation. Thus, initial evidence points more toward a strong self-reported association between constructs that is not supported on more objective fragmentation coding. Measurement overlap, construct ambiguity, and exclusion of potential confounds may underlie lack of a strong association between dissociation and objective-rated fragmentation. PMID:22348400

An Analysis of the FY-1C, Iridium 33, and Cosmos 2251 Fragments

Science.gov (United States)

Liou, J.-C.

2014-01-01

The beginning of the year 2013 marks the sixth anniversary of the destruction of the Fengyun-1C (FY-1C) weather satellite as the result of an anti-satellite test conducted by China in January 2007 and the fourth anniversary of the accidental collision between Cosmos 2251 and the operational Iridium 33 in February 2009. These two events represent the worst satellite breakups in history. A total of 5579 fragments have been cataloged by the U.S. Space Surveillance Network (SSN), and almost 5000 of them were still in orbit in January 2013. In addition to these cataloged objects, hundreds of thousands (or more) of fragments down to the millimeter size regime were also generated during the breakups. These fragments are too small to be tracked by the SSN, but are large enough to be a safety concern for human space activities and robotic missions in low Earth orbit (LEO, the region below 2000 km altitude). Like their cataloged siblings, many of them remain in orbit today. These two breakup events dramatically changed the landscape of the orbital debris environment in LEO. The spatial density of the cataloged population in January 2013 is shown as the top blue curve. The combined FY-1C, Iridium 33, and Cosmos 2251 fragments (black curve) account for about 50 percent of the cataloged population below an altitude of 1000 km. They are also responsible for the concentrations at 770 km and 850 km, altitudes at which the collisions occurred. The effects of the FY-1C, Iridium 33, and Cosmos 2251 fragments will continue to be felt for decades to come. For example, approximately half of the generated FY-1C fragments will remain in orbit 20 years from now. In general, the Iridium 33 and Cosmos 2251 fragments will decay faster than the FY-1C fragments because of their lower altitudes. Of the Iridium 33 and Cosmos 2251 fragments, the former have much shorter orbital lifetimes than the latter, because lightweight composite materials were heavily used in the construction of the Iridium

MCNP6 fragmentation of light nuclei at intermediate energies

Energy Technology Data Exchange (ETDEWEB)

Mashnik, Stepan G., E-mail: mashnik@lanl.gov [Los Alamos National Laboratory, Los Alamos, NM 87545 (United States); Kerby, Leslie M. [Los Alamos National Laboratory, Los Alamos, NM 87545 (United States); University of Idaho, Moscow, ID 83844 (United States)

2014-11-11

Fragmentation reactions induced on light target nuclei by protons and light nuclei of energies around 1 GeV/nucleon and below are studied with the latest Los Alamos Monte Carlo transport code MCNP6 and with its cascade-exciton model (CEM) and Los Alamos version of the quark-gluon string model (LAQGSM) event generators, version 03.03, used as stand-alone codes. Such reactions are involved in different applications, like cosmic-ray-induced single event upsets (SEU's), radiation protection, and cancer therapy with proton and ion beams, among others; therefore, it is important that MCNP6 simulates them as well as possible. CEM and LAQGSM assume that intermediate-energy fragmentation reactions on light nuclei occur generally in two stages. The first stage is the intranuclear cascade (INC), followed by the second, Fermi breakup disintegration of light excited residual nuclei produced after the INC. Both CEM and LAQGSM account also for coalescence of light fragments (complex particles) up to {sup 4}He from energetic nucleons emitted during INC. We investigate the validity and performance of MCNP6, CEM, and LAQGSM in simulating fragmentation reactions at intermediate energies and discuss possible ways of further improving these codes.

Fission fragment angular momentum

International Nuclear Information System (INIS)

Frenne, D. De

1991-01-01

Most of the energy released in fission is converted into translational kinetic energy of the fragments. The remaining excitation energy will be distributed among neutrons and gammas. An important parameter characterizing the scission configuration is the primary angular momentum of the nascent fragments. Neutron emission is not expected to decrease the spin of the fragments by more than one unit of angular momentum and is as such of less importance in the determination of the initial fragment spins. Gamma emission is a suitable tool in studying initial fragment spins because the emission time, number, energy, and multipolarity of the gammas strongly depend on the value of the primary angular momentum. The main conclusions of experiments on gamma emission were that the initial angular momentum of the fragments is large compared to the ground state spin and oriented perpendicular to the fission axis. Most of the recent information concerning initial fragment spin distributions comes from the measurement of isomeric ratios for isomeric pairs produced in fission. Although in nearly every mass chain isomers are known, only a small number are suitable for initial fission fragment spin studies. Yield and half-life considerations strongly limit the number of candidates. This has the advantage that the behavior of a specific isomeric pair can be investigated for a number of fissioning systems at different excitation energies of the fragments and fissioning nuclei. Because most of the recent information on primary angular momenta comes from measurements of isomeric ratios, the global deexcitation process of the fragments and the calculation of the initial fragment spin distribution from measured isomeric ratios are discussed here. The most important results on primary angular momentum determinations are reviewed and some theoretical approaches are given. 45 refs., 7 figs., 2 tabs

The Y4-RNA fragment, a potential diagnostic marker, exists in saliva

Directory of Open Access Journals (Sweden)

Tatsuya Ishikawa

2017-06-01

Full Text Available The 94-nt full-length Y4-RNA is thought to have roles in the initiation of DNA replication and RNA quality control. Although its 31/32-nt fragment also exists abundantly in plasma, little is known about its physiological role. Since the 31/32-nt Y4-RNA fragment in sera is reported to be more abundant in patients with coronary artery disease than healthy persons, the fragment may have a potential for a diagnostic and/or prognostic biomarker for some diseases regardless of its functionality. As a step toward further investigation of its potential utility, we examined if the 31/32-nt Y4-RNA fragment also exists in saliva that can be obtained noninvasively, and showed that, in addition to the 31/32-nt fragment, 14- and 11-nt Y4-RNA fragments are present in all saliva RNA samples from four healthy persons. We established a PCR method to accurately quantitate the amount of the 31/32-nt Y4-RNA fragment, and estimated its amount in saliva of healthy persons to be 0.06 ± 0.04 fmol per nanogram of saliva RNA. We also tried to develop an easier quantitation method using a DNA molecular beacon. Keywords: Y4-RNA fragment, Saliva RNA, Diagnostic/prognostic marker, Next-generation sequencing, RT-PCR, Molecular beacon

Identification and characterization of a thermally cleaved fragment of monoclonal antibody-A detected by sodium dodecyl sulfate-capillary gel electrophoresis.

Science.gov (United States)

Kubota, Kei; Kobayashi, Naoki; Yabuta, Masayuki; Ohara, Motomu; Naito, Toyohiro; Kubo, Takuya; Otsuka, Koji

2017-06-05

This report describes a novel, comprehensive approach to identifying a fragment peak of monoclonal antibody-A (mAb-A), detected by sodium dodecyl sulfate-capillary gel electrophoresis (SDS-cGE). The fragment migrated close to the internal standard (10kDa marker) of SDS-cGE and increased about 0.5% under a 25°C condition for 6 months. Generally, identification of fragments observed in SDS-cGE is challenging to carry out due to the difficulty of collecting analytical amounts of fractionations from the capillary. In this study, in-gel digestion peptide mapping and reversed phase liquid chromatography-mass spectrometry (RPLC-MS) were employed to elucidate the structure of the fragment. In addition, a Gelfree 8100 fractionation system was newly introduced to collect the fragment and the fraction was applied to the structural analysis of a mAb for the first time. These three analytical methods showed comparable results, proving that the fragment was a fraction of heavy chain HC1-104. The fragment contained complementarity determining regions (CDRs), which are significant to antigen binding, and thus would affect the efficacy of mAb-A. In addition, SDS-cGE without the 10kDa marker was demonstrated to clarify the increased amount of the fragment, and the experiment revealed that the fragment increases 0.2% per year in storage at 5°C. The combination of the three analytical methodologies successfully identified the impurity peak detected by SDS-cGE, providing information critical to assuring the quality and stability of the biotherapeutics. Copyright © 2017 Elsevier B.V. All rights reserved.

MCNP6 Simulation of Light and Medium Nuclei Fragmentation at Intermediate Energies

Energy Technology Data Exchange (ETDEWEB)

Mashnik, Stepan Georgievich [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Kerby, Leslie Marie [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Univ. of Idaho, Moscow, ID (United States)

2015-08-24

Fragmentation reactions induced on light and medium nuclei by protons and light nuclei of energies around 1 GeV/nucleon and below are studied with the Los Alamos transport code MCNP6 and with its CEM03.03 and LAQGSM03.03 event generators. CEM and LAQGSM assume that intermediate-energy fragmentation reactions on light nuclei occur generally in two stages. The first stage is the intranuclear cascade (INC), followed by the second, Fermi breakup disintegration of light excited residual nuclei produced after the INC. CEM and LAQGSM account also for coalescence of light fragments (complex particles) up to sup>4He from energetic nucleons emitted during INC. We investigate the validity and performance of MCNP6, CEM, and LAQGSM in simulating fragmentation reactions at intermediate energies and discuss possible ways of further improving these codes.

In silico fragment-based drug discovery: setup and validation of a fragment-to-lead computational protocol using S4MPLE.

Science.gov (United States)

Hoffer, Laurent; Renaud, Jean-Paul; Horvath, Dragos

2013-04-22

This paper describes the use and validation of S4MPLE in Fragment-Based Drug Design (FBDD)--a strategy to build drug-like ligands starting from small compounds called fragments. S4MPLE is a conformational sampling tool based on a hybrid genetic algorithm that is able to simulate one (conformer enumeration) or more molecules (docking). The goal of the current paper is to show that due to the judicious design of genetic operators, S4MPLE may be used without any specific adaptation as an in silico FBDD tool. Such fragment-to-lead evolution involves either growing of one or linking of several fragment-like binder(s). The native ability to specifically "dock" a substructure that is covalently anchored to its target (here, some prepositioned fragment formally part of the binding site) enables it to act like dedicated de novo builders and differentiates it from most classical docking tools, which may only cope with non-covalent interactions. Besides, S4MPLE may address growing/linking scenarios involving protein site flexibility, and it might also suggest "growth" moves by bridging the ligand to the site via water-mediated interactions if H2O molecules are simply appended to the input files. Therefore, the only development overhead required to build a virtual fragment→ligand growing/linking strategy based on S4MPLE were two chemoinformatics programs meant to provide a minimalistic management of the linker library. The first creates a duplicate-free library by fragmenting a compound database, whereas the second builds new compounds, attaching chemically compatible linkers to the starting fragments. S4MPLE is subsequently used to probe the optimal placement of the linkers within the binding site, with initial restraints on atoms from initial fragments, followed by an optimization of all kept poses after restraint removal. Ranking is mainly based on two criteria: force-field potential energy and RMSD shifts of the original fragment moieties. This strategy was applied to

Azimuthal Anisotropies in Nuclear Fragmentation

International Nuclear Information System (INIS)

Dabrowska, A.; Szarska, M.; Trzupek, A.; Wolter, W.; Wosiek, B.

2002-01-01

The directed and elliptic flow of fragments emitted from the excited projectile nuclei has been observed for 158 AGeV Pb collisions with the lead and plastic targets. For comparison the flow analysis has been performed for 10.6 AGeV Au collisions with the emulsion target. The strong directed flow of heaviest fragments is found. Light fragments exhibit directed flow opposite to that of heavy fragments. The elliptic flow for all multiply charged fragments is positive and increases with the charge of the fragment. The observed flow patterns in the fragmentation of the projectile nucleus are practically independent of the mass of the target nucleus and the collision energy. Emission of fragments in nuclear multifragmentation shows similar, although weaker, flow effects. (author)

Analysis of fission-fragment mass distribution within the quantum-mechanical fragmentation theory

Energy Technology Data Exchange (ETDEWEB)

Singh, Pardeep; Kaur, Harjeet [Guru Nanak Dev University, Department of Physics, Amritsar (India)

2016-11-15

The fission-fragment mass distribution is analysed for the {sup 208}Pb({sup 18}O, f) reaction within the quantum-mechanical fragmentation theory (QMFT). The reaction potential has been calculated by taking the binding energies, Coulomb potential and proximity potential of all possible decay channels and a stationary Schroedinger equation has been solved numerically to calculate the fission-fragment yield. The overall results for mass distribution are compared with those obtained in experiment. Fine structure dips in yield, corresponding to fragment shell closures at Z = 50 and N=82, which are observed by Bogachev et al., are reproduced successfully in the present calculations. These calculations will help to estimate the formation probabilities of fission fragments and to understand many related phenomena occurring in the fission process. (orig.)

Multiphoton ionization and fragmentation study of acetone using 308 nm laser radiation

Science.gov (United States)

Liu Houxiang, Li Shutao, Han Jingcheng, Zhu Rong, Guan Yifu, Wu Cunkai

1988-10-01

Multiphoton ionization and fragmentation (MPI-F) of acetone molecules using 308 nm laser radiation was studied by using a molecular beam and quadrupole mass spectrometer. The ion peaks of acetone molecule appear at m/e=15 and 43, corresponding to the two fragments CH3+ and CH3CO+. It is considered that these two ions are, respectively, formed by direct (2+1) and 2-photon ionization of methyl and acetyl radicals, generated by photodissociation of acetone molecule.

A new assay based on terminal restriction fragment length polymorphism of homocitrate synthase gene fragments for Candida species identification.

Science.gov (United States)

Szemiako, Kasjan; Śledzińska, Anna; Krawczyk, Beata

2017-08-01

Candida sp. have been responsible for an increasing number of infections, especially in patients with immunodeficiency. Species-specific differentiation of Candida sp. is difficult in routine diagnosis. This identification can have a highly significant association in therapy and prophylaxis. This work has shown a new application of the terminal restriction fragment length polymorphism (t-RFLP) method in the molecular identification of six species of Candida, which are the most common causes of fungal infections. Specific for fungi homocitrate synthase gene was chosen as a molecular target for amplification. The use of three restriction enzymes, DraI, RsaI, and BglII, for amplicon digestion can generate species-specific fluorescence labeled DNA fragment profiles, which can be used to determine the diagnostic algorithm. The designed method can be a cost-efficient high-throughput molecular technique for the identification of six clinically important Candida species.

Generation of human antibody fragments recognizing distinct epitopes of the nucleocapsid (N SARS-CoV protein using a phage display approach

Directory of Open Access Journals (Sweden)

Grasso Felicia

2005-09-01

Full Text Available Abstract Background Severe acute respiratory syndrome (SARS-CoV is a newly emerging virus that causes SARS with high mortality rate in infected people. Successful control of the global SARS epidemic will require rapid and sensitive diagnostic tests to monitor its spread, as well as, the development of vaccines and new antiviral compounds including neutralizing antibodies that effectively prevent or treat this disease. Methods The human synthetic single-chain fragment variable (scFv ETH-2 phage antibody library was used for the isolation of scFvs against the nucleocapsid (N protein of SARS-CoV using a bio panning-based strategy. The selected scFvs were characterized under genetics-molecular aspects and for SARS-CoV N protein detection in ELISA, western blotting and immunocytochemistry. Results Human scFv antibodies to N protein of SARS-CoV can be easily isolated by selecting the ETH-2 phage library on immunotubes coated with antigen. These in vitro selected human scFvs specifically recognize in ELISA and western blotting studies distinct epitopes in N protein domains and detect in immunohistochemistry investigations SARS-CoV particles in infected Vero cells. Conclusion The human scFv antibodies isolated and described in this study represent useful reagents for rapid detection of N SARS-CoV protein and SARS virus particles in infected target cells.

In silico fragment-based drug design.

Science.gov (United States)

Konteatis, Zenon D

2010-11-01

In silico fragment-based drug design (FBDD) is a relatively new approach inspired by the success of the biophysical fragment-based drug discovery field. Here, we review the progress made by this approach in the last decade and showcase how it complements and expands the capabilities of biophysical FBDD and structure-based drug design to generate diverse, efficient drug candidates. Advancements in several areas of research that have enabled the development of in silico FBDD and some applications in drug discovery projects are reviewed. The reader is introduced to various computational methods that are used for in silico FBDD, the fragment library composition for this technique, special applications used to identify binding sites on the surface of proteins and how to assess the druggability of these sites. In addition, the reader will gain insight into the proper application of this approach from examples of successful programs. In silico FBDD captures a much larger chemical space than high-throughput screening and biophysical FBDD increasing the probability of developing more diverse, patentable and efficient molecules that can become oral drugs. The application of in silico FBDD holds great promise for historically challenging targets such as protein-protein interactions. Future advances in force fields, scoring functions and automated methods for determining synthetic accessibility will all aid in delivering more successes with in silico FBDD.

Numerical analysis of fragmentation mechanisms in vapor explosions

Energy Technology Data Exchange (ETDEWEB)

Koshizuka, Seiichi; Ikeda, Hirokazu; Oka, Yoshiaki [Tokyo Univ., Tokai, Ibaraki (Japan). Nuclear Engineering Research Lab.

1998-01-01

Fragmentation of molten metal is the key process in vapor explosions. However this process is so rapid that the mechanisms have not been clarified yet in the experimental studies. Besides, numerical simulation is difficult because we have to analyze water, steam and molten metal simultaneously with evaporation and fragmentation. The authors have been developing a new numerical method, the Moving Particle Semi-implicit (MPS) method, based on moving particles and their interactions. Grids are not necessary. Incompressible flows with fragmentation on free surfaces have been calculated successfully using the MPS method. In the present study numerical simulation of the fragmentation processes using the MPS method is carried out to investigate the mechanisms. A numerical model to calculate evaporation from water to steam is developed. In this model, new particles are generated on water-steam interfaces. Effect of evaporation is also investigated. Growth of the filament is not accelerated when the normal evaporation is considered. This is because the normal evaporation needs a longer time than the moment of the jet impingement, though the filament growth is decided in this moment. Next, rapid evaporation based on spontaneous nucleation is considered. The filament growth is markedly accelerated. This result is consistent with the experimental fact that the spontaneous nucleation temperature is a necessary condition of small-scale vapor explosions. (J.P.N.)

Gamma ray transitions in de-excitation of 252Cf spontaneous fission fragments

International Nuclear Information System (INIS)

Khan, N.A.; Rashid, K.; Ahmad, M.; Qureshi, I.E.; Alam, G.D.; Ali, A.; Bhatti, N.; Horsch, F.

1983-11-01

Gamma rays in the range from 60 keV to 730 keV have been observed following the spontaneous fission of 252 Cf, with high resolution Ge(Li) detector, full width at half maximum (FWHM) of 700 eV at 122 keV, in coincidence with the two fission fragments observed with surface barrier detectors. A total number of 18, 636, 549 events were recorded over a run period of about 150 hours stretching over three weeks. The events were sorted to generate gamma ray spectra belonging to 2 amu intervals gamma of the fragment masses and 6 MeV intervals of the total kinetic energy released. Some of the prominent gamma lines belonging to various masses of the fission fragments have been identified. For some gamma lines, the intensities have been evaluated as a function of the total kinetic energy of the fission fragments. (authors)

Dissociation and memory fragmentation in post-traumatic stress disorder: an evaluation of the dissociative encoding hypothesis.

Science.gov (United States)

Bedard-Gilligan, Michele; Zoellner, Lori A

2012-01-01

Several prominent theories of post-traumatic stress disorder (PTSD) posit that peritraumatic dissociation results in insufficient encoding of the trauma memory and that persistent dissociation prevents memory elaboration, resulting in memory fragmentation and PTSD. In this review we summarise the empirical literature on peritraumatic and trait dissociation and trauma narrative fragmentation as measured by meta-memory and rater/objective coding. Across 16 studies to date, the association between dissociation and fragmentation was most prominent when examining peritraumatic dissociation and patient's own ratings of memory fragmentation. This relationship did not hold when examining trait dissociation or rater-coded or computer-generated measures of fragmentation. Thus initial evidence points more towards a strong self-reported association between constructs that is not supported on more objective fragmentation coding. Measurement overlap, construct ambiguity, and exclusion of potential confounds may underlie lack of a strong association between dissociation and objective-rated fragmentation.

Exact Solutions of Fragmentation Equations with General Fragmentation Rates and Separable Particles Distribution Kernels

Directory of Open Access Journals (Sweden)

S. C. Oukouomi Noutchie

2014-01-01

Full Text Available We make use of Laplace transform techniques and the method of characteristics to solve fragmentation equations explicitly. Our result is a breakthrough in the analysis of pure fragmentation equations as this is the first instance where an exact solution is provided for the fragmentation evolution equation with general fragmentation rates. This paper is the key for resolving most of the open problems in fragmentation theory including “shattering” and the sudden appearance of infinitely many particles in some systems with initial finite particles number.

Land fragmentation and production diversification

NARCIS (Netherlands)

Ciaian, Pavel; Guri, Fatmir; Rajcaniova, Miroslava; Drabik, Dusan; Paloma, Sergio Gomez Y.

2018-01-01

We analyze the impact of land fragmentation on production diversification in rural Albania. Albania represents a particularly interesting case for studying land fragmentation as the fragmentation is a direct outcome of land reforms. The results indicate that land fragmentation is an important driver

Fragmentation processes in nuclear reactions

International Nuclear Information System (INIS)

Legrain, R.

1984-08-01

Projectile and nuclear fragmentation are defined and processes referred to are recalled. The two different aspects of fragmentation are considered but the emphasis is also put on heavy ion induced reactions. The preliminary results of an experiment performed at GANIL to study peripheral heavy ions induced reactions at intermediate energy are presented. The results of this experiment will illustrate the characteristics of projectile fragmentation and this will also give the opportunity to study projectile fragmentation in the transition region. Then nuclear fragmentation is considered which is associated with more central collisions in the case of heavy ion induced reactions. This aspect of fragmentation is also ilustrated with two heavy ion experiments in which fragments emitted at large angle have been observed

Grain fragmentation in ultrasonic-assisted TIG weld of pure aluminum.

Science.gov (United States)

Chen, Qihao; Lin, Sanbao; Yang, Chunli; Fan, Chenglei; Ge, Hongliang

2017-11-01

Under the action of acoustic waves during an ultrasonic-assisted tungsten inert gas (TIG) welding process, a grain of a TIG weld of aluminum alloy is refined by nucleation and grain fragmentation. Herein, effects of ultrasound on grain fragmentation in the TIG weld of aluminum alloy are investigated via systematic welding experiments of pure aluminum. First, experiments involving continuous and fixed-position welding are performed, which demonstrate that ultrasound can break the grain of the TIG weld of pure aluminum. The microstructural characteristics of an ultrasonic-assisted TIG weld fabricated by fixed-position welding are analyzed. The microstructure is found to transform from plane crystal, columnar crystal, and uniform equiaxed crystal into plane crystal, deformed columnar crystal, and nonuniform equiaxed crystal after application of ultrasound. Second, factors influencing ultrasonic grain fragmentation are investigated. The ultrasonic amplitude and welding current are found to have a considerable effect on grain fragmentation. The degree of fragmentation first increases and then decreases with an increase in ultrasonic amplitude, and it increases with an increase in welding current. Measurement results of the vibration of the weld pool show that the degree of grain fragmentation is related to the intensity of acoustic nonlinearity in the weld pool. The greater the intensity of acoustic nonlinearity, the greater is the degree of grain fragmentation. Finally, the mechanism of ultrasonic grain fragmentation in the TIG weld of pure aluminum is discussed. A finite element simulation is used to simulate the acoustic pressure and flow in the weld pool. The acoustic pressure in the weld pool exceeds the cavitation threshold, and cavitation bubbles are generated. The flow velocity in the weld pool does not change noticeably after application of ultrasound. It is concluded that the high-pressure conditions induced during the occurrence of cavitation, lead to grain

Note: Primer Amysat 001; Fragment size is 211bp

Indian Academy of Sciences (India)

Renuka

Bhandara : Lanes 1–14 represent different strains of Bhandara Ecorace. Note: Primer Amysat 001; Fragment size is 211bp. Fig. 1. SSR profiles generated from genomic DNA of 16 strains from different individuals of (A.L, D. TV, D. BV, Modal, Sukinda, Raily, Bhandara) ecoraces of tasar silk worm, Antheraea mylitta using the.

Thermodynamical string fragmentation

Energy Technology Data Exchange (ETDEWEB)

Fischer, Nadine [Theoretical Particle Physics, Department of Astronomy and Theoretical Physics, Lund University,Sölvegatan 14A, Lund, SE-223 62 (Sweden); School of Physics and Astronomy, Monash University,Wellington Road, Clayton, VIC-3800 (Australia); Sjöstrand, Torbjörn [Theoretical Particle Physics, Department of Astronomy and Theoretical Physics, Lund University,Sölvegatan 14A, Lund, SE-223 62 (Sweden)

2017-01-31

The observation of heavy-ion-like behaviour in pp collisions at the LHC suggests that more physics mechanisms are at play than traditionally assumed. The introduction e.g. of quark-gluon plasma or colour rope formation can describe several of the observations, but as of yet there is no established paradigm. In this article we study a few possible modifications to the Pythia event generator, which describes a wealth of data but fails for a number of recent observations. Firstly, we present a new model for generating the transverse momentum of hadrons during the string fragmentation process, inspired by thermodynamics, where heavier hadrons naturally are suppressed in rate but obtain a higher average transverse momentum. Secondly, close-packing of strings is taken into account by making the temperature or string tension environment-dependent. Thirdly, a simple model for hadron rescattering is added. The effect of these modifications is studied, individually and taken together, and compared with data mainly from the LHC. While some improvements can be noted, it turns out to be nontrivial to obtain effects as big as required, and further work is called for.

Fragment Screening of Human Kynurenine Aminotransferase-II.

Science.gov (United States)

Jayawickrama, Gayan S; Nematollahi, Alireza; Sun, Guanchen; Church, W Bret

2018-03-01

Kynurenine aminotransferase-II (KAT-II) is a pyridoxal 5'-phosphate (PLP)-dependent enzyme that acts in the tryptophan metabolic pathway by catalyzing the transamination of kynurenine into kynurenic acid (KYNA). It is one of four isoforms in the KAT family, of which it is the primary homologue responsible for KYNA production in the mammalian brain. KAT-II is targeted for inhibition as KYNA is implicated in diseases such as schizophrenia, where it is found in elevated concentrations. Previously, many different approaches have been taken to develop KAT-II inhibitors, and herein fragment-based drug design (FBDD) approaches have been exploited to provide further lead compounds that can be designed into novel inhibitors. Surface plasmon resonance (SPR) was used to screen a fragment library containing 1000 compounds, of which 41 hits were identified. These hits were further evaluated with SPR, and 18 were selected for inhibition studies. From these hits, two fragments, F6037-0164 and F0037-7280, were pursued and determined to have an IC 50 of 524.5 (± 25.6) μM and 115.2 (± 4.5) μM, respectively. This strategy shows the viability of using FBDD in gleaning knowledge about KAT-II inhibition and generating leads for the production of KAT-II inhibitors.

Model tool to describe chemical structures in XML format utilizing structural fragments and chemical ontology.

Science.gov (United States)

Sankar, Punnaivanam; Alain, Krief; Aghila, Gnanasekaran

2010-05-24

We have developed a model structure-editing tool, ChemEd, programmed in JAVA, which allows drawing chemical structures on a graphical user interface (GUI) by selecting appropriate structural fragments defined in a fragment library. The terms representing the structural fragments are organized in fragment ontology to provide a conceptual support. ChemEd describes the chemical structure in an XML document (ChemFul) with rich semantics explicitly encoding the details of the chemical bonding, the hybridization status, and the electron environment around each atom. The document can be further processed through suitable algorithms and with the support of external chemical ontologies to generate understandable reports about the functional groups present in the structure and their specific environment.

Large scale meta-analysis of fragment-based screening campaigns: privileged fragments and complementary technologies.

Science.gov (United States)

Kutchukian, Peter S; Wassermann, Anne Mai; Lindvall, Mika K; Wright, S Kirk; Ottl, Johannes; Jacob, Jaison; Scheufler, Clemens; Marzinzik, Andreas; Brooijmans, Natasja; Glick, Meir

2015-06-01

A first step in fragment-based drug discovery (FBDD) often entails a fragment-based screen (FBS) to identify fragment "hits." However, the integration of conflicting results from orthogonal screens remains a challenge. Here we present a meta-analysis of 35 fragment-based campaigns at Novartis, which employed a generic 1400-fragment library against diverse target families using various biophysical and biochemical techniques. By statistically interrogating the multidimensional FBS data, we sought to investigate three questions: (1) What makes a fragment amenable for FBS? (2) How do hits from different fragment screening technologies and target classes compare with each other? (3) What is the best way to pair FBS assay technologies? In doing so, we identified substructures that were privileged for specific target classes, as well as fragments that were privileged for authentic activity against many targets. We also revealed some of the discrepancies between technologies. Finally, we uncovered a simple rule of thumb in screening strategy: when choosing two technologies for a campaign, pairing a biochemical and biophysical screen tends to yield the greatest coverage of authentic hits. © 2014 Society for Laboratory Automation and Screening.

Fragment-based drug design.

Science.gov (United States)

Feyfant, Eric; Cross, Jason B; Paris, Kevin; Tsao, Désirée H H

2011-01-01

Fragment-based drug design (FBDD), which is comprised of both fragment screening and the use of fragment hits to design leads, began more than 15 years ago and has been steadily gaining in popularity and utility. Its origin lies on the fact that the coverage of chemical space and the binding efficiency of hits are directly related to the size of the compounds screened. Nevertheless, FBDD still faces challenges, among them developing fragment screening libraries that ensure optimal coverage of chemical space, physical properties and chemical tractability. Fragment screening also requires sensitive assays, often biophysical in nature, to detect weak binders. In this chapter we will introduce the technologies used to address these challenges and outline the experimental advantages that make FBDD one of the most popular new hit-to-lead process.

Calculation of Beta Decay Half-Lives and Delayed Neutron Branching Ratio of Fission Fragments with Skyrme-QRPA

Directory of Open Access Journals (Sweden)

Minato Futoshi

2016-01-01

Full Text Available Nuclear β-decay and delayed neutron (DN emission is important for the r-process nucleosynthesis after the freeze-out, and stable and safe operation of nuclear reactors. Even though radioactive beam facilities have enabled us to measure β-decay and branching ratio of neutron-rich nuclei apart from the stability line in the nuclear chart, there are still a lot of nuclei which one cannot investigate experimentally. In particular, information on DN is rather scarce than that of T1/2. To predict T1/2 and the branching ratios of DN for next JENDL decay data, we have developed a method which comprises the quasiparticle-random-phase-approximation (QRPA and the Hauser-Feshbach statistical model (HFSM. In this work, we calculate fission fragments with T1/2 ≤ 50 sec. We obtain the rms deviation from experimental half-life of 3:71. Although the result is still worse than GT2 which has been adopted in JENDL decay data, DN spectra are newly calculated. We also discuss further subjects to be done in future for improving the present approach and making next generation of JENDL decay data.

Selective disulfide reduction for labeling and enhancement of Fab antibody fragments.

Science.gov (United States)

Kirley, Terence L; Greis, Kenneth D; Norman, Andrew B

2016-11-25

Many methods have been developed for chemical labeling and enhancement of the properties of antibodies and their common fragments, including the Fab and F(ab') 2 fragments. Somewhat selective reduction of some antibody disulfide bonds has been previously achieved, yielding antibodies and antibody fragments that can be labeled at defined sites, enhancing their utility and properties. Selective reduction of the two hinge disulfide bonds present in F(ab') 2 fragments using mild reduction has been useful. However, such reduction is often not quantitative and results in the reduction of multiple disulfide bonds, and therefore subsequent multiple labeling or conjugation sites are neither homogenous nor stoichiometric. Here, a simple and efficient selective reduction of the single disulfide bond linking the partial heavy chain and the intact light chain which compose the Fab fragment is accomplished utilizing tris(2-carboxyethyl)phosphine (TCEP) immobilized on agarose beads. The resultant reduced cysteine residues were labeled with several cysteine-selective fluorescent reagents, as well as by cysteine-directed PEGylation. These two cysteine residues can also be re-ligated by means of a bifunctional cysteine cross-linking agent, dibromobimane, thereby both restoring a covalent linkage between the heavy and light chains at this site, far removed from the antigen binding site, and also introducing a fluorescent probe. There are many other research and clinical uses for these selectively partially reduced Fab fragments, including biotinylation, toxin and drug conjugation, and incorporation of radioisotopes, and this technique enables simple generation of very useful Fab fragment derivatives with many potential applications. Copyright © 2016 Elsevier Inc. All rights reserved.

FragIdent--automatic identification and characterisation of cDNA-fragments.

Science.gov (United States)

Seelow, Dominik; Goehler, Heike; Hoffmann, Katrin

2009-03-02

Many genetic studies and functional assays are based on cDNA fragments. After the generation of cDNA fragments from an mRNA sample, their content is at first unknown and must be assigned by sequencing reactions or hybridisation experiments. Even in characterised libraries, a considerable number of clones are wrongly annotated. Furthermore, mix-ups can happen in the laboratory. It is therefore essential to the relevance of experimental results to confirm or determine the identity of the employed cDNA fragments. However, the manual approach for the characterisation of these fragments using BLAST web interfaces is not suited for larger number of sequences and so far, no user-friendly software is publicly available. Here we present the development of FragIdent, an application for the automatic identification of open reading frames (ORFs) within cDNA-fragments. The software performs BLAST analyses to identify the genes represented by the sequences and suggests primers to complete the sequencing of the whole insert. Gene-specific information as well as the protein domains encoded by the cDNA fragment are retrieved from Internet-based databases and included in the output. The application features an intuitive graphical interface and is designed for researchers without any bioinformatics skills. It is suited for projects comprising up to several hundred different clones. We used FragIdent to identify 84 cDNA clones from a yeast two-hybrid experiment. Furthermore, we identified 131 protein domains within our analysed clones. The source code is freely available from our homepage at http://compbio.charite.de/genetik/FragIdent/.

Amplifier channel for a fission fragment semiconductor detector

International Nuclear Information System (INIS)

Tyurin, G.P.

1981-01-01

To compensate the decrease of the transformation coefficient of fission fragment semiconductor detector (SCD) developed is a special amplification channel with controlled transfer coefficient. The block diagram of the channel is presented, the main functional units of which are as follows: preamplifying head with charge-sensitive and timing preamplifiers, linear amplifier and the circuit of spectrum position stabilization, which includes a differential discriminator, integrator and reference signal generator. The amplification channel is made in the CAMAC standard and has the following specifications: dinamical input capacitance of charge-sensitive amplifier c=10000 n PHI, signal amplitude at output of the linear amplifier at energy of fission fragments of 120 MeV has negative polarity and is equal to 5 V. Pulse amplitude change at SCD sensitivity decrease to 50% constitutes not more than 1%. Timing preamplifier has the gain factor at voltage of K=80 at front duration of 3.5 nc. Time resolution of the amplification channel is not worse than 1 nc. Dimensions of preamplifying head are 40x40x15 mm. The amplification channel permitted to use SCD for long-term measurements of fission fragment spectra [ru

A Strategy for Generating a Broad-Spectrum Monoclonal Antibody and Soluble Single-Chain Variable Fragments against Plant Potyviruses

Science.gov (United States)

Liu, Han-Lin; Lin, Wei-Fang; Hu, Wen-Chi; Lee, Yung-An

2015-01-01

Potyviruses are major pathogens that often cause mixed infection in calla lilies. To reduce the time and cost of virus indexing, a detection method for the simultaneous targeting of multiple potyviruses was developed by generating a broad-spectrum monoclonal antibody (MAb) for detecting the greatest possible number of potyviruses. The conserved 121-amino-acid core regions of the capsid proteins of Dasheen mosaic potyvirus (DsMV), Konjak mosaic potyvirus (KoMV), and Zantedeschia mild mosaic potyvirus (ZaMMV) were sequentially concatenated and expressed as a recombinant protein for immunization. After hybridoma cell fusion and selection, one stable cell line that secreted a group-specific antibody, named C4 MAb, was selected. In the reaction spectrum test, the C4 MAb detected at least 14 potyviruses by indirect enzyme-linked immunosorbent assay (I-ELISA) and Western blot analysis. Furthermore, the variable regions of the heavy (VH) and light (VL) chains of the C4 MAb were separately cloned and constructed as single-chain variable fragments (scFvs) for expression in Escherichia coli. Moreover, the pectate lyase E (PelE) signal peptide of Erwinia chrysanthemi S3-1 was added to promote the secretion of C4 scFvs into the medium. According to Western blot analysis and I-ELISA, the soluble C4 scFv (VL-VH) fragment showed a binding specificity similar to that of the C4 MAb. Our results demonstrate that a recombinant protein derived from fusion of the conserved regions of viral proteins has the potential to produce a broad-spectrum MAb against a large group of viruses and that the PelE signal peptide can improve the secretion of scFvs in E. coli. PMID:26209665

Practicing on Newly Dead

Directory of Open Access Journals (Sweden)

Jewel Abraham

2015-07-01

Full Text Available A newly dead cadaver simulation is practiced on the physical remains of the dead before the onset of rigor mortis. This technique has potential benefits for providing real-life in-situ experience for novice providers in health care practices. Evolving ethical views in health care brings into question some of the ethical aspects associated with newly dead cadaver simulation in terms of justification for practice, autonomy, consent, and the need of disclosure. A clear statement of policies and procedures on newly dead cadaver simulation has yet to be implemented. Although there are benefits and disadvantages to an in-situ cadaver simulation, such practices should not be carried out in secrecy as there is no compelling evidence that suggests such training as imperative. Secrecy in these practices is a violation of honor code of nursing ethics. As health care providers, practitioners are obliged to be ethically honest and trustworthy to their patients. The author explores the ethical aspects of using newly dead cadaver simulation in training novice nursing providers to gain competency in various lifesaving skills, which otherwise cannot be practiced on a living individual. The author explores multiple views on cadaver simulation in relation to ethical theories and practices such as consent and disclosure to family.

Neutralisation and binding of VHS virus by monovalent antibody fragments

DEFF Research Database (Denmark)

Cupit, P.M.; Lorenzen, Niels; Strachan, G.

2001-01-01

We have previously reported the cloning and characterisation of the heavy and light chain variable domain genes encoding three monoclonal antibodies (Mabs) that bind viral haemorrhagic septicaemia virus (VHSV). Two of these antibodies, 3F1H10 and 3F1A2 both neutralised the virus though 3F1A2...... appeared to recognise a broader range of virus isolates. The variable domains of these two antibodies differ by only four residues (Lorenzen et al., 2000a. Fish Shellfish Immunol. 10, 129-142). To further study the mechanism of neutralisation, Fab fragments as well as a series of recombinant bacterial...... single chain antibody (scAb) fragments were generated from the three anti-VHSV Mabs and their variable domain genes, respectively. Fabs and scAbs derived from the neutralising Mabs were both able to neutralise the VHSV type 1 isolate DK-F1. In addition, a series of scAb fragments were produced using...

Fragmentation in the branching coral Acropora palmata (Lamarck): growth, survivorship, and reproduction of colonies and fragments.

Science.gov (United States)

Lirman

2000-08-23

Acropora palmata, a branching coral abundant on shallow reef environments throughout the Caribbean, is susceptible to physical disturbance caused by storms. Accordingly, the survivorship and propagation of this species are tied to its capability to recover after fragmentation. Fragments of A. palmata comprised 40% of ramets within populations that had experienced recent storms. While the survivorship of A. palmata fragments was not directly related to the size of fragments, removal of fragments from areas where they settled was influenced by size. Survivorship of fragments was also affected by type of substratum; the greatest mortality (58% loss within the first month) was observed on sand, whereas fragments placed on top of live colonies of A. palmata fused to the underlying tissue and did not experience any losses. Fragments created by Hurricane Andrew on a Florida reef in August 1992 began developing new growth (proto-branches) 7 months after the storm. The number of proto-branches on fragments was dependent on size, but growth was not affected by the size of fragments. Growth-rates of proto-branches increased exponentially with time (1.7 cm year(-1) for 1993-1994, 2.7 cm year(-1) for 1994-1995, 4.2 cm year(-1) for 1995-1996, and 6.5 cm year(-1) for 1996-1997), taking over 4 years for proto-branches to achieve rates comparable to those of adult colonies on the same reef (6.9 cm year(-1)). In addition to the initial mortality and reduced growth-rates, fragmentation resulted in a loss of reproductive potential. Neither colonies that experienced severe fragmentation nor fragments contained gametes until 4 years after the initial damage. Although A. palmata may survive periodic fragmentation, the long-term effects of this process will depend ultimately on the balance between the benefits and costs of this process.

Plasminogen fragments K 1-3 and K 5 bind to different sites in fibrin fragment DD.

Science.gov (United States)

Grinenko, T V; Kapustianenko, L G; Yatsenko, T A; Yusova, O I; Rybachuk, V N

2016-01-01

Specific plasminogen-binding sites of fibrin molecule are located in Аα148-160 regions of C-terminal domains. Plasminogen interaction with these sites initiates the activation process of proenzyme and subsequent fibrin lysis. In this study we investigated the binding of plasminogen fragments K 1-3 and K 5 with fibrin fragment DD and their effect on Glu-plasminogen interaction with DD. It was shown that the level of Glu-plasminogen binding to fibrin fragment DD is decreased by 50-60% in the presence of K 1-3 and K 5. Fragments K 1-3 and K 5 have high affinity to fibrin fragment DD (Kd is 0.02 for K 1-3 and 0.054 μМ for K 5). K 5 interaction is independent and K 1-3 is partly dependent on C-terminal lysine residues. K 1-3 interacts with complex of fragment DD-immobilized K 5 as well as K 5 with complex of fragment DD-immobilized K 1-3. The plasminogen fragments do not displace each other from binding sites located in fibrin fragment DD, but can compete for the interaction. The results indicate that fibrin fragment DD contains different binding sites for plasminogen kringle fragments K 1-3 and K 5, which can be located close to each other. The role of amino acid residues of fibrin molecule Аα148-160 region in interaction with fragments K 1-3 and K 5 is discussed.

Spontaneous fragmentation of an alpha-active ceramic: a mechanism for dispersion of solid waste

International Nuclear Information System (INIS)

Clinard, F.W. Jr.; Rohr, D.L.

1980-01-01

Studies underway to characterize spontaneous fragmentation in 238 PuO 2 and to determine the mechanism(s) responsible are reported. Results reported here show that: spontaneous fragmentation of 238 PuO 2 generates a wide range of particle sizes, from a few mm to 1000 A or less; the phenomenon may continue with time or may saturate, depending on starting material; the magnitude of the effect is dependent on storage environment. Neither thermal stresses nor lattice damage appear to be solely responsible for fragmentation, but radiolysis of the environment could play an important role. Work is continuing in an effort to identify the controlling factors in this phenomenon

Using fragmentation trees and mass spectral trees for identifying unknown compounds in metabolomics.

Science.gov (United States)

Vaniya, Arpana; Fiehn, Oliver

2015-06-01

Identification of unknown metabolites is the bottleneck in advancing metabolomics, leaving interpretation of metabolomics results ambiguous. The chemical diversity of metabolism is vast, making structure identification arduous and time consuming. Currently, comprehensive analysis of mass spectra in metabolomics is limited to library matching, but tandem mass spectral libraries are small compared to the large number of compounds found in the biosphere, including xenobiotics. Resolving this bottleneck requires richer data acquisition and better computational tools. Multi-stage mass spectrometry (MSn) trees show promise to aid in this regard. Fragmentation trees explore the fragmentation process, generate fragmentation rules and aid in sub-structure identification, while mass spectral trees delineate the dependencies in multi-stage MS of collision-induced dissociations. This review covers advancements over the past 10 years as a tool for metabolite identification, including algorithms, software and databases used to build and to implement fragmentation trees and mass spectral annotations.

Novel approach of fragment-based lead discovery applied to renin inhibitors.

Science.gov (United States)

Tawada, Michiko; Suzuki, Shinkichi; Imaeda, Yasuhiro; Oki, Hideyuki; Snell, Gyorgy; Behnke, Craig A; Kondo, Mitsuyo; Tarui, Naoki; Tanaka, Toshimasa; Kuroita, Takanobu; Tomimoto, Masaki

2016-11-15

A novel approach was conducted for fragment-based lead discovery and applied to renin inhibitors. The biochemical screening of a fragment library against renin provided the hit fragment which showed a characteristic interaction pattern with the target protein. The hit fragment bound only to the S1, S3, and S3 SP (S3 subpocket) sites without any interactions with the catalytic aspartate residues (Asp32 and Asp215 (pepsin numbering)). Prior to making chemical modifications to the hit fragment, we first identified its essential binding sites by utilizing the hit fragment's substructures. Second, we created a new and smaller scaffold, which better occupied the identified essential S3 and S3 SP sites, by utilizing library synthesis with high-throughput chemistry. We then revisited the S1 site and efficiently explored a good building block attaching to the scaffold with library synthesis. In the library syntheses, the binding modes of each pivotal compound were determined and confirmed by X-ray crystallography and the library was strategically designed by structure-based computational approach not only to obtain a more active compound but also to obtain informative Structure Activity Relationship (SAR). As a result, we obtained a lead compound offering synthetic accessibility as well as the improved in vitro ADMET profiles. The fragments and compounds possessing a characteristic interaction pattern provided new structural insights into renin's active site and the potential to create a new generation of renin inhibitors. In addition, we demonstrated our FBDD strategy integrating highly sensitive biochemical assay, X-ray crystallography, and high-throughput synthesis and in silico library design aimed at fragment morphing at the initial stage was effective to elucidate a pocket profile and a promising lead compound. Copyright © 2016 Elsevier Ltd. All rights reserved.

Current perspectives in fragment-based lead discovery (FBLD)

Science.gov (United States)

Lamoree, Bas; Hubbard, Roderick E.

2017-01-01

It is over 20 years since the first fragment-based discovery projects were disclosed. The methods are now mature for most ‘conventional’ targets in drug discovery such as enzymes (kinases and proteases) but there has also been growing success on more challenging targets, such as disruption of protein–protein interactions. The main application is to identify tractable chemical startpoints that non-covalently modulate the activity of a biological molecule. In this essay, we overview current practice in the methods and discuss how they have had an impact in lead discovery – generating a large number of fragment-derived compounds that are in clinical trials and two medicines treating patients. In addition, we discuss some of the more recent applications of the methods in chemical biology – providing chemical tools to investigate biological molecules, mechanisms and systems. PMID:29118093

Study of the multi-fragment production in asymmetric heavy ion reactions at E/A = 600 MeV

International Nuclear Information System (INIS)

Hubele, J.C.

1992-03-01

In this thesis the fragmentation of Au projectiles in collisions with light target nuclei ( 12 C, 27 Al, 64 Cu) is studied at a projectile energy of 600 MeV per nucleon. For the description of an event three observables are used: the multiplicity M lp of the light particles, the largest observed charge Z max of the projectile fragments, as well as a newly introduced obsevable Z bound , which is defined as the sum of all charge contained in complex projectile fragments (Z ≥ 2). By means of this observable different exit channels can be identified: the formation of a heavy residual nucleus by evaporation of light particles, the binary fission, the decay into IMF's (3 ≤ Z ≤ 30) and the complete decay into light particles. At the applied incident energy in the case of Au+Cu reactions each of these decay channels can be realized. The observables Z bound and M lpp are proved as suited quantities for the reconstruction of the impact parameter. Furthermore independently on the target a universal relation between Z bound and the multiplicity distribution of medium-heavy fragments is found. By simple model assumptions it is made plausible that Z bound is correlated both with the size of the projectile residue and in the mean with its excitation energy. For the characterization of the decay into IMF's the multiplicity M imf of these fragments is applied. For all three targets with increasing centrality first an increasing of the mean fragment multiplicities to maximal values of 3-4 is observed. In the case of the Cu target and suggestively also at the Al target in the most central collisions again a decreasing of the multiplicity is found. The universal Z bound behaviour is a hint to a - at least partial - equilibration of the primary projectile residue before the decay. (HSI) [de

Molecular and FISH analyses of a 53-kbp intact DNA fragment inserted by biolistics in wheat (Triticum aestivum L.) genome.

Science.gov (United States)

Partier, A; Gay, G; Tassy, C; Beckert, M; Feuillet, C; Barret, P

2017-10-01

A large, 53-kbp, intact DNA fragment was inserted into the wheat ( Triticum aestivum L.) genome. FISH analyses of individual transgenic events revealed multiple insertions of intact fragments. Transferring large intact DNA fragments containing clusters of resistance genes or complete metabolic pathways into the wheat genome remains a challenge. In a previous work, we showed that the use of dephosphorylated cassettes for wheat transformation enabled the production of simple integration patterns. Here, we used the same technology to produce a cassette containing a 44-kb Arabidopsis thaliana BAC, flanked by one selection gene and one reporter gene. This 53-kb linear cassette was integrated in the bread wheat (Triticum aestivum L.) genome by biolistic transformation. Our results showed that transgenic plants harboring the entire cassette were generated. The inheritability of the cassette was demonstrated in the T1 and T2 generation. Surprisingly, FISH analysis performed on T1 progeny of independent events identified double genomic insertions of intact fragments in non-homoeologous positions. Inheritability of these double insertions was demonstrated by FISH analysis of the T1 generation. Relative conclusions that can be drawn from molecular or FISH analysis are discussed along with future prospects of the engineering of large fragments for wheat transformation or genome editing.

Chameleon fragmentation

Energy Technology Data Exchange (ETDEWEB)

Brax, Philippe [Institut de Physique Théorique, CEA, IPhT, CNRS, URA 2306, F-91191Gif/Yvette Cedex (France); Upadhye, Amol, E-mail: philippe.brax@cea.fr, E-mail: aupadhye@anl.gov [Institute for the Early Universe, Ewha University, International Education, Building #601, 11-1, Daehyun-Dong Seodaemun-Gu, Seoul 120-750 (Korea, Republic of)

2014-02-01

A scalar field dark energy candidate could couple to ordinary matter and photons, enabling its detection in laboratory experiments. Here we study the quantum properties of the chameleon field, one such dark energy candidate, in an ''afterglow'' experiment designed to produce, trap, and detect chameleon particles. In particular, we investigate the possible fragmentation of a beam of chameleon particles into multiple particle states due to the highly non-linear interaction terms in the chameleon Lagrangian. Fragmentation could weaken the constraints of an afterglow experiment by reducing the energy of the regenerated photons, but this energy reduction also provides a unique signature which could be detected by a properly-designed experiment. We show that constraints from the CHASE experiment are essentially unaffected by fragmentation for φ{sup 4} and 1/φ potentials, but are weakened for steeper potentials, and we discuss possible future afterglow experiments.

Chameleon fragmentation

International Nuclear Information System (INIS)

Brax, Philippe; Upadhye, Amol

2014-01-01

A scalar field dark energy candidate could couple to ordinary matter and photons, enabling its detection in laboratory experiments. Here we study the quantum properties of the chameleon field, one such dark energy candidate, in an ''afterglow'' experiment designed to produce, trap, and detect chameleon particles. In particular, we investigate the possible fragmentation of a beam of chameleon particles into multiple particle states due to the highly non-linear interaction terms in the chameleon Lagrangian. Fragmentation could weaken the constraints of an afterglow experiment by reducing the energy of the regenerated photons, but this energy reduction also provides a unique signature which could be detected by a properly-designed experiment. We show that constraints from the CHASE experiment are essentially unaffected by fragmentation for φ 4 and 1/φ potentials, but are weakened for steeper potentials, and we discuss possible future afterglow experiments

A simple strategy for subcloning and amplifying random multimegabase subchromosomal acentric DNA fragments as double minute chromosomes

International Nuclear Information System (INIS)

Hahn, P.J.; Giddings, L.; Lane, M.J.

1989-01-01

Restriction mapping of relatively large genomes (e.g. human) utilizing randomly generated DNA segments requires high mapping redundancy to successfully organize 'contigs' to represent the entire genome. The number of independent DNA segment maps required is dependent on the average size of a mapping segment; the larger the segment, the fewer required. The authors have developed a strategy for subcloning intact multimegabase subchromosomal fragments as double minute chromosomes. Such fragments could serve as primary mapping elements or as adjunct (linking) fragments to rapidly connect already existent contigs generated using yeast artificial chromosomes or cosmids. They present several lines of evidence supporting the viability of this approach. (1) X-ray treated EMT-6 mouse cells (7.5 Gr.) which are selected over several months with increasing levels of methotrexate (MTX) contain highly amplified circular DNA molecules (double minutes) which include the dihydrofolate reductase (DHFR) gene in a size range between 1,000 and 3,500 kilobases as determined by pulsed-field gel electrophoresis and these acentric chromosomal fragments have been stably maintained in culture for at least a year. (2) Preliminary data based on experiments involving fusion of X-irradiated Chinese Hamster Ovary (CH0 DG44) cells containing randomly inserted cotransfected Neomycin resistance and DHFR genes to mouse EMT-6 cells shows that the linked genes can be readily cotransferred as acentric subchromosomal fragment(s) suitable for gene amplification. (3) The studies of CHO cells with cell fusion transferred X-ray induced chromosomal fragments containing the natural CHO DHFR gene suggest that transferred chromosome fragments undergo gene amplification much more readily than nonfragmented endogenous DHFR genes

CT Texture Analysis of Ex Vivo Renal Stones Predicts Ease of Fragmentation with Shockwave Lithotripsy.

Science.gov (United States)

Cui, Helen W; Devlies, Wout; Ravenscroft, Samuel; Heers, Hendrik; Freidin, Andrew J; Cleveland, Robin O; Ganeshan, Balaji; Turney, Benjamin W

2017-07-01

Understanding the factors affecting success of extracorporeal shockwave lithotripsy (SWL) would improve informed decision-making on the most appropriate treatment modality for an individual patient. Although stone size and skin-to-stone distance do correlate with fragmentation efficacy, it has been shown that stone composition and architecture, as reflected by structural heterogeneity on CT, are also important factors. This study aims to determine if CT texture analysis (CTTA), a novel, nondestructive, and objective tool that generates statistical metrics reflecting stone heterogeneity, could have utility in predicting likelihood of SWL success. Seven spontaneously passed, intact renal tract stones, were scanned ex vivo using standard CT KUB and micro-CT. The stones were then fragmented in vitro using a clinical lithotripter, after which, chemical composition analysis was performed. CTTA was used to generate a number of metrics that were correlated to the number of shocks needed to fragment the stone. CTTA metrics reflected stone characteristics and composition, and predicted ease of SWL fragmentation. The strongest correlation with number of shocks required to fragment the stone was mean Hounsfield unit (HU) density (r = 0.806, p = 0.028) and a CTTA metric measuring the entropy of the pixel distribution of the stone image (r = 0.804, p = 0.039). Using multiple linear regression analysis, the best model showed that CTTA metrics of entropy and kurtosis could predict 92% of the outcome of number of shocks needed to fragment the stone. This was superior to using stone volume or density. CTTA metrics entropy and kurtosis have been shown in this experimental ex vivo setting to strongly predict fragmentation by SWL. This warrants further investigation in a larger clinical study for the contribution of CT textural metrics as a measure of stone heterogeneity, along with other known clinical factors, to predict likelihood of SWL success.

Analysis of Endonuclease R·EcoRI Fragments of DNA from Lambdoid Bacteriophages and Other Viruses by Agarose-Gel Electrophoresis

Science.gov (United States)

Helling, Robert B.; Goodman, Howard M.; Boyer, Herbert W.

1974-01-01

By means of agarose-gel electrophoresis, endonuclease R·EcoRI-generated fragments of DNA from various viruses were separated, their molecular weights were determined, and complete or partial fragment maps for lambda, φ80, and hybrid phages were constructed. Images PMID:4372397

Fragment library design: using cheminformatics and expert chemists to fill gaps in existing fragment libraries.

Science.gov (United States)

Kutchukian, Peter S; So, Sung-Sau; Fischer, Christian; Waller, Chris L

2015-01-01

Fragment based screening (FBS) has emerged as a mainstream lead discovery strategy in academia, biotechnology start-ups, and large pharma. As a prerequisite of FBS, a structurally diverse library of fragments is desirable in order to identify chemical matter that will interact with the range of diverse target classes that are prosecuted in contemporary screening campaigns. In addition, it is also desirable to offer synthetically amenable starting points to increase the probability of a successful fragment evolution through medicinal chemistry. Herein we describe a method to identify biologically relevant chemical substructures that are missing from an existing fragment library (chemical gaps), and organize these chemical gaps hierarchically so that medicinal chemists can efficiently navigate the prioritized chemical space and subsequently select purchasable fragments for inclusion in an enhanced fragment library.

Universality of projectile fragmentation model

International Nuclear Information System (INIS)

Chaudhuri, G.; Mallik, S.; Das Gupta, S.

2012-01-01

Presently projectile fragmentation reaction is an important area of research as it is used for the production of radioactive ion beams. In this work, the recently developed projectile fragmentation model with an universal temperature profile is used for studying the charge distributions of different projectile fragmentation reactions with different projectile target combinations at different incident energies. The model for projectile fragmentation consists of three stages: (i) abrasion, (ii) multifragmentation and (iii) evaporation

Newly graduated nurses' use of knowledge sources

DEFF Research Database (Denmark)

Voldbjerg, Siri Lygum; Grønkjaer, Mette; Sørensen, Erik Elgaard

2016-01-01

AIM: To advance evidence on newly graduated nurses' use of knowledge sources. BACKGROUND: Clinical decisions need to be evidence-based and understanding the knowledge sources that newly graduated nurses use will inform both education and practice. Qualitative studies on newly graduated nurses' use...... underscoring progression in knowledge use and perception of competence and confidence among newly graduated nurses. CONCLUSION: The transition phase, feeling of confidence and ability to use critical thinking and reflection, has a great impact on knowledge sources incorporated in clinical decisions....... The synthesis accentuates that for use of newly graduated nurses' qualifications and skills in evidence-based practice, clinical practice needs to provide a supportive environment which nurtures critical thinking and questions and articulates use of multiple knowledge sources....

Binding-Site Compatible Fragment Growing Applied to the Design of β2-Adrenergic Receptor Ligands.

Science.gov (United States)

Chevillard, Florent; Rimmer, Helena; Betti, Cecilia; Pardon, Els; Ballet, Steven; van Hilten, Niek; Steyaert, Jan; Diederich, Wibke E; Kolb, Peter

2018-02-08

Fragment-based drug discovery is intimately linked to fragment extension approaches that can be accelerated using software for de novo design. Although computers allow for the facile generation of millions of suggestions, synthetic feasibility is however often neglected. In this study we computationally extended, chemically synthesized, and experimentally assayed new ligands for the β 2 -adrenergic receptor (β 2 AR) by growing fragment-sized ligands. In order to address the synthetic tractability issue, our in silico workflow aims at derivatized products based on robust organic reactions. The study started from the predicted binding modes of five fragments. We suggested a total of eight diverse extensions that were easily synthesized, and further assays showed that four products had an improved affinity (up to 40-fold) compared to their respective initial fragment. The described workflow, which we call "growing via merging" and for which the key tools are available online, can improve early fragment-based drug discovery projects, making it a useful creative tool for medicinal chemists during structure-activity relationship (SAR) studies.

Multistable Perception in Older Adults: Constructing a Whole from Fragments.

Science.gov (United States)

Patel, Khushi; Reed, Maureen

2016-03-22

Visual perception is constructive in nature; that is, a coherent whole is generated from ambiguous fragments that are encountered in dynamic visual scenes. Creating this coherent whole from fragmented sensory inputs requires one to detect, identify, distinguish and organize sensory input. The organization of fragments into a coherent whole is facilitated by the continuous interactions between lower level sensory inputs and higher order processes. However, age-related declines are found in both neural structures and cognitive processes (e.g., attention and inhibition). The impact of these declines on the constructive nature of visual processing was the focus of this study. Here we asked younger adults, young-old (65-79 years), and old-old adults (80+ years) to view a multistable figure (i.e., Necker cube) under four conditions (free, priming, volition, and adaptation) and report, via a button press, when percepts spontaneously changed. The oldest-olds, unlike young-olds and younger adults, were influenced by priming, had less visual stability during volition and showed less ability to adapt to multistable stimuli. These results suggest that the ability to construct a coherent whole from fragments declines with age. More specifically, vision is constructed differently in the old-olds, which might influence environmental interpretations and navigational abilities in this age group.

Multistable Perception in Older Adults: Constructing a Whole from Fragments

Directory of Open Access Journals (Sweden)

Khushi Patel

2016-03-01

Full Text Available Visual perception is constructive in nature; that is, a coherent whole is generated from ambiguous fragments that are encountered in dynamic visual scenes. Creating this coherent whole from fragmented sensory inputs requires one to detect, identify, distinguish and organize sensory input. The organization of fragments into a coherent whole is facilitated by the continuous interactions between lower level sensory inputs and higher order processes. However, age-related declines are found in both neural structures and cognitive processes (e.g., attention and inhibition. The impact of these declines on the constructive nature of visual processing was the focus of this study. Here we asked younger adults, young-old (65–79 years, and old-old adults (80+ years to view a multistable figure (i.e., Necker cube under four conditions (free, priming, volition, and adaptation and report, via a button press, when percepts spontaneously changed. The oldest-olds, unlike young-olds and younger adults, were influenced by priming, had less visual stability during volition and showed less ability to adapt to multistable stimuli. These results suggest that the ability to construct a coherent whole from fragments declines with age. More specifically, vision is constructed differently in the old-olds, which might influence environmental interpretations and navigational abilities in this age group.

Role of mTOR, Bad, and Survivin in RasGAP Fragment N-Mediated Cell Protection

Science.gov (United States)

Yang, Jiang-Yan; Widmann, Christian

2013-01-01

Partial cleavage of p120 RasGAP by caspase-3 in stressed cells generates an N-terminal fragment, called fragment N, which activates an anti-apoptotic Akt-dependent survival response. Akt regulates several effectors but which of these mediate fragment N-dependent cell protection has not been defined yet. Here we have investigated the role of mTORC1, Bad, and survivin in the capacity of fragment N to protect cells from apoptosis. Neither rapamycin, an inhibitor of mTORC1, nor silencing of raptor, a subunit of the mTORC1 complex, altered the ability of fragment N from inhibiting cisplatin- and Fas ligand-induced death. Cells lacking Bad, despite displaying a stronger resistance to apoptosis, were still protected by fragment N against cisplatin-induced death. Fragment N was also able to protect cells from Fas ligand-induced death in conditions where Bad plays no role in apoptosis regulation. Fragment N expression in cells did neither modulate survivin mRNA nor its protein expression. Moreover, the expression of cytoplasmic survivin, known to exert anti-apoptotic actions in cells, still occurred in UV-B-irradiated epidermis of mouse expressing a caspase-3-resistant RasGAP mutant that cannot produce fragment N. Additionally, survivin function in cell cycle progression was not affected by fragment N. These results indicate that, taken individually, mTOR, Bad, or Survivin are not required for fragment N to protect cells from cell death. We conclude that downstream targets of Akt other than mTORC1, Bad, or survivin mediate fragment N-induced protection or that several Akt effectors can compensate for each other to induce the pro-survival fragment N-dependent response. PMID:23826368

An efficient method for isolating antibody fragments against small peptides by antibody phage display

DEFF Research Database (Denmark)

Duan, Zhi; Siegumfeldt, Henrik

2010-01-01

We generated monoclonal scFv (single chain variable fragment) antibodies from an antibody phage display library towards three small synthetic peptides derived from the sequence of s1-casein. Key difficulties for selection of scFv-phages against small peptides were addressed. Small peptides do....... The scFvs were sequenced and characterized, and specificity was characterized by ELISA. The methods developed in this study are universally applicable for antibody phage display to efficiently produce antibody fragments against small peptides....

Effective Fragment Potential Method for H-Bonding: How To Obtain Parameters for Nonrigid Fragments.

Science.gov (United States)

Dubinets, Nikita; Slipchenko, Lyudmila V

2017-07-20

Accuracy of the effective fragment potential (EFP) method was explored for describing intermolecular interaction energies in three dimers with strong H-bonded interactions, formic acid, formamide, and formamidine dimers, which are a part of HBC6 database of noncovalent interactions. Monomer geometries in these dimers change significantly as a function of intermonomer separation. Several EFP schemes were considered, in which fragment parameters were prepared for a fragment in its gas-phase geometry or recomputed for each unique fragment geometry. Additionally, a scheme in which gas-phase fragment parameters are shifted according to relaxed fragment geometries is introduced and tested. EFP data are compared against the coupled cluster with single, double, and perturbative triple excitations (CCSD(T)) method in a complete basis set (CBS) and the symmetry adapted perturbation theory (SAPT). All considered EFP schemes provide a good agreement with CCSD(T)/CBS for binding energies at equilibrium separations, with discrepancies not exceeding 2 kcal/mol. However, only the schemes that utilize relaxed fragment geometries remain qualitatively correct at shorter than equilibrium intermolecular distances. The EFP scheme with shifted parameters behaves quantitatively similar to the scheme in which parameters are recomputed for each monomer geometry and thus is recommended as a computationally efficient approach for large-scale EFP simulations of flexible systems.

Robust Object Tracking Using Valid Fragments Selection.

Science.gov (United States)

Zheng, Jin; Li, Bo; Tian, Peng; Luo, Gang

Local features are widely used in visual tracking to improve robustness in cases of partial occlusion, deformation and rotation. This paper proposes a local fragment-based object tracking algorithm. Unlike many existing fragment-based algorithms that allocate the weights to each fragment, this method firstly defines discrimination and uniqueness for local fragment, and builds an automatic pre-selection of useful fragments for tracking. Then, a Harris-SIFT filter is used to choose the current valid fragments, excluding occluded or highly deformed fragments. Based on those valid fragments, fragment-based color histogram provides a structured and effective description for the object. Finally, the object is tracked using a valid fragment template combining the displacement constraint and similarity of each valid fragment. The object template is updated by fusing feature similarity and valid fragments, which is scale-adaptive and robust to partial occlusion. The experimental results show that the proposed algorithm is accurate and robust in challenging scenarios.

Construction of Biologically Functional Bacterial Plasmids In Vitro

Science.gov (United States)

Cohen, Stanley N.; Chang, Annie C. Y.; Boyer, Herbert W.; Helling, Robert B.

1973-01-01

The construction of new plasmid DNA species by in vitro joining of restriction endonuclease-generated fragments of separate plasmids is described. Newly constructed plasmids that are inserted into Escherichia coli by transformation are shown to be biologically functional replicons that possess genetic properties and nucleotide base sequences from both of the parent DNA molecules. Functional plasmids can be obtained by reassociation of endonuclease-generated fragments of larger replicons, as well as by joining of plasmid DNA molecules of entirely different origins. Images PMID:4594039

Event generators

International Nuclear Information System (INIS)

Durand, D.; Gulminelli, F.; Lopez, O.; Vient, E.

1998-01-01

The results concerning the heavy ion collision simulations at Fermi energies by means of phenomenological models obtained in the last two years ar presented. The event generators are essentially following the phase of elaboration of analysis methods of data obtained by INDRA or NAUTILUS 4 π multidetectors. To identify and correctly quantify a phenomenon or a physical quantity it is necessary to verify by simulation the feasibility and validity of the analysis and also to estimate the bias introduced by the experimental filter. Many studies have shown this, for instance: the determination of the collision reaction plan for flow studies, determination of kinematical characteristics of the quasi-projectiles, and the excitation energy measurement stored in the hot nuclei. To Eugene, the currently utilised generator, several improvements were added: introduction of space-time correlations between the different products emitted in the decay of excited nuclei by calculating the trajectories of the particles in the final phase of the reaction; taking into account in the decay cascade of the discrete levels of the lighter fragments; the possibility of the schematically description of the explosion of the nucleus by simultaneous emission of multi-fragments. Thus, by comparing the calculations with the data relative to heavy systems studied with the NAUTILUS assembly it was possible to extract the time scales in the nuclear fragmentation. The utilisation of these event generators was extended to the analysis of INDRA data concerning the determination of the vaporization threshold in the collisions Ar + Ni and also the research of the expansion effects in the collisions Xe + Sn at 50 MeV/u

Isolation and characterization of reverse transcriptase fragments of LTR retrotransposons from the genome of Chenopodium quinoa (Amaranthaceae).

Science.gov (United States)

Kolano, Bozena; Bednara, Edyta; Weiss-Schneeweiss, Hanna

2013-10-01

High heterogeneity was observed among conserved domains of reverse transcriptase ( rt ) isolated from quinoa. Only one Ty1- copia rt was highly amplified. Reverse transcriptase sequences were located predominantly in pericentromeric region of quinoa chromosomes. The heterogeneity, genomic abundance, and chromosomal distribution of reverse transcriptase (rt)-coding fragments of Ty1-copia and Ty3-gypsy long terminal repeat retrotransposons were analyzed in the Chenopodium quinoa genome. Conserved domains of the rt gene were amplified and characterized using degenerate oligonucleotide primer pairs. Sequence analyses indicated that half of Ty1-copia rt (51 %) and 39 % of Ty3-gypsy rt fragments contained intact reading frames. High heterogeneity among rt sequences was observed for both Ty1-copia and Ty3-gypsy rt amplicons, with Ty1-copia more heterogeneous than Ty3-gypsy. Most of the isolated rt fragments were present in quinoa genome in low copy numbers, with only one highly amplified Ty1-copia rt sequence family. The gypsy-like RNase H fragments co-amplified with Ty1-copia-degenerate primers were shown to be highly amplified in the quinoa genome indicating either higher abundance of some gypsy families of which rt domains could not be amplified, or independent evolution of this gypsy-region in quinoa. Both Ty1-copia and Ty3-gypsy retrotransposons were preferentially located in pericentromeric heterochromatin of quinoa chromosomes. Phylogenetic analyses of newly amplified rt fragments together with well-characterized retrotransposon families from other organisms allowed identification of major lineages of retroelements in the genome of quinoa and provided preliminary insight into their evolutionary dynamics.

Fragmentations and rearrangements of metastable [C2H5OS]+ ions

NARCIS (Netherlands)

de Vries, Marcel; Oudman, D; Weringa, WD

1992-01-01

Several [C2H5OS]+ ions with different structures were generated from the appropriate precursors and their metastable ion spectra were determined. Deuterium labelled analogues of some of the [C2H5OS]+ ions were used to elucidate the nature of the observed fragmentations and their mechanisms.

Fragmentation of Andes-to-Amazon connectivity by hydropower dams.

Science.gov (United States)

Anderson, Elizabeth P; Jenkins, Clinton N; Heilpern, Sebastian; Maldonado-Ocampo, Javier A; Carvajal-Vallejos, Fernando M; Encalada, Andrea C; Rivadeneira, Juan Francisco; Hidalgo, Max; Cañas, Carlos M; Ortega, Hernan; Salcedo, Norma; Maldonado, Mabel; Tedesco, Pablo A

2018-01-01

Andes-to-Amazon river connectivity controls numerous natural and human systems in the greater Amazon. However, it is being rapidly altered by a wave of new hydropower development, the impacts of which have been previously underestimated. We document 142 dams existing or under construction and 160 proposed dams for rivers draining the Andean headwaters of the Amazon. Existing dams have fragmented the tributary networks of six of eight major Andean Amazon river basins. Proposed dams could result in significant losses in river connectivity in river mainstems of five of eight major systems-the Napo, Marañón, Ucayali, Beni, and Mamoré. With a newly reported 671 freshwater fish species inhabiting the Andean headwaters of the Amazon (>500 m), dams threaten previously unrecognized biodiversity, particularly among endemic and migratory species. Because Andean rivers contribute most of the sediment in the mainstem Amazon, losses in river connectivity translate to drastic alteration of river channel and floodplain geomorphology and associated ecosystem services.

Self-organized criticality in fragmenting

DEFF Research Database (Denmark)

Oddershede, L.; Dimon, P.; Bohr, J.

1993-01-01

The measured mass distributions of fragments from 26 fractured objects of gypsum, soap, stearic paraffin, and potato show evidence of obeying scaling laws; this suggests the possibility of self-organized criticality in fragmenting. The probability of finding a fragment scales inversely to a power...

Production of Energetic Light Fragments in Spallation Reactions

Directory of Open Access Journals (Sweden)

Mashnik Stepan G.

2014-03-01

Full Text Available Different reaction mechanisms contribute to the production of light fragments (LF from nuclear reactions. Available models cannot accurately predict emission of LF from arbitrary reactions. However, the emission of LF is important formany applications, such as cosmic-ray-induced single event upsets, radiation protection, and cancer therapy with proton and heavy-ion beams, to name just a few. The cascade-exciton model (CEM and the Los Alamos version of the quark-gluon string model (LAQGSM, as implemented in the CEM03.03 and LAQGSM03.03 event generators used in the Los Alamos Monte Carlo transport code MCNP6, describe quite well the spectra of fragments with sizes up to 4He across a broad range of target masses and incident energies. However, they do not predict high-energy tails for LF heavier than 4He. The standard versions of CEM and LAQGSM do not account for preequilibrium emission of LF larger than 4He. The aim of our work is to extend the preequilibrium model to include such processes. We do this by including the emission of fragments heavier than 4He at the preequilibrium stage, and using an improved version of the Fermi Break-up model, providing improved agreement with various experimental data.

Energy production using fission fragment rockets

International Nuclear Information System (INIS)

Chapline, G.; Matsuda, Y.

1991-08-01

Fission fragment rockets are nuclear reactors with a core consisting of thin fibers in a vacuum, and which use magnetic fields to extract the fission fragments from the reactor core. As an alternative to ordinary nuclear reactors, fission fragment rockets would have the following advantages: Approximately twice as efficient if one can directly convert the fission fragment energy into electricity; by reducing the buildup of a fission fragment inventory in the reactor one could avoid a Chernobyl type disaster; and collecting the fission fragments outside the reactor could simplify the waste disposal problem. 6 refs., 4 figs., 2 tabs

Fragmentation of relativistic nuclei

International Nuclear Information System (INIS)

Cork, B.

1975-06-01

Nuclei with energies of several GeV/n interact with hadrons and produce fragments that encompass the fields of nuclear physics, meson physics, and particle physics. Experimental results are now available to explore problems in nuclear physics such as the validity of the shell model to explain the momentum distribution of fragments, the contribution of giant dipole resonances to fragment production cross sections, the effective Coulomb barrier, and nuclear temperatures. A new approach to meson physics is possible by exploring the nucleon charge-exchange process. Particle physics problems are explored by measuring the energy and target dependence of isotope production cross sections, thus determining if limiting fragmentation and target factorization are valid, and measuring total cross sections to determine if the factorization relation, sigma/sub AB/ 2 = sigma/sub AA/ . sigma/sub BB/, is violated. Also, new experiments have been done to measure the angular distribution of fragments that could be explained as nuclear shock waves, and to explore for ultradense matter produced by very heavy ions incident on heavy atoms. (12 figures, 2 tables)

Detection of fission fragments by secondary emission; Detection des fragments de fission par emission secondaire

Energy Technology Data Exchange (ETDEWEB)

Audias, A [Commissariat a l' Energie Atomique, Saclay (France). Centre d' Etudes Nucleaires

1965-07-01

This fission fragment detecting apparatus is based on the principle that fragments traversing a thin foil will cause emission of secondary electrons. These electrons are then accelerated (10 kV) and directly detected by means of a plastic scintillator and associated photomultiplier. Some of the advantages of such a detector are, its rapidity, its discriminating power between alpha particles and fission fragments, its small energy loss in detecting the fragments and the relatively great amount of fissionable material which it can contain. This paper is subdivided as follows: a) theoretical considerations b) constructional details of apparatus and some experimental details and c) a study of the secondary emission effect itself. (author) [French] Le detecteur de fragments de fission que nous avons realise est base sur le principe de l'emission secondaire produite par les fragments de fission traversant une feuille mince: les electrons secondaires emis sont acceleres a des tensions telles (de l'ordre de 10 kV), qu'ils soient directement detectables par un scintillateur plastique associe a un photomultiplicateur. L'interet d'un tel detecteur reside: dans sa rapidite, sa tres bonne discrimination alpha, fission, la possibilite de detecter les fragments de fission avec une perte d'energie pouvant rester relativement faible, et la possibilite d'introduire des quantites de matiere fissile plus importantes que dans les autres types de detecteurs. Ce travail comporte: -) un apercu bibliographique de la theorie du phenomene, -) realisation et mise au point du detecteur avec etude experimentale de quelques parametres intervenant dans l'emission secondaire, -) etude de l'emission secondaire (sur la face d'emergence des fragments de fission) en fonction de l'energie du fragment et en fonction de l'epaisseur de matiere traversee avant emission secondaire, et -) une etude comparative de l'emission secondaire sur la face d'incidence et sur la face d'emergence des fragments de

Evaluation of interim and final waste forms for the newly generated liquid low-level waste flowsheet

International Nuclear Information System (INIS)

Abotsi, G.M.K.; Bostick, D.T.; Beck, D.E.

1996-05-01

The purpose of this review is to evaluate the final forms that have been proposed for radioactive-containing solid wastes and to determine their application to the solid wastes that will result from the treatment of newly generated liquid low-level waste (NGLLLW) and Melton Valley Storage Tank (MVST) supernate at the Oak Ridge National Laboratory (ORNL). Since cesium and strontium are the predominant radionuclides in NGLLLW and MVST supernate, this review is focused on the stabilization and solidification of solid wastes containing these radionuclides in cement, glass, and polymeric materials-the principal waste forms that have been tested with these types of wastes. Several studies have shown that both cesium and strontium are leached by distilled water from solidified cement, although the leachabilities of cesium are generally higher than those of strontium under similar conditions. The situation is exacerbated by the presence of sulfates in the solution, as manifested by cracking of the grout. Additives such as bentonite, blast-furnace slag, fly ash, montmorillonite, pottery clay, silica, and zeolites generally decrease the cesium and strontium release rates. Longer cement curing times (>28 d) and high ionic strengths of the leachates, such as those that occur in seawater, also decrease the leach rates of these radionuclides. Lower cesium leach rates are observed from vitrified wastes than from grout waste forms. However, significant quantities of cesium are volatilized due to the elevated temperatures required to vitrify the waste. Hence, vitrification will generally require the use of cleanup systems for the off-gases to prevent their release into the atmosphere

Thermodynamics of the fuel fragmentation gas

International Nuclear Information System (INIS)

Perez, R.B.; Alsmiller, R.G. Jr.

1977-01-01

In the context of nuclear reactor safety studies, a program is in progress at ORNL whereby fuel-fragmentation situations are mocked up by the application of high-current capacitor discharges through solid UO 2 samples. The goal of the present work is to predict such quantities as the number of gas and liquid fragments and their energy distributions. The point of view adopted is that upon fragmentation, a cloud of UO 2 vapor is formed containing ''primeval'' liquid fragments which act as condensation centers. In the evolution of time, fragment growth is controlled by nucleation, coagulation and evaporation processes. Eventually, the vapor-droplet system will reach a situation in which clusters (fragments) of various sizes and UO 2 vapor will coexist in an ''association-disassociation'' equilibrium. Thus, the physical model considered here consists of the identification of the fragmentation gas with an ''imperfect'' vapor, made up of interacting UO 2 vapor and liquid fragments. The results of the study are presented

The dual role of fragments in fragment-assembly methods for de novo protein structure prediction

Science.gov (United States)

Handl, Julia; Knowles, Joshua; Vernon, Robert; Baker, David; Lovell, Simon C.

2013-01-01

In fragment-assembly techniques for protein structure prediction, models of protein structure are assembled from fragments of known protein structures. This process is typically guided by a knowledge-based energy function and uses a heuristic optimization method. The fragments play two important roles in this process: they define the set of structural parameters available, and they also assume the role of the main variation operators that are used by the optimiser. Previous analysis has typically focused on the first of these roles. In particular, the relationship between local amino acid sequence and local protein structure has been studied by a range of authors. The correlation between the two has been shown to vary with the window length considered, and the results of these analyses have informed directly the choice of fragment length in state-of-the-art prediction techniques. Here, we focus on the second role of fragments and aim to determine the effect of fragment length from an optimization perspective. We use theoretical analyses to reveal how the size and structure of the search space changes as a function of insertion length. Furthermore, empirical analyses are used to explore additional ways in which the size of the fragment insertion influences the search both in a simulation model and for the fragment-assembly technique, Rosetta. PMID:22095594

Models of fragmentation with composite power laws

Science.gov (United States)

Tavassoli, Z.; Rodgers, G. J.

1999-06-01

Some models for binary fragmentation are introduced in which a time dependent transition size produces two regions of fragment sizes above and below the transition size. In the first model we assume a fixed rate of fragmentation for the largest fragment and two different rates of fragmentation in the two regions of sizes above and below the transition size. The model is solved exactly in the long time limit to reveal stable time-invariant solutions for the fragment size and mass distributions. These solutions exhibit composite power law behaviours; power laws with two different exponents for fragments in smaller and larger regions. A special case of the model with no fragmentation in the smaller size region is also examined. Another model is also introduced which have three regions of fragment sizes with different rates of fragmentation. The similarities between the stable distributions in our models and composite power law distributions from experimental work on shock fragmentation of long thin glass rods and thick clay plates are discussed.

Kinetics of fragmentation-annihilation processes

OpenAIRE

Filipe, JAN; Rodgers, GJ

1996-01-01

We investigate the kinetics of systems in which particles of one species undergo binary fragmentation and pair annihilation. In the latter, nonlinear process, fragments react at collision to produce an inert species, causing loss of mass. We analyze these systems in the reaction-limited regime by solving a continuous model within the mean-field approximation. The rate of fragmentation for a particle of mass x to break into fragments of masses y and x-y has the form x(lambda-1) (lambda > 0), a...

Fission fragment spins and spectroscopy

International Nuclear Information System (INIS)

Durell, J.L.

1988-01-01

Prompt γ-ray coincidence experiments have been carried out on γ-rays emitted from post-neutron emission fission fragments produced by the aup 19F + 197 Au and 18 O + 232 Th reactions. Decay schemes have been established for even-even nuclei ranging from 78 Se to 148 Nd. Many new states with spin up to ∼ 12h have been observed. Apart from providing a wealth of new information on the spectroscopy of neutron-rich nuclei, the data have been analyzed to determine the average spin of primary fission fragments as a function of fragment mass. The results suggest that the fragment spins are determined by the temperature and shape of the primary fragments at or near to scission

Measurement of a MMP-2 degraded Titin fragment in serum reflects changes in muscle turnover induced by atrophy

DEFF Research Database (Denmark)

Sun, S; Henriksen, K; Karsdal, M A

2014-01-01

used to assess biological and clinical relevance. RESULTS: A technically robust ELISA measuring the Titin fragment was developed against a Titin peptide fragment identified in human urine. The fragment was shown to be produced primarily by MMP-2 cleavage of Titin. In the rat muscle DEX induced atrophy...... model, Titin-MMP2 fragment was decreased in the beginning of DEX treatment, and then significantly increased later on during DEX administration. In the human bed rest study, the Titin-MMP2 fragment was initially decreased 11.9 (±3.7) % after 1day of bed rest, and then gradually increased ending up...... at a 16.4 (±4.6) % increase at day 47. CONCLUSIONS: We developed a robust ELISA measuring a muscle derived MMP-2 generated Titin degradation fragment in rat and human serum. Importantly, the fragment can be measured in serum and that these levels are related to induction of skeletal muscle atrophy....

Differential fragmentation patterns of pectin oligogalacturonides observed by nanoelectrospray quadrupole ion-trap mass spectrometry using automated spectra interpretation

DEFF Research Database (Denmark)

Mutenda, Kudzai E; Matthiesen, Rune; Roepstorff, Peter

2007-01-01

Oligogalacturonides of different degrees of polymerization (DP) and methyl esterification (DE) were structurally analyzed by nanoESI quadrupole ion-trap mass spectrometry. The fragmentation patterns of the oligogalacturonides were compared using the program 'Virtual Expert Mass Spectrometrist...... with free carboxylic acid groups underwent higher water loss compared to fully methyl-esterified oligogalacturonides under the same fragmentation conditions. Cross-ring cleavage, in which fragmentation occurs across the ring system of the galacturonate residue and signified by unique mass losses...... water loss than methyl-esterified ones will be postulated. In addition, the VEMS program was extended to automatically interpret and assign the fragment ions peaks generated in this study....

Generating West Nile Virus from an Infectious Clone.

Science.gov (United States)

Vandergaast, Rianna; Fredericksen, Brenda L

2016-01-01

WNV infectious clones are valuable tools for elucidating WNV biology. Nevertheless, relatively few infectious WNV clones have been generated because their construction is hampered by the instability of flaviviral genomes. More recently, advances in cloning techniques as well as the development of several two-plasmid WNV infectious clone systems have facilitated the generation of WNV infectious clones. Here we described a protocol for recovering WNV from a two-plasmid system. In this approach, large quantities of these constructs are digested with restriction enzymes to produce complementary restriction sites at the 3' end of the upstream fragment and the 5' end of the downstream fragment. These fragments are then annealed to produce linear template for in vitro transcription to synthesize infectious RNA. The resulting RNA is transfected into cells and after several days WNV is recovered in the culture supernatant. This method can be used to generate virus from infectious clones encoding high- and low-pathogenicity strains of WNV, as well as chimeric virues.

Fragmentation of atomic clusters: A theoretical study

International Nuclear Information System (INIS)

Lopez, M.J.; Jellinek, J.

1994-01-01

Collisionless fragmentation of nonrotating model n-atom metal clusters (n=12, 13, and 14) is studied using isoergic molecular-dynamics simulations. Minimum-energy paths for fragmentation are mapped out as functions of the distance between the centers of mass of the fragments. These paths provide information on the fragmentation energies for the different fragmentation channels. Fragmentation patterns (distributions of the fragmentation channel probabilities) and global and channel-specific fragmentation rate constants are computed and analyzed as functions of the internal energy and of the size of the clusters. The trends derived from the dynamics are compared with those obtained using the RRK and TST statistical approaches. The dynamics of the fragmentation process is analyzed in terms of characteristic quantities such as the distance between the centers of mass of the fragments, their relative translational energy, and their interaction energy, all considered as functions of time

Fragmentation of DNA affects the accuracy of the DNA quantitation by the commonly used methods

Directory of Open Access Journals (Sweden)

Sedlackova Tatiana

2013-02-01

Full Text Available Abstract Background Specific applications and modern technologies, like non-invasive prenatal testing, non-invasive cancer diagnostic and next generation sequencing, are currently in the focus of researchers worldwide. These have common characteristics in use of highly fragmented DNA molecules for analysis. Hence, for the performance of molecular methods, DNA concentration is a crucial parameter; we compared the influence of different levels of DNA fragmentation on the accuracy of DNA concentration measurements. Results In our comparison, the performance of the currently most commonly used methods for DNA concentration measurement (spectrophotometric, fluorometric and qPCR based were tested on artificially fragmented DNA samples. In our comparison, unfragmented and three specifically fragmented DNA samples were used. According to our results, the level of fragmentation did not influence the accuracy of spectrophotometric measurements of DNA concentration, while other methods, fluorometric as well as qPCR-based, were significantly influenced and a decrease in measured concentration was observed with more intensive DNA fragmentation. Conclusions Our study has confirmed that the level of fragmentation of DNA has significant impact on accuracy of DNA concentration measurement with two of three mostly used methods (PicoGreen and qPCR. Only spectrophotometric measurement was not influenced by the level of fragmentation, but sensitivity of this method was lowest among the three tested. Therefore if it is possible the DNA quantification should be performed with use of equally fragmented control DNA.

An experimental comparative study of radiography, ultrasonography and CT imaging in the IV catheter fragment

International Nuclear Information System (INIS)

Kweon, Dae Cheol

2016-01-01

The objective of this study was to detect the fragments generated during IV (intravenous) catheter injection of contrast medium and drug administration in a clinical setting and removal was performed by experimentally producing a phantom, and to compare the radiography, ultrasonography, and multi-detector computed tomography (MDCT) imaging and radiation dose. A 1 cm fragment of an 18 gage Teflon® IV catheter with saline was inserted into the IV control line. Radiography, CT, and ultrasonography were performed and radiography and CT dose were calculated. CT and ultrasonography showed an IV catheter fragment clinically and radiography showed no visible difference in the ability to provide a useful image of an IV catheter fragment modality (p >.05). Radiography of effective dose (0.2139 mSv·Gy-1·cm-2) form DAP DAP (0.93 μGy·m2 ), and dose length product (DLP) (201 mGy·cm) to effective dose was calculated as 0.483 mSv. IV catheter fragment were detected of radiography, ultrasonography and CT. These results can be obtained by menas of an excellent IV catheter fragment of detection capability CT. However, CT is followed by radiation exposure. IV catheter fragment confirming the position and information recommend an ultrasonography

TRU [transuranic] waste certification compliance requirements for acceptance of newly generated contact-handled wastes to be shipped to the Waste Isolation Pilot Plant: Revision 2

International Nuclear Information System (INIS)

1989-01-01

Compliance requirements are presented for certifying that unclassified, newly generated (NG), contact-handled (CH) transuranic (TRU) solid wastes from defense programs meet the Waste Isolation Pilot Plant (WIPP) Waste Acceptance Criteria (WAC). Where appropriate, transportation and interim storage requirements are incorporated; however, interim storage sites may have additional requirements consistent with these requirements. All applicable Department of Energy (DOE) orders must continue to be met. The compliance requirements for stored or buried waste are not addressed in this document. The compliance requirements are divided into four sections, primarily determined by the general feature that the requirements address. These sections are General Requirements, Waste Container Requirements, Waste Form Requirements, and Waste Package Requirements. The waste package is the combination of waste container and waste. 10 refs., 1 fig

DNA fragmentation in spermatozoa

DEFF Research Database (Denmark)

Rex, A S; Aagaard, J.; Fedder, J

2017-01-01

Sperm DNA Fragmentation has been extensively studied for more than a decade. In the 1940s the uniqueness of the spermatozoa protein complex which stabilizes the DNA was discovered. In the fifties and sixties, the association between unstable chromatin structure and subfertility was investigated....... In the seventies, the impact of induced DNA damage was investigated. In the 1980s the concept of sperm DNA fragmentation as related to infertility was introduced as well as the first DNA fragmentation test: the Sperm Chromatin Structure Assay (SCSA). The terminal deoxynucleotidyl transferase nick end labelling...... (TUNEL) test followed by others was introduced in the nineties. The association between DNA fragmentation in spermatozoa and pregnancy loss has been extensively investigated spurring the need for a therapeutic tool for these patients. This gave rise to an increased interest in the aetiology of DNA damage...

Photon-hadron fragmentation: theoretical situation

International Nuclear Information System (INIS)

Peschanski, R.

1983-07-01

Using a selection of new experimental results models of hadronic fragmentation and their phenomenological comparison are presented. Indeed a convenient theory of hadronic fragmentation -for instance based on Q.C.D.- does not exist: low transverse momentum fragmentation involves the badly known hadronic long-range forces. Models should clarify the situation in the prospect of an eventual future theory

Experimental study of dynamic fragmentation of shockloaded metals below and above melting

Directory of Open Access Journals (Sweden)

De Rességuier T.

2010-06-01

Full Text Available The breakout and reflection of a strong shock-wave upon the free surface of a metallic sample may lead to ejecta production of many types. Spall fracture is due to tensile stresses which result from the interaction of the incident and the reflected release waves. When the sample remains in solid state, one or several layers of finite thickness, called spalls, can be created and ejected. When melting is initiated during shock-wave propagation, tensile stresses are generated in a liquid medium and lead to the creation of an expanding cloud of liquid debris. This phenomenon, sometimes referred to as microspalling, consists in a dynamic fragmentation process in the melted material. The present paper is devoted to the experimental investigation of the transition from spall fracture in solid state to the micro-spalling process in molten metals. This study, realized on tin and on iron, involves different shock generators (gas gun, pulsed laser… and diagnostics (velocimetry, high-speed optical shadowgraphy, fragments recovery.

Recent progress on perturbative QCD fragmentation functions

International Nuclear Information System (INIS)

Cheung, K.

1995-05-01

The recent development of perturbative QCD (PQCD) fragmentation functions has strong impact on quarkonium production. I shall summarize B c meson production based on these PQCD fragmentation functions, as well as, the highlights of some recent activities on applying these PQCD fragmentation functions to explain anomalous J/ψ and ψ' production at the Tevatron. Finally, I discuss a fragmentation model based on the PQCD fragmentation functions for heavy quarks fragmenting into heavy-light mesons

Interactions between colloidal silver and photosynthetic pigments located in cyanobacteria fragments and in solution.

Science.gov (United States)

Siejak, Przemysław; Frackowiak, Danuta

2007-09-25

Changes in the yield of the fluorescence emitted by pigments of photosynthetic organisms could be used for the establishment of the presence of some toxic substances. The presence of colloidal metals can be indicated by enhancement of pigments' emission as a result of plasmons generation. The spectra of the pigments of cyanobacterium Synechocystis located in the bacterium fragments and in solutions with and without colloidal silver additions have been measured. The quantum yield of the pigments' fluorescence in solution has been observed to increase at some wavelength of excitation, while the fluorescence of the pigments in the bacteria fragments has been only quenched as a consequence of interactions with colloidal silver particles. Close contact between pigment molecules located in bacteria fragments and silver particles is probably not possible. We plan in future to investigate the influence of other, more typical metal pollutants of water, using similar spectral methods and several other photosynthetic bacteria pigments, in solution, in cell fragments and in the whole bacteria organisms.

Fragmentation and flow in central collisions

International Nuclear Information System (INIS)

Jacak, B.V.; Doss, K.G.R.; Gustafsson, H.A.

1987-01-01

Investigation of the fragmentation mechanism requires the measurement of complicated observables. To identify what part of the reacting system gives rise to the fragments, it would be useful to tag them as participants or spectators. A large acceptance for all the reaction products and an event-by-event measurement of the fragment multiplicity is required to distinguish fragment formation via sequential emission from a large equilibrated system and multifragmentation. In order to address whether fragments are formed early or late in the collision, information about the dynamical evolution of the reaction is necessary. This can be provided by study of the global properties of the events. This paper discusses experimental techniques applicable to studying fragmentation processes. 25 refs., 8 figs

Long-term effects of fragmentation and fragment properties on bird species richness in Hawaiian forests

Science.gov (United States)

David J. Flaspohler; Christian P. Giardina; Gregory P. Asner; Patrick Hart; Jonathan Price; Cassie Ka’apu Lyons; Xeronimo. Castaneda

2010-01-01

Forest fragmentation is a common disturbance affecting biological diversity, yet the impacts of fragmentation on many forest processes remain poorly understood. Forest restoration is likely to be more successful when it proceeds with an understanding of how native and exotic vertebrates utilize forest patches of different size. We used a system of forest fragments...

FragIdent – Automatic identification and characterisation of cDNA-fragments

Directory of Open Access Journals (Sweden)

Goehler Heike

2009-03-01

Full Text Available Abstract Background Many genetic studies and functional assays are based on cDNA fragments. After the generation of cDNA fragments from an mRNA sample, their content is at first unknown and must be assigned by sequencing reactions or hybridisation experiments. Even in characterised libraries, a considerable number of clones are wrongly annotated. Furthermore, mix-ups can happen in the laboratory. It is therefore essential to the relevance of experimental results to confirm or determine the identity of the employed cDNA fragments. However, the manual approach for the characterisation of these fragments using BLAST web interfaces is not suited for larger number of sequences and so far, no user-friendly software is publicly available. Results Here we present the development of FragIdent, an application for the automatic identification of open reading frames (ORFs within cDNA-fragments. The software performs BLAST analyses to identify the genes represented by the sequences and suggests primers to complete the sequencing of the whole insert. Gene-specific information as well as the protein domains encoded by the cDNA fragment are retrieved from Internet-based databases and included in the output. The application features an intuitive graphical interface and is designed for researchers without any bioinformatics skills. It is suited for projects comprising up to several hundred different clones. Conclusion We used FragIdent to identify 84 cDNA clones from a yeast two-hybrid experiment. Furthermore, we identified 131 protein domains within our analysed clones. The source code is freely available from our homepage at http://compbio.charite.de/genetik/FragIdent/.

Mass spectrometry for fragment screening.

Science.gov (United States)

Chan, Daniel Shiu-Hin; Whitehouse, Andrew J; Coyne, Anthony G; Abell, Chris

2017-11-08

Fragment-based approaches in chemical biology and drug discovery have been widely adopted worldwide in both academia and industry. Fragment hits tend to interact weakly with their targets, necessitating the use of sensitive biophysical techniques to detect their binding. Common fragment screening techniques include differential scanning fluorimetry (DSF) and ligand-observed NMR. Validation and characterization of hits is usually performed using a combination of protein-observed NMR, isothermal titration calorimetry (ITC) and X-ray crystallography. In this context, MS is a relatively underutilized technique in fragment screening for drug discovery. MS-based techniques have the advantage of high sensitivity, low sample consumption and being label-free. This review highlights recent examples of the emerging use of MS-based techniques in fragment screening. © 2017 The Author(s). Published by Portland Press Limited on behalf of the Biochemical Society.

Fragmentation of sperm DNA using the TUNEL method.

Science.gov (United States)

Chenlo, P H; Curi, S M; Pugliese, M N; Ariagno, J I; Sardi-Segovia, M; Furlan, M J; Repetto, H E; Zeitler, E; Cohen, M; Mendeluk, G R

2014-11-01

To establish the validity of the TUNEL assay in determining sperm DNA fragmentation, the relationship between the degree of fragmentation and the seminal parameters and the sample needed to conduct the test. We used semen samples from healthy fertile men (n=33), patients who consulted for infertility with a prescription for the TUNEL assay (n=77) and patients with intracytoplasmic sperm injection failure (n=20), analyzed according to the 2010 WHO. The TUNEL/propidium iodide test was performed by flow cytometry, on baseline and post-swim-up samples. The cutoff value for the TUNEL assay (ROC curves) was 26%, with a sensitivity and specificity of 85% and 89%, respectively. The pre-swim-up and post-swim-up medians of the results from the TUNEL assay showed no significant differences (17.0% vs. 12.9%, respectively). However, 39.1% of the samples showed a difference greater than 15 in absolute value between the results of the baseline and post-swim-up TUNEL assays. The linear correlation study of the morphology, mobility and vitality using the post-swim-up TUNEL assay showed a greater correlation than preselection, with significant results (r: -0.394, P<.0001; r: -0.461, P<.0001; r: -0.526, P<.0001). The TUNEL assay is a valid test for clinical use. DNA fragmentation is a factor independent from traditional semen tests. We found a greater susceptibility to damage generated in the laboratory procedures in the samples with lower quality. The sample of choice for evaluating DNA fragmentation will depend on whether the clinician is treating a natural or assisted fertilization. Copyright © 2014 AEU. Published by Elsevier Espana. All rights reserved.

Universal odd-even staggering in isotopic fragmentation and spallation cross sections of neutron-rich fragments

Science.gov (United States)

Mei, B.; Tu, X. L.; Wang, M.

2018-04-01

An evident odd-even staggering (OES) in fragment cross sections has been experimentally observed in many fragmentation and spallation reactions. However, quantitative comparisons of this OES effect in different reaction systems are still scarce for neutron-rich nuclei near the neutron drip line. By employing a third-order difference formula, the magnitudes of this OES in extensive experimental cross sections are systematically investigated for many neutron-rich nuclei with (N -Z ) from 1 to 23 over a broad range of atomic numbers (Z ≈3 -50 ). A comparison of these magnitude values extracted from fragment cross sections measured in different fragmentation and spallation reactions with a large variety of projectile-target combinations over a wide energy range reveals that the OES magnitude is almost independent of the projectile-target combinations and the projectile energy. The weighted average of these OES magnitudes derived from cross sections accurately measured in different reaction systems is adopted as the evaluation value of the OES magnitude. These evaluated OES magnitudes are recommended to be used in fragmentation and spallation models to improve their predictions for fragment cross sections.

Fragmentation reduces regional-scale spatial genetic structure in a wind-pollinated tree because genetic barriers are removed.

Science.gov (United States)

Wang, Rong; Compton, Stephen G; Shi, Yi-Su; Chen, Xiao-Yong

2012-09-01

Gene flow strongly influences the regional genetic structuring of plant populations. Seed and pollen dispersal patterns can respond differently to the increased isolation resulting from habitat fragmentation, with unpredictable consequences for gene flow and population structuring. In a recently fragmented landscape we compared the pre- and post-fragmentation genetic structure of populations of a tree species where pollen and seed dispersal respond differentially to forest fragmentation generated by flooding. Castanopsis sclerophylla is wind-pollinated, with seeds that are dispersed by gravity and rodents. Using microsatellites, we found no significant difference in genetic diversity between pre- and post-fragmentation cohorts. Significant genetic structure was observed in pre-fragmentation cohorts, due to an unknown genetic barrier that had isolated one small population. Among post-fragmentation cohorts this genetic barrier had disappeared and genetic structure was significantly weakened. The strengths of genetic structuring were at a similar level in both cohorts, suggesting that overall gene flow of C. sclerophylla has been unchanged by fragmentation at the regional scale. Fragmentation has blocked seed dispersal among habitats, but this appears to have been compensated for by enhanced pollen dispersal, as indicated by the disappearance of a genetic barrier, probably as a result of increased wind speeds and easier pollen movement over water. Extensive pollen flow can counteract some negative effects of fragmentation and assist the long-term persistence of small remnant populations.

Profitable, plug and play dispersed generation: the future?

NARCIS (Netherlands)

Graaff, de R.A.A.; Enslin, J.H.R.

2007-01-01

Historically, each generation of power plants has tended to be larger than its predecessor. In the 1980s, however, the size of newly constructed generating units began to decrease. The relatively small new generating units are usually connected to distribution networks, which are not designed to

Physics of projectile fragments

International Nuclear Information System (INIS)

Minamisono, Tadanori

1982-01-01

This is a study report on the polarization phenomena of the projectile fragments produced by heavy ion reactions, and the beta decay of fragments. The experimental project by using heavy ions with the energy from 50 MeV/amu to 250 MeV/amu was designed. Construction of an angle-dispersion spectrograph for projectile fragments was proposed. This is a two-stage spectrograph. The first stage is a QQDQQ type separator, and the second stage is QDQD type. Estimation shows that Co-66 may be separated from the nuclei with mass of 65 and 67. The orientation of fragments can be measured by detecting beta-ray. The apparatus consists of a uniform field magnet, an energy absorber, a stopper, a RF coil and a beta-ray hodoscope. This system can be used for not only this purpose but also for the measurement of hyperfine structure. (Kato, T.)

Fragment virtual screening based on Bayesian categorization for discovering novel VEGFR-2 scaffolds.

Science.gov (United States)

Zhang, Yanmin; Jiao, Yu; Xiong, Xiao; Liu, Haichun; Ran, Ting; Xu, Jinxing; Lu, Shuai; Xu, Anyang; Pan, Jing; Qiao, Xin; Shi, Zhihao; Lu, Tao; Chen, Yadong

2015-11-01

The discovery of novel scaffolds against a specific target has long been one of the most significant but challengeable goals in discovering lead compounds. A scaffold that binds in important regions of the active pocket is more favorable as a starting point because scaffolds generally possess greater optimization possibilities. However, due to the lack of sufficient chemical space diversity of the databases and the ineffectiveness of the screening methods, it still remains a great challenge to discover novel active scaffolds. Since the strengths and weaknesses of both fragment-based drug design and traditional virtual screening (VS), we proposed a fragment VS concept based on Bayesian categorization for the discovery of novel scaffolds. This work investigated the proposal through an application on VEGFR-2 target. Firstly, scaffold and structural diversity of chemical space for 10 compound databases were explicitly evaluated. Simultaneously, a robust Bayesian classification model was constructed for screening not only compound databases but also their corresponding fragment databases. Although analysis of the scaffold diversity demonstrated a very unevenly distribution of scaffolds over molecules, results showed that our Bayesian model behaved better in screening fragments than molecules. Through a literature retrospective research, several generated fragments with relatively high Bayesian scores indeed exhibit VEGFR-2 biological activity, which strongly proved the effectiveness of fragment VS based on Bayesian categorization models. This investigation of Bayesian-based fragment VS can further emphasize the necessity for enrichment of compound databases employed in lead discovery by amplifying the diversity of databases with novel structures.

Formation of plasma around wire fragments created by electrically exploded copper wire

International Nuclear Information System (INIS)

Taylor, Michael J.

2002-01-01

The physical processes occurring during the electrical explosion of metallic conductors has attracted interest for many years. Applications include circuit breakers, segmented lightning divertor strips for aircraft radomes, disruption of metallic shaped charge jets, plasma armatures for electromagnetic railguns and plasma generators for electrothermal-chemical guns. Recent work has cited the phenomenology of the fragmentation processes, particularly the development of a plasma around the lower resistance condensed fragments. An understanding of both the fragmentation process and the development of the accompanying formation of plasma is essential for the optimization of devices that utilize either of these phenomena. With the use of x-radiography and fast photography, this paper explores the wire explosion process, in particular the relationship between the fragmentation, plasma development and resistance rise that occurs during this period. A hypothesis is put forward to account for the development of plasma around the condensed wire fragments. Experimental parameters used in this study are defined. Wires studied were typically copper, with a diameter of 1 mm and length in excess of 150 mm. Circuit inductance used were from 26 to 800 μH. This relatively high circuit inductance gave circuit rise times less than 180 MA s -1 , slow with respect to many other exploding wire studies. Discharge duration ranged from 0.8 to 10 ms. (author)

MRI of displaced meniscal fragments

International Nuclear Information System (INIS)

Dunoski, Brian; Zbojniewicz, Andrew M.; Laor, Tal

2012-01-01

A torn meniscus frequently requires surgical fixation or debridement as definitive treatment. Meniscal tears with associated fragment displacement, such as bucket handle and flap tears, can be difficult to recognize and accurately describe on MRI, and displaced fragments can be challenging to identify at surgery. A displaced meniscal fragment can be obscured by synovium or be in a location not usually evaluated at arthroscopy. We present a pictorial essay of meniscal tears with displaced fragments in patients referred to a pediatric hospital in order to increase recognition and accurate interpretation by the radiologist, who in turn can help assist the surgeon in planning appropriate therapy. (orig.)

MRI of displaced meniscal fragments

Energy Technology Data Exchange (ETDEWEB)

Dunoski, Brian [University of Cincinnati College of Medicine, Department of Radiology, Cincinnati Children' s Hospital Medical Center, Cincinnati, OH (United States); Children' s Hospital of Michigan, Department of Radiology, Detroit, MI (United States); Zbojniewicz, Andrew M.; Laor, Tal [University of Cincinnati College of Medicine, Department of Radiology, Cincinnati Children' s Hospital Medical Center, Cincinnati, OH (United States)

2012-01-15

A torn meniscus frequently requires surgical fixation or debridement as definitive treatment. Meniscal tears with associated fragment displacement, such as bucket handle and flap tears, can be difficult to recognize and accurately describe on MRI, and displaced fragments can be challenging to identify at surgery. A displaced meniscal fragment can be obscured by synovium or be in a location not usually evaluated at arthroscopy. We present a pictorial essay of meniscal tears with displaced fragments in patients referred to a pediatric hospital in order to increase recognition and accurate interpretation by the radiologist, who in turn can help assist the surgeon in planning appropriate therapy. (orig.)

Dimensional crossover in fragmentation

Science.gov (United States)

Sotolongo-Costa, Oscar; Rodriguez, Arezky H.; Rodgers, G. J.

2000-11-01

Experiments in which thick clay plates and glass rods are fractured have revealed different behavior of fragment mass distribution function in the small and large fragment regions. In this paper we explain this behavior using non-extensive Tsallis statistics and show how the crossover between the two regions is caused by the change in the fragments’ dimensionality during the fracture process. We obtain a physical criterion for the position of this crossover and an expression for the change in the power-law exponent between the small and large fragment regions. These predictions are in good agreement with the experiments on thick clay plates.

Comparing forest fragmentation and its drivers in China and the USA with Globcover v2.2

Science.gov (United States)

Chen, Mingshi; Mao, Lijun; Zhou, Chunguo; Vogelmann, James E.; Zhu, Zhiliang

2010-01-01

Forest loss and fragmentation are of major concern to the international community, in large part because they impact so many important environmental processes. The main objective of this study was to assess the differences in forest fragmentation patterns and drivers between China and the conterminous United States (USA). Using the latest 300-m resolution global land cover product, Globcover v2.2, a comparative analysis of forest fragmentation patterns and drivers was made. The fragmentation patterns were characterized by using a forest fragmentation model built on the sliding window analysis technique in association with landscape indices. Results showed that China’s forests were substantially more fragmented than those of the USA. This was evidenced by a large difference in the amount of interior forest area share, with China having 48% interior forest versus the 66% for the USA. China’s forest fragmentation was primarily attributed to anthropogenic disturbances, driven particularly by agricultural expansion from an increasing and large population, as well as poor forest management practices. In contrast, USA forests were principally fragmented by natural land cover types. However, USA urban sprawl contributed more to forest fragmentation than in China. This is closely tied to the USA’s economy, lifestyle and institutional processes. Fragmentation maps were generated from this study, which provide valuable insights and implications regarding habitat planning for rare and endangered species. Such maps enable development of strategic plans for sustainable forest management by identifying areas with high amounts of human-induced fragmentation, which improve risk assessments and enable better targeting for protection and remediation efforts. Because forest fragmentation is a long-term, complex process that is highly related to political, institutional, economic and philosophical arenas, both nations need to take effective and comprehensive measures to mitigate

Analysis of multi-fragmentation reactions induced by relativistic heavy ions using the statistical multi-fragmentation model

Energy Technology Data Exchange (ETDEWEB)

Ogawa, T., E-mail: ogawa.tatsuhiko@jaea.go.jp [Research Group for Radiation Protection, Division of Environment and Radiation Sciences, Nuclear Science and Engineering Directorate, Japan Atomic Energy Agency, Shirakata-Shirane, Tokai, Ibaraki 319-1195 (Japan); Sato, T.; Hashimoto, S. [Research Group for Radiation Protection, Division of Environment and Radiation Sciences, Nuclear Science and Engineering Directorate, Japan Atomic Energy Agency, Shirakata-Shirane, Tokai, Ibaraki 319-1195 (Japan); Niita, K. [Research Organization for Information Science and Technology, Shirakata-shirane, Tokai, Ibaraki 319-1188 (Japan)

2013-09-21

The fragmentation cross-sections of relativistic energy nucleus–nucleus collisions were analyzed using the statistical multi-fragmentation model (SMM) incorporated with the Monte-Carlo radiation transport simulation code particle and heavy ion transport code system (PHITS). Comparison with the literature data showed that PHITS-SMM reproduces fragmentation cross-sections of heavy nuclei at relativistic energies better than the original PHITS by up to two orders of magnitude. It was also found that SMM does not degrade the neutron production cross-sections in heavy ion collisions or the fragmentation cross-sections of light nuclei, for which SMM has not been benchmarked. Therefore, SMM is a robust model that can supplement conventional nucleus–nucleus reaction models, enabling more accurate prediction of fragmentation cross-sections.

Analysis of multi-fragmentation reactions induced by relativistic heavy ions using the statistical multi-fragmentation model

International Nuclear Information System (INIS)

Ogawa, T.; Sato, T.; Hashimoto, S.; Niita, K.

2013-01-01

The fragmentation cross-sections of relativistic energy nucleus–nucleus collisions were analyzed using the statistical multi-fragmentation model (SMM) incorporated with the Monte-Carlo radiation transport simulation code particle and heavy ion transport code system (PHITS). Comparison with the literature data showed that PHITS-SMM reproduces fragmentation cross-sections of heavy nuclei at relativistic energies better than the original PHITS by up to two orders of magnitude. It was also found that SMM does not degrade the neutron production cross-sections in heavy ion collisions or the fragmentation cross-sections of light nuclei, for which SMM has not been benchmarked. Therefore, SMM is a robust model that can supplement conventional nucleus–nucleus reaction models, enabling more accurate prediction of fragmentation cross-sections

Cross-Linking Mast Cell Specific Gangliosides Stimulates the Release of Newly Formed Lipid Mediators and Newly Synthesized Cytokines

Directory of Open Access Journals (Sweden)

Edismauro Garcia Freitas Filho

2016-01-01

Full Text Available Mast cells are immunoregulatory cells that participate in inflammatory processes. Cross-linking mast cell specific GD1b derived gangliosides by mAbAA4 results in partial activation of mast cells without the release of preformed mediators. The present study examines the release of newly formed and newly synthesized mediators following ganglioside cross-linking. Cross-linking the gangliosides with mAbAA4 released the newly formed lipid mediators, prostaglandins D2 and E2, without release of leukotrienes B4 and C4. The effect of cross-linking these gangliosides on the activation of enzymes in the arachidonate cascade was then investigated. Ganglioside cross-linking resulted in phosphorylation of cytosolic phospholipase A2 and increased expression of cyclooxygenase-2. Translocation of 5-lipoxygenase from the cytosol to the nucleus was not induced by ganglioside cross-linking. Cross-linking of GD1b derived gangliosides also resulted in the release of the newly synthesized mediators, interleukin-4, interleukin-6, and TNF-α. The effect of cross-linking the gangliosides on the MAP kinase pathway was then investigated. Cross-linking the gangliosides induced the phosphorylation of ERK1/2, JNK1/2, and p38 as well as activating both NFκB and NFAT in a Syk-dependent manner. Therefore, cross-linking the mast cell specific GD1b derived gangliosides results in the activation of signaling pathways that culminate with the release of newly formed and newly synthesized mediators.

Medicinal chemistry inspired fragment-based drug discovery.

Science.gov (United States)

Lanter, James; Zhang, Xuqing; Sui, Zhihua

2011-01-01

Lead generation can be a very challenging phase of the drug discovery process. The two principal methods for this stage of research are blind screening and rational design. Among the rational or semirational design approaches, fragment-based drug discovery (FBDD) has emerged as a useful tool for the generation of lead structures. It is particularly powerful as a complement to high-throughput screening approaches when the latter failed to yield viable hits for further development. Engagement of medicinal chemists early in the process can accelerate the progression of FBDD efforts by incorporating drug-friendly properties in the earliest stages of the design process. Medium-chain acyl-CoA synthetase 2b and ketohexokinase are chosen as examples to illustrate the importance of close collaboration of medicinal chemists, crystallography, and modeling. Copyright © 2011 Elsevier Inc. All rights reserved.

Fragment-based quantitative structure-activity relationship (FB-QSAR) for fragment-based drug design.

Science.gov (United States)

Du, Qi-Shi; Huang, Ri-Bo; Wei, Yu-Tuo; Pang, Zong-Wen; Du, Li-Qin; Chou, Kuo-Chen

2009-01-30

In cooperation with the fragment-based design a new drug design method, the so-called "fragment-based quantitative structure-activity relationship" (FB-QSAR) is proposed. The essence of the new method is that the molecular framework in a family of drug candidates are divided into several fragments according to their substitutes being investigated. The bioactivities of molecules are correlated with the physicochemical properties of the molecular fragments through two sets of coefficients in the linear free energy equations. One coefficient set is for the physicochemical properties and the other for the weight factors of the molecular fragments. Meanwhile, an iterative double least square (IDLS) technique is developed to solve the two sets of coefficients in a training data set alternately and iteratively. The IDLS technique is a feedback procedure with machine learning ability. The standard Two-dimensional quantitative structure-activity relationship (2D-QSAR) is a special case, in the FB-QSAR, when the whole molecule is treated as one entity. The FB-QSAR approach can remarkably enhance the predictive power and provide more structural insights into rational drug design. As an example, the FB-QSAR is applied to build a predictive model of neuraminidase inhibitors for drug development against H5N1 influenza virus. (c) 2008 Wiley Periodicals, Inc.

Newly Homeless Youth Typically Return Home

OpenAIRE

Milburn, Norweeta G.; Rosenthal, Doreen; Rotheram-Borus, Mary Jane; Mallett, Shelley; Batterham, Philip; Rice, Eric; Solorio, Rosa

2007-01-01

165 newly homeless adolescents from Melbourne, Australia and 261 from Los Angeles, United States were surveyed and followed for two years. Most newly homeless adolescents returned home (70% U.S., 47% Australia) for significant amounts of time (39% U.S., 17% Australia more than 12 months) within two years of becoming homeless.

Fragmentation and disintegration of polymerizing PE particles : role of stress, brittleness and skin

NARCIS (Netherlands)

Keelapandal Ramamoorthy, S.N.

2009-01-01

Morphology control is an important issue in the field of polyolefins as well as catalyst development. New generations of supported catalysts often show complex fragmentation behaviour. A single catalyst particle (catalyst on support) is composed of many micro-grains that are packed together. During

Magma Expansion and Fragmentation in a Propagating Dike (Invited)

Science.gov (United States)

Jaupart, C. P.; Taisne, B.

2010-12-01

edifice. Such behavior can be accounted for by magma fragmentation at the top of a dike. Samples from the Mount St Helens cryptodome had vesiculated and lost some of their gas, and many of them were laced with tuffisite veins. Magma fragmentation within a dike allows efficient degassing due to the combination of three factors. One is that the gas phase is continuous, so that there is no difficulty in separating gas and melt. Furthermore, large internal overpressures are generated, which favors gas expulsion into country rock. A third factor is that dyke ascent is slow, which favours gas loss from the moving magmatic mixture.

Reframing landscape fragmentation's effects on ecosystem services.

Science.gov (United States)

Mitchell, Matthew G E; Suarez-Castro, Andrés F; Martinez-Harms, Maria; Maron, Martine; McAlpine, Clive; Gaston, Kevin J; Johansen, Kasper; Rhodes, Jonathan R

2015-04-01

Landscape structure and fragmentation have important effects on ecosystem services, with a common assumption being that fragmentation reduces service provision. This is based on fragmentation's expected effects on ecosystem service supply, but ignores how fragmentation influences the flow of services to people. Here we develop a new conceptual framework that explicitly considers the links between landscape fragmentation, the supply of services, and the flow of services to people. We argue that fragmentation's effects on ecosystem service flow can be positive or negative, and use our framework to construct testable hypotheses about the effects of fragmentation on final ecosystem service provision. Empirical efforts to apply and test this framework are critical to improving landscape management for multiple ecosystem services. Copyright © 2015 Elsevier Ltd. All rights reserved.

Fragment Size Distribution of Blasted Rock Mass

Science.gov (United States)

Jug, Jasmin; Strelec, Stjepan; Gazdek, Mario; Kavur, Boris

2017-12-01

Rock mass is a heterogeneous material, and the heterogeneity of rock causes sizes distribution of fragmented rocks in blasting. Prediction of blasted rock mass fragmentation has a significant role in the overall economics of opencast mines. Blasting as primary fragmentation can significantly decrease the cost of loading, transport, crushing and milling operations. Blast fragmentation chiefly depends on the specific blast design (geometry of blast holes drilling, the quantity and class of explosive, the blasting form, the timing and partition, etc.) and on the properties of the rock mass (including the uniaxial compressive strength, the rock mass elastic Young modulus, the rock discontinuity characteristics and the rock density). Prediction and processing of blasting results researchers can accomplish by a variety of existing software’s and models, one of them is the Kuz-Ram model, which is possibly the most widely used approach to estimating fragmentation from blasting. This paper shows the estimation of fragmentation using the "SB" program, which was created by the authors. Mentioned program includes the Kuz-Ram model. Models of fragmentation are confirmed and calibrated by comparing the estimated fragmentation with actual post-blast fragmentation from image processing techniques. In this study, the Kuz-Ram fragmentation model has been used for an open-pit limestone quarry in Dalmatia, southern Croatia. The resulting calibrated value of the rock factor enables the quality prognosis of fragmentation in further blasting works, with changed drilling geometry and blast design parameters. It also facilitates simulation in the program to optimize blasting works and get the desired fragmentations of the blasted rock mass.

Selective disulfide reduction for labeling and enhancement of Fab antibody fragments

International Nuclear Information System (INIS)

Kirley, Terence L.; Greis, Kenneth D.; Norman, Andrew B.

2016-01-01

Many methods have been developed for chemical labeling and enhancement of the properties of antibodies and their common fragments, including the Fab and F(ab’) 2 fragments. Somewhat selective reduction of some antibody disulfide bonds has been previously achieved, yielding antibodies and antibody fragments that can be labeled at defined sites, enhancing their utility and properties. Selective reduction of the two hinge disulfide bonds present in F(ab’) 2 fragments using mild reduction has been useful. However, such reduction is often not quantitative and results in the reduction of multiple disulfide bonds, and therefore subsequent multiple labeling or conjugation sites are neither homogenous nor stoichiometric. Here, a simple and efficient selective reduction of the single disulfide bond linking the partial heavy chain and the intact light chain which compose the Fab fragment is accomplished utilizing tris(2-carboxyethyl)phosphine (TCEP) immobilized on agarose beads. The resultant reduced cysteine residues were labeled with several cysteine-selective fluorescent reagents, as well as by cysteine-directed PEGylation. These two cysteine residues can also be re-ligated by means of a bifunctional cysteine cross-linking agent, dibromobimane, thereby both restoring a covalent linkage between the heavy and light chains at this site, far removed from the antigen binding site, and also introducing a fluorescent probe. There are many other research and clinical uses for these selectively partially reduced Fab fragments, including biotinylation, toxin and drug conjugation, and incorporation of radioisotopes, and this technique enables simple generation of very useful Fab fragment derivatives with many potential applications. - Highlights: • TCEP agarose is effective for selective reduction of a single Fab disulfide bond. • This disulfide is solvent accessible and distant from the antigen binding site. • A variety of buffers of varying pHs can be used, simplifying

A Novel Molecular Diagnostic of Glioblastomas: Detection of an Extracellular Fragment of Protein Tyrosine Phosphatase μ

Directory of Open Access Journals (Sweden)

Susan M. Burden-Gulley

2010-04-01

Full Text Available We recently found that normal human brain and low-grade astrocytomas express the receptor protein tyrosine phosphatase mu (PTPμ and that the more invasive astrocytomas, glioblastoma multiforme (GBM, downregulate full-length PTPμ expression. Loss of PTPμ expression in GBMs is due to proteolytic cleavage that generates an intracellular and potentially a cleaved and released extracellular fragment of PTPμ. Here, we identify that a cleaved extracellular fragment containing the domains required for PTPμ-mediated adhesion remains associated with GBM tumor tissue. We hypothesized that detection of this fragment would make an excellent diagnostic tool for the localization of tumor tissue within the brain. To this end, we generated a series of fluorescently tagged peptide probes that bind the PTPμ fragment. The peptide probes specifically recognize GBM cells in tissue sections of surgically resected human tumors. To test whether the peptide probes are able to detect GBM tumors in vivo, the PTPμ peptide probes were tested in both mouse flank and intracranial xenograft human glioblastoma tumor model systems. The glial tumors were molecularly labeled with the PTPμ peptide probes within minutes of tail vein injection using the Maestro FLEX In Vivo Imaging System. The label was stable for at least 3 hours. Together, these results indicate that peptide recognition of the PTPμ extracellular fragment provides a novel molecular diagnostic tool for detection of human glioblastomas. Such a tool has clear translational applications and may lead to improved surgical resections and prognosis for patients with this devastating disease.

Medium-scale melt-sodium fragmentation experiments

International Nuclear Information System (INIS)

Chu, T.Y.; Beattie, A.G.; Drotning, W.D.; Powers, D.A.

1979-01-01

The results of a series of fragmentation experiments involving up to 20 Kg of thermitically produced high temperature melts and 23 Kg of sodium are presented. Except for one experiment where some centimeter size particles are observed, the fragment distributions seem to be in the range of previous data. Spatial distribution of the fragments in the debris bed appears to be stratified. Scanning electron micrographs of fragments indicate fragmentation to be occurring in the molten state for the more intense interactions observed. Interaction data obtained show quiescent periods of 0.5 to 1.5 second between pressure pulses. The force impulse values per unit mass of melt seems to be in the same range as previous experiments

Dual Fragment Impact of PBX Charges

Science.gov (United States)

Haskins, Peter; Briggs, Richard; Leeming, David; White, Nathan; Cheese, Philip; DE&S MoD UK Team; Ordnance Test Solutions Ltd Team

2017-06-01

Fragment impact can pose a significant hazard to many systems containing explosives or propellants. Testing for this threat is most commonly carried out using a single fragment. However, it can be argued that an initial fragment strike (or strikes) could sensitise the energetic material to subsequent impacts, which may then lead to a more violent reaction than would have been predicted based upon single fragment studies. To explore this potential hazard we have developed the capability to launch 2 fragments from the same gun at a range of velocities, and achieve impacts on an acceptor charge with good control over the spatial and temporal separation of the strikes. In this paper we will describe in detail the experimental techniques we have used, both to achieve the dual fragment launch and observe the acceptor charge response. In addition, we will describe the results obtained against PBX filled explosive targets; discuss the mechanisms controlling the target response and their significance for vulnerability assessment. Results of these tests have clearly indicated the potential for detonation upon the second strike, at velocities well below those needed for shock initiation by a single fragment.

Generation of the beta-amyloid peptide and the amyloid precursor protein C-terminal fragment gamma are potentiated by FE65L1.

Science.gov (United States)

Chang, Yang; Tesco, Giuseppina; Jeong, William J; Lindsley, Loren; Eckman, Elizabeth A; Eckman, Christopher B; Tanzi, Rudolph E; Guénette, Suzanne Y

2003-12-19

Members of the FE65 family of adaptor proteins, FE65, FE65L1, and FE65L2, bind the C-terminal region of the amyloid precursor protein (APP). Overexpression of FE65 and FE65L1 was previously reported to increase the levels of alpha-secretase-derived APP (APPs alpha). Increased beta-amyloid (A beta) generation was also observed in cells showing the FE65-dependent increase in APPs alpha. To understand the mechanism for the observed increase in both A beta and APPs alpha given that alpha-secretase cleavage of a single APP molecule precludes A beta generation, we examined the effects of FE65L1 overexpression on APP C-terminal fragments (APP CTFs). Our data show that FE65L1 potentiates gamma-secretase processing of APP CTFs, including the amyloidogenic CTF C99, accounting for the ability of FE65L1 to increase generation of APP C-terminal domain and A beta 40. The FE65L1 modulation of these processing events requires binding of FE65L1 to APP and APP CTFs and is not because of a direct effect on gamma-secretase activity, because Notch intracellular domain generation is not altered by FE65L1. Furthermore, enhanced APP CTF processing can be detected in early endosome vesicles but not in endoplasmic reticulum or Golgi membranes, suggesting that the effects of FE65L1 occur at or near the plasma membrane. Finally, although FE65L1 increases APP C-terminal domain production, it does not mediate the APP-dependent transcriptional activation observed with FE65.

A mechanism of gene amplification driven by small DNA fragments.

Directory of Open Access Journals (Sweden)

Kuntal Mukherjee

Full Text Available DNA amplification is a molecular process that increases the copy number of a chromosomal tract and often causes elevated expression of the amplified gene(s. Although gene amplification is frequently observed in cancer and other degenerative disorders, the molecular mechanisms involved in the process of DNA copy number increase remain largely unknown. We hypothesized that small DNA fragments could be the trigger of DNA amplification events. Following our findings that small fragments of DNA in the form of DNA oligonucleotides can be highly recombinogenic, we have developed a system in the yeast Saccharomyces cerevisiae to capture events of chromosomal DNA amplification initiated by small DNA fragments. Here we demonstrate that small DNAs can amplify a chromosomal region, generating either tandem duplications or acentric extrachromosomal DNA circles. Small fragment-driven DNA amplification (SFDA occurs with a frequency that increases with the length of homology between the small DNAs and the target chromosomal regions. SFDA events are triggered even by small single-stranded molecules with as little as 20-nt homology with the genomic target. A double-strand break (DSB external to the chromosomal amplicon region stimulates the amplification event up to a factor of 20 and favors formation of extrachromosomal circles. SFDA is dependent on Rad52 and Rad59, partially dependent on Rad1, Rad10, and Pol32, and independent of Rad51, suggesting a single-strand annealing mechanism. Our results reveal a novel molecular model for gene amplification, in which small DNA fragments drive DNA amplification and define the boundaries of the amplicon region. As DNA fragments are frequently found both inside cells and in the extracellular environment, such as the serum of patients with cancer or other degenerative disorders, we propose that SFDA may be a common mechanism for DNA amplification in cancer cells, as well as a more general cause of DNA copy number variation

Fragmentation of massive dense cores down to ≲ 1000 AU: Relation between fragmentation and density structure

International Nuclear Information System (INIS)

Palau, Aina; Girart, Josep M.; Estalella, Robert; Fuente, Asunción; Fontani, Francesco; Sánchez-Monge, Álvaro; Commerçon, Benoit; Hennebelle, Patrick; Busquet, Gemma; Bontemps, Sylvain; Zapata, Luis A.; Zhang, Qizhou; Di Francesco, James

2014-01-01

In order to shed light on the main physical processes controlling fragmentation of massive dense cores, we present a uniform study of the density structure of 19 massive dense cores, selected to be at similar evolutionary stages, for which their relative fragmentation level was assessed in a previous work. We inferred the density structure of the 19 cores through a simultaneous fit of the radial intensity profiles at 450 and 850 μm (or 1.2 mm in two cases) and the spectral energy distribution, assuming spherical symmetry and that the density and temperature of the cores decrease with radius following power-laws. Even though the estimated fragmentation level is strictly speaking a lower limit, its relative value is significant and several trends could be explored with our data. We find a weak (inverse) trend of fragmentation level and density power-law index, with steeper density profiles tending to show lower fragmentation, and vice versa. In addition, we find a trend of fragmentation increasing with density within a given radius, which arises from a combination of flat density profile and high central density and is consistent with Jeans fragmentation. We considered the effects of rotational-to-gravitational energy ratio, non-thermal velocity dispersion, and turbulence mode on the density structure of the cores, and found that compressive turbulence seems to yield higher central densities. Finally, a possible explanation for the origin of cores with concentrated density profiles, which are the cores showing no fragmentation, could be related with a strong magnetic field, consistent with the outcome of radiation magnetohydrodynamic simulations.

Fragmentation of massive dense cores down to ≲ 1000 AU: Relation between fragmentation and density structure

Energy Technology Data Exchange (ETDEWEB)

Palau, Aina; Girart, Josep M. [Institut de Ciències de l' Espai (CSIC-IEEC), Campus UAB-Facultat de Ciències, Torre C5-parell 2, E-08193 Bellaterra, Catalunya (Spain); Estalella, Robert [Departament d' Astronomia i Meteorologia (IEEC-UB), Institut de Ciències del Cosmos, Universitat de Barcelona, Martí i Franquès, 1, E-08028 Barcelona (Spain); Fuente, Asunción [Observatorio Astronómico Nacional, P.O. Box 112, E-28803 Alcalá de Henares, Madrid (Spain); Fontani, Francesco; Sánchez-Monge, Álvaro [Osservatorio Astrofisico di Arcetri, INAF, Lago E. Fermi 5, I-50125 Firenze (Italy); Commerçon, Benoit; Hennebelle, Patrick [Laboratoire de Radioastronomie, UMR CNRS 8112, École Normale Supérieure et Observatoire de Paris, 24 rue Lhomond, F-75231 Paris Cedex 05 (France); Busquet, Gemma [INAF-Istituto di Astrofisica e Planetologia Spaziali, Area di Recerca di Tor Vergata, Via Fosso Cavaliere 100, I-00133 Roma (Italy); Bontemps, Sylvain [Université de Bordeaux, LAB, UMR 5804, F-33270 Floirac (France); Zapata, Luis A. [Centro de Radioastronomía y Astrofísica, Universidad Nacional Autónoma de México, P.O. Box 3-72, 58090 Morelia, Michoacán (Mexico); Zhang, Qizhou [Harvard-Smithsonian Center for Astrophysics, 60 Garden Street, Cambridge, MA 02138 (United States); Di Francesco, James, E-mail: palau@ieec.uab.es [Department of Physics and Astronomy, University of Victoria, P.O. Box 355, STN CSC, Victoria, BC, V8W 3P6 (Canada)

2014-04-10

In order to shed light on the main physical processes controlling fragmentation of massive dense cores, we present a uniform study of the density structure of 19 massive dense cores, selected to be at similar evolutionary stages, for which their relative fragmentation level was assessed in a previous work. We inferred the density structure of the 19 cores through a simultaneous fit of the radial intensity profiles at 450 and 850 μm (or 1.2 mm in two cases) and the spectral energy distribution, assuming spherical symmetry and that the density and temperature of the cores decrease with radius following power-laws. Even though the estimated fragmentation level is strictly speaking a lower limit, its relative value is significant and several trends could be explored with our data. We find a weak (inverse) trend of fragmentation level and density power-law index, with steeper density profiles tending to show lower fragmentation, and vice versa. In addition, we find a trend of fragmentation increasing with density within a given radius, which arises from a combination of flat density profile and high central density and is consistent with Jeans fragmentation. We considered the effects of rotational-to-gravitational energy ratio, non-thermal velocity dispersion, and turbulence mode on the density structure of the cores, and found that compressive turbulence seems to yield higher central densities. Finally, a possible explanation for the origin of cores with concentrated density profiles, which are the cores showing no fragmentation, could be related with a strong magnetic field, consistent with the outcome of radiation magnetohydrodynamic simulations.

Gallstone fragmentation by control electrohydraulic lithotripsy

International Nuclear Information System (INIS)

Tung, G.A.; Mueller, P.R.; Brink, J.A.; Saini, S.; Picus, D.; Simeone, J.F.; Ferrucci, J.T.

1989-01-01

The authors have performed in vitro contact electrohydraulic lithotripsy (EHL) of 100 gallstones > 10 mm in diameter to identify physical and technical factors that affect fragmentation success. Ninety-one of 100 stones were fragmented with a 3-F electrode (average, seven shocks; range, 1--42); only 12 stones were fragmented with a single shock. Of the nine stones refractory to 50 shocks, four were > 30 mm in diameter and five stones were densely calcified. The most important variable determining power requirements for fragmentation was gallstone size (R = .58), but radiographic calcification of gallstones was also important (R = .47). Stones < 15 mm tended to produce fragments of left-angle 2 mm; stones right-angle 20 mm tended to produce two to five large discrete fragments (P , .05). In addition, lithotripsy could be conducted equally well in 1:1 dilute diatrizoate contrast agent as in 1:6 normal saline, suggesting that contact EHL could be performed under fluoroscopy

Magnetic bead purification of labeled DNA fragments forhigh-throughput capillary electrophoresis sequencing

Energy Technology Data Exchange (ETDEWEB)

Elkin, Christopher; Kapur, Hitesh; Smith, Troy; Humphries, David; Pollard, Martin; Hammon, Nancy; Hawkins, Trevor

2001-09-15

We have developed an automated purification method for terminator sequencing products based on a magnetic bead technology. This 384-well protocol generates labeled DNA fragments that are essentially free of contaminates for less than $0.005 per reaction. In comparison to laborious ethanol precipitation protocols, this method increases the phred20 read length by forty bases with various DNA templates such as PCR fragments, Plasmids, Cosmids and RCA products. Our method eliminates centrifugation and is compatible with both the MegaBACE 1000 and ABIPrism 3700 capillary instruments. As of September 2001, this method has produced over 1.6 million samples with 93 percent averaging 620 phred20 bases as part of Joint Genome Institutes Production Process.

Fragmentation functions approach in pQCD fragmentation phenomena

International Nuclear Information System (INIS)

Rolli, S.

1996-07-01

Next-to-leading order parton fragmentation functions into light mesons are presented. They have been extracted from real and simulated e + e - data and used to predict inclusive single particle distributions at different machines

Characterization of a recombinant humanized anti-cocaine monoclonal antibody and its Fab fragment.

Science.gov (United States)

Kirley, Terence L; Norman, Andrew B

2015-01-01

Variations of post-translational modifications are important for stability and in vivo behavior of therapeutic antibodies. A recombinant humanized anti-cocaine monoclonal antibody (h2E2) was characterized for heterogeneity of N-linked glycosylation and disulfide bonds. In addition, charge heterogeneity, which is partially due to the presence or absence of C-terminal lysine on the heavy chains, was examined. For cocaine overdose therapy, Fab fragments may be therapeutic, and thus, a simplified method of generation, purification, and characterization of the Fab fragment generated by Endoproteinase Lys-C digestion was devised. Both the intact h2E2 antibody and purified Fab fragments were analyzed for their affinities for cocaine and 2 of its metabolites, benzoylecgonine and cocaethylene, by fluorescence quenching of intrinsic antibody tyrosine and tryptophan fluorescence resulting from binding of these drugs. Binding constants obtained from fluorescence quenching measurements are in agreement with recently published radioligand and ELISA binding assays. The dissociation constants determined for the h2E2 monoclonal and its Fab fragment are approximately 1, 5, and 20 nM for cocaethylene, cocaine, and benzoylecgonine, respectively. Tryptophan fluorescence quenching (emission at 330 nm) was measured after either excitation of tyrosine and tryptophan (280 nm) or selective excitation of tryptophan alone (295 nm). More accurate binding constants are obtained using tryptophan selective excitation at 295 nm, likely due to interfering absorption of cocaine and metabolites at 280 nm. These quenching results are consistent with multiple tryptophan and tyrosine residues in or near the predicted binding location of cocaine in a previously published 3-D model of this antibody's variable region.

Formation and fragmentation of radical peptide anions: insights from vacuum ultra violet spectroscopy.

Science.gov (United States)

Brunet, Claire; Antoine, Rodolphe; Dugourd, Philippe; Canon, Francis; Giuliani, Alexandre; Nahon, Laurent

2012-02-01

We have studied the photodissociation of gas-phase deprotonated caerulein anions by vacuum ultraviolet (VUV) photons in the 4.5 to 20 eV range, as provided by the DESIRS beamline at the synchrotron radiation facility SOLEIL (France). Caerulein is a sulphated peptide with three aromatic residues and nine amide bonds. Electron loss is found to be the major relaxation channel at every photon energy. However, an increase in the fragmentation efficiency (neutral losses and peptide backbone cleavages) as a function of the energy is also observed. The oxidized ions, generated by electron photodetachment were further isolated and activated by collision (CID) in a MS(3) scheme. The branching ratios of the different fragments observed by CID as a function of the initial VUV photon energy are found to be independent of the initial photon energy. Thus, there is no memory effect of the initial excitation energy on the fragmentation channels of the oxidized species on the time scale of our tandem MS experiment. We also report photofragment yields as a function of photon energy for doubly deprotonated caerulein ions, for both closed-shell ([M-2H](2-)) non-radical ions and open-shell ([M-3H](2-•)) radical ions. These latter ions are generated by electron photodetachment from [M-3H](3-) precursor ions. The detachment yield increases monotonically with the energy with the appearance of several absorption bands. Spectra for radical and non-radical ions are quite similar in terms of observed bands; however, the VUV fragmentation yield is enhanced by the presence of a radical in caerulein peptides. © American Society for Mass Spectrometry, 2011

Fragmentation of neck-like structures

International Nuclear Information System (INIS)

Montoya, C.; Bowman, D.R.; Peaslee, G.F.; Michigan State Univ., East Lansing, MI

1994-01-01

Evidence for intermediate mass fragment emission from neck-like structures joining projectile- and target-like residues has been observed for peripheral 129 Xe+ nat Cu collisions at E/A=50 MeV. These framents are emitted primarily at velocities intermediate between those of the projectile and the target. Relative to the charge distribution for fragments evaporated from the projectile-like residue, the distribution for ''neck'' emission shows an enhanced emission for fragments with 4 f < 8. (orig.)

Forest Fragments Surrounded by Sugar Cane Are More Inhospitable to Terrestrial Amphibian Abundance Than Fragments Surrounded by Pasture

Directory of Open Access Journals (Sweden)

Paula Eveline Ribeiro D’Anunciação

2013-01-01

Full Text Available In recent years, there has been increasing interest in matrix-type influence on forest fragments. Terrestrial amphibians are good bioindicators for this kind of research because of low vagility and high philopatry. This study compared richness, abundance, and species composition of terrestrial amphibians through pitfall traps in two sets of semideciduous seasonal forest fragments in southeastern Brazil, according to the predominant surrounding matrix (sugar cane and pasture. There were no differences in richness, but fragments surrounded by sugar cane had the lowest abundance of amphibians, whereas fragments surrounded by pastures had greater abundance. The most abundant species, Rhinella ornata, showed no biometric differences between fragment groups but like many other amphibians sampled showed very low numbers of individuals in fragments dominated by sugar cane fields. Our data indicate that the sugar cane matrix negatively influences the community of amphibians present in fragments surrounded by this type of land use.

PARP-1 cleavage fragments: signatures of cell-death proteases in neurodegeneration

Directory of Open Access Journals (Sweden)

Alexander Jonathan S

2010-12-01

Full Text Available Abstract The normal function of poly (ADP-ribose polymerase-1 (PARP-1 is the routine repair of DNA damage by adding poly (ADP ribose polymers in response to a variety of cellular stresses. Recently, it has become widely appreciated that PARP-1 also participates in diverse physiological and pathological functions from cell survival to several forms of cell death and has been implicated in gene transcription, immune responses, inflammation, learning, memory, synaptic functions, angiogenesis and aging. In the CNS, PARP inhibition attenuates injury in pathologies like cerebral ischemia, trauma and excitotoxicity demonstrating a central role of PARP-1 in these pathologies. PARP-1 is also a preferred substrate for several 'suicidal' proteases and the proteolytic action of suicidal proteases (caspases, calpains, cathepsins, granzymes and matrix metalloproteinases (MMPs on PARP-1 produces several specific proteolytic cleavage fragments with different molecular weights. These PARP-1 signature fragments are recognized biomarkers for specific patterns of protease activity in unique cell death programs. This review focuses on specific suicidal proteases active towards PARP-1 to generate signature PARP-1 fragments that can identify key proteases and particular forms of cell death involved in pathophysiology. The roles played by some of the PARP-1 fragments and their associated binding partners in the control of different forms of cell death are also discussed.

Fragmentation of Ceramics in Rapid Expansion Mode

Science.gov (United States)

Maiti, Spandan; Geubelle, Philippe H.; Rangaswamy, Krishnan

The study of the fragmentation process goes back to more than a century, motivated primarily by problems related to mining and ore handling (Grady and Kipp, 1985). Various theories have been proposed to predict the fragmentation stress and the fragment size and distribution. But the investigations are generally case specific and relate to only a narrow set of fragmentation processes. A number of theoretical studies of dynamic fragmentation in a rapidly expanding body can be found in the literature. For example, the study summarized in (Grady, 1982) presents a model based on a simple energy balance concept between the surface energy released due to fracture and the kinetic energy of the fragments. Subsequent refinements of the energy balance model have been proposed by (Glenn and Chudnovsky, 1986), which take into account the strain energy of the fragments and specify a threshold stress below which no fragmentation occurs. These models assume that the fracture events are instantaneous and occur simultaneously. Evidently, these assumptions are quite restrictive and these models can not take into account the transient nature of the fragmentation process after the onset of fracture in the material. A more recent model proposed by (Miller et al., 1999) however takes into account this time-dependent nature of the fragmentation event and the distribution of flaws of various strengths in the original material.

Thermochemical Fragment Energy Method for Biomolecules: Application to a Collagen Model Peptide.

Science.gov (United States)

Suárez, Ernesto; Díaz, Natalia; Suárez, Dimas

2009-06-09

Herein, we first review different methodologies that have been proposed for computing the quantum mechanical (QM) energy and other molecular properties of large systems through a linear combination of subsystem (fragment) energies, which can be computed using conventional QM packages. Particularly, we emphasize the similarities among the different methods that can be considered as variants of the multibody expansion technique. Nevertheless, on the basis of thermochemical arguments, we propose yet another variant of the fragment energy methods, which could be useful for, and readily applicable to, biomolecules using either QM or hybrid quantum mechanical/molecular mechanics methods. The proposed computational scheme is applied to investigate the stability of a triple-helical collagen model peptide. To better address the actual applicability of the fragment QM method and to properly compare with experimental data, we compute average energies by carrying out single-point fragment QM calculations on structures generated by a classical molecular dynamics simulation. The QM calculations are done using a density functional level of theory combined with an implicit solvent model. Other free-energy terms such as attractive dispersion interactions or thermal contributions are included using molecular mechanics. The importance of correcting both the intermolecular and intramolecular basis set superposition error (BSSE) in the QM calculations is also discussed in detail. On the basis of the favorable comparison of our fragment-based energies with experimental data and former theoretical results, we conclude that the fragment QM energy strategy could be an interesting addition to the multimethod toolbox for biomolecular simulations in order to investigate those situations (e.g., interactions with metal clusters) that are beyond the range of applicability of common molecular mechanics methods.

Percolation versus microcanonical fragmentation - comparison of fragment size distribution: Where is the liquid-gas transition in nuclei?

International Nuclear Information System (INIS)

Jaqaman, H.R.; Birzeit Univ.; Papp, G.; Eoetvoes Lorand Tudomanyegyetem, Budapest; Gross, D.H.E.; Freie Univ. Berlin

1990-01-01

The distributions of fragments produced by microcanonical multifragmentation of hot nuclei are compared with the cluster distributions predicted by a bond percolation model on a finite lattice. The conditional moments of these distributions are used together with the correlations between the largest three fragments in each event. Whereas percolation and statistical nuclear fragmentation agree in many details as in the usual plots of the averaged moments of the fragment distributions which yield the critical exponents, they turn out to be essentially different when less averaged quantities or correlations are considered. The differences between the predictions of the two models are mainly due to the particularities of the nuclear problem, especially the effect of the long-range Coulomb force which favours the break-up of the highly excited nucleus into two large fragments (pseudo-fission) and, to a somewhat lesser extent, enhances the possibility for the cracking of the nucleus into more than two large fragments. The fission events are, however, clearly separated from a second branch of critical correlations which shows up clearly in both nuclear fragmentation and percolation. We think that this critical correlation branch is due to the liquid-gas phase transition in finite nuclei. (orig.)

Large explosive basaltic eruptions at Katla volcano, Iceland: Fragmentation, grain size and eruption dynamics

Science.gov (United States)

Schmith, Johanne; Höskuldsson, Ármann; Holm, Paul Martin; Larsen, Guðrún

2018-04-01

Katla volcano in Iceland produces hazardous large explosive basaltic eruptions on a regular basis, but very little quantitative data for future hazard assessments exist. Here details on fragmentation mechanism and eruption dynamics are derived from a study of deposit stratigraphy with detailed granulometry and grain morphology analysis, granulometric modeling, componentry and the new quantitative regularity index model of fragmentation mechanism. We show that magma/water interaction is important in the ash generation process, but to a variable extent. By investigating the large explosive basaltic eruptions from 1755 and 1625, we document that eruptions of similar size and magma geochemistry can have very different fragmentation dynamics. Our models show that fragmentation in the 1755 eruption was a combination of magmatic degassing and magma/water-interaction with the most magma/water-interaction at the beginning of the eruption. The fragmentation of the 1625 eruption was initially also a combination of both magmatic and phreatomagmatic processes, but magma/water-interaction diminished progressively during the later stages of the eruption. However, intense magma/water interaction was reintroduced during the final stages of the eruption dominating the fine fragmentation at the end. This detailed study of fragmentation changes documents that subglacial eruptions have highly variable interaction with the melt water showing that the amount and access to melt water changes significantly during eruptions. While it is often difficult to reconstruct the progression of eruptions that have no quantitative observational record, this study shows that integrating field observations and granulometry with the new regularity index can form a coherent model of eruption evolution.

The formation of planets by disc fragmentation

Directory of Open Access Journals (Sweden)

Stamatellos Dimitris

2013-04-01

Full Text Available I discuss the role that disc fragmentation plays in the formation of gas giant and terrestrial planets, and how this relates to the formation of brown dwarfs and low-mass stars, and ultimately to the process of star formation. Protostellar discs may fragment, if they are massive enough and can cool fast enough, but most of the objects that form by fragmentation are brown dwarfs. It may be possible that planets also form, if the mass growth of a proto-fragment is stopped (e.g. if this fragment is ejected from the disc, or suppressed and even reversed (e.g by tidal stripping. I will discuss if it is possible to distinguish whether a planet has formed by disc fragmentation or core accretion, and mention of a few examples of observed exoplanets that are suggestive of formation by disc fragmentation.

Extraction of 16th Century Calender Fragments

DEFF Research Database (Denmark)

Holck, Jakob Povl; Etheridge, Christian

at the Cultural Heritage & Archaeometric Research Team, SDU. Upon finding medieval manuscript fragments in the university library’s special collections, scholars at the Centre for Medieval Literature are consulted. In most cases, digital pictures of the finds will circulate in the international community...... fragments may require extensive use of Big Data and other forms of analysis in order to be identified. Usually, the university library prefers not to remove the fragments from their “fragment carriers”. In order to read fragments that are only partially visible or invisible, x-ray technology may be deployed...... of medieval scholars. Thousands of 16th and 17th Century books are stored in the University Library of Southern Denmark. One out of five of these books is expected to contain medieval manuscript fragments or fragments of rare prints, e.g. incunabula....

Thermal fragmentation and deactivation of combustion-generated soot particles

KAUST Repository

Raj, Abhijeet

2014-09-01

The effect of thermal treatment on diesel soot and on a commercial soot in an inert environment under isothermal conditions at intermediate temperatures (400-900°C) is studied. Two important phenomena are observed in both the soot samples: soot fragmentation leading to its mass loss, and loss of soot reactivity towards O2. Several experimental techniques such as high resolution transmission electron microscopy, electron energy loss spectroscopy, thermo-gravimetric analysis with mass spectrometry, elemental analysis, Fourier transform infrared spectroscopy and X-ray diffraction have been used to identify the changes in structures, functional groups such as oxygenates and aliphatics, σ and π bonding, O/C and H/C ratios, and crystallite parameters of soot particles, introduced by heat. A decrease in the size of primary particles and an increase in the average polycyclic aromatic hydrocarbon (PAH) size was observed in soots after thermal treatment. The activation energies of soot oxidation for thermally treated soot samples were found to be higher than those for the untreated ones at most conversion levels. The cyclic or acyclic aliphatics with sp3 hybridization were present in significant amounts in all the soot samples, but their concentration decreased with thermal treatment. Interestingly, the H/C and the O/C ratios of soot particles increased after thermal treatment, and thus, they do not support the decrease in soot reactivity. The increase in the concentration of oxygenates on soot surface indicate that their desorption from soot surface in the form of CO, CO2 and other oxygenated compounds may not be significant at the temperatures (400-900°C) studied in this work. © 2014 The Combustion Institute.

Construction of a 3D-shaped, natural product like fragment library by fragmentation and diversification of natural products.

Science.gov (United States)

Prescher, Horst; Koch, Guido; Schuhmann, Tim; Ertl, Peter; Bussenault, Alex; Glick, Meir; Dix, Ina; Petersen, Frank; Lizos, Dimitrios E

2017-02-01

A fragment library consisting of 3D-shaped, natural product-like fragments was assembled. Library construction was mainly performed by natural product degradation and natural product diversification reactions and was complemented by the identification of 3D-shaped, natural product like fragments available from commercial sources. In addition, during the course of these studies, novel rearrangements were discovered for Massarigenin C and Cytochalasin E. The obtained fragment library has an excellent 3D-shape and natural product likeness, covering a novel, unexplored and underrepresented chemical space in fragment based drug discovery (FBDD). Copyright © 2016 Elsevier Ltd. All rights reserved.

Menadione-induced DNA fragmentation without 8-oxo-2'-deoxyguanosine formation in isolated rat hepatocytes

DEFF Research Database (Denmark)

Fischer-Nielsen, A; Corcoran, G B; Poulsen, H E

1995-01-01

Menadione (2-methyl-1,4-naphthoquinone) induces oxidative stress in cells causing perturbations in the cytoplasm as well as nicking of DNA. The mechanisms by which DNA damage occurs are still unclear, but a widely discussed issue is whether menadione-generated reactive oxygen species (ROS) directly...... damage DNA. In the present study, we measured the effect of menadione on formation of 7,8-dihydro-8-oxo-2'-deoxyguanosine (8-oxodG), an index of oxidative DNA base modifications, and on DNA fragmentation. Isolated hepatocytes from phenobarbital-pretreated rats were exposed to menadione, 25-400 micro......M, for 15, 90 or 180 min with or without prior depletion of reduced glutathione (GSH) by diethyl maleate. Menadione caused profound GSH depletion and internucleosomal DNA fragmentation, which was demonstrated by a prominent fragmentation ladder on agarose gel electrophoresis. We found no oxidative...

A novel method for in Situ detection of hydrolyzable casein fragments in a cheese matrix by antibody phage display technique and CLSM

DEFF Research Database (Denmark)

Duan, Zhi; Brüggemann, Dagmar Adeline; Siegumfeldt, Henrik

2009-01-01

three small synthetic peptides of the alpha(s1)-casein sequence. These peptides traverse enzymatic cleavage sites of casein during cheese ripening. The specificity of the generated anti-peptide antibodies was determined by ELISA and Western blot. Finally, an immunofluorescent labeling protocol......A novel method to monitor in situ hydrolyzable casein fragments during cheese ripening by using immunofluorescent labeling and confocal laser scanning microscopy (CLSM) was developed. Monoclonal single chain variable fragments of antibody (scFvs) were generated by antibody phage display toward...

The spectroscopy of fission fragments

International Nuclear Information System (INIS)

Phillips, W.R.

1998-01-01

High-resolution measurements on γ rays from fission fragments have provided a rich source of information, unobtainable at the moment in any other way, on the spectroscopy of neutron-rich nuclei. In recent years important data have been obtained on the yrast- and near yrast-structure of neutron-rich fission fragments. We discuss the scope of measurements which can be made on prompt gamma rays from secondary fission fragments, the techniques used in the experiments and some results recently obtained. (author)

Insulin-Like Growth Factor Binding Protein 4 Fragments Provide Incremental Prognostic Information on Cardiovascular Events in Patients With ST-Segment Elevation Myocardial Infarction

DEFF Research Database (Denmark)

Hjortebjerg, Rikke; Lindberg, Søren; Pedersen, Sune

2017-01-01

BACKGROUND: Fragments of insulin-like growth factor binding protein 4 (IGFBP-4) are potential new biomarkers for cardiac risk assessment. The fragments are generated on specific cleavage by pregnancy-associated plasma protein-A, which exerts proatherogenic activity. This study investigated the pr...

Immunoparesis in newly diagnosed Multiple Myeloma patients

DEFF Research Database (Denmark)

Sorrig, Rasmus; Klausen, Tobias W.; Salomo, Morten

2017-01-01

Immunoparesis (hypogammaglobulinemia) is associated to an unfavorable prognosis in newly diagnosed Multiple myeloma (MM) patients. However, this finding has not been validated in an unselected population-based cohort. We analyzed 2558 newly diagnosed MM patients in the Danish Multiple Myeloma...

Velocity distribution of fragments of catastrophic impacts

Science.gov (United States)

Takagi, Yasuhiko; Kato, Manabu; Mizutani, Hitoshi

1992-01-01

Three dimensional velocities of fragments produced by laboratory impact experiments were measured for basalts and pyrophyllites. The velocity distribution of fragments obtained shows that the velocity range of the major fragments is rather narrow, at most within a factor of 3 and that no clear dependence of velocity on the fragment mass is observed. The NonDimensional Impact Stress (NDIS) defined by Mizutani et al. (1990) is found to be an appropriate scaling parameter to describe the overall fragment velocity as well as the antipodal velocity.

Fragmentation in DNA double-strand breaks

International Nuclear Information System (INIS)

Wei Zhiyong; Suzhou Univ., Suzhou; Zhang Lihui; Li Ming; Fan Wo; Xu Yujie

2005-01-01

DNA double strand breaks are important lesions induced by irradiations. Random breakage model or quantification supported by this concept is suitable to analyze DNA double strand break data induced by low LET radiation, but deviation from random breakage model is more evident in high LET radiation data analysis. In this work we develop a new method, statistical fragmentation model, to analyze the fragmentation process of DNA double strand breaks. After charged particles enter the biological cell, they produce ionizations along their tracks, and transfer their energies to the cells and break the cellular DNA strands into fragments. The probable distribution of the fragments is obtained under the condition in which the entropy is maximum. Under the approximation E≅E 0 + E 1 l + E 2 l 2 , the distribution functions are obtained as exp(αl + βl 2 ). There are two components, the one proportional to exp(βl 2 ), mainly contributes to the low mass fragment yields, the other component, proportional to exp(αl), decreases slowly as the mass of the fragments increases. Numerical solution of the constraint equations provides parameters α and β. Experimental data, especially when the energy deposition is higher, support the statistical fragmentation model. (authors)

Fission fragment yields from heavy-ion-induced reactions measured with a fragment separator

Science.gov (United States)

Tarasov, O. B.; Delaune, O.; Farget, F.; Morrissey, D. J.; Amthor, A. M.; Bastin, B.; Bazin, D.; Blank, B.; Cacéres, L.; Chbihi, A.; Fernández-Dominguez, B.; Grévy, S.; Kamalou, O.; Lukyanov, S. M.; Mittig, W.; Pereira, J.; Perrot, L.; Saint-Laurent, M.-G.; Savajols, H.; Sherrill, B. M.; Stodel, C.; Thomas, J. C.; Villari, A. C.

2018-04-01

The systematic study of fission fragment yields under different initial conditions has provided valuable experimental data for benchmarking models of fission product yields. Nuclear reactions using inverse kinematics coupled to the use of a high-resolution spectrometer with good fragment identification are shown here to be a powerful tool to measure the inclusive isotopic yields of fission fragments. In-flight fusion-fission was used in this work to produce secondary beams of neutron-rich isotopes in the collisions of a 238U beam at 24 MeV/u with 9Be and 12C targets at GANIL using the LISE3 fragment separator. Unique identification of the A, Z, and atomic charge state, q, of fission products was attained with the Δ E- TKE-B ρ- ToF measurement technique. Mass, and atomic number distributions are reported for the two reactions. The results show the importance of different reaction mechanisms in the two cases. The optimal target material for higher yields of neutron-rich high- Z isotopes produced in fusion-fission reactions as a function of projectile energy is discussed.

An Alternative to Conventional Rock Fragmentation Methods Using SCDA: A Review

Directory of Open Access Journals (Sweden)

Radhika Vidanage De Silva

2016-11-01

Full Text Available Global energy and material consumption are expected to rise in exponential proportions during the next few decades, generating huge demands for deep earth energy (oil/gas recovery and mineral processing. Under such circumstances, the continuation of existing methods in rock fragmentation in such applications is questionable due to the proven adverse environmental impacts associated with them. In this regard; the possibility of using more environmentally friendly options as Soundless Chemical Demolition Agents (SCDAs play a vital role in replacing harmful conventional rock fragmentation techniques for gas; oil and mineral recovery. This study reviews up to date research on soundless cracking demolition agent (SCDA application on rock fracturing including its limitations and strengths, possible applications in the petroleum industry and the possibility of using existing rock fragmentation models for SCDA-based rock fragmentation; also known as fracking. Though the expansive properties of SCDAs are currently used in some demolition works, the poor usage guidelines available reflect the insufficient research carried out on its material’s behavior. SCDA is a cementitious powdery substance with quicklime (CaO as its primary ingredient that expands upon contact with water; which results in a huge expansive pressure if this CaO hydration reaction occurs in a confined condition. So, the mechanism can be used for rock fragmentation by injecting the SCDA into boreholes of a rock mass; where the resulting expansive pressure is sufficient to create an effective fracture network in the confined rock mass around the borehole. This expansive pressure development, however, dependent on many factors, where formation water content creates a negative influence on this due to required greater degree of hydration under greater water contents and temperature creates a positive influence by accelerating the reaction. Having a precise understanding of the fracture

Fragment emission from modestly excited nuclear systems

Energy Technology Data Exchange (ETDEWEB)

Lou, Y. [Indiana Univ., Bloomington, IN (United States). Dept. of Chemistry]|[Indiana Univ., Bloomington, IN (United States). Cyclotron Facility; Souza, R.T. de [Indiana Univ., Bloomington, IN (United States). Dept. of Chemistry]|[Indiana Univ., Bloomington, IN (United States). Cyclotron Facility; Chen, S.L. [Indiana Univ., Bloomington, IN (United States). Dept. of Chemistry]|[Indiana Univ., Bloomington, IN (United States). Cyclotron Facility; Cornell, E.W. [Indiana Univ., Bloomington, IN (United States). Dept. of Chemistry]|[Indiana Univ., Bloomington, IN (United States). Cyclotron Facility; Davin, B. [Indiana Univ., Bloomington, IN (United States). Dept. of Chemistry]|[Indiana Univ., Bloomington, IN (United States). Cyclotron Facility; Fox, D. [Indiana Univ., Bloomington, IN (United States). Dept. of Chemistry]|[Indiana Univ., Bloomington, IN (United States). Cyclotron Facility; Hamilton, T.M. [Indiana Univ., Bloomington, IN (United States). Dept. of Chemistry]|[Indiana Univ., Bloomington, IN (United States). Cyclotron Facility; Mcdonald, K. [Indiana Univ., Bloomington, IN (United States). Dept. of Chemistry]|[Indiana Univ., Bloomington, IN (United States). Cyclotron Facility; Tsang, M.B. [Michigan State Univ., East Lansing, MI (United States). National Superconducting Cyclotron Lab.; Glasmacher, T. [Michigan State Univ., East Lansing, MI (United States). National Superconducting Cyclotron Lab.; Dinius, J. [Michigan State Univ., East Lansing, MI (United States). National Superconducting Cyclotron Lab.; Gelbke, C.K. [Michigan State Univ., East Lansing, MI (United States). National Superconducting Cyclotron Lab.; Handzy, D.O. [Indiana Univ., Bloomington, IN (United States). Dept. of Chemistry]|[Indiana Univ., Bloomington, IN (United States). Cyclotron Facility]|[Michigan State Univ., East Lansing, MI (United States). National Superconducting Cyclotron Lab.; Hsi, W.C.

1996-07-08

Fragment emission patterns occurring in nuclear systems of modest excitation are studied. Exclusive measurement of fragment emission in {sup 14}N+{sup 197}Au reactions at E/A=100, 130 and 156 MeV allows selection of central collisions where a single source dominates the decay. Low threshold measurement of IMF emission for these events allows investigation of the influence of detector threshold effects. The time scale of fragment emission is deduced using fragment-fragment velocity correlations. Comparisons are made to the predictions of a statistical decay model. (orig.).

The spectroscopy of fission fragments

Energy Technology Data Exchange (ETDEWEB)

Phillips, W.R. [Department of Physics and Astronomy, University of Manchester, Manchester, M13 9PL (United Kingdom); Collaboration: La Direction des Sciences de la Matiere du CEA (FR); Le Fonds National de la Recherche Scientifique de Belgique (BE)

1998-12-31

High-resolution measurements on {gamma} rays from fission fragments have provided a rich source of information, unobtainable at the moment in any other way, on the spectroscopy of neutron-rich nuclei. In recent years important data have been obtained on the yrast- and near yrast-structure of neutron-rich fission fragments. We discuss the scope of measurements which can be made on prompt gamma rays from secondary fission fragments, the techniques used in the experiments and some results recently obtained. (author) 24 refs., 8 figs., 1 tab.

Endovascular Removal of Fractured Inferior Vena Cava Filter Fragments: 5-Year Registry Data with Prospective Outcomes on Retained Fragments.

Science.gov (United States)

Kesselman, Andrew J; Hoang, Nam Sao; Sheu, Alexander Y; Kuo, William T

2018-06-01

To evaluate the safety and efficacy of attempted percutaneous filter fragment removal during retrieval of fractured inferior vena cava (IVC) filters and to report outcomes associated with retained filter fragments. Over a 5-year period, 82 consecutive patients presenting with a fractured IVC filter were prospectively enrolled into an institutional review board-approved registry. There were 27 men and 55 women (mean, 47 y; range, 19-85 y). After main filter removal, percutaneous removal of fragments was attempted if they were deemed intravascular and accessible on preprocedural computed tomography (CT), cone-beam CT, and/or intravascular ultrasound; distal pulmonary artery (PA) fragments were left alone. A total of 185 fragments were identified (81 IVC, 33 PA, 16 cardiac, 2 hepatic vein, 1 renal vein, 1 aorta, 51 retroperitoneal). Mean filter dwell time was 2,183 days (range, 59-9,936 d). Eighty-seven of 185 fragments (47%) were deemed amenable to attempted removal: 65 IVC, 11 PA, 8 cardiac, 2 hepatic, and 1 aortic. Primary safety outcomes were major procedure-related complications. Fragment removal was successful in 78 of 87 cases (89.7%; 95% confidence interval [CI], 81.3-95.2). There were 6 minor complications with no consequence (6.9%; 95% CI, 2.6-14.4) involving intraprocedural fragment embolization and 1 major complication (1.1%; 95% CI, 0.0-6.2), a cardiac tamponade that was successfully treated. The complication rate from attempted cardiac fragment removal was 12.5% (1 of 8; 95% CI, 0.3-52.7). Among patients with retained cardiopulmonary fragments (n = 19), 81% remained asymptomatic during long-term clinical follow-up of 845 days (range, 386-2,071 d). Percutaneous removal of filter fragments from the IVC and proximal PAs is safe and effective overall, but attempted intracardiac fragment removal carries a higher risk of complication. Most residual filter fragments not amenable to percutaneous removal remain asymptomatic and may be monitored clinically

Structure of non-(1-84) PTH fragments secreted by parathyroid glands in primary and secondary hyperparathyroidism.

Science.gov (United States)

D'Amour, Pierre; Brossard, Jean-Hugues; Rousseau, Louise; Nguyen-Yamamoto, Loan; Nassif, Edgard; Lazure, Claude; Gauthier, Dany; Lavigne, Jeffrey R; Zahradnik, Richard J

2005-09-01

similar to the one obtained with his/her serum in each case. These results indicate that non-(1-84) PTH fragments are composed of a family of fragments which may be generated by specific or progressive cleavage at the N region. The longest fragment starts at position 4 and the shortest at position 15. A peptide starting at position 7 appears as the major component of non-(1-84) PTH fragments. The generation process is similar to the one described for smaller C-PTH fragments a number of years ago, suggesting a similar production mechanism and source for all C-PTH fragments.

Fragment Length of Circulating Tumor DNA.

Science.gov (United States)

Underhill, Hunter R; Kitzman, Jacob O; Hellwig, Sabine; Welker, Noah C; Daza, Riza; Baker, Daniel N; Gligorich, Keith M; Rostomily, Robert C; Bronner, Mary P; Shendure, Jay

2016-07-01

Malignant tumors shed DNA into the circulation. The transient half-life of circulating tumor DNA (ctDNA) may afford the opportunity to diagnose, monitor recurrence, and evaluate response to therapy solely through a non-invasive blood draw. However, detecting ctDNA against the normally occurring background of cell-free DNA derived from healthy cells has proven challenging, particularly in non-metastatic solid tumors. In this study, distinct differences in fragment length size between ctDNAs and normal cell-free DNA are defined. Human ctDNA in rat plasma derived from human glioblastoma multiforme stem-like cells in the rat brain and human hepatocellular carcinoma in the rat flank were found to have a shorter principal fragment length than the background rat cell-free DNA (134-144 bp vs. 167 bp, respectively). Subsequently, a similar shift in the fragment length of ctDNA in humans with melanoma and lung cancer was identified compared to healthy controls. Comparison of fragment lengths from cell-free DNA between a melanoma patient and healthy controls found that the BRAF V600E mutant allele occurred more commonly at a shorter fragment length than the fragment length of the wild-type allele (132-145 bp vs. 165 bp, respectively). Moreover, size-selecting for shorter cell-free DNA fragment lengths substantially increased the EGFR T790M mutant allele frequency in human lung cancer. These findings provide compelling evidence that experimental or bioinformatic isolation of a specific subset of fragment lengths from cell-free DNA may improve detection of ctDNA.

DebriSat - A Planned Laboratory-Based Satellite Impact Experiment for Breakup Fragment Characterizations

Science.gov (United States)

Liou, Jer-Chyi; Clark, S.; Fitz-Coy, N.; Huynh, T.; Opiela, J.; Polk, M.; Roebuck, B.; Rushing, R.; Sorge, M.; Werremeyer, M.

2013-01-01

The goal of the DebriSat project is to characterize fragments generated by a hypervelocity collision involving a modern satellite in low Earth orbit (LEO). The DebriSat project will update and expand upon the information obtained in the 1992 Satellite Orbital Debris Characterization Impact Test (SOCIT), which characterized the breakup of a 1960 s US Navy Transit satellite. There are three phases to this project: the design and fabrication of DebriSat - an engineering model representing a modern, 60-cm/50-kg class LEO satellite; conduction of a laboratory-based hypervelocity impact to catastrophically break up the satellite; and characterization of the properties of breakup fragments down to 2 mm in size. The data obtained, including fragment size, area-to-mass ratio, density, shape, material composition, optical properties, and radar cross-section distributions, will be used to supplement the DoD s and NASA s satellite breakup models to better describe the breakup outcome of a modern satellite.

Fragger: a protein fragment picker for structural queries.

Science.gov (United States)

Berenger, Francois; Simoncini, David; Voet, Arnout; Shrestha, Rojan; Zhang, Kam Y J

2017-01-01

Protein modeling and design activities often require querying the Protein Data Bank (PDB) with a structural fragment, possibly containing gaps. For some applications, it is preferable to work on a specific subset of the PDB or with unpublished structures. These requirements, along with specific user needs, motivated the creation of a new software to manage and query 3D protein fragments. Fragger is a protein fragment picker that allows protein fragment databases to be created and queried. All fragment lengths are supported and any set of PDB files can be used to create a database. Fragger can efficiently search a fragment database with a query fragment and a distance threshold. Matching fragments are ranked by distance to the query. The query fragment can have structural gaps and the allowed amino acid sequences matching a query can be constrained via a regular expression of one-letter amino acid codes. Fragger also incorporates a tool to compute the backbone RMSD of one versus many fragments in high throughput. Fragger should be useful for protein design, loop grafting and related structural bioinformatics tasks.

Kaon fragmentation function from NJL-jet model

International Nuclear Information System (INIS)

Matevosyan, Hrayr H.; Thomas, Anthony W.; Bentz, Wolfgang

2010-01-01

The NJL-jet model provides a sound framework for calculating the fragmentation functions in an effective chiral quark theory, where the momentum and isospin sum rules are satisfied without the introduction of ad hoc parameters [1]. Earlier studies of the pion fragmentation functions using the Nambu-Jona-Lasinio (NJL) model within this framework showed good qualitative agreement with the empirical parameterizations. Here we extend the NJL-jet model by including the strange quark. The corrections to the pion fragmentation function and corresponding kaon fragmentation functions are calculated using the elementary quark to quark-meson fragmentation functions from NJL. The results for the kaon fragmentation function exhibit a qualitative agreement with the empirical parameterizations, while the unfavored strange quark fragmentation to pions is shown to be of the same order of magnitude as the unfavored light quark's. The results of these studies are expected to provide important guidance for the analysis of a large variety of semi-inclusive data.

The N-end rule pathway counteracts cell death by destroying proapoptotic protein fragments.

Science.gov (United States)

Piatkov, Konstantin I; Brower, Christopher S; Varshavsky, Alexander

2012-07-03

In the course of apoptosis, activated caspases cleave ∼500 to ∼1,000 different proteins in a mammalian cell. The dynamics of apoptosis involve a number of previously identified, caspase-generated proapoptotic protein fragments, defined as those that increase the probability of apoptosis. In contrast to activated caspases, which can be counteracted by inhibitor of apoptosis proteins, there is little understanding of antiapoptotic responses to proapoptotic protein fragments. One possibility is the regulation of proapoptotic fragments through their selective degradation. The previously identified proapoptotic fragments Cys-RIPK1, Cys-TRAF1, Asp-BRCA1, Leu-LIMK1, Tyr-NEDD9, Arg-BID, Asp-BCL(XL), Arg-BIM(EL), Asp-EPHA4, and Tyr-MET bear destabilizing N-terminal residues. Tellingly, the destabilizing nature (but not necessarily the actual identity) of N-terminal residues of proapoptotic fragments was invariably conserved in evolution. Here, we show that these proapoptotic fragments are short-lived substrates of the Arg/N-end rule pathway. Metabolic stabilization of at least one such fragment, Cys-RIPK1, greatly augmented the activation of the apoptosis-inducing effector caspase-3. In agreement with this understanding, even a partial ablation of the Arg/N-end rule pathway in two specific N-end rule mutants is shown to sensitize cells to apoptosis. We also found that caspases can inactivate components of the Arg/N-end rule pathway, suggesting a mutual suppression between this pathway and proapoptotic signaling. Together, these results identify a mechanistically specific and functionally broad antiapoptotic role of the Arg/N-end rule pathway. In conjunction with other apoptosis-suppressing circuits, the Arg/N-end rule pathway contributes to thresholds that prevent a transient or otherwise weak proapoptotic signal from reaching the point of commitment to apoptosis.

Fragmentation of rotating protostellar clouds

International Nuclear Information System (INIS)

Tohline, J.E.

1980-01-01

We examine, with a three-dimensional hydrodynamic computer code, the behavior of rotating, isothermal gas clouds as they collapse from Jeans unstable configurations, in order to determine whether they are susceptible to fragmentation during the initial dynamic collapse phase of their evolution. We find that a gas cloud will not fragment unless (a) it begins collapsing from a radius much smaller than the Jeans radius (i.e., the cloud initially encloses many Jeans masses) and (b) irregularities in the cloud's initial structure (specifically, density inhomogeneities) enclose more than one Jeans mass of material. Gas pressure smooths out features that are not initially Jeans unstable while rotation plays no direct role in damping inhomogeneities. Instead of fragmenting, most of our models collapse to a ring configuration (as has been observed by other investigators in two-dimensional, axisymmetric models). The rings appear to be less susceptible to gragmentation from arbitrary perturbations in their structure than has previously been indicated in other work. Because our models, which include the effects of gas pressure, do not readily fragment during a phase of dynamic collapse, we suggest that gas clouds in the galactic disk undergo fragmentation only during quasi-equilibrium phases of their evolution

Analysis of Immunogenicity of Intracellular CTAR Fragments of Epstein-Barr Virus Latent Phase Protein LMP1.

Science.gov (United States)

Lomakin, Ya A; Shmidt, A A; Bobik, T V; Chernov, A S; Pyrkov, A Yu; Aleksandrova, N M; Okunola, D O; Vaskina, M I; Ponomarenko, N A; Telegin, G B; Dubina, M V; Belogurov, A A

2017-10-01

Intracellular fragments of latent phase protein LMP1 of Epstein-Barr virus, denoted as CTAR1/2/3, can trigger a variety of cell cascades and contribute to the transforming potential of the virus. Generation of recombinant proteins CTAR1/2/3 is expected to yield more ample data on functional and immunogenic characteristics of LMP1. We created genetic constructs for prokaryotic expression of LMP1 CTAR fragments and selected optimal conditions for their production and purification. Using a new library of LMP1 CTAR fragments, we carried out epitope mapping of a diagnostic anti-LMP1 antibody S12. Analysis of polyclonal serum antibodies from mice immunized with full-length LMP1 confirmed immunogenicity of CTAR elements comparable with that of full-length protein.

Dissertation: Precompound Emission of Energetic Light Fragments in Spallation Reactions

Energy Technology Data Exchange (ETDEWEB)

Kerby, Leslie Marie [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)

2015-08-04

Emission of light fragments (LF) from nuclear reactions is an open question. Different reaction mechanisms contribute to their production; the relative roles of each, and how they change with incident energy, mass number of the target, and the type and emission energy of the fragments is not completely understood. None of the available models are able to accurately predict emission of LF from arbitrary reactions. However, the ability to describe production of LF (especially at energies ≳ 30 MeV) from many reactions is important for different applications, such as cosmic-ray-induced Single Event Upsets (SEUs), radiation protection, and cancer therapy with proton and heavy-ion beams, to name just a few. The Cascade-Exciton Model (CEM) version 03.03 and the Los Alamos version of the Quark-Gluon String Model (LAQGSM) version 03.03 event generators in Monte Carlo N-Particle Transport Code version 6 (MCNP6) describe quite well the spectra of fragments with sizes up to ⁴He across a broad range of target masses and incident energies (up to ~ 5 GeV for CEM and up to ~ 1 TeV/A for LAQGSM). However, they do not predict the high energy tails of LF spectra heavier than ⁴He well. Most LF with energies above several tens of MeV are emitted during the precompound stage of a reaction. The current versions of the CEM and LAQGSM event generators do not account for precompound emission of LF larger than ⁴He. The aim of our work is to extend the precompound model in them to include such processes, leading to an increase of predictive power of LF-production in MCNP6. This entails upgrading the Modified Exciton Model currently used at the preequilibrium stage in CEM and LAQGSM. It also includes expansion and examination of the coalescence and Fermi break-up models used in the precompound stages of spallation reactions within CEM and LAQGSM. Extending our models to include emission of fragments heavier than ⁴He at the precompound stage has indeed provided results that have much

Electroconvulsive stimulation results in long-term survival of newly generated hippocampal neurons in rats

DEFF Research Database (Denmark)

Olesen, Mikkel Vestergaard; Wörtwein, Gitta; Folke, Jonas

2017-01-01

Electroconvulsive stimulation (ECS) is one of the strongest stimulators of hippocampal neurogenesis in rodents that represents a plausible mechanism for the efficacy of electroconvulsive therapy (ECT) in major depressive disorder. Using design-based stereological cell counting, we recently...... in neurogenesis facilitates the behavioral outcome of the forced swim test (FST), an animal model of depression. The results showed that ECS in conjunction with CRS stimulates hippocampal neurogenesis, and that a significant quantity of the newly formed hippocampal neurons survives up to 12 months. The new Brd......U-positive neurons showed time-dependent attrition of ∼40% from day 1 to 3 months, with no further decline between 3 and 12 months. ECS did not affect the number of pre-existing dentate granule neurons or the volume of the dentate granule cell layer, suggesting no damaging effect of the treatment. Finally, we found...

The Zero-Degree Detector system for fragmentation studies

International Nuclear Information System (INIS)

Adams, J.H.; Christl, M.J.; Howell, L.W.; Kuznetsov, E.

2007-01-01

The measurement of nuclear fragmentation cross-sections requires the detection and identification of individual projectile fragments. If light and heavy fragments are recorded in the same detector, it may be impossible to distinguish the signal from the light fragment. To overcome this problem, we have developed the Zero-degree Detector System (ZDDS). The ZDDS enables the measurement of cross-sections for light fragment production by using pixelated detectors to separately measure the signals of each fragment. The system has been used to measure the fragmentation of beams as heavy as Fe at the NASA Space Radiation Laboratory at Brookhaven National Laboratory and the Heavy Ion Medical Accelerator in Chiba, Japan

Mechanisms Affecting Population Density in Fragmented Habitat

Directory of Open Access Journals (Sweden)

Lutz Tischendorf

2005-06-01

Full Text Available We conducted a factorial simulation experiment to analyze the relative importance of movement pattern, boundary-crossing probability, and mortality in habitat and matrix on population density, and its dependency on habitat fragmentation, as well as inter-patch distance. We also examined how the initial response of a species to a fragmentation event may affect our observations of population density in post-fragmentation experiments. We found that the boundary-crossing probability from habitat to matrix, which partly determines the emigration rate, is the most important determinant for population density within habitat patches. The probability of crossing a boundary from matrix to habitat had a weaker, but positive, effect on population density. Movement behavior in habitat had a stronger effect on population density than movement behavior in matrix. Habitat fragmentation and inter-patch distance may have a positive or negative effect on population density. The direction of both effects depends on two factors. First, when the boundary-crossing probability from habitat to matrix is high, population density may decline with increasing habitat fragmentation. Conversely, for species with a high matrix-to-habitat boundary-crossing probability, population density may increase with increasing habitat fragmentation. Second, the initial distribution of individuals across the landscape: we found that habitat fragmentation and inter-patch distance were positively correlated with population density when individuals were distributed across matrix and habitat at the beginning of our simulation experiments. The direction of these relationships changed to negative when individuals were initially distributed across habitat only. Our findings imply that the speed of the initial response of organisms to habitat fragmentation events may determine the direction of observed relationships between habitat fragmentation and population density. The time scale of post-fragmentation

Study of the shape of fragmentation events in central collisions

International Nuclear Information System (INIS)

Nguyen, A.D.; Durand, D.; Bocage, F.; Bougault, R.; Brou, R.; Colin, J; Cussol, D.; Genouin-Duhamel, E.; Gulminelli, F.; Lecolley, J.F.; Lefort, T.; Le Neindre, N.; Lopez, O.; Louvel, M.; Peter, J.; Steckmeyer, J.C.; Tamain, B.; Vient, E.

1997-01-01

The study of the most central collisions resulting in the fragmentation of nuclear systems requires a precise as highly possible knowledge of the space-time configuration of matter. Particularly, it is important to be able to define the event shapes in order to estimate the equilibrium degree reached by the system in the moment of its breakup. To do that, an tensor analysis was developed end applied to data from INDRA for the system Xe + Sn at 50 MeV/u. The obtained results were compared with the predictions of the SIMON generator. The analysis indicates a quasi-sphericity of the fragmentation source. This result is a convincing evidence in favor of formation of a highly excited system in equilibrium the life-time of which is long enough to relax the shape degrees of freedom as well as the internal freedom degrees. A comparison between the experimental results corresponding to the Xe + Sn central collisions at 50 MeV/u and the predictions of a SIMON calculation for different shapes of the fragmenting source is presented as a function of the variables D and C, which are linear combinations of the eigenvalues of the tensor of the moments used for characterisation of the event shape

PET Imaging of Abdominal Aortic Aneurysm with 64Cu-Labeled Anti-CD105 Antibody Fab Fragment.

Science.gov (United States)

Shi, Sixiang; Orbay, Hakan; Yang, Yunan; Graves, Stephen A; Nayak, Tapas R; Hong, Hao; Hernandez, Reinier; Luo, Haiming; Goel, Shreya; Theuer, Charles P; Nickles, Robert J; Cai, Weibo

2015-06-01

The critical challenge in abdominal aortic aneurysm (AAA) research is the accurate diagnosis and assessment of AAA progression. Angiogenesis is a pathologic hallmark of AAA, and CD105 is highly expressed on newly formed vessels. Our goal was to use (64)Cu-labeled anti-CD105 antibody Fab fragment for noninvasive assessment of angiogenesis in the aortic wall in a murine model of AAA. Fab fragment of TRC105, a mAb that specifically binds to CD105, was generated by enzymatic papain digestion and conjugated to NOTA (1,4,7-triazacyclononane-1,4,7-triacetic acid) for (64)Cu labeling. The binding affinity/specificity of NOTA-TRC105-Fab was evaluated by flow cytometry and various ex vivo studies. BALB/c mice were anesthetized and treated with calcium phosphate to induce AAA and underwent weekly PET scans using (64)Cu-NOTA-TRC105-Fab. Biodistribution and autoradiography studies were also performed to confirm the accuracy of PET results. NOTA-TRC105-Fab exhibited high purity and specifically bound to CD105 in vitro. Uptake of (64)Cu-NOTA-TRC105-Fab increased from a control level of 3.4 ± 0.1 to 9.5 ± 0.4 percentage injected dose per gram (%ID/g) at 6 h after injection on day 5 and decreased to 7.2 ± 1.4 %ID/g on day 12, which correlated well with biodistribution and autoradiography studies (i.e., much higher tracer uptake in AAA than normal aorta). Of note, enhanced AAA contrast was achieved, due to the minimal background in the abdominal area of mice. Degradation of elastic fibers and highly expressed CD105 were observed in ex vivo studies. (64)Cu-NOTA-TRC105-Fab cleared rapidly through the kidneys, which enabled noninvasive PET imaging of the aorta with enhanced contrast and showed increased angiogenesis (CD105 expression) during AAA. (64)Cu-NOTA-TRC105-Fab PET may potentially be used for future diagnosis and prognosis of AAA. © 2015 by the Society of Nuclear Medicine and Molecular Imaging, Inc.

Quark fragmentation in e+e- collisions

International Nuclear Information System (INIS)

Oddone, P.

1984-12-01

This brief review of new results in quark and gluon fragmentation observed in e + e - collisions concentrates mostly on PEP results and, within PEP, mostly on TPC results. The new PETRA results have been reported at this conference by M. Davier. It is restricted to results on light quark fragmentation since the results on heavy quark fragmentation have been reported by J. Chapman

Conversion of des-tyrosine-y-endorphin by brain synaptic membrane associated peptidases: identification of generated peptide fragments

NARCIS (Netherlands)

Burbach, J.P.H.; Schotman, P.; Verhoef, J.; Kloet, E.R. de; Wied, D. de

1980-01-01

Des-tyrosine-γ-endorphin, a β-endorphin fragment with neuroleptic-like properties, was digested with a cSPM fraction of rat brain. A profile of metabolites and a time course of conversion were obtained by HPLC analysis of the digests. Quantitative amino acid analysis and a second HPLC fractionation

Prediction of Positions of Active Compounds Makes It Possible To Increase Activity in Fragment-Based Drug Development

Directory of Open Access Journals (Sweden)

Yoshifumi Fukunishi

2011-05-01

Full Text Available We have developed a computational method that predicts the positions of active compounds, making it possible to increase activity as a fragment evolution strategy. We refer to the positions of these compounds as the active position. When an active fragment compound is found, the following lead generation process is performed, primarily to increase activity. In the current method, to predict the location of the active position, hydrogen atoms are replaced by small side chains, generating virtual compounds. These virtual compounds are docked to a target protein, and the docking scores (affinities are examined. The hydrogen atom that gives the virtual compound with good affinity should correspond to the active position and it should be replaced to generate a lead compound. This method was found to work well, with the prediction of the active position being 2 times more efficient than random synthesis. In the current study, 15 examples of lead generation were examined. The probability of finding active positions among all hydrogen atoms was 26%, and the current method accurately predicted 60% of the active positions.

Fragmentation of a 500 MeV/nucleon 86Kr beam, investigated at the GSI projectile fragment separator

International Nuclear Information System (INIS)

Weber, M.; Donzaud, C.; Geissel, H.; Grewe, A.; Lewitowicz, M.; Magel, A.; Mueller, A.C.; Nickel, F.; Pfuetzner, M.; Piechaczek, A.; Pravikoff, M.; Roeckl, E.; Rykaczewski, K.; Saint-Laurent, M.G.; Schall, I.; Stephan, C.; Tassan-Got, L.; Voss, B.

1993-10-01

Production cross-sections and longitudinal momentum distributions have been investigated for reactions between a 500 MeV/nucleon 86 Kr beam and beryllium, copper and tantalum targets. Fragments in a wide A/Z range were studied at the projectile-fragment separator FRS at GSI. The experimental production cross-sections have been used for testing the predictions obtained from a semi-empirical parameterization, a statistical abrasion model and an intranuclear-cascade model. The present study allows to extrapolate the production cross-sections towards very neutron-rich isotopes such as the doubly magic nucleus 78 Ni. For fragments close to the projectile the measured longitudinal momentum distributions agrees qualitatively with a semi-empirical parameterization, which is based on the two-step picture of the fragmentation process. The momentum widths of lighter fragments, however, show deviations from this simple picture. (orig.)

Architectural fragments

DEFF Research Database (Denmark)

Bang, Jacob Sebastian

2018-01-01

I have created a large collection of plaster models: a collection of Obstructions, errors and opportunities that may develop into architecture. The models are fragments of different complex shapes as well as more simple circular models with different profiling and diameters. In this contect I have....... I try to invent the ways of drawing the models - that decode and unfold them into architectural fragments- into future buildings or constructions in the landscape. [1] Luigi Moretti: Italian architect, 1907 - 1973 [2] Man Ray: American artist, 1890 - 1976. in 2015, I saw the wonderful exhibition...... "Man Ray - Human Equations" at the Glyptotek in Copenhagen, organized by the Philips Collection in Washington D.C. and the Israel Museum in Jerusalem (in 2013). See also: "Man Ray - Human Equations" catalogue published by Hatje Cantz Verlag, Germany, 2014....

Chemical Production using Fission Fragments

International Nuclear Information System (INIS)

Dawson, J. K.; Moseley, F.

1960-01-01

Some reactor design considerations of the use of fission recoil fragment energy for the production of chemicals of industrial importance have been discussed previously in a paper given at the Second United Nations International Conference on the Peaceful Uses of Atomic Energy [A/Conf. 15/P.76]. The present paper summarizes more recent progress made on this topic at AERE, Harwell. The range-energy relationship for fission fragments is discussed in the context of the choice of fuel system for a chemical production reactor, and the experimental observation of a variation of chemical effect along the length of a fission fragment track is described for the irradiation of nitrogen-oxygen mixtures. Recent results are given on the effect of fission fragments on carbon monoxide-hydrogen gas mixtures and on water vapour. No system investigated to date shows any outstanding promise for large-scale chemical production. (author) [fr

The dynamics of fragment formation

International Nuclear Information System (INIS)

Keane, D.

1994-09-01

We demonstrate that in the Quantum Molecular Dynamics model, dynamical correlations can result in the production rate for final state nucleon clusters (and hence composite fragments) being higher than would be expected if statistics and the available phase space were dominant in determining composite formation. An intranuclear cascade or a Boltzmann-Uehling-Uhlenbeck model, combined with a statistical approach in the late stage of the collision to determine composites, provides an equivalent description only under limited conditions of centrality and beam energy. We use data on participant fragment production in Au + Au collisions in the Bevalac's BOS time projection chamber to map out the parameter space where statistical clustering provides a good description. In particular, we investigate momentum-space densities of fragments up to 4 He as a function of fragment transverse momentum, azimuth relative to the reaction plane, rapidity, multiplicity and beam energy

Transplantation of storm-generated coral fragments to enhance Caribbean coral reefs: A successful method but not a solution

Directory of Open Access Journals (Sweden)

Virginia H. Garrison

2012-03-01

Full Text Available In response to dramatic losses of reef-building corals and ongoing lack of recovery, a small-scale coral transplant project was initiated in the Caribbean (U.S. Virgin Islands in 1999 and was followed for 12 years. The primary objectives were to (1 identify a source of coral colonies for transplantation that would not result in damage to reefs, (2 test the feasibility of transplanting storm-generated coral fragments, and (3 develop a simple, inexpensive method for transplanting fragments that could be conducted by the local community. The ultimate goal was to enhance abundance of threatened reef-building species on local reefs. Storm-produced coral fragments of two threatened reef-building species [Acropora palmata and A. cervicornis (Acroporidae] and another fast-growing species [Porites porites (Poritidae] were collected from environments hostile to coral fragment survival and transplanted to degraded reefs. Inert nylon cable ties were used to attach transplanted coral fragments to dead coral substrate. Survival of 75 reference colonies and 60 transplants was assessed over 12 years. Only 9% of colonies were alive after 12 years: no A. cervicornis; 3% of A. palmata transplants and 18% of reference colonies; and 13% of P. porites transplants and 7% of reference colonies. Mortality rates for all species were high and were similar for transplant and reference colonies. Physical dislodgement resulted in the loss of 56% of colonies, whereas 35% died in place. Only A. palmata showed a difference between transplant and reference colony survival and that was in the first year only. Location was a factor in survival only for A. palmata reference colonies and after year 10. Even though the tested methods and concepts were proven effective in the field over the 12-year study, they do not present a solution. No coral conservation strategy will be effective until underlying intrinsic and/or extrinsic factors driving high mortality rates are understood and

In silico design of fragment-based drug targeting host processing α-glucosidase i for dengue fever

Science.gov (United States)

Toepak, E. P.; Tambunan, U. S. F.

2017-02-01

Dengue is a major health problem in the tropical and sub-tropical regions. The development of antiviral that targeting dengue’s host enzyme can be more effective and efficient treatment than the viral enzyme. Host enzyme processing α-glucosidase I has an important role in the maturation process of dengue virus envelope glycoprotein. The inhibition of processing α-glucosidase I can become a promising target for dengue fever treatment. The antiviral approach using in silico fragment-based drug design can generate drug candidates with high binding affinity. In this research, 198.621 compounds were obtained from ZINC15 Biogenic Database. These compounds were screened to find the favorable fragments according to Rules of Three and pharmacological properties. The screening fragments were docked into the active site of processing α-glucosidase I. The potential fragment candidates from the molecular docking simulation were linked with castanospermine (CAST) to generate ligands with a better binding affinity. The Analysis of ligand - enzyme interaction showed ligands with code LRS 22, 28, and 47 have the better binding free energy than the standard ligand. Ligand LRS 28 (N-2-4-methyl-5-((1S,3S,6S,7R,8R,8aR)-1,6,7,8-tetrahydroxyoctahydroindolizin-3-yl) pentyl) indolin-1-yl) propionamide) itself among the other ligands has the lowest binding free energy. Pharmacological properties prediction also showed the ligands LRS 22, 28, and 47 can be promising as the dengue fever drug candidates.

Hands as markers of fragmentation

Directory of Open Access Journals (Sweden)

A. Barnard

2005-07-01

Full Text Available Margaret Atwood is an internationally read, translated, and critiqued writer whose novels have established her as one of the most esteemed authors in English (McCombs & Palmer, 1991:1. Critical studies of her work deal mainly with notions of identity from psychoanalytical perspectives. This study has identified a gap in current critical studies on Atwood’s works, namely the challenging of textual unity which is paralleled in the challenging of the traditional (single narrative voice. The challenging of textual unity and the single narrative voice brings about the fragmentation of both. This article will focus on the role that hands play as markers of fragmentation in “The Blind Assassin” (2000. In the novel, the writing hand destabilises the narrative voice, since it is not connected to the voice of a single author. If the author of the text – the final signified – is eliminated, the text becomes fragmentary and open, inviting the reader to contribute to the creation of meaning. Hands play a signficant role in foregrounding the narrator’s fragmented identity, and consequently, the fragmentation of the text. We will investigate this concept in the light of Roland Barthes’ notion of the scriptor, whose hand is metaphorically severed from his or her “voice”. Instead of the text being a unified entity, it becomes unstable and it displays the absence of hierarchical textual levels. Based mainly on Barthes’ writings, this article concludes that hands foreground the narrator’s fragmented identity, which is paralleled in the fragmented text.

Heavy fragment radioactivity

International Nuclear Information System (INIS)

Silisteanu, I.

1991-06-01

The effect of collective mode excitation in heavy fragment radioactivity (HFR) is explored and discussed in the light of current experimental data. It is found that the coupling and resonance effects in fragment interaction and also the proper angular momentum effects may lead to an important enhancing of the emission process. New useful procedures are proposed for the study of nuclear decay properties. The relations between different decay processes are investigated in detail. We are also trying to understand and explain in a unified way the reaction mechanisms in decay phenomena. (author). 17 refs, 4 figs, 3 tabs

An Algebra for Program Fragments

DEFF Research Database (Denmark)

Kristensen, Bent Bruun; Madsen, Ole Lehrmann; Møller-Pedersen, Birger

1985-01-01

Program fragments are described either by strings in the concrete syntax or by constructor applications in the abstract syntax. By defining conversions between these forms, both may be intermixed. Program fragments are constructed by terminal and nonterminal symbols from the grammar and by variab...

Fragment Impact Toolkit (FIT)

Energy Technology Data Exchange (ETDEWEB)

Shevitz, Daniel Wolf [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Key, Brian P. [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Garcia, Daniel B. [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)

2017-09-05

The Fragment Impact Toolkit (FIT) is a software package used for probabilistic consequence evaluation of fragmenting sources. The typical use case for FIT is to simulate an exploding shell and evaluate the consequence on nearby objects. FIT is written in the programming language Python and is designed as a collection of interacting software modules. Each module has a function that interacts with the other modules to produce desired results.

A model for projectile fragmentation

International Nuclear Information System (INIS)

Chaudhuri, G; Mallik, S; Gupta, S Das

2013-01-01

A model for projectile fragmentation is developed whose origin can be traced back to the Bevalac era. The model positions itself between the phenomenological EPAX parametrization and transport models like 'Heavy Ion Phase Space Exploration' (HIPSE) model and antisymmetrised molecular dynamics (AMD) model. A very simple impact parameter dependence of input temperature is incorporated in the model which helps to analyze the more peripheral collisions. The model is applied to calculate the charge, isotopic distributions, average number of intermediate mass fragments and the average size of largest cluster at different Z bound of different projectile fragmentation reactions at different energies.

Gamma Radiation from Fission Fragments

International Nuclear Information System (INIS)

Higbie, Jack

1969-10-01

The gamma radiation from the fragments of the thermal neutron fission of 235 U has been investigated, and the preliminary data are presented here with suggestions for further lines of research and some possible interpretations of the data. The data have direct bearing on the fission process and the mode of fragment de-excitation. The parameters measured are the radiation decay curve for the time interval (1 - 7) x 10 -10 sec after fission, the photon yield, the total gamma ray energy yield, and the average photon energy. The last three quantities are measured as a function of the fragment mass

Gamma Radiation from Fission Fragments

Energy Technology Data Exchange (ETDEWEB)

Higbie, Jack

1969-10-15

The gamma radiation from the fragments of the thermal neutron fission of {sup 235}U has been investigated, and the preliminary data are presented here with suggestions for further lines of research and some possible interpretations of the data. The data have direct bearing on the fission process and the mode of fragment de-excitation. The parameters measured are the radiation decay curve for the time interval (1 - 7) x 10{sup -10} sec after fission, the photon yield, the total gamma ray energy yield, and the average photon energy. The last three quantities are measured as a function of the fragment mass.

Combining Fragment-Ion and Neutral-Loss Matching during Mass Spectral Library Searching: A New General Purpose Algorithm Applicable to Illicit Drug Identification.

Science.gov (United States)

Moorthy, Arun S; Wallace, William E; Kearsley, Anthony J; Tchekhovskoi, Dmitrii V; Stein, Stephen E

2017-12-19

A mass spectral library search algorithm that identifies compounds that differ from library compounds by a single "inert" structural component is described. This algorithm, the Hybrid Similarity Search, generates a similarity score based on matching both fragment ions and neutral losses. It employs the parameter DeltaMass, defined as the mass difference between query and library compounds, to shift neutral loss peaks in the library spectrum to match corresponding neutral loss peaks in the query spectrum. When the spectra being compared differ by a single structural feature, these matching neutral loss peaks should contain that structural feature. This method extends the scope of the library to include spectra of "nearest-neighbor" compounds that differ from library compounds by a single chemical moiety. Additionally, determination of the structural origin of the shifted peaks can aid in the determination of the chemical structure and fragmentation mechanism of the query compound. A variety of examples are presented, including the identification of designer drugs and chemical derivatives not present in the library.

Identification of potential glutaminyl cyclase inhibitors from lead-like libraries by in silico and in vitro fragment-based screening.

Science.gov (United States)

Szaszkó, Mária; Hajdú, István; Flachner, Beáta; Dobi, Krisztina; Magyar, Csaba; Simon, István; Lőrincz, Zsolt; Kapui, Zoltán; Pázmány, Tamás; Cseh, Sándor; Dormán, György

2017-02-01

A glutaminyl cyclase (QC) fragment library was in silico selected by disconnection of the structure of known QC inhibitors and by lead-like 2D virtual screening of the same set. The resulting fragment library (204 compounds) was acquired from commercial suppliers and pre-screened by differential scanning fluorimetry followed by functional in vitro assays. In this way, 10 fragment hits were identified ([Formula: see text]5 % hit rate, best inhibitory activity: 16 [Formula: see text]). The in vitro hits were then docked to the active site of QC, and the best scoring compounds were analyzed for binding interactions. Two fragments bound to different regions in a complementary manner, and thus, linking those fragments offered a rational strategy to generate novel QC inhibitors. Based on the structure of the virtual linked fragment, a 77-membered QC target focused library was selected from vendor databases and docked to the active site of QC. A PubChem search confirmed that the best scoring analogues are novel, potential QC inhibitors.

Fragmentation and bond strength of airborne diesel soot agglomerates

Directory of Open Access Journals (Sweden)

Messerer Armin

2008-06-01

Full Text Available Abstract Background The potential of diesel soot aerosol particles to break up into smaller units under mechanical stress was investigated by a direct impaction technique which measures the degree of fragmentation of individual agglomerates vs. impact energy. Diesel aerosol was generated by an idling diesel engine used for passenger vehicles. Both the aerosol emitted directly and aerosol that had undergone additional growth by Brownian coagulation ("aging" was investigated. Optionally a thermo-desoption technique at 280°C was used to remove all high-volatility and the majority of low-volatility HC adsorbates from the aerosol before aging. Results It was found that the primary soot agglomerates emitted directly from the engine could not be fragmented at all. Soot agglomerates permitted to grow additionally by Brownian coagulation of the primary emitted particles could be fragmented to a maximum of 75% and 60% respectively, depending on whether adsorbates were removed from their surface prior to aging or not. At most, these aged agglomerates could be broken down to roughly the size of the agglomerates from the primary emission. The energy required for a 50% fragmentation probability of all bonds within an agglomerate was reduced by roughly a factor of 2 when aging "dry" agglomerates. Average bond energies derived from the data were 0.52*10-16 and 1.2*10-16 J, respectively. This is about 2 orders of magnitude higher than estimates for pure van-der-Waals agglomerates, but agrees quite well with other observations. Conclusion Although direct conclusions regarding the behavior of inhaled diesel aerosol in contact with body fluids cannot be drawn from such measurements, the results imply that highly agglomerated soot aerosol particles are unlikely to break up into units smaller than roughly the size distribution emitted as tail pipe soot.

Fragmentation and bond strength of airborne diesel soot agglomerates

Science.gov (United States)

Rothenbacher, Sonja; Messerer, Armin; Kasper, Gerhard

2008-01-01

Background The potential of diesel soot aerosol particles to break up into smaller units under mechanical stress was investigated by a direct impaction technique which measures the degree of fragmentation of individual agglomerates vs. impact energy. Diesel aerosol was generated by an idling diesel engine used for passenger vehicles. Both the aerosol emitted directly and aerosol that had undergone additional growth by Brownian coagulation ("aging") was investigated. Optionally a thermo-desoption technique at 280°C was used to remove all high-volatility and the majority of low-volatility HC adsorbates from the aerosol before aging. Results It was found that the primary soot agglomerates emitted directly from the engine could not be fragmented at all. Soot agglomerates permitted to grow additionally by Brownian coagulation of the primary emitted particles could be fragmented to a maximum of 75% and 60% respectively, depending on whether adsorbates were removed from their surface prior to aging or not. At most, these aged agglomerates could be broken down to roughly the size of the agglomerates from the primary emission. The energy required for a 50% fragmentation probability of all bonds within an agglomerate was reduced by roughly a factor of 2 when aging "dry" agglomerates. Average bond energies derived from the data were 0.52*10-16 and 1.2*10-16 J, respectively. This is about 2 orders of magnitude higher than estimates for pure van-der-Waals agglomerates, but agrees quite well with other observations. Conclusion Although direct conclusions regarding the behavior of inhaled diesel aerosol in contact with body fluids cannot be drawn from such measurements, the results imply that highly agglomerated soot aerosol particles are unlikely to break up into units smaller than roughly the size distribution emitted as tail pipe soot. PMID:18533015

The b Quark Fragmentation Function, From LEP to TeVatron

Energy Technology Data Exchange (ETDEWEB)

Ben-haim, Eli [Univ. Pierre et Marie Curie, Paris (France)

2004-12-01

The b quark fragmentation distribution has been measured, using data registered by the DELPHI experiment at the Z pole, in the years 1994-1995. The measurement made use of 176000 inclusively reconstructed B meson candidates. The errors of this measurement are dominated by systematic effects, the principal ones being related to the energy calibration. The distribution has been established in a nine bin histogram. Its mean value has been found to be E> = 0.704 ± 0.001(stat.) ± 0.008(syst.). Using this measurement, and other available analyses of the b-quark fragmentation distribution in e⁺e^- collisions, the non-perturbative QCD component of the distribution has been extracted independently of any hadronic physics modeling. This distribution depends only on the way the perturbative QCD component has been defined. When the perturbative QCD component is taken from a parton shower Monte-Carlo, the non-perturbative QCD component is rather similar with those obtained from the Lund or Bowler models. When the perturbative QCD component is the result of an analytic NLL computation, the non-perturbative QCD component has to be extended in a non-physical region and thus cannot be described by any hadronic modeling. In the two examples, used to characterize these two situations, which are studied at present, it happens that the extracted non-perturbative QCD distribution has the same shape, being simply translated to higher-x values in the second approach, illustrating the ability of the analytic perturbative QCD approach to account for softer gluon radiation than with a parton shower generator. Using all the available analyses of the b-quark fragmentation distribution in e⁺e^- collisions, together with the result from DELPHI presented in this thesis, a combined world average b fragmentation distribution has been obtained. Its mean value has been found to be E> = 0.714 ± 0.002. An analysis of the B hadron

Anisotropy in highly charged ion induced molecule fragmentation

International Nuclear Information System (INIS)

Juhasz, Z.; Sulik, B.; Fremont, F.; Chesnel, J.Y.; Hajaji, A.

2006-01-01

Complete text of publication follows. Studying fragmentation processes of biologically relevant molecules due to highly charged ion impact is important to understand radiation damage in biological tissues. Energy spectra of the charged molecule fragments may reveal the different fragmentation patterns meanwhile the angular distributions of the fragments characterize the dependence of fragmentation probability on the initial orientation of the molecule. The research to explore the angular distribution of the molecule fragments has only recently been started[1]. In 2006 we performed measurements at ARIBE facility at GANIL, Caen (France), in order to investigate orientation effects in molecule fragmentation. Fragmentation of H 2 O, C 6 H 6 and CH 4 , which represent different level of symmetry, have been studied by 60 keV N 6+ ion impact. Energy spectra of the charged fragments at different observation angles have been taken. As our example spectra show the different protonic peaks can be attributed to different fragmentation processes. Significant anisotropy can be seen in the different processes. The strongest evidence for the anisotropy can be seen in the spectra of C 6 H 6 , where the spectra appear isotropic in almost the whole observed energy range except one peak, which has a strong angular dependence and is maximal around 90 deg. (author)

Generative electronic background music system

Energy Technology Data Exchange (ETDEWEB)

Mazurowski, Lukasz [Faculty of Computer Science, West Pomeranian University of Technology in Szczecin, Zolnierska Street 49, Szczecin, PL (Poland)

2015-03-10

In this short paper-extended abstract the new approach to generation of electronic background music has been presented. The Generative Electronic Background Music System (GEBMS) has been located between other related approaches within the musical algorithm positioning framework proposed by Woller et al. The music composition process is performed by a number of mini-models parameterized by further described properties. The mini-models generate fragments of musical patterns used in output composition. Musical pattern and output generation are controlled by container for the mini-models - a host-model. General mechanism has been presented including the example of the synthesized output compositions.

Generative electronic background music system

International Nuclear Information System (INIS)

Mazurowski, Lukasz

2015-01-01

In this short paper-extended abstract the new approach to generation of electronic background music has been presented. The Generative Electronic Background Music System (GEBMS) has been located between other related approaches within the musical algorithm positioning framework proposed by Woller et al. The music composition process is performed by a number of mini-models parameterized by further described properties. The mini-models generate fragments of musical patterns used in output composition. Musical pattern and output generation are controlled by container for the mini-models - a host-model. General mechanism has been presented including the example of the synthesized output compositions

Absolute fragmentation cross sections in atom-molecule collisions: Scaling laws for non-statistical fragmentation of polycyclic aromatic hydrocarbon molecules

Energy Technology Data Exchange (ETDEWEB)

Chen, T.; Gatchell, M.; Stockett, M. H.; Alexander, J. D.; Schmidt, H. T.; Cederquist, H.; Zettergren, H., E-mail: henning@fysik.su.se [Department of Physics, Stockholm University, S-106 91 Stockholm (Sweden); Zhang, Y. [Department of Mathematics, Faculty of Physics, M. V. Lomonosov Moscow State University, Leninskie Gory, 119991 Moscow (Russian Federation); Rousseau, P.; Maclot, S.; Delaunay, R.; Adoui, L. [CIMAP, UMR 6252, CEA/CNRS/ENSICAEN/Université de Caen Basse-Normandie, bd Henri Becquerel, BP 5133, F-14070 Caen Cedex 05 (France); Université de Caen Basse-Normandie, Esplanade de la Paix, F-14032 Caen (France); Domaracka, A.; Huber, B. A. [CIMAP, UMR 6252, CEA/CNRS/ENSICAEN/Université de Caen Basse-Normandie, bd Henri Becquerel, BP 5133, F-14070 Caen Cedex 05 (France); Schlathölter, T. [Zernike Institute for Advanced Materials, University of Groningen, Nijenborgh 4, 9747AG Groningen (Netherlands)

2014-06-14

We present scaling laws for absolute cross sections for non-statistical fragmentation in collisions between Polycyclic Aromatic Hydrocarbons (PAH/PAH{sup +}) and hydrogen or helium atoms with kinetic energies ranging from 50 eV to 10 keV. Further, we calculate the total fragmentation cross sections (including statistical fragmentation) for 110 eV PAH/PAH{sup +} + He collisions, and show that they compare well with experimental results. We demonstrate that non-statistical fragmentation becomes dominant for large PAHs and that it yields highly reactive fragments forming strong covalent bonds with atoms (H and N) and molecules (C{sub 6}H{sub 5}). Thus nonstatistical fragmentation may be an effective initial step in the formation of, e.g., Polycyclic Aromatic Nitrogen Heterocycles (PANHs). This relates to recent discussions on the evolution of PAHNs in space and the reactivities of defect graphene structures.

Remarks about the hypothesis of limiting fragmentation

International Nuclear Information System (INIS)

Chou, T.T.; Yang, C.N.

1987-01-01

Remarks are made about the hypothesis of limiting fragmentation. In particular, the concept of favored and disfavored fragment distribution is introduced. Also, a sum rule is proved leading to a useful quantity called energy-fragmentation fraction. (author). 11 refs, 1 fig., 2 tabs

Polarization and alignment of nucleus fission fragments

International Nuclear Information System (INIS)

Barabanov, A.L.; Grechukhin, D.P.

1987-01-01

Correlation of fragment orientation with orientation axis of fissile nucleus and with n-vector f vector of fragment divergence is considered. Estimations of polarization and alignment of fission fragments of preliminarily oriented nuclei in correlation (with n-vector f recording) and integral (with n-vector f averaging) experiments were conducted. It is shown that high sensitivity of polarization and fragment alignment to the character of nucleus movement at the stage of descent from barrier to rupture point exists

Nuclear energy release from fragmentation

Energy Technology Data Exchange (ETDEWEB)

Li, Cheng [The Key Laboratory of Beam Technology and Material Modification of Ministry of Education, College of Nuclear Science and Technology, Beijing Normal University, Beijing 100875 (China); Beijing Radiation Center, Beijing 100875 (China); Souza, S.R. [Instituto de Física, Universidade Federal do Rio de Janeiro Cidade Universitária, Caixa Postal 68528, 21945-970 Rio de Janeiro (Brazil); Tsang, M.B. [The Key Laboratory of Beam Technology and Material Modification of Ministry of Education, College of Nuclear Science and Technology, Beijing Normal University, Beijing 100875 (China); Beijing Radiation Center, Beijing 100875 (China); National Superconducting Cyclotron Laboratory and Physics and Astronomy Department, Michigan State University, East Lansing, MI 48824 (United States); Zhang, Feng-Shou, E-mail: fszhang@bnu.edu.cn [The Key Laboratory of Beam Technology and Material Modification of Ministry of Education, College of Nuclear Science and Technology, Beijing Normal University, Beijing 100875 (China); Beijing Radiation Center, Beijing 100875 (China); Center of Theoretical Nuclear Physics, National Laboratory of Heavy Ion Accelerator of Lanzhou, Lanzhou 730000 (China)

2016-08-15

It is well known that binary fission occurs with positive energy gain. In this article we examine the energetics of splitting uranium and thorium isotopes into various numbers of fragments (from two to eight) with nearly equal size. We find that the energy released by splitting {sup 230,232}Th and {sup 235,238}U into three equal size fragments is largest. The statistical multifragmentation model (SMM) is applied to calculate the probability of different breakup channels for excited nuclei. By weighing the probability distributions of fragment multiplicity at different excitation energies, we find the peaks of energy release for {sup 230,232}Th and {sup 235,238}U are around 0.7–0.75 MeV/u at excitation energy between 1.2 and 2 MeV/u in the primary breakup process. Taking into account the secondary de-excitation processes of primary fragments with the GEMINI code, these energy peaks fall to about 0.45 MeV/u.

Dihadron fragmentation function and its evolution

International Nuclear Information System (INIS)

Majumder, A.; Wang Xinnian

2004-01-01

Dihadron fragmentation functions and their evolution are studied in the process of e + e - annihilation. Under the collinear factorization approximation and facilitated by the cut-vertex technique, the two hadron inclusive cross section at leading order is shown to factorize into a short distance parton cross section and a long distance dihadron fragmentation function. We provide the definition of such a dihadron fragmentation function in terms of parton matrix elements and derive its Dokshitzer-Gribov-Lipatov-Altarelli-Parisi evolution equation at leading log. The evolution equation for the nonsinglet quark fragmentation function is solved numerically with a simple ansatz for the initial condition and results are presented for cases of physical interest

The Roles of Family B and D DNA Polymerases in Thermococcus Species 9°N Okazaki Fragment Maturation*

Science.gov (United States)

Greenough, Lucia; Kelman, Zvi; Gardner, Andrew F.

2015-01-01

During replication, Okazaki fragment maturation is a fundamental process that joins discontinuously synthesized DNA fragments into a contiguous lagging strand. Efficient maturation prevents repeat sequence expansions, small duplications, and generation of double-stranded DNA breaks. To address the components required for the process in Thermococcus, Okazaki fragment maturation was reconstituted in vitro using purified proteins from Thermococcus species 9°N or cell extracts. A dual color fluorescence assay was developed to monitor reaction substrates, intermediates, and products. DNA polymerase D (polD) was proposed to function as the replicative polymerase in Thermococcus replicating both the leading and the lagging strands. It is shown here, however, that it stops before the previous Okazaki fragments, failing to rapidly process them. Instead, Family B DNA polymerase (polB) was observed to rapidly fill the gaps left by polD and displaces the downstream Okazaki fragment to create a flap structure. This flap structure was cleaved by flap endonuclease 1 (Fen1) and the resultant nick was ligated by DNA ligase to form a mature lagging strand. The similarities to both bacterial and eukaryotic systems and evolutionary implications of archaeal Okazaki fragment maturation are discussed. PMID:25814667

Establishment probability in newly founded populations

Directory of Open Access Journals (Sweden)

Gusset Markus

2012-06-01

Full Text Available Abstract Background Establishment success in newly founded populations relies on reaching the established phase, which is defined by characteristic fluctuations of the population’s state variables. Stochastic population models can be used to quantify the establishment probability of newly founded populations; however, so far no simple but robust method for doing so existed. To determine a critical initial number of individuals that need to be released to reach the established phase, we used a novel application of the “Wissel plot”, where –ln(1 – P0(t is plotted against time t. This plot is based on the equation P0t=1–c1e–ω1t, which relates the probability of extinction by time t, P0(t, to two constants: c1 describes the probability of a newly founded population to reach the established phase, whereas ω1 describes the population’s probability of extinction per short time interval once established. Results For illustration, we applied the method to a previously developed stochastic population model of the endangered African wild dog (Lycaon pictus. A newly founded population reaches the established phase if the intercept of the (extrapolated linear parts of the “Wissel plot” with the y-axis, which is –ln(c1, is negative. For wild dogs in our model, this is the case if a critical initial number of four packs, consisting of eight individuals each, are released. Conclusions The method we present to quantify the establishment probability of newly founded populations is generic and inferences thus are transferable to other systems across the field of conservation biology. In contrast to other methods, our approach disaggregates the components of a population’s viability by distinguishing establishment from persistence.

Designer genes. Recombinant antibody fragments for biological imaging

Energy Technology Data Exchange (ETDEWEB)

Wu, A.M.; Yazaki, P.J. [Beckman Research Institute of the City of Hope, Duarte, CA (United States). Dept. of Molecular Biology

2000-09-01

Monoclonal antibodies (MAbs), with high specificity and high affinity for their target antigens, can be utilized for delivery of agents such as radionuclides, enzymes, drugs or toxins in vivo. However, the implementation of radiolabeled antibodies as magic bullets for detection and treatment of diseases such as cancer has required addressing several shortcomings of murine MAbs. These include their immunogenicity, sub-optimal targeting and pharmacokinetic properties, and practical issues of production and radiolabeling. Genetic engineering provides a powerful approach for redesigning antibodies for use in oncologic applications in vivo. Recombinant fragments have been produced that retain high affinity for target antigens, and display a combination of rapid, high-level tumor targeting with concomitant clearance from normal tissues and the circulation in animal models. An important first step was cloning and engineering of antibody heavy and light chain variable domains into single-chain Fvs (molecular weight, 25-17 kDa), in which the variable regions are joined via a synthetic linker peptide sequence. Although scFvs themselves showed limited tumor uptake in preclinical and clinical studies, they provide a useful building block for intermediate sized recombinant fragments. Covalently linked dimers or non-covalent dimers of scFvs (also known as diabodies) show improved targeting and clearance properties due to their higher molecular weight (55kDa) and increased avidity. Further gains can be made by generation of larger recombinant fragments, such as the minibody, an scFv-C{sub H}3 fusion protein that self-assembles into a bivalent dimer of 80 kDa. A systematic evaluation of scFv, diabody, minibody, and intact antibody (based on comparison of tumor uptakes, tumor: blood activity ratios, and calculation of an Imaging Figure of Merit) can form the basis for selection of combinations of recombinant fragments and radionuclides for imaging applications. Ease of engineering

Designer genes. Recombinant antibody fragments for biological imaging

International Nuclear Information System (INIS)

Wu, A.M.; Yazaki, P.J.

2000-01-01

Monoclonal antibodies (MAbs), with high specificy and high affinity for their target antigens, can be utilized for delivery of agents such as radionuclides, enzymes, drugs or toxins in vivo. However, the implementation of radiolabeled antibodies as magic bullets for detection and treatment of diseases such as cancer has required addressing several shortcomings of murine MAbs. These include their immunogenicity, sub-optimal targeting and pharmacokinetic properties, and practical issues of production and radiolabeling. Genetic engineering provides a powerful approach for redesigning antibodies for use in oncologic applications in vivo. Recombinant fragments have been produced that retain high affinity for target antigens, and display a combination of rapid, high-level tumor targeting with concomitant clearance from normal tissues and the circulation in animal models. An important first step was cloning and engineering of antibody heavy and light chain variable domains into single-chain Fvs (molecular weight, 25-17 kDa), in which the variable regions are joined via a synthetic linker peptide sequence. Although scFvs themselves showed limited tumor uptake in preclinical and clinical studies, they provide a useful building block for intermediate sized recombinant fragments. Covalently linked dimers or non-covalent dimers of scFvs (also known as diabodies) show improved targeting and clearance properties due to their higher molecular weight (55kDa) and increased avidity. Further gains can be made by generation of larger recombinant fragments, such as the minibody, an scFv-C H 3 fusion protein that self-assembles into a bivalent dimer of 80 kDa. A systematic evaluation of scFv, diabody, minibody, and intact antibody (based on comparison of tumor uptakes, tumor: blood activity ratios, and calculation of an Imaging Figure of Merit) can form the basis for selection of combinations of recombinant fragments and radionuclides for imaging applications. Ease of engineering and

Evolution equations for extended dihadron fragmentation functions

International Nuclear Information System (INIS)

Ceccopieri, F.A.; Bacchetta, A.

2007-03-01

We consider dihadron fragmentation functions, describing the fragmentation of a parton in two unpolarized hadrons, and in particular extended dihadron fragmentation functions, explicitly dependent on the invariant mass, M h , of the hadron pair. We first rederive the known results on M h -integrated functions using Jet Calculus techniques, and then we present the evolution equations for extended dihadron fragmentation functions. Our results are relevant for the analysis of experimental measurements of two-particle-inclusive processes at different energies. (orig.)

Quantitative experimental modelling of fragmentation during explosive volcanism

Science.gov (United States)

Thordén Haug, Ø.; Galland, O.; Gisler, G.

2012-04-01

Phreatomagmatic eruptions results from the violent interaction between magma and an external source of water, such as ground water or a lake. This interaction causes fragmentation of the magma and/or the host rock, resulting in coarse-grained (lapilli) to very fine-grained (ash) material. The products of phreatomagmatic explosions are classically described by their fragment size distribution, which commonly follows power laws of exponent D. Such descriptive approach, however, considers the final products only and do not provide information on the dynamics of fragmentation. The aim of this contribution is thus to address the following fundamental questions. What are the physics that govern fragmentation processes? How fragmentation occurs through time? What are the mechanisms that produce power law fragment size distributions? And what are the scaling laws that control the exponent D? To address these questions, we performed a quantitative experimental study. The setup consists of a Hele-Shaw cell filled with a layer of cohesive silica flour, at the base of which a pulse of pressurized air is injected, leading to fragmentation of the layer of flour. The fragmentation process is monitored through time using a high-speed camera. By varying systematically the air pressure (P) and the thickness of the flour layer (h) we observed two morphologies of fragmentation: "lift off" where the silica flour above the injection inlet is ejected upwards, and "channeling" where the air pierces through the layer along sub-vertical conduit. By building a phase diagram, we show that the morphology is controlled by P/dgh, where d is the density of the flour and g is the gravitational acceleration. To quantify the fragmentation process, we developed a Matlab image analysis program, which calculates the number and sizes of the fragments, and so the fragment size distribution, during the experiments. The fragment size distributions are in general described by power law distributions of

A role for fragment-based drug design in developing novel lead compounds for central nervous system targets

Directory of Open Access Journals (Sweden)

Michael J. Wasko

2015-09-01

Full Text Available Hundreds of millions of U.S. dollars are invested in the research and development of a single drug. Lead compound development is an area ripe for new design strategies. Therapeutic lead candidates have been traditionally found using high-throughput in vitro pharmacologic screening, a costly method for assaying thousands of compounds. This approach has recently been augmented by virtual screening, which employs computer models of the target protein to narrow the search for possible leads. A variant of virtual screening is fragment-based drug design, an emerging in silico lead discovery method that introduces low molecular weight fragments, rather than intact compounds, into the binding pocket of the receptor model. These fragments serve as starting points for growing the lead candidate. Current efforts in virtual fragment-based drug design within central nervous system (CNS targets are reviewed, as is a recent rule-based optimization strategy in which new molecules are generated within a 3D receptor binding pocket using the fragment as a scaffold. This process places special emphasis on creating synthesizable molecules but also exposes computational questions worth addressing. Fragment-based methods provide a viable, relatively low-cost alternative for therapeutic lead discovery and optimization that can be applied to CNS targets to augment current design strategies.

Generation of an approximately 2.4 Mb human X centromere-based minichromosome by targeted telomere-associated chromosome fragmentation in DT40.

Science.gov (United States)

Mills, W; Critcher, R; Lee, C; Farr, C J

1999-05-01

A linear mammalian artificial chromosome (MAC) will require at least three types of functional element: a centromere, two telomeres and origins of replication. As yet, our understanding of these elements, as well as many other aspects of structure and organization which may be critical for a fully functional mammalian chromosome, remains poor. As a way of defining these various requirements, minichromosome reagents are being developed and analysed. Approaches for minichromosome generation fall into two broad categories: de novo assembly from candidate DNA sequences, or the fragmentation of an existing chromosome to reduce it to a minimal size. Here we describe the generation of a human minichromosome using the latter, top-down, approach. A human X chromosome, present in a DT40-human microcell hybrid, has been manipulated using homologous recombination and the targeted seeding of a de novo telomere. This strategy has generated a linear approximately 2.4 Mb human X centromere-based minichromosome capped by two artificially seeded telomeres: one immediately flanking the centromeric alpha-satellite DNA and the other targeted to the zinc finger gene ZXDA in Xp11.21. The chromosome retains an alpha-satellite domain of approximately 1. 8 Mb, a small array of gamma-satellite repeat ( approximately 40 kb) and approximately 400 kb of Xp proximal DNA sequence. The mitotic stability of this minichromosome has been examined, both in DT40 and following transfer into hamster and human cell lines. In all three backgrounds, the minichromosome is retained efficiently, but in the human and hamster microcell hybrids its copy number is poorly regulated. This approach of engineering well-defined chromosome reagents will allow key questions in MAC development (such as whether a lower size limit exists) to be addressed. In addition, the 2.4 Mb minichromosome described here has potential to be developed as a vector for gene delivery.

Immune Response Generated With the Administration of Autologous Dendritic Cells Pulsed With an Allogenic Tumoral Cell-Lines Lysate in Patients With Newly Diagnosed Diffuse Intrinsic Pontine Glioma

Directory of Open Access Journals (Sweden)

Daniel Benitez-Ribas

2018-04-01

Full Text Available Background and objectiveDiffuse intrinsic pontine glioma (DIPG is a lethal brainstem tumor in children. Dendritic cells (DCs have T-cell stimulatory capacity and, therefore, potential antitumor activity for disease control. DCs vaccines have been shown to reactivate tumor-specific T cells in both clinical and preclinical settings. We designed a phase Ib immunotherapy (IT clinical trial with the use of autologous dendritic cells (ADCs pulsed with an allogeneic tumors cell-lines lysate in patients with newly diagnosed DIPG after irradiation (radiation therapy.MethodsNine patients with newly diagnosed DIPG met enrollment criteria. Autologous dendritic cell vaccines (ADCV were prepared from monocytes obtained by leukapheresis. Five ADCV doses were administered intradermally during induction phase. In the absence of tumor progression, patients received three boosts of tumor lysate every 3 months during the maintenance phase.ResultsVaccine fabrication was feasible in all patients included in the study. Non-specific KLH (9/9 patients and specific (8/9 patients antitumor response was identified by immunologic studies in peripheral blood mononuclear cells (PBMC. Immunological responses were also confirmed in the T lymphocytes isolated from the cerebrospinal fluid (CSF of two patients. Vaccine administration resulted safe in all patients treated with this schema.ConclusionThese preliminary results demonstrate that ADCV preparation is feasible, safe, and generate a DIPG-specific immune response detected in PBMC and CSF. This strategy shows a promising backbone for future schemas of combination IT.

Impact failure and fragmentation properties of metals

Energy Technology Data Exchange (ETDEWEB)

Grady, D.E. [Applied Research Associates, Albuquerque, NM (United States); Kipp, M.E. [Sandia National Labs., Albuquerque, NM (United States)

1998-03-01

In the present study we describe the development of an experimental fracture material property test method specific to dynamic fragmentation. Spherical test samples of the metals of interest are subjected to controlled impulsive stress loads by acceleration to high velocities with a light-gas launcher facility and subsequent normal impact on thin plates. Motion, deformation and fragmentation of the test samples are diagnosed with multiple flash radiography methods. The impact plate materials are selected to be transparent to the x-ray method so that only test metal material is imaged. Through a systematic series of such tests both strain-to-failure and fragmentation resistance properties are determined through this experimental method. Fragmentation property data for several steels, copper, aluminum, tantalum and titanium have been obtained to date. Aspects of the dynamic data have been analyzed with computational methods to achieve a better understanding of the processes leading to failure and fragmentation, and to test an existing computational fragmentation model.

Predicting "Hot" and "Warm" Spots for Fragment Binding.

Science.gov (United States)

Rathi, Prakash Chandra; Ludlow, R Frederick; Hall, Richard J; Murray, Christopher W; Mortenson, Paul N; Verdonk, Marcel L

2017-05-11

Computational fragment mapping methods aim to predict hotspots on protein surfaces where small fragments will bind. Such methods are popular for druggability assessment as well as structure-based design. However, to date researchers developing or using such tools have had no clear way of assessing the performance of these methods. Here, we introduce the first diverse, high quality validation set for computational fragment mapping. The set contains 52 diverse examples of fragment binding "hot" and "warm" spots from the Protein Data Bank (PDB). Additionally, we describe PLImap, a novel protocol for fragment mapping based on the Protein-Ligand Informatics force field (PLIff). We evaluate PLImap against the new fragment mapping test set, and compare its performance to that of simple shape-based algorithms and fragment docking using GOLD. PLImap is made publicly available from https://bitbucket.org/AstexUK/pli .

Scaling and critical behaviour in nuclear fragmentation

International Nuclear Information System (INIS)

Campi, X.

1990-09-01

These notes review recent results on nuclear fragmentation. An analysis of experimental data from exclusive experiments is made in the framework of modern theories of fragmentation of finite size objects. We discuss the existence of a critical regime of fragmentation and the relevance of scaling and finite size scaling

The politics of municipal fragmentation in Ghana

Directory of Open Access Journals (Sweden)

Abdulai Kuyini Mohammed

2015-06-01

Full Text Available The scholarly debate over the rival merits of local government consolidation and fragmentation is an old but enduring one. However, in this debate very little attention has been focused on the political dimension of council amalgamation and fragmentation – yet political considerations play a central role in both the formulation and outcomes of de-concentration policy. The purpose of this article is to fill a gap in the literature by examining local government fragmentation in Ghana from 1988 to 2014. The article does this by identifying the key players and analysing their interests and gains, as well as the tensions arising from the fragmentation exercise. The implications from the Ghanaian case for more general theories of fragmentation are drawn out.

Molten aluminum alloy fuel fragmentation experiments

International Nuclear Information System (INIS)

Gabor, J.D.; Purviance, R.T.; Cassulo, J.C.; Spencer, B.W.

1992-01-01

Experiments were conducted in which molten aluminum alloys were injected into a 1.2 m deep pool of water. The parameters varied were (i) injectant material (8001 aluminum alloy and 12.3 wt% U-87.7 wt% Al), (ii) melt superheat (O to 50 K), (iii) water temperature (313, 343 and 373 K) and (iv) size and geometry of the pour stream (5, 10 and 20 mm diameter circular and 57 mm annular). The pour stream fragmentation was dominated by surface tension with large particles (∼30 mm) being formed from varicose wave breakup of the 10-mm circular pours and from the annular flow off a 57 mm diameter tube. The fragments produced by the 5 mm circular et were smaller (∼ mm), and the 20 mm jet which underwent sinuous wave breakup produced ∼100 mm fragments. The fragments froze to form solid particles in 313 K water, and when the water was ≥343 K, the melt fragments did not freeze during their transit through 1.2 m of water

Simulations of High Speed Fragment Trajectories

Science.gov (United States)

Yeh, Peter; Attaway, Stephen; Arunajatesan, Srinivasan; Fisher, Travis

2017-11-01

Flying shrapnel from an explosion are capable of traveling at supersonic speeds and distances much farther than expected due to aerodynamic interactions. Predicting the trajectories and stable tumbling modes of arbitrary shaped fragments is a fundamental problem applicable to range safety calculations, damage assessment, and military technology. Traditional approaches rely on characterizing fragment flight using a single drag coefficient, which may be inaccurate for fragments with large aspect ratios. In our work we develop a procedure to simulate trajectories of arbitrary shaped fragments with higher fidelity using high performance computing. We employ a two-step approach in which the force and moment coefficients are first computed as a function of orientation using compressible computational fluid dynamics. The force and moment data are then input into a six-degree-of-freedom rigid body dynamics solver to integrate trajectories in time. Results of these high fidelity simulations allow us to further understand the flight dynamics and tumbling modes of a single fragment. Furthermore, we use these results to determine the validity and uncertainty of inexpensive methods such as the single drag coefficient model.

Microstructural characterization of pipe bomb fragments

International Nuclear Information System (INIS)

Gregory, Otto; Oxley, Jimmie; Smith, James; Platek, Michael; Ghonem, Hamouda; Bernier, Evan; Downey, Markus; Cumminskey, Christopher

2010-01-01

Recovered pipe bomb fragments, exploded under controlled conditions, have been characterized using scanning electron microscopy, optical microscopy and microhardness. Specifically, this paper examines the microstructural changes in plain carbon-steel fragments collected after the controlled explosion of galvanized, schedule 40, continuously welded, steel pipes filled with various smokeless powders. A number of microstructural changes were observed in the recovered pipe fragments: deformation of the soft alpha-ferrite grains, deformation of pearlite colonies, twin formation, bands of distorted pearlite colonies, slip bands, and cross-slip bands. These microstructural changes were correlated with the relative energy of the smokeless powder fillers. The energy of the smokeless powder was reflected in a reduction in thickness of the pipe fragments (due to plastic strain prior to fracture) and an increase in microhardness. Moreover, within fragments from a single pipe, there was a radial variation in microhardness, with the microhardness at the outer wall being greater than that at the inner wall. These findings were consistent with the premise that, with the high energy fillers, extensive plastic deformation and wall thinning occurred prior to pipe fracture. Ultimately, the information collected from this investigation will be used to develop a database, where the fragment microstructure and microhardness will be correlated with type of explosive filler and bomb design. Some analyses, specifically wall thinning and microhardness, may aid in field characterization of explosive devices.

Cryobiology of coral fragments.

Science.gov (United States)

Hagedorn, Mary; Farrell, Ann; Carter, Virginia L

2013-02-01

Around the world, coral reefs are dying due to human influences, and saving habitat alone may not stop this destruction. This investigation focused on the biological processes that will provide the first steps in understanding the cryobiology of whole coral fragments. Coral fragments are a partnership of coral tissue and endosymbiotic algae, Symbiodinium sp., commonly called zooxanthellae. These data reflected their separate sensitivities to chilling and a cryoprotectant (dimethyl sulfoxide) for the coral Pocillopora damicornis, as measured by tissue loss and Pulse Amplitude Modulated fluorometry 3weeks post-treatment. Five cryoprotectant treatments maintained the viability of the coral tissue and zooxanthellae at control values (1M dimethyl sulfoxide at 1.0, 1.5 and 2.0h exposures, and 1.5M dimethyl sulfoxide at 1.0 and 1.5h exposures, P>0.05, ANOVA), whereas 2M concentrations did not (Pzooxanthellae. During the winter when the fragments were chilled, the coral tissue remained relatively intact (∼25% loss) post-treatment, but the zooxanthellae numbers in the tissue declined after 5min of chilling (Pzooxanthellae numbers declined in response to chilling alone (P0.05, ANOVA), but it did not protect against the loss of zooxanthellae (Pzooxanthellae are the most sensitive element in the coral fragment complex and future cryopreservation protocols must be guided by their greater sensitivity. Copyright © 2012 Elsevier Inc. All rights reserved.

Measurement of a MMP-2 degraded Titin fragment in serum reflects changes in muscle turnover induced by atrophy.

Science.gov (United States)

Sun, S; Henriksen, K; Karsdal, M A; Armbrecht, G; Belavý, D L; Felsenberg, D; Rittweger, J; Wang, Y; Zheng, Q; Nedergaard, A F

2014-10-01

In this study we sought to determine whether a Titin peptide fragment can serve as a clinical biomarker for changes in muscle mass. Mass spectrometry was used to identify Titin fragment in urine. An antibody against this Titin sequence was raised and used to develop a competitive ELISA assay for measurement in serum. Rat tissue extractions in the presence or absence of a series of proteases of interest were used to identify its enzymatic origin. A rat model of dexamethasone (DEX) induced muscle atrophy and a human 56-day bed rest study with and without vibration therapy were used to assess biological and clinical relevance. A technically robust ELISA measuring the Titin fragment was developed against a Titin peptide fragment identified in human urine. The fragment was shown to be produced primarily by MMP-2 cleavage of Titin. In the rat muscle DEX induced atrophy model, Titin-MMP2 fragment was decreased in the beginning of DEX treatment, and then significantly increased later on during DEX administration. In the human bed rest study, the Titin-MMP2 fragment was initially decreased 11.9 (±3.7) % after 1day of bed rest, and then gradually increased ending up at a 16.4 (±4.6) % increase at day 47. We developed a robust ELISA measuring a muscle derived MMP-2 generated Titin degradation fragment in rat and human serum. Importantly, the fragment can be measured in serum and that these levels are related to induction of skeletal muscle atrophy. Copyright © 2014 Elsevier Inc. All rights reserved.

The particle size distribution of fragmented melt debris from molten fuel coolant interactions

International Nuclear Information System (INIS)

Fletcher, D.F.

1984-04-01

Results are presented of a study of the types of statistical distributions which arise when examining debris from Molten Fuel Coolant Interactions. The lognormal probability distribution and the modifications of this distribution which result from the mixing of two distributions or the removal of some debris are described. Methods of fitting these distributions to real data are detailed. A two stage fragmentation model has been developed in an attempt to distinguish between the debris produced by coarse mixing and fine scale fragmentation. However, attempts to fit this model to real data have proved unsuccessful. It was found that the debris particle size distributions from experiments at Winfrith with thermite generated uranium dioxide/molybdenum melts were Upper Limit Lognormal. (U.K.)

A new apparatus for the study of electron impact fragmentation of molecular clusters

International Nuclear Information System (INIS)

Barrett, G; Burgt, P J M van der

2008-01-01

This paper reports on the development of a new experiment for the study of electron-impact induced dissociation and fragmentation of molecular clusters and biomolecules and other species solvated in water clusters. The purpose is to look at clusters that are of interest to biophysics, atmospheric physics, and other fields. The experiment consists of a differentially pumped vacuum system, with an expansion chamber to generate a pulsed supersonic beam of clusters, and a collision chamber where the cluster beam intersects with an electron beam. Water clusters can be seeded with biomolecules emerging from a resistively heated oven. Investigation will be possible into both ion yields and long-lived neutral metastable yields produced by electron-impact fragmentation of relevant clusters and biomolecules

Selection of unadapted, pathogenic SHIVs encoding newly transmitted HIV-1 envelope proteins.

Science.gov (United States)

Del Prete, Gregory Q; Ailers, Braiden; Moldt, Brian; Keele, Brandon F; Estes, Jacob D; Rodriguez, Anthony; Sampias, Marissa; Oswald, Kelli; Fast, Randy; Trubey, Charles M; Chertova, Elena; Smedley, Jeremy; LaBranche, Celia C; Montefiori, David C; Burton, Dennis R; Shaw, George M; Markowitz, Marty; Piatak, Michael; KewalRamani, Vineet N; Bieniasz, Paul D; Lifson, Jeffrey D; Hatziioannou, Theodora

2014-09-10

Infection of macaques with chimeric viruses based on SIVMAC but expressing the HIV-1 envelope (Env) glycoproteins (SHIVs) remains the most powerful model for evaluating prevention and therapeutic strategies against AIDS. Unfortunately, only a few SHIVs are currently available. Furthermore, their generation has required extensive adaptation of the HIV-1 Env sequences in macaques so they may not accurately represent HIV-1 Env proteins circulating in humans, potentially limiting their translational utility. We developed a strategy for generating large numbers of SHIV constructs expressing Env proteins from newly transmitted HIV-1 strains. By inoculating macaques with cocktails of multiple SHIV variants, we selected SHIVs that can replicate and cause AIDS-like disease in immunologically intact rhesus macaques without requiring animal-to-animal passage. One of these SHIVs could be transmitted mucosally. We demonstrate the utility of the SHIVs generated by this method for evaluating neutralizing antibody administration as a protection against mucosal SHIV challenge. Copyright © 2014 Elsevier Inc. All rights reserved.

Fragmentation properties of 6Li

International Nuclear Information System (INIS)

Lovas, R.G.; Kruppa, A.T.; Beck, R.; Dickmann, F.

1987-01-01

The α+d and t+τ cluster structure of 6 Li is described in a microscopic α+d cluster model through quantities that enter into the description of cluster fragmentation processes. The states of the separate clusters α, d, t and τ are described as superpositions of Os Slater determinants belonging to different potential size parameters. To describe both the 6 Li and fragment state realistically, nucleon-nucleon forces optimized for the used model state spaces were constructed. The fragmentation properties predicted by them slightly differ from those calculated with some forces of common use provided the latter are modified so as to reproduce the α, d and 6 Li energies. (author) 61 refs.; 9 figs

A new location to split Cre recombinase for protein fragment complementation.

Science.gov (United States)

Rajaee, Maryam; Ow, David W

2017-11-01

We have previously described a recombinase-mediated gene stacking system in which the Cre recombinase is used to remove lox-site flanked DNA no longer needed after each round of Bxb1 integrase-mediated site-specific integration. The Cre recombinase can be conveniently introduced by hybridization with a cre-expressing plant. However, maintaining an efficient cre-expressing line over many generations can be a problem, as high production of this DNA-binding protein might interfere with normal chromosome activities. To counter this selection against high Cre activity, we considered a split-cre approach, in which Cre activity is reconstituted after separate parts of Cre are brought into the same genome by hybridization. To insure that the recombinase-mediated gene stacking system retains its freedom to operate, we tested for new locations to split Cre into complementing fragments. In this study, we describe testing four new locations for splitting the Cre recombinase for protein fragment complementation and show that the two fragments of Cre split between Lys244 and Asn245 can reconstitute activity that is comparable to that of wild-type Cre. © 2017 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

Geometrical scaling of jet fragmentation photons

Energy Technology Data Exchange (ETDEWEB)

Hattori, Koichi, E-mail: koichi.hattori@riken.jp [RIKEN BNL Research Center, Brookhaven National Laboratory, Upton NY 11973 (United States); Theoretical Research Division, Nishina Center, RIKEN, Wako, Saitama 351-0198 (Japan); McLerran, Larry, E-mail: mclerran@bnl.gov [RIKEN BNL Research Center, Brookhaven National Laboratory, Upton NY 11973 (United States); Physics Dept., Bdg. 510A, Brookhaven National Laboratory, Upton, NY-11973 (United States); Physics Dept., China Central Normal University, Wuhan (China); Schenke, Björn, E-mail: bschenke@bnl.gov [Physics Dept., Bdg. 510A, Brookhaven National Laboratory, Upton, NY-11973 (United States)

2016-12-15

We discuss jet fragmentation photons in ultrarelativistic heavy-ion collisions. We argue that, if the jet distribution satisfies geometrical scaling and an anisotropic spectrum, these properties are transferred to photons during the jet fragmentation.

Bespoke Fragments

DEFF Research Database (Denmark)

Kruse Aagaard, Anders

2017-01-01

The PhD project Bespoke Fragments is investigating the space emerging in the exploration of the relationship between digital drawing and fabrication, and the field of materials and their properties and capacities. Through a series of different experiments, the project situates itself in a shuttli...

Newly designed anterolateral and posterolateral locking anatomic plates for lateral tibial plateau fractures: a finite element study.

Science.gov (United States)

Chen, Pengbo; Lu, Hua; Shen, Hao; Wang, Wei; Ni, Binbin; Chen, Jishizhan

2017-02-23

Lateral column tibial plateau fracture fixation with a locking screw plate has higher mechanical stability than other fixation methods. The objectives of the present study were to introduce two newly designed locking anatomic plates for lateral tibial plateau fracture and to demonstrate their characteristics of the fixation complexes under the axial loads. Three different 3D finite element models of the lateral tibial plateau fracture with the bone plates were created. Various axial forces (100, 500, 1000, and 1500 N) were applied to simulate the axial compressive load on an adult knee during daily life. The equivalent maps of displacement and stress were output, and relative displacement was calculated along the fracture lines. The displacement and stresses in the fixation complexes increased with the axial force. The equivalent displacement or stress map of each fixation under different axial forces showed similar distributing characteristics. The motion characteristics of the three models differed, and the max-shear stress of trabecula increased with the axial load. These two novel plates could fix lateral tibial plateau fractures involving anterolateral and posterolateral fragments. Motions after open reduction and stable internal fixation should be advised to decrease the risk of trabecular microfracture. The relative displacement of the posterolateral fragments is different when using anterolateral plate and posterolateral plate, which should be considered in choosing the implants for different posterolateral plateau fractures.

Fracture mechanics model of fragmentation

International Nuclear Information System (INIS)

Glenn, L.A.; Gommerstadt, B.Y.; Chudnovsky, A.

1986-01-01

A model of the fragmentation process is developed, based on the theory of linear elastic fracture mechanics, which predicts the average fragment size as a function of strain rate and material properties. This approach permits a unification of previous results, yielding Griffith's solution in the low-strain-rate limit and Grady's solution at high strain rates

Polymer fragmentation in extensional flow

Energy Technology Data Exchange (ETDEWEB)

Maroja, Armando M.; Oliveira, Fernando A.; Ciesla, Michal; Longa, Lech

2001-06-01

In this paper we present an analysis of fragmentation of dilute polymer solutions in extensional flow. The transition rate is investigated both from theoretical and computational approaches, where the existence of a Gaussian distribution for the breaking bonds has been controversial. We give as well an explanation for the low fragmentation frequency found in DNA experiments.

Vibrational imaging of newly synthesized proteins in live cells by stimulated Raman scattering microscopy

Science.gov (United States)

Wei, Lu; Yu, Yong; Shen, Yihui; Wang, Meng C.; Min, Wei

2013-01-01

Synthesis of new proteins, a key step in the central dogma of molecular biology, has been a major biological process by which cells respond rapidly to environmental cues in both physiological and pathological conditions. However, the selective visualization of a newly synthesized proteome in living systems with subcellular resolution has proven to be rather challenging, despite the extensive efforts along the lines of fluorescence staining, autoradiography, and mass spectrometry. Herein, we report an imaging technique to visualize nascent proteins by harnessing the emerging stimulated Raman scattering (SRS) microscopy coupled with metabolic incorporation of deuterium-labeled amino acids. As a first demonstration, we imaged newly synthesized proteins in live mammalian cells with high spatial–temporal resolution without fixation or staining. Subcellular compartments with fast protein turnover in HeLa and HEK293T cells, and newly grown neurites in differentiating neuron-like N2A cells, are clearly identified via this imaging technique. Technically, incorporation of deuterium-labeled amino acids is minimally perturbative to live cells, whereas SRS imaging of exogenous carbon–deuterium bonds (C–D) in the cell-silent Raman region is highly sensitive, specific, and compatible with living systems. Moreover, coupled with label-free SRS imaging of the total proteome, our method can readily generate spatial maps of the quantitative ratio between new and total proteomes. Thus, this technique of nonlinear vibrational imaging of stable isotope incorporation will be a valuable tool to advance our understanding of the complex spatial and temporal dynamics of newly synthesized proteome in vivo. PMID:23798434

Heavy-Quark Production in the Target Fragmentation Region

CERN Document Server

Graudenz, Dirk

1997-01-01

Fixed-target experiments permit the study of hadron production in the target fragmentation region. It is expected that the tagging of specific particles in the target fragments can be employed to introduce a bias in the hard scattering process towards a specific flavour content. The case of hadrons containing a heavy quark is particularly attractive because of the clear experimental signatures and the applicability of perturbative QCD. The standard approach to one-particle inclusive processes based on fragmentation functions is valid in the current fragmentation region and for large transverse momenta $p_T$ in the target fragmentation region, but it fails for particle production at small $p_T$ in the target fragmentation region. A collinear singularity, which cannot be absorbed in the standard way into the phenomenological distribution functions, prohibits the application of this procedure. This situation is remedied by the introduction of a new set of distribution functions, the target fragmentation function...

Fragment Linking and Optimization of Inhibitors of the Aspartic Protease Endothiapepsin : Fragment-Based Drug Design Facilitated by Dynamic Combinatorial Chemistry

NARCIS (Netherlands)

Mondal, Milon; Radeva, Nedyalka; Fanlo-Virgos, Hugo; Otto, Sijbren; Klebe, Gerhard; Hirsch, Anna K. H.

2016-01-01

Fragment-based drug design (FBDD) affords active compounds for biological targets. While there are numerous reports on FBDD by fragment growing/optimization, fragment linking has rarely been reported. Dynamic combinatorial chemistry (DCC) has become a powerful hit-identification strategy for

Experimental modelling of fragmentation applied to volcanic explosions

Science.gov (United States)

Haug, Øystein Thordén; Galland, Olivier; Gisler, Galen R.

2013-12-01

Explosions during volcanic eruptions cause fragmentation of magma and host rock, resulting in fragments with sizes ranging from boulders to fine ash. The products can be described by fragment size distributions (FSD), which commonly follow power laws with exponent D. The processes that lead to power-law distributions and the physical parameters that control D remain unknown. We developed a quantitative experimental procedure to study the physics of the fragmentation process through time. The apparatus consists of a Hele-Shaw cell containing a layer of cohesive silica flour that is fragmented by a rapid injection of pressurized air. The evolving fragmentation of the flour is monitored with a high-speed camera, and the images are analysed to obtain the evolution of the number of fragments (N), their average size (A), and the FSD. Using the results from our image-analysis procedure, we find transient empirical laws for N, A and the exponent D of the power-law FSD as functions of the initial air pressure. We show that our experimental procedure is a promising tool for unravelling the complex physics of fragmentation during phreatomagmatic and phreatic eruptions.

Neighbouring charge fragmentations in low energy fission

International Nuclear Information System (INIS)

Montoya, M.

1986-10-01

Shell and odd-even effects in fission have been largely studied until now. The structure in fragment mass, charge and kinetic energy distributions of fragments were interpreted as shell and even-odd effects. In this paper, we want to show that the discret change of fragment charge symmetry should produce also structures in those distribution. 19 refs

Equilibrium simulations of proteins using molecular fragment replacement and NMR chemical shifts.

Science.gov (United States)

Boomsma, Wouter; Tian, Pengfei; Frellsen, Jes; Ferkinghoff-Borg, Jesper; Hamelryck, Thomas; Lindorff-Larsen, Kresten; Vendruscolo, Michele

2014-09-23

Methods of protein structure determination based on NMR chemical shifts are becoming increasingly common. The most widely used approaches adopt the molecular fragment replacement strategy, in which structural fragments are repeatedly reassembled into different complete conformations in molecular simulations. Although these approaches are effective in generating individual structures consistent with the chemical shift data, they do not enable the sampling of the conformational space of proteins with correct statistical weights. Here, we present a method of molecular fragment replacement that makes it possible to perform equilibrium simulations of proteins, and hence to determine their free energy landscapes. This strategy is based on the encoding of the chemical shift information in a probabilistic model in Markov chain Monte Carlo simulations. First, we demonstrate that with this approach it is possible to fold proteins to their native states starting from extended structures. Second, we show that the method satisfies the detailed balance condition and hence it can be used to carry out an equilibrium sampling from the Boltzmann distribution corresponding to the force field used in the simulations. Third, by comparing the results of simulations carried out with and without chemical shift restraints we describe quantitatively the effects that these restraints have on the free energy landscapes of proteins. Taken together, these results demonstrate that the molecular fragment replacement strategy can be used in combination with chemical shift information to characterize not only the native structures of proteins but also their conformational fluctuations.

Aspect Ratio Dependence of Impact Fragmentation

International Nuclear Information System (INIS)

Inaoka, H.; Toyosawa, E.; Takayasu, H.; Inaoka, H.

1997-01-01

A numerical model of three-dimensional impact fragmentation produces a power-law cumulative fragment mass distribution followed by a flat tail. The result is consistent with an experimental result in a recent paper by Meibom and Balslev [Phys. Rev. Lett. 76, 2492 (1996)]. Our numerical simulation also implies that the fragment mass distribution changes from a power law with a flat tail to a power law with a sudden cutoff, depending on the aspect ratio of the fractured object. copyright 1997 The American Physical Society

Gluon fragmentation in T(1S) decays

International Nuclear Information System (INIS)

Bienlein, J.K.

1983-05-01

In T(1S) decays most observables (sphericity, charged multiplicity, photonic energy fraction, inclusive spectra) can be understood assuming that gluons fragment like quarks. New results from LENA use the (axis-independent) Fox-Wolfram moments for the photonic energy deposition. Continuum reactions show 'standard' Field-Feynman fragmentation. T(1S) decays show a significant difference in the photonic energy topology. It is more isotropic than with the Field-Feynman fragmentation scheme. Gluon fragmentation into isoscalar mesons (a la Peterson and Walsh) is excluded. But if one forces the leading particle to be isoscalar, one gets good agreement with the data. (orig.)

Fragmentation of Relativistic 56Fe Nuclei in Emulsion

International Nuclear Information System (INIS)

Chernov, G.M.; Gulamov, K.G.; Gulyamov, U.G.; Navotny, V.Sh.; Petrov, N.V.; Svechnikova, L.N.; Jakobsson, B.; Oskarsson, A.; Otterlund, I.

1983-03-01

Experimental data on general characteristics of projectile fragments in inelastic interactions of relativistic 56 Fe nuclei in emulsion (multiplicities, transverse momentum distributions, azimuthal correlations) are presented and discussed. A strong dependence on the mass number of the projectile nucleus is observed for the transverse momenta of the emitted projectile fragments. These fragments exhibit an azimuthal asymmetry caused by the transverse motion of the fragmenting residue, but it is shown that this motion can be responsible only for a part of the increase in the average transverse momentum of the fragments with increasing mass of the projectile. (author)

CHARACTERIZATION OF CURRENTLY GENERATED TRANUSRANIC WASTE AT THE LOS ALAMOS NATIONAL LABORATORY'S PLUTONIUM PRODUCTION FACILITY

International Nuclear Information System (INIS)

Dodge, Robert L.; Montoya, Andy M.

2003-01-01

By the time the Waste Isolation Pilot Plant (WIPP) completes its Disposal Phase in FY 2034, the Department of Energy (DOE) will have disposed of approximately 109,378 cubic meters (m3) of Transuranic (TRU) waste in WIPP (1). If DOE adheres to its 2005 Pollution Prevention Goal of generating less than 141m3/yr of TRU waste, approximately 5000 m3 (4%) of that TRU waste will be newly generated (2). Because of the overwhelming majority (96%) of TRU waste destined for disposal at WIPP is legacy waste, the characterization and certification requirements were developed to resolve those issues related to legacy waste. Like many other DOE facilities Los Alamos National Laboratory (LANL) has a large volume (9,010m3) of legacy Transuranic Waste in storage (3). Unlike most DOE facilities LANL will generate approximately 140m3 of newly generated TRU waste each year3. LANL's certification program was established to meet the WIPP requirements for legacy waste and does not take advantage of the fundamental differences in waste knowledge between newly generated and legacy TRU waste

Percutaneous transhepatic fragmentation of gall stones and extraction of fragments

International Nuclear Information System (INIS)

Guenther, R.; Klose, K.; Schmidt, H.D.; Staritz, M.; Mainz Univ.; Mainz Univ.

1983-01-01

Attempts at percutaneous removal have been made in 13 patients with solitary and multiple intra- and extra-hepatic biliary duct stones measuring 5 to 30 mm. The stones were fragmented with a Dormia basket and the fragments removed transhepatically. In ten patients the procedure was successful, including one patient with multiple intra-hepatic stones. The procedure can be recommended for cases of calculous obstruction of biliary anastomoses or of stones which could not be removed by endoscopy, or where there is already biliary drainage being carried out, or in patients with a high opertive risk. In two patients, dilatation of the papilla was also carried out, in four patients a stenosis was dilated and in a further two patients, electro-incision of a stenosis was performed. (orig.) [de

The roles of family B and D DNA polymerases in Thermococcus species 9°N Okazaki fragment maturation.

Science.gov (United States)

Greenough, Lucia; Kelman, Zvi; Gardner, Andrew F

2015-05-15

During replication, Okazaki fragment maturation is a fundamental process that joins discontinuously synthesized DNA fragments into a contiguous lagging strand. Efficient maturation prevents repeat sequence expansions, small duplications, and generation of double-stranded DNA breaks. To address the components required for the process in Thermococcus, Okazaki fragment maturation was reconstituted in vitro using purified proteins from Thermococcus species 9°N or cell extracts. A dual color fluorescence assay was developed to monitor reaction substrates, intermediates, and products. DNA polymerase D (polD) was proposed to function as the replicative polymerase in Thermococcus replicating both the leading and the lagging strands. It is shown here, however, that it stops before the previous Okazaki fragments, failing to rapidly process them. Instead, Family B DNA polymerase (polB) was observed to rapidly fill the gaps left by polD and displaces the downstream Okazaki fragment to create a flap structure. This flap structure was cleaved by flap endonuclease 1 (Fen1) and the resultant nick was ligated by DNA ligase to form a mature lagging strand. The similarities to both bacterial and eukaryotic systems and evolutionary implications of archaeal Okazaki fragment maturation are discussed. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

Lead generation and examples opinion regarding how to follow up hits.

Science.gov (United States)

Orita, Masaya; Ohno, Kazuki; Warizaya, Masaichi; Amano, Yasushi; Niimi, Tatsuya

2011-01-01

In fragment-based drug discovery (FBDD), not only identifying the starting fragment hit to be developed but also generating a drug lead from that starting fragment hit is important. Converting fragment hits to leads is generally similar to a high-throughput screening (HTS) hits-to-leads approach in that properties associated with activity for a target protein, such as selectivity against other targets and absorption, distribution, metabolism, excretion, and toxicity (ADME/Tox), and physicochemical properties should be taken into account. However, enhancing the potency of the fragment hit is a key requirement in FBDD, unlike HTS, because initial fragment hits are generally weak. This enhancement is presently achieved by adding additional chemical groups which bind to additional parts of the target protein or by joining or combining two or more hit fragments; however, strategies for effecting greater improvements in effective activity are needed. X-ray analysis is a key technology attractive for converting fragments to drug leads. This method makes it clear whether a fragment hit can act as an anchor and provides insight regarding introduction of functional groups to improve fragment activity. Data on follow-up chemical synthesis of fragment hits has allowed for the differentiation of four different strategies: fragment optimization, fragment linking, fragment self-assembly, and fragment evolution. Here, we discuss our opinion regarding how to follow up on fragment hits, with a focus on the importance of fragment hits as an anchor moiety to so-called hot spots in the target protein using crystallographic data. Copyright © 2011 Elsevier Inc. All rights reserved.

The role of fragmentation mechanism in large-scale vapor explosions

International Nuclear Information System (INIS)

Liu, Jie

2003-01-01

A non-equilibrium, multi-phase, multi-component code PROVER-I is developed for propagation phase of vapor explosion. Two fragmentation models are used. The hydrodynamic fragmentation model is the same as Fletcher's one. A new thermal fragmentation model is proposed with three kinds of time scale for modeling instant fragmentation, spontaneous nucleation fragmentation and normal boiling fragmentation. The role of fragmentation mechanisms is investigated by the simulations of the pressure wave propagation and energy conversion ratio of ex-vessel vapor explosion. The spontaneous nucleation fragmentation results in a much higher pressure peak and a larger energy conversion ratio than hydrodynamic fragmentation. The instant fragmentation gives a slightly larger energy conversion ratio than spontaneous nucleation fragmentation, and the normal boiling fragmentation results in a smaller energy conversion ratio. The detailed analysis of the structure of pressure wave makes it clear that thermal detonation exists only under the thermal fragmentation circumstance. The high energy conversion ratio is obtained in a small vapor volume fraction. However, in larger vapor volume fraction conditions, the vapor explosion is weak. In a large-scale vapor explosion, the hydrodynamic fragmentation is essential when the pressure wave becomes strong, so a small energy conversion ratio is expected. (author)

Memory effects in nuclear fragmentation?

International Nuclear Information System (INIS)

Colonna, M.; Di Toro, M.; Guarnera, A.

1994-01-01

A general procedure to identify instability regions which lead to multifragmentation events is presented. The dominant mode at the instability point is determined from the knowledge of the mean properties (density and temperature) of the system at that point. For spinodal instabilities the dependence of fragment structures on the dynamical conditions is studied changing the beam energy and the considered equation of state. An important competition between two dynamical effects, expansion of the system and growth of fluctuations, is revealed. It is shown that in heavy-ion central collisions at medium energies memory effects of the configuration formed at the instability time could be observed in the final fragmentation pattern. Some hints towards a fully dynamical picture of fragmentation processes are finally suggested. ((orig.))

Environmental Impacts by Fragments Released from Nanoenabled Products: A Multiassay, Multimaterial Exploration by the SUN Approach.

Science.gov (United States)

Amorim, Mónica J B; Lin, Sijie; Schlich, Karsten; Navas, José M; Brunelli, Andrea; Neubauer, Nicole; Vilsmeier, Klaus; Costa, Anna L; Gondikas, Andreas; Xia, Tian; Galbis, Liliana; Badetti, Elena; Marcomini, Antonio; Hristozov, Danail; Kammer, Frank von der; Hund-Rinke, Kerstin; Scott-Fordsmand, Janeck J; Nel, André; Wohlleben, Wendel

2018-02-06

Nanoenabled products (NEPs) have numerous outdoor uses in construction, transportation or consumer scenarios, and there is evidence that their fragments are released in the environment at low rates. We hypothesized that the lower surface availability of NEPs fragment reduced their environmental effects with respect to pristine nanomaterials. This hypothesis was explored by testing fragments generated by intentional micronisation ("the SUN approach"; Nowack et al. Meeting the Needs for Released Nanomaterials Required for Further Testing: The SUN Approach. Environmental Science & Technology, 2016 (50), 2747). The NEPs were composed of four matrices (epoxy, polyolefin, polyoxymethylene, and cement) with up to 5% content of three nanomaterials (carbon nanotubes, iron oxide, and organic pigment). Regardless of the type of nanomaterial or matrix used, it was observed that nanomaterials were only partially exposed at the NEP fragment surface, indicating that mostly the intrinsic and extrinsic properties of the matrix drove the NEP fragment toxicity. Ecotoxicity in multiple assays was done covering relevant media from terrestrial to aquatic, including sewage treatment plant (biological activity), soil worms (Enchytraeus crypticus), and fish (zebrafish embryo and larvae and trout cell lines). We designed the studies to explore the possible modulation of ecotoxicity by nanomaterial additives in plastics/polymer/cement, finding none. The results support NEPs grouping by the matrix material regarding ecotoxicological effect during the use phase. Furthermore, control results on nanomaterial-free polymer fragments representing microplastic had no significant adverse effects up to the highest concentration tested.

CHARACTERIZATION OF 0.58 kb DNA STILBENE SYNTHASE ENCODING GENE FRAGMENT FROM MELINJO PLANT (Gnetum gnemon

Directory of Open Access Journals (Sweden)

Tri Joko Raharjo

2011-12-01

Full Text Available Resveratrol is a potent anticancer agent resulted as the main product of enzymatic reaction between common precursor in plants and Stilbene Synthase enzyme, which is expressed by sts gene. Characterization of internal fragment of Stilbene Synthase (STS encoding gene from melinjo plant (Gnetum gnemon L. has been carried out as part of a larger work to obtain a full length of Stilbene Synthase encoding gene of the plant. RT-PCR (Reverse Transcriptase Polymerase Chain Reaction was performed using two degenerated primers to amplify the gene fragment. Ten published STS conserved amino acid sequences from various plant species from genebank were utilized to construct a pair of GGF2 (5' GTTCCACCTGCGAAGCAGCC 3' and GGR2 (5' CTGGATCGCACATCC TGGTG 3' primers. Both designed primers were predicted to be in the position of 334-354 and 897-916 kb of the gene respectively. Total RNA isolated from melinjo leaves was used as template for the RT-PCR amplification process using two-step technique. A collection of 0.58 DNA fragments was generated from RT-PCR amplification and met the expected results. The obtained DNA fragments were subsequently isolated, refined and sequenced. A nucleotide sequence analysis was accomplished by comparing it to the existed sts genes available in genebank. Homology analysis of the DNA fragments with Arachis hypogaea L00952 sts gene showed high similarity level. Taken together, the results are evidence that the amplified fragment obtained in this study is part of melinjo sts gene

Origin of fragments in multifragmentation reactions

International Nuclear Information System (INIS)

Zbiri, K.; Aichelin, J.

2003-01-01

Using the quantum molecular dynamics approach we have started analyzing the results of the recent INDRA experiments at GSI facilities. For the first time we could identify a midrapidity source in which fragments are formed from an almost identical fraction of projectile and target nucleons. In smaller systems we have found this source. Nevertheless the fragment spectra at small and large angles is completely determined by the dynamics. We discuss how fragments are formed in the different regions of phase space and what they tell us about the reaction mechanism. (authors)

Gluon fragmentation into 3 PJ quarkonium

International Nuclear Information System (INIS)

Ma, J.P.

1995-01-01

The functions of the gluon fragmentation into 3 P j quarkonium are calculated to order α 2 s . With the recent progress in analysing quarkonium systems in QCD it is possible show how the so called divergence in the limit of the zero-binding energy, which is related to P-wave quarkonia, is treated correctly in the case of fragmentation functions. The obtained fragmentation functions satisfy explicitly at the order of α 2 s the Altarelli-Parisi equation and when z → 0 they behave as z -1 as expected. 19 refs., 7 figs

Origin of fragments in multifragmentation reactions

International Nuclear Information System (INIS)

Zbiri, K.; Aichelin, J.

2005-01-01

Using the quantum molecular dynamics approach we have started to analyze the results of the recent INDRA experiments at GSI experiments. For the first time we could identify a midrapidity source in which fragments are formed from a almost identical fraction of projectile and target nucleons. In smaller systems we have not found this source. Nevertheless the fragment spectra at small and large angles are completely determined by the dynamics. We discuss how fragments are formed in the different regions of phase space and what they tell us about the reaction mechanism. (author)

General Process for Business Idea Generation

OpenAIRE

Halinen, Anu

2017-01-01

This thesis presents a process for generating ideas with the intent to propagate new business within a micro-company. Utilizing this newly proposed process, generation of new ideas will be initiated allowing for subsequent business plans to be implemented to grow the existing customer base. Cloudberrywind is a family-owned and family-operated micro company in the Finnish region that offers information technology consulting services and support for project management to improve company efficie...

High-throughput fragment screening by affinity LC-MS.

Science.gov (United States)

Duong-Thi, Minh-Dao; Bergström, Maria; Fex, Tomas; Isaksson, Roland; Ohlson, Sten

2013-02-01

Fragment screening, an emerging approach for hit finding in drug discovery, has recently been proven effective by its first approved drug, vemurafenib, for cancer treatment. Techniques such as nuclear magnetic resonance, surface plasmon resonance, and isothemal titration calorimetry, with their own pros and cons, have been employed for screening fragment libraries. As an alternative approach, screening based on high-performance liquid chromatography separation has been developed. In this work, we present weak affinity LC/MS as a method to screen fragments under high-throughput conditions. Affinity-based capillary columns with immobilized thrombin were used to screen a collection of 590 compounds from a fragment library. The collection was divided into 11 mixtures (each containing 35 to 65 fragments) and screened by MS detection. The primary screening was performed in 3500 fragments per day). Thirty hits were defined, which subsequently entered a secondary screening using an active site-blocked thrombin column for confirmation of specificity. One hit showed selective binding to thrombin with an estimated dissociation constant (K (D)) in the 0.1 mM range. This study shows that affinity LC/MS is characterized by high throughput, ease of operation, and low consumption of target and fragments, and therefore it promises to be a valuable method for fragment screening.

Biological effectiveness of high-energy protons - Target fragmentation

International Nuclear Information System (INIS)

Cucinotta, F.A.; Katz, R.; Wilson, J.W.; Townsend, L.W.; Shinn, J.; Hajnal, F.

1991-01-01

High-energy protons traversing tissue produce local sources of high-linear-energy-transfer ions through nuclear fragmentation. The contribution of these target fragments to the biological effectiveness of high-energy protons using the cellular track model is examined. The effects of secondary ions are treated in terms of the production collision density using energy-dependent parameters from a high-energy fragmentation model. Calculations for mammalian cell cultures show that at high dose, at which intertrack effects become important, protons deliver damage similar to that produced by gamma rays, and with fragmentation the relative biological effectiveness (RBE) of protons increases moderately from unity. At low dose, where sublethal damage is unimportant, the contribution from target fragments dominates, causing the proton effectiveness to be very different from that of gamma rays with a strongly fluence-dependent RBE. At high energies, the nuclear fragmentation cross sections become independent of energy. This leads to a plateau in the proton single-particle-action cross section, below 1 keV/micron, since the target fragments dominate. 29 refs

Bootstrap embedding: An internally consistent fragment-based method

Energy Technology Data Exchange (ETDEWEB)

Welborn, Matthew; Tsuchimochi, Takashi; Van Voorhis, Troy [Department of Chemistry, Massachusetts Institute of Technology, 77 Massachusetts Avenue, Cambridge, Massachusetts 02139 (United States)

2016-08-21

Strong correlation poses a difficult problem for electronic structure theory, with computational cost scaling quickly with system size. Fragment embedding is an attractive approach to this problem. By dividing a large complicated system into smaller manageable fragments “embedded” in an approximate description of the rest of the system, we can hope to ameliorate the steep cost of correlated calculations. While appealing, these methods often converge slowly with fragment size because of small errors at the boundary between fragment and bath. We describe a new electronic embedding method, dubbed “Bootstrap Embedding,” a self-consistent wavefunction-in-wavefunction embedding theory that uses overlapping fragments to improve the description of fragment edges. We apply this method to the one dimensional Hubbard model and a translationally asymmetric variant, and find that it performs very well for energies and populations. We find Bootstrap Embedding converges rapidly with embedded fragment size, overcoming the surface-area-to-volume-ratio error typical of many embedding methods. We anticipate that this method may lead to a low-scaling, high accuracy treatment of electron correlation in large molecular systems.

Regulation of presynaptic Ca2+, synaptic plasticity and contextual fear conditioning by a N-terminal β-amyloid fragment.

Science.gov (United States)

Lawrence, James L M; Tong, Mei; Alfulaij, Naghum; Sherrin, Tessi; Contarino, Mark; White, Michael M; Bellinger, Frederick P; Todorovic, Cedomir; Nichols, Robert A

2014-10-22

Soluble β-amyloid has been shown to regulate presynaptic Ca(2+) and synaptic plasticity. In particular, picomolar β-amyloid was found to have an agonist-like action on presynaptic nicotinic receptors and to augment long-term potentiation (LTP) in a manner dependent upon nicotinic receptors. Here, we report that a functional N-terminal domain exists within β-amyloid for its agonist-like activity. This sequence corresponds to a N-terminal fragment generated by the combined action of α- and β-secretases, and resident carboxypeptidase. The N-terminal β-amyloid fragment is present in the brains and CSF of healthy adults as well as in Alzheimer's patients. Unlike full-length β-amyloid, the N-terminal β-amyloid fragment is monomeric and nontoxic. In Ca(2+) imaging studies using a model reconstituted rodent neuroblastoma cell line and isolated mouse nerve terminals, the N-terminal β-amyloid fragment proved to be highly potent and more effective than full-length β-amyloid in its agonist-like action on nicotinic receptors. In addition, the N-terminal β-amyloid fragment augmented theta burst-induced post-tetanic potentiation and LTP in mouse hippocampal slices. The N-terminal fragment also rescued LTP inhibited by elevated levels of full-length β-amyloid. Contextual fear conditioning was also strongly augmented following bilateral injection of N-terminal β-amyloid fragment into the dorsal hippocampi of intact mice. The fragment-induced augmentation of fear conditioning was attenuated by coadministration of nicotinic antagonist. The activity of the N-terminal β-amyloid fragment appears to reside largely in a sequence surrounding a putative metal binding site, YEVHHQ. These findings suggest that the N-terminal β-amyloid fragment may serve as a potent and effective endogenous neuromodulator. Copyright © 2014 the authors 0270-6474/14/3414210-09$15.00/0.

Fragmentation of molten core material by sodium

International Nuclear Information System (INIS)

Chu, T.Y.

1982-01-01

A series of scoping experiments was performed to study the fragmentation of prototypic high temperature melts in sodium. The quantity of melt involved was at least one order of magnitude larger than previous experiments. Two modes of contact were used: melt streaming into sodium and sodium into melt. The average bulk fragment size distribution was found to be in the range of previous data and the average size distribution was found to be insensitive to mode of contact. SEM studies showed that the metal component typically fragmented in the molten phase while the oxide component fragmented in the solid phase. For UO 2 -ZrO 2 /stainless steel melts no sigificant spatial separation of the metal and oxide was observed. The fragment size distribution was stratified vertically in the debris bed in all cases. While the bulk fragment size showed generally consistent trends, the individual experiments were sufficiently different to cause different degrees of stratification in the debris bed. For the highly stratified beds the permeability can decrease by as much as a factor of 20 from the bottom to the top of the bed

Quark fragmentation functions in NJL-jet model

Science.gov (United States)

Bentz, Wolfgang; Matevosyan, Hrayr; Thomas, Anthony

2014-09-01

We report on our studies of quark fragmentation functions in the Nambu-Jona-Lasinio (NJL) - jet model. The results of Monte-Carlo simulations for the fragmentation functions to mesons and nucleons, as well as to pion and kaon pairs (dihadron fragmentation functions) are presented. The important role of intermediate vector meson resonances for those semi-inclusive deep inelastic production processes is emphasized. Our studies are very relevant for the extraction of transverse momentum dependent quark distribution functions from measured scattering cross sections. We report on our studies of quark fragmentation functions in the Nambu-Jona-Lasinio (NJL) - jet model. The results of Monte-Carlo simulations for the fragmentation functions to mesons and nucleons, as well as to pion and kaon pairs (dihadron fragmentation functions) are presented. The important role of intermediate vector meson resonances for those semi-inclusive deep inelastic production processes is emphasized. Our studies are very relevant for the extraction of transverse momentum dependent quark distribution functions from measured scattering cross sections. Supported by Grant in Aid for Scientific Research, Japanese Ministry of Education, Culture, Sports, Science and Technology, Project No. 20168769.

Developments in SPR Fragment Screening.

Science.gov (United States)

Chavanieu, Alain; Pugnière, Martine

2016-01-01

Fragment-based approaches have played an increasing role alongside high-throughput screening in drug discovery for 15 years. The label-free biosensor technology based on surface plasmon resonance (SPR) is now sensitive and informative enough to serve during primary screens and validation steps. In this review, the authors discuss the role of SPR in fragment screening. After a brief description of the underlying principles of the technique and main device developments, they evaluate the advantages and adaptations of SPR for fragment-based drug discovery. SPR can also be applied to challenging targets such as membrane receptors and enzymes. The high-level of immobilization of the protein target and its stability are key points for a relevant screening that can be optimized using oriented immobilized proteins and regenerable sensors. Furthermore, to decrease the rate of false negatives, a selectivity test may be performed in parallel on the main target bearing the binding site mutated or blocked with a low-off-rate ligand. Fragment-based drug design, integrated in a rational workflow led by SPR, will thus have a predominant role for the next wave of drug discovery which could be greatly enhanced by new improvements in SPR devices.

TQC works in newly-built nuclear power plant and main electric power system plannings

International Nuclear Information System (INIS)

Akiyama, Yoshihisa; Kawakatsu, Tadashi; Hashimoto, Yasuo

1985-01-01

In the Kansai Electric Power Co., Inc., TQC has been introduced to solve such major problems in nuclear power generation as the securing of nuclear power reliability, the suppression of rises in the costs, the reduction in long periods of power failure and the promotion in siting of nuclear power plants. It is thus employed as a means of the ''creation of a slim and tough business constitution''. The state of activities in Kansai Electric are described in quality assurance of a newly-built nuclear power plant and in raising the reliability of the main electric power system to distribute the generated nuclear power and further the future prospects are explained. (Mori, K.)

The VERDI fission fragment spectrometer

Directory of Open Access Journals (Sweden)

Frégeau M.O.

2013-12-01

Full Text Available The VERDI time-of-flight spectrometer is dedicated to measurements of fission product yields and of prompt neutron emission data. Pre-neutron fission-fragment masses will be determined by the double time-of-flight (TOF technique. For this purpose an excellent time resolution is required. The time of flight of the fragments will be measured by electrostatic mirrors located near the target and the time signal coming from silicon detectors located at 50 cm on both sides of the target. This configuration, where the stop detector will provide us simultaneously with the kinetic energy of the fragment and timing information, significantly limits energy straggling in comparison to legacy experimental setup where a thin foil was usually used as a stop detector. In order to improve timing resolution, neutron transmutation doped silicon will be used. The high resistivity homogeneity of this material should significantly improve resolution in comparison to standard silicon detectors. Post-neutron fission fragment masses are obtained form the time-of-flight and the energy signal in the silicon detector. As an intermediary step a diamond detector will also be used as start detector located very close to the target. Previous tests have shown that poly-crystalline chemical vapour deposition (pCVD diamonds provides a coincidence time resolution of 150 ps not allowing complete separation between very low-energy fission fragments, alpha particles and noise. New results from using artificial single-crystal diamonds (sCVD show similar time resolution as from pCVD diamonds but also sufficiently good energy resolution.

Competitive fragmentation pathways of acetic acid dimer explored by synchrotron VUV photoionization mass spectrometry and electronic structure calculations.

Science.gov (United States)

Guan, Jiwen; Hu, Yongjun; Zou, Hao; Cao, Lanlan; Liu, Fuyi; Shan, Xiaobin; Sheng, Liusi

2012-09-28

In present study, photoionization and dissociation of acetic acid dimers have been studied with the synchrotron vacuum ultraviolet photoionization mass spectrometry and theoretical calculations. Besides the intense signal corresponding to protonated cluster ions (CH(3)COOH)(n)·H(+), the feature related to the fragment ions (CH(3)COOH)H(+)·COO (105 amu) via β-carbon-carbon bond cleavage is observed. By scanning photoionization efficiency spectra, appearance energies of the fragments (CH(3)COOH)·H(+) and (CH(3)COOH)H(+)·COO are obtained. With the aid of theoretical calculations, seven fragmentation channels of acetic acid dimer cations were discussed, where five cation isomers of acetic acid dimer are involved. While four of them are found to generate the protonated species, only one of them can dissociate into a C-C bond cleavage product (CH(3)COOH)H(+)·COO. After surmounting the methyl hydrogen-transfer barrier 10.84 ± 0.05 eV, the opening of dissociative channel to produce ions (CH(3)COOH)(+) becomes the most competitive path. When photon energy increases to 12.4 eV, we also found dimer cations can be fragmented and generate new cations (CH(3)COOH)·CH(3)CO(+). Kinetics, thermodynamics, and entropy factors for these competitive dissociation pathways are discussed. The present report provides a clear picture of the photoionization and dissociation processes of the acetic acid dimer in the range of the photon energy 9-15 eV.

Competitive fragmentation pathways of acetic acid dimer explored by synchrotron VUV photoionization mass spectrometry and electronic structure calculations

Science.gov (United States)

Guan, Jiwen; Hu, Yongjun; Zou, Hao; Cao, Lanlan; Liu, Fuyi; Shan, Xiaobin; Sheng, Liusi

2012-09-01

In present study, photoionization and dissociation of acetic acid dimers have been studied with the synchrotron vacuum ultraviolet photoionization mass spectrometry and theoretical calculations. Besides the intense signal corresponding to protonated cluster ions (CH3COOH)n.H+, the feature related to the fragment ions (CH3COOH)H+.COO (105 amu) via β-carbon-carbon bond cleavage is observed. By scanning photoionization efficiency spectra, appearance energies of the fragments (CH3COOH).H+ and (CH3COOH)H+.COO are obtained. With the aid of theoretical calculations, seven fragmentation channels of acetic acid dimer cations were discussed, where five cation isomers of acetic acid dimer are involved. While four of them are found to generate the protonated species, only one of them can dissociate into a C-C bond cleavage product (CH3COOH)H+.COO. After surmounting the methyl hydrogen-transfer barrier 10.84 ± 0.05 eV, the opening of dissociative channel to produce ions (CH3COOH)+ becomes the most competitive path. When photon energy increases to 12.4 eV, we also found dimer cations can be fragmented and generate new cations (CH3COOH).CH3CO+. Kinetics, thermodynamics, and entropy factors for these competitive dissociation pathways are discussed. The present report provides a clear picture of the photoionization and dissociation processes of the acetic acid dimer in the range of the photon energy 9-15 eV.

An Enumerative Combinatorics Model for Fragmentation Patterns in RNA Sequencing Provides Insights into Nonuniformity of the Expected Fragment Starting-Point and Coverage Profile.

Science.gov (United States)

Prakash, Celine; Haeseler, Arndt Von

2017-03-01

RNA sequencing (RNA-seq) has emerged as the method of choice for measuring the expression of RNAs in a given cell population. In most RNA-seq technologies, sequencing the full length of RNA molecules requires fragmentation into smaller pieces. Unfortunately, the issue of nonuniform sequencing coverage across a genomic feature has been a concern in RNA-seq and is attributed to biases for certain fragments in RNA-seq library preparation and sequencing. To investigate the expected coverage obtained from fragmentation, we develop a simple fragmentation model that is independent of bias from the experimental method and is not specific to the transcript sequence. Essentially, we enumerate all configurations for maximal placement of a given fragment length, F, on transcript length, T, to represent every possible fragmentation pattern, from which we compute the expected coverage profile across a transcript. We extend this model to incorporate general empirical attributes such as read length, fragment length distribution, and number of molecules of the transcript. We further introduce the fragment starting-point, fragment coverage, and read coverage profiles. We find that the expected profiles are not uniform and that factors such as fragment length to transcript length ratio, read length to fragment length ratio, fragment length distribution, and number of molecules influence the variability of coverage across a transcript. Finally, we explore a potential application of the model where, with simulations, we show that it is possible to correctly estimate the transcript copy number for any transcript in the RNA-seq experiment.

Self-Condensation Culture Enables Vascularization of Tissue Fragments for Efficient Therapeutic Transplantation

Directory of Open Access Journals (Sweden)

Yoshinobu Takahashi

2018-05-01

Full Text Available Summary: Clinical transplantation of tissue fragments, including islets, faces a critical challenge because of a lack of effective strategies that ensure efficient engraftment through the timely integration of vascular networks. We recently developed a complex organoid engineering method by “self-condensation” culture based on mesenchymal cell-dependent contraction, thereby enabling dissociated heterotypic lineages including endothelial cells to self-organize in a spatiotemporal manner. Here, we report the successful adaptation of this method for generating complex tissues from diverse tissue fragments derived from various organs, including pancreatic islets. The self-condensation of human and mouse islets with endothelial cells not only promoted functionalization in culture but also massively improved post-transplant engraftment. Therapeutically, fulminant diabetic mice were more efficiently treated by a vascularized islet transplant compared with the conventional approach. Given the general limitations of post-transplant vascularization associated with 3D tissue-based therapy, our approach offers a promising means of enhancing efficacy in the context of therapeutic tissue transplantation. : Takahashi et al. report on generating vascularized islet tissue from humans and mice. After transplantation, vascularized islets significantly improve survival of diabetic mice, demonstrating the quick normalization of blood glucose compared with conventional islet transplantation. Keywords: tissue engineering, tissue-based therapy, vascularization, islet transplantation, organoid

Specific Conjugation of the Hinge Region for Homogeneous Preparation of Antibody Fragment-Drug Conjugate: A Case Study for Doxorubicin-PEG-anti-CD20 Fab' Synthesis.

Science.gov (United States)

Zhou, Zhan; Zhang, Jing; Zhang, Yan; Ma, Guanghui; Su, Zhiguo

2016-01-20

Conventional preparation strategies for antibody-drug conjugates (ADCs) result in heterogeneous products with various molecular sizes and species. In this study, we developed a homogeneous preparation strategy by site-specific conjugation of the anticancer drug with an antibody fragment. The model drug doxorubicin (DOX) was coupled to the Fab' fragment of anti-CD20 IgG at its permissive sites through a heterotelechelic PEG linker, generating an antibody fragment-drug conjugate (AFDC). Anti-CD20 IgG was digested and reduced specifically with β-mercaptoethylamine to generate the Fab' fragment with two free mercapto groups in its hinge region. Meanwhile, DOX was conjugated with α-succinimidylsuccinate ω-maleimide polyethylene glycol (NHS-PEG-MAL) to form MAL-PEG-DOX, which was subsequently linked to the free mercapto containing Fab' fragment to form a Fab'-PEG-DOX conjugate. The dual site-specific bioconjugation was achieved through the combination of highly selective reduction of IgG and introduction of heterotelechelic PEG linker. The resulting AFDC provides an utterly homogeneous product, with a definite ratio of one fragment to two drugs. Laser confocal microscopy and cell ELISA revealed that the AFDC could accumulate in the antigen-positive Daudi tumor cell. In addition, the Fab'-PEG-DOX retained appreciable targeting ability and improved antitumor activity, demonstrating an excellent therapeutic effect on the lymphoma mice model for better cure rate and significantly reduced side effects.

Effective Fragmentation and Flyrock Control Strategies at Quarries

Directory of Open Access Journals (Sweden)

Sedat Esen

2017-01-01

Full Text Available This paper presents the effective fragmentation and flyrock control strategies that could be applied at quarries to improve the productivity and safety. Fragmentation measurement and modelling as well as a comprehensive drill and blast audit are essential for improving the fragmentation. Face profiling and bore tracking are good tools to manage the ―as-designed‖ and ―as-drilled‖ conditions to get reasonable fragmentation from face burden zone and minimise the flyrock risk. In general, a large scatter in fragmentation data was observed at sites and the causes should be analysed by a detailed root-cause analysis technique. Two case studies were presented in this paper showing some of the effective fragmentation strategies. Finally, a flyrock model was shown to determine the safe blast exclusion zone for the mining equipment and personnel. Some key guidelines were suggested to minimise the occurrence of the flyrock.

Release and characteristics of fungal fragments in various conditions

Energy Technology Data Exchange (ETDEWEB)

Mensah-Attipoe, Jacob [Department of Environmental Science, University of Eastern Finland, Yliopistonranta 1D, P. O. Box 1627, FI-70211 Kuopio (Finland); Saari, Sampo [Department of Physics, Tampere University of Technology, Korkeakoulunkatu 3, 33720 Tampere (Finland); Veijalainen, Anna-Maria; Pasanen, Pertti [Department of Environmental Science, University of Eastern Finland, Yliopistonranta 1D, P. O. Box 1627, FI-70211 Kuopio (Finland); Keskinen, Jorma [Department of Physics, Tampere University of Technology, Korkeakoulunkatu 3, 33720 Tampere (Finland); Leskinen, Jari T.T. [SIB Labs, University of Eastern Finland, Yliopistonranta 1E, P. O. Box 1627, FI-70211, Kuopio (Finland); Reponen, Tiina, E-mail: reponeta@ucmail.uc.edu [Department of Environmental Science, University of Eastern Finland, Yliopistonranta 1D, P. O. Box 1627, FI-70211 Kuopio (Finland); Department of Environmental Health, University of Cincinnati, P.O. Box 670056, Cincinnati, OH 45267-0056 (United States)

2016-03-15

Intact spores and submicrometer size fragments are released from moldy building materials during growth and sporulation. It is unclear whether all fragments originate from fungal growth or if small pieces of building materials are also aerosolized as a result of microbial decomposition. In addition, particles may be formed through nucleation from secondary metabolites of fungi, such as microbial volatile organic compounds (MVOCs). In this study, we used the elemental composition of particles to characterize the origin of submicrometer fragments released from materials contaminated by fungi. Particles from three fungal species (Aspergillus versicolor, Cladosporium cladosporioides and Penicillium brevicompactum), grown on agar, wood and gypsum board were aerosolized using the Fungal Spore Source Strength Tester (FSSST) at three air velocities (5, 16 and 27 m/s). Released spores (optical size, d{sub p} ≥ 0.8 μm) and fragments (d{sub p} ≤ 0.8 μm) were counted using direct-reading optical aerosol instruments. Particles were also collected on filters, and their morphology and elemental composition analyzed using scanning electron microscopes (SEMs) coupled with an Energy-Dispersive X-ray spectroscopy (EDX). Among the studied factors, air velocity resulted in the most consistent trends in the release of fungal particles. Total concentrations of both fragments and spores increased with an increase in air velocity for all species whereas fragment–spore (F/S) ratios decreased. EDX analysis showed common elements, such as C, O, Mg and Ca, for blank material samples and fungal growth. However, N and P were exclusive to the fungal growth, and therefore were used to differentiate biological fragments from non-biological ones. Our results indicated that majority of fragments contained N and P. Because we observed increased release of fragments with increased air velocities, nucleation of MVOCs was likely not a relevant process in the formation of fungal fragments. Based

Graph Theory. 1. Fragmentation of Structural Graphs

Directory of Open Access Journals (Sweden)

Lorentz JÄNTSCHI

2002-12-01

Full Text Available The investigation of structural graphs has many fields of applications in engineering, especially in applied sciences like as applied chemistry and physics, computer sciences and automation, electronics and telecommunication. The main subject of the paper is to express fragmentation criteria in graph using a new method of investigation: terminal paths. Using terminal paths are defined most of the fragmentation criteria that are in use in molecular topology, but the fields of applications are more generally than that, as I mentioned before. Graphical examples of fragmentation are given for every fragmentation criteria. Note that all fragmentation is made with a computer program that implements a routine for every criterion.[1] A web routine for tracing all terminal paths in graph can be found at the address: http://vl.academicdirect.ro/molecular_topology/tpaths/ [1] M. V. Diudea, I. Gutman, L. Jäntschi, Molecular Topology, Nova Science, Commack, New York, 2001, 2002.

Light fragment formation at intermediate energies

International Nuclear Information System (INIS)

Boal, D.H.

1982-03-01

This paper concerns itself mainly with the production of energetic protons and light fragments at wide angles. The experiments point to nucleon emission in proton-induced reactions as involving a mechanism in which the observed nucleon is directly knocked out of the nucleus. A similar feature seems to be required to explain (p,F) and (e,F) reactions: an energetic nucleon is produced in one scattering of the projectile, and the struck nucleon subsequently loses some of its energy as it traverses the remaining part of the nucleus, gathering up other nucleons as it goes, to become a fragment. This is what one might call the extreme snowball model, and a more accurate description probably involves multiple scattering of the projectile in addition to the extreme snowball contribution. This will be particularly true for fragments in the mass 6 to 9 region. This scenario also appears to apply to deuteron-induced fragment production. However, for alpha-induced reactions it would appear that the nucleons forming a fragment can originate from collisions involving different incident nucleons in the projectile. For heavy ions, this effect is even stronger, and the snowball contribution is greatly reduced compared to that of the traditional coalescence model

Measuring the temperature of hot nuclear fragments

International Nuclear Information System (INIS)

Wuenschel, S.; Bonasera, A.; May, L.W.; Souliotis, G.A.; Tripathi, R.; Galanopoulos, S.; Kohley, Z.; Hagel, K.; Shetty, D.V.; Huseman, K.; Soisson, S.N.; Stein, B.C.; Yennello, S.J.

2010-01-01

A new thermometer based on fragment momentum fluctuations is presented. This thermometer exhibited residual contamination from the collective motion of the fragments along the beam axis. For this reason, the transverse direction has been explored. Additionally, a mass dependence was observed for this thermometer. This mass dependence may be the result of the Fermi momentum of nucleons or the different properties of the fragments (binding energy, spin, etc.) which might be more sensitive to different densities and temperatures of the exploding fragments. We expect some of these aspects to be smaller for protons (and/or neutrons); consequently, the proton transverse momentum fluctuations were used to investigate the temperature dependence of the source.

A Role for Fragment-Based Drug Design in Developing Novel Lead Compounds for Central Nervous System Targets.

Science.gov (United States)

Wasko, Michael J; Pellegrene, Kendy A; Madura, Jeffry D; Surratt, Christopher K

2015-01-01

Hundreds of millions of U.S. dollars are invested in the research and development of a single drug. Lead compound development is an area ripe for new design strategies. Therapeutic lead candidates have been traditionally found using high-throughput in vitro pharmacological screening, a costly method for assaying thousands of compounds. This approach has recently been augmented by virtual screening (VS), which employs computer models of the target protein to narrow the search for possible leads. A variant of VS is fragment-based drug design (FBDD), an emerging in silico lead discovery method that introduces low-molecular weight fragments, rather than intact compounds, into the binding pocket of the receptor model. These fragments serve as starting points for "growing" the lead candidate. Current efforts in virtual FBDD within central nervous system (CNS) targets are reviewed, as is a recent rule-based optimization strategy in which new molecules are generated within a 3D receptor-binding pocket using the fragment as a scaffold. This process not only places special emphasis on creating synthesizable molecules but also exposes computational questions worth addressing. Fragment-based methods provide a viable, relatively low-cost alternative for therapeutic lead discovery and optimization that can be applied to CNS targets to augment current design strategies.

QGP and Modified Jet Fragmentation

International Nuclear Information System (INIS)

Wang, Xin-Nian

2005-01-01

Recent progresses in the study of jet modification in hotmedium and their consequences in high-energy heavy-ion collisions are reviewed. In particular, I will discuss energy loss for propagating heavy quarks and the resulting modified fragmentation function. Medium modification of the parton fragmentation function due to quark recombination are formulated within finite temperature field theory and their implication on the search for deconfined quark-gluon plasma is also discussed

Fragment Linking and Optimization of Inhibitors of the Aspartic Protease Endothiapepsin: Fragment-Based Drug Design Facilitated by Dynamic Combinatorial Chemistry.

Science.gov (United States)

Mondal, Milon; Radeva, Nedyalka; Fanlo-Virgós, Hugo; Otto, Sijbren; Klebe, Gerhard; Hirsch, Anna K H

2016-08-01

Fragment-based drug design (FBDD) affords active compounds for biological targets. While there are numerous reports on FBDD by fragment growing/optimization, fragment linking has rarely been reported. Dynamic combinatorial chemistry (DCC) has become a powerful hit-identification strategy for biological targets. We report the synergistic combination of fragment linking and DCC to identify inhibitors of the aspartic protease endothiapepsin. Based on X-ray crystal structures of endothiapepsin in complex with fragments, we designed a library of bis-acylhydrazones and used DCC to identify potent inhibitors. The most potent inhibitor exhibits an IC50 value of 54 nm, which represents a 240-fold improvement in potency compared to the parent hits. Subsequent X-ray crystallography validated the predicted binding mode, thus demonstrating the efficiency of the combination of fragment linking and DCC as a hit-identification strategy. This approach could be applied to a range of biological targets, and holds the potential to facilitate hit-to-lead optimization. © 2016 The Authors. Published by Wiley-VCH Verlag GmbH & Co. KGaA.

Fragmentation of dimethyl ether in femtosecond intense field

Science.gov (United States)

Zhu, Jingyi; Guo, Wei; Wang, Yanqiu; Wang, Li

2006-08-01

The fragmentation of dimethyl ether (DME) in intense femtosecond laser field has been studied at 810, 405 and 270 nm with intensities up to 2.48 × 10 15, 3.86 × 10 15 and 1.62 × 10 14 W/cm 2, respectively. At 405 nm, DME is possibly firstly ionized by multiphoton absorption, and then parent ion DME + dissociates into fragments via filed-induced dissociation. For 810 and 270 nm laser fields, DME firstly dissociates into CH 3O and CH 3 fragments and then these neutral fragments are ionized by field tunneling. Another possible way for DME to dissociate at 810 and 270 nm is that DME is ionized by intense field ejection of inner valance electron and then the excited DME + dissociates into fragment ions. Ultrafast rearrangement of DME or DME + in intense field may be responsible to the unpredictable fragment ions, CHO+/C2H5+andH2+.

Protein-observed (19)F-NMR for fragment screening, affinity quantification and druggability assessment.

Science.gov (United States)

Gee, Clifford T; Arntson, Keith E; Urick, Andrew K; Mishra, Neeraj K; Hawk, Laura M L; Wisniewski, Andrea J; Pomerantz, William C K

2016-08-01

NMR spectroscopy can be used to quantify the binding affinity between proteins and low-complexity molecules, termed 'fragments'; this versatile screening approach allows researchers to assess the druggability of new protein targets. Protein-observed (19)F-NMR (PrOF NMR) using (19)F-labeled amino acids generates relatively simple spectra that are able to provide dynamic structural information toward understanding protein folding and function. Changes in these spectra upon the addition of fragment molecules can be observed and quantified. This protocol describes the sequence-selective labeling of three proteins (the first bromodomains of Brd4 and BrdT, and the KIX domain of the CREB-binding protein) using commercially available fluorinated aromatic amino acids and fluorinated precursors as example applications of the method developed by our research group. Fragment-screening approaches are discussed, as well as Kd determination, ligand-efficiency calculations and druggability assessment, i.e., the ability to target these proteins using small-molecule ligands. Experiment times on the order of a few minutes and the simplicity of the NMR spectra obtained make this approach well-suited to the investigation of small- to medium-sized proteins, as well as the screening of multiple proteins in the same experiment.

A large-scale forest fragmentation experiment: the Stability of Altered Forest Ecosystems Project

Science.gov (United States)

Ewers, Robert M.; Didham, Raphael K.; Fahrig, Lenore; Ferraz, Gonçalo; Hector, Andy; Holt, Robert D.; Kapos, Valerie; Reynolds, Glen; Sinun, Waidi; Snaddon, Jake L.; Turner, Edgar C.

2011-01-01

Opportunities to conduct large-scale field experiments are rare, but provide a unique opportunity to reveal the complex processes that operate within natural ecosystems. Here, we review the design of existing, large-scale forest fragmentation experiments. Based on this review, we develop a design for the Stability of Altered Forest Ecosystems (SAFE) Project, a new forest fragmentation experiment to be located in the lowland tropical forests of Borneo (Sabah, Malaysia). The SAFE Project represents an advance on existing experiments in that it: (i) allows discrimination of the effects of landscape-level forest cover from patch-level processes; (ii) is designed to facilitate the unification of a wide range of data types on ecological patterns and processes that operate over a wide range of spatial scales; (iii) has greater replication than existing experiments; (iv) incorporates an experimental manipulation of riparian corridors; and (v) embeds the experimentally fragmented landscape within a wider gradient of land-use intensity than do existing projects. The SAFE Project represents an opportunity for ecologists across disciplines to participate in a large initiative designed to generate a broad understanding of the ecological impacts of tropical forest modification. PMID:22006969