
Sample records for neuregulin-1 gene encodes

  1. Behavioural effects of high fat diet in a mutant mouse model for the schizophrenia risk gene neuregulin 1

    DEFF Research Database (Denmark)

    Holm-hansen, S.; Low, J. K.; Zieba, J.


    on the behavioural phenotype of test mice and attenuated particular cognitive deficits of Nrg1 mutant females. This topic requires further investigations thereby also considering other dietary factors of relevance for schizophrenia as well as interactive effects of diet with medication and sex.......Schizophrenia patients are often obese or overweight and poor dietary choices appear to be a factor in this phenomenon. Poor diet has been found to have complex consequences for the mental state of patients. Thus, this study investigated whether an unhealthy diet [i.e. high fat diet (HFD)] impacts...... on the behaviour of a genetic mouse model for the schizophrenia risk gene neuregulin 1 (i.e. transmembrane domain Nrg1 mutant mice: Nrg1 HET). Female Nrg1 HET and wild-type-like littermates (WT) were fed with either HFD or a control chow diet. The mice were tested for baseline (e.g. anxiety) and schizophrenia...

  2. Schizophrenia-risk variant rs6994992 in the neuregulin-1 gene on brain developmental trajectories in typically developing children. (United States)

    Douet, V; Chang, L; Pritchett, A; Lee, K; Keating, B; Bartsch, H; Jernigan, T L; Dale, A; Akshoomoff, N; Murray, S; Bloss, C; Kennedy, D N; Amaral, D; Gruen, J; Kaufmann, W E; Casey, B J; Sowell, E; Ernst, T


    The neuregulin-1 (NRG1) gene is one of the best-validated risk genes for schizophrenia, and psychotic and bipolar disorders. The rs6994992 variant in the NRG1 promoter (SNP8NRG243177) is associated with altered frontal and temporal brain macrostructures and/or altered white matter density and integrity in schizophrenic adults, as well as healthy adults and neonates. However, the ages when these changes begin and whether neuroimaging phenotypes are associated with cognitive performance are not fully understood. Therefore, we investigated the association of the rs6994992 variant on developmental trajectories of brain macro- and microstructures, and their relationship with cognitive performance. A total of 972 healthy children aged 3-20 years had the genotype available for the NRG1-rs6994992 variant, and were evaluated with magnetic resonance imaging (MRI) and neuropsychological tests. Age-by-NRG1-rs6994992 interactions and genotype effects were assessed using a general additive model regression methodology, covaried for scanner type, socioeconomic status, sex and genetic ancestry factors. Compared with the C-carriers, children with the TT-risk-alleles had subtle microscopic and macroscopic changes in brain development that emerge or reverse during adolescence, a period when many psychiatric disorders are manifested. TT-children at late adolescence showed a lower age-dependent forniceal volume and lower fractional anisotropy; however, both measures were associated with better episodic memory performance. To our knowledge, we provide the first multimodal imaging evidence that genetic variation in NRG1 is associated with age-related changes on brain development during typical childhood and adolescence, and delineated the altered patterns of development in multiple brain regions in children with the T-risk allele(s).

  3. Neuregulin-1 genotypes and eye movements in schizophrenia

    DEFF Research Database (Denmark)

    Haraldsson, H.M.; Ettinger, U.; Magnusdottir, B.B.


    Neuregulin-1 (NRG-1) is a putative susceptibility gene for schizophrenia but the neurocognitive processes that may involve NRG-1 in schizophrenia are unknown. Deficits in antisaccade (AS) and smooth pursuit eye movements (SPEM) are promising endophenotypes, which may be associated with brain...... findings of impaired AS and SPEM performance in schizophrenia patients (all P eye movement variables...

  4. Neuregulin-1 genotypes and eye movements in schizophrenia

    DEFF Research Database (Denmark)

    Haraldsson, H.M.; Ettinger, U.; Magnusdottir, B.B.


    Neuregulin-1 (NRG-1) is a putative susceptibility gene for schizophrenia but the neurocognitive processes that may involve NRG-1 in schizophrenia are unknown. Deficits in antisaccade (AS) and smooth pursuit eye movements (SPEM) are promising endophenotypes, which may be associated with brain...... dysfunctions underlying the pathophysiology of schizophrenia. The aim of this study was to investigate the associations of NRG-1 genotypes with AS and SPEM in schizophrenia patients and healthy controls. Patients (N = 113) and controls (N = 106) were genotyped for two NRG-1 single nucleotide polymorphisms...... findings of impaired AS and SPEM performance in schizophrenia patients (all P

  5. Intravenous Glial Growth Factor 2 (GGF2) Isoform of Neuregulin-1β Improves Left Ventricular Function, Gene and Protein Expression in Rats after Myocardial Infarction (United States)

    Murphy, Abigail; Smith, Holly M.; Galindo, Cristi L.; Pentassuglia, Laura; Peng, Xuyang; Lenneman, Carrie G.; Odiete, Oghenerukevwe; Friedman, David B.; Kronenberg, Marvin W.; Zheng, Siyuen; Zhao, Zhongming; Song, Yanna; Harrell, Frank E.; Srinivas, Maya; Ganguly, Anindita; Iaci, Jennifer; Parry, Tom J.; Caggiano, Anthony O.; Sawyer, Douglas B.


    Aims Recombinant Neuregulin (NRG)-1β has multiple beneficial effects on cardiac myocytes in culture, and has potential as a clinical therapy for heart failure (HF). A number of factors may influence the effect of NRG-1β on cardiac function via ErbB receptor coupling and expression. We examined the effect of the NRG-1β isoform, glial growth factor 2 (GGF2), in rats with myocardial infarction (MI) and determined the impact of high-fat diet as well as chronicity of disease on GGF2 induced improvement in left ventricular systolic function. Potential mechanisms for GGF2 effects on the remote myocardium were explored using microarray and proteomic analysis. Methods and Results Rats with MI were randomized to receive vehicle, 0.625 mg/kg, or 3.25 mg/kg GGF2 in the presence and absence of high-fat feeding beginning at day 7 post-MI and continuing for 4 weeks. Residual left ventricular (LV) function was improved in both of the GGF2 treatment groups compared with the vehicle treated MI group at 4 weeks of treatment as assessed by echocardiography. High-fat diet did not prevent the effects of high dose GGF2. In experiments where treatment was delayed until 8 weeks after MI, high but not low dose GGF2 treatment was associated with improved systolic function. mRNA and protein expression analysis of remote left ventricular tissue revealed a number of changes in myocardial gene and protein expression altered by MI that were normalized by GGF2 treatment, many of which are involved in energy production. Conclusions This study demonstrates that in rats with MI induced systolic dysfunction, GGF2 treatment improves cardiac function. There are differences in sensitivity of the myocardium to GGF2 effects when administered early vs. late post-MI that may be important to consider in the development of GGF2 in humans. PMID:23437060

  6. Intravenous glial growth factor 2 (GGF2 isoform of neuregulin-1β improves left ventricular function, gene and protein expression in rats after myocardial infarction.

    Directory of Open Access Journals (Sweden)

    Michael F Hill

    Full Text Available Recombinant Neuregulin (NRG-1β has multiple beneficial effects on cardiac myocytes in culture, and has potential as a clinical therapy for heart failure (HF. A number of factors may influence the effect of NRG-1β on cardiac function via ErbB receptor coupling and expression. We examined the effect of the NRG-1β isoform, glial growth factor 2 (GGF2, in rats with myocardial infarction (MI and determined the impact of high-fat diet as well as chronicity of disease on GGF2 induced improvement in left ventricular systolic function. Potential mechanisms for GGF2 effects on the remote myocardium were explored using microarray and proteomic analysis.Rats with MI were randomized to receive vehicle, 0.625 mg/kg, or 3.25 mg/kg GGF2 in the presence and absence of high-fat feeding beginning at day 7 post-MI and continuing for 4 weeks. Residual left ventricular (LV function was improved in both of the GGF2 treatment groups compared with the vehicle treated MI group at 4 weeks of treatment as assessed by echocardiography. High-fat diet did not prevent the effects of high dose GGF2. In experiments where treatment was delayed until 8 weeks after MI, high but not low dose GGF2 treatment was associated with improved systolic function. mRNA and protein expression analysis of remote left ventricular tissue revealed a number of changes in myocardial gene and protein expression altered by MI that were normalized by GGF2 treatment, many of which are involved in energy production.This study demonstrates that in rats with MI induced systolic dysfunction, GGF2 treatment improves cardiac function. There are differences in sensitivity of the myocardium to GGF2 effects when administered early vs. late post-MI that may be important to consider in the development of GGF2 in humans.

  7. BACE1-Dependent Neuregulin-1 Signaling: An Implication for Schizophrenia

    Directory of Open Access Journals (Sweden)

    Zhengrong Zhang


    Full Text Available Schizophrenia is a chronic psychiatric disorder with a lifetime prevalence of about 1% in the general population. Recent studies have shown that Neuregulin-1 (Nrg1 is a candidate gene for schizophrenia. At least 15 alternative splicing of NRG1 isoforms all contain an extracellular epidermal growth factor (EGF-like domain, which is sufficient for Nrg1 biological activity including the formation of myelin sheaths and the regulation of synaptic plasticity. It is known that Nrg1 can be cleaved by β-secretase (BACE1 and the resulting N-terminal fragment (Nrg1-ntf binds to receptor tyrosine kinase ErbB4, which activates Nrg1/ErbB4 signaling. While changes in Nrg1 expression levels in schizophrenia still remain controversial, understanding the BACE1-cleaved Nrg1-ntf and Nrg1/ErbB4 signaling in schizophrenia neuropathogenesis is essential and important. In this review paper, we included three major parts: (1 Nrg1 structure and cleavage pattern by BACE1; (2 BACE1-dependent Nrg1 cleavage associated with schizophrenia in human studies; and (3 Animal studies of Nrg1 and BACE1 mutations with behavioral observations. Our review will provide a better understanding of Nrg1 in schizophrenia and a potential strategy for using BACE1 cleavage of Nrg1 as a unique biomarker for diagnosis, as well as a new therapeutic target, of schizophrenia.

  8. No significant association of the 5' end of neuregulin 1 and schizophrenia in a large Danish sample

    DEFF Research Database (Denmark)

    Ingason, Andrés; Søeby, Karen; Timm, Sally


    schizophrenia patients. We found that the at-risk haplotype initially reported in the Icelandic population was not found in significant excess (or = 1.4, p = 0.12). The haplotype structure in the Danish sample was similar to that of other reported in other Caucasian populations and highly different from......Neuregulin 1 has been implicated as a susceptibility gene in schizophrenia. Several research groups have reported association with the 5' end of the gene although no causative variant has been reported. We have investigated whether there is association with the 5' end of the gene in Danish...

  9. Protein Phosphatase-1 Regulates Expression of Neuregulin-1

    Directory of Open Access Journals (Sweden)

    Tatiana Ammosova


    Full Text Available Protein phosphatase 1 (PP1, a cellular serine/threonine phosphatase, is targeted to cellular promoters by its major regulatory subunits, PP1 nuclear targeting subunit, nuclear inhibitor of PP1 (NIPP1 and RepoMan. PP1 is also targeted to RNA polymerase II (RNAPII by NIPP1 where it can dephosphorylate RNAPII and cycle-dependent kinase 9 (CDK9. Here, we show that treatment of cells with a small molecule activator of PP1 increases the abundance of a neuregulin-1 (NRG-1-derived peptide. NRG-1 mRNA and protein levels were increased in the cells stably or transiently expressing mutant NIPP1 (mNIPP1 that does not bind PP1, but not in the cells expressing NIPP1. Expression of mNIPP1 also activated the NRG-1 promoter in an NF-κB-dependent manner. Analysis of extracts from mNIPP1 expressing cells by glycerol gradient centrifugation showed a redistribution of PP1 and CDK9 between large and small molecular weight complexes, and increased CDK9 Thr-186 phosphorylation. This correlated with the increased CDK9 activity. Further, RNAPII co-precipitated with mNIPP1, and phosphorylation of RNAPII C-terminal domain (CTD Ser-2 residues was greater in cells expressing mNIPP1. In mNIPP1 expressing cells, okadaic acid, a cell-permeable inhibitor of PP1, did not increase Ser-2 CTD phosphorylation inhibited by flavopiridol, in contrast to the NIPP1 expressing cells, suggesting that PP1 was no longer involved in RNAPII dephosphorylation. Finally, media conditioned with mNIPP1 cells induced the proliferation of wild type 84-31 cells, consistent with a role of neuregulin-1 as a growth promoting factor. Our study indicates that deregulation of PP1/NIPP1 holoenzyme activates NRG-1 expression through RNAPII and CDK9 phosphorylation in a NF-κB dependent manner.

  10. Expression pattern of neuregulin-1 type III during the development of the peripheral nervous system

    Directory of Open Access Journals (Sweden)

    Liang-liang Huang


    Full Text Available Neuregulin-1 type III is a key regulator in Schwann cell proliferation, committing to a myelinating fate and regulating myelin sheath thickness. However, the expression pattern of neuregulin-1 type III in the peripheral nervous system during developmental periods (such as the premyelinating stage, myelinating stage and postmyelinating stage has rarely been studied. In this study, dorsal root ganglia were isolated from rats between postnatal day 1 and postnatal day 56. The expression pattern of neuregulin-1 type III in dorsal root ganglia neurons at various developmental stages were compared by quantitative real-time polymerase chain reaction, western blot assay and immunofluorescent staining. The expression of neuregulin-1 type III mRNA reached its peak at postnatal day 3 and then stabilized at a relative high expression level from postnatal day 3 to postnatal day 56. The expression of neuregulin-1 type III protein increased gradually from postnatal day 1, reached a peak at postnatal day 28, and then decreased at postnatal day 56. Immunofluorescent staining results showed a similar tendency to western blot assay results. Experimental findings indicate that the expression of neuregulin-1 type III in rat dorsal root ganglion was increased during the premyelinating (from postnatal day 2 to postnatal day 5 and myelinating stage (from postnatal day 5 to postnatal day 10, but remained at a high level in the postmyelinating stage (after postnatal day 10.


    Directory of Open Access Journals (Sweden)

    Elmeida Effendy


    Full Text Available The neuregulin 1 (NRG1 gene which influences the development of white matter connectivity has been associated with schizophrenia. It influences neuronal migration, synaptogenesis, gliogenesis, neuron-glia communication, myelination, and neurotransmission in the brain and others. NRG1 is located in 8p13, and it is frequently replicated in schizphrenia. SNP8NRG433E1006 gene NRG1 is one of core at risk haplotype of schizphrenia. This study looked forward differences SNP8NRG433E1006 neuregulin 1 between Bataks ethnic with schizophrenia paranoid and Bataks ethnic healthy control. Methods: Batak ethnic with schizophrenia paranoid were recruited and interviewed with semi-structured MINI ICD-X to establish the diagnosis. All the eligible subjects were requested their permission for blood sampling. Healthy Batak ethnic were also recruited by mathcing the age and gender. The blood samples went through DNA isolation, Nested PCR, and DNA sequencing. Results: Ninety three subjects were recruited, but only 74 blood samples were succesfully sequenced. We found three types of polymorphisms, i.e. G/A allele at base pair (bp 76, G/T allele at bp 112, and deletion at bp 110 in Batak ethnic with schizophrenia. There were two kind sequences at bp 113-116 in Batak ethnics, and Batak ethnics with ATCG were at higher risk for having schizophrenia. This study support that NRG1 is a schizophrenia-susceptibility gene.

  12. What does a mouse tell us about neuregulin 1 – cannabis interactions?

    Directory of Open Access Journals (Sweden)

    Tim eKarl


    Full Text Available The link between cannabis and psychosis has been debated although there is substantial epidemiological evidence showing that cannabis increases the risk of psychosis. It has been hypothesized that schizophrenia patients carrying particular risk genes might be more sensitive to the psychosis-inducing effects of cannabis than other patients and healthy test subjects. Here we review the effects of cannabinoids on a mutant mouse model for the schizophrenia candidate gene neuregulin 1 (Nrg1. The studies suggest a complex interaction between cannabis and Nrg1: the neuro-behavioural effects of cannabinoids were different in Nrg1 mutant and control mice and depended on exposure time, sex and age of test animals. This research provides the first evidence of complex cannabis-Nrg1 interactions suggesting Nrg1 as a prime target for future clinical investigations. Furthermore, it highlights that animal model research can broaden our understanding of the complex multi-factorial aetiology of schizophrenia. Finally, the findings are important to preventive psychiatry: if the genes that confer genetic vulnerability to cannabis-induced psychosis were identified patients at-high risk could be forewarned of the potential dangers of cannabis abuse.

  13. Dysregulated Expression of Neuregulin-1 by Cortical Pyramidal Neurons Disrupts Synaptic Plasticity

    Directory of Open Access Journals (Sweden)

    Amit Agarwal


    Full Text Available Neuregulin-1 (NRG1 gene variants are associated with increased genetic risk for schizophrenia. It is unclear whether risk haplotypes cause elevated or decreased expression of NRG1 in the brains of schizophrenia patients, given that both findings have been reported from autopsy studies. To study NRG1 functions in vivo, we generated mouse mutants with reduced and elevated NRG1 levels and analyzed the impact on cortical functions. Loss of NRG1 from cortical projection neurons resulted in increased inhibitory neurotransmission, reduced synaptic plasticity, and hypoactivity. Neuronal overexpression of cysteine-rich domain (CRD-NRG1, the major brain isoform, caused unbalanced excitatory-inhibitory neurotransmission, reduced synaptic plasticity, abnormal spine growth, altered steady-state levels of synaptic plasticity-related proteins, and impaired sensorimotor gating. We conclude that an “optimal” level of NRG1 signaling balances excitatory and inhibitory neurotransmission in the cortex. Our data provide a potential pathomechanism for impaired synaptic plasticity and suggest that human NRG1 risk haplotypes exert a gain-of-function effect.

  14. Characterization of glial cell models and in vitro manipulation of the neuregulin1/ErbB system

    NARCIS (Netherlands)

    Pascal, Davide; Giovannelli, Alessia; Gnavi, Sara; Hoyng, Stefan Adriaan; de Winter, Fred; Morano, Michela; Fregnan, Federica; Dell'Albani, Paola; Zaccheo, Damiano; Perroteau, Isabelle; Pellitteri, Rosalia; Gambarotta, Giovanna


    The neuregulin1/ErbB system plays an important role in Schwann cell behavior both in normal and pathological conditions. Upon investigation of the expression of the neuregulin1/ErbB system in vitro, we explored the possibility to manipulate the system in order to increase the migration of Schwann

  15. Neuronal merlin influences ERBB2 receptor expression on Schwann cells through neuregulin 1 type III signalling. (United States)

    Schulz, Alexander; Kyselyova, Anna; Baader, Stephan L; Jung, Marie Juliane; Zoch, Ansgar; Mautner, Victor-Felix; Hagel, Christian; Morrison, Helen


    Axonal surface proteins encompass a group of heterogeneous molecules, which exert a variety of different functions in the highly interdependent relationship between axons and Schwann cells. We recently revealed that the tumour suppressor protein merlin, mutated in the hereditary tumour syndrome neurofibromatosis type 2, impacts significantly on axon structure maintenance in the peripheral nervous system. We now report on a role of neuronal merlin in the regulation of the axonal surface protein neuregulin 1 important for modulating Schwann cell differentiation and myelination. Specifically, neuregulin 1 type III expression is reduced in sciatic nerve tissue of neuron-specific knockout animals as well as in biopsies from seven patients with neurofibromatosis type 2. In vitro experiments performed on both the P19 neuronal cell line and primary dorsal root ganglion cells demonstrate the influence of merlin on neuregulin 1 type III expression. Moreover, expression of ERBB2, a Schwann cell receptor for neuregulin 1 ligands is increased in nerve tissue of both neuron-specific merlin knockout animals and patients with neurofibromatosis type 2, demonstrating for the first time that axonal merlin indirectly regulates Schwann cell behaviour. Collectively, we have identified that neuronally expressed merlin can influence Schwann cell activity in a cell-extrinsic manner.

  16. Partial genetic deletion of neuregulin 1 and adolescent stress interact to alter NMDA receptor binding in the medial prefrontal cortex

    Directory of Open Access Journals (Sweden)

    Tariq Waseem Chohan


    Full Text Available Schizophrenia is thought to arise due to a complex interaction between genetic and environmental factors during early neurodevelopment. We have recently shown that partial genetic deletion of the schizophrenia susceptibility gene neuregulin 1 (Nrg1 and adolescent stress interact to disturb sensorimotor gating, neuroendocrine activity and dendritic morphology in mice. Both stress and Nrg1 may have converging effects upon N-methyl-D-aspartate receptors (NMDARs which are implicated in the pathogenesis of schizophrenia, sensorimotor gating and dendritic spine plasticity. Using an identical repeated restraint stress paradigm to our previous study, here we determined NMDAR binding across various brain regions in adolescent Nrg1 heterozygous (HET and wild-type (WT mice using [3H] MK-801 autoradiography. Repeated restraint stress increased NMDAR binding in the ventral part of the lateral septum (LSV and the dentate gyrus (DG of the hippocampus irrespective of genotype. Partial genetic deletion of Nrg1 interacted with adolescent stress to promote an altered pattern of NMDAR binding in the infralimbic (IL subregion of the medial prefrontal cortex. In the IL, whilst stress tended to increase NMDAR binding in WT mice, it decreased binding in Nrg1 HET mice. However in the DG, stress selectively increased the expression of NMDAR binding in Nrg1 HET mice but not WT mice. These results demonstrate a Nrg1-stress interaction during adolescence on NMDAR binding in the medial prefrontal cortex.

  17. Behavioural characterization of neuregulin 1 (NRG1) type I over-expressing transgenic mice (United States)

    Deakin, Inga H.; Law, Amanda J.; Oliver, Peter L.; Schwab, Markus H.; Nave, Klaus Armin; Harrison, Paul J.; Bannerman, David M.


    Neuregulin 1 (NRG1) is a pleiotropic growth factor involved in diverse aspects of brain development and function. In schizophrenia, expression of the NRG1 type I isoform is selectively increased. However, virtually nothing is known about the roles of this isoform in brain. We have studied transgenic mice over-expressing type I NRG1 (NRG1type 1-tg) using a series of behavioural tests. NRG1type 1-tg mice have a tremor, are impaired on the accelerating rotarod, and have reduced prepulse inhibition in the context of an increased baseline startle response. There is no overall anxiety or activity phenotype, although female NRG1type 1-tg mice show mild increases in anxiety on some measures. The pattern of results shows both similarities and differences to those reported in hypomorphic NRG1 mice, and may be relevant for interpreting the increased NRG1 type I expression seen in schizophrenia. PMID:19829162

  18. The roles of neuregulin-1 in cardiac development, homeostasis, and disease. (United States)

    Rupert, Cassady E; Coulombe, Kareen Lk


    Neuregulin-1 (NRG-1) and its signaling receptors, erythroblastic leukemia viral oncogene homologs (ErbB) 2, 3, and 4, have been implicated in both cardiomyocyte development and disease, as well as in homeostatic cardiac function. NRG-1/ErbB signaling is involved in a multitude of cardiac processes ranging from myocardial and cardiac conduction system development to angiogenic support of cardiomyocytes, to cardioprotective effects upon injury. Numerous studies of NRG-1 employ a variety of platforms, including in vitro assays, animal models, and human clinical trials, with equally varying and, sometimes, contradictory outcomes. NRG-1 has the potential to be used as a therapeutic tool in stem cell therapies, tissue engineering applications, and clinical diagnostics and treatment. This review presents a concise summary of the growing body of literature to highlight the temporally persistent significance of NRG-1/ErbB signaling throughout development, homeostasis, and disease in the heart, specifically in cardiomyocytes.

  19. Inhibition of endoplasmic reticulum stress by neuregulin-1 protects against myocardial ischemia/reperfusion injury. (United States)

    Fang, Shan-Juan; Li, Peng-Yang; Wang, Chun-Mei; Xin, Yi; Lu, Wei-Wei; Zhang, Xiao-Xia; Zuo, Song; Ma, Chang-Sheng; Tang, Chao-Shu; Nie, Shao-Ping; Qi, Yong-Fen


    Neuregulin-1 (NRG-1), an endogenously produced polypeptide, is the ligand of cardiomyocyte ErbB receptors, with cardiovascular protective effects. In the present study, we explored whether the cardioprotective effect of NRG-1 against I/R injury is mediated by inhibiting myocardial endoplasmic reticulum (ER) stress. In vitro, NRG-1 directly inhibited the upregulation of ER stress markers such as glucose-regulated protein 78, CCAAT/enhancer binding protein homologous protein and cleaved caspase-12 induced by the ER stress inducers tunicamycin or dithiothreitol in both neonatal and adult ventricular myocytes. Attenuating ErbB signals by an ErbB inhibitor AG1478 or ErbB4 knockdown and preincubation with phosphoinositide 3-kinase inhibitors all reversed the effect of NRG-1 inhibiting ER stress in cultured neonatal rat cardiomyocytes. Concurrently, cardiomyocyte ER stress and apoptosis induced by hypoxia-reoxygenation were decreased by NRG-1 treatment in vitro. Furthermore, in an in vivo rat model of myocardium ischemia/reperfusion (I/R), intravenous NRG-1 administration significantly decreased ER stress and myocardial infarct size induced by I/R. NRG-1 could protect the heart against I/R injury by inhibiting myocardial ER stress, which might be mediated by the phosphoinositide 3-kinase/Akt signaling pathway. Copyright © 2016 Elsevier Inc. All rights reserved.

  20. Plasma soluble neuregulin-1 as a diagnostic biomarker for Alzheimer's disease. (United States)

    Chang, Keun-A; Shin, Ki Young; Nam, Eunjoo; Lee, Yeong-Bae; Moon, Cheil; Suh, Yoo-Hun; Lee, Sang Hyung


    To identify some apparent biomarker candidates for the diagnosis of Alzheimer's disease (AD) pathology, we investigated whether there would be a significant difference between the levels of the plasma proteins of AD patients and healthy people. A total of 115 subjects were enrolled, 60 individuals with AD and 55 healthy controls. There was a statistical difference in the mini-mental status exam (MMSE) scores and the clinical dementia rating (CDR) scores between the two groups. We used the immunoblotting assay to analyze several plasma proteins in the subjects. Amyloid-β (Aβ), S100a9, and soluble neuregulin-1 (sNRG-1), including α-synuclein (α-Syn) as a detection control were detected in the plasma samples. Unlike Aβ, S100a9 and α-Syn, the level of sNRG-1 of the AD patients was significantly higher than that of the healthy control subjects. The AD patients were divided into mild and moderate groups according to their MMSE and CDR scores. We found a significant correlation between the level of sNRG-1 and MMSE scores. The sNRG-1 level was significantly higher in mild AD patients as well as in moderate AD patients compared with that of the control subjects. These new findings indicate that increased plasma sNRG-1 levels might be a novel and reliable biological marker for the early diagnosis of AD. Copyright © 2016 Elsevier Ltd. All rights reserved.

  1. Neuregulin 1 Promotes Glutathione-Dependent Neuronal Cobalamin Metabolism by Stimulating Cysteine Uptake

    Directory of Open Access Journals (Sweden)

    Yiting Zhang


    Full Text Available Neuregulin 1 (NRG-1 is a key neurotrophic factor involved in energy homeostasis and CNS development, and impaired NRG-1 signaling is associated with neurological disorders. Cobalamin (Cbl, also known as vitamin B12, is an essential micronutrient which mammals must acquire through diet, and neurologic dysfunction is a primary clinical manifestation of Cbl deficiency. Here we show that NRG-1 stimulates synthesis of the two bioactive Cbl species adenosylcobalamin (AdoCbl and methylcobalamin (MeCbl in human neuroblastoma cells by both promoting conversion of inactive to active Cbl species and increasing neuronal Cbl uptake. Formation of active Cbls is glutathione- (GSH- dependent and the NRG-1-initiated increase is dependent upon its stimulation of cysteine uptake by excitatory amino acid transporter 3 (EAAT3, leading to increased GSH. The stimulatory effect of NRG-1 on cellular Cbl uptake is associated with increased expression of megalin, which is known to facilitate Cbl transport in ileum and kidney. MeCbl is a required cofactor for methionine synthase (MS and we demonstrate the ability of NRG-1 to increase MS activity, and affect levels of methionine methylation cycle metabolites. Our results identify novel neuroprotective roles of NRG-1 including stimulating antioxidant synthesis and promoting active Cbl formation.

  2. Distinct neurobehavioural effects of cannabidiol in transmembrane domain neuregulin 1 mutant mice.

    Directory of Open Access Journals (Sweden)

    Leonora E Long

    Full Text Available The cannabis constituent cannabidiol (CBD possesses anxiolytic and antipsychotic properties. We have previously shown that transmembrane domain neuregulin 1 mutant (Nrg1 TM HET mice display altered neurobehavioural responses to the main psychoactive constituent of cannabis, Δ(9-tetrahydrocannabinol. Here we investigated whether Nrg1 TM HET mice respond differently to CBD and whether CBD reverses schizophrenia-related phenotypes expressed by these mice. Adult male Nrg1 TM HET and wild type-like littermates (WT received vehicle or CBD (1, 50 or 100 mg/kg i.p. for 21 days. During treatment and 48 h after withdrawal we measured behaviour, whole blood CBD concentrations and autoradiographic receptor binding. Nrg1 HET mice displayed locomotor hyperactivity, PPI deficits and reduced 5-HT(2A receptor binding density in the substantia nigra, but these phenotypes were not reversed by CBD. However, long-term CBD (50 and 100 mg/kg selectively enhanced social interaction in Nrg1 TM HET mice. Furthermore, acute CBD (100 mg/kg selectively increased PPI in Nrg1 TM HET mice, although tolerance to this effect was manifest upon repeated CBD administration. Long-term CBD (50 mg/kg also selectively increased GABA(A receptor binding in the granular retrosplenial cortex in Nrg1 TM HET mice and reduced 5-HT(2A binding in the substantia nigra in WT mice. Nrg1 appears necessary for CBD-induced anxiolysis since only WT mice developed decreased anxiety-related behaviour with repeated CBD treatment. Altered pharmacokinetics in mutant mice could not explain our findings since no genotype differences existed in CBD blood concentrations. Here we demonstrate that Nrg1 modulates acute and long-term neurobehavioural effects of CBD, which does not reverse the schizophrenia-relevant phenotypes.

  3. Neuregulin 1 Prevents Phencyclidine-Induced Behavioral Impairments and Disruptions to GABAergic Signaling in Mice. (United States)

    Engel, Martin; Snikeris, Peta; Jenner, Andrew; Karl, Tim; Huang, Xu-Feng; Frank, Elisabeth


    Substantial evidence from human post-mortem and genetic studies has linked the neurotrophic factor neuregulin 1 (NRG1) to the pathophysiology of schizophrenia. Genetic animal models and in vitro experiments have suggested that altered NRG1 signaling, rather than protein changes, contributes to the symptomatology of schizophrenia. However, little is known about the effect of NRG1 on schizophrenia-relevant behavior and neurotransmission (particularly GABAergic and glutamatergic) in adult animals. To address this question, we treated adult mice with the extracellular signaling domain of NRG1 and assessed spontaneous locomotor activity and acoustic startle response, as well as extracellular GABA, glutamate, and glycine levels in the prefrontal cortex and hippocampus via microdialysis. Furthermore, we asked whether the effect of NRG1 would differ under schizophrenia-relevant impairments in mice and therefore co-treated mice with NRG1 and phencyclidine (PCP) (3 mg/kg). Acute intraventricularly- or systemically-injected NRG1 did not affect spontaneous behavior, but prevented PCP induced hyperlocomotion and deficits of prepulse inhibition. NRG1 retrodialysis (10 nM) reduced extracellular glutamate and glycine levels in the prefrontal cortex and hippocampus, and prevented PCP-induced increase in extracellular GABA levels in the hippocampus. With these results, we provide the first compelling in vivo evidence for the involvement of NRG1 signaling in schizophrenia-relevant behavior and neurotransmission in the adult nervous system, which highlight its treatment potential. Furthermore, the ability of NRG1 treatment to alter GABA, glutamate, and glycine levels in the presence of PCP also suggests that NRG1 signaling has the potential to alter disrupted neurotransmission in patients with schizophrenia.

  4. Perinatal phencyclidine administration decreases the density of cortical interneurons and increases the expression of neuregulin-1. (United States)

    Radonjić, Nevena V; Jakovcevski, Igor; Bumbaširević, Vladimir; Petronijević, Nataša D


    Perinatal phencyclidine (PCP) administration in rat blocks the N-methyl D-aspartate receptor (NMDAR) and causes symptoms reminiscent of schizophrenia in human. A growing body of evidence suggests that alterations in γ-aminobutyric acid (GABA) interneuron neurotransmission may be associated with schizophrenia. Neuregulin-1 (NRG-1) is a trophic factor important for neurodevelopment, synaptic plasticity, and wiring of GABA circuits. The aim of this study was to determine the long-term effects of perinatal PCP administration on the projection and local circuit neurons and NRG-1 expression in the cortex and hippocampus. Rats were treated on postnatal day 2 (P2), P6, P9, and P12 with either PCP (10 mg/kg) or saline. Morphological studies and determination of NRG-1 expression were performed at P70. We demonstrate reduced densities of principal neurons in the CA3 and dentate gyrus (DG) subregions of the hippocampus and a reduction of major interneuronal populations in all cortical and hippocampal regions studied in PCP-treated rats compared with controls. For the first time, we show the reduced density of reelin- and somatostatin-positive cells in the cortex and hippocampus of animals perinatally treated with PCP. Furthermore, an increase in the numbers of perisomatic inhibitory terminals around the principal cells was observed in the motor cortex and DG. We also show that perinatal PCP administration leads to an increased NRG-1 expression in the cortex and hippocampus. Taken together, our findings demonstrate that perinatal PCP administration increases NRG-1 expression and reduces the number of projecting and local circuit neurons, revealing complex consequences of NMDAR blockade.

  5. Two Genes Encoding Uracil Phosphoribosyltransferase Are Present in Bacillus subtilis

    DEFF Research Database (Denmark)

    Martinussen, Jan; Glaser, Philippe; Andersen, Paal S.


    Uracil phosphoribosyltransferase (UPRTase) catalyzes the key reaction in the salvage of uracil in many microorganisms. Surprisingly, two genes encoding UPRTase activity were cloned from Bacillus subtilis by complementation of an Escherichia coli mutant. The genes were sequenced, and the putative...

  6. Transgenic Overexpression of the Type I Isoform of Neuregulin 1 Affects Working Memory and Hippocampal Oscillations but not Long-term Potentiation (United States)

    Deakin, Inga H.; Nissen, Wiebke; Law, Amanda J.; Lane, Tracy; Kanso, Riam; Schwab, Markus H.; Nave, Klaus-Armin; Lamsa, Karri P.; Paulsen, Ole; Bannerman, David M.


    Neuregulin 1 (NRG1) is a growth factor involved in neurodevelopment and plasticity. It is a schizophrenia candidate gene, and hippocampal expression of the NRG1 type I isoform is increased in the disorder. We have studied transgenic mice overexpressing NRG1 type I (NRG1tg-type I) and their wild-type littermates and measured hippocampal electrophysiological and behavioral phenotypes. Young NRG1tg-type I mice showed normal memory performance, but in older NRG1tg-type I mice, hippocampus-dependent spatial working memory was selectively impaired. Hippocampal slice preparations from NRG1tg-type I mice exhibited a reduced frequency of carbachol-induced gamma oscillations and an increased tendency to epileptiform activity. Long-term potentiation in NRG1tg-type I mice was normal. The results provide evidence that NRG1 type I impacts on hippocampal function and circuitry. The effects are likely mediated via inhibitory interneurons and may be relevant to the involvement of NRG1 in schizophrenia. However, the findings, in concert with those from other genetic and pharmacological manipulations of NRG1, emphasize the complex and pleiotropic nature of the gene, even with regard to a single isoform. PMID:21878485

  7. Neuregulin-1 regulates cell adhesion via an ErbB2/phosphoinositide-3 kinase/Akt-dependent pathway: potential implications for schizophrenia and cancer.

    Directory of Open Access Journals (Sweden)

    Christopher G Kanakry


    Full Text Available Neuregulin-1 (NRG1 is a putative schizophrenia susceptibility gene involved extensively in central nervous system development as well as cancer invasion and metastasis. Using a B lymphoblast cell model, we previously demonstrated impairment in NRG1alpha-mediated migration in cells derived from patients with schizophrenia as well as effects of risk alleles in NRG1 and catechol-O-methyltransferase (COMT, a second gene implicated both in schizophrenia susceptibility and in cancer.Here, we examine cell adhesion, an essential component process of cell motility, using an integrin-mediated cell adhesion assay based on an interaction between ICAM-1 and the CD11a/CD18 integrin heterodimer expressed on lymphoblasts. In our assay, NRG1alpha induces lymphoblasts to assume varying levels of adhesion characterized by time-dependent fluctuations in the firmness of attachment. The maximum range of variation in adhesion over sixty minutes correlates strongly with NRG1alpha-induced migration (r(2 = 0.61. NRG1alpha-induced adhesion variation is blocked by erbB2, PI3K, and Akt inhibitors, but not by PLC, ROCK, MLCK, or MEK inhibitors, implicating the erbB2/PI3K/Akt1 signaling pathway in NRG1-stimulated, integrin-mediated cell adhesion. In cell lines from 20 patients with schizophrenia and 20 normal controls, cells from patients show a significant deficiency in the range of NRG1alpha-induced adhesion (p = 0.0002. In contrast, the response of patient-derived cells to phorbol myristate acetate is unimpaired. The COMT Val108/158Met genotype demonstrates a strong trend towards predicting the range of the NRG1alpha-induced adhesion response with risk homozygotes having decreased variation in cell adhesion even in normal subjects (p = 0.063.Our findings suggest that a mechanism of the NRG1 genetic association with schizophrenia may involve the molecular biology of cell adhesion.

  8. Bioinformatics analysis and detection of gelatinase encoded gene in Lysinibacillussphaericus (United States)

    Repin, Rul Aisyah Mat; Mutalib, Sahilah Abdul; Shahimi, Safiyyah; Khalid, Rozida Mohd.; Ayob, Mohd. Khan; Bakar, Mohd. Faizal Abu; Isa, Mohd Noor Mat


    In this study, we performed bioinformatics analysis toward genome sequence of Lysinibacillussphaericus (L. sphaericus) to determine gene encoded for gelatinase. L. sphaericus was isolated from soil and gelatinase species-specific bacterium to porcine and bovine gelatin. This bacterium offers the possibility of enzymes production which is specific to both species of meat, respectively. The main focus of this research is to identify the gelatinase encoded gene within the bacteria of L. Sphaericus using bioinformatics analysis of partially sequence genome. From the research study, three candidate gene were identified which was, gelatinase candidate gene 1 (P1), NODE_71_length_93919_cov_158.931839_21 which containing 1563 base pair (bp) in size with 520 amino acids sequence; Secondly, gelatinase candidate gene 2 (P2), NODE_23_length_52851_cov_190.061386_17 which containing 1776 bp in size with 591 amino acids sequence; and Thirdly, gelatinase candidate gene 3 (P3), NODE_106_length_32943_cov_169.147919_8 containing 1701 bp in size with 566 amino acids sequence. Three pairs of oligonucleotide primers were designed and namely as, F1, R1, F2, R2, F3 and R3 were targeted short sequences of cDNA by PCR. The amplicons were reliably results in 1563 bp in size for candidate gene P1 and 1701 bp in size for candidate gene P3. Therefore, the results of bioinformatics analysis of L. Sphaericus resulting in gene encoded gelatinase were identified.

  9. Inside-out Regulation of Ectodomain Cleavage of Cluster-of-Differentiation-44 (CD44) and of Neuregulin-1 Requires Substrate Dimerization. (United States)

    Hartmann, Monika; Parra, Liseth M; Ruschel, Anne; Lindner, Christina; Morrison, Helen; Herrlich, Andreas; Herrlich, Peter


    Ectodomain shedding of transmembrane precursor proteins generates numerous life-essential molecules, such as epidermal growth factor receptor ligands. This cleavage not only releases the regulatory growth factor, but it is also the required first step for the subsequent processing by γ-secretase and the release of gene regulatory intracellular fragments. Signaling within the cell modifies the cytoplasmic tails of substrates, a step important in starting the specific and regulated cleavage of a large number of studied substrates. Ectodomain cleavage occurs, however, on the outside of the plasma membrane and is carried out by membrane-bound metalloproteases. How the intracellular domain modification communicates with the ectodomain of the substrate to allow for cleavage to occur is unknown. Here, we show that homodimerization of a cluster-of-differentiation-44 or of pro-neuregulin-1 monomers represents an essential pre-condition for their regulated ectodomain cleavage. Both substrates are associated with their respective metalloproteases under both basal or cleavage-stimulated conditions. These interactions only turn productive by specific intracellular signal-induced intracellular domain modifications of the substrates, which in turn regulate metalloprotease access to the substrates' ectodomain and cleavage. We propose that substrate intracellular domain modification induces a relative rotation or other positional change of the dimerization partners that allow metalloprotease cleavage in the extracellular space. Our findings fill an important gap in understanding substrate-specific inside-out signal transfer along cleaved transmembrane proteins and suggest that substrate dimerization (homo- or possibly heterodimerization) might represent a general principle in ectodomain shedding. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  10. Distinct phenotypes of new transmembrane-domain neuregulin 1 mutant mice and the rescue effects of valproate on the observed schizophrenia-related cognitive deficits.

    Directory of Open Access Journals (Sweden)

    Ju-Chun ePei


    Full Text Available Accumulating evidence suggests that neuregulin 1 (NRG1 might be involved in the neurodevelopment, neural plasticity, GABAergic neurotransmission and pathogenesis of schizophrenia. NRG1 is abundantly expressed in the hippocampus, and emerging studies have begun to reveal the link between NRG1 signaling and cognitive deficits in schizophrenic patients. Because the transmembrane domain of NRG1 is vital for both forward and reverse signaling cascades, new Nrg1-deficient mice that carry a truncation of the transmembrane domain of the Nrg1 gene were characterized and used in this study to test a NRG1 loss-of-function hypothesis for schizophrenia. Both male and female Nrg1 heterozygous mutant mice and their wild-type littermates were used in a series of 4 experiments to characterize the impact of Nrg1 on behavioral phenotypes and to determine the importance of Nrg1 in the regulation of hippocampal neuromorphology and local GABAergic interneurons. First, a comprehensive battery of behavioral tasks indicated that male Nrg1-deficient mice exhibited significant impairments in cognitive functions. Second, pharmacological challenges were conducted and revealed that Nrg1 haploinsufficiency altered GABAergic activity in males. Third, although no genotype-specific neuromorphological alterations were found in the hippocampal CA1 pyramidal neurons, significant reductions in the hippocampal expressions of GAD67 and parvalbumin were revealed in the Nrg1-deficient males. Fourth, chronic treatment with valproate rescued the observed behavioral deficits and hippocampal GAD67 reduction in Nrg1-deficient males. Collectively, these results indicate the potential therapeutic effect of valproate and the importance of Nrg1 in the regulation of cognitive functions and hippocampal GABAergic interneurons, especially in males.

  11. Sensorimotor Gating Depends on Polymorphisms of the Serotonin-2A Receptor and Catechol-O-Methyltransferase, but Not on Neuregulin-1 Arg38Gln Genotype: A Replication Study (United States)

    Quednow, Boris B.; Schmechtig, Anne; Ettinger, Ulrich; Petrovsky, Nadine; Collier, David A.; Vollenweider, Franz X.; Wagner, Michael; Kumari, Veena


    Background Prepulse inhibition (PPI) of the acoustic startle response (ASR) is an operational measure of sensorimotor gating and a promising endophenotype of schizophrenia. We have recently shown that the linked serotonin-2A receptor (5-HT2AR) A-1438 G and T102C polymorphisms modulate PPI in schizophrenia patients. Moreover, it was shown that genetic variation in the catechol-O-methyltransferase (COMT) and the neuregulin-1 (NRG-1) proteins influences PPI in schizophrenia patients and healthy volunteers. Therefore, we aimed to replicate these results and investigated the impact of the related polymorphisms on PPI in healthy human volunteers. Methods We analyzed the 5-HT2AR A-1438 G/T102C (rs6311/rs6313), the COMT Val158Met (rs4680), and the NRG-1 Arg38Gln (rs3924999) polymorphisms, assessing startle reactivity, habituation, and PPI of ASR in 107 healthy Caucasian volunteers. Results Subjects homozygous for the 5-HT2AR T102C-T/A-1438 G-A allele showed increased PPI levels. In particular, male subjects with the COMT Met158Met-genotype also showed elevated PPI. The NRG-1 Arg38Gln genotype did not have a significant impact on PPI. Startle reactivity was not affected by any of the investigated polymorphisms. Conclusions We confirmed in an independent sample of healthy volunteers that PPI is influenced by genetic variation in the 5-HT2AR gene. The influence of the COMT Val158Met genotype on PPI appears to be sex-specific. These results underscore the significance of the serotonin and dopamine systems in the modulation of sensorimotor gating. PMID:19545856

  12. Genes encoding giant danio and golden shiner ependymin. (United States)

    Adams, D S; Kiyokawa, M; Getman, M E; Shashoua, V E


    Ependymin (EPN) is a brain glycoprotein that functions as a neurotrophic factor in optic nerve regeneration and long-term memory consolidation in goldfish. To date, true epn genes have been characterized in one order of teleost fish, Cypriniformes. In the study presented here, polymerase chain reactions were used to analyze the complete epn genes, gd (1480 bp), and sh (2071 bp), from Cypriniformes giant danio and shiner, respectively. Southern hybridizations demonstrated the existence of one copy of each gene per corresponding haploid genome. Each gene was found to contain six exons and five introns. Gene gd encodes a predicted 218-amino acid (aa) protein GD 93 percent conserved to goldfish EPN, while sh encodes a predicted 214-aa protein SH 91 percent homologous to goldfish. Evidence is presented classifying proteins previously termed "EPNs" into two major categories: true EPNs and non-EPN cerebrospinal fluid glycoproteins. Proteins GD and SH contain all the hallmark, features of true EPNs.

  13. Multiple genes encode the major surface glycoprotein of Pneumocystis carinii

    DEFF Research Database (Denmark)

    Kovacs, J A; Powell, F; Edman, J C


    this antigen is a good candidate for development as a vaccine to prevent or control P. carinii infection. We have cloned and sequenced seven related but unique genes encoding the major surface glycoprotein of rat P. carinii. Partial amino acid sequencing confirmed the identity of these genes. Based on Southern...... blot studies using chromosomal or restricted DNA, the major surface glycoproteins are the products of a multicopy family of genes. The predicted protein has an M(r) of approximately 123,000, is relatively rich in cysteine residues (5.5%) that are very strongly conserved, and contains a well conserved...... hydrophobic region at the carboxyl terminus. The presence of multiple related msg genes encoding the major surface glycoprotein of P. carinii suggests that antigenic variation is a possible mechanism for evading host defenses. Further characterization of this family of genes should allow the development...

  14. Human germline antibody gene segments encode polyspecific antibodies. (United States)

    Willis, Jordan R; Briney, Bryan S; DeLuca, Samuel L; Crowe, James E; Meiler, Jens


    Structural flexibility in germline gene-encoded antibodies allows promiscuous binding to diverse antigens. The binding affinity and specificity for a particular epitope typically increase as antibody genes acquire somatic mutations in antigen-stimulated B cells. In this work, we investigated whether germline gene-encoded antibodies are optimal for polyspecificity by determining the basis for recognition of diverse antigens by antibodies encoded by three VH gene segments. Panels of somatically mutated antibodies encoded by a common VH gene, but each binding to a different antigen, were computationally redesigned to predict antibodies that could engage multiple antigens at once. The Rosetta multi-state design process predicted antibody sequences for the entire heavy chain variable region, including framework, CDR1, and CDR2 mutations. The predicted sequences matched the germline gene sequences to a remarkable degree, revealing by computational design the residues that are predicted to enable polyspecificity, i.e., binding of many unrelated antigens with a common sequence. The process thereby reverses antibody maturation in silico. In contrast, when designing antibodies to bind a single antigen, a sequence similar to that of the mature antibody sequence was returned, mimicking natural antibody maturation in silico. We demonstrated that the Rosetta computational design algorithm captures important aspects of antibody/antigen recognition. While the hypervariable region CDR3 often mediates much of the specificity of mature antibodies, we identified key positions in the VH gene encoding CDR1, CDR2, and the immunoglobulin framework that are critical contributors for polyspecificity in germline antibodies. Computational design of antibodies capable of binding multiple antigens may allow the rational design of antibodies that retain polyspecificity for diverse epitope binding.

  15. A deep auto-encoder model for gene expression prediction. (United States)

    Xie, Rui; Wen, Jia; Quitadamo, Andrew; Cheng, Jianlin; Shi, Xinghua


    Gene expression is a key intermediate level that genotypes lead to a particular trait. Gene expression is affected by various factors including genotypes of genetic variants. With an aim of delineating the genetic impact on gene expression, we build a deep auto-encoder model to assess how good genetic variants will contribute to gene expression changes. This new deep learning model is a regression-based predictive model based on the MultiLayer Perceptron and Stacked Denoising Auto-encoder (MLP-SAE). The model is trained using a stacked denoising auto-encoder for feature selection and a multilayer perceptron framework for backpropagation. We further improve the model by introducing dropout to prevent overfitting and improve performance. To demonstrate the usage of this model, we apply MLP-SAE to a real genomic datasets with genotypes and gene expression profiles measured in yeast. Our results show that the MLP-SAE model with dropout outperforms other models including Lasso, Random Forests and the MLP-SAE model without dropout. Using the MLP-SAE model with dropout, we show that gene expression quantifications predicted by the model solely based on genotypes, align well with true gene expression patterns. We provide a deep auto-encoder model for predicting gene expression from SNP genotypes. This study demonstrates that deep learning is appropriate for tackling another genomic problem, i.e., building predictive models to understand genotypes' contribution to gene expression. With the emerging availability of richer genomic data, we anticipate that deep learning models play a bigger role in modeling and interpreting genomics.

  16. Transcriptional modulation of genes encoding nitrate reductase in ...

    African Journals Online (AJOL)


    Oct 26, 2016 ... The free aluminum (Al) content in soil can reach levels that are toxic to plants, and this has frequently limited increased productivity of cultures. Four genes encoding nitrate reductase (NR) were identified, named ZmNR1–4. With the aim of evaluating NR activity and the transcriptional modulation of the.

  17. Functional analysis of a gene encoding threonine synthase from rice ...

    African Journals Online (AJOL)

    The predicted amino acid sequence of OsTS is highly homologous to that of Arabidopsis TS and many bacterial TS encoded by thrC gene. The OsTS protein harbors a signature binding motif for pyridoxal- 5' -phosphate at the amino terminus. A thrC mutant strain of Escherichia coli was complemented by OsTS expression.

  18. Transcriptional modulation of genes encoding nitrate reductase in ...

    African Journals Online (AJOL)

    The free aluminum (Al) content in soil can reach levels that are toxic to plants, and this has frequently limited increased productivity of cultures. Four genes encoding nitrate reductase (NR) were identified, named ZmNR1–4. With the aim of evaluating NR activity and the transcriptional modulation of the ZmNR1, ZmNR2, ...

  19. Genes encoding chimeras of Neurospora crassa erg-3 and human ...

    Indian Academy of Sciences (India)


    In the yeast Saccharomyces cerevisiae, sterol. C-14 reductase is encoded by the ERG24 gene and erg24 null mutants are not viable on rich medium but they are viable on synthetic medium (Crowley et al 1996). Both the Neurospora and the yeast mutants have been used previously to test for sterol C-14 reductase function ...

  20. Genes encoding chimeras of Neurospora crassa erg-3 and human ...

    Indian Academy of Sciences (India) Keywords. Lamin B receptor; sterol reductase. Abstract. The human gene TM7SF2 encodes a polypeptide (SR-1) with high sequence similarity to sterol C-14 reductase, a key sterol biosynthetic enzyme in fungi, plants and mammals. In Neurospora and yeast this ...

  1. Chlorella viruses contain genes encoding a complete polyamine biosynthetic pathway (United States)

    Baumann, Sascha; Sander, Adrianne; Gurnon, James R.; Yanai-Balser, Giane; VanEtten, James L.; Piotrowski, Markus


    Two genes encoding the putative polyamine biosynthetic enzymes agmatine iminohydrolase (AIH) and N-carbamoylputrescine amidohydrolase (CPA) were cloned from the chloroviruses PBCV-1, NY-2A and MT325. They were expressed in Escherichia coli to form C-terminal (His)6-tagged proteins and the recombinant proteins were purified by Ni2+- binding affinity chromatography. The biochemical properties of the two enzymes are similar to AIH and CPA enzymes from Arabidopsis thaliana and Pseudomonas aeruginosa. Together with the previously known virus genes encoding ornithine/arginine decarboxlyase (ODC/ADC) and homospermidine synthase, the chloroviruses have genes that encode a complete set of functional enzymes that synthesize the rare polyamine homospermidine from arginine via agmatine, N-carbamoylputrescine and putrescine. The PBCV-1 aih and cpa genes are expressed early during virus infection together with the odc/adc gene, suggesting that biosynthesis of putrescine is important in early stages of viral replication. The aih and cpa genes are widespread in the chlorella viruses. PMID:17101165

  2. Cloning and sequencing the genes encoding goldfish and carp ependymin. (United States)

    Adams, D S; Shashoua, V E


    Ependymins (EPNs) are brain glycoproteins thought to function in optic nerve regeneration and long-term memory consolidation. To date, epn genes have been characterized in two orders of teleost fish. In this study, polymerase chain reactions (PCR) were used to amplify the complete 1.6-kb epn genes, gf-I and cc-I, from genomic DNA of Cypriniformes, goldfish and carp, respectively. Amplified bands were cloned and sequenced. Each gene consists of six exons and five introns. The exon portion of gf-I encodes a predicted 215-amino-acid (aa) protein previously characterized as GF-I, while cc-I encodes a predicted 215-aa protein 95% homologous to GF-I.

  3. Identification and use of genes encoding amatoxin and phallotoxin

    Energy Technology Data Exchange (ETDEWEB)

    Hallen, Heather E.; Walton, Jonathan D.; Luo, Hong; Scott-Craig, John S.


    The present invention relates to compositions and methods comprising genes and peptides associated with cyclic peptide toxins and toxin production in mushrooms. In particular, the present invention relates to using genes and proteins from Amanita species encoding Amanita peptides, specifically relating to amatoxins and phallotoxins. In a preferred embodiment, the present invention also relates to methods for detecting Amanita peptide toxin genes for identifying Amanita peptide-producing mushrooms and for diagnosing suspected cases of mushroom poisoning. Further, the present inventions relate to providing kits for diagnosing and monitoring suspected cases of mushroom poisoning in patients.

  4. Neuregulin1 displayed on motor axons regulates terminal Schwann cell-mediated synapse elimination at developing neuromuscular junctions (United States)

    Li, Yue; Mikesh, Michelle; Smith, Ian; Nave, Klaus-Armin; Schwab, Markus H.; Thompson, Wesley J.


    Synaptic connections in the nervous system are rearranged during development and in adulthood as a feature of growth, plasticity, aging, and disease. Glia are implicated as active participants in these changes. Here we investigated a signal that controls the participation of peripheral glia, the terminal Schwann cells (SCs), at the neuromuscular junction (NMJ) in mice. Transgenic manipulation of the levels of membrane-tethered neuregulin1 (NRG1-III), a potent activator of SCs normally presented on motor axons, alters the rate of loss of motor inputs at NMJs during developmental synapse elimination. In addition, NMJs of adult transgenic mice that expressed excess axonal NRG1-III exhibited continued remodeling, in contrast to the more stable morphologies of controls. In fact, synaptic SCs of these adult mice with NRG1-III overexpression exhibited behaviors evident in wild type neonates during synapse elimination, including an affinity for the postsynaptic myofiber surface and phagocytosis of nerve terminals. Given that levels of NRG1-III expression normally peak during the period of synapse elimination, our findings identify axon-tethered NRG1 as a molecular determinant for SC-driven neuromuscular synaptic plasticity. PMID:26755586

  5. Neuregulin1 displayed on motor axons regulates terminal Schwann cell-mediated synapse elimination at developing neuromuscular junctions. (United States)

    Lee, Young Il; Li, Yue; Mikesh, Michelle; Smith, Ian; Nave, Klaus-Armin; Schwab, Markus H; Thompson, Wesley J


    Synaptic connections in the nervous system are rearranged during development and in adulthood as a feature of growth, plasticity, aging, and disease. Glia are implicated as active participants in these changes. Here we investigated a signal that controls the participation of peripheral glia, the terminal Schwann cells (SCs), at the neuromuscular junction (NMJ) in mice. Transgenic manipulation of the levels of membrane-tethered neuregulin1 (NRG1-III), a potent activator of SCs normally presented on motor axons, alters the rate of loss of motor inputs at NMJs during developmental synapse elimination. In addition, NMJs of adult transgenic mice that expressed excess axonal NRG1-III exhibited continued remodeling, in contrast to the more stable morphologies of controls. In fact, synaptic SCs of these adult mice with NRG1-III overexpression exhibited behaviors evident in wild type neonates during synapse elimination, including an affinity for the postsynaptic myofiber surface and phagocytosis of nerve terminals. Given that levels of NRG1-III expression normally peak during the period of synapse elimination, our findings identify axon-tethered NRG1 as a molecular determinant for SC-driven neuromuscular synaptic plasticity.

  6. Bacteriophage-encoded shiga toxin gene in atypical bacterial host

    Directory of Open Access Journals (Sweden)

    Casas Veronica


    Full Text Available Abstract Background Contamination from fecal bacteria in recreational waters is a major health concern since bacteria capable of causing human disease can be found in animal feces. The Dog Beach area of Ocean Beach in San Diego, California is a beach prone to closures due to high levels of fecal indicator bacteria (FIB. A potential source of these FIB could be the canine feces left behind by owners who do not clean up after their pets. We tested this hypothesis by screening the DNA isolated from canine feces for the bacteriophage-encoded stx gene normally found in the virulent strains of the fecal bacterium Escherichia coli. Results Twenty canine fecal samples were collected, processed for total and bacterial fraction DNA, and screened by PCR for the stx gene. The stx gene was detected in the total and bacterial fraction DNA of one fecal sample. Bacterial isolates were then cultivated from the stx-positive fecal sample. Eighty nine of these canine fecal bacterial isolates were screened by PCR for the stx gene. The stx gene was detected in five of these isolates. Sequencing and phylogenetic analyses of 16S rRNA gene PCR products from the canine fecal bacterial isolates indicated that they were Enterococcus and not E. coli. Conclusions The bacteriophage-encoded stx gene was found in multiple species of bacteria cultivated from canine fecal samples gathered at the shoreline of the Dog Beach area of Ocean Beach in San Diego, California. The canine fecal bacteria carrying the stx gene were not the typical E. coli host and were instead identified through phylogenetic analyses as Enterococcus. This suggests a large degree of horizontal gene transfer of exotoxin genes in recreational waters.

  7. Molecular cloning and characterization of a gene encoding RING ...

    Indian Academy of Sciences (India)

    A RING zinc finger ankyrin protein gene, designated AdZFP1, was isolated from drought-tolerant Artemisia desertorum Spreng by mRNA differential display and RACE. Its cDNA was 1723 bp and encoded a putative protein of 445 amino acids with a predicted molecular mass of 47.9 kDa and an isoelectric point (pI) of 7.49.

  8. Identification of β-haemolysin-encoding genes in Streptococcus anginosus. (United States)

    Asam, D; Mauerer, S; Walheim, E; Spellerberg, B


    Streptococcus anginosus is an emerging pathogen, but little is known about its virulence factors. To detect the genes responsible for β-haemolysis we performed genomic mutagenesis of the β-haemolytic S. anginosus type strain ATCC 12395 using the vector pGhost9:ISS1. Integration site analysis of 15 non-haemolytic mutants identified a gene cluster with high homology to the genes of the streptolysin S (SLS) encoding sag gene cluster of S. pyogenes. The gene cluster harbours 10 open reading frames displaying significant similarities to the S. pyogenes genes sagA-sagI, with the identities on protein level ranging from 38 to 87%. Complementation assays of S. anginosus sagB and sagD integration mutants with the respective genes confirmed their importance for β-haemolysin production and suggest the presence of post-translational modifications in S. anginosus SLS similar to SLS of S. pyogenes. Characterization of the S. anginosus haemolysin in comparison to the S. pyogenes SLS showed that the haemolysin is surface bound, but in contrast to S. pyogenes neither fetal calf serum nor RNA was able to stabilize the haemolysin of S. anginosus in culture supernatants. Inhibition of β-haemolysis by polyethylene glycol of different sizes was carried out, giving no evidence of a pore-forming haemolytic mechanism. Analysis of a whole genome shotgun sequence of Streptococcus constellatus, a closely related streptococcal species that belongs to the S. anginosus group, revealed a similar sag gene cluster. Employing a genomic mutagenesis strategy we were able to determine an SLS encoding gene cluster in S. anginosus and demonstrate its importance for β-haemolysin production in S. anginosus. © 2013 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  9. Neuregulin-1 mutant mice indicate motor and sensory deficits, indeed few references for schizophrenia endophenotype model. (United States)

    Schneider, Silvia; Götz, Katja; Birchmeier, Carmen; Schwegler, Herbert; Roskoden, Thomas


    Neuregulins (Nrg) are a gene family that binds to tyrosine kinase receptors of the ErbB family. The protein of Nrg1 is to be involved in heart formation, migration of neurons, axonal pathfinding and synaptic function. A relation between Nrg1 and schizophrenia is assumed. Chronic impairment in schizophrenia is characterized by different positive and negative symptoms. Detectable markers of this disease in human and in animal models are activity, social behavior and sensory processing. In this study we compared heterozygous Nrg1 mutant mice in behavior and quantification of dopaminergic and serotoninergic neurons with wild type-like littermates. In the Nrg1 mutant mice the epidermal growth factor-like domain is replaced by the neomycin resistance gene. We found significant differences in locomotor and pain perception behavior. No differences were found in specific schizophrenia social interaction and prepulse inhibition behavior. The number of dopaminergic and serotoninergic neurons did not differ in the investigated regions ventral tegmental area, substantia nigra, periaqueductal grey and raphe nuclei. In conclusion, this analyzed Nrg1 mutant mice model did not serve as a complete schizophrenia model. Particular aspects of schizophrenia disease in locomotor and sensory behavior deficits could represent in this Nrg1 mutant mice. Beside several different models could Nrg1 deficiency represent an endophenotype of schizophrenia disease. Copyright © 2017 Elsevier B.V. All rights reserved.

  10. Design and optimization of PLGA microparticles for controlled and local delivery of Neuregulin-1 in traumatic spinal cord injury. (United States)

    Santhosh, Kallivalappil T; Alizadeh, Arsalan; Karimi-Abdolrezaee, Soheila


    Spinal cord injury (SCI) results in significant tissue damage that underlies functional impairments. Pharmacological interventions to confer neuroprotection and promote cell replacement are essential for SCI repair. We previously reported that Neuregulin-1 (Nrg-1) is acutely and permanently downregulated after SCI. Nrg-1 is a critical growth factor for differentiation of neural precursor cells (NPCs) into myelinating oligodendrocytes. We showed that intrathecal delivery of Nrg-1 enhances oligodendrocyte replacement following SCI. While an effective delivery system, intrathecal and systemic administration of growth factors with diverse biological targets may pose adverse off-target effects. Here, we have developed and optimized an injectable biodegradable poly(lactic-co-glycolic acid) (PLGA) microparticles system for sustained and prolonged intraspinal delivery of Nrg-1 in SCI. Recombinant human Nrg-1β1 peptide was encapsulated into PLGA microparticles. Optimal Nrg-1 release rate and duration were achieved by manipulating the porosity and size of PLGA particles. Our in vitro analysis showed a direct correlation between particle size and porosity with Nrg-1 release rate, while Nrg-1 loading efficiency in PLGA microparticles was inversely correlated with particle porosity. In SCI, local intraspinal injection of PLGA-Nrg-1 microparticles maintained significantly higher tissue levels of Nrg-1 for a long-term duration compared to Nrg-1 delivered intrathecally by osmotic pumps. Bioactivity of Nrg-1 in PLGA microparticles was verified by promoting oligodendrocyte differentiation of NPCs in vitro, and preservation of oligodendrocytes and axons in SCI. PLGA-Nrg-1 also attenuated neuroinflammation and glial scarring following SCI. We show, for the first time, the feasibility, efficacy and safety of PLGA microparticle system for local and controlled administration of Nrg-1 in SCI. Copyright © 2017 Elsevier B.V. All rights reserved.

  11. Expression and function of Neuregulin 1 and its signaling system ERBB2/3 in the enteric nervous system

    Directory of Open Access Journals (Sweden)

    Martina eBarrenschee


    Full Text Available Neuregulin 1 (NRG1 is suggested to promote the survival and maintenance of the enteric nervous system (ENS. As deficiency in its corresponding receptor signaling complex ERBB2/ERBB3 leads to postnatal colonic hypo/aganglionosis we assessed the distributional and expressional pattern of the NRG1-ERBB2/ERBB3 system in the human colon and explored the neurotrophic capacity of NRG1 on cultured enteric neurons.Site-specific mRNA expression of the NRG1-ERBB2/3 system was determined in microdissected samples harvested from enteric musculature and ganglia. Localization of NRG1, ERBB2 and ERBB3 was determined by dual-label-immunohistochemistry using pan-neuronal and pan-glial markers. Morphometric analysis was performed on NRG1-stimulated rat enteric nerve cultures to evaluate neurotrophic effects. mRNA expression of the NRG1-ERBB2/3 system was determined by qPCR. Co-localization of NRG1 with neuronal or synaptic markers was analyzed in enteric nerve cultures stimulated with glial cell line-derived neurotrophic factor (GDNF. The NRG1 system was expressed in both neurons and glial cells of enteric ganglia and in nerve fibers. NRG1 significantly enhanced growth parameters in enteric nerve cell cultures and ErB3 mRNA expression was down-regulated upon NRG1 stimulation. GDNF negatively regulates ErbB2 and ErbB3 mRNA expressionThe NRG1-ERBB2/3 system is physiologically present in the human ENS and NRG1 acts as a neurotrophic factor for the ENS. The down-regulation of ErbB3/ErbB2 in GDNF stimulated nerve cell cultures points to an interaction of both neurotrophic factors. Thus, the data may provide a basis to assess disturbed signaling components of the NRG1 system in enteric neuropathies.

  12. Systems properties of proteins encoded by imprinted genes. (United States)

    Sandhu, Kuljeet Singh


    Genomically imprinted genes show parentally fixed mono-allelic expression and are important for the mammalian development. Dysregulation of genomic imprinting leads to several complex pathological conditions. Though the genetic and epigenetic regulation of imprinted genes has been well studied, their protein aspects are largely ignored. Here, we systematically studied a sub-network centered on proteins encoded by imprinted genes within human interactome. Using concepts of network biology, we uncover a highly connected, transitive and central network module of imprinted gene-products and their interacting partners (IGPN). The network is enriched in development, metabolism and cell cycle related functions and its malfunctioning ascribes error intolerance to human interactome network. Further, detailed analysis revealed that its higher centrality is determined by 'date' interactions among the proteins belonging to different functional classes than the 'party' interactions within the same functional class. Interestingly, a significant proportion of this network genetically associates with disease phenotypes. Moreover, the network comprises of gene-sets that are upregulated in leukemia, psychosis, obesity/diabetes and downregulated in autism. We conclude that imprinted gene-products are part of a functionally and topologically important module of human interactome and errors in this sub-network are intolerant to, otherwise robust, human interactome. The findings might also shed light on how imprinted genes, which are rather very few, coordinate at protein level to pleiotropically regulate growth and metabolism during embryonic and post-natal development.

  13. Genes encoding longevity: from model organisms to humans. (United States)

    Kuningas, Maris; Mooijaart, Simon P; van Heemst, Diana; Zwaan, Bas J; Slagboom, P Eline; Westendorp, Rudi G J


    Ample evidence from model organisms has indicated that subtle variation in genes can dramatically influence lifespan. The key genes and molecular pathways that have been identified so far encode for metabolism, maintenance and repair mechanisms that minimize age-related accumulation of permanent damage. Here, we describe the evolutionary conserved genes that are involved in lifespan regulation of model organisms and humans, and explore the reasons of discrepancies that exist between the results found in the various species. In general, the accumulated data have revealed that when moving up the evolutionary ladder, together with an increase of genome complexity, the impact of candidate genes on lifespan becomes smaller. The presence of genetic networks makes it more likely to expect impact of variation in several interacting genes to affect lifespan in humans. Extrapolation of findings from experimental models to humans is further complicated as phenotypes are critically dependent on the setting in which genes are expressed, while laboratory conditions and modern environments are markedly dissimilar. Finally, currently used methodologies may have only little power and validity to reveal genetic variation in the population. In conclusion, although the study of model organisms has revealed potential candidate genetic mechanisms determining aging and lifespan, to what extent they explain variation in human populations is still uncertain.

  14. Gene family encoding the major toxins of lethal Amanita mushrooms. (United States)

    Hallen, Heather E; Luo, Hong; Scott-Craig, John S; Walton, Jonathan D


    Amatoxins, the lethal constituents of poisonous mushrooms in the genus Amanita, are bicyclic octapeptides. Two genes in A. bisporigera, AMA1 and PHA1, directly encode alpha-amanitin, an amatoxin, and the related bicyclic heptapeptide phallacidin, a phallotoxin, indicating that these compounds are synthesized on ribosomes and not by nonribosomal peptide synthetases. alpha-Amanitin and phallacidin are synthesized as proproteins of 35 and 34 amino acids, respectively, from which they are predicted to be cleaved by a prolyl oligopeptidase. AMA1 and PHA1 are present in other toxic species of Amanita section Phalloidae but are absent from nontoxic species in other sections. The genomes of A. bisporigera and A. phalloides contain multiple sequences related to AMA1 and PHA1. The predicted protein products of this family of genes are characterized by a hypervariable "toxin" region capable of encoding a wide variety of peptides of 7-10 amino acids flanked by conserved sequences. Our results suggest that these fungi have a broad capacity to synthesize cyclic peptides on ribosomes.

  15. Gene family encoding the major toxins of lethal Amanita mushrooms (United States)

    Hallen, Heather E.; Luo, Hong; Scott-Craig, John S.; Walton, Jonathan D.


    Amatoxins, the lethal constituents of poisonous mushrooms in the genus Amanita, are bicyclic octapeptides. Two genes in A. bisporigera, AMA1 and PHA1, directly encode α-amanitin, an amatoxin, and the related bicyclic heptapeptide phallacidin, a phallotoxin, indicating that these compounds are synthesized on ribosomes and not by nonribosomal peptide synthetases. α-Amanitin and phallacidin are synthesized as proproteins of 35 and 34 amino acids, respectively, from which they are predicted to be cleaved by a prolyl oligopeptidase. AMA1 and PHA1 are present in other toxic species of Amanita section Phalloidae but are absent from nontoxic species in other sections. The genomes of A. bisporigera and A. phalloides contain multiple sequences related to AMA1 and PHA1. The predicted protein products of this family of genes are characterized by a hypervariable “toxin” region capable of encoding a wide variety of peptides of 7–10 amino acids flanked by conserved sequences. Our results suggest that these fungi have a broad capacity to synthesize cyclic peptides on ribosomes. PMID:18025465

  16. Neuregulin-1 Administration Protocols Sufficient for Stimulating Cardiac Regeneration in Young Mice Do Not Induce Somatic, Organ, or Neoplastic Growth.

    Directory of Open Access Journals (Sweden)

    Balakrishnan Ganapathy

    Full Text Available We previously developed and validated a strategy for stimulating heart regeneration by administration of recombinant neuregulin (rNRG1, a growth factor, in mice. rNRG1 stimulated proliferation of heart muscle cells, cardiomyocytes, and was most effective when administration began during the neonatal period. Our results suggested the use of rNRG1 to treat pediatric patients with heart failure. However, administration in this age group may stimulate growth outside of the heart.NRG1 and ErbB receptor expression was determined by RT-PCR. rNRG1 concentrations in serum were quantified by ELISA. Mice that received protocols of recombinant neuregulin1-β1 administration (rNRG1, 100 ng/g body weight, daily subcutaneous injection for the first month of life, previously shown to induce cardiac regeneration, were examined at pre-determined intervals. Somatic growth was quantified by weighing. Organ growth was quantified by MRI and by weighing. Neoplastic growth was examined by MRI, visual inspection, and histopathological analyses. Phospho-ERK1/2 and S6 kinase were analyzed with Western blot and ELISA, respectively.Lung, spleen, liver, kidney, brain, and breast gland exhibited variable expression of the NRG1 receptors ErbB2, ErbB3, ErbB4, and NRG1. Body weight and tibia length were not altered in mice receiving rNRG1. MRI showed that administration of rNRG1 did not alter the volume of the lungs, liver, kidneys, brain, or spinal cord. Administration of rNRG1 did not alter the weight of the lungs, spleen, liver, kidneys, or brain. MRI, visual inspection, and histopathological analyses showed no neoplastic growth. Follow-up for 6 months showed no alteration of somatic or organ growth. rNRG1 treatment increased the levels of phospho-ERK1/2, but not phospho-S6 kinase.Administration protocols of rNRG1 for stimulating cardiac regeneration in mice during the first month of life did not induce unwanted growth effects. Further studies may be required to determine

  17. Mutational analysis of the nor gene cluster which encodes nitric-oxide reductase from Paracoccus denitrificans

    NARCIS (Netherlands)

    de Boer, A P; van der Oost, J.; Reijnders, W N; Westerhoff, H V; Stouthamer, A.H.; van Spanning, R J


    The genes that encode the hc-type nitric-oxide reductase from Paracoccus denitrificans have been identified. They are part of a cluster of six genes (norCBQDEF) and are found near the gene cluster that encodes the cd1-type nitrite reductase, which was identified earlier [de Boer, A. P. N.,

  18. Cloning and Characterization of upp, a Gene Encoding Uracil Phosphoribosyltransferase from Lactococcus lactis

    DEFF Research Database (Denmark)

    Martinussen, Jan; Hammer, Karin


    Uracil phosphoribosyltransferase catalyzes the key reaction in the salvage of uracil in many microorganisms. The gene encoding uracil phosphoribosyltransferase (upp) was cloned from Lactococcus lactis subsp. cremoris MG1363 by complementation of an Escherichia coli mutant. The gene was sequenced,...

  19. Metazoan Ribosome Inactivating Protein encoding genes acquired by Horizontal Gene Transfer. (United States)

    Lapadula, Walter J; Marcet, Paula L; Mascotti, María L; Sanchez-Puerta, M Virginia; Juri Ayub, Maximiliano


    Ribosome inactivating proteins (RIPs) are RNA N-glycosidases that depurinate a specific adenine residue in the conserved sarcin/ricin loop of 28S rRNA. These enzymes are widely distributed among plants and their presence has also been confirmed in several bacterial species. Recently, we reported for the first time in silico evidence of RIP encoding genes in metazoans, in two closely related species of insects: Aedes aegypti and Culex quinquefasciatus. Here, we have experimentally confirmed the presence of these genes in mosquitoes and attempted to unveil their evolutionary history. A detailed study was conducted, including evaluation of taxonomic distribution, phylogenetic inferences and microsynteny analyses, indicating that mosquito RIP genes derived from a single Horizontal Gene Transfer (HGT) event, probably from a cyanobacterial donor species. Moreover, evolutionary analyses show that, after the HGT event, these genes evolved under purifying selection, strongly suggesting they play functional roles in these organisms.

  20. Genome-wide identification of structural variants in genes encoding drug targets

    DEFF Research Database (Denmark)

    Rasmussen, Henrik Berg; Dahmcke, Christina Mackeprang


    The objective of the present study was to identify structural variants of drug target-encoding genes on a genome-wide scale. We also aimed at identifying drugs that are potentially amenable for individualization of treatments based on knowledge about structural variation in the genes encoding...

  1. DNA variants within the 5'-flanking region of milk-protein-encoding genes II. The β-lactoglobulin-encoding gene. (United States)

    Wagner, V A; Schild, T A; Geldermann, H


    For the detection of polymorphisms within the 5'-flanking region of the β-lactoglobulin (-LG) -encoding gene a nucleotide sequence containing 795 bp of the promoter and 59 bp of exon I was cloned and sequenced. After comparing the sequence from the DNA of 11 diverse cows (different breeds and milk-protein yields), 14 singlebp substitutions were identified within the 5'-flanking region and two in the 5'-untranslated region (5'-UTR) of exon I. Some of the variants are located in potential binding sites for trans-acting factors or in the 5'-UTR. A PCR-based RFLP analysis was performed, and the genotypes of an additional 60 cows were identified at five variable 5'-flanking sites. The results reveal three frequent combinations between the A and B alleles of the protein-coding region and the novel 5'-flanking DNA variants. This finding may explain the differences of the protein-variant-dependent β-LG synthesis (A>B) observed in vivo. A sequence comparison of the bovine and ovine promoters reveals an homology of 92.8% and shows a higher degree of conservation between positions -600 and -300.

  2. Genome-wide comparative analysis of NBS-encoding genes between Brassica species and Arabidopsis thaliana. (United States)

    Yu, Jingyin; Tehrim, Sadia; Zhang, Fengqi; Tong, Chaobo; Huang, Junyan; Cheng, Xiaohui; Dong, Caihua; Zhou, Yanqiu; Qin, Rui; Hua, Wei; Liu, Shengyi


    Plant disease resistance (R) genes with the nucleotide binding site (NBS) play an important role in offering resistance to pathogens. The availability of complete genome sequences of Brassica oleracea and Brassica rapa provides an important opportunity for researchers to identify and characterize NBS-encoding R genes in Brassica species and to compare with analogues in Arabidopsis thaliana based on a comparative genomics approach. However, little is known about the evolutionary fate of NBS-encoding genes in the Brassica lineage after split from A. thaliana. Here we present genome-wide analysis of NBS-encoding genes in B. oleracea, B. rapa and A. thaliana. Through the employment of HMM search and manual curation, we identified 157, 206 and 167 NBS-encoding genes in B. oleracea, B. rapa and A. thaliana genomes, respectively. Phylogenetic analysis among 3 species classified NBS-encoding genes into 6 subgroups. Tandem duplication and whole genome triplication (WGT) analyses revealed that after WGT of the Brassica ancestor, NBS-encoding homologous gene pairs on triplicated regions in Brassica ancestor were deleted or lost quickly, but NBS-encoding genes in Brassica species experienced species-specific gene amplification by tandem duplication after divergence of B. rapa and B. oleracea. Expression profiling of NBS-encoding orthologous gene pairs indicated the differential expression pattern of retained orthologous gene copies in B. oleracea and B. rapa. Furthermore, evolutionary analysis of CNL type NBS-encoding orthologous gene pairs among 3 species suggested that orthologous genes in B. rapa species have undergone stronger negative selection than those in B .oleracea species. But for TNL type, there are no significant differences in the orthologous gene pairs between the two species. This study is first identification and characterization of NBS-encoding genes in B. rapa and B. oleracea based on whole genome sequences. Through tandem duplication and whole genome

  3. Genome-wide comparative analysis of NBS-encoding genes in four Gossypium species. (United States)

    Xiang, Liuxin; Liu, Jinggao; Wu, Chaofeng; Deng, Yushan; Cai, Chaowei; Zhang, Xiao; Cai, Yingfan


    Nucleotide binding site (NBS) genes encode a large family of disease resistance (R) proteins in plants. The availability of genomic data of the two diploid cotton species, Gossypium arboreum and Gossypium raimondii, and the two allotetraploid cotton species, Gossypium hirsutum (TM-1) and Gossypium barbadense allow for a more comprehensive and systematic comparative study of NBS-encoding genes to elucidate the mechanisms of cotton disease resistance. Based on the genome assembly data, 246, 365, 588 and 682 NBS-encoding genes were identified in G. arboreum, G. raimondii, G. hirsutum and G. barbadense, respectively. The distribution of NBS-encoding genes among the chromosomes was nonrandom and uneven, and was tended to form clusters. Gene structure analysis showed that G. arboreum and G. hirsutum possessed a greater proportion of CN, CNL, and N genes and a lower proportion of NL, TN and TNL genes compared to that of G. raimondii and G. barbadense, while the percentages of RN and RNL genes remained relatively unchanged. The percentage changes among them were largest for TNL genes, about 7 times. Exon statistics showed that the average exon numbers per NBS gene in G. raimondii and G. barbadense were all greater than that in G. arboretum and G. hirsutum. Phylogenetic analysis revealed that the TIR-NBS genes of G. barbadense were closely related with that of G. raimondii. Sequence similarity analysis showed that diploid cotton G. arboreum possessed a larger proportion of NBS-encoding genes similar to that of allotetraploid cotton G. hirsutum, while diploid G. raimondii possessed a larger proportion of NBS-encoding genes similar to that of allotetraploid cotton G. barbadense. The synteny analysis showed that more NBS genes in G. raimondii and G. arboreum were syntenic with that in G. barbadense and G. hirsutum, respectively. The structural architectures, amino acid sequence similarities and synteny of NBS-encoding genes between G. arboreum and G. hirsutum, and between G

  4. Molecular cloning and functional analysis of the gene encoding ...

    African Journals Online (AJOL)

    Here we report for the first time the cloning of a full-length cDNA encoding GGPPS (Jc-GGPPS) from Jatropha curcas L. The full-length cDNA was 1414 base pair (bp), with an 1110-bp open reading frame (ORF) encoding a 370- amino-acids polypeptide. Bioinformatic analysis revealed that Jc-GGPPS is a member of the ...

  5. The Phytophthora infestans avirulence gene Avr4 encodes an RXLR-dEER effector

    NARCIS (Netherlands)

    Poppel, van P.M.J.A.; Jun Guo, J.; Vondervoort, van de P.J.I.; Jung, M.W.M.; Birch, P.R.J.; Whisson, S.C.; Govers, F.


    Resistance in potato against the oomycete Phytophthora infestans is conditioned by resistance (R) genes that are introgressed from wild Solanum spp. into cultivated potato. According to the gene-for-gene model, proteins encoded by R genes recognize race-specific effectors resulting in a

  6. Genes Encoding Aluminum-Activated Malate Transporter II and their Association with Fruit Acidity in Apple


    Baiquan Ma; Liao Liao; Hongyu Zheng; Jie Chen; Benhong Wu; Collins Ogutu; Shaohua Li; Korban, Schuyler S.; Yuepeng Han


    A gene encoding aluminum-activated malate transporter (ALMT) was previously reported as a candidate for the locus controlling acidity in apple ( × Borkh.). In this study, we found that apple genes can be divided into three families and the gene belongs to the family. Duplication of genes in apple is related to the polyploid origin of the apple genome. Divergence in expression has occurred between the gene and its homologs in the family and only the gene is significantly associated wi...

  7. Identification and characterization of a gene encoding a putative ...

    Indian Academy of Sciences (India)


    Oct 30, 2012 ... data demonstrated that AhLPAT4 had 1631 nucleotides, encoding a putative 43.8 kDa protein with 383 amino acid residues. The deduced protein ... senting the major components of vegetable oils. It is an efficient ... are then transported to endoplasmic reticulum (ER) or cyto- plasm to form acyl-CoA ...

  8. Cloning, expression and characterisation of a novel gene encoding ...

    African Journals Online (AJOL)



    Jan 12, 2012 ... 1Department of Entomology, China Agricultural University, Beijing 100193, China. 2Plant Protection Institute of Hebei Academy of Agricultural and Forestry Sciences, Baoding 071000, China. ... cDNA from Bemisia tabaci encoding a CSP (GU250808), denoted BtabCSP was cloned by RT-PCR and.

  9. Surfactant Protein-D-Encoding Gene Variant Polymorphisms Are Linked to Respiratory Outcome in Premature Infants

    DEFF Research Database (Denmark)

    Sorensen, Grith Lykke; Dahl, Marianne; Tan, Qihua


    OBJECTIVE: Associations between the genetic variation within or downstream of the surfactant protein-D-encoding gene (SFTPD), which encodes the collectin surfactant protein-D (SP-D) and may lead to respiratory distress syndrome or bronchopulmonary dysplasia, recently were reported. Our aim was to...

  10. Differential Expression of Two Paralogous Genes of Bacillus subtilis Encoding Single-Stranded DNA Binding Protein

    NARCIS (Netherlands)

    Lindner, Cordula; Nijland, Reindert; Hartskamp, Mariska van; Bron, Sierd; Hamoen, Leendert W.; Kuipers, Oscar P.

    The Bacillus subtilis genome comprises two paralogous single-stranded DNA binding protein (SSB) genes, ssb and ywpH, which show distinct expression patterns. The main ssb gene is strongly expressed during exponential growth and is coregulated with genes encoding the ribosomal proteins S6 and S18.

  11. The presence of two S-layer-protein-encoding genes is conserved among species related to Lactobacillus acidophilus

    NARCIS (Netherlands)

    Boot, H.J.; Kolen, C.P.A.M.; Pot, B.; Kersters, K.; Pouwels, P.H.


    Previously we have shown that the type strain of Lactobacillus acidophilus possesses two S-protein-encoding genes, one of which is silent, on a chromosomal segment of 6 kb. The S-protein-encoding gene in the expression site can be exchanged for the silent S-protein-encoding gene by inversion of this

  12. Enterotoxin-encoding genes in Staphylococcus spp. from bulk goat milk. (United States)

    Lyra, Daniele G; Sousa, Francisca G C; Borges, Maria F; Givisiez, Patrícia E N; Queiroga, Rita C R E; Souza, Evandro L; Gebreyes, Wondwossen A; Oliveira, Celso J B


    Although Staphylococcus aureus has been implicated as the main Staphylococcus species causing human food poisoning, recent studies have shown that coagulase-negative Staphylococcus could also harbor enterotoxin-encoding genes. Such organisms are often present in goat milk and are the most important mastitis-causing agents. Therefore, this study aimed to investigate the occurrence of enterotoxin-encoding genes among coagulase-positive (CoPS) and coagulase-negative (CoNS) staphylococci isolated from raw goat milk produced in the semi-arid region of Paraiba, the most important region for goat milk production in Brazil. Enterotoxin-encoding genes were screened in 74 staphylococci isolates (30 CoPS and 44 CoNS) by polymerase chain reaction targeting the genes sea, seb, sec, sed, see, seg, seh, and sei. Enterotoxin-encoding genes were found in nine (12.2%) isolates, and four different genes (sea, sec, seg, and sei) were identified amongst the isolates. The most frequent genes were seg and sei, which were often found simultaneously in 44.5% of the isolates. The gene sec was the most frequent among the classical genes, and sea was found only in one isolate. All CoPS isolates (n=7) harboring enterotoxigenic genes were identified as S. aureus. The two coagulase-negative isolates were S. haemolyticus and S. hominis subsp. hominis and they harbored sei and sec genes, respectively. A higher frequency of enterotoxin-encoding genes was observed amongst CoPS (23.3%) than CoNS (4.5%) isolates (p<0.05), reinforcing the importance of S. aureus as a potential foodborne agent. However, the potential risk posed by CoNS in goat milk should not be ignored because it has a higher occurrence in goat milk and enterotoxin-encoding genes were detected in some isolates.

  13. In silicio search for genes encoding peroxisomal proteins in Saccharomyces cerevisiae. (United States)

    Kal, A J; Hettema, E H; van den Berg, M; Koerkamp, M G; van Ijlst, L; Distel, B; Tabak, H F


    The biogenesis of peroxisomes involves the synthesis of new proteins that after, completion of translation, are targeted to the organelle by virtue of peroxisomal targeting signals (PTS). Two types of PTSs have been well characterized for import of matrix proteins (PTS1 and PTS2). Induction of the genes encoding these matrix proteins takes place in oleate-containing medium and is mediated via an oleate response element (ORE) present in the region preceding these genes. The authors have searched the yeast genome for OREs preceding open reading frames (ORFs), and for ORFs that contain either a PTS1 or PTS2. Of the ORFs containing an ORE, as well as either a PTS1 or a PTS2, many were known to encode bona fide peroxisomal matrix proteins. In addition, candidate genes were identified as encoding putative new peroxisomal proteins. For one case, subcellular location studies validated the in silicio prediction. This gene encodes a new peroxisomal thioesterase.

  14. Cloning, expression and characterisation of a novel gene encoding ...

    African Journals Online (AJOL)

    Sequencing and structural analyses of the full length cDNA indicated that BtabCSP is 381 bp in length, encoding 126 amino acid residues of which a 22 amino acid residue coded for a signal peptide. The predicted molecular weight of BtabCSP is 14.17 kDa. The BtabCSP amino acid residues deduced from the respective ...

  15. New recombinant bacterium comprises a heterologous gene encoding glycerol dehydrogenase and/or an up-regulated native gene encoding glycerol dehydrogenase, useful for producing ethanol

    DEFF Research Database (Denmark)


    TECHNOLOGY FOCUS - BIOTECHNOLOGY - Preparation (claimed): Producing recombinant bacterium having enhanced ethanol production characteristics when cultivated in growth medium comprising glycerol comprises: (a) transforming a parental bacterium by (i) the insertion of a heterologous gene encoding......, and galactomannan. The method is a fermentation process performed under strict anaerobic conditions....

  16. Identification of toxin genes encoding Cyt proteins from standard ...

    African Journals Online (AJOL)

    Polymerase chain reaction-restriction fragment length polymorphism methods for identification of cyt subclasses from Bacillus thuringiensis were established. Eight of 68 standard and ten of 107 Argentine B. thuringiensis strains harbor at least one cyt gene. The combination of cyt1Aa/cyt2Ba genes was identified in four ...

  17. Molecular quantification of genes encoding for green-fluorescent proteins

    DEFF Research Database (Denmark)

    Felske, A; Vandieken, V; Pauling, B V


    A quantitative PCR approach is presented to analyze the amount of recombinant green fluorescent protein (gfp) genes in environmental DNA samples. The quantification assay is a combination of specific PCR amplification and temperature gradient gel electrophoresis (TGGE). Gene quantification is pro...... PCR strategy is a highly specific and sensitive way to monitor recombinant DNA in environments like the efflux of a biotechnological plant....

  18. Development of a gene synthesis platform for the efficient large scale production of small genes encoding animal toxins. (United States)

    Sequeira, Ana Filipa; Brás, Joana L A; Guerreiro, Catarina I P D; Vincentelli, Renaud; Fontes, Carlos M G A


    Gene synthesis is becoming an important tool in many fields of recombinant DNA technology, including recombinant protein production. De novo gene synthesis is quickly replacing the classical cloning and mutagenesis procedures and allows generating nucleic acids for which no template is available. In addition, when coupled with efficient gene design algorithms that optimize codon usage, it leads to high levels of recombinant protein expression. Here, we describe the development of an optimized gene synthesis platform that was applied to the large scale production of small genes encoding venom peptides. This improved gene synthesis method uses a PCR-based protocol to assemble synthetic DNA from pools of overlapping oligonucleotides and was developed to synthesise multiples genes simultaneously. This technology incorporates an accurate, automated and cost effective ligation independent cloning step to directly integrate the synthetic genes into an effective Escherichia coli expression vector. The robustness of this technology to generate large libraries of dozens to thousands of synthetic nucleic acids was demonstrated through the parallel and simultaneous synthesis of 96 genes encoding animal toxins. An automated platform was developed for the large-scale synthesis of small genes encoding eukaryotic toxins. Large scale recombinant expression of synthetic genes encoding eukaryotic toxins will allow exploring the extraordinary potency and pharmacological diversity of animal venoms, an increasingly valuable but unexplored source of lead molecules for drug discovery.

  19. Distinct Patterns of Gene Gain and Loss: Diverse Evolutionary Modes of NBS-Encoding Genes in Three Solanaceae Crop Species. (United States)

    Qian, Lan-Hua; Zhou, Guang-Can; Sun, Xiao-Qin; Lei, Zhao; Zhang, Yan-Mei; Xue, Jia-Yu; Hang, Yue-Yu


    Plant resistance conferred by nucleotide binding site (NBS)-encoding resistance genes plays a key role in the defense against various pathogens throughout the entire plant life cycle. However, comparative analyses for the systematic evaluation and determination of the evolutionary modes of NBS-encoding genes among Solanaceae species are rare. In this study, 447, 255, and 306 NBS-encoding genes were identified from the genomes of potato, tomato, and pepper, respectively. These genes usually clustered as tandem arrays on chromosomes; few existed as singletons. Phylogenetic analysis indicated that three subclasses [TNLs (TIR-NBS-LRR), CNLs (CC-NBS-LRR), and RNLs (RPW8-NBS-LRR)] each formed a monophyletic clade and were distinguished by unique exon/intron structures and amino acid motif sequences. By comparing phylogenetic and systematic relationships, we inferred that the NBS-encoding genes in the present genomes of potato, tomato, and pepper were derived from 150 CNL, 22 TNL, and 4 RNL ancestral genes, and underwent independent gene loss and duplication events after speciation. The NBS-encoding genes therefore exhibit diverse and dynamic evolutionary patterns in the three Solanaceae species, giving rise to the discrepant gene numbers observed today. Potato shows a "consistent expansion" pattern, tomato exhibits a pattern of "first expansion and then contraction," and pepper presents a "shrinking" pattern. The earlier expansion of CNLs in the common ancestor led to the dominance of this subclass in gene numbers. However, RNLs remained at low copy numbers due to their specific functions. Along the evolutionary process of NBS-encoding genes in Solanaceae, species-specific tandem duplications contributed the most to gene expansions. Copyright © 2017 Qian et al.

  20. Asthma and genes encoding components of the vitamin D pathway

    Directory of Open Access Journals (Sweden)

    Raby Benjamin A


    Full Text Available Abstract Background Genetic variants at the vitamin D receptor (VDR locus are associated with asthma and atopy. We hypothesized that polymorphisms in other genes of the vitamin D pathway are associated with asthma or atopy. Methods Eleven candidate genes were chosen for this study, five of which code for proteins in the vitamin D metabolism pathway (CYP27A1, CYP27B1, CYP2R1, CYP24A1, GC and six that are known to be transcriptionally regulated by vitamin D (IL10, IL1RL1, CD28, CD86, IL8, SKIIP. For each gene, we selected a maximally informative set of common SNPs (tagSNPs using the European-derived (CEU HapMap dataset. A total of 87 SNPs were genotyped in a French-Canadian family sample ascertained through asthmatic probands (388 nuclear families, 1064 individuals and evaluated using the Family Based Association Test (FBAT program. We then sought to replicate the positive findings in four independent samples: two from Western Canada, one from Australia and one from the USA (CAMP. Results A number of SNPs in the IL10, CYP24A1, CYP2R1, IL1RL1 and CD86 genes were modestly associated with asthma and atopy (p IL10 and VDR genes as well as in the IL10 and IL1RL1 genes were associated with asthma (p IL10 and CYP24A1 genes were again modestly associated with asthma and atopy (p IL10 and VDR was replicated in CAMP, but not in the other populations. Conclusion A number of genes involved in the vitamin D pathway demonstrate modest levels of association with asthma and atopy. Multilocus models testing genes in the same pathway are potentially more effective to evaluate the risk of asthma, but the effects are not uniform across populations.

  1. Variation of genes encoding GGPLs syntheses among Mycoplasma fermentans strains. (United States)

    Fujihara, Masatoshi; Ishida, Noriko; Asano, Kozo; Matsuda, Kazuhiro; Nomura, Nobuo; Nishida, Yoshihiro; Harasawa, Ryô


    The information of the biosynthesis pathways of Mycoplasma fermentans specific major lipid-antigen, named glycoglycerophospholipids (GGPLs), is expected to be some of help to understand the virulence of M. fermentans. We examined primary structure of cholinephosphotransferase (mf1) and glucosyltransferase (mf3) genes, which engage GGPL-I and GGPL-III synthesis, in 20 strains, and found four types of variations in the mf1 gene but the mf3 gene in two strains was not detected by PCR. These results may have important implications in virulence factor of M. fermentans.

  2. Occurrence of enterotoxin-encoding genes in Staphylococcus aureus causing mastitis in lactating goats

    Directory of Open Access Journals (Sweden)

    Daneelly H. Ferreira


    Full Text Available Staphylococcal enterotoxins are the leading cause of human food poisoning worldwide. Staphylococcus spp. are the main mastitis-causing agents in goats and frequently found in high counts in goat milk. This study aimed to investigate the occurrence of enterotoxin-encoding genes in Staphylococcus aureus associated with mastitis in lactating goats in Paraiba State, Brazil. Milk samples (n=2024 were collected from 393 farms. Staphylococcus aureus was isolated in 55 milk samples. Classical (sea, seb, sec, sed, see and novel (seg, seh, sei enterotoxin-encoding genes were investigated by means of polymerase chain reaction (PCR. From thirty-six tested isolates, enterotoxin-encoding genes were detected in 7 (19.5% S. aureus. The gene encoding enterotoxin C (seC was identified in six isolates, while seiwas observed in only one isolate. The genes sea, seb, sed, see, seg and seh were not observed amongst the S. aureus investigated in this study. In summary, S. aureus causing mastitis in goats can harbor enterotoxin-encoding genes and seC was the most frequent gene observed amongst the investigated isolates. This finding is important for surveillance purposes, since enterotoxin C should be investigated in human staphylococcal food poisoning outbreaks caused by consumption of goat milk and dairy products.

  3. Designing of a single gene encoding four functional proteins. (United States)

    Inouye, Masayori; Ishida, Yojiro; Inouye, Keiko


    In the genomes of some organisms such as bacteriophages and bacteria, a DNA sequence is able to encode two different proteins, indicating that genetic information is compacted in DNA twice denser than in usual DNA. In theory, a DNA sequence has a maximal capacity to produce six different mRNAs, however, it is an intriguing question how many of these mRNAs are able to synthesize functional proteins. Here, we design a DNA sequence encoding four collagen-like proteins, two, (Gly-Arg-Pro)n and (Gly-Ala-Pro)n, from a sense mRNA and the other two, also (Gly-Arg-Pro)n and (Gly-Ala-Pro)n from its antisense mRNA, all of which are expected to form triple-helical structures unique to collagens. Other designs such as the combination of (Gly-Arg-Pro)n, (Gly-Val-Pro)n, (Gly-Thr-Pro)n and (Gly-Arg-Pro)n are also possible. The proposed DNA sequence is considered to contain the most compact genetic information ever created. Copyright © 2017 Elsevier Ltd. All rights reserved.

  4. Putative ACP phosphodiesterase gene (acpD) encodes an azoreductase. (United States)

    Nakanishi, M; Yatome, C; Ishida, N; Kitade, Y


    An FMN-dependent NADH-azoreductase of Escherichia coli was purified and analyzed for identification of the gene responsible for azo reduction by microorganisms. The N-terminal sequence of the azoreductase conformed to that of the acpD gene product, acyl carrier protein phosphodiesterase. Overexpression of the acpD gene provided the E. coli with a large amount of the 23-kDa protein and more than 800 times higher azoreductase activity. The purified gene product exhibited activity corresponding to that of the native azoreductase. The reaction followed a ping-pong mechanism requiring 2 mol of NADH to reduce 1 mol of methyl red (4'-dimethylaminoazobenzene-2-carboxylic acid) into 2-aminobenzoic acid and N,N'-dimethyl-p-phenylenediamine. On the other hand, the gene product could not convert holo-acyl carrier protein into the apo form under either in vitro or in vivo conditions. These data indicate that the acpD gene product is not acyl carrier protein phosphodiesterase but an azoreductase.

  5. The transferome of metabolic genes explored: analysis of the horizontal transfer of enzyme encoding genes in unicellular eukaryotes. (United States)

    Whitaker, John W; McConkey, Glenn A; Westhead, David R


    Metabolic networks are responsible for many essential cellular processes, and exhibit a high level of evolutionary conservation from bacteria to eukaryotes. If genes encoding metabolic enzymes are horizontally transferred and are advantageous, they are likely to become fixed. Horizontal gene transfer (HGT) has played a key role in prokaryotic evolution and its importance in eukaryotes is increasingly evident. High levels of endosymbiotic gene transfer (EGT) accompanied the establishment of plastids and mitochondria, and more recent events have allowed further acquisition of bacterial genes. Here, we present the first comprehensive multi-species analysis of E/HGT of genes encoding metabolic enzymes from bacteria to unicellular eukaryotes. The phylogenetic trees of 2,257 metabolic enzymes were used to make E/HGT assertions in ten groups of unicellular eukaryotes, revealing the sources and metabolic processes of the transferred genes. Analyses revealed a preference for enzymes encoded by genes gained through horizontal and endosymbiotic transfers to be connected in the metabolic network. Enrichment in particular functional classes was particularly revealing: alongside plastid related processes and carbohydrate metabolism, this highlighted a number of pathways in eukaryotic parasites that are rich in enzymes encoded by transferred genes, and potentially key to pathogenicity. The plant parasites Phytophthora were discovered to have a potential pathway for lipopolysaccharide biosynthesis of E/HGT origin not seen before in eukaryotes outside the Plantae. The number of enzymes encoded by genes gained through E/HGT has been established, providing insight into functional gain during the evolution of unicellular eukaryotes. In eukaryotic parasites, genes encoding enzymes that have been gained through horizontal transfer may be attractive drug targets if they are part of processes not present in the host, or are significantly diverged from equivalent host enzymes.


    NARCIS (Netherlands)



    The concentration of glutamate dehydrogenase (GDH) varies strongly between different organs and between different regions within organs. To permit further studies on the regulation of GDH expression, we isolated and characterized the rat gene encoding the GDH protein. This gene contains 13 exons and

  7. Chromosomal location of the gene encoding phosphoribosylpyrophosphate synthetase in Escherichia coli

    DEFF Research Database (Denmark)

    Hove-Jensen, Bjarne


    by conjugation. Transductional analysis of the prs region established the gene order as purB-fadR-dadR-tre-pth-prs-hemA-trp. Two additional mutations were identified in the mutant: one in gsk, the gene encoding guanosine kinase, and one in lon, conferring a mucoid colony morphology. The contribution of each...

  8. Isolation and characterization of the rat glutamine synthetase-encoding gene

    NARCIS (Netherlands)

    van de Zande, L.; Labruyère, W. T.; Arnberg, A. C.; Wilson, R. H.; van den Bogaert, A. J.; Das, A. T.; van Oorschot, D. A.; Frijters, C.; Charles, R.; Moorman, A. F.


    From a rat genomic library in phage lambda Charon4A, a complete glutamine synthetase-encoding gene was isolated. The gene is 9.5-10 kb long, consists of seven exons, and codes for two mRNA species of 1375 nucleotides (nt) and 2787 nt, respectively. For both mRNAs, full-length cDNAs containing a

  9. Nucleotide sequence of the Agrobacterium tumefaciens octopine Ti plasmid-encoded tmr gene

    NARCIS (Netherlands)

    Heidekamp, F.; Dirkse, W.G.; Hille, J.; Ormondt, H. van


    The nucleotide sequence of the tmr gene, encoded by the octopine Ti plasmid from Agrobacterium tumefaciens (pTiAch5), was determined. The T-DNA, which encompasses this gene, is involved in tumor formation and maintenance, and probably mediates the cytokinin-independent growth of transformed plant

  10. Identification, mapping, and cloning of the gene encoding cyanase in Escherichia coli K-12. (United States)

    Sung, Y C; Parsell, D; Anderson, P M; Fuchs, J A


    The gene in Escherichia coli for cyanase, designated cynS, was localized to a BglII restriction site approximately 1.7 kilobases from the lacA end of the lac operon. The gene was cloned into the pUC13 vector. Maxicell analysis of plasmid-encoded proteins confirmed that the BglII site is in the region encoding the structural gene for cyanase. Cyanase-deficient strains had increased sensitivity to cyanate and were not able to use cyanate as a nitrogen source.

  11. Identification, mapping, and cloning of the gene encoding cyanase in Escherichia coli K-12.


    Sung, Y C; Parsell, D; Anderson, P M; Fuchs, J A


    The gene in Escherichia coli for cyanase, designated cynS, was localized to a BglII restriction site approximately 1.7 kilobases from the lacA end of the lac operon. The gene was cloned into the pUC13 vector. Maxicell analysis of plasmid-encoded proteins confirmed that the BglII site is in the region encoding the structural gene for cyanase. Cyanase-deficient strains had increased sensitivity to cyanate and were not able to use cyanate as a nitrogen source.

  12. Identification and characterization of the genes encoding the core histones and histone variants of Neurospora crassa.


    Hays, Shan M; Swanson, Johanna; Eric U Selker


    We have identified and characterized the complete complement of genes encoding the core histones of Neurospora crassa. In addition to the previously identified pair of genes that encode histones H3 and H4 (hH3 and hH4-1), we identified a second histone H4 gene (hH4-2), a divergently transcribed pair of genes that encode H2A and H2B (hH2A and hH2B), a homolog of the F/Z family of H2A variants (hH2Az), a homolog of the H3 variant CSE4 from Saccharomyces cerevisiae (hH3v), and a highly diverged ...

  13. Escherichia coli yjjPB genes encode a succinate transporter important for succinate production. (United States)

    Fukui, Keita; Nanatani, Kei; Hara, Yoshihiko; Yamakami, Suguru; Yahagi, Daiki; Chinen, Akito; Tokura, Mitsunori; Abe, Keietsu


    Under anaerobic conditions, Escherichia coli produces succinate from glucose via the reductive tricarboxylic acid cycle. To date, however, no genes encoding succinate exporters have been established in E. coli. Therefore, we attempted to identify genes encoding succinate exporters by screening an E. coli MG1655 genome library. We identified the yjjPB genes as candidates encoding a succinate transporter, which enhanced succinate production in Pantoea ananatis under aerobic conditions. A complementation assay conducted in Corynebacterium glutamicum strain AJ110655ΔsucE1 demonstrated that both YjjP and YjjB are required for the restoration of succinate production. Furthermore, deletion of yjjPB decreased succinate production in E. coli by 70% under anaerobic conditions. Taken together, these results suggest that YjjPB constitutes a succinate transporter in E. coli and that the products of both genes are required for succinate export.

  14. Cloning and heterologous expression of a gene encoding lycopene ...

    African Journals Online (AJOL)

    This report describes the cloning and expression of a gene lycopene epsilon cyclase, (LCYE) from Camellia sinensis var assamica which is a precursor of the carotenoid lutein in tea. The 1982 bp cDNA sequence with 1599 bp open reading frame of LCYE was identified from an SSH library constructed for quality trait in tea.

  15. Molecular cloning and functional analysis of the gene encoding ...

    African Journals Online (AJOL)



    Jun 7, 2010 ... It is a branch point enzyme, which regulates coordination with the other prenyltransferases (GDP and FDP synthase respectively) of the precursor flux towards mono-, sesqui-, and diterpenoids ... branch point enzyme in terpenoid biosynthesis, and that ..... complementation of the gene cluster for carotenoid.

  16. Isolation and characterization of a gene encoding a polyethylene ...

    Indian Academy of Sciences (India)


    Common wheat Hanxuan 10, a drought-tolerant cultivar, was used as the plant material. Seeds were germinated and grown in a growth chamber (20°±1°C, ..... References. Bechtold N, Ellis J and Pelletier G 1993 In planta Agrobacterium- mediated gene transfer by infiltration of Arabidopsis thaliana plants; C. R. Acad. Sci.

  17. Identification and characterization of a gene encoding a putative ...

    Indian Academy of Sciences (India)

    In this study, a full-length AhLPAT4 gene was isolated via cDNA library screening and rapid amplification of cDNA ends (RACE); our data demonstrated that AhLPAT4 ... Oil Crops Research Institute of the Chinese Academy of Agricultural Sciences, Key Laboratory of Biology and Genetic Improvement of Oil Crops, Ministry of ...

  18. Molecular characterization of rpoB gene encoding the RNA ...

    African Journals Online (AJOL)

    Polymerase chain reaction (PCR) mediated direct DNA sequencing was evaluated for rapid detection of Rifampicin resistance (RMPr) of Mycobacterium tuberculosis. After amplification of the rpoB gene, the product was sequenced using ABI 310 Genetic Analyzer and the rifampicin resistance in M. tuberculosis were ...

  19. Isolation and characterization of a gene encoding a polyethylene ...

    Indian Academy of Sciences (India)

    The National Key Facility for Crop Gene Resources and Genetic Improvement, Key Laboratory of Crop Germplasm & Biotechnology, Ministry of Agriculture, Institute of Crop Science, Chinese Academy of Agricultural Sciences, Beijing 100081, China; Biotechnology Research Institute, Chinese Academy of Agricultural ...

  20. Association between GH encoding gene polymorphism and semen ...

    African Journals Online (AJOL)

    The objective of this present study was to investigate relationships between the growth hormone gene restriction fragment length polymorphism (RFLP) and bull sperm characteristics. A total of 89 bulls from two semen evaluation stations were genotyped for the bovine growth hormone (bGH)-AluI polymorphism by ...

  1. Cloning and heterologous expression of a gene encoding lycopene ...

    African Journals Online (AJOL)



    Apr 6, 2011 ... This report describes the cloning and expression of a gene lycopene epsilon cyclase, (LCYE) from. Camellia sinensis var assamica which is a precursor of the carotenoid lutein in tea. The 1982 bp cDNA sequence with 1599 bp open reading frame of LCYE was identified from an SSH library constructed for.

  2. Gene encoding virulence markers among Escherichia coli isolates ...

    African Journals Online (AJOL)

    River water sources and diarrhoeic stools of residents in the Venda Region, Limpopo Province of South Africa were analysed for the prevalence of Escherichia coli (E. coli) and the presence of virulence genes among the isolates. A control group of 100 nondiarrhoeic stool samples was included. Escherichia coli was ...

  3. Absence of repellents in Ustilago maydis induces genes encoding small secreted proteins. (United States)

    Teertstra, Wieke R; Krijgsheld, Pauline; Wösten, Han A B


    The rep1 gene of the maize pathogen Ustilago maydis encodes a pre-pro-protein that is processed in the secretory pathway into 11 peptides. These so-called repellents form amphipathic amyloid fibrils at the surface of aerial hyphae. A SG200 strain in which the rep1 gene is inactivated (∆rep1 strain) is affected in aerial hyphae formation. We here assessed changes in global gene expression as a consequence of the inactivation of the rep1 gene. Microarray analysis revealed that only 31 genes in the ∆rep1 SG200 strain had a fold change in expression of ≥2. Twenty-two of these genes were up-regulated and half of them encode small secreted proteins (SSPs) with unknown functions. Seven of the SSP genes and two other genes that are over-expressed in the ∆rep1 SG200 strain encode proteins that can be classified as secreted cysteine-rich proteins (SCRPs). Interestingly, most of the SCRPs are predicted to form amyloids. The SCRP gene um00792 showed the highest up-regulation in the ∆rep1 strain. Using GFP as a reporter, it was shown that this gene is over-expressed in the layer of hyphae at the medium-air interface. Taken together, it is concluded that inactivation of rep1 hardly affects the expression profile of U. maydis, despite the fact that the mutant strain has a strong reduced ability to form aerial hyphae.

  4. What is a gene, post-ENCODE? History and updated definition. (United States)

    Gerstein, Mark B; Bruce, Can; Rozowsky, Joel S; Zheng, Deyou; Du, Jiang; Korbel, Jan O; Emanuelsson, Olof; Zhang, Zhengdong D; Weissman, Sherman; Snyder, Michael


    While sequencing of the human genome surprised us with how many protein-coding genes there are, it did not fundamentally change our perspective on what a gene is. In contrast, the complex patterns of dispersed regulation and pervasive transcription uncovered by the ENCODE project, together with non-genic conservation and the abundance of noncoding RNA genes, have challenged the notion of the gene. To illustrate this, we review the evolution of operational definitions of a gene over the past century--from the abstract elements of heredity of Mendel and Morgan to the present-day ORFs enumerated in the sequence databanks. We then summarize the current ENCODE findings and provide a computational metaphor for the complexity. Finally, we propose a tentative update to the definition of a gene: A gene is a union of genomic sequences encoding a coherent set of potentially overlapping functional products. Our definition side-steps the complexities of regulation and transcription by removing the former altogether from the definition and arguing that final, functional gene products (rather than intermediate transcripts) should be used to group together entities associated with a single gene. It also manifests how integral the concept of biological function is in defining genes.

  5. Molecular cloning and characterization of a gene encoding RING ...

    Indian Academy of Sciences (India)


    induced by exogenous abscisic acid (ABA) and also by salinity, cold and heat to some extent. Overexpression of the. AdZFP1 gene in ... For heat treatment, plants were incubated in sealed flasks at 37ºC for 1, 3, 6, 12 and 24 .... After drying in an oven, the samples were weighed again. The percentage of moisture in the soil ...

  6. Escherichia coli rpiA gene encoding ribose phosphate isomerase A

    DEFF Research Database (Denmark)

    Hove-Jensen, Bjarne; Maigaard, Marianne


    The rpiA gene encoding ribose phosphate isomerase A was cloned from phage 1A2(471) of the Kohara gene library. Subcloning, restriction, and complementation analyses revealed an 1,800-bp SspI-generated DNA fragment that contained the entire control and coding sequences. This DNA fragment was seque...... strains harboring the rpiA gene in a multicopy plasmid contained up to 42-fold as much ribose phosphate isomerase A activity as the haploid strain....

  7. Transient receptor potential (TRP gene superfamily encoding cation channels

    Directory of Open Access Journals (Sweden)

    Pan Zan


    Full Text Available Abstract Transient receptor potential (TRP non-selective cation channels constitute a superfamily, which contains 28 different genes. In mammals, this superfamily is divided into six subfamilies based on differences in amino acid sequence homology between the different gene products. Proteins within a subfamily aggregate to form heteromeric or homomeric tetrameric configurations. These different groupings have very variable permeability ratios for calcium versus sodium ions. TRP expression is widely distributed in neuronal tissues, as well as a host of other tissues, including epithelial and endothelial cells. They are activated by environmental stresses that include tissue injury, changes in temperature, pH and osmolarity, as well as volatile chemicals, cytokines and plant compounds. Their activation induces, via intracellular calcium signalling, a host of responses, including stimulation of cell proliferation, migration, regulatory volume behaviour and the release of a host of cytokines. Their activation is greatly potentiated by phospholipase C (PLC activation mediated by coupled GTP-binding proteins and tyrosine receptors. In addition to their importance in maintaining tissue homeostasis, some of these responses may involve various underlying diseases. Given the wealth of literature describing the multiple roles of TRP in physiology in a very wide range of different mammalian tissues, this review limits itself to the literature describing the multiple roles of TRP channels in different ocular tissues. Accordingly, their importance to the corneal, trabecular meshwork, lens, ciliary muscle, retinal, microglial and retinal pigment epithelial physiology and pathology is reviewed.

  8. An optimized dosing regimen of cimaglermin (neuregulin 1β3, glial growth factor 2) enhances molecular markers of neuroplasticity and functional recovery after permanent ischemic stroke in rats. (United States)

    Iaci, Jennifer F; Parry, Tom J; Huang, Zhihong; Pavlopoulos, Elias; Finklestein, Seth P; Ren, Jingmei; Caggiano, Anthony


    Cimaglermin (neuregulin 1β3, glial growth factor 2) is a neuregulin growth factor family member in clinical development for chronic heart failure. Previously, in a permanent middle cerebral artery occlusion (pMCAO) rat stroke model, systemic cimaglermin treatment initiated up to 7 days after ischemia onset promoted recovery without reduced lesion volume. Presented here to extend the evidence are two studies that use a rat stroke model to evaluate the effects of cimaglermin dose level and dose frequency initiated 24 hr after pMCAO. Forelimb- and hindlimb-placing scores (proprioceptive behavioral tests), body-swing symmetry, and infarct volume were compared between treatment groups (n = 12/group). Possible mechanisms underlying cimaglermin-mediated neurologic recovery were examined through axonal growth and synapse formation histological markers. Cimaglermin was evaluated over a wider dose range (0.02, 0.1, or 1.0 mg/kg) than doses previously shown to be effective but used the same dosing regimen (2 weeks of daily intravenous administration, then 1 week without treatment). The dose-frequency study used the dose-ranging study's most effective dose (1.0 mg/kg) to compare daily, once per week, and twice per week dosing for 3 weeks (then 1 week without treatment). Dose- and frequency-dependent functional improvements were observed with cimaglermin without reduced lesion volume. Cimaglermin treatment significantly increased growth-associated protein 43 expression in both hemispheres (particularly somatosensory and motor cortices) and also increased synaptophysin expression. These data indicate that cimaglermin enhances recovery after stroke. Immunohistochemical changes were consistent with axonal sprouting and synapse formation but not acute neuroprotection. Cimaglermin represents a potential clinical development candidate for ischemic stroke treatment. © 2015 The Authors. Journal of Neuroscience Research Published by Wiley Periodicals, Inc.

  9. Epistatic and functional interactions of catechol-o-methyltransferase (COMT and AKT1 on neuregulin1-ErbB signaling in cell models.

    Directory of Open Access Journals (Sweden)

    Yoshitatsu Sei


    Full Text Available Neuregulin1 (NRG1-ErbB signaling has been implicated in the pathogenesis of cancer and schizophrenia. We have previously reported that NRG1-stimulated migration of B lymphoblasts is PI3K-AKT1dependent and impaired in patients with schizophrenia and significantly linked to the catechol-o-methyltransferase (COMT Val108/158Met functional polymorphism.We have now examined AKT1 activation in NRG1-stimulated B lymphoblasts and other cell models and explored a functional relationship between COMT and AKT1. NRG1-induced AKT1 phosphorylation was significantly diminished in Val carriers compared to Met carriers in both normal subjects and in patients. Further, there was a significant epistatic interaction between a putatively functional coding SNP in AKT1 (rs1130233 and COMT Val108/158Met genotype on AKT1 phosphorylation. NRG1 induced translocation of AKT1 to the plasma membrane also was impaired in Val carriers, while PIP(3 levels were not decreased. Interestingly, the level of COMT enzyme activity was inversely correlated with the cells' ability to synthesize phosphatidylserine (PS, a factor that attracts the pleckstrin homology domain (PHD of AKT1 to the cell membrane. Transfection of SH-SY5Y cells with a COMT Val construct increased COMT activity and significantly decreased PS levels as well as NRG1-induced AKT1 phosphorylation and migration. Administration of S-adenosylmethionine (SAM rescued all of these deficits. These data suggest that AKT1 function is influenced by COMT enzyme activity through competition with PS synthesis for SAM, which in turn dictates AKT1-dependent cellular responses to NRG1-mediated signaling.Our findings implicate genetic and functional interactions between COMT and AKT1 and may provide novel insights into pathogenesis of schizophrenia and other ErbB-associated human diseases such as cancer.

  10. Tissue engineering intrafusal fibers: dose- and time-dependent differentiation of nuclear bag fibers in a defined in vitro system using neuregulin 1-beta-1. (United States)

    Rumsey, John W; Das, Mainak; Kang, Jung-Fong; Wagner, Robert; Molnar, Peter; Hickman, James J


    While much is known about muscle spindle structure, innervation and function, relatively few factors have been identified that regulate intrafusal fiber differentiation and spindle development. Identification of these factors will be a crucial step in tissue engineering functional muscle systems. In this study, we investigated the role of the growth factor, neuregulin 1-beta-1 (Nrg 1-beta-1) EGF, for its ability to influence myotube fate specification in a defined culture system utilizing the non-biological substrate N-1[3-(trimethoxysilyl)propyl]-diethylenetriamine (DETA). Based on morphological and immunocytochemical criteria, Nrg 1-beta-1 treatment of developing myotubes increases the ratio of nuclear bag fibers to total myotubes from 0.019 to 0.100, approximately a five-fold increase. The myotube cultures were evaluated for expression of the intrafusal fiber-specific alpha cardiac-like myosin heavy chain and for the expression of the non-specific slow myosin heavy chain. Additionally, the expression of ErbB2 receptors on all myotubes was observed, while phosphorylated ErbB2 receptors were only observed in Nrg 1-beta-1-treated intrafusal fibers. After Nrg 1-beta-1 treatment, we were able to observe the expression of the intrafusal fiber-specific transcription factor Egr3 only in fibers exhibiting the nuclear bag phenotype. Finally, nuclear bag fibers were characterized electrophysiologically for the first time in vitro. This data shows conclusively, in a serum-free system, that Nrg 1-beta-1 is necessary to drive specification of forming myotubes to the nuclear bag phenotype.

  11. The evolution of genes encoding for green fluorescent proteins: insights from cephalochordates (amphioxus) (United States)

    Yue, Jia-Xing; Holland, Nicholas D.; Holland, Linda Z.; Deheyn, Dimitri D.


    Green Fluorescent Protein (GFP) was originally found in cnidarians, and later in copepods and cephalochordates (amphioxus) (Branchiostoma spp). Here, we looked for GFP-encoding genes in Asymmetron, an early-diverged cephalochordate lineage, and found two such genes closely related to some of the Branchiostoma GFPs. Dim fluorescence was found throughout the body in adults of Asymmetron lucayanum, and, as in Branchiostoma floridae, was especially intense in the ripe ovaries. Spectra of the fluorescence were similar between Asymmetron and Branchiostoma. Lineage-specific expansion of GFP-encoding genes in the genus Branchiostoma was observed, largely driven by tandem duplications. Despite such expansion, purifying selection has strongly shaped the evolution of GFP-encoding genes in cephalochordates, with apparent relaxation for highly duplicated clades. All cephalochordate GFP-encoding genes are quite different from those of copepods and cnidarians. Thus, the ancestral cephalochordates probably had GFP, but since GFP appears to be lacking in more early-diverged deuterostomes (echinoderms, hemichordates), it is uncertain whether the ancestral cephalochordates (i.e. the common ancestor of Asymmetron and Branchiostoma) acquired GFP by horizontal gene transfer (HGT) from copepods or cnidarians or inherited it from the common ancestor of copepods and deuterostomes, i.e. the ancestral bilaterians.

  12. Characterization of genes encoding poly(A polymerases in plants: evidence for duplication and functional specialization.

    Directory of Open Access Journals (Sweden)

    Lisa R Meeks

    Full Text Available BACKGROUND: Poly(A polymerase is a key enzyme in the machinery that mediates mRNA 3' end formation in eukaryotes. In plants, poly(A polymerases are encoded by modest gene families. To better understand this multiplicity of genes, poly(A polymerase-encoding genes from several other plants, as well as from Selaginella, Physcomitrella, and Chlamydomonas, were studied. METHODOLOGY/PRINCIPAL FINDINGS: Using bioinformatics tools, poly(A polymerase-encoding genes were identified in the genomes of eight species in the plant lineage. Whereas Chlamydomonas reinhardtii was found to possess a single poly(A polymerase gene, other species possessed between two and six possible poly(A polymerase genes. With the exception of four intron-lacking genes, all of the plant poly(A polymerase genes (but not the C. reinhardtii gene possessed almost identical intron positions within the poly(A polymerase coding sequences, suggesting that all plant poly(A polymerase genes derive from a single ancestral gene. The four Arabidopsis poly(A polymerase genes were found to be essential, based on genetic analysis of T-DNA insertion mutants. GFP fusion proteins containing three of the four Arabidopsis poly(A polymerases localized to the nucleus, while one such fusion protein was localized in the cytoplasm. The fact that this latter protein is largely pollen-specific suggests that it has important roles in male gametogenesis. CONCLUSIONS/SIGNIFICANCE: Our results indicate that poly(A polymerase genes have expanded from a single ancestral gene by a series of duplication events during the evolution of higher plants, and that individual members have undergone sorts of functional specialization so as to render them essential for plant growth and development. Perhaps the most interesting of the plant poly(A polymerases is a novel cytoplasmic poly(A polymerase that is expressed in pollen in Arabidopsis; this is reminiscent of spermatocyte-specific cytoplasmic poly(A polymerases in

  13. Identification and characterization of MFA1, the gene encoding Candida albicans a-factor pheromone. (United States)

    Dignard, Daniel; El-Naggar, Ahmed L; Logue, Mary E; Butler, Geraldine; Whiteway, Malcolm


    In the opaque state, MTLa and MTLalpha strains of Candida albicans are able to mate, and this mating is directed by a pheromone-mediated signaling process. We have used comparisons of genome sequences to identify a C. albicans gene encoding a candidate a-specific mating factor. This gene is conserved in Candida dubliniensis and is similar to a three-gene family in the related fungus Candida parapsilosis but has extremely limited similarity to the Saccharomyces cerevisiae MFA1 (ScMFA1) and ScMFA2 genes. All these genes encode C-terminal CAAX box motifs characteristic of prenylated proteins. The C. albicans gene, designated CaMFA1, is found on chromosome 2 between ORF19.2165 and ORF19.2219. MFA1 encodes an open reading frame of 42 amino acids that is predicted to be processed to a 14-amino-acid prenylated mature pheromone. Microarray analysis shows that MFA1 is poorly expressed in opaque MTLa cells but is induced when the cells are treated with alpha-factor. Disruption of this C. albicans gene blocks the mating of MTLa cells but not MTLalpha cells, while the reintegration of the gene suppresses this cell-type-specific mating defect.

  14. Characterization of the FKBP12-Encoding Genes in Aspergillus fumigatus.

    Directory of Open Access Journals (Sweden)

    Katie Falloon

    Full Text Available Invasive aspergillosis, largely caused by Aspergillus fumigatus, is responsible for a growing number of deaths among immunosuppressed patients. Immunosuppressants such as FK506 (tacrolimus that target calcineurin have shown promise for antifungal drug development. FK506-binding proteins (FKBPs form a complex with calcineurin in the presence of FK506 (FKBP12-FK506 and inhibit calcineurin activity. Research on FKBPs in fungi is limited, and none of the FKBPs have been previously characterized in A. fumigatus. We identified four orthologous genes of FKBP12, the human FK506 binding partner, in A. fumigatus and designated them fkbp12-1, fkbp12-2, fkbp12-3, and fkbp12-4. Deletional analysis of the four genes revealed that the Δfkbp12-1 strain was resistant to FK506, indicating FKBP12-1 as the key mediator of FK506-binding to calcineurin. The endogenously expressed FKBP12-1-EGFP fusion protein localized to the cytoplasm and nuclei under normal growth conditions but also to the hyphal septa following FK506 treatment, revealing its interaction with calcineurin. The FKBP12-1-EGFP fusion protein didn't localize at the septa in the presence of FK506 in the cnaA deletion background, confirming its interaction with calcineurin. Testing of all deletion strains in the Galleria mellonella model of aspergillosis suggested that these proteins don't play an important role in virulence. While the Δfkbp12-2 and Δfkbp12-3 strains didn't show any discernable phenotype, the Δfkbp12-4 strain displayed slight growth defect under normal growth conditions and inhibition of the caspofungin-mediated "paradoxical growth effect" at higher concentrations of the antifungal caspofungin. Together, these results indicate that while only FKBP12-1 is the bona fide binding partner of FK506, leading to the inhibition of calcineurin in A. fumigatus, FKBP12-4 may play a role in basal growth and the caspofungin-mediated paradoxical growth response. Exploitation of differences between A


    Directory of Open Access Journals (Sweden)

    Marjanca Starčič-Erjavec


    Full Text Available Methods 110 uropathogenic Escherichia coli strains (UPEC obtained from the Institute of Microbiology and Immunology of the Medical Faculty in Ljubljana were screened by PCR withprimers specific for the following toxin encoding genes: hlyA (haemolysin, cnf1 (cytotoxicnecrotising factor 1, usp (uropathogenic specific protein USP and ibeA (invasin. Dotblot hybridisation experiments were performed to validate the PCR assays.Results In 44% of the strains usp gene sequences were detected. The prevalence of hlyA and cnf1was 25% and 23%, respectively. Only 9% of the strains harbored ibeA. The majority of thetested toxin encoding genes was found in strains belonging to the B2 phylogenetic group.Conclusions The toxin encoding genes hlyA, cnf1 and usp were strongly co-associated. Further, we founda statistically significant co-association of ibeA and usp. The prevalence of the testedtoxin encoding genes in E. coli strains from urinary tract infections isolated in Slovenia iscomparable to those from studies in other geographic regions.

  16. Compensation for differences in gene copy number among yeast ribosomal proteins is encoded within their promoters (United States)

    Zeevi, Danny; Sharon, Eilon; Lotan-Pompan, Maya; Lubling, Yaniv; Shipony, Zohar; Raveh-Sadka, Tali; Keren, Leeat; Levo, Michal; Weinberger, Adina; Segal, Eran


    Coordinate regulation of ribosomal protein (RP) genes is key for controlling cell growth. In yeast, it is unclear how this regulation achieves the required equimolar amounts of the different RP components, given that some RP genes exist in duplicate copies, while others have only one copy. Here, we tested whether the solution to this challenge is partly encoded within the DNA sequence of the RP promoters, by fusing 110 different RP promoters to a fluorescent gene reporter, allowing us to robustly detect differences in their promoter activities that are as small as ∼10%. We found that single-copy RP promoters have significantly higher activities, suggesting that proper RP stoichiometry is indeed partly encoded within the RP promoters. Notably, we also partially uncovered how this regulation is encoded by finding that RP promoters with higher activity have more nucleosome-disfavoring sequences and characteristic spatial organizations of these sequences and of binding sites for key RP regulators. Mutations in these elements result in a significant decrease of RP promoter activity. Thus, our results suggest that intrinsic (DNA-dependent) nucleosome organization may be a key mechanism by which genomes encode biologically meaningful promoter activities. Our approach can readily be applied to uncover how transcriptional programs of other promoters are encoded. PMID:22009988

  17. Genetic variants in nuclear-encoded mitochondrial genes influence AIDS progression.

    Directory of Open Access Journals (Sweden)

    Sher L Hendrickson

    Full Text Available BACKGROUND: The human mitochondrial genome includes only 13 coding genes while nuclear-encoded genes account for 99% of proteins responsible for mitochondrial morphology, redox regulation, and energetics. Mitochondrial pathogenesis occurs in HIV patients and genetically, mitochondrial DNA haplogroups with presumed functional differences have been associated with differential AIDS progression. METHODOLOGY/PRINCIPAL FINDINGS: Here we explore whether single nucleotide polymorphisms (SNPs within 904 of the estimated 1,500 genes that specify nuclear-encoded mitochondrial proteins (NEMPs influence AIDS progression among HIV-1 infected patients. We examined NEMPs for association with the rate of AIDS progression using genotypes generated by an Affymetrix 6.0 genotyping array of 1,455 European American patients from five US AIDS cohorts. Successfully genotyped SNPs gave 50% or better haplotype coverage for 679 of known NEMP genes. With a Bonferroni adjustment for the number of genes and tests examined, multiple SNPs within two NEMP genes showed significant association with AIDS progression: acyl-CoA synthetase medium-chain family member 4 (ACSM4 on chromosome 12 and peroxisomal D3,D2-enoyl-CoA isomerase (PECI on chromosome 6. CONCLUSIONS: Our previous studies on mitochondrial DNA showed that European haplogroups with presumed functional differences were associated with AIDS progression and HAART mediated adverse events. The modest influences of nuclear-encoded mitochondrial genes found in the current study add support to the idea that mitochondrial function plays a role in AIDS pathogenesis.

  18. A Gene Selection Method for Microarray Data Based on Binary PSO Encoding Gene-to-Class Sensitivity Information. (United States)

    Han, Fei; Yang, Chun; Wu, Ya-Qi; Zhu, Jian-Sheng; Ling, Qing-Hua; Song, Yu-Qing; Huang, De-Shuang


    Traditional gene selection methods for microarray data mainly considered the features' relevance by evaluating their utility for achieving accurate predication or exploiting data variance and distribution, and the selected genes were usually poorly explicable. To improve the interpretability of the selected genes as well as prediction accuracy, an improved gene selection method based on binary particle swarm optimization (BPSO) and prior information is proposed in this paper. In the proposed method, BPSO encoding gene-to-class sensitivity (GCS) information is used to perform gene selection. The gene-to-class sensitivity information, extracted from the samples by extreme learning machine (ELM), is encoded into the selection process in four aspects: initializing particles, updating the particles, modifying maximum velocity, and adopting mutation operation adaptively. Constrained by the gene-to-class sensitivity information, the new method can select functional gene subsets which are significantly sensitive to the samples' classes. With the few discriminative genes selected by the proposed method, ELM, K-nearest neighbor and support vector machine classifiers achieve much high prediction accuracy on five public microarray data, which in turn verifies the efficiency and effectiveness of the proposed gene selection method.

  19. The rnhB gene encoding RNase HII of Streptococcus pneumoniae and evidence of conserved motifs in eucaryotic genes. (United States)

    Zhang, Y B; Ayalew, S; Lacks, S A


    A single RNase H enzyme was detected in extracts of Streptococcus pneumoniae. The gene encoding this enzyme was cloned and expressed in Escherichia coli, as demonstrated by its ability to complement a double-mutant rnhA recC strain. Sequence analysis of the cloned DNA revealed an open reading frame of 290 codons that encodes a polypeptide of 31.9 kDa. The predicted protein exhibits a low level of homology (19% identity of amino acid residues) to RNase HII encoded by rnhB of E. coli. Identification of the S. pneumoniae RNase HII translation start site by amino-terminal sequencing of the protein and of mRNA start sites by primer extension with reverse transcriptase showed that the major transcript encoding rnhB begins at the protein start site. Comparison of the S. pneumoniae and E. coli RNase HII sequences and sequences of other, putative bacterial rnhB gene products surmised from sequencing data revealed three conserved motifs. Use of these motifs to search for homologous genes in eucaryotes demonstrated the presence of rnhB genes in a yeast and a roundworm. Partial rnhB gene sequences were detected among expressed sequences of mouse and human cells. From these data, it appears that RNase HII is universally present in living cells.

  20. Allotopic Expression of a Gene Encoding FLAG Tagged-subunit 8 of Yeast Mitochondrial ATP Synthase

    Directory of Open Access Journals (Sweden)



    Full Text Available Subunit 8 of yeast mitochondrial ATP synthase is a polypeptide of 48 amino acids encoded by the mitochondrial ATP8 gene. A nuclear version of subunit 8 gene has been designed to encode FLAG tagged-subunit 8 fused with a mitochondrial signal peptide. The gene has been cloned into a yeast expression vector and then expressed in a yeast strain lacking endogenous subunit 8. Results showed that the gene was successfully expressed and the synthesized FLAG tagged-subunit 8 protein was imported into mitochondria. Following import, the FLAG tagged-subunit 8 protein assembled into functional mitochondrial ATP synthase complex. Furthermore, the subunit 8 protein could be detected using anti-FLAG tag monoclonal antibody.

  1. Characterization of genes encoding for acquired bacitracin resistance in Clostridium perfringens. (United States)

    Charlebois, Audrey; Jalbert, Louis-Alexandre; Harel, Josée; Masson, Luke; Archambault, Marie


    Phenotypic bacitracin resistance has been reported in Clostridium perfringens. However, the genes responsible for the resistance have not yet been characterized. Ninety-nine C. perfringens isolates recovered from broilers and turkeys were tested for phenotypic bacitracin resistance. Bacitracin MIC(90) (>256 µg/ml) was identical for both turkey and chicken isolates; whereas MIC(50) was higher in turkey isolates (6 µg/ml) than in chicken isolates (3 µg/ml). Twenty-four of the 99 isolates showed high-level bacitracin resistance (MIC breakpoint >256 µg/ml) and the genes encoding for this resistance were characterized in C. perfringens c1261_A strain using primer walking. Sequence analysis and percentages of amino acid identity revealed putative genes encoding for both an ABC transporter and an overproduced undecaprenol kinase in C. perfringens c1261_A strain. These two mechanisms were shown to be both encoded by the putative bcrABD operon under the control of a regulatory gene, bcrR. Efflux pump inhibitor thioridazine was shown to increase significantly the susceptibility of strain c1261_A to bacitracin. Upstream and downstream from the bcr cluster was an IS1216-like element, which may play a role in the dissemination of this resistance determinant. Pulsed-field gel electrophoresis with prior double digestion with I-CeuI/MluI enzymes followed by hybridization analyses revealed that the bacitracin resistance genes bcrABDR were located on the chromosome. Semi-quantitative RT-PCR demonstrated that this gene cluster is expressed under bacitracin stress. Microarray analysis revealed the presence of these genes in all bacitracin resistant strains. This study reports the discovery of genes encoding for a putative ABC transporter and an overproduced undecaprenol kinase associated with high-level bacitracin resistance in C. perfringens isolates from turkeys and broiler chickens.

  2. Characterization of genes encoding for acquired bacitracin resistance in Clostridium perfringens.

    Directory of Open Access Journals (Sweden)

    Audrey Charlebois

    Full Text Available Phenotypic bacitracin resistance has been reported in Clostridium perfringens. However, the genes responsible for the resistance have not yet been characterized. Ninety-nine C. perfringens isolates recovered from broilers and turkeys were tested for phenotypic bacitracin resistance. Bacitracin MIC(90 (>256 µg/ml was identical for both turkey and chicken isolates; whereas MIC(50 was higher in turkey isolates (6 µg/ml than in chicken isolates (3 µg/ml. Twenty-four of the 99 isolates showed high-level bacitracin resistance (MIC breakpoint >256 µg/ml and the genes encoding for this resistance were characterized in C. perfringens c1261_A strain using primer walking. Sequence analysis and percentages of amino acid identity revealed putative genes encoding for both an ABC transporter and an overproduced undecaprenol kinase in C. perfringens c1261_A strain. These two mechanisms were shown to be both encoded by the putative bcrABD operon under the control of a regulatory gene, bcrR. Efflux pump inhibitor thioridazine was shown to increase significantly the susceptibility of strain c1261_A to bacitracin. Upstream and downstream from the bcr cluster was an IS1216-like element, which may play a role in the dissemination of this resistance determinant. Pulsed-field gel electrophoresis with prior double digestion with I-CeuI/MluI enzymes followed by hybridization analyses revealed that the bacitracin resistance genes bcrABDR were located on the chromosome. Semi-quantitative RT-PCR demonstrated that this gene cluster is expressed under bacitracin stress. Microarray analysis revealed the presence of these genes in all bacitracin resistant strains. This study reports the discovery of genes encoding for a putative ABC transporter and an overproduced undecaprenol kinase associated with high-level bacitracin resistance in C. perfringens isolates from turkeys and broiler chickens.

  3. fosI Is a New Integron-Associated Gene Cassette Encoding Reduced Susceptibility to Fosfomycin


    Pelegrino,Karla de Oliveira; Campos, Juliana Coutinho; Sampaio, Suely Carlos Ferreira; Lezirovitz,Karina; Seco, Bruna Mara; Pereira, Mayne de Oliveira; Rocha, Darlan Augusto da Costa; Jové, Thomas; Nicodemo, Antonio Carlos; Sampaio, Jorge Luiz Mello


    In this work, we demonstrate that the fosI gene encodes a predicted small protein with 134 amino acids and determines reduced susceptibility to fosfomycin. It raised the MIC from 0.125 to 6 μg/ml when the pBRA100 plasmid was introduced into Escherichia coli TOP10 and to 16 μg/ml when the gene was cloned into the pBC_SK(−) vector and expressed in E. coli TOP10.

  4. The Drosophila gene brainiac encodes a glycosyltransferase putatively involved in glycosphingolipid synthesis

    DEFF Research Database (Denmark)

    Schwientek, Tilo; Keck, Birgit; Levery, Steven B


    The Drosophila genes fringe and brainiac exhibit sequence similarities to glycosyltransferases. Drosophila and mammalian fringe homologs encode UDP-N-acetylglucosamine:fucose-O-Ser beta1,3-N-acetylglucosaminyltransferases that modulate the function of Notch family receptors. The biological functi...

  5. Reduction of antinutritional glucosinolates in Brassica oilseeds by mutation of genes encoding transporters

    DEFF Research Database (Denmark)

    Nour-Eldin, Hussam Hassan; Madsen, Svend Roesen; Engelen, Steven


    The nutritional value of Brassica seed meals is reduced by the presence of glucosinolates, which are toxic compounds involved in plant defense. Mutation of the genes encoding two glucosinolate transporters (GTRs) eliminated glucosinolates from Arabidopsis thaliana seeds, but translation of loss-o...... glucosinolate content in other oilseed crops, such as Camelina sativa or Crambe abyssinica....

  6. Effects of deoxycycline induced lentivirus encoding FasL gene on ...

    African Journals Online (AJOL)

    Spleen lymphocytes of rats were transfected with the lentiviral vector system encoding FasL gene and 5 days later were induced by doxycycline for 24 h, followed by detection of FasL mRNA. The apoptosis index of Th1 cells was measured through both Annexin V-FITC flow cytometry and TUNEL. Additionally flow cytometry ...

  7. Nucleotide sequences of the genes encoding fructosebisphosphatase and phosphoribulokinase from Xanthobacter flavus H4-14

    NARCIS (Netherlands)

    Meijer, Wilhelmus; Enequist, H.G.; Terpstra, Peter; Dijkhuizen, L.


    The genes encoding fructosebisphosphatase and phosphoribulokinase present on a 2.5 kb SalI fragment from Xanthobacter flavus H4-14 were sequenced. Two large open reading frames (ORFs) were identified, preceded by plausible ribosome-binding sites. The ORFs were transcribed in the same direction and

  8. Mutations in genes encoding subunits of RNA polymerases I and III cause Treacher Collins syndrome.

    NARCIS (Netherlands)

    Dauwerse, J.G.; Dixon, J.; Seland, S.; Ruivenkamp, C.A.; Haeringen, A. van; Hoefsloot, L.H.; Peters, D.J.; Boers, A.C.; Daumer-Haas, C.; Maiwald, R.; Zweier, C.; Kerr, B.; Cobo, A.M.; Toral, J.F.; Hoogeboom, A.J.M.; Lohmann, D.R.; Hehr, U.; Dixon, M.J.; Breuning, M.H.; Wieczorek, D.


    We identified a deletion of a gene encoding a subunit of RNA polymerases I and III, POLR1D, in an individual with Treacher Collins syndrome (TCS). Subsequently, we detected 20 additional heterozygous mutations of POLR1D in 252 individuals with TCS. Furthermore, we discovered mutations in both

  9. Haploinsufficiency of the genes encoding the tumor suppressor Pten predisposes zebrafish to hemangiosarcoma

    NARCIS (Netherlands)

    Choorapoikayil, S.; Kuiper, R.V.; de Bruin, A.; den Hertog, J.


    PTEN is an essential tumor suppressor that antagonizes Akt/PKB signaling. The zebrafish genome encodes two Pten genes, ptena and ptenb. Here, we report that zebrafish mutants that retain a single wild-type copy of ptena or ptenb (ptena(+/-)ptenb(-/-) or ptena(-/-)ptenb(+/-)) are viable and fertile.

  10. Erratum Genomewide analysis of NBS-encoding genes in kiwi fruit ...

    Indian Academy of Sciences (India)

    c Indian Academy of Sciences. Erratum. Genomewide analysis of NBS-encoding genes in kiwi fruit (Actinidia chinensis). Yingjun Li, Yan Zhong, Kaihui Huang and Zong-Ming Cheng. J. Genet. 95, 997–1001. The following statement in the footnote of the first page is missing in the published version of the above article.

  11. Phenotypical Manifestations of Mutations in the Genes Encoding Subunits of the Cardiac Sodium Channel

    NARCIS (Netherlands)

    Wilde, Arthur A. M.; Brugada, Ramon


    Variations in the gene encoding for the major sodium channel (Na(v)1.5) in the heart, SCN5A, has been shown to cause a number of arrhythmia syndromes (with or without structural changes in the myocardium), including the long-QT syndrome (type 3), Brugada syndrome, (progressive) cardiac conduction

  12. TMC and EVER genes belong to a larger novel family, the TMC gene family encoding transmembrane proteins

    Directory of Open Access Journals (Sweden)

    Mutai Hideki


    Full Text Available Abstract Background Mutations in the transmembrane cochlear expressed gene 1 (TMC1 cause deafness in human and mouse. Mutations in two homologous genes, EVER1 and EVER2 increase the susceptibility to infection with certain human papillomaviruses resulting in high risk of skin carcinoma. Here we report that TMC1, EVER1 and EVER2 (now TMC6 and TMC8 belong to a larger novel gene family, which is named TMC for trans membrane channel-like gene family. Results Using a combination of iterative database searches and reverse transcriptase-polymerase chain reaction (RT-PCR experiments we assembled contigs for cDNA encoding human, murine, puffer fish, and invertebrate TMC proteins. TMC proteins of individual species can be grouped into three subfamilies A, B, and C. Vertebrates have eight TMC genes. The majority of murine TMC transcripts are expressed in most organs; some transcripts, however, in particular the three subfamily A members are rare and more restrictively expressed. Conclusion The eight vertebrate TMC genes are evolutionary conserved and encode proteins that form three subfamilies. Invertebrate TMC proteins can also be categorized into these three subfamilies. All TMC genes encode transmembrane proteins with intracellular amino- and carboxyl-termini and at least eight membrane-spanning domains. We speculate that the TMC proteins constitute a novel group of ion channels, transporters, or modifiers of such.

  13. Characterization of the BMR1 gene encoding a transcription factor for melanin biosynthesis genes in the phytopathogenic fungus Bipolaris oryzae. (United States)

    Kihara, Junichi; Moriwaki, Akihiro; Tanaka, Nozomi; Tanaka, Chihiro; Ueno, Makoto; Arase, Sakae


    We isolated and characterized Bipolaris melanin regulation 1 gene (BMR1) encoding a transcription factor for melanin biosynthesis genes in the phytopathogenic fungus Bipolaris oryzae. Sequence analysis showed that the BMR1 gene encodes a putative protein of 1012 amino acids that has 99% sequence similarity to transcription factor Cmr1 of Cochliobolus heterostrophus. The predicted B. oryzae Bmr1 protein has two DNA-binding motifs, two Cys2His2 zinc finger domains, and a Zn(II)2Cys6 binuclear cluster domain at the N-terminal region of Bmr1. Targeted disruption of the BMR1 gene showed that BMR1 is essential for melanin biosynthesis in B. oryzae. The overexpression of the BMR1 gene led to more dark colonies than in the wild-type strain under dark conditions. Real-time PCR analysis showed that the BMR1 expression of the overexpression transformant was about 10-fold that of the wild type under dark conditions and of the expression of three melanin biosynthesis genes. These results indicated that BMR1 encodes the transcription factor of melanin biosynthesis genes in B. oryzae.

  14. Cloning of human genes encoding novel G protein-coupled receptors

    Energy Technology Data Exchange (ETDEWEB)

    Marchese, A.; Docherty, J.M.; Heiber, M. [Univ. of Toronto, (Canada)] [and others


    We report the isolation and characterization of several novel human genes encoding G protein-coupled receptors. Each of the receptors contained the familiar seven transmembrane topography and most closely resembled peptide binding receptors. Gene GPR1 encoded a receptor protein that is intronless in the coding region and that shared identity (43% in the transmembrane regions) with the opioid receptors. Northern blot analysis revealed that GPR1 transcripts were expressed in the human hippocampus, and the gene was localized to chromosome 15q21.6. Gene GPR2 encoded a protein that most closely resembled an interleukin-8 receptor (51% in the transmembrane regions), and this gene, not expressed in the six brain regions examined, was localized to chromosome 17q2.1-q21.3. A third gene, GPR3, showed identity (56% in the transmembrane regions) with a previously characterized cDNA clone from rat and was localized to chromosome 1p35-p36.1. 31 refs., 5 figs., 1 tab.

  15. EWS and FUS bind a subset of transcribed genes encoding proteins enriched in RNA regulatory functions

    DEFF Research Database (Denmark)

    Luo, Yonglun; Friis, Jenny Blechingberg; Fernandes, Ana Miguel


    Background FUS (TLS) and EWS (EWSR1) belong to the FET-protein family of RNA and DNA binding proteins. FUS and EWS are structurally and functionally related and participate in transcriptional regulation and RNA processing. FUS and EWS are identified in translocation generated cancer fusion proteins...... at different levels. Gene Ontology analyses showed that FUS and EWS target genes preferentially encode proteins involved in regulatory processes at the RNA level. Conclusions The presented results yield new insights into gene interactions of EWS and FUS and have identified a set of FUS and EWS target genes......IP-seq). Our results show that FUS and EWS bind to a subset of actively transcribed genes, that binding often is downstream the poly(A)-signal, and that binding overlaps with RNA polymerase II. Functional examinations of selected target genes identified that FUS and EWS can regulate gene expression...

  16. Screening of the Enterocin-Encoding Genes and Antimicrobial Activity in Enterococcus Species. (United States)

    Ogaki, Mayara Baptistucci; Rocha, Katia Real; Terra, MÁrcia Regina; Furlaneto, MÁrcia Cristina; Maia, Luciana Furlaneto


    In the current study, a total of 135 enterococci strains from different sources were screened for the presence of the enterocin-encoding genes entA, entP, entB, entL50A, and entL50B. The enterocin genes were present at different frequencies, with entA occurring the most frequently, followed by entP and entB; entL50A and L50B were not detected. The occurrence of single enterocin genes was higher than the occurrence of multiple enterocin gene combinations. The 80 isolates that harbor at least one enterocin-encoding gene (denoted "Gene(+) strains") were screened for antimicrobial activity. A total of 82.5% of the Gene(+) strains inhibited at least one of the indicator strains, and the isolates harboring multiple enterocin-encoding genes inhibited a larger number of indicator strains than isolates harboring a single gene. The indicator strains that exhibited growth inhibition included Listeria innocua strain CLIP 12612 (ATCC BAA-680), Listeria monocytogenes strain CDC 4555, Enterococcus faecalis ATCC 29212, Staphylococcus aureus ATCC 25923, S. aureus ATCC 29213, S. aureus ATCC 6538, Salmonella enteritidis ATCC 13076, Salmonella typhimurium strain UK-1 (ATCC 68169), and Escherichia coli BAC 49LT ETEC. Inhibition due to either bacteriophage lysis or cytolysin activity was excluded. The growth inhibition of antilisterial Gene+ strains was further tested under different culture conditions. Among the culture media formulations, the MRS agar medium supplemented with 2% (w/v) yeast extract was the best solidified medium for enterocin production. Our findings extend the current knowledge of enterocin-producing enterococci, which may have potential applications as biopreservatives in the food industry due to their capability of controlling food spoilage pathogens.

  17. Gene set of nuclear-encoded mitochondrial regulators is enriched for common inherited variation in obesity.

    Directory of Open Access Journals (Sweden)

    Nadja Knoll

    Full Text Available There are hints of an altered mitochondrial function in obesity. Nuclear-encoded genes are relevant for mitochondrial function (3 gene sets of known relevant pathways: (1 16 nuclear regulators of mitochondrial genes, (2 91 genes for oxidative phosphorylation and (3 966 nuclear-encoded mitochondrial genes. Gene set enrichment analysis (GSEA showed no association with type 2 diabetes mellitus in these gene sets. Here we performed a GSEA for the same gene sets for obesity. Genome wide association study (GWAS data from a case-control approach on 453 extremely obese children and adolescents and 435 lean adult controls were used for GSEA. For independent confirmation, we analyzed 705 obesity GWAS trios (extremely obese child and both biological parents and a population-based GWAS sample (KORA F4, n = 1,743. A meta-analysis was performed on all three samples. In each sample, the distribution of significance levels between the respective gene set and those of all genes was compared using the leading-edge-fraction-comparison test (cut-offs between the 50(th and 95(th percentile of the set of all gene-wise corrected p-values as implemented in the MAGENTA software. In the case-control sample, significant enrichment of associations with obesity was observed above the 50(th percentile for the set of the 16 nuclear regulators of mitochondrial genes (p(GSEA,50 = 0.0103. This finding was not confirmed in the trios (p(GSEA,50 = 0.5991, but in KORA (p(GSEA,50 = 0.0398. The meta-analysis again indicated a trend for enrichment (p(MAGENTA,50 = 0.1052, p(MAGENTA,75 = 0.0251. The GSEA revealed that weak association signals for obesity might be enriched in the gene set of 16 nuclear regulators of mitochondrial genes.

  18. The pyrH gene of Lactococcus lactis subsp. cremoris encoding UMP kinase is transcribed as part of an operon including the frr1 gene encoding ribosomal recycling factor

    DEFF Research Database (Denmark)

    Wadskov-Hansen, Steen Lüders; Martinussen, Jan; Hammer, Karin


    establishing the ability of the encoded protein to synthesize UDP. The pyrH gene in L. lactis is flanked downstream by frr1 encoding ribosomal recycling factor 1 and upstream by an open reading frame, orfA, of unknown function. The three genes were shown to constitute an operon transcribed in the direction orf...

  19. Nicotine-induced neuroplasticity counteracts the effect of schizophrenia-linked neuregulin 1 signaling on NMDAR function in the rat hippocampus. (United States)

    Yamazaki, Yoshihiko; Sumikawa, Katumi


    A high rate of heavy tobacco smoking among people with schizophrenia has been suggested to reflect self-medication and amelioration of cognitive dysfunction, a core feature of schizophrenia. NMDAR hypofunction is hypothesized to be a mechanism of cognitive dysfunction, and excessive schizophrenia-linked neuregulin 1 (NRG1) signaling through its receptor ErbB4 can suppress NMDAR function by preventing Src-mediated enhancement of NMDAR responses. Here we investigated whether chronic nicotine exposure in rats by subcutaneous injection of nicotine (0.5-1 mg/kg, twice daily for 10-15 days) counteracts the suppressive effect of NRG1β on NMDAR-mediated responses recorded from CA1 pyramidal cells in acute hippocampal slices. We found that NRG1β, which prevents the enhancement of NMDAR responses by the Src-family-kinase-activating peptide pYEEI in naive rats, failed to block the effect of pYEEI in nicotine-exposed rats. In naive rats, NRG1β acts only on GluN2B-NMDARs by blocking their Src-mediated upregulation. Chronic nicotine exposure causes enhanced GluN2B-NMDAR responses via Src upregulation and recruits Fyn for the enhancement of GluN2A-NMDAR responses. NRG1β has no effect on both enhanced basal GluN2B-NMDAR responses and Fyn-mediated enhancement of GluN2A-NMDAR responses. Src-mediated enhancement of GluN2B-NMDAR responses and Fyn-mediated enhancement of GluN2A-NMDAR responses initiate long-term potentiation (LTP) of AMPAR synaptic responses in naive and nicotine-exposed CA1 pyramidal cells, respectively. These results suggest that NRG1β suppresses LTP by blocking Src-mediated enhancement of GluN2B-NMDAR responses, but has no effect on LTP in nicotine-exposed rats. These effects of chronic nicotine exposure may counteract the negative effect of increased NRG1-ErbB4 signaling on the cellular mechanisms of learning and memory in individuals with schizophrenia, and therefore may motivate heavy smoking. Copyright © 2016 Elsevier Ltd. All rights reserved.

  20. Genes Encoding Aluminum-Activated Malate Transporter II and their Association with Fruit Acidity in Apple

    Directory of Open Access Journals (Sweden)

    Baiquan Ma


    Full Text Available A gene encoding aluminum-activated malate transporter (ALMT was previously reported as a candidate for the locus controlling acidity in apple ( × Borkh.. In this study, we found that apple genes can be divided into three families and the gene belongs to the family. Duplication of genes in apple is related to the polyploid origin of the apple genome. Divergence in expression has occurred between the gene and its homologs in the family and only the gene is significantly associated with malic acid content. The locus consists of two alleles, and . resides in the tonoplast and its ectopic expression in yeast was found to increase the influx of malic acid into yeast cells significantly, suggesting it may function as a vacuolar malate channel. In contrast, encodes a truncated protein because of a single nucleotide substitution of G with A in the last exon. As this truncated protein resides within the cell membrane, it is deemed to be nonfunctional as a vacuolar malate channel. The frequency of the genotype is very low in apple cultivars but is high in wild relatives, which suggests that apple domestication may be accompanied by selection for the gene. In addition, variations in the malic acid content of mature fruits were also observed between accessions with the same genotype in the locus. This suggests that the gene is not the only genetic determinant of fruit acidity in apple.

  1. Variation in genes encoding eosinophil granule proteins in atopic dermatitis patients from Germany

    Directory of Open Access Journals (Sweden)

    Epplen Jörg T


    Full Text Available Abstract Background Atopic dermatitis (AD is believed to result from complex interactions between genetic and environmental factors. A main feature of AD as well as other allergic disorders is serum and tissue eosinophilia. Human eosinophils contain high amounts of cationic granule proteins, including eosinophil cationic protein (ECP, eosinophil-derived neurotoxin (EDN, eosinophil peroxidase (EPO and major basic protein (MBP. Recently, variation in genes encoding eosinophil granule proteins has been suggested to play a role in the pathogenesis of allergic disorders. We therefore genotyped selected single nucleotide polymorphisms within the ECP, EDN, EPO and MBP genes in a cohort of 361 German AD patients and 325 healthy controls. Results Genotype and allele frequencies did not differ between patients and controls for all polymorphisms investigated in this study. Haplotype analysis did not reveal any additional information. Conclusion We did not find evidence to support an influence of variation in genes encoding eosinophil granule proteins for AD pathogenesis in this German cohort.

  2. Campylobacter jejuni gene cj0511 encodes a serine peptidase essential for colonisation

    Directory of Open Access Journals (Sweden)

    A.V. Karlyshev


    Full Text Available According to MEROPS peptidase database, Campylobacter species encode 64 predicted peptidases. However, proteolytic properties of only a few of these proteins have been confirmed experimentally. In this study we identified and characterised a Campylobacter jejuni gene cj0511 encoding a novel peptidase. The proteolytic activity associated with this enzyme was demonstrated in cell lysates. Moreover, enzymatic studies conducted with a purified protein confirmed a prediction of it being a serine peptidase. Furthermore, cj0511 mutant was found to be severely attenuated in chicken colonisation model, suggesting a role of the Cj0511 protein in infection.

  3. Nucleotide sequence and characterization of a Bacillus subtilis gene encoding a flagellar switch protein.


    Zuberi, A R; Bischoff, D S; Ordal, G W


    The nucleotide sequence of the Bacillus subtilis fliM gene has been determined. This gene encodes a 38-kDa protein that is homologous to the FliM flagellar switch proteins of Escherichia coli and Salmonella typhimurium. Expression of this gene in Che+ cells of E. coli and B. subtilis interferes with normal chemotaxis. The nature of the chemotaxis defect is dependent upon the host used. In B. subtilis, overproduction of FliM generates mostly nonmotile cells. Those cells that are motile switch ...

  4. Isolation and molecular characterisation of the gene encoding eburicol 14α-demethylase (CYP51) from Penicillium italicum

    NARCIS (Netherlands)

    Nistelrooy, J.G.M. van; Brink, J.M. van den; Kan, J.A.L. van; Gorcom, R.F.M. van; Waard, M.A. de


    The CYP51 gene encoding eburicol 14α-demethylase (P450(14DM)) was cloned from a genomic library of the filamentous fungal plant pathogen Penicillium italicum, by heterologous hybridisation with the corresponding gene encoding lanosterol 14α-demethylase from the yeast Candida tropicalis. The

  5. The carB gene encoding the large subunit of carbamoylphosphate synthetase from Lactococcus lactis is transcribed monocistronically

    DEFF Research Database (Denmark)

    Martinussen, Jan; Hammer, Karin


    The biosynthesis of carbamoylphosphate is catalysed by the heterodimeric enzyme carbamoylphosphate synthetase (CPSase). The genes encoding the two subunits in procaryotes are normally transcribed as an operon, whereas in Lactococcus lactis, the gene encoding the large subunit (carB) is shown to b...

  6. Variants within the 5'-flanking regions of bovine milk protein genes: I. κ-casein-encoding gene. (United States)

    Schild, T A; Wagner, V; Geldermann, H


    In order to identify DNA variants within the 5'-flanking region of the bovine κ-casein (κCn)-encoding gene, this area of the gene from 13 cows belonging to seven breeds (Holstein Friesian, Brown Swiss, German Simmental, Jersey, Galloway, Scottish Highland and Ceylon Dwarf Zebu) was analysed. For each individual, about 1 kb of the 5'-flanking region including exon I was amplified by polymerase chain reaction (PCR). The biotinylated PCR product was immobilized on magnetic beads followed by direct bidirectional sequencing using an automated DNA sequencer. Fifteen DNA variants were identified, some of which are located within potential regulatory sites and possibly involved in the expression of the κ-casein encoding gene.

  7. Identification and characterization of the genes encoding carbon monoxide dehydrogenase in Terrabacter carboxydivorans. (United States)

    Lee, Jae Ho; Park, Sae Woong; Kim, Young Min; Oh, Jeong-Il


    Terrabacter carboxydivorans is able to grow aerobically at low concentrations of carbon monoxide (CO) as a sole source of carbon and energy. The genes for carbon monoxide dehydrogenase (CO-DH) were cloned from T. carboxydivorans and analyzed. The operon encoding T. carboxydivorans CO-DH was composed of three structural genes with the transcriptional order of cutB, cutC and cutA, as well as an additional accessory gene (orf4). Phylogenetic analysis of CutA revealed that T. carboxydivorans CO-DH was classified into a group distinct from previously characterized CO-DHs. Expression of antisense RNA for the cutB or cutA gene in T. carboxydivorans led to a decrease in CO-DH activity, confirming that cutBCA genes are the functional genes encoding CO-DH. The CO-DH operon was expressed even in the absence of CO and further inducible by CO. In addition, CO-DH synthesis was increased in the stationary phase compared to the exponential phase during heterotrophic growth on glucose and glycerol. Point mutations of a partially inverted repeat sequence (TCGGA-N6-GCCCA) in the upstream region of the cutB gene almost abolished expression of the CO-DH operon, indicating that the inverted-repeat sequence might be a cis-acting regulatory site for the positive regulation of the CO-DH operon. Copyright © 2017 Institut Pasteur. Published by Elsevier Masson SAS. All rights reserved.

  8. Diversity of plasmids encoding histidine decarboxylase gene in Tetragenococcus spp. isolated from Japanese fish sauce. (United States)

    Satomi, Masataka; Furushita, Manabu; Oikawa, Hiroshi; Yano, Yutaka


    Nineteen isolates of histamine producing halophilic bacteria were isolated from four fish sauce mashes, each mash accumulating over 1000 ppm of histamine. The complete sequences of the plasmids encoding the pyruvoyl dependent histidine decarboxylase gene (hdcA), which is harbored in histamine producing bacteria, were determined. In conjunction, the sequence regions adjacent to hdcA were analyzed to provide information regarding its genetic origin. As reference strains, Tetragenococcus halophilus H and T. muriaticus JCM10006(T) were also studied. Phenotypic and 16S rRNA gene sequence analyses identified all isolates as T. halophilus, a predominant histamine producing bacteria present during fish sauce fermentation. Genetic analyses (PCR, Southern blot, and complete plasmid sequencing) of the histamine producing isolates confirmed that all the isolates harbored approximately 21-37 kbp plasmids encoding a single copy of the hdc cluster consisting of four genes related to histamine production. Analysis of hdc clusters, including spacer regions, indicated >99% sequence similarity among the isolates. All of the plasmids sequenced encoded traA, however genes related to plasmid conjugation, namely mob genes and oriT, were not identified. Two putative mobile genetic elements, ISLP1-like and IS200-like, respectively, were identified in the up- and downstream region of the hdc cluster of all plasmids. Most of the sequences, except hdc cluster and two adjacent IS elements, were diverse among plasmids, suggesting that each histamine producers harbored a different histamine-related plasmid. These results suggested that the hdc cluster was not spread by clonal dissemination depending on the specific plasmid and that the hdc cluster in tetragenococcal plasmid was likely encoded on transformable elements. Copyright © 2011 Elsevier B.V. All rights reserved.

  9. Sequence and regulation of a gene encoding a human 89-kilodalton heat shock protein

    Energy Technology Data Exchange (ETDEWEB)

    Hickey, E.; Brandon, S.E.; Weber, L.A.; Lloyd, D.


    Vertebrate cells synthesize two forms of the 82- to 90-kilodalton heat shock protein that are encoded by distinct gene families. In HeLa cells, both proteins (hsp89/alpha/ and hspio/beta/) are abundant under normal growth conditions and are synthesized at increased rates in response to heat stress. Only the larger form, hsp89/alpha/, is induced by the adenovirus E1A gene product. The authors have isolated a human hsp89/alpha/ gene that shows complete sequence identity with heat- and E1A-inducible cDNA used as a hybridization probe. The 5'-flanking region contained overlapping and inverted consensus heat shock control elements that can confer heat-inducible expression n a /beta/-globin reporter gene. The gene contained 10 intervening sequences. The first intron was located adjacent to the translation start codon, an arrangement also found in the Drosophila hsp82 gene. The spliced mRNA sequence contained a single open reading frame encoding an 84,564-dalton polypeptide showing high homology with the hsp82 to hsp90 proteins of other organisms. The deduced hsp89/alpha/ protein sequence differed from the human hsp89/beta/ sequence reported elsewhere in at least 99 out of the 732 amino acids. Transcription of the hsp89/alpha/ gene was induced by serum during normal cell growth, but expression did not appear to be restricted to a particular stage of the cell cycles. hsp89/alpha/ mRNA was considerably more stable than the mRNA encoding hsp70, which can account for the higher constitutive rate of hsp89 synthesis in unstressed cells.

  10. [The SNPs analysis of encoding sequence of interacting factor gene in Chinese population]. (United States)

    Li, Jiang; Zhang, Qing-jiong; Xiao, Xue-shan; Li, Jia-zhang; Zhang, Feng-sheng; Li, Shi-qiang; Li, Wei; Li, Tuo; Jia, Xiao-yun; Guo, Li; Guo, Xiang-ming


    To screen the variations of TG interacting factor(TGIF) gene in encoding sequence in Chinese high myopia patients and normal controls and to analyze the SNPs of TGIF gene encoding sequence in Chinese population. Genomic DNA was collected from 204 probands with high myopia and 112 unrelated persons without high myopia. The coding sequences of TGIF gene in 316 subjects were analyzed by using exon-by-exon PCR heteroduplex-SSCP analysis and sequencing. There were 3 types of SNP and one single nucleotide mutation in the coding sequence of TGIF gene: IVS-2 nt350 G --> T(36/204), codon140 CCA --> CCG; Pro140Pro codon163 CCG --> CTG;Pro163Leu and codon126 GTG --> GCG; Val126Ala(1/204). The SNPs of codon140 CCA --> CCG and codon163 CCG --> CTG were composed of 3 alleles and 5 genotypes in Chinese population which abide by Hardy-Weinberg law. There was no evidence to prove that mutations in the TGIF gene are responsible for the high myopia in Chinese. Three SNPs of coding sequence TGIF gene in Chinese population abide by Hardy-Weinberg law.

  11. Chicken genome analysis reveals novel genes encoding biotin-binding proteins related to avidin family

    Directory of Open Access Journals (Sweden)

    Nordlund Henri R


    Full Text Available Abstract Background A chicken egg contains several biotin-binding proteins (BBPs, whose complete DNA and amino acid sequences are not known. In order to identify and characterise these genes and proteins we studied chicken cDNAs and genes available in the NCBI database and chicken genome database using the reported N-terminal amino acid sequences of chicken egg-yolk BBPs as search strings. Results Two separate hits showing significant homology for these N-terminal sequences were discovered. For one of these hits, the chromosomal location in the immediate proximity of the avidin gene family was found. Both of these hits encode proteins having high sequence similarity with avidin suggesting that chicken BBPs are paralogous to avidin family. In particular, almost all residues corresponding to biotin binding in avidin are conserved in these putative BBP proteins. One of the found DNA sequences, however, seems to encode a carboxy-terminal extension not present in avidin. Conclusion We describe here the predicted properties of the putative BBP genes and proteins. Our present observations link BBP genes together with avidin gene family and shed more light on the genetic arrangement and variability of this family. In addition, comparative modelling revealed the potential structural elements important for the functional and structural properties of the putative BBP proteins.

  12. Organization and expression of the Paramecium caudatum gene encoding nucleosome assembly protein 1. (United States)

    Nishiyama, N; Sawatsubashi, S; Ishida, M; Yamauchi, K


    The complete genomic and partial complementary DNAs encoding the ciliate Paramecium caudatum nucleosome assembly protein 1 (NAP1) have been sequenced. The nap1 gene is situated 1.2 kbp from the hemoglobin (hb) gene, with the 3' end of both genes facing each other. The nap1 gene contains no introns, and encodes a protein of 369 amino acid residues with a calculated molecular weight of 42,627. The P. caudatum NAP1 amino acid sequence shares only 23-27% identity with NAP1 amino acid sequences from other eukaryotes. Although the nap1 transcript was detected in the P. caudatum cells at both the logarithmic and stationary phases, its level increased during the stationary phase. Southern blot analysis and polymerase chain reaction amplification revealed that the P. caudatum macronucleus has a heterogeneous composition at genomic regions around the nap1 gene. The present studies indicate the nap1 and hb genes are closely arranged in the macronucleus with the intergenic region between their sequences heterogeneously composed.

  13. A multiplex PCR for detection of genes encoding exfoliative toxins from Staphylococcus hyicus

    DEFF Research Database (Denmark)

    Andresen, Lars Ole; Ahrens, Peter


    Aims: To develop a multiplex PCR for detection of genes encoding the exfoliative toxins ExhA, ExhB, ExhC and ExhD from Staphylococcus hyicus and to estimate the prevalence of exfoliative toxins among Staph. hyicus isolates from Danish pig herds with exudative epidermitis (EE). Methods and Results......: A multiplex PCR employing specific primers for each of the genes encoding four different exfoliative toxins was developed and evaluated using a collection of Staph. hyicus with known toxin type and a number of other staphylococcal species. A total of 314 Staph. hyicus isolates from pigs with EE were screened...... by multiplex PCR and the combined results of the present and previous investigations showed that ExhA, ExhB, ExhC and ExhD was found in 20, 33, 18 and 22%, respectively, of 60 cases of EE investigated. Conclusions: This study has provided a new tool for detection of toxigenic Staph. hyicus and a more...

  14. The promoter of the glucoamylase-encoding gene of Aspergillus niger functions in Ustilago maydis

    Energy Technology Data Exchange (ETDEWEB)

    Smith, T.L. (Dept. of Agriculture, Madison, WI (United States) Univ. of Wisconsin, Madison (United States)); Gaskell, J.; Cullen, D. (Dept. of Agriculture, Madison, WI (United States)); Berka, R.M.; Yang, M.; Henner, D.J. (Genentech Inc., San Francisco, CA (United States))


    Promoter sequences from the Aspergillus niger glucoamylase-encoding gene (glaA) were linked to the bacterial hygromycin (Hy) phosphotransferase-encoding gene (hph) and this chimeric marker was used to select Hy-resistant (Hy[sup R]) Ustilago maydis transformants. This is an example of an Ascomycete promoter functioning in a Basidiomycete. Hy[sup R] transformants varied with respect to copy number of integrated vector, mitotic stability, and tolerance to Hy. Only 216 bp of glaA promoter sequence is required for expression in U. maydis but this promoter is not induced by starch as it is in Aspergillus spp. The transcription start points are the same in U. maydis and A. niger.

  15. Molecular evolution and expression profile of the chemerine encoding gene RARRES2 in baboon and chimpanzee


    González Alvarez, Rafael; Garza Rodríguez, María; DELGADO ENCISO, IVÁN; Treviño Alvarado, Víctor M.; Canales del Castillo, Ricardo.; Martínez De Villarreal, Laura E.; Lugo Trampe, Ángel; Tejero, María E.; Schlabritz Loutsevitch, Natalia E.; Rocha Pizaña, María; Cole, Shelley A.; Reséndez Pérez, Diana; Moises Alvarez, Mario; Comuzzie, Anthony G.; Barrera Saldaña, Hugo A.


    Abstract Background Chemerin, encoded by the retinoic acid receptor responder 2 (RARRES2) gene is an adipocytesecreted protein with autocrine/paracrine functions in adipose tissue, metabolism and inflammation with a recently described function in vascular tone regulation, liver, steatosis, etc. This molecule is believed to represent a critical endocrine signal linking obesity to diabetes. There are no data available regarding evolution of RARRES2 in non-human primates and great apes. Expressi...

  16. Enterotoxin-Encoding Genes in Staphylococcus spp. from Food Handlers in a University Restaurant. (United States)

    da Silva, Sabina Dos Santos Paulino; Cidral, Thiago André; Soares, Maria José dos Santos; de Melo, Maria Celeste Nunes


    Food handlers carrying enterotoxin-producing Staphylococcus are a potential source of food poisoning. The aim of this study was to analyze genes encoding enterotoxins in coagulase-positive Staphylococcus (CoPS) and coagulase-negative Staphylococcus (CoNS) isolated from the anterior nostrils and hands of food handlers at a university restaurant in the city of Natal, Northeast Brazil. Thirty food handlers were screened for the study. The isolates were subjected to Gram staining, a bacitracin sensitivity test, mannitol fermentation, and catalase and coagulase tests. CoNS and CoPS strains were subsequently identified by a Vitek 2 System (BioMerieux, France) and various biochemical tests. Polymerase chain reaction was used to detect genes for enterotoxins A, B, C, D, E, G, H, and I (sea, seb, sec, sed, see, seg, seh, and sei) and a disc-diffusion method was used to determine susceptibility to several classes of antimicrobials. All food handlers presented staphylococci on their hands and/or noses. The study found 58 Staphylococcus spp., of which 20.7% were CoPS and 79.3% were CoNS. S. epidermidis was the most prevalent species. Twenty-nine staphylococci (50%) were positive for one or more enterotoxin genes, and the most prevalent genes were seg and sei, each with a frequency of 29.3%. Indeed, CoNS encoded a high percentage of enterotoxin genes (43.5%). However, S. aureus encoded even more enterotoxin genes (75%). Most isolates showed sensitivity to the antibiotics used for testing, except for penicillin (only 35% sensitive). The results from this study reinforce that coagulase-negative as well as coagulase-positive staphylococci isolated from food handlers are capable of genotypic enterotoxigenicity.

  17. Isolation of Clostridium difficile and Detection of A and B Toxins Encoding Genes

    Directory of Open Access Journals (Sweden)

    Abbas Ali Imani Fooladi


    Full Text Available Background: Clostridium difficile is the most important anaerobic, gram positive, spore forming bacillus which is known as a prevalent factor leading to antibiotic associated diarrheas and is the causative agent of pseudomembrane colitis. The role of this bacterium along with the over use of antibiotics have been proved to result in colitis. The major virulence factors of these bacteria are the A and B toxins. Objectives: The purpose of this study was to isolate C. difficile from stool samples and detect A and B toxins encoding genes, in order toserve as a routine method for clinical diagnosis. Materials and Methods: Recognition of A and B toxins encoding genes by uniplex and multiplex PCR using two pairs of primers from 136 accumulated stool samples. Results: Results of the present study showed that out of 136 stool samples, three C. difficile were isolated and these strains contained A and B toxins encoding genes. Conclusions: It was concluded that although detection of C. difficile from stool samples based on PCR (polymerase chain reaction is expensive, yet this method is more sensitive and less time-consuming than culture methods and can be used as a clinical laboratory test.

  18. Characteristic analysis of the ampC gene encoding beta-lactamase from Photobacterium phosphoreum. (United States)

    Lin, Juey-Wen; Weng, Shu-Fen; Chao, Yuh-Fen; Chung, Yi-Ting


    The ampC gene of Photobacterium phosphoreum ATCC 11040 was cloned and identified. Nucleotide sequence of the regulatory region R&R and the ampC gene (GenBank Accession No. AY787792) from P. phosphoreum has been determined, and the encoded beta-lactamase is deduced. The beta-lactamase encoded by the ampC gene has a calculated M(r) 31,198 and comprises 285 amino acid residues (pI 7.35). There is a signal peptide of 20 amino acid residues MKLRFIASTLLLSFSQLASA to lead the beta-lactamase secretion, and the cleavage site is between ASA-Q; thus, the matured protein only has M(r) 29,019 and comprises 265 amino acid residues (pI 6.21). The specific amino acid residues STFK (65th to 68th), SDN (125th to 127th), and D (158th) located 33 residues downstream from the SDN loop of the class A beta-lactamases are highly conserved, but the KTG is not found. The gene order of the ampC is , the genes running in the opposite directions. Functional analysis elicits that R&R([ampC]) does function to lead to the gene expression. Primer extension assay elicits that the ampC gene's transcriptional initiation +1 is -26 C upstream of the start codon; the P([I])-promoter should be the promoter response for the gene expression. Analysis of the R&R([ampC]) elicits that the upstream activator binding sequence Sigma UAS TGTTTAAATACGCTTTGAACA is like the two-component regulator binding sequence TGT-N(8-12)-ACA. It implies that P. phosphoreum ampC gene could be under-regulated by the specific two-component regulator.

  19. TMpcp: a Tuber magnatum gene which encodes a putative mitochondrial phosphate carrier. (United States)

    Garnero, L; Bonfante, P


    Little is known about the genome of Tuber, Ascomycetes which comprise a number of ectomycorrhizal species. Screening of a genomic library of Tuber magnatum led to identification of a chitin synthase gene (chs). On sequencing upstream of it in the same phage, we found a 2000 bp long fragment that proved to contain a hypothetical gene with high homology with mitochondrial phosphate carriers from human and bovine heart, and from Saccharomyces cerevisiae. The sequence contains two putative introns and its open reading frame encodes for a protein 305 amino acids long. A primary sequence analysis revealed 6 hydrophobic segments and a signature pattern, similar to that of other mitochondrial carriers.

  20. PRS1 is a key member of the gene family encoding phosphoribosylpyrophosphate synthetase in Saccharomyces cerevisiae

    DEFF Research Database (Denmark)

    Carter, Andrew T.; Beiche, Flora; Hove-Jensen, Bjarne


    In Saccharomyces cerevisiae the metabolite phosphoribosyl-pyrophosphate (PRPP) is required for purine, pyrimidine, tryptophan and histidine biosynthesis. Enzymes that can synthesize PRPP can be encoded by at least four genes. We have studied 5-phospho-ribosyl-1(α)-pyrophosphate synthetases (PRS......) genetically and biochemically. Each of the four genes, all of which are transcribed, has been disrupted in haploid yeast strains of each mating type and although all disruptants are able to grow on complete medium, differences in growth rate and enzyme activity suggest that disruption of PRS1 or PRS3 has...

  1. fosI Is a New Integron-Associated Gene Cassette Encoding Reduced Susceptibility to Fosfomycin. (United States)

    Pelegrino, Karla de Oliveira; Campos, Juliana Coutinho; Sampaio, Suely Carlos Ferreira; Lezirovitz, Karina; Seco, Bruna Mara; Pereira, Mayne de Oliveira; Rocha, Darlan Augusto da Costa; Jové, Thomas; Nicodemo, Antonio Carlos; Sampaio, Jorge Luiz Mello


    In this work, we demonstrate that the fosI gene encodes a predicted small protein with 134 amino acids and determines reduced susceptibility to fosfomycin. It raised the MIC from 0.125 to 6 μg/ml when the pBRA100 plasmid was introduced into Escherichia coli TOP10 and to 16 μg/ml when the gene was cloned into the pBC_SK(-) vector and expressed in E. coli TOP10. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  2. Molecular characterization of genes encoding leucoanthocyanidin reductase involved in proanthocyanidin biosynthesis in apple

    Directory of Open Access Journals (Sweden)

    Yuepeng eHan


    Full Text Available Proanthocyanidins (PAs are the major component of phenolics in apple, but mechanisms involved in PA biosynthesis remain unclear. Here, the relationship between the PA biosynthesis and the expression of genes encoding leucoanthocyanidin reductase (LAR and anthocyanidin reductase (ANR was investigated in fruit skin of one apple cultivar and three crabapples. Transcript levels of LAR1 and ANR2 genes were significantly correlated with the contents of catechin and epicatechin, respectively, which suggests their active roles in PA synthesis. Surprisingly, transcript levels for both LAR1 and LAR2 genes were almost undetectable in two crabapples that accumulated both flavan-3-ols and PAs. This contradicts the previous finding that LAR1 gene is a strong candidate regulating the accumulation of metabolites such as epicatechin and PAs in apple. Ectopic expression of apple MdLAR1 gene in tobacco suppresses expression of the late genes in anthocyanin biosynthetic pathway, resulting in loss of anthocyanin in flowers. Interestingly, a decrease in PA biosynthesis was also observed in flowers of transgenic tobacco plants overexpressing the MdLAR1 gene, which could be attributed to decreased expression of both the NtANR1 and NtANR2 genes. Our study not only confirms the in vivo function of apple LAR1 gene, but it is also helpful for understanding the mechanism of PA biosynthesis.

  3. Two homologous low-temperature-inducible genes from Arabidopsis encode highly hydrophobic proteins. (United States)

    Capel, J; Jarillo, J A; Salinas, J; Martínez-Zapater, J M


    We have characterized two related cDNAs (RCI2A and RCI2B) corresponding to genes from Arabidopsis thaliana, the expression of which is transiently induced by low, nonfreezing temperatures. RCI2A and RCI2B encode small (54 amino acids), highly hydrophobic proteins that bear two potential transmembrane domains. They show similarity to proteins encoded by genes from barley (Hordeum vulgare L.) and wheatgrass (Lophophyrum elongatum) that are regulated by different stress conditions. Their high level of sequence homology (78%) and their genomic location in a single restriction fragment suggest that both genes originated as a result of a tandem duplication. However, their regulatory sequences have diverged enough to confer on them different expression patterns. Like most of the cold-inducible plant genes characterized, the expression of RCI2A and RCI2B is also promoted by abscisic acid (ABA) and dehydration but is not a general response to stress conditions, since it is not induced by salt stress or by anaerobiosis. Furthermore, low temperatures are able to induce RCI2A and RCI2B expression in ABA-deficient and -insensitive genetic backgrounds, indicating that both ABA-dependent and -independent pathways regulate the low-temperature responsiveness of these two genes.

  4. A single Danio rerio hars gene encodes both cytoplasmic and mitochondrial histidyl-tRNA synthetases.

    Directory of Open Access Journals (Sweden)

    Ashley L Waldron

    Full Text Available Histidyl tRNA Synthetase (HARS is a member of the aminoacyl tRNA synthetase (ARS family of enzymes. This family of 20 enzymes is responsible for attaching specific amino acids to their cognate tRNA molecules, a critical step in protein synthesis. However, recent work highlighting a growing number of associations between ARS genes and diverse human diseases raises the possibility of new and unexpected functions in this ancient enzyme family. For example, mutations in HARS have been linked to two different neurological disorders, Usher Syndrome Type IIIB and Charcot Marie Tooth peripheral neuropathy. These connections raise the possibility of previously undiscovered roles for HARS in metazoan development, with alterations in these functions leading to complex diseases. In an attempt to establish Danio rerio as a model for studying HARS functions in human disease, we characterized the Danio rerio hars gene and compared it to that of human HARS. Using a combination of bioinformatics, molecular biology, and cellular approaches, we found that while the human genome encodes separate genes for cytoplasmic and mitochondrial HARS protein, the Danio rerio genome encodes a single hars gene which undergoes alternative splicing to produce the respective cytoplasmic and mitochondrial versions of Hars. Nevertheless, while the HARS genes of humans and Danio differ significantly at the genomic level, we found that they are still highly conserved at the amino acid level, underscoring the potential utility of Danio rerio as a model organism for investigating HARS function and its link to human diseases in vivo.

  5. Comparative analysis of resistance gene analogues encoding NBS-LRR domains in cotton. (United States)

    Khan, Abdul Manan; Khan, Asif Ali; Azhar, Muhammad Tehseen; Amrao, Luqman; Cheema, Hafiza Masooma Naseer


    Plant production is severely affected by biotic and abiotic stresses R-genes exhibit resistance against a range of diseases and pathogens in plants. The nucleotide binding site and leucine rich repeat (NBS-LRR) class of R-genes is the most comprehensively studied in terms of sequence evolution and genome distribution. The differential response for resistance against biotic and abiotic stress has been observed in cultivated and wild relatives of the genus Gossypium. Efforts have been made to address the recent evolution of NBS-LRR sequences within Gossypium hirsutum and resistance gene analogue (RGA) sequences derived from G. arboreum and G. raimondii. The % identity and phylogenetic analysis of NBS-LRR-encoded RGAs from tetraploid New World cotton and its diploid ancestors G. raimondii and G. arboreum suggest that the evolution of NBS-LRR-encoding sequences in G. hirsutum occurred by gradual accumulation of mutants that led to positive selection and a slow rate of divergence within distinct R-gene families. The allotetraploid genome of cotton, after separating from its diploid parents, experienced polyploidisation, natural and artificial selection, hybrid necrosis, duplication and recombination which became the reason to shed off and evolve new genes for its survival. These driving forces influenced the development of genomic architecture that make it susceptible to diseases and pathogens as compared to donor parents. © 2015 Society of Chemical Industry.

  6. Production of cyanophycin in Rhizopus oryzae through the expression of a cyanophycin synthetase encoding gene. (United States)

    Meussen, Bas J; Weusthuis, Ruud A; Sanders, Johan P M; Graaff, Leo H de


    Cyanophycin or cyanophycin granule peptide is a protein that results from non-ribosomal protein synthesis in microorganisms such as cyanobacteria. The amino acids in cyanophycin can be used as a feedstock in the production of a wide range of chemicals such as acrylonitrile, polyacrylic acid, 1,4-butanediamine, and urea. In this study, an auxotrophic mutant (Rhizopus oryzae M16) of the filamentous fungus R. oryzae 99-880 was selected to express cyanophycin synthetase encoding genes. These genes originated from Synechocystis sp. strain PCC6803, Anabaena sp. strain PCC7120, and a codon optimized version of latter gene. The genes were under control of the pyruvate decarboxylase promoter and terminator elements of R. oryzae. Transformants were generated by the biolistic transformation method. In only two transformants both expressing the cyanophycin synthetase encoding gene from Synechocystis sp. strain PCC6803 was a specific enzyme activity detected of 1.5 mU/mg protein. In one of these transformants was both water-soluble and insoluble cyanophycin detected. The water-soluble fraction formed the major fraction and accounted for 0.5% of the dry weight. The water-insoluble CGP was produced in trace amounts. The amino acid composition of the water-soluble form was determined and constitutes of equimolar amounts of arginine and aspartic acid.

  7. A putative gene cluster from a Lyngbya wollei bloom that encodes paralytic shellfish toxin biosynthesis.

    Directory of Open Access Journals (Sweden)

    Troco K Mihali

    Full Text Available Saxitoxin and its analogs cause the paralytic shellfish-poisoning syndrome, adversely affecting human health and coastal shellfish industries worldwide. Here we report the isolation, sequencing, annotation, and predicted pathway of the saxitoxin biosynthetic gene cluster in the cyanobacterium Lyngbya wollei. The gene cluster spans 36 kb and encodes enzymes for the biosynthesis and export of the toxins. The Lyngbya wollei saxitoxin gene cluster differs from previously identified saxitoxin clusters as it contains genes that are unique to this cluster, whereby the carbamoyltransferase is truncated and replaced by an acyltransferase, explaining the unique toxin profile presented by Lyngbya wollei. These findings will enable the creation of toxin probes, for water monitoring purposes, as well as proof-of-concept for the combinatorial biosynthesis of these natural occurring alkaloids for the production of novel, biologically active compounds.

  8. The Schizosaccharomyces pombe mam1 gene encodes an ABC transporter mediating secretion of M-factor

    DEFF Research Database (Denmark)

    Christensen, P U; Davey, William John; Nielsen, O


    In the fission yeast Schizosaccharomyces pombe, cells of opposite mating type communicate via diffusible peptide pheromones prior to mating. We have cloned the S. pombe mam1 gene, which encodes a 1336-amino acid protein belonging to the ATP-binding cassette (ABC) superfamily. The mam1 gene is only...... expressed in M cells and the gene product is responsible for the secretion of the mating pheromone. M-factor, a nonapeptide that is S-farnesylated and carboxy-methylated on its C-terminal cysteine residue. The predicted Mam1 protein is highly homologous to mammalian multiple drug-resistance proteins...... and to the Saccharomyces cerevisiae STE6 gene product, which mediates export of a-factor mating pheromone. We show that STE6 can also mediate secretion of M-factor in S. pombe....

  9. Transcription Factors Encoded on Core and Accessory Chromosomes of Fusarium oxysporum Induce Expression of Effector Genes.

    Directory of Open Access Journals (Sweden)

    H Charlotte van der Does


    Full Text Available Proteins secreted by pathogens during host colonization largely determine the outcome of pathogen-host interactions and are commonly called 'effectors'. In fungal plant pathogens, coordinated transcriptional up-regulation of effector genes is a key feature of pathogenesis and effectors are often encoded in genomic regions with distinct repeat content, histone code and rate of evolution. In the tomato pathogen Fusarium oxysporum f. sp. lycopersici (Fol, effector genes reside on one of four accessory chromosomes, known as the 'pathogenicity' chromosome, which can be exchanged between strains through horizontal transfer. The three other accessory chromosomes in the Fol reference strain may also be important for virulence towards tomato. Expression of effector genes in Fol is highly up-regulated upon infection and requires Sge1, a transcription factor encoded on the core genome. Interestingly, the pathogenicity chromosome itself contains 13 predicted transcription factor genes and for all except one, there is a homolog on the core genome. We determined DNA binding specificity for nine transcription factors using oligonucleotide arrays. The binding sites for homologous transcription factors were highly similar, suggesting that extensive neofunctionalization of DNA binding specificity has not occurred. Several DNA binding sites are enriched on accessory chromosomes, and expression of FTF1, its core homolog FTF2 and SGE1 from a constitutive promoter can induce expression of effector genes. The DNA binding sites of only these three transcription factors are enriched among genes up-regulated during infection. We further show that Ftf1, Ftf2 and Sge1 can activate transcription from their binding sites in yeast. RNAseq analysis revealed that in strains with constitutive expression of FTF1, FTF2 or SGE1, expression of a similar set of plant-responsive genes on the pathogenicity chromosome is induced, including most effector genes. We conclude that the Fol

  10. Cloning and sequencing of the gene encoding LipL21 in the vaccinal leptospira serovars

    Directory of Open Access Journals (Sweden)

    Rasoul Hoseinpur


    Full Text Available Background: Leptospirosis is a zoonotic disease in humans and animals, caused by the bacterium Leptospira interrogans. Gene expressing LipL21 is one of the genes identified in the bacterium, existing only in the pathogenic strains. The aim of this study was to cloning and analyzing the sequence of the gene encoding surface lipoprotein, LipL21, in five vaccinal leptospira serovars in Iran. Material and Methods: Pathogenic Leptospira interrogans serovars were cultured in EMJH medium with 10% rabbit serum. After genomic DNA extraction, PCR with specific primers was employed and the resulting product inserted in a vector then transferred into E. Coli DH5&alpha. The recombinant plasmids were finally sent for sequencing. Results: The analysis of gene lipL21 in domestic vaccinal serovars and comparison of them with other serovars in the GenBank database revealed that three vaccinal serovars serjo hardjo, canicola and pomona had 100% similarity with each other and grippotyphosa serovar had the highest difference with the vaccinal serovars. In general, the results showed that this gene is a highly conserved gene in the domestic vaccinal serovars and serovars in the GenBank database with more than 95.7 percent similarity. Conclusion: These results showed that the gene, lipL21, is highly conserved in the vaccinal serovars (similarities > 96.4 %. Therefore, the gene encoding surface protein LipL21 can serve as a useful serologic test with high specificity and sensitivity for diagnosis of leptospirosis in clinical samples and in future as an effective subunit vaccine candidate to be used.

  11. Transcription Factors Encoded on Core and Accessory Chromosomes of Fusarium oxysporum Induce Expression of Effector Genes. (United States)

    van der Does, H Charlotte; Fokkens, Like; Yang, Ally; Schmidt, Sarah M; Langereis, Léon; Lukasiewicz, Joanna M; Hughes, Timothy R; Rep, Martijn


    Proteins secreted by pathogens during host colonization largely determine the outcome of pathogen-host interactions and are commonly called 'effectors'. In fungal plant pathogens, coordinated transcriptional up-regulation of effector genes is a key feature of pathogenesis and effectors are often encoded in genomic regions with distinct repeat content, histone code and rate of evolution. In the tomato pathogen Fusarium oxysporum f. sp. lycopersici (Fol), effector genes reside on one of four accessory chromosomes, known as the 'pathogenicity' chromosome, which can be exchanged between strains through horizontal transfer. The three other accessory chromosomes in the Fol reference strain may also be important for virulence towards tomato. Expression of effector genes in Fol is highly up-regulated upon infection and requires Sge1, a transcription factor encoded on the core genome. Interestingly, the pathogenicity chromosome itself contains 13 predicted transcription factor genes and for all except one, there is a homolog on the core genome. We determined DNA binding specificity for nine transcription factors using oligonucleotide arrays. The binding sites for homologous transcription factors were highly similar, suggesting that extensive neofunctionalization of DNA binding specificity has not occurred. Several DNA binding sites are enriched on accessory chromosomes, and expression of FTF1, its core homolog FTF2 and SGE1 from a constitutive promoter can induce expression of effector genes. The DNA binding sites of only these three transcription factors are enriched among genes up-regulated during infection. We further show that Ftf1, Ftf2 and Sge1 can activate transcription from their binding sites in yeast. RNAseq analysis revealed that in strains with constitutive expression of FTF1, FTF2 or SGE1, expression of a similar set of plant-responsive genes on the pathogenicity chromosome is induced, including most effector genes. We conclude that the Fol pathogenicity

  12. Identification and differential expression dynamics of peach small GTPases encoding genes during fruit development and ripening (United States)

    Falchi, Rachele; Cipriani, Guido; Marrazzo, Teresa; Nonis, Alberto; Vizzotto, Giannina; Ruperti, Benedetto


    The function of monomeric GTPases of the RAS superfamily in fruit development and ripening has been partially characterized. Here the identification of peach (Prunus persica) small GTPases of the RAS superfamily expressed in fruit and the characterization of their expression profiles during fruit development are described. Extensive searches on expressed sequence tag (EST) databases led to the selection of a total of 24 genes from peach encoding proteins with significant similarity to Arabidopsis small GTPases. Sequence similarity analyses and identification of conserved motifs, diagnostic of specific RAS families and subfamilies, enabled bona fide assignment of fourteen PpRAB, seven PpARF/ARL/SAR, two PpROP and one PpRAN GTPases. Transcriptional expression profiles of peach monomeric GTPases, analysed by real-time quantitative reverse transcription-PCR, were obtained for mesocarp samples, collected in two consecutive years. Reproducible patterns of expression could be identified for five peach RAB-encoding genes (PpRABA1-1, PpRABA2, PpRABD2-1, PpRABD2-2, and PpRABC2), two ARFs (PpARFA1-1 and PpARLB1), and two ROPs (PpROP3 and PpROP4). Interestingly, the transient transcriptional up-regulation of PpARF genes and of PpRAB genes of the A and D clades, putatively controlling the exocytic delivery of cell wall components and modifying enzymes, appeared to coincide with peaks of growth speed and sugar accumulation and with the final phases of ripening. To our knowledge, this is the first description of the co-ordinated differential expression of a set of genes encoding small GTPases of the ARF and RAB families which takes place during key moments of fruit development and maturation. PMID:20501747

  13. Mutagenesis in sequence encoding of human factor VII for gene therapy of hemophilia

    Directory of Open Access Journals (Sweden)

    B Kazemi


    Full Text Available "nBackground: Current treatment of hemophilia which is one of the most common bleeding disorders, involves replacement therapy using concentrates of FVIII and FIX .However, these concentrates have been associated with viral infections and thromboembolic complications and development of antibodies. "nThe use of recombinant human factor VII (rhFVII is effective  for the treatment of patients with  hemophilia A or B, who develop antibodies ( referred as inhibitors against  replacement therapy , because it induces coagulation independent of FVIII and FIX. However, its short half-life and high cost have limited its use. One potential solution to this problem may be the use of FVIIa gene transfer, which would attain continuing therapeutic levels of expression from a single injection. The aim of this study was to engineer a novel hFVII (human FVII gene containing a cleavage site for the intracellular protease and furin, by PCR mutagenesis "nMethods: The sequence encoding light and heavy chains of hFVII, were amplified by using hFVII/pTZ57R and specific primers, separately. The PCR products were cloned in pTZ57R vector. "nResults and discussion: Cloning was confirmed by restriction analysis or PCR amplification using specific primers and plasmid universal primers. Mutagenesis of sequence encoding light and heavy chain was confirmed by restriction enzyme. "nConclusion: In the present study, it was provided recombinant plasmids based on mutant form of DNA encoding light and heavy chains.  Joining mutant form of DNA encoding light chain with mutant heavy chain led to a new variant of hFVII. This variant can be activated by furin and an increase in the proportion of activated form of FVII. This mutant form of hFVII may be used for gene therapy of hemophilia.

  14. Identification and characterization of multiple Spidroin 1 genes encoding major ampullate silk proteins in Nephila clavipes. (United States)

    Gaines, W A; Marcotte, W R


    Spider dragline silk is primarily composed of proteins called major ampullate spidroins (MaSps) that consist of a large repeat array flanked by nonrepetitive N- and C-terminal domains. Until recently, there has been little evidence for more than one gene encoding each of the two major spidroin silk proteins, MaSp1 and MaSp2. Here, we report the deduced N-terminal domain sequences for two distinct MaSp1 genes from Nephila clavipes (MaSp1A and MaSp1B) and for MaSp2. All three MaSp genes are co-expressed in the major ampullate gland. A search of the GenBank database also revealed two distinct MaSp1 C-terminal domain sequences. Sequencing confirmed that both MaSp1 genes are present in all seven Nephila clavipes spiders examined. The presence of nucleotide polymorphisms in these genes confirmed that MaSp1A and MaSp1B are distinct genetic loci and not merely alleles of the same gene. We experimentally determined the transcription start sites for all three MaSp genes and established preliminary pairing between the two MaSp1 N- and C-terminal domains. Phylogenetic analysis of these new sequences and other published MaSp N- and C-terminal domain sequences illustrated that duplications of MaSp genes may be widespread among spider species.

  15. Expression and characterization of the genes encoding azoreductases from Bacillus subtilis and Geobacillus stearothermophilus. (United States)

    Sugiura, Wataru; Yoda, Tomoko; Matsuba, Takashi; Tanaka, Yoshinori; Suzuki, Yasuhiko


    Azoreductases have been characterized as enzymes that can decolorize azo dyes by reducing azo groups. In this study, genes encoding proteins having homology with the azoreductase gene of Bacillus sp. OY1-2 were obtained from Bacillus subtilis ATCC6633, B. subtilis ISW1214, and Geobacillus stearotherophilus IFO13737 by polymerase chain reaction. All three genes encoded proteins with 174 amino acids. The deduced amino acid sequences of azoreductase homologs from B. subtilis ISW1214, B. subtilis ATCC6633, and G. stearotherophilus IFO13737 showed similarity of 53.3, 53.9, and 53.3% respectively to that of Bacillus sp. OY1-2. All three genes were expressed in Escherichia coli, and were characterized as having the decolorizing activity of azo dyes in a beta-NADPH dependent manner. The transformation of several azo dyes into colorless compounds by recombinant enzymes was demonstrated to have distinct substrate specificity from that of azoreductase from Bacillus sp. OY1-2.

  16. A universal method for the identification of genes encoding amatoxins and phallotoxins in poisonous mushrooms (United States)

    Wołoszyn, Agata; Kotłowski, Roman

    As the currently known diagnostic DNA targets amplified in the PCR assays for detection of poisonous mushrooms have their counterparts in edible species, there is a need to design PCR primers specific to the genes encoding amanitins and phallotoxins, which occur only in poisonous mushrooms. The aim of the study was testing of PCR-based method for detection of all genes encoding hepatotoxic cyclic peptides - amanitins and phallotoxins present in the most dangerous poisonous mushrooms. Degenerate primers in the PCR were designed on the basis of amanitins (n=13) and phallotoxins (n=5) genes in 18 species of poisonous mushrooms deposited to Genbank of the National Center for Biotechnology Information. The specificity of the PCR assays was confirmed against 9 species of edible mushrooms, death cap - Amanita phalloides and panther cap - Amanita pantherina. Designed two couples of PCR-primers specific to amanitins and phallotoxins genes can be recommended for detection of Amanita phalloides and other mushroom species producing hepatotoxic cyclic peptides - amanitins and phallotoxins.

  17. Large-scale analysis of NBS domain-encoding resistance gene analogs in Triticeae

    Directory of Open Access Journals (Sweden)

    Dhia Bouktila


    Full Text Available Proteins containing nucleotide binding sites (NBS encoded by plant resistance genes play an important role in the response of plants to a wide array of pathogens. In this paper, an in silico search was conducted in order to identify and characterize members of NBS-encoding gene family in the tribe of Triticeae. A final dataset of 199 sequences was obtained by four search methods. Motif analysis confirmed the general structural organization of the NBS domain in cereals, characterized by the presence of the six commonly conserved motifs: P-loop, RNBS-A, Kinase-2, Kinase-3a, RNBS-C and GLPL. We revealed the existence of 11 distinct distribution patterns of these motifs along the NBS domain. Four additional conserved motifs were shown to be significantly present in all 199 sequences. Phylogenetic analyses, based on genetic distance and parsimony, revealed a significant overlap between Triticeae sequences and Coiled coil-Nucleotide binding site-Leucine rich repeat (CNL-type functional genes from monocotyledons. Furthermore, several Triticeae sequences belonged to clades containing functional homologs from non Triticeae species, which has allowed for these sequences to be functionally assigned. The findings reported, in this study, will provide a strong groundwork for the isolation of candidate R-genes in Triticeae crops and the understanding of their evolution.

  18. Chitinase Genes Responsive to Cold Encode Antifreeze Proteins in Winter Cereals1 (United States)

    Yeh, Sansun; Moffatt, Barbara A.; Griffith, Marilyn; Xiong, Fei; Yang, Daniel S.C.; Wiseman, Steven B.; Sarhan, Fathey; Danyluk, Jean; Xue, Yi Qi; Hew, Choy L.; Doherty-Kirby, Amanda; Lajoie, Gilles


    Antifreeze proteins similar to two different chitinases accumulate during cold acclimation in winter rye (Secale cereale). To determine whether these cold-responsive chitinases require post-translational modification to bind to ice, cDNAs coding for two different full-length chitinases were isolated from a cDNA library produced from cold-acclimated winter rye leaves. CHT9 is a 1,193-bp clone that encodes a 31.7-kD class I chitinase and CHT46 is a 998-bp clone that codes for a 24.8-kD class II chitinase. Chitinase-antifreeze proteins purified from the plant were similar in mass to the predicted mature products of CHT9 and CHT46, thus indicating that there was little chemical modification of the amino acid sequences in planta. To confirm these results, the mature sequences of CHT9 and CHT46 were expressed in Escherichia coli and the products of both cDNAs modified the growth of ice. Transcripts of both genes accumulated late in cold acclimation in winter rye. Southern analysis of winter rye genomic DNA indicated the presence of a small gene family homologous to CHT46. In hexaploid wheat, CHT46 homologs mapped to the homeologous group 1 chromosomes and were expressed in response to cold and drought. We conclude that two novel cold-responsive genes encoding chitinases with ice-binding activity may have arisen in winter rye and other cereals through gene duplication. PMID:11080301

  19. Identification and characterization of a gene encoding for a nucleotidase from Phaseolus vulgaris. (United States)

    Cabello-Díaz, Juan Miguel; Gálvez-Valdivieso, Gregorio; Caballo, Cristina; Lambert, Rocío; Quiles, Francisco Antonio; Pineda, Manuel; Piedras, Pedro


    Nucleotidases are phosphatases that catalyze the removal of phosphate from nucleotides, compounds with an important role in plant metabolism. A phosphatase enzyme, with high affinity for nucleotides monophosphate previously identified and purified in embryonic axes from French bean, has been analyzed by MALDI TOF/TOF and two internal peptides have been obtained. The information of these peptide sequences has been used to search in the genome database and only a candidate gene that encodes for the phosphatase was identified (PvNTD1). The putative protein contains the conserved domains (motif I-IV) for haloacid dehalogenase-like hydrolases superfamily. The residues involved in the catalytic activity are also conserved. A recombinant protein overexpressed in Escherichia coli has shown molybdate resistant phosphatase activity with nucleosides monophosphate as substrate, confirming that the identified gene encodes for the phosphatase with high affinity for nucleotides purified in French bean embryonic axes. The activity of the purified protein was inhibited by adenosine. The expression of PvNTD1 gene was induced at the specific moment of radicle protrusion in embryonic axes. The gene was also highly expressed in young leaves whereas the level of expression in mature tissues was minimal. Copyright © 2015 The Authors. Published by Elsevier GmbH.. All rights reserved.

  20. Isolation and Characterization of the Genes Encoding Basic and Acidic Chitinase in Arabidopsis thaliana (United States)

    Samac, Deborah A.; Hironaka, Cathy M.; Yallaly, Peter E.; Shah, Dilip M.


    Plants synthesize a number of antimicrobial proteins in response to pathogen invasion and environmental stresses. These proteins include two classes of chitinases that have either basic or acidic isoelectric points and that are capable of degrading fungal cell wall chitin. We have cloned and determined the nucleotide sequence of the genes encoding the acidic and basic chitinases from Arabidopsis thaliana (L.) Heynh. Columbia wild type. Both chitinases are encoded by single copy genes that contain introns, a novel feature in chitinase genes. The basic chitinase has 73% amino acid sequence similarity to the basic chitinase from tobacco, and the acidic chitinase has 60% amino acid sequence similarity to the acidic chitinase from cucumber. Expression of the basic chitinase is organ-specific and age-dependent in Arabidopsis. A high constitutive level of expression was observed in roots with lower levels in leaves and flowering shoots. Exposure of plants to ethylene induced high levels of systemic expression of basic chitinase with expression increasing with plant age. Constitutive expression of basic chitinase was observed in roots of the ethylene insensitive mutant (etr) of Arabidopsis, demonstrating that root-specific expression is ethylene independent. Expression of the acidic chitinase gene was not observed in normal, untreated Arabidopsis plants or in plants treated with ethylene or salicylate. However, a transient expression assay indicated that the acidic chitinase promoter is active in Arabidopsis leaf tissue. Images Figure 6 Figure 7 PMID:16667600

  1. Characterization and Expression of Genes Encoding Three Small Heat Shock Proteins in Sesamia inferens (Lepidoptera: Noctuidae

    Directory of Open Access Journals (Sweden)

    Meng Sun


    Full Text Available The pink stem borer, Sesamia inferens (Walker, is a major pest of rice and is endemic in China and other parts of Asia. Small heat shock proteins (sHSPs encompass a diverse, widespread class of stress proteins that have not been characterized in S. inferens. In the present study, we isolated and characterized three S. inferens genes that encode members of the α-crystallin/sHSP family, namely, Sihsp21.4, Sihsp20.6, and Sihsp19.6. The three cDNAs encoded proteins of 187, 183 and 174 amino acids with calculated molecular weights of 21.4, 20.6 and 19.6 kDa, respectively. The deduced amino acid sequences of the three genes showed strong similarity to sHSPs identified in other lepidopteran insects. Sihsp21.4 contained an intron, but Sihsp20.6 and Sihsp19.6 lacked introns. Real-time quantitative PCR analyses revealed that Sihsp21.4 was most strongly expressed in S. inferens heads; Whereas expression of Sihsp20.6 and Sihsp19.6 was highest in eggs. The three S. inferens sHSP genes were up-regulated during low temperature stress. In summary, our results show that S. inferens sHSP genes have distinct regulatory roles in the physiology of S. inferens.

  2. Phenotypic interactions of spinster with the genes encoding proteins for cell death control in Drosophila melanogaster. (United States)

    Sakurai, Akira; Nakano, Yoshiro; Koganezawa, Masayuki; Yamamoto, Daisuke


    The spin gene was first identified by its mutant phenotype, which is characterized by extremely strong mate refusal by females in response to male courtship in Drosophila. Spin mutants are also known to be accompanied by a remarkable reduction in programmed cell death in the reproductive and nervous systems. To better understand the molecular functions of spin, we searched for its genetic modifiers. Forced expression of spin(+) in somatic cells as driven by ptc-Gal4 in the testis resulted in the invasion of mature sperm into the anterior testes tip, which is otherwise occupied only by immature germ cells. To obtain genes that modulate spin's effect, the gain-of-function spin phenotype was observed in the presence of a chromosome harboring an EP or GS P-element insertion, which initiates transcription of the genomic sequence neighboring the insertion site. We isolated th and emc as suppressors of spin and atg8a as a gene that reproduces the spin phenotype on its own. th encodes Inhibitor of apoptosis-1, and mammalian Id genes homologous to emc are known to inhibit apoptosis. atg8a encodes a protein essential for autophagy. These results suggest that spin promotes cell death mechanisms that are regulated negatively by th and emc and positively by atg8a. (c) 2010 Wiley Periodicals, Inc.

  3. The Non-Mendelian Green Cotyledon Gene in Soybean Encodes a Small Subunit of Photosystem II. (United States)

    Kohzuma, Kaori; Sato, Yutaka; Ito, Hisashi; Okuzaki, Ayako; Watanabe, Mai; Kobayashi, Hideki; Nakano, Michiharu; Yamatani, Hiroshi; Masuda, Yu; Nagashima, Yumi; Fukuoka, Hiroyuki; Yamada, Tetsuya; Kanazawa, Akira; Kitamura, Keisuke; Tabei, Yutaka; Ikeuchi, Masahiko; Sakamoto, Wataru; Tanaka, Ayumi; Kusaba, Makoto


    Chlorophyll degradation plays important roles in leaf senescence including regulation of degradation of chlorophyll-binding proteins. Although most genes encoding enzymes of the chlorophyll degradation pathway have been identified, the regulation of their activity has not been fully understood. Green cotyledon mutants in legume are stay-green mutants, in which chlorophyll degradation is impaired during leaf senescence and seed maturation. Among them, the soybean (Glycine max) green cotyledon gene cytG is unique because it is maternally inherited. To isolate cytG, we extensively sequenced the soybean chloroplast genome, and detected a 5-bp insertion causing a frame-shift in psbM, which encodes one of the small subunits of photosystem II. Mutant tobacco plants (Nicotiana tabacum) with a disrupted psbM generated using a chloroplast transformation technique had green senescent leaves, confirming that cytG encodes PsbM. The phenotype of cytG was very similar to that of mutant of chlorophyll b reductase catalyzing the first step of chlorophyll b degradation. In fact, chlorophyll b-degrading activity in dark-grown cytG and psbM-knockout seedlings was significantly lower than that of wild-type plants. Our results suggest that PsbM is a unique protein linking photosynthesis in presenescent leaves with chlorophyll degradation during leaf senescence and seed maturation. Additionally, we discuss the origin of cytG, which may have been selected during domestication of soybean. © 2017 American Society of Plant Biologists. All Rights Reserved.

  4. Detailed analysis of putative genes encoding small proteins in legume genomes

    Directory of Open Access Journals (Sweden)

    Gabriel eGuillén


    Full Text Available Diverse plant genome sequencing projects coupled with powerful bioinformatics tools have facilitated massive data analysis to construct specialized databases classified according to cellular function. However, there are still a considerable number of genes encoding proteins whose function has not yet been characterized. Included in this category are small proteins (SPs, 30-150 amino acids encoded by short open reading frames (sORFs. SPs play important roles in plant physiology, growth, and development. Unfortunately, protocols focused on the genome-wide identification and characterization of sORFs are scarce or remain poorly implemented. As a result, these genes are underrepresented in many genome annotations. In this work, we exploited publicly available genome sequences of Phaseolus vulgaris, Medicago truncatula, Glycine max and Lotus japonicus to analyze the abundance of annotated SPs in plant legumes. Our strategy to uncover bona fide sORFs at the genome level was centered in bioinformatics analysis of characteristics such as evidence of expression (transcription, presence of known protein regions or domains, and identification of orthologous genes in the genomes explored. We collected 6170, 10461, 30521, and 23599 putative sORFs from P. vulgaris, G. max, M. truncatula, and L. japonicus genomes, respectively. Expressed sequence tags (ESTs available in the DFCI Gene Index database provided evidence that ~one-third of the predicted legume sORFs are expressed. Most potential SPs have a counterpart in a different plant species and counterpart regions or domains in larger proteins. Potential functional sORFs were also classified according to a reduced set of GO categories, and the expression of 13 of them during P. vulgaris nodule ontogeny was confirmed by qPCR. This analysis provides a collection of sORFs that potentially encode for meaningful SPs, and offers the possibility of their further functional evaluation.

  5. Atypical DNA methylation of genes encoding cysteine-rich peptides in Arabidopsis thaliana

    Directory of Open Access Journals (Sweden)

    You Wanhui


    Full Text Available Abstract Background In plants, transposons and non-protein-coding repeats are epigenetically silenced by CG and non-CG methylation. This pattern of methylation is mediated in part by small RNAs and two specialized RNA polymerases, termed Pol IV and Pol V, in a process called RNA-directed DNA methylation. By contrast, many protein-coding genes transcribed by Pol II contain in their gene bodies exclusively CG methylation that is independent of small RNAs and Pol IV/Pol V activities. It is unclear how the different methylation machineries distinguish between transposons and genes. Here we report on a group of atypical genes that display in their coding region a transposon-like methylation pattern, which is associated with gene silencing in sporophytic tissues. Results We performed a methylation-sensitive amplification polymorphism analysis to search for targets of RNA-directed DNA methylation in Arabidopsis thaliana and identified several members of a gene family encoding cysteine-rich peptides (CRPs. In leaves, the CRP genes are silent and their coding regions contain dense, transposon-like methylation in CG, CHG and CHH contexts, which depends partly on the Pol IV/Pol V pathway and small RNAs. Methylation in the coding region is reduced, however, in the synergid cells of the female gametophyte, where the CRP genes are specifically expressed. Further demonstrating that expressed CRP genes lack gene body methylation, a CRP4-GFP fusion gene under the control of the constitutive 35 S promoter remains unmethylated in leaves and is transcribed to produce a translatable mRNA. By contrast, a CRP4-GFP fusion gene under the control of a CRP4 promoter fragment acquires CG and non-CG methylation in the CRP coding region in leaves similar to the silent endogenous CRP4 gene. Conclusions Unlike CG methylation in gene bodies, which does not dramatically affect Pol II transcription, combined CG and non-CG methylation in CRP coding regions is likely to

  6. Characterisation and expression of a gene encoding a mutarotase from the fungus Rhizopus nigricans. (United States)

    Vilfan, Tanja; Cresnar, Bronislava; Fournier, Didier; Stojan, Jure; Breskvar, Katja


    A gene coding for a mutarotase was isolated and characterised from the filamentous fungus Rhizopus nigricans. In order to determine the encoded enzyme's activity a recombinant protein was prepared in the baculovirus expression system and the mutarotase activity was determined. Expression studies showed that the gene is repressed by high as well as low concentrations of glucose and derepressed during deficiency of glucose. Besides the regulation at the level of transcription, an accelerative effect of glucose in growth medium on the mutarotase mRNA decay was also demonstrated. Moreover, a Southern hybridisation performed at lower temperatures suggested that the R. nigricans genome harbours a nucleotide sequence, that is homologous to the isolated gene.

  7. Cloning of the genes encoding two murine and human cochlear unconventional type I myosins

    Energy Technology Data Exchange (ETDEWEB)

    Crozet, F.; El Amraoui, Z.; Blanchard, S. [Institut Pasteur, Paris (France)] [and others


    Several lines of evidence indicate a crucial role for unconventional myosins in the function of the sensory hair cells of the inner ear. We report here the characterization of the cDNAs encoding two unconventional type I myosins from a mouse cochlear cDNA library. The first cDNA encodes a putative protein named Myo1c, which is likely to be the murine orthologue of the bullfrog myosin I{beta} and which may be involved in the gating of the mechanotransduction channel of the sensory hair cells. This myosin belongs to the group of short-tailed myosins I, with its tail ending shortly after a polybasic, TH-1-like domain. The second cDNA encodes a novel type I myosin Myo1f which displays three regions: a head domain with the conserved ATP- and actin-binding sites, a neck domain with a single IQ motif, and a tail domain with the tripartite structure initially described in protozoan myosins I. The tail of Myo1f includes (1) a TH-1 region rich in basic residues, which may interact with anionic membrane phospholipids; (2) a TH-2 proline-rich region, expected to contain an ATP-insensitive actin-binding site; and (3) an SH-3 domain found in a variety of cytoskeletal and signaling proteins. Northern blot analysis indicated that the genes encoding Myo1c and Myo1f display a widespread tissue expression in the adult mouse. Myo1c and Myo1f were mapped by in situ hybridization to the chromosomal regions 11D-11E and 17B-17C, respectively. The human orthologuous genes MYO1C and MYO1F were also characterized, and mapped to the human chromosomal regions 17p13 and 19p13.2- 19p1.3.3, respectively. 45 refs., 5 figs., 2 tabs.

  8. Identification of three genes encoding microsomal oleate desaturases (FAD2) from the oilseed crop Camelina sativa. (United States)

    Kang, Jinling; Snapp, Anna R; Lu, Chaofu


    Camelina sativa is a re-emerging low-input oilseed crop that may provide economical vegetable oils for industrial applications. It is desirable to increase the monounsaturated oleic acid (cis-9-octadecenoic acid, 18:1), and to decrease polyunsaturated fatty acids (PUFA), linoleic (cis, cis-9,12-octadecadienoic acid, 18:2) and α-linolenic (all-cis-9,12,15-octadecatrienoic acid, 18:3) acids, in camelina oils to improve oxidative stability. 18:1 desaturation is mainly controlled by the microsomal oleate desaturase (FAD2; EC encoded by the FAD2 gene. Three FAD2 genes, designated CsFAD2-1 to 3, were identified in camelina. Functional expression of these genes in yeast confirmed that they all encode microsomal oleate desaturases. Although the three CsFAD2 genes share very high sequence similarity, they showed different expression patterns. Expression of CsFAD2-1 was detected in all tissues examined, including developing seed, flower, as well as in vegetable tissues such as leaf, root, and stem. Transcripts of CsFAD2-2 and CsFAD2-3 were mainly detected in developing seeds, suggesting their major roles in storage oil desaturation in seed. The introns of the three CsFAD2 genes, which showed greater sequence variations, may provide additional resources for designing molecular markers in breeding. Furthermore, the roles of CsFAD2 in PUFA synthesis were demonstrated by mutant analysis and by antisense gene expression in camelina seed. Published by Elsevier Masson SAS.

  9. Chromosome locations of genes encoding human signal transduction adapter proteins, Nck (NCK), Shc (SHC1), and Grb2 (GRB2)

    DEFF Research Database (Denmark)

    Huebner, K; Kastury, K; Druck, T


    Abnormalities due to chromosomal aberration or point mutation in gene products of growth factor receptors or in ras gene products, which lie on the same signaling pathway, can cause disease in animals and humans. Thus, it can be important to determine chromosomal map positions of genes encoding "...

  10. Proanthocyanidin Synthesis and Expression of Genes Encoding Leucoanthocyanidin Reductase and Anthocyanidin Reductase in Developing Grape Berries and Grapevine Leaves

    National Research Council Canada - National Science Library

    Jochen Bogs; Mark O. Downey; John S. Harvey; Anthony R. Ashton; Gregory J. Tanner; Simon P. Robinson


    .... We measured PA content and expression of genes encoding ANR, LAR, and leucoanthocyanidin dioxygenase in grape berries during development and in grapevine leaves, which accumulated PA throughout leaf expansion...

  11. Genes encoding novel lipid transporters and their use to increase oil production in vegetative tissues of plants

    Energy Technology Data Exchange (ETDEWEB)

    Xu, Changcheng; Fan, Jilian; Yan, Chengshi; Shanklin, John


    The present invention discloses a novel gene encoding a transporter protein trigalactosyldiacylglycerol-5 (TGD5), mutations thereof and their use to enhance TAG production and retention in plant vegetative tissue.

  12. Identification of the Gene Encoding Isoprimeverose-producing Oligoxyloglucan Hydrolase in Aspergillus oryzae* (United States)

    Matsuzawa, Tomohiko; Mitsuishi, Yasushi; Kameyama, Akihiko


    Aspergillus oryzae produces a unique β-glucosidase, isoprimeverose-producing oligoxyloglucan hydrolase (IPase), that recognizes and releases isoprimeverose (α-d-xylopyranose-(1→6)-d-glucopyranose) units from the non-reducing ends of oligoxyloglucans. A gene encoding A. oryzae IPase, termed ipeA, was identified and expressed in Pichia pastoris. With the exception of cellobiose, IpeA hydrolyzes a variety of oligoxyloglucans and is a member of the glycoside hydrolase family 3. Xylopyranosyl branching at the non-reducing ends was vital for IPase activity, and galactosylation at a α-1,6-linked xylopyranosyl side chain completely abolished IpeA activity. Hepta-oligoxyloglucan saccharide (Xyl3Glc4) substrate was preferred over tri- (Xyl1Glc2) and tetra- (Xyl2Glc2) oligoxyloglucan saccharides substrates. IpeA transferred isoprimeverose units to other saccharides, indicating transglycosylation activity. The ipeA gene was expressed in xylose and xyloglucan media and was strongly induced in the presence of xyloglucan endo-xyloglucanase-hydrolyzed products. This is the first study to report the identification of a gene encoding IPase in eukaryotes. PMID:26755723

  13. Identification of the Gene Encoding Isoprimeverose-producing Oligoxyloglucan Hydrolase in Aspergillus oryzae. (United States)

    Matsuzawa, Tomohiko; Mitsuishi, Yasushi; Kameyama, Akihiko; Yaoi, Katsuro


    Aspergillus oryzae produces a unique β-glucosidase, isoprimeverose-producing oligoxyloglucan hydrolase (IPase), that recognizes and releases isoprimeverose (α-D-xylopyranose-(1 → 6)-D-glucopyranose) units from the non-reducing ends of oligoxyloglucans. A gene encoding A. oryzae IPase, termed ipeA, was identified and expressed in Pichia pastoris. With the exception of cellobiose, IpeA hydrolyzes a variety of oligoxyloglucans and is a member of the glycoside hydrolase family 3. Xylopyranosyl branching at the non-reducing ends was vital for IPase activity, and galactosylation at a α-1,6-linked xylopyranosyl side chain completely abolished IpeA activity. Hepta-oligoxyloglucan saccharide (Xyl3Glc4) substrate was preferred over tri- (Xyl1Glc2) and tetra- (Xyl2Glc2) oligoxyloglucan saccharides substrates. IpeA transferred isoprimeverose units to other saccharides, indicating transglycosylation activity. The ipeA gene was expressed in xylose and xyloglucan media and was strongly induced in the presence of xyloglucan endo-xyloglucanase-hydrolyzed products. This is the first study to report the identification of a gene encoding IPase in eukaryotes. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  14. Cloning and characterization of a gene encoding trehalose phosphorylase (TP) from Pleurotus sajor-caju. (United States)

    Han, Sang-Eun; Kwon, Hawk-Bin; Lee, Seung-Bum; Yi, Bu-Young; Murayama, Ikuo; Kitamoto, Yutaka; Byun, Myung-Ok


    Complementary DNA for a gene encoding trehalose phosphorylase (TP) that reversibly catalyzes trehalose synthesis and degradation from alpha-glucose-1-phosphate (alpha-Glc-1-P) and glucose was cloned from Pleurotus sajor-caju. The cDNA of P. sajor-caju TP (designated PsTP, GenBank Accession No. AF149777) encodes a polypeptide of 751 amino acids with a deduced molecular mass of 83.7 kDa. The PsTP gene is expressed in mycelia, pilei, and stipes of fruiting bodies. Trehalose phosphorylase PsTP was purified from PsTP-transformed Escherichia coli. The enzyme catalyzes both the phosphorolysis of trehalose to produce alpha-Glc-1-P and glucose, and the synthesis of trehalose. The apparent K(m) values for trehalose and Pi in phosphorolytic reaction at pH 7.0 were 74.8 and 5.4 mM, respectively. The PsTP gene complemented Saccharomyces cerevisiae Deltatps1, Deltatps2 double-mutant cells, allowing their growth on glucose medium. Furthermore, yeast transformed with PsTP produced 2-2.5-fold more trehalose than non-transformants or cells transformed with empty vector only.

  15. Role of sequence encoded κB DNA geometry in gene regulation by Dorsal (United States)

    Mrinal, Nirotpal; Tomar, Archana; Nagaraju, Javaregowda


    Many proteins of the Rel family can act as both transcriptional activators and repressors. However, mechanism that discerns the ‘activator/repressor’ functions of Rel-proteins such as Dorsal (Drosophila homologue of mammalian NFκB) is not understood. Using genomic, biophysical and biochemical approaches, we demonstrate that the underlying principle of this functional specificity lies in the ‘sequence-encoded structure’ of the κB-DNA. We show that Dorsal-binding motifs exist in distinct activator and repressor conformations. Molecular dynamics of DNA-Dorsal complexes revealed that repressor κB-motifs typically have A-tract and flexible conformation that facilitates interaction with co-repressors. Deformable structure of repressor motifs, is due to changes in the hydrogen bonding in A:T pair in the ‘A-tract’ core. The sixth nucleotide in the nonameric κB-motif, ‘A’ (A6) in the repressor motifs and ‘T’ (T6) in the activator motifs, is critical to confer this functional specificity as A6 → T6 mutation transformed flexible repressor conformation into a rigid activator conformation. These results highlight that ‘sequence encoded κB DNA-geometry’ regulates gene expression by exerting allosteric effect on binding of Rel proteins which in turn regulates interaction with co-regulators. Further, we identified and characterized putative repressor motifs in Dl-target genes, which can potentially aid in functional annotation of Dorsal gene regulatory network. PMID:21890896

  16. Expression of Mitochondrial-Encoded Genes in Blood Differentiate Acute Renal Allograft Rejection (United States)

    Roedder, Silke; Sigdel, Tara; Hsieh, Szu-Chuan; Cheeseman, Jennifer; Metes, Diana; Macedo, Camila; Reed, Elaine F.; Gritsch, H. A.; Zeevi, Adriana; Shapiro, Ron; Kirk, Allan D.; Sarwal, Minnie M.


    Despite potent immunosuppression, clinical and biopsy confirmed acute renal allograft rejection (AR) still occurs in 10–15% of recipients, ~30% of patients demonstrate subclinical rejection on biopsy, and ~50% of them can show molecular inflammation, all which increase the risk of chronic dysfunction and worsened allograft outcomes. Mitochondria represent intracellular endogenous triggers of inflammation, which can regulate immune cell differentiation, and expansion and cause antigen-independent graft injury, potentially enhancing the development of acute rejection. In the present study, we investigated the role of mitochondrial DNA encoded gene expression in biopsy matched peripheral blood (PB) samples from kidney transplant recipients. Quantitative PCR was performed in 155 PB samples from 115 unique pediatric (21 years) renal allograft recipients at the point of AR (n = 61) and absence of rejection (n = 94) for the expression of 11 mitochondrial DNA encoded genes. We observed increased expression of all genes in adult recipients compared to pediatric recipients; separate analyses in both cohorts demonstrated increased expression during rejection, which also differentiated borderline rejection and showed an increasing pattern in serially collected samples (0–3 months prior to and post rejection). Our results provide new insights on the role of mitochondria during rejection and potentially indicate mitochondria as targets for novel immunosuppression. PMID:29164120

  17. Expression of Mitochondrial-Encoded Genes in Blood Differentiate Acute Renal Allograft Rejection

    Directory of Open Access Journals (Sweden)

    Silke Roedder


    Full Text Available Despite potent immunosuppression, clinical and biopsy confirmed acute renal allograft rejection (AR still occurs in 10–15% of recipients, ~30% of patients demonstrate subclinical rejection on biopsy, and ~50% of them can show molecular inflammation, all which increase the risk of chronic dysfunction and worsened allograft outcomes. Mitochondria represent intracellular endogenous triggers of inflammation, which can regulate immune cell differentiation, and expansion and cause antigen-independent graft injury, potentially enhancing the development of acute rejection. In the present study, we investigated the role of mitochondrial DNA encoded gene expression in biopsy matched peripheral blood (PB samples from kidney transplant recipients. Quantitative PCR was performed in 155 PB samples from 115 unique pediatric (<21 years and adult (>21 years renal allograft recipients at the point of AR (n = 61 and absence of rejection (n = 94 for the expression of 11 mitochondrial DNA encoded genes. We observed increased expression of all genes in adult recipients compared to pediatric recipients; separate analyses in both cohorts demonstrated increased expression during rejection, which also differentiated borderline rejection and showed an increasing pattern in serially collected samples (0–3 months prior to and post rejection. Our results provide new insights on the role of mitochondria during rejection and potentially indicate mitochondria as targets for novel immunosuppression.

  18. Gene therapy for bladder pain with gene gun particle encoding pro-opiomelanocortin cDNA. (United States)

    Chuang, Yao-Chi; Chou, A-K; Wu, P-C; Chiang, Po-Hui; Yu, T-J; Yang, L-C; Yoshimura, Naoki; Chancellor, Michael B


    Interstitial cystitis is a bladder hypersensitivity disease associated with bladder pain that has been a major challenge to understand and treat. We hypothesized that targeted and localized expression of endogenous opioid peptide in the bladder could be useful for the treatment of bladder pain. Pro-opiomelanocortin (POMC) is one of such precursor molecules. In this study we developed a gene gun method for the transfer of POMC cDNA in vivo and investigated its therapeutic effect on acetic acid induced bladder hyperactivity in rats. Human POMC cDNA was cloned into a modified pCMV plasmid and delivered into the bladder wall of adult female rats by direct injection or the gene gun. Three days after gene therapy continuous cystometrograms were performed using urethane anesthesia by filling the bladder (0.08 ml per minute) with saline, followed by 0.3% acetic acid. Bladder immunohistochemical testing was used to detect endorphin after POMC cDNA transfer. The intercontraction interval was decreased after intravesical instillation of acetic acid (73.1% or 68.1% decrease) in 2 control groups treated with saline or the gene gun without POMC cDNA, respectively. However, rats that received POMC cDNA via the gene gun showed a significantly decreased response (intercontraction interval 35% decreased) to acetic acid instillation, whereas this antinociceptive effect was not detected in the plasmid POMC cDNA direct injection group. This effect induced by POMC gene gun treatment was reversed by intramuscular naloxone (1 mg/kg), an opioid antagonist. Increased endorphin immunoreactivity with anti-endorphin antibodies was observed in the bladder of gene gun treated animals. The POMC gene can be transferred in the bladder using the gene gun and increased bladder expression of endorphin can suppress nociceptive responses induced by bladder irritation. Thus, POMC gene gun delivery may be useful for the treatment of interstitial cystitis and other types of visceral pain.

  19. The gene Sr33, an ortholog of barley Mla genes, encodes resistance to wheat stem rust race Ug99. (United States)

    Periyannan, Sambasivam; Moore, John; Ayliffe, Michael; Bansal, Urmil; Wang, Xiaojing; Huang, Li; Deal, Karin; Luo, Mingcheng; Kong, Xiuying; Bariana, Harbans; Mago, Rohit; McIntosh, Robert; Dodds, Peter; Dvorak, Jan; Lagudah, Evans


    Wheat stem rust, caused by the fungus Puccinia graminis f. sp. tritici, afflicts bread wheat (Triticum aestivum). New virulent races collectively referred to as "Ug99" have emerged, which threaten global wheat production. The wheat gene Sr33, introgressed from the wild relative Aegilops tauschii into bread wheat, confers resistance to diverse stem rust races, including the Ug99 race group. We cloned Sr33, which encodes a coiled-coil, nucleotide-binding, leucine-rich repeat protein. Sr33 is orthologous to the barley (Hordeum vulgare) Mla mildew resistance genes that confer resistance to Blumeria graminis f. sp. hordei. The wheat Sr33 gene functions independently of RAR1, SGT1, and HSP90 chaperones. Haplotype analysis from diverse collections of Ae. tauschii placed the origin of Sr33 resistance near the southern coast of the Caspian Sea.

  20. The Novel Gene CRNDE Encodes a Nuclear Peptide (CRNDEP Which Is Overexpressed in Highly Proliferating Tissues.

    Directory of Open Access Journals (Sweden)

    Lukasz Michal Szafron

    Full Text Available CRNDE, recently described as the lncRNA-coding gene, is overexpressed at RNA level in human malignancies. Its role in gametogenesis, cellular differentiation and pluripotency has been suggested as well. Herein, we aimed to verify our hypothesis that the CRNDE gene may encode a protein product, CRNDEP. By using bioinformatics methods, we identified the 84-amino acid ORF encoded by one of two CRNDE transcripts, previously described by our research team. This ORF was cloned into two expression vectors, subsequently utilized in localization studies in HeLa cells. We also developed a polyclonal antibody against CRNDEP. Its specificity was confirmed in immunohistochemical, cellular localization, Western blot and immunoprecipitation experiments, as well as by showing a statistically significant decrease of endogenous CRNDEP expression in the cells with transient shRNA-mediated knockdown of CRNDE. Endogenous CRNDEP localizes predominantly to the nucleus and its expression seems to be elevated in highly proliferating tissues, like the parabasal layer of the squamous epithelium, intestinal crypts or spermatocytes. After its artificial overexpression in HeLa cells, in a fusion with either the EGFP or DsRed Monomer fluorescent tag, CRNDEP seems to stimulate the formation of stress granules and localize to them. Although the exact role of CRNDEP is unknown, our preliminary results suggest that it may be involved in the regulation of the cell proliferation. Possibly, CRNDEP also participates in oxygen metabolism, considering our in silico results, and the correlation between its enforced overexpression and the formation of stress granules. This is the first report showing the existence of a peptide encoded by the CRNDE gene.

  1. A novel MFS transporter encoding gene in Fusarium verticillioides probably involved in iron-siderophore transport. (United States)

    López-Errasquín, Elena; González-Jaén, M Teresa; Callejas, Carmen; Vázquez, Covadonga


    The major facilitator superfamily (MFS) is a ubiquitous group of proteins involved in the transport of a wide range of compounds, including toxins produced by fungal species. In this paper, a novel MFS encoding gene (Fusarium iron related gene or FIR1), which had shown an up-regulation in fumonisin-inducing conditions, has been identified and characterized. The deduced protein sequence, which predicted 14 transmembrane domains typical of MFS transporters and its phylogenetic relationships with representative members of MFS transporters suggested a possible function of FIR1 as a siderophore transporter. A real-time RT-PCR protocol has been developed to analyse the expression pattern of the FIR1 gene in relation to siderophore production. The results indicated that the synthesis of extracellular siderophores by F. verticillioides observed in absence of extracellular iron was repressed in iron-supplemented cultures and showed a good correspondence with FIR1 gene expression. However, the pattern of FIR1 gene expression observed suggested that this gene did not seem to be functionally related to fumonisin production.

  2. Potential transfer of extended spectrum β-lactamase encoding gene, blashv18 gene, between Klebsiella pneumoniae in raw foods. (United States)

    Jung, Yangjin; Matthews, Karl R


    This study investigated the transfer frequency of the extended-spectrum β-lactamase-encoding gene (blaSHV18) among Klebsiella pneumoniae in tryptic soy broth (TSB), pasteurized milk, unpasteurized milk, alfalfa sprouts and chopped lettuce at defined temperatures. All transconjugants were characterized phenotypically and genotypically. KP04(ΔKM) and KP08(ΔKM) isolated from seed sprouts and KP342 were used as recipients in mating experiments with K. pneumoniae ATCC 700603 serving as the donor. In mating experiments, no transconjugants were detected at 4 °C in liquid media or chopped lettuce, but detected in all media tested at 15 °C, 24 °C, and 37 °C. At 24 °C, the transfer of blaSHV18 gene occurred more frequently in alfalfa sprouts (5.15E-04 transconjugants per recipient) and chopped lettuce (3.85E-05) than liquid media (1.08E-05). On chopped lettuce, transconjugants were not detected at day 1 post-mating at 15 °C, but observed on day 2 (1.43E-05). Transconjugants carried the blaSHV18 gene transferred from the donor and the virulence gene harbored by recipient. More importantly, a class 1 integrase gene and resistance to tetracycline, trimethoprim/sulfamethoxazole were co-transferred during mating. These quantitative results suggest that fresh produce exposed to temperature abuse may serve as a competent vehicle for the spread of gene encoding for antibiotic resistance, having a potential negative impact on human health. Copyright © 2016 Elsevier Ltd. All rights reserved.

  3. Expression and characteristics of the gene encoding azoreductase from Rhodobacter sphaeroides AS1.1737. (United States)

    Bin, Yan; Jiti, Zhou; Jing, Wang; Cuihong, Du; Hongman, Hou; Zhiyong, Song; Yongming, Bao


    A gene that encodes a protein with azoreductase activity was obtained by PCR amplification from Rhodobacter sphaeroides AS1.1737. The enzyme, with a molecular weight of 18.7 kD, was heterologously expressed in Escherichia coli and its azoreductase activity was characterized. Furthermore, the reduction mechanism of azo dyes catalyzed by the azoreductase was studied in detail. The presence of a hydrazo-intermediate was identified, which provided a convincing evidence for the assumption that azo dyes were degraded via an incomplete reduction stage.

  4. Molecular characterization of genes encoding cytosolic Hsp70s in the zygomycete fungus Rhizopus nigricans


    Černila, Boštjan; Črešnar, Bronislava; Breskvar, Katja


    Previous studies have shown that some stressors, including steroid hormones 21-OH progesterone and testosterone, stimulate the accumulation of heat shock protein 70 (hsp70) messenger ribonucleic acid (mRNA) population in the zygomycete filamentous fungus Rhizopus nigricans. In this study we report the cloning of 3 R nigricans hsp70 genes (Rnhsp70-1, Rnhsp70-2, and Rnhsp70-3) encoding cytosolic Hsp70s. With a Southern blot experiment under high stringency conditions we did not detect any addit...

  5. Leuconostoc lactis beta-galactosidase is encoded by two overlapping genes.


    David, S; Stevens, H.; van Riel, M.; Simons, G; de Vos, W M


    A 16-kb BamHI fragment of the lactose plasmid pNZ63 from Leuconostoc lactis NZ6009 was cloned in Escherichia coli MC1061 by using pACYC184 and was found to express a functional beta-galactosidase. Deletion and complementation analysis showed that the coding region for beta-galactosidase was located on a 5.8-kb SalI-BamHI fragment. Nucleotide sequence analysis demonstrated that this fragment contained two partially overlapping genes, lacL (1,878 bp) and lacM (963 bp), that could encode protein...

  6. Transfer and expression of the gene encoding a human myeloid membrane antigen (gp150). (United States)

    Look, A T; Peiper, S C; Rebentisch, M B; Ashmun, R A; Roussel, M F; Rettenmier, C W; Sherr, C J


    DNA from the human myeloid cell line HL-60 was cotransfected with the cloned thymidine kinase (tk) gene of herpes simplex virus into tk-deficient mouse L cells. tk-positive recipients expressing antigens detected on HL-60 cells were isolated with a fluorescence-activated cell sorter by use of a panel of monoclonal antibodies that detect epitopes on both normal and malignant myeloid cells. Independently sorted populations of transformed mouse cells showed concordant reactivities with four of the monoclonal antibodies in the panel (DU-HL60-4, MY7, MCS.2, and SJ-D1), which suggested that these antibodies reacted to products of a single human gene. A second round of DNA transfection and cell sorting was performed with donor DNA from primary transformants. Two different dominant selection systems were used to isolate secondary mouse L cell and NIH/3T3 cell transformants that coexpressed the same epitopes. Analysis of cellular DNA from secondary mouse cell subclones with a probe specific for human repetitive DNA sequences revealed a minimal human DNA complement containing a characteristic set of restriction fragments common to independently derived subclones. Two glycoproteins, of 130,000 (gp130) and 150,000 (gp150) mol wt, were specifically immunoprecipitated from metabolically labeled lysates of mouse cell transformants and were shown to contain [35S]methionine-labeled tryptic peptides identical to those of analogous glycoproteins expressed in the donor human myeloid cell line. Kinetic and biochemical analyses established that gp130 is a precursor that differs in its carbohydrate moiety from gp150, the mature form of the glycoprotein detected on the cell surface. The isolation of human gene sequences encoding gp150 in a mouse cell genetic background provides the possibility of molecularly cloning the gene and represents a general strategy for isolating human genes encoding differentiation-specific cell surface antigens.

  7. Expression analysis of the Theileria parva subtelomere-encoded variable secreted protein gene family.

    Directory of Open Access Journals (Sweden)

    Jacqueline Schmuckli-Maurer

    Full Text Available The intracellular protozoan parasite Theileria parva transforms bovine lymphocytes inducing uncontrolled proliferation. Proteins released from the parasite are assumed to contribute to phenotypic changes of the host cell and parasite persistence. With 85 members, genes encoding subtelomeric variable secreted proteins (SVSPs form the largest gene family in T. parva. The majority of SVSPs contain predicted signal peptides, suggesting secretion into the host cell cytoplasm.We analysed SVSP expression in T. parva-transformed cell lines established in vitro by infection of T or B lymphocytes with cloned T. parva parasites. Microarray and quantitative real-time PCR analysis revealed mRNA expression for a wide range of SVSP genes. The pattern of mRNA expression was largely defined by the parasite genotype and not by host background or cell type, and found to be relatively stable in vitro over a period of two months. Interestingly, immunofluorescence analysis carried out on cell lines established from a cloned parasite showed that expression of a single SVSP encoded by TP03_0882 is limited to only a small percentage of parasites. Epitope-tagged TP03_0882 expressed in mammalian cells was found to translocate into the nucleus, a process that could be attributed to two different nuclear localisation signals.Our analysis reveals a complex pattern of Theileria SVSP mRNA expression, which depends on the parasite genotype. Whereas in cell lines established from a cloned parasite transcripts can be found corresponding to a wide range of SVSP genes, only a minority of parasites appear to express a particular SVSP protein. The fact that a number of SVSPs contain functional nuclear localisation signals suggests that proteins released from the parasite could contribute to phenotypic changes of the host cell. This initial characterisation will facilitate future studies on the regulation of SVSP gene expression and the potential biological role of these enigmatic

  8. Genes encoding proteoglycans are associated with the risk of anterior cruciate ligament ruptures. (United States)

    Mannion, Sasha; Mtintsilana, Asanda; Posthumus, Michael; van der Merwe, Willem; Hobbs, Hayden; Collins, Malcolm; September, Alison V


    Genetic variants within genes involved in fibrillogenesis have previously been implicated in anterior cruciate ligament (ACL) injury susceptibility. Proteoglycans also have important functions in fibrillogenesis and maintaining the structural integrity of ligaments. Genes encoding proteoglycans are plausible candidates to be investigated for associations with ACL injury susceptibility; polymorphisms within genes encoding the proteoglycans aggrecan (ACAN), biglycan (BGN), decorin (DCN), fibromodulin (FMOD) and lumican (LUM) were examined. A case-control genetic association study was conducted. 227 participants with surgically diagnosed ACL ruptures (ACL group) and 234 controls without any history of ACL injury were genotyped for 10 polymorphisms in 5 proteoglycan genes. Inferred haplotypes were constructed for specific regions. The G allele of ACAN rs1516797 was significantly under-represented in the controls (p=0.024; OR=0.72; 95% CI 0.55 to 0.96) compared with the ACL group. For DCN rs516115, the GG genotype was significantly over-represented in female controls (p=0.015; OR=9.231; 95%CI 1.16 to 73.01) compared with the ACL group and the AA genotype was significantly under-represented in controls (p=0.013; OR=0.33; 95% CI 0.14 to 0.78) compared with the female non-contact ACL injury subgroup. Haplotype analyses implicated regions overlapping ACAN (rs2351491 C>T-rs1042631 T>C-rs1516797 T>G), BGN (rs1126499 C>T-rs1042103 G>A) and LUM-DCN (rs2268578 T>C-rs13312816 A>T-rs516115 A>G) in ACL injury susceptibility. These independent associations and haplotype analyses suggest that regions within ACAN, BGN, DCN and a region spanning LUM-DCN are associated with ACL injury susceptibility. Taking into account the functions of these genes, it is reasonable to propose that genetic sequence variability within the genes encoding proteoglycans may potentially modulate the ligament fibril properties. Published by the BMJ Publishing Group Limited. For permission to use (where not

  9. Neuregulinas 1-alfa e 1-beta na regeneração de nervos periféricos Neuregulins 1-alpha and 1-beta on the regeneration the peripheral nerves

    Directory of Open Access Journals (Sweden)

    Fabiano Inácio de Souza


    Full Text Available OBJETIVO: Avaliar o efeito das neuregulinas 1-alfa e 1-beta na regeneração de nervos ciáticos de camundongos C57BL/6J, adultos, machos, através da técnica de tubulização. MÉTODOS: Utilizaram-se 18 animais, divididos em 3 grupos, implantando-se prótese de polietileno em falhas de 4,0 mm no nervo ciático esquerdo: grupo 1 contendo apenas colágeno purificado (Vitrogen®; grupo 2, colágeno associado a neuregulina 1-alfa; grupo 3 com colágeno e neuregulina 1-beta. O grupo controle foi formado por 6 segmentos de nervos ciáticos direitos. Após 4 semanas, os animais foram sacrificados; extraiu-se segmento do ponto médio do nervo regenerado no interior das próteses, padronizaram-se cortes histológicos e confecção das lâminas para análise histomorfométrica. Confrontaram-se os resultados estatisticamente. RESULTADOS: Os animais tratados com neuregulinas tiveram maior número de axônios mielinizados, com diferença estatisticamente significante quando comparados ao grupo colágeno. Não houve diferença estatística entre os grupos de neuregulinas 1-alfa e 1-beta. CONCLUSÃO: a adição de neuregulinas proporcionou aumento significativo do número de fibras mielinizadas.OBJECTIVE: to evaluate the effect of the neuregulins 1-alpha and 1-beta on the regeneration the sciatic nerves of male adult C57BL/6J mice, using the tubulization technique. METHODS: eighteen animals were used, divided into three groups. A polyethylene prosthesis was implanted in a 4.0 mm defect of the left sciatic nerve, as follows: group 1 containing only purified collagen (Vitrogen®; group 2, collagen with neuregulin 1-alpha; group 3, collagen with neuregulin 1-beta. The control group consisted of six segments of right sciatic nerves. After four weeks, the animals were sacrificed. A segment from the midpoint of the nerve regenerated inside the prostheses was extracted; histological sections were standardized, and slides were made up for histomorphometric analysis

  10. Hierarchical Control of Nitrite Respiration by Transcription Factors Encoded within Mobile Gene Clusters of Thermus thermophilus. (United States)

    Alvarez, Laura; Quintáns, Nieves G; Blesa, Alba; Baquedano, Ignacio; Mencía, Mario; Bricio, Carlos; Berenguer, José


    Denitrification in Thermus thermophilus is encoded by the nitrate respiration conjugative element (NCE) and nitrite and nitric oxide respiration (nic) gene clusters. A tight coordination of each cluster's expression is required to maximize anaerobic growth, and to avoid toxicity by intermediates, especially nitric oxides (NO). Here, we study the control of the nitrite reductases (Nir) and NO reductases (Nor) upon horizontal acquisition of the NCE and nic clusters by a formerly aerobic host. Expression of the nic promoters PnirS, PnirJ, and PnorC, depends on the oxygen sensor DnrS and on the DnrT protein, both NCE-encoded. NsrR, a nic-encoded transcription factor with an iron-sulfur cluster, is also involved in Nir and Nor control. Deletion of nsrR decreased PnorC and PnirJ transcription, and activated PnirS under denitrification conditions, exhibiting a dual regulatory role never described before for members of the NsrR family. On the basis of these results, a regulatory hierarchy is proposed, in which under anoxia, there is a pre-activation of the nic promoters by DnrS and DnrT, and then NsrR leads to Nor induction and Nir repression, likely as a second stage of regulation that would require NO detection, thus avoiding accumulation of toxic levels of NO. The whole system appears to work in remarkable coordination to function only when the relevant nitrogen species are present inside the cell.

  11. Modeling the fitness consequences of a cyanophage-encoded photosynthesis gene.

    Directory of Open Access Journals (Sweden)

    Jason G Bragg

    Full Text Available BACKGROUND: Phages infecting marine picocyanobacteria often carry a psbA gene, which encodes a homolog to the photosynthetic reaction center protein, D1. Host encoded D1 decays during phage infection in the light. Phage encoded D1 may help to maintain photosynthesis during the lytic cycle, which in turn could bolster the production of deoxynucleoside triphosphates (dNTPs for phage genome replication. METHODOLOGY/PRINCIPAL FINDINGS: To explore the consequences to a phage of encoding and expressing psbA, we derive a simple model of infection for a cyanophage/host pair--cyanophage P-SSP7 and Prochlorococcus MED4--for which pertinent laboratory data are available. We first use the model to describe phage genome replication and the kinetics of psbA expression by host and phage. We then examine the contribution of phage psbA expression to phage genome replication under constant low irradiance (25 microE m(-2 s(-1. We predict that while phage psbA expression could lead to an increase in the number of phage genomes produced during a lytic cycle of between 2.5 and 4.5% (depending on parameter values, this advantage can be nearly negated by the cost of psbA in elongating the phage genome. Under higher irradiance conditions that promote D1 degradation, however, phage psbA confers a greater advantage to phage genome replication. CONCLUSIONS/SIGNIFICANCE: These analyses illustrate how psbA may benefit phage in the dynamic ocean surface mixed layer.

  12. Distribution of genes encoding aminoglycoside-modifying enzymes among clinical isolates of methicillin-resistant staphylococci

    Directory of Open Access Journals (Sweden)

    N Perumal


    Full Text Available The objective of this study was to determine the distribution of genes encoding aminoglycoside-modifying enzymes (AMEs and staphylococcal cassette chromosome mec (SCCmec elements among clinical isolates of methicillin-resistant staphylococci (MRS. Antibiotic susceptibility test was done using Kirby-Bauer disk diffusion method. The presence of SCCmec types and AME genes, namely, aac (6′-Ie-aph (2′′, aph (3′-IIIa and ant (4′-Ia was determined using two different multiplex polymerase chain reaction. The most encountered AME genes were aac (6′-Ie-aph (2′′ (55.4% followed by aph (3′-IIIa (32.3% and ant (4′-Ia gene (9%. SCCmec type I (34% was predominant in this study. In conclusion, the aac (6′-Ie-aph (2′′ was the most common AME gene and SCCmec type I was most predominant among the MRS isolates.

  13. Cloning and analysis of the DNA polymerase-encoding gene from Thermus caldophilus GK24. (United States)

    Kwon, S T; Kim, J S; Park, J H; Kim, H K; Lee, D S


    The gene encoding Thermus caldophilus GK24 (Tca) DNA polymerase was cloned into Escherichia coli using the structural gene coding for Thermus aquaticus YT-1 (Taq) DNA polymerase as a hybridization probe. The nucleotide sequence of the cloned DNA was determined. The primary structure of the Tca DNA polymerase was deduced from the nucleotide sequence. The Tca DNA polymerase comprised 834 amino acid residues and its molecular mass was determined to be 93,810. On alignment of the whole amino acid sequence, Tca DNA polymerase showed a high sequence homology with the E. coli DNA polymerase I-like DNA polymerases, and 86% identity with Taq DNA polymerase, 38% with E. coli and Streptococcus pneumoniae (Spn) DNA polymerase I. An extremely high sequence identity was observed in the region containing the polymerase activity. The codon usage in the Tca DNA polymerase gene was in fact similar to the characteristic usages in the genes for proteins from bacteria of genus Thermus: the G+C content in the third position of the codons was as high as 93%. The Tca DNA polymerase gene was expressed under the control of tac promoter on a high copy plasmid, pTCA in E. coli.

  14. Cloning, characterization and identification of the gene encoding phosphatidylinositol 4-kinase. (United States)

    Pramanik, A; Garcia, E; Ospina, R; Powell, M; Martinez, M; Alejo, W; McKoy, J; Moore, C W


    The vast majority of AIDS-related deaths are associated with opportunistic infections. For fungal infections, there are few effective antifungals, particularly for systemic use. The discovery that very low doses of the bleomycin family of anticancer chemical congeners compromise the integrity of fungal cell walls led to our approach to identify genes that complement-cell wall defects, and develop methods to facilitate the identification of new antifungals targeted to fungal cell walls. This report describes one of the genes cloned by complementation of the blm1-1 mutation of S. cerevisiae using a YCp50-based yeast genomic library. Characterization and identification of the gene were carried out using drug screening tests, Southern hybridization analyses, DNA sequencing and DNA sequence similarity searches in databases. The gene STT4, is essential for viability and encodes a phosphatidylinositol 4-kinase that plays an important role in the phosphatidylinositol-mediated signal transduction pathway required for cell wall integrity. Like blm1-1 mutant strains, stt4 cells arrest mostly in the G2/M phase of the cell cycle. Further studies using this approach should help us understand the role of PI4-K in maintaining fungal cell-wall integrity, identify additional genes affecting potential target structures in cell walls of opportunistic fungal pathogens in AIDS patients, and assist in drug discovery and antifungal drug design.

  15. Characterization of the pelL gene encoding a novel pectate lyase of Erwinia chrysanthemi 3937. (United States)

    Lojkowska, E; Masclaux, C; Boccara, M; Robert-Baudouy, J; Hugouvieux-Cotte-Pattat, N


    Erwinia chrysanthemi 3937 secretes five major isoenzymes of pectate lyases encoded by the pelA, pelB, pelC, pelD and pelE genes. Recently, a new set of pectate lyases was identified in E. chrysanthemi mutants deleted of those pel genes. We cloned the pelL gene, encoding one of these secondary pectate lyases of E. chrysanthemi 3937, from a genomic bank of a strain deleted of the five major pel genes. The nucleotide sequence of the region containing the pelL gene was determined. The pelL reading frame is 1275 bases long, corresponding to a protein of 425 amino acids including a typical amino-terminal signal sequence of 25 amino acids. Comparison of the amino acid sequences of PelL and the exo-pectate lyase PelX of E. chrysanthemi EC16 revealed a low homology, limited to 220 residues of the central part of the proteins. No homology was detected with other bacterial pectinolytic enzymes. Regulation of pelL transcription was analysed using gene fusion. As shown for the other pel genes, the transcription of pelL is dependent on various environmental conditions. It is induced by pectic catabolic products and affected by growth phase, temperature, iron starvation, osmolarity, anaerobiosis, nitrogen starvation and catabolite repression. Regulation of pelL expression appeared to be independent of the KdgR repressor, which controls all the steps of pectin catabolism. In contrast, the pecS gene, which is involved in regulation of the synthesis of the major pectate lyases and of cellulase, also appeared to be involved in pelL expression. The PelL protein is able to macerate plant tissue. This enzyme has a basic isoelectric point, presents an endo-cleaving activity on polygalacturonate or partially methylated pectin, with a basic pH optimum and an absolute requirement for Ca2+. The pelL mutant displayed a reduced virulence on potato tubers and Saintpaulia ionantha plants, demonstrating the important role of this enzyme in soft-rot disease.

  16. Expression of genes encoding multi-transmembrane proteins in specific primate taste cell populations.

    Directory of Open Access Journals (Sweden)

    Bryan D Moyer

    Full Text Available BACKGROUND: Using fungiform (FG and circumvallate (CV taste buds isolated by laser capture microdissection and analyzed using gene arrays, we previously constructed a comprehensive database of gene expression in primates, which revealed over 2,300 taste bud-associated genes. Bioinformatics analyses identified hundreds of genes predicted to encode multi-transmembrane domain proteins with no previous association with taste function. A first step in elucidating the roles these gene products play in gustation is to identify the specific taste cell types in which they are expressed. METHODOLOGY/PRINCIPAL FINDINGS: Using double label in situ hybridization analyses, we identified seven new genes expressed in specific taste cell types, including sweet, bitter, and umami cells (TRPM5-positive, sour cells (PKD2L1-positive, as well as other taste cell populations. Transmembrane protein 44 (TMEM44, a protein with seven predicted transmembrane domains with no homology to GPCRs, is expressed in a TRPM5-negative and PKD2L1-negative population that is enriched in the bottom portion of taste buds and may represent developmentally immature taste cells. Calcium homeostasis modulator 1 (CALHM1, a component of a novel calcium channel, along with family members CALHM2 and CALHM3; multiple C2 domains; transmembrane 1 (MCTP1, a calcium-binding transmembrane protein; and anoctamin 7 (ANO7, a member of the recently identified calcium-gated chloride channel family, are all expressed in TRPM5 cells. These proteins may modulate and effect calcium signalling stemming from sweet, bitter, and umami receptor activation. Synaptic vesicle glycoprotein 2B (SV2B, a regulator of synaptic vesicle exocytosis, is expressed in PKD2L1 cells, suggesting that this taste cell population transmits tastant information to gustatory afferent nerve fibers via exocytic neurotransmitter release. CONCLUSIONS/SIGNIFICANCE: Identification of genes encoding multi-transmembrane domain proteins

  17. Nuclear scaffold attachment sites within ENCODE regions associate with actively transcribed genes.

    Directory of Open Access Journals (Sweden)

    Mignon A Keaton


    Full Text Available The human genome must be packaged and organized in a functional manner for the regulation of DNA replication and transcription. The nuclear scaffold/matrix, consisting of structural and functional nuclear proteins, remains after extraction of nuclei and anchors loops of DNA. In the search for cis-elements functioning as chromatin domain boundaries, we identified 453 nuclear scaffold attachment sites purified by lithium-3,5-iodosalicylate extraction of HeLa nuclei across 30 Mb of the human genome studied by the ENCODE pilot project. The scaffold attachment sites mapped predominately near expressed genes and localized near transcription start sites and the ends of genes but not to boundary elements. In addition, these regions were enriched for RNA polymerase II and transcription factor binding sites and were located in early replicating regions of the genome. We believe these sites correspond to genome-interactions mediated by transcription factors and transcriptional machinery immobilized on a nuclear substructure.

  18. Cloning and characterization of a delta-6 desaturase encoding gene from Nannochloropsis oculata (United States)

    Ma, Xiaolei; Yu, Jianzhong; Zhu, Baohua; Pan, Kehou; Pan, Jin; Yang, Guanpin


    A gene ( NANOC-D6D) encoding a desaturase that removes two hydrogen atoms from fatty acids at delta 6 position was isolated from a cDNA library of Nannochloropsis oculata (Droop) D. J. Hibberd (Eustigmatophyceae). The unicellular marine microalga N. oculata synthesizes rich long chain polyunsaturated fatty acids (LCPUFAs), including eicosapentaenoic acid (20:5n-3, EPA). The deduced protein contains 474 amino acids that fold into 4 trans-membrane domains. The neighbor-joining phylogenetic tree indicates that NANOC-D6D is phylogenetically close to the delta-6 fatty acid desaturase of marine microalgae such as Glossomastix chrysoplasta, Thalassiosira pseudonana, and Phaeodactylum tricornutum. The gene was expressed in Saccharomyces cerevisiae INVScl to verify the substrate specificity of NANOC-D6D. Our results suggest that the recombinant NANOC-D6D simultaneously desaturates linoleic acid (LA) and α-linolenic acid (ALA).

  19. Relating genes to function: identifying enriched transcription factors using the ENCODE ChIP-Seq significance tool. (United States)

    Auerbach, Raymond K; Chen, Bin; Butte, Atul J


    Biological analysis has shifted from identifying genes and transcripts to mapping these genes and transcripts to biological functions. The ENCODE Project has generated hundreds of ChIP-Seq experiments spanning multiple transcription factors and cell lines for public use, but tools for a biomedical scientist to analyze these data are either non-existent or tailored to narrow biological questions. We present the ENCODE ChIP-Seq Significance Tool, a flexible web application leveraging public ENCODE data to identify enriched transcription factors in a gene or transcript list for comparative analyses. The ENCODE ChIP-Seq Significance Tool is written in JavaScript on the client side and has been tested on Google Chrome, Apple Safari and Mozilla Firefox browsers. Server-side scripts are written in PHP and leverage R and a MySQL database. The tool is available at Supplementary material is available at Bioinformatics online.

  20. Reconstruction of ancestral gene orders using probabilistic and gene encoding approaches.

    Directory of Open Access Journals (Sweden)

    Ning Yang

    Full Text Available Current tools used in the reconstruction of ancestral gene orders often fall into event-based and adjacency-based methods according to the principles they follow. Event-based methods such as GRAPPA are very accurate but with extremely high complexity, while more recent methods based on gene adjacencies such as InferCARsPro is relatively faster, but often produces an excessive number of chromosomes. This issue is mitigated by newer methods such as GapAdj, however it sacrifices a considerable portion of accuracy. We recently developed an adjacency-based method in the probabilistic framework called PMAG to infer ancestral gene orders. PMAG relies on calculating the conditional probabilities of gene adjacencies that are found in the leaf genomes using the Bayes' theorem. It uses a novel transition model which accounts for adjacency changes along the tree branches as well as a re-rooting procedure to prevent any information loss. In this paper, we improved PMAG with a new method to assemble gene adjacencies into valid gene orders, using an exact solver for traveling salesman problem (TSP to maximize the overall conditional probabilities. We conducted a series of simulation experiments using a wide range of configurations. The first set of experiments was to verify the effectiveness of our strategy of using the better transition model and re-rooting the tree under the targeted ancestral genome. PMAG was then thoroughly compared in terms of three measurements with its four major competitors including InferCARsPro, GapAdj, GASTS and SCJ in order to assess their performances. According to the results, PMAG demonstrates superior performance in terms of adjacency, distance and assembly accuracies, and yet achieves comparable running time, even all TSP instances were solved exactly. PMAG is available for free at

  1. Life without putrescine: disruption of the gene-encoding polyamine oxidase in Ustilago maydis odc mutants. (United States)

    Valdés-Santiago, Laura; Guzmán-de-Peña, Doralinda; Ruiz-Herrera, José


    In previous communications the essential role of spermidine in Ustilago maydis was demonstrated by means of the disruption of the genes encoding ornithine decarboxylase (ODC) and spermidine synthase (SPE). However, the assignation of specific roles to each polyamine in different cellular functions was not possible because the spermidine added to satisfy the auxotrophic requirement of odc/spe double mutants is partly back converted into putrescine. In this study, we have approached this problem through the disruption of the gene-encoding polyamine oxidase (PAO), required for the conversion of spermidine into putrescine, and the construction of odc/pao double mutants that were unable to synthesize putrescine by either ornithine decarboxylation or retroconversion from spermidine. Phenotypic analysis of the mutants provided evidence that putrescine is only an intermediary in spermidine biosynthesis, and has no direct role in cell growth, dimorphic transition, or any other vital function of U. maydis. Nevertheless, our results show that putrescine may play a role in the protection of U. maydis against salt and osmotic stress, and possibly virulence. Evidence was also obtained that the retroconversion of spermidine into putrescine is not essential for U. maydis growth but may be important for its survival under natural conditions.

  2. Haploinsufficiency of the genes encoding the tumor suppressor Pten predisposes zebrafish to hemangiosarcoma

    Directory of Open Access Journals (Sweden)

    Suma Choorapoikayil


    PTEN is an essential tumor suppressor that antagonizes Akt/PKB signaling. The zebrafish genome encodes two Pten genes, ptena and ptenb. Here, we report that zebrafish mutants that retain a single wild-type copy of ptena or ptenb (ptena+/−ptenb−/− or ptena−/−ptenb+/− are viable and fertile. ptena+/−ptenb−/− fish develop tumors at a relatively high incidence (10.2% and most tumors developed close to the eye (26/30. Histopathologically, the tumor masses were associated with the retrobulbar vascular network and diagnosed as hemangiosarcomas. A single tumor was identified in 42 ptena−/−ptenb+/− fish and was also diagnosed as hemangiosarcoma. Immunohistochemistry indicated that the tumor cells in ptena+/−ptenb−/− and ptena−/−ptenb+/− fish proliferated rapidly and were of endothelial origin. Akt/PKB signaling was activated in the tumors, whereas Ptena was still detected in tumor tissue from ptena+/−ptenb−/− zebrafish. We conclude that haploinsufficiency of the genes encoding Pten predisposes to hemangiosarcoma in zebrafish.

  3. Haploinsufficiency of the genes encoding the tumor suppressor Pten predisposes zebrafish to hemangiosarcoma. (United States)

    Choorapoikayil, Suma; Kuiper, Raoul V; de Bruin, Alain; den Hertog, Jeroen


    PTEN is an essential tumor suppressor that antagonizes Akt/PKB signaling. The zebrafish genome encodes two Pten genes, ptena and ptenb. Here, we report that zebrafish mutants that retain a single wild-type copy of ptena or ptenb (ptena(+/-)ptenb(-/-) or ptena(-/-)ptenb(+/-)) are viable and fertile. ptena(+/-)ptenb(-/-) fish develop tumors at a relatively high incidence (10.2%) and most tumors developed close to the eye (26/30). Histopathologically, the tumor masses were associated with the retrobulbar vascular network and diagnosed as hemangiosarcomas. A single tumor was identified in 42 ptena(-/-)ptenb(+/-) fish and was also diagnosed as hemangiosarcoma. Immunohistochemistry indicated that the tumor cells in ptena(+/-)ptenb(-/-) and ptena(-/-)ptenb(+/-) fish proliferated rapidly and were of endothelial origin. Akt/PKB signaling was activated in the tumors, whereas Ptena was still detected in tumor tissue from ptena(+/-)ptenb(-/-) zebrafish. We conclude that haploinsufficiency of the genes encoding Pten predisposes to hemangiosarcoma in zebrafish.

  4. Variants within the 5'-flanking regions of bovine milk-protein-encoding genes. III. Genes encoding the Ca-sensitive caseins αs1, α s2 and β. (United States)

    Schild, T A; Geldermann, H


    The 5'-flanking regions of the Ca-sensitive casein-encoding gene family were analysed for DNA variants by automated DNA sequencing of 13 cows belonging to seven breeds. About 1 kbp of each 5'-flanking region, including non-coding exon I, was amplified by PCR and sequenced bidirectionally. A total number of 34 variable sites (17 for the α s1, 10 for the α s2, and 7 for the β casein encoding gene) was identified. Variants were computer-analysed for location in putative regulatory sites in order to predict potential influences on gene expression.

  5. The Relationship Between Transcript Expression Levels of Nuclear Encoded (TFAM, NRF1 and Mitochondrial Encoded (MT-CO1 Genes in Single Human Oocytes During Oocyte Maturation

    Directory of Open Access Journals (Sweden)

    Ghaffari Novin M.


    Full Text Available In some cases of infertility in women, human oocytes fail to mature when they reach the metaphase II (MII stage. Mitochondria plays an important role in oocyte maturation. A large number of mitochondrial DNA (mtDNA, copied in oocytes, is essential for providing adenosine triphosphate (ATP during oocyte maturation. The purpose of this study was to identify the relationship between transcript expression levels of the mitochondrial encoded gene (MT-CO1 and two nuclear encoded genes, nuclear respiratory factor 1 (NRF1 and mitochondrial transcription factor A (TFAM in various stages of human oocyte maturation. Nine consenting patients, age 21-35 years old, with male factors were selected for ovarian stimulation and intracytoplasmic sperm injection (ICSI procedures. mRNA levels of mitochondrial- related genes were performed by singlecell TaqMan® quantitative real-time polymerase chain reaction (qRT-PCR. There was no significant relationship between the relative expression levels in germinal vesicle (GV stage oocytes (p = 0.62. On the contrary, a significant relationship was seen between the relative expression levels of TFAM and NRF1 and the MT-CO1 genes at the stages of metaphase I (MI and MII (p = 0.03 and p = 0.002. A relationship exists between the transcript expression levels of TFAM and NRF1, and MT-CO1 genes in various stages of human oocyte maturation.

  6. Isolation and characterization of 17 different genes encoding putative endopolygalacturonase genes from Rhizopus oryzae (United States)

    Polygalacturonase enzymes are a valuable aid in the retting of flax for production of linens and, more recently, production of biofuels from citrus wastes. In a search of the recently sequenced Rhizopus oryzae strain 99-880 genome database, 18 putative endopolygalacturonase genes were identified, w...

  7. Small gene family encoding an eggshell (chorion) protein of the human parasite Schistosoma mansoni

    Energy Technology Data Exchange (ETDEWEB)

    Bobek, L.A.; Rekosh, D.M.; Lo Verde, P.T.


    The authors isolated six independent genomic clones encoding schistosome chorion or eggshell proteins from a Schistosoma mansoni genomic library. A linkage map of five of the clones spanning 35 kilobase pairs (kbp) of the S. mansoni genome was constructed. The region contained two eggshell protein genes closely linked, separated by 7.5 kbp of intergenic DNA. The two genes of the cluster were arranged in the same orientation, that is, they were transcribed from the same strand. The sixth clone probably represents a third copy of the eggshell gene that is not contained within the 35-kbp region. The 5- end of the mRNA transcribed from these genes was defined by primer extension directly off the RNA. The ATCAT cap site sequence was homologous to a silkmoth chorion PuTCATT cap site sequence, where Pu indicates any purine. DNA sequence analysis showed that there were no introns in these genes. The DNA sequences of the three genes were very homologous to each other and to a cDNA clone, pSMf61-46, differing only in three or four nucleotices. A multiple TATA box was located at positions -23 to -31, and a CAAAT sequence was located at -52 upstream of the eggshell transcription unit. Comparison of sequences in regions further upstream with silkmoth and Drosophila sequences revealed very short elements that were shared. One such element, TCACGT, recently shown to be an essential cis-regulatory element for silkmoth chorion gene promoter function, was found at a similar position in all three organisms.

  8. Generating a knockdown transgene against Drosophila heterochromatic Tim17b gene encoding mitochondrial translocase subunit.

    Directory of Open Access Journals (Sweden)

    Mikael Garabedian

    Full Text Available Heterochromatic regions of eukaryotic genomes contain multiple functional elements involved in chromosomal dynamics, as well as multiple housekeeping genes. Cytological and molecular peculiarities of heterochromatic loci complicate genetic studies based on standard approaches developed using euchromatic genes. Here, we report the development of an RNAi-based knockdown transgenic construct and red fluorescent reporter transgene for a small gene, Tim17b, which localizes in constitutive heterochromatin of Drosophila melanogaster third chromosome and encodes a mitochondrial translocase subunit. We demonstrate that Tim17b protein is required strictly for protein delivery to mitochondrial matrix. Knockdown of Tim17b completely disrupts functions of the mitochondrial translocase complex. Using fluorescent recovery after photobleaching assay, we show that Tim17b protein has a very stable localization in the membranes of the mitochondrial network and that its exchange rate is close to zero when compared with soluble proteins of mitochondrial matrix. These results confirm that we have developed comprehensive tools to study functions of heterochromatic Tim17b gene.

  9. The pep4 gene encoding proteinase A is involved in dimorphism and pathogenesis of Ustilago maydis. (United States)

    Soberanes-Gutiérrez, Cinthia V; Juárez-Montiel, Margarita; Olguín-Rodríguez, Omar; Hernández-Rodríguez, César; Ruiz-Herrera, José; Villa-Tanaca, Lourdes


    Vacuole proteases have important functions in different physiological processes in fungi. Taking this aspect into consideration, and as a continuation of our studies on the analysis of the proteolytic system of Ustilago maydis, a phytopathogenic member of the Basidiomycota, we have analysed the role of the pep4 gene encoding the vacuolar acid proteinase PrA in the pathogenesis and morphogenesis of the fungus. After confirmation of the location of the protease in the vacuole using fluorescent probes, we obtained deletion mutants of the gene in sexually compatible strains of U. maydis (FB1 and FB2), and analysed their phenotypes. It was observed that the yeast to mycelium dimorphic transition induced by a pH change in the medium, or the use of a fatty acid as sole carbon source, was severely reduced in Δpep4 mutants. In addition, the virulence of the mutants in maize seedlings was reduced, as revealed by the lower proportion of plants infected and the reduction in size of the tumours induced by the pathogen, when compared with wild-type strains. All of these phenotypic alterations were reversed by complementation of the mutant strains with the wild-type gene. These results provide evidence of the importance of the pep4 gene for the morphogenesis and virulence of U. maydis. © 2015 BSPP AND JOHN WILEY & SONS LTD.

  10. Molecular characterization of genes encoding cytosolic Hsp70s in the zygomycete fungus Rhizopus nigricans. (United States)

    Cernila, Bostjan; Cresnar, Bronislava; Breskvar, Katja


    Previous studies have shown that some stressors, including steroid hormones 21-OH progesterone and testosterone, stimulate the accumulation of heat shock protein 70 (hsp70) messenger ribonucleic acid (mRNA) population in the zygomycete filamentous fungus Rhizopus nigricans. In this study we report the cloning of 3 R nigricans hsp70 genes (Rnhsp70-1, Rnhsp70-2, and Rnhsp70-3) encoding cytosolic Hsp70s. With a Southern blot experiment under high stringency conditions we did not detect any additional highly homologous copies of the cytosolic hsp70 genes in the R nigricans genome. Sequence analyses showed that all 3 genes contain introns within the open reading frame. The dynamics of the R nigricans molecular response to progesterone, 21-OH progesterone, and testosterone, as well as to heat shock, copper ions, hydrogen peroxide, and ethanol was studied by temporal analysis of Rnhsp70-1 and Rnhsp70-2 mRNA accumulation. Northern blot experiments revealed that the Rnhsp70-2 transcript level is not affected by testosterone, whereas mRNA levels of both genes are rapidly increased with all the other stressors studied. Moreover, the decrease of transcript levels is notably delayed in ethanol stress, and a difference is observed between the profiles of Rnhsp70-1 and Rnhsp70-2 transcripts during heat stress.

  11. Biodiversity of genes encoding anti-microbial traits within plant associated microbes

    Directory of Open Access Journals (Sweden)

    Walaa Kamel Mousa


    Full Text Available The plant is an attractive versatile home for diverse associated microbes. A subset of these microbes produce a diversity of anti-microbial natural products including polyketides, non-ribosomal peptides, terpenoids, heterocylic nitrogenous compounds, volatile compounds, bacteriocins and lytic enzymes. In recent years, detailed molecular analysis has led to a better understanding of the underlying genetic mechanisms. New genomic and bioinformatic tools have permitted comparisons of orthologous genes between species, leading to predictions of the associated evolutionary mechanisms responsible for diversification at the genetic and corresponding biochemical levels. The purpose of this review is to describe the biodiversity of biosynthetic genes of plant-associated bacteria and fungi that encode selected examples of antimicrobial natural products. For each compound, the target pathogen and biochemical mode of action are described, in order to draw attention to the complexity of these phenomena. We review recent information of the underlying molecular diversity and draw lessons through comparative genomic analysis of the orthologous genes. We conclude by discussing emerging themes and gaps, discuss the metabolic pathways in the context of the phylogeny and ecology of their microbial hosts, and discuss potential evolutionary mechanisms that led to the diversification of biosynthetic gene clusters.

  12. NECC1, a candidate choriocarcinoma suppressor gene that encodes a homeodomain consensus motif. (United States)

    Asanoma, Kazuo; Matsuda, Takao; Kondo, Haruhiko; Kato, Kiyoko; Kishino, Tatsuya; Niikawa, Norio; Wake, Norio; Kato, Hidenori


    We isolated a candidate choriocarcinoma suppressor gene from a PCR-based subtracted fragmentary cDNA library between normal placental villi and the choriocarcinoma cell line CC1. This gene comprises an open reading frame of 219 nt encoding 73 amino acids and contains a homeodomain as a consensus motif. This gene, designated NECC1 (not expressed in choriocarcinoma clone 1), is located on human chromosome 4q11-q12. NECC1 expression is ubiquitous in the brain, placenta, lung, smooth muscle, uterus, bladder, kidney, and spleen. Normal placental villi expressed NECC1, but all choriocarcinoma cell lines examined and most of the surgically removed choriocarcinoma tissue samples failed to express it. We transfected this gene into choriocarcinoma cell lines and observed remarkable alterations in cell morphology and suppression of in vivo tumorigenesis. Induction of CSH1 (chorionic somatomammotropin hormone 1) by NECC1 expression suggested differentiation of choriocarcinoma cells to syncytiotrophoblasts. Our results suggest that loss of NECC1 expression is involved in malignant conversion of placental trophoblasts.

  13. Molecular characterization of genes encoding cytosolic Hsp70s in the zygomycete fungus Rhizopus nigricans (United States)

    Černila, Boštjan; Črešnar, Bronislava; Breskvar, Katja


    Previous studies have shown that some stressors, including steroid hormones 21-OH progesterone and testosterone, stimulate the accumulation of heat shock protein 70 (hsp70) messenger ribonucleic acid (mRNA) population in the zygomycete filamentous fungus Rhizopus nigricans. In this study we report the cloning of 3 R nigricans hsp70 genes (Rnhsp70-1, Rnhsp70-2, and Rnhsp70-3) encoding cytosolic Hsp70s. With a Southern blot experiment under high stringency conditions we did not detect any additional highly homologous copies of the cytosolic hsp70 genes in the R nigricans genome. Sequence analyses showed that all 3 genes contain introns within the open reading frame. The dynamics of the R nigricans molecular response to progesterone, 21-OH progesterone, and testosterone, as well as to heat shock, copper ions, hydrogen peroxide, and ethanol was studied by temporal analysis of Rnhsp70-1 and Rnhsp70-2 mRNA accumulation. Northern blot experiments revealed that the Rnhsp70-2 transcript level is not affected by testosterone, whereas mRNA levels of both genes are rapidly increased with all the other stressors studied. Moreover, the decrease of transcript levels is notably delayed in ethanol stress, and a difference is observed between the profiles of Rnhsp70-1 and Rnhsp70-2 transcripts during heat stress. PMID:15115284

  14. Mitochondrial Genes of Dinoflagellates Are Transcribed by a Nuclear-Encoded Single-Subunit RNA Polymerase.

    Directory of Open Access Journals (Sweden)

    Chang Ying Teng

    Full Text Available Dinoflagellates are a large group of algae that contribute significantly to marine productivity and are essential photosynthetic symbionts of corals. Although these algae have fully-functioning mitochondria and chloroplasts, both their organelle genomes have been highly reduced and the genes fragmented and rearranged, with many aberrant transcripts. However, nothing is known about their RNA polymerases. We cloned and sequenced the gene for the nuclear-encoded mitochondrial polymerase (RpoTm of the dinoflagellate Heterocapsa triquetra and showed that the protein presequence targeted a GFP construct into yeast mitochondria. The gene belongs to a small gene family, which includes a variety of 3'-truncated copies that may have originated by retroposition. The catalytic C-terminal domain of the protein shares nine conserved sequence blocks with other single-subunit polymerases and is predicted to have the same fold as the human enzyme. However, the N-terminal (promoter binding/transcription initiation domain is not well-conserved. In conjunction with the degenerate nature of the mitochondrial genome, this suggests a requirement for novel accessory factors to ensure the accurate production of functional mRNAs.

  15. [Cloning, prokaryotic expression and antibacterial assay of Tenecin gene encoding an antibacterial peptide from Tenebrio molitor]. (United States)

    Liu, Ying; Jiang, Yu-xin; Li, Chao-pin


    To clone tenecin gene, an antibacterial peptide gene, from Tenebrio molitor for its prokaryotic expression and explore the molecular mechanism for regulating the expression of antibacterial peptide in Tenebrio molitor larvae. The antibacterial peptide was induced from the larvae of Tenebrio molitor by intraperitoneal injection of Escherichia coli DH-5α (1×10(8)/ml). RT-PCR was performed 72 h after the injection to clone Tenecin gene followed by sequencing and bioinformatic analysis. The recombinant expression vector pET-28a(+)-Tenecin was constructed and transformed into E. coli BL21(DE3) cells and the expression of tenecin protein was observed after IPTG induction. Tenecin expression was detected in transformed E.coli using SDS-PAGE after 1 mmol/L IPTG induction. Tenecin gene, which was about 255 bp in length, encoded Tenecin protein with a relative molecular mass of 9 kD. Incubation of E.coli with 80, 60, 40, and 20 µg/ml tenecin for 18 h resulted in a diameter of the inhibition zone of 25.1∓0.03, 20.7∓0.06, 17.2∓0.11 and 9.3∓0.04 mm, respectively. Tenecin protein possesses strong antibacterial activity against E. coli DH-5α, which warrants further study of this protein for its potential as an antibacterial agent in clinical application.

  16. The orphan G-protein-coupled receptor-encoding gene V28 is closely related to genes for chemokine receptors and is expressed in lymphoid and neural tissues. (United States)

    Raport, C J; Schweickart, V L; Eddy, R L; Shows, T B; Gray, P W


    A polymerase chain reaction (PCR) strategy with degenerate primers was used to identify novel G-protein-coupled receptor-encoding genes from human genomic DNA. One of the isolated clones, termed V28, showed high sequence similarity to the genes encoding human chemokine receptors for monocyte chemoattractant protein 1 (MCP-1) and macrophage inflammatory protein 1 alpha (MIP-1 alpha)/RANTES, and to the rat orphan receptor-encoding gene RBS11. When RNA was analyzed by Northern blot, V28 was found to be most highly expressed in neural and lymphoid tissues. Myeloid cell lines, particularly THP.1 cells, showed especially high expression of V28. We have mapped V28 to human chromosome 3p21-3pter, near the MIP-1 alpha/RANTES receptor-encoding gene.

  17. Evidence of gene conversion in genes encoding the Gal/GalNac lectin complex of Entamoeba.

    Directory of Open Access Journals (Sweden)

    Gareth D Weedall


    Full Text Available The human gut parasite Entamoeba histolytica, uses a lectin complex on its cell surface to bind to mucin and to ligands on the intestinal epithelia. Binding to mucin is necessary for colonisation and binding to intestinal epithelia for invasion, therefore blocking this binding may protect against amoebiasis. Acquired protective immunity raised against the lectin complex should create a selection pressure to change the amino acid sequence of lectin genes in order to avoid future detection. We present evidence that gene conversion has occurred in lineages leading to E. histolytica strain HM1:IMSS and E. dispar strain SAW760. This evolutionary mechanism generates diversity and could contribute to immune evasion by the parasites.

  18. Construction of four double gene substitution human x bovine rotavirus reassortant vaccine candidates: each bears two outer capsid human rotavirus genes, one encoding P serotype 1A and the other encoding G serotype 1, 2, 3, or 4 specificity. (United States)

    Hoshino, Y; Jones, R W; Chanock, R M; Kapikian, A Z


    Previously, four human x bovine rotavirus reassortant candidate vaccines, each of which derived ten genes from bovine rotavirus UK strain and only the outer capsid protein VP7-gene from human rotavirus strain D (G serotype 1), DS-1 (G serotype 2), P (G serotype 3), or ST3 (G serotype 4), were developed [Midthun et al., (1985): Journal of Virology 53:949-954; (1986): Journal of Clinical Microbiology 24:822-826]. Such human x bovine reassortant vaccines should theoretically provide antigenic coverage for the four epidemiologically most important VP7(G) serotypes 1, 2, 3, and 4. In an attempt to increase the antigenicity of VP7-based human x animal reassortant rotavirus vaccines which derive a single VP7-encoding gene from the human strain and the remaining ten genes from the animal strain, we generated double gene substitution reassortants. This was done by incorporating another protective antigen (VP4) of an epidemiologically important human rotavirus by crossing human rotavirus Wa strain (P serotype 1A), with each of the human x bovine single VP7-gene substitution rotavirus reassortants. In this way four separate double gene substitution rotavirus reassortants were generated. Each of these reassortants bears the VP4-encoding gene from human rotavirus Wa strain, the VP7-encoding gene from human rotavirus strain D, DS-1, P, or ST3, and the remaining nine genes from bovine rotavirus strain UK. The safety, antigenicity, and protective efficacy of individual components as well as combinations of strains are currently under evaluation.

  19. Characterization of the gene encoding the polymorphic immunodominant molecule, a neutralizing antigen of Theileria parva

    Energy Technology Data Exchange (ETDEWEB)

    Toye, P.G.; Metzelaar, M.J.; Wijngaard, P.L.J. [Univ. Hospital, Utrecht (Netherlands)] [and others


    Theileria parva, a tick-transmitted protozoan parasite related to Plasmodium spp., causes the disease East Coast fever, an acute and usually fatal lymphoproliferative disorder of cattle in Africa. Previous studies using sera from cattle that have survived infection identified a polymorphic immunodominant molecule (PIM) that is expressed by both the infective sporozoite stage of the parasite and the intracellular schizont. Here we show that mAb specific for the PIM Ag can inhibit sporozoite invasion of lymphocytes in vitro. A cDNA clone encoding the PIM Ag of the T. parva (Muguga) stock was obtained by using these mAb in a novel eukaryotic expression cloning system that allows isolation of cDNA encoding cytoplasmic or surface Ags. To establish the molecular basis of the polymorphism of PIM, the cDNA of the PIM Ag from a buffalo-derived T. parva stock was isolated and its sequence was compared with that of the cattle-derived Muguga PIM. The two cDNAs showed considerable identity in both the 5{prime} and 3{prime} regions, but there was substantial sequence divergence in the central regions. Several types of repeated sequences were identified in the variant regions. In the Muguga form of the molecule, there were five tandem repeats of the tetrapeptide, QPEP, that were shown, by transfection of a deleted version of the PIM gene, not to react with several anti-PIM mAbs. By isolating and sequencing the genomic version of the gene, we identified two small introns in the 3{prime} region of the gene. Finally, we showed that polyclonal rat Abs against recombinant PIM neutralize sporozoite infectivity in vitro, suggesting that the PIM Ag should be evaluated for its capacity to immunize cattle against East Coast Fever.

  20. Virulence plasmid of Rhodococcus equi contains inducible gene family encoding secreted proteins. (United States)

    Byrne, B A; Prescott, J F; Palmer, G H; Takai, S; Nicholson, V M; Alperin, D C; Hines, S A


    Rhodococcus equi causes severe pyogranulomatous pneumonia in foals. This facultative intracellular pathogen produces similar lesions in immunocompromised humans, particularly in AIDS patients. Virulent strains of R. equi bear a large plasmid that is required for intracellular survival within macrophages and for virulence in foals and mice. Only two plasmid-encoded proteins have been described previously; a 15- to 17-kDa surface protein designated virulence-associated protein A (VapA) and an antigenically related 20-kDa protein (herein designated VapB). These two proteins are not expressed by the same R. equi isolate. We describe here the substantial similarity between VapA and VapB. Moreover, we identify three additional genes carried on the virulence plasmid, vapC, -D, and -E, that are tandemly arranged downstream of vapA. These new genes are members of a gene family and encode proteins that are approximately 50% homologous to VapA, VapB, and each other. vapC, -D, and -E are found only in R. equi strains that express VapA and are highly conserved in VapA-positive isolates from both horses and humans. VapC, -D, and -E are secreted proteins coordinately regulated by temperature with VapA; the proteins are expressed when R. equi is cultured at 37 degrees C but not at 30 degrees C, a finding that is compatible with a role in virulence. As secreted proteins, VapC, -D, and -E may represent targets for the prevention of rhodococcal pneumonia. An immunologic study using VapA-specific antibodies and recombinant Vap proteins revealed no evidence of cross-reactivity despite extensive sequence similarity over the carboxy terminus of all four proteins.

  1. Enhanced expression in tobacco of the gene encoding green fluorescent protein by modification of its codon usage

    NARCIS (Netherlands)

    Rouwendal, G.J.A.; Mendes, O.; Wolbert, E.J.H.; Boer, de A.D.


    The gene encoding green fluorescent protein (GFP) from Aequorea victoria was resynthesized to adapt its codon usage for expression in plants by increasing the frequency of codons with a C or a G in the third position from 32 to 60%. The strategy for constructing the synthetic gfp gene was based on

  2. Regulatory elements in the promoter region of the rat gene encoding the acyl-CoA-binding protein

    DEFF Research Database (Denmark)

    Elholm, M; Bjerking, G; Knudsen, J


    Acyl-CoA-binding protein (ACBP) is an ubiquitously expressed 10-kDa protein which is present in high amounts in cells involved in solute transport or secretion. Rat ACBP is encoded by a gene containing the typical hallmarks of a housekeeping gene. Analysis of the promoter region of the rat ACBP g...

  3. Prevalence of genes encoding for members of the staphylococcal leukotoxin family among clinical isolates of Staphylococcus aureus

    NARCIS (Netherlands)

    von Eiff, Christof; Friedrich, Alexander W.; Peters, Georg; Becker, Karsten

    Well-characterized Staphylococcus aureus nasal and blood isolates (N = 429) were tested by polymerase chain reaction for the prevalence of genes that encode leukocidal toxins. The leukotoxin genes lukE+lukD were found at high prevalence, significantly more so in blood (82%) than in nasal isolates

  4. Isolation and characterization of the lacA gene encoding beta-galactosidase in Bacillus subtilis and a regulator gene, lacR. (United States)

    Daniel, R A; Haiech, J; Denizot, F; Errington, J


    We have isolated transposon insertions in the lacA gene encoding an endogenous beta-galactosidase of Bacillus subtilis. Upstream of the putative operon containing lacA is a negative regulator, lacR, which encodes a product related to a family of regulators that includes the lactose repressor, lacI, of Escherichia coli. New strains with insertions in the lacA gene should be of use in studies using lacZ fusions in B. subtilis.

  5. Isolation and characterization of the lacA gene encoding beta-galactosidase in Bacillus subtilis and a regulator gene, lacR.


    Daniel, R A; Haiech, J; Denizot, F; Errington, J


    We have isolated transposon insertions in the lacA gene encoding an endogenous beta-galactosidase of Bacillus subtilis. Upstream of the putative operon containing lacA is a negative regulator, lacR, which encodes a product related to a family of regulators that includes the lactose repressor, lacI, of Escherichia coli. New strains with insertions in the lacA gene should be of use in studies using lacZ fusions in B. subtilis.

  6. Pseudomonas aeruginosa LysR PA4203 regulator NmoR acts as a repressor of the PA4202 nmoA gene, encoding a nitronate monooxygenase

    DEFF Research Database (Denmark)

    Vercammen, Ken; Wei, Qing; Charlier, Daniel


    The PA4203 gene encodes a LysR regulator and lies between the ppgL gene (PA4204), which encodes a periplasmic gluconolactonase, and, in the opposite orientation, the PA4202 (nmoA) gene, coding for a nitronate monooxygenase, and ddlA (PA4201), encoding a d-alanine alanine ligase. The intergenic...... gene, encoding a quinone oxidoreductase, was the most highly upregulated gene in the nmoR deletion mutant, independently of MexT. Finally, deletion of the nmoA gene resulted in an increased sensitivity of the cells to 3-nitropropionic acid (3-NPA), confirming the role of the nitronate monooxygenase...

  7. Degradation of Benzene by Pseudomonas veronii 1YdBTEX2 and 1YB2 Is Catalyzed by Enzymes Encoded in Distinct Catabolism Gene Clusters. (United States)

    de Lima-Morales, Daiana; Chaves-Moreno, Diego; Wos-Oxley, Melissa L; Jáuregui, Ruy; Vilchez-Vargas, Ramiro; Pieper, Dietmar H


    Pseudomonas veronii 1YdBTEX2, a benzene and toluene degrader, and Pseudomonas veronii 1YB2, a benzene degrader, have previously been shown to be key players in a benzene-contaminated site. These strains harbor unique catabolic pathways for the degradation of benzene comprising a gene cluster encoding an isopropylbenzene dioxygenase where genes encoding downstream enzymes were interrupted by stop codons. Extradiol dioxygenases were recruited from gene clusters comprising genes encoding a 2-hydroxymuconic semialdehyde dehydrogenase necessary for benzene degradation but typically absent from isopropylbenzene dioxygenase-encoding gene clusters. The benzene dihydrodiol dehydrogenase-encoding gene was not clustered with any other aromatic degradation genes, and the encoded protein was only distantly related to dehydrogenases of aromatic degradation pathways. The involvement of the different gene clusters in the degradation pathways was suggested by real-time quantitative reverse transcription PCR. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  8. Cloning and expression of putative cytotonic enterotoxin-encoding genes from Aeromonas hydrophila. (United States)

    Chopra, A K; Pham, R; Houston, C W


    A genomic library from a diarrheal isolate, SSU, of Aeromonas hydrophila was constructed in a cosmid vector, pHC79, and in bacteriophage lambda EMBL3. Cell lysates from various Escherichia coli clones containing the recombinant cosmid were examined for their ability to elongate Chinese hamster ovary (CHO) cells, which is a typical enterotoxic response. Based on restriction analysis, a 4.0-kb SalI DNA fragment from one of the clones that exhibited enterotoxic activity was subcloned into a bacteriophage T7 RNA polymerase/promoter hyperexpression system. The cell lysate from this E. coli [pSL24] clone caused CHO cells to elongate and revealed the presence of a major 35-kDa polypeptide by [35S]methionine labeling and sodium dodecyl sulfate (SDS)-polyacrylamide-gel electrophoresis (PAGE). The toxin was biologically heat labile, losing all activity within 20 min at 56 degrees C. In addition, another enterotoxin-producing clone, E. coli[pSBS32], was isolated from cosmid and lambda bacteriophage libraries. We localized this heat-stable (56 degrees C/20 min) enterotoxin to a 4.8-kb SalI-BamHI fragment. Both enterotoxins caused elevation of cyclic adenosine monophosphate (cAMP) in CHO cells. The DNA fragments encoding these enterotoxins did not hybridize with each other. However, a 4.8-kb SalI-BamHI DNA fragment encoding a heat-stable enterotoxin hybridized to a 3.5-kb BamHI DNA fragment of a plasmid, pHPC100, that contained a cytotonic enterotoxin-encoding gene isolated from A. trota. Our data suggest Aeromonas species produce different structural types of cytotonic enterotoxins that are functionally similar.

  9. Analysis of the structural genes encoding M-factor in the fission yeast Schizosaccharomyces pombe: identification of a third gene, mfm3

    DEFF Research Database (Denmark)

    Kjaerulff, S; Davey, William John; Nielsen, O


    We previously identified two genes, mfm1 and mfm2, with the potential to encode the M-factor mating pheromone of the fission yeast Schizosaccharomyces pombe (J. Davey, EMBO J. 11:951-960, 1992), but further analysis revealed that a mutant strain lacking both genes still produced active M-factor. ......We previously identified two genes, mfm1 and mfm2, with the potential to encode the M-factor mating pheromone of the fission yeast Schizosaccharomyces pombe (J. Davey, EMBO J. 11:951-960, 1992), but further analysis revealed that a mutant strain lacking both genes still produced active M...

  10. The zebrafish moonshine gene encodes transcriptional intermediary factor 1gamma, an essential regulator of hematopoiesis.

    Directory of Open Access Journals (Sweden)

    David G Ransom


    Full Text Available Hematopoiesis is precisely orchestrated by lineage-specific DNA-binding proteins that regulate transcription in concert with coactivators and corepressors. Mutations in the zebrafish moonshine (mon gene specifically disrupt both embryonic and adult hematopoiesis, resulting in severe red blood cell aplasia. We report that mon encodes the zebrafish ortholog of mammalian transcriptional intermediary factor 1gamma (TIF1gamma (or TRIM33, a member of the TIF1 family of coactivators and corepressors. During development, hematopoietic progenitor cells in mon mutants fail to express normal levels of hematopoietic transcription factors, including gata1, and undergo apoptosis. Three different mon mutant alleles each encode premature stop codons, and enforced expression of wild-type tif1gamma mRNA rescues embryonic hematopoiesis in homozygous mon mutants. Surprisingly, a high level of zygotic tif1gamma mRNA expression delineates ventral mesoderm during hematopoietic stem cell and progenitor formation prior to gata1 expression. Transplantation studies reveal that tif1gamma functions in a cell-autonomous manner during the differentiation of erythroid precursors. Studies in murine erythroid cell lines demonstrate that Tif1gamma protein is localized within novel nuclear foci, and expression decreases during erythroid cell maturation. Our results establish a major role for this transcriptional intermediary factor in the differentiation of hematopoietic cells in vertebrates.

  11. Design and evaluation of novel primers for the detection of genes encoding diverse enzymes of methylotrophy and autotrophy. (United States)

    Hung, Wei-Lian; Wade, William G; Chen, Yin; Kelly, Donovan P; Wood, Ann P


    The phylogenetic significance of the diversity of key enzymes of methylotrophic and autotrophic metabolism is discussed. Primers for these key enzymes were designed using gene sequences encoding methanol dehydrogenase (mxaF; using subsets from database sequences for 22 Bacteria), hydroxypyruvate reductase (hpr; 36 sequences), methylamine dehydrogenase (mauA; 12 sequences), methanesulfonate monooxygenase (msmA; four sequences), and the ccbL and cbbM genes of ribulose bisphosphate carboxylase (26 and 23 sequences). These were effective in amplifying the correct gene products for the target genes in reference organisms and in test organisms not previously shown to contain the genes, as well as in some methylotrophic Proteobacteria isolated from the human mouth. The availability of the new primers increases the probability of detecting diverse examples of the genes encoding these key enzymes both in natural populations and in isolated bacterial strains.

  12. Kallmann syndrome: mutations in the genes encoding prokineticin-2 and prokineticin receptor-2.

    Directory of Open Access Journals (Sweden)

    Catherine Dodé


    Full Text Available Kallmann syndrome combines anosmia, related to defective olfactory bulb morphogenesis, and hypogonadism due to gonadotropin-releasing hormone deficiency. Loss-of-function mutations in KAL1 and FGFR1 underlie the X chromosome-linked form and an autosomal dominant form of the disease, respectively. Mutations in these genes, however, only account for approximately 20% of all Kallmann syndrome cases. In a cohort of 192 patients we took a candidate gene strategy and identified ten and four different point mutations in the genes encoding the G protein-coupled prokineticin receptor-2 (PROKR2 and one of its ligands, prokineticin-2 (PROK2, respectively. The mutations in PROK2 were detected in the heterozygous state, whereas PROKR2 mutations were found in the heterozygous, homozygous, or compound heterozygous state. In addition, one of the patients heterozygous for a PROKR2 mutation was also carrying a missense mutation in KAL1, thus indicating a possible digenic inheritance of the disease in this individual. These findings reveal that insufficient prokineticin-signaling through PROKR2 leads to abnormal development of the olfactory system and reproductive axis in man. They also shed new light on the complex genetic transmission of Kallmann syndrome.

  13. Identification of Genes Encoding Granule-Bound Starch Synthase Involved in Amylose Metabolism in Banana Fruit (United States)

    Liu, Weixin; Xu, Biyu; Jin, Zhiqiang


    Granule-bound starch synthase (GBSS) is responsible for amylose synthesis, but the role of GBSS genes and their encoded proteins remains poorly understood in banana. In this study, amylose content and GBSS activity gradually increased during development of the banana fruit, and decreased during storage of the mature fruit. GBSS protein in banana starch granules was approximately 55.0 kDa. The protein was up-regulated expression during development while it was down-regulated expression during storage. Six genes, designated as MaGBSSI-1, MaGBSSI-2, MaGBSSI-3, MaGBSSI-4, MaGBSSII-1, and MaGBSSII-2, were cloned and characterized from banana fruit. Among the six genes, the expression pattern of MaGBSSI-3 was the most consistent with the changes in amylose content, GBSS enzyme activity, GBSS protein levels, and the quantity or size of starch granules in banana fruit. These results suggest that MaGBSSI-3 might regulate amylose metabolism by affecting the variation of GBSS levels and the quantity or size of starch granules in banana fruit during development or storage. PMID:24505384

  14. Sudden infant death syndrome caused by cardiac arrhythmias: only a matter of genes encoding ion channels? (United States)

    Sarquella-Brugada, Georgia; Campuzano, Oscar; Cesar, Sergi; Iglesias, Anna; Fernandez, Anna; Brugada, Josep; Brugada, Ramon


    Sudden infant death syndrome is the unexpected demise of a child younger than 1 year of age which remains unexplained after a complete autopsy investigation. Usually, it occurs during sleep, in males, and during the first 12 weeks of life. The pathophysiological mechanism underlying the death is unknown, and the lethal episode is considered multifactorial. However, in cases without a conclusive post-mortem diagnosis, suspicious of cardiac arrhythmias may also be considered as a cause of death, especially in families suffering from any cardiac disease associated with sudden cardiac death. Here, we review current understanding of sudden infant death, focusing on genetic causes leading to lethal cardiac arrhythmias, considering both genes encoding ion channels as well as structural proteins due to recent association of channelopathies and desmosomal genes. We support a comprehensive analysis of all genes associated with sudden cardiac death in families suffering of infant death. It allows the identification of the most plausible cause of death but also of family members at risk, providing cardiologists with essential data to adopt therapeutic preventive measures in families affected with this lethal entity.

  15. Halloween genes encode P450 enzymes that mediate steroid hormone biosynthesis in Drosophila melanogaster. (United States)

    Gilbert, Lawrence I


    Mutation of members of the Halloween gene family results in embryonic lethality. We have shown that two of these genes code for enzymes responsible for specific steps in the synthesis of ecdysone, a polyhydroxylated sterol that is the precursor of the major molting hormone of all arthropods, 20-hydroxyecdysone. These two mitochondrial P450 enzymes, coded for by disembodied (dib) (CYP302A1) and shadow (sad) (CYP315A1), are the C22 and C2 hydroxylases, respectively, as shown by transfection of the gene into S2 cells and subsequent biochemical analysis. These are the last two enzymes in the ecdysone biosynthetic pathway. A third enzyme, necessary for the critical conversion of ecdysone to 20-hydroxyecdysone, the 20-monooxygenase, is encoded by shade (shd) (CYP314A1). All three enzymes are mitochondrial although shade has motifs suggesting both mitochondrial and microsomal locations. By tagging these enzymes, their subcellular location has been confirmed by confocal microscopy. Shade is present in several tissues as expected while disembodied and shadow are restricted to the ring gland. The paradigm used should allow us to define the enzymes mediating the entire ecdysteroid biosynthetic pathway.

  16. A Mutation in the Tubulin-Encoding Gene Causes Complex Cortical Malformations and Unilateral Hypohidrosis

    Directory of Open Access Journals (Sweden)

    Shinobu Fukumura MD


    Full Text Available Recent studies have emphasized the association between tubulin gene mutations and developmental abnormalities of the cortex. In this study, the authors identified a mutation in the tubulin-encoding class III β-tubulin ( TUBB3 gene in a 4-year-old boy presenting with brain abnormalities and unilateral hypohidrosis. The patient showed a left internal strabismus, moderate developmental delay, and congenital hypohidrosis of the right side of the body. Magnetic resonance imaging disclosed gyral disorganization mainly in the left perisylvian region, dysmorphic and hypertrophic basal ganglia with fusion between the putamen and caudate nucleus without affecting the anterior limb of the internal capsule, and moderate hypoplasia of the right brain stem and cerebellum. Diffusion tensor imaging studies revealed disorganization of the pyramidal fibers. The amplitude of the sympathetic skin response was low in the right arm, which led to a diagnosis of focal autonomic neuropathy. Sequencing the TUBB3 gene revealed a de novo missense mutation, c.862G>A (p.E288K.

  17. Mutations Affecting Light Regulation of Nuclear Genes Encoding Chloroplast Glyceraldehyde-3-Phosphate Dehydrogenase in Arabidopsis1 (United States)

    Chan, Chui Sien; Peng, Hsiao-Ping; Shih, Ming-Che


    Expression of nuclear genes that encode the A and B subunits of chloroplast glyceraldehyde-3-phosphate dehydrogenase (GAPA and GAPB) of Arabidopsis is known to be regulated by light. We used a negative selection approach to isolate mutants that were defective in light-regulated expression of the GAPA gene. Two dominant mutants belonging to the same complementation group, uga1-1 and uga1-2, were then characterized. These two mutants showed a dramatic reduction in GAPA mRNA level in both mature plants and seedlings. Surprisingly, mutations in uga1-1 and uga1-2 had no effect on the expression of GAPB and several other light-regulated genes. In addition, we found that the chloroplast glyceraldehyde-3-phosphate dehydrogenase enzyme activity of the mutants was only slightly lower than that of the wild type. Western-blot analysis showed that the GAPA protein level was nearly indistinguishable between the wild-type and the uga mutants. These results suggested that posttranscriptional control was involved in the up-regulation of the GAPA protein in the mutants. The uga1-1 mutation was mapped to the bottom arm of chromosome V of the Arabidopsis genome. PMID:12428012

  18. Mutations affecting light regulation of nuclear genes encoding chloroplast glyceraldehyde-3-phosphate dehydrogenase in Arabidopsis. (United States)

    Chan, Chui Sien; Peng, Hsiao-Ping; Shih, Ming-Che


    Expression of nuclear genes that encode the A and B subunits of chloroplast glyceraldehyde-3-phosphate dehydrogenase (GAPA and GAPB) of Arabidopsis is known to be regulated by light. We used a negative selection approach to isolate mutants that were defective in light-regulated expression of the GAPA gene. Two dominant mutants belonging to the same complementation group, uga1-1 and uga1-2, were then characterized. These two mutants showed a dramatic reduction in GAPA mRNA level in both mature plants and seedlings. Surprisingly, mutations in uga1-1 and uga1-2 had no effect on the expression of GAPB and several other light-regulated genes. In addition, we found that the chloroplast glyceraldehyde-3-phosphate dehydrogenase enzyme activity of the mutants was only slightly lower than that of the wild type. Western-blot analysis showed that the GAPA protein level was nearly indistinguishable between the wild-type and the uga mutants. These results suggested that posttranscriptional control was involved in the up-regulation of the GAPA protein in the mutants. The uga1-1 mutation was mapped to the bottom arm of chromosome V of the Arabidopsis genome.

  19. Growth Characteristics of Methanomassiliicoccus luminyensis and Expression of Methyltransferase Encoding Genes

    Directory of Open Access Journals (Sweden)

    Lena Kröninger


    Full Text Available DNA sequence analysis of the human gut revealed the presence a seventh order of methanogens referred to as Methanomassiliicoccales. Methanomassiliicoccus luminyensis is the only member of this order that grows in pure culture. Here, we show that the organism has a doubling time of 1.8 d with methanol + H2 and a growth yield of 2.4 g dry weight/mol CH4. M. luminyensis also uses methylamines + H2 (monomethylamine, dimethylamine, and trimethylamine with doubling times of 2.1–2.3 d. Similar cell yields were obtained with equimolar concentrations of methanol and methylamines with respect to their methyl group contents. The transcript levels of genes encoding proteins involved in substrate utilization indicated increased amounts of mRNA from the mtaBC2 gene cluster in methanol-grown cells. When methylamines were used as substrates, mRNA of the mtb/mtt operon and of the mtmBC1 cluster were found in high abundance. The transcript level of mtaC2 was almost identical in methanol- and methylamine-grown cells, indicating that genes for methanol utilization were constitutively expressed in high amounts. The same observation was made with resting cells where methanol always yielded the highest CH4 production rate independently from the growth substrate. Hence, M. luminyensis is adapted to habitats that provide methanol + H2 as substrates.

  20. The Candida albicans-specific gene EED1 encodes a key regulator of hyphal extension.

    LENUS (Irish Health Repository)

    Martin, Ronny


    The extension of germ tubes into elongated hyphae by Candida albicans is essential for damage of host cells. The C. albicans-specific gene EED1 plays a crucial role in this extension and maintenance of filamentous growth. eed1Δ cells failed to extend germ tubes into long filaments and switched back to yeast growth after 3 h of incubation during growth on plastic surfaces. Expression of EED1 is regulated by the transcription factor Efg1 and ectopic overexpression of EED1 restored filamentation in efg1Δ. Transcriptional profiling of eed1Δ during infection of oral tissue revealed down-regulation of hyphal associated genes including UME6, encoding another key transcriptional factor. Ectopic overexpression of EED1 or UME6 rescued filamentation and damage potential in eed1Δ. Transcriptional profiling during overexpression of UME6 identified subsets of genes regulated by Eed1 or Ume6. These data suggest that Eed1 and Ume6 act in a pathway regulating maintenance of hyphal growth thereby repressing hyphal-to-yeast transition and permitting dissemination of C. albicans within epithelial tissues.

  1. Analysis of a polygalacturonase gene of Ustilago maydis and characterization of the encoded enzyme. (United States)

    Castruita-Domínguez, José P; González-Hernández, Sandra E; Polaina, Julio; Flores-Villavicencio, Lérida L; Alvarez-Vargas, Aurelio; Flores-Martínez, Alberto; Ponce-Noyola, Patricia; Leal-Morales, Carlos A


    Ustilago maydis is a pathogenic fungus that produces the corn smut. It is a biotrophic parasite that depends on living plant tissues for its proliferation and development. Polygalacturonases are secreted by pathogens to solubilize the plant cell-wall and are required for pathogen virulence. In this paper, we report the isolation of a U. maydis polygalacturonase gene (Pgu1) and the functional and structural characterization of the encoded enzyme. The U. maydis Pgu1 gene is expressed when the fungus is grown in liquid culture media containing different carbon sources. In plant tissue, the expression increased as a function of incubation time. Pgu1 gene expression was detected during plant infection around 10 days post-infection with U. maydis FB-D12 strain in combination with teliospore formation. Synthesis and secretion of active recombinant PGU1 were achieved using Pichia pastoris, the purified enzyme had a optimum temperature of 34 °C, optimum pH of 4.5, a Km of 57.84 g/L for polygalacturonic acid, and a Vmax of 28.9 µg/min mg. Structural models of PGU1 based on homologous enzymes yielded a typical right-handed β-helix fold of pectinolytic enzymes classified in the glycosyl hydrolases family 28, and the U. maydis PGU1 is related with endo rather than exo polygalacturonases. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  2. The novel BLM3 gene encodes a protein that protects against lethal effects of oxidative damage. (United States)

    Febres, D E; Pramanik, A; Caton, M; Doherty, K; McKoy, J; Garcia, E; Alejo, W; Moore, C W


    Mutational alteration of the BLM3 gene in Saccharomyces cerevisiae confers hypersensitivities to lethal effects of ionizing radiation, anticancer bleomycins and structurally-related phleomycins. Bleomycin is used clinically in the treatment of many types of cancers, including Kaposi's sarcoma. The BLM3 gene was cloned from a genomic library by complementing the drug hypersensitivities conferred by the codominant blm3-1 mutation. The nucleotide sequence of BLM3 encodes a predicted integral protein of 1804 amino acids with seven to ten potential transmembrane domains and additional motifs. The blm3 null mutation was created by gene replacement, and found not to be essential for growth in the absence of the bleomycin-phleomycin antibiotics. Sequence analyses suggest the Blm3p could be a potential member of the major facilitator superfamily (MFS) of permeases. Northern dot blot analyses using a human RNA master tissue blot containing RNA from fifty different fetal and adult tissues revealed sequence homology in adult tissues to BLM3, but no sequence homology in fetal tissues. The function of the Blm3p is presently unknown. We propose several functions for the Blm3p in protecting cells against oxidative agents, including roles in detoxification, transport and defending against DNA damage.

  3. Identification of genes encoding granule-bound starch synthase involved in amylose metabolism in banana fruit.

    Directory of Open Access Journals (Sweden)

    Hongxia Miao

    Full Text Available Granule-bound starch synthase (GBSS is responsible for amylose synthesis, but the role of GBSS genes and their encoded proteins remains poorly understood in banana. In this study, amylose content and GBSS activity gradually increased during development of the banana fruit, and decreased during storage of the mature fruit. GBSS protein in banana starch granules was approximately 55.0 kDa. The protein was up-regulated expression during development while it was down-regulated expression during storage. Six genes, designated as MaGBSSI-1, MaGBSSI-2, MaGBSSI-3, MaGBSSI-4, MaGBSSII-1, and MaGBSSII-2, were cloned and characterized from banana fruit. Among the six genes, the expression pattern of MaGBSSI-3 was the most consistent with the changes in amylose content, GBSS enzyme activity, GBSS protein levels, and the quantity or size of starch granules in banana fruit. These results suggest that MaGBSSI-3 might regulate amylose metabolism by affecting the variation of GBSS levels and the quantity or size of starch granules in banana fruit during development or storage.

  4. Knockdown of Five Genes Encoding Uncharacterized Proteins Inhibits Entamoeba histolytica Phagocytosis of Dead Host Cells. (United States)

    Sateriale, Adam; Miller, Peter; Huston, Christopher D


    Entamoeba histolytica is the protozoan parasite that causes invasive amebiasis, which is endemic to many developing countries and characterized by dysentery and liver abscesses. The virulence of E. histolytica correlates with the degree of host cell engulfment, or phagocytosis, and E. histolytica phagocytosis alters amebic gene expression in a feed-forward manner that results in an increased phagocytic ability. Here, we used a streamlined RNA interference screen to silence the expression of 15 genes whose expression was upregulated in phagocytic E. histolytica trophozoites to determine whether these genes actually function in the phagocytic process. When five of these genes were silenced, amebic strains with significant decreases in the ability to phagocytose apoptotic host cells were produced. Phagocytosis of live host cells, however, was largely unchanged, and the defects were surprisingly specific for phagocytosis. Two of the five encoded proteins, which we named E. histolytica ILWEQ (EhILWEQ) and E. histolytica BAR (EhBAR), were chosen for localization via SNAP tag labeling and localized to the site of partially formed phagosomes. Therefore, both EhILWEQ and EhBAR appear to contribute to E. histolytica virulence through their function in phagocytosis, and the large proportion (5/15 [33%]) of gene-silenced strains with a reduced ability to phagocytose host cells validates the previously published microarray data set demonstrating feed-forward control of E. histolytica phagocytosis. Finally, although only limited conclusions can be drawn from studies using the virulence-deficient G3 Entamoeba strain, the relative specificity of the defects induced for phagocytosis of apoptotic cells but not healthy cells suggests that cell killing may play a rate-limiting role in the process of Entamoeba histolytica host cell engulfment. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

  5. Calcium-activated potassium (BK) channels are encoded by duplicate slo1 genes in teleost fishes. (United States)

    Rohmann, Kevin N; Deitcher, David L; Bass, Andrew H


    Calcium-activated, large conductance potassium (BK) channels in tetrapods are encoded by a single slo1 gene, which undergoes extensive alternative splicing. Alternative splicing generates a high level of functional diversity in BK channels that contributes to the wide range of frequencies electrically tuned by the inner ear hair cells of many tetrapods. To date, the role of BK channels in hearing among teleost fishes has not been investigated at the molecular level, although teleosts account for approximately half of all extant vertebrate species. We identified slo1 genes in teleost and nonteleost fishes using polymerase chain reaction and genetic sequence databases. In contrast to tetrapods, all teleosts examined were found to express duplicate slo1 genes in the central nervous system, whereas nonteleosts that diverged prior to the teleost whole-genome duplication event express a single slo1 gene. Phylogenetic analyses further revealed that whereas other slo1 duplicates were the result of a single duplication event, an independent duplication occurred in a basal teleost (Anguilla rostrata) following the slo1 duplication in teleosts. A third, independent slo1 duplication (autotetraploidization) occurred in salmonids. Comparison of teleost slo1 genomic sequences to their tetrapod orthologue revealed a reduced number of alternative splice sites in both slo1 co-orthologues. For the teleost Porichthys notatus, a focal study species that vocalizes with maximal spectral energy in the range electrically tuned by BK channels in the inner ear, peripheral tissues show the expression of either one (e.g., vocal muscle) or both (e.g., inner ear) slo1 paralogues with important implications for both auditory and vocal physiology. Additional loss of expression of one slo1 paralogue in nonneural tissues in P. notatus suggests that slo1 duplicates were retained via subfunctionalization. Together, the results predict that teleost fish achieve a diversity of BK channel subfunction via

  6. Triple subcellular targeting of isopentenyl diphosphate isomerases encoded by a single gene. (United States)

    Guirimand, Grégory; Guihur, Anthony; Phillips, Michael A; Oudin, Audrey; Glévarec, Gaëlle; Mahroug, Samira; Melin, Céline; Papon, Nicolas; Clastre, Marc; Giglioli-Guivarc'h, Nathalie; St-Pierre, Benoit; Rodríguez-Concepción, Manuel; Burlat, Vincent; Courdavault, Vincent


    Isopentenyl diphosphate isomerase (IDI) is a key enzyme of the isoprenoid pathway, catalyzing the interconversion of isopentenyl diphosphate and dimethylallyl diphosphate, the universal precursors of all isoprenoids. In plants, several subcellular compartments, including cytosol/ER, peroxisomes, mitochondria and plastids, are involved in isoprenoid biosynthesis. Here, we report on the unique triple targeting of two Catharanthus roseus IDI isoforms encoded by a single gene (CrIDI1). The triple localization of CrIDI1 in mitochondria, plastids and peroxisomes is explained by alternative transcription initiation of CrIDI1, by the specificity of a bifunctional N-terminal mitochondria/plastid transit peptide and by the presence of a C-terminal peroxisomal targeting signal. Moreover, bimolecular fluorescence complementation assays revealed self-interactions suggesting that the IDI likely acts as a multimer in vivo.

  7. Chromosomal location of the genes encoding complement components C5 and factor H in the mouse

    DEFF Research Database (Denmark)

    D'Eustachio, P; Kristensen, Torsten; Wetsel, R A


    Complementary DNA probes corresponding to the factor H and C5 polypeptides have been used to determine the chromosomal localizations of these two complement components. Both probes revealed complex and polymorphic arrays of DNA fragments in Southern blot analysis of mouse genomic DNA. Following...... to chromosome 1 or chromosome 3. Following the inheritance of DNA restriction fragment-length polymorphisms revealed by the probes in recombinant inbred mouse strains allowed the factor H-associated fragments to be mapped to Sas-1 on chromosome 1, and the C5-associated fragments to be mapped to Hc. Analysis...... of three-point crosses, in turn, placed the latter locus 19 cM distal to Sd on chromosome 2. We have designated the two loci Cfh and C5, respectively. This genetic analysis raises the possibility that C5 and factor H are both encoded by complex loci composed of distinct structural and regulatory genes....

  8. Reduction of antinutritional glucosinolates in Brassica oilseeds by mutation of genes encoding transporters. (United States)

    Nour-Eldin, Hussam Hassan; Madsen, Svend Roesen; Engelen, Steven; Jørgensen, Morten Egevang; Olsen, Carl Erik; Andersen, Jonathan Sonne; Seynnaeve, David; Verhoye, Thalia; Fulawka, Rudy; Denolf, Peter; Halkier, Barbara Ann


    The nutritional value of Brassica seed meals is reduced by the presence of glucosinolates, which are toxic compounds involved in plant defense. Mutation of the genes encoding two glucosinolate transporters (GTRs) eliminated glucosinolates from Arabidopsis thaliana seeds, but translation of loss-of-function phenotypes into Brassica crops is challenging because Brassica is polyploid. We mutated one of seven and four of 12 GTR orthologs and reduced glucosinolate levels in seeds by 60-70% in two different Brassica species (Brassica rapa and Brassica juncea). Reduction in seed glucosinolates was stably inherited over multiple generations and maintained in field trials of two mutant populations at three locations. Successful translation of the gtr loss-of-function phenotype from model plant to two Brassica crops suggests that our transport engineering approach could be broadly applied to reduce seed glucosinolate content in other oilseed crops, such as Camelina sativa or Crambe abyssinica.

  9. MED resulting from recessively inherited mutations in the gene encoding calcium-activated nucleotidase CANT1. (United States)

    Balasubramanian, Karthika; Li, Bing; Krakow, Deborah; Nevarez, Lisette; Ho, Patric J; Ainsworth, Julia A; Nickerson, Deborah A; Bamshad, Michael J; Immken, LaDonna; Lachman, Ralph S; Cohn, Daniel H


    Multiple Epiphyseal Dysplasia (MED) is a relatively mild skeletal dysplasia characterized by mild short stature, joint pain, and early-onset osteoarthropathy. Dominantly inherited mutations in COMP, MATN3, COL9A1, COL9A2, and COL9A3, and recessively inherited mutations in SLC26A2, account for the molecular basis of disease in about 80-85% of the cases. In two families with recurrent MED of an unknown molecular basis, we used exome sequencing and candidate gene analysis to identify homozygosity for recessively inherited missense mutations in CANT1, which encodes calcium-activated nucleotidase 1. The MED phenotype is thus allelic to the more severe Desbuquois dysplasia phenotype and the results identify CANT1 as a second locus for recessively inherited MED. © 2017 Wiley Periodicals, Inc.

  10. Cloning and identification of a gene encoding spore cortex-lytic enzyme in Bacillus thuringiensis. (United States)

    Hu, Kun; Yang, Haihua; Liu, Gang; Tan, Huarong


    Spore cortex-lytic enzymes are essential for germination in Bacilli. A gene-encoding spore cortex-lytic enzyme designated sleB was cloned from Bacillus thuringiensis. Disruption of sleB did not affect vegetative growth of B. thuringiensis, but the fall in optical density at 600 nm in the mutant spores was much slower than in the wild type strain during spore germination induced by L-alanine. Moreover, the mutant spores did not become completely dark, as compared with the wild type strain. These showed that sleB is required for normal spore germination in B. thuringiensis. Reverse transcription polymerase chain reaction analysis indicated that sleB is transcribed during sporulation. Western blot experiment also proved that SleB accumulated in sporulating cells as a precursor protein, and in spores as a mature processed form.

  11. The abp gene in Geobacillus stearothermophilus T-6 encodes a GH27 β-L-arabinopyranosidase. (United States)

    Salama, Rachel; Alalouf, Onit; Tabachnikov, Orly; Zolotnitsky, Gennady; Shoham, Gil; Shoham, Yuval


    In this study we demonstrate that the abp gene in Geobacillus stearothermophilus T-6 encodes a family 27 glycoside hydrolase β-L-arabinopyranosidase. The catalytic constants towards the chromogenic substrate pNP-β-L-arabinopyranoside were 0.8±0.1 mM, 6.6±0.3 s(-1), and 8.2±0.3 s(-1) mM(-1) for K(m), k(cat) and k(cat)/K(m), respectively. (13)C NMR spectroscopy unequivocally showed that Abp is capable of removing β-L-arabinopyranose residues from the natural arabino-polysaccharide, larch arabinogalactan. Most family 27 enzymes are active on galactose and contain a conserved Asp residue, whereas in Abp this residue is Ile67, which shifts the specificity of the enzyme towards arabinopyranoside. Copyright © 2012 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.

  12. WRKY domain-encoding genes of a crop legume chickpea (Cicer arietinum): comparative analysis with Medicago truncatula WRKY family and characterization of group-III gene(s). (United States)

    Kumar, Kamal; Srivastava, Vikas; Purayannur, Savithri; Kaladhar, V Chandra; Cheruvu, Purnima Jaiswal; Verma, Praveen Kumar


    The WRKY genes have been identified as important transcriptional modulators predominantly during the environmental stresses, but they also play critical role at various stages of plant life cycle. We report the identification of WRKY domain (WD)-encoding genes from galegoid clade legumes chickpea (Cicer arietinum L.) and barrel medic (Medicago truncatula). In total, 78 and 98 WD-encoding genes were found in chickpea and barrel medic, respectively. Comparative analysis suggests the presence of both conserved and unique WRKYs, and expansion of WRKY family in M. truncatula primarily by tandem duplication. Exclusively found in galegoid legumes, CaWRKY16 and its orthologues encode for a novel protein having a transmembrane and partial Exo70 domains flanking a group-III WD. Genomic region of galegoids, having CaWRKY16, is more dynamic when compared with millettioids. In onion cells, fused CaWRKY16-EYFP showed punctate fluorescent signals in cytoplasm. The chickpea WRKY group-III genes were further characterized for their transcript level modulation during pathogenic stress and treatments of abscisic acid, jasmonic acid, and salicylic acid (SA) by real-time PCR. Differential regulation of genes was observed during Ascochyta rabiei infection and SA treatment. Characterization of A. rabiei and SA inducible gene CaWRKY50 showed that it localizes to plant nucleus, binds to W-box, and have a C-terminal transactivation domain. Overexpression of CaWRKY50 in tobacco plants resulted in early flowering and senescence. The in-depth comparative account presented here for two legume WRKY genes will be of great utility in hastening functional characterization of crop legume WRKYs and will also help in characterization of Exo70Js. © The Author 2016. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.

  13. Stable disruption of ethanol production by deletion of the genes encoding alcohol dehydrogenase isozymes in Saccharomyces cerevisiae. (United States)

    Ida, Yoshihiro; Furusawa, Chikara; Hirasawa, Takashi; Shimizu, Hiroshi


    We analyzed the effects of the deletions of genes encoding alcohol dehydrogenase (ADH) isozymes of Saccharomyces cerevisiae. The decrease in ethanol production by ADH1 deletion alone could be partially compensated by the upregulation of other isozyme genes, while the deletion of all known ADH isozyme genes stably disrupted ethanol production. Copyright © 2011 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

  14. Cloning and overexpression in Escherichia coli of the genes encoding NAD-dependent alcohol dehydrogenase from two Sulfolobus species. (United States)

    Cannio, R; Fiorentino, G; Carpinelli, P; Rossi, M; Bartolucci, S


    The gene adh encoding a NAD-dependent alcohol dehydrogenase from the novel strain RC3 of Sulfolobus sp. was cloned and sequenced. Both the adh gene from Sulfolobus sp. strain RC3 and the alcohol dehydrogenase gene from Sulfolobus solfataricus (DSM 1617) were expressed at a high level in Escherichia coli, and the recombinant enzymes were purified, characterized, and compared. Only a few amino acid replacements were responsible for the different kinetic and physicochemical features investigated. PMID:8550434

  15. Flagellin Encoded in Gene-Based Vector Vaccines Is a Route-Dependent Immune Adjuvant.

    Directory of Open Access Journals (Sweden)

    Hamada F Rady

    Full Text Available Flagellin has been tested as a protein-based vaccine adjuvant, with the majority of studies focused on antibody responses. Here, we evaluated the adjuvant activity of flagellin for both cellular and humoral immune responses in BALB/c mice in the setting of gene-based immunization, and have made several novel observations. DNA vaccines and adenovirus (Ad vectors were engineered to encode mycobacterial protein Ag85B, with or without flagellin of Salmonella typhimurium (FliC. DNA-encoded flagellin given IM enhanced splenic CD4+ and CD8+ T cell responses to co-expressed vaccine antigen, including memory responses. Boosting either IM or intranasally with Ad vectors expressing Ag85B without flagellin led to durable enhancement of Ag85B-specific antibody and CD4+ and CD8+ T cell responses in both spleen and pulmonary tissues, correlating with significantly improved protection against challenge with pathogenic aerosolized M. tuberculosis. However, inclusion of flagellin in both DNA prime and Ad booster vaccines induced localized pulmonary inflammation and transient weight loss, with route-dependent effects on vaccine-induced T cell immunity. The latter included marked reductions in levels of mucosal CD4+ and CD8+ T cell responses following IM DNA/IN Ad mucosal prime-boosting, although antibody responses were not diminished. These findings indicate that flagellin has differential and route-dependent adjuvant activity when included as a component of systemic or mucosally-delivered gene-based prime-boost immunization. Clear adjuvant activity for both T and B cell responses was observed when flagellin was included in the DNA priming vaccine, but side effects occurred when given in an Ad boosting vector, particularly via the pulmonary route.

  16. The microcephaly ASPM gene is expressed in proliferating tissues and encodes for a mitotic spindle protein. (United States)

    Kouprina, Natalay; Pavlicek, Adam; Collins, N Keith; Nakano, Megumi; Noskov, Vladimir N; Ohzeki, Jun-Ichirou; Mochida, Ganeshwaran H; Risinger, John I; Goldsmith, Paul; Gunsior, Michelle; Solomon, Greg; Gersch, William; Kim, Jung-Hyun; Barrett, J Carl; Walsh, Christopher A; Jurka, Jerzy; Masumoto, Hiroshi; Larionov, Vladimir


    The most common cause of primary autosomal recessive microcephaly (MCPH) appears to be mutations in the ASPM gene which is involved in the regulation of neurogenesis. The predicted gene product contains two putative N-terminal calponin-homology (CH) domains and a block of putative calmodulin-binding IQ domains common in actin binding cytoskeletal and signaling proteins. Previous studies in mouse suggest that ASPM is preferentially expressed in the developing brain. Our analyses reveal that ASPM is widely expressed in fetal and adult tissues and upregulated in malignant cells. Several alternatively spliced variants encoding putative ASPM isoforms with different numbers of IQ motifs were identified. The major ASPM transcript contains 81 IQ domains, most of which are organized into a higher order repeat (HOR) structure. Another prominent spliced form contains an in-frame deletion of exon 18 and encodes 14 IQ domains not organized into a HOR. This variant is conserved in mouse. Other spliced variants lacking both CH domains and a part of the IQ motifs were also detected, suggesting the existence of isoforms with potentially different functions. To elucidate the biochemical function of human ASPM, we developed peptide specific antibodies to the N- and C-termini of ASPM. In a western analysis of proteins from cultured human and mouse cells, the antibodies detected bands with mobilities corresponding to the predicted ASPM isoforms. Immunostaining of cultured human cells with antibodies revealed that ASPM is localized in the spindle poles during mitosis. This finding suggests that MCPH is the consequence of an impairment in mitotic spindle regulation in cortical progenitors due to mutations in ASPM.

  17. The k43 gene, required for chorion gene amplification and diploid cell chromosome replication, encodes the Drosophila homolog of yeast origin recognition complex subunit 2


    Landis, Gary; Kelley, Richard; Spradling, Allan C.; Tower, John


    Lethal alleles of the Drosophila k43 gene result in small or missing imaginal discs, greatly reduced mitotic index, and fragmented and abnormally condensed chromosomes. A female-sterile allele of k43 specifically reduces chorion gene amplification in ovarian follicle cells. k43 was cloned by chromosomal walking, and the identification of the k43 gene was confirmed by phenotypic rescue and sequence analysis of mutant alleles. The sequence analyses reveal that the k43 gene encodes the Drosophil...

  18. Cloning and functional characterization of the gene encoding the transcription factor Acel in the basidiomycete Phanerochaete chrysosporium

    Directory of Open Access Journals (Sweden)



    Full Text Available In this report we describe the isolation and characterization of a gene encoding the transcription factor Acel (Activation protein of cup 1 Expression in the white rot fungus Phanerochaete chrysosporium. Pc-acel encodes a predicted protein of 633 amino acids containing the copper-fist DNA binding domain typically found in fungal transcription factors such as Acel, Macl and Haal from Saccharomyces cerevisiae. The Pc-acel gene is localized in Scaffold 5, between coordinates 220841 and 222983. A S. cerevisiae acel null mutant strain unable to grow in high-copper medium was fully complemented by transformation with the cDNA of Pc-acel. Moreover, Northern blot hybridization studies indicated that Pc-acel cDNA restores copper inducibility of the yeast cup 1 gene, which encodes the metal-binding protein metallothionein implicated in copper resistance. To our knowledge, this is first report describing an Acel transcription factor in basidiomycetes

  19. Identification of Antithrombin-Modulating Genes. Role of LARGE, a Gene Encoding a Bifunctional Glycosyltransferase, in the Secretion of Proteins? (United States)

    de la Morena-Barrio, María Eugenia; Buil, Alfonso; Antón, Ana Isabel; Martínez-Martínez, Irene; Miñano, Antonia; Gutiérrez-Gallego, Ricardo; Navarro-Fernández, José; Aguila, Sonia; Souto, Juan Carlos; Vicente, Vicente; Soria, José Manuel; Corral, Javier


    The haemostatic relevance of antithrombin together with the low genetic variability of SERPINC1, and the high heritability of plasma levels encourage the search for modulating genes. We used a hypothesis-free approach to identify these genes, evaluating associations between plasma antithrombin and 307,984 polymorphisms in the GAIT study (352 individuals from 21 Spanish families). Despite no SNP reaching the genome wide significance threshold, we verified milder positive associations in 307 blood donors from a different cohort. This validation study suggested LARGE, a gene encoding a protein with xylosyltransferase and glucuronyltransferase activities that forms heparin-like linear polysaccharides, as a potential modulator of antithrombin based on the significant association of one SNPs, rs762057, with anti-FXa activity, particularly after adjustment for age, sex and SERPINC1 rs2227589 genotype, all factors influencing antithrombin levels (p = 0.02). Additional results sustained this association. LARGE silencing inHepG2 and HEK-EBNA cells did not affect SERPINC1 mRNA levels but significantly reduced the secretion of antithrombin with moderate intracellular retention. Milder effects were observed on α1-antitrypsin, prothrombin and transferrin. Our study suggests LARGE as the first known modifier of plasma antithrombin, and proposes a new role for LARGE in modulating extracellular secretion of certain glycoproteins. PMID:23705025

  20. L-lactic acid production from D-xylose with Candida sonorensis expressing a heterologous lactate dehydrogenase encoding gene. (United States)

    Koivuranta, Kari T; Ilmén, Marja; Wiebe, Marilyn G; Ruohonen, Laura; Suominen, Pirkko; Penttilä, Merja


    Bioplastics, like polylactic acid (PLA), are renewable alternatives for petroleum-based plastics. Lactic acid, the monomer of PLA, has traditionally been produced biotechnologically with bacteria. With genetic engineering, yeast have the potential to replace bacteria in biotechnological lactic acid production, with the benefits of being acid tolerant and having simple nutritional requirements. Lactate dehydrogenase genes have been introduced to various yeast to demonstrate this potential. Importantly, an industrial lactic acid producing process utilising yeast has already been implemented. Utilisation of D-xylose in addition to D-glucose in production of biochemicals such as lactic acid by microbial fermentation would be beneficial, as it would allow lignocellulosic raw materials to be utilised in the production processes. The yeast Candida sonorensis, which naturally metabolises D-xylose, was genetically modified to produce L-lactic acid from D-xylose by integrating the gene encoding L-lactic acid dehydrogenase (ldhL) from Lactobacillus helveticus into its genome. In microaerobic, CaCO3-buffered conditions a C. sonorensis ldhL transformant having two copies of the ldhL gene produced 31 g l-1 lactic acid from 50 g l-1 D-xylose free of ethanol.Anaerobic production of lactic acid from D-xylose was assessed after introducing an alternative pathway of D-xylose metabolism, i.e. by adding a xylose isomerase encoded by XYLA from Piromyces sp. alone or together with the xylulokinase encoding gene XKS1 from Saccharomyces cerevisiae. Strains were further modified by deletion of the endogenous xylose reductase encoding gene, alone or together with the xylitol dehydrogenase encoding gene. Strains of C. sonorensis expressing xylose isomerase produced L-lactic acid from D-xylose in anaerobic conditions. The highest anaerobic L-lactic acid production (8.5 g l-1) was observed in strains in which both the xylose reductase and xylitol dehydrogenase encoding genes had been

  1. Identification and characterization of the gltK gene encoding a membrane-associated glucose transport protein of pseudomonas aeruginosa. (United States)

    Adewoye, L O; Worobec, E A


    The Pseudomonas aeruginosa oprB gene encodes the carbohydrate-selective OprB porin, which translocates substrate molecules across the outer membrane to the periplasmic glucose-binding protein. We identified and cloned two open reading frames (ORFs) flanking the oprB gene but are not in operonic arrangement with the oprB gene. The downstream ORF encodes a putative polypeptide homologous to members of a family of transcriptional repressors, whereas the oprB gene is preceded by an ORF encoding a putative product, which exhibits strong homology to several carbohydrate transport ATP-binding cassette (ABC) proteins. The genomic copy of the upstream ORF was mutagenized by homologous recombination. Analysis of the deletion mutant in comparison with the wild type revealed a significant reduction in [14C] glucose transport activity in the mutant strain, suggesting that this ORF likely encodes the inner membrane component of the glucose ABC transporter. It is thus designated gltK gene to reflect its homology to the Pseudomona fluorescens mtlK and its involvement in the high-affinity glucose transport system. Multiple alignment analysis revealed that the P. aeruginosa gltK gene product is a member of the MalK subfamily of ABC proteins.

  2. All genes encoding enzymes participating in melatonin biosynthesis in the chicken pineal gland are transcribed rhythmically. (United States)

    Adamska, I; Marhelava, K; Walkiewicz, D; Kedzierska, U; Markowska, M; Majewski, P M


    Our recent research on the pineal gland of young chickens confirmed that three genes encoding enzymes involved in pineal melatonin biosynthesis, tryptophan hydroxylase 1 (Tph1), arylalkylamine-N-acetyltransferase (Aanat) and acetylserotonin O-methyltransferase (Asmt), are transcribed rhythmically under light:dark (L:D) 12:12 conditions in vivo. Additionally, in the pineal gland of maturing chickens, the dopa decarboxylase (Ddc) gene is transcribed rhythmically at a specific stage of the developmental process. Therefore, the aim of the present study was to verify whether all of these genes are transcribed rhythmically in vivo under constant darkness (D:D) and in pinealocyte cultures under both L:D and D:D. Experiments were performed on chickens maintained under L:D 12:12 conditions. Chickens at 15 days of age were divided into two groups; chickens from the first group remained under the same conditions, whereas those from the second group were kept in darkness. Subsequently, 16-day-old animals were sacrificed every 2 hours over a 24-h period. For the in vitro experiments, 16-day-old chickens were sacrificed at ZT 6, and their pineal glands were isolated. Pineal cultures were maintained for up to two days in L:D conditions. Then, the pinealocyte cultures were divided into two groups: the first remained under L:D conditions, whereas the second was transferred to D:D conditions. Pinealocytes were subsequently collected every 2 hours over a 24-h period. Transcription was evaluated using the RT-qPCR method, and the rhythm percentage was calculated through Cosinor analysis. The mRNA levels of all genes examined were rhythmic under all conditions. Moreover, in silico analysis of the promoters of all of the genes examined revealed the presence of enhancer box sequences in all of the promoters as well as DBP/E4BP4 binding elements in the promoters of Tph1 and Asmt. This suggests that these genes may all be regulated transcriptionally by the molecular clock mechanism and may

  3. Diversification and molecular evolution of ATOH8, a gene encoding a bHLH transcription factor.

    Directory of Open Access Journals (Sweden)

    Jingchen Chen

    Full Text Available ATOH8 is a bHLH domain transcription factor implicated in the development of the nervous system, kidney, pancreas, retina and muscle. In the present study, we collected sequence of ATOH8 orthologues from 18 vertebrate species and 24 invertebrate species. The reconstruction of ATOH8 phylogeny and sequence analysis showed that this gene underwent notable divergences during evolution. For those vertebrate species investigated, we analyzed the gene structure and regulatory elements of ATOH8. We found that the bHLH domain of vertebrate ATOH8 was highly conserved. Mammals retained some specific amino acids in contrast to the non-mammalian orthologues. Mammals also developed another potential isoform, verified by a human expressed sequence tag (EST. Comparative genomic analyses of the regulatory elements revealed a replacement of the ancestral TATA box by CpG-islands in the eutherian mammals and an evolutionary tendency for TATA box reduction in vertebrates in general. We furthermore identified the region of the effective promoter of human ATOH8 which could drive the expression of EGFP reporter in the chicken embryo. In the opossum, both the coding region and regulatory elements of ATOH8 have some special features, such as the unique extended C-terminus encoded by the third exon and absence of both CpG islands and TATA elements in the regulatory region. Our gene mapping data showed that in human, ATOH8 was hosted in one chromosome which is a fusion product of two orthologous chromosomes in non-human primates. This unique chromosomal environment of human ATOH8 probably subjects its expression to the regulation at chromosomal level. We deduce that the great interspecific differences found in both ATOH8 gene sequence and its regulatory elements might be significant for the fine regulation of its spatiotemporal expression and roles of ATOH8, thus orchestrating its function in different tissues and organisms.

  4. [Cloning of y3 gene encoding a tobacco mosaic virus inhibitor from Coprinus comatus and transformation to Nicotiana tabacum]. (United States)

    Wang, Xueren; He, Tao; Zhang, Gaina; Hao, Jianguo; Jia, Jingfen


    The protein Y3 was a TMV inhibitor which was encoded by y3 gene. The aim of this work was to clone the full length of y3 gene from Coprinus comatus and to reveal its inhibitory function to TMV in in vivo conditions. We amplified the unknown 5'- terminal cDNA sequence of y3 gene with 5'- Full RACE Core Set (TaKaRa), obtained the full length of this gene by RT-PCR, constructed the expression plasmid pCAMBIA1301-y3 via inserting gene y3 sequence, CaMV 35 S promoter, and NOS terminator at MCS and transformed it into Nicotiana tabacum via agrobacterium-mediation. The full length of y3 gene was 534 bps including one ORF encoding 130 amino acid residues (GenBank Accession No. GQ859168; EMBL FN546262). The cDNA sequence and its deduced amino acid sequence showed high similarity (94%) to the published fragment of y3 gene sequence. Northern blot analysis proved the transcription of y3 gene in transgenic tobacco plants. The transgenic plants inoculated with TMV expressed the inhibitory activity to TMV. We cloned the full length of y3 gene and obtained transgenic tobacco plants. The expression of y3 gene in transgenic plants improved the inhibitory activity to TMV. The cloning and expression analysis of y3 gene might provide background information for future studying of y3 gene.

  5. The apeE Gene of Salmonella typhimurium Encodes an Outer Membrane Esterase Not Present in Escherichia coli


    Carinato, Maria E.; Collin-Osdoby, Patricia; Yang, Xioming; Knox, Tina M.; Conlin, Christopher A.; Miller, Charles G.


    Salmonella typhimurium apeR mutations lead to overproduction of an outer membrane-associated N-acetyl phenylalanine β-naphthyl ester-cleaving esterase that is encoded by the apeE gene (P. Collin-Osdoby and C. G. Miller, Mol. Gen. Genet. 243:674–680, 1994). This paper reports the cloning and nucleotide sequencing of the S. typhimurium apeE gene as well as some properties of the esterase that it encodes. The predicted product of apeE is a 69.9-kDa protein which is processed to a 67-kDa species ...

  6. Evolutionary genomics of plant genes encoding N-terminal-TM-C2 domain proteins and the similar FAM62 genes and synaptotagmin genes of metazoans

    Directory of Open Access Journals (Sweden)

    Craxton Molly


    Full Text Available Abstract Background Synaptotagmin genes are found in animal genomes and are known to function in the nervous system. Genes with a similar domain architecture as well as sequence similarity to synaptotagmin C2 domains have also been found in plant genomes. The plant genes share an additional region of sequence similarity with a group of animal genes named FAM62. FAM62 genes also have a similar domain architecture. Little is known about the functions of the plant genes and animal FAM62 genes. Indeed, many members of the large and diverse Syt gene family await functional characterization. Understanding the evolutionary relationships among these genes will help to realize the full implications of functional studies and lead to improved genome annotation. Results I collected and compared plant Syt-like sequences from the primary nucleotide sequence databases at NCBI. The collection comprises six groups of plant genes conserved in embryophytes: NTMC2Type1 to NTMC2Type6. I collected and compared metazoan FAM62 sequences and identified some similar sequences from other eukaryotic lineages. I found evidence of RNA editing and alternative splicing. I compared the intron patterns of Syt genes. I also compared Rabphilin and Doc2 genes. Conclusion Genes encoding proteins with N-terminal-transmembrane-C2 domain architectures resembling synaptotagmins, are widespread in eukaryotes. A collection of these genes is presented here. The collection provides a resource for studies of intron evolution. I have classified the collection into homologous gene families according to distinctive patterns of sequence conservation and intron position. The evolutionary histories of these gene families are traceable through the appearance of family members in different eukaryotic lineages. Assuming an intron-rich eukaryotic ancestor, the conserved intron patterns distinctive of individual gene families, indicate independent origins of Syt, FAM62 and NTMC2 genes. Resemblances

  7. Glyceraldehyde-3-Phosphate Dehydrogenase-Encoding Gene as a Useful Taxonomic Tool for Staphylococcus spp. (United States)

    Yugueros, Javier; Temprano, Alejandro; Berzal, Beatriz; Sánchez, María; Hernanz, Carmen; Luengo, José María; Naharro, Germán


    The gap gene of Staphylococcus aureus, encoding glyceraldehyde-3-phosphate dehydrogenase, was used as a target to amplify a 933-bp DNA fragment by PCR with a pair of primers 26 and 25 nucleotides in length. PCR products, detected by agarose gel electrophoresis, were also amplified from 12 Staphylococcus spp. analyzed previously. Hybridization with an internal 279-bp DNA fragment probe was positive in all PCR-positive samples. No PCR products were amplified when other gram-positive and gram-negative bacterial genera were analyzed using the same pair of primers. AluI digestion of PCR-generated products gave 12 different restriction fragment length polymorphism (RFLP) patterns, one for each species analyzed. However, we could detect two intraspecies RFLP patterns in Staphylococcus epidermidis, Staphylococcus hominis, and Staphylococcus simulans which were different from the other species. An identical RFLP pattern was observed for 112 S. aureus isolates from humans, cows, and sheep. The sensitivity of the PCR assays was very high, with a detection limit for S. aureus cells of 20 CFU when cells were suspended in saline. PCR amplification of the gap gene has the potential for rapid identification of at least 12 species belonging to the genus Staphylococcus, as it is highly specific. PMID:11101563

  8. [Detection of Leishmania spp. based on the gene encoding HSP20]. (United States)

    Montalvo, Ana M; Fraga, Jorge; Rodríguez, Omaira; Blanco, Orestes; Llanos-Cuentas, Alejandro; García, Ana L; Valencia, Braulio M; Muskus, Carlos; Van der Auwera, Gert; Requena, José M


    Explore a new target for molecular diagnosis of Leishmania. We evaluated the utility of the gene that encodes the heat shock protein 20-kDa (Hsp20) for detecting Leishmania by polymerase chain reaction (PCR). PCR was normalized and analytical parameters were determined, as well as the validity and diagnostic accuracy, and concordance with the PCR - 18S. PCR-Hsp20 with DNA was obtained from a group of clinical samples from different sources. The analytical parameters were adequate. The sensitivity obtained was 86% and the specificity was 100%. The concordance with the reference method was good (κ = 0.731), which supports its potential use for diagnosis. The possibility of subsequent identification of the species by sequencing the amplified product gives an additional advantage. The usefulness of this gene as a new target for the detection of Leishmania was demonstrated. Because of its potential, it is recommended to improve the sensitivity of the method and to evaluate it in different endemic regions.

  9. The you gene encodes an EGF-CUB protein essential for Hedgehog signaling in zebrafish.

    Directory of Open Access Journals (Sweden)

    Ian G Woods


    Full Text Available Hedgehog signaling is required for many aspects of development in vertebrates and invertebrates. Misregulation of the Hedgehog pathway causes developmental abnormalities and has been implicated in certain types of cancer. Large-scale genetic screens in zebrafish have identified a group of mutations, termed you-class mutations, that share common defects in somite shape and in most cases disrupt Hedgehog signaling. These mutant embryos exhibit U-shaped somites characteristic of defects in slow muscle development. In addition, Hedgehog pathway mutations disrupt spinal cord patterning. We report the positional cloning of you, one of the original you-class mutations, and show that it is required for Hedgehog signaling in the development of slow muscle and in the specification of ventral fates in the spinal cord. The you gene encodes a novel protein with conserved EGF and CUB domains and a secretory pathway signal sequence. Epistasis experiments support an extracellular role for You upstream of the Hedgehog response mechanism. Analysis of chimeras indicates that you mutant cells can appropriately respond to Hedgehog signaling in a wild-type environment. Additional chimera analysis indicates that wild-type you gene function is not required in axial Hedgehog-producing cells, suggesting that You is essential for transport or stability of Hedgehog signals in the extracellular environment. Our positional cloning and functional studies demonstrate that You is a novel extracellular component of the Hedgehog pathway in vertebrates.

  10. Cloning and analysis of the DNA polymerase-encoding gene from Thermus filiformis. (United States)

    Jung, S E; Choi, J J; Kim, H K; Kwon, S T


    The gene encoding Thermus filiformis (Tfi) DNA polymerase was cloned and its nucleotide sequence was determined. The primary structure of Tfi DNA polymerase was deduced from its nucleotide sequence. Tfi DNA polymerase is comprised of 833 amino acid residues and its molecular mass was determined to be 93,890 Da. The deduced amino acid sequence of Tfi DNA polymerase showed a high sequence homology to E. coli DNA polymerase I-like DNA polymerases: 78.5% homology to Taq DNA polymerase, 78.4% to Tca DNA polymerase, and 41.8% to E. coli DNA polymerase I. An extremely high sequence identity was observed in the region containing polymerase activity. The G + C content of the coding region for the Tfi DNA polymerase gene was 68.5%, which was higher than that of the chromosomal DNA (65%). The G + C contents in the first, second, and third positions of the codons used were 71.8%, 40.9%, and 92.7% respectively. Codon usage in Tfi DNA polymerase was heavily biased towards the use of G + C in the third position. Rare codons with U or A as the third base were sometimes used to avoid using GA(A/T) TC and TCGA sequences, as they are recognition sites for the restriction endonucleases TfiI and TaqI.

  11. Saccharomyces cerevisiae gene ISW2 encodes a microtubule-interacting protein required for premeiotic DNA replication. (United States)

    Trachtulcová, P; Janatová, I; Kohlwein, S D; Hasek, J


    A molecular genetic characterization of the ORF YOR304W (ISW2), identified in a screen of a yeast lambdagt11 library using a monoclonal antibody that reacts with a 210 kDa mammalian microtubule-interacting protein, is presented in this paper. The protein encoded by the ORF YOR304W is 50% identical to the Drosophila nucleosome remodelling factor ISWI and is therefore a new member of the SNF2 protein family and has been recently entered into SDG as ISW2. Although not essential for vegetative growth, we found that the ISW2 gene is required for early stages in sporulation. The isw2 homozygous deletant diploid strain was blocked in the G(1) phase of the cell cycle, unable to execute the premeiotic DNA replication and progress through the nuclear meiotic division cycle. ISW2 expression from a multicopy plasmid had the same effect as deletion, but ISW2 expression from a centromeric plasmid rescued the deletion phenotype. In vegetatively growing diploid cells, the Isw2 protein was preferentially found in the cytoplasm, co-localizing with microtubules. An accumulation of the Isw2 protein within the nucleus was observed in cells entering sporulation. Together with data published very recently by Tsukiyama et al. (1999), we propose a role for the Isw2 protein in facilitating chromatin accessibility for transcriptional factor(s) that positively regulate meiosis/sporulation-specific genes. Copyright 2000 John Wiley & Sons, Ltd.

  12. Cotton PRP5 gene encoding a proline-rich protein is involved in fiber development. (United States)

    Xu, Wen-Liang; Zhang, De-Jing; Wu, Yan-Feng; Qin, Li-Xia; Huang, Geng-Qing; Li, Juan; Li, Long; Li, Xue-Bao


    Proline-rich proteins contribute to cell wall structure of specific cell types and are involved in plant growth and development. In this study, a fiber-specific gene, GhPRP5, encoding a proline-rich protein was functionally characterized in cotton. GhPRP5 promoter directed GUS expression only in trichomes of both transgenic Arabidopsis and tobacco plants. The transgenic Arabidopsis plants with overexpressing GhPRP5 displayed reduced cell growth, resulting in smaller cell size and consequently plant dwarfs, in comparison with wild type plants. In contrast, knock-down of GhPRP5 expression by RNA interference in cotton enhanced fiber development. The fiber length of transgenic cotton plants was longer than that of wild type. In addition, some genes involved in fiber elongation and wall biosynthesis of cotton were up-regulated or down-regulated in the transgenic cotton plants owing to suppression of GhPRP5. Collectively, these data suggested that GhPRP5 protein as a negative regulator participates in modulating fiber development of cotton.

  13. Arabidopsis STAY-GREEN, Mendel's Green Cotyledon Gene, Encodes Magnesium-Dechelatase. (United States)

    Shimoda, Yousuke; Ito, Hisashi; Tanaka, Ayumi


    Pheophytin a is an essential component of oxygenic photosynthetic organisms, because the primary charge separation between chlorophyll a and pheophytin a is the first step in the conversion of light energy. In addition, conversion of chlorophyll a to pheophytin a is the first step of chlorophyll degradation. Pheophytin is synthesized by extracting magnesium (Mg) from chlorophyll; the enzyme Mg-dechelatase catalyzes this reaction. In this study, we report that Mendel's green cotyledon gene, STAY-GREEN (SGR), encodes Mg-dechelatase. The Arabidopsis thaliana genome has three SGR genes, STAY-GREEN1 (SGR1), STAY-GREEN2 (SGR2), and STAY-GREEN LIKE (SGRL). Recombinant SGR1/2 extracted Mg from chlorophyll a but had very low or no activity against chlorophyllide a; in contrast, SGRL had higher dechelating activity against chlorophyllide a compared to chlorophyll a. All SGRs could not extract Mg from chlorophyll b. Enzymatic experiments using the photosystem and light-harvesting complexes showed that SGR extracts Mg not only from free chlorophyll but also from chlorophyll in the chlorophyll-protein complexes. Furthermore, most of the chlorophyll and chlorophyll-binding proteins disappeared when SGR was transiently expressed by a chemical induction system. Thus, SGR is not only involved in chlorophyll degradation but also contributes to photosystem degradation. {copyright, serif} 2016 American Society of Plant Biologists. All rights reserved.

  14. Cloning, mapping and nucleotide sequencing of a gene encoding a universal stress protein in Escherichia coli. (United States)

    Nyström, T; Neidhardt, F C


    The response of non-differentiating bacteria to nutrient starvation is complex and includes the sequential synthesis of starvation-inducible proteins. Although starvation for different individual nutrients generally provokes unique and individual patterns of protein expression, some starvation stimulons share member proteins. Two-dimensional polyacrylamide gel electrophoresis revealed that the synthesis of a small (13.5 kDa) cytoplasmic protein in Escherichia coli was greatly increased during growth inhibition caused by the exhaustion of any of a variety of nutrients (carbon, nitrogen, phosphate, sulphate, required amino acid) or by the presence of a variety of toxic agents including heavy metals, oxidants, acids and antibiotics. To determine further the mode of regulation of the protein designated UspA (universal stress protein A) we cloned the gene encoding the protein by the technique of reverse genetics. We isolated the protein from a preparative two-dimensional polyacrylamide gel, determined its N-terminal amino acid sequence, and used this sequence to construct a degenerate oligonucleotide probe. Two phages of the Kohara library were found to contain the gene which then was subcloned from the DNA in the overlapping region of these two clones. The amino acid sequence, deduced from the nucleotide sequence of the uspA gene, shows no significant homology with any other known protein. The uspA gene maps at 77 min on the E. coli W3110 chromosome, and is transcribed in a clockwise direction. The increase in the level of UspA during growth arrest was found to be primarily a result of transcriptional activation of the corresponding gene. The induction was independent of the RelA/SpoT, RpoH, KatF, OmpR, AppY, Lrp, PhoB and H-NS proteins during stress conditions that are known to induce or activate these global regulators. The -10 and -35 regions upstream of the transcriptional start site of the uspA gene are characteristic of a sigma 70-dependent promoter.

  15. Proanthocyanidin synthesis in Theobroma cacao: genes encoding anthocyanidin synthase, anthocyanidin reductase, and leucoanthocyanidin reductase. (United States)

    Liu, Yi; Shi, Zi; Maximova, Siela; Payne, Mark J; Guiltinan, Mark J


    The proanthocyanidins (PAs), a subgroup of flavonoids, accumulate to levels of approximately 10% total dry weight of cacao seeds. PAs have been associated with human health benefits and also play important roles in pest and disease defense throughout the plant. To dissect the genetic basis of PA biosynthetic pathway in cacao (Theobroma cacao), we have isolated three genes encoding key PA synthesis enzymes, anthocyanidin synthase (ANS), anthocyanidin reductase (ANR) and leucoanthocyanidin reductase (LAR). We measured the expression levels of TcANR, TcANS and TcLAR and PA content in cacao leaves, flowers, pod exocarp and seeds. In all tissues examined, all three genes were abundantly expressed and well correlated with PA accumulation levels, suggesting their active roles in PA synthesis. Overexpression of TcANR in an Arabidopsis ban mutant complemented the PA deficient phenotype in seeds and resulted in reduced anthocyanidin levels in hypocotyls. Overexpression of TcANS in tobacco resulted in increased content of both anthocyanidins and PAs in flower petals. Overexpression of TcANS in an Arabidopsis ldox mutant complemented its PA deficient phenotype in seeds. Recombinant TcLAR protein converted leucoanthocyanidin to catechin in vitro. Transgenic tobacco overexpressing TcLAR had decreased amounts of anthocyanidins and increased PAs. Overexpressing TcLAR in Arabidopsis ldox mutant also resulted in elevated synthesis of not only catechin but also epicatechin. Our results confirm the in vivo function of cacao ANS and ANR predicted based on sequence homology to previously characterized enzymes from other species. In addition, our results provide a clear functional analysis of a LAR gene in vivo.

  16. Adenovirus-encoding virus-associated RNAs suppress HDGF gene expression to support efficient viral replication.

    Directory of Open Access Journals (Sweden)

    Saki Kondo

    Full Text Available Non-coding small RNAs are involved in many physiological responses including viral life cycles. Adenovirus-encoding small RNAs, known as virus-associated RNAs (VA RNAs, are transcribed throughout the replication process in the host cells, and their transcript levels depend on the copy numbers of the viral genome. Therefore, VA RNAs are abundant in infected cells after genome replication, i.e. during the late phase of viral infection. Their function during the late phase is the inhibition of interferon-inducible protein kinase R (PKR activity to prevent antiviral responses; recently, mivaRNAs, the microRNAs processed from VA RNAs, have been reported to inhibit cellular gene expression. Although VA RNA transcription starts during the early phase, little is known about its function. The reason may be because much smaller amount of VA RNAs are transcribed during the early phase than the late phase. In this study, we applied replication-deficient adenovirus vectors (AdVs and novel AdVs lacking VA RNA genes to analyze the expression changes in cellular genes mediated by VA RNAs using microarray analysis. AdVs are suitable to examine the function of VA RNAs during the early phase, since they constitutively express VA RNAs but do not replicate except in 293 cells. We found that the expression level of hepatoma-derived growth factor (HDGF significantly decreased in response to the VA RNAs under replication-deficient condition, and this suppression was also observed during the early phase under replication-competent conditions. The suppression was independent of mivaRNA-induced downregulation, suggesting that the function of VA RNAs during the early phase differs from that during the late phase. Notably, overexpression of HDGF inhibited AdV growth. This is the first report to show the function, in part, of VA RNAs during the early phase that may be contribute to efficient viral growth.

  17. Mutations of the CEP290 gene encoding a centrosomal protein cause Meckel-Gruber syndrome. (United States)

    Frank, Valeska; den Hollander, Anneke I; Brüchle, Nadina Ortiz; Zonneveld, Marijke N; Nürnberg, Gudrun; Becker, Christian; Du Bois, Gabriele; Kendziorra, Heide; Roosing, Susanne; Senderek, Jan; Nürnberg, Peter; Cremers, Frans P M; Zerres, Klaus; Bergmann, Carsten


    Meckel-Gruber syndrome (MKS) is an autosomal recessive, lethal multisystemic disorder characterized by meningooccipital encephalocele, cystic kidney dysplasia, hepatobiliary ductal plate malformation, and postaxial polydactyly. Recently, genes for MKS1 and MKS3 were identified, putting MKS on the list of ciliary disorders (ciliopathies). By positional cloning in a distantly related multiplex family, we mapped a novel locus for MKS to a 3-Mb interval on 12q21. Sequencing of the CEP290 gene located in the minimal critical region showed a homozygous 1-bp deletion supposed to lead to loss of function of the encoded centrosomal protein CEP290/nephrocystin-6. CEP290 is thought to be involved in chromosome segregation and localizes to cilia, centrosomes, and the nucleus. Subsequent analysis of another consanguineous multiplex family revealed homozygous haplotypes and the same frameshift mutation. Our findings add to the increasing body of evidence that ciliopathies can cause a broad spectrum of disease phenotypes, and pleiotropic effects of CEP290 mutations range from single organ involvement with isolated Leber congenital amaurosis to Joubert syndrome and lethal early embryonic multisystemic malformations in Meckel-Gruber syndrome. We compiled clinical and genetic data of all patients with CEP290 mutations described so far. No clear-cut genotype-phenotype correlations were apparent as almost all mutations are nonsense, frameshift, or splice-site changes and scattered throughout the gene irrespective of the patients' phenotypes. Conclusively, other factors than the type and location of CEP290 mutations may underlie phenotypic variability. (c) 2007 Wiley-Liss, Inc.

  18. The occurrence of subtilase-cytotoxin-encoding genes in environmental Escherichia coli isolated from a Northern California estuary. (United States)

    Pereira, Maria das Graças C; Byrne, Barbara A; Nguyen, Trân B H; Lewis, David J; Atwill, E Robert


    The presence of subtilase-cytotoxin-encoding genes was determined in 397 environmental Escherichia coli strains isolated from water, suspended solids, and sediments sampled from different hydrological and environmental conditions in a California estuary. A total of 7 strains (1.76%) were found to harbor subtilase-cytotoxin-encoding genes. Using primers targeting subA only, we generated PCR amplicons from 2 strains; while using primers targeting the 3' end of SubA downstream to the 5' end of SubB, amplicons of 232 bp were generated from 5 additional strains. The 556 bp subA sequences were almost identical to that in the subtilase-cytotoxin-positive strain ED 591 (98%), while subAB sequences of 2 non-Shiga-toxigenic strains revealed 100% similarity with the Shiga-toxigenic E. coli O113:H21 strain 98NK2 that was isolated from an outbreak of hemolytic uremic syndrome. Additionally, the serogroup O113:H21 was present in this collection of environmental E. coli, and it was found to harbor stx2d, hra1 that encodes the heat resistant agglutinin 1, and a subAB sequence similar to that in the non-Shiga-toxigenic E. coli subtilase cytotoxin strain ED 591. To further understand potential health risks posed by strains encoding SubAB, future epidemiological studies should consider screening isolates for subAB regardless of the presence of Shiga-toxin-encoding genes.

  19. Distribution and diversity of tetracycline resistance genes encoding ribosomal protection proteins in Mekong river sediments in Vietnam. (United States)

    Kobayashi, Takeshi; Suehiro, Fujiyo; Cach Tuyen, Bui; Suzuki, Satoru


    We investigated the distribution and diversity of tetracycline resistance genes encoding ribosomal protection proteins (RPPs) in river and channel sediments of the Mekong Delta in Vietnam. The sediment samples were taken from nine sites in the Hau River in southern Vietnam and from 1 site in a channel in Can Tho City in May 2004 using an Ekman-Birge sediment surface sampler. The RPP genes were amplified using PCR with DNA templates obtained directly from the sediments. The tet(M), tet(S), and tet(W) genes were detected by PCR in most sediment samples. Denaturing gradient gel electrophoresis analysis of these genes and sequencing of the resulting bands showed that tet(S) and tet(W) had only one genotype each, but that tet(M) had at least two, which were tentatively called type 1 and type 2. Type 1 tet(M) was identical to the gene encoded in various plasmids and transposons of gram-positive and gram-negative bacteria, and type 2tet(M) was similar to the gene encoded in Tn1545 of Enterococcus faecalis (99% identity, 170 bp/171 bp). This study showed that various RPP genes were widely distributed in the river and channel sediments of the Mekong Delta.

  20. Quantitative analysis of clinically relevant mutations occurring in lymphoid cells harboring γ-retrovirus-encoded hsvtk suicide genes


    Wang, X.; Olszewska, M; Capacio, V; Stefanski, J; Przybylowski, M.; Samakoglu, S; Chang, AH; Sadelain, M.; Rivière, I


    The in vivo regulation of T lymphocyte activity by the activation of a suicide mechanism is an essential paradigm for the safety of adoptive cell therapies. In light of reports showing that γ-retroviral vector-encoded herpes simplex virus thymidine kinase (hsvtk) undergoes recombination, we undertook a thorough investigation of the genomic stability of SFG-based vectors using two variants of the wild-type hsvtk gene. In a large panel of independent clones, we demonstrate that both hsvtk genes...

  1. Mutagenesis of the gene encoding cytochrome c550 of Paracoccus denitrificans and analysis of the resultant physiological effects.


    Van Spanning, R J; Wansell, C; Harms, N; Oltmann, L F; Stouthamer, A H


    By using synthetic oligonucleotides, the gene encoding soluble cytochrome c550 was isolated from a genomic bank of Paracoccus denitrificans. The nucleotide sequence of the gene was determined, and the deduced amino acid sequence of the mature protein was found to be similar to the primary structure of purified cytochrome c550 except for the presence of seven additional amino acid residues at the C terminus. At the N terminus of the primary structure was found an additional stretch of 19 amino...

  2. The ARG9 Gene Encodes the Plastid-Resident N-Acetyl Ornithine Aminotransferase in the Green Alga Chlamydomonas reinhardtii▿


    Remacle, Claire; Cline, Sara; Boutaffala, Layla; Gabilly, Stéphane; Larosa, Véronique; Barbieri, M. Rosario; Coosemans, Nadine; Hamel, Patrice P.


    Here we report the characterization of the Chlamydomonas reinhardtii gene ARG9, encoding the plastid resident N-acetyl ornithine aminotransferase, which is involved in arginine synthesis. Integration of an engineered ARG9 cassette in the plastid chromosome of the nuclear arg9 mutant restores arginine prototrophy. This suggests that ARG9 could be used as a new selectable marker for plastid transformation.

  3. Molecular cloning of the gene which encodes beta-N-acetylglucosaminidase from a marine bacterium, Alteromonas sp. strain O-7. (United States)

    Tsujibo, H; Fujimoto, K; Tanno, H; Miyamoto, K; Kimura, Y; Imada, C; Okami, Y; Inamori, Y


    The gene encoding the periplasmic beta-N-acetylglucosaminidase (GlcNAcase B) from a marine Alteromonas sp. strain, O-7, was cloned and sequenced. The protein sequence of GlcNAcase B revealed a highly significant homology with Vibrio GlcNAcase and alpha- and beta-chains of human beta-hexosaminidase. PMID:7574618

  4. Molecular cloning of the gene which encodes beta-N-acetylglucosaminidase from a marine bacterium, Alteromonas sp. strain O-7.


    Tsujibo, H; Fujimoto, K; Tanno, H; Miyamoto, K.; Kimura, Y.; Imada, C; Okami, Y; Inamori, Y


    The gene encoding the periplasmic beta-N-acetylglucosaminidase (GlcNAcase B) from a marine Alteromonas sp. strain, O-7, was cloned and sequenced. The protein sequence of GlcNAcase B revealed a highly significant homology with Vibrio GlcNAcase and alpha- and beta-chains of human beta-hexosaminidase.

  5. Differential regulation of mnp2, a new manganese peroxidase-encoding gene from the ligninolytic fungus Trametes versicolor PRL 572 (United States)

    Tomas Johansson; Per Olof Nyman; Daniel Cullen


    A peroxidase-encoding gene, mnp2, and its corresponding cDNA were characterized from the white-rot basidiomycete Trametes versicolor PRL 572. We used quantitative reverse transcriptase-mediated PCR to identify mnp2 transcripts in nutrient-limited stationary cultures. Although mnp2 lacks upstream metal response elements (MREs), addition of MnSO4 to cultures increased...

  6. Expression of the Immediate-Early Gene-Encoded Protein Egr-1 ("zif268") during in Vitro Classical Conditioning (United States)

    Mokin, Maxim; Keifer, Joyce


    Expression of the immediate-early genes (IEGs) has been shown to be induced by activity-dependent synaptic plasticity or behavioral training and is thought to play an important role in long-term memory. In the present study, we examined the induction and expression of the IEG-encoded protein Egr-1 during an in vitro neural correlate of eyeblink…

  7. Genetic association analysis of 13 nuclear-encoded mitochondrial candidate genes with type II diabetes mellitus : the DAMAGE study

    NARCIS (Netherlands)

    Reiling, Erwin; van Vliet-Ostaptchouk, Jana V.; van't Riet, Esther; van Haeften, Timon W.; Arp, Pascal A.; Hansen, Torben; Kremer, Dennis; Groenewoud, Marlous J.; van Hove, Els C.; Romijn, Johannes A.; Smit, Jan W. A.; Nijpels, Giel; Heine, Robert J.; Uitterlinden, Andre G.; Pedersen, Oluf; Slagboom, P. Eline; Maassen, Johannes A.; Hofker, Marten H.; 't Hart, Leen M.; Dekker, Jacqueline M.

    Mitochondria play an important role in many processes, like glucose metabolism, fatty acid oxidation and ATP synthesis. In this study, we aimed to identify association of common polymorphisms in nuclear-encoded genes involved in mitochondrial protein synthesis and biogenesis with type II diabetes

  8. Genetic association analysis of 13 nuclear-encoded mitochondrial candidate genes with type II diabetes mellitus: The DAMAGE study

    DEFF Research Database (Denmark)

    Reiling, Erwin; van Vliet-Ostaptchouk, Jana V; van 't Riet, Esther


    Mitochondria play an important role in many processes, like glucose metabolism, fatty acid oxidation and ATP synthesis. In this study, we aimed to identify association of common polymorphisms in nuclear-encoded genes involved in mitochondrial protein synthesis and biogenesis with type II diabetes...

  9. The genome of the mustard leaf beetle encodes two active xylanases originally acquired from bacteria through horizontal gene transfer. (United States)

    Pauchet, Yannick; Heckel, David G


    The primary plant cell wall comprises the most abundant polysaccharides on the Earth and represents a rich source of energy for organisms which have evolved the ability to digest them. Enzymes able to degrade plant cell wall polysaccharides are widely distributed in micro-organisms but are generally absent in animals, although their presence in insects, especially phytophagous beetles from the superfamilies Chrysomeloidea and Curculionoidea, has recently begun to be appreciated. The observed patchy distribution of endogenous genes encoding these enzymes in animals has raised questions about their evolutionary origins. Recent evidence suggests that endogenous plant cell wall degrading enzymes-encoding genes have been acquired by animals through a mechanism known as horizontal gene transfer (HGT). HGT describes how genetic material is moved by means other than vertical inheritance from a parent to an offspring. Here, we provide evidence that the mustard leaf beetle, Phaedon cochleariae, possesses in its genome genes encoding active xylanases from the glycoside hydrolase family 11 (GH11). We also provide evidence that these genes were originally acquired by P. cochleariae from a species of gammaproteobacteria through HGT. This represents the first example of the presence of genes from the GH11 family in animals.

  10. Transcript accumulation from the rpoS gene encoding a stationary-phase sigma factor in Pseudomonas chlororaphis strain O6 is regulated by the polyphosphate kinase gene. (United States)

    Kim, H J; Yang, K Y; Cho, B H; Kim, K Y; Lee, M C; Kim, Y H; Anderson, A J; Kim, Y C


    Polyphosphate levels are modulated by the actions of polyphosphate kinase, encoded by ppk, and exopolyphosphatase, encoded by ppx. The genes ppk and ppx are adjacent to each other in the genome of the root colonizer, Pseudomonas chlororaphis O6. A ppk-deficient mutant was more sensitive to oxidative stress than the wild-type and the ppx mutant. Transcripts from ppx increased as cultures matured from mid- to late-logarithmic and stationary phases, whereas abundance was greater for ppk in the late-logarithmic phase than in the stationary phase. Transcript accumulation from the rpoS gene, encoding the stationary-phase sigma factor RpoS, was decreased in the mid- and late-logarithmic and stationary phases in the ppk mutant. Thus, ppk regulates rpoS transcript accumulation in P. chlororaphis 06. However, mutations in either the ppk or ppx genes had no effect on induction of systemic resistance in plants colonized by P. chlororaphis O6.

  11. Efficient antibody diversification by gene conversion in vivo in the absence of selection for V(D)J-encoded determinants. (United States)

    Sayegh, C E; Drury, G; Ratcliffe, M J


    Antibody diversification in the bursa of Fabricius occurs by gene conversion: pseudogene-derived sequences replace homologous sequences in rearranged immunoglobulin genes. Bursal cells expressing a truncated immunoglobulin mu heavy chain, introduced by retroviral gene transfer, bypass normal requirements for endogenous surface immunoglobulin expression. Immunoglobulin light chain rearrangements in such cells undergo gene conversion under conditions where the products are not selected based on their ability to encode a functional protein. The efficiency with which gene conversion maintains a productive reading frame exceeds 97% under such non-selective conditions. By analysis of donor pseudogene usage we demonstrate that bursal cell development is not driven by a restricted set of antigenic specificities. We further demonstrate that gene conversion can restore a productive reading frame to out-of-frame VJ(L) junctions, providing a rationale for the elimination of cells containing non-productive VJ(L) rearrangements prior to the onset of gene conversion in normal bursal cell development.

  12. The life-extending gene Indy encodes an exchanger for Krebs-cycle intermediates. (United States)

    Knauf, Felix; Mohebbi, Nilufar; Teichert, Carsten; Herold, Diana; Rogina, Blanka; Helfand, Stephen; Gollasch, Maik; Luft, Friedrich C; Aronson, Peter S


    A longevity gene called Indy (for 'I'm not dead yet'), with similarity to mammalian genes encoding sodium-dicarboxylate cotransporters, was identified in Drosophila melanogaster. Functional studies in Xenopus oocytes showed that INDY mediates the flux of dicarboxylates and citrate across the plasma membrane, but the specific transport mechanism mediated by INDY was not identified. To test whether INDY functions as an anion exchanger, we examined whether substrate efflux is stimulated by transportable substrates added to the external medium. Efflux of [14C]citrate from INDY-expressing oocytes was greatly accelerated by the addition of succinate to the external medium, indicating citrate-succinate exchange. The succinate-stimulated [14C]citrate efflux was sensitive to inhibition by DIDS (4,4'-di-isothiocyano-2,2'-disulphonic stilbene), as demonstrated previously for INDY-mediated succinate uptake. INDY-mediated efflux of [14C]citrate was also stimulated by external citrate and oxaloacetate, indicating citrate-citrate and citrate-oxaloacetate exchange. Similarly, efflux of [14C]succinate from INDY-expressing oocytes was stimulated by external citrate, alpha-oxoglutarate and fumarate, indicating succinate-citrate, succinate-alpha-oxoglutarate and succinate-fumarate exchange respectively. Conversely, when INDY-expressing Xenopus oocytes were loaded with succinate and citrate, [14C]succinate uptake was markedly stimulated, confirming succinate-succinate and succinate-citrate exchange. Exchange of internal anion for external citrate was markedly pH(o)-dependent, consistent with the concept that citrate is co-transported with a proton. Anion exchange was sodium-independent. We conclude that INDY functions as an exchanger of dicarboxylate and tricarboxylate Krebs-cycle intermediates. The effect of decreasing INDY activity, as in the long-lived Indy mutants, may be to alter energy metabolism in a manner that favours lifespan extension.

  13. StAR Enhances Transcription of Genes Encoding the Mitochondrial Proteases Involved in Its Own Degradation (United States)

    Bahat, Assaf; Perlberg, Shira; Melamed-Book, Naomi; Lauria, Ines; Langer, Thomas


    Steroidogenic acute regulatory protein (StAR) is essential for steroid hormone synthesis in the adrenal cortex and the gonads. StAR activity facilitates the supply of cholesterol substrate into the inner mitochondrial membranes where conversion of the sterol to a steroid is catalyzed. Mitochondrial import terminates the cholesterol mobilization activity of StAR and leads to mounting accumulation of StAR in the mitochondrial matrix. Our studies suggest that to prevent mitochondrial impairment, StAR proteolysis is executed by at least 2 mitochondrial proteases, ie, the matrix LON protease and the inner membrane complexes of the metalloproteases AFG3L2 and AFG3L2:SPG7/paraplegin. Gonadotropin administration to prepubertal rats stimulated ovarian follicular development associated with increased expression of the mitochondrial protein quality control system. In addition, enrichment of LON and AFG3L2 is evident in StAR-expressing ovarian cells examined by confocal microscopy. Furthermore, reporter studies of the protease promoters examined in the heterologous cell model suggest that StAR expression stimulates up to a 3.5-fold increase in the protease gene transcription. Such effects are StAR-specific, are independent of StAR activity, and failed to occur upon expression of StAR mutants that do not enter the matrix. Taken together, the results of this study suggest the presence of a novel regulatory loop, whereby acute accumulation of an apparent nuisance protein in the matrix provokes a mitochondria to nucleus signaling that, in turn, activates selected transcription of genes encoding the enrichment of mitochondrial proteases relevant for enhanced clearance of StAR. PMID:24422629

  14. Identification of genes encoding glycosyltransferases involved in lipopolysaccharide synthesis in Porphyromonas gingivalis. (United States)

    Shoji, Mikio; Sato, Keiko; Yukitake, Hideharu; Kamaguchi, Arihide; Sasaki, Yuko; Naito, Mariko; Nakayama, Koji


    Porphyromonas gingivalis can synthesize both A-LPS and O-LPS, which contain anionic O-polysaccharides and conventional O-polysaccharides, respectively. A-LPS can anchor virulence proteins to the cell surface, and elucidating the mechanism of A-LPS synthesis is therefore important for understanding the pathogenicity of this bacterium. To identify the genes involved in LPS synthesis, we focused on uncharacterized genes encoding the glycosyltransferases, PGN_0361, PGN_ 1239, PGN_1240, and PGN_1668, which were tentatively named gtfC, gtfD, gtfE, and gtfF, respectively, and characterized their mutants. We found that disruption of gtfC and gtfF resulted in A-LPS deficiency. In addition, a gtfD mutant had abnormal A-LPS synthesis, and a gtfE mutant exhibited a rough-type LPS which possesses a short oligosaccharide with lipid A-core. We then constructed a gtfC and gtfD double mutant, since their amino acid sequences are very similar, and this mutant similarly possessed a rough-type LPS. Cross-complementation analysis revealed that the GtfD protein is a functional homolog of the Escherichia coli WbbL protein, which is a rhamnosyltransferase. These results suggested that the GtfE protein is essential for the synthesis of both O-LPS and A-LPS, and that GtfC and GtfD proteins may work together to synthesize the two kinds of LPS. In addition, the GtfF protein was essential for A-LPS synthesis, although this may be achieved in a strain-specific manner. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

  15. Gene encoding erythrocyte binding ligand linked to blood stage multiplication rate phenotype in Plasmodium yoelii yoelii. (United States)

    Pattaradilokrat, Sittiporn; Culleton, Richard L; Cheesman, Sandra J; Carter, Richard


    Variation in the multiplication rate of blood stage malaria parasites is often positively correlated with the severity of the disease they cause. The rodent malaria parasite Plasmodium yoelii yoelii has strains with marked differences in multiplication rate and pathogenicity in the blood. We have used genetic analysis by linkage group selection (LGS) to identify genes that determine differences in multiplication rate. Genetic crosses were generated between genetically unrelated, fast- (17XYM) and slowly multiplying (33XC) clones of P. y. yoelii. The uncloned progenies of these crosses were placed under multiplication rate selection in blood infections in mice. The selected progenies were screened for reduction in intensity of quantitative genetic markers of the slowly multiplying parent. A small number of strongly selected markers formed a linkage group on P. y. yoelii chromosome 13. Of these, that most strongly selected marked the gene encoding the P. yoelii erythrocyte binding ligand (pyebl), which has been independently identified by Otsuki and colleagues [Otsuki H, et al. (2009) Proc Natl Acad Sci USA 106:10.1073/pnas.0811313106] as a major determinant of virulence in these parasites. In an analysis of a previous genetic cross in P. y. yoelii, pyebl alleles of fast- and slowly multiplying parents segregated with the fast and slow multiplication rate phenotype in the cloned recombinant progeny, implying the involvement of the pyebl locus in determining the multiplication rate. Our genome-wide LGS analysis also indicated effects of at least 1 other locus on multiplication rate, as did the findings of Otsuki and colleagues on virulence in P. y. yoelii.

  16. Plasmodium falciparum var genes expressed in children with severe malaria encode CIDRα1 domains

    DEFF Research Database (Denmark)

    Jespersen, Jakob S.; Wang, Christian W.; Mkumbaye, Sixbert I.


    Most severe Plasmodium falciparum infections are experienced by young children. Severe symptoms are precipitated by vascular sequestration of parasites expressing a particular subset of the polymorphic P. falciparum erythrocyte membrane protein 1 (PfEMP1) adhesion molecules. Parasites binding hum...... the hypothesis that the CIDRα1-EPCR interaction is key to the pathogenesis of severe malaria and strengthen the rationale for pursuing a vaccine or adjunctive treatment aiming at inhibiting or reducing the damaging effects of this interaction....... endothelial protein C receptor (EPCR) through the CIDRα1 domain of certain PfEMP1 were recently associated with severe malaria in children. However, it has remained unclear to which extend the EPCR-binding CIDRα1 domains epitomize PfEMP1 expressed in severe malaria. Here, we characterized the near full......-length transcripts dominating the var transcriptome in children with severe malaria and found that the only common feature of the encoded PfEMP1 was CIDRα1 domains. Such genes were highly and dominantly expressed in both children with severe malarial anaemia and cerebral malaria. These observations support...

  17. Idiopathic neonatal necrotising fasciitis caused by community-acquired MSSA encoding Panton Valentine Leukocidin genes.

    LENUS (Irish Health Repository)

    Dunlop, Rebecca L E


    Neonatal necrotising fasciitis is very rare in comparison to the adult presentation of the disease and a Plastic Surgeon may only encounter one such case during his or her career. Often this is initially misdiagnosed and managed as simple cellulitis. It generally affects previously healthy babies, the site is often the lower back area and a history of minor skin trauma may be elicited. The causative organism is usually Streptococcus or polymicrobial, as is the case in the adult population. We present the case of a previously healthy 11-day-old infant with idiopathic, rapidly progressive necrotising fasciitis of the back, cause by Methicillin sensitive Staphylococcus aureus (MSSA) infection. The strain was isolated and found to encode the Panton-Valentine Leukocidin genes, which have been associated with particularly severe necrotising infections in other sites, with high mortality. These strains are the subject of specific treatment and eradication guidance in the UK but awareness of this and the importance of obtaining detailed culture typing is likely to be low amongst Plastic Surgeons.

  18. Brd1 gene in maize encodes a brassinosteroid C-6 oxidase.

    Directory of Open Access Journals (Sweden)

    Irina Makarevitch

    Full Text Available The role of brassinosteroids in plant growth and development has been well-characterized in a number of plant species. However, very little is known about the role of brassinosteroids in maize. Map-based cloning of a severe dwarf mutant in maize revealed a nonsense mutation in an ortholog of a brassinosteroid C-6 oxidase, termed brd1, the gene encoding the enzyme that catalyzes the final steps of brassinosteroid synthesis. Homozygous brd1-m1 maize plants have essentially no internode elongation and exhibit no etiolation response when germinated in the dark. These phenotypes could be rescued by exogenous application of brassinolide, confirming the molecular defect in the maize brd1-m1 mutant. The brd1-m1 mutant plants also display alterations in leaf and floral morphology. The meristem is not altered in size but there is evidence for differences in the cellular structure of several tissues. The isolation of a maize mutant defective in brassinosteroid synthesis will provide opportunities for the analysis of the role of brassinosteroids in this important crop system.

  19. The rice FISH BONE gene encodes a tryptophan aminotransferase, which affects pleiotropic auxin-related processes. (United States)

    Yoshikawa, Takanori; Ito, Momoyo; Sumikura, Tsuyoshi; Nakayama, Akira; Nishimura, Takeshi; Kitano, Hidemi; Yamaguchi, Isomaro; Koshiba, Tomokazu; Hibara, Ken-Ichiro; Nagato, Yasuo; Itoh, Jun-Ichi


    Auxin is a fundamental plant hormone and its localization within organs plays pivotal roles in plant growth and development. Analysis of many Arabidopsis mutants that were defective in auxin biosynthesis revealed that the indole-3-pyruvic acid (IPA) pathway, catalyzed by the TRYPTOPHAN AMINOTRANSFERASE OF ARABIDOPSIS (TAA) and YUCCA (YUC) families, is the major biosynthetic pathway of indole-3-acetic acid (IAA). In contrast, little information is known about the molecular mechanisms of auxin biosynthesis in rice. In this study, we identified a auxin-related rice mutant, fish bone (fib). FIB encodes an orthologue of TAA genes and loss of FIB function resulted in pleiotropic abnormal phenotypes, such as small leaves with large lamina joint angles, abnormal vascular development, small panicles, abnormal organ identity and defects in root development, together with a reduction in internal IAA levels. Moreover, we found that auxin sensitivity and polar transport activity were altered in the fib mutant. From these results, we suggest that FIB plays a pivotal role in IAA biosynthesis in rice and that auxin biosynthesis, transport and sensitivity are closely interrelated. © 2014 The Authors The Plant Journal © 2014 John Wiley & Sons Ltd.

  20. The Arabidopsis DELAYED DEHISCENCE1 Gene Encodes an Enzyme in the Jasmonic Acid Synthesis Pathway (United States)

    Sanders, Paul M.; Lee, Pei Yun; Biesgen, Christian; Boone, James D.; Beals, Thomas P.; Weiler, Elmar W.; Goldberg, Robert B.


    delayed dehiscence1 is an Arabidopsis T-DNA mutant in which anthers release pollen grains too late for pollination to occur. The delayed dehiscence1 defect is caused by a delay in the stomium degeneration program. The gene disrupted in delayed dehiscence1 encodes 12-oxophytodienoate reductase, an enzyme in the jasmonic acid biosynthesis pathway. We rescued the mutant phenotype by exogenous application of jasmonic acid and obtained seed set from previously male-sterile plants. In situ hybridization studies showed that during the early stages of floral development, DELAYED DEHISCENCE1 mRNA accumulated within all floral organs. Later, DELAYED DEHISCENCE1 mRNA accumulated specifically within the pistil, petals, and stamen filaments. DELAYED DEHISCENCE1 mRNA was not detected in the stomium and septum cells of the anther that are involved in pollen release. The T-DNA insertion in delayed dehiscence1 eliminated both DELAYED DEHISCENCE1 mRNA accumulation and 12-oxophytodienoate reductase activity. These experiments suggest that jasmonic acid signaling plays a role in controlling the time of anther dehiscence within the flower. PMID:10899973

  1. Molecular cloning and expression analysis of the gene encoding proline dehydrogenase from Jatropha curcas L. (United States)

    Wang, Haibo; Ao, Pingxing; Yang, Shuanglong; Zou, Zhurong; Wang, Shasha; Gong, Ming


    Proline dehydrogenase (ProDH) (EC is a key enzyme in the catabolism of proline. The enzyme JcProDH and its complementary DNA (cDNA) were isolated from Jatropha curcas L., an important woody oil plant used as a raw material for biodiesels. It has been classified as a member of the Pro_dh superfamily based on multiple sequence alignment, phylogenetic characterization, and its role in proline catabolism. Its cDNA is 1674 bp in length with a complete open reading frame of 1485 bp, which encodes a polypeptide chain of 494 amino acids with a predicted molecular mass of 54 kD and a pI of 8.27. Phylogenetic analysis indicated that JcProDH showed high similarity with ProDH from other plants. Reverse transcription PCR (RT-PCR) analysis revealed that JcProDH was especially abundant in the seeds and flowers but scarcely present in the stems, roots, and leaves. In addition, the expression of JcProDH increased in leaves experiencing environmental stress such as cold (5 °C), heat (42 °C), salt (300 mM), and drought (30 % PEG6000). The JcProDH protein was successfully expressed in the yeast strain INVSc1 and showed high enzyme activity in proline catabolism. This result confirmed that the JcProDH gene negatively participated in the stress response.

  2. Hypersensitive Response of Plasmid-Encoded AHL Synthase Gene to Lifestyle and Nutrient by Ensifer adhaerens X097

    Directory of Open Access Journals (Sweden)

    Yanhua Zeng


    Full Text Available It is known that some bacteria, especially members of the family Rhizobiaceae, have multiple N-acyl homoserine lactones (AHL synthase genes and produce multiple AHL signals. However, how bacteria selectively utilize these multiple genes and signals to cope with changing environments is poorly understood. Ensifer adhaerens is an important microorganism in terms of biotechnology, ecology and evolutionary. In this study, we investigated the AHL-based QS system of E. adhaerens X097 and its response to different lifestyles or nutrients. Draft genome sequence data indicated that X097 harbored three distinct AHL synthase genes (ensI1, 2, 3 and seven luxR homologs, which was different from other E. adhaerens strains. In vitro expression indicated that plasmid-encoded ensI1 and ensI2 directed production of multiple AHLs, while chromosome-encoded ensI3 only directed production of C14-HSL. Predicted three dimensional structure of EnsI3 was quite different from that of EnsI1 and EnsI2. X097 produced different AHL profiles in Luria-Bertani (LB and NFB medium, under biofilm and planktonic lifestyle, respectively. Notably, expression of ensI1 and ensI2 but not ensI3 is hypersensitive to different lifestyles and nutrients. The hypersensitive response of plasmid-encoded AHL synthase genes to different culture conditions may shed a light on the phylogenetic development of AHL synthase genes in Rhizobiaceae family.

  3. The rgg0182 gene encodes a transcriptional regulator required for the full Streptococcus thermophilus LMG18311 thermal adaptation

    Directory of Open Access Journals (Sweden)

    Bertin Stéphane


    Full Text Available Abstract Background Streptococcus thermophilus is an important starter strain for the production of yogurt and cheeses. The analysis of sequenced genomes of four strains of S. thermophilus indicates that they contain several genes of the rgg familly potentially encoding transcriptional regulators. Some of the Rgg proteins are known to be involved in bacterial stress adaptation. Results In this study, we demonstrated that Streptococcus thermophilus thermal stress adaptation required the rgg0182 gene which transcription depends on the culture medium and the growth temperature. This gene encoded a protein showing similarity with members of the Rgg family transcriptional regulator. Our data confirmed that Rgg0182 is a transcriptional regulator controlling the expression of its neighboring genes as well as chaperones and proteases encoding genes. Therefore, analysis of a Δrgg0182 mutant revealed that this protein played a role in the heat shock adaptation of Streptococcus thermophilus LMG18311. Conclusions These data showed the importance of the Rgg0182 transcriptional regulator on the survival of S. thermophilus during dairy processes and more specifically during changes in temperature.

  4. Mutations of the Corynebacterium glutamicum NCgl1221 gene, encoding a mechanosensitive channel homolog, induce L-glutamic acid production. (United States)

    Nakamura, Jun; Hirano, Seiko; Ito, Hisao; Wachi, Masaaki


    Corynebacterium glutamicum is a biotin auxotroph that secretes L-glutamic acid in response to biotin limitation; this process is employed in industrial L-glutamic acid production. Fatty acid ester surfactants and penicillin also induce L-glutamic acid secretion, even in the presence of biotin. However, the mechanism of L-glutamic acid secretion remains unclear. It was recently reported that disruption of odhA, encoding a subunit of the 2-oxoglutarate dehydrogenase complex, resulted in L-glutamic acid secretion without induction. In this study, we analyzed odhA disruptants and found that those which exhibited constitutive L-glutamic acid secretion carried additional mutations in the NCgl1221 gene, which encodes a mechanosensitive channel homolog. These NCgl1221 gene mutations lead to constitutive L-glutamic acid secretion even in the absence of odhA disruption and also render cells resistant to an L-glutamic acid analog, 4-fluoroglutamic acid. Disruption of the NCgl1221 gene essentially abolishes L-glutamic acid secretion, causing an increase in the intracellular L-glutamic acid pool under biotin-limiting conditions, while amplification of the wild-type NCgl1221 gene increased L-glutamate secretion, although only in response to induction. These results suggest that the NCgl1221 gene encodes an L-glutamic acid exporter. We propose that treatments that induce L-glutamic acid secretion alter membrane tension and trigger a structural transformation of the NCgl1221 protein, enabling it to export L-glutamic acid.

  5. The yeast ISN1 (YOR155c gene encodes a new type of IMP-specific 5'-nucleotidase

    Directory of Open Access Journals (Sweden)

    Schmitter Jean-Marie


    Full Text Available Abstract Background The purine salvage enzyme inosine 5'-monophosphate (IMP-specific 5'-nucleotidase catalyzes degradation of IMP to inosine. Although this enzymatic activity has been purified and characterized in Saccharomyces cerevisiae, the gene encoding IMP 5'-nucleotidase had not been identified. Results Mass spectrometry analysis of several peptides of this enzyme purified from yeast allowed identification of the corresponding gene as YOR155c, an open reading frame of unknown function, renamed ISN1. The deduced Isn1p sequence was clearly not homologous to 5'-nucleotidases from other species. However, significant similarities to Isn1p were found in proteins of unknown function from Neurospora crassa, Plasmodium falciparum and several yeast species. Knock-out of ISN1 resulted in the total loss of IMP-specific 5'-nucleotidase activity, thus confirming that the ISN1 gene indeed encodes the enzymatic activity purified from yeast. In vivo studies revealed that, when IMP is overproduced through constitutive activation of the IMP de novo synthesis pathway, ISN1 is required for excretion of inosine and hypoxanthine in the medium. Conclusion We have identified a new yeast gene, ISN1 (YOR155c, as encoding IMP-specific 5'-nucleotidase activity. The ISN1 gene defines a new type of 5'-nucleotidase which was demonstrated to be functional in vivo.

  6. Plasmodium falciparum associated with severe childhood malaria preferentially expresses PfEMP1 encoded by group A var genes

    DEFF Research Database (Denmark)

    Jensen, Anja T R; Magistrado, Pamela; Sharp, Sarah


    Parasite-encoded variant surface antigens (VSAs) like the var gene-encoded Plasmodium falciparum erythrocyte membrane protein 1 (PfEMP1) family are responsible for antigenic variation and infected red blood cell (RBC) cytoadhesion in P. falciparum malaria. Parasites causing severe malaria...... in nonimmune patients tend to express a restricted subset of VSA (VSA(SM)) that differs from VSA associated with uncomplicated malaria and asymptomatic infection (VSA(UM)). We compared var gene transcription in unselected P. falciparum clone 3D7 expressing VSA(UM) to in vitro-selected sublines expressing VSA...... genes, such as PFD1235w/MAL7P1.1, appear to be involved in the pathogenesis of severe disease and are thus attractive candidates for a vaccine against life-threatening P. falciparum malaria....

  7. Several genes encoding enzymes with the same activity are necessary for aerobic fungal degradation of cellulose in nature

    DEFF Research Database (Denmark)

    Busk, Peter Kamp; Lange, Mette; Pilgaard, Bo


    . In the present study we further developed the method Peptide Pattern Recognition to an automatic approach not only to find all genes encoding glycoside hydrolases and lytic polysaccharide monooxygenases in fungal genomes but also to predict the function of the genes. The functional annotation is an important...... feature as it provides a direct route to predict function from primary sequence. Furthermore, we used Peptide Pattern Recognition to compare the cellulose-degrading enzyme activities encoded by 39 fungal genomes. The results indicated that cellobiohydrolases and AA9 lytic polysaccharide monooxygenases...... only few of these genes were found in fungi that have a limited number of natural, lignocellulotic substrates. This correlation suggests that enzymes with different properties are necessary for degradation of cellulose in different complex substrates. Interestingly, clustering of the fungi based...

  8. Changes in mitochondrial DNA alter expression of nuclear encoded genes associated with tumorigenesis

    Energy Technology Data Exchange (ETDEWEB)

    Jandova, Jana; Janda, Jaroslav [Southern Arizona VA Healthcare System, Department of Medicine, Dermatology Division and Arizona Cancer Center, University of Arizona, 1515 N Campbell Avenue, Tucson, AZ 857 24 (United States); Sligh, James E, E-mail: [Southern Arizona VA Healthcare System, Department of Medicine, Dermatology Division and Arizona Cancer Center, University of Arizona, 1515 N Campbell Avenue, Tucson, AZ 857 24 (United States)


    We previously reported the presence of a mtDNA mutation hotspot in UV-induced premalignant and malignant skin tumors in hairless mice. We have modeled this change (9821insA) in murine cybrid cells and demonstrated that this alteration in mtDNA associated with mtBALB haplotype can alter the biochemical characteristics of cybrids and subsequently can contribute to significant changes in their behavioral capabilities. This study shows that changes in mtDNA can produce differences in expression levels of specific nuclear-encoded genes, which are capable of triggering the phenotypes such as seen in malignant cells. From a potential list of differentially expressed genes discovered by microarray analysis, we selected MMP-9 and Col1a1 for further studies. Real-time PCR confirmed up-regulation of MMP-9 and down-regulation of Col1a1 in cybrids harboring the mtDNA associated with the skin tumors. These cybrids also showed significantly increased migration and invasion abilities compared to wild type. The non-specific MMP inhibitor, GM6001, was able to inhibit migratory and invasive abilities of the 9821insA cybrids confirming a critical role of MMPs in cellular motility. Nuclear factor-{kappa}B (NF-{kappa}B) is a key transcription factor for production of MMPs. An inhibitor of NF-{kappa}B activation, Bay 11-7082, was able to inhibit the expression of MMP-9 and ultimately decrease migration and invasion of mutant cybrids containing 9821insA. These studies confirm a role of NF-{kappa}B in the regulation of MMP-9 expression and through this regulation modulates the migratory and invasive capabilities of cybrids with mutant mtDNA. Enhanced migration and invasion abilities caused by up-regulated MMP-9 may contribute to the tumorigenic phenotypic characteristics of mutant cybrids. -- Highlights: Black-Right-Pointing-Pointer Cybrids are useful models to study the role of mtDNA changes in cancer development. Black-Right-Pointing-Pointer mtDNA changes affect the expression of nuclear

  9. Predominance of a versatile-peroxidase-encoding gene, mnp4, as demonstrated by gene replacement via a gene targeting system for Pleurotus ostreatus. (United States)

    Salame, Tomer M; Knop, Doriv; Tal, Dana; Levinson, Dana; Yarden, Oded; Hadar, Yitzhak


    Pleurotus ostreatus (the oyster mushroom) and other white rot filamentous basidiomycetes are key players in the global carbon cycle. P. ostreatus is also a commercially important edible fungus with medicinal properties and is important for biotechnological and environmental applications. Efficient gene targeting via homologous recombination (HR) is a fundamental tool for facilitating comprehensive gene function studies. Since the natural HR frequency in Pleurotus transformations is low (2.3%), transformed DNA is predominantly integrated ectopically. To overcome this limitation, a general gene targeting system was developed by producing a P. ostreatus PC9 homokaryon Δku80 strain, using carboxin resistance complemented by the development of a protocol for hygromycin B resistance protoplast-based DNA transformation and homokaryon isolation. The Δku80 strain exhibited exclusive (100%) HR in the integration of transforming DNA, providing a high efficiency of gene targeting. Furthermore, the Δku80 strains produced showed a phenotype similar to that of the wild-type PC9 strain, with similar growth fitness, ligninolytic functionality, and capability of mating with the incompatible strain PC15 to produce a dikaryon which retained its resistance to the corresponding selection and was capable of producing typical fruiting bodies. The applicability of this system is demonstrated by inactivation of the versatile peroxidase (VP) encoded by mnp4. This enzyme is part of the ligninolytic system of P. ostreatus, being one of the nine members of the manganese-peroxidase (MnP) gene family, and is the predominantly expressed VP in Mn(2+)-deficient media. mnp4 inactivation provided a direct proof that mnp4 encodes a key VP responsible for the Mn(2+)-dependent and Mn(2+)-independent peroxidase activity under Mn(2+)-deficient culture conditions.

  10. Predominance of a Versatile-Peroxidase-Encoding Gene, mnp4, as Demonstrated by Gene Replacement via a Gene Targeting System for Pleurotus ostreatus (United States)

    Salame, Tomer M.; Knop, Doriv; Tal, Dana; Levinson, Dana; Yarden, Oded


    Pleurotus ostreatus (the oyster mushroom) and other white rot filamentous basidiomycetes are key players in the global carbon cycle. P. ostreatus is also a commercially important edible fungus with medicinal properties and is important for biotechnological and environmental applications. Efficient gene targeting via homologous recombination (HR) is a fundamental tool for facilitating comprehensive gene function studies. Since the natural HR frequency in Pleurotus transformations is low (2.3%), transformed DNA is predominantly integrated ectopically. To overcome this limitation, a general gene targeting system was developed by producing a P. ostreatus PC9 homokaryon Δku80 strain, using carboxin resistance complemented by the development of a protocol for hygromycin B resistance protoplast-based DNA transformation and homokaryon isolation. The Δku80 strain exhibited exclusive (100%) HR in the integration of transforming DNA, providing a high efficiency of gene targeting. Furthermore, the Δku80 strains produced showed a phenotype similar to that of the wild-type PC9 strain, with similar growth fitness, ligninolytic functionality, and capability of mating with the incompatible strain PC15 to produce a dikaryon which retained its resistance to the corresponding selection and was capable of producing typical fruiting bodies. The applicability of this system is demonstrated by inactivation of the versatile peroxidase (VP) encoded by mnp4. This enzyme is part of the ligninolytic system of P. ostreatus, being one of the nine members of the manganese-peroxidase (MnP) gene family, and is the predominantly expressed VP in Mn2+-deficient media. mnp4 inactivation provided a direct proof that mnp4 encodes a key VP responsible for the Mn2+-dependent and Mn2+-independent peroxidase activity under Mn2+-deficient culture conditions. PMID:22636004

  11. Cloning, characterization, expression analysis and inhibition studies of a novel gene encoding Bowman-Birk type protease inhibitor from rice bean (United States)

    This paper presents the first study describing the isolation, cloning and characterization of a full length gene encoding Bowman-Birk protease inhibitor (RbTI) from rice bean (Vigna umbellata). A full-length protease inhibitor gene with complete open reading frame of 327bp encoding 109 amino acids w...

  12. Nucleotide variants of genes encoding components of the Wnt signalling pathway and the risk of non-syndromic tooth agenesis. (United States)

    Mostowska, A; Biedziak, B; Zadurska, M; Dunin-Wilczynska, I; Lianeri, M; Jagodzinski, P P


    Tooth agenesis is one of the most common dental anomalies, with a complex and not yet fully elucidated aetiology. Given the crucial role of the Wnt signalling pathway during tooth development, the purpose of this study was to determine whether nucleotide variants of genes encoding components of this signalling pathway might be associated with hypodontia and oligodontia in the Polish population. A set of 34 single nucleotide polymorphism (SNPs) in 13 WNT and WNT-related genes were analyzed in a group of 157 patients with tooth agenesis and a properly matched control group (n = 430). In addition, direct sequencing was performed to detect mutations in the MSX1, PAX9 and WNT10A genes. Both single-marker and haplotype analyses showed highly significant association between SNPs in the WNT10A gene and the risk for tooth agenesis. Moreover, nine pathogenic mutations within the coding region of the WNT10A gene were identified in 26 out of 42 (62%) tested patients. One novel heterozygous mutation was identified in the PAX9 gene. Borderline association with the risk of non-syndromic tooth agenesis was also observed for the APC, CTNNB1, DVL2 and WNT11 polymorphisms. In conclusion, nucleotide variants of genes encoding important components of the Wnt signalling pathway might influence the risk of tooth agenesis. © 2012 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  13. The Aspergillus niger (ficuum) aphA gene encodes a pH 6.0-optimum acid phosphatase. (United States)

    Mullaney, E J; Daly, C B; Ehrlich, K C; Ullah, A H


    We have used the Aspergillus niger (An) aphA gene as a probe and cloned the A. ficuum (Af) SRRC 265 gene encoding an extracellular pH 6.0-optimum acid phosphatase (APase6) from a genomic library. The identity of the Af aphA gene was confirmed and its nucleotide (nt) sequence verified by comparing its deduced amino acid (aa) sequence to that of purified Af APase6. A comparison of the nt sequences of the An and Af genes suggested that errors were made in the previously reported An aphA sequence. Several regions of the An aphA were resequenced and the mistakes corrected. With its nt sequence corrected, the An aphA is nearly identical to the cloned Af gene encoding APase6, and in 90.4% agreement in the coding regions. Both genes have three conserved introns and when translated, both nt sequences code for a polypeptide of 614 aa. There is now evidence that the two cloned genes are homologous and code for acid phosphatases that are 96% identical.

  14. Molecular and Biochemical Characterization of Two Xylanase-Encoding Genes from Cellulomonas pachnodae (United States)

    Cazemier, Anne E.; Verdoes, Jan C.; van Ooyen, Albert J. J.; Op den Camp, Huub J. M.


    Two xylanase-encoding genes, named xyn11A and xyn10B, were isolated from a genomic library of Cellulomonas pachnodae by expression in Escherichia coli. The deduced polypeptide, Xyn11A, consists of 335 amino acids with a calculated molecular mass of 34,383 Da. Different domains could be identified in the Xyn11A protein on the basis of homology searches. Xyn11A contains a catalytic domain belonging to family 11 glycosyl hydrolases and a C-terminal xylan binding domain, which are separated from the catalytic domain by a typical linker sequence. Binding studies with native Xyn11A and a truncated derivative of Xyn11A, lacking the putative binding domain, confirmed the function of the two domains. The second xylanase, designated Xyn10B, consists of 1,183 amino acids with a calculated molecular mass of 124,136 Da. Xyn10B also appears to be a modular protein, but typical linker sequences that separate the different domains were not identified. It comprises a N-terminal signal peptide followed by a stretch of amino acids that shows homology to thermostabilizing domains. Downstream of the latter domain, a catalytic domain specific for family 10 glycosyl hydrolases was identified. A truncated derivative of Xyn10B bound tightly to Avicel, which was in accordance with the identified cellulose binding domain at the C terminus of Xyn10B on the basis of homology. C. pachnodae, a (hemi)cellulolytic bacterium that was isolated from the hindgut of herbivorous Pachnoda marginata larvae, secretes at least two xylanases in the culture fluid. Although both Xyn11A and Xyn10B had the highest homology to xylanases from Cellulomonas fimi, distinct differences in the molecular organizations of the xylanases from the two Cellulomonas species were identified. PMID:10473422

  15. Characterization of mouse UDP-glucose pyrophosphatase, a Nudix hydrolase encoded by the Nudt14 gene

    Energy Technology Data Exchange (ETDEWEB)

    Heyen, Candy A.; Tagliabracci, Vincent S.; Zhai, Lanmin [Department of Biochemistry and Molecular Biology, Indiana University School of Medicine, Indianapolis, IN 46202 (United States); Roach, Peter J., E-mail: [Department of Biochemistry and Molecular Biology, Indiana University School of Medicine, Indianapolis, IN 46202 (United States)


    Recombinant mouse UDP-glucose pyrophosphatase (UGPPase), encoded by the Nudt14 gene, was produced in Escherichia coli and purified close to homogeneity. The enzyme catalyzed the conversion of [{beta}-{sup 32}P]UDP-glucose to [{sup 32}P]glucose-1-P and UMP, confirming that it hydrolyzed the pyrophosphate of the nucleoside diphosphate sugar to generate glucose-1-P and UMP. The enzyme was also active toward ADP-ribose. Activity is dependent on the presence of Mg{sup 2+} and was greatest at alkaline pH above 8. Kinetic analysis indicated a K{sub m} of {approx}4 mM for UDP-glucose and {approx}0.3 mM for ADP-ribose. Based on V{sub max}/K{sub m} values, the enzyme was {approx}20-fold more active toward ADP-ribose. UGPPase behaves as a dimer in solution and can be cross-linked to generate a species of M{sub r} 54,000 from a monomer of 30,000 as judged by SDS-PAGE. The dimerization was not affected by the presence of glucose-1-P or UDP-glucose. Using antibodies raised against the recombinant protein, Western analysis indicated that UGPPase was widely expressed in mouse tissues, including skeletal muscle, liver, kidney, heart, lung, fat, heart and pancreas with a lower level in brain. It was generally present as a doublet when analyzed by SDS-PAGE, suggesting the occurrence of some form of post-translational modification. Efforts to interconvert the species by adding or inhibiting phosphatase activity were unsuccessful, leaving the nature of the modification unknown. Sequence alignments and database searches revealed related proteins in species as distant as Drosophila melanogaster and Caenorhabditis elegans.

  16. AMD-associated genes encoding stress-activated MAPK pathway constituents are identified by interval-based enrichment analysis.

    Directory of Open Access Journals (Sweden)

    John Paul SanGiovanni

    Full Text Available PURPOSE: To determine whether common DNA sequence variants within groups of genes encoding elements of stress-activated mitogen-activated protein kinase (MAPK signaling pathways are, in aggregate, associated with advanced AMD (AAMD. METHODS: We used meta-regression and exact testing methods to identify AAMD-associated SNPs in 1177 people with AAMD and 1024 AMD-free elderly peers from 3 large-scale genotyping projects on the molecular genetics of AMD. SNPs spanning independent AAMD-associated genomic intervals were examined with a multi-locus-testing method (INRICH for enrichment within five sets of genes encoding constituents of stress-activated MAPK signaling cascades. RESULTS: Four-of-five pathway gene sets showed enrichment with AAMD-associated SNPs; findings persisted after adjustment for multiple testing in two. Strongest enrichment signals (P = 0.006 existed in a c-Jun N-terminal kinase (JNK/MAPK cascade (Science Signaling, STKE CMP_10827. In this pathway, seven independent AAMD-associated regions were resident in 6 of 25 genes examined. These included sequence variants in: 1 three MAP kinase kinase kinases (MAP3K4, MAP3K5, MAP3K9 that phosphorylate and activate the MAP kinase kinases MAP2K4 and MAP2K7 (molecules that phosphorylate threonine and tyrosine residues within the activation loop of JNK; 2 a target of MAP2K7 (JNK3A1 that activates complexes involved in transcriptional regulation of stress related genes influencing cell proliferation, apoptosis, motility, metabolism and DNA repair; and 3 NR2C2, a transcription factor activated by JNK1A1 (a drugable molecule influencing retinal cell viability in model systems. We also observed AAMD-related sequence variants resident in genes encoding PPP3CA (a drugable molecule that inactivates MAP3K5, and two genes (TGFB2, TGFBR2 encoding factors involved in MAPK sensing of growth factors/cytokines. CONCLUSIONS: Linkage disequilibrium (LD-independent genomic enrichment analysis yielded

  17. Genomic organization and chromosomal localization of the human and mouse genes encoding the {alpha} receptor component for ciliary neurotrophic factor

    Energy Technology Data Exchange (ETDEWEB)

    Valenzuela, D.M.; Rojas, E.; McClain, J. [Regeneron Pharmaceuticals, Inc., Tarrytown, NY (United States)] [and others


    Ciliary neurotrophic factor (CNTF) has recently been found to share receptor components with, and to be structurally related to, a family of broadly acting cytokines, including interleukin-6, leukemia inhibitory factor, and oncostatin M. However, the CNTF receptor complex also includes a CNTF-specific component known as CNTF receptor {alpha} (CNTFR{alpha}). Here we describe the molecular cloning of the human and mouse genes encoding CNTFR. We report that the human and mouse genes have an identical intron-exon structure that correlates well with the domain structure of CNTFR{alpha}. That is, the signal peptide and the immunoglobulin-like domain are each encoded by single exons, the cytokine receptor-like domain is distributed among 4 exons, and the C-terminal glycosyl phosphatidylinositol recognition domain in encoded by the final coding exon. The position of the introns within the cytokine receptor-like domain corresponds to those found in other members of the cytokine receptor superfamily. Confirming a recent study using radiation hybrids, we have also mapped the human CNTFR gene to chromosome band 9p13 and the mouse gene to a syntenic region of chromosome 4. 24 refs., 4 figs.

  18. The POLARIS gene of Arabidopsis encodes a predicted peptide required for correct root growth and leaf vascular patterning. (United States)

    Casson, Stuart A; Chilley, Paul M; Topping, Jennifer F; Evans, I Marta; Souter, Martin A; Lindsey, Keith


    The POLARIS (PLS) gene of Arabidopsis was identified as a promoter trap transgenic line, showing beta-glucuronidase fusion gene expression predominantly in the embryonic and seedling root, with low expression in aerial parts. Cloning of the PLS locus revealed that the promoter trap T-DNA had inserted into a short open reading frame (ORF). Rapid amplification of cDNA ends PCR, RNA gel blot analysis, and RNase protection assays showed that the PLS ORF is located within a short ( approximately 500 nucleotides) auxin-inducible transcript and encodes a predicted polypeptide of 36 amino acid residues. pls mutants exhibit a short-root phenotype and reduced vascularization of leaves. pls roots are hyperresponsive to exogenous cytokinins and show increased expression of the cytokinin-inducible gene ARR5/IBC6 compared with the wild type. pls seedlings also are less responsive to the growth-inhibitory effects of exogenous auxin and show reduced expression of the auxin-inducible gene IAA1 compared with the wild type. The PLS peptide-encoding region of the cDNA partially complements the pls mutation and requires the PLS ORF ATG for activity, demonstrating the functionality of the peptide-encoding ORF. Ectopic expression of the PLS ORF reduces root growth inhibition by exogenous cytokinins and increases leaf vascularization. We propose that PLS is required for correct auxin-cytokinin homeostasis to modulate root growth and leaf vascular patterning.

  19. Cloning and expression of a novel, moderately thermostable xylanase-encoding gene (Cflxyn11A) from Cellulomonas flavigena. (United States)

    Amaya-Delgado, Lorena; Mejía-Castillo, Teresa; Santiago-Hernández, Alejandro; Vega-Estrada, Jesús; Amelia, Farrés-G-S; Xoconostle-Cázares, Beatriz; Ruiz-Medrano, Roberto; Montes-Horcasitas, María Del Carmen; Hidalgo-Lara, María Eugenia


    The Cfl xyn11A gene, encoding the endo-1,4-beta-xylanase Cfl Xyn11A from Cellulomonas flavigena, was isolated from a genomic DNA library. The open reading frame of the Cfl xyn11A gene was 999 base pairs long and encoded a polypeptide (Cfl Xyn11A) of 332 amino acids with a calculated molecular mass of 35,110Da. The Cfl xyn11A gene was expressed in Escherichia coli and the recombinant enzyme, with an estimated molecular weight of 31kDa was purified and xylanase activity was measured. Cfl Xyn11A showed optimal activity at pH 6.5 and 55 degrees C. The enzyme demonstrated moderate thermal stability as Cfl Xyn11A maintained 50% of its activity when incubated at 55 degrees C for 1h or at 45 degrees C for 6h. This is the first report describing the cloning, expression and functional characterization of an endo-1,4-beta-xylanase-encoding gene from C. flavigena. Cfl Xyn11A may be suitable for industrial applications in the food and feed industries, or in the pre-treatment of lignocellulosic biomass required to improve the yields of fermentable sugars for bioethanol production. Copyright (c) 2010 Elsevier Ltd. All rights reserved.

  20. The Retrovirus pol Gene Encodes a Product Required for DNA Integration: Identification of a Retrovirus int Locus (United States)

    Panganiban, Antonito T.; Temin, Howard M.


    We mutagenized cloned spleen necrosis virus DNA to identify a region of the retrovirus genome encoding a polypeptide required for integration of viral DNA. Five plasmids bearing different lesions in the 3' end of the pol gene were examined for the ability to integrate or replicate following transfection of chicken embryo fibroblasts. Transfection with one of these DNAs resulted in the generation of mutant virus incapable of integrating but able to replicate at low levels; this phenotype is identical to that of mutants bearing alterations in the cis-acting region, att. To determine whether the 3' end of the pol gene encodes a protein that interacts with att, we did a complementation experiment. Cells were first infected with an att- virus and then superinfected with the integration-deficient virus containing a lesion in the pol gene and a wild-type att site. The results showed that the att- virus provided a trans-acting function allowing integration of viral DNA derived from the mutant bearing a wild-type att site. Thus, the 3' end of the pol gene serves as an ``int'' locus and encodes a protein mediating integration of retrovirus DNA through interaction with att.

  1. Identification of genes encoding hypothetical proteins in open-reading frame expressed sequence tags from mammalian stages of Trypanosoma cruzi. (United States)

    Martins, C; Reis-Cunha, J L; Silva, M N; Pereira, E G; Pappas, G J; Bartholomeu, D C; Zingales, B


    Approximately 50% of the predicted protein-coding genes of the Trypanosoma cruzi CL Brener strain are annotated as hypothetical or conserved hypothetical proteins. To further characterize these genes, we generated 1161 open-reading frame expressed sequence tags (ORESTES) from the mammalian stages of the VL10 human strain. Sequence clustering resulted in 435 clusters, consisting of 339 singletons and 96 contigs. Significant matches to the T. cruzi predicted gene database were found for ~94% contigs and ~69% singletons. These included genes encoding surface proteins, known to be intensely expressed in the parasite mammalian stages and implicated in host cell invasion and/or immune evasion mechanisms. Among 151 contigs and singletons with similarity to predicted hypothetical protein-coding genes and conserved hypothetical protein-coding genes, 83% showed no match with T. cruzi EST and/or proteome databases. These ORESTES are the first experimental evidence that the corresponding genes are in fact transcribed. Sequences with no significant match were searched against several T. cruzi and National Center for Biotechnology Information non-redundant sequence databases. The ORESTES analysis indicated that 124 predicted conserved hypothetical protein-coding genes and 27 predicted hypothetical protein-coding genes annotated in the CL Brener genome are transcribed in the VL10 mammalian stages. Six ORESTES annotated as hypothetical protein-coding genes showing no match to EST and/or proteome databases were confirmed by Northern blot in VL10. The generation of this set of ORESTES complements the T. cruzi genome annotation and suggests new stage-regulated genes encoding hypothetical proteins.

  2. Identification and functional analysis of the genes encoding Δ6-desaturase from Ribes nigrum† (United States)

    Song, Li-Ying; Lu, Wan-Xiang; Hu, Jun; Zhang, Yan; Yin, Wei-Bo; Chen, Yu-Hong; Hao, Shan-Ting; Wang, Bai-Lin; Wang, Richard R-C; Hu, Zan-Min


    Gamma-linolenic acid (γ-linolenic acid, GLA; C18:3 Δ6, 9, 12) belongs to the omega-6 family and exists primarily in several plant oils, such as evening primrose oil, blackcurrant oil, and borage oil. Δ6-desaturase is a key enzyme involved in the synthesis of GLA. There have been no previous reports on the genes encoding Δ6-desaturase in blackcurrant (Ribes nigrum L.). In this research, five nearly identical copies of Δ6-desaturase gene-like sequences, named RnD8A, RnD8B, RnD6C, RnD6D, and RnD6E, were isolated from blackcurrant. Heterologous expression in Saccharomyces cerevisiae and/or Arabidopsis thaliana confirmed that RnD6C/D/E were Δ6-desaturases that could use both α-linolenic acids (ALA; C18:3 Δ9,12,15) and linoleic acid (LA; C18:2 Δ9,12) precursors in vivo, whereas RnD8A/B were Δ8-sphlingolipid desaturases. Expression of GFP tagged with RnD6C/D/E showed that blackcurrant Δ6-desaturases were located in the mitochondrion (MIT) in yeast and the endoplasmic reticulum (ER) in tobacco. GC-MS results showed that blackcurrant accumulated GLA and octadecatetraenoic acids (OTA; C18:4 Δ6,9,12,15) mainly in seeds and a little in other organs and tissues. RT-PCR results showed that RnD6C and RnD6E were expressed in all the tissues at a low level, whereas RnD6D was expressed at a high level only in seeds, leading to the accumulation of GLA and OTA in seeds. This research provides new insights to our understanding of GLA synthesis and accumulation in plants and the evolutionary relationship of this class of desaturases, and new clues as to the amino acid determinants which define precise enzyme activity. PMID:20231328

  3. Identification and functional analysis of the genes encoding Delta6-desaturase from Ribes nigrum. (United States)

    Song, Li-Ying; Lu, Wan-Xiang; Hu, Jun; Zhang, Yan; Yin, Wei-Bo; Chen, Yu-Hong; Hao, Shan-Ting; Wang, Bai-Lin; Wang, Richard R-C; Hu, Zan-Min


    Gamma-linolenic acid (gamma-linolenic acid, GLA; C18:3 Delta(6, 9, 12)) belongs to the omega-6 family and exists primarily in several plant oils, such as evening primrose oil, blackcurrant oil, and borage oil. Delta(6)-desaturase is a key enzyme involved in the synthesis of GLA. There have been no previous reports on the genes encoding Delta(6)-desaturase in blackcurrant (Ribes nigrum L.). In this research, five nearly identical copies of Delta(6)-desaturase gene-like sequences, named RnD8A, RnD8B, RnD6C, RnD6D, and RnD6E, were isolated from blackcurrant. Heterologous expression in Saccharomyces cerevisiae and/or Arabidopsis thaliana confirmed that RnD6C/D/E were Delta(6)-desaturases that could use both alpha-linolenic acids (ALA; C18:3 Delta(9,12,15)) and linoleic acid (LA; C18:2 Delta(9,12)) precursors in vivo, whereas RnD8A/B were Delta(8)-sphingolipid desaturases. Expression of GFP tagged with RnD6C/D/E showed that blackcurrant Delta(6)-desaturases were located in the mitochondrion (MIT) in yeast and the endoplasmic reticulum (ER) in tobacco. GC-MS results showed that blackcurrant accumulated GLA and octadecatetraenoic acids (OTA; C18:4 Delta(6,9,12,15)) mainly in seeds and a little in other organs and tissues. RT-PCR results showed that RnD6C and RnD6E were expressed in all the tissues at a low level, whereas RnD6D was expressed at a high level only in seeds, leading to the accumulation of GLA and OTA in seeds. This research provides new insights to our understanding of GLA synthesis and accumulation in plants and the evolutionary relationship of this class of desaturases, and new clues as to the amino acid determinants which define precise enzyme activity.

  4. Overexpression of genes encoding glycolytic enzymes in Corynebacterium glutamicum enhances glucose metabolism and alanine production under oxygen deprivation conditions. (United States)

    Yamamoto, Shogo; Gunji, Wataru; Suzuki, Hiroaki; Toda, Hiroshi; Suda, Masako; Jojima, Toru; Inui, Masayuki; Yukawa, Hideaki


    We previously reported that Corynebacterium glutamicum strain ΔldhAΔppc+alaD+gapA, overexpressing glyceraldehyde-3-phosphate dehydrogenase-encoding gapA, shows significantly improved glucose consumption and alanine formation under oxygen deprivation conditions (T. Jojima, M. Fujii, E. Mori, M. Inui, and H. Yukawa, Appl. Microbiol. Biotechnol. 87:159-165, 2010). In this study, we employ stepwise overexpression and chromosomal integration of a total of four genes encoding glycolytic enzymes (herein referred to as glycolytic genes) to demonstrate further successive improvements in C. glutamicum glucose metabolism under oxygen deprivation. In addition to gapA, overexpressing pyruvate kinase-encoding pyk and phosphofructokinase-encoding pfk enabled strain GLY2/pCRD500 to realize respective 13% and 20% improved rates of glucose consumption and alanine formation compared to GLY1/pCRD500. Subsequent overexpression of glucose-6-phosphate isomerase-encoding gpi in strain GLY3/pCRD500 further improved its glucose metabolism. Notably, both alanine productivity and yield increased after each overexpression step. After 48 h of incubation, GLY3/pCRD500 produced 2,430 mM alanine at a yield of 91.8%. This was 6.4-fold higher productivity than that of the wild-type strain. Intracellular metabolite analysis showed that gapA overexpression led to a decreased concentration of metabolites upstream of glyceraldehyde-3-phosphate dehydrogenase, suggesting that the overexpression resolved a bottleneck in glycolysis. Changing ratios of the extracellular metabolites by overexpression of glycolytic genes resulted in reduction of the intracellular NADH/NAD(+) ratio, which also plays an important role on the improvement of glucose consumption. Enhanced alanine dehydrogenase activity using a high-copy-number plasmid further accelerated the overall alanine productivity. Increase in glycolytic enzyme activities is a promising approach to make drastic progress in growth-arrested bioprocesses.

  5. A negative element involved in Kaposi's sarcoma-associated herpesvirus-encoded ORF11 gene expression

    Energy Technology Data Exchange (ETDEWEB)

    Chen, Lei [Los Alamos National Laboratory


    The ORF11 of the Kaposi's sarcoma-associated herpesvirus (KSHV) is a lytic viral gene with delayed-early expression kinetics. How the ORF11 gene expression is regulated in the KSHV lytic cascade is largely unknown. Here we report that the deletion of the KSHV viral IL-6 gene from the viral genome leads to deregulated ORF11 gene expression. The KSHV-encoded viral IL-6 protein was found not to be essentially involved in the regulation of ORF11, suggesting a potential transcriptional cis-regulation. A negative element was identified downstream of the ORF11 gene, which suppresses the ORF11 basal promoter activity in a position-independent manner.

  6. Determination of ploidy level and isolation of genes encoding acetyl-CoA carboxylase in Japanese Foxtail (Alopecurus japonicus.

    Directory of Open Access Journals (Sweden)

    Hongle Xu

    Full Text Available Ploidy level is important in biodiversity studies and in developing strategies for isolating important plant genes. Many herbicide-resistant weed species are polyploids, but our understanding of these polyploid weeds is limited. Japanese foxtail, a noxious agricultural grass weed, has evolved herbicide resistance. However, most studies on this weed have ignored the fact that there are multiple copies of target genes. This may complicate the study of resistance mechanisms. Japanese foxtail was found to be a tetraploid by flow cytometer and chromosome counting, two commonly used methods in the determination of ploidy levels. We found that there are two copies of the gene encoding plastidic acetyl-CoA carboxylase (ACCase in Japanese foxtail and all the homologous genes are expressed. Additionally, no difference in ploidy levels or ACCase gene copy numbers was observed between an ACCase-inhibiting herbicide-resistant and a herbicide-sensitive population in this study.

  7. Composition and expression of genes encoding carbohydrate-active enzymes in the straw-degrading mushroom Volvariella volvacea.

    Directory of Open Access Journals (Sweden)

    Bingzhi Chen

    Full Text Available Volvariella volvacea is one of a few commercial cultivated mushrooms mainly using straw as carbon source. In this study, the genome of V. volcacea was sequenced and assembled. A total of 285 genes encoding carbohydrate-active enzymes (CAZymes in V. volvacea were identified and annotated. Among 15 fungi with sequenced genomes, V. volvacea ranks seventh in the number of genes encoding CAZymes. In addition, the composition of glycoside hydrolases in V. volcacea is dramatically different from other basidiomycetes: it is particularly rich in members of the glycoside hydrolase families GH10 (hemicellulose degradation and GH43 (hemicellulose and pectin degradation, and the lyase families PL1, PL3 and PL4 (pectin degradation but lacks families GH5b, GH11, GH26, GH62, GH93, GH115, GH105, GH9, GH53, GH32, GH74 and CE12. Analysis of genome-wide gene expression profiles of 3 strains using 3'-tag digital gene expression (DGE reveals that 239 CAZyme genes were expressed even in potato destrose broth medium. Our data also showed that the formation of a heterokaryotic strain could dramatically increase the expression of a number of genes which were poorly expressed in its parental homokaryotic strains.

  8. Cloning and characterization of SmZF1, a gene encoding a Schistosoma mansoni zinc finger protein

    Directory of Open Access Journals (Sweden)

    Souza Paulo R Eleutério de


    Full Text Available The zinc finger motifs (Cys2His2 are found in several proteins playing a role in the regulation of transcripton. SmZF1, a Schistosoma mansoni gene encoding a zinc finger protein was initially isolated from an adult worm cDNA library, as a partial cDNA. The full sequence of the gene was obtained by subcloning and sequencing cDNA and genomic fragments. The collated gene sequence is 2181 nt and the complete cDNA sequence is 705 bp containing the full open reading frame of the gene. Analysis of the genome sequence revealed the presence of three introns interrupting the coding region. The open reading frame theoretically encodes a protein of 164 amino acids, with a calculated molecular mass of 18,667Da. The predicted protein contains three zinc finger motifs, usually present in transcription regulatory proteins. PCR amplification with specific primers for the gene allowed for the detection of the target in egg, cercariae, schistosomulum and adult worm cDNA libraries indicating the expression of the mRNA in these life cycle stages of S. mansoni. This pattern of expression suggests the gene plays a role in vital functions of different life cycle stages of the parasite. Future research will be directed to elucidate the functional role of SmZF1.

  9. The maize brown midrib2 (bm2) gene encodes a methylenetetrahydrofolate reductase that contributes to lignin accumulation (United States)

    Tang, Ho Man; Liu, Sanzhen; Hill-Skinner, Sarah; Wu, Wei; Reed, Danielle; Yeh, Cheng-Ting; Nettleton, Dan; Schnable, Patrick S


    The midribs of maize brown midrib (bm) mutants exhibit a reddish-brown color associated with reductions in lignin concentration and alterations in lignin composition. Here, we report the mapping, cloning, and functional and biochemical analyses of the bm2 gene. The bm2 gene was mapped to a small region of chromosome 1 that contains a putative methylenetetrahydrofolate reductase (MTHFR) gene, which is down-regulated in bm2 mutant plants. Analyses of multiple Mu-induced bm2-Mu mutant alleles confirmed that this constitutively expressed gene is bm2. Yeast complementation experiments and a previously published biochemical characterization show that the bm2 gene encodes a functional MTHFR. Quantitative RT-PCR analyses demonstrated that the bm2 mutants accumulate substantially reduced levels of bm2 transcript. Alteration of MTHFR function is expected to influence accumulation of the methyl donor S-adenosyl-l-methionine (SAM). Because SAM is consumed by two methyltransferases in the lignin pathway (Ye et al., 1994), the finding that bm2 encodes a functional MTHFR is consistent with its lignin phenotype. Consistent with this functional assignment of bm2, the expression patterns of genes in a variety of SAM-dependent or -related pathways, including lignin biosynthesis, are altered in the bm2 mutant. Biochemical assays confirmed that bm2 mutants accumulate reduced levels of lignin with altered composition compared to wild-type. Hence, this study demonstrates a role for MTHFR in lignin biosynthesis. PMID:24286468

  10. Effect of hypoxia on the expression of nuclear genes encoding mitochondrial proteins in U87 glioma cells

    Directory of Open Access Journals (Sweden)

    O. H. Minchenko


    Full Text Available We have studied the effect of hypoxia on the expression of nuclear genes encoding mitochondrial proteins in U87 glioma cells under the inhibition of IRE1 (inositol requiring enzyme-1, which controls cell proliferation and tumor growth as a central mediator of endoplasmic reticulum stress. It was shown that hypoxia down-regulated gene expression of malate dehydrogenase 2 (MDH2, malic enzyme 2 (ME2, mitochondrial aspartate aminotransferase (GOT2, and subunit B of succinate dehydrogenase (SDHB in control (transfected by empty vector glioma cells in a gene specific manner. At the same time, the expression level of mitochondrial NADP+-dependent isocitrate dehydrogenase 2 (IDH2 and subunit D of succinate dehydrogenase (SDHD genes in these cells does not significantly change in hypoxic conditions. It was also shown that the inhibition of ІRE1 signaling enzyme function in U87 glioma cells decreases the effect of hypoxia on the expression of ME2, GOT2, and SDHB genes and introduces the sensitivity of IDH2 gene to hypoxia. Furthermore, the expression of all studied genes depends on IRE1-mediated endoplasmic reticulum stress signaling in gene specific manner, because ІRE1 knockdown significantly decreases their expression in normoxic conditions, except for IDH2 gene, which expression level is strongly up-regulated. Therefore, changes in the expression level of nuclear genes encoding ME2, MDH2, IDH2, SDHB, SDHD, and GOT2 proteins possibly reflect metabolic reprogramming of mitochondria by hypoxia and IRE1-mediated endoplasmic reticulum stress signaling and correlate with suppression of glioma cell proliferation under inhibition of the IRE1 enzyme function.

  11. Molecular characterization and evolution of a gene family encoding both female- and male-specific reproductive proteins in Drosophila. (United States)

    Sirot, Laura K; Findlay, Geoffrey D; Sitnik, Jessica L; Frasheri, Dorina; Avila, Frank W; Wolfner, Mariana F


    Gene duplication is an important mechanism for the evolution of new reproductive proteins. However, in most cases, each resulting paralog continues to function within the same sex. To investigate the possibility that seminal fluid proteins arise through duplicates of female reproductive genes that become "co-opted" by males, we screened female reproductive genes in Drosophila melanogaster for cases of duplication in which one of the resulting paralogs produces a protein in males that is transferred to females during mating. We identified a set of three tandemly duplicated genes that encode secreted serine-type endopeptidase homologs, two of which are expressed primarily in the female reproductive tract (RT), whereas the third is expressed specifically in the male RT and encodes a seminal fluid protein. Evolutionary and gene expression analyses across Drosophila species suggest that this family arose from a single-copy gene that was female-specific; after duplication, one paralog evolved male-specific expression. Functional tests of knockdowns of each gene in D. melanogaster show that one female-expressed gene is essential for full fecundity, and both female-expressed genes contribute singly or in combination to a female's propensity to remate. In contrast, knockdown of the male-expressed paralog had no significant effect on female fecundity or remating. These data are consistent with a model in which members of this gene family exert effects on females by acting on a common, female-expressed target. After duplication and male co-option of one paralog, the evolution of the interacting proteins could have resulted in differential strengths or effects of each paralog. © The Author 2014. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution. All rights reserved. For permissions, please e-mail:

  12. Structure of the gene encoding chitinase D of Bacillus circulans WL-12 and possible homology of the enzyme to other prokaryotic chitinases and class III plant chitinases.


    Watanabe, T.; Oyanagi, W; K. Suzuki(Kyoto University); Ohnishi, K.; Tanaka, H.


    The gene (chiD) encoding the precursor of chitinase D was found to be located immediately upstream of the chiA gene, encoding chitinase A1, which is a key enzyme in the chitinase system of Bacillus circulans WL-12. Sequencing analysis revealed that the deduced polypeptide encoded by the chiD gene was 488 amino acids long and the distance between the coding regions of the chiA and chiD genes was 103 bp. Remarkable similarity was observed between the N-terminal one-third of chitinase D and the ...

  13. Sequence variation in the alpha-toxin encoding plc gene of Clostridium perfringens strains isolated from diseased and healthy chickens

    DEFF Research Database (Denmark)

    Abildgaard, L; Engberg, RM; Pedersen, Karl


    The aim of the present study was to analyse the genetic diversity of the alpha-toxin encoding plc gene and the variation in a-toxin production of Clostridium perfringens type A strains isolated from presumably healthy chickens and chickens suffering from either necrotic enteritis (NE) or cholangio......-hepatitis. The a-toxin encoding plc genes from 60 different pulsed-field gel electrophoresis (PFGE) types (strains) of C perfringens were sequenced and translated in silico to amino acid sequences and the a-toxin production was investigated in batch cultures of 45 of the strains using an enzyme......-linked immunosorbent assay (ELISA) approach. Overall, the truncated amino acid sequences showed close similarity (> 98% at the amino acid level) to previously reported sequences from chicken-derived C. perfringens isolates. Variations were however observed in 23 out of 379 aa positions leading to the definition of 26...

  14. Multiple sulfatase deficiency is caused by mutations in the gene encoding the human C(alpha)-formylglycine generating enzyme. (United States)

    Dierks, Thomas; Schmidt, Bernhard; Borissenko, Ljudmila V; Peng, Jianhe; Preusser, Andrea; Mariappan, Malaiyalam; von Figura, Kurt


    C(alpha)-formylglycine (FGly) is the catalytic residue in the active site of eukaryotic sulfatases. It is posttranslationally generated from a cysteine in the endoplasmic reticulum. The genetic defect of FGly formation causes multiple sulfatase deficiency (MSD), a lysosomal storage disorder. We purified the FGly generating enzyme (FGE) and identified its gene and nine mutations in seven MSD patients. In patient fibroblasts, the activity of sulfatases is partially restored by transduction of FGE encoding cDNA, but not by cDNA carrying an MSD mutation. The gene encoding FGE is highly conserved among pro- and eukaryotes and has a paralog of unknown function in vertebrates. FGE is localized in the endoplasmic reticulum and is predicted to have a tripartite domain structure.

  15. Cartilage tissue formation from dedifferentiated chondrocytes by codelivery of BMP-2 and SOX-9 genes encoding bicistronic vector. (United States)

    Cha, Byung-Hyun; Kim, Jae-Hwan; Kang, Sun-Woong; Do, Hyun-Jin; Jang, Ju-Woong; Choi, Yon Rak; Park, Hansoo; Kim, Byung-Soo; Lee, Soo-Hong


    Articular cartilage, when damaged by degenerative disease or trauma, has limited ability for self-repair. Recently, many trials have demonstrated that gene therapy combined with tissue engineering techniques would be a promising approach for cartilage regeneration. Bone morphogenetic protein 2 (BMP-2) is an important signal for upregulation of osteogenesis and chondrogenesis of stem cells. Sex-determining region Y box gene 9 (SOX-9) has also been reported as one of the key transcription factors for chondrogenesis. We hypothesized that codelivery of BMP-2 and SOX-9 genes would result in improved efficiency of recovery of normal chondrogenic properties in dedifferentiated chondrocytes. To this aim, we constructed a bicistronic vector encoding the BMP-2 and SOX-9 genes linked to the "self-cleaving" 2A peptide sequence. After gene delivery to dedifferentiated chondrocytes using a microporator transfection system, we confirmed over 65% delivery efficiency of the BMP-2 and SOX-9 genes. According to RT-PCR analysis and Alcian blue staining, simultaneous delivery of BMP-2/SOX-9 resulted in significantly increased expression of chondrogenesis-related markers (type II collagen and aggrecan) and GAG matrix formation compared with individual delivery of the BMP-2 or SOX-9 gene. Six weeks after in vivo transplantation, BMP-2/SOX-9 genes also showed a significant increase in cartilage formation compared with the BMP-2 or SOX-9 gene. These results demonstrate that codelivery of two chondrogenic lineage-determining genes can enhance normal chondrogenic properties of dedifferentiated chondrocytes followed by improved cartilage formation.

  16. Biosynthesis of Actinorhodin and Related Antibiotics: Discovery of Alternative Routes for Quinone Formation Encoded in the act Gene Cluster

    National Research Council Canada - National Science Library

    Okamoto, Susumu; Taguchi, Takaaki; Ochi, Kozo; Ichinose, Koji


    .... Furthermore, in vitro, we showed a quinone-forming activity of the ActVA-ORF5/ActVB system in addition to that of a known C-6 monooxygenase, ActVA-ORF6, by using emodinanthrone as a model substrate. Our results demonstrate that the act gene cluster encodes two alternative routes for quinone formation by C-6 oxygenation in BIQ biosynthesis.

  17. Regulation of the Escherichia coli rmf gene encoding the ribosome modulation factor: growth phase- and growth rate-dependent control.


    Yamagishi, M.; Matsushima, H; Wada, A.; Sakagami, M.; Fujita, N.; Ishihama, A


    Ribosome modulation factor (RMF) is a protein specifically associated with 100S ribosome dimers which start to accumulate in Escherichia coli cells upon growth transition from exponential to stationary phase. The structural gene, rmf, encoding the 55 amino acid residues RMF protein has been cloned from the 21.8 min region of the E. coli genome and sequenced. While rmf was silent in rapidly growing exponential phase cells, a high level of transcription took place concomitantly with the growth ...

  18. Excretion of putrescine by the putrescine-ornithine antiporter encoded by the potE gene of Escherichia coli.


    Kashiwagi, K; Miyamoto, S; Suzuki, F; Kobayashi, H; Igarashi, K


    Excretion of putrescine from Escherichia coli was assessed by measuring its uptake into inside-out membrane vesicles. The vesicles were prepared from wild-type E. coli or E. coli transformed with plasmids containing one of the three polyamine transport systems. The results indicate that excretion of putrescine is catalyzed by the putrescine transport protein, encoded by the potE gene located at 16 min on the E. coli chromosome. Loading of ornithine (or lysine) inside the vesicles was essentia...

  19. [Polymorphism of genes encoding proteins of DNA repair vs. occupational and environmental exposure to lead, arsenic and pesticides]. (United States)

    Bukowski, Karol; Woźniak, Katarzyna


    Genetic polymorphism is associated with the occurrence of at least 2 different alleles in the locus with a frequency higher than 1% in the population. Among polymorphisms we can find single nucleotide polymorphism (SNP) and polymorphism of variable number of tandem repeats. The presence of certain polymorphisms in genes encoding DNA repair enzymes is associated with the speed and efficiency of DNA repair and can protect or expose humans to the effects provoked by xenobiotics. Chemicals, such as lead, arsenic pesticides are considered to exhibit strong toxicity. There are many different polymorphisms in genes encoding DNA repair enzymes, which determine the speed and efficiency of DNA damage repair induced by these xenobiotics. In the case of lead, the influence of various polymorphisms, such as APE1 (apurinic/apyrimidinic endonuclease 1) (rs1130409), hOGG1 (human 8-oxoguanine glycosylase) (rs1052133), XRCC1 (X-ray repair cross-complementing protein group 1) (rs25487), XRCC1 (rs1799782) and XRCC3 (X-ray repair cross-complementing protein group 3) (rs861539) were described. For arsenic polymorphisms, such as ERCC2 (excision repair cross-complementing) (rs13181), XRCC3 (rs861539), APE1 (rs1130409) and hOGG1 (rs1052133) were examined. As to pesticides, separate and combined effects of polymorphisms in genes encoding DNA repair enzymes, such as XRCC1 (rs1799782), hOGG1 (rs1052133), XRCC4 (X-ray repair cross-complementing protein group 4) (rs28360135) and the gene encoding the detoxification enzyme PON1 paraoxonase (rs662) were reported. Med Pr 2018;69(1). This work is available in Open Access model and licensed under a CC BY-NC 3.0 PL license.

  20. Variation in the Gene Encoding the Serotonin Transporter is Associated with a Measure of Sociopathy in Alcoholics


    Herman, Aryeh I.; Conner, Tamlin S.; Anton, Raymond F.; Gelernter, Joel; Kranzler, Henry R.; Covault, Jonathan


    The present study examined the association between a measure of sociopathy and 5-HTTLPR genotype in a sample of individuals from Project MATCH, a multi-center alcohol treatment trial. 5-HTTLPR, an insertion/deletion polymorphism in SLC6A4, the gene encoding the serotonin transporter protein, results in functionally distinct long (L) and short (S) alleles. The S allele has been associated with a variety of psychiatric disorders and symptoms including alcohol dependence, but it is unknown wheth...

  1. The UmGcn5 gene encoding histone acetyltransferase from Ustilago maydis is involved in dimorphism and virulence. (United States)

    González-Prieto, Juan Manuel; Rosas-Quijano, Raymundo; Domínguez, Angel; Ruiz-Herrera, José


    We isolated a gene encoding a histone acetyltransferase from Ustilago maydis (DC.) Cda., which is orthologous to the Saccharomyces cerevisiae GCN5 gene. The gene was isolated from genomic clones identified by their specific hybridization to a gene fragment obtained by the polymerase chain reaction (PCR). This gene (Umgcn5; um05168) contains an open reading frame (ORF) of 1421bp that encodes a putative protein of 473 amino acids with a Mr. of 52.6kDa. The protein exhibits a high degree of homology with histone acetyltransferases from different organisms. Null a2b2 ΔUmgcn5 mutants were constructed by substitution of the region encoding the catalytic site with a hygromycin B resistance cassette. Null a1b1 ΔUmgcn5 mutants were isolated from genetic crosses of a2b2 ΔUmgcn5 and a1b1 wild-type strains in maize. Mutants displayed a slight reduction in growth rate under different conditions, and were more sensitive than the wild type to stress conditions, but more important, they grew as long mycelial cells, and formed fuzz-like colonies under all conditions where wild-type strains grew in the yeast-like morphology and formed smooth colonies. This phenotype was not reverted by cAMP addition. Mutants were not virulent to maize plants, and were unable to form teliospores. These phenotypic alterations of the mutants were reverted by their transformation with the wild-type gene. Copyright © 2014 Elsevier Inc. All rights reserved.

  2. The frequency of genes encoding three putative group B streptococcal virulence factors among invasive and colonizing isolates

    Directory of Open Access Journals (Sweden)

    Borchardt Stephanie M


    Full Text Available Abstract Background Group B Streptococcus (GBS causes severe infections in very young infants and invasive disease in pregnant women and adults with underlying medical conditions. GBS pathogenicity varies between and within serotypes, with considerable variation in genetic content between strains. Three proteins, Rib encoded by rib, and alpha and beta C proteins encoded by bca and bac, respectively, have been suggested as potential vaccine candidates for GBS. It is not known, however, whether these genes occur more frequently in invasive versus colonizing GBS strains. Methods We screened 162 invasive and 338 colonizing GBS strains from different collections using dot blot hybridization to assess the frequency of bca, bac and rib. All strains were defined by serotyping for capsular type, and frequency differences were tested using the Chi square test. Results Genes encoding the beta C protein (bac and Rib (rib occurred at similar frequencies among invasive and colonizing isolates, bac (20% vs. 23%, and rib (28% vs. 20%, while the alpha (bca C protein was more frequently found in colonizing strains (46% vs, invasive (29%. Invasive strains were associated with specific serotype/gene combinations. Conclusion Novel virulence factors must be identified to better understand GBS disease.

  3. Carboxylesterase 1A2 encoding gene with increased transcription and potential rapid drug metabolism in Asian populations

    DEFF Research Database (Denmark)

    Rasmussen, Henrik Berg; Madsen, Majbritt Busk; Lyauk, Yassine Kamal


    The carboxylesterase 1 gene (CES1) encodes a hydrolase implicated in the metabolism of commonly used drugs. CES1A2, a hybrid of CES1 and a CES1-like pseudogene, has a promoter that is weak in most individuals. However, some individuals harbor a promoter haplotype of this gene with two overlapping...... Sp1 sites that confer significantly increased transcription potentially leading to rapid drug metabolism. This CES1A2 haplotype has previously been reported to be common among Asians. Using polymerase chain reaction followed by sequencing, the present study examined variation in the promoter and 5...

  4. Functional analysis of the protein encoded by the virulence gene psvA of Pseudomonas syringae pv. eriobotryae


    Kamiunten, Hiroshi; Sakamaki, Ikuko; Matsuo, Mitsuhiro


    The Pseudomonas syringae pv. eriobotryae (Pse) virulence gene psvA, (2193 bp), has been isolated but not been functionally characterized. The psvA gene was divided into two parts; the N-terninal region (psvAN, nucleotides (nt) 1-1386), and the C-terminal region (psvAC, nt 1387-2193). Functional analysis of the proteins encoded by psvAN and psvAC was carried out. The PsvAC shows sequence similarity to the Ulp1 endopeptidase family, which includes small ubiquitin-like modifier (SUMO) proteases....

  5. Characterization of high-level expression and sequencing of the Escherichia coli K-12 cynS gene encoding cyanase.


    Sung, Y C; Anderson, P M; Fuchs, J A


    Restriction fragments containing the gene encoding cyanase, cynS, without its transcriptional regulatory sequences were placed downstream of lac and tac promoters in various pUC derivatives to maximize production of cyanase. Plasmid pSJ105, which contains the cynS gene and an upstream open reading frame, gave the highest expression of cyanase. Approximately 50% of the total soluble protein in stationary-phase cultures of a lac-deleted strain containing plasmid pSJ105 was cyanase. The inserted...

  6. Global gene expression during stringent response in Corynebacterium glutamicum in presence and absence of the rel gene encoding (pppGpp synthase

    Directory of Open Access Journals (Sweden)

    Kalinowski Jörn


    Full Text Available Background The stringent response is the initial reaction of microorganisms to nutritional stress. During stringent response the small nucleotides (pppGpp act as global regulators and reprogram bacterial transcription. In this work, the genetic network controlled by the stringent response was characterized in the amino acid-producing Corynebacterium glutamicum. Results The transcriptome of a C. glutamicum rel gene deletion mutant, unable to synthesize (pppGpp and to induce the stringent response, was compared with that of its rel-proficient parent strain by microarray analysis. A total of 357 genes were found to be transcribed differentially in the rel-deficient mutant strain. In a second experiment, the stringent response was induced by addition of DL-serine hydroxamate (SHX in early exponential growth phase. The time point of the maximal effect on transcription was determined by real-time RT-PCR using the histidine and serine biosynthetic genes. Transcription of all of these genes reached a maximum at 10 minutes after SHX addition. Microarray experiments were performed comparing the transcriptomes of SHX-induced cultures of the rel-proficient strain and the rel mutant. The differentially expressed genes were grouped into three classes. Class A comprises genes which are differentially regulated only in the presence of an intact rel gene. This class includes the non-essential sigma factor gene sigB which was upregulated and a large number of genes involved in nitrogen metabolism which were downregulated. Class B comprises genes which were differentially regulated in response to SHX in both strains, independent of the rel gene. A large number of genes encoding ribosomal proteins fall into this class, all being downregulated. Class C comprises genes which were differentially regulated in response to SHX only in the rel mutant. This class includes genes encoding putative stress proteins and global transcriptional regulators that might be

  7. A lepidopteran-specific gene family encoding valine-rich midgut proteins.

    Directory of Open Access Journals (Sweden)

    Jothini Odman-Naresh

    Full Text Available Many lepidopteran larvae are serious agricultural pests due to their feeding activity. Digestion of the plant diet occurs mainly in the midgut and is facilitated by the peritrophic matrix (PM, an extracellular sac-like structure, which lines the midgut epithelium and creates different digestive compartments. The PM is attracting increasing attention to control lepidopteran pests by interfering with this vital function. To identify novel PM components and thus potential targets for insecticides, we performed an immunoscreening with anti-PM antibodies using an expression library representing the larval midgut transcriptome of the tobacco hornworm, Manduca sexta. We identified three cDNAs encoding valine-rich midgut proteins of M. sexta (MsVmps, which appear to be loosely associated with the PM. They are members of a lepidopteran-specific family of nine VMP genes, which are exclusively expressed in larval stages in M. sexta. Most of the MsVMP transcripts are detected in the posterior midgut, with the highest levels observed for MsVMP1. To obtain further insight into Vmp function, we expressed MsVMP1 in insect cells and purified the recombinant protein. Lectin staining and glycosidase treatment indicated that MsVmp1 is highly O-glycosylated. In line with results from qPCR, immunoblots revealed that MsVmp1 amounts are highest in feeding larvae, while MsVmp1 is undetectable in starving and molting larvae. Finally using immunocytochemistry, we demonstrated that MsVmp1 localizes to the cytosol of columnar cells, which secrete MsVmp1 into the ectoperitrophic space in feeding larvae. In starving and molting larvae, MsVmp1 is found in the gut lumen, suggesting that the PM has increased its permeability. The present study demonstrates that lepidopteran species including many agricultural pests have evolved a set of unique proteins that are not found in any other taxon and thus may reflect an important adaptation in the highly specialized lepidopteran

  8. The yeast Dekkera bruxellensis genome contains two orthologs of the ARO10 gene encoding for phenylpyruvate decarboxylase. (United States)

    de Souza Liberal, Anna Theresa; Carazzolle, Marcelo Falsarella; Pereira, Gonçalo Amarante; Simões, Diogo Ardaillon; de Morais, Marcos Antonio


    The yeast Dekkera bruxellensis possesses important physiological traits that enable it to grow in industrial environments as either spoiling yeast of wine production or a fermenting strain used for lambic beer, or fermenting yeast in the bioethanol production process. In this work, in silico analysis of the Dekkera genome database allowed the identification of two paralogous genes encoding for phenylpyruvate decarboxylase (DbARO10) that represents a unique trait among the hemiascomycetes. The molecular analysis of the theoretical protein confirmed its protein identity. Upon cultivation of the cell in medium containing phenylpyruvate, both increases in gene expression and in phenylpyruvate decarboxylase activity were observed. Both genes were differentially expressed depending on the culture condition and the type of metabolism, which indicated the difference in the biological function of their corresponding proteins. The importance of the duplicated DbARO10 genes in the D. bruxellensis genome was discussed and represents the first effort to understand the production of flavor by this yeast.

  9. A novel human gene encoding a G-protein-coupled receptor (GPR15) is located on chromosome 3

    Energy Technology Data Exchange (ETDEWEB)

    Heiber, M.; Marchese, A.; O`Dowd, B.F. [Univ. of Toronto, Ontario (Canada)] [and others


    We used sequence similarities among G-protein-coupled receptor genes to discover a novel receptor gene. Using primers based on conserved regions of the opioid-related receptors, we isolated a PCR product that was used to locate the full-length coding region of a novel human receptor gene, which we have named GPR15. A comparison of the amino acid sequence of the receptor gene, which we have named GPR15. A comparison of the amino acid sequence of the receptor encoded by GPR15 with other receptors revealed that it shared sequence identity with the angiotensin II AT1 and AT2 receptors, the interleukin 8b receptor, and the orphan receptors GPR1 and AGTL1. GPR15 was mapped to human chromosome 3q11.2-q13.1. 12 refs., 2 figs.

  10. A family of genes encoding zona pellucida (ZP) domain proteins is expressed in various epithelial tissues during Drosophila embryogenesis. (United States)

    Jaźwińska, Anna; Affolter, Markus


    Zona pellucida (ZP) domain proteins have been identified in various species from worms to humans. Most of the characterized ZP family members are secreted or remain anchored to the plasma membrane where they play a structural role and/or act as receptors. In humans, several ZP proteins attracted attention because of their abundant expression in certain organs and their relation to various diseases. Here, we compare the molecular architecture and embryonic expression pattern of the 18 genes encoding ZP proteins in Drosophila melanogaster. Only five of these genes have been genetically characterized. All ZP genes are expressed in the embryo in epithelial tissues, such as the foregut, the hindgut, the Malpighian tubules, the salivary glands, the tracheal system, sensory organs and epidermis. Five genes are expressed during oogenesis; two of them are transcribed in the follicular epithelium, but not in the germ line cells.

  11. The pkI gene encoding pyruvate kinase I links to the luxZ gene which enhances bioluminescence of the lux operon from Photobacterium leiognathi. (United States)

    Lin, J W; Lu, H C; Chen, H Y; Weng, S F


    Partial 3'-end nucleotide sequence of the pkI gene (GenBank accession No. AF019143) from Photobacterium leiognathi ATCC 25521 has been determined, and the encoded pyruvate kinase I is deduced. Pyruvate kinase I is the key enzyme of glycolysis, which converts phosphoenol pyruvate to pyruvate. Alignment and comparison of pyruvate kinase Is from P. leiognathi, E. coli and Salmonella typhimurium show that they are homologous. Nucleotide sequence reveals that the pkI gene is linked to the luxZ gene that enhances bioluminescence of the lux operon from P. leiognathi. The gene order of the pkI and luxZ genes is-pk1-ter-->-R&R"-luxZ-ter"-->, whereas ter is transcriptional terminator for the pkI and related genes, and R&R" is the regulatory region and ter" is transcriptional terminator for the luxZ gene. It clearly elicits that the pkI gene and luxZ gene are divided to two operons. Functional analysis confirms that the potential hairpin loop omega T is the transcriptional terminator for the pkI and related genes. It infers that the pkI and related genes are simply linked to the luxZ gene in P. leiognathi genome.

  12. aes, the gene encoding the esterase B in Escherichia coli, is a powerful phylogenetic marker of the species

    Directory of Open Access Journals (Sweden)

    Tuffery Pierre


    Full Text Available Abstract Background Previous studies have established a correlation between electrophoretic polymorphism of esterase B, and virulence and phylogeny of Escherichia coli. Strains belonging to the phylogenetic group B2 are more frequently implicated in extraintestinal infections and include esterase B2 variants, whereas phylogenetic groups A, B1 and D contain less virulent strains and include esterase B1 variants. We investigated esterase B as a marker of phylogeny and/or virulence, in a thorough analysis of the esterase B-encoding gene. Results We identified the gene encoding esterase B as the acetyl-esterase gene (aes using gene disruption. The analysis of aes nucleotide sequences in a panel of 78 reference strains, including the E. coli reference (ECOR strains, demonstrated that the gene is under purifying selection. The phylogenetic tree reconstructed from aes sequences showed a strong correlation with the species phylogenetic history, based on multi-locus sequence typing using six housekeeping genes. The unambiguous distinction between variants B1 and B2 by electrophoresis was consistent with Aes amino-acid sequence analysis and protein modelling, which showed that substituted amino acids in the two esterase B variants occurred mostly at different sites on the protein surface. Studies in an experimental mouse model of septicaemia using mutant strains did not reveal a direct link between aes and extraintestinal virulence. Moreover, we did not find any genes in the chromosomal region of aes to be associated with virulence. Conclusion Our findings suggest that aes does not play a direct role in the virulence of E. coli extraintestinal infection. However, this gene acts as a powerful marker of phylogeny, illustrating the extensive divergence of B2 phylogenetic group strains from the rest of the species.

  13. aes, the gene encoding the esterase B in Escherichia coli, is a powerful phylogenetic marker of the species. (United States)

    Lescat, Mathilde; Hoede, Claire; Clermont, Olivier; Garry, Louis; Darlu, Pierre; Tuffery, Pierre; Denamur, Erick; Picard, Bertrand


    Previous studies have established a correlation between electrophoretic polymorphism of esterase B, and virulence and phylogeny of Escherichia coli. Strains belonging to the phylogenetic group B2 are more frequently implicated in extraintestinal infections and include esterase B2 variants, whereas phylogenetic groups A, B1 and D contain less virulent strains and include esterase B1 variants. We investigated esterase B as a marker of phylogeny and/or virulence, in a thorough analysis of the esterase B-encoding gene. We identified the gene encoding esterase B as the acetyl-esterase gene (aes) using gene disruption. The analysis of aes nucleotide sequences in a panel of 78 reference strains, including the E. coli reference (ECOR) strains, demonstrated that the gene is under purifying selection. The phylogenetic tree reconstructed from aes sequences showed a strong correlation with the species phylogenetic history, based on multi-locus sequence typing using six housekeeping genes. The unambiguous distinction between variants B1 and B2 by electrophoresis was consistent with Aes amino-acid sequence analysis and protein modelling, which showed that substituted amino acids in the two esterase B variants occurred mostly at different sites on the protein surface. Studies in an experimental mouse model of septicaemia using mutant strains did not reveal a direct link between aes and extraintestinal virulence. Moreover, we did not find any genes in the chromosomal region of aes to be associated with virulence. Our findings suggest that aes does not play a direct role in the virulence of E. coli extraintestinal infection. However, this gene acts as a powerful marker of phylogeny, illustrating the extensive divergence of B2 phylogenetic group strains from the rest of the species.

  14. Rapid transient isoform-specific neuregulin1 transcription in motor neurons is regulated by neurotrophic factors and axon-target interactions (United States)

    Wang, Jiajing; Hmadcha, Abdelkrim; Zakarian, Vaagn; Song, Fei; Loeb, Jeffrey A.


    The neuregulins (NRGs) are a family of alternatively spliced factors that play important roles in nervous system development and disease. In motor neurons, NRG1 expression is regulated by activity and neurotrophic factors, however, little is known about what controls isoform-specific transcription. Here we show that NRG1 expression in the chick embryo increases in motor neurons that have extended their axons and that limb bud ablation before motor axon outgrowth prevents this induction, suggesting a trophic role from the developing limb. Consistently, NRG1 induction after limb bud ablation can be rescued by adding back the neurotrophic factors BDNF and GDNF. Mechanistically, BDNF induces a rapid and transient increase in type I and type III NRG1 mRNAs that peak at 4 h in rat embryonic ventral spinal cord cultures. Blocking MAPK or PI3K signaling or blocking transcription with Actinomycin D blocks BDNF induced NRG1 gene induction. BDNF had no effect on mRNA degradation, suggesting that transcriptional activation rather than message stability is important. Furthermore, BDNF activates a reporter construct that includes 700bp upstream of the type I NRG1 start site. Protein synthesis is also required for type I NRG1 mRNA transcription as cycloheximide produced a super-induction of type I, but not type III NRG1 mRNA, possibly through a mechanism involving sustained activation of MAPK and PI3K. These results reveal the existence of highly responsive, transient transcriptional regulatory mechanisms that differentially modulate NRG1 isoform expression as a function of extracellular and intracellular signaling cascades and mediated by neurotrophic factors and axon-target interactions. PMID:25913151

  15. Effect of long-term actual spaceflight on the expression of key genes encoding serotonin and dopamine system (United States)

    Popova, Nina; Shenkman, Boris; Naumenko, Vladimir; Kulikov, Alexander; Kondaurova, Elena; Tsybko, Anton; Kulikova, Elisabeth; Krasnov, I. B.; Bazhenova, Ekaterina; Sinyakova, Nadezhda

    The effect of long-term spaceflight on the central nervous system represents important but yet undeveloped problem. The aim of our work was to study the effect of 30-days spaceflight of mice on Russian biosatellite BION-M1 on the expression in the brain regions of key genes of a) serotonin (5-HT) system (main enzymes in 5-HT metabolism - tryptophan hydroxylase-2 (TPH-2), monoamine oxydase A (MAO A), 5-HT1A, 5-HT2A and 5-HT3 receptors); b) pivotal enzymes in DA metabolism (tyrosine hydroxylase, COMT, MAO A, MAO B) and D1, D2 receptors. Decreased expression of genes encoding the 5-HT catabolism (MAO A) and 5-HT2A receptor in some brain regions was shown. There were no differences between “spaceflight” and control mice in the expression of TPH-2 and 5-HT1A, 5-HT3 receptor genes. Significant changes were found in genetic control of DA system. Long-term spaceflight decreased the expression of genes encoding the enzyme in DA synthesis (tyrosine hydroxylase in s.nigra), DA metabolism (MAO B in the midbrain and COMT in the striatum), and D1 receptor in hypothalamus. These data suggested that 1) microgravity affected genetic control of 5-HT and especially the nigrostriatal DA system implicated in the central regulation of muscular tonus and movement, 2) the decrease in the expression of genes encoding key enzyme in DA synthesis, DA degradation and D1 receptor contributes to the movement impairment and dyskinesia produced by the spaceflight. The study was supported by Russian Foundation for Basic Research grant № 14-04-00173.

  16. MicroRNAs tend to synergistically control expression of genes encoding extensively-expressed proteins in humans

    Directory of Open Access Journals (Sweden)

    Xue Chen


    Full Text Available Considering complicated microRNA (miRNA biogenesis and action mechanisms, it was thought so high energy-consuming for a cell to afford simultaneous over-expression of many miRNAs. Thus it prompts that an alternative miRNA regulation pattern on protein-encoding genes must exist, which has characteristics of energy-saving and precise protein output. In this study, expression tendency of proteins encoded by miRNAs’ target genes was evaluated in human organ scale, followed by quantitative assessment of miRNA synergism. Expression tendency analysis suggests that universally expressed proteins (UEPs tend to physically interact in clusters and participate in fundamental biological activities whereas disorderly expressed proteins (DEPs are inclined to relatively independently execute organ-specific functions. Consistent with this, miRNAs that mainly target UEP-encoding mRNAs, such as miR-21, tend to collaboratively or even synergistically act with other miRNAs in fine-tuning protein output. Synergistic gene regulation may maximize miRNAs’ efficiency with less dependence on miRNAs’ abundance and overcome the deficiency that targeting plenty of genes by single miRNA makes miRNA-mediated regulation high-throughput but insufficient due to target gene dilution effect. Furthermore, our in vitro experiment verified that merely 25 nM transfection of miR-21 be sufficient to influence the overall state of various human cells. Thus miR-21 was identified as a hub in synergistic miRNA–miRNA interaction network. Our findings suggest that synergistic miRNA–miRNA interaction is an important endogenous miRNA regulation mode, which ensures adequate potency of miRNAs at low abundance, especially those implicated in fundamental biological regulation.

  17. The p10 gene of Bombyx mori nucleopolyhedrosis virus encodes a ...

    Indian Academy of Sciences (India)

    In baculovirus-based high-level expression of cloned foreign genes, the viral very late gene promoters of polyhedrin (polh) and p10 are extensively exploited. Here we report the cloning and characterization of the p10 gene from a local isolate of Bombyx mori nucleopolyhedrosis virus (BmNPV). The gene harbours a 213-bp ...

  18. Locus heterogeneity disease genes encode proteins with high interconnectivity in the human protein interaction network

    Directory of Open Access Journals (Sweden)

    Benjamin eKeith


    Full Text Available Mutations in genes potentially lead to a number of genetic diseases with differing severity. These disease genes have been the focus of research in recent years showing that the disease gene population as a whole is not homogeneous, and can be categorised according to their interactions. Locus heterogeneity describes a single disorder caused by mutations in different genes each acting individually to cause the same disease. Using datasets of experimentally derived human disease genes and protein interactions, we created a protein interaction network to investigate the relationships between the products of genes associated with a disease displaying locus heterogeneity, and use network parameters to suggest properties that distinguish these disease genes from the overall disease gene population. Through the manual curation of known causative genes of 100 diseases displaying locus heterogeneity and 397 single-gene Mendelian disorders, we use network parameters to show that our locus heterogeneity network displays distinct properties from the global disease network and a Mendelian network. Using the global human proteome, through random simulation of the network we show that heterogeneous genes display significant interconnectivity. Further topological analysis of this network revealed clustering of locus heterogeneity genes that cause identical disorders, indicating that these disease genes are involved in similar biological processes. We then use this information to suggest novel genes that may also contribute to diseases with locus heterogeneity.

  19. Several genes encoding enzymes with the same activity are necessary for aerobic fungal degradation of cellulose in nature. (United States)

    Busk, Peter K; Lange, Mette; Pilgaard, Bo; Lange, Lene


    The cellulose-degrading fungal enzymes are glycoside hydrolases of the GH families and lytic polysaccharide monooxygenases. The entanglement of glycoside hydrolase families and functions makes it difficult to predict the enzymatic activity of glycoside hydrolases based on their sequence. In the present study we further developed the method Peptide Pattern Recognition to an automatic approach not only to find all genes encoding glycoside hydrolases and lytic polysaccharide monooxygenases in fungal genomes but also to predict the function of the genes. The functional annotation is an important feature as it provides a direct route to predict function from primary sequence. Furthermore, we used Peptide Pattern Recognition to compare the cellulose-degrading enzyme activities encoded by 39 fungal genomes. The results indicated that cellobiohydrolases and AA9 lytic polysaccharide monooxygenases are hallmarks of cellulose-degrading fungi except brown rot fungi. Furthermore, a high number of AA9, endocellulase and β-glucosidase genes were identified, not in what are known to be the strongest, specialized lignocellulose degraders but in saprophytic fungi that can use a wide variety of substrates whereas only few of these genes were found in fungi that have a limited number of natural, lignocellulotic substrates. This correlation suggests that enzymes with different properties are necessary for degradation of cellulose in different complex substrates. Interestingly, clustering of the fungi based on their predicted enzymes indicated that Ascomycota and Basidiomycota use the same enzymatic activities to degrade plant cell walls.

  20. Isolation of an osmotic stress- and abscisic acid-induced gene encoding an acidic endochitinase from Lycopersicon chilense. (United States)

    Chen, R D; Yu, L X; Greer, A F; Cheriti, H; Tabaeizadeh, Z


    We have identified one osmotic stress- and abscisic acid-responsive member of the endochitinase (EC gene family from leaves of drought-stressed Lycopersicon chilense plants, a natural inhabitant of extremely arid regions in South America. The 966-bp full-length cDNA (designated pcht28) encodes an acidic chitinase precursor with an amino-terminal signal peptide. The mature protein is predicted to have 229 amino acid residues with a relative molecular mass of 24,943 and pI value of 6.2. Sequence analysis revealed that pcht28 has a high degree of homology with class II chitinases (EC from tomato and tobacco. Expression of the pcht28 protein in Escherichia coli verified that it is indeed a chitinase. Northern blot analysis indicated that this gene has evolved a different pattern of expression from that of other family members reported thus far. It is highly induced by both osmotic stress and the plant hormone abscisic acid. Southern blot analysis of genomic DNA suggested that the pcht28-related genes may form a small multigene family in this species. The efficiency of induction of the gene by drought stress, in leaves and stems, is significantly higher in L. chilense than in the cultivated tomato. It is speculated that, besides its general defensive function, the pcht28-encoded chitinase may play a particular role in plant development or in protecting plants from pathogen attack during water stress.

  1. Several genes encoding enzymes with the same activity are necessary for aerobic fungal degradation of cellulose in nature.

    Directory of Open Access Journals (Sweden)

    Peter K Busk

    Full Text Available The cellulose-degrading fungal enzymes are glycoside hydrolases of the GH families and lytic polysaccharide monooxygenases. The entanglement of glycoside hydrolase families and functions makes it difficult to predict the enzymatic activity of glycoside hydrolases based on their sequence. In the present study we further developed the method Peptide Pattern Recognition to an automatic approach not only to find all genes encoding glycoside hydrolases and lytic polysaccharide monooxygenases in fungal genomes but also to predict the function of the genes. The functional annotation is an important feature as it provides a direct route to predict function from primary sequence. Furthermore, we used Peptide Pattern Recognition to compare the cellulose-degrading enzyme activities encoded by 39 fungal genomes. The results indicated that cellobiohydrolases and AA9 lytic polysaccharide monooxygenases are hallmarks of cellulose-degrading fungi except brown rot fungi. Furthermore, a high number of AA9, endocellulase and β-glucosidase genes were identified, not in what are known to be the strongest, specialized lignocellulose degraders but in saprophytic fungi that can use a wide variety of substrates whereas only few of these genes were found in fungi that have a limited number of natural, lignocellulotic substrates. This correlation suggests that enzymes with different properties are necessary for degradation of cellulose in different complex substrates. Interestingly, clustering of the fungi based on their predicted enzymes indicated that Ascomycota and Basidiomycota use the same enzymatic activities to degrade plant cell walls.

  2. The Escherichia coli Serogroup O1 and O2 Lipopolysaccharides Are Encoded by Multiple O-antigen Gene Clusters (United States)

    Delannoy, Sabine; Beutin, Lothar; Mariani-Kurkdjian, Patricia; Fleiss, Aubin; Bonacorsi, Stéphane; Fach, Patrick


    Escherichia coli strains belonging to serogroups O1 and O2 are frequently associated with human infections, especially extra-intestinal infections such as bloodstream infections or urinary tract infections. These strains can be associated with a large array of flagellar antigens. Because of their frequency and clinical importance, a reliable detection of E. coli O1 and O2 strains and also the frequently associated K1 capsule is important for diagnosis and source attribution of E. coli infections in humans and animals. By sequencing the O-antigen clusters of various O1 and O2 strains we showed that the serogroups O1 and O2 are encoded by different sets of O-antigen encoding genes and identified potentially new O-groups. We developed qPCR-assays to detect the various O1 and O2 variants and the K1-encoding gene. These qPCR assays proved to be 100% sensitive and 100% specific and could be valuable tools for the investigations of zoonotic and food-borne infection of humans with O1 and O2 extra-intestinal (ExPEC) or Shiga toxin-producing E. coli (STEC) strains. PMID:28224115

  3. A Cooperia punctata gene family encoding 14 kDa excretory-secretory antigens conserved for trichostrongyloid nematodes. (United States)

    Yatsuda, A P; De Vries, E; Vieira Bressan, M C; Eysker, M


    A polymorphic set of 14 kDa excretory-secretory (E-S) antigen-encoding cDNAs, with similarity to a previously characterized 15 kDa E-S antigen of Haemonchus contortus, was cloned from Cooperia punctata. Five cDNAs encoding predicted proteins of 70-80% identity were sequenced. Genomic analyses of individuals proved the existence of three 14 kDa E-S antigen-encoding genes, excluding that the differences reflected polymorphisms between individuals in a population. Southern blots indicated the presence of additional members of this gene family. Thus, despite the fact that heterologously expressed C. punctata 14 kDa E-S products are shown to be recognized by immune sera, potential pitfalls in the development of a recombinant vaccine are presented by this genetic diversity. Vaccine design could be further rationalized by knowledge of the function, and possible redundancy in function, of the E-S products which is presently lacking. The limitations encountered in assigning a function to the 14/15 kDa family of E-S proteins that is thus far unique to the trichostrongyloid nematodes are discussed.

  4. The decarboxylation of the weak-acid preservative, sorbic acid, is encoded by linked genes in Aspergillus spp. (United States)

    Plumridge, Andrew; Melin, Petter; Stratford, Malcolm; Novodvorska, Michaela; Shunburne, Lee; Dyer, Paul S; Roubos, Johannes A; Menke, Hildegard; Stark, Jacques; Stam, Hein; Archer, David B


    The ability to resist anti-microbial compounds is of key evolutionary benefit to microorganisms. Aspergillus niger has previously been shown to require the activity of a phenylacrylic acid decarboxylase (encoded by padA1) for the decarboxylation of the weak-acid preservative sorbic acid (2,4-hexadienoic acid) to 1,3-pentadiene. It is now shown that this decarboxylation process also requires the activity of a putative 4-hydroxybenzoic acid (3-octaprenyl-4-hydroxybenzoic acid) decarboxylase, encoded by a gene termed ohbA1, and a putative transcription factor, sorbic acid decarboxylase regulator, encoded by sdrA. The padA1,ohbA1 and sdrA genes are in close proximity to each other on chromosome 6 in the A. niger genome and further bioinformatic analysis revealed conserved synteny at this locus in several Aspergillus species and other ascomycete fungi indicating clustering of metabolic function. This cluster is absent from the genomes of A. fumigatus and A. clavatus and, as a consequence, neither species is capable of decarboxylating sorbic acid. Copyright 2010 Elsevier Inc. All rights reserved.

  5. Analysis of viral protein-2 encoding gene of avian encephalomyelitis virus from field specimens in Central Java region, Indonesia. (United States)

    Haryanto, Aris; Ermawati, Ratna; Wati, Vera; Irianingsih, Sri Handayani; Wijayanti, Nastiti


    Avian encephalomyelitis (AE) is a viral disease which can infect various types of poultry, especially chicken. In Indonesia, the incidence of AE infection in chicken has been reported since 2009, the AE incidence tends to increase from year to year. The objective of this study was to analyze viral protein 2 (VP-2) encoding gene of AE virus (AEV) from various species of birds in field specimen by reverse transcription polymerase chain reaction (RT-PCR) amplification using specific nucleotides primer for confirmation of AE diagnosis. A total of 13 AEV samples are isolated from various species of poultry which are serologically diagnosed infected by AEV from some areas in central Java, Indonesia. Research stage consists of virus samples collection from field specimens, extraction of AEV RNA, amplification of VP-2 protein encoding gene by RT-PCR, separation of RT-PCR product by agarose gel electrophoresis, DNA sequencing and data analysis. Amplification products of the VP-2 encoding gene of AEV by RT-PCR methods of various types of poultry from field specimens showed a positive results on sample code 499/4/12 which generated DNA fragment in the size of 619 bp. Sensitivity test of RT-PCR amplification showed that the minimum concentration of RNA template is 127.75 ng/µl. The multiple alignments of DNA sequencing product indicated that positive sample with code 499/4/12 has 92% nucleotide homology compared with AEV with accession number AV1775/07 and 85% nucleotide homology with accession number ZCHP2/0912695 from Genbank database. Analysis of VP-2 gene sequence showed that it found 46 nucleotides difference between isolate 499/4/12 compared with accession number AV1775/07 and 93 nucleotides different with accession number ZCHP2/0912695. Analyses of the VP-2 encoding gene of AEV with RT-PCR method from 13 samples from field specimen generated the DNA fragment in the size of 619 bp from one sample with sample code 499/4/12. The sensitivity rate of RT-PCR is to amplify

  6. Analysis of viral protein-2 encoding gene of avian encephalomyelitis virus from field specimens in Central Java region, Indonesia

    Directory of Open Access Journals (Sweden)

    Aris Haryanto


    Full Text Available Aim: Avian encephalomyelitis (AE is a viral disease which can infect various types of poultry, especially chicken. In Indonesia, the incidence of AE infection in chicken has been reported since 2009, the AE incidence tends to increase from year to year. The objective of this study was to analyze viral protein 2 (VP-2 encoding gene of AE virus (AEV from various species of birds in field specimen by reverse transcription polymerase chain reaction (RT-PCR amplification using specific nucleotides primer for confirmation of AE diagnosis. Materials and Methods: A total of 13 AEV samples are isolated from various species of poultry which are serologically diagnosed infected by AEV from some areas in central Java, Indonesia. Research stage consists of virus samples collection from field specimens, extraction of AEV RNA, amplification of VP-2 protein encoding gene by RT-PCR, separation of RT-PCR product by agarose gel electrophoresis, DNA sequencing and data analysis. Results: Amplification products of the VP-2 encoding gene of AEV by RT-PCR methods of various types of poultry from field specimens showed a positive results on sample code 499/4/12 which generated DNA fragment in the size of 619 bp. Sensitivity test of RT-PCR amplification showed that the minimum concentration of RNA template is 127.75 ng/μl. The multiple alignments of DNA sequencing product indicated that positive sample with code 499/4/12 has 92% nucleotide homology compared with AEV with accession number AV1775/07 and 85% nucleotide homology with accession number ZCHP2/0912695 from Genbank database. Analysis of VP-2 gene sequence showed that it found 46 nucleotides difference between isolate 499/4/12 compared with accession number AV1775/07 and 93 nucleotides different with accession number ZCHP2/0912695. Conclusions: Analyses of the VP-2 encoding gene of AEV with RT-PCR method from 13 samples from field specimen generated the DNA fragment in the size of 619 bp from one sample with

  7. Functional analysis of the Phycomyces carRA gene encoding the enzymes phytoene synthase and lycopene cyclase.

    Directory of Open Access Journals (Sweden)

    Catalina Sanz

    Full Text Available Phycomyces carRA gene encodes a protein with two domains. Domain R is characterized by red carR mutants that accumulate lycopene. Domain A is characterized by white carA mutants that do not accumulate significant amounts of carotenoids. The carRA-encoded protein was identified as the lycopene cyclase and phytoene synthase enzyme by sequence homology with other proteins. However, no direct data showing the function of this protein have been reported so far. Different Mucor circinelloides mutants altered at the phytoene synthase, the lycopene cyclase or both activities were transformed with the Phycomyces carRA gene. Fully transcribed carRA mRNA molecules were detected by Northern assays in the transformants and the correct processing of the carRA messenger was verified by RT-PCR. These results showed that Phycomyces carRA gene was correctly expressed in Mucor. Carotenoids analysis in these transformants showed the presence of ß-carotene, absent in the untransformed strains, providing functional evidence that the Phycomyces carRA gene complements the M. circinelloides mutations. Co-transformation of the carRA cDNA in E. coli with different combinations of the carotenoid structural genes from Erwinia uredovora was also performed. Newly formed carotenoids were accumulated showing that the Phycomyces CarRA protein does contain lycopene cyclase and phytoene synthase activities. The heterologous expression of the carRA gene and the functional complementation of the mentioned activities are not very efficient in E. coli. However, the simultaneous presence of both carRA and carB gene products from Phycomyces increases the efficiency of these enzymes, presumably due to an interaction mechanism.

  8. A cloned gene of Cryptosporidium parvum encodes neutralization-sensitive epitopes. (United States)

    Perryman, L E; Jasmer, D P; Riggs, M W; Bohnet, S G; McGuire, T C; Arrowood, M J


    Two mAb, C6B6 and 7D10, each significantly reduced infection of mice by Cryptosporidium parvum and reacted with a 23-kDa glycoprotein (p23) of geographically disperse C. parvum isolates. The antibodies were used to identify plaques in a cDNA library prepared from C. parvum sporozoite mRNA. cDNA insert sequences from positive plaques were determined and used to isolate additional clones encoding p23 coding sequences. A consensus open reading frame of 333 base pairs, encoding 111 amino acids, was identified in this collection of cDNAs. The predicted amino acid sequence contained one N-glycosylation site, but lacked hydrophobic membrane spanning regions. Epitope mapping revealed that mAb 7D10 defines the linear epitope QDKPAD which occurs twice in the C terminal region of the peptide encoded by the ORF. This same C terminal peptide region contains a non-linear epitope bound by mAb C6B6. Serum from mice immunized with synthetic C terminal peptide reacted with sporozoite p23. The occurrence of neutralization-sensitive epitopes encoded by defined regions of the C. parvum genome suggests that recombinant proteins or synthetic peptides containing these epitopes may prove useful for inducing immune responses that diminish infection.

  9. Changes in expression of putative antigens encoded by pigment genes in mouse melanomas at different stages of malignant progression. (United States)

    Orlow, S J; Hearing, V J; Sakai, C; Urabe, K; Zhou, B K; Silvers, W K; Mintz, B


    Cutaneous melanomas of Tyr-SV40E transgenic mice (mice whose transgene consists of the tyrosinase promoter fused to the coding regions of simian virus 40 early genes) strikingly resemble human melanomas in their development and progression. Unlike human melanomas, the mouse tumors all arise in genetically identical individuals, thereby better enabling expression of specific genes to be characterized in relation to advancing malignancy. The products of pigment genes are of particular interest because peptides derived from these proteins have been reported to function as autoantigens with immunotherapeutic potential in some melanoma patients. However, the diminished pigmentation characteristic of many advanced melanomas raises the possibility that some of the relevant products may no longer be expressed in the most malignant cells. We have therefore investigated the contributions of several pigment genes in melanotic vs. relatively amelanotic components of primary and metastatic mouse melanomas. The analyses reveal marked differences within and among tumors in levels of mRNAs and proteins encoded by the wild-type alleles at the albino, brown, slaty, and silver loci. Tyrosinase (the protein encoded by the albino locus) was most often either absent or undetectable as melanization declined. The protein encoded by the slaty locus (tyrosinase-related protein 2) was the only one of those tested that was clearly present in all the tumor samples. These results suggest that sole reliance on targeting tyrosinase-based antigens might selectively favor survival of more malignant cells, whereas targeting the ensemble of the antigens tested might contribute toward a more inclusive and effective antimelanoma strategy.

  10. Zea mI, the maize homolog of the allergen-encoding Lol pI gene of rye grass. (United States)

    Broadwater, A H; Rubinstein, A L; Chay, C H; Klapper, D G; Bedinger, P A


    Sequence analysis of a pollen-specific cDNA from maize has identified a homolog (Zea mI) of the gene (Lol pI) encoding the major allergen of rye-grass pollen. The protein encoded by the partial cDNA sequence is 59.3% identical and 72.7% similar to the comparable region of the reported amino acid sequence of Lol pIA. Southern analysis indicates that this cDNA represents a member of a small multigene family in maize. Northern analysis shows expression only in pollen, not in vegetative or female floral tissues. The timing of expression is developmentally regulated, occurring at a low level prior to the first pollen mitosis and at a high level after this postmeiotic division. Western analysis detects a protein in maize pollen lysates using polyclonal antiserum and monoclonal antibodies directed against purified Lolium perenne allergen.

  11. Ankyrin repeat domain-encoding genes in the wPip strain of Wolbachia from the Culex pipiens group

    Directory of Open Access Journals (Sweden)

    Parkhill Julian


    Full Text Available Abstract Background Wolbachia are obligate endosymbiotic bacteria maternally transmitted through the egg cytoplasm that are responsible for several reproductive disorders in their insect hosts, such as cytoplasmic incompatibility (CI in infected mosquitoes. Species in the Culex pipiens complex display an unusually high number of Wolbachia-induced crossing types, and based on present data, only the wPip strain is present. Results The sequencing of the wPip strain of Wolbachia revealed the presence of 60 ankyrin repeat domain (ANK encoding genes and expression studies of these genes were carried out in adult mosquitoes. One of these ANK genes, pk2, is shown to be part of an operon of three prophage-associated genes with sex-specific expression, and is present in two identical copies in the genome. Another homolog of pk2 is also present that is differentially expressed in different Cx. pipiens group strains. A further two ANK genes showed sex-specific regulation in wPip-infected Cx. pipiens group adults. Conclusion The high number, variability and differential expression of ANK genes in wPip suggest an important role in Wolbachia biology, and the gene family provides both markers and promising candidates for the study of reproductive manipulation.

  12. A novel metagenome-derived gene cluster from termite hindgut: Encoding phosphotransferase system components and high glucose tolerant glucosidase. (United States)

    Gao, Gang; Wang, An; Gong, Bo-Liang; Li, Qing-Qing; Liu, Yu-Huan; He, Zhu-Mei; Li, Gang


    Functional screening of a metagenomic library of termite hindgut identified an overlapping gene cluster encoding the phosphotransferase system (PTS) components, which consisted of a glucoside specific PTS enzyme II gene (glu1923) and a glycoside hydrolase gene (glu1392). Hydrolytic experiments revealed that the combined effect of Glu1923 and Glu1392 was responsible for the utilization of glucosidic substrates in recombinant Escherichia coli (E. coli) strains. Yeast two hybrid analysis suggested that there was an interaction between Glu1923 and Glu1392, and the domain EIIA of Glu1923 played an important role for the interaction. In addition, the hydrolase Glu1392 displayed hydrolysis ability toward cellobiose and maltose, and had a very high tolerance to glucose with a Ki value of 2.25M. These properties make Glu1392 an interesting candidate in biotechnology applications after further study. Copyright © 2015 Elsevier Inc. All rights reserved.

  13. Small-scale expressed sequence tag analysis of Theileria uilenbergi: identification of a gene family encoding potential antigenic proteins. (United States)

    Liu, Zhijie; Dang, Zhisheng; Luo, Jianxun; Yin, Hong; Ahmed, Jabbar S; Seitzer, Ulrike


    Recently, Theileria sp. (China) has been designated as T. luwenshuni[formerly Theileria sp. (China 1)] and T. uilenbergi[formerly Theileria sp. (China 2)]. A cDNA library of T. uilenbergi merozoites was constructed and subjected to random sequencing. Among the obtained sequences were three highly identical cDNA clones, indicating a gene family. Bioinformatic analyses indicated these genes contain signal peptides and encode potential immunogenic proteins. The presence of tandemly arranged and additional variants of these genes was shown. Analysis of one recombinantly expressed clone revealed immunoreactivity for serum from Theileria-infected animals. No cross-reaction with serum of T. lestoquardi-, Babesia motasi-, or Anaplasma ovis-infected animals was observed, indicating a potential antigen for development of serological diagnostic tools.

  14. Isolation and Cloning of cDNA Fragment of Gene Encoding for Multidrug Resistance Associated Protein from M. affine.

    Directory of Open Access Journals (Sweden)

    Utut Widyastuti Suharsono


    Full Text Available Isolation and Cloning of cDNA Fragment of Gene Encoding for Multidrug Resistance Associated Protein from M. affine. M. affine can grow well in acid soil with high level of soluble aluminum. One of the important proteins in the detoxifying xenobiotic stress including acid and Al stresses is a multidrug resistance associated protein (MRP encoded by mrp gene. The objective of this research is to isolate and clone the cDNA fragment of MaMrp encoding MRP from M. affine. By reverse transcription, total cDNA had been synthesized from the total RNA as template. The fragment of cDNA MaMrp had been successfully isolated by PCR by using total cDNA as template and mrp primer designed from A. thaliana, yeast, and human. This fragment was successfully inserted into pGEM-T Easy and the recombinant plasmid was successfully introduced into E. coli DH5α. Nucleotide sequence analysis showed that the lenght of MaMrp fragment is 633 bp encoding 208 amino acids. Local alignment analysis based on nucleotide of mRNA showed that MaMrp fragment is 69% identical to AtMrp1 and 63% to AtMrp from A. thaliana. Based on deduced amino acid sequence, MaMRP is 84% identical to part of AtMRP13, 77% to AtMRP12, and 73% to AtMRP1 from A. thaliana respectively. Alignment analysis with AtMRP1 showed that MaMRP fragment is located in TM1 and NBF1 domains and has a specific amino acid sequence QCKAQLQNMEEE.

  15. Seven different genes encode a diverse mixture of isoforms of Bet v 1, the major birch pollen allergen. (United States)

    Schenk, Martijn F; Gilissen, Ludovicus Jwj; Esselink, Gerhard D; Smulders, Marinus Jm


    Pollen of the European white birch (Betula pendula, syn. B. verrucosa) is an important cause of hay fever. The main allergen is Bet v 1, member of the pathogenesis-related class 10 (PR-10) multigene family. To establish the number of PR-10/Bet v 1 genes and the isoform diversity within a single tree, PCR amplification, cloning and sequencing of PR-10 genes was performed on two diploid B. pendula cultivars and one interspecific tetraploid Betula hybrid. Sequences were attributed to putative genes based on sequence identity and intron length. Information on transcription was derived by comparison with homologous cDNA sequences available in GenBank/EMBL/DDJB. PCR-cloning of multigene families is accompanied by a high risk for the occurrence of PCR recombination artifacts. We screened for and excluded these artifacts, and also detected putative artifact sequences among database sequences. Forty-four different PR-10 sequences were recovered from B. pendula and assigned to thirteen putative genes. Sequence homology suggests that three genes were transcribed in somatic tissue and seven genes in pollen. The transcription of three other genes remains unknown. In total, fourteen different Bet v 1-type isoforms were identified in the three cultivars, of which nine isoforms were entirely new. Isoforms with high and low IgE-reactivity are encoded by different genes and one birch pollen grain has the genetic background to produce a mixture of isoforms with varying IgE-reactivity. Allergen diversity is even higher in the interspecific tetraploid hybrid, consistent with the presence of two genomes. Isoforms of the major birch allergen Bet v 1 are encoded by multiple genes, and we propose to name them accordingly. The present characterization of the Bet v 1 genes provides a framework for the screening of specific Bet v 1 genes among other B. pendula cultivars or Betula species, and for future breeding for trees with a reduced allergenicity. Investigations towards sensitization and

  16. Seven different genes encode a diverse mixture of isoforms of Bet v 1, the major birch pollen allergen

    Directory of Open Access Journals (Sweden)

    Gilissen Ludovicus JWJ


    Full Text Available Abstract Background Pollen of the European white birch (Betula pendula, syn. B. verrucosa is an important cause of hay fever. The main allergen is Bet v 1, member of the pathogenesis-related class 10 (PR-10 multigene family. To establish the number of PR-10/Bet v 1 genes and the isoform diversity within a single tree, PCR amplification, cloning and sequencing of PR-10 genes was performed on two diploid B. pendula cultivars and one interspecific tetraploid Betula hybrid. Sequences were attributed to putative genes based on sequence identity and intron length. Information on transcription was derived by comparison with homologous cDNA sequences available in GenBank/EMBL/DDJB. PCR-cloning of multigene families is accompanied by a high risk for the occurrence of PCR recombination artifacts. We screened for and excluded these artifacts, and also detected putative artifact sequences among database sequences. Results Forty-four different PR-10 sequences were recovered from B. pendula and assigned to thirteen putative genes. Sequence homology suggests that three genes were transcribed in somatic tissue and seven genes in pollen. The transcription of three other genes remains unknown. In total, fourteen different Bet v 1-type isoforms were identified in the three cultivars, of which nine isoforms were entirely new. Isoforms with high and low IgE-reactivity are encoded by different genes and one birch pollen grain has the genetic background to produce a mixture of isoforms with varying IgE-reactivity. Allergen diversity is even higher in the interspecific tetraploid hybrid, consistent with the presence of two genomes. Conclusion Isoforms of the major birch allergen Bet v 1 are encoded by multiple genes, and we propose to name them accordingly. The present characterization of the Bet v 1 genes provides a framework for the screening of specific Bet v 1 genes among other B. pendula cultivars or Betula species, and for future breeding for trees with a reduced

  17. Evaluation of biofilm production and characterization of genes encoding type III secretion system among Pseudomonas aeruginosa isolated from burn patients. (United States)

    Jabalameli, Fereshteh; Mirsalehian, Akbar; Khoramian, Babak; Aligholi, Marzieh; Khoramrooz, Seyed Sajjad; Asadollahi, Parisa; Taherikalani, Morovat; Emaneini, Mohammad


    Pseudomonas aeruginosa is one of the common pathogenic causes of serious infections in burn patients throughout the world. Type III secretion toxins are thought to promote the dissemination of P. aeruginosa from the site of infection, the bacterial evasion of the host immune response and inhibition of DNA synthesis leading to host cell death. A total of 96 isolates of P. aeruginosa were collected from wound infections of burn patients, from April to July 2010. Antimicrobial susceptibility of the isolates were determined by disk agar diffusion method. Polymerase chain reaction (PCR)-based method was used for targeting the genes encoding the type III secretion toxins. The quantitative determination of biofilm-forming capacity was determined by a colorimetric microtiter plate assay. All the isolates were resistant to cefixime and ceftriaxone. More than 90% of the isolates were resistant to amikacin, carbenicillin, cefepime, cefotaxime, cefpodoxime, gatifloxacin, gentamicin, piperacillin/tazobactam, ticarcillin and tobramycin. All the isolates carried the exoT gene, 95% carried exoY, 64.5% carried exoU and 29% carried the exoS gene. Most of the isolates (58%) carried both exoY and exoU genes while 24% showed the concomitant presence of exoS and exoY and 1% carried both exoS and exoU. Coexistence of exoS, exoY and exoU was seen in 4% of the isolates. Biofilm formation was seen in more than 96% of the isolates among which 47% were strong biofilm producers, 26% were moderate and 22.9% were weak biofilm formers. In conclusion, the findings of this study show that the genes, particularly the exoU gene, encoding the type III secretion toxins, are commonly disseminated among the P. aeruginosa strains isolated from burn patients. Copyright © 2012 Elsevier Ltd and ISBI. All rights reserved.

  18. PCR primers to study the diversity of expressed fungal genes encoding lignocellulolytic enzymes in soils using high-throughput sequencing.

    Directory of Open Access Journals (Sweden)

    Florian Barbi

    Full Text Available Plant biomass degradation in soil is one of the key steps of carbon cycling in terrestrial ecosystems. Fungal saprotrophic communities play an essential role in this process by producing hydrolytic enzymes active on the main components of plant organic matter. Open questions in this field regard the diversity of the species involved, the major biochemical pathways implicated and how these are affected by external factors such as litter quality or climate changes. This can be tackled by environmental genomic approaches involving the systematic sequencing of key enzyme-coding gene families using soil-extracted RNA as material. Such an approach necessitates the design and evaluation of gene family-specific PCR primers producing sequence fragments compatible with high-throughput sequencing approaches. In the present study, we developed and evaluated PCR primers for the specific amplification of fungal CAZy Glycoside Hydrolase gene families GH5 (subfamily 5 and GH11 encoding endo-β-1,4-glucanases and endo-β-1,4-xylanases respectively as well as Basidiomycota class II peroxidases, corresponding to the CAZy Auxiliary Activity family 2 (AA2, active on lignin. These primers were experimentally validated using DNA extracted from a wide range of Ascomycota and Basidiomycota species including 27 with sequenced genomes. Along with the published primers for Glycoside Hydrolase GH7 encoding enzymes active on cellulose, the newly design primers were shown to be compatible with the Illumina MiSeq sequencing technology. Sequences obtained from RNA extracted from beech or spruce forest soils showed a high diversity and were uniformly distributed in gene trees featuring the global diversity of these gene families. This high-throughput sequencing approach using several degenerate primers constitutes a robust method, which allows the simultaneous characterization of the diversity of different fungal transcripts involved in plant organic matter degradation and may

  19. Characterization and expression analysis of a gene encoding CBF/DREB1 transcription factor from mangrove Aegiceras corniculatum. (United States)

    Peng, Ya-Lan; Wang, You-Shao; Cheng, Hao; Wang, Li-Ying


    Several transcription factors play important roles in survival of plants under cold, drought and salt stresses by serving as master regulator of sets of downstream stress-responsive genes. A gene encoding CBF/DREB1 transcription factor (C-repeat binding factor/dehydration responsive element-binding factor 1) was isolated from mangrove Aegiceras corniculatum and designated AcCBF1. The full-length cDNA of AcCBF1 was 896 bp containing 618 bp ORF encoding a protein of 205 amino acids. Multiple sequence analysis showed that the corresponding protein had 100 % identity to AmCBF1 (KC776908) from mangrove Avicennia marina, and contains an AP2/ERE DNA-binding domain and two CBF signature sequences. Expression analyses based on quantitative real-time PCR revealed that the AcCBF1 gene was expressed in all tissues of A. corniculatum under normal condition with the highest expression level detected in leaves. When exposed to abiotic stresses, AcCBF1 gene showed different expression patterns in different tissues. Generally, AcCBF1 gene could be rapidly and strongly induced by cold and drought, while slightly induced by abscisic acid and salinity. Furthermore, light could positively regulate the cold-induction level of AcCBF1. These results suggest that the AcCBF1 may be playing important role in the signaling pathway of cold stress and also involved in the cross-talk among abiotic stresses. Further studies focusing on the promotors and downstream stress-responsive genes of AcCBF1 will help to better understand the regulatory mechanisms of mangrove A. corniculatum under abiotic stresses.

  20. Three genes encoding AOP2, a protein involved in aliphatic glucosinolate biosynthesis, are differentially expressed in Brassica rapa. (United States)

    Zhang, Jifang; Liu, Zhiyuan; Liang, Jianli; Wu, Jian; Cheng, Feng; Wang, Xiaowu


    The glucosinolate biosynthetic gene AOP2 encodes an enzyme that plays a crucial role in catalysing the conversion of beneficial glucosinolates into anti-nutritional ones. In Brassica rapa, three copies of BrAOP2 have been identified, but their function in establishing the glucosinolate content of B. rapa is poorly understood. Here, we used phylogenetic and gene structure analyses to show that BrAOP2 proteins have evolved via a duplication process retaining two highly conserved domains at the N-terminal and C-terminal regions, while the middle part has experienced structural divergence. Heterologous expression and in vitro enzyme assays and Arabidopsis mutant complementation studies showed that all three BrAOP2 genes encode functional BrAOP2 proteins that convert the precursor methylsulfinyl alkyl glucosinolate to the alkenyl form. Site-directed mutagenesis showed that His356, Asp310, and Arg376 residues are required for the catalytic activity of one of the BrAOP2 proteins (BrAOP2.1). Promoter-β-glucuronidase lines revealed that the BrAOP2.3 gene displayed an overlapping but distinct tissue- and cell-specific expression profile compared with that of the BrAOP2.1 and BrAOP2.2 genes. Quantitative real-time reverse transcription-PCR assays demonstrated that BrAOP2.1 showed a slightly different pattern of expression in below-ground tissue at the seedling stage and in the silique at the reproductive stage compared with BrAOP2.2 and BrAOP2.3 genes in B. rapa. Taken together, our results revealed that all three BrAOP2 paralogues are active in B. rapa but have functionally diverged. © The Author 2015. Published by Oxford University Press on behalf of the Society for Experimental Biology.

  1. Emergence of Extensively Drug Resistant Acinetobacter baumannii-Encoding Integrons and Extended-Spectrum Beta-Lactamase Genes Isolated from Ventilator-Associated Pneumonia Patients

    National Research Council Canada - National Science Library

    Mohammad Sadegh Rezai; Alireza Rafiei; Fatemeh Ahangarkani; Masoumeh Bagheri-Nesami; Attieh Nikkhah; Khaironesa Shafahi; Gohar Eslami; Azin Hajalibeig; Rezvan Khajavi


    ... of A. baumannii-associated VAP in developing countries such as Iran with limited resources. 2. The mcr-1 gene, encoded for phosphoethanolamine transferase, was borne on a mobile plasmid in E.coli and K...

  2. Characterization of the Genes Encoding d-Amino Acid Transaminase and Glutamate Racemase, Two d-Glutamate Biosynthetic Enzymes of Bacillus sphaericus ATCC 10208 (United States)

    Fotheringham, Ian G.; Bledig, Stefan A.; Taylor, Paul P.


    In Bacillus sphaericus and other Bacillus spp., d-amino acid transaminase has been considered solely responsible for biosynthesis of d-glutamate, an essential component of cell wall peptidoglycan, in contrast to the glutamate racemase employed by many other bacteria. We report here the cloning of the dat gene encoding d-amino acid transaminase and the glr gene encoding a glutamate racemase from B. sphaericus ATCC 10208. The glr gene encodes a 28.8-kDa protein with 40 to 50% sequence identity to the glutamate racemases of Lactobacillus, Pediococcus, and Staphylococcus species. The dat gene encodes a 31.4-kDa peptide with 67% primary sequence homology to the d-amino acid transaminase of the thermophilic Bacillus sp. strain YM1. PMID:9696787

  3. Cross-Platform DNA Encoding for Single-Cell Imaging of Gene Expression. (United States)

    Zrazhevskiy, Pavel; Akilesh, Shreeram; Tai, Wanyi; Queitsch, Konstantin; True, Lawrence D; Fromm, Jonathan; Wu, David; Nelson, Peter; Stamatoyannopoulos, John A; Gao, Xiaohu


    Integration of imaging data across different molecular target types can provide in-depth insight into cell physiology and pathology, but remains challenging owing to poor compatibility between target-type-specific labeling methods. We show that cross-platform imaging analysis can be readily achieved through DNA encoding of molecular targets, which translates the molecular identity of various target types into a uniform in situ array of ssDNA tags for subsequent labeling with complementary imaging probes. The concept was demonstrated through multiplexed imaging of mRNAs and their corresponding proteins with multicolor quantum dots. The results reveal heterogeneity of cell transfection with siRNA and outline disparity in RNA interference (RNAi) kinetics at the level of both the mRNA and the encoded protein. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  4. Identification and Functional Characterization of Genes Encoding Omega-3 Polyunsaturated Fatty Acid Biosynthetic Activities from Unicellular Microalgae

    Directory of Open Access Journals (Sweden)

    Royah Vaezi


    Full Text Available In order to identify novel genes encoding enzymes involved in the biosynthesis of nutritionally important omega-3 long chain polyunsaturated fatty acids, a database search was carried out in the genomes of the unicellular photoautotrophic green alga Ostreococcus RCC809 and cold-water diatom Fragilariopsis cylindrus. The search led to the identification of two putative “front-end” desaturases (Δ6 and Δ4 from Ostreococcus RCC809 and one Δ6-elongase from F. cylindrus. Heterologous expression of putative open reading frames (ORFs in yeast revealed that the encoded enzyme activities efficiently convert their respective substrates: 54.1% conversion of α-linolenic acid for Δ6-desaturase, 15.1% conversion of 22:5n-3 for Δ4-desaturase and 38.1% conversion of γ-linolenic acid for Δ6-elongase. The Δ6-desaturase from Ostreococcus RCC809 displays a very strong substrate preference resulting in the predominant synthesis of stearidonic acid (C18:4Δ6,9,12,15. These data confirm the functional characterization of omega-3 long chain polyunsaturated fatty acid biosynthetic genes from these two species which have until now not been investigated for such activities. The identification of these new genes will also serve to expand the repertoire of activities available for metabolically engineering the omega-3 trait in heterologous hosts as well as providing better insights into the synthesis of eicosapentaenoic acid (EPA and docosahexaenoic acid (DHA in marine microalgae.

  5. Cloning and characterization of shk2, a gene encoding a novel p21-activated protein kinase from fission yeast. (United States)

    Yang, P; Kansra, S; Pimental, R A; Gilbreth, M; Marcus, S


    We describe the characterization of a novel gene, shk2, encoding a second p21(cdc42/rac)-activated protein kinase (PAK) homolog in fission yeast. Like other known PAKs, Shk2 binds to Cdc42 in vivo and in vitro. While overexpression of either shk2 or cdc42 alone does not impair growth of wild type fission yeast cells, cooverexpression of the two genes is toxic and leads to highly aberrant cell morphology, providing evidence for functional interaction between Cdc42 and Shk2 proteins in vivo. Fission yeast shk2 null mutants are viable and exhibit no obvious phenotypic defects. Overexpression of shk2 restores viability and normal morphology but not full mating competence to fission yeast cells carrying a shk1 null mutation. Additional genetic data suggest that Shk2, like Cdc42 and Shk1, participates in Ras-dependent morphological control and mating response pathways in fission yeast. We also show that overexpression of byr2, a gene encoding a Ste11/MAPK kinase kinase homolog, suppresses the mating defect of cells partially defective for Shk1 function, providing evidence of a link between PAKs and mitogen-activated protein kinase signaling in fission yeast. Taken together, our results suggest that Shk2 is partially overlapping in function with Shk1, with Shk1 being the dominant protein in function.

  6. The Drosophila Medea gene is required downstream of dpp and encodes a functional homolog of human Smad4. (United States)

    Hudson, J B; Podos, S D; Keith, K; Simpson, S L; Ferguson, E L


    The Transforming Growth Factor-beta superfamily member decapentaplegic (dpp) acts as an extracellular morphogen to pattern the embryonic ectoderm of the Drosophila embryo. To identify components of the dpp signaling pathway, we screened for mutations that act as dominant maternal enhancers of a weak allele of the dpp target gene zerknŁllt. In this screen, we recovered new alleles of the Mothers against dpp (Mad) and Medea genes. Phenotypic analysis of the new Medea mutations indicates that Medea, like Mad, is required for both embryonic and imaginal disc patterning. Genetic analysis suggests that Medea may have two independently mutable functions in patterning the embryonic ectoderm. Complete elimination of maternal and zygotic Medea activity in the early embryo results in a ventralized phenotype identical to that of null dpp mutants, indicating that Medea is required for all dpp-dependent signaling in embryonic dorsal-ventral patterning. Injection of mRNAs encoding DPP or a constitutively activated form of the DPP receptor, Thick veins, into embryos lacking all Medea activity failed to induce formation of any dorsal cell fates, demonstrating that Medea acts downstream of the thick veins receptor. We cloned Medea and found that it encodes a protein with striking sequence similarity to human SMAD4. Moreover, injection of human SMAD4 mRNA into embryos lacking all Medea activity conferred phenotypic rescue of the dorsal-ventral pattern, demonstrating conservation of function between the two gene products.

  7. The biodiversity of Lactobacillus spp. from Iranian raw milk Motal cheese and antibacterial evaluation based on bacteriocin-encoding genes. (United States)

    Azizi, Fahimeh; Habibi Najafi, Mohammad B; Edalatian Dovom, Mohammad R


    Lactobacilli, as the largest group of lactic acid bacteria, produce large amounts of antimicrobial metabolites such as organic acids, fatty acids, ammonia, hydrogen peroxide, diacetyl and bacteriocin, which inhibit the growth of pathogenic bacteria and increase shelf life of food. The aim of this study was to identify the Lactobacillus spp. isolated from Iranian raw milk Motal cheese and to detect the presence of bacteriocin genes in the isolated Lactobacillus strains exhibiting antimicrobial activity. For this purpose, 6 Motal cheese samples from Dasht-e-Moghan region, Iran, were subjected to microbial characterization. Nineteen Lactobacillus spp. were isolated and subsequently identified based on biochemical and molecular methods. According to the sequencing of isolates, Lactobacillus spp. consisted primarily of Lactobacillus brevis, Lactobacillus plantarum, Lactobacillus casei and Lactobacillus buchneri. The identified isolates were then evaluated for antimicrobial activity against Escherichia coli ATCC 25922, Listeria innocua ATCC 33090 and Staphylococcus aureus ATCC 25923. The results of PCR analysis using specific primers of genes encoding Bacteriocin, revealed the presence of Plantaricin A and Plantaricin EF in all Lactobacillus plantarum isolates and Brevicin 174A in 5 of Lactobacillus brevis isolates, whereas the gene encoding Pediocin PA-1 was not observed in any of examined isolates. It is therefore concluded that bacteriocinogenic isolates could be recommended as suitable candidates to be used as starter, adjunct-starter or antimicrobial agents for production of fermented and non-fermented products.

  8. Metadata Analysis ofPhanerochaete chrysosporiumGene Expression Data Identified Common CAZymes Encoding Gene Expression Profiles Involved in Cellulose and Hemicellulose Degradation. (United States)

    Kameshwar, Ayyappa Kumar Sista; Qin, Wensheng


    In literature, extensive studies have been conducted on popular wood degrading white rot fungus, Phanerochaete chrysosporium about its lignin degrading mechanisms compared to the cellulose and hemicellulose degrading abilities. This study delineates cellulose and hemicellulose degrading mechanisms through large scale metadata analysis of P. chrysosporium gene expression data (retrieved from NCBI GEO) to understand the common expression patterns of differentially expressed genes when cultured on different growth substrates. Genes encoding glycoside hydrolase classes commonly expressed during breakdown of cellulose such as GH-5,6,7,9,44,45,48 and hemicellulose are GH-2,8,10,11,26,30,43,47 were found to be highly expressed among varied growth conditions including simple customized and complex natural plant biomass growth mediums. Genes encoding carbohydrate esterase class enzymes CE (1,4,8,9,15,16) polysaccharide lyase class enzymes PL-8 and PL-14, and glycosyl transferases classes GT (1,2,4,8,15,20,35,39,48) were differentially expressed in natural plant biomass growth mediums. Based on these results, P. chrysosporium, on natural plant biomass substrates was found to express lignin and hemicellulose degrading enzymes more than cellulolytic enzymes except GH-61 (LPMO) class enzymes, in early stages. It was observed that the fate of P. chrysosporium transcriptome is significantly affected by the wood substrate provided. We believe, the gene expression findings in this study plays crucial role in developing genetically efficient microbe with effective cellulose and hemicellulose degradation abilities.

  9. A conserved gene family encodes transmembrane proteins with fibronectin, immunoglobulin and leucine-rich repeat domains (FIGLER

    Directory of Open Access Journals (Sweden)

    Haga Christopher L


    Full Text Available Abstract Background In mouse the cytokine interleukin-7 (IL-7 is required for generation of B lymphocytes, but human IL-7 does not appear to have this function. A bioinformatics approach was therefore used to identify IL-7 receptor related genes in the hope of identifying the elusive human cytokine. Results Our database search identified a family of nine gene candidates, which we have provisionally named fibronectin immunoglobulin leucine-rich repeat (FIGLER. The FIGLER 1–9 genes are predicted to encode type I transmembrane glycoproteins with 6–12 leucine-rich repeats (LRR, a C2 type Ig domain, a fibronectin type III domain, a hydrophobic transmembrane domain, and a cytoplasmic domain containing one to four tyrosine residues. Members of this multichromosomal gene family possess 20–47% overall amino acid identity and are differentially expressed in cell lines and primary hematopoietic lineage cells. Genes for FIGLER homologs were identified in macaque, orangutan, chimpanzee, mouse, rat, dog, chicken, toad, and puffer fish databases. The non-human FIGLER homologs share 38–99% overall amino acid identity with their human counterpart. Conclusion The extracellular domain structure and absence of recognizable cytoplasmic signaling motifs in members of the highly conserved FIGLER gene family suggest a trophic or cell adhesion function for these molecules.

  10. Stress tolerances of nullmutants of function-unknown genes encoding menadione stress-responsive proteins in Aspergillus nidulans. (United States)

    Leiter, Éva; Bálint, Mihály; Miskei, Márton; Orosz, Erzsébet; Szabó, Zsuzsa; Pócsi, István


    A group of menadione stress-responsive function-unkown genes of Aspergillus nidulans (Locus IDs ANID_03987.1, ANID_06058.1, ANID_10219.1, and ANID_10260.1) was deleted and phenotypically characterized. Importantly, comparative and phylogenetic analyses of the tested A. nidulans genes and their orthologs shed light only on the presence of a TANGO2 domain with NRDE protein motif in the translated ANID_06058.1 gene but did not reveal any recognizable protein-encoding domains in other protein sequences. The gene deletion strains were subjected to oxidative, osmotic, and metal ion stress and, surprisingly, only the ΔANID_10219.1 mutant showed an increased sensitivity to 0.12 mmol l(-1) menadione sodium bisulfite. The gene deletions affected the stress sensitivities (tolerances) irregularly, for example, some strains grew more slowly when exposed to various oxidants and/or osmotic stress generating agents, meanwhile the ΔANID_10260.1 mutant possessed a wild-type tolerance to all stressors tested. Our results are in line with earlier studies demonstrating that the deletions of stress-responsive genes do not confer necessarily any stress-sensitivity phenotypes, which can be attributed to compensatory mechanisms based on other elements of the stress response system with overlapping functions. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  11. Chloroplast-encoded serotonin N-acetyltransferase in the red alga Pyropia yezoensis: gene transition to the nucleus from chloroplasts. (United States)

    Byeon, Yeong; Yool Lee, Hyoung; Choi, Dong-Woog; Back, Kyoungwhan


    Melatonin biosynthesis involves the N-acetylation of arylalkylamines such as serotonin, which is catalysed by serotonin N-acetyltransferase (SNAT), the penultimate enzyme of melatonin biosynthesis in both animals and plants. Here, we report the functional characterization of a putative N-acetyltransferase gene in the chloroplast genome of the alga laver (Pyropia yezoensis, formerly known as Porphyra yezoensis) with homology to the rice SNAT gene. To confirm that the putative Pyropia yezoensis SNAT (PySNAT) gene encodes an SNAT, we cloned the full-length chloroplastidic PySNAT gene by PCR and purified the recombinant PySNAT protein from Escherichia coli. PySNAT was 174 aa and had 50% amino acid identity with cyanobacteria SNAT. Purified recombinant PySNAT showed a peak activity at 55 °C with a K m of 467 µM and V max of 28 nmol min-1 mg(-1) of protein. Unlike other plant SNATs, PySNAT localized to the cytoplasm due to a lack of N-terminal chloroplast transit peptides. Melatonin was present at 0.16ng g(-1) of fresh mass but increased during heat stress. Phylogenetic analysis of the sequence suggested that PySNAT has evolved from the cyanobacteria SNAT gene via endosymbiotic gene transfer. Additionally, the chloroplast transit peptides of plant SNATs were acquired 1500 million years ago, concurrent with the appearance of green algae. © The Author 2014. Published by Oxford University Press on behalf of the Society for Experimental Biology.

  12. The k43 gene, required for chorion gene amplification and diploid cell chromosome replication, encodes the Drosophila homolog of yeast origin recognition complex subunit 2. (United States)

    Landis, G; Kelley, R; Spradling, A C; Tower, J


    Lethal alleles of the Drosophila k43 gene result in small or missing imaginal discs, greatly reduced mitotic index, and fragmented and abnormally condensed chromosomes. A female-sterile allele of k43 specifically reduces chorion gene amplification in ovarian follicle cells. k43 was cloned by chromosomal walking, and the identification of the k43 gene was confirmed by phenotypic rescue and sequence analysis of mutant alleles. The sequence analyses reveal that the k43 gene encodes the Drosophila homolog of the yeast origin recognition complex subunit 2 (Orc2p), a protein required for replication origin function and transcriptional silencing in yeast. These results suggest an evolutionarily conserved role for Orc2p in eukaryotic chromosomal DNA replication.

  13. Mutations in the gene encoding the low-density lipoprotein receptor LRP4 cause abnormal limb development in the mouse. (United States)

    Simon-Chazottes, Dominique; Tutois, Sylvie; Kuehn, Michael; Evans, Martin; Bourgade, Franck; Cook, Sue; Davisson, Muriel T; Guénet, Jean-Louis


    Positional cloning of two recessive mutations of the mouse that cause polysyndactyly (dan and mdig-Chr 2) confirmed that the gene encoding MEGF7/LRP4, a member of the low-density lipoprotein receptor family, plays an essential role in the process of digit differentiation. Pathologies observed in the mutant mice provide insight into understanding the function(s) of LRP4 as a negative regulator of the Wnt-beta-catenin signaling pathway and may help identify the genetic basis for common human disorders with similar phenotypes.

  14. Expression of genes encoding F-1-ATPase results in uncoupling of glycolysis from biomass production in Lactococcus lactis

    DEFF Research Database (Denmark)

    Købmann, Brian Jensen; Solem, Christian; Pedersen, M.B.


    of the genes encoding F-1-ATPase was found to decrease the intracellular energy level and resulted in a decrease in the growth rate. The yield of biomass also decreased, which showed that the incorporated F-1-ATPase activity caused glycolysis to be uncoupled from biomass production. The increase in ATPase...... threefold in nongrowing cells resuspended in buffer, but in steadily growing cells no increase in flux was observed. The latter result shows that glycolysis occurs close to its maximal capacity and indicates that control of the glycolytic flux under these conditions resides in the glycolytic reactions...

  15. Evidence against the structural gene encoding type II collagen (COL2A1) as the mutant locus in achondroplasia. (United States)

    Ogilvie, D; Wordsworth, P; Thompson, E; Sykes, B


    The structure of the locus encoding the major cartilage collagen gene (COL2A1) was studied in a total of 19 cases of achondroplasia. No gross rearrangements were seen. The segregation of COL2A1 was examined in three affected kindreds using restriction site and length variants as genetic markers. In two kindreds discordant segregation between the achondroplasia and COL2A1 loci was demonstrated. Paternity/maternity was confirmed using a 'minisatellite' core sequence probe which reveals cross hybridising polymorphic loci. Images PMID:3005580

  16. Cloning and Expression Analysis of MEP Pathway Enzyme-encoding Genes in Osmanthus fragrans


    Chen Xu; Huogeng Li; Xiulian Yang; Chunsun Gu; Hongna Mu; Yuanzheng Yue; Lianggui Wang


    The 2-C-methyl-d-erythritol 4-phosphate (MEP) pathway is responsible for the biosynthesis of many crucial secondary metabolites, such as carotenoids, monoterpenes, plastoquinone, and tocopherols. In this study, we isolated and identified 10 MEP pathway genes in the important aromatic plant sweet osmanthus (Osmanthus fragrans). Multiple sequence alignments revealed that 10 MEP pathway genes shared high identities with other reported proteins. The genes showed distinctive expression profiles in...

  17. The Sporothrix schenckii Gene Encoding for the Ribosomal Protein L6 Has Constitutive and Stable Expression and Works as an Endogenous Control in Gene Expression Analysis (United States)

    Trujillo-Esquivel, Elías; Martínez-Álvarez, José A.; Clavijo-Giraldo, Diana M.; Hernández, Nahúm V.; Flores-Martínez, Alberto; Ponce-Noyola, Patricia; Mora-Montes, Héctor M.


    Sporothrix schenckii is one of the causative agents of sporotrichosis, a worldwide-distributed mycosis that affects humans and other mammals. The interest in basic and clinical features of this organism has significantly increased in the last years, yet little progress in molecular aspects has been reported. Gene expression analysis is a set of powerful tools that helps to assess the cell response to changes in the extracellular environment, the genetic networks controlling metabolic pathways, and the adaptation to different growth conditions. Most of the quantitative methodologies used nowadays require data normalization, and this is achieved measuring the expression of endogenous control genes. Reference genes, whose expression is assumed to suffer minimal changes regardless the cell morphology, the stage of the cell cycle or the presence of harsh extracellular conditions are commonly used as controls in Northern blotting assays, microarrays, and semi-quantitative or quantitative RT-PCR. Since the biology of the organisms is usually species specific, it is difficult to find a reliable group of universal genes that can be used as controls for data normalization in experiments addressing the gene expression, regardless the taxonomic classification of the organism under study. Here, we compared the transcriptional stability of the genes encoding for elongation factor 1A, Tfc1, a protein involved in transcription initiation on Pol III promoters, ribosomal protein L6, histone H2A, β-actin, β-tubulin, glyceraldehyde 3-phosphate dehydrogenase, UAF30, the upstream activating factor 30, and the transcription initiation factor TFIID subunit 10, during the fungal growth in different culture media and cell morphologies. Our results indicated that only the gene encoding for the ribosomal protein L6 showed a stable and constant expression. Furthermore, it displayed not transcriptional changes when S. schenckii infected larvae of Galleria mellonella or interacted with immune

  18. The Sporothrix schenckii Gene Encoding for the Ribosomal Protein L6 Has Constitutive and Stable Expression and Works as an Endogenous Control in Gene Expression Analysis

    Directory of Open Access Journals (Sweden)

    Elías Trujillo-Esquivel


    Full Text Available Sporothrix schenckii is one of the causative agents of sporotrichosis, a worldwide-distributed mycosis that affects humans and other mammals. The interest in basic and clinical features of this organism has significantly increased in the last years, yet little progress in molecular aspects has been reported. Gene expression analysis is a set of powerful tools that helps to assess the cell response to changes in the extracellular environment, the genetic networks controlling metabolic pathways, and the adaptation to different growth conditions. Most of the quantitative methodologies used nowadays require data normalization, and this is achieved measuring the expression of endogenous control genes. Reference genes, whose expression is assumed to suffer minimal changes regardless the cell morphology, the stage of the cell cycle or the presence of harsh extracellular conditions are commonly used as controls in Northern blotting assays, microarrays, and semi-quantitative or quantitative RT-PCR. Since the biology of the organisms is usually species specific, it is difficult to find a reliable group of universal genes that can be used as controls for data normalization in experiments addressing the gene expression, regardless the taxonomic classification of the organism under study. Here, we compared the transcriptional stability of the genes encoding for elongation factor 1A, Tfc1, a protein involved in transcription initiation on Pol III promoters, ribosomal protein L6, histone H2A, β-actin, β-tubulin, glyceraldehyde 3-phosphate dehydrogenase, UAF30, the upstream activating factor 30, and the transcription initiation factor TFIID subunit 10, during the fungal growth in different culture media and cell morphologies. Our results indicated that only the gene encoding for the ribosomal protein L6 showed a stable and constant expression. Furthermore, it displayed not transcriptional changes when S. schenckii infected larvae of Galleria mellonella or

  19. The BAT1 gene in the MHC encodes an evolutionarily conserved putative nuclear RNA helicase of the DEAD family

    Energy Technology Data Exchange (ETDEWEB)

    Peelman, L.J.; Van Zeveren, A.; Coppeiters, W. [State Univ. Ghent, Merelbeke (Belgium)] [and others


    The BAT1 gene has previously been identified about 30 kb upstream from the tumor necrosis factor (TNF) locus and close to a NF{sub kb}-related gene of the nuclear factor family in the major histocompatibility complex (MHC) of human, mouse, and pig. We now show that the BAT1 translation product is the homolog of the rat p47 nuclear protein, the WM6 Drosophila gene product, and probably also Ce08102 of Caenorhabditis elegans, all members of the DEAD protein family of ATP-dependent RNA helicases. This family has more than 40 members, including the eukaryotic translation initiation factor-4A (eIF-4A), the human nuclear protein p68, and the Drosophila oocyte polar granule component vasa. BAT1 spans about 10 kb, is split into 10 exons of varying length, and encodes a protein of 428 amino acids ({approximately}48 kDa). Human and pig BAT1 cDNAs display 95.6% identity in the coding region and 80% identity in the 5{prime} and 3{prime} noncoding regions. Several repeat sequences of different types were identified in introns of the porcine BAT1 gene. Three different mRNAs, 4.1,1.7, and 0.9 kb, respectively, were detected in all tissues analyzed upon hybridization with porcine BAT1 cDNA. Transfection and expression of human BAT1 cDNA after tagging with a heterologous antibody recognition epitope revealed a nuclear localization of the hybrid protein. An MspI RFLP was detected in an SLA class I typed family, confirming the localization of the BAT1 gene in the porcine MHC. BAT1 thus encodes a putative nuclear ATP-dependent RNA helicase and is likely to have an indispensable function. 35 refs., 6 figs., 1 tab.

  20. A new cotton SDR family gene encodes a polypeptide possessing aldehyde reductase and 3-ketoacyl-CoA reductase activities. (United States)

    Pang, Yu; Song, Wen-Qiang; Chen, Fang-Yuan; Qin, Yong-Mei


    To understand regulatory mechanisms of cotton fiber development, microarray analysis has been performed for upland cotton (Gossypium hirsutum). Based on this, a cDNA (GhKCR3) encoding a polypeptide belonging to short-chain alcohol dehydrogenase/reductase family was isolated and cloned. It contains an open reading frame of 987 bp encoding a polypeptide of 328 amino acid residues. Following its overexpression in bacterial cells, the purified recombinant protein specifically uses NADPH to reduce a variety of short-chain aldehydes. A fragment between Gly180 and Gly191 was found to be essential for its catalytic activity. Though the GhKCR3 gene shares low sequence similarities to the ortholog of Saccharomyces cerevisiae YBR159w that encodes 3-ketoacyl-CoA reductase (KCR) catalyzing the second step of fatty acid elongation, it was surprisingly able to complement the yeast ybr159wDelta mutant. Gas chromatography-mass spectrometry analysis showed that very long-chain fatty acids, especially C26:0, were produced in the ybr159wDelta mutant cells expressing GhKCR3. Applying palmitoyl-CoA and malonyl-CoA as substrates, GhKCR3 showed KCR activity in vitro. Quantitative real time-PCR analysis indicated GhKCR3 transcripts accumulated in rapidly elongating fibers, roots, and stems. Our results suggest that GhKCR3 is probably a novel KCR contributing to very long-chain fatty acid biosynthesis in plants.

  1. Occurrence of blaNDM-1 & absence of blaKPC genes encoding carbapenem resistance in uropathogens from a tertiary care centre from north India

    Directory of Open Access Journals (Sweden)

    Balvinder Mohan


    Interpretation & conclusions: The bla NDM-1 gene was absent in our isolates obtained during 2008 but was present amongst Enterobacteriaceae isolated in 2012. The bla KPC gene was also not found. Nine isolates obtained during the two years had multiple genes encoding carbapenemases confirming the previous reports of emergence of GNB containing genes encoding multiple carbapenemases. Typing using BOX-PCR indicated that this emergence was not because of clonal expansion of a single strain, and multiple strains were circulating at a single point of time.

  2. CYT-21 : A nuclear gene encoding a mytochondrial ribosomal protein of Neurospora crassa

    NARCIS (Netherlands)

    Kuiper, Marius Tiemen Roelof


    The purpose of my work has been to set up a procedure to isolate specific nuclear genes that are involved in the mitochondrial biogenesis of Neurospora crassa; to study the function and expresslon of one such gene and to determine which nuclearmitochondrial interactlons are involved in the

  3. Characterization and expression analysis of genes encoding ubiquitin conjugating domain-containing enzymes in Carica papaya. (United States)

    Jue, Dengwei; Sang, Xuelian; Shu, Bo; Liu, Liqin; Wang, Yicheng; Jia, Zhiwei; Zou, Yu; Shi, Shengyou


    Ripening affects the quality and nutritional contents of fleshy fruits and is a crucial process of fruit development. Although several studies have suggested that ubiquitin-conjugating enzyme (E2s or UBC enzymes) are involved in the regulation of fruit ripening, little is known about the function of E2s in papaya (Carica papaya). In the present study, we searched the papaya genome and identified 34 putative UBC genes, which were clustered into 17 phylogenetic subgroups. We also analyzed the nucleotide sequences of the papaya UBC (CpUBC) genes and found that both exon-intron junctions and sequence motifs were highly conserved among the phylogenetic subgroups. Using real-time PCR analysis, we also found that all the CpUBC genes were expressed in roots, stems, leaves, male and female flowers, and mature fruit, although the expression of some of the genes was increased or decreased in one or several specific organs. We also found that the expression of 13 and two CpUBC genes were incresesd or decreased during one and two ripening stages, respectively. Expression analyses indicates possible E2s playing a more significant role in fruit ripening for further studies. To the best of our knowledge, this is the first reported genome-wide analysis of the papaya UBC gene family, and the results will facilitate further investigation of the roles of UBC genes in fruit ripening and will aide in the functional validation of UBC genes in papaya.

  4. Housekeeping gene on the X chromosome encodes a protein similar to ubiquitin

    Energy Technology Data Exchange (ETDEWEB)

    Toniolo, D.; Persico, M.; Alcalay, M.


    An X chromosome gene located 40 kilobases downstream from the G6PD gene, at Xq28, was isolated and sequenced. This gene, which the authors named GdX, spans about 3.5 kilobases of genomic DNA. GdX is a single-copy gene, is conserved in evolution, and has the features of a housekeeping gene. At its 5' end, a cluster of CpG dinucleotides is methylated on the inactive X chromosome and unmethylated on the active X chromosome. The GdX gene can code for a 157 amino acid protein, GdX. Residues 1-74 of GdX show 43% identity to ubiquitin, a highly conserved 76 amino acid protein. The COOH-terminal moiety of GdX is characterized in its central part (residues 110-128) by a sequence homologous to the COOH-terminal hormonogenic site of thyroglobulin. The structural organization of the GdX protein suggests the existence of a family of genes, in addition to the ubiquitin gene, that could play specific roles in key cellular processes, possible through protein-protein recognition.

  5. Expression of the rgMT gene, encoding for a rice metallothionein ...

    Indian Academy of Sciences (India)

    ... as well as the impact of gene expression in yeast (Saccharomyces cerevisiae) and Arabidopsis thaliana under heavy metal ion, salt and oxidative stresses. The results indicate that the rgMT gene was expressed in the cytoplasm of transgenic cells. Yeast cells transgenic for rgMT showed vigorous growth compared to the ...

  6. Expression and functional analysis of genes encoding cytokinin receptor-like histidine kinase in maize (Zea mays L.). (United States)

    Wang, Bo; Chen, Yanhong; Guo, Baojian; Kabir, Muhammad Rezaul; Yao, Yingyin; Peng, Huiru; Xie, Chaojie; Zhang, Yirong; Sun, Qixin; Ni, Zhongfu


    Cytokinin signaling is vital for plant growth and development which function via the two-component system (TCS). As one of the key component of TCS, transmembrane histidine kinases (HK) are encoded by a small gene family in plants. In this study, we focused on expression and functional analysis of cytokinin receptor-like HK genes (ZmHK) in maize. Firstly, bioinformatics analysis revealed that seven cloned ZmHK genes have different expression patterns during maize development. Secondly, ectopic expression by CaMV35S promoter in Arabidopsis further revealed that functional differentiation exists among these seven members. Among them, the ZmHK1a2-OX transgenic line has the lowest germination rate in the dark, ZmHK1-OX and ZmHK2a2-OX can delay leaf senescence, and seed size of ZmHK1-OX, ZmHK1a2-OX, ZmHK2-OX, ZmHK3b-OX and ZmHK2a2-OX was obviously reduced as compared to wild type. Additionally, ZmHK genes play opposite roles in shoot and root development; all ZmHK-OX transgenic lines display obvious shorter root length and reduced number of lateral roots, but enhanced shoot development compared with the wild type. Most notably, Arabidopsis response regulator ARR5 gene was up-regulated in ZmHK1-OX, ZmHK1a2-OX, ZmHK2-OX, ZmHK3b-OX and ZmHK2a2-OX as compared to wild type. Although the causal link between ZmHK genes and cytokinin signaling pathway is still an area to be further elucidated, these findings reflected that the diversification of ZmHK genes expression patterns and functions occurred in the course of maize evolution, indicating that some ZmHK genes might play different roles during maize development.

  7. Identification and targeted disruption of the mouse gene encoding ESG1 (PH34/ECAT2/DPPA5

    Directory of Open Access Journals (Sweden)

    Ichisaka Tomoko


    Full Text Available Abstract Background Embryonic stem cell-specific gene (ESG 1, which encodes a KH-domain containing protein, is specifically expressed in early embryos, germ cells, and embryonic stem (ES cells. Previous studies identified genomic clones containing the mouse ESG1 gene and five pseudogenes. However, their chromosomal localizations or physiological functions have not been determined. Results A Blast search of mouse genomic databases failed to locate the ESG1 gene. We identified several bacterial artificial clones containing the mouse ESG1 gene and an additional ESG1-like sequence with a similar gene structure from chromosome 9. The ESG1-like sequence contained a multiple critical mutations, indicating that it was a duplicated pseudogene. The 5' flanking region of the ESG1 gene, but not that of the pseudogene, exhibited strong enhancer and promoter activity in undifferentiated ES cells by luciferase reporter assay. To study the physiological functions of the ESG1 gene, we replaced this sequence in ES cells with a β-geo cassette by homologous recombination. Despite specific expression in early embryos and germ cells, ESG1-/- mice developed normally and were fertile. We also generated ESG1-/- ES cells both by a second independent homologous recombination and directly from blastocysts derived from heterozygous intercrosses. Northern blot and western blot analyses confirmed the absence of ESG1 in these cells. These ES cells demonstrated normal morphology, proliferation, and differentiation. Conclusion The mouse ESG1 gene, together with a duplicated pseudogene, is located on chromosome 9. Despite its specific expression in pluripotent cells and germ cells, ESG1 is dispensable for self-renewal of ES cells and establishment of germcells.

  8. High prevalence of diarrheagenic Escherichia coli carrying toxin-encoding genes isolated from children and adults in southeastern Brazil. (United States)

    Spano, Liliana Cruz; da Cunha, Keyla Fonseca; Monfardini, Mariane Vedovatti; de Cássia Bergamaschi Fonseca, Rita; Scaletsky, Isabel Christina Affonso


    Diarrheagenic Escherichia coli (DEC) are important bacterial causes of childhood diarrhea in Brazil, but its impact in adults is unknown. This study aimed at investigating DEC among children and adults living in endemic areas. A total of 327 stools specimens were collected from children (n = 141) and adults (n = 186) with diarrhea attending health centers. Diarrheagenic E. coli (DEC) were identified by their virulence genes (multiplex polymerase chain reaction) and HEp-2 cell adherence patterns. DEC were detected in 56 (40%) children and 74 (39%) adults; enteroaggregative E. coli (EAEC) (23%) was the most prevalent pathotype, followed by diffusely adherent E. coli (DAEC) (13%), and occurred at similar frequencies in both diarrheal groups. Atypical enteropathogenic E. coli (aEPEC) strains were recovered more frequently from children (6%) than from adults (1%). Twenty-six percent of the EAEC were classified as typical EAEC possessing aggR gene, and carried the aap gene. EAEC strains carrying aggR-aap-aatA genes were significantly more frequent among children than adults (p < 0.05). DAEC strains possessing Afa/Dr. genes were detected from children (10%) and adults (6%). EAEC and DAEC strains harboring genes for the EAST1 (astA), Pet, Pic, and Sat toxins were common in both diarrheal groups. The astA and the porcine AE/associated adhesin (paa) genes were found in most of aEPEC strains. High levels of resistance to antimicrobial drugs were found among DAEC and aEPEC isolates. The results show a high proportion of EAEC and DAEC carrying toxin-encoding genes among adults with diarrhea.

  9. DNA Immunization with the Gene Encoding P4 Nuclease of Leishmania amazonensis Protects Mice against Cutaneous Leishmaniasis (United States)

    Campbell, Kimberly; Diao, Hong; Ji, Jiaxiang; Soong, Lynn


    Infection with the protozoan parasite Leishmania amazonensis can cause diverse clinical forms of leishmaniasis. Immunization with purified P4 nuclease protein has been shown to elicit a protective response in mice challenged with L. amazonensis and L. pifanoi. To explore the potential of a DNA-based vaccine, we tested the L. amazonensis gene encoding P4 nuclease as well as adjuvant constructs encoding murine interleukin-12 (IL-12) and L. amazonensis HSP70. Susceptible BALB/c mice were immunized with the DNA encoding P4 alone, P4/IL-12, or P4/HSP70 prior to challenge with L. amazonensis promastigotes. Mice given P4/IL-12 exhibited no lesion development and had a 3- to 4-log reduction in tissue parasite burdens compared to controls. This protection corresponded to significant increases in gamma interferon and tumor necrosis factor alpha production and a reduction in parasite-specific immunoglobulin G1, suggesting an enhancement in Th1 responses. Moreover, we immunized mice with the L. amazonensis vaccines to determine if this vaccine regimen could provide cross-protection against a genetically diverse species, L. major. While the P4/HSP70 vaccine led to self-healing lesions, the P4/IL-12 vaccine provided negligible protection against L. major infection. This is the first report of successful use of a DNA vaccine to induce protection against L. amazonensis infection. Additionally, our results indicate that different vaccine combinations, including DNA encoding P4, HSP70, or IL-12, can provide significant protection against both Old World and New World cutaneous leishmaniasis. PMID:14573646

  10. Molecular cloning, expression, and chromosomal localization of the gene encoding a human myeloid membrane antigen (gp150). (United States)

    Look, A T; Peiper, S C; Rebentisch, M B; Ashmun, R A; Roussel, M F; Lemons, R S; Le Beau, M M; Rubin, C M; Sherr, C J


    DNA from a tertiary mouse cell transformant containing amplified human sequences encoding a human myeloid membrane glycoprotein, gp150, was used to construct a bacteriophage lambda library. A single recombinant phage containing 12 kilobases (kb) of human DNA was isolated, and molecular subclones were then used to isolate the complete gp150 gene from a human placental genomic DNA library. The intact gp150 gene, assembled from three recombinant phages, proved to be biologically active when transfected into NIH 3T3 cells. Molecular probes from the gp150 locus annealed with a 4.0-kb polyadenylated RNA transcript derived from human myeloid cell lines and from tertiary mouse cell transformants. The gp150 gene was assigned to human chromosome 15, and was subchromosomally localized to bands q25-26 by in situ hybridization. The chromosomal location of the gp150 gene coincides cytogenetically with the region assigned to the c-fes proto-oncogene, another human gene specifically expressed by myeloid cells.

  11. Cloning and characterization of F3PYC gene encoding pyruvate carboxylase in Aspergillus flavus strain (F3). (United States)

    Qayyum, Sadia; Khan, Ibrar; Bhatti, Zulfiqar Ahmad; Peng, Changsheng


    Pyruvate carboxylase is a major enzyme for biosynthesis of organic acids like; citric acid, fumeric acid, and L-malic acid. These organic acids play very important role for biological remediation of heavy metals. In this study, gene walking method was used to clone and characterize pyruvate carboxylase gene (F3PYC) from heavy metal resistant indigenous fungal isolate Aspergillus flavus (F3). 3579 bp of an open reading frame which encodes 1193 amino acid protein (isoelectric point: 6.10) with a calculated molecular weight of 131.2008 kDa was characterized. Deduced protein showed 90-95% similarity to those deduced from PYC gene from different fungal strains including; Aspergillus parasiticus, Neosartorya fischeri, Aspergillus fumigatus, Aspergillus clavatus, and Aspergillus niger. Protein generated from the PYC gene was a homotetramer (α4) and having four potential N-linked glycosylation sites and had no signal peptide. Amongst most possible N-glycosylation sites were -N-S-S-I- at 36 amino acid, -N-G-T-V- at 237 amino acid, N-G-S-S- at 517 amino acid, and N-T-S-R- at 1111 amino acid, with several functions have been proposed for the carbohydrate moiety such as thermal stability, pH, and temperature optima for activity and stabilization of the three-dimensional structure. Hence, cloning of F3PYC gene from A. flavus has important biotechnological applications.

  12. Unfolded Protein Response (UPR Regulator Cib1 Controls Expression of Genes Encoding Secreted Virulence Factors in Ustilago maydis.

    Directory of Open Access Journals (Sweden)

    Martin Hampel

    Full Text Available The unfolded protein response (UPR, a conserved eukaryotic signaling pathway to ensure protein homeostasis in the endoplasmic reticulum (ER, coordinates biotrophic development in the corn smut fungus Ustilago maydis. Exact timing of UPR activation is required for virulence and presumably connected to the elevated expression of secreted effector proteins during infection of the host plant Zea mays. In the baker's yeast Saccharomyces cerevisiae, expression of UPR target genes is induced upon binding of the central regulator Hac1 to unfolded protein response elements (UPREs in their promoters. While a role of the UPR in effector secretion has been described previously, we investigated a potential UPR-dependent regulation of genes encoding secreted effector proteins. In silico prediction of UPREs in promoter regions identified the previously characterized effector genes pit2 and tin1-1, as bona fide UPR target genes. Furthermore, direct binding of the Hac1-homolog Cib1 to the UPRE containing promoter fragments of both genes was confirmed by quantitative chromatin immunoprecipitation (qChIP analysis. Targeted deletion of the UPRE abolished Cib1-dependent expression of pit2 and significantly affected virulence. Furthermore, ER stress strongly increased Pit2 expression and secretion. This study expands the role of the UPR as a signal hub in fungal virulence and illustrates, how biotrophic fungi can coordinate cellular physiology, development and regulation of secreted virulence factors.

  13. Unfolded Protein Response (UPR) Regulator Cib1 Controls Expression of Genes Encoding Secreted Virulence Factors in Ustilago maydis. (United States)

    Hampel, Martin; Jakobi, Mareike; Schmitz, Lara; Meyer, Ute; Finkernagel, Florian; Doehlemann, Gunther; Heimel, Kai


    The unfolded protein response (UPR), a conserved eukaryotic signaling pathway to ensure protein homeostasis in the endoplasmic reticulum (ER), coordinates biotrophic development in the corn smut fungus Ustilago maydis. Exact timing of UPR activation is required for virulence and presumably connected to the elevated expression of secreted effector proteins during infection of the host plant Zea mays. In the baker's yeast Saccharomyces cerevisiae, expression of UPR target genes is induced upon binding of the central regulator Hac1 to unfolded protein response elements (UPREs) in their promoters. While a role of the UPR in effector secretion has been described previously, we investigated a potential UPR-dependent regulation of genes encoding secreted effector proteins. In silico prediction of UPREs in promoter regions identified the previously characterized effector genes pit2 and tin1-1, as bona fide UPR target genes. Furthermore, direct binding of the Hac1-homolog Cib1 to the UPRE containing promoter fragments of both genes was confirmed by quantitative chromatin immunoprecipitation (qChIP) analysis. Targeted deletion of the UPRE abolished Cib1-dependent expression of pit2 and significantly affected virulence. Furthermore, ER stress strongly increased Pit2 expression and secretion. This study expands the role of the UPR as a signal hub in fungal virulence and illustrates, how biotrophic fungi can coordinate cellular physiology, development and regulation of secreted virulence factors.

  14. Clinical and Microbiological Aspects of Linezolid Resistance Mediated by the cfr Gene Encoding a 23S rRNA Methyltransferase▿ (United States)

    Arias, Cesar A.; Vallejo, Martha; Reyes, Jinnethe; Panesso, Diana; Moreno, Jaime; Castañeda, Elizabeth; Villegas, Maria V.; Murray, Barbara E.; Quinn, John P.


    The cfr (chloramphenicol-florfenicol resistance) gene encodes a 23S rRNA methyltransferase that confers resistance to linezolid. Detection of linezolid resistance was evaluated in the first cfr-carrying human hospital isolate of linezolid and methicillin-resistant Staphylococcus aureus (designated MRSA CM-05) by dilution and diffusion methods (including Etest). The presence of cfr was investigated in isolates of staphylococci colonizing the patient's household contacts and clinical isolates recovered from patients in the same unit where MRSA CM-05 was isolated. Additionally, 68 chloramphenicol-resistant Colombian MRSA isolates recovered from hospitals between 2001 and 2004 were screened for the presence of the cfr gene. In addition to erm(B), the erm(A) gene was also detected in CM-05. The isolate belonged to sequence type 5 and carried staphylococcal chromosomal cassette mec type I. We were unable to detect the cfr gene in any of the human staphylococci screened (either clinical or colonizing isolates). Agar and broth dilution methods detected linezolid resistance in CM-05. However, the Etest and disk diffusion methods failed to detect resistance after 24 h of incubation. Oxazolidinone resistance mediated by the cfr gene is rare, and acquisition by a human isolate appears to be a recent event in Colombia. The detection of cfr-mediated linezolid resistance might be compromised by the use of the disk diffusion or Etest method. PMID:18174304

  15. Analysis and expression of the thrC gene of Brevibacterium lactofermentum and characterization of the encoded threonine synthase. (United States)

    Malumbres, M; Mateos, L M; Lumbreras, M A; Guerrero, C; Martín, J F


    The thrC gene of Brevibacterium lactofermentum was cloned by complementation of Escherichia coli thrC auxotrophs. The gene was located by deletion mapping and complementation analysis in a 2.9-kb Sau3AI-HindIII fragment of the genome. This fragment also complemented a B. lactofermentum UL1035 threonine auxotroph that was deficient in threonine synthase. A 1,892-bp DNA fragment of this region was sequenced; this fragment contained a 1,446-bp open reading frame that encoded a 481-amino-acid protein having a deduced M(r) of 52,807. The gene was expressed in E. coli, by using the phage T7 system, as a 53-kDa protein. The promoter region subcloned in promoter-probe plasmids was functional in E. coli. A Northern analysis revealed that the gene was expressed as a monocistronic 1,400-nucleotide transcript. The transcription start point of the thrC gene was located by S1 mapping 6 bp upstream from the translation initiation codon, which indicated that this promoter was one of the leaderless transcription-initiating sequences. The threonine synthase overexpressed in B. lactofermentum UL1035 was purified almost to homogeneity. The active form corresponded to a monomeric 52.8-kDa protein, as shown by sodium dodecyl sulfate-polyacrylamide gel electrophoresis. The purified enzyme required pyridoxal phosphate as its only cofactor to convert homoserine phosphate into threonine. Images PMID:8074505

  16. Identification of five new genes, closely related to the interleukin-1beta converting enzyme gene, that do not encode functional proteases. (United States)

    Rocher, C; Faucheu, C; Blanchet, A M; Claudon, M; Hervé, F; Durand, L; Harnois, M; Diu-Hercend, A; Lalanne, J L


    Interleukin-1beta converting enzyme (ICE) was the first identified member of a growing family of cysteine proteases that now includes ten mammalian homologs. Within this large family, two functional proteins, denoted TX and TY share 60% amino-acid identity with ICE in the mature protein and, together with ICE, constitute the ICE subfamily. The present study describes the identification of five new gene sequences, denoted S1-S5, closely related to ICE and TX and belonging to this subfamily. Sequences were identified using genomic Southern-blot analysis of human DNA with probes corresponding to ICE and TX exon 6. Using PCR amplification and cloning, the complete exon-6 sequence of these new genes was identified; three exhibit around 90% identity with Ice within exon 6, whereas the two others share about 70% identity with Ice. Examination of open reading frames and of amino acids essential for ICE activity indicate that none of these genes encodes for a functional protease. In conclusion, extensive analysis of the genes closely related to Ice shows that the Ice subfamily is constituted of eight members. Three of them encode for functional proteases (ICE, TX and TY) whereas the remaining members probably correspond to pseudogenes.

  17. Identification of a promoter for the vegetative insecticidal protein-encoding gene vip3LB from Bacillus thuringiensis. (United States)

    Mesrati, Lobna Abdelkefi; Tounsi, Slim; Kamoun, Fakher; Jaoua, Samir


    The expression of vip3LB, one of the vegetative insecticidal protein-encoding genes of Bacillus thuringiensis, was studied at the transcriptional level. By primer extension analysis, we have identified, for the first time, the transcription start point of vip3-type gene. Upstream from vip3LB transcription start point, was found a nucleotide sequence partially homologous to the consensus sequence for the E sigma(E) holoenzyme of B. subtilis. Thus, it was strongly suggested that the identified vip3 promoter was under the control of sigma(35)-like enzyme, the B. thuringiensis homolog of sigma(E). The transcriptional activity from the promoter was detected at the vegetative stage of growth starting at mid-log phase as well as during the middle stage of sporulation.

  18. A Single Point Mutation in the Gene Encoding Gb3/CD77 Synthase Causes a Rare Inherited Polyagglutination Syndrome* (United States)

    Suchanowska, Anna; Kaczmarek, Radoslaw; Duk, Maria; Lukasiewicz, Jolanta; Smolarek, Dorota; Majorczyk, Edyta; Jaskiewicz, Ewa; Laskowska, Anna; Wasniowska, Kazimiera; Grodecka, Magdalena; Lisowska, Elwira; Czerwinski, Marcin


    Rare polyagglutinable NOR erythrocytes contain three unique globoside (Gb4Cer) derivatives, NOR1, NORint, and NOR2, in which Gal(α1–4), GalNAc(β1–3)Gal(α1–4), and Gal(α1–4)GalNAc(β1–3)Gal(α1–4), respectively, are linked to the terminal GalNAc residue of Gb4Cer. NOR1 and NOR2, which both terminate with a Gal(α1–4)GalNAc- sequence, react with anti-NOR antibodies commonly present in human sera. While searching for an enzyme responsible for the biosynthesis of Gal(α1–4)GalNAc, we identified a mutation in the A4GALT gene encoding Gb3/CD77 synthase (α1,4-galactosyltransferase). Fourteen NOR-positive donors were heterozygous for the C>G mutation at position 631 of the open reading frame of the A4GALT gene, whereas 495 NOR-negative donors were homozygous for C at this position. The enzyme encoded by the mutated gene contains glutamic acid instead of glutamine at position 211 (substitution Q211E). To determine whether this mutation could change the enzyme specificity, we transfected a teratocarcinoma cell line (2102Ep) with vectors encoding the consensus Gb3/CD77 synthase and Gb3/CD77 synthase with Glu at position 211. The cellular glycolipids produced by these cells were analyzed by flow cytometry, high-performance thin-layer chromatography, enzymatic degradation, and MALDI-TOF mass spectrometry. Cells transfected with either vector expressed the P1 blood group antigen, which was absent from untransfected cells. Cells transfected with the vector encoding the Gb3/CD77 synthase with Glu at position 211 expressed both P1 and NOR antigens. Collectively, these results suggest that the C631G mutation alters the acceptor specificity of Gb3/CD77 synthase, rendering it able to catalyze synthesis of the Gal(α1–4)Gal and Gal(α1–4)GalNAc moieties. PMID:22965229

  19. A single point mutation in the gene encoding Gb3/CD77 synthase causes a rare inherited polyagglutination syndrome. (United States)

    Suchanowska, Anna; Kaczmarek, Radoslaw; Duk, Maria; Lukasiewicz, Jolanta; Smolarek, Dorota; Majorczyk, Edyta; Jaskiewicz, Ewa; Laskowska, Anna; Wasniowska, Kazimiera; Grodecka, Magdalena; Lisowska, Elwira; Czerwinski, Marcin


    Rare polyagglutinable NOR erythrocytes contain three unique globoside (Gb4Cer) derivatives, NOR1, NOR(int), and NOR2, in which Gal(α1-4), GalNAc(β1-3)Gal(α1-4), and Gal(α1-4)GalNAc(β1-3)Gal(α1-4), respectively, are linked to the terminal GalNAc residue of Gb4Cer. NOR1 and NOR2, which both terminate with a Gal(α1-4)GalNAc- sequence, react with anti-NOR antibodies commonly present in human sera. While searching for an enzyme responsible for the biosynthesis of Gal(α1-4)GalNAc, we identified a mutation in the A4GALT gene encoding Gb3/CD77 synthase (α1,4-galactosyltransferase). Fourteen NOR-positive donors were heterozygous for the C>G mutation at position 631 of the open reading frame of the A4GALT gene, whereas 495 NOR-negative donors were homozygous for C at this position. The enzyme encoded by the mutated gene contains glutamic acid instead of glutamine at position 211 (substitution Q211E). To determine whether this mutation could change the enzyme specificity, we transfected a teratocarcinoma cell line (2102Ep) with vectors encoding the consensus Gb3/CD77 synthase and Gb3/CD77 synthase with Glu at position 211. The cellular glycolipids produced by these cells were analyzed by flow cytometry, high-performance thin-layer chromatography, enzymatic degradation, and MALDI-TOF mass spectrometry. Cells transfected with either vector expressed the P1 blood group antigen, which was absent from untransfected cells. Cells transfected with the vector encoding the Gb3/CD77 synthase with Glu at position 211 expressed both P1 and NOR antigens. Collectively, these results suggest that the C631G mutation alters the acceptor specificity of Gb3/CD77 synthase, rendering it able to catalyze synthesis of the Gal(α1-4)Gal and Gal(α1-4)GalNAc moieties.

  20. Genes Encoding Cucumber Full-Size ABCG Proteins Show Different Responses to Plant Growth Regulators and Sclareolide. (United States)

    Rajsz, Adam; Warzybok, Anna; Migocka, Magdalena

    Full-size members of the ABCG (ATP-binding cassette, subfamily G) subfamily of ABC transporters have been found only in plants and fungi. The plant genes encoding full-size ABCGs identified so far appeared to be differentially regulated under various environmental constraints, plant growth regulators, and microbial elicitors, indicating a broad functional role of these proteins in plant responses to abiotic and biotic stress. Nevertheless, the structure and physiological function of full-size ABCGs in many plant species are still unknown. We have recently identified 16 genes encoding full-size ABCG proteins in cucumber and found that the transcripts of two of them, CsABCG36 (CsPDR8) and CsABCG40 (CsPDR12), are most abundant in roots and are significantly affected by phytohormones and auxin herbicide. In this study, we analyzed the structure and phylogeny of all the full-size cucumber ABCG transporters and studied the organ expression profiles of the remaining 14 CsABCG genes. In addition, we investigated the effect of different plant growth regulators and the diterpene sclareolide on CsABCG expression in cucumber roots. Until now, the full-size plant ABCG transporters have been grouped into five different clusters. The new phylogenetic analysis of full-size ABCGs from model plants and cucumber clustered these proteins into six different subgroups. Interestingly, the expression profiles of cucumber ABCG genes assigned to the same clusters were not correlated, suggesting functional diversification or different regulatory mechanisms of the full-size cucumber ABCG proteins.

  1. Identification and Analysis of a Gene from Calendula officinalis Encoding a Fatty Acid Conjugase (United States)

    Qiu, Xiao; Reed, Darwin W.; Hong, Haiping; MacKenzie, Samuel L.; Covello, Patrick S.


    Two homologous cDNAs, CoFad2 and CoFac2, were isolated from a Calendula officinalis developing seed by a polymerase chain reaction-based cloning strategy. Both sequences share similarity to FAD2 desaturases and FAD2-related enzymes. In C. officinalis plants CoFad2 was expressed in all tissues tested, whereas CoFac2 expression was specific to developing seeds. Expression of CoFad2 cDNA in yeast (Saccharomyces cerevisiae) indicated it encodes a Δ12 desaturase that introduces a double bond at the 12 position of 16:1(9Z) and 18:1(9Z). Expression of CoFac2 in yeast revealed that the encoded enzyme acts as a fatty acid conjugase converting 18:2(9Z, 12Z) to calendic acid 18:3(8E, 10E, 12Z). The enzyme also has weak activity on the mono-unsaturates 16:1(9Z) and 18:1(9Z) producing compounds with the properties of 8,10 conjugated dienes. PMID:11161042

  2. A single human gene encoding multiple tyrosine hydroxylases with different predicted functional characteristics. (United States)

    Grima, B; Lamouroux, A; Boni, C; Julien, J F; Javoy-Agid, F; Mallet, J

    Catecholaminergic systems in discrete regions of the brain are thought to be important in affective psychoses, learning and memory, reinforcement and sleep-wake cycle regulation. Tyrosine hydroxylase (TH) is the first enzyme in the pathway of catecholamine synthesis. Its importance is reflected in the diversity of the mechanisms that have been described which control its activity; TH levels vary both during development and as a function of the activity of the nervous system. Recently, we deduced the complete amino-acid sequence of rat TH from a complementary DNA clone encoding a functional enzyme. Here we demonstrate that, in man, TH molecules are encoded by at least three distinct messenger RNAs. The expression of these mRNAs varies in different parts of the nervous system. The sequence differences observed are confined to the 5' termini of the messengers and involve alternative splicing events. This variation has clear functional consequences for each putative form of the enzyme and could represent a novel means of regulating catecholamine levels in normal and pathological neurons.

  3. A chromosomal Borrelia burgdorferi gene encodes a 22-kilodalton lipoprotein, P22, that is serologically recognized in Lyme disease. (United States)

    Lam, T T; Nguyen, T P; Fikrig, E; Flavell, R A


    We describe the isolation of the gene encoding a 22-kDa antigen from Borrelia burgdorferi, the etiologic agent of Lyme disease. The p22 gene is 582 nucleotides in length and encodes a protein of 194 amino acids with a predicted molecular mass of 21.8 kDa. The leader signal sequence of P22 consists of a positively charged short amino terminus, a central hydrophobic domain, and at the carboxyl terminus, a cleavage site that is presumably recognized and cleaved by a B. burgdorferi signal peptidase. P22 has 98.5% homology with the recently described B. burgdorferi protein IpLA7. P22 is processed as a lipoprotein, as demonstrated by [3H]palmitate labeling. Pulsed-field gel electrophoresis showed that p22, like LA7, is localized to the linear chromosome of B. burgdorferi. Examination of sera from patients with Lyme disease revealed that antibodies to P22 are rarely detected in patients with early-stage disease characterized by erythema migrans (2 of 20), and 35% of the patients with late-stage disease characterized by arthritis (9 of 26) developed antibodies to P22. Sera from patients with syphilis did not react with P22. When patients with late-stage disease were tested for their antibody reactivities to four other outer surface proteins (OspA), OspB, OspE, and OspF), 75% of these patients responded to P22 or to one or more outer surface proteins.

  4. Disruption of the Gene Encoding Endo-β-1, 4-Xylanase Affects the Growth and Virulence of Sclerotinia sclerotiorum. (United States)

    Yu, Yang; Xiao, Jifen; Du, Jiao; Yang, Yuheng; Bi, Chaowei; Qing, Ling


    Sclerotinia sclerotiorum (Lib.) de Bary is a devastating fungal pathogen with worldwide distribution. S. sclerotiorum is a necrotrophic fungus that secretes many cell wall-degrading enzymes (CWDEs) that destroy plant's cell-wall components. Functional analyses of the genes that encode CWDEs will help explain the mechanisms of growth and pathogenicity of S. sclerotiorum. Here, we isolated and characterized a gene SsXyl1 that encoded an endo-β-1, 4-xylanase in S. sclerotiorum. The SsXyl1 expression showed a slight increase during the development and germination stages of sclerotia and a dramatic increase during infection. The expression of SsXyl1 was induced by xylan. The SsXyl1 deletion strains produce aberrant sclerotia that could not germinate to form apothecia. The SsXyl1 deletion strains also lost virulence to the hosts. This study demonstrates the important roles of endo-β-1, 4-xylanase in the growth and virulence of S. sclerotiorum.

  5. Isolation and characterization of a gene encoding a polyethylene glycol-induced cysteine protease in common wheat. (United States)

    Zang, Qing-Wei; Wang, Cai-Xiang; Li, Xu-Yan; Guo, Zhi-Ai; Jing, Rui-Lian; Zhao, Jun; Chang, Xiao-Ping


    Plant cysteine protease (CP) genes are induced by abiotic stresses such as drought, yet their functions remain largely unknown. We isolated the full-length cDNA encoding a Triticum aestivum CP gene, designated TaCP, from wheat by the rapid amplification of cDNA ends (RACE) method. Sequence analysis revealed that TaCP contains an open reading frame encoding a protein of 362 amino acids, which is 96% identical to barley cysteine protease HvSF42. The TaCP transcript level in wheat seedlings was upregulated during polyethylene glycol (PEG) stress, with a peak appearing around 12 h after treatment. TaCP expression level increased rapidly with NaCl treatment at 48 h. TaCP responded strongly to low temperature (4 degree C) treatment from 1 h post-treatment and reached a peak of about 40-fold at 72 h. However, it showed only a very slight response to abscisic acid (ABA). More than one copy of TaCP was present in each of the three genomes of hexaploid wheat and its diploid donors. TaCP fused with green fluorescent protein (GFP) was located in the plasma membrane of onion epidermis cells. Transgenic Arabidopsis plants overexpressing TaCP showed stronger drought tolerance and higher CP activity under water-stressed conditions than wild-type Arabidopsis plants. The results suggest that TaCP plays a role in tolerance to water deficit.

  6. Monogalactosyldiacylglycerol: An abundant galactosyllipid of Cirsium brevicaule A. GRAY leaves inhibits the expression of gene encoding fatty acid synthase. (United States)

    Inafuku, Masashi; Takara, Kensaku; Taira, Naoyuki; Nugara, Ruwani N; Kamiyama, Yasuo; Oku, Hirosuke


    The leaves of Cirsium brevicaule A. GRAY (CL) significantly decreased hepatic lipid accumulation and the expression of fatty acid synthase gene (FASN) in mice. We aimed to purify and identify the active compound(s) from CL and determine the inhibitory mechanism of expression of FASN. We purified monogalactosyldiacylglycerol (MGDG) from extracts of CL (CL-MGDG) and showed that it was the active CL component through analyses of its effects on the expression of genes of human breast cancer cell line, SKBR-3. The content and fatty acid composition of CL-MGDG are distinctly different from those of other vegetable-derived MGDGs. Treatment of SKBR-3 cells with MGDG decreased the level of FASN mRNA as well as the levels of mRNA encoding other protein involved in lipogenesis. Further, MGDG treatments significantly inhibited luciferase activities of constructs containing liver X receptor response element in FASN promoter region without altering the levels of mRNA encoding transcription factors. MGDG and the FASN inhibitor C75 decreased the viabilities of SKBR-3 cells in a concentration-dependent manner. CL-MGDG more potently inhibited cell viability than a commercial MGDG preparation. CL represents a good source of glycoglycerolipids with potential as functional ingredients of food. Copyright © 2016 Elsevier GmbH. All rights reserved.

  7. The maize (Zea mays ssp. mays var. B73 genome encodes 33 members of the purple acid phosphatase gene family

    Directory of Open Access Journals (Sweden)

    Eliécer eGonzález Muñoz


    Full Text Available Purple acid phosphatases (PAPs play an important role in plant phosphorus nutrition, both by liberating phosphorus from organic sources in the soil and by modulating distribution within the plant throughout growth and development. Furthermore, members of the PAP protein family have been implicated in a broader role in plant mineral homeostasis, stress responses and development. We have identified 33 candidate PAP encoding gene models in the maize (Zea mays ssp. mays var. B73 reference genome. The maize Pap family includes a clear single-copy ortholog of the Arabidopsis gene AtPAP26, shown previously to encode both major intracellular and secreted acid phosphatase activities. Certain groups of PAPs present in Arabidopsis, however, are absent in maize, while the maize family contains a number of expansions, including a distinct radiation not present in Arabidopsis. Analysis of RNA-sequencing based transcriptome data revealed accumulation of maize Pap transcripts in multiple plant tissues at multiple stages of development, and increased accumulation of specific transcripts under low phosphorus availability. These data suggest the maize PAP family as a whole to have broad significance throughout the plant life cycle, while highlighting potential functional specialization of individual family members.

  8. Inactivation of a Pleurotus ostreatus versatile peroxidase-encoding gene (mnp2) results in reduced lignin degradation. (United States)

    Salame, Tomer M; Knop, Doriv; Levinson, Dana; Mabjeesh, Sameer J; Yarden, Oded; Hadar, Yitzhak


    Lignin biodegradation by white-rot fungi is pivotal to the earth's carbon cycle. Manganese peroxidases (MnPs), the most common extracellular ligninolytic peroxidases produced by white-rot fungi, are considered key in ligninolysis. Pleurotus ostreatus, the oyster mushroom, is a preferential lignin degrader occupying niches rich in lignocellulose such as decaying trees. Here, we provide direct, genetically based proof for the functional significance of MnP to P. ostreatus ligninolytic capacity under conditions mimicking its natural habitat. When grown on a natural lignocellulosic substrate of cotton stalks under solid-state culture conditions, gene and isoenzyme expression profiles of its short MnP and versatile peroxidase (VP)-encoding gene family revealed that mnp2 was predominately expressed. mnp2, encoding the versatile short MnP isoenzyme 2 was disrupted. Inactivation of mnp2 resulted in three interrelated phenotypes, relative to the wild-type strain: (i) reduction of 14% and 36% in lignin mineralization of stalks non-amended and amended with Mn(2+), respectively; (ii) marked reduction of the bioconverted lignocellulose sensitivity to subsequent bacterial hydrolyses; and (iii) decrease in fungal respiration rate. These results may serve as the basis to clarify the roles of the various types of fungal MnPs and VPs in their contribution to white-rot decay of wood and lignocellulose in various ecosystems. © 2013 Society for Applied Microbiology and John Wiley & Sons Ltd.

  9. Cloning and expression of gene encoding P23 protein from Cryptosporidium parvum

    Directory of Open Access Journals (Sweden)

    Dinh Thi Bich Lan


    Full Text Available We cloned the cp23 gene coding P23 (glycoprotein from Cryptosporidium parvum isolated from Thua Thien Hue province, Vietnam. The coding region of cp23 gene from C. parvum is 99% similar with cp23 gene deposited in NCBI (accession number: U34390. SDS-PAGE and Western blot analysis showed that the cp23 gene in E. coli BL21 StarTM (DE3 produced polypeptides with molecular weights of approximately 37, 40 and 49 kDa. These molecules may be non-glycosylated or glycosylated P23 fusion polypeptides. Recombinant P23 protein purified by GST (glutathione S-transferase affinity chromatography can be used as an antigen for C. parvum antibody production as well as to develop diagnostic kit for C. parvum.

  10. Sequence and molecular analysis of the Rhizobium etli glsA gene, encoding a thermolabile glutaminase. (United States)

    Calderón, J; Huerta-Saquero, A; Du Pont, G; Durán, S


    We sequenced a 2.1 kb fragment of DNA carrying the structural glsA gene, which codes for the Rhizobium etli thermolabile glutaminase (A). The glsA gene complements the R. etli LM16 mutant that lacks glutaminase A activity, and is expressed in the heterologous host Sinorhizobium meliloti. The deduced amino acid sequence consists of 309 residues, with a calculated molecular mass of 33 kDa. The amino acid sequence shares 53% and 43% identity with two hypothetical glutaminases of E. coli; 42% identity with liver-type; 38% identity with kidney-type glutaminase; 41% and 40% identity hypothetical glutaminases of Bacillus subtilis; and 41% and 37% identity with two putative glutaminases of Caenorhabditis elegans. The glsA gene represents the first glutaminase gene cloned and sequenced in prokaryotes.

  11. Mutations of the CEP290 gene encoding a centrosomal protein cause Meckel-Gruber syndrome.

    NARCIS (Netherlands)

    Frank, V.; Hollander, A.I. den; Bruchle, N.O.; Zonneveld, M.N.; Nurnberg, G.; Becker, C.; Bois, G. Du; Kendziorra, H.; Roosing, S.; Senderek, J.; Nurnberg, P.; Cremers, F.P.M.; Zerres, K.; Bergmann, C.


    Meckel-Gruber syndrome (MKS) is an autosomal recessive, lethal multisystemic disorder characterized by meningooccipital encephalocele, cystic kidney dysplasia, hepatobiliary ductal plate malformation, and postaxial polydactyly. Recently, genes for MKS1 and MKS3 were identified, putting MKS on the

  12. New variants of lepidoptericidal toxin genes encoding Bacillus thuringiensis Vip3Aa proteins. (United States)

    Sauka, Diego H; Rodriguez, Sonia E; Benintende, Graciela B


    Bacillus thuringiensis is an entomopathogenic bacterium characterized by producing parasporal proteinaceous insecticidal crystal inclusions during sporulation. Many strains are capable of also expressing other insecticidal proteins called Vip during the vegetative growing phase. Particularly, Vip3A proteins have activity against certain Lepidoptera species through a unique mechanism of action which emphasized their possible use in resistance management strategies against resistant pests. The aim of the work was to develop a polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) method that can distinguish between vip3A genes from B. thuringiensis strains. In addition, 4 novel vip3Aa genes were cloned and sequenced. The method was originally based on amplification of a single PCR amplicon and the use of 2 restriction enzymes with recognition sites that facilitate simultaneous detection. Subsequently, a third restriction enzyme was used to distinguish between vip3A variants. Thirteen vip3Aa genes were identified in strains belonging to 10 different B. thuringiensis serovars. Three intra-subclass variants of vip3Aa genes could be differentiated. The presented method can serve as an invaluable tool for the investigation of known and novel vip3A genes in B. thuringiensis strains. To the best of our knowledge, this is the first report where variants of a same subclass of insecticidal genes could be distinguished following PCR-RFLP. Copyright © 2013 S. Karger AG, Basel.

  13. Molecular characterization of a Theileria lestoquardi gene encoding for immunogenic protein splice variants. (United States)

    Bakheit, M A; Scholzen, T; Ahmed, J S; Seitzer, U


    A Theileria lestoquardi schizont cDNA library was screened using sera collected from sheep recovering from a natural malignant theileriosis infection. An immunogenic clone (clone-5) was isolated and its full sequence was obtained using rapid amplification of cDNA ends polymerase chain reaction (PCR) technique. PCR experiments and sequencing demonstrated the presence of two transcript forms of the gene, resulting from splicing variation at the single intron found in the gene. Both gene products, clone-5 long and clone-5 short variants with calculated molecular weights of 99.9 and 72.7 kDa, respectively, were expressed in a T. lestoquardi-infected cell line. BLAST searches suggested the presence of homologues of the gene in both the Theileria parva and Theileria annulata genomes, with identities of 53 and 62% on the DNA level, respectively. The intron was preserved in size, sequence, and location within the gene in these parasites. Analysis of the subcellular localization of the clone-5 proteins showed a predominant parasite membrane association in T. lestoquardi-infected cells. Both recombinantly produced forms were found to be reactive with sera from infected animals. Bioinformatic analyses were employed to address the possible function of the gene products in the biology of T. lestoquardi.

  14. Structural organization of the genes encoding the small nuclear RNAs U1 to U6 of Tetrahymena thermophila is very similar to that of plant small nuclear RNA genes

    DEFF Research Database (Denmark)

    Orum, H; Nielsen, Henrik; Engberg, J


    We report the sequences of the genes encoding the small nuclear RNAs (snRNAs) U1 to U6 of the ciliate Tetrahymena thermophila. The genes of the individual snRNAs exist in two to six slightly different copies per haploid genome. Sequence analyses of the gene-flanking regions indicate that there ar......We report the sequences of the genes encoding the small nuclear RNAs (snRNAs) U1 to U6 of the ciliate Tetrahymena thermophila. The genes of the individual snRNAs exist in two to six slightly different copies per haploid genome. Sequence analyses of the gene-flanking regions indicate...

  15. Assignment of genes encoding metallothioneins I and II to Chinese hamster chromosomes 3. Evidence for the role of chromosome rearrangement in gene amplification

    Energy Technology Data Exchange (ETDEWEB)

    Stallings, R.L.; Munk, A.C.; Longmire, J.L.; Hildebrand, C.E.; Crawford, B.D.


    Cadmium resistant (Cd/sup r/) variants with coordinately amplified metallothionein I and II (MTI and MTII) genes have been derived from both Chinese hamster ovary and near-euploid Chinese hamster cell lines. Cytogenetic analyses of Cd/sup r/ variants consistently revealed breakage and rearrangement involving chromosome 3p. In situ hybridization with Chinese hamster MT-encoding cDNA probe localized amplified MT gene sequences near the translocation breakpoint involving chromosome 3p. These observations suggested that both functionally related, isometallothionein loci are linked on Chinese hamster chromosome 3. Southern blot analyses of DNAs isolated from a panel of Chinese hamster x mouse somatic cell hybrids which segregate hamster chromosomes confirmed that both MTI and MTII are located on chromosome 3. The authors speculate that rearrangement of chromosome 3p could be causally involved with the amplification of MT genes in Cd/sup r/ hamster cell lines. 34 references, 3 figures, 1 table.

  16. Gene Disruption in Scedosporium aurantiacum: Proof of Concept with the Disruption of SODC Gene Encoding a Cytosolic Cu,Zn-Superoxide Dismutase. (United States)

    Pateau, Victoire; Razafimandimby, Bienvenue; Vandeputte, Patrick; Thornton, Christopher R; Guillemette, Thomas; Bouchara, Jean-Philippe; Giraud, Sandrine


    Scedosporium species are opportunistic pathogens responsible for a large variety of infections in humans. An increasing occurrence was observed in patients with underlying conditions such as immunosuppression or cystic fibrosis. Indeed, the genus Scedosporium ranks the second among the filamentous fungi colonizing the respiratory tracts of the CF patients. To date, there is very scarce information on the pathogenic mechanisms, at least in part because of the limited genetic tools available. In the present study, we successfully developed an efficient transformation and targeted gene disruption approach on the species Scedosporium aurantiacum. The disruption cassette was constructed using double-joint PCR procedure, and resistance to hygromycin B as the selection marker. This proof of concept was performed on the functional gene SODC encoding the Cu,Zn-superoxide dismutase. Disruption of the SODC gene improved susceptibility of the fungus to oxidative stress. This technical advance should open new research areas and help to better understand the biology of Scedosporium species.

  17. Isolation and expression analysis of FTZ-F1 encoding gene of black rock fish ( Sebastes schlegelii) (United States)

    Shafi, Muhammad; Wang, Yanan; Zhou, Xiaosu; Ma, Liman; Muhammad, Faiz; Qi, Jie; Zhang, Quanqi


    Sex related FTZ-F1 is a transcriptional factor regulating the expression of fushi tarazu (a member of the orphan nuclear receptors) gene. In this study, FTZ-F1 gene ( FTZ-F1) was isolated from the testis of black rockfish ( Sebastes schlegeli) by homology cloning. The full-length cDNA of S. schlegeli FTZ-F1 ( ssFTZ-F1) contained a 232bp 5' UTR, a 1449bp ORF encoding FTZ-F1 (482 amino acid residules in length) with an estimated molecular weight of 5.4kD and a 105bp 3' UTR. Sequence, tissue distribution and phylogenic analysis showed that ssFTZ-F1 belonged to FTZ group, holding highly conserved regions including I, II and III FTZ-F1 boxes and an AF-2 hexamer. Relatively high expression was observed at different larva stages. In juveniles (105 days old), the transcript of ssFTZ-F1 can be detected in all tissues and the abuncance of the gene transcript in testis, ovary, spleen and brain was higher than that in other tissues. In mature fish, the abundance of gene transcript was higher in testis, ovary, spleen and brain than that in liver (trace amount), and the gene was not transcribed in other tissues. The highest abundance of gene transcript was always observed in gonads of both juvenile and mature fish. In addition, the abundance of gene transcript in male tissues were higher than that in female tissue counterparts ( P<0.05).

  18. Real-time PCR expression profiling of genes encoding potential virulence factors in Candida albicans biofilms: identification of model-dependent and -independent gene expression

    Directory of Open Access Journals (Sweden)

    Řičicová Markéta


    Full Text Available Abstract Background Candida albicans infections are often associated with biofilm formation. Previous work demonstrated that the expression of HWP1 (hyphal wall protein and of genes belonging to the ALS (agglutinin-like sequence, SAP (secreted aspartyl protease, PLB (phospholipase B and LIP (lipase gene families is associated with biofilm growth on mucosal surfaces. We investigated using real-time PCR whether genes encoding potential virulence factors are also highly expressed in biofilms associated with abiotic surfaces. For this, C. albicans biofilms were grown on silicone in microtiter plates (MTP or in the Centres for Disease Control (CDC reactor, on polyurethane in an in vivo subcutaneous catheter rat (SCR model, and on mucosal surfaces in the reconstituted human epithelium (RHE model. Results HWP1 and genes belonging to the ALS, SAP, PLB and LIP gene families were constitutively expressed in C. albicans biofilms. ALS1-5 were upregulated in all model systems, while ALS9 was mostly downregulated. ALS6 and HWP1 were overexpressed in all models except in the RHE and MTP, respectively. The expression levels of SAP1 were more pronounced in both in vitro models, while those of SAP2, SAP4 and SAP6 were higher in the in vivo model. Furthermore, SAP5 was highly upregulated in the in vivo and RHE models. For SAP9 and SAP10 similar gene expression levels were observed in all model systems. PLB genes were not considerably upregulated in biofilms, while LIP1-3, LIP5-7 and LIP9-10 were highly overexpressed in both in vitro models. Furthermore, an elevated lipase activity was detected in supernatans of biofilms grown in the MTP and RHE model. Conclusions Our findings show that HWP1 and most of the genes belonging to the ALS, SAP and LIP gene families are upregulated in C. albicans biofilms. Comparison of the fold expression between the various model systems revealed similar expression levels for some genes, while for others model-dependent expression

  19. Outsourcing the Nucleus: Nuclear Pore Complex Genes are no Longer Encoded in Nucleomorph Genomes

    Directory of Open Access Journals (Sweden)

    Nadja Neumann


    Full Text Available The nuclear pore complex (NPC facilitates transport between nucleus and cytoplasm. The protein constituents of the NPC, termed nucleoporins (Nups, are conserved across a wide diversity of eukaryotes. In apparent exception to this, no nucleoporin genes have been identified in nucleomorph genomes. Nucleomorphs, nuclear remnants of once free-living eukaryotes, took up residence as secondary endosymbionts in cryptomonad and chlorarachniophyte algae. As these genomes are highly reduced, Nup genes may have been lost, or relocated to the host nucleus. However, Nup genes are often poorly conserved between species, so absence may be an artifact of low sequence similarity. We therefore constructed an evolutionary bioinformatic screen to establish whether the apparent absence of Nup genes in nucleomorph genomes is due to genuine absence or the inability of current methods to detect homologues. We searched green plant (Arabidopsis and rice, green alga (Chlamydomonas reinhardtii and red alga (Cyanidioschyzon merolae genomes, plus two nucleomorph genomes (Bigelowiella natans and Guillardia theta with profile hidden Markov models (HMMs from curated alignments of known vertebrate/yeast Nups. Since the plant, algal and nucleomorph genomes all belong to the kingdom Plantae, and are evolutionarily distant from the outgroup (vertebrate/yeast training set, we use the plant and algal genomes as internal positive controls for the sensitivity of the searches in nucleomorph genomes. We fi nd numerous Nup homologues in all plant and free-living algal species, but none in either nucleomorph genome. BLAST searches using identified plant and algal Nups also failed to detect nucleomorph homologues. We conclude that nucleomorph Nup genes have either been lost, being replaced by host Nup genes, or, that nucleomorph Nup genes have been transferred to the host nucleus twice independently; once in the evolution of the red algal nucleomorph and once in the green algal nucleomorph.

  20. Evolution of land plant genes encoding L-Ala-D/L-Glu epimerases (AEEs) via horizontal gene transfer and positive selection. (United States)

    Yang, Zefeng; Wang, Yifan; Zhou, Yong; Gao, Qingsong; Zhang, Enying; Zhu, Lei; Hu, Yunyun; Xu, Chenwu


    The L-Ala-D/L-Glu epimerases (AEEs), a subgroup of the enolase superfamily, catalyze the epimerization of L-Ala-D/L-Glu and other dipeptides in bacteria and contribute to the metabolism of the murein peptide of peptidoglycan. Although lacking in peptidoglycan, land plants possess AEE genes that show high similarity to those in bacteria. Similarity searches revealed that the AEE gene is ubiquitous in land plants, from bryophytas to angiosperms. However, other eukaryotes, including green and red algae, do not contain genes encoding proteins with an L-Ala-D/L-Glu_epimerase domain. Homologs of land plant AEE genes were found to only be present in prokaryotes, especially in bacteria. Phylogenetic analysis revealed that the land plant AEE genes formed a monophyletic group with some bacterial homologs. In addition, land plant AEE proteins showed the highest similarity with these bacterial homologs and shared motifs only conserved in land plant and these bacterial AEEs. Integrated information on the taxonomic distribution, phylogenetic relationships and sequence similarity of the AEE proteins revealed that the land plant AEE genes were acquired from bacteria through an ancient horizontal gene transfer (HGT) event. Further evidence revealed that land plant AEE genes had undergone positive selection and formed the main characteristics of exon/intron structures through gaining some introns during the initially evolutionary period in the ancestor of land plants. The results of this study clearly demonstrated that the ancestor of land plants acquired an AEE gene from bacteria via an ancient HGT event. Other findings illustrated that adaptive evolution through positive selection has contributed to the functional adaptation and fixation of this gene in land plants.

  1. Evolution of land plant genes encoding L-Ala-D/L-Glu epimerases (AEEs) via horizontal gene transfer and positive selection (United States)


    Background The L-Ala-D/L-Glu epimerases (AEEs), a subgroup of the enolase superfamily, catalyze the epimerization of L-Ala-D/L-Glu and other dipeptides in bacteria and contribute to the metabolism of the murein peptide of peptidoglycan. Although lacking in peptidoglycan, land plants possess AEE genes that show high similarity to those in bacteria. Results Similarity searches revealed that the AEE gene is ubiquitous in land plants, from bryophytas to angiosperms. However, other eukaryotes, including green and red algae, do not contain genes encoding proteins with an L-Ala-D/L-Glu_epimerase domain. Homologs of land plant AEE genes were found to only be present in prokaryotes, especially in bacteria. Phylogenetic analysis revealed that the land plant AEE genes formed a monophyletic group with some bacterial homologs. In addition, land plant AEE proteins showed the highest similarity with these bacterial homologs and shared motifs only conserved in land plant and these bacterial AEEs. Integrated information on the taxonomic distribution, phylogenetic relationships and sequence similarity of the AEE proteins revealed that the land plant AEE genes were acquired from bacteria through an ancient horizontal gene transfer (HGT) event. Further evidence revealed that land plant AEE genes had undergone positive selection and formed the main characteristics of exon/intron structures through gaining some introns during the initially evolutionary period in the ancestor of land plants. Conclusions The results of this study clearly demonstrated that the ancestor of land plants acquired an AEE gene from bacteria via an ancient HGT event. Other findings illustrated that adaptive evolution through positive selection has contributed to the functional adaptation and fixation of this gene in land plants. PMID:23452519

  2. The oil palm Shell gene controls oil yield and encodes a homologue of SEEDSTICK (United States)

    Singh, Rajinder; Leslie Low, Eng-Ti; Ooi, Leslie Cheng-Li; Ong-Abdullah, Meilina; Chin, Ting Ngoot; Nagappan, Jayanthi; Nookiah, Rajanaidu; Amiruddin, Mohd Din; Rosli, Rozana; Abdul Manaf, Mohamad Arif; Chan, Kuang-Lim; Halim, Mohd Amin; Azizi, Norazah; Lakey, Nathan; Smith, Steven W; Budiman, Muhammad A; Hogan, Michael; Bacher, Blaire; Van Brunt, Andrew; Wang, Chunyan; Ordway, Jared M; Sambanthamurthi, Ravigadevi; Martienssen, Robert A


    A key event in the domestication and breeding of the oil palm, Elaeis guineensis, was loss of the thick coconut-like shell surrounding the kernel. Modern E. guineensis has three fruit forms, dura (thick-shelled), pisifera (shell-less) and tenera (thin-shelled), a hybrid between dura and pisifera1–4. The pisifera palm is usually female-sterile but the tenera yields far more oil than dura, and is the basis for commercial palm oil production in all of Southeast Asia5. Here, we describe the mapping and identification of the Shell gene responsible for the different fruit forms. Using homozygosity mapping by sequencing we found two independent mutations in the DNA binding domain of a homologue of the MADS-box gene SEEDSTICK (STK) which controls ovule identity and seed development in Arabidopsis. The Shell gene is responsible for the tenera phenotype in both cultivated and wild palms from sub-Saharan Africa, and our findings provide a genetic explanation for the single gene heterosis attributed to Shell, via heterodimerization. This gene mutation explains the single most important economic trait in oil palm, and has implications for the competing interests of global edible oil production, biofuels and rainforest conservation6. PMID:23883930

  3. Construction of adenovirus vectors encoding the lumican gene by gateway recombinant cloning technology. (United States)

    Wang, Gui-Fang; Qi, Bing; Tu, Lei-Lei; Liu, Lian; Yu, Guo-Cheng; Zhong, Jing-Xiang


    To construct adenovirus vectors of lumican gene by gateway recombinant cloning technology to further understand the role of lumican gene in myopia. Gateway recombinant cloning technology was used to construct adenovirus vectors. The wild-type (wt) and mutant (mut) forms of the lumican gene were synthesized and amplified by polymerase chain reaction (PCR). The lumican cDNA fragments were purified and ligated into the adenovirus shuttle vector pDown-multiple cloning site (MCS)-/internal ribozyme entry site (IRES)/enhanced green fluorescent protein (EGFP). Then the desired DNA fragments were integrated into the destination vector pAV.Des1d yielding the final expression constructs pAV.Ex1d-cytomegalovirus (CMV)>wt-lumican/IRES/EGFP and pAV.Ex1d-CMV>mut-lumican/IRES /EGFP, respectively. The adenovirus plasmids pAV.Ex1d-CMV>wt-lumican/IRES/EGFP and pAV.Ex1d-CMV>mut-lumican/IRES/EGFP were successfully constructed by gateway recombinant cloning technology. Positive clones identified by PCR and sequencing were selected and packaged into recombinant adenovirus in HEK293 cells. We construct adenovirus vectors containing the lumican gene by gateway recombinant cloning technology, which provides a basis for investigating the role of lumican gene in the pathogenesis of high myopia.

  4. Cloning and Expression Analysis of MEP Pathway Enzyme-encoding Genes in Osmanthus fragrans

    Directory of Open Access Journals (Sweden)

    Chen Xu


    Full Text Available The 2-C-methyl-d-erythritol 4-phosphate (MEP pathway is responsible for the biosynthesis of many crucial secondary metabolites, such as carotenoids, monoterpenes, plastoquinone, and tocopherols. In this study, we isolated and identified 10 MEP pathway genes in the important aromatic plant sweet osmanthus (Osmanthus fragrans. Multiple sequence alignments revealed that 10 MEP pathway genes shared high identities with other reported proteins. The genes showed distinctive expression profiles in various tissues, or at different flower stages and diel time points. The qRT-PCR results demonstrated that these genes were highly expressed in inflorescences, which suggested a tissue-specific transcript pattern. Our results also showed that OfDXS1, OfDXS2, and OfHDR1 had a clear diurnal oscillation pattern. The isolation and expression analysis provides a strong foundation for further research on the MEP pathway involved in gene function and molecular evolution, and improves our understanding of the molecular mechanism underlying this pathway in plants.

  5. Cloning and Expression Analysis of MEP Pathway Enzyme-encoding Genes in Osmanthus fragrans. (United States)

    Xu, Chen; Li, Huogeng; Yang, Xiulian; Gu, Chunsun; Mu, Hongna; Yue, Yuanzheng; Wang, Lianggui


    The 2-C-methyl-d-erythritol 4-phosphate (MEP) pathway is responsible for the biosynthesis of many crucial secondary metabolites, such as carotenoids, monoterpenes, plastoquinone, and tocopherols. In this study, we isolated and identified 10 MEP pathway genes in the important aromatic plant sweet osmanthus (Osmanthus fragrans). Multiple sequence alignments revealed that 10 MEP pathway genes shared high identities with other reported proteins. The genes showed distinctive expression profiles in various tissues, or at different flower stages and diel time points. The qRT-PCR results demonstrated that these genes were highly expressed in inflorescences, which suggested a tissue-specific transcript pattern. Our results also showed that OfDXS1, OfDXS2, and OfHDR1 had a clear diurnal oscillation pattern. The isolation and expression analysis provides a strong foundation for further research on the MEP pathway involved in gene function and molecular evolution, and improves our understanding of the molecular mechanism underlying this pathway in plants.

  6. Daphnia Halloween genes that encode cytochrome P450s mediating the synthesis of the arthropod molting hormone: evolutionary implications. (United States)

    Rewitz, Kim F; Gilbert, Lawrence I


    In crustaceans and insects, development and reproduction are controlled by the steroid hormone, 20-hydroxyecdysone (20E). Like other steroids, 20E, is synthesized from cholesterol through reactions involving cytochrome P450s (CYPs). In insects, the CYP enzymes mediating 20E biosynthesis have been identified, but evidence of their probable presence in crustaceans is indirect, relying solely on the ability of crustaceans to synthesize 20E. To investigate the presence of these genes in crustaceans, the genome of Daphnia pulex was examined for orthologs of these genes, the Halloween genes, encoding those biosynthetic CYP enzymes. Single homologs of spook-CYP307A1, phantom-CYP306A1, disembodied-CYP302A1, shadow-CYP315A1 and shade-CYP314A1 were identified in the Daphnia data base. Phylogenetic analysis indicates an orthologous relationship between the insect and Daphnia genes. Conserved intron/exon structures and microsynteny further support the conclusion that these steroidogenic CYPs have been conserved in insects and crustaceans through some 400 million years of evolution. Although these arthropod steroidogenic CYPs are related to steroidogenic CYPs in Caenorhabditis elegans and vertebrates, the data suggest that the arthropod steroidogenic CYPs became functionally specialized in a common ancestor of arthropods and are unique to these animals.

  7. Hyperexpression of a Bacillus thuringiensis delta-endotoxin-encoding gene in Escherichia coli: properties of the product. (United States)

    Ge, A Z; Pfister, R M; Dean, D H


    Conditions for hyperexpression, in Escherichia coli, of the Bacillus thuringiensis var, kurstaki gene, cryIA9(c)73, encoding an insecticidal crystal protein, CryIA(c)73, were investigated by varying the promoter type, host cell, plasmid copy number, the second codon and number of terminators. The cryIA(c)73 gene was cloned into three E. coli expression vectors, pKK223-3 (Ptac promoter), pET-3a (P phi 10 promoter), and pUC19 (Ptac promoter). The level of cryIA(c)73 expression was measured by ELISA and compared to total cellular protein over growth periods of 24 and 48 h. Maximum expression levels of 284 microgram CryIA(C)73/ml (48% of cellular protein) were obtained in shake flasks with the Ptac promoter in E. coli JM103. Optimal conditions were found to be low-copy-number plasmid (pBR322 ori), 48 h of growth, in lon+ cells. A change of the gene's second codon to AAA can improve expression by two to three fold but is undetectable in the presence of a strong E. coli promoter. The cryIA(c)73 gene product, in E. coli, formed crystals with the same lattice structure as the native crystals formed in B. thuringiensis (as visualized by electron microscopy). Bioassay results (insect toxicity and specificity) of the crystal produced in E. coli were similar to that produced in B. thuringiensis.

  8. Daphnia Halloween genes that encode cytochrome P450s mediating the synthesis of the arthropod molting hormone: Evolutionary implications

    Directory of Open Access Journals (Sweden)

    Gilbert Lawrence I


    Full Text Available Abstract Background In crustaceans and insects, development and reproduction are controlled by the steroid hormone, 20-hydroxyecdysone (20E. Like other steroids, 20E, is synthesized from cholesterol through reactions involving cytochrome P450s (CYPs. In insects, the CYP enzymes mediating 20E biosynthesis have been identified, but evidence of their probable presence in crustaceans is indirect, relying solely on the ability of crustaceans to synthesize 20E. Results To investigate the presence of these genes in crustaceans, the genome of Daphnia pulex was examined for orthologs of these genes, the Halloween genes, encoding those biosynthetic CYP enzymes. Single homologs of spook-CYP307A1, phantom-CYP306A1, disembodied-CYP302A1, shadow-CYP315A1 and shade-CYP314A1 were identified in the Daphnia data base. Phylogenetic analysis indicates an orthologous relationship between the insect and Daphnia genes. Conserved intron/exon structures and microsynteny further support the conclusion that these steroidogenic CYPs have been conserved in insects and crustaceans through some 400 million years of evolution. Conclusion Although these arthropod steroidogenic CYPs are related to steroidogenic CYPs in Caenorhabditis elegans and vertebrates, the data suggest that the arthropod steroidogenic CYPs became functionally specialized in a common ancestor of arthropods and are unique to these animals.

  9. The rad9 gene of Coprinus cinereus encodes a proline-rich protein required for meiotic chromosome condensation and synapsis

    Energy Technology Data Exchange (ETDEWEB)

    Seitz, L.C.; Tang, Keliang; Cummings, W.J.; Zolan, M.E. [Indiana Univ., Bloomington, IN (United States)


    The rad9 gene of Coprinus cinereus is essential for the normal completion of meiosis. We examined surface-spread preparations of wild-type and rad9-1 nuclei from the meiotic stages of karyogamy through metaphase I, and we determined the primary sequence, structure, and meiotic expression of the rad9 gene. In wild-type C. cinereus, karyogamy is followed by condensation and alignment of homologous chromosomes. Condensation and axial core development largely precede synapsis, which often initiates at telomeres. A diffuse diplotene phase coincides with dissolution of the synaptonemal complex, and subsequently chromosomes further condense as the cells progress into metaphase I. In contrast, although karyogamy and nucleolar fusion are apparently normal in rad9-1 basidia, only short stretches of synaptonemal complex form. These correlate with stretches of condensed chromatin, mostly at apparent chromosome ends, and regions of presumptive triple synapsis are numerous. rad9-1 basidia enter the diffuse stages of early diplotene, and then 50% of these cells enter metaphase I by the criteria of nucleolar elimination and at least some chromatin condensation. rad9 gene expression is induced after gamma irradiation and during meiosis. The gene has 27 exons and encodes a predicted protein of 2157 amino acids, with a proline-rich amino terminus. 62 refs., 10 figs.

  10. The Rad9 Gene of Coprinus Cinereus Encodes a Proline-Rich Protein Required for Meiotic Chromosome Condensation and Synapsis (United States)

    Seitz, L. C.; Tang, K.; Cummings, W. J.; Zolan, M. E.


    The rad9 gene of Coprinus cinereus is essential for the normal completion of meiosis. We examined surface-spread preparations of wild-type and rad9-1 nuclei from the meiotic stages of karyogamy through metaphase I, and we determined the primary sequence, structure, and meiotic expression of the rad9 gene. In wild-type C. cinereus, karyogamy is followed by condensation and alignment of homologous chromosomes. Condensation and axial core development largely precede synapsis, which often initiates at telomeres. A diffuse diplotene phase coincides with dissolution of the synaptonemal complex, and subsequently chromosomes further condense as the cells progress into metaphase I. In contrast, although karyogamy and nucleolar fusion are apparently normal in rad9-1 basidia, only short stretches of synaptonemal complex form. These correlate with stretches of condensed chromatin, mostly at apparent chromosome ends, and regions of presumptive triple synapsis are numerous. rad9-1 basidia enter the diffuse stage of early diplotene, and then 50% of these cells enter metaphase I by the criteria of nucleolar elimination and at least some chromatin condensation. rad9 gene expression is induced after gamma irradiation and during meiosis. The gene has 27 exons and encodes a predicted protein of 2157 amino acids, with a proline-rich amino terminus. PMID:8846891

  11. Quantitative analysis of clinically relevant mutations occurring in lymphoid cells harboring γ-retrovirus-encoded hsvtk suicide genes (United States)

    Wang, X; Olszewska, M; Capacio, V; Stefanski, J; Przybylowski, M; Samakoglu, S; Chang, AH; Sadelain, M; Rivière, I


    The in vivo regulation of T lymphocyte activity by the activation of a suicide mechanism is an essential paradigm for the safety of adoptive cell therapies. In light of reports showing that γ-retroviral vector-encoded herpes simplex virus thymidine kinase (hsvtk) undergoes recombination, we undertook a thorough investigation of the genomic stability of SFG-based vectors using two variants of the wild-type hsvtk gene. In a large panel of independent clones, we demonstrate that both hsvtk genes undergo recombination with molecular signatures indicative of template switching in GC-rich regions displaying homology at the deletion junctions or RNA splicing. In the absence of ganciclovir selection, the frequency of recombination is 3% per retroviral replication cycle. Our results underscore the importance of the five nucleotide difference between the two hsvtk genes that account for the presence of recombinogenic hot spots in one variant and not the other, indicating that the probability of RNA splicing is influenced by minute nucleotide changes in sequences adjacent to the splice donor and acceptor sites. Furthermore, our mutational analysis in an unbiased panel of human lymphoid cells (that is, without immune or ganciclovir-mediated selective pressure) provides a robust in vitro assay to predict and quantify clinically relevant mutations in hsvtk suicide genes, which can be applied to studying and improving the stability of any transgene expressed in γ-retroviral or lentiviral vectors. PMID:18563185

  12. Quantitative analysis of clinically relevant mutations occurring in lymphoid cells harboring gamma-retrovirus-encoded hsvtk suicide genes. (United States)

    Wang, X; Olszewska, M; Capacio, V; Stefanski, J; Przybylowski, M; Samakoglu, S; Chang, A H; Sadelain, M; Rivière, I


    The in vivo regulation of T lymphocyte activity by the activation of a suicide mechanism is an essential paradigm for the safety of adoptive cell therapies. In light of reports showing that gamma-retroviral vector-encoded herpes simplex virus thymidine kinase (hsvtk) undergoes recombination, we undertook a thorough investigation of the genomic stability of SFG-based vectors using two variants of the wild-type hsvtk gene. In a large panel of independent clones, we demonstrate that both hsvtk genes undergo recombination with molecular signatures indicative of template switching in GC-rich regions displaying homology at the deletion junctions or RNA splicing. In the absence of ganciclovir selection, the frequency of recombination is 3% per retroviral replication cycle. Our results underscore the importance of the five nucleotide difference between the two hsvtk genes that account for the presence of recombinogenic hot spots in one variant and not the other, indicating that the probability of RNA splicing is influenced by minute nucleotide changes in sequences adjacent to the splice donor and acceptor sites. Furthermore, our mutational analysis in an unbiased panel of human lymphoid cells (that is, without immune or ganciclovir-mediated selective pressure) provides a robust in vitro assay to predict and quantify clinically relevant mutations in hsvtk suicide genes, which can be applied to studying and improving the stability of any transgene expressed in gamma-retroviral or lentiviral vectors.

  13. Phase I study of liposome-DNA complexes encoding the interleukin-2 gene in dogs with osteosarcoma lung metastases. (United States)

    Dow, Steven; Elmslie, Robyn; Kurzman, Ilene; MacEwen, Gregory; Pericle, Federica; Liggitt, Denny


    Systemic gene delivery using cationic liposome-DNA complexes (LDCs) has been shown to elicit potent antitumor activity in mice with tumor metastases to the lungs. However, intravenous gene delivery for treatment of established cancer has not been evaluated previously in a spontaneous, large animal model. We therefore evaluated the safety, toxicity, and efficacy of intravenous gene delivery, using LDCs in dogs with established tumor metastases. Twenty dogs with chemotherapy-resistant osteosarcoma metastases to the lungs received a series of intravenous infusions of cationic liposomes and plasmid DNA encoding the canine interleukin-2 (IL-2) cDNA. Effects of intravenous gene delivery on immune activation, clinical and hematologic parameters, tumor responses, and survival times were assessed. We found that slow intravenous administration of IL-2 LDCs resulted in detectable IL-2 transgene expression in lung tissues of dogs. Repeated intravenous infusions of LDCs were well tolerated by dogs with lung tumor metastases and elicited systemic immune activation, as reflected by fever, leukogram changes, monocyte activation, and increased natural killer cell activity. Three of 20 dogs experienced partial or complete regression of lung metastases after infusion of IL-2 LDCs. Overall survival times were significantly increased in treated dogs compared with historical control animals with the same stage of disease. We conclude that repeated intravenous infusion of LDCs in cancerbearing dogs is safe and well tolerated at low doses and may be capable of eliciting antitumor activity in some animals with advanced tumor metastases.

  14. Mutation in the gene encoding ubiquitin ligase LRSAM1 in patients with Charcot-Marie-Tooth disease.

    Directory of Open Access Journals (Sweden)

    Duane L Guernsey


    Full Text Available Charcot-Marie-Tooth disease (CMT represents a family of related sensorimotor neuropathies. We studied a large family from a rural eastern Canadian community, with multiple individuals suffering from a condition clinically most similar to autosomal recessive axonal CMT, or AR-CMT2. Homozygosity mapping with high-density SNP genotyping of six affected individuals from the family excluded 23 known genes for various subtypes of CMT and instead identified a single homozygous region on chromosome 9, at 122,423,730-129,841,977 Mbp, shared identical by state in all six affected individuals. A homozygous pathogenic variant was identified in the gene encoding leucine rich repeat and sterile alpha motif 1 (LRSAM1 by direct DNA sequencing of genes within the region in affected DNA samples. The single nucleotide change mutates an intronic consensus acceptor splicing site from AG to AA. Direct analysis of RNA from patient blood demonstrated aberrant splicing of the affected exon, causing an obligatory frameshift and premature truncation of the protein. Western blotting of immortalized cells from a homozygous patient showed complete absence of detectable protein, consistent with the splice site defect. LRSAM1 plays a role in membrane vesicle fusion during viral maturation and for proper adhesion of neuronal cells in culture. Other ubiquitin ligases play documented roles in neurodegenerative diseases. LRSAM1 is a strong candidate for the causal gene for the genetic disorder in our kindred.

  15. The isolation and characterization of a Neurospora crassa gene (ubi::crp-6) encoding a ubiquitin-40S ribosomal protein fusion protein. (United States)

    Tarawneh, K A; Anumula, K R; Free, S J


    We have isolated and sequenced a Neurospora crassa gene encoding a single copy of ubiquitin (UBI) fused to the S27a ribosomal (r) protein. We have opted to name this gene the ubiquitin/cytoplasmic r-protein gene 6 (ubi::crp-6). The ubi::crp-6 gene generates a 700-nucleotide (nt) transcript. It shares a 700-bp regulatory region with the cytoplasmic r-protein gene 5 (crp-5), a gene encoding the N. crassa S26 r-protein. The two genes are transcribed divergently from the common regulatory region and their mRNA levels are regulated in parallel during growth on a variety of carbon sources.

  16. The Gene Encoding Protocadherin 9 (PCDH9), a Novel Risk Factor for Major Depressive Disorder. (United States)

    Xiao, Xiao; Zheng, Fanfan; Chang, Hong; Ma, Yina; Yao, Yong-Gang; Luo, Xiong-Jian; Li, Ming


    Genomic analyses have identified only a handful of robust risk loci for major depressive disorder (MDD). In addition to the published genome-wide significant genes, it is believed that there are undiscovered 'treasures' underlying the current MDD genome-wide association studies (GWASs) and gene expression data sets, and digging into these data will allow better understanding of the illness and development of new therapeutic approaches. For this purpose, we performed a meta-analytic study combining three MDD GWAS data sets (23andMe, CONVERGE, and PGC), and then conducted independent replications of significant loci in two additional samples. The genome-wide significant variants then underwent explorative analyses on MDD-related phenotypes, cognitive function alterations, and gene expression in brains. In the discovery meta-analysis, a previously unidentified single-nucleotide polymorphism (SNP) rs9540720 in the PCDH9 gene was genome-wide significantly associated with MDD (p=1.69 × 10-8 in a total of 89 610 cases and 246 603 controls), and the association was further strengthened when additional replication samples were included (p=1.20 × 10-8 in a total of 136 115 cases and 355 275 controls). The risk SNP was also associated with multiple MDD-related phenotypes and cognitive function impairment in diverse samples. Intriguingly, the risk allele of rs9540720 predicted lower PCDH9 expression, consistent with the diagnostic analysis results that PCDH9 mRNA expression levels in the brain and peripheral blood tissues were reduced in MDD patients compared with healthy controls. These convergent lines of evidence suggest that PCDH9 is likely a novel risk gene for MDD. Our study highlights the necessity and importance of excavating the public data sets to explore risk genes for MDD, and this approach is also applicable to other complex diseases.Neuropsychopharmacology advance online publication, 1 November 2017; doi:10.1038/npp.2017.241.

  17. The heterologous expression of polysaccharidase-encoding genes with oenological relevance in Saccharomyces cerevisiae. (United States)

    van Rensburg, P; Strauss, M L A; Lambrechts, M G; Cordero Otero, R R; Pretorius, I S


    The main objective of this study was to develop polysaccharide-degrading wine strains of Saccharomyces cerevisiae, which are able to improve aspects of wine processing and clarification, as well as colour extraction and stabilization during winemaking. Two yeast expression/secretion gene cassettes were constructed, namely (i) a pectinase gene cassette (pPPK) consisting of the endo-polygalacturonase gene (pelE) from Erwinia chrysanthemi and the pectate lyase gene (peh1) from Erwinia carotovora and (ii) a glucanase/xylanase gene cassette (pEXS) containing the endo-beta-1,4-glucanase gene (end1) from Butyrivibrio fibrisolvens and the endo-beta-1,4-xylanase gene (xynC) from Aspergillus niger. The commercial wine yeast strain, VIN13, was transformed separately with these two gene cassettes and checked for the production of pectinase, glucanase and xylanase activities. Pinot Noir, Cinsaut and Muscat d'Alexandria grape juices were fermented using the VIN13[pPPK] pectinase- and the VIN13[pEXS] glucanase/xylanase-producing transformants. Chemical analyses of the resultant wines indicated that (i) the pectinase-producing strain caused a decrease in the concentration of phenolic compounds in Pinot Noir whereas the glucanase/xylanase-producing strain caused an increase in phenolic compounds presumably because of the degradation of the grape skins; (ii) the glucanase/xylanase-producing strain caused a decrease in wine turbidity, especially in Pinot Noir wine, as well as a clear increase in colour intensity and (iii) in the Muscat d'Alexandria and Cinsaut wines, the differences between the control wines (fermented with the untransformed VIN3 strain) and the wines produced by the two transformed strains were less prominent showing that the effect of these polysaccharide-degrading enzymes is cultivar-dependent. The recombinant wine yeasts producing pectinase, glucanase and xylanase activities during the fermentation of Pinot Noir, Cinsaut and Muscat d'Alexandria grape juice

  18. Mutations in Three Genes Encoding Proteins Involved in Hair Shaft Formation Cause Uncombable Hair Syndrome

    DEFF Research Database (Denmark)

    Ü Basmanav, F Buket; Cau, Laura; Tafazzoli, Aylar


    to being combed flat. Until now, both simplex and familial UHS-affected case subjects with autosomal-dominant as well as -recessive inheritance have been reported. However, none of these case subjects were linked to a molecular genetic cause. Here, we report the identification of UHS-causative mutations...... located in the three genes PADI3 (peptidylarginine deiminase 3), TGM3 (transglutaminase 3), and TCHH (trichohyalin) in a total of 11 children. All of these individuals carry homozygous or compound heterozygous mutations in one of these three genes, indicating an autosomal-recessive inheritance pattern...

  19. The abnormal spindle-like, microcephaly-associated (ASPM) gene encodes a centrosomal protein. (United States)

    Zhong, Xueyan; Liu, Limin; Zhao, Ailian; Pfeifer, Gerd P; Xu, Xingzhi


    Homozygous mutations in the abnormal spindle-like, microcephaly-associated ASPM gene are the leading cause of autosomal recessive primary microcephaly. ASPM is the putative human ortholog of the Drosophila melanogaster abnormal spindles gene (asp), which is essential for mitotic spindle function. Here, we report that downregulation of endogenous ASPM by siRNA decreases protein levels of endogenous BRCA1. ASPM localizes to the centrosome in interphase and to the spindle poles from prophase through telophase. These findings indicate that ASPM may be involved in mitotic spindle function, possibly, through regulation of BRCA1.

  20. Cloning and characterization of two novel β-glucosidase genes encoding isoenzymes of the cellobiase complex from Cellulomonas biazotea. (United States)

    Chan, Anthony K N; Ng, Alan K L; Ng, Kate K Y; Wong, W K R


    Enzymatic degradation of cellulosic waste to generate renewable biofuels has offered an attractive solution to the energy problem. Synergistic hydrolysis of cellulose residues requires the participation of three different types of cellulases - endoglucanases, exoglucanases, and β-glucosidases (Bgl). Our group has been interested in using Bgl of Cellulomonas biazotea in studies designed to investigate cooperative action among different cellulases. We previously have cloned bgl genes encoding Cba and Cba3, which are C. biazotea Bgl isozymes representing two different Bgl families, respectively; specifically, Glycoside Hydrolase Family 3 (GH3) and Glycoside Hydrolase Family 1 (GH1). To gain an understanding of the complexity of Bgl in C. biazotea, we analyzed E. coli clones containing plasmids into which C. biazotea DNA had been inserted; these clones could hydrolyze 4-methylumbelliferyl β-d-glucopyranoside (MUG) supplemented in solid agar media, suggesting they might contain bgl genes. Through restriction analysis and DNA sequencing, two novel bgl genes, designated cba4 and cba5 and encoding Cba4 (484 amino acids) and Cba5 (758 amino acids) were identified. Cba4 and Cba5 appear to be members of GH1 and GH3, respectively. Both Cba4 and Cba5 were concluded to be genuine cellobiases as each was found to enable their E. coli hosts to survive on media in which cellobiose was the sole carbon source. Despite lacking a typical secretory signal sequence, Cba4 and Cba5 are secretory proteins. Although they are isoenzymes, Cba, Cba3, Cba4, and Cba5 were shown to possess distinct substrate specificities. These four Bgl members may play important roles in hydrolyzing a wide variety of β-glucosides including cellobiose and non-cellulosic substrates. Copyright © 2017 Elsevier B.V. All rights reserved.

  1. Inactivation of genes encoding plastoglobuli-like proteins in Synechocystis sp. PCC 6803 leads to a light-sensitive phenotype. (United States)

    Cunningham, Francis X; Tice, Ashley B; Pham, Christina; Gantt, Elisabeth


    Plastoglobulins (PGL) are the predominant proteins of lipid globules in the plastids of flowering plants. Genes encoding proteins similar to plant PGL are also present in algae and cyanobacteria but in no other organisms, suggesting an important role for these proteins in oxygenic photosynthesis. To gain an understanding of the core and fundamental function of PGL, the two genes that encode PGL-like polypeptides in the cyanobacterium Synechocystis sp. PCC 6803 (pgl1 and pgl2) were inactivated individually and in combination. The resulting mutants were able to grow under photoautotrophic conditions, dividing at rates that were comparable to that of the wild-type (WT) under low-light (LL) conditions (10 microeinsteins x m(-2) x s(-1)) but lower than that of the WT under moderately high-irradiance (HL) conditions (150 microeinsteins x m(-2) x s(-1)). Under HL, each Deltapgl mutant had less chlorophyll, a lower photosystem I (PSI)/PSII ratio, more carotenoid per unit of chlorophyll, and very much more myxoxanthophyll (a carotenoid symptomatic of high light stress) per unit of chlorophyll than the WT. Large, heterogeneous inclusion bodies were observed in cells of mutants inactivated in pgl2 or both pgl2 and pgl1 under both LL and HL conditions. The mutant inactivated in both pgl genes was especially sensitive to the light environment, with alterations in pigmentation, heterogeneous inclusion bodies, and a lower PSI/PSII ratio than the WT even for cultures grown under LL conditions. The WT cultures grown under HL contained 2- to 3-fold more PGL1 and PGL2 per cell than cultures grown under LL conditions. These and other observations led us to conclude that the PGL-like polypeptides of Synechocystis play similar but not identical roles in some process relevant to the repair of photooxidative damage.

  2. Korean, Japanese, and Chinese populations featured similar genes encoding drug-metabolizing enzymes and transporters: a DMET Plus microarray assessment. (United States)

    Yi, SoJeong; An, Hyungmi; Lee, Howard; Lee, Sangin; Ieiri, Ichiro; Lee, Youngjo; Cho, Joo-Youn; Hirota, Takeshi; Fukae, Masato; Yoshida, Kenji; Nagatsuka, Shinichiro; Kimura, Miyuki; Irie, Shin; Sugiyama, Yuichi; Shin, Dong Wan; Lim, Kyoung Soo; Chung, Jae-Yong; Yu, Kyung-Sang; Jang, In-Jin


    Interethnic differences in genetic polymorphism in genes encoding drug-metabolizing enzymes and transporters are one of the major factors that cause ethnic differences in drug response. This study aimed to investigate genetic polymorphisms in genes involved in drug metabolism, transport, and excretion among Korean, Japanese, and Chinese populations, the three major East Asian ethnic groups. The frequencies of 1936 variants representing 225 genes encoding drug-metabolizing enzymes and transporters were determined from 786 healthy participants (448 Korean, 208 Japanese, and 130 Chinese) using the Affymetrix Drug-Metabolizing Enzymes and Transporters Plus microarray. To compare allele or genotype frequencies in the high-dimensional data among the three East Asian ethnic groups, multiple testing, principal component analysis (PCA), and regularized multinomial logit model through least absolute shrinkage and selection operator were used. On microarray analysis, 1071 of 1936 variants (>50% of markers) were found to be monomorphic. In a large number of genetic variants, the fixation index and Pearson's correlation coefficient of minor allele frequencies were less than 0.034 and greater than 0.95, respectively, among the three ethnic groups. PCA identified 47 genetic variants with multiple testing, but was unable to discriminate ethnic groups by the first three components. Multinomial least absolute shrinkage and selection operator analysis identified 269 genetic variants that showed different frequencies among the three ethnic groups. However, none of those variants distinguished between the three ethnic groups during subsequent PCA. Korean, Japanese, and Chinese populations are not pharmacogenetically distant from one another, at least with regard to drug disposition, metabolism, and elimination.

  3. The Rice TCM5 Gene Encoding a Novel Deg Protease Protein is Essential for Chloroplast Development under High Temperatures. (United States)

    Zheng, Kailun; Zhao, Jian; Lin, Dongzhi; Chen, Jiaying; Xu, Jianlong; Zhou, Hua; Teng, Sheng; Dong, Yanjun


    High temperature affects a broad spectrum of cellular components and metabolism in plants. The Deg/HtrA family of ATP-independent serine endopeptidases is present in nearly all organisms. Deg proteases are required for the survival of Escherichia coli at high temperatures. However, it is still unclear whether rice Deg proteases are required for chloroplast development under high temperatures. In this study, we reported the first rice deg mutant tcm5 (thermo-sensitive chlorophyll-deficient mutant 5) that has an albino phenotype, defective chloroplasts and could not survive after the 4-5 leaf seedling stage when grown at high temperature (32 °C). However, when grown at low temperatures (20 °C), tcm5 has a normal phenotype. Map-based cloning showed that TCM5 encoding a chloroplast-targeted Deg protease protein. The TCM5 transcripts were highly expressed in all green tissues and undetectable in other tissues, showing the tissue-specific expression. In tcm5 mutants grown at high temperatures, the transcript levels of certain genes associated with chloroplast development especially PSII-associated genes were severely affected, but recovered to normal levels at low temperatures. These results showed important role of TCM5 for chloroplast development under high temperatures. The TCM5 encodes chloroplast-targeted Deg protease protein which is important for chloroplast development and the maintenance of PSII function and its disruption would lead to a defective chloroplast and affected expression levels of genes associated with chloroplast development and photosynthesis at early rice seedling stage under high temperatures.

  4. Cloning, structural analysis, and chromosomal localization of the human CSRP2 gene encoding the LIM domain protein CRP2. (United States)

    Weiskirchen, R; Erdel, M; Utermann, G; Bister, K


    The CSRP2 gene encoding the LIM domain protein CRP2 was originally identified in quail based on its strong transcriptional suppression in transformed avian fibroblasts. Here we have isolated a human CSRP2 cDNA clone encoding a 193-amino-acid human CRP2 (hCRP2) protein with 96.4% amino acid sequence identity to the avian homolog. The CSRP2 cDNA clone was used to isolate CSRP2-related clones from gamma EMBL3 and P1 libraries of human genomic DNA. The complete organization of the CSRP2 gene was determined by nucleic acid hybridization, transcriptional mapping, and nucleotide sequence analysis. The gene spans a total of approximately 22 kb and contains six exons. The coding region is confined to exons 2-6 and predicts a hCRP2 protein identical in its amino acid sequence to the protein deduced from the CSRP2 cDNA clone. By fluorescence in situ hybridization using both lambda EMBL3 and P1 library clones as hybridization probes and a new method for computerized signal localization, CSRP2 was mapped to chromosome subband 12q21.1, a region frequently affected by deletion or breakage events in various tumor types. The library screens also led to the isolation of a CSRP2-related ps