WorldWideScience

Sample records for network lac operon

  1. Deterministic and stochastic population-level simulations of an artificial lac operon genetic network

    Directory of Open Access Journals (Sweden)

    Zygourakis Kyriacos

    2011-07-01

    Full Text Available Abstract Background The lac operon genetic switch is considered as a paradigm of genetic regulation. This system has a positive feedback loop due to the LacY permease boosting its own production by the facilitated transport of inducer into the cell and the subsequent de-repression of the lac operon genes. Previously, we have investigated the effect of stochasticity in an artificial lac operon network at the single cell level by comparing corresponding deterministic and stochastic kinetic models. Results This work focuses on the dynamics of cell populations by incorporating the above kinetic scheme into two Monte Carlo (MC simulation frameworks. The first MC framework assumes stochastic reaction occurrence, accounts for stochastic DNA duplication, division and partitioning and tracks all daughter cells to obtain the statistics of the entire cell population. In order to better understand how stochastic effects shape cell population distributions, we develop a second framework that assumes deterministic reaction dynamics. By comparing the predictions of the two frameworks, we conclude that stochasticity can create or destroy bimodality, and may enhance phenotypic heterogeneity. Conclusions Our results show how various sources of stochasticity act in synergy with the positive feedback architecture, thereby shaping the behavior at the cell population level. Further, the insights obtained from the present study allow us to construct simpler and less computationally intensive models that can closely approximate the dynamics of heterogeneous cell populations.

  2. Dynamic model of gene regulation for the lac operon

    Energy Technology Data Exchange (ETDEWEB)

    Angelova, Maia; Ben-Halim, Asma, E-mail: maia.angelova@northumbria.ac.uk, E-mail: asma.benhalim@northumbria.ac.uk [Intelligent Modelling Lab, School of Computing, Engineering and Information Sciences, Northumbria University, Newcastle upon Tyne NE2 1XE (United Kingdom)

    2011-03-01

    Gene regulatory network is a collection of DNA which interact with each other and with other matter in the cell. The lac operon is an example of a relatively simple genetic network and is one of the best-studied structures in the Escherichia coli bacteria. In this work we consider a deterministic model of the lac operon with a noise term, representing the stochastic nature of the regulation. The model is written in terms of a system of simultaneous first order differential equations with delays. We investigate an analytical and numerical solution and analyse the range of values for the parameters corresponding to a stable solution.

  3. Evolution and Biophysics of the Escherichia coli lac Operon

    Science.gov (United States)

    Ray, J. Christian; Igoshin, Oleg; Quan, Selwyn; Monds, Russell; Cooper, Tim; Balázsi, Gábor

    2011-03-01

    To understand, predict, and control the evolution of living organisms, we consider biophysical effects and molecular network architectures. The lactose utilization system of E. coli is among the most well-studied molecular networks in biology, making it an ideal candidate for such studies. Simulations show how the genetic architecture of the wild-type operon attenuates large metabolic intermediate fluctuations that are predicted to occur in an equivalent system with the component genes on separate operons. Quantification of gene expression in the lac operon evolved in growth conditions containing constant lactose, alternating with glucose, or constant glucose, shows characteristic gene expression patterns depending on conditions. We are simulating these conditions to show context-dependent biophysical sources and costs of different lac operon architectures.

  4. Structural explanation for allolactose (lac operon inducer) synthesis by lacZ β-galactosidase and the evolutionary relationship between allolactose synthesis and the lac repressor

    National Research Council Canada - National Science Library

    Wheatley, Robert W; Lo, Summie; Jancewicz, Larisa J; Dugdale, Megan L; Huber, Reuben E

    2013-01-01

    β-Galactosidase (lacZ) has bifunctional activity. It hydrolyzes lactose to galactose and glucose and catalyzes the intramolecular isomerization of lactose to allolactose, the lac operon inducer. β...

  5. DNA sequence of the lactose operon: the lacA gene and the transcriptional termination region.

    OpenAIRE

    Hediger, M A; Johnson, D F; Nierlich, D P; Zabin, I

    1985-01-01

    The lac operon of Escherichia coli spans approximately 5300 base pairs and includes the lacZ, lacY, and lacA genes in addition to the operator, promoter, and transcription termination regions. We report here the sequence of the lacA gene and the region distal to it, confirming the sequence of thiogalactoside transacetylase and completing the sequence of the lac operon. The lacA gene is characterized by use of rare codons, suggesting an origin from a plasmid, transposon, or virus gene. UUG is ...

  6. Effector Overlap between the lac and mel Operons of Escherichia coli: Induction of the mel Operon with β-Galactosides.

    Science.gov (United States)

    Narang, Atul; Oehler, Stefan

    2017-05-01

    The lac (lactose) operon (which processes β-galactosides) and the mel (melibiose) operon (which processes α-galactosides) of Escherichia coli have a close historical connection. A number of shared substrates and effectors of the permeases and regulatory proteins have been reported over the years. Until now, β-thiogalactosides like TMG (methyl-β-d-thiogalactopyranoside) and IPTG (isopropyl-β-d-thiogalactopyranoside) have not generally been considered to be inducers of the mel operon. The same is true for β-galactosides such as lactose [β-d-galactopyranosyl-(1→4)-d-glucose], which is a substrate but is not itself an inducer of the lac operon. This report shows that all three sugars can induce the mel operon significantly when they are accumulated in the cell by Lac permease. Strong induction by β-thiogalactosides is observed in the presence of Lac permease, and strong induction by lactose (more than 200-fold) is observed in the absence of β-galactosidase. This finding calls for reevaluation of TMG uptake experiments as assays for Lac permease that were performed with mel(+) strains.IMPORTANCE The typical textbook picture of bacterial operons is that of stand-alone units of genetic information that perform, in a regulated manner, well-defined cellular functions. Less attention is given to the extensive interactions that can be found between operons. Well-described examples of such interactions are the effector molecules shared by the lac and mel operons. Here, we show that this set has to be extended to include β-galactosides, which have been, until now, considered not to effect the expression of the mel operon. That they can be inducers of the mel operon as well as the lac operon has not been noted in decades of research because of the Escherichia coli genetic background used in previous studies. Copyright © 2017 American Society for Microbiology.

  7. Solving a discrete model of the lac operon using Z3

    Science.gov (United States)

    Gutierrez, Natalia A.

    2014-05-01

    A discrete model for the Lcac Operon is solved using the SMT-solver Z3. Traditionally the Lac Operon is formulated in a continuous math model. This model is a system of ordinary differential equations. Here, it was considerated as a discrete model, based on a Boolean red. The biological problem of Lac Operon is enunciated as a problem of Boolean satisfiability, and it is solved using an STM-solver named Z3. Z3 is a powerful solver that allows understanding the basic dynamic of the Lac Operon in an easier and more efficient way. The multi-stability of the Lac Operon can be easily computed with Z3. The code that solves the Boolean red can be written in Python language or SMT-Lib language. Both languages were used in local version of the program as online version of Z3. For future investigations it is proposed to solve the Boolean red of Lac Operon using others SMT-solvers as cvc4, alt-ergo, mathsat and yices.

  8. DNA sequence of the lactose operon: the lacA gene and the transcriptional termination region.

    Science.gov (United States)

    Hediger, M A; Johnson, D F; Nierlich, D P; Zabin, I

    1985-10-01

    The lac operon of Escherichia coli spans approximately 5300 base pairs and includes the lacZ, lacY, and lacA genes in addition to the operator, promoter, and transcription termination regions. We report here the sequence of the lacA gene and the region distal to it, confirming the sequence of thiogalactoside transacetylase and completing the sequence of the lac operon. The lacA gene is characterized by use of rare codons, suggesting an origin from a plasmid, transposon, or virus gene. UUG is the translation initiation codon. A preliminary examination of 3' end of the lac messenger in the region distal to the lacA gene indicates several endpoints. A predominant one is located at the 3' end of a G + C-rich hairpin structure, which may be involved in termination of transcription or in post-transcriptional processing. An open reading frame of 702 base pairs is present on the complementary strand downstream from lacA.

  9. Loss of the lac operon contributes to Salmonella invasion of epithelial cells through derepression of flagellar synthesis.

    Science.gov (United States)

    Jiang, Lingyan; Ni, Zhiwei; Wang, Lei; Feng, Lu; Liu, Bin

    2015-03-01

    Salmonella, a genus that is closely related to Escherichia coli, includes many pathogens of humans and other animals. A notable feature that distinguishes Salmonella from E. coli is lactose negativity, because the lac operon is lost in most Salmonella genomes. Here, we expressed the lac operon in Salmonella enterica serovar Typhimurium and compared the virulence of the Lac(+) strain to that of the wild-type strain in a murine model, invasion assays, and macrophage replication assays. We showed that the Lac(+) strain is attenuated in vivo and the attenuation of virulence is caused by its defect in epithelial cell invasion. However, the invasion-defective phenotype is unrelated to lactose utilization. Through sequencing and the comparison of the transcriptome profile between the Lac(+) and wild-type strains during invasion, we found that most flagellar genes were markedly downregulated in the Lac(+) strain, while other genes associated with invasion, such as the majority of genes encoded in Salmonella pathogenicity island 1, were not differentially expressed. Moreover, we discovered that lacA is the major repressor of flagellar gene expression in the lac operon. In conclusion, these data demonstrate that the lac operon decreases Salmonella invasion of epithelial cells through repression of flagellar biosynthesis. As the ability to invade epithelial cells is a critical virulence determinant of Salmonella, our results provide important evidence that the loss of the lac operon contributes to the evolution of Salmonella pathogenicity.

  10. lac operon induction in Escherichia coli: Systematic comparison of IPTG and TMG induction and influence of the transacetylase LacA.

    Science.gov (United States)

    Marbach, Anja; Bettenbrock, Katja

    2012-01-01

    Most commonly used expression systems in bacteria are based on the Escherichia coli lac promoter. Furthermore, lac operon elements are used today in systems and synthetic biology. In the majority of the cases the gratuitous inducers IPTG or TMG are used. Here we report a systematic comparison of lac promoter induction by TMG and IPTG which focuses on the aspects inducer uptake, population heterogeneity and a potential influence of the transacetylase, LacA. We provide induction curves in E. coli LJ110 and in isogenic lacY and lacA mutant strains and we show that both inducers are substrates of the lactose permease at low inducer concentrations but can also enter cells independently of lactose permease if present at higher concentrations. Using a gfp reporter strain we compared TMG and IPTG induction at single cell level and showed that bimodal induction with IPTG occurred at approximately ten-fold lower concentrations than with TMG. Furthermore, we observed that lac operon induction is influenced by the transacetylase, LacA. By comparing two Plac-gfp reporter strains with and without a lacA deletion we could show that in the lacA(+) strain the fluorescence level decreased after few hours while the fluorescence further increased in the lacA(-) strain. The results indicate that through the activity of LacA the IPTG concentration can be reduced below an inducing threshold concentration-an influence that should be considered if low inducer amounts are used. Copyright © 2011 Elsevier B.V. All rights reserved.

  11. Hopf Bifurcation and Delay-Induced Turing Instability in a Diffusive lac Operon Model

    Science.gov (United States)

    Cao, Xin; Song, Yongli; Zhang, Tonghua

    In this paper, we investigate the dynamics of a lac operon model with delayed feedback and diffusion effect. If the system is without delay or the delay is small, the positive equilibrium is stable so that there are no spatial patterns formed; while the time delay is large enough the equilibrium becomes unstable so that rich spatiotemporal dynamics may occur. We have found that time delay can not only incur temporal oscillations but also induce imbalance in space. With different initial values, the system may have different spatial patterns, for instance, spirals with one head, four heads, nine heads, and even microspirals.

  12. Dynamics and bistability in a reduced model of the lac operon

    Science.gov (United States)

    Yildirim, Necmettin; Santillán, Moisés; Horike, Daisuke; Mackey, Michael C.

    2004-06-01

    It is known that the lac operon regulatory pathway is capable of showing bistable behavior. This is an important complex feature, arising from the nonlinearity of the involved mechanisms, which is essential to understand the dynamic behavior of this molecular regulatory system. To find which of the mechanisms involved in the regulation of the lac operon is the origin of bistability, we take a previously published model which accounts for the dynamics of mRNA, lactose, allolactose, permease and β-galactosidase involvement and simplify it by ignoring permease dynamics (assuming a constant permease concentration). To test the behavior of the reduced model, three existing sets of data on β-galactosidase levels as a function of time are simulated and we obtain a reasonable agreement between the data and the model predictions. The steady states of the reduced model were numerically and analytically analyzed and it was shown that it may indeed display bistability, depending on the extracellular lactose concentration and growth rate.

  13. Interplay of protein and DNA structure revealed in simulations of the lac operon.

    Directory of Open Access Journals (Sweden)

    Luke Czapla

    Full Text Available The E. coli Lac repressor is the classic textbook example of a protein that attaches to widely spaced sites along a genome and forces the intervening DNA into a loop. The short loops implicated in the regulation of the lac operon suggest the involvement of factors other than DNA and repressor in gene control. The molecular simulations presented here examine two likely structural contributions to the in-vivo looping of bacterial DNA: the distortions of the double helix introduced upon association of the highly abundant, nonspecific nucleoid protein HU and the large-scale deformations of the repressor detected in low-resolution experiments. The computations take account of the three-dimensional arrangements of nucleotides and amino acids found in crystal structures of DNA with the two proteins, the natural rest state and deformational properties of protein-free DNA, and the constraints on looping imposed by the conformation of the repressor and the orientation of bound DNA. The predicted looping propensities capture the complex, chain-length-dependent variation in repression efficacy extracted from gene expression studies and in vitro experiments and reveal unexpected chain-length-dependent variations in the uptake of HU, the deformation of repressor, and the folding of DNA. Both the opening of repressor and the presence of HU, at levels approximating those found in vivo, enhance the probability of loop formation. HU affects the global organization of the repressor and the opening of repressor influences the levels of HU binding to DNA. The length of the loop determines whether the DNA adopts antiparallel or parallel orientations on the repressor, whether the repressor is opened or closed, and how many HU molecules bind to the loop. The collective behavior of proteins and DNA is greater than the sum of the parts and hints of ways in which multiple proteins may coordinate the packaging and processing of genetic information.

  14. The Essential yhcSR Two-Component Signal Transduction System Directly Regulates the lac and opuCABCD Operons of Staphylococcus aureus

    Science.gov (United States)

    Yan, Meiying; Hall, Jeffrey W.; Yang, Junshu; Ji, Yinduo

    2012-01-01

    Our previous studies suggested that the essential two-component signal transduction system, YhcSR, regulates the opuCABCD operon at the transcriptional level, and the Pspac-driven opuCABCD partially complements the lethal effects of yhcS antisense RNA expression in Staphylococcus aureus. However, the reason why yhcSR regulon is required for growth is still unclear. In this report, we present that the lac and opuC operons are directly transcriptionally regulated by YhcSR. Using real-time RT-PCR we showed that the down-regulation of yhcSR expression affected the transcription of lacA encoding galactose-6-phosphotase isomerase subunit LacA, and opuCA encoding a subunit of a glycine betaine/carnitine/choline ABC transporter. Promoter-lux reporter fusion studies further confirmed the transcriptional regulation of lac by YhcSR. Gel shift assays revealed that YhcR binds to the promoter regions of the lac and opuC operons. Moreover, the Pspac-driven lacABC expression in trans was able to partially complement the lethal effect of induced yhcS antisense RNA. Likewise, the Pspac-driven opuCABCD expression in trans complemented the growth defect of S. aureus in a high osmotic strength medium during the depletion of YhcSR. Taken together, the above data indicate that the yhcSR system directly regulates the expression of lac and opuC operons, which, in turn, may be partially associated with the essentiality of yhcSR in S. aureus. These results provide a new insight into the biological functions of the yhcSR, a global regulator. PMID:23226327

  15. The essential yhcSR two-component signal transduction system directly regulates the lac and opuCABCD operons of Staphylococcus aureus.

    Directory of Open Access Journals (Sweden)

    Meiying Yan

    Full Text Available Our previous studies suggested that the essential two-component signal transduction system, YhcSR, regulates the opuCABCD operon at the transcriptional level, and the Pspac-driven opuCABCD partially complements the lethal effects of yhcS antisense RNA expression in Staphylococcus aureus. However, the reason why yhcSR regulon is required for growth is still unclear. In this report, we present that the lac and opuC operons are directly transcriptionally regulated by YhcSR. Using real-time RT-PCR we showed that the down-regulation of yhcSR expression affected the transcription of lacA encoding galactose-6-phosphotase isomerase subunit LacA, and opuCA encoding a subunit of a glycine betaine/carnitine/choline ABC transporter. Promoter-lux reporter fusion studies further confirmed the transcriptional regulation of lac by YhcSR. Gel shift assays revealed that YhcR binds to the promoter regions of the lac and opuC operons. Moreover, the Pspac-driven lacABC expression in trans was able to partially complement the lethal effect of induced yhcS antisense RNA. Likewise, the Pspac-driven opuCABCD expression in trans complemented the growth defect of S. aureus in a high osmotic strength medium during the depletion of YhcSR. Taken together, the above data indicate that the yhcSR system directly regulates the expression of lac and opuC operons, which, in turn, may be partially associated with the essentiality of yhcSR in S. aureus. These results provide a new insight into the biological functions of the yhcSR, a global regulator.

  16. The extent of co-metabolism of glucose and galactose by L. lactis changes with the expression of the lacSZ operon from Streptococcus thermophilus

    DEFF Research Database (Denmark)

    Solem, Christian; Købmann, Brian Jensen; Jensen, Peter Ruhdal

    2008-01-01

    and only glucose was metabolized in glycolysis. Interestingly, strains with low expression of the operon showed a mixed acid metabolism and co-metabolism of galactose and glucose. The lactose flux increased gradually with increasing expression of the lacSZ operon until an optimum was observed...... indicates that lactose transport is not rate-limiting for glycolysis in Loctococcus. Finally, an additional ATP drain was introduced into the fastest growing strain, CS2004, to test whether the ATP demand controlled glycolysis under these conditions, but in fact no increase in glycolytic flux was observed...

  17. Statistical analysis of the spatial distribution of operons in the transcriptional regulation network of Escherichia coli

    OpenAIRE

    Warren, P. B.; Wolde, P.R. ten

    2003-01-01

    We have performed a statistical analysis of the spatial distribution of operons in the transcriptional regulation network of Escherichia coli. The analysis reveals that operons that regulate each other and operons that are coregulated tend to lie next to each other on the genome. Moreover, these pairs of operons tend to be transcribed in diverging directions. This spatial arrangement of operons allows the upstream regulatory regions to interfere with each other. This affords additional regula...

  18. Identification of an intestine-specific promoter and inducible expression of bacterial α-galactosidase in mammalian cells by a lac operon system

    Directory of Open Access Journals (Sweden)

    Ya-Feng Zhai

    2012-10-01

    Full Text Available Abstract Background α-galactosidase has been widely used in animal husbandry to reduce anti-nutritional factors (such as α-galactoside in feed. Intestine-specific and substrate inducible expression of α-galactosidase would be highly beneficial for transgenic animal production. Methods To achieve the intestine-specific and substrate inducible expression of α-galactosidase, we first identified intestine-specific promoters by comparing the transcriptional activity and tissue specificity of four intestine-specific promoters from human intestinal fatty acid binding protein, rat intestinal fatty acid binding protein, human mucin-2 and human lysozyme. We made two chimeric constructs combining the promoter and enhancer of human mucin-2, rat intestinal trefoil factor and human sucrase-isomaltase. Then a modified lac operon system was constructed to investigate the induction of α-galactosidase expression and enzyme activity by isopropyl β-D-1-thiogalactopyranoside (IPTG and an α-galactosidase substrate, α-lactose. We declared that the research carried out on human (Zhai Yafeng was in compliance with the Helsinki Declaration, and experimental research on animals also followed internationally recognized guidelines. Results The activity of the human mucin-2 promoter was about 2 to 3 times higher than that of other intestine-specific promoters. In the lac operon system, the repressor significantly decreased (P P Conclusions We have successfully constructed a high specificity inducible lac operon system in an intestine-derived cell line, which could be of great value for gene therapy applications and transgenic animal production.

  19. Artificial control of nitrate respiration through the lac promoter permits the assessment of oxygen-mediated posttranslational regulation of the nar operon in Pseudomonas aeruginosa.

    Science.gov (United States)

    Noriega, Chris E; Sharma, Vandana; Rowe, John J

    2007-09-01

    In this study, oxygen and nitrate regulation of transcription and subsequent protein expression of the unique narK1K2GHJI respiratory operon of Pseudomonas aeruginosa were investigated. Under the control of PLAC, P. aeruginosa was able to transcribe nar and subsequently express methyl viologen-linked nitrate reductase activity under aerobic conditions without nitrate. Modulation of PLAC through the LacI repressor enabled us to assess both transcriptional and posttranslational regulation by oxygen during physiological whole-cell nitrate reduction.

  20. Deterministic and stochastic simulation and analysis of biochemical reaction networks the lactose operon example.

    Science.gov (United States)

    Yildirim, Necmettin; Kazanci, Caner

    2011-01-01

    A brief introduction to mathematical modeling of biochemical regulatory reaction networks is presented. Both deterministic and stochastic modeling techniques are covered with examples from enzyme kinetics, coupled reaction networks with oscillatory dynamics and bistability. The Yildirim-Mackey model for lactose operon is used as an example to discuss and show how deterministic and stochastic methods can be used to investigate various aspects of this bacterial circuit. © 2011 Elsevier Inc. All rights reserved.

  1. Teaching the Big Ideas of Biology with Operon Models

    Science.gov (United States)

    Cooper, Robert A.

    2015-01-01

    This paper presents an activity that engages students in model-based reasoning, requiring them to predict the behavior of the trp and lac operons under different environmental conditions. Students are presented six scenarios for the "trp" operon and five for the "lac" operon. In most of the scenarios, specific mutations have…

  2. Protein distributions from a stochastic model of the lac operon of E. coli with DNA looping: analytical solution and comparison with experiments.

    Directory of Open Access Journals (Sweden)

    Krishna Choudhary

    Full Text Available Although noisy gene expression is widely accepted, its mechanisms are subjects of debate, stimulated largely by single-molecule experiments. This work is concerned with one such study, in which Choi et al., 2008, obtained real-time data and distributions of Lac permease in E. coli. They observed small and large protein bursts in strains with and without auxiliary operators. They also estimated the size and frequency of these bursts, but these were based on a stochastic model of a constitutive promoter. Here, we formulate and solve a stochastic model accounting for the existence of auxiliary operators and DNA loops. We find that DNA loop formation is so fast that small bursts are averaged out, making it impossible to extract their size and frequency from the data. In contrast, we can extract not only the size and frequency of the large bursts, but also the fraction of proteins derived from them. Finally, the proteins follow not the negative binomial distribution, but a mixture of two distributions, which reflect the existence of proteins derived from small and large bursts.

  3. Interplay of gene expression noise and ultrasensitive dynamics affects bacterial operon organization.

    Science.gov (United States)

    Ray, J Christian J; Igoshin, Oleg A

    2012-01-01

    Bacterial chromosomes are organized into polycistronic cotranscribed operons, but the evolutionary pressures maintaining them are unclear. We hypothesized that operons alter gene expression noise characteristics, resulting in selection for or against maintaining operons depending on network architecture. Mathematical models for 6 functional classes of network modules showed that three classes exhibited decreased noise and 3 exhibited increased noise with same-operon cotranscription of interacting proteins. Noise reduction was often associated with a decreased chance of reaching an ultrasensitive threshold. Stochastic simulations of the lac operon demonstrated that the predicted effects of transcriptional coupling hold for a complex network module. We employed bioinformatic analysis to find overrepresentation of noise-minimizing operon organization compared with randomized controls. Among constitutively expressed physically interacting protein pairs, higher coupling frequencies appeared at lower expression levels, where noise effects are expected to be dominant. Our results thereby suggest an important role for gene expression noise, in many cases interacting with an ultrasensitive switch, in maintaining or selecting for operons in bacterial chromosomes.

  4. Interplay of gene expression noise and ultrasensitive dynamics affects bacterial operon organization.

    Directory of Open Access Journals (Sweden)

    J Christian J Ray

    Full Text Available Bacterial chromosomes are organized into polycistronic cotranscribed operons, but the evolutionary pressures maintaining them are unclear. We hypothesized that operons alter gene expression noise characteristics, resulting in selection for or against maintaining operons depending on network architecture. Mathematical models for 6 functional classes of network modules showed that three classes exhibited decreased noise and 3 exhibited increased noise with same-operon cotranscription of interacting proteins. Noise reduction was often associated with a decreased chance of reaching an ultrasensitive threshold. Stochastic simulations of the lac operon demonstrated that the predicted effects of transcriptional coupling hold for a complex network module. We employed bioinformatic analysis to find overrepresentation of noise-minimizing operon organization compared with randomized controls. Among constitutively expressed physically interacting protein pairs, higher coupling frequencies appeared at lower expression levels, where noise effects are expected to be dominant. Our results thereby suggest an important role for gene expression noise, in many cases interacting with an ultrasensitive switch, in maintaining or selecting for operons in bacterial chromosomes.

  5. Isolation and characterization of the lacA gene encoding beta-galactosidase in Bacillus subtilis and a regulator gene, lacR.

    Science.gov (United States)

    Daniel, R A; Haiech, J; Denizot, F; Errington, J

    1997-09-01

    We have isolated transposon insertions in the lacA gene encoding an endogenous beta-galactosidase of Bacillus subtilis. Upstream of the putative operon containing lacA is a negative regulator, lacR, which encodes a product related to a family of regulators that includes the lactose repressor, lacI, of Escherichia coli. New strains with insertions in the lacA gene should be of use in studies using lacZ fusions in B. subtilis.

  6. Isolation and characterization of the lacA gene encoding beta-galactosidase in Bacillus subtilis and a regulator gene, lacR.

    OpenAIRE

    Daniel, R A; Haiech, J; Denizot, F; Errington, J

    1997-01-01

    We have isolated transposon insertions in the lacA gene encoding an endogenous beta-galactosidase of Bacillus subtilis. Upstream of the putative operon containing lacA is a negative regulator, lacR, which encodes a product related to a family of regulators that includes the lactose repressor, lacI, of Escherichia coli. New strains with insertions in the lacA gene should be of use in studies using lacZ fusions in B. subtilis.

  7. The cyanase operon and cyanate metabolism.

    Science.gov (United States)

    Anderson, P M; Sung, Y C; Fuchs, J A

    1990-12-01

    Cyanase is an inducible enzyme in E. coli that catalyzes bicarbonate-dependent decomposition of cyanate. It is encoded as part of an operon we have named the cyn operon, which includes three genes in the following order: cynT (cyanate permease), cynS (cyanase), and cynX (protein of unknown function). The direction of transcription is opposite to that of the lac operon, and the 3'-end of the cyn operon overlaps the 3'-end of the lac operon by 98 nucleotides. The gene cynR (regulatory protein) is located upstream from the cyn operon, and its transcription is opposite that of the cyn operon. The genes of the cyn operon and the cynR gene have been cloned, sequenced and over-expressed. Cyanate at concentrations of about 1 mM is toxic to strains of E. coli lacking the cyanase gene, but strains in which the inducible gene for cyanase is present can grow on cyanate as the sole source of nitrogen at concentrations as high as 20 mM. The presence of cyanase itself is not sufficient to overcome cyanate toxicity--the permease must also be present. Strains lacking the cyanase gene, but having a functional permease gene, are extremely sensitive to cyanate. Uptake of cyanate involves the product of the permease gene in an energy-dependent process. It appears that the cyn operon has evolved to function in detoxification/decomposition of cyanate arising from both intra- and extracellular sources.

  8. Operon prediction in Pyrococcus furiosus

    OpenAIRE

    Tran, Thao T.; Dam, Phuongan; Su, Zhengchang; Poole, Farris L.; Adams, Michael W.W.; Zhou, G. Tong; Xu, Ying

    2006-01-01

    Identification of operons in the hyperthermophilic archaeon Pyrococcus furiosus represents an important step to understanding the regulatory mechanisms that enable the organism to adapt and thrive in extreme environments. We have predicted operons in P.furiosus by combining the results from three existing algorithms using a neural network (NN). These algorithms use intergenic distances, phylogenetic profiles, functional categories and gene-order conservation in their operon prediction. Our me...

  9. A single mutation in the core domain of the lac repressor reduces leakiness

    NARCIS (Netherlands)

    Gatti-Lafranconi, Pietro; Dijkman, Willem; Devenish, Sean RA; Hollfelder, Florian

    2013-01-01

    The lac operon provides cells with the ability to switch from glucose to lactose metabolism precisely when necessary. This metabolic switch is mediated by the lac repressor (LacI), which in the absence of lactose binds to the operator DNA sequence to inhibit transcription. Allosteric rearrangements

  10. LacR Is a Repressor of lacABCD and LacT Is an Activator of lacTFEG, Constituting the lac Gene Cluster in Streptococcus pneumoniae

    NARCIS (Netherlands)

    Afzal, Muhammad; Shafeeq, Sulman; Kuipers, Oscar P.

    Comparison of the transcriptome of Streptococcus pneumoniae strain D39 grown in the presence of either lactose or galactose with that of the strain grown in the presence of glucose revealed the elevated expression of various genes and operons, including the lac gene cluster, which is organized into

  11. Detecting uber-operons in prokaryotic genomes.

    Science.gov (United States)

    Che, Dongsheng; Li, Guojun; Mao, Fenglou; Wu, Hongwei; Xu, Ying

    2006-01-01

    We present a study on computational identification of uber-operons in a prokaryotic genome, each of which represents a group of operons that are evolutionarily or functionally associated through operons in other (reference) genomes. Uber-operons represent a rich set of footprints of operon evolution, whose full utilization could lead to new and more powerful tools for elucidation of biological pathways and networks than what operons have provided, and a better understanding of prokaryotic genome structures and evolution. Our prediction algorithm predicts uber-operons through identifying groups of functionally or transcriptionally related operons, whose gene sets are conserved across the target and multiple reference genomes. Using this algorithm, we have predicted uber-operons for each of a group of 91 genomes, using the other 90 genomes as references. In particular, we predicted 158 uber-operons in Escherichia coli K12 covering 1830 genes, and found that many of the uber-operons correspond to parts of known regulons or biological pathways or are involved in highly related biological processes based on their Gene Ontology (GO) assignments. For some of the predicted uber-operons that are not parts of known regulons or pathways, our analyses indicate that their genes are highly likely to work together in the same biological processes, suggesting the possibility of new regulons and pathways. We believe that our uber-operon prediction provides a highly useful capability and a rich information source for elucidation of complex biological processes, such as pathways in microbes. All the prediction results are available at our Uber-Operon Database: http://csbl.bmb.uga.edu/uber, the first of its kind.

  12. The Energy Landscape of Hyperstable LacI-DNA Loops

    Science.gov (United States)

    Kahn, Jason

    2009-03-01

    The Escherichia coli LacI protein represses transcription of the lac operon by blocking access to the promoter through binding at a promoter-proximal DNA operator. The affinity of tetrameric LacI (and therefore the repression efficiency) is enhanced by simultaneous binding to an auxiliary operator, forming a DNA loop. Hyperstable LacI-DNA loops were previously shown to be formed on DNA constructs that include a sequence-directed bend flanked by operators. Biochemical experiments showed that two such constructs (9C14 and 11C12) with different helical phasing between the operators and the DNA bend form different DNA loop shapes. The geometry and topology of the loops and the relevance of alternative conformations suggested by probable flexible linkers in LacI remain unclear. Bulk and single molecule fluorescence resonance energy transfer (SM-FRET, with D. English) experiments on a dual fluorophore-labeled 9C14-LacI loop demonstrate that it adopts a single, stable, rigid closed-form loop conformation. Here, we characterize the LacI-9C14 loop by SM-FRET as a function of inducer isopropyl-β,D-thiogalactoside (IPTG) concentration. Energy transfer measurements reveal partial but incomplete destabilization of loop formation by IPTG. Surprisingly, there is no change in the energy transfer efficiency of the remaining looped population. Models for the regulation of the lac operon often assume complete disruption of LacI-operator complexes upon inducer binding to LacI. Our work shows that even at saturating IPTG there is still a significant population of LacI-DNA complexes in a looped state, in accord with previous in vivo experiments that show incomplete induction (with J. Maher). Finally, we will report progress on characterizing the ``energy landscape'' for DNA looping upon systematic variation of the DNA linkers between the operators and the bending locus. Rod mechanics simulations (with N. Perkins) provide testable predictions on loop stability, topology, and FRET.

  13. Binary particle swarm optimization for operon prediction.

    Science.gov (United States)

    Chuang, Li-Yeh; Tsai, Jui-Hung; Yang, Cheng-Hong

    2010-07-01

    An operon is a fundamental unit of transcription and contains specific functional genes for the construction and regulation of networks at the entire genome level. The correct prediction of operons is vital for understanding gene regulations and functions in newly sequenced genomes. As experimental methods for operon detection tend to be nontrivial and time consuming, various methods for operon prediction have been proposed in the literature. In this study, a binary particle swarm optimization is used for operon prediction in bacterial genomes. The intergenic distance, participation in the same metabolic pathway, the cluster of orthologous groups, the gene length ratio and the operon length are used to design a fitness function. We trained the proper values on the Escherichia coli genome, and used the above five properties to implement feature selection. Finally, our study used the intergenic distance, metabolic pathway and the gene length ratio property to predict operons. Experimental results show that the prediction accuracy of this method reached 92.1%, 93.3% and 95.9% on the Bacillus subtilis genome, the Pseudomonas aeruginosa PA01 genome and the Staphylococcus aureus genome, respectively. This method has enabled us to predict operons with high accuracy for these three genomes, for which only limited data on the properties of the operon structure exists.

  14. Development of a "Lac" Operon Concept Inventory (LOCI)

    Science.gov (United States)

    Stefanski, Katherine M.; Gardner, Grant E.; Seipelt-Thiemann, Rebecca L.

    2016-01-01

    Concept inventories (CIs) are valuable tools for educators that assess student achievement and identify misconceptions held by students. Results of student responses can be used to adjust or develop new instructional methods for a given topic. The regulation of gene expression in both prokaryotes and eukaryotes is an important concept in genetics…

  15. Mapping DNA-Lac repressor interaction with ultra-fast optical tweezers

    Science.gov (United States)

    Monico, Carina; Tempestini, Alessia; Vanzi, Francesco; Pavone, Francesco S.; Capitanio, Marco

    2015-03-01

    The lac operon is a well-known example of gene expression regulation, based on the specific interaction of Lac repressor protein (LacI) with its target DNA sequence (operator). We recently developed an ultrafast force-clamp laser trap technique capable of probing molecular interactions with sub-ms temporal resolution, under controlled pN-range forces. With this technique, we tested the interaction of LacI with different DNA constructs. Based on position along the DNA sequence, the observed interactions can be interpreted as specific binding to operator sequences and transient interactions with nonspecific sequences.

  16. The use of lac-type promoters in control analysis

    DEFF Research Database (Denmark)

    Jensen, Peter Ruhdal; Westerhoff, H. v.; Michelsen, Ole

    1993-01-01

    , the tacI promoter when the latter is high. The endogenous lac operon is placed under the control of a second copy of the lacUV5 promoter and a lacYam mutation (eliminating lactose permease, the transport system for the inducer isopropyl-thio-beta-D-galactoside) is introduced. The method was demonstrated...... the wild-type level. Thus, in the absence of inducer, no expression of atp genes could be detected when the atp operon was controlled by the lacUV5 promoter, and we estimate that the expression was less than 0.0025 times the wild-type level. We show that the introduction of a lac Y mutation facilitated...... the attainment of steady induction levels of partially induced cells. The mutation also reduced positive cooperativity in the dependence of expression on the concentration of isopropyl-thio-beta-D-galactoside (the inducer) and shifted the concentration of inducer needed for half maximum induction to higher...

  17. Transcriptome dynamics-based operon prediction in prokaryotes.

    Science.gov (United States)

    Fortino, Vittorio; Smolander, Olli-Pekka; Auvinen, Petri; Tagliaferri, Roberto; Greco, Dario

    2014-05-16

    Inferring operon maps is crucial to understanding the regulatory networks of prokaryotic genomes. Recently, RNA-seq based transcriptome studies revealed that in many bacterial species the operon structure vary with the change of environmental conditions. Therefore, new computational solutions that use both static and dynamic data are necessary to create condition specific operon predictions. In this work, we propose a novel classification method that integrates RNA-seq based transcriptome profiles with genomic sequence features to accurately identify the operons that are expressed under a measured condition. The classifiers are trained on a small set of confirmed operons and then used to classify the remaining gene pairs of the organism studied. Finally, by linking consecutive gene pairs classified as operons, our computational approach produces condition-dependent operon maps. We evaluated our approach on various RNA-seq expression profiles of the bacteria Haemophilus somni, Porphyromonas gingivalis, Escherichia coli and Salmonella enterica. Our results demonstrate that, using features depending on both transcriptome dynamics and genome sequence characteristics, we can identify operon pairs with high accuracy. Moreover, the combination of DNA sequence and expression data results in more accurate predictions than each one alone. We present a computational strategy for the comprehensive analysis of condition-dependent operon maps in prokaryotes. Our method can be used to generate condition specific operon maps of many bacterial organisms for which high-resolution transcriptome data is available.

  18. Identification of anthranilate and benzoate metabolic operons of Pseudomonas fluorescens and functional characterization of their promoter regions

    Directory of Open Access Journals (Sweden)

    Lee Vincent D

    2006-01-01

    Full Text Available Abstract Background In an effort to identify alternate recombinant gene expression systems in Pseudomonas fluorescens, we identified genes encoding two native metabolic pathways that were inducible with inexpensive compounds: the anthranilate operon (antABC and the benzoate operon (benABCD. Results The antABC and benABCD operons were identified by homology to the Acinetobacter sp. anthranilate operon and Pseudomonas putida benzoate operon, and were confirmed to be regulated by anthranilate or benzoate, respectively. Fusions of the putative promoter regions to the E. coli lacZ gene were constructed to confirm inducible gene expression. Each operon was found to be controlled by an AraC family transcriptional activator, located immediately upstream of the first structural gene in each respective operon (antR or benR. Conclusion We have found the anthranilate and benzoate promoters to be useful for tightly controlling recombinant gene expression at both small (

  19. Transcriptional Regulation and Evolution of Lactose Genes in the Galactose-Lactose Operon of Lactococcus lactis NCDO2054

    Science.gov (United States)

    Vaughan, Elaine E.; Pridmore, R. David; Mollet, Beat

    1998-01-01

    The genetics of lactose utilization within the slow-lactose-fermenting Lactococcus lactis strain NCDO2054 was studied with respect to the organization, expression, and evolution of the lac genes. Initially the β-galactosidase gene (lacZ) was cloned by complementation of an Escherichia coli mutant on a 7-kb HpaI fragment. Nucleotide sequence analysis of the complete fragment revealed part of a gal-lac operon, and the genes were characterized by inactivation and complementation analyses and in vitro enzyme activity measurements. The gene order is galK-galT-lacA-lacZ-galE; the gal genes encode enzymes of the Leloir pathway for galactose metabolism, and lacA encodes a galactoside acetyltransferase. The galT and galE genes of L. lactis LM0230 (a lactose plasmid-cured derivative of the fast-lactose-fermenting L. lactis C2) were highly similar at the nucleotide sequence level to their counterparts in strain NCDO2054 and, furthermore, had the same gene order except for the presence of the intervening lacA-lacZ strain NCDO2054. Analysis of mRNA for the gal and lac genes revealed an unusual transcriptional organization for the operon, with a surprisingly large number of transcriptional units. The regulation of the lac genes was further investigated by using fusions consisting of putative promoter fragments and the promoterless β-glucuronidase gene (gusA) from E. coli, which identified three lactose-inducible intergenic promoters in the gal-lac operon. The greater similarity of the lacA and lacZ genes to homologs in gram-negative organisms than to those of gram-positive bacteria, in contrast to the homologies of the gal genes, suggests that the genes within the gal operon of L. lactis NCDO2054 have been recently acquired. Thus, the lacA-lacZ genes appear to have engaged the promoters of the gal operon in order to direct and control their expression. PMID:9733693

  20. Natural selection for operons depends on genome size.

    Science.gov (United States)

    Nuñez, Pablo A; Romero, Héctor; Farber, Marisa D; Rocha, Eduardo P C

    2013-01-01

    In prokaryotes, genome size is associated with metabolic versatility, regulatory complexity, effective population size, and horizontal transfer rates. We therefore analyzed the covariation of genome size and operon conservation to assess the evolutionary models of operon formation and maintenance. In agreement with previous results, intraoperonic pairs of essential and of highly expressed genes are more conserved. Interestingly, intraoperonic pairs of genes are also more conserved when they encode proteins at similar cell concentrations, suggesting a role of cotranscription in diminishing the cost of waste and shortfall in gene expression. Larger genomes have fewer and smaller operons that are also less conserved. Importantly, lower conservation in larger genomes was observed for all classes of operons in terms of gene expression, essentiality, and balanced protein concentration. We reached very similar conclusions in independent analyses of three major bacterial clades (α- and β-Proteobacteria and Firmicutes). Operon conservation is inversely correlated to the abundance of transcription factors in the genome when controlled for genome size. This suggests a negative association between the complexity of genetic networks and operon conservation. These results show that genome size and/or its proxies are key determinants of the intensity of natural selection for operon organization. Our data fit better the evolutionary models based on the advantage of coregulation than those based on genetic linkage or stochastic gene expression. We suggest that larger genomes with highly complex genetic networks and many transcription factors endure weaker selection for operons than smaller genomes with fewer alternative tools for genetic regulation.

  1. Stochastic simulations of the tetracycline operon

    Directory of Open Access Journals (Sweden)

    Kaznessis Yiannis N

    2011-01-01

    Full Text Available Abstract Background The tetracycline operon is a self-regulated system. It is found naturally in bacteria where it confers resistance to antibiotic tetracycline. Because of the performance of the molecular elements of the tetracycline operon, these elements are widely used as parts of synthetic gene networks where the protein production can be efficiently turned on and off in response to the presence or the absence of tetracycline. In this paper, we investigate the dynamics of the tetracycline operon. To this end, we develop a mathematical model guided by experimental findings. Our model consists of biochemical reactions that capture the biomolecular interactions of this intriguing system. Having in mind that small biological systems are subjects to stochasticity, we use a stochastic algorithm to simulate the tetracycline operon behavior. A sensitivity analysis of two critical parameters embodied this system is also performed providing a useful understanding of the function of this system. Results Simulations generate a timeline of biomolecular events that confer resistance to bacteria against tetracycline. We monitor the amounts of intracellular TetR2 and TetA proteins, the two important regulatory and resistance molecules, as a function of intrecellular tetracycline. We find that lack of one of the promoters of the tetracycline operon has no influence on the total behavior of this system inferring that this promoter is not essential for Escherichia coli. Sensitivity analysis with respect to the binding strength of tetracycline to repressor and of repressor to operators suggests that these two parameters play a predominant role in the behavior of the system. The results of the simulations agree well with experimental observations such as tight repression, fast gene expression, induction with tetracycline, and small intracellular TetR2 amounts. Conclusions Computer simulations of the tetracycline operon afford augmented insight into the

  2. High accuracy operon prediction method based on STRING database scores.

    Science.gov (United States)

    Taboada, Blanca; Verde, Cristina; Merino, Enrique

    2010-07-01

    We present a simple and highly accurate computational method for operon prediction, based on intergenic distances and functional relationships between the protein products of contiguous genes, as defined by STRING database (Jensen,L.J., Kuhn,M., Stark,M., Chaffron,S., Creevey,C., Muller,J., Doerks,T., Julien,P., Roth,A., Simonovic,M. et al. (2009) STRING 8-a global view on proteins and their functional interactions in 630 organisms. Nucleic Acids Res., 37, D412-D416). These two parameters were used to train a neural network on a subset of experimentally characterized Escherichia coli and Bacillus subtilis operons. Our predictive model was successfully tested on the set of experimentally defined operons in E. coli and B. subtilis, with accuracies of 94.6 and 93.3%, respectively. As far as we know, these are the highest accuracies ever obtained for predicting bacterial operons. Furthermore, in order to evaluate the predictable accuracy of our model when using an organism's data set for the training procedure, and a different organism's data set for testing, we repeated the E. coli operon prediction analysis using a neural network trained with B. subtilis data, and a B. subtilis analysis using a neural network trained with E. coli data. Even for these cases, the accuracies reached with our method were outstandingly high, 91.5 and 93%, respectively. These results show the potential use of our method for accurately predicting the operons of any other organism. Our operon predictions for fully-sequenced genomes are available at http://operons.ibt.unam.mx/OperonPredictor/.

  3. Regulation of endothelial-specific transgene expression by the LacI repressor protein in vivo.

    Directory of Open Access Journals (Sweden)

    Susan K Morton

    Full Text Available Genetically modified mice have played an important part in elucidating gene function in vivo. However, conclusions from transgenic studies may be compromised by complications arising from the site of transgene integration into the genome and, in inducible systems, the non-innocuous nature of inducer molecules. The aim of the present study was to use the vascular system to validate a technique based on the bacterial lac operon system, in which transgene expression can be repressed and de-repressed by an innocuous lactose analogue, IPTG. We have modified an endothelium specific promoter (TIE2 with synthetic LacO sequences and made transgenic mouse lines with this modified promoter driving expression of mutant forms of connexin40 and an independently translated reporter, EGFP. We show that tissue specificity of this modified promoter is retained in the vasculature of transgenic mice in spite of the presence of LacO sequences, and that transgene expression is uniform throughout the endothelium of a range of adult systemic and cerebral arteries and arterioles. Moreover, transgene expression can be consistently down-regulated by crossing the transgenic mice with mice expressing an inhibitor protein LacI(R, and in one transgenic line, transgene expression could be de-repressed rapidly by the innocuous inducer, IPTG. We conclude that the modified bacterial lac operon system can be used successfully to validate transgenic phenotypes through a simple breeding schedule with mice homozygous for the LacI(R protein.

  4. PPO: predictor for prokaryotic operons.

    Science.gov (United States)

    Chuang, Li-Yeh; Tsai, Jui-Hung; Yang, Cheng-Hong

    2010-12-15

    We present an operon predictor for prokaryotic operons (PPO), which can predict operons in the entire prokaryotic genome. The prediction algorithm used in PPO allows the user to select binary particle swarm optimization (BPSO), a genetic algorithm (GA) or some other methods introduced in the literature to predict operons. The operon predictor on our web server and the provided database are easy to access and use. The main features offered are: (i) selection of the prediction algorithm; (ii) adjustable parameter settings of the prediction algorithm; (iii) graphic visualization of results; (iv) integrated database queries; (v) listing of experimentally verified operons; and (vi) related tools. PPO is freely available at http://bio.kuas.edu.tw/PPO/.

  5. Operon structure of Staphylococcus aureus.

    Science.gov (United States)

    ten Broeke-Smits, Nicole J P; Pronk, Tessa E; Jongerius, Ilse; Bruning, Oskar; Wittink, Floyd R; Breit, Timo M; van Strijp, Jos A G; Fluit, Ad C; Boel, C H Edwin

    2010-06-01

    In bacteria, gene regulation is one of the fundamental characteristics of survival, colonization and pathogenesis. Operons play a key role in regulating expression of diverse genes involved in metabolism and virulence. However, operon structures in pathogenic bacteria have been determined only by in silico approaches that are dependent on factors such as intergenic distances and terminator/promoter sequences. Knowledge of operon structures is crucial to fully understand the pathophysiology of infections. Presently, transcriptome data obtained from growth curves in a defined medium were used to predict operons in Staphylococcus aureus. This unbiased approach and the use of five highly reproducible biological replicates resulted in 93.5% significantly regulated genes. These data, combined with Pearson's correlation coefficients of the transcriptional profiles, enabled us to accurately compile 93% of the genome in operon structures. A total of 1640 genes of different functional classes were identified in operons. Interestingly, we found several operons containing virulence genes and showed synergistic effects for two complement convertase inhibitors transcribed in one operon. This is the first experimental approach to fully identify operon structures in S. aureus. It forms the basis for further in vitro regulation studies that will profoundly advance the understanding of bacterial pathophysiology in vivo.

  6. Fundamental relationship between operon organization and gene expression

    Science.gov (United States)

    Lim, Han N.; Lee, Yeong; Hussein, Razika

    2011-01-01

    Half a century has passed since the discovery of operons (groups of genes that are transcribed together as a single mRNA). Despite the importance of operons in bacterial gene networks, the relationship between their organization and gene expression remains poorly understood. Here we show using synthetic operons in Escherichia coli that the expression of a given gene increases with the length of the operon and as its position moves farther from the end of the operon. These findings can be explained by a common mechanism; increasing the distance from the start of a gene to the end of the operon (termed the “transcription distance”) provides more time for translation to occur during transcription, resulting in increased expression. We confirmed experimentally that the increased expression is indeed due to increased translation. Furthermore our analysis indicates the translation initiation rate for an mRNA is sixfold greater during transcription than after its release, which amplifies the impact of the transcription distance on gene expression. As a result of these mechanisms, gene expression increases by ∼40% for each 1,000 nucleotides of transcription distance. In summary, we demonstrate that a fundamental relationship exists between gene expression and the number, length, and order of the genes in an operon. This relationship has important implications for understanding the functional basis of genome organization and practical applications for synthetic biology. PMID:21670266

  7. Operon structure of Staphylococcus aureus

    NARCIS (Netherlands)

    ten Broeke-Smits, N.J.P.; Pronk, T.E.; Jongerius, I.; Bruning, O.; Wittink, F.R.; Breit, T.M.; van Strijp, J.A.G.; Fluit, A.C.; Boel, C.H.E.

    2010-01-01

    In bacteria, gene regulation is one of the fundamental characteristics of survival, colonization and pathogenesis. Operons play a key role in regulating expression of diverse genes involved in metabolism and virulence. However, operon structures in pathogenic bacteria have been determined only by in

  8. Interplay of Noisy Gene Expression and Dynamics Explains Patterns of Bacterial Operon Organization

    Science.gov (United States)

    Igoshin, Oleg

    2011-03-01

    Bacterial chromosomes are organized into operons -- sets of genes co-transcribed into polycistronic messenger RNA. Hypotheses explaining the emergence and maintenance of operons include proportional co-regulation, horizontal transfer of intact ``selfish'' operons, emergence via gene duplication, and co-production of physically interacting proteins to speed their association. We hypothesized an alternative: operons can reduce or increase intrinsic gene expression noise in a manner dependent on the post-translational interactions, thereby resulting in selection for or against operons in depending on the network architecture. We devised five classes of two-gene network modules and show that the effects of operons on intrinsic noise depend on class membership. Two classes exhibit decreased noise with co-transcription, two others reveal increased noise, and the remaining one does not show a significant difference. To test our modeling predictions we employed bioinformatic analysis to determine the relationship gene expression noise and operon organization. The results confirm the overrepresentation of noise-minimizing operon architectures and provide evidence against other hypotheses. Our results thereby suggest a central role for gene expression noise in selecting for or maintaining operons in bacterial chromosomes. This demonstrates how post-translational network dynamics may provide selective pressure for organizing bacterial chromosomes, and has practical consequences for designing synthetic gene networks. This work is supported by National Institutes of Health grant 1R01GM096189-01.

  9. Molecular characterization of lysR-lysXE, gcdR-gcdHG and amaR-amaAB operons for lysine export and catabolism: a comprehensive lysine catabolic network in Pseudomonas aeruginosa PAO1.

    Science.gov (United States)

    Madhuri Indurthi, Sai; Chou, Han-Ting; Lu, Chung-Dar

    2016-05-01

    Among multiple interconnected pathways for l-Lysine catabolism in pseudomonads, it has been reported that Pseudomonas aeruginosa PAO1 employs the decarboxylase and the transaminase pathways. However, up until now, knowledge of several genes involved in operation and regulation of these pathways was still missing. Transcriptome analyses coupled with promoter activity measurements and growth phenotype analyses led us to identify new members in l-Lys and d-Lys catabolism and regulation, including gcdR-gcdHG for glutarate utilization, dpkA, amaR-amaAB and PA2035 for d-Lys catabolism, lysR-lysXE for putative l-Lys efflux and lysP for putative l-Lys uptake. The gcdHG operon encodes an acyl-CoA transferase (gcdG) and glutaryl-CoA dehydrogenase (gcdH) and is under the control of the transcriptional activator GcdR. Growth on l-Lys was enhanced in the mutants of lysX and lysE, supporting the operation of l-Lys efflux. The transcriptional activator LysR is responsible for l-Lys specific induction of lysXE and the PA4181-82 operon of unknown function. The putative operator sites of GcdR and LysR were deduced from serial deletions and comparative genomic sequence analyses, and the formation of nucleoprotein complexes was demonstrated with purified His-tagged GcdR and LysR. The amaAB operon encodes two enzymes to convert pipecolate to 2-aminoadipate. Induction of the amaAB operon by l-Lys, d-Lys and pipecolate requires a functional AmaR, supporting convergence of Lys catabolic pathways to pipecolate. Growth on pipecolate was retarded in the gcdG and gcdH mutants, suggesting the importance of glutarate in pipecolate and 2-aminoadipate utilization. Furthermore, this study indicated links in the control of interconnected networks of lysine and arginine catabolism in P. aeruginosa.

  10. The post-transcriptional operon

    DEFF Research Database (Denmark)

    2011-01-01

    A post-transcriptional operon is a set of monocistronic mRNAs encoding functionally related proteins that are co-regulated by a group of RNA-binding proteins and/or small non-coding RNAs so that protein expression is coordinated at the post-transcriptional level. The post-transcriptional operon...... model (PTO) is used to describe data from an assortment of methods (e.g. RIP-Chip, CLIP-Chip, miRNA profiling, ribosome profiling) that globally address the functionality of mRNA. Several examples of post-transcriptional operons have been documented in the literature and demonstrate the usefulness...

  11. The use of a hands-on model in learning the regulation of an inducible operon and the development of a gene regulation concept inventory

    Science.gov (United States)

    Stefanski, Katherine M.

    A central concept in genetics is the regulation of gene expression. Inducible gene expression is often taught in undergraduate biology courses using the lac operon of Escherichia coli (E. coli ). With national calls for reform in undergraduate biology education and a body of literature that supports the use of active learning techniques including hands-on learning and analogies we were motivated to develop a hands-on analogous model of the lac operon. The model was developed over two iterations and was administered to genetics students. To determine the model's worth as a learning tool a concept inventory (CI) was developed using rigorous protocols. Concept inventories are valuable tools which can be used to assess students' understanding of a topic and pinpoint commonly held misconceptions as well as the value of educational tools. Through in-class testing (n =115) the lac operon concept inventory (LOCI) was demonstrated to be valid, predictive, and reliable (? coefficient = 0.994). LOCI scores for students who participated in the hands-on activity (n = 67) were 7.5% higher (t = -2.281, P operon. We were able to determine the efficacy of the activity and identify misconceptions held by students about the lac operon because of the use of a valid and reliable CI.

  12. Synergic role of the two ars operons in arsenic tolerance in Pseudomonas putida KT2440.

    Science.gov (United States)

    Fernández, Matilde; Udaondo, Zulema; Niqui, José-Luis; Duque, Estrella; Ramos, Juan-Luis

    2014-10-01

    The chromosome of Pseudomonas putida KT2440 carries two clusters of genes, denoted ars1 and ars2, that are annotated as putative arsenic resistance operons. In this work, we present evidence that both operons encode functional arsenic-response regulatory genes as well as arsenic extrusion systems that confer resistance to both arsenite [As(III)] and arsenate [As(V)]. Transcriptional fusions of P(ars1) and P(ars2) to lacZ revealed that expression of both operons was induced by arsenite and arsenate. We generated single mutants in ars1 and ars2, which showed lower resistance to arsenic than the wild-type strain. A double ars1/ars2 was found to be highly sensitive to arsenic. Minimum inhibitory concentrations (MICs) for single mutants decreased two- to fourfold with respect to the parental strain, while in the double mutant the MIC decreased 128-fold for arsenite and 32-fold for arsenate. Bioinformatic analysis revealed that the ars2 resistance operon is part of the core genome of P. putida, while the ars1 operon appears to only occur in the KT2440 strain, suggesting that ars1 was acquired by horizontal gene transfer. The presence of ars1 in KT2440 may explain why it exhibits higher resistance to arsenic than other P. putida strains, which bear only the ars2 operon.

  13. DOOR: a database for prokaryotic operons.

    Science.gov (United States)

    Mao, Fenglou; Dam, Phuongan; Chou, Jacky; Olman, Victor; Xu, Ying

    2009-01-01

    We present a database DOOR (Database for prOkaryotic OpeRons) containing computationally predicted operons of all the sequenced prokaryotic genomes. All the operons in DOOR are predicted using our own prediction program, which was ranked to be the best among 14 operon prediction programs by a recent independent review. Currently, the DOOR database contains operons for 675 prokaryotic genomes, and supports a number of search capabilities to facilitate easy access and utilization of the information stored in it. (1) Querying the database: the database provides a search capability for a user to find desired operons and associated information through multiple querying methods. (2) Searching for similar operons: the database provides a search capability for a user to find operons that have similar composition and structure to a query operon. (3) Prediction of cis-regulatory motifs: the database provides a capability for motif identification in the promoter regions of a user-specified group of possibly coregulated operons, using motif-finding tools. (4) Operons for RNA genes: the database includes operons for RNA genes. (5) OperonWiki: the database provides a wiki page (OperonWiki) to facilitate interactions between users and the developer of the database. We believe that DOOR provides a useful resource to many biologists working on bacteria and archaea, which can be accessed at http://csbl1.bmb.uga.edu/OperonDB.

  14. The life-cycle of operons.

    Science.gov (United States)

    Price, Morgan N; Arkin, Adam P; Alm, Eric J

    2006-06-01

    Operons are a major feature of all prokaryotic genomes, but how and why operon structures vary is not well understood. To elucidate the life-cycle of operons, we compared gene order between Escherichia coli K12 and its relatives and identified the recently formed and destroyed operons in E. coli. This allowed us to determine how operons form, how they become closely spaced, and how they die. Our findings suggest that operon evolution may be driven by selection on gene expression patterns. First, both operon creation and operon destruction lead to large changes in gene expression patterns. For example, the removal of lysA and ruvA from ancestral operons that contained essential genes allowed their expression to respond to lysine levels and DNA damage, respectively. Second, some operons have undergone accelerated evolution, with multiple new genes being added during a brief period. Third, although genes within operons are usually closely spaced because of a neutral bias toward deletion and because of selection against large overlaps, genes in highly expressed operons tend to be widely spaced because of regulatory fine-tuning by intervening sequences. Although operon evolution may be adaptive, it need not be optimal: new operons often comprise functionally unrelated genes that were already in proximity before the operon formed.

  15. The Life-cycle of Operons

    Energy Technology Data Exchange (ETDEWEB)

    Price, Morgan N.; Arkin, Adam P.; Alm, Eric J.

    2005-11-18

    Operons are a major feature of all prokaryotic genomes, but how and why operon structures vary is not well understood. To elucidate the life-cycle of operons, we compared gene order between Escherichia coli K12 and its relatives and identified the recently formed and destroyed operons in E. coli. This allowed us to determine how operons form, how they become closely spaced, and how they die. Our findings suggest that operon evolution is driven by selection on gene expression patterns. First, both operon creation and operon destruction lead to large changes in gene expression patterns. For example, the removal of lysA and ruvA from ancestral operons that contained essential genes allowed their expression to respond to lysine levels and DNA damage, respectively. Second, some operons have undergone accelerated evolution, with multiple new genes being added during a brief period. Third, although most operons are closely spaced because of a neutral bias towards deletion and because of selection against large overlaps, highly expressed operons tend to be widely spaced because of regulatory fine-tuning by intervening sequences. Although operon evolution seems to be adaptive, it need not be optimal: new operons often comprise functionally unrelated genes that were already in proximity before the operon formed.

  16. Computational analysis of Ciona intestinalis operons.

    Science.gov (United States)

    Zeller, Robert W

    2010-07-01

    Operons are clusters of genes that are co-regulated from a common promoter. Operons are typically associated with prokaryotes, although a small number of eukaryotes have been shown to possess them. Among metazoans, operons have been extensively characterized in the nematode Caenorhabditis elegans in which ∼15% of the total genes are organized into operons. The most recent genome assembly for the ascidian Ciona intestinalis placed ∼20% of the genes (2909 total) into 1310 operons. The majority of these operons are composed of two genes, while the largest are composed of six. Here is reported a computational analysis of the genes that comprise the Ciona operons. Gene ontology (GO) terms were identified for about two-thirds of the operon-encoded genes. Using the extensive collection of public EST libraries, estimates of temporal patterns of gene expression were generated for the operon-encoded genes. Lastly, conservation of operons was analyzed by determining how many operon-encoded genes were present in the ascidian Ciona savignyi and whether these genes were organized in orthologous operons. Over 68% of the operon-encoded genes could be assigned one or more GO terms and 697 of the 1310 operons contained genes in which all genes had at least one GO term. Of these 697 operons, GO terms were shared by all of the genes within 146 individual operons, suggesting that most operons encode genes with unrelated functions. An analysis of operon gene expression from nine different EST libraries indicated that for 587 operons, all of the genes that comprise an individual operon were expressed together in at least one EST library, suggesting that these genes may be co-regulated. About 50% (74/146) of the operons with shared GO terms also showed evidence of gene co-regulation. Comparisons with the C. savignyi genome identified orthologs for 1907 of 2909 operon genes. About 38% (504/1310) of the operons are conserved between the two Ciona species. These results suggest that like

  17. Investigating Evolutionary Dynamics of RHA1 Operons.

    Science.gov (United States)

    Chen, Yong; Geng, Dandan; Ehrhardt, Kristina; Zhang, Shaoqiang

    2016-01-01

    Grouping genes as operons is an important genomic feature of prokaryotic organisms. The comprehensive understanding of the operon organizations would be helpful to decipher transcriptional mechanisms, cellular pathways, and the evolutionary landscape of prokaryotic genomes. Although thousands of prokaryotes have been sequenced, genome-wide investigation of the evolutionary dynamics (division and recombination) of operons among these genomes remains unexplored. Here, we systematically analyzed the operon dynamics of Rhodococcus jostii RHA1 (RHA1), an oleaginous bacterium with high potential applications in biofuel, by comparing 340 prokaryotic genomes that were carefully selected from different genera. Interestingly, 99% of RHA1 operons were observed to exhibit evolutionary events of division and recombination among the 340 compared genomes. An operon that encodes all enzymes related to histidine biosynthesis in RHA1 (His-operon) was found to be segmented into smaller gene groups (sub-operons) in diverse genomes. These sub-operons were further reorganized with different functional genes as novel operons that are related to different biochemical processes. Comparatively, the operons involved in the functional categories of lipid transport and metabolism are relatively conserved among the 340 compared genomes. At the pathway level, RHA1 operons found to be significantly conserved were involved in ribosome synthesis, oxidative phosphorylation, and fatty acid synthesis. These analyses provide evolutionary insights of operon organization and the dynamic associations of various biochemical pathways in different prokaryotes.

  18. Investigating Evolutionary Dynamics of RHA1 Operons

    OpenAIRE

    Yong Chen; Dandan Geng; Kristina Ehrhardt; Shaoqiang Zhang

    2016-01-01

    Grouping genes as operons is an important genomic feature of prokaryotic organisms. The comprehensive understanding of the operon organizations would be helpful to decipher transcriptional mechanisms, cellular pathways, and the evolutionary landscape of prokaryotic genomes. Although thousands of prokaryotes have been sequenced, genome-wide investigation of the evolutionary dynamics (division and recombination) of operons among these genomes remains unexplored. Here, we systematically analyzed...

  19. The Life-cycle of Operons

    Energy Technology Data Exchange (ETDEWEB)

    Price, Morgan N.; Arkin, Adam P.; Alm, Eric J.

    2007-03-15

    Operons are a major feature of all prokaryotic genomes, buthow and why operon structures vary is not well understood. To elucidatethe life-cycle of operons, we compared gene order between Escherichiacoli K12 and its relatives and identified the recently formed anddestroyed operons in E. coli. This allowed us to determine how operonsform, how they become closely spaced, and how they die. Our findingssuggest that operon evolution may be driven by selection on geneexpression patterns. First, both operon creation and operon destructionlead to large changes in gene expression patterns. For example, theremoval of lysA and ruvA from ancestral operons that contained essentialgenes allowed their expression to respond to lysine levels and DNAdamage, respectively. Second, some operons have undergone acceleratedevolution, with multiple new genes being added during a brief period.Third, although genes within operons are usually closely spaced becauseof a neutral bias toward deletion and because of selection against largeoverlaps, genes in highly expressed operons tend to be widely spacedbecause of regulatory fine-tuning by intervening sequences. Althoughoperon evolution may be adaptive, it need not be optimal: new operonsoften comprise functionally unrelated genes that were already inproximity before the operon formed.

  20. Problem-Solving Test: Tryptophan Operon Mutants

    Science.gov (United States)

    Szeberenyi, Jozsef

    2010-01-01

    This paper presents a problem-solving test that deals with the regulation of the "trp" operon of "Escherichia coli." Two mutants of this operon are described: in mutant A, the operator region of the operon carries a point mutation so that it is unable to carry out its function; mutant B expresses a "trp" repressor protein unable to bind…

  1. Characterization of the cyn operon in Escherichia coli K12.

    Science.gov (United States)

    Sung, Y C; Fuchs, J A

    1988-10-15

    Escherichia coli can overcome the toxicity of environmental cyanate by hydrolysis of cyanate to ammonia and bicarbonate. This reaction is catalyzed by the enzyme cyanase, encoded by the cynS gene. The nucleotide sequence of cynS has been reported (Sung, Y.-c., Anderson, P. M., and Fuchs, J. A. (1987) J. Bacteriol. 169, 5224-5230). The nucleotide sequence of the complete cyn operon has now been determined. The cyn operon is approximately 2600 base pairs and includes cynT, cynS, and cynX, which encode cyanate permease, cyanase, and a protein of unknown function, respectively. Two cyanate-inducible transcripts of 1500 and 2500 nucleotides, respectively, were detected by Northern blot analysis. S1 nuclease mapping experiments indicated that two different cyn mRNAs have a common 5'-end and two different 3'-ends. One 3'-end was located within the coding region of cynX, whereas the other 3'-end includes the entire DNA sequence of cynX. The longer transcript contained 98 nucleotides complementary to lac mRNA produced by the predominant lac transcription termination sequence. Termination vectors were used to show that both 3'-ends were generated by sequences that caused transcriptional termination in vivo. Expression vectors were used to demonstrate that a protein corresponding to the expected size was synthesized from the DNA fragment containing the open reading frame designated cynX. The predicted amino acid sequence of cynX indicates that it is a very hydrophobic protein. The level of cynX expression was significantly less than that of cynT or cynS expression.

  2. [Deletion of spoIVF operon affects the sporulation and the production of crystal in Bacillus thuringiensis G03].

    Science.gov (United States)

    Sun, Chang-po; Song, Fu-ping; Zhang, Jie; Huang, Da-fang

    2007-08-01

    The spoIVF operon exists in Bacillus universally. Two proteins encoded by the spoIVF operon are essential for the sporulation of Bacillus subtilis. In this study, a spoIVF operon disruption mutant G03 (spoIVF-), in which the spoIVF operon was deleted, was constructed by homologous recombination. The result showed that the mutant strain lost the ability of sporulation. At the same time, the expression of Insecticidal Crystal Protein (ICP) was severely reduced in G03 (spoIVF-) mutant strain and resulted in no crystals. The lacZ gene was fused with the promoter of the cry1Aa gene and expressed in mutant strain G03 (spoIVF-) and G03 wild strain. The activity of beta-galactosidase much lower in mutant G03 (spoIVF-) strain than in the wild-type strain. This further suggested that the activity of sigmaE and sigmaK factors was affected in mutant G03 (spoIVF-) strain. The ability of sporulation and production of Insecticide Crystal Protein was complemented by the expression of spoIVF operon through the vector of pSTK in the mutant strain. In all, The spoIVF operon is essential for the sporulation and the expression of cry gene controlled by sigmaE and sigmaK factors.

  3. ODB: a database of operons accumulating known operons across multiple genomes.

    Science.gov (United States)

    Okuda, Shujiro; Katayama, Toshiaki; Kawashima, Shuichi; Goto, Susumu; Kanehisa, Minoru

    2006-01-01

    Operon structures play an important role in co-regulation in prokaryotes. Although over 200 complete genome sequences are now available, databases providing genome-wide operon information have been limited to certain specific genomes. Thus, we have developed an ODB (Operon DataBase), which provides a data retrieval system of known operons among the many complete genomes. Additionally, putative operons that are conserved in terms of known operons are also provided. The current version of our database contains about 2000 known operon information in more than 50 genomes and about 13 000 putative operons in more than 200 genomes. This system integrates four types of associations: genome context, gene co-expression obtained from microarray data, functional links in biological pathways and the conservation of gene order across the genomes. These associations are indicators of the genes that organize an operon, and the combination of these indicators allows us to predict more reliable operons. Furthermore, our system validates these predictions using known operon information obtained from the literature. This database integrates known literature-based information and genomic data. In addition, it provides an operon prediction tool, which make the system useful for both bioinformatics researchers and experimental biologists. Our database is accessible at http://odb.kuicr.kyoto-u.ac.jp/.

  4. REMap: Operon Map of M. tuberculosis

    Science.gov (United States)

    Xia, Fang Fang; Stevens, Rick L.; Bishai, William R.; Lamichhane, Gyanu

    2016-01-01

    A map of the transcriptional organization of genes of an organism is a basic tool that is necessary to understand and facilitate a more accurate genetic manipulation of the organism. Operon maps are largely generated by computational prediction programs that rely on gene conservation and genome architecture and may not be physiologically relevant. With the widespread use of RNA sequencing (RNAseq), the prediction of operons based on actual transcriptome sequencing rather than computational genomics alone is much needed. Here, we report a validated operon map of Mycobacterium tuberculosis, developed using RNAseq data from both the exponential and stationary phases of growth. At least 58.4% of M. tuberculosis genes are organized into 749 operons. Our prediction algorithm, REMap (RNA Expression Mapping of operons), considers the many cases of transcription coverage of intergenic regions, and avoids dependencies on functional annotation and arbitrary assumptions about gene structure. As a result, we demonstrate that REMap is able to more accurately predict operons, especially those that contain long intergenic regions or functionally unrelated genes, than previous operon prediction programs. The REMap algorithm is publicly available as a user-friendly tool that can be readily modified to predict operons in other bacteria. PMID:27450008

  5. Cross-Regulation between the phz1 and phz2 Operons Maintain a Balanced Level of Phenazine Biosynthesis in Pseudomonas aeruginosa PAO1.

    Science.gov (United States)

    Cui, Qinna; Lv, Huinan; Qi, Zhuangzhuang; Jiang, Bei; Xiao, Bo; Liu, Linde; Ge, Yihe; Hu, Xiaomei

    2016-01-01

    Gene duplication often provides selective advantages for the survival of microorganisms in adapting to varying environmental conditions. P. aeruginosa PAO1 possesses two seven-gene operons [phz1 (phzA1B1C1D1E1F1G1) and phz2 (phzA2B2C2D2E2F2G2)] that are involved in the biosynthesis of phenazine-1-carboxylic acid and its derivatives. Although the two operons are highly homologous and their functions are well known, it is unclear how the two phz operons coordinate their expressions to maintain the phenazine biosynthesis. By constructing single and double deletion mutants of the two phz operons, we found that the phz1-deletion mutant produced the same or less amount of phenazine-1-carboxylic acid and pyocyanin in GA medium than the phz2-knockout mutant while the phz1-phz2 double knockout mutant did not produce any phenazines. By generating phzA1 and phzA2 translational and transcriptional fusions with a truncated lacZ reporter, we found that the expression of the phz1 operon increased significantly at the post-transcriptional level and did not alter at the transcriptional level in the absence of the phz2 operon. Surprisingly, the expression the phz2 operon increased significantly at the post-transcriptional level and only moderately at the transcriptional level in the absence of the phz1 operon. Our findings suggested that a complex cross-regulation existed between the phz1 and phz2 operons. By mediating the upregulation of one phz operon expression while the other was deleted, this crosstalk would maintain the homeostatic balance of phenazine biosynthesis in P. aeruginosa PAO1.

  6. Cross-Regulation between the phz1 and phz2 Operons Maintain a Balanced Level of Phenazine Biosynthesis in Pseudomonas aeruginosa PAO1.

    Directory of Open Access Journals (Sweden)

    Qinna Cui

    Full Text Available Gene duplication often provides selective advantages for the survival of microorganisms in adapting to varying environmental conditions. P. aeruginosa PAO1 possesses two seven-gene operons [phz1 (phzA1B1C1D1E1F1G1 and phz2 (phzA2B2C2D2E2F2G2] that are involved in the biosynthesis of phenazine-1-carboxylic acid and its derivatives. Although the two operons are highly homologous and their functions are well known, it is unclear how the two phz operons coordinate their expressions to maintain the phenazine biosynthesis. By constructing single and double deletion mutants of the two phz operons, we found that the phz1-deletion mutant produced the same or less amount of phenazine-1-carboxylic acid and pyocyanin in GA medium than the phz2-knockout mutant while the phz1-phz2 double knockout mutant did not produce any phenazines. By generating phzA1 and phzA2 translational and transcriptional fusions with a truncated lacZ reporter, we found that the expression of the phz1 operon increased significantly at the post-transcriptional level and did not alter at the transcriptional level in the absence of the phz2 operon. Surprisingly, the expression the phz2 operon increased significantly at the post-transcriptional level and only moderately at the transcriptional level in the absence of the phz1 operon. Our findings suggested that a complex cross-regulation existed between the phz1 and phz2 operons. By mediating the upregulation of one phz operon expression while the other was deleted, this crosstalk would maintain the homeostatic balance of phenazine biosynthesis in P. aeruginosa PAO1.

  7. RNA-mediated reciprocal regulation between two bacterial operons is RNase III dependent.

    Science.gov (United States)

    Johnson, Christopher M; Haemig, Heather H A; Chatterjee, Anushree; Wei-Shou, Hu; Weaver, Keith E; Dunny, Gary M

    2011-01-01

    In bacteria, RNAs regulate gene expression and function via several mechanisms. An RNA may pair with complementary sequences in a target RNA to impact transcription, translation, or degradation of the target. Control of conjugation of pCF10, a pheromone response plasmid of Enterococcus faecalis, is a well-characterized system that serves as a model for the regulation of gene expression in bacteria by intercellular signaling. The prgQ operon, whose products mediate conjugation, is negatively regulated by two products of the prgX operon, Anti-Q, a small RNA, and PrgX, the transcriptional repressor of the prgQ promoter. Here we show that Qs, an RNA from the 5' end of the prgQ operon, represses expression of PrgX by targeting prgX mRNA for cleavage by RNase III. Our results demonstrate that the prgQ and prgX operons each use RNAs to negatively regulate gene expression from the opposing operon by different mechanisms. Such reciprocal regulation between two operons using RNAs has not been previously demonstrated. Furthermore, these results show that Qs is an unusually versatile RNA, serving three separate functions in the regulation of conjugation. Understanding the potential versatility of RNAs and their various roles in gene regulatory networks will allow us to better understand how cells regulate complex behavior. Bacteria use RNA to regulate gene expression by a variety of mechanisms. The prgQ and prgX operons of pCF10, a conjugative plasmid of Enterococcus faecalis, have been shown to negatively regulate one another by a variety of mechanisms. One of these mechanisms involves Anti-Q, a small RNA from the prgX operon that prevents gene expression from the prgQ operon. In this work, we find that Qs, an RNA from the prgQ operon, negatively regulates gene expression from the prgX operon. These findings have a number of implications. (i) The Anti-Q and Qs RNAs act by different mechanisms, highlighting the variety of ways in which bacteria can regulate gene expression

  8. ODB: a database for operon organizations, 2011 update.

    Science.gov (United States)

    Okuda, Shujiro; Yoshizawa, Akiyasu C

    2011-01-01

    ODB (Operon DataBase) aims to collect data of all known and conserved operons in completely sequenced genomes. Three newly updated features of this database have been added as follows: (i) Data from included operons were updated. The genome-wide analysis of transcription and transcriptional units has become popular recently and ODB successfully integrates these high-throughput operon data, including genome-wide transcriptional units of five prokaryotes and two eukaryotes. The current version of our database contains information from about 10,000 known operons in more than 50 genomes, and more than 400,000 conserved operons obtained from more than 1000 bacterial genomes. (ii) ODB proposes the idea of reference operons as a new operon prediction tool. A reference operon, a set of possible orthologous genes that organize operons, is defined by clustering all known operons. A large number of known operons, including the recently added genome-wide analysis of operons, allowed us to define more reliable reference operons. (iii) ODB also provides new graphical interfaces. One is for comparative analyses of operon structures in multiple genomes. The other is for visualization of possible operons in multiple genomes obtained from the reference operons. The 2011 updated version of ODB is now available at http://operondb.jp/.

  9. Transcriptional and functional analysis of galactooligosaccharide uptake by lacS in Lactobacillus acidophilus

    Science.gov (United States)

    Andersen, Joakim M.; Barrangou, Rodolphe; Abou Hachem, Maher; Lahtinen, Sampo; Goh, Yong Jun; Svensson, Birte; Klaenhammer, Todd R.

    2011-01-01

    Probiotic microbes rely on their ability to survive in the gastrointestinal tract, adhere to mucosal surfaces, and metabolize available energy sources from dietary compounds, including prebiotics. Genome sequencing projects have proposed models for understanding prebiotic catabolism, but mechanisms remain to be elucidated for many prebiotic substrates. Although β-galactooligosaccharides (GOS) are documented prebiotic compounds, little is known about their utilization by lactobacilli. This study aimed to identify genetic loci in Lactobacillus acidophilus NCFM responsible for the transport and catabolism of GOS. Whole-genome oligonucleotide microarrays were used to survey the differential global transcriptome during logarithmic growth of L. acidophilus NCFM using GOS or glucose as a sole source of carbohydrate. Within the 16.6-kbp gal-lac gene cluster, lacS, a galactoside-pentose-hexuronide permease-encoding gene, was up-regulated 5.1-fold in the presence of GOS. In addition, two β-galactosidases, LacA and LacLM, and enzymes in the Leloir pathway were also encoded by genes within this locus and up-regulated by GOS stimulation. Generation of a lacS-deficient mutant enabled phenotypic confirmation of the functional LacS permease not only for the utilization of lactose and GOS but also lactitol, suggesting a prominent role of LacS in the metabolism of a broad range of prebiotic β-galactosides, known to selectively modulate the beneficial gut microbiota. PMID:22006318

  10. traY and traI are required for oriT-dependent enhanced recombination between lac-containing plasmids and lambda plac5.

    Science.gov (United States)

    Carter, J R; Porter, R D

    1991-02-01

    Recombination between F42lac and lambda plac5 is typically 20- to 50-fold more efficient than recombination between chromosomal lac and lambda plac5. This enhancement of recombination requires trans-acting factors located in the promoter-distal and promoter-proximal regions of the main traY-to-traI (traZ) operon. By testing the ability of deletion mutants of tra to support enhanced recombination, we have identified traY as the only product has been ruled out. We also report that traI is the only gene from the promoter-distal end of the traY to traI operon that is required for recombination enhancement. Of the two proposed domains of traI, we conclude that the oriT-nicking activity is essential, whereas the helicase activity is largely dispensable. The possibility of a third traI activity is also discussed.

  11. Evolutionary dynamics of nematode operons: easy come, slow go.

    Science.gov (United States)

    Qian, Wenfeng; Zhang, Jianzhi

    2008-03-01

    Operons are widespread in prokaryotes, but are uncommon in eukaryotes, except nematode worms, where approximately 15% of genes reside in over 1100 operons in the model organism Caenorhabditis elegans. It is unclear how operons have become abundant in nematode genomes. The "one-way street" hypothesis asserts that once formed by chance, operons are very difficult to break, because the breakage would leave downstream genes in an operon without a promoter, and hence, unexpressed. To test this hypothesis, we analyzed the presence and absence of C. elegans operons in Caenorhabditis briggsae, Caenorhabditis remanei, and Caenorhabditis brenneri, using Pristionchus pacificus and Brugia malayi as outgroups, and identified numerous operon gains and losses. Coupled with experimental examination of trans-splicing patterns, our comparative genomic analysis revealed diverse molecular mechanisms of operon losses, including inversion, insertion, and relocation, but the presence of internal promoters was not found to facilitate operon losses. In several cases, the data allowed inference of mechanisms by which downstream genes are expressed after operon breakage. We found that the rate of operon gain is approximately 3.3 times that of operon loss. Thus, the evolutionary dynamics of nematode operons is better described as "easy come, slow go," rather than a "one-way street." Based on a mathematic model of operon gains and losses and additional assumptions, we projected that the number of operons in C. elegans will continue to rise by 6%-18% in future evolution before reaching equilibrium between operon gains and losses.

  12. Chromosomal insertion of the entire Escherichia coli lactose operon, into two strains of Pseudomonas, using a modified mini-Tn5 delivery system

    DEFF Research Database (Denmark)

    Hansen, L. H.; Sørensen, S. J.; Jensen, Lars Bogø

    1997-01-01

    A 12-kb PstI fragment including the entire E. coli lactose operon (lacIPOZYA) was inserted in one copy into the chromosome of Pseudomonas putida, Pseudomonas fluorescens and an E. coli strain with lac(-) phenotype. This was made possible by improvements of an already existing mini-Tn5 transposon...... flanked by NotI sites needed in the mini-Tn5 delivery system; (b) the generation of E. coli nonlysogenic strains expressing the pi protein thus being capable of maintaining and delivering R6K-based mini-Tn5 vectors to other E. coli strains; (c) the successful insertion of the E. coli lactose operon...... into the P. fluorescens chromosome giving P. fluorescens the ability to grow on lactose; (d) evidence from Southern blotting that contradicts the assumption that the mini-Tn5 delivery system always creates one-copy inserts. These improvements allow insertion of large DNA fragments encoding highly expressed...

  13. Operon and non-operon gene clusters in the C. elegans genome.

    Science.gov (United States)

    Blumenthal, Thomas; Davis, Paul; Garrido-Lecca, Alfonso

    2015-04-28

    Nearly 15% of the ~20,000 C. elegans genes are contained in operons, multigene clusters controlled by a single promoter. The vast majority of these are of a type where the genes in the cluster are ~100 bp apart and the pre-mRNA is processed by 3' end formation accompanied by trans-splicing. A spliced leader, SL2, is specialized for operon processing. Here we summarize current knowledge on several variations on this theme including: (1) hybrid operons, which have additional promoters between genes; (2) operons with exceptionally long (> 1 kb) intercistronic regions; (3) operons with a second 3' end formation site close to the trans-splice site; (4) alternative operons, in which the exons are sometimes spliced as a single gene and sometimes as two genes; (5) SL1-type operons, which use SL1 instead of SL2 to trans-splice and in which there is no intercistronic space; (6) operons that make dicistronic mRNAs; and (7) non-operon gene clusters, in which either two genes use a single exon as the 3' end of one and the 5' end of the next, or the 3' UTR of one gene serves as the outron of the next. Each of these variations is relatively infrequent, but together they show a remarkable variety of tight-linkage gene arrangements in the C. elegans genome.

  14. GyrA interacts with MarR to reduce repression of the marRAB operon in Escherichia coli.

    Science.gov (United States)

    Domain, Francis; Levy, Stuart B

    2010-02-01

    Bacterial two-hybrid studies of randomly cloned Escherichia coli DNA identified a physical interaction between GyrA, subunit A of gyrase, and MarR, a repressor of the marRAB operon. GyrA-His immobilized on Ni-nitrilotriacetic acid (NiNTA) resin bound MarR, while MarR alone did not bind. GyrA interfered with MarR binding to marO, as detected by electrophoretic mobility assays. In a strain bearing the marRAB operon and a marO-lacZ reporter, overexpression of GyrA increased LacZ activity, indicating decreased repression of marO-lacZ by MarR. These results were confirmed by an increased survival of cells treated with quinolones and other antibiotics when GyrA was overexpressed. This work, like a previous study examining TktA (12), shows that unrelated proteins can regulate MarR activity. The findings reveal an unexpected regulatory function of GyrA in antibiotic resistance.

  15. CCC/WPA study : Des Lacs NWR

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — Summary of the Civilian Conservation Corps (CCC) camp at Des Lacs National Wildlife Refuge from July 1935-May 1942 to carry on restoration and development of Des...

  16. Characterization of the regulation of a plant polysaccharide utilization operon and its role in biofilm formation in Bacillus subtilis

    Science.gov (United States)

    Habib, Cameron; Yu, Yiyang; Gozzi, Kevin; Ching, Carly; Shemesh, Moshe

    2017-01-01

    The soil bacterium Bacillus subtilis is often found in association with plants in the rhizosphere. Previously, plant polysaccharides have been shown to stimulate formation of root-associated multicellular communities, or biofilms, in this bacterium, yet the underlying mechanism is not fully understood. A five-gene gan operon (ganSPQAB) in B. subtilis has recently been shown to be involved in utilization of the plant-derived polysaccharide galactan. Despite these findings, molecular details about the regulation of the operon and the role of the operon in biofilm formation remain elusive. In this study, we performed comprehensive genetic analyses on the regulation of the gan operon. We show that this operon is regulated both by a LacI-like transcription repressor (GanR), which directly binds to pairs of inverted DNA repeats in the promoter region of the operon, and by the catabolite control protein A (CcpA). Derepression can be triggered by the presence of the inducer β-1,4-galactobiose, a hydrolysis product of galactan, or in situ when B. subtilis cells are associated with plant roots. In addition to the transcriptional regulation, the encoded ß-galactosidase GanA (by ganA), which hydrolyzes ß-1,4-galactobiose into galactose, is inhibited at the enzymatic level by the catalytic product galactose. Thus, the galactan utilization pathway is under complex regulation involving both positive and negative feedback mechanisms in B. subtilis. We discuss about the biological significance of such complex regulation as well as a hypothesis of biofilm induction by galactan via multiple mechanisms. PMID:28617843

  17. The LacI–Family Transcription Factor, RbsR, Is a Pleiotropic Regulator of Motility, Virulence, Siderophore and Antibiotic Production, Gas Vesicle Morphogenesis and Flotation in Serratia

    Directory of Open Access Journals (Sweden)

    Chin M. Lee

    2017-09-01

    Full Text Available Gas vesicles (GVs are proteinaceous, gas-filled organelles used by some bacteria to enable upward movement into favorable air/liquid interfaces in aquatic environments. Serratia sp. ATCC39006 (S39006 was the first enterobacterium discovered to produce GVs naturally. The regulation of GV assembly in this host is complex and part of a wider regulatory network affecting various phenotypes, including antibiotic biosynthesis. To identify new regulators of GVs, a comprehensive mutant library containing 71,000 insertion mutants was generated by random transposon mutagenesis and 311 putative GV-defective mutants identified. Three of these mutants were found to have a transposon inserted in a LacI family transcription regulator gene (rbsR of the putative ribose operon. Each of these rbsR mutants was GV-defective; no GVs were visible by phase contrast microscopy (PCM or transmission electron microscopy (TEM. GV deficiency was caused by the reduction of gvpA1 and gvrA transcription (the first genes of the two contiguous operons in the GV gene locus. Our results also showed that a mutation in rbsR was highly pleiotropic; the production of two secondary metabolites (carbapenem and prodigiosin antibiotics was abolished. Interestingly, the intrinsic resistance to the carbapenem antibiotic was not affected by the rbsR mutation. In addition, the production of a siderophore, cellulase and plant virulence was reduced in the mutant, whereas it exhibited increased swimming and swarming motility. The RbsR protein was predicted to bind to regions upstream of at least 18 genes in S39006 including rbsD (the first gene of the ribose operon and gvrA. Electrophoretic mobility shift assays (EMSA confirmed that RbsR bound to DNA sequences upstream of rbsD, but not gvrA. The results of this study indicate that RbsR is a global regulator that affects the modulation of GV biogenesis, but also with complex pleiotropic physiological impacts in S39006.

  18. Aerobic activation of transcription of the anaerobically inducible Escherichia coli focA-pfl operon by fumarate nitrate regulator.

    Science.gov (United States)

    Reyes-Ramírez, Francisca; Sawers, R Gary

    2006-02-01

    Expression of the anaerobically inducible focA-pfl operon in Escherichia coli was activated nearly sevenfold relative to wild-type under aerobic growth conditions by increasing the dosage of the fnr gene on a pBR322-based plasmid (pCH21). No effect on anaerobic expression levels was observed, suggesting that operon expression under these conditions is maximal. Examination of the complex transcript pattern of the focA-pfl operon confirmed that in strains bearing pCH21 all transcripts, with the exception of the promoter 7 transcript, were up-regulated aerobically. Western analysis of strains bearing pCH21 revealed that the fumarate nitrate regulator (FNR) level was increased approximately ninefold relative to the level in strains bearing a single copy of the fnr gene aerobically, but was only overproduced threefold anaerobically. Analysis of an fnr-lacZ fusion indicated that fnr expression was more strongly negatively autoregulated in anaerobic cells compared with aerobic cells when pCH21 was present. Taken together, these findings suggest that high-level overproduction of FNR is prevented anaerobically by active FNR repressing expression of the fnr gene. Furthermore, transcription from promoter 7 of the focA-pfl operon, which depends on both ArcA-P and FNR, cannot be activated aerobically by overproduction of FNR alone, while promoter 6, which is less dependent on ArcA-P, can be activated under these conditions.

  19. A Quantitative bgl Operon Model for E. coli Requires BglF Conformational Change for Sugar Transport

    Science.gov (United States)

    Chopra, Paras; Bender, Andreas

    The bgl operon is responsible for the metabolism of β-glucoside sugars such as salicin or arbutin in E. coli. Its regulatory system involves both positive and negative feedback mechanisms and it can be assumed to be more complex than that of the more closely studied lac and trp operons. We have developed a quantitative model for the regulation of the bgl operon which is subject to in silico experiments investigating its behavior under different hypothetical conditions. Upon administration of 5mM salicin as an inducer our model shows 80-fold induction, which compares well with the 60-fold induction measured experimentally. Under practical conditions 5-10mM inducer are employed, which is in line with the minimum inducer concentration of 1mM required by our model. The necessity of BglF conformational change for sugar transport has been hypothesized previously, and in line with those hypotheses our model shows only minor induction if conformational change is not allowed. Overall, this first quantitative model for the bgl operon gives reasonable predictions that are close to experimental results (where measured). It will be further refined as values of the parameters are determined experimentally. The model was developed in Systems Biology Markup Language (SBML) and it is available from the authors and from the Biomodels repository [www.ebi.ac.uk/biomodels].

  20. In vivo DNA cloning and adjacent gene fusing with a mini-Mu-lac bacteriophage containing a plasmid replicon.

    OpenAIRE

    Groisman, E A; Castilho, B A; Casadaban, M J

    1984-01-01

    A mini-Mu bacteriophage containing a high copy number plasmid replicon was constructed to clone genes in vivo. A chloramphenicol resistance gene for independent selection and the lacZYA operon to form gene fusions were also incorporated into this phage. This mini-Mu element can transpose at a high frequency when derepressed, and it can be complemented by a helper Mu prophage for lytic growth. DNA sequences that are flanked by two copies of this mini-Mu can be packaged along with them. After i...

  1. Absorption toward Red BL Lac Objects

    Science.gov (United States)

    Stocke, J. T.; Rector, T. A.

    Based upon the prototypical high-z molecular absorber, PKS 1413+135, we present a summary of properties and search strategies for new high-z absorbers. It is suspicious that two of the four high-z molecular absorbers are BL Lac Objects (PKS 1413+135 & B2 0218+357), suggesting a link between the presence of the foreground absorber and the low equivalent width emission lines of BL Lacs. Also, based upon a new optical absorption line study of radio-selected BL Lac Objects (Stocke & Rector 1997), we find a large overabundance of intervening Mg II absorption line systems in these objects compared to quasars, which also seems to link low equivalent width emission lines to the presence of foreground absorption. Not only does this suggest that the optical characteristics of BL Lacs can be created by microlensing due to stars associated with foreground absorbing gas but also that red BL Lacs are a rich sample to search for new examples of foreground absorbers.

  2. Metagenomic Guilt by Association: An Operonic Perspective

    Science.gov (United States)

    Vey, Gregory

    2013-01-01

    Next-generation sequencing projects continue to drive a vast accumulation of metagenomic sequence data. Given the growth rate of this data, automated approaches to functional annotation are indispensable and a cornerstone heuristic of many computational protocols is the concept of guilt by association. The guilt by association paradigm has been heavily exploited by genomic context methods that offer functional predictions that are complementary to homology-based annotations, thereby offering a means to extend functional annotation. In particular, operon methods that exploit co-directional intergenic distances can provide homology-free functional annotation through the transfer of functions among co-operonic genes, under the assumption that guilt by association is indeed applicable. Although guilt by association is a well-accepted annotative device, its applicability to metagenomic functional annotation has not been definitively demonstrated. Here a large-scale assessment of metagenomic guilt by association is undertaken where functional associations are predicted on the basis of co-directional intergenic distances. Specifically, functional annotations are compared within pairs of adjacent co-directional genes, as well as operons of various lengths (i.e. number of member genes), in order to reveal new information about annotative cohesion versus operon length. The results suggests that co-directional gene pairs offer reduced confidence for metagenomic guilt by association due to difficulty in resolving the existence of functional associations when intergenic distance is the sole predictor of pairwise gene interactions. However, metagenomic operons, particularly those with substantial lengths, appear to be capable of providing a superior basis for metagenomic guilt by association due to increased annotative stability. The need for improved recognition of metagenomic operons is discussed, as well as the limitations of the present work. PMID:23940763

  3. Revamping the role of biofilm regulating operons in device-associated Staphylococci and Pseudomonas aeruginosa

    Directory of Open Access Journals (Sweden)

    Pradeep P Halebeedu

    2014-01-01

    Full Text Available Extensive use of indwelling devices in modern medicine has revoked higher incidence of device associated infections and most of these devices provide an ideal surface for microbial attachment to form strong biofilms. These obnoxious biofilms are responsible for persistent infections, longer hospitalization and high mortality rate. Gene regulations in bacteria play a significant role in survival, colonization and pathogenesis. Operons being a part of gene regulatory network favour cell colonization and biofilm formation in various pathogens. This review explains the functional role of various operons in biofilm expression and regulation observed in device-associated pathogens such as Staphylococcus aureus, Staphylococcus epidermidis and Pseudomonas aeruginosa.

  4. Clustering environments of BL Lac objects

    Science.gov (United States)

    Wurtz, Ronald; Ellingson, Erica; Stocke, John T.; Yee, H. K. C.

    1993-01-01

    We report measurements of the amplitude of the BL Lac galaxy spatial covariance function, B(gb), for the fields of five BL Lacertae objects. We present evidence for rich clusters around MS 1207+39 and MS 1407+59, and confirm high richness for the cluster containing H0414+009. We discuss the ease of 3C 66 A and find evidence for a poor cluster based on an uncertain redshift of z = 0.444. These data suggest that at least some BL Lac objects are consistent with being FR 1 radio galaxies in rich clusters.

  5. The comparison between LAC and ALA

    Directory of Open Access Journals (Sweden)

    Tzu-heng Chiu

    2000-12-01

    Full Text Available A good library association serves its members, improves the librarianship, and helps library institutions achieving their missions. This article describes the history, missions and goals, organization structure, membership, financial sources, professional activities, publication, and website of the Library Association of China (LAC and American Library Association (ALA, respectively. Considering social / cultural / political differences between Taiwan and the United Sates, the author then compares these two library associations from the eight factors mentioned above. At the end, suggestions for the LAC are proposed.[Article content in Chinese

  6. ODB: a database for operon organizations, 2011 update

    OpenAIRE

    Okuda, Shujiro; Yoshizawa, Akiyasu C

    2011-01-01

    ODB (Operon DataBase) aims to collect data of all known and conserved operons in completely sequenced genomes. Three newly updated features of this database have been added as follows: (i) Data from included operons were updated. The genome-wide analysis of transcription and transcriptional units has become popular recently and ODB successfully integrates these high-throughput operon data, including genome-wide transcriptional units of five prokaryotes and two eukaryotes. The current version ...

  7. Transcriptional and functional analysis of galactooligosaccharide uptake by lacS in Lactobacillus acidophilus

    DEFF Research Database (Denmark)

    Andersen, Joakim Mark; Barrangou, Rodolphe; Abou Hachem, Maher

    2011-01-01

    remain to be elucidated for many prebiotic substrates. Although β-galactooligosaccharides (GOS) are documented prebiotic compounds, little is known about their utilization by lactobacilli. This study aimed to identify genetic loci in Lactobacillus acidophilus NCFM responsible for the transport...... and catabolism of GOS. Whole-genome oligonucleotide microarrays were used to survey the differential global transcriptome during logarithmic growth of L. acidophilus NCFM using GOS or glucose as a sole source of carbohydrate. Within the 16.6-kbp gal-lac gene cluster, lacS, a galactoside...

  8. Transcriptional Control in the l-Arabinose Operon of Escherichia coli B/r

    Science.gov (United States)

    Cleary, Paul P.; Englesberg, Ellis

    1974-01-01

    The structural genes involved in l-arabinose metabolism are regulated by the protein product of the araC gene. This protein functions as both an activator and repressor of enzyme synthesis in this gene complex. Using λh80dara deoxyribonucleic acid in hybridization studies, we have shown that the ara operon, including structural genes araB, araA, and araD, is transcribed in the direction araB to araD and that initiation of transcription of these genes requires an active araC gene. The half-life of this message, approximately 3 min at 30 C, is the same in the presence or absence of the araC protein in the activator state. However, an unexplained 2-min lag in decay of ara messenger ribonucleic acid that does not occur in decay of lac messenger ribonucleic acid is observed. This lag period requires activated araC protein. PMID:4206866

  9. A dual-function sRNA from B. subtilis: SR1 acts as a peptide encoding mRNA on the gapA operon.

    Science.gov (United States)

    Gimpel, Matthias; Heidrich, Nadja; Mäder, Ulrike; Krügel, Hans; Brantl, Sabine

    2010-05-01

    Small non-coding RNAs (sRNAs) have been found to regulate gene expression in all three kingdoms of life. So far, relatively little is known about sRNAs from Gram-positive bacteria. SR1 is a regulatory sRNA from the Bacillus subtilis chromosome that inhibits by base-pairing translation initiation of ahrC mRNA encoding a transcriptional activator of the arginine catabolic operons. Here we present a novel target of SR1, the glycolytic gapA operon. Both microarray and Northern blot analyses show that the amount of gapA operon mRNA is significantly higher in the presence of SR1 when cells were grown in complex medium until stationary phase. Translational lacZ fusions and toeprinting analyses demonstrate that SR1 does not promote translation of gapA mRNA. By contrast, the half-life of gapA operon mRNA is strongly reduced in the sr1 knockout strain. SR1 does not act as a base-pairing sRNA on gapA operon mRNA. Instead, we demonstrate that the 39 aa peptide encoded by SR1, SR1P, is responsible for the effect of SR1 on the gapA operon. We show that SR1P binds GapA, thereby stabilizing the gapA operon mRNA by a hitherto unknown mechanism. SR1 is the first dual-function sRNA found in B. subtilis.

  10. Role of translation in the UTP-modulated attenuation at the pyrBI operon of Escherichia coli

    DEFF Research Database (Denmark)

    Clemmesen, Kåre; Bonekamp, Fons; Karlström, Olle

    1985-01-01

    B leader peptide. In addition a gene fusion encoding a hybrid protein with -galactosidase activity was formed between the pyrB start and the rest of lacZ. This gene fusion is expressed from the lac promoter and the transcript is subject to facultative termination at the pyrBI attenuator. Different variants......A 273 bp DNA fragment containing the attenuator of the pyrBI operon was inserted into a synthetic cloning site early in the lacZ gene on a plasmid. By this operation the first few codons of lacZ were joined through a linker to the last 39 codons of the open reading frame for the putative pyr...... of the lacZ start were used that either contained a stop codon or directed the translation toward the attenuator in any of the alternative reading frames. The following results were obtained. No significant read-through of transcription over the pyrB attenuator was seen when the leader translation ended 49...

  11. Plasmids as scribbling pads for operon formation and propagation.

    Science.gov (United States)

    Norris, Vic; Merieau, Annabelle

    2013-09-01

    Many bacterial genes are in operons and the process whereby operons are formed is therefore fundamental. To help elucidate this process, we propose in the Scribbling Pad hypothesis that bacteria have been constantly using plasmids for genetic experimentation and, in particular, for the construction of operons. This hypothesis simultaneously solves the problems of the creation of operons and the way operons are propagated. We cite results in the literature to support the hypothesis and make experimental predictions to test it. Copyright © 2013 Institut Pasteur. Published by Elsevier Masson SAS. All rights reserved.

  12. Mutagenesis of ribosomal protein S8 from Escherichia coli: defects in regulation of the spc operon.

    Science.gov (United States)

    Wower, I; Kowaleski, M P; Sears, L E; Zimmermann, R A

    1992-02-01

    The structural features of Escherichia coli ribosomal protein S8 that are involved in translational regulation of spc operon expression and, therefore, in its interaction with RNA have been investigated by use of a genetic approach. The rpsH gene, which encodes protein S8, was first inserted into an expression vector under the control of the lac promoter and subsequently mutagenized with methoxylamine or nitrous acid. A screening procedure based on the regulatory role of S8 was used to identify mutants that were potentially defective in their ability to associate with spc operon mRNA and, by inference, 16S mRNA. In this way, we isolated 39 variants of the S8 gene containing alterations at 34 different sites, including 37 that led to single amino acid substitutions and 2 that generated premature termination codons. As the mutations were distributed throughout the polypeptide chain, our results indicate that amino acid residues important for the structural integrity of the RNA-binding domain are not localized to a single segment. Nonetheless, the majority were located within three short sequences at the N terminus, middle, and C terminus that are phylogenetically conserved among all known eubacterial and chloroplast versions of this protein. We conclude that these sites encompass the main structural determinants required for the interaction of protein S8 with RNA.

  13. A global analysis of adaptive evolution of operons in cyanobacteria.

    Science.gov (United States)

    Memon, Danish; Singh, Abhay K; Pakrasi, Himadri B; Wangikar, Pramod P

    2013-02-01

    Operons are an important feature of prokaryotic genomes. Evolution of operons is hypothesized to be adaptive and has contributed significantly towards coordinated optimization of functions. Two conflicting theories, based on (i) in situ formation to achieve co-regulation and (ii) horizontal gene transfer of functionally linked gene clusters, are generally considered to explain why and how operons have evolved. Furthermore, effects of operon evolution on genomic traits such as intergenic spacing, operon size and co-regulation are relatively less explored. Based on the conservation level in a set of diverse prokaryotes, we categorize the operonic gene pair associations and in turn the operons as ancient and recently formed. This allowed us to perform a detailed analysis of operonic structure in cyanobacteria, a morphologically and physiologically diverse group of photoautotrophs. Clustering based on operon conservation showed significant similarity with the 16S rRNA-based phylogeny, which groups the cyanobacterial strains into three clades. Clade C, dominated by strains that are believed to have undergone genome reduction, shows a larger fraction of operonic genes that are tightly packed in larger sized operons. Ancient operons are in general larger, more tightly packed, better optimized for co-regulation and part of key cellular processes. A sub-clade within Clade B, which includes Synechocystis sp. PCC 6803, shows a reverse trend in intergenic spacing. Our results suggest that while in situ formation and vertical descent may be a dominant mechanism of operon evolution in cyanobacteria, optimization of intergenic spacing and co-regulation are part of an ongoing process in the life-cycle of operons.

  14. Transcriptional Analysis of the MrpJ Network: Modulation of Diverse Virulence-Associated Genes and Direct Regulation of mrp Fimbrial and flhDC Flagellar Operons in Proteus mirabilis

    Science.gov (United States)

    Bode, Nadine J.; Debnath, Irina; Kuan, Lisa; Schulfer, Anjelique; Ty, Maureen

    2015-01-01

    The enteric bacterium Proteus mirabilis is associated with a significant number of catheter-associated urinary tract infections (UTIs). Strict regulation of the antagonistic processes of adhesion and motility, mediated by fimbriae and flagella, respectively, is essential for disease progression. Previously, the transcriptional regulator MrpJ, which is encoded by the mrp fimbrial operon, has been shown to repress both swimming and swarming motility. Here we show that MrpJ affects an array of cellular processes beyond adherence and motility. Microarray analysis found that expression of mrpJ mimicking levels observed during UTIs leads to differential expression of 217 genes related to, among other functions, bacterial virulence, type VI secretion, and metabolism. We probed the molecular mechanism of transcriptional regulation by MrpJ using transcriptional reporters and chromatin immunoprecipitation (ChIP). Binding of MrpJ to two virulence-associated target gene promoters, the promoters of the flagellar master regulator flhDC and mrp itself, appears to be affected by the condensation state of the native chromosome, although both targets share a direct MrpJ binding site proximal to the transcriptional start. Furthermore, an mrpJ deletion mutant colonized the bladders of mice at significantly lower levels in a transurethral model of infection. Additionally, we observed that mrpJ is widely conserved in a collection of recent clinical isolates. Altogether, these findings support a role of MrpJ as a global regulator of P. mirabilis virulence. PMID:25847961

  15. Regulation of mtl operon promoter of Bacillus subtilis: requirements of its use in expression vectors

    Directory of Open Access Journals (Sweden)

    Altenbuchner Josef

    2011-10-01

    Full Text Available Abstract Background Several vector systems have been developed to express any gene desired to be studied in Bacillus subtilis. Among them, the transcriptionally regulated promoters involved in carbohydrate utilization are a research priority. Expression systems based on Bacillus promoters for xylose, maltose, and mannose utilization, as well as on the heterologous E. coli lactose promoter, have been successfully constructed. The promoter of the mtlAFD operon for utilization of mannitol is another promising candidate for its use in expression vectors. In this study, we investigated the regulation of the mtl genes in order to identify the elements needed to construct a strong mannitol inducible expression system in B. subtilis. Results Regulation of the promoters of mtlAFD operon (PmtlA and mtlR (PmtlR encoding the activator were investigated by fusion to lacZ. Identification of the PmtlA and PmtlR transcription start sites revealed the σA like promoter structures. Also, the operator of PmtlA was determined by shortening, nucleotide exchange, and alignment of PmtlA and PmtlR operator regions. Deletion of the mannitol-specific PTS genes (mtlAF resulted in PmtlA constitutive expression demonstrating the inhibitory effect of EIICBMtl and EIIAMtl on MtlR in the absence of mannitol. Disruption of mtlD made the cells sensitive to mannitol and glucitol. Both PmtlA and PmtlR were influenced by carbon catabolite repression (CCR. However, a CcpA deficient mutant showed only a slight reduction in PmtlR catabolite repression. Similarly, using PgroE as a constitutive promoter, putative cre sites of PmtlA and PmtlR slightly reduced the promoter activity in the presence of glucose. In contrast, glucose repression of PmtlA and PmtlR was completely abolished in a ΔptsG mutant and significantly reduced in a MtlR (H342D mutant. Conclusions The mtl operon promoter (PmtlA is a strong promoter that reached a maximum of 13,000 Miller units with lacZ as a reporter on

  16. Optimal gene partition into operons correlates with gene functional order

    Science.gov (United States)

    Zaslaver, Alon; Mayo, Avi; Ronen, Michal; Alon, Uri

    2006-09-01

    Gene arrangement into operons varies between bacterial species. Genes in a given system can be on one operon in some organisms and on several operons in other organisms. Existing theories explain why genes that work together should be on the same operon, since this allows for advantageous lateral gene transfer and accurate stoichiometry. But what causes the frequent separation into multiple operons of co-regulated genes that act together in a pathway? Here we suggest that separation is due to benefits made possible by differential regulation of each operon. We present a simple mathematical model for the optimal distribution of genes into operons based on a balance of the cost of operons and the benefit of regulation that provides 'just-when-needed' temporal order. The analysis predicts that genes are arranged such that genes on the same operon do not skip functional steps in the pathway. This prediction is supported by genomic data from 137 bacterial genomes. Our work suggests that gene arrangement is not only the result of random historical drift, genome re-arrangement and gene transfer, but has elements that are solutions of an evolutionary optimization problem. Thus gene functional order may be inferred by analyzing the operon structure across different genomes.

  17. Germline expression influences operon organization in the Caenorhabditis elegans genome.

    Science.gov (United States)

    Reinke, Valerie; Cutter, Asher D

    2009-04-01

    Operons are found across multiple kingdoms and phyla, from prokaryotes to chordates. In the nematode Caenorhabditis elegans, the genome contains >1000 operons that compose approximately 15% of the protein-coding genes. However, determination of the force(s) promoting the origin and maintenance of operons in C. elegans has proved elusive. Compared to bacterial operons, genes within a C. elegans operon often show poor coexpression and only sometimes encode proteins with related functions. Using analysis of microarray and large-scale in situ hybridization data, we demonstrate that almost all operon-encoded genes are expressed in germline tissue. However, genes expressed during spermatogenesis are excluded from operons. Operons group together along chromosomes in local clusters that also contain monocistronic germline-expressed genes. Additionally, germline expression of genes in operons is largely independent of the molecular function of the encoded proteins. These analyses demonstrate that mechanisms governing germline gene expression influence operon origination and/or maintenance. Thus, gene expression in a specific tissue can have profound effects on the evolution of genome organization.

  18. ProOpDB: Prokaryotic Operon DataBase.

    Science.gov (United States)

    Taboada, Blanca; Ciria, Ricardo; Martinez-Guerrero, Cristian E; Merino, Enrique

    2012-01-01

    The Prokaryotic Operon DataBase (ProOpDB, http://operons.ibt.unam.mx/OperonPredictor) constitutes one of the most precise and complete repositories of operon predictions now available. Using our novel and highly accurate operon identification algorithm, we have predicted the operon structures of more than 1200 prokaryotic genomes. ProOpDB offers diverse alternatives by which a set of operon predictions can be retrieved including: (i) organism name, (ii) metabolic pathways, as defined by the KEGG database, (iii) gene orthology, as defined by the COG database, (iv) conserved protein domains, as defined by the Pfam database, (v) reference gene and (vi) reference operon, among others. In order to limit the operon output to non-redundant organisms, ProOpDB offers an efficient method to select the most representative organisms based on a precompiled phylogenetic distances matrix. In addition, the ProOpDB operon predictions are used directly as the input data of our Gene Context Tool to visualize their genomic context and retrieve the sequence of their corresponding 5' regulatory regions, as well as the nucleotide or amino acid sequences of their genes.

  19. Identification and analysis of internal promoters in Caenorhabditis elegans operons.

    Science.gov (United States)

    Huang, Peiming; Pleasance, Erin D; Maydan, Jason S; Hunt-Newbury, Rebecca; O'Neil, Nigel J; Mah, Allan; Baillie, David L; Marra, Marco A; Moerman, Donald G; Jones, Steven J M

    2007-10-01

    The current Caenorhabditis elegans genomic annotation has many genes organized in operons. Using directionally stitched promoterGFP methodology, we have conducted the largest survey to date on the regulatory regions of annotated C. elegans operons and identified 65, over 25% of those studied, with internal promoters. We have termed these operons "hybrid operons." GFP expression patterns driven from internal promoters differ in tissue specificity from expression of operon promoters, and serial analysis of gene expression data reveals that there is a lack of expression correlation between genes in many hybrid operons. The average length of intergenic regions with putative promoter activity in hybrid operons is larger than previous estimates for operons as a whole. Genes with internal promoters are more commonly involved in gene duplications and have a significantly lower incidence of alternative splicing than genes without internal promoters, although we have observed almost all trans-splicing patterns in these two distinct groups. Finally, internal promoter constructs are able to rescue lethal knockout phenotypes, demonstrating their necessity in gene regulation and survival. Our work suggests that hybrid operons are common in the C. elegans genome and that internal promoters influence not only gene organization and expression but also operon evolution.

  20. Computational operon prediction in whole-genomes and metagenomes.

    Science.gov (United States)

    Zaidi, Syed Shujaat Ali; Zhang, Xuegong

    2017-07-01

    Microbial diversity in unique environmental settings enables abrupt responses catalysed by altering the gene regulation and formation of gene clusters called operons. Operons increases bacterial adaptability, which in turn increases their survival. This review article presents the emergence of computational operon prediction methods for whole microbial genomes and metagenomes, and discusses their strengths and limitations. Most of the whole-genome operon prediction methods struggle to generalize on unrelated genomes. The applicability of universal whole-genome operon prediction methods to metagenomic data is an interesting yet less investigated question. We have evaluated the potential of various operon prediction features for genomic and metagenomic data. Most of operon prediction methods with high accuracy have been compiled into databases. Despite of the high predictive performance, the data among many databases are not completely consistent for similar species. We performed a correlation analysis between the computationally predicted operon databases and experimentally validated data for Escherichia coli, Bacillus subtilis and Mycobacterium tuberculosis. Operon prediction for most of the less characterized microbes cannot be verified due to absence of experimentally validated operons. The generation of validated information for other microbes would test the authenticity of operon databases for other less annotated microbes as well. Advances in sequencing technologies and development of better analysis methods will help researchers to overcome the technological hurdles (such as long sequencing reads and improved contig size) and further improve operon predictions and better utilize operonic information. © The Author 2016. Published by Oxford University Press. All rights reserved. For permissions, please email: journals.permissions@oup.com.

  1. Operons are a conserved feature of nematode genomes.

    Science.gov (United States)

    Pettitt, Jonathan; Philippe, Lucas; Sarkar, Debjani; Johnston, Christopher; Gothe, Henrike Johanna; Massie, Diane; Connolly, Bernadette; Müller, Berndt

    2014-08-01

    The organization of genes into operons, clusters of genes that are co-transcribed to produce polycistronic pre-mRNAs, is a trait found in a wide range of eukaryotic groups, including multiple animal phyla. Operons are present in the class Chromadorea, one of the two main nematode classes, but their distribution in the other class, the Enoplea, is not known. We have surveyed the genomes of Trichinella spiralis, Trichuris muris, and Romanomermis culicivorax and identified the first putative operons in members of the Enoplea. Consistent with the mechanism of polycistronic RNA resolution in other nematodes, the mRNAs produced by genes downstream of the first gene in the T. spiralis and T. muris operons are trans-spliced to spliced leader RNAs, and we are able to detect polycistronic RNAs derived from these operons. Importantly, a putative intercistronic region from one of these potential enoplean operons confers polycistronic processing activity when expressed as part of a chimeric operon in Caenorhabditis elegans. We find that T. spiralis genes located in operons have an increased likelihood of having operonic C. elegans homologs. However, operon structure in terms of synteny and gene content is not tightly conserved between the two taxa, consistent with models of operon evolution. We have nevertheless identified putative operons conserved between Enoplea and Chromadorea. Our data suggest that operons and "spliced leader" (SL) trans-splicing predate the radiation of the nematode phylum, an inference which is supported by the phylogenetic profile of proteins known to be involved in nematode SL trans-splicing. Copyright © 2014 by the Genetics Society of America.

  2. Transcriptional analysis of the MrpJ network: modulation of diverse virulence-associated genes and direct regulation of mrp fimbrial and flhDC flagellar operons in Proteus mirabilis.

    Science.gov (United States)

    Bode, Nadine J; Debnath, Irina; Kuan, Lisa; Schulfer, Anjelique; Ty, Maureen; Pearson, Melanie M

    2015-06-01

    The enteric bacterium Proteus mirabilis is associated with a significant number of catheter-associated urinary tract infections (UTIs). Strict regulation of the antagonistic processes of adhesion and motility, mediated by fimbriae and flagella, respectively, is essential for disease progression. Previously, the transcriptional regulator MrpJ, which is encoded by the mrp fimbrial operon, has been shown to repress both swimming and swarming motility. Here we show that MrpJ affects an array of cellular processes beyond adherence and motility. Microarray analysis found that expression of mrpJ mimicking levels observed during UTIs leads to differential expression of 217 genes related to, among other functions, bacterial virulence, type VI secretion, and metabolism. We probed the molecular mechanism of transcriptional regulation by MrpJ using transcriptional reporters and chromatin immunoprecipitation (ChIP). Binding of MrpJ to two virulence-associated target gene promoters, the promoters of the flagellar master regulator flhDC and mrp itself, appears to be affected by the condensation state of the native chromosome, although both targets share a direct MrpJ binding site proximal to the transcriptional start. Furthermore, an mrpJ deletion mutant colonized the bladders of mice at significantly lower levels in a transurethral model of infection. Additionally, we observed that mrpJ is widely conserved in a collection of recent clinical isolates. Altogether, these findings support a role of MrpJ as a global regulator of P. mirabilis virulence. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  3. Computational identification of operon-like transcriptional loci in eukaryotes.

    Science.gov (United States)

    Nannapaneni, Kishore; Ben-Shahar, Yehuda; Keen, Henry L; Welsh, Michael J; Casavant, Thomas L; Scheetz, Todd E

    2013-07-01

    Operons are primarily a bacterial phenomenon, not commonly observed in eukaryotes. However, new research indicates that operons are found in higher organisms as well. There are instances of operons found in C. elegans, Drosophila melanogaster and other eukaryotic species. We developed a prototype using positional, structural and gene expression information to identify candidate operons. We focused our efforts on "trans-spliced" operons in which the pre-mRNA is trans-spliced into individual transcripts and subsequently translated, as widely observed in C. elegans and some instances in Drosophila. We identify several candidate operons in Drosophila melanogaster of which two have been subsequently molecularly validated. Copyright © 2013 Elsevier Ltd. All rights reserved.

  4. Metazoan operons accelerate recovery from growth arrested states

    Science.gov (United States)

    Zaslaver, Alon; Baugh, L. Ryan; Sternberg, Paul W.

    2011-01-01

    Summary Existing theories explain why operons are advantageous in prokaryotes, but their occurrence in metazoans is an enigma. Nematode operon genes, typically consisting of growth genes, are significantly up-regulated during recovery from growth-arrested states. This expression pattern is anti-correlated to non-operon genes consistent with a competition for transcriptional resources. We find that transcriptional resources are initially limiting during recovery, and that recovering animals are highly sensitive to any additional decrease in transcriptional resources. Operons become advantageous because by clustering growth genes into operons, fewer promoters compete for the limited transcriptional machinery, effectively increasing the concentration of transcriptional resources, and accelerating recovery. Mathematical modeling reveals how a moderate increase in transcriptional resources can substantially enhance transcription rate and recovery. This design principle occurs in different nematodes and the chordate C. intestinalis. As transition from arrest to rapid growth is shared by many metazoans, operons could have evolved to facilitate these processes. PMID:21663799

  5. Stochastic dynamics of macromolecular-assembly networks.

    Science.gov (United States)

    Saiz, Leonor; Vilar, Jose

    2006-03-01

    The formation and regulation of macromolecular complexes provides the backbone of most cellular processes, including gene regulation and signal transduction. The inherent complexity of assembling macromolecular structures makes current computational methods strongly limited for understanding how the physical interactions between cellular components give rise to systemic properties of cells. Here we present a stochastic approach to study the dynamics of networks formed by macromolecular complexes in terms of the molecular interactions of their components [1]. Exploiting key thermodynamic concepts, this approach makes it possible to both estimate reaction rates and incorporate the resulting assembly dynamics into the stochastic kinetics of cellular networks. As prototype systems, we consider the lac operon and phage λ induction switches, which rely on the formation of DNA loops by proteins [2] and on the integration of these protein-DNA complexes into intracellular networks. This cross-scale approach offers an effective starting point to move forward from network diagrams, such as those of protein-protein and DNA-protein interaction networks, to the actual dynamics of cellular processes. [1] L. Saiz and J.M.G. Vilar, submitted (2005). [2] J.M.G. Vilar and L. Saiz, Current Opinion in Genetics & Development, 15, 136-144 (2005).

  6. Regulation of Ribosomal Protein Operons rplM-rpsI, rpmB-rpmG, and rplU-rpmA at the Transcriptional and Translational Levels.

    Science.gov (United States)

    Aseev, Leonid V; Koledinskaya, Ludmila S; Boni, Irina V

    2016-09-15

    It is widely assumed that in the best-characterized model bacterium Escherichia coli, transcription units encoding ribosomal proteins (r-proteins) and regulation of their expression have been already well defined. However, transcription start sites for several E. coli r-protein operons have been established only very recently, so that information concerning the regulation of these operons at the transcriptional or posttranscriptional level is still missing. This paper describes for the first time the in vivo regulation of three r-protein operons, rplM-rpsI, rpmB-rpmG, and rplU-rpmA The results demonstrate that transcription of all three operons is subject to ppGpp/DksA-dependent negative stringent control under amino acid starvation, in parallel with the rRNA operons. By using single-copy translational fusions with the chromosomal lacZ gene, we show here that at the translation level only one of these operons, rplM-rpsI, is regulated by the mechanism of autogenous repression involving the 5' untranslated region (UTR) of the operon mRNA, while rpmB-rpmG and rplU-rpmA are not subject to this type of regulation. This may imply that translational feedback control is not a general rule for modulating the expression of E. coli r-protein operons. Finally, we report that L13, a primary protein in 50S ribosomal subunit assembly, serves as a repressor of rplM-rpsI expression in vivo, acting at a target within the rplM translation initiation region. Thus, L13 represents a novel example of regulatory r-proteins in bacteria. It is important to obtain a deeper understanding of the regulatory mechanisms responsible for coordinated and balanced synthesis of ribosomal components. In this paper, we highlight the major role of a stringent response in regulating transcription of three previously unexplored r-protein operons, and we show that only one of them is subject to feedback regulation at the translational level. Improved knowledge of the regulatory pathways controlling ribosome

  7. pqiABC and yebST, Putative mce Operons of Escherichia coli, Encode Transport Pathways and Contribute to Membrane Integrity.

    Science.gov (United States)

    Nakayama, Takayuki; Zhang-Akiyama, Qiu-Mei

    2017-01-01

    The membranes of single-cell organisms are crucial as the first line of defense. The outer membrane of Gram-negative bacteria is an asymmetric bilayer in which lipopolysaccharides (LPSs) and phospholipids are localized in the outer and inner leaflet, respectively. This asymmetry is important for membrane integrity. In Escherichia coli, the Mla transport pathway maintains this asymmetry by removing phospholipids from the outer leaflet. The MlaD component of this system is a mammalian cell entry (MCE) domain protein, and E. coli has two other MCE domain proteins of unknown function (PqiB and YebT). Here, we show that these two proteins are components of novel transport pathways that contribute to membrane integrity. The pqiAB operon is regulated by SoxS and RpoS. The yebST operon contains pqiAB homologues. Here, we found a third member of the pqi operon, ymbA (pqiC). A PqiB-PqiC complex bridges the inner and the outer membrane, and in other bacteria, pqiBC genes are located in operons together with transporter proteins. We show here that simultaneous deletion of pqiABC and yebST operons in an Δmla background rendered cells more sensitive to SDS-EDTA, and the SDS-EDTA sensitivity of mla mutants was rescued by additional copies of pqiABC We also found that the yebST operon was induced by a defect in LPS molecules. In conclusion, PqiABC and YebST are novel transport pathways related to the Mla transport pathway and important for membrane integrity. Membranes of bacteria are crucial for stress resistance. The composition of the E. coli outer membrane is asymmetric, with asymmetry maintained by the Mla ABC transport pathway. We propose that the stress-inducible pqiABC operon and homologous yebST operon, both of previously unknown function, encode transport pathway proteins related to the Mla transport pathway. Deletion of these operons rendered cells more sensitive to membrane stress, and additional copies of pqiABC suppressed the SDS-EDTA sensitivity of mla mutant

  8. The evolutionary dynamics of operon distributions in eukaryote genomes.

    Science.gov (United States)

    Cutter, Asher D; Agrawal, Aneil F

    2010-06-01

    Genes in nematode and ascidian genomes frequently occur in operons--multiple genes sharing a common promoter to generate a polycistronic primary transcript--and such genes comprise 15-20% of the coding genome for Caenorhabditis elegans and Ciona intestinalis. Recent work in nematodes has demonstrated that the identity of genes within operons is highly conserved among species and that the unifying feature of genes within operons is that they are expressed in germline tissue. However, it is generally unknown what processes are responsible for generating the distribution of operon sizes across the genome, which are composed of up to eight genes per operon. Here we investigate several models for operon evolution to better understand their abundance, distribution of sizes, and evolutionary dynamics over time. We find that birth-death models of operon evolution reasonably describe the relative abundance of operons of different sizes in the C. elegans and Ciona genomes and generate predictions about the number of monocistronic, nonoperon genes that likely participate in the birth-death process. This theory, and applications to C. elegans and Ciona, motivates several new and testable hypotheses about eukaryote operon evolution.

  9. ATP-dependent arsenical pumps, gene products of the arsenical resistance operon of R-factor R773

    Energy Technology Data Exchange (ETDEWEB)

    Chen, C.M.; San Francisco, M.J.D.; Weigel, U.; Rosen, B.P.

    1986-05-01

    Plasmid-encoded resistance to antibiotics and heavy metals is frequently through synthesis of new transport systems for extrusion of the toxic compound. The inducible arsenical resistance (ars) operon of the conjugative R-factor R773 encodes two transport systems: one for arsenate and one for arsenite. In vivo studies of the energetics of arsenical extrusion have suggested that ATP is the driving force and that a PNF is neither necessary nor sufficient. The 4.3 Kb HindIII fragment containing the ars operon was cloned into M13 mWB2348 in both orientations, a series of ordered deletions were created using Ba131 digestion, and the sequence of the operon determined. Four open reading frames, arsA, B, C, and D, were found. From genetic evidence, the ArsA and B proteins comprise the arsenite pump, while the ArsC and D proteins are involved in arsenate pumping. The arsA ORF encodes a soluble protein of 63,167 Da with two potential adenylate binding sites. The ArsA protein was purified from the cytosol and shown to bind ATP. The arsB ORF encodes a membrane protein of 31,197 Da. The arsC ORF encodes a membrane protein of 17,311 Da. Mini-Nu phage transposition was used to create gene fusions between the arsC gene and lacZ. By immunoprecipitation and immunoblots using anti-..beta..-galactosidase serum, this strain was shown to produce a 133 kDa hybrid protein localized in inner membrane and not found in the cytosol. The arsD ORF encodes a 15,811 Da soluble protein. The ArsD protein has been purified from the cytosol. In summary, the data suggest that the ars operon produces a single transcript for the synthesis of two resistances and two anion pumps.

  10. Regulation of the putative bglPH operon for aryl-beta-glucoside utilization in Bacillus subtilis.

    Science.gov (United States)

    Krüger, S; Hecker, M

    1995-01-01

    The expression of the putative operon bglPH of Bacillus subtilis was studied by using bglP'-lacZ transcriptional fusions. The bglP gene encodes an aryl-beta-glucoside-specific enzyme II of the phosphoenolpyruvate sugar:phosphotransferase system, whereas the bglH gene product functions as a phospho-beta-glucosidase. Expression of bglPH is regulated by at least two different mechanisms: (i) carbon catabolite repression and (ii) induction via an antitermination mechanism. Distinct deletions of the promoter region were created to determine cis-acting sites for regulation. An operatorlike structure partially overlapping the -35 box of the promoter of bglP appears to be the catabolite-responsive element of this operon. The motif is similar to that of amyO and shows no mismatches with respect to the consensus sequence established as the target of carbon catabolite repression in B. subtilis. Catabolite repression is abolished in both ccpA and ptsH1 mutants. The target of the induction by the substrate, salicin or arbutin, is a transcriptional terminator located downstream from the promoter of bglP. This structure is very similar to that of transcriptional terminators which regulate the induction of the B. subtilis sacB gene, the sacPA operon, and the Escherichia coli bgl operon. The licT gene product, a member of the BglG-SacY family of antitermination proteins, is essential for the induction process. Expression of bglP is under the negative control of its own gene product. The general proteins of the phosphoenolpyruvate-dependent phosphotransferase system are required for bglP expression. Furthermore, the region upstream from bglP, which reveals a high AT content, exerts a negative regulatory effect on bglP expression. PMID:7559347

  11. Archaeal rRNA operons, intron splicing and homing endonucleases, RNA polymerase operons and phylogeny

    DEFF Research Database (Denmark)

    Garrett, Roger Antony; Aagaard, Claus Sindbjerg; Andersen, Morten

    1994-01-01

    Over the past decade our laboratory has had a strong interest in defining the phylogenetic status of the archaea. This has involved determining and analysing the sequences of operons of both rRNAs and RNA polymerases and it led to the discovery of the first archaeal rRNA intron. What follows...

  12. BL LAC CANDIDATES FOR TeV OBSERVATIONS

    Energy Technology Data Exchange (ETDEWEB)

    Massaro, F.; Funk, S. [SLAC National Laboratory and Kavli Institute for Particle Astrophysics and Cosmology, 2575 Sand Hill Road, Menlo Park, CA 94025 (United States); Paggi, A.; D' Abrusco, R. [Smithsonian Astrophysical Observatory, 60 Garden Street, Cambridge, MA 02138 (United States); Errando, M. [Department of Physics and Astronomy, Barnard College, Columbia University, New York, NY 10027 (United States); Masetti, N. [INAF-Istituto di Astrofisica Spaziale e Fisica Cosmica di Bologna, via Gobetti 101, I-40129 Bologna (Italy); Tosti, G. [Dipartimento di Fisica, Universita degli Studi di Perugia, I-06123 Perugia (Italy)

    2013-07-15

    BL Lac objects are the most numerous class of extragalactic TeV-detected sources. One of the biggest difficulties in investigating their TeV emission is due to their limited number, since only 47 BL Lac objects are known to be TeV emitters. In this paper, we propose new criteria to select TeV BL Lac candidates based on infrared and X-ray observations. We apply our selection criteria to the BL Lac objects listed in the ROMA-BZCAT catalog, thereby identifying 41 potential TeV emitters. We then perform a search over a more extended sample combining the ROSAT bright source catalog and the WISE all-sky survey, revealing 54 additional candidates for TeV observations. Our investigation also led to a tentative classification of 16 unidentified X-ray sources as BL Lac candidates. This analysis provides new interesting BL Lac targets for future observations with ground-based Cherenkov telescopes.

  13. BL LAC candidates for TeV observations

    Energy Technology Data Exchange (ETDEWEB)

    Massaro, F.; Paggi, A.; Errando, M.; D' Abrusco, R.; Masetti, N.; Tosti, G.; Funk, S.

    2013-07-01

    BL Lac objects are the most numerous class of extragalactic TeV-detected sources. One of the biggest difficulties in investigating their TeV emission is due to their limited number, since only 47 BL Lac objects are known to be TeV emitters. In this paper, we propose new criteria to select TeV BL Lac candidates based on infrared and X-ray observations. We apply our selection criteria to the BL Lac objects listed in the ROMA-BZCAT catalog, thereby identifying 41 potential TeV emitters. We then perform a search over a more extended sample combining the ROSAT bright source catalog and the WISE all-sky survey, revealing 54 additional candidates for TeV observations. Our investigation also led to a tentative classification of 16 unidentified X-ray sources as BL Lac candidates. This analysis provides new interesting BL Lac targets for future observations with ground-based Cherenkov telescopes.

  14. Adsorption Properties of Lac Dyes on Wool, Silk, and Nylon

    OpenAIRE

    Wei, Bo; Chen, Qiu-Yuan; Chen, Guoqiang; Tang, Ren-Cheng; Zhang, Jun

    2013-01-01

    There has been growing interest in the dyeing of textiles with natural dyes. The research about the adsorption properties of natural dyes can help to understand their adsorption mechanism and to control their dyeing process. This study is concerned with the kinetics and isotherms of adsorption of lac dyes on wool, silk, and nylon fibers. It was found that the adsorption kinetics of lac dyes on the three fibers followed the pseudosecond-order kinetic model, and the adsorption rate of lac dyes ...

  15. le lac municipal d'Ebol

    African Journals Online (AJOL)

    Nsom Zamo, Annie Claude

    Dans l'optique d'évaluer le Lac Municipal d'Ebolowa (LME) sur les plans hydrologique, morphométrique et physicochimique, une étude a été menée de février à ... superficie du LME, un débit spécifique moyen de 0,28 m3/s, une transparence n'excédant pas les 50 cm et un temps de renouvellement des eaux largement ...

  16. Differential transcriptional regulation of Aggregatibacter actinomycetemcomitans lsrACDBFG and lsrRK operons by integration host factor protein.

    Science.gov (United States)

    Torres-Escobar, Ascención; Juárez-Rodríguez, María Dolores; Demuth, Donald R

    2014-04-01

    We previously showed that the Aggregatibacter actinomycetemcomitans lsrACDBFG and lsrRK operons are regulated by LsrR and cyclic AMP receptor protein (CRP) and that proper regulation of the lsr locus is required for optimal biofilm growth by A. actinomycetemcomitans. Here, we identified sequences that reside immediately upstream from both the lsrA and lsrR start codons that closely resemble the consensus recognition sequence of Escherichia coli integration host factor (IHF) protein. A. actinomycetemcomitans IHFα and IHFβ were expressed and purified as hexahistidine fusion proteins, and using electrophoretic mobility shift assays (EMSAs), the IHFα-IHFβ protein complex was shown to bind to probes containing the putative IHF recognition sequences. In addition, single-copy chromosomal insertions of lsrR promoter-lacZ and lsrA promoter-lacZ transcriptional fusions in wild-type A. actinomycetemcomitans and ΔihfA and ΔihfB mutant strains showed that IHF differentially regulates the lsr locus and functions as a negative regulator of lsrRK and a positive regulator of lsrACDBFG. Deletion of ihfA or ihfB also reduced biofilm formation and altered biofilm architecture relative to the wild-type strain, and these phenotypes were partially complemented by a plasmid-borne copy of ihfA or ihfB. Finally, using 5' rapid amplification of cDNA ends (RACE), two transcriptional start sites (TSSs) and two putative promoters were identified for lsrRK and three TSSs and putative promoters were identified for lsrACDBFG. The function of the two lsrRK promoters and the positive regulatory role of IHF in regulating lsrACDBFG expression were confirmed with a series of lacZ transcriptional fusion constructs. Together, our results highlight the complex transcriptional regulation of the lsrACDBFG and lsrRK operons and suggest that multiple promoters and the architecture of the lsrACDBFG-lsrRK intergenic region may control the expression of these operons.

  17. Metazoan operons accelerate recovery from growth-arrested states.

    Science.gov (United States)

    Zaslaver, Alon; Baugh, L Ryan; Sternberg, Paul W

    2011-06-10

    Existing theories explain why operons are advantageous in prokaryotes, but their occurrence in metazoans is an enigma. Nematode operon genes, typically consisting of growth genes, are significantly upregulated during recovery from growth-arrested states. This expression pattern is anticorrelated to nonoperon genes, consistent with a competition for transcriptional resources. We find that transcriptional resources are initially limiting during recovery and that recovering animals are highly sensitive to any additional decrease in transcriptional resources. We provide evidence that operons become advantageous because, by clustering growth genes into operons, fewer promoters compete for the limited transcriptional machinery, effectively increasing the concentration of transcriptional resources and accelerating recovery. Mathematical modeling reveals how a moderate increase in transcriptional resources can substantially enhance transcription rate and recovery. This design principle occurs in different nematodes and the chordate C. intestinalis. As transition from arrest to rapid growth is shared by many metazoans, operons could have evolved to facilitate these processes. Copyright © 2011 Elsevier Inc. All rights reserved.

  18. The SOS-LUX-LAC-FLUORO-Toxicity-test on the International Space Station (ISS)

    Science.gov (United States)

    Rabbow, E.; Rettberg, P.; Baumstark-Khan, C.; Horneck, G.

    In the 21 st century, an increasing number of astronauts will visit the International Space Station (ISS) for prolonged times. Therefore it is of utmost importance to provide necessary basic knowledge concerning risks to their health and their ability to work on the station and during extravehicular activities (EVA) in free space. It is the aim of one experiment of the German project TRIPLE-LUX (to be flown on the ISS) to provide an estimation of health risk resulting from exposure of the astronauts to the radiation in space inside the station as well as during extravehicular activities on one hand, and of exposure of astronauts to unavoidable or as yet unknown ISS-environmental genotoxic substances on the other. The project will (i) provide increased knowledge of the biological action of space radiation and enzymatic repair of DNA damage, (ii) uncover cellular mechanisms of synergistic interaction of microgravity and space radiation and (iii) examine the space craft milieu with highly specific biosensors. For these investigations, the bacterial biosensor SOS-LUX-LAC-FLUORO-Toxicity-test will be used, combining the SOS-LUX-Test invented at DLR Germany (Patent) with the commercially available LAC-FLUORO-Test. The SOS-LUX-Test comprises genetically modified bacteria transformed with the pBR322-derived plasmid pPLS-1. This plasmid carries the promoterless lux operon of Photobacterium leiognathi as a reporter element under control of the DNA-damage dependent SOS promoter of ColD as sensor element. This system reacts to radiation and other agents that induce DNA damages with a dose dependent measurable emission of bioluminescence of the transformed bacteria. The analogous LAC-FLUORO-Test has been developed for the detection of cellular responses to cytotoxins. It is based on the constitutive expression of green fluorescent protein (GFP) mediated by the bacterial protein expression vector pGFPuv (Clontech, Palo Alto, USA). In response to cytotoxic agents, this system

  19. Assessment of Ramsar site Lac Bonaire - June 2010

    NARCIS (Netherlands)

    Debrot, A.O.; Meesters, H.W.G.; Slijkerman, D.M.E.

    2010-01-01

    Following a helpdesk question from the Dutch Ministry of Agriculture, Nature and Food Quality (LNV) concerning potential threats to the Ramsar Site, Lac Bonaire, the authors visited Lac Bay from 27-29 May 2010. The mangroves, seagrass beds and the reef, both inside and outside of the bay were

  20. Functional analysis of putative operons in Brugia malayi.

    Science.gov (United States)

    Liu, Canhui; Oliveira, Ana; Chauhan, Chitra; Ghedin, Elodie; Unnasch, Thomas R

    2010-01-01

    Operons are a common mode of gene organization in Caenorhabditis elegans. Similar gene arrangements suggest that functional operons may exist in Brugia malayi. To definitively test this hypothesis, a bicistronic reporter vector consisting of an upstream firefly luciferase gene and a downstream renilla luciferase gene was constructed. The genome was then surveyed to identify 15 gene pairs that were likely to represent operons. Two of four domains upstream of the 5' gene from these clusters exhibited promoter activity. When constructs replicating the promoter and intergenic arrangement found in the native putative operon were transfected into embryos, both firefly and renilla activities were detected, while constructs with the promoter alone or intergenic region alone produced no activity from the downstream reporter. These data confirm that functional operons exist in B. malayi. Mutation of three U-rich element homologues present in one of the operons resulted in a decrease in downstream renilla reporter activity, suggesting that these were important in mRNA maturation. Hemi-nested reverse transcriptase-PCR assays demonstrated that while the mRNA encoding the native downstream open reading frame of one operon contained an SL1 spliced leader at its 5' end, the renilla gene mRNA produced from the corresponding transgenic construct did not. Copyright 2009 Australian Society for Parasitology Inc. Published by Elsevier Ltd. All rights reserved.

  1. A phylogenomic analysis of the Actinomycetales mce operons

    Directory of Open Access Journals (Sweden)

    Riley Lee W

    2007-02-01

    Full Text Available Abstract Background The genome of Mycobacterium tuberculosis harbors four copies of a cluster of genes termed mce operons. Despite extensive research that has demonstrated the importance of these operons on infection outcome, their physiological function remains obscure. Expanding databases of complete microbial genome sequences facilitate a comparative genomic approach that can provide valuable insight into the role of uncharacterized proteins. Results The M. tuberculosis mce loci each include two yrbE and six mce genes, which have homology to ABC transporter permeases and substrate-binding proteins, respectively. Operons with an identical structure were identified in all Mycobacterium species examined, as well as in five other Actinomycetales genera. Some of the Actinomycetales mce operons include an mkl gene, which encodes an ATPase resembling those of ABC uptake transporters. The phylogenetic profile of Mkl orthologs exactly matched that of the Mce and YrbE proteins. Through topology and motif analyses of YrbE homologs, we identified a region within the penultimate cytoplasmic loop that may serve as the site of interaction with the putative cognate Mkl ATPase. Homologs of the exported proteins encoded adjacent to the M. tuberculosis mce operons were detected in a conserved chromosomal location downstream of the majority of Actinomycetales operons. Operons containing linked mkl, yrbE and mce genes, resembling the classic organization of an ABC importer, were found to be common in Gram-negative bacteria and appear to be associated with changes in properties of the cell surface. Conclusion Evidence presented suggests that the mce operons of Actinomycetales species and related operons in Gram-negative bacteria encode a subfamily of ABC uptake transporters with a possible role in remodeling the cell envelope.

  2. Differential expression of the seven rRNA operon promoters from the plant growth-promoting bacterium Pseudomonas sp. UW4.

    Science.gov (United States)

    Duan, Jin; Reimer, Lori; Heikkila, John J; Glick, Bernard R

    2014-12-01

    Bacteria often have multiple copies of ribosomal RNA (rrn) genes in their genomes. The presence of multiple rrn operons suggests an advantage to the organism, perhaps through adjustable control of protein expression in response to altered environmental conditions. In the work described here, the strengths of the seven rRNA promoters of Pseudomonas sp. UW4 were individually assessed by separately cloning each promoter region into an expression vector and monitoring the activity of the reporter protein, the Escherichia coli lacZ gene product. The lacZ expression was the highest for the rrnE promoter under all growth conditions, with the various promoters demonstrating a range of strengths. These findings indicate that these promoters are not functionally identical. This observation suggests that the differential expression of rrn operons under various physiological conditions and growth stages allows better regulation of rRNA, conferring an advantage to P. sp. UW4 through a more fine-tuned control of protein expression in a wide range of environmental situations. © 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved.

  3. The ntrBC genes of Azospirillum brasilense are part of a nifR3-like-ntrB-ntrC operon and are negatively regulated.

    Science.gov (United States)

    Machado, H B; Yates, M G; Funayama, S; Rigo, L U; Steffens, M B; Souza, E M; Pedrosa, F O

    1995-08-01

    A cosmid able to complement the Nif- and nitrate-dependent growth phenotypes of the Azospirillum brasilense mutant FP9 was isolated from a genomic library of the wild-type strain FP2. A 6-kb DNA region was sequenced and showed two open reading frames (ORFs) identified as the ntrB and ntrC genes. An ORF1 located upstream from the ntrB gene and coding for a 36-kDa polypeptide showed similarity to the nifR3 gene of Rhodobacter capsulatus and the ORF1 of Rhizobium leguminosarum, both located upstream from the ntrB gene in a complex operon. Two other unidentified ORFs (ORF5 and partial ORF4) coding for hydrophobic polypeptides were also observed. delta ORF1-ntrBC, ORF1, ntrB, and ntrC mutants obtained by recombination of suicide plasmids containing an insertion of a promoterless lacZ kanamycin cassette showed decreased nitrogenase activities and were unable to grow on nitrate as the sole N source. These phenotypes were restored by complementation with plasmids containing the ntrC gene. Analysis of lacZ transcriptional fusions suggested that the ORF1-ntrBC operon in Azospirillum brasilense is expressed from a promoter located upstream from the ORF1 and that it is negatively regulated by the ntrC gene product.

  4. Rv2031c of Mycobacterium tuberculosis: a master regulator of Rv2028-Rv2031 (HspX operon

    Directory of Open Access Journals (Sweden)

    Khurram eMushtaq

    2015-04-01

    Full Text Available AbstractGenes belonging to the same operon are transcribed as a single mRNA molecule in all prokaryotes. The genes of the same operon are presumed to be involved in similar metabolic and physiological processes. Hence, computational analysis of constituent proteins could provide important clues to the functional relationships within the operonic genes. This tends to be more fruitful in the case of Mycobacterium tuberculosis (Mtb, considering the number of hypothetical genes with unknown functions and interacting partners. Dramatic advances in the past decade have increased our knowledge of the mechanisms that tubercle bacilli employ to survive within the host. But the phenomenon of Mtb latency continues to baffle all. Rv2031c belonging to dormancy regulon of Mtb is predominantly expressed during latency, with myriad immunological roles. Thus we attempted to analyze the operon comprising Rv2031c protein to gain insights into its role during latency. In the current study, we have carried out computational analysis of proteins encoded by genes known to be a part of this operon. Our study includes phylogenetic analysis, modeling of protein 3D structures, and protein interaction network analysis. We describe the mechanistic role in the establishment of latency and regulation of DevS/DevR component system. Additionally, we have identified the probable role of these proteins in carbohydrate metabolism, erythromycin tolerance and nucleotide synthesis. Hence, these proteins can modulate the metabolism of mycobacterium inside the host cells and can be important for its survival in latency. The functional characterization and interactome of this important operon can give insight into its role during latency along with the exploitation of constituent proteins as drug targets and vaccine candidates.

  5. Adsorption Properties of Lac Dyes on Wool, Silk, and Nylon

    Directory of Open Access Journals (Sweden)

    Bo Wei

    2013-01-01

    Full Text Available There has been growing interest in the dyeing of textiles with natural dyes. The research about the adsorption properties of natural dyes can help to understand their adsorption mechanism and to control their dyeing process. This study is concerned with the kinetics and isotherms of adsorption of lac dyes on wool, silk, and nylon fibers. It was found that the adsorption kinetics of lac dyes on the three fibers followed the pseudosecond-order kinetic model, and the adsorption rate of lac dyes was the fastest for silk and the slowest for wool. The activation energies for the adsorption process on wool, silk, and nylon were found to be 107.15, 87.85, and 45.31 kJ/mol, respectively. The adsorption of lac dyes on the three fibers followed the Langmuir mechanism, indicating that the electrostatic interactions between lac dyes and those fibers occurred. The saturation values for lac adsorption on the three fibers decreased in the order of wool > silk > nylon; the Langmuir affinity constant of lac adsorption on nylon was much higher than those on wool and silk.

  6. The Discovery of Low-Luminosity BL Lacs

    Science.gov (United States)

    Rector, Travis A.; Stocke, John T.

    1995-12-01

    Many of the properties of BL Lacs have become explicable in terms of the ``relativistic beaming'' hypothesis whereby BL Lacs are ``highly beamed'' FR-I radio galaxies (i.e. our line of sight to these objects is nearly along the jet axis). Further, radio-selected BL Lacs (RBLs) are believed to be seen nearly ``on-axis'' (the line-of-sight angle theta ~ 8deg ) while X-ray selected BL Lacs (XBLs) are seen at larger angles (theta ~ 30deg ; the X-ray emitting jet is believed to be less collimated). However, a major problem with this model was that a transition population between beamed BL Lacs and unbeamed FR-Is had not been detected. Low-luminosity BL Lacs may be such a transition population, and were predicted to exist by Browne and Marcha (1993). We present ROSAT HRI images, VLA radio maps and optical spectra which confirm the existence of low-luminosity BL Lacs, objects which were previously mis-identified in the EMSS catalog as clusters of galaxies. Thus our results strengthen the relativistic beaming hypothesis.

  7. A GFP-lacZ bicistronic reporter system for promoter analysis in environmental gram-negative bacteria.

    Directory of Open Access Journals (Sweden)

    Rafael Silva-Rocha

    Full Text Available Here, we describe a bicistronic reporter system for the analysis of promoter activity in a variety of gram-negative bacteria at both the population and single-cell levels. This synthetic genetic tool utilizes an artificial operon comprising the gfp and lacZ genes that are assembled in a suicide vector, which is integrated at specific sites within the chromosome of the target bacterium, thereby creating a monocopy reporter system. This tool was instrumental for the complete in vivo characterization of two promoters, Pb and Pc, that drive the expression of the benzoate and catechol degradation pathways, respectively, of the soil bacterium Pseudomonas putida KT2440. The parameterization of these promoters in a population (using β-galactosidase assays and in single cells (using flow cytometry was necessary to examine the basic numerical features of these systems, such as the basal and maximal levels and the induction kinetics in response to an inducer (benzoate. Remarkably, GFP afforded a view of the process at a much higher resolution compared with standard lacZ tests; changes in fluorescence faithfully reflected variations in the transcriptional regimes of individual bacteria. The broad host range of the vector/reporter platform is an asset for the characterization of promoters in different bacteria, thereby expanding the diversity of genomic chasses amenable to Synthetic Biology methods.

  8. The melanin operon of Streptomyces antibioticus: expression and use as a marker in gram-negative bacteria.

    Science.gov (United States)

    Tseng, H C; Lin, C K; Hsu, B J; Leu, W M; Lee, Y H; Chiou, S J; Hu, N T; Chen, C W

    1990-01-31

    The melC operon of Streptomyces antibioticus contains two genes, melC1 and melC2, necessary for the production of melanin pigment. We transferred the coding sequence of melC1 and melC2 to Escherichia coli plasmid pMTL23 such that its transcription was under the control of the lac promoter and melC1 was translationally fused to the lacZ alpha fragment. E. coli cultures containing this plasmid, pIF413, produced melanin after overnight incubation on 2YT agar supplemented with 0.1 mM CuCl2, 0.36 mM IPTG (or 0.2% lactose), and 2 mM tyrosine. Erwina carotovora could also be transformed by pIF413 to produce melanin. Two shuttle vectors were constructed: pLUS415 for E. coli and Streptomyces, and pLAF413 for E. coli and Xanthomonas campestris. These vectors confer melanin pigmentation in all the hosts that harbor them. The melC sequence provides the vectors with a convenient cloning marker for insertional or replacement inactivation.

  9. Differential Regulation of rRNA and tRNA Transcription from the rRNA-tRNA Composite Operon in Escherichia coli.

    Science.gov (United States)

    Takada, Hiraku; Shimada, Tomohiro; Dey, Debashish; Quyyum, M Zuhaib; Nakano, Masahiro; Ishiguro, Akira; Yoshida, Hideji; Yamamoto, Kaneyoshi; Sen, Ranjan; Ishihama, Akira

    2016-01-01

    Escherichia coli contains seven rRNA operons, each consisting of the genes for three rRNAs (16S, 23S and 5S rRNA in this order) and one or two tRNA genes in the spacer between 16S and 23S rRNA genes and one or two tRNA genes in the 3' proximal region. All of these rRNA and tRNA genes are transcribed from two promoters, P1 and P2, into single large precursors that are afterward processed to individual rRNAs and tRNAs by a set of RNases. In the course of Genomic SELEX screening of promoters recognized by RNA polymerase (RNAP) holoenzyme containing RpoD sigma, a strong binding site was identified within 16S rRNA gene in each of all seven rRNA operons. The binding in vitro of RNAP RpoD holoenzyme to an internal promoter, referred to the promoter of riRNA (an internal RNA of the rRNA operon), within each 16S rRNA gene was confirmed by gel shift assay and AFM observation. Using this riRNA promoter within the rrnD operon as a representative, transcription in vitro was detected with use of the purified RpoD holoenzyme, confirming the presence of a constitutive promoter in this region. LacZ reporter assay indicated that this riRNA promoter is functional in vivo. The location of riRNA promoter in vivo as identified using a set of reporter plasmids agrees well with that identified in vitro. Based on transcription profile in vitro and Northern blot analysis in vivo, the majority of transcript initiated from this riRNA promoter was estimated to terminate near the beginning of 23S rRNA gene, indicating that riRNA leads to produce the spacer-coded tRNA. Under starved conditions, transcription of the rRNA operon is markedly repressed to reduce the intracellular level of ribosomes, but the levels of both riRNA and its processed tRNAGlu stayed unaffected, implying that riRNA plays a role in the continued steady-state synthesis of tRNAs from the spacers of rRNA operons. We then propose that the tRNA genes organized within the spacers of rRNA-tRNA composite operons are expressed

  10. Differential Regulation of rRNA and tRNA Transcription from the rRNA-tRNA Composite Operon in Escherichia coli.

    Directory of Open Access Journals (Sweden)

    Hiraku Takada

    Full Text Available Escherichia coli contains seven rRNA operons, each consisting of the genes for three rRNAs (16S, 23S and 5S rRNA in this order and one or two tRNA genes in the spacer between 16S and 23S rRNA genes and one or two tRNA genes in the 3' proximal region. All of these rRNA and tRNA genes are transcribed from two promoters, P1 and P2, into single large precursors that are afterward processed to individual rRNAs and tRNAs by a set of RNases. In the course of Genomic SELEX screening of promoters recognized by RNA polymerase (RNAP holoenzyme containing RpoD sigma, a strong binding site was identified within 16S rRNA gene in each of all seven rRNA operons. The binding in vitro of RNAP RpoD holoenzyme to an internal promoter, referred to the promoter of riRNA (an internal RNA of the rRNA operon, within each 16S rRNA gene was confirmed by gel shift assay and AFM observation. Using this riRNA promoter within the rrnD operon as a representative, transcription in vitro was detected with use of the purified RpoD holoenzyme, confirming the presence of a constitutive promoter in this region. LacZ reporter assay indicated that this riRNA promoter is functional in vivo. The location of riRNA promoter in vivo as identified using a set of reporter plasmids agrees well with that identified in vitro. Based on transcription profile in vitro and Northern blot analysis in vivo, the majority of transcript initiated from this riRNA promoter was estimated to terminate near the beginning of 23S rRNA gene, indicating that riRNA leads to produce the spacer-coded tRNA. Under starved conditions, transcription of the rRNA operon is markedly repressed to reduce the intracellular level of ribosomes, but the levels of both riRNA and its processed tRNAGlu stayed unaffected, implying that riRNA plays a role in the continued steady-state synthesis of tRNAs from the spacers of rRNA operons. We then propose that the tRNA genes organized within the spacers of rRNA-tRNA composite operons

  11. Operon prediction using chaos embedded particle swarm optimization.

    Science.gov (United States)

    Chuang, Li-Yeh; Yang, Cheng-Huei; Tsai, Jui-Hung; Yang, Cheng-Hong

    2013-01-01

    Operons contain valuable information for drug design and determining protein functions. Genes within an operon are co-transcribed to a single-strand mRNA and must be coregulated. The identification of operons is, thus, critical for a detailed understanding of the gene regulations. However, currently used experimental methods for operon detection are generally difficult to implement and time consuming. In this paper, we propose a chaotic binary particle swarm optimization (CBPSO) to predict operons in bacterial genomes. The intergenic distance, participation in the same metabolic pathway and the cluster of orthologous groups (COG) properties of the Escherichia coli genome are used to design a fitness function. Furthermore, the Bacillus subtilis, Pseudomonas aeruginosa PA01, Staphylococcus aureus and Mycobacterium tuberculosis genomes are tested and evaluated for accuracy, sensitivity, and specificity. The computational results indicate that the proposed method works effectively in terms of enhancing the performance of the operon prediction. The proposed method also achieved a good balance between sensitivity and specificity when compared to methods from the literature.

  12. Transcriptional regulation of Aggregatibacter actinomycetemcomitans lsrACDBFG and lsrRK operons and their role in biofilm formation.

    Science.gov (United States)

    Torres-Escobar, Ascención; Juárez-Rodríguez, María Dolores; Lamont, Richard J; Demuth, Donald R

    2013-01-01

    Autoinducer-2 (AI-2) is required for biofilm formation and virulence of the oral pathogen Aggregatibacter actinomycetemcomitans, and we previously showed that lsrB codes for a receptor for AI-2. The lsrB gene is expressed as part of the lsrACDBFG operon, which is divergently transcribed from an adjacent lsrRK operon. In Escherichia coli, lsrRK encodes a repressor and AI-2 kinase that function to regulate lsrACDBFG. To determine if lsrRK controls lsrACDBFG expression and influences biofilm growth of A. actinomycetemcomitans, we first defined the promoters for each operon. Transcriptional reporter plasmids containing the 255-bp lsrACDBFG-lsrRK intergenic region (IGR) fused to lacZ showed that essential elements of lsrR promoter reside 89 to 255 bp upstream from the lsrR start codon. Two inverted repeat sequences that represent potential binding sites for LsrR and two sequences resembling the consensus cyclic AMP receptor protein (CRP) binding site were identified in this region. Using electrophoretic mobility shift assay (EMSA), purified LsrR and CRP proteins were shown to bind probes containing these sequences. Surprisingly, the 255-bp IGR did not contain the lsrA promoter. Instead, a fragment encompassing nucleotides +1 to +159 of lsrA together with the 255-bp IGR was required to promote lsrA transcription. This suggests that a region within the lsrA coding sequence influences transcription, or alternatively that the start codon of A. actinomycetemcomitans lsrA has been incorrectly annotated. Transformation of ΔlsrR, ΔlsrK, ΔlsrRK, and Δcrp deletion mutants with lacZ reporters containing the lsrA or lsrR promoter showed that LsrR negatively regulates and CRP positively regulates both lsrACDBFG and lsrRK. However, in contrast to what occurs in E. coli, deletion of lsrK had no effect on the transcriptional activity of the lsrA or lsrR promoters, suggesting that another kinase may be capable of phosphorylating AI-2 in A. actinomycetemcomitans. Finally, biofilm

  13. Botulism on the Des Lacs Refuge and control measures

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — Report on botulism at Des Lacs National Wildlife Refuge. Summaries of botulism outbreaks on the refuge for 1935-1937 are included, as well as information on...

  14. Radio detection of 18 RASS BL Lac objects

    Directory of Open Access Journals (Sweden)

    Anderson M.W.B.

    2009-01-01

    Full Text Available We present the radio detection of 18 BL Lac objects from our survey of over 575 deg2 of sky. These 18 objects are located within 20'' of the X-ray position, of which 11 have a measured red-shift. All candidates are radio emitters above ~1 mJy and fall within the range of existing samples on the two colour, αRO vs αOX, diagram with a transitional population of three evident. Two unusual sources have been identified, a candidate radio quiet BL Lac, RX J0140.9-4130, and an extreme HBL, RX J0109.9-4020, with log (νpeak ≈19:2. The BL Lac log(N-log(S relation is consistent with other samples and indicates the ROSAT All Sky Survey (RASS could contain (2000±400 BL Lac objects.

  15. Radio Detection of 18 RASS BL Lac Objects

    Directory of Open Access Journals (Sweden)

    Anderson M. W. B.

    2009-12-01

    Full Text Available We present the radio detection of 18 BL Lac objects from oursurvey of over 575 deg$^2$ of sky. These 18 objects are located within$20arcsec$ of the X-ray position, of which 11 have a measuredred-shift. All candidates are radio emitters above $sim$1 mJy and fall within the range of existing samples on the two colour, $alpha _mathrm{RO}$ vs $alpha _mathrm{OX}$, diagram with a transitional population of three evident. Two unusual sources have been identified, a candidate radio quiet BL Lac, RX J0140.9-4130, and an extreme HBL, RX J0109.9-4020, with $log( u _mathrm{peak}approx 19.2$. The BL Lac $log(N-log(S$ relation is consistent with other samples and indicates the ROSAT All Sky Survey (RASS could contain ($2000{pm}400$ BL Lac objects.

  16. Land use plan : Des Lacs National Wildlife Refuge

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — The purpose of this land use plan for Des Lacs National Wildlife Refuge is to outline the principal practices and procedures necessary to establish a reasonable...

  17. [Wildlife inventory plan : Des Lacs National Wildlife Refuge

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — This wildlife inventory plan describes methods for collecting migratory birds, upland birds, big game, predator, and small mammal surveys at Des Lacs National...

  18. Des Lacs National Wildlife Refuge Water Management Plan 2015

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — The Des Lacs National Wildlife Refuge Water Management Plan has been developed to meet the station objectives set forth in the Master Plan. This plan contains 2014...

  19. Des Lacs National Wildlife Refuge Water Management Plan 2009

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — The Des Lacs NWR Water Management Plan has been developed to meet the station objectives set forth in the Master Plan. The purpose of this plan is to establish a...

  20. A chromosomally located traHIJKCLMN operon encoding a putative type IV secretion system is involved in the virulence of Yersinia ruckeri.

    Science.gov (United States)

    Méndez, J; Fernández, L; Menéndez, A; Reimundo, P; Pérez-Pascual, D; Navais, R; Guijarro, J A

    2009-02-01

    Nucleotide sequence analysis of the region surrounding the pIVET8 insertion site in Yersinia ruckeri 150RiviXII, previously selected by in vivo expression technology (IVET), revealed the presence of eight genes (traHIJKCLMN [hereafter referred to collectively as the tra operon or tra cluster]), which are similar both in sequence and organization to the tra operon cluster found in the virulence-related plasmid pADAP from Serratia entomophila. Interestingly, the tra cluster of Y. ruckeri is chromosomally encoded, and no similar tra cluster has been identified yet in the genomic analysis of human pathogenic yersiniae. A traI insertional mutant was obtained by homologous recombination. Coinfection experiments with the mutant and the parental strain, as well as 50% lethal dose determinations, indicate that this operon is involved in the virulence of this bacterium. All of these results suggest the implication of the tra cluster in a virulence-related type IV secretion/transfer system. Reverse transcriptase PCR studies showed that this cluster is transcribed as an operon from a putative promoter located upstream of traH and that the mutation of traI had a polar effect. A traI::lacZY transcriptional fusion displayed higher expression levels at 18 degrees C, the temperature of occurrence of the disease, and under nutrient-limiting conditions. PCR detection analysis indicated that the tra cluster is present in 15 Y. ruckeri strains from different origins and with different plasmid profiles. The results obtained in the present study support the conclusion, already suggested by different authors, that Y. ruckeri is a very homogeneous species that is quite different from the other members of the genus Yersinia.

  1. An Optically Selected Sample of BL Lac Objects

    Science.gov (United States)

    Londish, D. M.; Croom, S. M.; Boyle, B. J.; Sadler, E. M.

    2004-08-01

    BL Lac objects are thought to be the beamed counterparts of FRI/FRII radio galaxies (cf. review by Urry & Padovani 1995, PASP, 107,803); at optical wavelengths these objects are dominated by Doppler boosted, synchrotron radiation, the resultant featureless continuum making BL Lacs all but impossible to target in optical surveys. To date, therefore, all BL Lac samples have been initially identified in radio and/or X-ray surveys, thus these objects are naturally found to be emitters at these frequencies. The first optically selected sample of BL Lac objects was identified from scrutiny of spectra in two redshift surveys (2QZ and 6QZ) using the 2dF and 6dF instruments at Siding Spring, NSW, Australia (Croom et al. 2001, MNRAS, 325, 483; MNRAS, 2004, 349, 1397). Of 52 featureless continuum objects identified, only 14 objects have radio flux densitites > 0.15mJy. Five of these 14 also have detectable X-ray emission. With optical b J magnitudes in the range 16.4 Rector et al. 2000, ApJ, 120, 1626) and the radio-selected 1Jy BL Lac Sample (z=0.6, Stickel et al. 1991, ApJ, 374, 431; Rector & Stocke 2001, AJ, 122,565). This raises the question as to why such X-ray-quiet, radio-quiet BL Lacs (lineless QSOs?) have not been found at lower redshifts, and what mechanisms are responsible for the lack of such detectable X-ray and radio emission in these optically selected BL Lacs. DL acknowledges support from the Science Foundation, University of Sydney.

  2. Tricistronic operon expression of the genes gcaD (tms), which encodes N-acetylglucosamine 1-phosphate uridyltransferase, prs, which encodes phosphoribosyl diphosphate synthetase, and ctc in vegetative cells of Bacillus subtilis

    DEFF Research Database (Denmark)

    Hilden, Ida; Krath, Britta N.; Hove-Jensen, Bjarne

    1995-01-01

    The gcaD, prs, and ctc genes were shown to be organized as a tricistronic operon. The transcription of the prs gene, measured as phosphoribosyl diphosphate synthetase activity, and of the ctc gene, measured as β-galactosidase activity specified by a ctc-lacZ protein fusion, were dependent...... on the promoter in front of the gcaD gene. Analysis of cDNA molecules prepared with gcaD-prs-ctc-specified mRNA as the template revealed an RNA transcript that encompassed all three cistrons....

  3. Lac Courte Oreilles Energy Analysis Project

    Energy Technology Data Exchange (ETDEWEB)

    Leslie Isham; Denise Johnson

    2009-04-01

    The Lac Courte Oreilles Tribe applied for first step funding in 2007 and was awarded in October of that year. We wanted to perform an audit to begin fulfilling two commitments we made to our membership and resolutions that we adopted. One was the Kyoto Protocol and reduce our carbon emissions by 25% and to produce 25% of our energy by sustainable means. To complete these goals we needed to begin with first assessing what our carbon emissions are and begin taking the steps to conserve on the energy we currently use. The First Step Grant gave us the opportunity to do this. Upon funding the Energy Project was formed under the umbrella of the LCO Public Works Department and Denise Johnson was hired as the coordinator. She quickly began fulfilling the objectives of the project. Denise began by contact the LCO College and hiring interns who were able to go to each Tribal entity and perform line logging to read and document the energy used for each electrical appliance. Data was also gathered for one full year from each entity for all their utility bills (gasoline, electric, natural gas, fuel oil, etc.). Relationships were formed with the Green Team and other Green Committees in the area that could assist us in this undertaking. The Energy Task Force was of great assistance as well recommending other committees and guidance to completing our project. The data was gathered, compiled and placed into spreadsheets that would be understandable for anyone who didn't have a background in Renewable Resources. While gathering the data Denise was also looking for ways to conserve energy usage, policies changes to implement and any possible viable renewable energy resources. Changes in the social behaviors of our members and employees will require further education by workshops, energy fairs, etc.. This will be looked into and done in coordination with our schools. The renewable resources seem most feasible are wind resources as well as Bio Mass both of which need further

  4. Regulation of Bacillus subtilis bacillithiol biosynthesis operons by Spx.

    Science.gov (United States)

    Gaballa, Ahmed; Antelmann, Haike; Hamilton, Chris J; Helmann, John D

    2013-10-01

    Bacillithiol is the major low molecular mass thiol produced by many firmicutes bacteria, including the model organism Bacillus subtilis and pathogens such as Bacillus anthracis and Staphylococcus aureus. We have previously shown that four genes (bshA, bshB1, bshB2 and bshC) are involved in bacillithiol biosynthesis. Here, we report that these four genes are encoded within three, unlinked operons all expressed from canonical σ(A)-dependent promoters as determined by 5'RACE (rapid amplification of cDNA ends). The bshA and bshB1 genes are embedded within a seven-gene operon additionally including mgsA, encoding methylglyoxal synthase, and the essential genes cca and birA, encoding tRNA nucleotidyltransferase (CCA transferase) and biotin-protein ligase, respectively. The bshB2 gene is co-transcribed with unknown function genes, while bshC is expressed both as part of a two-gene operon (with the upstream putative pantothenate biosynthesis gene ylbQ) and from its own promoter. All three operons are expressed at a reduced level in an spx null mutant, consistent with a direct role of Spx as a transcriptional activator for these operons, and all three operons are induced by the thiol oxidant diamide. In contrast with other Spx-regulated genes characterized to date, the effects of Spx on basal expression and diamide-stimulated expression appear to be independent of Cys10 in the redox centre of Spx. Consistent with the role of Spx as an activator of bacillithiol biosynthetic genes, cellular levels of bacillithiol are reduced several-fold in an spx null mutant.

  5. The HC-LAC: a Platform for Modeling Hydrology and Climate Change in Latin America and the Caribbean

    Science.gov (United States)

    Moreda, F.; Wyatt, A.; Bruhn, M.; Wheaton, W.; Miralles-Wilhelm, F.; Muñoz-Castillo, R.; Rineer, J.

    2013-05-01

    This platform, called the Hydrology and Climate Change in Latin America and The Caribbean, or "HC-LAC", is an integrated quantitative simulation of hydrology and climate change. The HC-LAC is composed of two principal components: the Analytical Hydrography Dataset (AHD) and an enhanced version of the Generalized Watershed Loading Function (GWLF). The AHD is a spatially explicit surface water data layer of Central and South America derived from digital elevation data from the Shuttle Radar Topography Mission (SRTM) and modified by the USGS to provide more accurate flow between cells in the raster data. For the LAC area, AHD consists 230, 000 catchments and stream segments with an average area of 100 km2 and length of 10 km, respectively. The AHD data structure is patterned after the US National Hydrography Dataset Plus (NHDPlus), thus providing a proven structure for flexible data integration and analyses necessary for spatial models like the HC-LAC. The structure of the AHD enables the implementation of water balance modeling and general routing of flows through the stream network thus supporting a range of environmental models. GWLF is applied on each AHD catchment which is characterized by multiple land use and soil type. The response of each land use in a given catchment is modeled separately in generating stream flow as well as recharge to soil storage. The stream flows generated from each catchment are routed through stream networks, providing total flow at any point in the stream network. A pilot implementation of the HC-LAC was established for the Rio Grande basin in North West Argentina (drainage area 6,700 km2). The model was parameterized and calibrated using readily available data. Three stream flow time series were generated using a reference climate case and two climate change projections. The reference case was based on historical records and assumes no climate change. The two climate change projections were generated using the IPCC "A2" high

  6. Genomic arrangement of bacterial operons is constrained by biological pathways encoded in the genome

    OpenAIRE

    Yin, Yanbin; Zhang, Han; Olman, Victor; Ying XU

    2010-01-01

    It is generally known that bacterial genes working in the same biological pathways tend to group into operons, possibly to facilitate cotranscription and to provide stoichiometry. However, very little is understood about what may determine the global arrangement of bacterial genes in a genome beyond the operon level. Here we present evidence that the global arrangement of operons in a bacterial genome is largely influenced by the tendency that a bacterium keeps its operons encoding the same b...

  7. Jacques Monod and the Advent of the Age of Operons

    Indian Academy of Sciences (India)

    In this article, I will focus on the first, more because of personal competence than any other reason. Monod himself considered his contributions on allostery to be more significant than the operon model. He is reported to have surprised his colleagues one day by saying that he had discovered the “second secret of life”.

  8. Rapid customised operon assembly by yeast recombinational cloning.

    Science.gov (United States)

    Liu, Michael A; Kenyon, Johanna J; Lee, Jason; Reeves, Peter R

    2017-06-01

    We have developed a system called the Operon Assembly Protocol (OAP), which takes advantage of the homologous recombination DNA repair pathway in Saccharomyces cerevisiae to assemble full-length operons from a series of overlapping PCR products into a specially engineered yeast-Escherichia coli shuttle vector. This flexible, streamlined system can be used to assemble several operon clones simultaneously, and each clone can be expressed in the same E. coli tester strain to facilitate direct functional comparisons. We demonstrated the utility of the OAP by assembling and expressing a series of E. coli O1A O-antigen gene cluster clones containing various gene deletions or replacements. We then used these constructs to assess the substrate preferences of several Wzx flippases, which are responsible for translocation of oligosaccharide repeat units (O units) across the inner membrane during O-antigen biosynthesis. We were able to identify several O unit structural features that appear to be important determinants of Wzx substrate preference. The OAP system should be broadly applicable for the genetic manipulation of any bacterial operon and can be modified for use in other host species. It could also have potential uses in fields such as glycoengineering.

  9. Jacques Monod and the Advent of the Age of Operons

    Indian Academy of Sciences (India)

    Home; Journals; Resonance – Journal of Science Education; Volume 15; Issue 12. Jacques Monod and the Advent of the Age of Operons. R Jayaraman. General Article Volume 15 Issue 12 December 2010 pp 1084-1096. Fulltext. Click here to view fulltext PDF. Permanent link:

  10. Operon Formation is Driven by Co-Regulation and Not by Horizontal Gene Transfer

    Energy Technology Data Exchange (ETDEWEB)

    Price, Morgan N.; Huang, Katherine H.; Arkin, Adam P.; Alm, Eric J.

    2005-04-12

    Although operons are often subject to horizontal gene transfer (HGT), non-HGT genes are particularly likely to be in operons. To resolve this apparent discrepancy and to determine whether HGT is involved in operon formation, we examined the evolutionary history of the genes and operons in Escherichia coli K12. We show that genes that have homologs in distantly related bacteria but not in close relatives of E. coli (indicating HGTi) form new operons at about the same rates as native genes. Furthermore, genes in new operons are no more likely than other genes to have phylogenetic trees that are inconsistent with the species tree. In contrast, essential genes and ubiquitous genes without paralogs (genes believed to undergo HGT rarely) often form new operons. We conclude that HGT is not associated with operon formation, but instead promotes the prevalence of pre-existing operons. To explain operon formation, we propose that new operons reduce the amount of regulatory information required to specify optimal expression patterns. Consistent with this hypothesis, operons have greater amounts of conserved regulatory sequences than do individually transcribed genes.

  11. Fucose-Mediated Transcriptional Activation of the fcs Operon by FcsR in Streptococcus pneumoniae

    NARCIS (Netherlands)

    Manzoor, Irfan; Shafeeq, Sulman; Afzal, Muhammad; Kuipers, Oscar P

    2015-01-01

    In this study, we explore the impact of fucose on the transcriptome of S. pneumoniae D39. The expression of various genes and operons, including the fucose uptake PTS and utilization operon (fcs operon) was altered in the presence of fucose. By means of quantitative RT-PCR and β-galactosidase

  12. vanO, a new glycopeptide resistance operon in environmental Rhodococcus equi isolates

    DEFF Research Database (Denmark)

    Gudeta, Dereje Dadi; Moodley, Arshnee; Bortolaia, Valeria

    2014-01-01

    We describe sequence and gene organization of a new glycopeptide resistance operon (vanO) in Rhodococcus equi from soil. The vanO operon has low homology to enterococccal van operons and harbors a vanHOX cluster transcribed in opposite direction to the vanS-vanR regulatory system and comprised...

  13. Characterization of the Cobalamin and Fep Operons in Methylobium petrolphilum PM1

    Energy Technology Data Exchange (ETDEWEB)

    Ewing, J

    2005-09-06

    The bacterium Methylobium petroleophilum PM1 is economically important due to its ability to degrade methyl tert-butyl ether (MTBE), a fuel additive. Because PM1 is a representative of all MTBE degraders, it is important to understand the transport pathways critical for the organism to survive in its particular environment. In this study, the cobalamin pathway and select iron transport genes will be characterized to help further understand all metabolic pathways in PM1. PM1 contains a total of four cobalamin operons. A single operon is located on the chromosome. Located on the megaplasmid are two tandem repeats of cob operons and a very close representative of the cob operon located on the chromosome. The fep operon, an iron transport mechanism, lies within the multiple copies of the cob operon. The cob operon and the fep operon appear to be unrelated except for a shared need for the T-on-B-dependent energy transduction complex to assist the operons in moving large molecules across the outer membrane of the cell. A genomic study of the cob and the fep operons with that of phylogenetically related organisms helped to confirm the identity of the cob and fep operons and to represent the pathways. More study of the pathways should be done to find the relationship that positions the two seemingly unrelated cob and fep genes together in what appears to be one operon.

  14. Comprehensive Analysis of Rice Laccase Gene (OsLAC Family and Ectopic Expression of OsLAC10 Enhances Tolerance to Copper Stress in Arabidopsis

    Directory of Open Access Journals (Sweden)

    Qingquan Liu

    2017-01-01

    Full Text Available Laccases are encoded by a multigene family and widely distributed in plant genomes where they play roles oxidizing monolignols to produce higher-order lignin involved in plant development and stress responses. We identified 30 laccase genes (OsLACs from rice, which can be divided into five subfamilies, mostly expressed during early development of the endosperm, growing roots, and stems. OsLACs can be induced by hormones, salt, drought, and heavy metals stresses. The expression level of OsLAC10 increased 1200-fold after treatment with 20 μM Cu for 12 h. The laccase activities of OsLAC10 were confirmed in an Escherichia coli expression system. Lignin accumulation increased in the roots of Arabidopsis over-expressing OsLAC10 (OsLAC10-OX compared to wild-type controls. After growth on 1/2 Murashige and Skoog (MS medium containing toxic levels of Cu for seven days, roots of the OsLAC10-OX lines were significantly longer than those of the wild type. Compared to control plants, the Cu concentration decreased significantly in roots of the OsLAC10-OX line under hydroponic conditions. These results provided insights into the evolutionary expansion and functional divergence of OsLAC family. In addition, OsLAC10 is likely involved in lignin biosynthesis, and reduces the uptake of Cu into roots required for Arabidopsis to develop tolerance to Cu.

  15. Radio-weak BL Lac Objects in the Fermi Era

    Science.gov (United States)

    Massaro, F.; Marchesini, E. J.; D'Abrusco, R.; Masetti, N.; Andruchow, I.; Smith, Howard A.

    2017-01-01

    The existence of “radio-weak BL Lac objects” (RWBLs) has been an open question, and has remained unsolved since the discovery that quasars could be radio-quiet or radio-loud. Recently, several groups identified RWBL candidates, mostly found while searching for low-energy counterparts of the unidentified or unassociated gamma-ray sources listed in the Fermi catalogs. Confirming RWBLs is a challenging task since they could be confused with white dwarfs (WDs) or weak emission line quasars (WELQs) when there are not sufficient data to precisely draw their broadband spectral energy distribution, and their classification is mainly based on a featureless optical spectra. Motivated by the recent discovery that Fermi BL Lacs appear to have very peculiar mid-IR emission, we show that it is possible to distinguish between WDs, WELQs, and BL Lacs using the [3.4]-[4.6]-[12] μm color-color plot built using the WISE magnitudes when the optical spectrum is available. On the basis of this analysis, we identify WISE J064459.38+603131 and WISE J141046.00+740511.2 as the first two genuine RWBLs, both potentially associated with Fermi sources. Finally, to strengthen our identification of these objects as true RWBLs, we present multifrequency observations for these two candidates to show that their spectral behavior is indeed consistent with that of the BL Lac population.

  16. 76 FR 68124 - Television Broadcasting Services; Fond du Lac, WI

    Science.gov (United States)

    2011-11-03

    ... [Federal Register Volume 76, Number 213 (Thursday, November 3, 2011)] [Proposed Rules] [Pages 68124-68125] [FR Doc No: 2011-28452] FEDERAL COMMUNICATIONS COMMISSION 47 CFR Part 73 [MB Docket No. 09-115, RM-11543; DA 11-1502] Television Broadcasting Services; Fond du Lac, WI AGENCY: Federal...

  17. RADIO-WEAK BL LAC OBJECTS IN THE FERMI ERA

    Energy Technology Data Exchange (ETDEWEB)

    Massaro, F.; Marchesini, E. J. [Dipartimento di Fisica, Università degli Studi di Torino (UniTO), via Pietro Giuria 1, I-10125 Torino (Italy); D’Abrusco, R.; Smith, Howard A. [Smithsonian Astrophysical Observatory, 60 Garden Street, 02138 Cambridge, MA (United States); Masetti, N. [INAF—Istituto di Astrofisica Spaziale e Fisica Cosmica di Bologna, via Gobetti 101, I-40129, Bologna (Italy); Andruchow, I. [Facultad de Ciencias Astronómicas y Geofísicas, Universidad Nacional de La Plata, Paseo del Bosque, B1900FWA, La Plata (Argentina)

    2017-01-10

    The existence of “radio-weak BL Lac objects” (RWBLs) has been an open question, and has remained unsolved since the discovery that quasars could be radio-quiet or radio-loud. Recently, several groups identified RWBL candidates, mostly found while searching for low-energy counterparts of the unidentified or unassociated gamma-ray sources listed in the Fermi catalogs. Confirming RWBLs is a challenging task since they could be confused with white dwarfs (WDs) or weak emission line quasars (WELQs) when there are not sufficient data to precisely draw their broadband spectral energy distribution, and their classification is mainly based on a featureless optical spectra. Motivated by the recent discovery that Fermi BL Lacs appear to have very peculiar mid-IR emission, we show that it is possible to distinguish between WDs, WELQs, and BL Lacs using the [3.4]–[4.6]–[12] μ m color–color plot built using the WISE magnitudes when the optical spectrum is available. On the basis of this analysis, we identify WISE J064459.38+603131 and WISE J141046.00+740511.2 as the first two genuine RWBLs, both potentially associated with Fermi sources. Finally, to strengthen our identification of these objects as true RWBLs, we present multifrequency observations for these two candidates to show that their spectral behavior is indeed consistent with that of the BL Lac population.

  18. Preliminary fish survey of Lac Tseny in north- western Madagascar

    African Journals Online (AJOL)

    ABSTRACT. We surveyed the fish fauna of Lac Tseny, in the Sofia Region of northwestern Madagascar, during October 2010 by observ- ing commercial catches and targeted netting of areas used by endemic species. We recorded seven native fish species at the lake, including three endemic cichlids, a herring and a catfish ...

  19. Purification and characterization of two phospho-β-galactosidases, LacG1 and LacG2, from Lactobacillus gasseri ATCC33323(T).

    Science.gov (United States)

    Honda, Hiroyuki; Nagaoka, Seiji; Kawai, Yasushi; Kemperman, Robèr; Kok, Jan; Yamazaki, Yukiko; Tateno, Yoshio; Kitazawa, Haruki; Saito, Tadao

    2012-01-01

    Lactobacillus gasseri ATCC33323(T) expresses four enzymes showing phospho-β-galactosidase activity (LacG1, LacG2, Pbg1 and Pbg2). We previously reported the purification and characterization of two phospho-β-galactosidases (Pbg1 and Pbg2) from Lactobacillus gasseri JCM1031 cultured in lactose medium. Here we aimed to characterize LacG1 and LacG2, and classify the four enzymes into 'phospho-β-galactosidase' or 'phospho-β-glucosidase.' LacG1 and recombinant LacG2 (rLacG2), from Lb. gasseri ATCC33323(T), were purified to homogeneity using column chromatography. Kinetic experiments were performed using sugar substrates, o-nitrophenyl-β-D-galactopyranoside 6-phosphate (ONPGal-6P) and o-nitrophenyl-β-D-glucopyranoside 6-phosphate (ONPGlc-6P), synthesized in our laboratory. LacG1 and rLacG2 exhibited high k(cat)/K(m) values for ONPGal-6P as compared with Pbg1 and Pbg2. The V(max) values for ONPGal-6P were higher than phospho-β-galactosidases previously purified and characterized from several lactic acid bacteria. A phylogenetic tree analysis showed that LacG1 and LacG2 belong to the phospho-β-galactosidase cluster and Pbg1 and Pbg2 belong to the phospho-β-glucosidase cluster. Our data suggest two phospho-β-galactosidase, LacG1 and LacG2, are the primary enzymes for lactose utilization in Lb. gasseri ATCC33323(T). We propose a reclassification of Pbg1 and Pbg2 as phospho-β-glucosidase.

  20. Analysis of expression profile of mce operon genes (mce1, mce2, mce3 operon) in different Mycobacterium tuberculosis isolates at different growth phases.

    Science.gov (United States)

    Singh, Pratibha; Katoch, V M; Mohanty, K K; Chauhan, Devendra Singh

    2016-04-01

    Mycobacterium tuberculosis (M. tuberculosis) has four homologous mammalian cell entry (mce) operons (mce1-4) that encode exported proteins and have a possible role in the virulence mechanism of this pathogen. The expression of mce operon is considered to be complex and not completely understood. Although expression of mce operon at different in vitro growth phases has been studied earlier, its expression in different M. tuberculosis isolates under different growth phases is not yet studied. The present preliminary study was conducted on a limited number of isolates to know the trend of expression pattern of mce operon genes in different M. tuberculosis isolates under different growth stages. In this study, we monitored the transcriptional profile of selected mce operon genes (mce1A, mce1D, mce2A, mce2D, mce3A, mce3C) in different M.tuberculosis isolates (MDR1, MDR2, and sensitive isolate) at early exponential and stationary phases using real-time quantitative PCR. The expression ratio of all selected mce operon genes in all M. tuberculosis isolates was reduced at the initial phase and increased substantially at a later phase of growth. Higher expression of mce1 operon genes was found in all M. tuberculosis isolates as compared to other mce operon genes (mce2 and mce3 operons) at stationary growth phase. the higher expression of mce operon genes at stationary phase (as compared to early exponential phase) suggested growth phase dependent expression of mce operon genes. This indicated that the mce operon genes might have a role in M. tuberculosis survival and adaptation on the onset of adverse condition like stationary phase. Identification of differentially expressed genes will add to our understanding of the bacilli involved in adaptation to different growth conditions.

  1. Expression of the glycolytic gapA operon in Bacillus subtilis: differential syntheses of proteins encoded by the operon.

    Science.gov (United States)

    Meinken, Christoph; Blencke, Hans-Matti; Ludwig, Holger; Stülke, Jörg

    2003-03-01

    Glycolysis is one of the central routes of carbon catabolism in Bacillus subtilis. Several glycolytic enzymes, including the key enzyme glyceraldehyde-3-phosphate dehydrogenase, are encoded in the hexacistronic gapA operon. Expression of this operon is induced by a variety of sugars and amino acids. Under non-inducing conditions, expression is repressed by the CggR repressor protein, the product of the promoter-proximal gene of the operon. Here, it is shown that the amount of glyceraldehyde-3-phosphate dehydrogenase encoded by the second gene of the operon exceeds that of the CggR repressor by about 100-fold. This differential synthesis was attributed to an mRNA processing event that takes place at the 3' end of the cggR open reading frame and to differential segmental stabilities of the resulting cleavage products. The mRNA specifying the truncated cggR gene is quickly degraded, whereas the downstream processing products encompassing gapA are quite stable. This increased stability is conferred by the presence of a stem-loop structure at the 5' end of the processed mRNAs. Mutations were introduced in the region of the cleavage site. A mutation affecting the stability of the stem-loop structure immediately downstream of the processing site had two effects. First, the steady-state transcript pattern was drastically shifted towards the primary transcripts; second, the stability of the processed mRNA containing the destabilized stem-loop structure was strongly decreased. This results in a reduction of the amount of glyceraldehyde-3-phosphate dehydrogenase in the cell. It is concluded that mRNA processing is involved in differential syntheses of the proteins encoded by the gapA operon.

  2. Computing Optical Variable Periods of BL Lac Object S5 0716+ 714 ...

    Indian Academy of Sciences (India)

    Key words. BL Lac object: general—S5 0716 + 714: individual. 1. Introduction. The study of long-term periodical variation is an important way to get the charac- teristics of BL Lac objects (Villata et al. 1997). If the long-term period of variation exists, which often means that the BL Lac objects have rotation, vibration and orbital.

  3. Fucose-Mediated Transcriptional Activation of the fcs Operon by FcsR in Streptococcus pneumoniae.

    Science.gov (United States)

    Manzoor, Irfan; Shafeeq, Sulman; Afzal, Muhammad; Kuipers, Oscar P

    2015-01-01

    In this study, we explore the impact of fucose on the transcriptome of S. pneumoniae D39. The expression of various genes and operons, including the fucose uptake PTS and utilization operon (fcs operon) was altered in the presence of fucose. By means of quantitative RT-PCR and β-galactosidase analysis, we demonstrate the role of the transcriptional regulator FcsR, present upstream of the fcs operon, as a transcriptional activator of the fcs operon. We also predict a 19-bp putative FcsR regulatory site (5'-ATTTGAACATTATTCAAGT-3') in the promoter region of the fcs operon. The functionality of this predicted FcsR regulatory site was further confirmed by promoter-truncation experiments, where deletion of half of the FscR regulatory site or full deletion led to the abolition of expression of the fcs operon. © 2015 S. Karger AG, Basel.

  4. Trans-splicing and operons in C. elegans.

    Science.gov (United States)

    Blumenthal, Thomas

    2012-11-20

    About 70% of C. elegans mRNAs are trans-spliced to one of two 22 nucleotide spliced leaders. SL1 is used to trim off the 5' ends of pre-mRNAs and replace them with the SL1 sequence. This processing event is very closely related to cis-splicing, or intron removal. The SL1 sequence is donated by a 100 nt small nuclear ribonucleoprotein particle (snRNP), the SL1 snRNP. This snRNP is structurally and functionally similar to the U snRNAs (U1, U2, U4, U5 and U6) that play key roles in intron removal and trans-splicing, except that the SL1 snRNP is consumed in the process. More than half of C. elegans pre-mRNAs are subject to SL1 trans-splicing, whereas ~30% are not trans-spliced. The remaining genes are trans-spliced by SL2, which is donated by a similar snRNP, the SL2 snRNP. SL2 recipients are all downstream genes in closely spaced gene clusters similar to bacterial operons. They are transcribed from a promoter at the 5' end of the cluster of between 2 and 8 genes. This transcription makes a polycistronic pre-mRNA that is co-transcriptionally processed by cleavage and polyadenylation at the 3' end of each gene, and this event is closely coupled to the SL2 trans-splicing event that occurs only ~100 nt further downstream. SL2 trans-splicing requires a sequence between the genes, the Ur element, that likely base pairs with the 5' splice site on the SL2 snRNP, in a manner analogous to the interaction between the 5' splice site in cis-splicing with the U1 snRNP. The key difference is that in trans-splicing, the snRNP contains the 5' splice site, whereas in cis-splicing the pre-mRNA does. Some operons, termed "hybrid operons", contain an additional promoter between two genes that can express the downstream gene or genes with a developmental profile that is different from that of the entire operon. The operons contain primarily genes required for rapid growth, including genes whose products are needed for mitochondrial function and the basic machinery of gene expression

  5. Local gene regulation details a recognition code within the LacI transcriptional factor family.

    Directory of Open Access Journals (Sweden)

    Francisco M Camas

    2010-11-01

    Full Text Available The specific binding of regulatory proteins to DNA sequences exhibits no clear patterns of association between amino acids (AAs and nucleotides (NTs. This complexity of protein-DNA interactions raises the question of whether a simple set of wide-coverage recognition rules can ever be identified. Here, we analyzed this issue using the extensive LacI family of transcriptional factors (TFs. We searched for recognition patterns by introducing a new approach to phylogenetic footprinting, based on the pervasive presence of local regulation in prokaryotic transcriptional networks. We identified a set of specificity correlations--determined by two AAs of the TFs and two NTs in the binding sites--that is conserved throughout a dominant subgroup within the family regardless of the evolutionary distance, and that act as a relatively consistent recognition code. The proposed rules are confirmed with data of previous experimental studies and by events of convergent evolution in the phylogenetic tree. The presence of a code emphasizes the stable structural context of the LacI family, while defining a precise blueprint to reprogram TF specificity with many practical applications.

  6. Differential regulation of the mcb and emr operons of Escherichia coli: role of mcb in multidrug resistance.

    Science.gov (United States)

    Lomovskaya, O; Kawai, F; Matin, A

    1996-04-01

    The mcb operon (which is responsible for microcin B17 production) and the emr operon (which encodes a multidrug resistance pump) share a common negative regulator, EmrR. Nevertheless, compounds that induce the emr operon repress the mcb operon. The pump dedicated to microcin B17 extrusion can also protect the calls against sparfloxacin and other toxic compounds.

  7. Functional characterization of the agtABCD and agtSR operons for 4-aminobutyrate and 5-aminovalerate uptake and regulation in Pseudomonas aeruginosa PAO1.

    Science.gov (United States)

    Chou, Han Ting; Li, Jeng-Yi; Lu, Chung-Dar

    2014-01-01

    Growth of Pseudomonas aeruginosa on diamines cadaverine, putrescine, and diaminopropane requires the γ-glutamylation pathway to convert these diamines into δ-aminovalerate (AMV), γ-aminobutyrate (GABA), and β-alanine. From DNA microarrays experiments the agtABCD operon (PA0603-0606) encoding components for an ABC transporter system was found inducible by exogenous AMV, GABA, and β-alanine, but not by diamines. Induction of the agtABCD operon was abolished in the mutants of upstream agtS (PA0600) or agtR (PA0601) genes encoding the membrane-anchored sensor and the response regulator of a two-component regulatory system, respectively. Growth phenotype analysis supports the physiological functions of these agt genes on utilization of AMV and GABA. Through measurements of β-galactosidase activities from an agtA::lacZ fusion, the requirement of a functional AgtS in control of the induction effect by exogenous AMV and GABA was further substantiated. The recombinant hexa-hisidine tagged agtR was constructed and purified to demonstrate its specific interactions with the agtA promoter region by electrophoretic mobility shift assays. In summary, this study establishes the functions of agtSR and agtABCD operons in AMV and GABA uptake, and provides a potential linkage between AMV/GABA metabolism and polymicrobial infection through the recently reported function of agtR in sensing of peptidoglycan shed by gram-positive bacteria (Korgaonkar et al., Proc Natl Acad Sci USA 110:1059-1064, 2013).

  8. Design and characterisation of synthetic operons for biohydrogen technology.

    Science.gov (United States)

    Lamont, Ciaran M; Sargent, Frank

    2017-04-01

    Biohydrogen is produced by a number of microbial systems and the commonly used host bacterium Escherichia coli naturally produces hydrogen under fermentation conditions. One approach to engineering additional hydrogen production pathways is to introduce non-native hydrogenases into E. coli. An attractive candidate is the soluble [NiFe]-hydrogenase from Ralstonia eutropha, which has been shown to link NADH/NAD+ biochemistry directly to hydrogen metabolism, an activity that E. coli does not perform. In this work, three synthetic operons were designed that code for the soluble hydrogenase and two different enzyme maturase systems. Interestingly, using this system, the recombinant soluble hydrogenase was found to be assembled by the native E. coli [NiFe]-hydrogenase assembly machinery, and, vice versa, the synthetic maturase operons were able to complement E. coli mutants defective in hydrogenase biosynthesis. The heterologously expressed soluble hydrogenase was found to be active and was shown to produce biohydrogen in vivo.

  9. Elucidation of Operon Structures across Closely Related Bacterial Genomes

    Science.gov (United States)

    Li, Guojun

    2014-01-01

    About half of the protein-coding genes in prokaryotic genomes are organized into operons to facilitate co-regulation during transcription. With the evolution of genomes, operon structures are undergoing changes which could coordinate diverse gene expression patterns in response to various stimuli during the life cycle of a bacterial cell. Here we developed a graph-based model to elucidate the diversity of operon structures across a set of closely related bacterial genomes. In the constructed graph, each node represents one orthologous gene group (OGG) and a pair of nodes will be connected if any two genes, from the corresponding two OGGs respectively, are located in the same operon as immediate neighbors in any of the considered genomes. Through identifying the connected components in the above graph, we found that genes in a connected component are likely to be functionally related and these identified components tend to form treelike topology, such as paths and stars, corresponding to different biological mechanisms in transcriptional regulation as follows. Specifically, (i) a path-structure component integrates genes encoding a protein complex, such as ribosome; and (ii) a star-structure component not only groups related genes together, but also reflects the key functional roles of the central node of this component, such as the ABC transporter with a transporter permease and substrate-binding proteins surrounding it. Most interestingly, the genes from organisms with highly diverse living environments, i.e., biomass degraders and animal pathogens of clostridia in our study, can be clearly classified into different topological groups on some connected components. PMID:24959722

  10. Identification and Characterization of the fis Operon in Enteric Bacteria

    OpenAIRE

    Beach, Michael B.; Osuna, Robert

    1998-01-01

    The small DNA binding protein Fis is involved in several different biological processes in Escherichia coli. It has been shown to stimulate DNA inversion reactions mediated by the Hin family of recombinases, stimulate integration and excision of phage λ genome, regulate the transcription of several different genes including those of stable RNA operons, and regulate the initiation of DNA replication at oriC. fis has also been isolated from Salmonella typhimurium, and the genomic sequence of Ha...

  11. Growth and sporulation defects in Bacillus subtilis mutants with a single rrn operon can be suppressed by amplification of the rrn operon.

    Science.gov (United States)

    Yano, Koichi; Masuda, Kenta; Akanuma, Genki; Wada, Tetsuya; Matsumoto, Takashi; Shiwa, Yuh; Ishige, Taichiro; Yoshikawa, Hirofumi; Niki, Hironori; Inaoka, Takashi; Kawamura, Fujio

    2016-01-01

    The genome of Bacillus subtilis strain 168 encodes ten rRNA (rrn) operons. We previously reported that strains with only a single rrn operon had a decreased growth and sporulation frequency. We report here the isolation and characterization of suppressor mutants from seven strains that each have a single rrn operon (rrnO, A, J, I, E, D or B). The suppressor mutants for strain RIK656 with a single rrnO operon had a higher frequency of larger colonies. These suppressor mutants had not only increased growth rates, but also increased sporulation frequencies and ribosome levels compared to the parental mutant strain RIK656. Quantitative PCR analyses showed that all these suppressor mutants had an increased number of copies of the rrnO operon. Suppressor mutants were also isolated from the six other strains with single rrn operons (rrnA, J, I, E, D or B). Next generation and capillary sequencing showed that all of the suppressor mutants had tandem repeats of the chromosomal locus containing the remaining rrn operon (amplicon). These amplicons varied in size from approximately 9 to 179 kb. The amplifications were likely to be initiated by illegitimate recombination between non- or micro-homologous sequences, followed by unequal crossing-over during DNA replication. These results are consistent with our previous report that rrn operon copy number has a major role in cellular processes such as cell growth and sporulation.

  12. Wind Resource Assessment Report: Mille Lacs Indian Reservation, Minnesota

    Energy Technology Data Exchange (ETDEWEB)

    Jimenez, Antonio C. [National Renewable Energy Lab. (NREL), Golden, CO (United States); Robichaud, Robi [National Renewable Energy Lab. (NREL), Golden, CO (United States)

    2013-12-01

    The U.S. Environmental Protection Agency (EPA) launched the RE-Powering America's Land initiative to encourage development of renewable energy on potentially contaminated land and mine sites. EPA collaborated with the U.S. Department of Energy's (DOE's) National Renewable Energy Laboratory (NREL) and the Mille Lacs Band of Chippewa Indians to evaluate the wind resource and examine the feasibility of a wind project at a contaminated site located on the Mille Lacs Indian Reservation in Minnesota. The wind monitoring effort involved the installation of a 60-m met tower and the collection of 18 months of wind data at multiple heights above the ground. This report focuses on the wind resource assessment, the estimated energy production of wind turbines, and an assessment of the economic feasibility of a potential wind project sited this site.

  13. Du Lac de Geneve au Lac Baikal: deux metropoles en construction

    Directory of Open Access Journals (Sweden)

    Guy Mettan

    2006-08-01

    Full Text Available En apparence, Geneve et Irkutsk n'ont rien en commun. A part une amitie reciproque et la proximite d'un lac, il est difficile de trouver des points communs entre la Suisse francophone, dont Geneve est la ville le plus importante, et la Siberie centrale, dont Irkutsk, est la capitale. Et pourtant les deux regions, malgre les differences de taille, de densite de la population, de climat, d'economie et de traditions culturelles, sont confrontees au meme probleme: elles sont trop petites et trop limitees pour assurer, avec leurs seuls moyens, leur avenir et elles doivent imperativement s'unir a des villes voisines pour renforcer leur statut de metropole regionale et s'imposer face aux regions et aux pays concurrents.C'est ainsi qu'Irkutsk projette de s'unir aux villes voisines d'Angarsk et de Chelekhov pour constituer une megapole au c?ur de la Siberie, tandis qu'a Geneve le debat fait rage pour trouver des solutions a l'exiguite geographique et a l'insuffisance des moyens face aux grandes regions metropolitaines de France, d'Italie et d'Allemagne.Ce debat est propre a toute la Suisse. Malgre sa petitesse, la Suisse est divisee en 26 cantons. Ces unites administratives sont jugees trop couteuses, trop petites, trop lourdes et trop compliquees pour assurer l'avenir economique et meme politique du pays. De nombreux groupes de reflexion proposent donc de reduire ce nombre a 3, 5 ou 10 grandes provinces selon les cas. En Suisse, romande, il y a dix ans, des mouvements politiques ont meme lance l'idee de fusionner les cantons de Vaud (dont Lausanne est la capitale et de Geneve. Mais l'echec a ete fracassant : le peuple des deux cantons a refuse cette option a 80% des voix. On cherche donc d'autres solutions.Les discussions s'orientent desormais autour de la constitution d'une grande metropole lemanique qui regrouperait les deux grandes villes de Geneve et Lausanne et les villes plus petites de Montreux, Vevey, Nyon ainsi que la ville francaise d

  14. Predicted transcription factor binding sites as predictors of operons in Escherichia coli and Streptomyces coelicolor.

    Science.gov (United States)

    Laing, Emma; Sidhu, Khushwant; Hubbard, Simon J

    2008-02-12

    As a polycistronic transcriptional unit of one or more adjacent genes, operons play a key role in regulation and function in prokaryotic biology, and a better understanding of how they are constituted and controlled is needed. Recent efforts have attempted to predict operonic status in sequenced genomes using a variety of techniques and data sources. To date, non-homology based operon prediction strategies have mainly used predicted promoters and terminators present at the extremities of transcriptional unit as predictors, with reasonable success. However, transcription factor binding sites (TFBSs), typically found upstream of the first gene in an operon, have not yet been evaluated. Here we apply a method originally developed for the prediction of TFBSs in Escherichia coli that minimises the need for prior knowledge and tests its ability to predict operons in E. coli and the 'more complex', pharmaceutically important, Streptomyces coelicolor. We demonstrate that through building genome specific TFBS position-specific-weight-matrices (PSWMs) it is possible to predict operons in E. coli and S. coelicolor with 83% and 93% accuracy respectively, using only TFBS as delimiters of operons. Additionally, the 'palindromicity' of TFBS footprint data of E. coli is characterised. TFBS are proposed as novel independent features for use in prokaryotic operon prediction (whether alone or as part of a set of features) given their efficacy as operon predictors in E. coli and S. coelicolor. We also show that TFBS footprint data in E. coli generally contains inverted repeats with significantly (p operon predictions.

  15. Genomic arrangement of bacterial operons is constrained by biological pathways encoded in the genome.

    Science.gov (United States)

    Yin, Yanbin; Zhang, Han; Olman, Victor; Xu, Ying

    2010-04-06

    It is generally known that bacterial genes working in the same biological pathways tend to group into operons, possibly to facilitate cotranscription and to provide stoichiometry. However, very little is understood about what may determine the global arrangement of bacterial genes in a genome beyond the operon level. Here we present evidence that the global arrangement of operons in a bacterial genome is largely influenced by the tendency that a bacterium keeps its operons encoding the same biological pathway in nearby genomic locations, and by the tendency to keep operons involved in multiple pathways in locations close to the other members of their participating pathways. We also observed that the activation frequencies of pathways also influence the genomic locations of their encoding operons, tending to have operons of the more frequently activated pathways more tightly clustered together. We have quantitatively assessed the influences on the global genomic arrangement of operons by different factors. We found that the current arrangements of operons in most of the bacterial genomes we studied tend to minimize the overall distance between consecutive operons of a same pathway across all pathways encoded in the genome.

  16. Insights into arsenic multi-operons expression and arsenic resistance mechanisms in Rhodopseudomonas palustris CGA009

    Directory of Open Access Journals (Sweden)

    Chungui eZhao

    2015-09-01

    Full Text Available Arsenic (As is widespread in the environment and causes numerous health problems. Rhodopseudomonas palustris has been regarded as a good model organism for studying arsenic detoxification since it was first demonstrated to methylate environmental arsenic by conversion to soluble or gaseous methylated species. However, the detailed arsenic resistance mechanisms remain unknown though there are at least three arsenic-resistance operons (ars1, ars2 and ars3 in R. palustris. In this study, we investigated how arsenic multi-operons contributed to arsenic detoxification in R. palustris. The expression of ars2 or ars3 operons increased with increasing environmental arsenite (As(III concentrations (up to 1.0 mM while transcript of ars1 operon was not detected in the middle log-phase (55 h. ars2 operon was actively expressed even at the low concentration of As(III (0.01 μM, whereas the ars3 operon was expressed at 1.0 µM of As(III, indicating that there was a differential regulation mechanism for the three arsenic operons. Furthermore, ars2 and ars3 operons were maximally transcribed in the early log-phase where ars2 operon was 5.4-fold higher than that of ars3 operon. A low level of ars1 transcript was only detected at 43 h (early log-phase. Arsenic speciation analysis demonstrated that R. palustris could reduce As(V to As(III.

  17. cas du lac Fetzara, région de Annaba

    African Journals Online (AJOL)

    Water feeding Fetzara Lake come from various horizon, it remain influence by geological formations crossing who give their different .... et par conséquent les eaux de pluies participent faiblement au chimisme de l'eau du lac. 0. 1. 2. 3. D éb its (m3. /s). Période d'observation (déc. 2009-mars 2010). 0. 5. 10. 15. 20. D éb.

  18. Le lokonda des Bosanga du Lac Tumba | Mangulu | Annales ...

    African Journals Online (AJOL)

    Il s'agit particulièrement, dans la conjugaison, de l'expression d'aspects par le recours aussi bien aux auxiliaires qu'aux particules postposées à la forme verbale simple. Le tout tend donc à confirmer les hypothèses avancées récemment par la recherche historique : les Ekonda seraient parvenus dans la région des Lacs, ...

  19. L'aménagement piscicole des lacs subalpins

    Directory of Open Access Journals (Sweden)

    VIVIER P.

    1964-04-01

    Le rendement financier annuel varie non seulement avec l'abondance des captures mais aussi avec la qualité du poisson péché. Aussi dans le Lac Léman le prix moyen de 10 kg de poisson péchés a augmenté de 4 F, de 1922 à 1961, grâce à une plus grande abondance relative des Corégones.

  20. Gene-mutation assays in lambda-lacZ transgenic mice : comparison of lacZ with endogenous genes in splenocytes and small intestinal epithelium

    NARCIS (Netherlands)

    Delft, J.H.M. van; Bergmans, A.; Dam, F.J. van; Tates, A.D.; Howard, L.; Winton, D.J.; Baan, R.A.

    1998-01-01

    Comparison of results derived from transgenic animal gene-mutation assays with those from mutation analyses in endogenous genes is an important step in the validation of the former. We have used λlacZ transgenic mice to study alkylation-induced mutagenesis in vivo in (a) lacZ and hprt in spleen

  1. Purification and characterization of two phospho-β-galactosidases, LacG1 and LacG2, from Lactobacillus gasseri ATCC33323T

    NARCIS (Netherlands)

    Honda, Hiroyuki; Nagaoka, Seiji; Kawai, Yasushi; Kemperman, Robèr; Kok, Jan; Yamazaki, Yukiko; Tateno, Yoshio; Kitazawa, Haruki; Saito, Tadao

    2012-01-01

    Lactobacillus gasseri ATCC33323T expresses four enzymes showing phospho-β-galactosidase activity (LacG1, LacG2, Pbg1 and Pbg2). We previously reported the purification and characterization of two phospho-β-galactosidases (Pbg1 and Pbg2) from Lactobacillus gasseri JCM1031 cultured in lactose medium.

  2. Evolution of mosaic operons by horizontal gene transfer and gene displacement in situ

    OpenAIRE

    Omelchenko, Marina V.; Makarova, Kira S.; Wolf, Yuri I.; Rogozin, Igor B.; Koonin, Eugene V.

    2003-01-01

    Background Shuffling and disruption of operons and horizontal gene transfer are major contributions to the new, dynamic view of prokaryotic evolution. Under the 'selfish operon' hypothesis, operons are viewed as mobile genetic entities that are constantly disseminated via horizontal gene transfer, although their retention could be favored by the advantage of coregulation of functionally linked genes. Here we apply comparative genomics and phylogenetic analysis to examine horizontal transfer o...

  3. Chemo-enzymatic modification of poly-N-acetyllactosamine (LacNAc oligomers and N,N-diacetyllactosamine (LacDiNAc based on galactose oxidase treatment

    Directory of Open Access Journals (Sweden)

    Christiane E. Kupper

    2012-05-01

    Full Text Available The importance of glycans in biological systems is highlighted by their various functions in physiological and pathological processes. Many glycan epitopes on glycoproteins and glycolipids are based on N-acetyllactosamine units (LacNAc; Galβ1,4GlcNAc and often present on extended poly-LacNAc glycans ([Galβ1,4GlcNAc]n. Poly-LacNAc itself has been identified as a binding motif of galectins, an important class of lectins with functions in immune response and tumorigenesis. Therefore, the synthesis of natural and modified poly-LacNAc glycans is of specific interest for binding studies with galectins as well as for studies of their possible therapeutic applications. We present the oxidation by galactose oxidase and subsequent chemical or enzymatic modification of terminal galactose and N-acetylgalactosamine residues of poly-N-acetyllactosamine (poly-LacNAc oligomers and N,N-diacetyllactosamine (LacDiNAc by galactose oxidase. Product formation starting from different poly-LacNAc oligomers was characterised and optimised regarding formation of the C6-aldo product. Further modification of the aldehyde containing glycans, either by chemical conversion or enzymatic elongation, was established. Base-catalysed β-elimination, coupling of biotin–hydrazide with subsequent reduction to the corresponding hydrazine linkage, and coupling by reductive amination to an amino-functionalised poly-LacNAc oligomer were performed and the products characterised by LC–MS and NMR analysis. Remarkably, elongation of terminally oxidised poly-LacNAc glycans by β3GlcNAc- and β4Gal-transferase was also successful. In this way, a set of novel, modified poly-LacNAc oligomers containing terminally and/or internally modified galactose residues were obtained, which can be used for binding studies and various other applications.

  4. Engineered ribosomal RNA operon copy-number variants of E. coli reveal the evolutionary trade-offs shaping rRNA operon number.

    Science.gov (United States)

    Gyorfy, Zsuzsanna; Draskovits, Gabor; Vernyik, Viktor; Blattner, Frederick F; Gaal, Tamas; Posfai, Gyorgy

    2015-02-18

    Ribosomal RNA (rrn) operons, characteristically present in several copies in bacterial genomes (7 in E. coli), play a central role in cellular physiology. We investigated the factors determining the optimal number of rrn operons in E. coli by constructing isogenic variants with 5-10 operons. We found that the total RNA and protein content, as well as the size of the cells reflected the number of rrn operons. While growth parameters showed only minor differences, competition experiments revealed a clear pattern: 7-8 copies were optimal under conditions of fluctuating, occasionally rich nutrient influx and lower numbers were favored in stable, nutrient-limited environments. We found that the advantages of quick adjustment to nutrient availability, rapid growth and economic regulation of ribosome number all contribute to the selection of the optimal rrn operon number. Our results suggest that the wt rrn operon number of E. coli reflects the natural, 'feast and famine' life-style of the bacterium, however, different copy numbers might be beneficial under different environmental conditions. Understanding the impact of the copy number of rrn operons on the fitness of the cell is an important step towards the creation of functional and robust genomes, the ultimate goal of synthetic biology. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  5. Operon conservation and the evolution of trans-splicing in the phylum Nematoda.

    Science.gov (United States)

    Guiliano, David B; Blaxter, Mark L

    2006-11-24

    The nematode Caenorhabditis elegans is unique among model animals in that many of its genes are cotranscribed as polycistronic pre-mRNAs from operons. The mechanism by which these operonic transcripts are resolved into mature mRNAs includes trans-splicing to a family of SL2-like spliced leader exons. SL2-like spliced leaders are distinct from SL1, the major spliced leader in C. elegans and other nematode species. We surveyed five additional nematode species, representing three of the five major clades of the phylum Nematoda, for the presence of operons and the use of trans-spliced leaders in resolution of polycistronic pre-mRNAs. Conserved operons were found in Pristionchus pacificus, Nippostrongylus brasiliensis, Strongyloides ratti, Brugia malayi, and Ascaris suum. In nematodes closely related to the rhabditine C. elegans, a related family of SL2-like spliced leaders is used for operonic transcript resolution. However, in the tylenchine S. ratti operonic transcripts are resolved using a family of spliced leaders related to SL1. Non-operonic genes in S. ratti may also receive these SL1 variants. In the spirurine nematodes B. malayi and A. suum operonic transcripts are resolved using SL1. Mapping these phenotypes onto the robust molecular phylogeny for the Nematoda suggests that operons evolved before SL2-like spliced leaders, which are an evolutionary invention of the rhabditine lineage.

  6. Operon conservation and the evolution of trans-splicing in the phylum Nematoda.

    Directory of Open Access Journals (Sweden)

    David B Guiliano

    2006-11-01

    Full Text Available The nematode Caenorhabditis elegans is unique among model animals in that many of its genes are cotranscribed as polycistronic pre-mRNAs from operons. The mechanism by which these operonic transcripts are resolved into mature mRNAs includes trans-splicing to a family of SL2-like spliced leader exons. SL2-like spliced leaders are distinct from SL1, the major spliced leader in C. elegans and other nematode species. We surveyed five additional nematode species, representing three of the five major clades of the phylum Nematoda, for the presence of operons and the use of trans-spliced leaders in resolution of polycistronic pre-mRNAs. Conserved operons were found in Pristionchus pacificus, Nippostrongylus brasiliensis, Strongyloides ratti, Brugia malayi, and Ascaris suum. In nematodes closely related to the rhabditine C. elegans, a related family of SL2-like spliced leaders is used for operonic transcript resolution. However, in the tylenchine S. ratti operonic transcripts are resolved using a family of spliced leaders related to SL1. Non-operonic genes in S. ratti may also receive these SL1 variants. In the spirurine nematodes B. malayi and A. suum operonic transcripts are resolved using SL1. Mapping these phenotypes onto the robust molecular phylogeny for the Nematoda suggests that operons evolved before SL2-like spliced leaders, which are an evolutionary invention of the rhabditine lineage.

  7. Regulation of the L-arabinose operon of Escherichia coli.

    Science.gov (United States)

    Schleif, R

    2000-12-01

    Over forty years of research on the L-arabinose operon of Escherichia coli have provided insights into the mechanism of positive regulation of gene activity. This research also discovered DNA looping and the mechanism by which the regulatory protein changes its DNA-binding properties in response to the presence of arabinose. As is frequently seen in focused research on biological subjects, the initial studies were primarily genetic. Subsequently, the genetic approaches were augmented by physiological and then biochemical studies. Now biophysical studies are being conducted at the atomic level, but genetics still has a crucial role in the study of this system.

  8. Biodiversité et structure des communautés de poissons du lac Hlan ...

    African Journals Online (AJOL)

    Cette étude concerne l\\'un des petits lacs du sud Bénin : le lac Hlan. Elle vise à faire l\\'inventaire de l\\'ichtyofaune et à déterminer l\\'organisation des peuplements de poissons du lac. L\\'ichtyofaune a été échantillonnée mensuellement de septembre 2004 à août 2005 au moyen de la pêche artisanale. Les données ...

  9. Aspartoacylase-lacZ knockin mice: an engineered model of Canavan disease.

    Directory of Open Access Journals (Sweden)

    Nadine Mersmann

    Full Text Available Canavan Disease (CD is a recessive leukodystrophy caused by loss of function mutations in the gene encoding aspartoacylase (ASPA, an oligodendrocyte-enriched enzyme that hydrolyses N-acetylaspartate (NAA to acetate and aspartate. The neurological phenotypes of different rodent models of CD vary considerably. Here we report on a novel targeted aspa mouse mutant expressing the bacterial β-Galactosidase (lacZ gene under the control of the aspa regulatory elements. X-Gal staining in known ASPA expression domains confirms the integrity of the modified locus in heterozygous aspa lacZ-knockin (aspa(lacZ/+ mice. In addition, abundant ASPA expression was detected in Schwann cells. Homozygous (aspa(lacZ/lacZ mutants are ASPA-deficient, show CD-like histopathology and moderate neurological impairment with behavioural deficits that are more pronounced in aspa(lacZ/lacZ males than females. Non-invasive ultrahigh field proton magnetic resonance spectroscopy revealed increased levels of NAA, myo-inositol and taurine in the aspa(lacZ/lacZ brain. Spongy degeneration was prominent in hippocampus, thalamus, brain stem, and cerebellum, whereas white matter of optic nerve and corpus callosum was spared. Intracellular vacuolisation in astrocytes coincides with axonal swellings in cerebellum and brain stem of aspa(lacZ/lacZ mutants indicating that astroglia may act as an osmolyte buffer in the aspa-deficient CNS. In summary, the aspa(lacZ mouse is an accurate model of CD and an important tool to identify novel aspects of its complex pathology.

  10. Induced Spawning of Giant Gouramy Osphronemus gouramy Lac. by Ovaprim

    Directory of Open Access Journals (Sweden)

    H. Arfah

    2007-07-01

    Full Text Available Spawning season of giant gouramy Osphronemus gouramy Lac is not happen continuously through the year so the supply of fry is not enough for fulfilling the demand.  Artificial fertilization will be useful to produce larvae and fry at out of their spawning season.  In this study, three dose levels of ovaprim, i.e. 0.6, 0.7 and 0.8 ml/kg fish were used to induce spawning of giant gouramy.  Parameters observed were the width of abdomen, number of eggs, fertilization rate, hatching rate, and survival rate of larvae.  The results of this study showed that average of fertilization rate reached 4.3% with number of eggs fertilized was 50 eggs, hatching rate 78.5% with number of larvae hatched was 43 larvas.   Average of larvae survived until the end of experiment was 35, with average survival rate was 76.82%.  Based on the achievement in this study, induced spawning by ovaprim could be applied to giant gouramy, although the success is still very low. Keywords: giant gouramy, Osphronemus gouramy Lac., artificial spawning, ovaprim.   ABSTRAK Musim pemijahan ikan gurame Osphronemus gouramy Lac. bukan sepanjang tahun sehingga pasokan benih tidak selalu tersedia dalam jumlah yang cukup. Pemijahan buatan memungkinkan untuk memperoleh suplai larva dan benih di luar musim pemijahannya. Pada penelitian ini tiga tingkatan dosis ovaprim, yaitu  0,6 ml/kg, 0,7 ml/kg, 0,8 ml/kg ikan digunakan untuk merangsang pemijahan ikan gurame. Parameter yang diamati adalah lebar perut, jumlah telur, derajat pembuahan telur (Fertilization Rate, derajat penetasan telur (Hatching Rate dan tingkat kelangsungan hidup larva (Survival Rate. Rata-rata derajat pembuahan telur ikan gurame yang dipijahkan secara buatan mencapai 4,30% dengan jumlah telur yang dibuahi sebanyak 50 butir, sedangkan derajat penetasan rata-rata adalah 78,50 % dengan jumlah rata-rata telur yang menetas sebanyak 43 butir. Rata-rata jumlah larva hidup pada akhir masa pemeliharaan adalah 35 ekor, dengan

  11. Unprecedented high-resolution view of bacterial operon architecture revealed by RNA sequencing.

    Science.gov (United States)

    Conway, Tyrrell; Creecy, James P; Maddox, Scott M; Grissom, Joe E; Conkle, Trevor L; Shadid, Tyler M; Teramoto, Jun; San Miguel, Phillip; Shimada, Tomohiro; Ishihama, Akira; Mori, Hirotada; Wanner, Barry L

    2014-07-08

    We analyzed the transcriptome of Escherichia coli K-12 by strand-specific RNA sequencing at single-nucleotide resolution during steady-state (logarithmic-phase) growth and upon entry into stationary phase in glucose minimal medium. To generate high-resolution transcriptome maps, we developed an organizational schema which showed that in practice only three features are required to define operon architecture: the promoter, terminator, and deep RNA sequence read coverage. We precisely annotated 2,122 promoters and 1,774 terminators, defining 1,510 operons with an average of 1.98 genes per operon. Our analyses revealed an unprecedented view of E. coli operon architecture. A large proportion (36%) of operons are complex with internal promoters or terminators that generate multiple transcription units. For 43% of operons, we observed differential expression of polycistronic genes, despite being in the same operons, indicating that E. coli operon architecture allows fine-tuning of gene expression. We found that 276 of 370 convergent operons terminate inefficiently, generating complementary 3' transcript ends which overlap on average by 286 nucleotides, and 136 of 388 divergent operons have promoters arranged such that their 5' ends overlap on average by 168 nucleotides. We found 89 antisense transcripts of 397-nucleotide average length, 7 unannotated transcripts within intergenic regions, and 18 sense transcripts that completely overlap operons on the opposite strand. Of 519 overlapping transcripts, 75% correspond to sequences that are highly conserved in E. coli (>50 genomes). Our data extend recent studies showing unexpected transcriptome complexity in several bacteria and suggest that antisense RNA regulation is widespread. Importance: We precisely mapped the 5' and 3' ends of RNA transcripts across the E. coli K-12 genome by using a single-nucleotide analytical approach. Our resulting high-resolution transcriptome maps show that ca. one-third of E. coli operons are

  12. Relationship between operon preference and functional properties of persistent genes in bacterial genomes.

    Science.gov (United States)

    Bratlie, Marit S; Johansen, Jostein; Drabløs, Finn

    2010-01-28

    Genes in bacteria may be organised into operons, leading to strict co-expression of the genes that participate in the same operon. However, comparisons between different bacterial genomes have shown that much of the operon structure is dynamic on an evolutionary time scale. This indicates that there are opposing effects influencing the tendency for operon formation, and these effects may be reflected in properties like evolutionary rate, complex formation, metabolic pathways and gene fusion. We have used multi-species protein-protein comparisons to generate a high-quality set of genes that are persistent in bacterial genomes (i.e. they have close to universal distribution). We have analysed these genes with respect to operon participation and important functional properties, including evolutionary rate and protein-protein interactions. Genes for ribosomal proteins show a very slow rate of evolution. This is consistent with a strong tendency for the genes to participate in operons and for their proteins to be involved in essential and well defined complexes. Persistent genes for non-ribosomal proteins can be separated into two classes according to tendency to participate in operons. Those with a strong tendency for operon participation make proteins with fewer interaction partners that seem to participate in relatively static complexes and possibly linear pathways. Genes with a weak tendency for operon participation tend to produce proteins with more interaction partners, but possibly in more dynamic complexes and convergent pathways. Genes that are not regulated through operons are therefore more evolutionary constrained than the corresponding operon-associated genes and will on average evolve more slowly.

  13. Evolution of the hyaluronic acid synthesis (has) operon in Streptococcus zooepidemicus and other pathogenic streptococci.

    Science.gov (United States)

    Blank, Lars M; Hugenholtz, Philip; Nielsen, Lars K

    2008-07-01

    Hyaluronic acid (HA) is a ubiquitous linear polysaccharide in vertebrates and also is the capsule material of some pathogenic bacteria including group A and C streptococci. In bacteria, the HA synthase occurs in an operon (has) coding for enzymes involved in the production of HA precursors. We report two new members of the has operon family from Streptococcus equi subsp. zooepidemicus (S. zooepidemicus) and Streptococcus equi subsp. equi (S. equi). The has operon of S. zooepidemicus contains, in order, hasA, hasB, hasC, glum, and pgi, whereas these genes are separated on two operons in S. equi (hasA, hasB, hasC and hasC, glmU, pgi). The transcription start site and a sigma(70) promoter were experimentally identified 50 bp upstream of hasA in S. zooepidemicus. We performed a phylogenetic analysis of each of the has operon genes to determine the evolutionary origin(s) of the streptococcal has operon. In contrast to other capsular and exopolysaccharide operons, has operons have undergone no detectable interspecies lateral gene transfers in their construction, instead relying on intragenome gene duplication for their assembly. Specifically, hasC and glmU appear to have been duplicated into the S. zooepidemicus has operon from remotely located but near-identical paralogues most likely to improve HA productivity by gene dosage in this streptococcus. The intragene rearrangements appear to be ongoing events and the two has operons of the S. equi subspecies represent two alternatives of the same gene arrangement. A scenario for the evolution of streptococcal has operons is proposed.

  14. Expression of the entire polyhydroxybutyrate operon ofRalstonia eutrophain plants.

    Science.gov (United States)

    Mozes-Koch, Rita; Tanne, Edna; Brodezki, Alexandra; Yehuda, Ran; Gover, Ofer; Rabinowitch, Haim D; Sela, Ilan

    2017-01-01

    Previously we demonstrated that an entire bacterial operon (the PRN operon) is expressible in plants when driven by the Tomato -yellow-leaf-curl-virus (TYLCV) -derived universal vector IL-60.Petroleum-derived plastics are not degradable, and are therefore harmful to the environment. Fermentation of bacteria carrying operons for polyhydroxyalkanoates (PHAs) produces degradable bioplastics which are environmentally friendly. However, bacterial production of bioplastics is not cost-effective, and attention is turning to their production in plants. Such "green" plastics would be less expensive and environmentally friendly. Hence, attempts are being made to substitute petroleum-derived plastics with "green" plastics. However, transformation of plants with genes of operons producing bioplastics has deleterious effects. Transformation of plastids does not cause deleterious effects, however it is a complicated procedures. We have developed another TYLCV-based vector (SE100) and show that yet another bacterial operon (the phaCAB operon) when driven by SE100 is also expressed in plants. We employed the combination of SE100 and the phaCAB operon to drive the operon to the plastids and produce in plants a biodegradable plastic [polyhydroxybutyrate (PHB)].Here we indicate that the bacterial operon (phaCAB), when driven by the newly developed universal plant vector SE100 is directed to chloroplasts and produces in plants PHB, a leading PHA. The PHB-producing plants circumvent the need for complicated technical procedures. The viral vector system SE100 facilitated the production of the bio-plastic poly-3-hydroxybutyrate. This was achieved by using the full pha-CAB operon indicating that TYLCV based system can transcribe and translate genes from bacterial operons controlled by a single cis element. Our data hints to the participation of the chloroplasts in these processes.

  15. Exploring the Magnetic Field Configuration in BL Lac Using GMVA

    Directory of Open Access Journals (Sweden)

    Bindu Rani

    2016-09-01

    Full Text Available The high radio frequency polarization imaging of non-thermal emission from active galactic nuclei (AGN is a direct way to probe the magnetic field strength and structure in the immediate vicinity of supermassive black holes (SMBHs and is crucial in testing the jet-launching scenario. To explore the the magnetic field configuration at the base of jets in blazars, we took advantage of the full polarization capabilities of the Global Millimeter VLBI Array (GMVA. With an angular resolution of ∼50 micro-arcseconds (μas at 86 GHz, one could resolve scales up to ∼450 gravitational radii (for a 10 9 solar mass black hole at a redshift of 0.1. We present here the preliminary results of our study on the blazar BL Lac. Our results suggest that on sub-mas scales the core and the central jet of BL Lac are significantly polarized with two distinct regions of polarized intensity. We also noted a great morphological similarity between the 7 mm/3 mm VLBI images at very similar angular resolution.

  16. The pseudogenes of Mycobacterium leprae reveal the functional relevance of gene order within operons.

    Science.gov (United States)

    Muro, Enrique M; Mah, Nancy; Moreno-Hagelsieb, Gabriel; Andrade-Navarro, Miguel A

    2011-03-01

    Almost 50 years following the discovery of the prokaryotic operon, the functional relevance of gene order within operons remains unclear. In this work, we take advantage of the eroded genome of Mycobacterium leprae to add evidence supporting the notion that functionally less important genes have a tendency to be located at the end of its operons. M. leprae's genome includes 1133 pseudogenes and 1614 protein-coding genes and can be compared with the close genome of M. tuberculosis. Assuming M. leprae's pseudogenes to represent dispensable genes, we have studied the position of these pseudogenes in the operons of M. leprae and of their orthologs in M. tuberculosis. We observed that both tend to be located in the 3' (downstream) half of the operon (P-values of 0.03 and 0.18, respectively). Analysis of pseudogenes in all available prokaryotic genomes confirms this trend (P-value of 7.1 × 10(-7)). In a complementary analysis, we found a significant tendency for essential genes to be located at the 5' (upstream) half of the operon (P-value of 0.006). Our work provides an indication that, in prokarya, functionally less important genes have a tendency to be located at the end of operons, while more relevant genes tend to be located toward operon starts.

  17. A predictive biophysical model of translational coupling to coordinate and control protein expression in bacterial operons.

    Science.gov (United States)

    Tian, Tian; Salis, Howard M

    2015-08-18

    Natural and engineered genetic systems require the coordinated expression of proteins. In bacteria, translational coupling provides a genetically encoded mechanism to control expression level ratios within multi-cistronic operons. We have developed a sequence-to-function biophysical model of translational coupling to predict expression level ratios in natural operons and to design synthetic operons with desired expression level ratios. To quantitatively measure ribosome re-initiation rates, we designed and characterized 22 bi-cistronic operon variants with systematically modified intergenic distances and upstream translation rates. We then derived a thermodynamic free energy model to calculate de novo initiation rates as a result of ribosome-assisted unfolding of intergenic RNA structures. The complete biophysical model has only five free parameters, but was able to accurately predict downstream translation rates for 120 synthetic bi-cistronic and tri-cistronic operons with rationally designed intergenic regions and systematically increased upstream translation rates. The biophysical model also accurately predicted the translation rates of the nine protein atp operon, compared to ribosome profiling measurements. Altogether, the biophysical model quantitatively predicts how translational coupling controls protein expression levels in synthetic and natural bacterial operons, providing a deeper understanding of an important post-transcriptional regulatory mechanism and offering the ability to rationally engineer operons with desired behaviors. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  18. Vulnerabilities in Yersinia pestis caf operon are unveiled by a Salmonella vector.

    Directory of Open Access Journals (Sweden)

    Ling Cao

    Full Text Available During infection, Yersinia pestis uses its F1 capsule to enhance survival and cause virulence to mammalian host. Since F1 is produced in large quantities and secreted into the host tissues, it also serves as a major immune target. To hold this detrimental effect under proper control, Y. pestis expresses the caf operon (encoding the F1 capsule in a temperature-dependent manner. However, additional properties of the caf operon limit its expression. By overexpressing the caf operon in wild-type Salmonella enterica serovar Typhimurium under a potent promoter, virulence of Salmonella was greatly attenuated both in vitro and in vivo. In contrast, expression of the caf operon under the regulation of its native promoter exhibited negligible impairment of Salmonellae virulence. In-depth investigation revealed all individual genes in the caf operon attenuated Salmonella when overexpressed. The deleterious effects of caf operon and the caf individual genes were further confirmed when they were overexpressed in Y. pestis KIM6+. This study suggests that by using a weak inducible promoter, the detrimental effects of the caf operon are minimally manifested in Y. pestis. Thus, through tight regulation of the caf operon, Y. pestis precisely balances its capsular anti-phagocytic properties with the detrimental effects of caf during interaction with mammalian host.

  19. Vulnerabilities in Yersinia pestis caf Operon Are Unveiled by a Salmonella Vector

    Science.gov (United States)

    Cao, Ling; Lim, Timothy; Jun, SangMu; Thornburg, Theresa; Avci, Recep; Yang, Xinghong

    2012-01-01

    During infection, Yersinia pestis uses its F1 capsule to enhance survival and cause virulence to mammalian host. Since F1 is produced in large quantities and secreted into the host tissues, it also serves as a major immune target. To hold this detrimental effect under proper control, Y. pestis expresses the caf operon (encoding the F1 capsule) in a temperature-dependent manner. However, additional properties of the caf operon limit its expression. By overexpressing the caf operon in wild-type Salmonella enterica serovar Typhimurium under a potent promoter, virulence of Salmonella was greatly attenuated both in vitro and in vivo. In contrast, expression of the caf operon under the regulation of its native promoter exhibited negligible impairment of Salmonellae virulence. In-depth investigation revealed all individual genes in the caf operon attenuated Salmonella when overexpressed. The deleterious effects of caf operon and the caf individual genes were further confirmed when they were overexpressed in Y. pestis KIM6+. This study suggests that by using a weak inducible promoter, the detrimental effects of the caf operon are minimally manifested in Y. pestis. Thus, through tight regulation of the caf operon, Y. pestis precisely balances its capsular anti-phagocytic properties with the detrimental effects of caf during interaction with mammalian host. PMID:22558420

  20. Functional Operons in Secondary Metabolic Gene Clusters in Glarea lozoyensis (Fungi, Ascomycota, Leotiomycetes).

    Science.gov (United States)

    Yue, Qun; Chen, Li; Li, Yan; Bills, Gerald F; Zhang, Xinyu; Xiang, Meichun; Li, Shaojie; Che, Yongsheng; Wang, Chengshu; Niu, Xuemei; An, Zhiqiang; Liu, Xingzhong

    2015-06-16

    Operons are multigene transcriptional units which occur mostly in prokaryotes but rarely in eukaryotes. Protein-coding operons have not been reported in the Fungi even though they represent a very diverse kingdom of organisms. Here, we report a functional operon involved in the secondary metabolism of the fungus Glarea lozoyensis belonging to Leotiomycetes (Ascomycota). Two contiguous genes, glpks3 and glnrps7, encoding polyketide synthase and nonribosomal peptide synthetase, respectively, are cotranscribed into one dicistronic mRNA under the control of the same promoter, and the mRNA is then translated into two individual proteins, GLPKS3 and GLNRPS7. Heterologous expression in Aspergillus nidulans shows that the GLPKS3-GLNRPS7 enzyme complex catalyzes the biosynthesis of a novel pyrrolidinedione-containing compound, xenolozoyenone (compound 1), which indicates the operon is functional. Although it is structurally similar to prokaryotic operons, the glpks3-glnrps7 operon locus has a monophylogenic origin from fungi rather than having been horizontally transferred from prokaryotes. Moreover, two additional operons, glpks28-glnrps8 and glpks29-glnrps9, were verified at the transcriptional level in the same fungus. This is the first report of protein-coding operons in a member of the Fungi. Operons are multigene transcriptional units which occur mostly in prokaryotes but rarely in eukaryotes. Three operon-like gene structures for secondary metabolism that were discovered in the filamentous fungus Glarea lozoyensis are the first examples of protein-coding operons identified in a member of the Fungi. Among them, the glpks3-glnrps7 operon is responsible for the biosynthesis of xenolozoyenone, which is a novel tetramic acid-containing compound. Although structurally similar to prokaryotic operons, the glpks3-glnrps7 operon locus did not result from horizontal gene transfer from prokaryotes. In addition, operonlike structures have been predicted in silico to be common in

  1. The physics of protein-DNA interaction networks in the control of gene expression

    Science.gov (United States)

    Saiz, Leonor

    2012-05-01

    Protein-DNA interaction networks play a central role in many fundamental cellular processes. In gene regulation, physical interactions and reactions among the molecular components together with the physical properties of DNA control how genes are turned on and off. A key player in all these processes is the inherent flexibility of DNA, which provides an avenue for long-range interactions between distal DNA elements through DNA looping. Such versatility enables multiple interactions and results in additional complexity that is remarkably difficult to address with traditional approaches. This topical review considers recent advances in statistical physics methods to study the assembly of protein-DNA complexes with loops, their effects in the control of gene expression, and their explicit application to the prototypical lac operon genetic system of the E. coli bacterium. In the last decade, it has been shown that the underlying physical properties of DNA looping can actively control transcriptional noise, cell-to-cell variability, and other properties of gene regulation, including the balance between robustness and sensitivity of the induction process. These physical properties are largely dependent on the free energy of DNA looping, which accounts for DNA bending and twisting effects. These new physical methods have also been used in reverse to uncover the actual in vivo free energy of looping double-stranded DNA in living cells, which was not possible with existing experimental techniques. The results obtained for DNA looping by the lac repressor inside the E. coli bacterium showed a more malleable DNA than expected as a result of the interplay of the simultaneous presence of two distinct conformations of looped DNA.

  2. [New method of construction of artificial translational-coupled operons in bacterial chromosome].

    Science.gov (United States)

    Gulevich, A Iu; Skorokhodova, A Iu; Ermishev, V Iu; Krylov, A A; Minaeva, N I; Polonskaia, Z M; Zimenkov, D V; Biriukova, I V; Mashko, S V

    2009-01-01

    The new method of translational-coupled operons construction in bacterial chromosome has been developed on the basis of recombineering approach. It includes construction in vitro of the artificial operon with efficiently translated proximal cistron followed by its insertion E. coli chromosome, modification of the operon due to Red-driven insertion of the special "Junction" with excisable selective marker in the intercistronic region of the initial operon and excising the marker. The structure of this Junction has been designed and tested in the present investigation. It consists of: 1) E. coli rplC-rplD intercistronic region for placing the TAA-codon of the proximal operon's gene in the SD-sequence (TAAGGAG) of rplD; 2) Cm(R)-gene flanked by lambdaattL/R-sites in such a fashion that after lambdaInt/Xis-driven excision of the marker the residual lambdaattB-site would not contain the termination codons in frame with ATG of rplD; 3) E. coli trpE-trpD intercistronic region for location of ATG of trpD at the position of initiation codon of the distal gene of original operon. The general design of desired construction provides the conversion of the original two-cistronic operon into three-cistronic operon with translational-coupled genes, where the coupling of the artificial ORF (rplD'-lambdaattB-'trpE) with the proximal gene is occurred due to rplC-rplD intercistronic region and the coupling of this ORF with the distal gene--due to trpE-trpD. The experimental implementation of the described strategy was showed by construction of artificial operon P(tac-aroG4-serA5, where expression optimization of the distal serA5 gene was achieved via construction of three-cistronic operon with translational-coupled genes.

  3. Insights into arsenic multi-operons expression and resistance mechanisms in Rhodopseudomonas palustris CGA009.

    Science.gov (United States)

    Zhao, Chungui; Zhang, Yi; Chan, Zhuhua; Chen, Shicheng; Yang, Suping

    2015-01-01

    Arsenic (As) is widespread in the environment and causes numerous health problems. Rhodopseudomonas palustris has been regarded as a good model organism for studying arsenic detoxification since it was first demonstrated to methylate environmental arsenic by conversion to soluble or gaseous methylated species. However, the detailed arsenic resistance mechanisms remain unknown though there are at least three arsenic-resistance operons (ars1, ars2, and ars3) in R. palustris. In this study, we investigated how arsenic multi-operons contributed to arsenic detoxification in R. palustris. The expression of ars2 or ars3 operons increased with increasing environmental arsenite (As(III)) concentrations (up to 1.0 mM) while transcript of ars1 operon was not detected in the middle log-phase (55 h). ars2 operon was actively expressed even at the low concentration of As(III) (0.01 μM), whereas the ars3 operon was expressed at 1.0 μM of As(III), indicating that there was a differential regulation mechanism for the three arsenic operons. Furthermore, ars2 and ars3 operons were maximally transcribed in the early log-phase where ars2 operon was 5.4-fold higher than that of ars3 operon. A low level of ars1 transcript was only detected at 43 h (early log-phase). Arsenic speciation analysis demonstrated that R. palustris could reduce As(V) to As(III). Collectively, strain CGA009 detoxified arsenic by using arsenic reduction and methylating arsenic mechanism, while the latter might occur with the presence of higher concentrations of arsenic.

  4. lac repressor mutants with double or triple exchanges in the recognition helix bind specifically to lac operator variants with multiple exchanges.

    Science.gov (United States)

    Sartorius, J; Lehming, N; Kisters, B; von Wilcken-Bergmann, B; Müller-Hill, B

    1989-01-01

    Several lac repressor mutants have been isolated which repress beta-galactosidase synthesis in Escherichia coli up to 200-fold. They do so by binding specifically to particular symmetrical lac Oc operator variants. The mutations in the lac repressor are localized in two separate parts of the recognition helix comprising (i) residues 1 and 2 which interact with base pairs 4 and 5 of lac operator and (ii) residue 6 which recognizes operator base pair 6. Mutations of residues 1 and 2 may be combined with a mutation of residue 6. The resulting mutant protein binds specifically to an operator variant with three symmetric exchanges in base pairs 4, 5 and 6. PMID:2663473

  5. Optical Spectra Evolution of BL Lac Objects XW Bi1,∗ , BZ Wang2 ...

    Indian Academy of Sciences (India)

    Abstract. Many quasi-simultaneous optical observations of nine BL. Lac objects are obtained from literature. We study the relationship between the optical spectral index and the luminosity of BL Lac objects, and are tempted to exploit spectral evolution in the optical frequency ranges. Our results show that: (i) The optical ...

  6. Flat radio-spectrum galaxies and BL Lacs I. Core properties

    NARCIS (Netherlands)

    Dennett-Thorpe, J; Marcha, MJ

    This paper concerns the relationship of BL Lacs and flat-spectrum weak emission-line galaxies. We compare the weak emission-line galaxies and the BL Lacs in a sample of 57 flat-spectrum objects (Marcha et al. 1996), using high-frequency radio and non-thermal optical flux densities, spectral indices

  7. Transformation of lacZ using different promoters in the commercially ...

    African Journals Online (AJOL)

    Stackhouse) M. Steentoft, L.M. Irvine and W.F. Farnham with lacZ-containing plasmids by microparticle bombardment. Transient expression of the lacZ reporter gene was compared under the control of three different viral promoters including the ...

  8. Louisiana SIP: LAC 33:III Ch 21 Subchap J, 2147--Limiting Volatile Organic Compound (VOC) Emissions from Reactor Processes and Distillation Operations in Synthetic Organic Chemical manufacturing Industry (SOCMI); SIP effective 1998-02-02 (LAc74) to more..

    Science.gov (United States)

    Louisiana SIP: LAC 33:III Ch 21 Subchap J, 2147--Limiting Volatile Organic Compound (VOC) Emissions from Reactor Processes and Distillation Operations in Synthetic Organic Chemical manufacturing Industry (SOCMI); SIP effective 1998-02-02 (LAc74) more...

  9. Engineering adherent bacteria by creating a single synthetic curli operon.

    Science.gov (United States)

    Drogue, Benoît; Thomas, Philippe; Balvay, Laurent; Prigent-Combaret, Claire; Dorel, Corinne

    2012-11-16

    The method described here consists in redesigning E. coli adherence properties by assembling the minimum number of curli genes under the control of a strong and metal-overinducible promoter, and in visualizing and quantifying the resulting gain of bacterial adherence. This method applies appropriate engineering principles of abstraction and standardization of synthetic biology, and results in the BBa_K540000 Biobrick (Best new Biobrick device, engineered, iGEM 2011). The first step consists in the design of the synthetic operon devoted to curli overproduction in response to metal, and therefore in increasing the adherence abilities of the wild type strain. The original curli operon was modified in silico in order to optimize transcriptional and translational signals and escape the "natural" regulation of curli. This approach allowed to test with success our current understanding of curli production. Moreover, simplifying the curli regulation by switching the endogenous complex promoter (more than 10 transcriptional regulators identified) to a simple metal-regulated promoter makes adherence much easier to control. The second step includes qualitative and quantitative assessment of adherence abilities by implementation of simple methods. These methods are applicable to a large range of adherent bacteria regardless of biological structures involved in biofilm formation. Adherence test in 24-well polystyrene plates provides a quick preliminary visualization of the bacterial biofilm after crystal violet staining. This qualitative test can be sharpened by the quantification of the percentage of adherence. Such a method is very simple but more accurate than only crystal violet staining as described previously with both a good repeatability and reproducibility. Visualization of GFP-tagged bacteria on glass slides by fluorescence or laser confocal microscopy allows to strengthen the results obtained with the 24-well plate test by direct observation of the phenomenon.

  10. Evolution of mal ABC transporter operons in the Thermococcales and Thermotogales.

    Science.gov (United States)

    Noll, Kenneth M; Lapierre, Pascal; Gogarten, J Peter; Nanavati, Dhaval M

    2008-01-15

    The mal genes that encode maltose transporters have undergone extensive lateral transfer among ancestors of the archaea Thermococcus litoralis and Pyrococcus furiosus. Bacterial hyperthermophiles of the order Thermotogales live among these archaea and so may have shared in these transfers. The genome sequence of Thermotoga maritima bears evidence of extensive acquisition of archaeal genes, so its ancestors clearly had the capacity to do so. We examined deep phylogenetic relationships among the mal genes of these hyperthermophiles and their close relatives to look for evidence of shared ancestry. We demonstrate that the two maltose ATP binding cassette (ABC) transporter operons now found in Tc. litoralis and P. furiosus (termed mal and mdx genes, respectively) are not closely related to one another. The Tc. litoralis and P. furiosus mal genes are most closely related to bacterial mal genes while their respective mdx genes are archaeal. The genes of the two mal operons in Tt. maritima are not related to genes in either of these archaeal operons. They are highly similar to one another and belong to a phylogenetic lineage that includes mal genes from the enteric bacteria. A unique domain of the enteric MalF membrane spanning proteins found also in these Thermotogales MalF homologs supports their relatively close relationship with these enteric proteins. Analyses of genome sequence data from other Thermotogales species, Fervidobacterium nodosum, Thermosipho melanesiensis, Thermotoga petrophila, Thermotoga lettingae, and Thermotoga neapolitana, revealed a third apparent mal operon, absent from the published genome sequence of Tt. maritima strain MSB8. This third operon, mal3, is more closely related to the Thermococcales' bacteria-derived mal genes than are mal1 and mal2. F. nodosum, Ts. melanesiensis, and Tt. lettingae have only one of the mal1-mal2 paralogs. The mal2 operon from an unknown species of Thermotoga appears to have been horizontally acquired by a Thermotoga

  11. Evolution of mal ABC transporter operons in the Thermococcales and Thermotogales

    Directory of Open Access Journals (Sweden)

    Gogarten J Peter

    2008-01-01

    Full Text Available Abstract Background The mal genes that encode maltose transporters have undergone extensive lateral transfer among ancestors of the archaea Thermococcus litoralis and Pyrococcus furiosus. Bacterial hyperthermophiles of the order Thermotogales live among these archaea and so may have shared in these transfers. The genome sequence of Thermotoga maritima bears evidence of extensive acquisition of archaeal genes, so its ancestors clearly had the capacity to do so. We examined deep phylogenetic relationships among the mal genes of these hyperthermophiles and their close relatives to look for evidence of shared ancestry. Results We demonstrate that the two maltose ATP binding cassette (ABC transporter operons now found in Tc. litoralis and P. furiosus (termed mal and mdx genes, respectively are not closely related to one another. The Tc. litoralis and P. furiosus mal genes are most closely related to bacterial mal genes while their respective mdx genes are archaeal. The genes of the two mal operons in Tt. maritima are not related to genes in either of these archaeal operons. They are highly similar to one another and belong to a phylogenetic lineage that includes mal genes from the enteric bacteria. A unique domain of the enteric MalF membrane spanning proteins found also in these Thermotogales MalF homologs supports their relatively close relationship with these enteric proteins. Analyses of genome sequence data from other Thermotogales species, Fervidobacterium nodosum, Thermosipho melanesiensis, Thermotoga petrophila, Thermotoga lettingae, and Thermotoga neapolitana, revealed a third apparent mal operon, absent from the published genome sequence of Tt. maritima strain MSB8. This third operon, mal3, is more closely related to the Thermococcales' bacteria-derived mal genes than are mal1 and mal2. F. nodosum, Ts. melanesiensis, and Tt. lettingae have only one of the mal1-mal2 paralogs. The mal2 operon from an unknown species of Thermotoga appears to

  12. The REX survey as a Tool to Test the Beaming Model for BL Lacs

    Science.gov (United States)

    Caccianiga, A.; della Ceca, R.; Gioia, I. M.; Maccacaro, T.; Wolter, A.

    We present the preliminary properties of the BL Lacs discovered in the REX survey (Caccianiga et al. 1998). In particular, we discuss a few sources with optical spectral properties ``intermediate'' between those of BL Lacs and those of elliptical galaxies. These objects could harbour weak (in the optical band) sources of non-thermal continuum in their nuclei and, if confirmed, they could represent the faint tail of the BL Lac population. The existence of such ``weak'' BL Lacs is matter of discussion in recent literature (e.g. Marcha et al. 1996) and could lead to a revision of the defining criteria of a BL Lac and, consequently, of their cosmological and statistical properties.

  13. Radiocarbon measurements at LAC-UFF: Recent performance

    Science.gov (United States)

    Linares, Roberto; Macario, Kita D.; Santos, Guaciara M.; Carvalho, Carla; dos Santos, Hellen C.; Gomes, Paulo R. S.; Castro, Maikel D.; Oliveira, Fabiana M.; Alves, Eduardo Q.

    2015-10-01

    In 2012 a single stage accelerator mass spectrometer from NEC was installed at the Radiocarbon Laboratory of Universidade Federal Fluminense (LAC-UFF), Niterói, Brazil. Here, we present a status report of our facility. We discuss some modifications applied to our combustion protocol in an attempt to reduce our procedural blank, mostly to processed organic samples. Measurements of reference materials indicate low precision and accuracy that are partially related to beam optics through the acceleration tube. We observed that once the beam current intensity increases the measured 13C+/12C+ becomes erratic. Therefore, in order to maintain the AMS-δ13C values within reasonable values, so that fractionation corrections using the spectrometer 13C+/12C+ values does not affect the final 14C results, we are forced to limit the 12C- beam intensity to ⩽30 μA. This requirement was confirmed during our accuracy tests, when measuring selected annual tree-rings wood samples from a Parana pine (Araucaria angustifolia) between 1927 and 1997 previously measured at the Keck Carbon Cycle AMS Facility (KCCAMS), at the University of California, Irvine (UCI). At the LAC-UFF tree-ring wood samples were processed and measured in 4 different batches during a period of about 5 months. The 14C results were later compared to the high-precision data obtained at KCCAMS/UCI and reached a good agreement. Recently a problem associated with graphitization yield were finally identified and new measurements with secondary standards are promising.

  14. Impact of the deletion of the six mce operons in Mycobacterium smegmatis.

    Science.gov (United States)

    Klepp, Laura I; Forrellad, Marina A; Osella, Ana V; Blanco, Federico C; Stella, Emma J; Bianco, María Verónica; Santangelo, María de la Paz; Sassetti, Cristopher; Jackson, Mary; Cataldi, Angel A; Bigi, Fabiana; Morbidoni, Héctor R

    2012-07-01

    The Mycobacterium smegmatis genome contains six operons designated mce (mammalian cell entry). These operons, which encode membrane and exported proteins, are highly conserved in pathogenic and non-pathogenic mycobacteria. Although the function of the Mce protein family has not yet been established in Mycobacterium smegmatis, the requirement of the mce4 operon for cholesterol utilization and uptake by Mycobacterium tuberculosis has recently been demonstrated. In this study, we report the construction of an M. smegmatis knock-out mutant deficient in the expression of all six mce operons. The consequences of these mutations were studied by analyzing physiological parameters and phenotypic traits. Differences in colony morphology, biofilm formation and aggregation in liquid cultures were observed, indicating that mce operons of M. smegmatis are implicated in the maintenance of the surface properties of the cell. Importantly, the mutant strain showed reduced cholesterol uptake when compared to the parental strain. Further cholesterol uptake studies using single mce mutant strains showed that the mutation of operon mce4 was reponsible for the cholesterol uptake failure detected in the sextuple mce mutant. This finding demonstrates that mce4operon is involved in cholesterol transport in M. smegmatis. Copyright © 2012 Institut Pasteur. Published by Elsevier Masson SAS. All rights reserved.

  15. Highly divergent 16S rRNA sequences in ribosomal operons of Scytonema hyalinum (Cyanobacteria.

    Directory of Open Access Journals (Sweden)

    Jeffrey R Johansen

    Full Text Available A highly divergent 16S rRNA gene was found in one of the five ribosomal operons present in a species complex currently circumscribed as Scytonema hyalinum (Nostocales, Cyanobacteria using clone libraries. If 16S rRNA sequence macroheterogeneity among ribosomal operons due to insertions, deletions or truncation is excluded, the sequence heterogeneity observed in S. hyalinum was the highest observed in any prokaryotic species thus far (7.3-9.0%. The secondary structure of the 16S rRNA molecules encoded by the two divergent operons was nearly identical, indicating possible functionality. The 23S rRNA gene was examined for a few strains in this complex, and it was also found to be highly divergent from the gene in Type 2 operons (8.7%, and likewise had nearly identical secondary structure between the Type 1 and Type 2 operons. Furthermore, the 16S-23S ITS showed marked differences consistent between operons among numerous strains. Both operons have promoter sequences that satisfy consensus requirements for functional prokaryotic transcription initiation. Horizontal gene transfer from another unknown heterocytous cyanobacterium is considered the most likely explanation for the origin of this molecule, but does not explain the ultimate origin of this sequence, which is very divergent from all 16S rRNA sequences found thus far in cyanobacteria. The divergent sequence is highly conserved among numerous strains of S. hyalinum, suggesting adaptive advantage and selective constraint of the divergent sequence.

  16. N-acetylgalatosamine-mediated regulation of the aga operon by AgaR in Streptococcus pneumoniae

    Directory of Open Access Journals (Sweden)

    Muhammad Afzal

    2016-09-01

    Full Text Available Here, we analyze the transcriptomic response of Streptococcus pneumoniae D39 to N-acetylgalactosamine (NAGa. Transcriptome comparison of S. pneumoniae D39 grown NAGaM17 (0.5% NAGa + M17 to that grown in GM17 (0.5% Glucose + M17 revealed the elevated expression of various carbon metabolic genes/operons, including a PTS operon (denoted here as the aga operon, which is putatively involved in NAGa transport and utilization, in the presence of NAGa. We further studied the role of a GntR-family transcriptional regulator (denoted here as AgaR in the regulation of aga operon. Our transcriptome and RT-PCR data suggest the role of AgaR as a transcriptional repressor of the aga operon. We predicted a 20-bp operator site of AagR (5’- ATAATTAATATAACAACAAA -3’ in the promoter region of the aga operon (PbgaC, which was further verified by mutating the AgaR operator site in the respective promoter. The role of CcpA in the additional regulation of the aga operon was elucidated by further transcriptome analyses and confirmed by quantitative RT-PCR.

  17. Regulation of gene expression: Cryptic β-glucoside (bgl) operon of Escherichia coli as a paradigm

    Science.gov (United States)

    Harwani, Dharmesh

    2014-01-01

    Bacteria have evolved various mechanisms to extract utilizable substrates from available resources and consequently acquire fitness advantage over competitors. One of the strategies is the exploitation of cryptic cellular functions encoded by genetic systems that are silent under laboratory conditions, such as the bgl (β-glucoside) operon of E. coli. The bgl operon of Escherichia coli, involved in the uptake and utilization of aromatic β-glucosides salicin and arbutin, is maintained in a silent state in the wild type organism by the presence of structural elements in the regulatory region. This operon can be activated by mutations that disrupt these negative elements. The fact that the silent bgl operon is retained without accumulating deleterious mutations seems paradoxical from an evolutionary view point. Although this operon appears to be silent, specific physiological conditions might be able to regulate its expression and/or the operon might be carrying out function(s) apart from the utilization of aromatic β-glucosides. This is consistent with the observations that the activated operon confers a Growth Advantage in Stationary Phase (GASP) phenotype to Bgl+ cells and exerts its regulation on at least twelve downstream target genes. PMID:25763016

  18. Regulation of gene expression: Cryptic β-glucoside (bgl operon of Escherichia coli as a paradigm

    Directory of Open Access Journals (Sweden)

    Dharmesh Harwani

    2014-12-01

    Full Text Available Bacteria have evolved various mechanisms to extract utilizable substrates from available resources and consequently acquire fitness advantage over competitors. One of the strategies is the exploitation of cryptic cellular functions encoded by genetic systems that are silent under laboratory conditions, such as the bgl (β-glucoside operon of E. coli. The bgl operon of Escherichia coli, involved in the uptake and utilization of aromatic β-glucosides salicin and arbutin, is maintained in a silent state in the wild type organism by the presence of structural elements in the regulatory region. This operon can be activated by mutations that disrupt these negative elements. The fact that the silent bgl operon is retained without accumulating deleterious mutations seems paradoxical from an evolutionary view point. Although this operon appears to be silent, specific physiological conditions might be able to regulate its expression and/or the operon might be carrying out function(s apart from the utilization of aromatic β-glucosides. This is consistent with the observations that the activated operon confers a Growth Advantage in Stationary Phase (GASP phenotype to Bgl+ cells and exerts its regulation on at least twelve downstream target genes.

  19. LOV Histidine Kinase Modulates the General Stress Response System and Affects the virB Operon Expression in Brucella abortus.

    Directory of Open Access Journals (Sweden)

    Gabriela Sycz

    Full Text Available Brucella is the causative agent of the zoonotic disease brucellosis, and its success as an intracellular pathogen relies on its ability to adapt to the harsh environmental conditions that it encounters inside the host. The Brucella genome encodes a sensor histidine kinase containing a LOV domain upstream from the kinase, LOVHK, which plays an important role in light-regulated Brucella virulence. In this report we study the intracellular signaling pathway initiated by the light sensor LOVHK using an integrated biochemical and genetic approach. From results of bacterial two-hybrid assays and phosphotransfer experiments we demonstrate that LOVHK functionally interacts with two response regulators: PhyR and LovR, constituting a functional two-component signal-transduction system. LOVHK contributes to the activation of the General Stress Response (GSR system in Brucella via PhyR, while LovR is proposed to be a phosphate-sink for LOVHK, decreasing its phosphorylation state. We also show that in the absence of LOVHK the expression of the virB operon is down-regulated. In conclusion, our results suggest that LOVHK positively regulates the GSR system in vivo, and has an effect on the expression of the virB operon. The proposed regulatory network suggests a similar role for LOVHK in other microorganisms.

  20. The Genomic Pattern of tDNA Operon Expression in E. coli.

    Directory of Open Access Journals (Sweden)

    2005-06-01

    Full Text Available In fast-growing microorganisms, a tRNA concentration profile enriched in major isoacceptors selects for the biased usage of cognate codons. This optimizes translational rate for the least mass invested in the translational apparatus. Such translational streamlining is thought to be growth-regulated, but its genetic basis is poorly understood. First, we found in reanalysis of the E. coli tRNA profile that the degree to which it is translationally streamlined is nearly invariant with growth rate. Then, using least squares multiple regression, we partitioned tRNA isoacceptor pools to predicted tDNA operons from the E. coli K12 genome. Co-expression of tDNAs in operons explains the tRNA profile significantly better than tDNA gene dosage alone. Also, operon expression increases significantly with proximity to the origin of replication, oriC, at all growth rates. Genome location explains about 15% of expression variation in a form, at a given growth rate, that is consistent with replication-dependent gene concentration effects. Yet the change in the tRNA profile with growth rate is less than would be expected from such effects. We estimated per-copy expression rates for all tDNA operons that were consistent with independent estimates for rDNA operons. We also found that tDNA operon location, and the location dependence of expression, were significantly different in the leading and lagging strands. The operonic organization and genomic location of tDNA operons are significant factors influencing their expression. Nonrandom patterns of location and strandedness shown by tDNA operons in E. coli suggest that their genomic architecture may be under selection to satisfy physiological demand for tRNA expression at high growth rates.

  1. Fitness Effects of Network Non-Linearity Induced by Gene Expression Noise

    Science.gov (United States)

    Ray, Christian; Cooper, Tim; Balazsi, Gabor

    2012-02-01

    In the non-equilibrium dynamics of growing microbial cells, metabolic enzymes can create non-linearities in metabolite concentration because of non-linear degradation (utilization): an enzyme can saturate in the process of metabolite utilization. Increasing metabolite production past the saturation point then results in an ultrasensitive metabolite response. If the production rate of a metabolite depends on a second enzyme or other protein-mediated process, uncorrelated gene expression noise can thus cause transient metabolite concentration bursts. Such bursts are physiologically unnecessary and may represent a source of selection against the ultrasensitive switch, especially if the fluctuating metabolic intermediate is toxic. Selection may therefore favor correlated gene expression fluctuations for enzymes in the same pathway, such as by same-operon membership in bacteria. Using a modified experimental lac operon system, we are undertaking a combined theoretical-experimental approach to demonstrate that (i) the lac operon has an implicit ultrasensitive switch that we predict is avoided by gene expression correlations induced by same-operon membership; (ii) bacterial growth rates are sensitive to crossing the ultrasensitive threshold. Our results suggest that correlations in intrinsic gene expression noise are exploited by evolution to ameliorate the detrimental effects of nonlinearities in metabolite concentrations.

  2. lacZ transduced human breast cancer xenografts as an in vivo model for the study of invasion and metastasis

    DEFF Research Database (Denmark)

    Brünner, N; Thompson, E W; Spang-Thomsen, M

    1992-01-01

    . The resulting cell lines were selected for antibiotic (G418) resistance, and cell-sorted for lacZ expression. lacZ continued to be expressed in cultured cells for at least 20 passages without further G418 selection. The lacZ gene codes for beta-D-galactosidase, and cells expressing this gene stain blue...

  3. Transcription of glycolytic genes and operons in Bacillus subtilis: evidence for the presence of multiple levels of control of the gapA operon.

    Science.gov (United States)

    Ludwig, H; Homuth, G; Schmalisch, M; Dyka, F M; Hecker, M; Stülke, J

    2001-07-01

    Glycolysis is one of the main pathways of carbon catabolism in Bacillus subtilis. Although the biochemical activity of glycolytic enzymes has been studied in detail, no information about the expression of glycolytic genes has so far been available in this organism. Therefore, transcriptional analysis of all glycolytic genes was performed. The genes cggR, gapA, pgk, tpi, pgm and eno, encoding the enzymes required for the interconversion of triose phosphates, are transcribed as a hexacistronic operon as demonstrated by Northern analysis. This gapA operon is repressed by the regulator CggR. The presence of sugars and amino acids synergistically results in the induction of the gapA operon. The transcriptional start site upstream of cggR was mapped by primer extension. Transcripts originating upstream of cggR are processed near the 3' end of cggR. This endonucleolytic cleavage leads to differential stability of the resulting processing products: the monocistronic cggR message is very rapidly degraded, whereas the mRNA species encoding glycolytic enzymes exhibit much higher stability. An additional internal constitutive promoter was identified upstream of pgk. Thus, gapA is the most strongly regulated gene of this operon. The pfk pyk operon encoding phosphofructokinase and pyruvate kinase is weakly induced by glucose. In contrast, the genes pgi and fbaA, coding for phosphoglucoisomerase and fructose-1,6-bisphosphate aldolase, are constitutively expressed.

  4. The CodY-dependent clhAB2 operon is involved in cell shape, chaining and autolysis in Bacillus cereus ATCC 14579.

    Science.gov (United States)

    Huillet, Eugénie; Bridoux, Ludovic; Wanapaisan, Pagakrong; Rejasse, Agnès; Peng, Qi; Panbangred, Watanalai; Lereclus, Didier

    2017-01-01

    The Gram-positive pathogen Bacillus cereus is able to grow in chains of rod-shaped cells, but the regulation of chaining remains largely unknown. Here, we observe that glucose-grown cells of B. cereus ATCC 14579 form longer chains than those grown in the absence of glucose during the late exponential and transition growth phases, and identify that the clhAB2 operon is required for this chain lengthening phenotype. The clhAB2 operon is specific to the B. cereus group (i.e., B. thuringiensis, B. anthracis and B. cereus) and encodes two membrane proteins of unknown function, which are homologous to the Staphylococcus aureus CidA and CidB proteins involved in cell death control within glucose-grown cells. A deletion mutant (ΔclhAB2) was constructed and our quantitative image analyses show that ΔclhAB2 cells formed abnormal short chains regardless of the presence of glucose. We also found that glucose-grown cells of ΔclhAB2 were significantly wider than wild-type cells (1.47 μm ±CI95% 0.04 vs 1.19 μm ±CI95% 0.03, respectively), suggesting an alteration of the bacterial cell wall. Remarkably, ΔclhAB2 cells showed accelerated autolysis under autolysis-inducing conditions, compared to wild-type cells. Overall, our data suggest that the B. cereus clhAB2 operon modulates peptidoglycan hydrolase activity, which is required for proper cell shape and chain length during cell growth, and down-regulates autolysin activity. Lastly, we studied the transcription of clhAB2 using a lacZ transcriptional reporter in wild-type, ccpA and codY deletion-mutant strains. We found that the global transcriptional regulatory protein CodY is required for the basal level of clhAB2 expression under all conditions tested, including the transition growth phase while CcpA, the major global carbon regulator, is needed for the high-level expression of clhAB2 in glucose-grown cells.

  5. Louisiana SIP: LAC 33:III Ch. 7 - Table 1a - Secondary Ambient Air Quality Standards; SIP effective 1989-05-08 (LAc49) and 1989-08-14 (LAc50) to 2011-08-03 (LAd34 - Moved to Section 711 and revised [adds PM-2.5])

    Science.gov (United States)

    Louisiana SIP: LAC 33:III Ch. 7 - Table 1a - Secondary Ambient Air Quality Standards; SIP effective 1989-05-08 (LAc49) and 1989-08-14 (LAc50) to 2011-08-03 (LAd34 - Moved to Section 711 and revised [adds PM-2.5])

  6. Louisiana SIP: LAC 33:III Ch. 7 - Table 1 - Primary Ambient Air Quality Standards; SIP effective 1989-05-08 (LAc49) and 1989-08-14 (LAc50) to 2011-08-03 (LAd34 - Moved to Section 711 and revised [adds PM-2.5] )

    Science.gov (United States)

    Louisiana SIP: LAC 33:III Ch. 7 - Table 1 - Primary Ambient Air Quality Standards; SIP effective 1989-05-08 (LAc49) and 1989-08-14 (LAc50) to 2011-08-03 (LAd34 - Moved to Section 711 and revised [adds PM-2.5] )

  7. [Thermoanaerobacter ethanolicus gene cluster containing the alpha- and beta-galactosidases genes melA and lacA, and properties of recombinant lacA].

    Science.gov (United States)

    Volkov, I Iu; Lunina, N A; Berezina, O V; Velikodvorskaia, G A; Zverlov, V V

    2005-01-01

    The nucleotide sequence of a 4936 bp Thermoanaerobacter ethanolicus genomic DNA fragment containing the thermostable beta-galactosidase gene lacA and two incomplete open reading frames has been determined. The product of the first frame is highly homologous to alpha-galactosidases (melibiases), the product of the third frame is homologous to the alpha-D-mannosidases. The terminal area of the lacA, immediately following the stop-codon, harbors presumably a transcription termination site. Based on the location of the putative alpha-galactosidase gene melA and of the beta-galactosidase gene lacA on the T. ethanolicus chromosome, their combined transcription could be presumed. The calculated molecular mass of LacA is 86 kDa. LacA belongs to GH family 2 (GH2). Maximal activity of the purified recombinant enzyme was observed between pH values of 5.7 and 6.0 and temperatures of 75-80 degrees C. The highest activity, 480 units mg(-1), was found on lactose (Km 30 mM), the activities on pNPhGal and oNPhGal amounting to 330 and 420 units mg(-1), respectively. Immobilization on aldehyde silochrome increases the thermostability of the enzyme and keeps its high activity.

  8. Operon conservation and the evolution of trans-splicing in the phylum Nematoda

    National Research Council Canada - National Science Library

    Guiliano, David B; Blaxter, Mark L

    2006-01-01

    .... We surveyed five additional nematode species, representing three of the five major clades of the phylum Nematoda, for the presence of operons and the use of trans-spliced leaders in resolution...

  9. Incorporation of a horizontally transferred gene into an operon during cnidarian evolution.

    Directory of Open Access Journals (Sweden)

    Catherine E Dana

    Full Text Available Genome sequencing has revealed examples of horizontally transferred genes, but we still know little about how such genes are incorporated into their host genomes. We have previously reported the identification of a gene (flp that appears to have entered the Hydra genome through horizontal transfer. Here we provide additional evidence in support of our original hypothesis that the transfer was from a unicellular organism, and we show that the transfer occurred in an ancestor of two medusozoan cnidarian species. In addition we show that the gene is part of a bicistronic operon in the Hydra genome. These findings identify a new animal phylum in which trans-spliced leader addition has led to the formation of operons, and define the requirements for evolution of an operon in Hydra. The identification of operons in Hydra also provides a tool that can be exploited in the construction of transgenic Hydra strains.

  10. Parallel Evolution and Horizontal Gene Transfer of the pst Operon in Firmicutes from Oligotrophic Environments

    Directory of Open Access Journals (Sweden)

    Alejandra Moreno-Letelier

    2011-01-01

    Full Text Available The high affinity phosphate transport system (pst is crucial for phosphate uptake in oligotrophic environments. Cuatro Cienegas Basin (CCB has extremely low P levels and its endemic Bacillus are closely related to oligotrophic marine Firmicutes. Thus, we expected the pst operon of CCB to share the same evolutionary history and protein similarity to marine Firmicutes. Orthologs of the pst operon were searched in 55 genomes of Firmicutes and 13 outgroups. Phylogenetic reconstructions were performed for the pst operon and 14 concatenated housekeeping genes using maximum likelihood methods. Conserved domains and 3D structures of the phosphate-binding protein (PstS were also analyzed. The pst operon of Firmicutes shows two highly divergent clades with no correlation to the type of habitat nor a phylogenetic congruence, suggesting horizontal gene transfer. Despite sequence divergence, the PstS protein had a similar 3D structure, which could be due to parallel evolution after horizontal gene transfer events.

  11. A functional glycogen biosynthesis pathway in Lactobacillus acidophilus: expression and analysis of the glg operon

    OpenAIRE

    Goh, Yong Jun; Klaenhammer, Todd R.

    2013-01-01

    Glycogen metabolism contributes to energy storage and various physiological functions in some prokaryotes, including colonization persistence. A role for glycogen metabolism is proposed on the survival and fitness of Lactobacillus acidophilus, a probiotic microbe, in the human gastrointestinal environment. L.?acidophilus?NCFM possesses a glycogen metabolism (glg) operon consisting of glgBCDAP - amy - pgm genes. Expression of the glg operon and glycogen accumulation were carbon source- and gro...

  12. Bacterial cellulose biosynthesis: diversity of operons, subunits, products, and functions.

    Science.gov (United States)

    Römling, Ute; Galperin, Michael Y

    2015-09-01

    Recent studies of bacterial cellulose biosynthesis, including structural characterization of a functional cellulose synthase complex, provided the first mechanistic insight into this fascinating process. In most studied bacteria, just two subunits, BcsA and BcsB, are necessary and sufficient for the formation of the polysaccharide chain in vitro. Other subunits - which differ among various taxa - affect the enzymatic activity and product yield in vivo by modulating (i) the expression of the biosynthesis apparatus, (ii) the export of the nascent β-D-glucan polymer to the cell surface, and (iii) the organization of cellulose fibers into a higher-order structure. These auxiliary subunits play key roles in determining the quantity and structure of resulting biofilms, which is particularly important for the interactions of bacteria with higher organisms - leading to rhizosphere colonization and modulating the virulence of cellulose-producing bacterial pathogens inside and outside of host cells. We review the organization of four principal types of cellulose synthase operon found in various bacterial genomes, identify additional bcs genes that encode components of the cellulose biosynthesis and secretion machinery, and propose a unified nomenclature for these genes and subunits. We also discuss the role of cellulose as a key component of biofilms and in the choice between acute infection and persistence in the host. Copyright © 2015 Elsevier Ltd. All rights reserved.

  13. Bacterial cellulose biosynthesis: diversity of operons, subunits, products and functions

    Science.gov (United States)

    Römling, Ute; Galperin, Michael Y.

    2015-01-01

    Summary Recent studies of bacterial cellulose biosynthesis, including structural characterization of a functional cellulose synthase complex, provided the first mechanistic insight into this fascinating process. In most studied bacteria, just two subunits, BcsA and BcsB, are necessary and sufficient for the formation of the polysaccharide chain in vitro. Other subunits – which differ among various taxa – affect the enzymatic activity and product yield in vivo by modulating expression of biosynthesis apparatus, export of the nascent β-D-glucan polymer to the cell surface, and the organization of cellulose fibers into a higher-order structure. These auxiliary subunits play key roles in determining the quantity and structure of the resulting biofilm, which is particularly important for interactions of bacteria with higher organisms that lead to rhizosphere colonization and modulate virulence of cellulose-producing bacterial pathogens inside and outside of host cells. Here we review the organization of four principal types of cellulose synthase operons found in various bacterial genomes, identify additional bcs genes that encode likely components of the cellulose biosynthesis and secretion machinery, and propose a unified nomenclature for these genes and subunits. We also discuss the role of cellulose as a key component of biofilms formed by a variety of free-living and pathogenic bacteria and, for the latter, in the choice between acute infection and persistence in the host. PMID:26077867

  14. Intra- and intergenomic variation of ribosomal RNA operons in concurrent Alteromonas macleodii strains.

    Science.gov (United States)

    López-Pérez, Mario; Gonzaga, Aitor; Martin-Cuadrado, Ana-Belen; López-García, Purificación; Rodriguez-Valera, Francisco; Kimes, Nikole E

    2013-04-01

    Biodiversity estimates based on ribosomal operon sequence diversity rely on the premise that a sequence is characteristic of a single specific taxon or operational taxonomic unit (OTU). Here, we have studied the sequence diversity of 14 ribosomal RNA operons (rrn) contained in the genomes of two isolates (five operons in each genome) and four metagenomic fosmids, all from the same seawater sample. Complete sequencing of the isolate genomes and the fosmids establish that they represent strains of the same species, Alteromonas macleodii, with average nucleotide identity (ANI) values >97 %. Nonetheless, we observed high levels of intragenomic heterogeneity (i.e., variability between operons of a single genome) affecting multiple regions of the 16S and 23S rRNA genes as well as the internally transcribed spacer 1 (ITS-1) region. Furthermore, the ribosomal operons exhibited intergenomic heterogeneity (i.e., variability between operons located in separate genomes) in each of these regions, compounding the variability. Our data reveal the extensive heterogeneity observed in natural populations of A. macleodii at a single point in time and support the idea that distinct lineages of A. macleodii exist in the deep Mediterranean. These findings highlight the potential of rRNA fingerprinting methods to misrepresent species diversity while simultaneously failing to recognize the ecological significance of individual strains.

  15. DOOR 2.0: presenting operons and their functions through dynamic and integrated views.

    Science.gov (United States)

    Mao, Xizeng; Ma, Qin; Zhou, Chuan; Chen, Xin; Zhang, Hanyuan; Yang, Jincai; Mao, Fenglou; Lai, Wei; Xu, Ying

    2014-01-01

    We have recently developed a new version of the DOOR operon database, DOOR 2.0, which is available online at http://csbl.bmb.uga.edu/DOOR/ and will be updated on a regular basis. DOOR 2.0 contains genome-scale operons for 2072 prokaryotes with complete genomes, three times the number of genomes covered in the previous version published in 2009. DOOR 2.0 has a number of new features, compared with its previous version, including (i) more than 250,000 transcription units, experimentally validated or computationally predicted based on RNA-seq data, providing a dynamic functional view of the underlying operons; (ii) an integrated operon-centric data resource that provides not only operons for each covered genome but also their functional and regulatory information such as their cis-regulatory binding sites for transcription initiation and termination, gene expression levels estimated based on RNA-seq data and conservation information across multiple genomes; (iii) a high-performance web service for online operon prediction on user-provided genomic sequences; (iv) an intuitive genome browser to support visualization of user-selected data; and (v) a keyword-based Google-like search engine for finding the needed information intuitively and rapidly in this database.

  16. A Novel Method for Accurate Operon Predictions in All SequencedProkaryotes

    Energy Technology Data Exchange (ETDEWEB)

    Price, Morgan N.; Huang, Katherine H.; Alm, Eric J.; Arkin, Adam P.

    2004-12-01

    We combine comparative genomic measures and the distance separating adjacent genes to predict operons in 124 completely sequenced prokaryotic genomes. Our method automatically tailors itself to each genome using sequence information alone, and thus can be applied to any prokaryote. For Escherichia coli K12 and Bacillus subtilis, our method is 85 and 83% accurate, respectively, which is similar to the accuracy of methods that use the same features but are trained on experimentally characterized transcripts. In Halobacterium NRC-1 and in Helicobacterpylori, our method correctly infers that genes in operons are separated by shorter distances than they are in E.coli, and its predictions using distance alone are more accurate than distance-only predictions trained on a database of E.coli transcripts. We use microarray data from sixphylogenetically diverse prokaryotes to show that combining intergenic distance with comparative genomic measures further improves accuracy and that our method is broadly effective. Finally, we survey operon structure across 124 genomes, and find several surprises: H.pylori has many operons, contrary to previous reports; Bacillus anthracis has an unusual number of pseudogenes within conserved operons; and Synechocystis PCC6803 has many operons even though it has unusually wide spacings between conserved adjacent genes.

  17. Evolution of a tRNA operon in gamma purple bacteria.

    Science.gov (United States)

    Giroux, S; Cedergren, R

    1989-01-01

    Genomic DNA from eubacteria belonging to the gamma-3 subdivision of purple bacteria, as classified by Woese (C.R. Woese, Microbiol. Rev. 51:221-271, 1987), were probed with the argT operon of Escherichia coli encoding 5'-tRNA(Arg)-tRNA(His)-tRNA(Leu)-tRNA(Pro)-3'. The homologous operon from Vibrio harveyi was isolated and sequenced. Comparison of the five available sequences of this tRNA cluster from members of the families Enterobacteriaceae, Aeromonadaceae, and Vibrionaceae led to the conclusion that variations in different versions of this operon arose not only by point mutations but also by duplication and addition-deletion of entire tRNA genes. This data base permitted the formulation of a proposal dealing with the evolutionary history of this operon and suggested that DNA regions containing tRNA genes are active centers (hot spots) of recombination. Finally, since the operon from V. harveyi was not highly repetitive and did not contain tRNA pseudogenes, as in the Photobacterium phosphoreum operon, hybridization of genomic DNAs from different photobacterial strains with probes specific for the repeated pseudogene element was performed. We conclude that the phylogenetic distribution of the repetitive DNA is restricted to strains of P. phosphoreum. Images PMID:2687235

  18. Winter report on biological projects : Des Lacs and Lostwood Migratory Bird Refuge : 1935-1936

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — Report on biological projects taking place during the winter of 1935-1936 on Des Lacs National Wildlife Refuge and Lostwood National Wildlife Refuge. Activities...

  19. Des Lacs National Wildlife Refuge : Annual narrative report : Calendar year 2003

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — This annual narrative report for Des Lacs National Wildlife Refuge summarizes Refuge activities during the 2003 calendar year. The report begins with a summary of...

  20. Summary of wood duck boxes, Des Lacs NWR 1976-1983

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — Summary of wood duck boxes checked for eggs and activity on the Des Lacs National Wildlife Refuge from 1976 to 1983. Some years did not have any wood ducks, these...

  1. Des Lacs National Wildlife Refuge : Annual Narrative Report : Calendar Year 1984

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — This annual narrative report for Des Lacs National Wildlife Refuge outlines Refuge accomplishments during the 1984 calendar year. The report begins with a summary of...

  2. Des Lacs National Wildlife Refuge: Annual narrative report: Calendar year 1999

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — This annual narrative report for Des Lacs National Wildlife Refuge outlines Refuge accomplishments during the 1999 calendar year. The report begins with a summary of...

  3. Des Lacs National Wildlife Refuge : Annual narrative report : Calendar year 2007

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — This annual narrative report for Des Lacs National Wildlife Refuge summarizes Refuge activities during the 2007 calendar year. The report begins with a summary of...

  4. Des Lacs National Wildlife Refuge: Annual narrative report: Calendar year 1998

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — This annual narrative report for Des Lacs National Wildlife Refuge summarizes Refuge activities during the 1998 calendar year. The report begins with a summary of...

  5. 1997-1998 lake water quality assessment for Upper Des Lacs Lake, North Dakota

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — This is a summary of the data collected on Upper Des Lacs Lake as part of the State's Lake Water Quality Assessment Project. The Project is designed to characterize...

  6. Des Lacs National Wildlife Refuge: Annual narrative report: Calendar year 2001

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — This annual narrative report for Des Lacs National Wildlife Refuge summarizes Refuge activities during the 2001 calendar year. The report begins with a summary of...

  7. Des Lacs National Wildlife Refuge: Annual narrative report: Calendar year 2000

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — This annual narrative report for Des Lacs National Wildlife Refuge summarizes Refuge activities during the 2000 calendar year. The report begins with a summary of...

  8. Des Lacs National Wildlife Refuge : Annual Narrative Report : Calendar Year 1981

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — This annual narrative report for Des Lacs National Wildlife Refuge outlines Refuge accomplishments during the 1981 calendar year. The report begins with a summary of...

  9. Des Lacs National Wildlife Refuge : Annual narrative report : Calendar year 2004

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — This annual narrative report for Des Lacs National Wildlife Refuge summarizes Refuge activities during the 2004 calendar year. The report begins with a summary of...

  10. Planning and accomplishment narrative : January 1 - June 30, 1973 : Des Lacs National Wildlife Refuge

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — This planning and accomplishment report for Des Lacs National Wildlife Refuge outlines Refuge activities from January 1st through June 30th, 1973. The report begins...

  11. Des Lacs National Wildlife Refuge: Annual narrative report: Calendar year 1989

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — This annual narrative report for Des Lacs National Wildlife Refuge outlines Refuge accomplishments during the 1989 calendar year. The report begins with a summary of...

  12. Des Lacs National Wildlife Refuge: Annual narrative report: Calendar year 1994

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — This annual narrative report for Des Lacs National Wildlife Refuge outlines Refuge accomplishments during the 1994 calendar year. The report begins with a summary of...

  13. Quarterly narrative report for Des Lacs National Wildlife Refuge [May-July, 1941

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — This narrative report for Des Lacs Migratory Waterfowl Refuge outlines Refuge accomplishments from May through July of 1941. The report begins by summarizing the...

  14. Integrated Pest Management Plan 2005-2010 Des Lacs National Wildlife Refuge Complex

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — The purpose of the Integrated Pest Management Plan is to provide a comprehensive, environmentally sensitive approach to managing pests on the Des Lacs NWRC. The...

  15. Des Lacs National Wildlife Refuge : Annual Narrative Report : Calendar Year 1985

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — This annual narrative report for Des Lacs National Wildlife Refuge outlines Refuge accomplishments during the 1985 calendar year. The report begins with a summary of...

  16. Des Lacs National Wildlife Refuge : Annual narrative report : Calendar year 2005

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — This annual narrative report for Des Lacs National Wildlife Refuge summarizes Refuge activities during the 2005 calendar year. The report begins with a summary of...

  17. Narrative report September, October, November, December, 1946 Des Lacs National Wildlife Refuge & Easement Refuges - District IV

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — This narrative report for Des Lacs National Wildlife Refuge outlines Refuge accomplishments from September through December of 1946. The report begins by summarizing...

  18. Des Lacs National Wildlife Refuge: Annual narrative report: Calendar year 1990

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — This annual narrative report for Des Lacs National Wildlife Refuge outlines Refuge accomplishments during the 1990 calendar year. The report begins with a summary of...

  19. Rice Lake National Wildlife Refuge (including Mille Lacs and Sandstone): Annual narrative report: Calendar year 1985

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — This annual narrative report for Rice Lake NWR and Mille Lacs NWR outlines Refuge accomplishments during the 1985 calendar year. The report begins with a summary of...

  20. Sustaining the natural and economical resources of the Lac Courte Oreilles, Leslie Isham; Jason Weaver

    Energy Technology Data Exchange (ETDEWEB)

    Isham, Leslie; Weaver, Jason

    2013-09-30

    The Lac Courte Oreilles Band of Lake Superior Chippewa Indians, located in northwest Wisconsin has developed a project, entitled Sustaining the Natural and Economic Resources of the LCO Ojibwe. This technical report is a summary of the project.

  1. Narrative report for September, October, November and December 1944 Des Lacs National Wildlife Refuge

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — This narrative report for Des Lacs National Wildlife Refuge outlines Refuge accomplishments from September through December of 1944. The report begins by summarizing...

  2. Narrative report May, June, July, August, 1946 Des Lacs National Wildlife Refuge & Easement Refuges - District IV

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — This narrative report for Des Lacs National Wildlife Refuge outlines Refuge accomplishments from May through August of 1946. The report begins by summarizing the...

  3. Caractérisation des apports sédimentaires et morphologie du lac du ...

    African Journals Online (AJOL)

    Les resultats obtenus par l'fapplication d'fun modele debits liquides-debits solides saisonniers sur le lac d'Ayame sont tres encourageants car les coefficients de correlation varient de 0,64 a 0,91. Par ailleurs, cette etude a permis de realiser la premiere carte bathymetrique du lac d'Ayame 1, 54 ans apres sa mise en eau.

  4. STRUCTURAL ASPECTS REGARDING TO THE IMAGE OF ICE HOTEL BALEA LAC BREND

    OpenAIRE

    ZAHARIA Marian; Cristian Valentin HAPENCIUC; Ioana ZAHEU

    2008-01-01

    Applying a poll-based survey provides important information regarding the tourist offer particulars in Bâlea Lac area. On the day the survey is performed its main advantage is also outlined: the fact that this information display a good accuracy, are obtained in a short time span and involving relatively low expenses. Data collection and centralization of the answers provided by interviewed tourists regarding tourism practice in the Bâlea Lac area have led to drawing up distributions that are...

  5. Cloning and comparison of third beta-glucoside utilization (bglEFIA) operon with two operons of Pectobacterium carotovorum subsp. carotovorum LY34.

    Science.gov (United States)

    Hong, Su Young; An, Chang Long; Cho, Kye Man; Lee, Sun Mi; Kim, Yong Hee; Kim, Min Keun; Cho, Soo Jeong; Lim, Yong Pyo; Kim, Hoon; Yun, Han Dae

    2006-04-01

    A third bgl operon containing bglE, bglF, bglI, and bglA was isolated from Pectobacterium carotovorum subsp. carotovorum LY34 (Pcc LY34). The sequences of BglE, BglF, and Bgll were similar to those of the phosphotransferase system (PTS) components IIB, IIC, and IIA respectively. BglF contains important residues for the phosphotransferase system. The amino acid sequence of BglA showed high similarity to various 6-phospho-beta-glucosidases and to a member of glycosyl hydrolase family 1. Sequence and structural analysis also revealed that these four genes were organized in a putative operon that differed from two operons previously isolated from Pcc LY34, bglTPB (accession no. AY542524) and ascGFB (accession no. AY622309). The transcription regulator for this operon was not found, and the EII complexes for PTS were encoded separately by three genes (bglE, bglF, and bglI). The BglA enzyme had a molecular weight estimated to be 57,350 Da by SDS-PAGE. The purified beta-glucosidase hydrolyzed salicin, arbutin, rhoNPG, rhoNPbetaG6P, and MUG, exhibited maximal activity at pH 7.0 and 40 degrees C, and displayed enhanced activity in the presence of Mg2+ and Ca2+. Two glutamate residues (Glu178 and Glu378) were found to be essential for enzyme activity.

  6. The nif Gene Operon of the Methanogenic Archaeon Methanococcus maripaludis

    Science.gov (United States)

    Kessler, Peter S.; Blank, Carrine; Leigh, John A.

    1998-01-01

    Nitrogen fixation occurs in two domains, Archaea and Bacteria. We have characterized a nif (nitrogen fixation) gene cluster in the methanogenic archaeon Methanococcus maripaludis. Sequence analysis revealed eight genes, six with sequence similarity to known nif genes and two with sequence similarity to glnB. The gene order, nifH, ORF105 (similar to glnB), ORF121 (similar to glnB), nifD, nifK, nifE, nifN, and nifX, was the same as that found in part in other diazotrophic methanogens and except for the presence of the glnB-like genes, also resembled the order found in many members of the Bacteria. Using transposon insertion mutagenesis, we determined that an 8-kb region required for nitrogen fixation corresponded to the nif gene cluster. Northern analysis revealed the presence of either a single 7.6-kb nif mRNA transcript or 10 smaller mRNA species containing portions of the large transcript. Polar effects of transposon insertions demonstrated that all of these mRNAs arose from a single promoter region, where transcription initiated 80 bp 5′ to nifH. Distinctive features of the nif gene cluster include the presence of the six primary nif genes in a single operon, the placement of the two glnB-like genes within the cluster, the apparent physical separation of the cluster from any other nif genes that might be in the genome, the fragmentation pattern of the mRNA, and the regulation of expression by a repression mechanism described previously. Our study and others with methanogenic archaea reporting multiple mRNAs arising from gene clusters with only a single putative promoter sequence suggest that mRNA processing following transcription may be a common occurrence in methanogens. PMID:9515920

  7. Transcription analysis and small non-protein coding RNAs associated with bacterial ribosomal protein operons.

    Science.gov (United States)

    Khayrullina, G A; Raabe, C A; Hoe, C H; Becker, K; Reinhardt, R; Tang, T H; Rozhdestvensky, T S; Kopylov, A M

    2012-01-01

    For decades ribosome biogenesis and translation represent key targets in the antimicrobial drug development to combat bacterial infections. Here we report a survey of various small non-protein coding (ncRNAs) associated with ribosomal protein (r-protein) operons in the bacterial pathogens S. aureus, V. cholerae, S. Typhi and M. tuberculosis. We identified four ncRNA candidates that overlap with important structural regions involved in translational feedback regulation. Most notable are the ncRNA 55 family containing the unique recognition site of the L10-(L12)4 complex that consequently might be involved in L10 operon regulation, and ncRNA StyR 337 that resembles the pseudoknot secondary structure of the S4 regulatory region. These findings potentially implicate the candidate ncRNAs in translational regulation of the corresponding operons. In total we report 28 intergenically encoded ncRNAs that map in sense orientation to 14 ribosomal protein operons and 13 cis-antisense encoded ncRNAs transcribed complementary to nine r-protein mRNAs. All ncRNA candidates were independently validated by extensive Northern blot hybridizations to account for growth-stage specific ncRNA transcription and to check ncRNA integrity. In addition we revisited the str-operon as experimental model to monitor internal initiation of transcription in the operon throughout bacterial growth by real-time PCR. Our data indicate additional facets of ribosomal protein operons transcription, and might lead to novel insights of ribosome biogenesis, as well as exploration of strategies involving differential drug development.

  8. Multiple rRNA operons are essential for efficient cell growth and sporulation as well as outgrowth in Bacillus subtilis.

    Science.gov (United States)

    Yano, Koichi; Wada, Tetsuya; Suzuki, Shota; Tagami, Kazumi; Matsumoto, Takashi; Shiwa, Yuh; Ishige, Taichiro; Kawaguchi, Yasuhiro; Masuda, Kenta; Akanuma, Genki; Nanamiya, Hideaki; Niki, Hironori; Yoshikawa, Hirofumi; Kawamura, Fujio

    2013-11-01

    The number of copies of rRNA (rrn) operons in a bacterial genome differs greatly among bacterial species. Here we examined the phenotypic effects of variations in the number of copies of rRNA genes in the genome of Bacillus subtilis by analysis of eight mutant strains constructed to carry from two to nine copies of the rrn operon. We found that a decrease in the number of copies from ten to one increased the doubling time, and decreased the sporulation frequency and motility. The maximum levels for transformation activity were similar among the strains, although the competence development was significantly delayed in the strain with a single rrn operon. Normal sporulation only occurred if more than four copies of the rrn operon were present, although ten copies were needed for vegetative growth after germination of the spores. This behaviour was seen even though the intracellular level of ribosomes was similar among strains with four to ten copies of the rrn operon. Furthermore, ten copies of the rrn operon were needed for the highest swarming activity. We also constructed 21 strains that carried all possible combinations of two copies of the rrn operons, and found that these showed a range of growth rates and sporulation frequencies that all fell between those recorded for strains with one or three copies of the rrn operon. The results suggested that the copy number of the rrn operon has a major influence on cellular processes such as growth rate and sporulation frequency.

  9. Characterization of MarR, the repressor of the multiple antibiotic resistance (mar) operon in Escherichia coli.

    OpenAIRE

    Seoane, A S; Levy, S B

    1995-01-01

    The marRAB operon is one of two operons in the mar locus of Escherichia coli that are divergently transcribed from a central regulatory region, marO. The marRAB operon, transcribed from marOII, controls intrinsic resistance or susceptibility to multiple antibiotics and is inducible by structurally unrelated compounds such as tetracycline and chloramphenicol (S. P. Cohen, H. Hachler, and S. B. Levy, J. Bacteriol. 175:1484-1492, 1993). To clarify the role of the operon in response to environmen...

  10. Identification of an operon, Pil-Chp, that controls twitching motility and virulence in Xylella fastidiosa.

    Science.gov (United States)

    Cursino, Luciana; Galvani, Cheryl D; Athinuwat, Dusit; Zaini, Paulo A; Li, Yaxin; De La Fuente, Leonardo; Hoch, Harvey C; Burr, Thomas J; Mowery, Patricia

    2011-10-01

    Xylella fastidiosa is an important phytopathogenic bacterium that causes many serious plant diseases, including Pierce's disease of grapevines. Disease manifestation by X. fastidiosa is associated with the expression of several factors, including the type IV pili that are required for twitching motility. We provide evidence that an operon, named Pil-Chp, with genes homologous to those found in chemotaxis systems, regulates twitching motility. Transposon insertion into the pilL gene of the operon resulted in loss of twitching motility (pilL is homologous to cheA genes encoding kinases). The X. fastidiosa mutant maintained the type IV pili, indicating that the disrupted pilL or downstream operon genes are involved in pili function, and not biogenesis. The mutated X. fastidiosa produced less biofilm than wild-type cells, indicating that the operon contributes to biofilm formation. Finally, in planta the mutant produced delayed and less severe disease, indicating that the Pil-Chp operon contributes to the virulence of X. fastidiosa, presumably through its role in twitching motility.

  11. Quantifying translational coupling in E. coli synthetic operons using RBS modulation and fluorescent reporters.

    Science.gov (United States)

    Levin-Karp, Ayelet; Barenholz, Uri; Bareia, Tasneem; Dayagi, Michal; Zelcbuch, Lior; Antonovsky, Niv; Noor, Elad; Milo, Ron

    2013-06-21

    Translational coupling is the interdependence of translation efficiency of neighboring genes encoded within an operon. The degree of coupling may be quantified by measuring how the translation rate of a gene is modulated by the translation rate of its upstream gene. Translational coupling was observed in prokaryotic operons several decades ago, but the quantitative range of modulation translational coupling leads to and the factors governing this modulation were only partially characterized. In this study, we systematically quantify and characterize translational coupling in E. coli synthetic operons using a library of plasmids carrying fluorescent reporter genes that are controlled by a set of different ribosome binding site (RBS) sequences. The downstream gene expression level is found to be enhanced by the upstream gene expression via translational coupling with the enhancement level varying from almost no coupling to over 10-fold depending on the upstream gene's sequence. Additionally, we find that the level of translational coupling in our system is similar between the second and third locations in the operon. The coupling depends on the distance between the stop codon of the upstream gene and the start codon of the downstream gene. This study is the first to systematically and quantitatively characterize translational coupling in a synthetic E. coli operon. Our analysis will be useful in accurate manipulation of gene expression in synthetic biology and serves as a step toward understanding the mechanisms involved in translational expression modulation.

  12. Cop-like operon: Structure and organization in species of the Lactobacillale order

    Directory of Open Access Journals (Sweden)

    ANGÉLICA REYES

    2006-01-01

    Full Text Available Copper is an essential and toxic trace metal for bacteria and, therefore, must be tightly regulated in the cell. Enterococcus hirae is a broadly studied model for copper homeostasis. The intracellular copper levels in E. hirae are regulated by the cop operon, which is formed by four genes: copA and copB that encode ATPases for influx and efflux of copper, respectively; copZ that encodes a copper chaperone; and copY, a copper responsive repressor. Since the complete genome sequence for E. hirae is not available, it is possible that other genes may encode proteins involved in copper homeostasis. Here, we identified a cop-like operon in nine species of Lactobacillale order with a known genome sequence. All of them always encoded a CopY-like repressor and a copper ATPase. The alignment of the cop-like operon promoter region revealed two CopY binding sites, one of which was conserved in all strains, and the second was only present in species of Streptococcus genus and L. johnsonii. Additional proteins associated to copper metabolism, CutC and Cupredoxin, also were detected. This study allowed for the description of the structure and organization of the cop operon and discussion of a phylogenetic hypothesis based on the differences observed in this operon's organization and its regulation in Lactobacillale order.

  13. Burkholderia contaminans Biofilm Regulating Operon and Its Distribution in Bacterial Genomes

    Directory of Open Access Journals (Sweden)

    Olga L. Voronina

    2016-01-01

    Full Text Available Biofilm formation by Burkholderia spp. is a principal cause of lung chronic infections in cystic fibrosis patients. A “lacking biofilm production” (LBP strain B. contaminans GIMC4587:Bct370-19 has been obtained by insertion modification of clinical strain with plasposon mutagenesis. It has an interrupted transcriptional response regulator (RR gene. The focus of our investigation was a two-component signal transduction system determination, including this RR. B. contaminans clinical and LBP strains were analyzed by whole genome sequencing and bioinformatics resources. A four-component operon (BiofilmReg has a key role in biofilm formation. The relative location (i.e., by being separated by another gene of RR and histidine kinase genes is unique in BiofilmReg. Orthologs were found in other members of the Burkholderiales order. Phylogenetic analysis of strains containing BiofilmReg operons demonstrated evidence for earlier inheritance of a three-component operon. During further evolution one lineage acquired a fourth gene, whereas others lost the third component of the operon. Mutations in sensor domains have created biodiversity which is advantageous for adaptation to various ecological niches. Different species Burkholderia and Achromobacter strains all demonstrated similar BiofilmReg operon structure. Therefore, there may be an opportunity to develop a common drug which is effective for treating all these causative agents.

  14. Burkholderia contaminans Biofilm Regulating Operon and Its Distribution in Bacterial Genomes.

    Science.gov (United States)

    Voronina, Olga L; Kunda, Marina S; Ryzhova, Natalia N; Aksenova, Ekaterina I; Semenov, Andrey N; Romanova, Yulia M; Gintsburg, Alexandr L

    2016-01-01

    Biofilm formation by Burkholderia spp. is a principal cause of lung chronic infections in cystic fibrosis patients. A "lacking biofilm production" (LBP) strain B. contaminans GIMC4587:Bct370-19 has been obtained by insertion modification of clinical strain with plasposon mutagenesis. It has an interrupted transcriptional response regulator (RR) gene. The focus of our investigation was a two-component signal transduction system determination, including this RR. B. contaminans clinical and LBP strains were analyzed by whole genome sequencing and bioinformatics resources. A four-component operon (BiofilmReg) has a key role in biofilm formation. The relative location (i.e., by being separated by another gene) of RR and histidine kinase genes is unique in BiofilmReg. Orthologs were found in other members of the Burkholderiales order. Phylogenetic analysis of strains containing BiofilmReg operons demonstrated evidence for earlier inheritance of a three-component operon. During further evolution one lineage acquired a fourth gene, whereas others lost the third component of the operon. Mutations in sensor domains have created biodiversity which is advantageous for adaptation to various ecological niches. Different species Burkholderia and Achromobacter strains all demonstrated similar BiofilmReg operon structure. Therefore, there may be an opportunity to develop a common drug which is effective for treating all these causative agents.

  15. The diversity of membrane transporters encoded in bacterial arsenic-resistance operons

    Directory of Open Access Journals (Sweden)

    Yiren Yang

    2015-05-01

    Full Text Available Transporter-facilitated arsenite extrusion is the major pathway of arsenic resistance within bacteria. So far only two types of membrane-bound transporter proteins, ArsB and ArsY (ACR3, have been well studied, although the arsenic transporters in bacteria display considerable diversity. Utilizing accumulated genome sequence data, we searched arsenic resistance (ars operons in about 2,500 bacterial strains and located over 700 membrane-bound transporters which are encoded in these operons. Sequence analysis revealed at least five distinct transporter families, with ArsY being the most dominant, followed by ArsB, ArsP (a recently reported permease family, Major Facilitator protein Superfamily (MFS and Major Intrinsic Protein (MIP. In addition, other types of transporters encoded in the ars operons were found, but in much lower frequencies. The diversity and evolutionary relationships of these transporters with regard to arsenic resistance will be discussed.

  16. Footprints of Optimal Protein Assembly Strategies in the Operonic Structure of Prokaryotes

    Directory of Open Access Journals (Sweden)

    Jan Ewald

    2015-04-01

    Full Text Available In this work, we investigate optimality principles behind synthesis strategies for protein complexes using a dynamic optimization approach. We show that the cellular capacity of protein synthesis has a strong influence on optimal synthesis strategies reaching from a simultaneous to a sequential synthesis of the subunits of a protein complex. Sequential synthesis is preferred if protein synthesis is strongly limited, whereas a simultaneous synthesis is optimal in situations with a high protein synthesis capacity. We confirm the predictions of our optimization approach through the analysis of the operonic organization of protein complexes in several hundred prokaryotes. Thereby, we are able to show that cellular protein synthesis capacity is a driving force in the dissolution of operons comprising the subunits of a protein complex. Thus, we also provide a tested hypothesis explaining why the subunits of many prokaryotic protein complexes are distributed across several operons despite the presumably less precise co-regulation.

  17. The pyrimidine operon pyrRPB-carA from Lactococcus lactis

    DEFF Research Database (Denmark)

    Martinussen, Jan; Schallert, J.; Andersen, Birgit

    2001-01-01

    The four genes pyrR, pyrP, pyrB, and carA were found to constitute an operon in Lactococcus lactis subsp, lactis MG1363. The functions of the different genes were established by mutational analysis. The first gene in the operon is the pyrimidine regulatory gene, pyrR, which is responsible...... for the regulation of the expression of the pyrimidine biosynthetic genes leading to UMP formation. The second gene encodes a membrane-bound high-affinity uracil permease, required for utilization of exogenous uracil. The last two genes in the operon, pyrB and carA, encode pyrimidine biosynthetic enzymes; aspartate...... transcarbamoylase (pyrB) is the second enzyme in the pathway, whereas carbamoyl-phosphate synthetase subunit A (carA) is the small subunit of a heterodimeric enzyme, catalyzing the formation of carbamoyl phosphate. The carA gene product is shown to be required for both pyrimidine and arginine biosynthesis...

  18. Can CF3-Functionalized La@C60 Be Isolated Experimentally and Become Superconducting?

    Science.gov (United States)

    Guan, Jie; Tománek, David

    2017-06-01

    Superconducting behavior even under harsh ambient conditions is expected to occur in La@C(60) if it could be isolated from the primary metallofullerene soot when functionalized by CF(3) radicals. We use ab initio density functional theory calculations to compare the stability and electronic structure of C(60) and the La@C(60) endohedral metallofullerene to their counterparts functionalized by CF(3). We found that CF(3) radicals favor binding to C(60) and La@C(60), and have identified the most stable isomers. Structures with an even number m of radicals are energetically preferred for C(60) and structures with odd m for La@C(60) due to the extra charge on the fullerene. This is consistent with a wide HOMO-LUMO gap in La@C(60)(CF(3))(m) with odd m, causing extra stabilization in the closed-shell electronic configuration. CF(3) radicals are both stabilizing agents and molecular separators in a metallic crystal, which could increase the critical temperature for superconductivity.

  19. Fine-tuned transcriptional regulation of malate operons in Enterococcus faecalis.

    Science.gov (United States)

    Mortera, Pablo; Espariz, Martín; Suárez, Cristian; Repizo, Guillermo; Deutscher, Josef; Alarcón, Sergio; Blancato, Víctor; Magni, Christian

    2012-03-01

    In Enterococcus faecalis, the mae locus is constituted by two putative divergent operons, maePE and maeKR. The first operon encodes a putative H(+)/malate symporter (MaeP) and a malic enzyme (MaeE) previously shown to be essential for malate utilization in this bacterium. The maeKR operon encodes two putative proteins with significant similarity to two-component systems involved in sensing malate and activating its assimilation in bacteria. Our transcriptional and genetic assays showed that maePE and maeKR are induced in response to malate by the response regulator MaeR. In addition, we observed that both operons were partially repressed in the presence of glucose. Accordingly, the cometabolism of this sugar and malate was detected. The binding of the complex formed by CcpA and its corepressor P-Ser-HPr to a cre site located in the mae region was demonstrated in vitro and explains the carbon catabolite repression (CCR) observed for the maePE operon. However, our results also provide evidence for a CcpA-independent CCR mechanism regulating the expression of both operons. Finally, a biomass increment of 40 or 75% was observed compared to the biomass of cells grown only on glucose or malate, respectively. Cells cometabolizing both carbon sources exhibit a higher rate of glucose consumption and a lower rate of malate utilization. The growth improvement achieved by E. faecalis during glucose-malate cometabolism might explain why this microorganism employs different regulatory systems to tightly control the assimilation of both carbon sources.

  20. Transcriptional regulation of the virR operon of the intracellular pathogen Rhodococcus equi.

    Science.gov (United States)

    Byrne, Gavin A; Russell, Dean A; Chen, Xiaoxiao; Meijer, Wim G

    2007-07-01

    The virR operon, located on the virulence plasmid of the intracellular pathogen Rhodococcus equi, contains five genes, two of which (virR and orf8) encode transcriptional regulators. The first gene of the operon (virR), encoding a LysR-type transcriptional regulator, is transcribed at a constitutive low level, whereas the four downstream genes are induced by low pH and high growth temperature. Differential regulation of the virR operon genes could not be explained by differential mRNA stability, as there were no major differences in mRNA half-lives of the transcripts representing each of the five genes within the virR operon. Transcription of virR is driven by the P(virR) promoter, with a transcription start site 53 bp upstream of the virR initiation codon. The four genes downstream of virR are transcribed from P(virR) and from a second promoter, P(orf5), located 585 bp downstream of the virR initiation codon. VirR binds to a site overlapping the initiation codon of virR, resulting in negative autoregulation of the virR gene, explaining its low constitutive transcription level. The P(orf5) promoter is induced by high temperature and low pH, thus explaining the observed differential gene expression of the virR operon. VirR has a positive effect on P(orf5) activity, whereas the response regulator encoded by orf8 is not involved in regulating transcription of the virR operon. The P(virR) promoter is strikingly similar to those recognized by the principal sigma factors of Streptomyces and Mycobacterium, whereas the P(orf5) promoter does not share sequence similarity with P(virR). This suggests that P(orf5) is recognized by an alternative sigma factor.

  1. Operon Conservation and the Evolution of trans-Splicing in the Phylum Nematoda

    OpenAIRE

    Guiliano, David B.; Blaxter, Mark L.

    2006-01-01

    The nematode Caenorhabditis elegans is unique among model animals in that many of its genes are cotranscribed as polycistronic pre-mRNAs from operons. The mechanism by which these operonic transcripts are resolved into mature mRNAs includes trans-splicing to a family of SL2-like spliced leader exons. SL2-like spliced leaders are distinct from SL1, the major spliced leader in C. elegans and other nematode species. We surveyed five additional nematode species, representing three of the five maj...

  2. Evidence for Vertical Inheritance and Loss of the Leukotoxin Operon in Genus Mannheimia

    DEFF Research Database (Denmark)

    Larsen, Jesper; Pedersen, Anders Gorm; Christensen, Henrik

    2007-01-01

    as a commensal in the ovine rumen. We have tested the hypothesis that horizontal gene transfer of the leukotoxin operon has catalyzed pathogenic adaptation and speciation of M. haemolytica + M. glucosida, or other major subclades, by using a strategy that combines compositional and phylogenetic methods. We show....... On one hand, it opposes the hypothesis of horizontal gene transfer as a catalyst of pathogenic adaptation and speciation. On the other hand, it indicates that losses of the leukotoxin operons in the radiating lineages of M. ruminalis have catalyzed their adaptation to a commensal environment...

  3. UlaR activates expression of the ula operon in Streptococcus pneumoniae in the presence of ascorbic acid

    NARCIS (Netherlands)

    Afzal, Muhammad; Shafeeq, Sulman; Henriques-Normark, Birgitta; Kuipers, Oscar P

    In this study, the regulatory mechanism of the ula (utilization of l-ascorbic acid) operon, putatively responsible for transport and utilization of ascorbic acid in Streptococcus pneumoniae strain D39, is studied. β-Galactosidase assay data demonstrate that expression of the ula operon is increased

  4. Repression of the pyr operon in Lactobacillus plantarum prevents its ability to grow at low carbon dioxide levels

    DEFF Research Database (Denmark)

    Nicoloff, Hervé; Elagöz, Aram; Arsène-Ploetze, Florence

    2005-01-01

    (encoding CPS-A) responds to arginine availability, whereas pyrAaAb (encoding CPS-P) is part of the pyrR1BCAaAbDFE operon coding for the de novo pyrimidine pathway repressed by exogenous uracil. The pyr operon is regulated by transcription attenuation mediated by a trans-acting repressor that binds...

  5. Inhibition of Transcription of the Histidine Operon In Vitro by the First Enzyme of the Histidine Pathway

    Science.gov (United States)

    Blasi, Francesco; Bruni, Carmelo B.; Avitabile, Alessandra; Deeley, Roger G.; Goldberger, Robert F.; Meyers, Marilyn M.

    1973-01-01

    An in vitro system was developed for transcription of the histidine operon of Esherichia coli carried in the genome of a defective ϕ80 transducing phage. The messenger RNA (mRNA) of the histidine operon synthesized in the in vitro system was detected by hybridization to single strands of both ϕ80 and ϕ80dhis DNA, and by competition of this hybridization with unlabeled histidine mRNA that had been synthesized in vivo (RNA extracted from cells in which the histidine operon had been derepressed). Under the conditions used, RNA complementary to the histidine operon was about 15% of the total RNA that was synthesized in vitro from the ϕ80dhis DNA template. The RNA complementary to the histidine operon was synthesized on the “sense” strand (the R strand) of ϕ80dhis in the form of a polycistronic message with a sedimentation coefficient (about 38 S) very close to that observed for the histidine mRNA synthesized in vivo. Synthesis of the histidine operon RNA appears to be subject to control in vitro. Addition of the first enzyme of the pathway for histidine biosynthesis blocked transcription of the histidine operon specifically, strongly suggesting that this enzyme acts as a regulatory protein for the histidine operon. PMID:4582195

  6. Transcriptional regulation of the Aggregatibacter actinomycetemcomitans ygiW-qseBC operon by QseB and integration host factor proteins.

    Science.gov (United States)

    Juárez-Rodríguez, María Dolores; Torres-Escobar, Ascención; Demuth, Donald R

    2014-12-01

    The QseBC two-component system plays a pivotal role in regulating virulence and biofilm growth of the oral pathogen Aggregatibacter actinomycetemcomitans. We previously showed that QseBC autoregulates the ygiW-qseBC operon. In this study, we characterized the promoter that drives ygiW-qseBC expression. Using lacZ transcriptional fusion constructs and 5'-rapid amplification of cDNA ends, we showed that ygiW-qseBC expression is driven by a promoter that initiates transcription 53 bases upstream of ygiW and identified putative cis-acting promoter elements, whose function was confirmed using site-specific mutagenesis. Using electrophoretic mobility shift assays, two trans-acting proteins were shown to interact with the ygiW-qseBC promoter. The QseB response regulator bound to probes containing the direct repeat sequence CTTAA-N6-CTTAA, where the CTTAA repeats flank the -35 element of the promoter. The ygiW-qseBC expression could not be detected in A. actinomycetemcomitans ΔqseB or ΔqseBC strains, but was restored to WT levels in the ΔqseBC mutant when complemented by single copy chromosomal insertion of qseBC. Interestingly, qseB partially complemented the ΔqseBC strain, suggesting that QseB could be activated in the absence of QseC. QseB activation required its phosphorylation since complementation did not occur using qseB(pho-), encoding a protein with the active site aspartate substituted with alanine. These results suggest that QseB is a strong positive regulator of ygiW-qseBC expression. In addition, integration host factor (IHF) bound to two sites in the promoter region and an additional site near the 5' end of the ygiW ORF. The expression of ygiW-qseBC was increased by twofold in ΔihfA and ΔihfB strains of A. actinomycetemcomitans, suggesting that IHF is a negative regulator of the ygiW-qseBC operon. © 2014 The Authors.

  7. The Radio-optical Spectra of BL Lacs and Possible Relatives

    Science.gov (United States)

    Dennett-Thorpe, J.

    I consider the suggestion that, in a complete sample of flat-spectrum radio sources with available optical spectra (Marcha et al 1996), the strong emission line objects, or those with passive elliptical spectra are close relatives of the BL Lacs. New observations at four frequencies from 8 to 43GHz are presented, together with evidence for radio variability. Combined with other radio and optical data from the literature, we are able to construct the non-thermal SEDs and use these to address the questions: are the optically passive objects potentially `unrecognised' BL Lacs (either intrinsically weak and/or hidden by starlight)? What is the relationship between the surprising number of strong emission-line objects and the BL Lacs?

  8. What can BeppoSAX tell us about X-ray spectra of BL Lacs?

    Energy Technology Data Exchange (ETDEWEB)

    Wolter, Anna; Comastri, Andrea; Ghisellini, Gabriele; Giommi, Paolo; Guainazzi, Matteo; Maccacaro, Tommaso; Maraschi, Laura; Padovani, Paolo; Raiteri, Claudia; Tagliaferri, Gianpiero; Urry, C. Megan; Villata, Massimo

    1999-01-01

    The wide energy band of BeppoSAX, together with its good energy resolution, offers the opportunity to investigate the overall X-ray spectra of BL Lacs, in order to measure in detail their shape, to establish where the Compton component becomes dominant over the synchrotron component. We present here preliminary results from the first year of BeppoSAX observations for a sample of soft X-ray selected BL Lacs. Ten XBL have been observed and analyzed so far: variability with respect to previous observations is very common, spectra are generally well fitted by a single power law, although a few examples of more complex spectra are present. We show BeppoSAX spectra and compare the results on the correlation between the X-ray slope and the peak frequency of the overall spectral energy distribution with those for a sample of radio selected BL Lacs.

  9. STRUCTURAL ASPECTS REGARDING TO THE IMAGE OF ICE HOTEL BALEA LAC BREND

    Directory of Open Access Journals (Sweden)

    Marian ZAHARIA

    2008-06-01

    Full Text Available Applying a poll-based survey provides important information regarding the tourist offer particulars in Bâlea Lac area. On the day the survey is performed its main advantage is also outlined: the fact that this information display a good accuracy, are obtained in a short time span and involving relatively low expenses. Data collection and centralization of the answers provided by interviewed tourists regarding tourism practice in the Bâlea Lac area have led to drawing up distributions that are presented in the paper. Based on the respective information, statistics methods adequate to the study of tourist opinion on the Bâlea Lac Ice Hotel brand image. Several issues have been outlined, regarding the types of respondents based on their category, Romanian or foreigners, from Romania and based on destination countries, function of: the type of stay; the means of information; their answers referring to their first arrival at Bâlea Lac; the degree of destination assessment; their opinion on host reception; their preference for Bâlea Lac; appreciating value for money; age groups; gender; social and professional standing. The image created through the attractions and services provided in the Bâlea Lac tourist area by tourism activities closely related to the Ice Hotel is well appreciated, so that they have opened up a rather favourable expectancy for those willing to come back and for those tempted to try and spend their holidays in the presented hotel.

  10. Water resources of the Lac Qui Parle River Watershed, Southwestern Minnesota

    Science.gov (United States)

    Cotter, R.D.; Bidwell, L.E.

    1968-01-01

    The Lac qui Parle River watershed is underlain by thick water-bearing sections of glacial drift and Cretaceous rocks. Drainage is from the Coteau des Praries, a plateau in the southwest, to the Lac qui Parle reservoir, about 800 feet lower than the plateau. The term "watershed" as used in this report refers to that part of the drainage basin (767 square miles) within Minnesota. The total area of the drainage basin, including South Dakota, is 1110 square miles. Most waters from the watershed are of good quality.

  11. effort de pêche et production piscicole au lac d'ayame i

    African Journals Online (AJOL)

    USER

    Le suivi mensuel des pêches entre août 2004 et juillet 2005 dans les trois principaux débarcadères du lac d'Ayamé I a permis d'évaluer la production piscicole à 236,9 t de poisson dans ces stations. Cette production a été estimée à 381,8 t, à l'échelle du lac ; ce qui demeure nettement inférieure aux 1060 t produites en ...

  12. Novel Functions and Regulation of Cryptic Cellobiose Operons in Escherichia coli.

    Directory of Open Access Journals (Sweden)

    Vinuselvi Parisutham

    Full Text Available Presence of cellobiose as a sole carbon source induces mutations in the chb and asc operons of Escherichia coli and allows it to grow on cellobiose. We previously engineered these two operons with synthetic constitutive promoters and achieved efficient cellobiose metabolism through adaptive evolution. In this study, we characterized two mutations observed in the efficient cellobiose metabolizing strain: duplication of RBS of ascB gene, (β-glucosidase of asc operon and nonsense mutation in yebK, (an uncharacterized transcription factor. Mutations in yebK play a dominant role by modulating the length of lag phase, relative to the growth rate of the strain when transferred from a rich medium to minimal cellobiose medium. Mutations in ascB, on the other hand, are specific for cellobiose and help in enhancing the specific growth rate. Taken together, our results show that ascB of the asc operon is controlled by an internal putative promoter in addition to the native cryptic promoter, and the transcription factor yebK helps to remodel the host physiology for cellobiose metabolism. While previous studies characterized the stress-induced mutations that allowed growth on cellobiose, here, we characterize the adaptation-induced mutations that help in enhancing cellobiose metabolic ability. This study will shed new light on the regulatory changes and factors that are needed for the functional coupling of the host physiology to the activated cryptic cellobiose metabolism.

  13. Redundant phenazine operons in Pseudomonas aeruginosa exhibit environment-dependent expression and differential roles in pathogenicity.

    Science.gov (United States)

    Recinos, David A; Sekedat, Matthew D; Hernandez, Adriana; Cohen, Taylor Sitarik; Sakhtah, Hassan; Prince, Alice S; Price-Whelan, Alexa; Dietrich, Lars E P

    2012-11-20

    Evolutionary biologists have postulated that several fitness advantages may be conferred by the maintenance of duplicate genes, including environmental adaptation resulting from differential regulation. We examined the expression and physiological contributions of two redundant operons in the adaptable bacterium Pseudomonas aeruginosa PA14. These operons, phzA1-G1 (phz1) and phzA2-G2 (phz2), encode nearly identical sets of proteins that catalyze the synthesis of phenazine-1-carboxylic acid, the precursor for several phenazine derivatives. Phenazines perform diverse roles in P. aeruginosa physiology and act as virulence factors during opportunistic infections of plant and animal hosts. Although reports have indicated that phz1 is regulated by the Pseudomonas quinolone signal, factors controlling phz2 expression have not been identified, and the relative contributions of these redundant operons to phenazine biosynthesis have not been evaluated. We found that in liquid cultures, phz1 was expressed at higher levels than phz2, although phz2 showed a greater contribution to phenazine production. In colony biofilms, phz2 was expressed at high levels, whereas phz1 expression was not detectable, and phz2 was responsible for virtually all phenazine production. Analysis of mutants defective in quinolone signal synthesis revealed a critical role for 4-hydroxy-2-heptylquinoline in phz2 induction. Finally, deletion of phz2, but not of phz1, decreased lung colonization in a murine model of infection. These results suggest that differential regulation of the redundant phz operons allows P. aeruginosa to adapt to diverse environments.

  14. Efficient metabolic pathway engineering in transgenic tobacco and tomato plastids with synthetic multigene operons.

    Science.gov (United States)

    Lu, Yinghong; Rijzaani, Habib; Karcher, Daniel; Ruf, Stephanie; Bock, Ralph

    2013-02-19

    The engineering of complex metabolic pathways requires the concerted expression of multiple genes. In plastids (chloroplasts) of plant cells, genes are organized in operons that are coexpressed as polycistronic transcripts and then often are processed further into monocistronic mRNAs. Here we have used the tocochromanol pathway (providing tocopherols and tocotrienols, collectively also referred to as "vitamin E") as an example to establish principles of successful multigene engineering by stable transformation of the chloroplast genome, a technology not afflicted with epigenetic variation and/or instability of transgene expression. Testing a series of single-gene constructs (encoding homogentisate phytyltransferase, tocopherol cyclase, and γ-tocopherol methyltransferase) and rationally designed synthetic operons in tobacco and tomato plants, we (i) confirmed previous results suggesting homogentisate phytyltransferase as the limiting enzymatic step in the pathway, (ii) comparatively characterized the bottlenecks in tocopherol biosynthesis in transplastomic leaves and tomato fruits, and (iii) achieved an up to tenfold increase in total tocochromanol accumulation. In addition, our results uncovered an unexpected light-dependent regulatory link between tocochromanol metabolism and the pathways of photosynthetic pigment biosynthesis. The synthetic operon design developed here will facilitate future synthetic biology applications in plastids, especially the design of artificial operons that introduce novel biochemical pathways into plants.

  15. Unity in organisation and regulation of catabolic operons in Lactobacillus plantarum, Lactococcus lactis and Listeria monocytogenes

    NARCIS (Netherlands)

    Andersson, U.; Molenaar, D.; Radstrom, P.; Vos, de W.M.

    2005-01-01

    Global regulatory circuits together with more specific local regulators play a notable role when cells are adapting to environmental changes. Lactococcus lactis is a lactic acid bacterium abundant in nature fermenting most mono- and disaccharides. Comparative genomics analysis of the operons

  16. Differential control of Salmonella heat shock operons by structured mRNAs.

    Science.gov (United States)

    Cimdins, Annika; Roßmanith, Johanna; Langklotz, Sina; Bandow, Julia E; Narberhaus, Franz

    2013-08-01

    DnaK-DnaJ-GrpE and GroES-GroEL are the major chaperone machineries in bacteria. In many species, dnaKJ and groESL are encoded in bicistronic operons. Quantitative proteomics revealed that DnaK and GroEL amounts in Salmonella dominate over DnaJ and GroES respectively. An imperfect transcriptional terminator in the intergenic region of dnaKJ is known to result in higher transcript levels of the first gene. Here, we examined the groESL operon and asked how the second gene in a heat shock operon can be preferentially expressed and found that an RNA structure in the 5'untranslated region of groES is responsible. The secondary structure masks the Shine-Dalgarno (SD) sequence and AUG start codon and thereby modulates translation of groES mRNA. Reporter gene assays combined with structure probing and toeprinting analysis revealed a dynamic temperature-sensitive RNA structure. Following an increase in temperature, only the second of two RNA hairpins melts and partially liberates the SD sequence, thus facilitating translation. Translation of groEL is not temperature-regulated leading to an excess of the chaperonin in the cell at low temperature. Discussion in a broader context shows how structured RNA segments can differentially control expression of temperature-affected operons in various ways. © 2013 John Wiley & Sons Ltd.

  17. Novel Functions and Regulation of Cryptic Cellobiose Operons in Escherichia coli.

    Science.gov (United States)

    Parisutham, Vinuselvi; Lee, Sung Kuk

    2015-01-01

    Presence of cellobiose as a sole carbon source induces mutations in the chb and asc operons of Escherichia coli and allows it to grow on cellobiose. We previously engineered these two operons with synthetic constitutive promoters and achieved efficient cellobiose metabolism through adaptive evolution. In this study, we characterized two mutations observed in the efficient cellobiose metabolizing strain: duplication of RBS of ascB gene, (β-glucosidase of asc operon) and nonsense mutation in yebK, (an uncharacterized transcription factor). Mutations in yebK play a dominant role by modulating the length of lag phase, relative to the growth rate of the strain when transferred from a rich medium to minimal cellobiose medium. Mutations in ascB, on the other hand, are specific for cellobiose and help in enhancing the specific growth rate. Taken together, our results show that ascB of the asc operon is controlled by an internal putative promoter in addition to the native cryptic promoter, and the transcription factor yebK helps to remodel the host physiology for cellobiose metabolism. While previous studies characterized the stress-induced mutations that allowed growth on cellobiose, here, we characterize the adaptation-induced mutations that help in enhancing cellobiose metabolic ability. This study will shed new light on the regulatory changes and factors that are needed for the functional coupling of the host physiology to the activated cryptic cellobiose metabolism.

  18. Transcription analysis of the Streptomyces coelicolor A3(2) rrnA operon

    DEFF Research Database (Denmark)

    van Wezel, G P; Krab, I M; Douthwaite, S

    1994-01-01

    Transcription start sites and processing sites of the Streptomyces coelicolor A3(2) rrnA operon have been investigated by a combination of in vivo and in vitro transcription analyses. The data from these approaches are consistent with the existence of four in vivo transcription sites, correspondi...

  19. Characterization of the Leptospira interrogans S10-spc-alpha operon

    NARCIS (Netherlands)

    Zuerner, R. L.; Hartskeerl, R. A.; van de Kemp, H.; Bal, A. E.

    2000-01-01

    A ribosomal protein gene cluster from the spirochaete Leptospira interrogans was characterized. This locus is homologous to the Escherichia coli S10, spc, and alpha operons. Analysis of L. interrogans RNA showed that the ribosomal protein genes within this cluster are co-transcribed, thus forming an

  20. Sliding and target location of DNA-binding proteins: an NMR view of the lac repressor system

    NARCIS (Netherlands)

    Loth, K.|info:eu-repo/dai/nl/304824437; Gnida, M.; Romanuka, J.|info:eu-repo/dai/nl/30483761X; Kaptein, R.|info:eu-repo/dai/nl/074334603; Boelens, R.|info:eu-repo/dai/nl/070151407

    2013-01-01

    In non-specific lac headpiece-DNA complexes selective NMR line broadening is observed that strongly depends on length and composition of the DNA fragments. This broadening involves amide protons found in the non-specific lac-DNA structure to be interacting with the DNA phosphate backbone, and can be

  1. Cloning, nucleotide sequencing, and expression of the beta-galactosidase-encoding gene (lacA) from Aspergillus oryzae.

    Science.gov (United States)

    Ito, Yoshiyuki; Sasaki, Takashi; Kitamoto, Katsuhiko; Kumagai, Chieko; Takahashi, Kohjiro; Gomi, Katsuya; Tamura, Gakuzo

    2002-06-01

    lacA coding for beta-galactosidase (beta-gal) was cloned from the genomic DNA of Aspergillus oryzae RIB40. There were 9 exons in lacA and the coding region of 3,015 bp encoded a protein of 1,005 aa with a deduced molecular mass of 109,898. A. oryzae lacA was highly homologous to fungal beta-gals, with the highest aa identity of 70.7% to A. niger lacA, and also showed significant identity to acid beta-gals belonging to family 35 glycosyl hydrolases. Approximately 10 copies of lacA under control of A. oryzae glaA promoter were integrated into the chromosome of A. oryzae M-2-3. The recombinant strain expressed more than 700-fold of the beta-gal activity as compared to the wild type strain under induction by maltose.

  2. Expression profile of mce4 operon of Mycobacterium tuberculosis following environmental stress.

    Science.gov (United States)

    Rathor, Nisha; Garima, Kushal; Sharma, Naresh Kumar; Narang, Anshika; Varma-Basil, Mandira; Bose, Mridula

    2016-09-01

    The mce4 operon is one of the four mce operons with eight genes (yrbE4A, yrbE4B, mce4A, mce4B, mce4C, mce4D, mce4E and mce4F) of Mycobacterium tuberculosis. It expresses in the later phase of infection and imports cholesterol for long term survival of the bacilli. To cause latent infection, M. tuberculosis undergoes metabolic reprogramming of its genes to survive in the hostile environment like low availability of oxygen and nutrition depletion inside the host. To analyze real time expression profile of mce4 operon under various stress conditions. M. tuberculosis H37Rv was exposed to surface stress (0.1% SDS for 30min and 90min in late log and stationary phase of culture), hypoxia (5, 10, 15 and 20days) and grown in the presence of either glycerol or cholesterol as sole source of carbon. The expression profile of genes of mce4 operon was analyzed by real time PCR. Surface stress induced expression of mce4C and yrbE4B in late log phase on 30min and 90min exposure respectively. The SDS exposure for 30min induced mce4C, mce4D and mce4F in stationary phase. All eight genes were induced significantly on 10th and 15th days of hypoxia and in the presence of cholesterol. Hypoxia and cholesterol are potent factors for the expression of mce4 operon of M. tuberculosis. Copyright © 2016. Published by Elsevier Ltd.

  3. Regulation of the Cobalt/Nickel Efflux Operon dmeRF in Agrobacterium tumefaciens and a Link between the Iron-Sensing Regulator RirA and Cobalt/Nickel Resistance.

    Science.gov (United States)

    Dokpikul, Thanittra; Chaoprasid, Paweena; Saninjuk, Kritsakorn; Sirirakphaisarn, Sirin; Johnrod, Jaruwan; Nookabkaew, Sumontha; Sukchawalit, Rojana; Mongkolsuk, Skorn

    2016-08-01

    The Agrobacterium tumefaciens C58 genome harbors an operon containing the dmeR (Atu0890) and dmeF (Atu0891) genes, which encode a transcriptional regulatory protein belonging to the RcnR/CsoR family and a metal efflux protein belonging to the cation diffusion facilitator (CDF) family, respectively. The dmeRF operon is specifically induced by cobalt and nickel, with cobalt being the more potent inducer. Promoter-lacZ transcriptional fusion, an electrophoretic mobility shift assay, and DNase I footprinting assays revealed that DmeR represses dmeRF transcription through direct binding to the promoter region upstream of dmeR A strain lacking dmeF showed increased accumulation of intracellular cobalt and nickel and exhibited hypersensitivity to these metals; however, this strain displayed full virulence, comparable to that of the wild-type strain, when infecting a Nicotiana benthamiana plant model under the tested conditions. Cobalt, but not nickel, increased the expression of many iron-responsive genes and reduced the induction of the SoxR-regulated gene sodBII Furthermore, control of iron homeostasis via RirA is important for the ability of A. tumefaciens to cope with cobalt and nickel toxicity. The molecular mechanism of the regulation of dmeRF transcription by DmeR was demonstrated. This work provides evidence of a direct interaction of apo-DmeR with the corresponding DNA operator site in vitro The recognition site for apo-DmeR consists of 10-bp AT-rich inverted repeats separated by six C bases (5'-ATATAGTATACCCCCCTATAGTATAT-3'). Cobalt and nickel cause DmeR to dissociate from the dmeRF promoter, which leads to expression of the metal efflux gene dmeF This work also revealed a connection between iron homeostasis and cobalt/nickel resistance in A. tumefaciens. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

  4. Baseline survey of anthropogenic pressures for the Lac Bay ecosystem, Bonaire

    NARCIS (Netherlands)

    Debrot, A.O.

    2012-01-01

    Lac Bay of Bonaire is a shallow non-estuarine lagoon of about 700 hectares, separated from the open sea by a shallow coral barrier-reef. It possesses the only major concentration of seagrass beds and mangroves of the island. It is a designated Ramsar wetland of international significance, an

  5. 77 FR 27245 - Big Stone National Wildlife Refuge, Big Stone and Lac Qui Parle Counties, MN

    Science.gov (United States)

    2012-05-09

    ... From the Federal Register Online via the Government Publishing Office DEPARTMENT OF THE INTERIOR Fish and Wildlife Service Big Stone National Wildlife Refuge, Big Stone and Lac Qui Parle Counties, MN AGENCY: Fish and Wildlife Service, Interior. ACTION: Notice of availability; request for comments...

  6. Dynamical Black Hole Masses of BL Lac Objects from the Sloan Digital Sky Survey

    NARCIS (Netherlands)

    Plotkin, Richard M.; Markoff, Sera; Trager, Scott C.; Anderson, Scott F.

    2012-01-01

    We measure black hole masses for 71 BL Lac objects from the Sloan Digital Sky Survey (SDSS) with redshifts out to z ∼ 0.4. We perform spectral decompositions of their nuclei from their host galaxies and measure their stellar velocity dispersions. Black hole masses are then derived from the black

  7. Dynamical black hole masses of BL Lac objects from the Sloan Digital Sky Survey

    NARCIS (Netherlands)

    Plotkin, R. M.; Markoff, S.; Trager, S. C.; Anderson, S. F.

    We measure black hole masses for 71 BL Lac objects from the Sloan Digital Sky Survey with redshifts out to z˜ 0.4. We perform spectral decompositions of their nuclei from their host galaxies and measure their stellar velocity dispersions. Black hole masses are then derived from the black hole mass -

  8. Dynamical black hole masses of BL Lac objects from the Sloan Digital Sky Survey

    NARCIS (Netherlands)

    Plotkin, R.M.; Markoff, S.; Trager, S.C.; Anderson, S.F.

    2011-01-01

    We measure black hole masses for 71 BL Lac objects from the Sloan Digital Sky Survey with redshifts out to z∼ 0.4. We perform spectral decompositions of their nuclei from their host galaxies and measure their stellar velocity dispersions. Black hole masses are then derived from the black hole mass -

  9. Modelling the IDV Emissions of the BL Lac Objects with a Langevin ...

    Indian Academy of Sciences (India)

    Abstract. In this paper, we introduce a simplified model for explain- ing the observations of optical intra-day variability (IDV) of the BL. Lac Objects. We assume that the source of the IDV are the stochastic oscillations of an accretion disk around a supermassive black hole. The stochastic fluctuations on the vertical direction of ...

  10. The Lac-Croche plutonic complex, Quebec: basement of Grenville paragneisses?

    NARCIS (Netherlands)

    Schrijver, K.

    1969-01-01

    A concordant body of presumably igneous, but deformed and at least partly recrystallized rocks, the Lac-Croche Plutonic Complex, consists of leuconoritic and mangeritic gneisses, and of monzonitic and granitic rocks. It is surrounded by gneisses, at least partly of sedimentary origin. Inclusions of

  11. Caractérisation des sables et morphologie du fond du lac du ...

    African Journals Online (AJOL)

    ... tourmaline, diopside and epidote) and light minerals (quartz and feldspars). Elsewhere, this study has permitted to carry out the first bathymetric Map of this lake 26 years after its setting in water. Keywords: keywordBarrage, lac, granulométrie, minéralogie, bathymétrie, Taabo./Dam, lake, grain size, mineralogy, bathymetry ...

  12. Transformation of lacZ using different promoters in the commercially ...

    African Journals Online (AJOL)

    Yomi

    2012-01-26

    Jan 26, 2012 ... Transformation of lacZ using different promoters in the commercially important red alga, Gracilaria gracilis. Suzanne M. Huddy, Ann E. Meyers* and Vernon E. Coyne. Department of Molecular and Cell Biology, University of Cape Town, P Bag X3, Rondebosch, 7701, South Africa. Accepted 10 November ...

  13. Structural identification and biological activity of six new Shellolic esters from Lac.

    Science.gov (United States)

    Lu, Jin; Shang, Lei; Wen, Huimin; Huang, Jian; Li, Guoyu; Wang, Jinhui

    2018-03-01

    Six new sesquiterpenoid esters, named Shellolic ester A-F (1-6), along with four known Lac dyes (7-10) were isolated from methanol extract of the secretions of Laccifer lacca. Their structures were established on the basis of spectroscopic analyses (IR, HR-ESI-MS, 1D and 2D NMR) and by comparison with published data. Biological activities evaluation of the isolates showed that they were inactive against human cancer cell lines (HepG2, MCF-7, Hela and C6) and LPS-treated RAW264.7, which is well consistent with that Lac resin used as nontoxic material in agriculture applications, pharmaceutical formulations, and food additives. However, compound 2, 4, 7, 9, 10 were found to be considerable active against B. subtilis, E. coli, and S. aureus microorganisms. The results complements the current knowledge about Lac produced from China. Meanwhile, Our present study further reveals that Lac resin are edible with no toxicity and physiologically harmless at the level employed as an excipient. Copyright © 2017. Published by Elsevier B.V.

  14. Chaotic Behaviour of Intra-Day Variability of BL Lac Object S5 0716 ...

    Indian Academy of Sciences (India)

    Home; Journals; Journal of Astrophysics and Astronomy; Volume 35; Issue 2. Chaotic Behaviour of Intra-Day Variability of BL Lac Object S5 0716+714 ... In this paper, we introduce a method of non-linear time series analysis, and calculate the correlation dimension of the IDV light curves of S5 0716+714 over seven nights ...

  15. Period of Light Variability in BL Lac ON 231 Xu Yun Bing1, Zhang ...

    Indian Academy of Sciences (India)

    Abstract. In this paper, the authors have compiled the data of about 100 years in B-band of the BL Lac ON 231 and used this database to analyze periodicity signals in the optical light curve. Two different methods were applied: the wavelet analysis and the Discrete Correlation Function (DCF) method. We revealed the ...

  16. Function, Structure, and Evolution of the Major Facilitator Superfamily: The LacY Manifesto

    Directory of Open Access Journals (Sweden)

    M. Gregor Madej

    2014-01-01

    Full Text Available The major facilitator superfamily (MFS is a diverse group of secondary transporters with members found in all kingdoms of life. A paradigm for MFS is the lactose permease (LacY of Escherichia coli, which couples the stoichiometric translocation of a galactopyranoside and an H+ across the cytoplasmic membrane. LacY has been the test bed for the development of many methods applied for the analysis of transport proteins. X-ray structures of an inward-facing conformation and the most recent structure of an almost occluded conformation confirm many conclusions from previous studies. Although structure models are critical, they are insufficient to explain the catalysis of transport. The clues to understanding transport are based on the principles of enzyme kinetics. Secondary transport is a dynamic process—static snapshots of X-ray crystallography describe it only partially. However, without structural information, the underlying chemistry is virtually impossible to conclude. A large body of biochemical/biophysical data derived from systematic studies of site-directed mutants in LacY suggests residues critically involved in the catalysis, and a working model for the symport mechanism that involves alternating access of the binding site is presented. The general concepts derived from the bacterial LacY are examined for their relevance to other MFS transporters.

  17. Multiple Lac-mediated loops revealed by Bayesian statistics and tethered particle motion

    CERN Document Server

    Johnson, Stephanie; Phillips, Rob; Wiggins, Chris H; Lindén, Martin

    2014-01-01

    The bacterial transcription factor LacI loops DNA by binding to two separate locations on the DNA simultaneously. Despite being one of the best-studied model systems for transcriptional regulation, the number and conformations of loop structures accessible to LacI remain unclear, though the importance of multiple co-existing loops has been implicated in interactions between LacI and other cellular regulators of gene expression. To probe this issue, we have developed a new analysis method for tethered particle motion (TPM), a versatile and commonly-used in vitro single-molecule technique. Our method, vbTPM, is based on a variational Bayes treatment of hidden Markov models. It learns the number of distinct states (i.e., DNA-protein conformations) directly from TPM data with better resolution than existing methods, while easily correcting for common experimental artifacts. Studying short (roughly 100 bp) LacI-mediated loops, we are able to resolve three distinct loop structures, more than previously reported at ...

  18. Kinetic Analysis of Lactose Exchange in Proteoliposomes Reconstituted with Purified lac Permease

    NARCIS (Netherlands)

    Lolkema, Julius S.; Carrasco, Nancy; Kaback, H. Ronald

    1991-01-01

    Lactose exchange catalyzed by purified lac permease reconstituted into proteoliposomes was analyzed with unequal concentrations of lactose on either side of the membrane and at low pH so as to prevent equilibration of the two pools. Exchange with external concentrations below 1.0 mM is a

  19. Dynamical black hole masses of BL Lac objects from the Sloan Digital Sky Survey

    NARCIS (Netherlands)

    Plotkin, R. M.; Markoff, S.; Trager, S. C.; Anderson, S. F.

    We measure black hole masses for 71 BL Lac objects from the Sloan Digital Sky Survey with redshifts out to z similar to 0.4. We perform spectral decompositions of their nuclei from their host galaxies and measure their stellar velocity dispersions. Black hole masses are then derived from the black

  20. Functions of the duplicated hik31 operons in central metabolism and responses to light, dark, and carbon sources in Synechocystis sp. strain PCC 6803.

    Science.gov (United States)

    Nagarajan, Sowmya; Sherman, Debra M; Shaw, Isaac; Sherman, Louis A

    2012-01-01

    There are two closely related hik31 operons involved in signal transduction on the chromosome and the pSYSX plasmid in the cyanobacterium Synechocystis sp. strain PCC 6803. We studied the growth, cell morphology, and gene expression in operon and hik mutants for both copies, under different growth conditions, to examine whether the duplicated copies have the same or different functions and gene targets and whether they are similarly regulated. Phenotype analysis suggested that both operons regulated common and separate targets in the light and the dark. The chromosomal operon was involved in the negative control of autotrophic events, whereas the plasmid operon was involved in the positive control of heterotrophic events. Both the plasmid and double operon mutant cells were larger and had division defects. The growth data also showed a regulatory role for the chromosomal hik gene under high-CO(2) conditions and the plasmid operon under low-O(2) conditions. Metal stress experiments indicated a role for the chromosomal hik gene and operon in mediating Zn and Cd tolerance, the plasmid operon in Co tolerance, and the chromosomal operon and plasmid hik gene in Ni tolerance. We conclude that both operons are differentially and temporally regulated. We suggest that the chromosomal operon is the primarily expressed copy and the plasmid operon acts as a backup to maintain appropriate gene dosages. Both operons share an integrated regulatory relationship and are induced in high light, in glucose, and in active cell growth. Additionally, the plasmid operon is induced in the dark with or without glucose.

  1. THE CONTRIBUTION OF FERMI -2LAC BLAZARS TO DIFFUSE TEV–PEV NEUTRINO FLUX

    Energy Technology Data Exchange (ETDEWEB)

    Aartsen, M. G. [Department of Physics, University of Adelaide, Adelaide, 5005 (Australia); Abraham, K. [Physik-department, Technische Universität München, D-85748 Garching (Germany); Ackermann, M. [DESY, D-15735 Zeuthen (Germany); Adams, J. [Dept. of Physics and Astronomy, University of Canterbury, Private Bag 4800, Christchurch (New Zealand); Aguilar, J. A.; Ansseau, I. [Université Libre de Bruxelles, Science Faculty CP230, B-1050 Brussels (Belgium); Ahlers, M. [Dept. of Physics and Wisconsin IceCube Particle Astrophysics Center, University of Wisconsin, Madison, WI 53706 (United States); Ahrens, M. [Oskar Klein Centre and Dept. of Physics, Stockholm University, SE-10691 Stockholm (Sweden); Altmann, D.; Anton, G. [Erlangen Centre for Astroparticle Physics, Friedrich-Alexander-Universität Erlangen-Nürnberg, D-91058 Erlangen (Germany); Andeen, K. [Department of Physics, Marquette University, Milwaukee, WI, 53201 (United States); Anderson, T.; Arlen, T. C. [Dept. of Physics, Pennsylvania State University, University Park, PA 16802 (United States); Archinger, M.; Baum, V. [Institute of Physics, University of Mainz, Staudinger Weg 7, D-55099 Mainz (Germany); Arguelles, C.; Axani, S. [Dept. of Physics, Massachusetts Institute of Technology, Cambridge, MA 02139 (United States); Auffenberg, J. [III. Physikalisches Institut, RWTH Aachen University, D-52056 Aachen (Germany); Bai, X. [Physics Department, South Dakota School of Mines and Technology, Rapid City, SD 57701 (United States); Barwick, S. W., E-mail: thorsten.gluesenkamp@fau.de [Dept. of Physics and Astronomy, University of California, Irvine, CA 92697 (United States); Collaboration: IceCube Collaboration; and others

    2017-01-20

    The recent discovery of a diffuse cosmic neutrino flux extending up to PeV energies raises the question of which astrophysical sources generate this signal. Blazars are one class of extragalactic sources which may produce such high-energy neutrinos. We present a likelihood analysis searching for cumulative neutrino emission from blazars in the 2nd Fermi -LAT AGN catalog (2LAC) using IceCube neutrino data set 2009-12, which was optimized for the detection of individual sources. In contrast to those in previous searches with IceCube, the populations investigated contain up to hundreds of sources, the largest one being the entire blazar sample in the 2LAC catalog. No significant excess is observed, and upper limits for the cumulative flux from these populations are obtained. These constrain the maximum contribution of 2LAC blazars to the observed astrophysical neutrino flux to 27% or less between around 10 TeV and 2 PeV, assuming the equipartition of flavors on Earth and a single power-law spectrum with a spectral index of −2.5. We can still exclude the fact that 2LAC blazars (and their subpopulations) emit more than 50% of the observed neutrinos up to a spectral index as hard as −2.2 in the same energy range. Our result takes into account the fact that the neutrino source count distribution is unknown, and it does not assume strict proportionality of the neutrino flux to the measured 2LAC γ -ray signal for each source. Additionally, we constrain recent models for neutrino emission by blazars.

  2. VizieR Online Data Catalog: The CLASS BL Lac sample (Marcha+, 2013)

    Science.gov (United States)

    Marcha, M. J. M.; Caccianiga, A.

    2014-04-01

    This paper presents a new sample of BL Lac objects selected from a deep (30mJy) radio survey of flat spectrum radio sources (the CLASS blazar survey). The sample is one of the largest well-defined samples in the low-power regime with a total of 130 sources of which 55 satisfy the 'classical' optical BL Lac selection criteria, and the rest have indistinguishable radio properties. The primary goal of this study is to establish the radio luminosity function (RLF) on firm statistical ground at low radio luminosities where previous samples have not been able to investigate. The gain of taking a peek at lower powers is the possibility to search for the flattening of the luminosity function which is a feature predicted by the beaming model but which has remained elusive to observational confirmation. In this study, we extend for the first time the BL Lac RLF down to very low radio powers ~1022W/Hz, i.e. two orders of magnitude below the RLF currently available in the literature. In the process, we confirm the importance of adopting a broader, and more physically meaningful set of classification criteria to avoid the systematic missing of low-luminosity BL Lacs. Thanks to the good statistics we confirm the existence of weak but significant positive cosmological evolution for the BL Lac population, and we detect, for the first time the flattening of the RLF at L~1025W/Hz in agreement with the predictions of the beaming model. (1 data file).

  3. Contribution of the Chromosomal ccdAB Operon to Bacterial Drug Tolerance.

    Science.gov (United States)

    Gupta, Kritika; Tripathi, Arti; Sahu, Alishan; Varadarajan, Raghavan

    2017-10-01

    One of the first identified and best-studied toxin-antitoxin (TA) systems in Escherichia coli is the F-plasmid-based CcdAB system. This system is involved in plasmid maintenance through postsegregational killing. More recently, ccdAB homologs have been found on the chromosome, including in pathogenic strains of E. coli and other bacteria. However, the functional role of chromosomal ccdAB genes, if any, has remained unclear. We show that both the native ccd operon of the E. coli O157 strain (ccdO157) and the ccd operon from the F plasmid (ccdF), when inserted on the E. coli chromosome, lead to protection from cell death under multiple antibiotic stress conditions through formation of persisters, with the O157 operon showing higher protection. While the plasmid-encoded CcdB toxin is a potent gyrase inhibitor and leads to bacterial cell death even under fully repressed conditions, the chromosomally encoded toxin leads to growth inhibition, except at high expression levels, where some cell death is seen. This was further confirmed by transiently activating the chromosomal ccd operon through overexpression of an active-site inactive mutant of F-plasmid-encoded CcdB. Both the ccdF and ccdO157 operons may share common mechanisms for activation under stress conditions, eventually leading to multidrug-tolerant persister cells. This study clearly demonstrates an important role for chromosomal ccd systems in bacterial persistence.IMPORTANCE A large number of free-living and pathogenic bacteria are known to harbor multiple toxin-antitoxin systems, on plasmids as well as on chromosomes. The F-plasmid CcdAB system has been extensively studied and is known to be involved in plasmid maintenance. However, little is known about the function of its chromosomal counterpart, found in several pathogenic E. coli strains. We show that the native chromosomal ccd operon of the E. coli O157 strain is involved in drug tolerance and confers protection from cell death under multiple antibiotic

  4. Water quality and hydrology of the Lac Vieux Desert watershed, Gogebic County, Michigan, and Vilas County, Wisconsin, 2002-04

    Science.gov (United States)

    Weaver, T.L.; Neff, B.P.; Ellis, J.M.

    2005-01-01

    Lac Vieux Desert is a prominent 6.6 square-mile lake that straddles the Michigan-Wisconsin border and forms the headwaters of the Wisconsin River. For generations, the Lac Vieux Desert Band of Lake Superior Chippewa Indians have used Lac Vieux Desert and the surrounding area for growing and harvesting wild rice, and hunting and fishing. The Lac Vieux Desert Band is concerned about the impact of lake-stage regulation on hydrology and ecology, and the impact on water quality of development along and near the shore, and recreational watercraft use and sport fishing. In 2005, the U.S. Geological Survey completed a water-resources investigation of the Lac Vieux Desert watershed in cooperation with the Lac Vieux Desert Band of Lake Superior Chippewa Indians.Water quality of Lac Vieux Desert is typical of many lakes in the northern United States. Trophic State Index calculations classify Lac Vieux Desert as a highly productive eutrophic lake. The pH of water in Lac Vieux Desert ranged from 6.5 to 9.5, and specific conductance ranged from 62 to 114 µs/cm. Chloride concentration was less than 1.5 mg/L, indicating little effect from septic-tank or road-salt input. Results indicate that the water can be classified as soft, with hardness concentrations reported as calcium carbonate ranging from 29 to 49 mg/L. Concentrations of calcium, magnesium, chloride, and other dissolved solids ranged from 47 to 77 mg/L. Alkalinity of Lac Vieux Desert ranged from 27 to 38 mg/L.Pervasive aquatic blooms, including a bloom noted during the September 2003 sampling, are apparently common in late summer. Biological productivity at Lac Vieux Desert does not appear to have changed appreciably between 1973 and 2004. In the current study, total phosphorus concentrations ranged from 0.01 to 0.064 mg/L and dissolved nitrite plus nitrate nitrogen concentrations ranged from at, or below detection limit to 0.052 mg/L. Overabundance of nutrients in Lac Vieux Desert, particularly nitrogen and phosphorus

  5. RegulonDB (version 4.0): transcriptional regulation, operon organization and growth conditions in Escherichia coli K-12.

    Science.gov (United States)

    Salgado, Heladia; Gama-Castro, Socorro; Martínez-Antonio, Agustino; Díaz-Peredo, Edgar; Sánchez-Solano, Fabiola; Peralta-Gil, Martín; Garcia-Alonso, Delfino; Jiménez-Jacinto, Verónica; Santos-Zavaleta, Alberto; Bonavides-Martínez, César; Collado-Vides, Julio

    2004-01-01

    RegulonDB is the primary database of the major international maintained curation of original literature with experimental knowledge about the elements and interactions of the network of transcriptional regulation in Escherichia coli K-12. This includes mechanistic information about operon organization and their decomposition into transcription units (TUs), promoters and their sigma type, binding sites of specific transcriptional regulators (TRs), their organization into 'regulatory phrases', active and inactive conformations of TRs, as well as terminators and ribosome binding sites. The database is complemented with clearly marked computational predictions of TUs, promoters and binding sites of TRs. The current version has been expanded to include information beyond specific mechanisms aimed at gathering different growth conditions and the associated induced and/or repressed genes. RegulonDB is now linked with Swiss-Prot, with microarray databases, and with a suite of programs to analyze and visualize microarray experiments. We provide a summary of the biological knowledge contained in RegulonDB and describe the major changes in the design of the database. RegulonDB can be accessed on the web at the URL: http://www.cifn.unam.mx/Computational_Biology/regulondb/.

  6. Enzymatic Synthesis of N-Acetyllactosamine (LacNAc Type 1 Oligomers and Characterization as Multivalent Galectin Ligands

    Directory of Open Access Journals (Sweden)

    Thomas Fischöder

    2017-08-01

    Full Text Available Repeats of the disaccharide unit N-acetyllactosamine (LacNAc occur as type 1 (Galβ1, 3GlcNAc and type 2 (Galβ1, 4GlcNAc glycosylation motifs on glycoproteins and glycolipids. The LacNAc motif acts as binding ligand for lectins and is involved in many biological recognition events. To the best of our knowledge, we present, for the first time, the synthesis of LacNAc type 1 oligomers using recombinant β1,3-galactosyltransferase from Escherichia coli and β1,3-N-acetylglucosaminyltranferase from Helicobacter pylori. Tetrasaccharide glycans presenting LacNAc type 1 repeats or LacNAc type 1 at the reducing or non-reducing end, respectively, were conjugated to bovine serum albumin as a protein scaffold by squarate linker chemistry. The resulting multivalent LacNAc type 1 presenting neo-glycoproteins were further studied for specific binding of the tumor-associated human galectin 3 (Gal-3 and its truncated counterpart Gal-3∆ in an enzyme-linked lectin assay (ELLA. We observed a significantly increased affinity of Gal-3∆ towards the multivalent neo-glycoprotein presenting LacNAc type 1 repeating units. This is the first evidence for differences in glycan selectivity of Gal-3∆ and Gal-3 and may be further utilized for tracing Gal-3∆ during tumor progression and therapy.

  7. USING THE METHODS OF WAVELET ANALYSIS AND SINGULAR SPECTRUM ANALYSIS IN THE STUDY OF RADIO SOURCE BL LAC

    OpenAIRE

    Donskykh, G. I.; Ryabov, M. I.; Sukharev, A. I.; Aller, M.

    2014-01-01

    We investigated the monitoring data of extragalactic source BL Lac. This monitoring was held withUniversityofMichigan26-meter radio  telescope. To study flux density of extragalactic source BL Lac at frequencies of 14.5, 8 and 4.8 GHz, the wavelet analysis and singular spectrum analysis were used. Calculating the integral wavelet spectra allowed revealing long-term  components  (~7-8 years) and short-term components (~ 1-4 years) in BL Lac. Studying of VLBI radio maps (by the program Mojave) ...

  8. Overexpression, purification and crystallization of the tetrameric form of SorC sorbitol operon regulator

    Energy Technology Data Exchange (ETDEWEB)

    Sanctis, Daniele de; Rêgo, Ana T.; Marçal, David; McVey, Colin E.; Carrondo, Maria A. [Instituto de Tecnologia Química e Biológica, Universidade Nova de Lisboa, Avenida da República, Apartado 127, 2781-901 Oeiras (Portugal); Enguita, Francisco J., E-mail: fenguita@fm.ul.pt [Instituto de Medicina Molecular, Avenida Professor Egas Moniz, 1649-028 Lisboa (Portugal); Instituto de Tecnologia Química e Biológica, Universidade Nova de Lisboa, Avenida da República, Apartado 127, 2781-901 Oeiras (Portugal)

    2008-01-01

    The sorbitol operon regulator from K. pneumoniae has been overexpressed in E. coli, purified and crystallized. Diffraction data were collected to 3.2 Å. The sorbitol operon regulator (SorC) regulates the metabolism of l-sorbose in Klebsiella pneumonia. SorC was overexpressed in Escherichia coli and purified, and crystals were obtained of a tetrameric form. A single crystal showed X-ray diffraction to 3.20 Å. The crystal belongs to space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 91.6, b = 113.3, c = 184.1 Å. Analysis of the molecular-replacement solution indicates the presence of four SorC molecules in the asymmetric unit.

  9. The dnd operon for DNA phosphorothioation modification system in Escherichia coli is located in diverse genomic islands.

    Science.gov (United States)

    Ho, Wing Sze; Ou, Hong-Yu; Yeo, Chew Chieng; Thong, Kwai Lin

    2015-03-17

    Strains of Escherichia coli that are non-typeable by pulsed-field gel electrophoresis (PFGE) due to in-gel degradation can influence their molecular epidemiological data. The DNA degradation phenotype (Dnd(+)) is mediated by the dnd operon that encode enzymes catalyzing the phosphorothioation of DNA, rendering the modified DNA susceptible to oxidative cleavage during a PFGE run. In this study, a PCR assay was developed to detect the presence of the dnd operon in Dnd(+) E. coli strains and to improve their typeability. Investigations into the genetic environments of the dnd operon in various E. coli strains led to the discovery that the dnd operon is harboured in various diverse genomic islands. The dndBCDE genes (dnd operon) were detected in all Dnd(+) E. coli strains by PCR. The addition of thiourea improved the typeability of Dnd(+) E. coli strains to 100% using PFGE and the Dnd(+) phenotype can be observed in both clonal and genetically diverse E. coli strains. Genomic analysis of 101 dnd operons from genome sequences of Enterobacteriaceae revealed that the dnd operons of the same bacterial species were generally clustered together in the phylogenetic tree. Further analysis of dnd operons of 52 E. coli genomes together with their respective immediate genetic environments revealed a total of 7 types of genetic organizations, all of which were found to be associated with genomic islands designated dnd-encoding GIs. The dnd-encoding GIs displayed mosaic structure and the genomic context of the 7 islands (with 1 representative genome from each type of genetic organization) were also highly variable, suggesting multiple recombination events. This is also the first report where two dnd operons were found within a strain although the biological implication is unknown. Surprisingly, dnd operons were frequently found in pathogenic E. coli although their link with virulence has not been explored. Genomic islands likely play an important role in facilitating the horizontal

  10. Conjugative Plasmid Transfer in Xylella fastidiosa Is Dependent on tra and trb Operon Functions

    OpenAIRE

    Burbank, Lindsey P.; Van Horn, Christopher R.

    2017-01-01

    The insect-transmitted plant pathogen Xylella fastidiosa is capable of efficient horizontal gene transfer (HGT) and recombination. Natural transformation occurs at high rates in X. fastidiosa, but there also is evidence that certain strains of X. fastidiosa carry native plasmids equipped with transfer and mobilization genes, suggesting conjugation as an additional mechanism of HGT in some instances. Two operons, tra and trb, putatively encoding a conjugative type IV secretion system, are foun...

  11. Structural organization of the transfer RNA operon I of Vibrio cholerae

    Indian Academy of Sciences (India)

    Unknown

    restriction enzyme EcoRI at 37°C according to the in- structions of the manufacturer (New .... (b) Schematic representation of the EcoRI restriction map and the structural organization of tRNA operon I in V. cholerae El Tor/O139 and clas- ... MED/09/154/97 from the Department of Biotechnology,. New Delhi. Both AG and AM ...

  12. Functional characterization of a lipoprotein-encoding operon in Campylobacter jejuni.

    Directory of Open Access Journals (Sweden)

    Mayumi Oakland

    Full Text Available BACKGROUND: Bacterial lipoproteins have important functions in bacterial pathogenesis and physiology. In Campylobacter jejuni, a major foodborne pathogen causing gastroenteritis in humans, the majority of lipoproteins have not been functionally characterized. Previously, we showed by DNA microarray that CmeR, a transcriptional regulator repressing the expression of the multidrug efflux pump CmeABC, modulates the expression of a three-gene operon (cj0089, cj0090, and cj0091 encoding a cluster of lipoproteins in C. jejuni. METHODOLOGY/PRINCIPAL FINDINGS: In this work, we characterized the function and regulation of the cj0089-cj0090-cj0091 operon. In contrast to the repression of cmeABC, CmeR activates the expression of the lipoprotein genes and the regulation is confirmed by immunoblotting using anti-Cj0089 and anti-Cj0091 antibodies. Gel mobility shift assay showed that CmeR directly binds to the promoter of the lipoprotein operon, but the binding is much weaker compared with the promoter of cmeABC. Analysis of different cellular fractions indicated that Cj0089 was associated with the inner membrane, while Cj0091 was located on the outer membrane. Inactivation of cj0091, but not cj0089, significantly reduced the adherence of C. jejuni to INT 407 cells in vitro, indicating that Cj0091 has a function in adherence. When inoculated into chickens, the Cj0091 mutant also showed a defect in early colonization of the intestinal tract, suggesting that Cj0091 contributes to Campylobacter colonization in vivo. It was also shown that Cj0091 was produced and immunogenic in chickens that were naturally infected by C. jejuni. CONCLUSION/SIGNIFICANCE: These results indicate that the lipoprotein operon is subject to direct regulation by CmeR and that Cj0091 functions as an adhesion mechanism in C. jejuni and contributes to Campylobacter colonization of the intestinal tract in animal hosts.

  13. Combinatorial optimization of synthetic operons for the microbial production of p-coumaryl alcohol with Escherichia coli.

    Science.gov (United States)

    van Summeren-Wesenhagen, Philana V; Voges, Raphael; Dennig, Alexander; Sokolowsky, Sascha; Noack, Stephan; Schwaneberg, Ulrich; Marienhagen, Jan

    2015-06-11

    Microbes are extensively engineered to produce compounds of biotechnological or pharmaceutical interest. However, functional integration of synthetic pathways into the respective host cell metabolism and optimization of heterologous gene expression for achieving high product titers is still a challenging task. In this manuscript, we describe the optimization of a tetracistronic operon for the microbial production of the plant-derived phenylpropanoid p-coumaryl alcohol in Escherichia coli. Basis for the construction of a p-coumaryl alcohol producing strain was the development of Operon-PLICing as method for the rapid combinatorial assembly of synthetic operons. This method is based on the chemical cleavage reaction of phosphorothioate bonds in an iodine/ethanol solution to generate complementary, single-stranded overhangs and subsequent hybridization of multiple DNA-fragments. Furthermore, during the assembly of these DNA-fragments, Operon-PLICing offers the opportunity for balancing gene expression of all pathway genes on the level of translation for maximizing product titers by varying the spacing between the Shine-Dalgarno sequence and START codon. With Operon-PLICing, 81 different clones, each one carrying a different p-coumaryl alcohol operon, were individually constructed and screened for p-coumaryl alcohol formation within a few days. The absolute product titer of the best five variants ranged from 48 to 52 mg/L p-coumaryl alcohol without any further optimization of growth and production conditions. Operon-PLICing is sequence-independent and thus does not require any specific recognition or target sequences for enzymatic activities since all hybridization sites can be arbitrarily selected. In fact, after PCR-amplification, no endonucleases or ligases, frequently used in other methods, are needed. The modularity, simplicity and robustness of Operon-PLICing would be perfectly suited for an automation of cloning in the microtiter plate format.

  14. Regulation of nrf operon expression in pathogenic enteric bacteria: sequence divergence reveals new regulatory complexity.

    Science.gov (United States)

    Godfrey, Rita E; Lee, David J; Busby, Stephen J W; Browning, Douglas F

    2017-05-01

    The Escherichia coli K-12 nrf operon encodes a periplasmic nitrite reductase, the expression of which is driven from a single promoter, pnrf. Expression from pnrf is activated by the FNR transcription factor in response to anaerobiosis and further increased in response to nitrite by the response regulator proteins, NarL and NarP. FNR-dependent transcription is suppressed by the binding of two nucleoid associated proteins, IHF and Fis. As Fis levels increase in cells grown in rich medium, the positioning of its binding site, overlapping the promoter -10 element, ensures that pnrf is sharply repressed. Here, we investigate the expression of the nrf operon promoter from various pathogenic enteric bacteria. We show that pnrf from enterohaemorrhagic E. coli is more active than its K-12 counterpart, exhibits substantial FNR-independent activity and is insensitive to nutrient quality, due to an improved -10 element. We also demonstrate that the Salmonella enterica serovar Typhimurium core promoter is more active than previously thought, due to differences around the transcription start site, and that its expression is repressed by downstream sequences. We identify the CsrA RNA binding protein as being responsible for this, and show that CsrA differentially regulates the E. coli K-12 and Salmonella nrf operons. © 2017 The Authors Molecular Microbiology Published by John Wiley & Sons Ltd.

  15. OpWise: Operons aid the identification of differentially expressed genes in bacterial microarray experiments

    Directory of Open Access Journals (Sweden)

    Arkin Adam P

    2006-01-01

    Full Text Available Abstract Background Differentially expressed genes are typically identified by analyzing the variation between replicate measurements. These procedures implicitly assume that there are no systematic errors in the data even though several sources of systematic error are known. Results OpWise estimates the amount of systematic error in bacterial microarray data by assuming that genes in the same operon have matching expression patterns. OpWise then performs a Bayesian analysis of a linear model to estimate significance. In simulations, OpWise corrects for systematic error and is robust to deviations from its assumptions. In several bacterial data sets, significant amounts of systematic error are present, and replicate-based approaches overstate the confidence of the changers dramatically, while OpWise does not. Finally, OpWise can identify additional changers by assigning genes higher confidence if they are consistent with other genes in the same operon. Conclusion Although microarray data can contain large amounts of systematic error, operons provide an external standard and allow for reasonable estimates of significance. OpWise is available at http://microbesonline.org/OpWise.

  16. The Legionella pneumophila GIG operon responds to gold and copper in planktonic and biofilm cultures.

    Directory of Open Access Journals (Sweden)

    Kathleen Jwanoswki

    Full Text Available Legionella pneumophila contaminates man-made water systems and creates numerous exposure risks for Legionnaires' Disease. Because copper/silver ionization is commonly used to control L. pneumophila, its mechanisms of metal response and detoxification are of significant interest. Here we describe an L. pneumophila operon with significant similarity to the GIG operon of Cupriavidus metallidurans. The Legionella GIG operon is present in a subset of strains and has been acquired as part of the ICE-βox 65-kB integrative conjugative element. We assessed GIG promoter activity following exposure of L. pneumophila to multiple concentrations of HAuCl4, CuSO4 and AgNO3. At 37°C, control stationary phase cultures exhibited GIG promoter activity. This activity increased significantly in response to 20 and 50uM HAuCl4 and CuSO4 but not in response to AgNO3. Conversely, at 26°C, cultures exhibited decreased promoter response to copper. GIG promoter activity was also induced by HAuCl4 or CuSO4 during early biofilm establishment at both temperatures. When an L. pneumophila GIG promoter construct was transformed into E. coli DH5α, cultures showed baseline expression levels that did not increase following metal addition. Analysis of L. pneumophila transcriptional regulatory mutants suggested that GIG up-regulation in the presence of metal ions may be influenced by the stationary phase sigma factor, RpoS.

  17. The Legionella pneumophila GIG operon responds to gold and copper in planktonic and biofilm cultures.

    Science.gov (United States)

    Jwanoswki, Kathleen; Wells, Christina; Bruce, Terri; Rutt, Jennifer; Banks, Tabitha; McNealy, Tamara L

    2017-01-01

    Legionella pneumophila contaminates man-made water systems and creates numerous exposure risks for Legionnaires' Disease. Because copper/silver ionization is commonly used to control L. pneumophila, its mechanisms of metal response and detoxification are of significant interest. Here we describe an L. pneumophila operon with significant similarity to the GIG operon of Cupriavidus metallidurans. The Legionella GIG operon is present in a subset of strains and has been acquired as part of the ICE-βox 65-kB integrative conjugative element. We assessed GIG promoter activity following exposure of L. pneumophila to multiple concentrations of HAuCl4, CuSO4 and AgNO3. At 37°C, control stationary phase cultures exhibited GIG promoter activity. This activity increased significantly in response to 20 and 50uM HAuCl4 and CuSO4 but not in response to AgNO3. Conversely, at 26°C, cultures exhibited decreased promoter response to copper. GIG promoter activity was also induced by HAuCl4 or CuSO4 during early biofilm establishment at both temperatures. When an L. pneumophila GIG promoter construct was transformed into E. coli DH5α, cultures showed baseline expression levels that did not increase following metal addition. Analysis of L. pneumophila transcriptional regulatory mutants suggested that GIG up-regulation in the presence of metal ions may be influenced by the stationary phase sigma factor, RpoS.

  18. The Mannitol Operon Repressor MTIR belongs to a new class of transcription regulators in bacteria.

    Energy Technology Data Exchange (ETDEWEB)

    Tan, K.; Borovilos, M.; Zhou, M; Horer, S; Clancy, S; Moy, S; Volkart, LL; Sassoon, J; Baumann, U; Joachimiak, A (Biosciences Division); (Univ. of Berne)

    2009-12-25

    Many bacteria express phosphoenolpyruvate-dependent phosphotransferase systems (PTS). The mannitol-specific PTS catalyze the uptake and phosphorylation of d-mannitol. The uptake system comprises several genes encoded in the single operon. The expression of the mannitol operon is regulated by a proposed transcriptional factor, mannitol operon repressor (MtlR) that was first studied in Escherichia coli. Here we report the first crystal structures of MtlR from Vibrio parahemeolyticus (Vp-MtlR) and its homolog YggD protein from Shigella flexneri (Sf-YggD). MtlR and YggD belong to the same protein family (Pfam05068). Although Vp-MtlR and Sf-YggD share low sequence identity (22%), their overall structures are very similar, representing a novel all {alpha}-helical fold, and indicate similar function. However, their lack of any known DNA-binding structural motifs and their unfavorable electrostatic properties imply that MtlR/YggD are unlikely to bind a specific DNA operator directly as proposed earlier. This structural observation is further corroborated by in vitro DNA-binding studies of E. coli MtlR (Ec-MtlR), which detected no interaction of Ec-MtlR with the well characterized mannitol operator/promoter region. Therefore, MtlR/YggD belongs to a new class of transcription factors in bacteria that may regulate gene expression indirectly as a part of a larger transcriptional complex.

  19. Transcription and translation of the rpsJ, rplN and rRNA operons of the tubercle bacillus.

    Science.gov (United States)

    Cortes, Teresa; Cox, Robert Ashley

    2015-04-01

    Several species of the genus Mycobacterium are human pathogens, notably the tubercle bacillus (Mycobacterium tuberculosis). The rate of proliferation of a bacterium is reflected in the rate of ribosome synthesis. This report describes a quantitative analysis of the early stages of the synthesis of ribosomes of M. tuberculosis. Specifically, the roles of three large operons, namely: the rrn operon (1.7 microns) encoding rrs (16S rRNA), rrl (23S rRNA) and rrf (5S rRNA); the rpsJ operon (1.93 microns), which encodes 11 ribosomal proteins; and the rplN operon (1.45 microns), which encodes 10 ribosomal proteins. A mathematical framework based on properties of population-average cells was developed to identify the number of transcripts of the rpsJ and rplN operons needed to maintain exponential growth. The values obtained were supported by RNaseq data. The motif 5'-gcagac-3' was found close to 5' end of transcripts of mycobacterial rplN operons, suggesting it may form part of the RpsH feedback binding site because the same motif is present in the ribosome within the region of rrs that forms the binding site for RpsH. Medical Research Council.

  20. The Xis2d protein of CTnDOT binds to the intergenic region between the mob and tra operons.

    Science.gov (United States)

    Hopp, Crystal M; Gardner, Jeffrey F; Salyers, Abigail A

    2015-09-01

    CTnDOT is a 65kbp integrative and conjugative element (ICE) that carries genes encoding both tetracycline and erythromycin resistances. The excision operon of this element encodes Xis2c, Xis2d, and Exc proteins involved in the excision of CTnDOT from host chromosomes. These proteins are also required in the complex transcriptional regulation of the divergently transcribed transfer (tra) and mobilization (mob) operons of CTnDOT. Transcription of the tra operon is positively regulated by Xis2c and Xis2d, whereas, transcription of the mob operon is positively regulated by Xis2d and Exc. Xis2d is the only protein that is involved in the excision reaction, as well as the transcriptional regulation of both the mob and tra operons. This paper helps establish how Xis2d binds the DNA in the mob and tra region. Unlike other excisionase proteins, Xis2d binds a region of dyad symmetry. The binding site is located in the intergenic region between the mob and tra promoters, and once bound Xis2d induces a bend in the DNA. Xis2d binding to this region could be the preliminary step for the activation of both operons. Then the other proteins, like Exc, can interact with Xis2d and form higher order complexes. Copyright © 2015 Elsevier B.V. All rights reserved.

  1. Expression of the lacZ gene in Escherichia coli irradiated with gamma rays

    Directory of Open Access Journals (Sweden)

    Mikio Kato

    2014-10-01

    Full Text Available Exposure of bacterial cells to ionizing radiation damages cellular components and causes cell death. We examined the induction of the plasmid-encoded lacZ gene in Escherichia coli JM109 harboring pUC19 after irradiation with gamma rays. The data demonstrated that cells irradiated with 6 or 8 kGy gamma rays lost their ability to grow on nutrient agar plates, but retained the ability to induce lacZ gene expression by IPTG at about 10% the level of the nonirradiated control. Thus, inactivation of cells by irradiation may provide another option for establishing a vehicle of protein and DNA, as nonpropagating protein-producing apparatus, albeit with lower capacity than intact cells.

  2. TRICALCAR : Weaving Community Based Wireless Networks in ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    This grant will support a capacity-building and applied research project on community wireless networking in Latin America and the Caribbean (LAC). Researchers will review, update and adapt 18 existing online thematic modules, and design seven new ones. A group of wireless experts with expertise in the social impacts ...

  3. Caractérisation des sables et morphologie du fond du lac du ...

    African Journals Online (AJOL)

    Administrateur

    2Laboratoire de Géologie Marine et Sédimentologie ; UFR-Sciences de la Terre et des Ressources Minières, Université de Cocody,. 22 BP 582 ... Par ailleurs, cette étude a permis de réaliser la première carte bathymétrique du lac de Taabo 26 ans après sa mise en eau. ... de vie constitue une des conséquences les plus.

  4. Typical near surface layer current patterns in Lake Geneva's main basin (Grand Lac)

    Science.gov (United States)

    Razmi, A.; Barry, D. A.; Bouffard, D.; Lemmin, U.

    2014-12-01

    The Lake Geneva current field is controlled by a variable wind field and thermal stratification. Typical current patterns in the Grand Lac which is oriented roughly in the East-West direction were determined under real time wind conditions and thermal stratifications using the DELFT3D-FLOW hydrodynamic model. The model solves the Reynolds-Averaged Navier-Stokes equations, combined with a k-ɛ turbulence closure in σ (lakebed-following) coordinates. The model was forced by a space-time dependent wind stress and heat flux over a 2.2 km × 2.2 km horizontal grid (interpolated onto the model grid) provided by the Swiss Meteorological office (COSMO2, MeteoSwiss) in 2012. Modeling results revealed stronger circulation for the large scale gyres in the non-stratified season (winter), compared with the stratified season (summer). A clockwise circulation pattern in the western part and a counter-clockwise current pattern in the central part of the Grand Lac are identified under large scale north-easterly winds (Bise), which occur frequently. For large scale south-westerly winds (Vent), another frequent wind, a long-fetch (up to ~ 30 km) leads to a clockwise circulation pattern in the central part of the main basin while a counter-clockwise recirculating gyre is induced in the eastern part. Strong eastward currents are observed near the Grand Lac north-shore. The simulation results compared well with ADCP data and time series of temperature profiles from the middle of the Grand Lac.

  5. Évaluation du niveau de pollution par les métaux lourds des lacs ...

    African Journals Online (AJOL)

    La présente étude a pour objectif principal d'évaluer le niveau de pollution métallique des lacs Bini et Dang (Ngaoundéré, Cameroun) à travers l'analyse des eaux et des sédiments de surface. La concentration des métaux lourds (Ni, Cr, Fe, Pb, Cd, Zn) a été mesurée par spectrophotométrie d'absorption atomique.

  6. Separating the BL Lac and cluster X-ray emissions in Abell 689 with Chandra

    Science.gov (United States)

    Giles, P. A.; Maughan, B. J.; Birkinshaw, M.; Worrall, D. M.; Lancaster, K.

    2012-01-01

    We present the results of a Chandra observation of the galaxy cluster Abell 689 (z = 0.279). Abell 689 is one of the most luminous clusters detected in the ROSAT All Sky Survey (RASS), but was flagged as possibly including significant point source contamination. The small point spread function of the Chandra telescope allows us to confirm this and separate the point source from the extended cluster X-ray emission. For the cluster, we determine a bolometric luminosity of Lbol= (3.3 ± 0.3) × 1044 erg s-1 and a temperature of kT = 5.1+2.2- 1.3 keV when including a physically motivated background model. We compare our measured luminosity for A689 to that quoted in the RASS, and find L0.1-2.4 keV= 2.8 × 1044 erg s-1, a value ˜10 times lower than the ROSAT measurement. Our analysis of the point source shows evidence for significant pile-up, with a pile-up fraction of ≃60 per cent. Sloan Digital Sky Survey spectra and Hubble Space Telescope (HST) images lead us to the conclusion that the point source within Abell 689 is a BL Lac object. Using radio and optical observations from the Very Large Array and HST archives, we determine αro= 0.50, αox= 0.77 and αrx= 0.58 for the BL Lac, which would classify it as being of 'high-energy peak BL Lac' type. Spectra extracted of A689 show a hard X-ray excess at energies above 6 keV that we interpret as inverse-Compton emission from aged electrons that may have been transported into the cluster from the BL Lac.

  7. Far Ultraviolet Spectroscopy of Old Novae. II. RR Pic, V533 Her, and DI Lac

    Science.gov (United States)

    Sion, Edward M.; Godon, Patrick; Jones, Liam

    2017-03-01

    The old novae V533 Her (Nova Her 1963), DI Lac (Nova Lac 1910), and RR Pic (Nova Pic 1891) are in (or near) their quiescent stage, following their nova explosions, and continue to accrete at a high rate in the aftermath of their explosions. They exhibit continua that are steeply rising into the FUV, as well as absorption lines and emission lines of uncertain origin. All three have Far Ultraviolet Spectroscopic Explorer (FUSE) spectra that offer not only higher spectral resolution but also wavelength coverage extending down to the Lyman Limit. For DI Lac, we have matched these FUSE spectra with existing archival International Ultraviolet Explorer spectral coverage to broaden the FUV wavelength coverage. We adopted the newly determined interstellar reddening corrections of Selvelli & Gilmozzi. The dereddened FUV spectra have been modeled with our grids of optically thick accretion disks and hot, NLTE white dwarf (WD) photospheres. The results of our modeling analysis indicate that the hot components in RR Pic and V533 Her are likely to be accretion disks with mass accretion rates of 10-8 M ⊙ yr-1 and 10-9 M ⊙ yr-1 respectively. However, the disk cannot produce the observed absorption lines. For the WD to be the source of the absorption lines in these two systems, it must be very hot, with a radius several times its expected size (because the WD in these systems is massive, it has a smaller radius). For DI Lac, we find the best fit to be a disk with \\dot{M}={10}-10 {M}⊙ {{yr}}-1 with a 30,000 K WD. Based on observations made with the NASA-CNES-CSA Far Ultraviolet Spectroscopic Explorer (FUSE). FUSE was operated for NASA by the Johns Hopkins University under NASA contract NAS5-32985.

  8. Analyses de la dégradation du lac Kinkony pour la conservation du ...

    African Journals Online (AJOL)

    ... de ces changements et leur éventuelle synergie sur la biologie de la faune menacée requièrent de plus amples recherches, des aménagements anti - érosifs sur les quatre bassins environnants les plus vulnérables et des restaurations de phragmitaies sont proposés pour la conservation de la biodiversité du lac Kinkony.

  9. Clinical, metabolic, and genetic aspects of cytochrome C oxidase deficiency in Saguenay-Lac-Saint-Jean.

    OpenAIRE

    Morin, C; Mitchell, G; Larochelle, J; Lambert, M; Ogier, H; Robinson, B H; De Braekeleer, M

    1993-01-01

    Thirty-four children with lactic acidosis and Leigh encephalopathy due to cytochrome C oxidase (COX) deficiency distributed in 28 families have recently been identified in northeastern Quebec, particularly in the Saguenay-Lac-Saint-Jean (SLSJ) region. The segregation analysis was consistent with an autosomal recessive mode of inheritance. The incidence was estimated at 1/2,063 live births between 1979 and 1990, and the carrier rate was estimated at 1/23 inhabitants in SLSJ. In SLSJ, the place...

  10. Examen de la gestion et stratégies de protection des berges du Lac ...

    African Journals Online (AJOL)

    La dégradation du lac Bam au Burkina Faso préoccupe les acteurs nationaux et internationaux. Le présent travail vise principalement à contribuer à la connaissance des facteurs de dégradation et des stratégies de gestion durable. Spécifiquement, il voudrait identifier les acteurs impliqués dans la gestion des berges ...

  11. High Prevalence of Diverse Insertion Sequences within the rRNA Operons of Mycoplasma bovis.

    Science.gov (United States)

    Amram, Eytan; Borovok, Ilya; Nachum-Biala, Yaarit; Ayling, Roger; Lerner, Uri; Harrus, Shimon; Lysnyansky, Inna

    2016-11-01

    Insertion sequences (ISs) are widespread in the genome of Mycoplasma bovis strain PG45, but no ISs were identified within its two tandemly positioned rRNA operons (rrn1 and rrn2). However, characterization of the rrn locus in 70 M. bovis isolates revealed the presence of ISs related to the ISMbov1 (IS30 family) and ISMbov4 (IS4 family) isomers in 35 isolates. ISs were inserted into intergenic region 1 (IGR-1) or IGR-3, which are the putative promoter regions of rrn1 and rrn2, respectively, and into IGR-5, located downstream of the rrl2 gene. Seven different configurations (A to G) of the rrn locus with respect to ISs were identified, including those in five annotated genomes. The transcriptional start site for the single rrn operon in M. bovis strain 88127 was mapped within IGR-1, 60 bp upstream of the rrs gene. Notably, only 1 nucleotide separated the direct repeat (DR) for ISMbov1 and the promoter -35 element in configuration D, while in configuration F, the -35 motif was a part of the ISMbov1 DR. Relative quantitative real-time (qRT) PCR analysis and growth rate comparisons detected a significant increase (P operons that did not have ISs. A high prevalence of IS elements within or close to the M. bovis rrn operon-promoter region may reflect their important role in regulation of both ribosome synthesis and function. Data presented in this study show a high prevalence of diverse ISs within the M. bovis rrn locus resulting in intraspecies variability and diversity. Such abundance of IS elements near or within the rrn locus may offer a selective advantage to M. bovis Moreover, the fact that expression of the rrs genes as well as the number of viable cells increased in the group of strains with IS element insertion within a putative promoter -35 sequence (configuration F) in comparison to that in strains with one or two rrn operons that do not have ISs may serve as a basis for understanding the possible role of M. bovis IS elements in fundamental biological processes

  12. Archive of Geosample Data and Information from the University of Minnesota National Lacustrine Core Repository (LacCore)

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — The National Lacustrine Core Repository (LacCore), operated by the University of Minnesota is a partner in the Index to Marine and Lacustrine Geological Samples...

  13. Rice Lake National Wildlife Refuge and Mille Lacs National Wildlife Refuge: Comprehensive Conservation Plan and Environmental Assessment

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — This Comprehensive Conservation Plan (CCP) was written to guide management on Rice Lake and Mille Lacs NWRs for the next 15 years. This plan outlines the refuges'...

  14. Integrating Usability Engineering in the Iterative Design Process of the Land Attack Combat System (LACS) Human Computer Interface (HCI)

    National Research Council Canada - National Science Library

    Borja, Ana T

    2004-01-01

    ...) for its intended purposes. This paper presents our approach of the usability engineering activities and the results from a 1-year Fiscal Year 2003 effort for the development of the LACS Human Computer Interface (HCI...

  15. Complete Genomes of Bacillus coagulans S-lac and Bacillus subtilis TO-A JPC, Two Phylogenetically Distinct Probiotics

    National Research Council Canada - National Science Library

    Khatri, Indu; Sharma, Shailza; Ramya, T N C; Subramanian, Srikrishna

    2016-01-01

    .... We report the complete genomes of two commercially available probiotics, Bacillus coagulans S-lac and Bacillus subtilis TO-A JPC, and compare them with the genomes of other Bacillus and Lactobacillus...

  16. The use of lacZ marker in enumeration of Azotobacter chroococcum in carrier based inoculants

    Directory of Open Access Journals (Sweden)

    Manu Solanki

    2014-06-01

    Full Text Available A transconjugant of Azotobacter chroococcum Mac 27 tagged with lac Z(A. chroococcum Mac27 L was found to possess high levels of β-galactosidase activity constitutively.Further, the lac Z marker was found to be stably integrated into the chromosome of the A. chroococcum Mac 27 and did not have any adverse effect on growth, nitrogen fixation and excretion of ammonia. A quick method to determine the viable cell number in broth culture and carrier based inoculants has been developed on the basis of β-galactosidase assay. It was found that there was a direct relationship between the number of cell as determined by standard plate count and intensity of colour that developed upon degradation of ONPG due to β-galactosidase activity .The method was found to be sensitive enough to determine 1.7 x 10(6 CFU mL-1 in broth culture as well as carrier based Azotobacter inoculants. Further, it was observed that when A. chroococcum Mac27 L was inoculated on Brassica campestris, it could be detected in the presence of other bacteria capable of growing on Burks agar medium containing X-gal on the basis of lac Z genetic marker.

  17. Bifunctional lacZ alpha-ccdB genes for selective cloning of PCR products.

    Science.gov (United States)

    Gabant, P; Drèze, P L; Van Reeth, T; Szpirer, J; Szpirer, C

    1997-11-01

    The use of PCR-amplified DNA-fragments is a classical approach to generate recombinant DNA. To facilitate the cloning of PCR products, we have constructed two new pKIL vectors that allow selection of recombinants. The multiple cloning sites (MCS) of these plasmids contain two adjacent Aspel sites and a unique HindII site. Cleavage of these vectors with Aspel produce linearized molecules with a single thymidine nucleotide at the 3' ends allowing TA cloning of Taq-amplified fragments. On the other hand, cleavage with HindII can be used for the cloning of blunt-ended PCR products generated by other DNA polymerases. The LacZ alpha-CcdB fusion protein produced by these plasmids has retained both the CcdB killer activity and the ability to alpha-complement the truncated LacZ delta M15. This bifunctionality allowed us to show that small PCR products (< 1000 bp) that do not disrupt lacZ alpha efficiently do inactivate CcdB, which demonstrates that the CcdB-based selection is well adapted for cloning of PCR products, especially for small size fragments.

  18. Laccase Gene Sh-lac Is Involved in the Growth and Melanin Biosynthesis of Scleromitrula shiraiana.

    Science.gov (United States)

    Lǚ, Zhiyuan; Kang, Xin; Xiang, Zhonghuai; He, Ningjia

    2017-03-01

    Scleromitrula shiraiana causes the popcorn disease in mulberry trees resulting in severe economic losses. Previous studies have shown that melanin may play a vital role in establishing the pathogenicity of fungi. In the present study, we identified the melanin produced in S. shiraiana belongs to DHN melanin by gas chromatography-mass spectrometry, and cloned the laccase Sh-lac, a potential DHN melanin biosynthesis gene from S. shiraiana. We obtained two stable Sh-lac silenced transformants using RNAi, ilac-4 and 8 to elucidate the DHN melanin biosynthetic pathway in S. shiraiana. The melanin production of ilac-4 and ilac-8 was significantly reduced, and their vegetative growth was also suppressed. Results such as these led to a proposal that Sh-lac played a key role in DHN melanin formation in S. shiraiana and may function differentially with other melanin biosynthetic genes. The inhibition of melanin was accompanied by the decrease of oxalic acid and the adhesion of hyphae was impaired. Our results indicated that laccase was an important enzyme in the synthesis of melanin and might play a critical role in the pathogenicity of S. shiraiana.

  19. The REX survey as a tool to test the beaming model for BL Lacs

    CERN Document Server

    Caccianiga, A; MacCacaro, T; Wolter, A; Gioia, I M

    1999-01-01

    In the context of the beaming model (BM) BL Lac and FR I radio galaxies are thought to be the same class of sources seen at different angles. If this picture is correct, we expect to find some transition objects with intermediate properties between the two classes. To date, this intermediate population of objects is missing, probably due to the limiting fluxes of the current X-ray/radio surveys and/or to the criteria used to separate BL Lacs from normal elliptical galaxies. As pointed out by Browne and Marcha (1993), the detection of the transition objects requires particular attention since the "weak" BL Lac nucleus is hidden by the light of the host elliptical galaxy. A useful criterion often used to assess the presence of a non-thermal source, in addition to the stellar emission of the host galaxy, is the Ca contrast at 4000 AA (K/sub 4000/). This quantity, which is defined as the relative depression of the spectrum across 4000 AA, is a typical feature observed in a "normal" elliptical galaxy; the samples ...

  20. Trans-splicing and operons in metazoans: translational control in maternally regulated development and recovery from growth arrest.

    Science.gov (United States)

    Danks, Gemma B; Raasholm, Martina; Campsteijn, Coen; Long, Abby M; Manak, J Robert; Lenhard, Boris; Thompson, Eric M

    2015-03-01

    Polycistronic mRNAs transcribed from operons are resolved via the trans-splicing of a spliced-leader (SL) RNA. Trans-splicing also occurs at monocistronic transcripts. The phlyogenetically sporadic appearance of trans-splicing and operons has made the driving force(s) for their evolution in metazoans unclear. Previous work has proposed that germline expression drives operon organization in Caenorhabditis elegans, and a recent hypothesis proposes that operons provide an evolutionary advantage via the conservation of transcriptional machinery during recovery from growth arrested states. Using a modified cap analysis of gene expression protocol we mapped sites of SL trans-splicing genome-wide in the marine chordate Oikopleura dioica. Tiled microarrays revealed the expression dynamics of trans-spliced genes across development and during recovery from growth arrest. Operons did not facilitate recovery from growth arrest in O. dioica. Instead, we found that trans-spliced transcripts were predominantly maternal. We then analyzed data from C. elegans and Ciona intestinalis and found that an enrichment of trans-splicing and operon gene expression in maternal mRNA is shared between all three species, suggesting that this may be a driving force for operon evolution in metazoans. Furthermore, we found that the majority of known terminal oligopyrimidine (TOP) mRNAs are trans-spliced in O. dioica and that the SL contains a TOP-like motif. This suggests that the SL in O. dioica confers nutrient-dependent translational control to trans-spliced mRNAs via the TOR-signaling pathway. We hypothesize that SL-trans-splicing provides an evolutionary advantage in species that depend on translational control for regulating early embryogenesis, growth and oocyte production in response to nutrient levels. © The Author 2014. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  1. AraC protein, regulation of the L-arabinose operon in Escherichia coli, and the light switch mechanism of AraC action

    OpenAIRE

    Schleif, Robert

    2010-01-01

    This review covers the physiological aspects of regulation of the arabinose operon in Escherichia coli and the physical and regulatory properties of the operon's controlling gene, araC. It also describes the light switch mechanism as an explanation for many of the protein's properties. Although many thousands of homologs of AraC exist and regulate many diverse operons in response to many different inducers or physiological states, homologs that regulate arabinose-catabolizing genes in respons...

  2. lac-1 and lag-1 with ras-1 affect aging and the biological clock in Neurospora crassa.

    Science.gov (United States)

    Brunson, John K; Griffith, James; Bowles, Daneisha; Case, Mary E; Arnold, Jonathan

    2016-12-01

    Using an automated cell counting technique developed previously (Case et al., Ecology and Evolution 2014; 4: 3494), we explore the lifespan effects of lac-1, a ceramide synthase gene paralogous to lag-1 in Neurospora crassa in conjunction with the band bd (ras-1) gene. We find that the replicative lifespan of a lac-1KObd double mutants is short, about one race tube cycle, and this double mutant lacks a strong ~21-hr clock cycle as shown by race tube and fluorometer analysis of fluorescent strains including lac-1KO . This short replicative lifespan phenotype is contrasted with a very long estimated chronological lifespan for lac-1KObd double mutants from 247 to 462 days based on our regression analyses on log viability, and for the single mutant lac-1KO, 161 days. Both of these estimated lifespans are much higher than that of previously studied WT and bd single mutant strains. In a lac-1 rescue and induction experiment, the expression of lac-1+ as driven by a quinic acid-dependent promoter actually decreases the median chronological lifespan of cells down to only 7 days, much lower than the 34-day median lifespan found in control bd conidia also grown on quinic acid media, which we interpret as an effect of balancing selection acting on ceramide levels based on previous findings from the literature. Prior work has shown phytoceramides can act as a signal for apoptosis in stressed N. crassa cells. To test this hypothesis of balancing selection on phytoceramide levels, we examine the viability of WT, lag-1KObd, and lac-1KObd strains following the dual stresses of heat and glycolysis inhibition, along with phytoceramide treatments of different dosages. We find that the phytoceramide dosage-response curve is altered in the lag-1KObd mutant, but not in the lac-1KObd mutant. We conclude that phytoceramide production is responsible for the previously reported longevity effects in the lag-1KObd mutant, but a different ceramide may be responsible for the longevity effect

  3. Massive horizontal gene transfer, strictly vertical inheritance and ancient duplications differentially shape the evolution of Bacillus cereus enterotoxin operons hbl, cytK and nhe.

    Science.gov (United States)

    Böhm, Maria-Elisabeth; Huptas, Christopher; Krey, Viktoria Magdalena; Scherer, Siegfried

    2015-11-10

    Bacillus cereus sensu lato comprises eight closely related species including the human pathogens Bacillus anthracis and Bacillus cereus. Within B. cereus sensu lato, chromosomally and plasmid-encoded toxins exist. While plasmid-mediated horizontal gene transfer of the emetic toxin, anthrax and insecticidal toxins is known, evolution of enterotoxin genes within the group has not been studied. We report draft genome assemblies of 25 strains, a phylogenetic network of 142 strains based on ANI derived from genome sequences and a phylogeny based on whole-genome SNP analysis. The data clearly support subdivision of B. cereus sensu lato into seven phylogenetic groups. While group I, V and VII represent B. pseudomycoides, B. toyonensis and B. cytotoxicus, which are distinguishable at species level (ANI border ≥ 96 %), strains ascribed to the other five species do not match phylogenic groups. The chromosomal enterotoxin operons nheABC and hblCDAB are abundant within B. cereus both isolated from infections and from the environment. While the duplicated hbl variant hbl a is present in 22 % of all strains investigated, duplication of nheABC is extremely rare (0.02 %) and appears to be phylogenetically unstable. Distribution of toxin genes was matched to a master tree based on seven concatenated housekeeping genes, which depicts species relationships in B. cereus sensu lato as accurately as whole-genome comparisons. Comparison to the phylogeny of enterotoxin genes uncovered ample evidence for horizontal transfer of hbl, cytK and plcR, as well as frequent deletion of both toxins and duplication of hbl. No evidence for nhe deletion was found and stable horizontal transfer of nhe is rare. Therefore, evolution of B. cereus enterotoxin operons is shaped unexpectedly different for yet unknown reasons. Frequent exchange of the pathogenicity factors hbl, cytK and plcR in B. cereus sensu lato appears to be an important mechanism of B. cereus virulence evolution, including so

  4. Induction of phospholipase- and flagellar synthesis in Serratia liquefaciens is controlled by expression of the flagellar master operon flhD

    DEFF Research Database (Denmark)

    Givskov, M; Eberl, L; Christiansen, Gunna

    1995-01-01

    . Expression of flagella is demonstrated to follow a growth-phase-dependent pattern. Cloning, complementation studies and DNA-sequencing analysis has identified a genetic region in Serratia liquefaciens which exhibits extensive homology to the Escherichia coli flhD flagellar master operon. Interruption...... of the chromosomal flhD operon in S. liquefaciens results in non-flagellated and phospholipase-negative cells, but the synthesis of other exoenzymes is not affected. By placing the flhD operon under the control of a foreign inducible promoter we have shown that increased transcription through the flhD operon leads...

  5. CcpA affects expression of the groESL and dnaK operons in Lactobacillus plantarum

    Directory of Open Access Journals (Sweden)

    Marasco Rosangela

    2006-11-01

    Full Text Available Abstract Background Lactic acid bacteria (LAB are widely used in food industry and their growth performance is important for the quality of the fermented product. During industrial processes changes in temperature may represent an environmental stress to be overcome by starters and non-starters LAB. Studies on adaptation to heat shock have shown the involvement of the chaperon system-proteins in various Gram-positive bacteria. The corresponding operons, namely the dnaK and groESL operons, are controlled by a negative mechanism involving the HrcA repressor protein binding to the cis acting element CIRCE. Results We studied adaptation to heat shock in the lactic acid bacterium Lactobacillus plantarum. The LM3-2 strain, carrying a null mutation in the ccpA gene, encoding the catabolite control protein A (CcpA, showed a lower percent of survival to high temperature with respect to the LM3 wild type strain. Among proteins differentially expressed in the two strains, the GroES chaperon was more abundant in the wild type strain compared to the mutant strain under standard growth conditions. Transcriptional studies showed that class I heat shock operons were differentially expressed upon heat shock in both strains. Indeed, the dnaK and groESL operons were induced about two times more in the LM3 strain compared to the LM3-2 strain. Analysis of the regulatory region of the two operons showed the presence of cre sequences, putative binding sites for the CcpA protein. Conclusion The L. plantarum dnaK and groESL operons are characterized by the presence of the cis acting sequence CIRCE in the promoter region, suggesting a negative regulation by the HrcA/CIRCE system, which is a common type of control among the class I heat shock operons of Gram-positive bacteria. We found an additional system of regulation, based on a positive control exerted by the CcpA protein, which would interact with cre sequences present in the regulatory region of the dnaK and gro

  6. Expression of the ompATb operon accelerates ammonia secretion and adaptation of Mycobacterium tuberculosis to acidic environments.

    Science.gov (United States)

    Song, Houhui; Huff, Jason; Janik, Katharine; Walter, Kerstin; Keller, Christine; Ehlers, Stefan; Bossmann, Stefan H; Niederweis, Michael

    2011-05-01

    Homeostasis of intracellular pH is a trait critical for survival of Mycobacterium tuberculosis in macrophages. However, mechanisms by which M. tuberculosis adapts to acidic environments are poorly understood. In this study, we analysed the physiological functions of OmpATb, a surface-accessible protein of M. tuberculosis. OmpATb did not complement the permeability defects of a Mycobacterium smegmatis porin mutant to glucose, serine and glycerol, in contrast to the porin MspA. Uptake rates of these solutes were unchanged in an ompATb operon mutant of M. tuberculosis indicating that OmpATb is not a general porin. Chemical analysis of low-pH culture filtrates showed that the proteins encoded by the ompATb operon are involved in generating a rapid ammonia burst, which neutralized medium pH and preceded exponential growth of M. tuberculosis. Addition of ammonia accelerated growth of the ompATb operon mutant demonstrating that ammonia secretion is indeed a mechanism by which M. tuberculosis neutralizes acidic environments. Infection experiments revealed that the ompATb operon was not required for full virulence in mice suggesting that M. tuberculosis has multiple mechanisms of resisting phagosomal acidification. Taken together, these results show that the ompATb operon is necessary for rapid ammonia secretion and adaptation of M. tuberculosis to acidic environments in vitro but not in mice. © 2011 Blackwell Publishing Ltd.

  7. Genetic characterization of the hdrRM operon: a novel high-cell-density-responsive regulator in Streptococcus mutans.

    Science.gov (United States)

    Merritt, Justin; Zheng, Lanyan; Shi, Wenyuan; Qi, Fengxia

    2007-08-01

    Many species of bacteria can adhere to surfaces and grow as sessile communities. The continued accumulation of bacteria can eventually lead to the extremely high-cell-density environment characteristic of many biofilms or cell colonies. This is the normal habitat of the cariogenic species Streptococcus mutans, which normally resides in the high-cell-density, multispecies community commonly referred to as dental plaque. Previous work has demonstrated that the transcription of two separate bacteriocins can be activated by the high-cell-density conditions created through the centrifugation and incubation of cell pellets. In this study, we identified an uncharacterized two-gene operon that was induced >10-fold by conditions of high cell density. The genes of the operon encode a putative transcription regulator and a membrane protein, which were renamed as hdrR and hdrM, respectively. A transcription fusion to the hdrRM operon confirmed its induction by high cell density. Mutation of hdrM abolished bacteriocin production, greatly increased natural competence, reduced the growth rate, and severely affected biofilm formation. Interestingly, no obvious phenotypes were observed from a non-polar mutation of hdrR or mutations affecting the entire operon. These data suggest that the hdrRM operon may constitute a novel regulatory system responsible for mediating a cellular response to a high-cell-density environment.

  8. Silencing of Essential Genes within a Highly Coordinated Operon in Escherichia coli.

    Science.gov (United States)

    Goh, Shan; Hohmeier, Angela; Stone, Timothy C; Offord, Victoria; Sarabia, Francisco; Garcia-Ruiz, Cristina; Good, Liam

    2015-08-15

    Essential bacterial genes located within operons are particularly challenging to study independently because of coordinated gene expression and the nonviability of knockout mutants. Essentiality scores for many operon genes remain uncertain. Antisense RNA (asRNA) silencing or in-frame gene disruption of genes may help establish essentiality but can lead to polar effects on genes downstream or upstream of the target gene. Here, the Escherichia coli ribF-ileS-lspA-fkpB-ispH operon was used to evaluate the possibility of independently studying an essential gene using expressed asRNA and target gene overexpression to deregulate coupled expression. The gene requirement for growth in conditional silencing strains was determined by the relationship of target mRNA reduction with growth inhibition as the minimum transcript level required for 50% growth (MTL50). Mupirocin and globomycin, the protein inhibitors of IleS and LspA, respectively, were used in sensitization assays of strains containing both asRNA-expressing and open reading frame-expressing plasmids to examine deregulation of the overlapping ileS-lspA genes. We found upstream and downstream polar silencing effects when either ileS or lspA was silenced, indicating coupled expression. Weighted MTL50 values (means and standard deviations) of ribF, ileS, and lspA were 0.65 ± 0.18, 0.64 ± 0.06, and 0.76 ± 0.10, respectively. However, they were not significantly different (P = 0.71 by weighted one-way analysis of variance). The gene requirement for ispH could not be determined due to insufficient growth reduction. Mupirocin and globomycin sensitization experiments indicated that ileS-lspA expression could not be decoupled. The results highlight the inherent challenges associated with genetic analyses of operons; however, coupling of essential genes may provide opportunities to improve RNA-silencing antimicrobials. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  9. Transcription of the extended hyp-operon in Nostoc sp. strain PCC 7120

    Science.gov (United States)

    Agervald, Åsa; Stensjö, Karin; Holmqvist, Marie; Lindblad, Peter

    2008-01-01

    Background The maturation of hydrogenases into active enzymes is a complex process and e.g. a correctly assembled active site requires the involvement of at least seven proteins, encoded by hypABCDEF and a hydrogenase specific protease, encoded either by hupW or hoxW. The N2-fixing cyanobacterium Nostoc sp. strain PCC 7120 may contain both an uptake and a bidirectional hydrogenase. The present study addresses the presence and expression of hyp-genes in Nostoc sp. strain PCC 7120. Results RT-PCRs demonstrated that the six hyp-genes together with one ORF may be transcribed as a single operon. Transcriptional start points (TSPs) were identified 280 bp upstream from hypF and 445 bp upstream of hypC, respectively, demonstrating the existence of several transcripts. In addition, five upstream ORFs located in between hupSL, encoding the small and large subunits of the uptake hydrogenase, and the hyp-operon, and two downstream ORFs from the hyp-genes were shown to be part of the same transcript unit. A third TSP was identified 45 bp upstream of asr0689, the first of five ORFs in this operon. The ORFs are annotated as encoding unknown proteins, with the exception of alr0692 which is identified as a NifU-like protein. Orthologues of the four ORFs asr0689-alr0692, with a highly conserved genomic arrangement positioned between hupSL, and the hyp genes are found in several other N2-fixing cyanobacteria, but are absent in non N2-fixing cyanobacteria with only the bidirectional hydrogenase. Short conserved sequences were found in six intergenic regions of the extended hyp-operon, appearing between 11 and 79 times in the genome. Conclusion This study demonstrated that five ORFs upstream of the hyp-gene cluster are co-transcribed with the hyp-genes, and identified three TSPs in the extended hyp-gene cluster in Nostoc sp. strain PCC 7120. This may indicate a function related to the assembly of a functional uptake hydrogenase, hypothetically in the assembly of the small subunit of

  10. Characterization of the Proteasome Accessory Factor (paf) Operon in Mycobacterium tuberculosis▿

    OpenAIRE

    Festa, Richard A.; Pearce, Michael J.; Darwin, K. Heran

    2007-01-01

    In a previous screen for Mycobacterium tuberculosis mutants that are hypersusceptible to reactive nitrogen intermediates (RNI), two genes associated with the M. tuberculosis proteasome were identified. One of these genes, pafA (proteasome accessory factor A), encodes a protein of unknown function. In this work, we determined that pafA is in an operon with two additional genes, pafB and pafC. In order to assess the contribution of these genes to RNI resistance, we isolated mutants with transpo...

  11. Spontaneous mutations in the flhD operon generate motility heterogeneity in Escherichia coli biofilm.

    Science.gov (United States)

    Horne, Shelley M; Sayler, Joseph; Scarberry, Nicholas; Schroeder, Meredith; Lynnes, Ty; Prüß, Birgit M

    2016-11-08

    Heterogeneity and niche adaptation in bacterial biofilm involve changes to the genetic makeup of the bacteria and gene expression control. We hypothesized that i) spontaneous mutations in the flhD operon can either increase or decrease motility and that ii) the resulting motility heterogeneity in the biofilm might lead to a long-term increase in biofilm biomass. We allowed the highly motile E. coli K-12 strain MC1000 to form seven- and fourteen-day old biofilm, from which we recovered reduced motility isolates at a substantially greater frequency (5.4 %) than from a similar experiment with planktonic bacteria (0.1 %). Biofilms formed exclusively by MC1000 degraded after 2 weeks. In contrast, biofilms initiated with a 1:1 ratio of MC1000 and its isogenic flhD::kn mutant remained intact at 4 weeks and the two strains remained in equilibrium for at least two weeks. These data imply that an 'optimal' biofilm may contain a mixture of motile and non-motile bacteria. Twenty-eight of the non-motile MC1000 isolates contained an IS1 element in proximity to the translational start of FlhD or within the open reading frames for FlhD or FlhC. Two isolates had an IS2 and one isolate had an IS5 in the open reading frame for FlhD. An additional three isolates contained deletions that included the RNA polymerase binding site, five isolates contained point mutations and small deletions in the open reading frame for FlhC. The locations of all these mutations are consistent with the lack of motility and further downstream within the flhD operon than previously published IS elements that increased motility. We believe that the location of the mutation within the flhD operon determines whether the effect on motility is positive or negative. To test the second part of our hypothesis where motility heterogeneity in a biofilm may lead to a long-term increase in biofilm biomass, we quantified biofilm biomass by MC1000, MC1000 flhD::kn, and mixtures of the two strains at ratios of 1:1, 10

  12. Transcription of the extended hyp-operon in Nostoc sp. strain PCC 7120

    Directory of Open Access Journals (Sweden)

    Lindblad Peter

    2008-04-01

    Full Text Available Abstract Background The maturation of hydrogenases into active enzymes is a complex process and e.g. a correctly assembled active site requires the involvement of at least seven proteins, encoded by hypABCDEF and a hydrogenase specific protease, encoded either by hupW or hoxW. The N2-fixing cyanobacterium Nostoc sp. strain PCC 7120 may contain both an uptake and a bidirectional hydrogenase. The present study addresses the presence and expression of hyp-genes in Nostoc sp. strain PCC 7120. Results RT-PCRs demonstrated that the six hyp-genes together with one ORF may be transcribed as a single operon. Transcriptional start points (TSPs were identified 280 bp upstream from hypF and 445 bp upstream of hypC, respectively, demonstrating the existence of several transcripts. In addition, five upstream ORFs located in between hupSL, encoding the small and large subunits of the uptake hydrogenase, and the hyp-operon, and two downstream ORFs from the hyp-genes were shown to be part of the same transcript unit. A third TSP was identified 45 bp upstream of asr0689, the first of five ORFs in this operon. The ORFs are annotated as encoding unknown proteins, with the exception of alr0692 which is identified as a NifU-like protein. Orthologues of the four ORFs asr0689-alr0692, with a highly conserved genomic arrangement positioned between hupSL, and the hyp genes are found in several other N2-fixing cyanobacteria, but are absent in non N2-fixing cyanobacteria with only the bidirectional hydrogenase. Short conserved sequences were found in six intergenic regions of the extended hyp-operon, appearing between 11 and 79 times in the genome. Conclusion This study demonstrated that five ORFs upstream of the hyp-gene cluster are co-transcribed with the hyp-genes, and identified three TSPs in the extended hyp-gene cluster in Nostoc sp. strain PCC 7120. This may indicate a function related to the assembly of a functional uptake hydrogenase, hypothetically in the

  13. Role of P27 -P55 operon from Mycobacterium tuberculosis in the resistance to toxic compounds

    Directory of Open Access Journals (Sweden)

    Cataldi Angel A

    2011-07-01

    Full Text Available Abstract Background The P27-P55 (lprG-Rv1410c operon is crucial for the survival of Mycobacterium tuberculosis, the causative agent of human tuberculosis, during infection in mice. P55 encodes an efflux pump that has been shown to provide Mycobacterium smegmatis and Mycobacterium bovis BCG with resistance to several drugs, while P27 encodes a mannosylated glycoprotein previously described as an antigen that modulates the immune response against mycobacteria. The objective of this study was to determine the individual contribution of the proteins encoded in the P27-P55 operon to the resistance to toxic compounds and to the cell wall integrity of M. tuberculosis. Method In order to test the susceptibility of a mutant of M. tuberculosis H37Rv in the P27-P55 operon to malachite green, sodium dodecyl sulfate, ethidium bromide, and first-line antituberculosis drugs, this strain together with the wild type strain and a set of complemented strains were cultivated in the presence and in the absence of these drugs. In addition, the malachite green decolorization rate of each strain was obtained from decolorization curves of malachite green in PBS containing bacterial suspensions. Results The mutant strain decolorized malachite green faster than the wild type strain and was hypersensitive to both malachite green and ethidium bromide, and more susceptible to the first-line antituberculosis drugs: isoniazid and ethambutol. The pump inhibitor reserpine reversed M. tuberculosis resistance to ethidium bromide. These results suggest that P27-P55 functions through an efflux-pump like mechanism. In addition, deletion of the P27-P55 operon made M. tuberculosis susceptible to sodium dodecyl sulfate, suggesting that the lack of both proteins causes alterations in the cell wall permeability of the bacterium. Importantly, both P27 and P55 are required to restore the wild type phenotypes in the mutant. Conclusions The results clearly indicate that P27 and P55 are

  14. Free cooling in an urban environment - A lake and ground water distribution network to cover the heating and cooling needs of buildings - Feasibility study for the City of Neuchatel, Switzerland; Freecooling en milieu urbain. Reseau de distribution d'eau de lac et d'eau souterraine pour couvrir les besoins en rafraichissement et en chaleur des batiments. Etude de faisabilite pour la Ville de Neuchatel, Suisse - Rapport final

    Energy Technology Data Exchange (ETDEWEB)

    Matthey, B.; Affolter, M.

    2009-12-15

    The potential cooling demand in the City of Neuchatel (35,000 inhabitants) is estimated to at least 15 MW. Considering the natural cooling resources available (the Lake of Neuchatel, the Serriere spring, groundwater), these needs can be satisfied without electrical refrigeration equipment. However, the multiplicity of resources and needs implicates the use of multiple and complementary water supply systems: individual wells, multiple building network, lake water distribution network for an entire district. Three exploitation systems to supply cooling water to the center of Neuchatel have been evaluated: lake water, ground water, existing drinking water network. The analysis indicates that the realization of a lake water network for free cooling and heat pumps is economically attractive. In a first step and to meet the short-term demand, the providing of cool water through the existing drinking water network can be considered. In Serriere, the use of the heating and cooling resource of the Serriere river has been evaluated. The results demonstrate the technical and economical feasibility of a heating and cooling water supply network. (authors)

  15. Promoter selectivity of the Bacillus subtilis response regulator DegU, a positive regulator of the fla/che operon and sacB.

    Science.gov (United States)

    Tsukahara, Kensuke; Ogura, Mitsuo

    2008-01-15

    The response regulator DegU and its cognate histidine kinase DegS constitute a two-component system in the Gram-positive soil bacterium Bacillus subtilis. Unphosphorylated and phosphorylated forms of DegU are known to activate target gene transcription in B. subtilis. Although phosphorylated DegU (DegU-P) regulates more than one hundred and twenty genes, the targets of unphosphorylated DegU are unknown, except for comK. We found that the fla/che (flagella and chemotaxis) operon is positively regulated by unphosphorylated DegU. The effect was most prominent in a strain bearing the functional swrAA gene, a positive regulator of fla/che. Unphosphorylated DegU bound to two regions in the fla/che regulatory region containing an inverted repeat-like sequence that resembles the inverted repeat (IR) in the comK promoter. Mutational analysis revealed that positive regulation of fla/che by SwrAA requires DegU-binding. An analysis of the DegU-P-regulated gene sacB (levansucrase gene) by footprint and mutational analyses revealed that DegU-P bound to a direct repeat (DR) of the DegU-recognition motifs, which has been shown to be functional in vivo, while unphosphorylated DegU did not. These results strongly suggest that the arrangement of the DegU-binding motifs determines whether unphosphorylated DegU or DegU-P binds to the sacB promoter. The hypothesis was confirmed by observing degS-independent expression when the DR in the sacB-lacZ fusion was changed to an IR, suggesting that unphosphorylated DegU regulates the sacB promoter through the newly created IR. This was confirmed by binding of unphosphorylated DegU to the IR in the sacB promoter. This study demonstrated that DegU positively regulates flgB and sacB through its binding to the promoter regions. We demonstrated that DegU-P prefers binding to DR but not to IR in the sacB promoter.

  16. Temperature Regulation of Shigella Virulence: Identification of Temperature-Regulated Shigella Invasion Genes by the Isolation of inv::lacZ Operon Fusions and the Characterization of the Virulence Gene Regulator virR

    Science.gov (United States)

    1991-04-10

    iron chelating hydroxamate compound or j% siderophore , has been implicated in the increased virulence of E. coli ColV strains (Williams, 1979). In...and ipaC) of Shigella flexneri. Microbial Pathogen. 4:345-357. 7. Baudry, B. , A. T. Maurelli. P. Clerc. J. C. Sadoff, and P. J. Sansonetti. 1987...serotype 5. Microbial Pathogen. 8:197-211. 146 17. Buysse, J. M., C. K, Stover. E. V. Oaks, M, Venkatesan. and D. J. Kopecko. 1987. Cloning of Invasion

  17. ANALYSIS AND REMEDIATION OF THE 2013 LAC-MÉGANTIC TRAIN DERAILMENT

    Directory of Open Access Journals (Sweden)

    S. Brunke

    2016-06-01

    Full Text Available On July 6, 2013 a train owned by Montréal, Maine & Atlantic Railway (MMA Company derailed in Lac-Mégantic, Quebec, Canada triggering the explosion of the tankers carrying crude oil. Several buildings in the downtown core were destroyed. The Sûreté du Québec confirmed the death of 47 people in the disaster. Through the Canadian Space Agency (CSA Rapid Information Products and Services (RIPS program, MDA developed value-added products that allowed stakeholders and all levels of government (municipal, provincial and federal to get an accurate picture of the disaster. The goal of this RIPS Project was to identify the contribution that remote sensing technology can provide to disasters such as the train derailment and explosion at Lac-Mégantic through response and remediation monitoring. Through monitoring and analysis, the Lac-Mégantic train derailment response and remediation demonstrated how Earth observation data can be used for situational awareness in a disaster and in documenting the remediation process. Both high resolution optical and RADARSAT-2 SAR image products were acquired and analyzed over the disaster remediation period as each had a role in monitoring. High resolution optical imagery provided a very clear picture of the current state of remediation efforts, however it can be difficult to acquire due to cloud cover and weather conditions. The RADARSAT-2 SAR images can be acquired in all weather conditions at any time of day making it ideal for mission critical information gathering. MDA’s automated change detection processing enabled rapid delivery of advanced information products.

  18. Constraining the red shifts of TeV BL Lac objects

    Science.gov (United States)

    Qin, Longhua; Wang, Jiancheng; Yan, Dahai; Yang, Chuyuan; Yuan, Zunli; Zhou, Ming

    2018-01-01

    We present a model-dependent method to estimate the red shifts of three TeV BL Lac objects (BL Lacs) through fitting their (quasi-)simultaneous multi-waveband spectral energy distributions (SEDs) with a one-zone leptonic synchrotron self-Compton model. Considering the impact of electron energy distributions (EEDs) on the results, we use three types of EEDs to fit the SEDs: a power-law EED with exponential cut-off (PLC), a log-parabola (PLLP) EED and the broken power-law (BPL) EED. We also use a parameter α to describe the uncertainties of the extragalactic background light models, as in Abdo et al. We then use a Markov chain Monte Carlo method to explore the multi-dimensional parameter space and obtain the uncertainties of the model parameters based on the observational data. We apply our method to obtain the red shifts of three TeV BL Lac objects in the marginalized 68 per cent confidence, and find that the PLC EED does not fit the SEDs. For 3C66A, the red shift is 0.14-0.31 and 0.16-0.32 in the BPL and PLLP EEDs. For PKS1424+240, the red shift is 0.55-0.68 and 0.55-0.67 in the BPL and PLLP EEDs. For PG1553+113, the red shift is 0.22-0.48 and 0.22-0.39 in the BPL and PLLP EEDs. We also estimate the red shift of PKS1424+240 in the high stage to be 0.46-0.67 in the PLLP EED, roughly consistent with that in the low stage.

  19. Contribution à l'étude de l'intérêt de la flore aquatique d'un lac de ...

    African Journals Online (AJOL)

    Saad

    L'étude présentée ici est réalisée durant la période allant de mars à octobre 2011 dans le lac Dayet Aoua situé dans la province .... quelques pieds de saule entourent le lac sur ses bords immédiats. Le lac est ... Tableau 1 : Valeurs moyennes des paramètres physicochimiques mesurés aux profondeurs,. 0m, 1m, 2m et 4m.

  20. Evaluation of critical indicators in the process of acquiring supplies and services LAC-UFPE

    Science.gov (United States)

    Caetano, V. F.; Ferreira, C. V.; dos Santos, M. J.; Honorato, F. A.

    2015-01-01

    In laboratories linked to public universities and accredited by the NBR ISO/IEC 17025, to meet efficiently item 4.6 (procurement of supplies and services) is a challenge that can be accomplished by programming based on historical purchases and services. In this study, we evaluated the critical procurement items to meet the quality management system of the LAC-UFPE: reagents, certified reference material, of equipment parts, maintenance and calibration of equipment and instruments. It was found that the most critical item is the certified reference material, the purchase or repair of which must be expedited within 125 days prior to the receipt to occur within the desired period.

  1. Lac du Flambeau Band of Lake Superior Chippewa Indians Strategic Energy Plan

    Energy Technology Data Exchange (ETDEWEB)

    Bryan Hoover

    2009-11-16

    This plan discusses the current energy use on the Lac du Flambeau Reservation, the current status of the Tribe's energy program, as well as the issues and concerns with energy on the reservation. This plan also identifies and outlines energy opportunities, goals, and objectives for the Tribe to accomplish. The overall goal of this plan is to address the energy situation of the reservation in a holistic manner for the maximum benefit to the Tribe. This plan is an evolving document that will be re-evaluated as the Tribe's energy situation changes.

  2. VLBA Observations of Low Luminosity Flat Spectrum Radio Galaxies and BL Lac Objects: Polarisation Properties

    Science.gov (United States)

    Bondi, M.; Dallacasa, D.; Stanghellini, C.; Marchã, M. J. M.

    We obtained two-epoch VLBA observations at 5 GHz of a list of radio galaxies drawn from the 200 mJy sample (Marcha et al. 1996). The objects selected for milli-arcsecond scale observations are classified, on the basis of their optical spectroscopic and polarimetric properties, as BL Lac objects, normal weak line radio galaxies, broad line radio galaxies, and transition objects (those with intermediate properties). We present preliminary results on the radio polarization properties, on the milli-arcsecond scale, of objects with different optical properties and discuss structural variations detected from the two epochs.

  3. Water resources of the Fond du Lac Indian Reservation, east-central Minnesota

    Science.gov (United States)

    Ruhl, J.F.

    1989-01-01

    Water resources in the Fond du Lac Indian Reservation meet the present (1987) needs for drinking-water supplies and other household uses with respect to water quality and quantity, and provide valuable ecological, recreational, and aesthetic benefits. Total annual water use in the Reservation is about 36.5 million gallons per year and per capita use is about 100 gallons per day. Practically all the water is used for domestic supply. Ground water is the source of all water supplies in the Reservation.

  4. Fermi LAT Detection of a Gamma-ray Flare from the BL Lac Object ON 246

    Science.gov (United States)

    Becerra, Josefa

    2015-06-01

    The Large Area Telescope (LAT) on board the Fermi Gamma-ray Space Telescope has observed increasing gamma-ray flux from a source positionally consistent with the BL Lac object ON 246 (RA=187.55871 deg, Dec=25.30198 deg, J2000, Beasley et al. 2002, ApJS, 141, 13; with redshift z=0.135, Nass et al. 1996, A&A, 309, 419), also known as S3 1227+25 and 3FGL J1230.3+2519 (3FGL; Acero et al. 2015, arXiv:1501.02003).

  5. Partial characterization of ribosomal operons of Lactobacillus delbrueckii UFV H2b20 Caracterização parcial de operons ribossomais de Lactobacillus delbrueckii UFV H2b20

    Directory of Open Access Journals (Sweden)

    Juliana Teixeira de Magalhães

    2005-06-01

    Full Text Available Ribosomal operons are great tools for microbe community characterization and for microorganisms relationship study, particularly in the case of the acid lactic bacteria. The ribosomal operon of the probiotic strain Lactobacillus delbrueckii UFV H2b20 was partially characterized. A genomic library of this strain was constructed and the clones with partial ribosomal operon were sub-cloned using the shot-gun method for subsequent sequencing with the forward primer. The sequence analysis revealed that the 3' end of the rDNA 16S was following by the short spacer region 1 (16S-23S and that the 3' end of the rDNA 23S was following by the short spacer region 2 (23S-5S, which preceded the rDNA 5S. In the flanking region of the rDNA 5S gene of this operon rrn, a region encoding six tRNAs was detected.Operons ribossomais têm sido instrumentos importantes na caracterização de comunidades microbianas e no estudo de relacionamentos entre microrganismos, principalmente em bactérias do ácido láctico. Operons ribossomais da linhagem probiótica, Lactobacillus delbrueckii UFV H2b20, foram parcialmente caracterizados. Um banco genômico da linhagem foi construído e os clones, contendo parte do operon ribossomal, foram subclonados pelo método de "shot gun", para em seguida serem seqüenciados com primer "forward". As seqüências indicaram a presença da extremidade 3' do rDNA 16S seguida da região espaçadora curta 1 (16S-23S e a presença da extremidade 3' do rDNA 23S seguido da região espaçadora 2 (23S-5S, que por sua vez precedia o rDNA 5S. Adjacente ao gene rDNA 5S deste operon rrn uma região codificadora de 6 tRNAs foi detectada.

  6. Genome-wide analysis of trans-splicing in the nematode Pristionchus pacificus unravels conserved gene functions for germline and dauer development in divergent operons.

    Science.gov (United States)

    Sinha, Amit; Langnick, Claudia; Sommer, Ralf J; Dieterich, Christoph

    2014-09-01

    Discovery of trans-splicing in multiple metazoan lineages led to the identification of operon-like gene organization in diverse organisms, including trypanosomes, tunicates, and nematodes, but the functional significance of such operons is not completely understood. To see whether the content or organization of operons serves similar roles across species, we experimentally defined operons in the nematode model Pristionchus pacificus. We performed affinity capture experiments on mRNA pools to specifically enrich for transcripts that are trans-spliced to either the SL1- or SL2-spliced leader, using spliced leader-specific probes. We obtained distinct trans-splicing patterns from the analysis of three mRNA pools (total mRNA, SL1 and SL2 fraction) by RNA-seq. This information was combined with a genome-wide analysis of gene orientation and spacing. We could confirm 2219 operons by RNA-seq data out of 6709 candidate operons, which were predicted by sequence information alone. Our gene order comparison of the Caenorhabditis elegans and P. pacificus genomes shows major changes in operon organization in the two species. Notably, only 128 out of 1288 operons in C. elegans are conserved in P. pacificus. However, analysis of gene-expression profiles identified conserved functions such as an enrichment of germline-expressed genes and higher expression levels of operonic genes during recovery from dauer arrest in both species. These results provide support for the model that a necessity for increased transcriptional efficiency in the context of certain developmental processes could be a selective constraint for operon evolution in metazoans. Our method is generally applicable to other metazoans to see if similar functional constraints regulate gene organization into operons. © 2014 Sinha et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

  7. High-level expression of Bacillus naganoensis pullulanase from recombinant Escherichia coli with auto-induction: effect of lac operator.

    Directory of Open Access Journals (Sweden)

    Yao Nie

    Full Text Available Pullulanase plays an important role in specific hydrolysis of branch points in amylopectin and is generally employed as an important enzyme in starch-processing industry. So far, however, the production level of pullulanase is still somewhat low from wide-type strains and even heterologous expression systems. Here the gene encoding Bacillus naganoensis pullulanase was amplified and cloned. For expression of the protein, two recombinant systems, Escherichia coli BL21(DE3/pET-20b(+-pul and E. coli BL21(DE3/pET-22b(+-pul, were constructed, both bearing T7 promoter and signal peptide sequence, but different in the existance of lac operator and lacI gene encoding lac repressor. Recombinant pullulanase was initially expressed with the activity of up to 14 U/mL by E. coli BL21(DE3/pET-20b(+-pul with IPTG induction in LB medium, but its expression level reduced continually with the extension of cryopreservation time and basal expression was observed. However, E. coli BL21(DE3/pET-22b(+-pul , involving lac operator downstream of T7 promoter to regulate foreign gene transcription, exhibited pullulanase activity consistently without detected basal expression. By investigating the effect of lac operator, basal expression of foreign protein was found to cause expression instability and negative effect on production of target protein. Thus double-repression strategy was proposed that lac operators in both chromosome and plasmid were bound with lac repressor to repress T7 RNA polymerase synthesis and target protein expression before induction. Consequently, the total activity of pullulanase was remarkably increased to 580 U/mL with auto-induction by lac operator-involved E. coli BL21(DE3/pET-22b(+-pul. When adding 0.6% glycine in culture, the extracellular production of pullulanase was significantly improved with the extracellular activity of 502 U/mL, which is a relatively higher level achieved to date for extracellular production of pullulanase. The

  8. Functional characterization of a conserved archaeal viral operon revealing single-stranded DNA binding, annealing and nuclease activities

    DEFF Research Database (Denmark)

    Guo, Yang; Kragelund, Birthe Brandt; White, Malcolm F.

    2015-01-01

    encoding proteins of unknown function and forming an operon with ORF207 (gp19). SIRV2 gp17 was found to be a single-stranded DNA (ssDNA) binding protein different in structure from all previously characterized ssDNA binding proteins. Mutagenesis of a few conserved basic residues suggested a U......-shaped binding path for ssDNA. The recombinant gp18 showed an ssDNA annealing activity often associated with helicases and recombinases. To gain insight into the biological role of the entire operon, we characterized SIRV2 gp19 and showed it to possess a 5'→3' ssDNA exonuclease activity, in addition...... for rudiviruses and the close interaction among the ssDNA binding, annealing and nuclease proteins strongly point to a role of the gene operon in genome maturation and/or DNA recombination that may function in viral DNA replication/repair....

  9. Differentiation of Serratia liquefaciens into swarm cells is controlled by the expression of the flhD master operon

    DEFF Research Database (Denmark)

    Eberl, L; Winson, MK; Sternberg, C

    1996-01-01

    The velocity with which a swarming colony of Serratia liquefaciens colonizes the surface of a suitable solid substratum was controlled by modulating the expression of the flhD master operon. In liquid medium, the stimulation of flhD expression resulted in filamentous, multinucleate, and hyperflag......The velocity with which a swarming colony of Serratia liquefaciens colonizes the surface of a suitable solid substratum was controlled by modulating the expression of the flhD master operon. In liquid medium, the stimulation of flhD expression resulted in filamentous, multinucleate......, and hyperflagellated cells that were indistinguishable from swarm cells isolated from the edge of a swarm colony. Thus, expression of the flhD master operon appears to play a central role in the process of swarm cell differentiation....

  10. Glucose & sodium chloride induced biofilm production & ica operon in clinical isolates of staphylococci

    Directory of Open Access Journals (Sweden)

    Astha Agarwal

    2013-01-01

    Full Text Available Background & objectives: All colonizing and invasive staphylococcal isolates may not produce biofilm but may turn biofilm producers in certain situations due to change in environmental factors. This study was done to test the hypothesis that non biofilm producing clinical staphylococci isolates turn biofilm producers in presence of sodium chloride (isotonic and high concentration of glucose, irrespective of presence or absence of ica operon. Methods: Clinical isolates of 100 invasive, 50 colonizing and 50 commensal staphylococci were tested for biofilm production by microtiter plate method in different culture media (trypticase soy broth alone or supplemented with 0.9% NaCl/ 5 or 10% glucose. All isolates were tested for the presence of ica ADBC genes by PCR. Results: Biofilm production significantly increased in the presence of glucose and saline, most, when both glucose and saline were used together. All the ica positive staphylococcal isolates and some ica negative isolates turned biofilm producer in at least one of the tested culture conditions. Those remained biofilm negative in different culture conditions were all ica negative. Interpretation & conclusions: The present results showed that the use of glucose or NaCl or combination of both enhanced biofilm producing capacity of staphylococcal isolates irrespective of presence or absence of ica operon.

  11. Glucose & sodium chloride induced biofilm production & ica operon in clinical isolates of staphylococci.

    Science.gov (United States)

    Agarwal, Astha; Jain, Amita

    2013-01-01

    All colonizing and invasive staphylococcal isolates may not produce biofilm but may turn biofilm producers in certain situations due to change in environmental factors. This study was done to test the hypothesis that non biofilm producing clinical staphylococci isolates turn biofilm producers in presence of sodium chloride (isotonic) and high concentration of glucose, irrespective of presence or absence of ica operon. Clinical isolates of 100 invasive, 50 colonizing and 50 commensal staphylococci were tested for biofilm production by microtiter plate method in different culture media (trypticase soy broth alone or supplemented with 0.9% NaCl/ 5 or 10% glucose). All isolates were tested for the presence of ica ADBC genes by PCR. Biofilm production significantly increased in the presence of glucose and saline, most, when both glucose and saline were used together. All the ica positive staphylococcal isolates and some ica negative isolates turned biofilm producer in at least one of the tested culture conditions. Those remained biofilm negative in different culture conditions were all ica negative. The present results showed that the use of glucose or NaCl or combination of both enhanced biofilm producing capacity of staphylococcal isolates irrespective of presence or absence of ica operon.

  12. Biological clocks and the coordination theory of RNA operons and regulons.

    Science.gov (United States)

    Keene, J D

    2007-01-01

    One of the regulatory models of circadian rhythms involves the oscillation of transcription and translation. Although transcription factors have been widely examined during circadian processes, posttranscriptional mechanisms are less well-studied. Several laboratories have used microarrays to detect changes in mRNA expression throughout the circadian cycle and have found that mRNAs encoding the RNA-binding proteins (RBPs) nocturnin and butyrate response factor (BRF1) undergo rhythmic changes. Nocturnin is a deadenylation enzyme that removes poly(A) from the 3' ends of mRNAs, whereas BRF1 destabilizes mRNAs encoding early response gene (ERG) transcripts that contain AU-rich sequences in their 3'-untranslated regions (UTRs). Moroni and coworkers proposed that BRF1 functions as an oscillating posttranscriptional RNA operon (PTRO) that diurnally degrades ERG transcripts in peripheral organs (Keene and Tenenbaum 2002; Benjamin et al. 2006). The PTRO model posits that mRNAs can be members of one or more discrete functionally related subsets of mRNAs as determined by cis elements in mRNA and trans-acting RBPs or microRNAs that collectively recognize these cis elements (Keene 2007). This chapter describes the basis of posttranscriptional coordination by RNA operons and their potential for horizontal transfer among cells and discusses the potential for RBPs and microRNAs to participate in coordinating circadian rhythms and other biological clocks.

  13. A functional glycogen biosynthesis pathway in Lactobacillus acidophilus: expression and analysis of the glg operon

    Science.gov (United States)

    Goh, Yong Jun; Klaenhammer, Todd R

    2013-01-01

    Glycogen metabolism contributes to energy storage and various physiological functions in some prokaryotes, including colonization persistence. A role for glycogen metabolism is proposed on the survival and fitness of Lactobacillus acidophilus, a probiotic microbe, in the human gastrointestinal environment. L. acidophilus NCFM possesses a glycogen metabolism (glg) operon consisting of glgBCDAP-amy-pgm genes. Expression of the glg operon and glycogen accumulation were carbon source- and growth phase-dependent, and were repressed by glucose. The highest intracellular glycogen content was observed in early log-phase cells grown on trehalose, which was followed by a drastic decrease of glycogen content prior to entering stationary phase. In raffinose-grown cells, however, glycogen accumulation gradually declined following early log phase and was maintained at stable levels throughout stationary phase. Raffinose also induced an overall higher temporal glg expression throughout growth compared with trehalose. Isogenic ΔglgA (glycogen synthase) and ΔglgB (glycogen-branching enzyme) mutants are glycogen-deficient and exhibited growth defects on raffinose. The latter observation suggests a reciprocal relationship between glycogen synthesis and raffinose metabolism. Deletion of glgB or glgP (glycogen phosphorylase) resulted in defective growth and increased bile sensitivity. The data indicate that glycogen metabolism is involved in growth maintenance, bile tolerance and complex carbohydrate utilization in L. acidophilus. PMID:23879596

  14. Carbonic anhydrase in Escherichia coli. A product of the cyn operon.

    Science.gov (United States)

    Guilloton, M B; Korte, J J; Lamblin, A F; Fuchs, J A; Anderson, P M

    1992-02-25

    The product of the cynT gene of the cyn operon in Escherichia coli has been identified as a carbonic anhydrase. The cyn operon also includes the gene cynS, encoding the enzyme cyanase. Cyanase catalyzes the reaction of cyanate with bicarbonate to give ammonia and carbon dioxide. The carbonic anhydrase was isolated from an Escherichia coli strain overexpressing the cynT gene and characterized. The purified enzyme was shown to contain 1 Zn2+/subunit (24 kDa) and was found to behave as an oligomer in solution; the presence of bicarbonate resulted in partial dissociation of the oligomeric enzyme. The kinetic properties of the enzyme are similar to those of carbonic anhydrases from other species, including inhibition by sulfonamides and cyanate. The amino acid sequence shows a high degree of identity with the sequences of two plant carbonic anhydrases. but not with animal and algal carbonic anhydrases. Since carbon dioxide formed in the bicarbonate-dependent decomposition of cyanate diffuses out of the cell faster than it would be hydrated to bicarbonate, the apparent function of the induced carbonic anhydrase is to catalyze hydration of carbon dioxide and thus prevent depletion of cellular bicarbonate.

  15. Characterization of a Mycobacterium avium subsp. avium Operon Associated with Virulence and Drug Detoxification

    Directory of Open Access Journals (Sweden)

    Mariana Noelia Viale

    2014-01-01

    Full Text Available The lprG-p55 operon of Mycobacterium tuberculosis and Mycobacterium bovis is involved in the transport of toxic compounds. P55 is an efflux pump that provides resistance to several drugs, while LprG is a lipoprotein that modulates the host's immune response against mycobacteria. The knockout mutation of this operon severely reduces the replication of both mycobacterial species during infection in mice and increases susceptibility to toxic compounds. In order to gain insight into the function of LprG in the Mycobacterium avium complex, in this study, we assayed the effect of the deletion of lprG gene in the D4ER strain of Mycobacterium avium subsp. avium. The replacement of lprG gene with a hygromycin cassette caused a polar effect on the expression of p55. Also, a twofold decrease in ethidium bromide susceptibility was observed and the resistance to the antibiotics rifampicin, amikacin, linezolid, and rifabutin was impaired in the mutant strain. In addition, the mutation decreased the virulence of the bacteria in macrophages in vitro and in a mice model in vivo. These findings clearly indicate that functional LprG and P55 are necessary for the correct transport of toxic compounds and for the survival of MAA in vitro and in vivo.

  16. Relationship between the persistence of mer operon sequences in Escherichia coli and their resistance to mercury.

    Science.gov (United States)

    Murtaza, Imtiyaz; Dutt, Amit; Ali, Arif

    2002-03-01

    Studies related to geographic distribution of E. coli carrying mer operon sequences were carried out on the Indian subcontinent. Out of the 80 E. coli isolates, collected from five geographically distinct regions of India, 68 were found to be resistant to one or the other heavy metal used in the study. Among these isolates, 36 were found to be resistant to the inorganic form (HgCl2) and only 5 to resist both the inorganic and organic forms of mercury. Colony hybridization studies revealed 35 isolates out of 68 to hybridize with the probe. Interestingly, some of the mercury-sensitive isolates (Hgs), especially from the Dal Lake, were found positive in hybridization studies. These findings, supported by mercury volatilization studies, indicate the presence of nonfunctional/vestigial mer sequences in the isolates collected from different environments. On the other hand, few of the mercury-resistant isolates (Hgr) from the Yamuna River did not show any sign of hybridization. Further, volatilization studies also indicated an alternate mode of resistance mechanism operating in them. The studies demonstrate that the mer operon sequences share very high homology among the E. coli isolates collected from different geographical locations, and this metal resistance may be a genetic character that arose from a common ancestral background.

  17. Genetic and biochemical characterization of the F-ATPase operon from Streptococcus sanguis 10904.

    Science.gov (United States)

    Kuhnert, Wendi L; Quivey Jr, Robert G

    2003-03-01

    Oral streptococci utilize an F-ATPase to regulate cytoplasmic pH. Previous studies have shown that this enzyme is a principal determinant of aciduricity in the oral streptococcal species Streptococcus sanguis and Streptococcus mutans. Differences in the pH optima of the respective ATPases appears to be the main reason that S. mutans is more tolerant of low pH values than S. sanguis and hence pathogenic. We have recently reported the genetic arrangement for the S. mutans operon. For purposes of comparative structural biology we have also investigated the F-ATPase from S. sanguis. Here, we report the genetic characterization and expression in Escherichia coli of the S. sanguis ATPase operon. Sequence analysis showed a gene order of atpEBFHAGDC and that a large intergenic space existed upstream of the structural genes. Activity data demonstrate that ATPase activity is induced under acidic conditions in both S. sanguis and S. mutans; however, it is not induced to the same extent in the nonpathogenic S. sanguis. Expression studies with an atpD deletion strain of E. coli showed that S. sanguis-E. coli hybrid enzymes were able to degrade ATP but were not sufficiently functional to permit growth on succinate minimal media. Hybrid enzymes were found to be relatively insensitive to inhibition by dicyclohexylcarbodiimide, indicating loss of productive coupling between the membrane and catalytic subunits.

  18. Identification and characterization of an operon, msaABCR, that controls virulence and biofilm development in Staphylococcus aureus.

    Science.gov (United States)

    Sahukhal, Gyan S; Elasri, Mohamed O

    2014-06-11

    Community-acquired, methicillin-resistant Staphylococcus aureus strains often cause localized infections in immunocompromised hosts, but some strains show enhanced virulence leading to severe infections even among healthy individuals with no predisposing risk factors. The genetic basis for this enhanced virulence has yet to be determined. S. aureus possesses a wide variety of virulence factors, the expression of which is carefully coordinated by a variety of regulators. Several virulence regulators have been well characterized, but others have yet to be thoroughly investigated. Previously, we identified the msa gene as a regulator of several virulence genes, biofilm development, and antibiotic resistance. We also found evidence of the involvement of upstream genes in msa function. To investigate the mechanism of regulation of the msa gene (renamed msaC), we examined the upstream genes whose expression was affected by its deletion. We showed that msaC is part of a newly defined four-gene operon (msaABCR), in which msaC is a non-protein-coding RNA that is essential for the function of the operon. Furthermore, we found that an antisense RNA (msaR) is complementary to the 5' end of the msaB gene and is expressed in a growth phase-dependent manner suggesting that it is involved in regulation of the operon. These findings allow us to define a new operon that regulates fundamental phenotypes in S. aureus such as biofilm development and virulence. Characterization of the msaABCR operon will allow us to investigate the mechanism of function of this operon and the role of the individual genes in regulation and interaction with its targets. This study identifies a new element in the complex regulatory circuits in S. aureus, and our findings may be therapeutically relevant.

  19. Characterization of a β-Glucoside Operon (bgc) Prevalent in Septicemic and Uropathogenic Escherichia coli Strains▿ †

    Science.gov (United States)

    Neelakanta, Girish; Sankar, T. Sabari; Schnetz, Karin

    2009-01-01

    Escherichia coli strains, in general, do not ferment cellobiose and aryl-β-d-glucosidic sugars, although “cryptic” β-d-glucoside systems have been characterized. Here we describe an additional cryptic operon (bgc) for the utilization of cellobiose and the aryl-β-d-glucosides arbutin and salicin at low temperature. The bgc operon was identified by the characterization of β-glucoside-positive mutants of an E. coli septicemia strain (i484) in which the well-studied bgl (aryl-β-d-glucoside) operon was deleted. These bgc* mutants appeared after 5 days of incubation on salicin indicator plates at 28°C. The bgc operon codes for proteins homologous to β-glucoside/cellobiose-specific phosphoenolpyruvate-dependent phosphotransfer system permease subunits IIB (BgcE), IIC (BgcF), and IIA (BgcI); a porin (BgcH); and a phospho-β-d-glucosidase (BgcA). Next to the bgc operon maps the divergent bgcR gene, which encodes a GntR-type transcriptional regulator. Expression of the bgc operon is dependent on the cyclic-AMP-dependent regulator protein CRP and positively controlled by BgcR. In the bgc* mutants, a single nucleotide exchange enhances the activity of the bgc promoter, rendering it BgcR independent. Typing of a representative collection of E. coli demonstrated the prevalence of bgc in strains of phylogenetic group B2, representing mainly extraintestinal pathogens, while it is rare among commensal E. coli strains. The bgc locus is also present in the closely related species Escherichia albertii. Further, bioinformatic analyses demonstrated that homologs of the bgc genes exist in the enterobacterial Klebsiella, Enterobacter, and Citrobacter spp. and also in gram-positive bacteria, indicative of horizontal gene transfer events. PMID:19233952

  20. Differential decay of RNA of the CFA/I fimbrial operon and control of relative gene expression.

    OpenAIRE

    Jordi, B J; op den Camp, I E; de Haan, L A; van der Zeijst, B A; Gaastra, W

    1993-01-01

    CFA/I fimbriae on human enterotoxigenic Escherichia coli are composed of the CfaB protein, the product of the second gene of the CFA/I operon. We show here that CfaB is expressed at a higher level than other proteins of the CFA/I operon. mRNA encoding the CfaB protein is much more abundant than mRNA encoding CfaA, the first protein, together with CfaB or mRNA encoding CfaA only. Only one promoter, upstream of cfaA, is present. These data indicate that a primary transcript containing cfaA and ...

  1. Systemic RNAi delivery to the muscles of ROSA26 mice reduces lacZ expression.

    Directory of Open Access Journals (Sweden)

    Jessica Wei

    Full Text Available RNAi has potential for therapeutically downregulating the expression of dominantly inherited genes in a variety of human genetic disorders. Here we used the ROSA26 mouse, which constitutively expresses the bacterial lacZ gene in tissues body wide, as a model to test the ability to downregulate gene expression in striated muscles. Recombinant adeno-associated viral vectors (rAAVs were generated that express short hairpin RNAs (shRNAs able to target the lacZ mRNA. Systemic delivery of these rAAV6 vectors led to a decrease of β-galactosidase expression of 30-50-fold in the striated muscles of ROSA26 mice. However, high doses of vectors expressing 21 nucleotide shRNA sequences were associated with significant toxicity in both liver and cardiac muscle. This toxicity was reduced in cardiac muscle using lower vector doses. Furthermore, improved knockdown in the absence of toxicity was obtained by using a shorter (19 nucleotide shRNA guide sequence. These results support the possibility of using rAAV vectors to deliver RNAi sequences systemically to treat dominantly inherited disorders of striated muscle.

  2. Lightning Detection by LAC Onboard the Japanese Venus Climate Orbiter, Planet-C

    Science.gov (United States)

    Takahashi, Y.; Yoshida, J.; Yair, Y.; Imamura, T.; Nakamura, M.

    2008-06-01

    Lightning activity in Venus has been a mystery for a long period, although many studies based on observations both by spacecraft and by ground-based telescope have been carried out. This situation may be attributed to the ambiguity of these evidential measurements. In order to conclude this controversial subject, we are developing a new type of lightning detector, LAC (Lightning and Airglow Camera), which will be onboard Planet-C (Venus Climate Orbiter: VCO). Planet-C will be launched in 2010 by JAXA. To distinguish an optical lightning flash from other pulsing noises, high-speed sampling at 50 kHz for each pixel, that enables us to investigate the time variation of each lightning flash phenomenon, is adopted. On the other hand, spatial resolution is not the first priority. For this purpose we developed a new type of APD (avalanche photo diode) array with a format of 8×8. A narrow band interference filter at wavelength of 777.4 nm (OI), which is the expected lightning color based on laboratory discharge experiment, is chosen for lightning measurement. LAC detects lightning flash with an optical intensity of average of Earth’s lightning or less at a distance of 3 Rv. In this paper, firstly we describe the background of the Venus lightning study to locate our spacecraft project, and then introduce the mission details.

  3. In vitro transcription accurately predicts lac repressor phenotype in vivo in Escherichia coli

    Directory of Open Access Journals (Sweden)

    Matthew Almond Sochor

    2014-07-01

    Full Text Available A multitude of studies have looked at the in vivo and in vitro behavior of the lac repressor binding to DNA and effector molecules in order to study transcriptional repression, however these studies are not always reconcilable. Here we use in vitro transcription to directly mimic the in vivo system in order to build a self consistent set of experiments to directly compare in vivo and in vitro genetic repression. A thermodynamic model of the lac repressor binding to operator DNA and effector is used to link DNA occupancy to either normalized in vitro mRNA product or normalized in vivo fluorescence of a regulated gene, YFP. An accurate measurement of repressor, DNA and effector concentrations were made both in vivo and in vitro allowing for direct modeling of the entire thermodynamic equilibrium. In vivo repression profiles are accurately predicted from the given in vitro parameters when molecular crowding is considered. Interestingly, our measured repressor–operator DNA affinity differs significantly from previous in vitro measurements. The literature values are unable to replicate in vivo binding data. We therefore conclude that the repressor-DNA affinity is much weaker than previously thought. This finding would suggest that in vitro techniques that are specifically designed to mimic the in vivo process may be necessary to replicate the native system.

  4. Comparative and functional analysis of the rRNA-operons and their tRNA gene complement in different lactic acid bacteria

    NARCIS (Netherlands)

    Vries, de M.C.; Siezen, R.J.; Wijman, J.G.E.; Zhao, Y.; Kleerebezem, M.; Vos, de W.M.; Vaughan, E.E.

    2006-01-01

    The complete genome sequences of the lactic acid bacteria (LAB), Lactobacillus plantarum, Lactococcus lactis, and Lactobacillus johnsonii were used to compare location, sequence, organisation, and regulation of the ribosomal RNA (rrn) operons. All rrn operons of the examined LAB diverge from the

  5. Identification of a novel operon in Lactococcus lactis encoding three enzymes for lactic acid synthesis: phosphofructokinase, pyruvate kinase, and lactate dehydrogenase.

    Science.gov (United States)

    Llanos, R M; Harris, C J; Hillier, A J; Davidson, B E

    1993-01-01

    The discovery of a novel multicistronic operon that encodes phosphofructokinase, pyruvate kinase, and lactate dehydrogenase in the lactic acid bacterium Lactococcus lactis is reported. The three genes in the operon, designated pfk, pyk, and ldh, contain 340, 502, and 325 codons, respectively. The intergenic distances are 87 bp between pfk and pyk and 117 bp between pyk and ldh. Plasmids containing pfk and pyk conferred phosphofructokinase and pyruvate kinase activity, respectively, on their host. The identity of ldh was established previously by the same approach (R. M. Llanos, A. J. Hillier, and B. E. Davidson, J. Bacteriol. 174:6956-6964, 1992). Each of the genes is preceded by a potential ribosome binding site. The operon is expressed in a 4.1-kb transcript. The 5' end of the transcript was determined to be a G nucleotide positioned 81 bp upstream from the pfk start codon. The pattern of codon usage within the operon is highly biased, with 11 unused amino acid codons. This degree of bias suggests that the operon is highly expressed. The three proteins encoded on the operon are key enzymes in the Embden-Meyerhoff pathway, the central pathway of energy production and lactic acid synthesis in L. lactis. For this reason, we have called the operon the las (lactic acid synthesis) operon. Images PMID:8478320

  6. Enhanced resistance of Saccharomyces cerevisiae to vanillin by expression of lacA from Trametes sp. AH28-2.

    Science.gov (United States)

    Ji, Lei; Shen, Yu; Xu, Lili; Peng, Bingyin; Xiao, Yazhong; Bao, Xiaoming

    2011-09-01

    Saccharomyces cerevisiae is affected by the presence of certain phenolic compounds such as vanillin during fermentation of pretreated lignocellulosic hydrolysates. Since vanillin can be polymerized in the presence of laccase into compounds with lower toxicity, the laccase gene, lacA, from Trametes sp. AH28-2 was fused to the α-factor signal sequence and transferred into S. cerevisiae CEN.PK strains for secretory expression. Furthermore, the chaperone gene, KAR2, was overexpressed to promote the translocation of laccase. In the presence of 8 mmol/L vanillin, a shorter lag phase was observed in the lacA gene expressing strains. The vanillin-specific conversion rate of the lacA-expressing strain BSJX0A2 was 0.069 g g(-1)biomass h(-1), while it was 0.065 g g(-1)biomass h(-1) in the reference strain. Copyright © 2011 Elsevier Ltd. All rights reserved.

  7. Position of the lacZX90 mutation and hybridization between complete and incomplete beta-galactosidase.

    Science.gov (United States)

    Mandecki, W; Fowler, A V; Zabin, I

    1981-01-01

    The position of the termination codon in lacZX90 was determined by isolation of a lac+ revertant. Lysine was found to replace tyrosine at position 1,012 of beta-galactosidase, indicating that X90 protein lacked the carboxyl-terminal 10 residues. A heat- and urea-sensitive hybrid enzyme was formed in vivo when supC, which supplies tyrosine to the position in the polypeptide corresponding to the nonsense codon, was used to suppress lacZX90. This result shows that suppression that adds back the original amino acid may not lead to the production of the wild-type enzyme if the latter is multimeric, because incomplete chains can be incorporated into the oligomer. PMID:6790520

  8. Occurrence of adhesin-encoding operons in Escherichia coli isolated from breeders with salpingitis and chicks with omphalitis Ocorrência de operons codificadores de adesinas em Escherichia coli isolada de aves reprodutoras com salpingite e de pintinhos com onfalite

    Directory of Open Access Journals (Sweden)

    Terezinha Knöbl

    2006-06-01

    Full Text Available The occurrence of fim, pap and sfa operons in Escherichia coli isolated from breeders with salpingitis and chicks with omphalitis was evaluated. Analysis of 100 E. coli isolates, by colony hybridization tests, showed that 78 (78% were fim+, one (1% was sfa+, seven (7% were fim+ associated with pap+, eigth (8% were fim+ and sfa+, one (1% was fim+pap+sfa+ and five (5% isolates did not hybridize with any probe. These results suggest that fim adhesion-encoding operon plays an important role in pathogenesis of E. coli infection in chickens with salpingitis and omphalitis.Ocorrência dos operons fim, pap e sfa em amostras de Escherichia coli isoladas de reprodutoras com salpingite e pintinhos com onfalite foi avaliada. A análise de 100 amostras através dos testes de hibridização de colônia mostrou que 78 (78% amostras eram fim+, uma (1% era sfa+, sete (7% eram fim+ associada a pap+, oito (8% eram fim+ e uma (1% era fim+pap+sfa+ e cinco (5% amostras não hibridizaram com nenhuma sonda. Estes resultados sugerem que o operon fim pode ter um importante papel na patogenia da infecção de Escherichia coli em reprodutoras com salpingite e pintinhos com onfalite.

  9. Opalinus claystone - low alkali (LAC) concrete interaction: Mineralogical investigations and identification of a Mg-rich phase

    OpenAIRE

    Lerouge, Catherine; Gaboreau, Stéphane; Grangeon, Sylvain; Roosz, S; Jenni, Andreas; Mäder, Urs; Claret, Francis; Cloet, Veerle

    2016-01-01

    International audience; A five-years-old interface between a low alkali concrete (LAC, CEM III/B containing 66% slag and 10% nano-silica) and Opalinus (OPA) claystone from CI drillhole (Mont Terri Underground Rock Laboratory – Jenni et al., 2014) was studied for its textural properties, mineralogy and chemistry, in order to investigate the alkaline perturbation. After five years, the reactivity between LAC concrete and Opalinus claystone is found to be limited to a ~1 mm–thick with a porous (...

  10. Mutagenicity of ultraviolet A radiation in the lacI transgene in Big Blue mouse embryonic fibroblasts

    OpenAIRE

    Kim, Sang-in; Gerd P Pfeifer; Besaratinia, Ahmad

    2007-01-01

    Sunlight ultraviolet A (UVA) irradiation has been implicated in the etiology of human skin cancer. A genotoxic mode of action for UVA radiation has been suggested that involves photosensitization reactions giving rise to promutagenic DNA lesions. We investigated the mutagenicity of UVA in the lacI transgene in Big Blue mouse embryonic fibroblasts. UVA irradiation of these cells at a physiologically relevant dose of 18 J/cm2 caused a 2.8-fold increase in the lacI mutant frequency relative to c...

  11. Role of the ganSPQAB Operon in Degradation of Galactan by Bacillus subtilis.

    Science.gov (United States)

    Watzlawick, Hildegard; Morabbi Heravi, Kambiz; Altenbuchner, Josef

    2016-10-15

    Bacillus subtilis possesses different enzymes for the utilization of plant cell wall polysaccharides. This includes a gene cluster containing galactan degradation genes (ganA and ganB), two transporter component genes (ganQ and ganP), and the sugar-binding lipoprotein-encoding gene ganS (previously known as cycB). These genes form an operon that is regulated by GanR. The degradation of galactan by B. subtilis begins with the activity of extracellular GanB. GanB is an endo-β-1,4-galactanase and is a member of glycoside hydrolase (GH) family 53. This enzyme was active on high-molecular-weight arabinose-free galactan and mainly produced galactotetraose as well as galactotriose and galactobiose. These galacto-oligosaccharides may enter the cell via the GanQP transmembrane proteins of the galactan ABC transporter. The specificity of the galactan ABC transporter depends on the sugar-binding lipoprotein, GanS. Purified GanS was shown to bind galactotetraose and galactotriose using thermal shift assay. The energy for this transport is provided by MsmX, an ATP-binding protein. The transported galacto-oligosaccharides are further degraded by GanA. GanA is a β-galactosidase that belongs to GH family 42. The GanA enzyme was able to hydrolyze short-chain β-1,4-galacto-oligosaccharides as well as synthetic β-galactopyranosides into galactose. Thermal shift assay as well as electrophoretic mobility shift assay demonstrated that galactobiose is the inducer of the galactan operon regulated by GanR. DNase I footprinting revealed that the GanR protein binds to an operator overlapping the -35 box of the σ(A)-type promoter of Pgan, which is located upstream of ganS IMPORTANCE: Bacillus subtilis is a Gram-positive soil bacterium that utilizes different types of carbohydrates, such as pectin, as carbon sources. So far, most of the pectin degradation systems and enzymes have been thoroughly studied in B. subtilis Nevertheless, the B. subtilis utilization system of galactan, which is

  12. Complex processing patterns of mRNAs of the large ATP synthase operon in Arabidopsis chloroplasts.

    Directory of Open Access Journals (Sweden)

    Mustafa Malik Ghulam

    Full Text Available Chloroplasts are photosynthetic cell organelles which have evolved from endosymbiosis of the cyanobacterial ancestor. In chloroplasts, genes are still organized into transcriptional units as in bacteria but the corresponding poly-cistronic mRNAs undergo complex processing events, including inter-genic cleavage and 5' and 3' end-definition. The current model for processing proposes that the 3' end of the upstream cistron transcripts and the 5' end of the downstream cistron transcripts are defined by the same RNA-binding protein and overlap at the level of the protein-binding site. We have investigated the processing mechanisms that operate within the large ATP synthase (atp operon, in Arabidopsis thaliana chloroplasts. This operon is transcribed by the plastid-encoded RNA polymerase starting from two promoters, which are upstream and within the operon, respectively, and harbors four potential sites for RNA-binding proteins. In order to study the functional significance of the promoters and the protein-binding sites for the maturation processes, we have performed a detailed mapping of the atp transcript ends. Our data indicate that in contrast to maize, atpI and atpH transcripts with overlapping ends are very rare in Arabidopsis. In addition, atpA mRNAs, which overlap with atpF mRNAs, are even truncated at the 3' end, thus representing degradation products. We observe, instead, that the 5' ends of nascent poly-cistronic atp transcripts are defined at the first protein-binding site which follows either one of the two transcription initiation sites, while the 3' ends are defined at the subsequent protein-binding sites or at hairpin structures that are encountered by the progressing RNA polymerase. We conclude that the overlapping mechanisms of mRNA protection have only a limited role in obtaining stable processed atp mRNAs in Arabidopsis. Our findings suggest that during evolution of different plant species as maize and Arabidopsis, chloroplasts

  13. Characterization of the Divergent sacBK and sacAR Operons, Involved in Sucrose Utilization by Lactococcus lactis

    NARCIS (Netherlands)

    Luesink, Evert J.; Marugg, Joey D.; Kuipers, Oscar P.; Vos, Willem M. de

    1999-01-01

    The divergently transcribed sacBK and sacAR operons, which are involved in the utilization of sucrose by Lactococcus lactis NZ9800, were examined by transcriptional and gene inactivation studies. Northern analyses of RNA isolated from cells grown at the expense of different carbon sources revealed

  14. Genomics of pyrrolnitrin biosynthetic loci : evidence for conservation and whole-operon mobility within Gram-negative bacteria

    NARCIS (Netherlands)

    Costa, Rodrigo; van Aarle, Ingrid M.; Mendes, Rodrigo; van Elsas, Jan Dirk

    Pyrrolnitrin (PRN) is a tryptophan-derived secondary metabolite produced by a narrow range of Gram-negative bacteria. The PRN biosynthesis by rhizobacteria presumably has a key role in their life strategies and in the biocontrol of plant diseases. The biosynthetic operon that encodes the pathway

  15. Transformation and characterization of an arsenic gene operon from urease-positive thermophilic Campylobacter (UPTC) in Escherichia coli.

    Science.gov (United States)

    Matsuda, M; Kuribayashi, T; Yamamoto, S; Millar, B C; Moore, J E

    2016-01-01

    An arsenate susceptibility test was performed with transformed and cultured Escherichia coli DH5α cells, which carried recombinant DNA of full-length arsenic (ars) operon, namely a putative membrane permease, ArsP; a transcriptional repressor, ArsR; an arsenate reductase, ArsC; and an arsenical-resistance membrane transporter, Acr3, from the Japanese urease-positive thermophilic Campylobacter lari (UPTC) CF89-12. The E. coli DH5α transformant showed reduced susceptibility to arsenate (~1536 μg/mL), compared to the control. Thus, these ars four-genes from the UPTC CF89-12 strain cells could confer a reduced susceptibility to arsenate in the transformed and E. coli DH5α cells. E. coli transformants with truncated ars operons, acr3 (acr3) and arsC-acr3 (∆arsC-acr3), of the ars operon, showed an MIC value of 384 μg/mL (~384 μg/mL), similar to the E. coli cells which carried the pGEM-T vector (control). Reverse transcription PCR confirmed in vivo transcription of recombinant full-length ars operon and deletion variants (∆acr3 and ∆arsC-acr3) in the transformed E. coli cells.

  16. Five phosphonate operon gene products as components of a multi-subunit complex of the carbon-phosphorus lyase pathway

    DEFF Research Database (Denmark)

    Jochimsen, Bjarne; Lolle, Signe; McSorley, Fern R.

    2011-01-01

    Organophosphonate utilization by Escherichia coli requires the 14 cistrons of the phnCDEFGHIJKLMNOP operon, of which the carbon-phosphorus lyase has been postulated to consist of the seven polypeptides specified by phnG to phnM. A 5,660-bp DNA fragment encompassing phnGHIJKLM is cloned, followed...

  17. Effet des conditions climatiques sur le niveau du lac Sidi Ali (Moyen Atlas, Maroc

    Directory of Open Access Journals (Sweden)

    Claude Martin

    2011-11-01

    Full Text Available Le lac Sidi Ali est un lac naturel d'altitude (2070-2080 m, sans exutoire superficiel, déterminé par le barrage d'une coulée basaltique. Doté d'un bassin versant apparent de 15,6 km2, il est alimenté par des eaux de ruissellement et par des sources karstiques. Son niveau subit des variations très fortes, annuelles et interannuelles, sous le contrôle des conditions climatiques, et en particulier des pluies et de l'évapotranspiration. Les périodes de sécheresse qui ont marqué les trois dernières décennies, se sont traduites par un abaissement du niveau de près de 7 m. Mais les précipitations abondantes des années 2008-09 et 2009-10 ont provoqué une nette remontée. Une régression multiple d'assez bonne qualité (r = 0,87 lie la variation annuelle du niveau (d'août à août à différents paramètres (conditions climatiques et niveau initial du lac.Lake Sidi Ali is a natural lake at high altitude (2070-2080 m, without surface outlet, determined by the dam of a basalt flow. With an apparent catchment of 15.6 km2, it is fed by runoff and karst springs. Its level shows strong annual and interannual variations, depending on weather conditions, particularly rainfall and evapotranspiration. Droughts that have marked the last three decades have resulted in a lowering of about 7 m of the water level. But heavy rainfall that occurred in 2008-09 and 2009-10 caused a marked rise. A multiple regression of sufficient quality (r = 0.87 binds the annual change (from august to august at differents parameters (weather conditions and initial level of the lake.

  18. Hunt for optical lightning flash in Venus using LAC onboard Akatsuki spacecraft

    Science.gov (United States)

    Takahashi, Yukihiro; Sato, Mitsuteru; Imai, Masataka

    2017-04-01

    There are not a few extensive investigations using data obtained with spacecraft and ground-based telescopes have been carried out in order to get a firm evidence of lightning discharge in Venus, we don't reach consensus on its existence. Indeed there exist some strong indications of electrical discharge both in optical and radio wave measurements. But these "evidences" are sometimes not accepted in the majority of researcher community. LAC on board Akatsuki, Venus climate orbiter, is the first sensor optimized for the lightning flash detection in planets other than the Earth so that it can identify the optical flash caused by electrical discharge in the atmosphere of Venus. Unique performance of LAC compared to other equipments used in the previous studies of Venus is the high-speed sampling rate at 30 kHz for all 32 pixels of APD matrix, enabling us to distinguish the optical lightning flash from other pulsing noises. We selected OI 777 nm line for lightning detection, which is expected to be the most prominent emission in CO2-dominant atmosphere based on the laboratory experiments. The second attempt of the insertion of Akatsuki into the orbit around Venus on December 7, 2015 was quite successful. After checking the sound condition of high-voltage system for the APD detector, the regular operation of LAC at nominal high-voltage of 300 V for lightning hunt was started on December 1, 2016. Due to the elongated orbit than that planned originally, we have an umbra for about 30 min to observe the lightning flash in the night side of Venus every 10 days. Up to now (January 11, 2017), we have examined three times observations with total observation time period of 70 min but couldn't find any lightning signals, though we confirmed the scattered sun light near the limb and tens of pulses caused by cosmic rays. If the spacecraft is located at a distance of 5,500 km from Venus surface, the threshold of triggering is 1/20 of the average of the Earth lightning flash and the

  19. Influence of the three nucleotides upstream of the initiation codon on expression of the Escherichia coli lacZ gene in Saccharomyces cerevisiae

    NARCIS (Netherlands)

    Looman, A. C.; Kuivenhoven, J. A.

    1993-01-01

    By introducing synthetic oligonucleotides into a lacZ-yeast expression vector a set of 47 plasmids (out of 64 possible) was generated, differing only in the three bases immediately upstream of the AUG initiation codon of the Escherichia coli lacZ gene. Expression of the beta-galactosidase fusion

  20. Differential turnover of the multiple processed transcripts of the Escherichia coli focA-pflB operon.

    Science.gov (United States)

    Sawers, R Gary

    2006-08-01

    Expression of the anaerobically inducible focA-pflB operon of Escherichia coli is subject to complex transcriptional and post-transcriptional control, which generates eight transcripts whose 5' ends span approximately 1.2 kb. All eight transcripts have the same 3' end. The 5' ends of three of the transcripts, termed 6, 6a and 7, are located upstream of the operon. The promoters generating transcripts 6 and 7 are anaerobically regulated by FNR and ArcA approximately P, while promoter 6a is constitutively active. The 5' ends of the other five transcripts are all located within the operon. Most of the 5' ends of these operon-internal transcripts result from RNA polymerase-dependent processing of the three longer primary transcripts, 6, 6a and 7. Here, it is demonstrated that subsequent to, and distinct from, these processing events, post-transcriptional modification of these transcripts also occurs through the action of the endoribonuclease RNase E. Transcripts 6 and 7 exhibit differential stability with half-lives of 1 and 5 min, respectively. Transcript 7, which has the longer half-life, is the longest transcript of the operon and has a approximately 340 base untranslated leader. Two of the operon-internal transcripts, 4 and 5, also have comparatively short half-lives in the wild-type, which are significantly increased in a mutant with impaired RNase E activity. A precursor-product relationship is observed between the longer transcripts 3-7 and transcripts 1 and 2. The 5' ends of transcripts 1 and 2 are closest to the pflB gene and have half-lives of approximately 7-8 min. The consequence of this regulation is an accumulation of full-length pflB transcript and comparably low levels of dicistronic transcript. This ensures different levels of synthesis of the formate transporter FocA and pyruvate formate-lyase during anaerobic growth, while maintaining coordinate regulation. Transcript analysis throughout the growth phase revealed that maximal anaerobic expression of

  1. Functional analysis of an intergenic non-coding sequence within mce1 operon of M.tuberculosis

    Directory of Open Access Journals (Sweden)

    Bose Mridula

    2010-04-01

    Full Text Available Abstract Background The mce operons play an important role in the entry of M. tuberculosis into macrophages and non-phagocytic cells. Their non-redundant function as well as complex regulation is implied by the phenotype of mce mutants. Recently, mce1 operon was found to extend over 13 genes, fadD5 (Rv0166 being the first gene of the operon. The presence of a non-coding sequence of 200 base pairs between Rv0166 and Rv0167 is peculiar to mce1 among the four mce operons of M.tuberculosis. We have examined the function of this region. Results We predicted putative promoter activity of the 200 base pairs of non-coding, intergenic region between Rv0166 and Rv0167 in silico using MEME software and designate it as intergenic promoter, IGPr. We demonstrate both promoter activity and a putative negative regulatory function of this fragment by reporter assays carried out in the surrogate host M.smegmatis. We find that the repressive elements not only control the native promoter but also repress a heterologous promoter of M.smegmatis. The higher activity of the intergenic promoter in a clinical isolate in comparison with the wild type sequence from M.tuberculosis H37Rv could be correlated with a point mutation within the negative element. We have mapped two transcription start sites for mce1 operon both of which are utilized in M.tuberculosis H37Rv as well as the clinical isolate VPCI591. Our studies show that the promoter activity in the non-coding region is relevant not only in reporter gene expression but also in the expression of mce1 operon in M. tuberculosis cells grown in synthetic medium. Conclusion The mce operon of M.tuberculosis H37Rv potentially can be transcribed from two promoters P1 and P2, former mapping upstream of Rv0166 and the latter in the non-coding intergenic region between Rv0166 and Rv0167. The transcription initiation from P1 results in a transcript with Rv0166 while that from P2 will be without it. The sequences between the

  2. Regulatory mutants of the aroF-tyrA operon of Escherichia coli K-12.

    Science.gov (United States)

    Cobbett, C S; Delbridge, M L

    1987-06-01

    The regulatory region of the aroF-tyrA operon was fused to the chloramphenicol acetyltransferase (cat) gene on a plasmid vector. Expression of the cat gene was subject to repression by tyrR+. This fusion was used to isolate regulatory mutants with increased expression of the cat gene in which repression by tyrR+ was affected. Nucleotide sequencing of these mutants has led to the identification of three sites involved in the repression of aroF by tyrR+. The existence of a functional promoter divergently transcribing from the aroF regulatory region was also demonstrated by using the cat fusion vector. The expression of this promoter is also regulated by tyrR+.

  3. Evolution of the Leukotoxin Operon in Genus Mannheimia

    DEFF Research Database (Denmark)

    Larsen, Jesper; Pedersen, Anders Gorm; Christensen, Henrik

    The leukotoxin protein of Mannheimia haemolytica belongs to the HlyA-like subfamily of cytotoxic RTX (repeats in toxin) proteins. To test the hypothesis that different lineages of genus Mannheimia gained the leukotoxin operon via horizontal gene transfer we used a strategy that combines......RNA sequences; (iii) phylogeny of 24 leukotoxin gene sequences and 16 homologous genes retrieved from SWISS-PROT by using PSI-BLAST. Our data show no evidence for horizontal gene transfer into this clade. We propose that vertical descent from the common ancestor of genus Mannheimia, with subsequent loss...... compositional and phylogenetic methods: (i) ranking of genes according to their convergence to the average genome signature of M. haemolytica based on the relative 3:1 dinucleotide bias in 56 individual genes; (ii) estimation of ancestral character states on a phylogeny of 43 Mannheimia strains based on 16S r...

  4. Control analysis as a tool to understand the formation of the las operon in Lactococcus lactis

    DEFF Research Database (Denmark)

    Købmann, Brian Jensen; Solem, Christian; Jensen, Peter Ruhdal

    2005-01-01

    control on glycolysis and growth rate but high negative control on formate production. We find that PFK and PK have zero control on glycolysis and growth rate at the wildtype enzyme level but both enzymes exert strong positive control on the glycolytic flux at reduced activities. PK has high positive...... coefficient increased towards 3. Increased las expression resulted in a slight decrease in the glycolytic flux. At the wildtype level the control was close to zero on both glycolysis and the pyruvate branches. The sum of control coefficients for the three enzymes individually was comparable to the control...... coefficient found for the entire operon; the strong positive control by PK almost cancels out the negative control by LDH on formate production. The analysis suggests that co-regulation of PFK and PK provides a very efficient way to regulate glycolysis, and co-regulating PK and LDH allows the cells...

  5. Conjugative Plasmid Transfer in Xylella fastidiosa Is Dependent ontraandtrbOperon Functions.

    Science.gov (United States)

    Burbank, Lindsey P; Van Horn, Christopher R

    2017-11-01

    The insect-transmitted plant pathogen Xylella fastidiosa is capable of efficient horizontal gene transfer (HGT) and recombination. Natural transformation occurs at high rates in X. fastidiosa , but there also is evidence that certain strains of X. fastidiosa carry native plasmids equipped with transfer and mobilization genes, suggesting conjugation as an additional mechanism of HGT in some instances. Two operons, tra and trb , putatively encoding a conjugative type IV secretion system, are found in some but not all X. fastidiosa isolates, often on native plasmids. X. fastidiosa strains that carry the conjugative transfer genes can belong to different subspecies and frequently differ in host ranges. Using X. fastidiosa strain M23 ( X. fastidiosa subsp. fastidiosa ) or Dixon ( X. fastidiosa subsp. multiplex ) as the donor strain and Temecula ( X. fastidiosa subsp. fastidiosa ) as the recipient strain, plasmid transfer was characterized using the mobilizable broad-host-range vector pBBR5pemIK. Transfer of plasmid pBBR5pemIK was observed under in vitro conditions with both donor strains and was dependent on both tra and trb operon functions. A conjugative mechanism likely contributes to gene transfer between diverse strains of X. fastidiosa , possibly facilitating adaptation to new environments or different hosts. IMPORTANCE Xylella fastidiosa is an important plant pathogen worldwide, infecting a wide range of different plant species. The emergence of new diseases caused by X. fastidiosa , or host switching of existing strains, is thought to be primarily due to the high frequency of HGT and recombination in this pathogen. Transfer of plasmids by a conjugative mechanism enables movement of larger amounts of genetic material at one time, compared with other routes of gene transfer such as natural transformation. Establishing the prevalence and functionality of this mechanism in X. fastidiosa contributes to a better understanding of HGT, adaptation, and disease emergence

  6. The ppm operon is essential for acylation and glycosylation of lipoproteins in Corynebacterium glutamicum.

    Directory of Open Access Journals (Sweden)

    Niloofar Mohiman

    Full Text Available BACKGROUND: Due to their contribution to bacterial virulence, lipoproteins and members of the lipoprotein biogenesis pathway represent potent drug targets. Following translocation across the inner membrane, lipoprotein precursors are acylated by lipoprotein diacylglycerol transferase (Lgt, cleaved off their signal peptides by lipoprotein signal peptidase (Lsp and, in Gram-negative bacteria, further triacylated by lipoprotein N-acyl transferase (Lnt. The existence of an active apolipoprotein N-acyltransferase (Ms-Ppm2 involved in the N-acylation of LppX was recently reported in M. smegmatis. Ms-Ppm2 is part of the ppm operon in which Ppm1, a polyprenol-monophosphomannose synthase, has been shown to be essential in lipoglycans synthesis but whose function in lipoprotein biosynthesis is completely unknown. RESULTS: In order to clarify the role of the ppm operon in lipoprotein biosynthesis, we investigated the post-translational modifications of two model lipoproteins (AmyE and LppX in C. glutamicum Δppm1 and Δppm2 mutants. Our results show that both proteins are anchored into the membrane and that their N-termini are N-acylated by Cg-Ppm2. The acylated N-terminal peptide of LppX was also found to be modified by hexose moieties. This O-glycosylation is localized in the N-terminal peptide of LppX and disappeared in the Δppm1 mutant. While compromised in the absence of Cg-Ppm2, LppX O-glycosylation could be restored when Cg-Ppm1, Cg-Ppm2 or the homologous Mt-Ppm1 of M. tuberculosis was overexpressed. CONCLUSION: Together, these results show for the first time that Cg-Ppm1 (Ppm synthase and Cg-Ppm2 (Lnt operate in a common biosynthetic pathway in which lipoprotein N-acylation and glycosylation are tightly coupled.

  7. Contribution of the nos-pdt operon to virulence phenotypes in methicillin-sensitive Staphylococcus aureus.

    Science.gov (United States)

    Sapp, April M; Mogen, Austin B; Almand, Erin A; Rivera, Frances E; Shaw, Lindsey N; Richardson, Anthony R; Rice, Kelly C

    2014-01-01

    Nitric oxide (NO) is emerging as an important regulator of bacterial stress resistance, biofilm development, and virulence. One potential source of endogenous NO production in the pathogen Staphylococcus aureus is its NO-synthase (saNOS) enzyme, encoded by the nos gene. Although a role for saNOS in oxidative stress resistance, antibiotic resistance, and virulence has been recently-described, insights into the regulation of nos expression and saNOS enzyme activity remain elusive. To this end, transcriptional analysis of the nos gene in S. aureus strain UAMS-1 was performed, which revealed that nos expression increases during low-oxygen growth and is growth-phase dependent. Furthermore, nos is co-transcribed with a downstream gene, designated pdt, which encodes a prephenate dehydratase (PDT) enzyme involved in phenylalanine biosynthesis. Deletion of pdt significantly impaired the ability of UAMS-1 to grow in chemically-defined media lacking phenylalanine, confirming the function of this enzyme. Bioinformatics analysis revealed that the operon organization of nos-pdt appears to be unique to the staphylococci. As described for other S. aureus nos mutants, inactivation of nos in UAMS-1 conferred sensitivity to oxidative stress, while deletion of pdt did not affect this phenotype. The nos mutant also displayed reduced virulence in a murine sepsis infection model, and increased carotenoid pigmentation when cultured on agar plates, both previously-undescribed nos mutant phenotypes. Utilizing the fluorescent stain 4-Amino-5-Methylamino-2',7'-Difluorofluorescein (DAF-FM) diacetate, decreased levels of intracellular NO/reactive nitrogen species (RNS) were detected in the nos mutant on agar plates. These results reinforce the important role of saNOS in S. aureus physiology and virulence, and have identified an in vitro growth condition under which saNOS activity appears to be upregulated. However, the significance of the operon organization of nos-pdt and potential

  8. Contribution of the nos-pdt operon to virulence phenotypes in methicillin-sensitive Staphylococcus aureus.

    Directory of Open Access Journals (Sweden)

    April M Sapp

    Full Text Available Nitric oxide (NO is emerging as an important regulator of bacterial stress resistance, biofilm development, and virulence. One potential source of endogenous NO production in the pathogen Staphylococcus aureus is its NO-synthase (saNOS enzyme, encoded by the nos gene. Although a role for saNOS in oxidative stress resistance, antibiotic resistance, and virulence has been recently-described, insights into the regulation of nos expression and saNOS enzyme activity remain elusive. To this end, transcriptional analysis of the nos gene in S. aureus strain UAMS-1 was performed, which revealed that nos expression increases during low-oxygen growth and is growth-phase dependent. Furthermore, nos is co-transcribed with a downstream gene, designated pdt, which encodes a prephenate dehydratase (PDT enzyme involved in phenylalanine biosynthesis. Deletion of pdt significantly impaired the ability of UAMS-1 to grow in chemically-defined media lacking phenylalanine, confirming the function of this enzyme. Bioinformatics analysis revealed that the operon organization of nos-pdt appears to be unique to the staphylococci. As described for other S. aureus nos mutants, inactivation of nos in UAMS-1 conferred sensitivity to oxidative stress, while deletion of pdt did not affect this phenotype. The nos mutant also displayed reduced virulence in a murine sepsis infection model, and increased carotenoid pigmentation when cultured on agar plates, both previously-undescribed nos mutant phenotypes. Utilizing the fluorescent stain 4-Amino-5-Methylamino-2',7'-Difluorofluorescein (DAF-FM diacetate, decreased levels of intracellular NO/reactive nitrogen species (RNS were detected in the nos mutant on agar plates. These results reinforce the important role of saNOS in S. aureus physiology and virulence, and have identified an in vitro growth condition under which saNOS activity appears to be upregulated. However, the significance of the operon organization of nos-pdt and

  9. A mutant crp allele that differentially activates the operons of the fuc regulon in Escherichia coli.

    Science.gov (United States)

    Zhu, Y; Lin, E C

    1988-05-01

    L-Fucose is used by Escherichia coli through an inducible pathway mediated by a fucP-encoded permease, a fucI-encoded isomerase, a fucK-encoded kinase, and a fucA-encoded aldolase. The adolase catalyzes the formation of dihydroxyacetone phosphate and L-lactaldehyde. Anaerobically, lactaldehyde is converted by a fucO-encoded oxidoreductase to L-1,2-propanediol, which is excreted. The fuc genes belong to a regulon comprising four linked operons: fucO, fucA, fucPIK, and fucR. The positive regulator encoded by fucR responds to fuculose 1-phosphate as the effector. Mutants serially selected for aerobic growth on propanediol became constitutive in fucO and fucA [fucO(Con) fucA(Con)], but noninducible in fucPIK [fucPIK(Non)]. An external suppressor mutation that restored growth on fucose caused constitutive expression of fucPIK. Results from this study indicate that this suppressor mutation occurred in crp, which encodes the cyclic AMP-binding (or receptor) protein. When the suppressor allele (crp-201) was transduced into wild-type strains, the recipient became fucose negative and fucose sensitive (with glycerol as the carbon and energy source) because of impaired expression of fucA. The fucPIK operon became hyperinducible. The growth rate on maltose was significantly reduced, but growth on L-rhamnose, D-galactose, L-arabinose, glycerol, or glycerol 3-phosphate was close to normal. Lysogenization of fuc+ crp-201 cells by a lambda bacteriophage bearing crp+ restored normal growth ability on fucose. In contrast, lysogenization of [fucO(Con)fucA(Con)fucPIK(Non)crp-201] cells by the same phage retarded their growth on fucose.

  10. Single nucleotide polymorphism in the genes of mce1 and mce4 operons of Mycobacterium tuberculosis: analysis of clinical isolates and standard reference strains.

    Science.gov (United States)

    Pasricha, Rashmi; Chandolia, Amita; Ponnan, Prija; Saini, Neeraj Kumar; Sharma, Sangeeta; Chopra, Madhu; Basil, Mandira Varma; Brahmachari, Vani; Bose, Mridula

    2011-02-23

    The presence of four mammalian cell entry (mce) operons in Mycobacterium tuberculosis suggests the essentiality of the functions of the genes in these operons. The differential expression of the four mce operons in different phases of in vitro growth and in infected animals reported earlier from our laboratory further justifies the apparent redundancy for these genes in the genome.Here we investigate the extent of polymorphism in eight genes in the mce1 and mce4 operons of M. tuberculosis from four standard reference strains (H37Rv, H37Ra, LVS (Low Virulent Strain) and BCG) and 112 clinical isolates varying in their drug susceptibility profile, analysed by direct sequencing and Sequenom MassARRAY platform. We discovered 20 single nucleotide polymorphisms (SNPs) in the two operons. The comparative analysis of the genes of mce1 and mce4 operons revealed that yrbE1A [Rv0167] was most polymorphic in mce1 operon while yrbE4A [Rv3501c] and lprN [Rv3495c] had the highest number of SNPs in the mce4 operon. Of 20 SNPs, 12 were found to be nonsynonymous and were further analysed for their pathological relevance to M. tuberculosis using web servers PolyPhen and PMut, which predicted five deleterious nonsynonymous SNPs. A mutation from proline to serine at position 359 of the native Mce1A protein was most deleterious as predicted by both PolyPhen and PMut servers. Energy minimization of the structure of native Mce1A protein and mutated protein was performed using InsightII. The mutated Mce1A protein showed structural changes that could account for the effects of this mutation. Our results show that SNPs in the coding sequences of mce1 and mce4 operons in clinical isolates can be significantly high. Moreover, mce4 operon is significantly more polymorphic than mce1 operon (p operon and synonymous substitutions are more in mce4 operon. In silico modeling predict that nonsynonymous SNP at mce1A [Rv0169], a virulence gene could play a pivotal role in causing functional changes in M

  11. CcpA represses the expression of the divergent cit operons of Enterococcus faecalis through multiple cre sites.

    Science.gov (United States)

    Suárez, Cristian A; Blancato, Víctor S; Poncet, Sandrine; Deutscher, Josef; Magni, Christian

    2011-10-11

    In Enterococcus faecalis the genes encoding the enzymes involved in citrate metabolism are organized in two divergent operons, citHO and oadHDB-citCDEFX-oadA-citMG (citCL locus). Expression of both operons is specifically activated by adding citrate to the medium. This activation is mediated by binding of the GntR-like transcriptional regulator (CitO) to the cis-acting sequences located in the cit intergenic region. Early studies indicated that citrate and glucose could not be co-metabolized suggesting some form of catabolite repression, however the molecular mechanism remained unknown. In this study, we observed that the citHO promoter is repressed in the presence of sugars transported by the Phosphoenolpyruvate:carbohydrate Phosphotranserase System (PTS sugars). This result strongly suggested that Carbon Catabolic Repression (CCR) impedes the expression of the activator CitO and the subsequent induction of the cit pathway. In fact, we demonstrate that CCR is acting on both promoters. It is partially relieved in a ccpA-deficient E. faecalis strain indicating that a CcpA-independent mechanism is also involved in regulation of the two operons. Furthermore, sequence analysis of the citH/oadH intergenic region revealed the presence of three putative catabolite responsive elements (cre). We found that they are all active and able to bind the CcpA/P-Ser-HPr complex, which downregulates the expression of the cit operons. Systematic mutation of the CcpA/P-Ser-HPr binding sites revealed that cre1 and cre2 contribute to citHO repression, while cre3 is involved in CCR of citCL. In conclusion, our study establishes that expression of the cit operons in E. faecalis is controlled by CCR via CcpA-dependent and -independent mechanisms.

  12. The Redshift of the BL Lac Object TXS 0506+056

    Science.gov (United States)

    Paiano, Simona; Falomo, Renato; Treves, Aldo; Scarpa, Riccardo

    2018-02-01

    The bright BL Lac object TXS 0506+056 is the most likely counterpart of the IceCube neutrino event EHE 170922A. The lack of this redshift prevents a comprehensive understanding of the modeling of the source. We present high signal-to-noise optical spectroscopy, in the range 4100–9000 Å, obtained at the 10.4 m Gran Telescopio Canarias. The spectrum is characterized by a power-law continuum and is marked by faint interstellar features. In the regions unaffected by these features, we found three very weak (EW ∼ 0.1 Å) emission lines that we identify with [O II] 3727 Å, [O III] 5007 Å, and [N II] 6583 Å, yielding the redshift z = 0.3365 ± 0.0010.

  13. Nutrient status of the lowbush blueberry, Lac-Saint-Jean area, Quebec, Canada. [Vaccinium angustifolium

    Energy Technology Data Exchange (ETDEWEB)

    Bouchard, A.R.; Gagnon, M.J.

    1987-01-01

    The lowbush blueberry (Vaccinium angustifolium Ait.) is an important commercial crop of the Lac-Saint-Jean area (Quebec, Canada). The major blueberry fields are located on sandy soils relatively poor in available mineral nutrients. The nutrients originate from a thin organic layer found on the top of these sandy soils. The leaf mineral contents (N, P, K, Mg, Ca, Mn, Fe, Cu, Zn and B) were measured in five blueberry fields during 1984 and 1985. Soil pH and soil available P, K, and Mg were also assessed. The results show that the leaf mineral contents are generally adequate. However, K and Zn might be occasionally deficient when compared to the actual established standards. The available Mg in soil was significantly correlated with the leaf Mg concentration. The data also suggest that the influence of the pH following the burn pruning seems to influence the nutrition of this species.

  14. Multiple ant species tending lac insect Kerria yunnanensis (Hemiptera: Kerriidae) provide asymmetric protection against parasitoids.

    Science.gov (United States)

    Chen, Youqing; Lu, Zhixing; Li, Qiao; Hoffmann, Benjamin D; Zhang, Wei

    2014-01-01

    This study investigated the effects of ant attendance on the parasitoid community and parasitism of lac insect Kerria yunnanensis aggregations in Yunnan province, China. We manipulated ant attendance to establish three treatments: (1) ant exclusion; (2) low ant attendance by several ant species; and (3) high ant attendance by Crematogaster macaoensis. Five parasitoid species were collected, with two species contributing 82.7 and 13.2% of total abundance respectively. Total parasitoid abundance was lowest in the February sample when K. yunnanensis was in its younger life stage, being significantly lower in the ant exclusion treatment. In April, all three treatments had significantly different parasitoid abundances, being highest in the ant exclusion treatment and the lowest in the high ant attendance treatment. When ants were present, there were strong negative relationships between total parasitoid abundance and ant abundance, with the relationships being dependent upon the ant species composition and abundance. The patterns of total parasitoid abundance were driven by the two most abundant parasitoid species. Parasitoid species richness did not differ among treatments or between sample times, however, multivariate analysis confirmed that overall parasitoid community structure differed significantly among treatments and between sample times, with the high ant attendance treatment differing most from the other two treatments. Interestingly the absence of ants did not result in increased parasitism from four of the five parasitoids. Ants in lac insect farming systems have a clear role for agricultural pest management. A full understanding of the asymmetric abilities of ants to influence parasitoid communities, and affect parasitism of hosts will require further experimental manipulation to assess the relative roles of 1) the abundance of each individual ant species on parasitoid access to hosts, 2) competition among parasitoids, and 3) the interaction between the

  15. Variabilité journalière de la qualité physico-chimique du lac M'koa ...

    African Journals Online (AJOL)

    échantillonnage en continu du lac M'koa de Jacqueville pendant. 24 heures en moyenne, un échantillonneur automatique Hach Lange GmbH type BL. 2000 a été posé en un point A de coordonnées. 5°12,415'N - 4°25,045'W (Figure 2). Ce point.

  16. LacZ and interleukin-3 expression in vivo after retroviral transduction of marrow-derived human osteogenic mesenchymal progenitors.

    Science.gov (United States)

    Allay, J A; Dennis, J E; Haynesworth, S E; Majumdar, M K; Clapp, D W; Shultz, L D; Caplan, A I; Gerson, S L

    1997-08-10

    Human marrow-derived mesenchymal progenitor cells (hMPCs), which have the capacity for osteogenic and marrow stromal differentiation, were transduced with the myeloproliferative sarcoma virus (MPSV)-based retrovirus, vM5LacZ, that contains the LacZ and neo genes. Stable transduction and gene expression occurred in 18% of cells. After culture expansion and selection in G418, approximately 70% of neo(r) hMPCs co-expressed LacZ. G418-selected hMPC retain their osteogenic potential and form bone in vivo when seeded into porous calcium phosphate ceramic cubes implanted subcutaneously into SCID mice. LacZ expression was evident within osteoblasts and osteocytes in bone developing within the ceramics 6 and 9 weeks after implantation. Likewise, hMPCs transduced with human interleukin-3 (hIL-3) cDNA, adhered to ceramic cubes and implanted into SCID mice, formed bone and secreted detectable levels of hIL-3 into the systemic circulation for at least 12 weeks. These data indicate that genetically transduced, culture-expanded bone marrow-derived hMPCs retain a precursor phenotype and maintain similar levels of transgene expression during osteogenic lineage commitment and differentiation in vivo. Because MPCs have been shown to differentiate into bone, cartilage, and tendon, these cells may be a useful target for gene therapy.

  17. 78 FR 3911 - Big Stone National Wildlife Refuge, Big Stone and Lac Qui Parle Counties, MN; Final Comprehensive...

    Science.gov (United States)

    2013-01-17

    ... From the Federal Register Online via the Government Publishing Office DEPARTMENT OF THE INTERIOR Fish and Wildlife Service Big Stone National Wildlife Refuge, Big Stone and Lac Qui Parle Counties, MN; Final Comprehensive Conservation Plan and Finding of No Significant Impact for Environmental Assessment...

  18. Analysis of in-vivo LacR-mediated gene repression based on the mechanics of DNA looping.

    Science.gov (United States)

    Zhang, Yongli; McEwen, Abbye E; Crothers, Donald M; Levene, Stephen D

    2006-12-27

    Interactions of E. coli lac repressor (LacR) with a pair of operator sites on the same DNA molecule can lead to the formation of looped nucleoprotein complexes both in vitro and in vivo. As a major paradigm for loop-mediated gene regulation, parameters such as operator affinity and spacing, repressor concentration, and DNA bending induced by specific or non-specific DNA-binding proteins (e.g., HU), have been examined extensively. However, a complete and rigorous model that integrates all of these aspects in a systematic and quantitative treatment of experimental data has not been available. Applying our recent statistical-mechanical theory for DNA looping, we calculated repression as a function of operator spacing (58-156 bp) from first principles and obtained excellent agreement with independent sets of in-vivo data. The results suggest that a linear extended, as opposed to a closed v-shaped, LacR conformation is the dominant form of the tetramer in vivo. Moreover, loop-mediated repression in wild-type E. coli strains is facilitated by decreased DNA rigidity and high levels of flexibility in the LacR tetramer. In contrast, repression data for strains lacking HU gave a near-normal value of the DNA persistence length. These findings underscore the importance of both protein conformation and elasticity in the formation of small DNA loops widely observed in vivo, and demonstrate the utility of quantitatively analyzing gene regulation based on the mechanics of nucleoprotein complexes.

  19. Bird communities of contrasting semi-natural habitats of Lac bay, Bonaire, during the fall migration season, 2011

    NARCIS (Netherlands)

    Debrot, A.O.; Bemmelen, van R.S.A.; Ligon, J.

    2013-01-01

    The mangrove and seagrass lagoon of Lac Bay on Bonaire covers an area of roughly 700 ha. It is home to endangered green sea turtles, Chelonia mydas, and the Caribbean queen conch, Strombus gigas, and is a roosting and breeding area for several birds. Based on its nature values this 7 km2 bay has

  20. Structure-based rational design to enhance the solubility and thermostability of a bacterial laccase Lac15.

    Directory of Open Access Journals (Sweden)

    Zemin Fang

    Full Text Available Bacterial laccases are ideal alternatives of fungal laccases for specific industrial applications due to specific characteristics such as alkalescence dependence and high chloride tolerance. However, some bacterial laccases presented as inclusion bodies when expressing in Escherichia coli and showed thermal instability. In this study, rational design was employed to enhance the solubility and the thermostablity of the bacterial laccase Lac15-His6 based on the crystal structure obtained previously. After deletion of His-tag and residues323-332, the obtained Lac15D was completely expressed in soluble form even at a higher temperature of 28°C, compared to only 50% of Lac15-His6 expressed solubly at 16°C. It showed a two-time higher activity at temperatures lower than 35°C and a half-life increasing from 72 min to 150 min at 45°C. When used in chromogenic reactions, Lac15D showed constant activity toward dye precursors and their combinations under alkaline conditions, demonstrating its application potential in hair coloring biotechnology.

  1. Effects of Acid LAC and Kem-Gest acid blends on growth performance and microbial shedding in weanling pigs.

    Science.gov (United States)

    Walsh, M C; Sholly, D M; Hinson, R B; Trapp, S A; Sutton, A L; Radcliffe, J S; Smith, J W; Richert, B T

    2007-02-01

    Weanling pigs with mean initial BW of 6.04 kg (Exp.1) and 5.65 kg (Exp. 2) and mean age at weaning of 18.2 d (Exp. 1) and 17.7 d (Exp. 2) were used in two 5-wk experiments (Exp. 1, n = 180; Exp. 2, n = 300) to evaluate the effects of an organic acid blend (Acid LAC, Kemin Americas Inc., Des Moines, IA) and an inorganic/organic acid blend (Kem-Gest, Kemin Americas Inc.) on weanling pig growth performance and microbial shedding. In Exp. 1, the 5 dietary treatments were 1) negative control, 2) diet 1 + 55 ppm carbadox, 3) diet 1 + 0.4% Acid LAC, 4) diet 1 + 0.2% Kem-Gest, 5) diet 1 + 0.4% Acid LAC and 0.2% Kem-Gest. In Exp. 2, the 6 dietary treatments were diets 1 through 4 corresponding to Exp. 1, plus 5) sequence 1: 0.4% Acid LAC for 7 d followed by 0.2% Kem-Gest for 28 d, and 6) sequence 2: 0.2% Kem-Gest for 7 d followed by 0.4% Acid LAC for 28 d. Pigs were housed at 6 (Exp. 1) or 10 (Exp. 2) pigs/pen. Treatments were fed throughout the experiment in 3 phases: d 0 to 7, d 7 to 21, and d 21 to 35. In Exp. 1, there were no differences (P > 0.05) in ADG, ADFI, or G:F among the dietary treatments at any time during the study. In Exp. 2, throughout the study, pigs fed carbadox (diet 2) and sequence 1 (diet 5) diets had the greatest ADG (d 0 to 35; 262, 294, 257, 257, 292, and 261 g/d, diets 1 through 6, respectively; P 0.10) at any sampling time. In Exp. 1, fecal E. coli concentrations for pigs fed the carbadox (P Gest on d 34, and the pigs fed the negative control diet tended (P Gest diets was similar to each other and to that of the carbadox-fed pigs. Adding the combination of 0.4% Acid LAC and 0.2% Kem-Gest to nursery pig diets reduced ADFI and pig growth rate. In Exp. 2, pigs fed the acid sequence of Acid LAC-Kem-Gest had similar growth performance to pigs fed carbadox, and this novel dietary acid sequence may have merit as a replacement for antibiotics in the nursery phase.

  2. Characterization of the opposing roles of H-NS and TraJ in transcriptional regulation of the F-plasmid tra operon.

    Science.gov (United States)

    Will, William R; Frost, Laura S

    2006-01-01

    The transfer (tra) operon of the conjugative F plasmid of Escherichia coli is a polycistronic 33-kb operon which encodes most of the proteins necessary for F-plasmid transfer. Here, we report that transcription from PY, the tra operon promoter, is repressed by the host nucleoid-associated protein, H-NS. Electrophoretic mobility shift assays indicate that H-NS binds preferentially to the tra promoter region, while Northern blot and transcriptional fusion analyses indicate that transcription of traY, the first gene in the tra operon, is derepressed in an hns mutant throughout growth. The plasmid-encoded regulatory protein TraJ is essential for transcription of the tra operon in wild-type Escherichia coli; however, TraJ is not necessary for plasmid transfer or traY operon transcription in an hns mutant. This indicates that H-NS represses transcription from PY directly and not indirectly via its effects on TraJ levels. These results suggest that TraJ functions to disrupt H-NS silencing at PY, allowing transcription of the tra operon.

  3. Lethality of MalE-LacZ hybrid protein shares mechanistic attributes with oxidative component of antibiotic lethality.

    Science.gov (United States)

    Takahashi, Noriko; Gruber, Charley C; Yang, Jason H; Liu, Xiaobo; Braff, Dana; Yashaswini, Chittampalli N; Bhubhanil, Sakkarin; Furuta, Yoshikazu; Andreescu, Silvana; Collins, James J; Walker, Graham C

    2017-08-09

    Downstream metabolic events can contribute to the lethality of drugs or agents that interact with a primary cellular target. In bacteria, the production of reactive oxygen species (ROS) has been associated with the lethal effects of a variety of stresses including bactericidal antibiotics, but the relative contribution of this oxidative component to cell death depends on a variety of factors. Experimental evidence has suggested that unresolvable DNA problems caused by incorporation of oxidized nucleotides into nascent DNA followed by incomplete base excision repair contribute to the ROS-dependent component of antibiotic lethality. Expression of the chimeric periplasmic-cytoplasmic MalE-LacZ72-47 protein is an historically important lethal stress originally identified during seminal genetic experiments that defined the SecY-dependent protein translocation system. Multiple, independent lines of evidence presented here indicate that the predominant mechanism for MalE-LacZ lethality shares attributes with the ROS-dependent component of antibiotic lethality. MalE-LacZ lethality requires molecular oxygen, and its expression induces ROS production. The increased susceptibility of mutants sensitive to oxidative stress to MalE-LacZ lethality indicates that ROS contribute causally to cell death rather than simply being produced by dying cells. Observations that support the proposed mechanism of cell death include MalE-LacZ expression being bacteriostatic rather than bactericidal in cells that overexpress MutT, a nucleotide sanitizer that hydrolyzes 8-oxo-dGTP to the monophosphate, or that lack MutM and MutY, DNA glycosylases that process base pairs involving 8-oxo-dGTP. Our studies suggest stress-induced physiological changes that favor this mode of ROS-dependent death.

  4. A local average connectivity-based method for identifying essential proteins from the network level.

    Science.gov (United States)

    Li, Min; Wang, Jianxin; Chen, Xiang; Wang, Huan; Pan, Yi

    2011-06-01

    Identifying essential proteins is very important for understanding the minimal requirements of cellular survival and development. Fast growth in the amount of available protein-protein interactions has produced unprecedented opportunities for detecting protein essentiality from the network level. Essential proteins have been found to be more abundant among those highly connected proteins. However, there exist a number of highly connected proteins which are not essential. By analyzing these proteins, we find that few of their neighbors interact with each other. Thus, we propose a new local method, named LAC, to determine a protein's essentiality by evaluating the relationship between a protein and its neighbors. The performance of LAC is validated based on the yeast protein interaction networks obtained from two different databases: DIP and BioGRID. The experimental results of the two networks show that the number of essential proteins predicted by LAC clearly exceeds that explored by Degree Centrality (DC). More over, LAC is also compared with other seven measures of protein centrality (Neighborhood Component (DMNC), Betweenness Centrality (BC), Closeness Centrality (CC), Bottle Neck (BN), Information Centrality (IC), Eigenvector Centrality (EC), and Subgraph Centrality (SC)) in identifying essential proteins. The comparison results based on the validations of sensitivity, specificity, F-measure, positive predictive value, negative predictive value, and accuracy consistently show that LAC outweighs these seven previous methods. Copyright © 2011 Elsevier Ltd. All rights reserved.

  5. AraC protein, regulation of the l-arabinose operon in Escherichia coli, and the light switch mechanism of AraC action.

    Science.gov (United States)

    Schleif, Robert

    2010-09-01

    This review covers the physiological aspects of regulation of the arabinose operon in Escherichia coli and the physical and regulatory properties of the operon's controlling gene, araC. It also describes the light switch mechanism as an explanation for many of the protein's properties. Although many thousands of homologs of AraC exist and regulate many diverse operons in response to many different inducers or physiological states, homologs that regulate arabinose-catabolizing genes in response to arabinose were identified. The sequence similarities among them are discussed in light of the known structure of the dimerization and DNA-binding domains of AraC.

  6. An Inducible Operon Is Involved in Inulin Utilization in Lactobacillus plantarum Strains, as Revealed by Comparative Proteogenomics and Metabolic Profiling.

    Science.gov (United States)

    Buntin, Nirunya; Hongpattarakere, Tipparat; Ritari, Jarmo; Douillard, François P; Paulin, Lars; Boeren, Sjef; Shetty, Sudarshan A; de Vos, Willem M

    2017-01-15

    The draft genomes of Lactobacillus plantarum strains isolated from Asian fermented foods, infant feces, and shrimp intestines were sequenced and compared to those of well-studied strains. Among 28 strains of L. plantarum, variations in the genomic features involved in ecological adaptation were elucidated. The genome sizes ranged from approximately 3.1 to 3.5 Mb, of which about 2,932 to 3,345 protein-coding sequences (CDS) were predicted. The food-derived isolates contained a higher number of carbohydrate metabolism-associated genes than those from infant feces. This observation correlated to their phenotypic carbohydrate metabolic profile, indicating their ability to metabolize the largest range of sugars. Surprisingly, two strains (P14 and P76) isolated from fermented fish utilized inulin. β-Fructosidase, the inulin-degrading enzyme, was detected in the supernatants and cell wall extracts of both strains. No activity was observed in the cytoplasmic fraction, indicating that this key enzyme was either membrane-bound or extracellularly secreted. From genomic mining analysis, a predicted inulin operon of fosRABCDXE, which encodes β-fructosidase and many fructose transporting proteins, was found within the genomes of strains P14 and P76. Moreover, pts1BCA genes, encoding sucrose-specific IIBCA components involved in sucrose transport, were also identified. The proteomic analysis revealed the mechanism and functional characteristic of the fosRABCDXE operon involved in the inulin utilization of L. plantarum The expression levels of the fos operon and pst genes were upregulated at mid-log phase. FosE and the LPXTG-motif cell wall anchored β-fructosidase were induced to a high abundance when inulin was present as a carbon source. Inulin is a long-chain carbohydrate that may act as a prebiotic, which provides many health benefits to the host by selectively stimulating the growth and activity of beneficial bacteria in the colon. While certain lactobacilli can catabolize

  7. Recombination and selectional forces in cyanopeptolin NRPS operons from highly similar, but geographically remote Planktothrix strains

    Directory of Open Access Journals (Sweden)

    Kristensen Tom

    2008-08-01

    Full Text Available Abstract Background Cyanopeptolins are nonribosomally produced heptapetides showing a highly variable composition. The cyanopeptolin synthetase operon has previously been investigated in three strains from the genera Microcystis, Planktothrix and Anabaena. Cyanopeptolins are displaying protease inhibitor activity, but the biological function(s is (are unknown. Cyanopeptolin gene cluster variability and biological functions of the peptide variants are likely to be interconnected. Results We have investigated two cyanopeptolin gene clusters from highly similar, but geographically remote strains of the same genus. Sequencing of a nonribosomal peptide synthetase (NRPS cyanopeptolin gene cluster from the Japanese strain Planktothrix NIES 205 (205-oci, showed the 30 kb gene cluster to be highly similar to the oci gene cluster previously described in Planktothrix NIVA CYA 116, isolated in Norway. Both operons contained seven NRPS modules, a sulfotransferase (S and a glyceric acid loading (GA-domain. Sequence analyses showed a high degree of conservation, except for the presence of an epimerase domain in NIES 205 and the regions around the epimerase, showing high substitution rates and Ka/Ks values above 1. The two strains produce almost identical cyanopeptolins, cyanopeptolin-1138 and oscillapeptin E respectively, but with slight differences regarding the production of minor cyanopeptolin variants. These variants may be the result of relaxed adenylation (A-domain specificity in the nonribosomal enzyme complex. Other genetic markers (16S rRNA, ntcA and the phycocyanin cpcBA spacer were identical, supporting that these geographically separated Planktothrix strains are closely related. Conclusion A horizontal gene transfer event resulting in exchange of a whole module-encoding region was observed. Nucleotide statistics indicate that both purifying selection and positive selection forces are operating on the gene cluster. The positive selection forces are

  8. Simple whole-cell biodetection and bioremediation of heavy metals based on an engineered lead-specific operon.

    Science.gov (United States)

    Wei, Wei; Liu, Xiangzhi; Sun, Peiqing; Wang, Xin; Zhu, Hong; Hong, Mei; Mao, Zong-Wan; Zhao, Jing

    2014-03-18

    A lead-specific binding protein, PbrR, and promoter pbr from the lead resistance operon, pbr, of Cupriavidus metallidurans CH34 was incorporated into E. coli in conjunction with an engineered downstream RFP (red fluorescence protein), which allowed for highly sensitive and selective whole-cell detection of lead ions. The subsequent display of PbrR on the E. coli cell surface permitted selective adsorption of lead ions from solution containing various heavy metal ions. The surface-engineered E. coli bacteria effectively protected Arabidopsis thaliana seed germination from the toxicity of lead ions at high concentrations. Engineering the E. coli bacteria harboring these lead-specific elements from the pbr operon may potentially be a valuable general strategy for biodetection and bioremediation of toxic heavy metal ions in the environment.

  9. The Escherichia coli L-Arabinose Operon: Binding Sites of the Regulatory Proteins and a Mechanism of Positive and Negative Regulation

    National Research Council Canada - National Science Library

    Sharon Ogden; Dennis Haggerty; Carol M. Stoner; David Kolodrubetz; Robert Schleif

    1980-01-01

    The locations of DNA binding by the proteins involved with positive and negative regulation of transcription initiation of the L-arabinose operon in Escherichia coli have been determined by the DNase I protection method...

  10. Multi-epoch intranight optical monitoring of eight radio-quiet BL Lac candidates

    Science.gov (United States)

    Kumar, P.; Gopal-Krishna; Stalin, C. S.; Chand, H.; Srianand, R.; Petitjean, P.

    2017-10-01

    For a new sample of eight weak-line quasars (WLQs) we report a sensitive search in 20 intranight monitoring sessions, for blazar-like optical flux variations on hour-like and longer time-scale (day/month/year-like). The sample consists exclusively of the WLQs that are not radio-loud and either have been classified as 'radio-weak probable BL Lac candidates' and/or are known to have exhibited at least one episode of large, blazar-like optical variability. Whereas only a hint of intranight variability is seen for two of these WLQs, J104833.5+620305.0 (z = 0.219) and J133219.6+622715.9 (z = 3.15), statistically significant internight variability at a few per cent level is detected for three of the sources, including the radio-intermediate WLQ J133219.6+622715.9 (z = 3.15) and the well-known bona fide radio-quiet WLQs J121221.5+534128.0 (z = 3.10) and WLQ J153259.9-003944.1 (z = 4.62). In the rest frame, this variability is intraday and in the far-ultraviolet band. On the time-scale of a decade, we find for three of the WLQs large brightness changes, amounting to 1.655 ± 0.009, 0.163 ± 0.010 and 0.144 ± 0.018 mag, for J104833.5+620305.0, J123743.1+630144.9 and J232428.4+144324.4, respectively. Whereas the latter two are confirmed radio-quiet WLQs, the extragalactic nature of J104833.5+620305.0 remains to be well established, thanks to the absence of any feature(s) in its available optical spectra. This study forms a part of our ongoing campaign of intranight optical monitoring of radio-quiet WLQs, in order to improve the understanding of this enigmatic class of active galactic nuclei and to look among them for a possible tiny, elusive population of radio-quiet BL Lacs.

  11. ESTIMASI HERITABILITAS DAN RESPONS SELEKSI PERSILANGAN IKAN GURAMI (Osphronemus goramy Lac.

    Directory of Open Access Journals (Sweden)

    Sularto Sularto

    2016-11-01

    Full Text Available Ikan gurami (Osphronemus goramy Lac. dikenal sebagai ikan yang lambat tumbuh. Perbaikan mutu genetik dapat dilakukan untuk mengatasi kendala tersebut, salah satunya adalah melalui program seleksi. Pembentukan populasi dasar dengan menggabungkan persilangan empat populasi Kalimantan, Jambi, Majalengka (M, dan Tasikmalaya dilakukan untuk meningkatkan keragaman genetik. Tujuan penelitian ini untuk mengestimasi nilai heritabilitas dan respons seleksi karakter pertumbuhan bobot ikan gurami hasil persilangan empat populasi gurami sebagai populasi dasar. Persilangan dilakukan dengan rasio jantan: betina (1:1 dan terbentuk 12 famili. Seleksi dilakukan menggunakan metode seleksi famili berdasarkan karakter bobot. Parameter yang diamati adalah karakter pertumbuhan bobot. Data yang digunakan untuk perhitungan etimasi heritabilitas dan respons seleksi adalah data bobot pada umur 11 bulan. Dari data tersebut digunakan untuk menghitung koefisien keragaman (CV, diferensial seleksi (S, estimasi nilai heritabilitas (h2, estimasi respons seleksi (R, dan standard error (SE. Hasil penelitian menunjukkan bahwa populasi dasar yang terbentuk memiliki nilai estimasi heritabilitas 0,4991 yang termasuk kategori tinggi, diferensial seleksi sebesar 124,22 g; sehingga mendapatkan nilai estimasi respons seleksi sebesar 62 g atau (18,2%. Giant gourami (Osphronemus goramy Lac. is known as a slow growing fish. Genetic improvement can be done to overcome this obstacle; one way is through the selection program. Formation of base population by combining cross four populations can increase genetic diversity. The crosses four populations were: Kalimantan (Borneo, Jambi, Majalengka, and Tasikmalaya. The purpose of this study was to estimate the heritability and response to selection of characters in length and weights of giant gourami from four crosses population as the base population of synthetic material. Crossings were made with the ratio of male: female (1:1 to form 12 families

  12. Deoxyribonucleic Acid-Ribonucleic Acid Hybridization Studies on the l-Arabinose Operon of Escherichia coli B/r

    Science.gov (United States)

    Wilcox, Gary; Singer, Judith; Heffernan, Laurel

    1971-01-01

    An increase in the rate of synthesis of ara-specific messenger ribonucleic acid as measured by deoxyribonucleic acid-ribonucleic acid hybridization has been detected in the induced wild-type (ara+) strain of Escherichia coli B/r as compared with the uninduced control, thus providing evidence that regulation of the positively controlled l-arabinose operon is at the level of transcription. PMID:4941555

  13. Deoxyribonucleic acid-ribonucleic acid hybridization studies on the L-Arabinose operon of Escherichia coli B-r.

    Science.gov (United States)

    Wilcox, G; Singer, J; Heffernan, L

    1971-10-01

    An increase in the rate of synthesis of ara-specific messenger ribonucleic acid as measured by deoxyribonucleic acid-ribonucleic acid hybridization has been detected in the induced wild-type (ara(+)) strain of Escherichia coli B/r as compared with the uninduced control, thus providing evidence that regulation of the positively controlled l-arabinose operon is at the level of transcription.

  14. Development and validation of an rDNA operon based primer walking strategy applicable to de novo bacterial genome finishing.

    Directory of Open Access Journals (Sweden)

    Alexander William Eastman

    2015-01-01

    Full Text Available Advances in sequencing technology have drastically increased the depth and feasibility of bacterial genome sequencing. However, little information is available that details the specific techniques and procedures employed during genome sequencing despite the large numbers of published genomes. Shotgun approaches employed by second-generation sequencing platforms has necessitated the development of robust bioinformatics tools for in silico assembly, and complete assembly is limited by the presence of repetitive DNA sequences and multi-copy operons. Typically, re-sequencing with multiple platforms and laborious, targeted Sanger sequencing are employed to finish a draft bacterial genome. Here we describe a novel strategy based on the identification and targeted sequencing of repetitive rDNA operons to expedite bacterial genome assembly and finishing. Our strategy was validated by finishing the genome of Paenibacillus polymyxa strain CR1, a bacterium with potential in sustainable agriculture and bio-based processes. An analysis of the 38 contigs contained in the P. polymyxa strain CR1 draft genome revealed 12 repetitive rDNA operons with varied intragenic and flanking regions of variable length, unanimously located at contig boundaries and within contig gaps. These highly similar but not identical rDNA operons were experimentally verified and sequenced simultaneously with multiple, specially designed primer sets. This approach also identified and corrected significant sequence rearrangement generated during the initial in silico assembly of sequencing reads. Our approach reduces the required effort associated with blind primer walking for contig assembly, increasing both the speed and feasibility of genome finishing. Our study further reinforces the notion that repetitive DNA elements are major limiting factors for genome finishing. Moreover, we provided a step-by-step workflow for genome finishing, which may guide future bacterial genome finishing

  15. BadR and BadM Proteins Transcriptionally Regulate Two Operons Needed for Anaerobic Benzoate Degradation by Rhodopseudomonas palustris.

    Science.gov (United States)

    Hirakawa, Hidetada; Hirakawa, Yuko; Greenberg, E Peter; Harwood, Caroline S

    2015-07-01

    The bacterium Rhodopseudomonas palustris grows with the aromatic acid benzoate and the alicyclic acid cyclohexanecarboxylate (CHC) as sole carbon sources. The enzymatic steps in an oxygen-independent pathway for CHC degradation have been elucidated, but it was unknown how the CHC operon (badHI aliAB badK) encoding the enzymes for CHC degradation was regulated. aliA and aliB encode enzymes for the conversion of CHC to cyclohex-1-enecarboxyl-coenzyme A (CHene-CoA). At this point, the pathway for CHC degradation merges with the pathway for anaerobic benzoate degradation, as CHene-CoA is an intermediate in both degradation pathways. Three enzymes, encoded by badK, badH, and badI, prepare and cleave the alicyclic ring of CHene-CoA to yield pimelyl-CoA. Here, we show that the MarR transcription factor family member, BadR, represses transcription of the CHC operon by binding near the transcription start site of badH. 2-Ketocyclohexane-1-carboxyl-CoA, an intermediate of CHC and benzoate degradation, interacts with BadR to abrogate repression. We also present evidence that the transcription factor BadM binds to the promoter of the badDEFGAB (Bad) operon for the anaerobic conversion of benzoate to CHene-CoA to repress its expression. Contrary to previous reports, BadR does not appear to control expression of the Bad operon. These data enhance our view of the transcriptional regulation of anaerobic benzoate degradation by R. palustris. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  16. Lactose inhibits the growth of Rhizobium meliloti cells that contain an actively expressed Escherichia coli lactose operon.

    OpenAIRE

    Timblin, C R; Kahn, M L

    1984-01-01

    Expression of the Escherichia coli lactose operon in Rhizobium meliloti 104A14 made the cells sensitive to the addition of the beta-galactosides lactose, phenyl-beta-D-galactoside, and lactobionic acid. Growth stopped when the beta-galactoside was added and viability decreased modestly during the next few hours, but little cell lysis was observed and the cells appeared normal. Protein synthesis was not inhibited. Growth was inhibited only when beta-galactosidase expression was greater than 16...

  17. Role of the gerA operon in L-alanine germination of Bacillus licheniformis spores

    Directory of Open Access Journals (Sweden)

    Løvdal Irene S

    2012-03-01

    Full Text Available Abstract Background The genome of Bacillus licheniformis DSM 13 harbours three neighbouring open reading frames showing protein sequence similarities to the proteins encoded from the Bacillus subtilis subsp. subtilis 168 gerA operon, GerAA, GerAB and GerAC. In B. subtilis, these proteins are assumed to form a germinant receptor involved in spore germination induced by the amino acid L-alanine. Results In this study we show that disruption of the gerAA gene in B. licheniformis MW3 hamper L-alanine and casein hydrolysate-triggered spore germination, measured by absorbance at 600 nm and confirmed by phase contrast microscopy. This ability was restored by complementation with a plasmid-borne copy of the gerA locus. Addition of D-alanine in the casein hydrolysate germination assay abolished germination of both B. licheniformis MW3 and the complementation mutant. Germination of both B. licheniformis MW3 and the gerA disruption mutant was induced by the non-nutrient germinant Ca2+-Dipicolinic acid. Conclusions These results demonstrate that the B. licheniformis MW3 gerA locus is involved in germination induced by L-alanine and potentially other components present in casein hydrolysate.

  18. Riboflavin synthesis genes are linked with the lux operon of Photobacterium phosphoreum.

    Science.gov (United States)

    Lee, C Y; O'Kane, D J; Meighen, E A

    1994-01-01

    Four genes immediately downstream of luxG in the Photobacterium phosphoreum lux operon (ribEBHA) have been sequenced and shown to be involved in riboflavin synthesis. Sequence analyses and complementation of Escherichia coli riboflavin auxotrophs showed that the gene products of ribB and ribA are 3,4-dihydroxy-2-butanone 4-phosphate (DHBP) synthetase and GTP cyclohydrolase II, respectively. By expression of P. phosphoreum ribE in E. coli using the bacteriophage T7 promoter-RNA polymerase system, ribE was shown to code for riboflavin synthetase, which catalyzes the conversion of lumazine to riboflavin. Increased thermal stability of RibE on expression with RibH indicated that ribH coded for lumazine synthetase. The organization of the rib genes in P. phosphoreum is quite distinct, with ribB and ribA being linked but separated by ribH, whereas in E. coli, they are unlinked and in Bacillus subtilis, RibB and RibA functions are coded by a single gene. Images PMID:8144477

  19. Genetic analysis of the stationary phase-induced mcb operon promoter in Escherichia coli.

    Science.gov (United States)

    Mao, W; Siegele, D A

    1998-01-01

    A combination of deletion analysis and random mutagenesis was used to identify regulatory elements in Pmcb, the stationary phase-induced promoter of the mcb operon. Our results indicate that Pmcb is controlled by at least three different factors, two previously identified and at least one unknown factor, which act at four different sites in the promoter. Sequences between -344 and -164 upstream of the transcriptional start site were required for wild-type levels of mcb transcription in stationary phase. More dramatic reductions in both exponential and stationary phase expression were observed when sequences from -164 to -54 were deleted. Point mutations located between -105 and -138 decreased both exponential and stationary phase expression. All but one of these mutations decreased OmpR-dependent activation of Pmcb transcription. EmrR, also known as MprA, acts directly or indirectly at sequences downstream of -54 to repress Pmcb. A minimal promoter containing sequences from -34 to +79 was still induced > or = 10-fold in stationary phase. Point mutations within this region identified sequences at -8, -11, -30, -31 and -32 as important for Pmcb activity. These bases are in the gearbox sequence, present in Pmcb and several other stationary phase-induced Escherichia coli promoters.

  20. Biofilm formation of ica operon-positive Staphylococcus epidermidis from different sources.

    Science.gov (United States)

    Argudín, Maria Angeles; Vanderhaeghen, Wannes; Vandendriessche, Stien; Vandecandelaere, Ilse; Denis, Olivier; Coenye, Tom; Butaye, Patrick

    2015-12-01

    Information on the prevalence of biofilm-related factors (PIA, Bhp, Aap, Embp) in Staphylococcus epidermidis of animal origin is scarce. In this study, 263 S. epidermidis isolates of diverse origin (animal, farmers, patients, and laboratory staff) were investigated for the presence of the ica operon (icaRADBC). The icaRADBC-positive isolates were further characterized by means of biofilm formation, presence of other biofilm-related genes, antimicrobial resistance, and population structure. Of all isolates, 28.5% (n = 75) were icaRADBC-positive, including 16.5% of animal origin, 29.1% farmer isolates, and 44.6% hospital-associated isolates (including patients and laboratory staff isolates). Most icaRADBC-positive isolates carried embp (n = 73), aap (n = 57), bhp (n = 22), and IS256 (n = 29). Statistical differences were found between animal and patient isolates for the presence of icaRADBC, bhp, and aap. No statistically significant relation was found between the presence of one or more genes and the level of biofilm formation. Most icaRADBC-positive isolates belonged to the clonal complex 5 (formerly 2) and most sequence types corresponded to types previously observed in community and nosocomial S. epidermidis populations. Although the prevalence of S. epidermidis in the nasal cavity of bovines and poultry is low, some isolates belong to STs related to ica-positive clinical strains. © 2015 APMIS. Published by John Wiley & Sons Ltd.

  1. Supra-operonic clusters of functionally related genes (SOCs) are a source of horizontal gene co-transfers.

    Science.gov (United States)

    Pang, Tin Yau; Lercher, Martin J

    2017-01-09

    Adaptation of bacteria occurs predominantly via horizontal gene transfer (HGT). While it is widely recognized that horizontal acquisitions frequently encompass multiple genes, it is unclear what the size distribution of successfully transferred DNA segments looks like and what evolutionary forces shape this distribution. Here, we identified 1790 gene family pairs that were consistently co-gained on the same branches across a phylogeny of 53 E. coli strains. We estimated a lower limit of their genomic distances at the time they were transferred to their host genomes; this distribution shows a sharp upper bound at 30 kb. The same gene-pairs can have larger distances (up to 70 kb) in other genomes. These more distant pairs likely represent recent acquisitions via transduction that involve the co-transfer of excised prophage genes, as they are almost always associated with intervening phage-associated genes. The observed distribution of genomic distances of co-transferred genes is much broader than expected from a model based on the co-transfer of genes within operons; instead, this distribution is highly consistent with the size distribution of supra-operonic clusters (SOCs), groups of co-occurring and co-functioning genes that extend beyond operons. Thus, we propose that SOCs form a basic unit of horizontal gene transfer.

  2. An operon for production of bioactive gibberellin A4phytohormone with wide distribution in the bacterial rice leaf streak pathogen Xanthomonas oryzae pv. oryzicola.

    Science.gov (United States)

    Nagel, Raimund; Turrini, Paula C G; Nett, Ryan S; Leach, Jan E; Verdier, Valérie; Van Sluys, Marie-Anne; Peters, Reuben J

    2017-05-01

    Phytopathogens have developed elaborate mechanisms to attenuate the defense response of their host plants, including convergent evolution of complex pathways for production of the GA phytohormones, which were actually first isolated from the rice fungal pathogen Gibberella fujikuroi. The rice bacterial pathogen Xanthomonas oryzae pv. oryzicola (Xoc) has been demonstrated to contain a biosynthetic operon with cyclases capable of producing the universal GA precursor ent-kaurene. Genetic (knock-out) studies indicate that the derived diterpenoid serves as a virulence factor for this rice leaf streak pathogen, serving to reduce the jasmonic acid-mediated defense response. Here the functions of the remaining genes in the Xoc operon are elucidated and the distribution of the operon in X. oryzae is investigated in over 100 isolates. The Xoc operon leads to production of the bioactive GA 4 , an additional step beyond production of the penultimate precursor GA 9 mediated by the homologous operons recently characterized from rhizobia. Moreover, this GA biosynthetic operon was found to be widespread in Xoc (> 90%), but absent in the other major X. oryzae pathovar. These results indicate selective pressure for production of GA 4 in the distinct lifestyle of Xoc, and the importance of GA to both fungal and bacterial pathogens of rice. © 2017 The Authors. New Phytologist © 2017 New Phytologist Trust.

  3. ERRATIC FLARING OF BL LAC IN 2012–2013: MULTIWAVELENGTH OBSERVATIONS

    Energy Technology Data Exchange (ETDEWEB)

    Wehrle, Ann E. [Space Science Institute, 4750 Walnut Street, Suite 205, Boulder, CO 80301 (United States); Grupe, Dirk [Space Science Center, Morehead State University, 235 Martindale Drive, Morehead, KY 40351 (United States); Jorstad, Svetlana G.; Marscher, Alan P. [Institute for Astrophysical Research, Boston University, 725 Commonwealth Avenue, Boston, MA 02215 (United States); Gurwell, Mark [Harvard-Smithsonian Center for Astrophysics, Cambridge, MA-02138 (United States); Baloković, Mislav; Hovatta, Talvikki; Harrison, Fiona H. [Cahill Center for Astronomy and Astrophysics, Caltech, Pasadena, CA 91125 (United States); Madejski, Grzegorz M. [Kavli Institute for Particle Astrophysics and Cosmology, SLAC National Accelerator Laboratory, Menlo Park, CA 94025 (United States); Stern, Daniel, E-mail: awehrle@spacescience.org [Jet Propulsion Laboratory, California Institute of Technology, Pasadena, CA 91109 (United States)

    2016-01-10

    BL Lac, the eponymous blazar, flared to historically high levels at millimeter, infrared, X-ray, and gamma-ray wavelengths in 2012. We present observations made with Herschel, Swift, NuSTAR, Fermi, the Submillimeter Array, CARMA, and the VLBA in 2012–2013, including three months with nearly daily sampling at several wavebands. We have also conducted an intensive campaign of 30 hr with every-orbit observations by Swift and NuSTAR, accompanied by Herschel, and Fermi observations. The source was highly variable at all bands. Time lags, correlations between bands, and the changing shapes of the spectral energy distributions can be explained by synchrotron radiation and inverse Compton emission from nonthermal seed photons originating from within the jet. The passage of four new superluminal very long baseline interferometry knots through the core and two stationary knots about 4 pc downstream accompanied the high flaring in 2012–2013. The seed photons for inverse Compton scattering may arise from the stationary knots and from a Mach disk near the core where relatively slow-moving plasma generates intense nonthermal radiation. The 95 spectral energy distributions obtained on consecutive days form the most densely sampled, broad wavelength coverage for any blazar. The observed spectral energy distributions and multi-waveband light curves are similar to simulated spectral energy distributions and light curves generated with a model in which turbulent plasma crosses a conical shock with a Mach disk.

  4. A LacI-family regulator activates maltodextrin metabolism of Enterococcus faecium.

    Directory of Open Access Journals (Sweden)

    Xinglin Zhang

    Full Text Available Enterococcus faecium is a gut commensal of humans and animals. In the intestinal tract, E. faecium will have access to a wide variety of carbohydrates, including maltodextrins and maltose, which are the sugars that result from the enzymatic digestion of starch by host-derived and microbial amylases. In this study, we identified the genetic determinants for maltodextrin utilization of E. faecium E1162. We generated a deletion mutant of the mdxABCD-pulA gene cluster that is homologous to maltodextrin uptake genes in other Gram-positive bacteria, and a deletion mutant of the mdxR gene, which is predicted to encode a LacI family regulator of mdxABCD-pulA. Both mutations impaired growth on maltodextrins but had no effect on the growth on maltose and glucose. Comparative transcriptome analysis showed that eight genes (including mdxABCD-pulA were expressed at significantly lower levels in the isogenic ΔmdxR mutant strain compared to the parental strain when grown on maltose. Quantitative real-time RT-PCR confirmed the results of transcriptome analysis and showed that the transcription of a putative maltose utilization gene cluster is induced in a semi-defined medium supplemented with maltose but is not regulated by MdxR. Understanding the maltodextrin metabolism of E. faecium could yield novel insights into the underlying mechanisms that contribute to the gut commensal lifestyle of E. faecium.

  5. Multiwavelength Observations of 6 BL Lac Objects in 2008-2012

    Directory of Open Access Journals (Sweden)

    Morozova D.A.

    2013-12-01

    Full Text Available We present results of 4 years of VLBA monitoring along with γ-ray and optical R-band photometric observations of 6 BL Lac objects (3C 66A, S5 0716+71, PKS 0735+17, S4 0954+68, W Com, and OT 081. We have analyzed total intensity images obtained with the VLBA at 43 GHz and investigated the kinematic evolution of the parsec scale jets of the sources. For all sources we compare flux variations in the VLBI core and bright superluminal knots with γ-ray and optical light curves. The majority of γ-ray flares have optical counterparts. 67% of the γ-ray events are coincident with the appearance of new superluminal knots and/or flares in the millimeter-wave core. These results support the conclusion that for many flares in blazars the region of the γ-ray and optical emission is located in the vicinity or downstream of the mm-wave VLBI core.

  6. Genotype to phenotype mapping and the fitness landscape of the E. coli lac promoter.

    Directory of Open Access Journals (Sweden)

    Jakub Otwinowski

    Full Text Available Genotype-to-phenotype maps and the related fitness landscapes that include epistatic interactions are difficult to measure because of their high dimensional structure. Here we construct such a map using the recently collected corpora of high-throughput sequence data from the 75 base pairs long mutagenized E. coli lac promoter region, where each sequence is associated with its phenotype, the induced transcriptional activity measured by a fluorescent reporter. We find that the additive (non-epistatic contributions of individual mutations account for about two-thirds of the explainable phenotype variance, while pairwise epistasis explains about 7% of the variance for the full mutagenized sequence and about 15% for the subsequence associated with protein binding sites. Surprisingly, there is no evidence for third order epistatic contributions, and our inferred fitness landscape is essentially single peaked, with a small amount of antagonistic epistasis. There is a significant selective pressure on the wild type, which we deduce to be multi-objective optimal for gene expression in environments with different nutrient sources. We identify transcription factor (CRP and RNA polymerase binding sites in the promotor region and their interactions without difficult optimization steps. In particular, we observe evidence for previously unexplored genetic regulatory mechanisms, possibly kinetic in nature. We conclude with a cautionary note that inferred properties of fitness landscapes may be severely influenced by biases in the sequence data.

  7. The Lac Des Iles Palladium Deposit, Ontario, Canada. Part II. Halogen variations in apatite

    Science.gov (United States)

    Schisa, Paul; Boudreau, Alan; Djon, Lionnel; Tchalikian, Arnaud; Corkery, John

    2015-03-01

    Analysis of apatite from the Mine Block Intrusion (MBI) of the Lac des Iles Igneous Complex shows two pronounced trends in the halogens. Apatite from relatively fresh norite and melanorites from the Pd-sulfide zone contain up to 57 mol% chlorapatite endmember with significant hydroxyapatite component. In contrast, in altered rock (amphibolite and greenschist assemblages) the chlorapatite component is typically less than 10 mol% with wide variation in the F- and OH-endmember components. The latter trend is attributed to Cl loss to degassing and alteration, whereas the former is attributed to Cl enrichment in the ore-bearing rocks. It is suggested that the relatively H2O-rich and intermediate Cl content of the early igneous fluids degassed from the deeper levels of the MBI can explain the high Pd/Pt and Pd/Ir ratios of the deposit. A model is presented in which disseminated Pd-rich sulfides are initially introduced by a high-temperature magmatic fluid that also influenced crystallization to produce the gross modal variations of the igneous host rock. This high-temperature mineralization event was subsequently modified by the influx of late igneous and country fluids at amphibolite to greenschist conditions.

  8. Halogen Variations in Apatite of the Lac Des Iles Palladium Deposit, Ontario, Canada

    Science.gov (United States)

    Boudreau, A. E.

    2014-12-01

    Analysis of apatite from the Mine Block Intrusion (MBI) of the Lac des Iles Igneous Complex show two pronounced trends in the halogens. Apatite from relatively fresh norite and melanorites from the Pd-sulfide zone contain up to 57 mole % chlorapatite endmember with significant hydroxyapatite component. In contrast, in altered rock (amphibolite and greenschist assemblages) and in the more evolved barren rocks the chlorapatite component is typically less than 10 mole % with wide variation in the F- and OH-endmember components. The latter trend is attributed to Cl loss to degassing and alteration whereas the former is attributed to Cl-enrichment in the ore-bearing rocks. It is suggested that the relatively H2O-rich and intermediate Cl content of the early igneous fluids degassed from the deeper levels of the MBI can explain the high Pd/Pt and Pd/Ir ratios of the deposit. A model is presented in which disseminated Pd-rich sulfide are initially introduced by a high temperature magmatic fluid that also influenced crystallization to produce the gross modal variations of the igneous host rock. This high temperature mineralization event was subsequently modified by the influx of late igneous and country fluids at amphibolite to greenschist conditions.

  9. The Periplasmic Cavity of LacY Mutant Cys154→Gly: How Open is Open?

    Science.gov (United States)

    Jiang, Xiaoxu; Driessen, Arnold J. M.; Feringa, Ben L.; Kaback, H. Ronald

    2013-01-01

    The lactose permease from Escherichia coli (LacY) is a galactoside/H+ symporter that catalyzes the coupled stoichiometric transport of a sugar and an H + across the cytoplasmic membrane. x-ray crystal structures of WT LacY and the conformationally restricted mutant Cys154→Gly exhibit an inward-facing conformation with a tightly sealed periplasmic side and a deep central cleft or cavity open to the cytoplasm. Although the crystal structures may give the impression that LacY is a rigid molecule, multiple converging lines of evidence demonstrate that galactoside binding to WT LacY induces reciprocal opening and closing of periplasmic and cytoplasmic cavities, respectively. By this means, the sugar- and H+-binding sites in the middle of the molecule are exposed alternatively to either side of the membrane. In contrast to the crystal structure, biochemical/biophysical studies with mutant Cys154→Gly show that the periplasmic side is paralyzed in an open-outward conformation. In this study, a rigid, funnel-shaped, maleimide-containing molecule was used to probe the periplasmic cavity of a pseudo WT and the Cys154→Gly mutant by site-directed alkylation. The findings provide strong support for previous observations and indicate further that the external opening of the periplasmic cleft in the mutant is patent to the extent of at least 8.5 Å in the absence of sugar or about half that of the WT cavity with bound galactoside. PMID:23962108

  10. Données préliminaires sur la diversité du zooplancton du lac Nokoué

    African Journals Online (AJOL)

    SARAH

    31 juil. 2017 ... une modification des peuplements et le plus souvent, une diminution de la biodiversité. .... Ce lac est riche en diversité ichtyologique avec. 51 espèces de poisson (Lalèyè et ..... Figure 1: Variations spatiales de la richesse taxonomique et de la densité du zooplancton durant l'étude. Tableau 3: Principales ...

  11. Probing BL Lac and Cluster Evolution via a Wide-angle, Deep X-ray Selected Sample

    Science.gov (United States)

    Perlman, E.; Jones, L.; White, N.; Angelini, L.; Giommi, P.; McHardy, I.; Wegner, G.

    1994-12-01

    The WARPS survey (Wide-Angle ROSAT Pointed Survey) has been constructed from the archive of all public ROSAT PSPC observations, and is a subset of the WGACAT catalog. WARPS will include a complete sample of >= 100 BL Lacs at F_x >= 10(-13) erg s(-1) cm(-2) . A second selection technique will identify ~ 100 clusters at 0.15 = 0.304 +/- 0.062 for XBLs but = 0.60 +/- 0.05 for RBLs. Models of the X-ray luminosity function (XLF) are also poorly constrained. WARPS will allow us to compute an accurate XLF, decreasing the error bars above by over a factor of two. We will also test for low-luminosity BL Lacs, whose non-thermal nuclear sources are dim compared to the host galaxy. Browne and Marcha (1993) claim the EMSS missed most of these objects and is incomplete. If their predictions are correct, 20-40% of the BL Lacs we find will fall in this category, enabling us to probe the evolution and internal workings of BL Lacs at lower luminosities than ever before. By removing likely QSOs before optical spectroscopy, WARPS requires only modest amounts of telescope time. It will extend measurement of the cluster XLF both to higher redshifts (z>0.5) and lower luminosities (LX<1x10(44) erg s(-1) ) than previous measurements, confirming or rejecting the 3sigma detection of negative evolution found in the EMSS, and constraining Cold Dark Matter cosmologies. Faint NELGs are a recently discovered major contributor to the X-ray background. They are a mixture of Sy2s, starbursts and galaxies of unknown type. Detailed classification and evolution of their XLF will be determined for the first time.

  12. Induction of somatic mutations but not methylated DNA adducts in λlacZ transgenic mice by dichlorvos

    NARCIS (Netherlands)

    Pletsa, V.; Steenwinkel, M.-J.S.T.; Delft, J.H.M. van; Baan, R.A.; Kyrtopoulos, S.A.

    1999-01-01

    In order to examine the in vivo genotoxic activity of dichlorvos, λlacZ transgenic mice (Muta(TM)Mouse) were treated i.p. with single (4.4 or 11 mg/kg) or multiple (5x11 mg/kg) doses of this agent and sacrificed 4 h or 14 days post-treatment for DNA adduct measurement or mutant frequency analysis,

  13. Narrative report May, June, July, August, 1953 Des Lacs National Wildlife Refuge, Lostwood National Wildlife Refuge, & Easement Refuges - District IV & 4a

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — This narrative report for Des Lacs National Wildlife Refuge outlines Refuge accomplishments from May through August of 1953. The report begins by summarizing the...

  14. Narrative report May, June, July, August, 1954 Des Lacs National Wildlife Refuge, Lostwood National Wildlife Refuge, Lake Ilo National Wildlife Refuge, & Easement Refuges - District IV & 4a

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — This narrative report for Des Lacs National Wildlife Refuge outlines Refuge accomplishments from May through August of 1954. The report begins by summarizing the...

  15. Narrative report May, June, July, August, 1963 Des Lacs National Wildlife Refuge, Lake Ilo National Wildlife Refuge, & Easement Refuges - District IV

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — This narrative report for Des Lacs National Wildlife Refuge outlines Refuge accomplishments from May through August of 1963. The report begins by summarizing the...

  16. Narrative report September, October, November, December, 1961 Des Lacs National Wildlife Refuge, Lostwood National Wildlife Reufge, Lake Ilo National Wildlife Refuge, & Easement Refuges - District IV & IVa

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — This narrative report for Des Lacs National Wildlife Refuge, Lostwood National Wildlife Refuge, Lake Ilo National Wildlife Refuge, and Easement Refuges - District IV...

  17. Narrative report September, October, November, December, 1959 Des Lacs National Wildlife Refuge, Lostwood National Wildlife Refuge, Lake Ilo National Wildlife Refuge, and Easement Refuges - District IV & IVa

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — This narrative report for Des Lacs National Wildlife Refuge, Lostwood National Wildlife Refuge, Lake Ilo National Wildlife Refuge, and Easement Refuges - District IV...

  18. Narrative report September, October, November, December, 1958 Des Lacs National Wildlife Refuge, Lostwood National Wildlife Refuge, Lake Ilo National Wildlife Refuge & Easement Refuges - District IV & IVa

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — This narrative report for Des Lacs National Wildlife Refuge, Lostwood National Wildlife Refuge, Lake Ilo National Wildlife Refuge, and Easement Refuges - District IV...

  19. Narrative report May, June, July, August, 1962 Des Lacs National Wildlife Refuge, Lake Ilo National Wildlife Refuge, & Easement Refuges - District IV

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — This narrative report for Des Lacs National Wildlife Refuge, Lake Ilo National Wildlife Refuge, and Easement Refuges - District IV outlines Refuge accomplishments...

  20. Deposition mechanism and microstructure of laser-assisted cold-sprayed (LACS) Al-12 wt.%Si coatings: effects of laser power

    CSIR Research Space (South Africa)

    Olakanmi, EO

    2013-06-01

    Full Text Available Surface treatment is one of the most costly processes for treating metallic components against corrosion. Laser-assisted cold spray (LACS) has an opportunity to decrease those costs particularly in transportation systems, chemical industries...

  1. Narrative report May, June, July, August, 1957 Des Lacs National Wildlife Refuge, Lostwood National Wildlife Refuge, Lake Ilo National Wildlife Refuge, & Easement Refuges - District IV & IVa

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — This narrative report for Des Lacs National Wildlife Refuge outlines Refuge accomplishments from May through August of 1957. The report begins by summarizing the...

  2. Narrative report May, June, July, August, 1956 Des Lacs National Wildlife Refuge, Lostwood National Wildlife Refuge, Lake Ilo National Wildlife Refuge

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — This narrative report for Des Lacs National Wildlife Refuge outlines Refuge accomplishments from May through August of 1956. The report begins by summarizing the...

  3. Narrative report September, October, November, December, 1957 Des Lacs National Wildlife Refuge, Lostwood National Wildlife Refuge, Lake Ilo National Wildlife Refuge & Easement Refuges - District IV & IVa

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — This narrative report for Des Lacs National Wildlife Refuge outlines Refuge accomplishments from September through December of 1957. The report begins by summarizing...

  4. Narrative report May, June, July, August, 1959 Des Lacs National Wildlife Refuge, Lostwood National Wildlife Refuge, Lake Ilo National Wildlife Refuge & Easement Refuges - District IV & IVa

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — This narrative report for Des Lacs National Wildlife Refuge, Lostwood National Wildlife Refuge, Lake Ilo National Wildlife Refuge, and Easement Refuges - District IV...

  5. Narrative report January, February, March, April, 1957 Des Lacs National Wildlife Refuge, Lostwood National Wildlife Refuge, Lake Ilo National Wildlife Refuge, & Easement Refuges - District IV & IVa

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — This narrative report for Des Lacs National Wildlife Refuge outlines Refuge accomplishments from January through April of 1957. The report begins by summarizing the...

  6. Distinct roles of two ceramide synthases, CaLag1p and CaLac1p, in the morphogenesis of Candida albicans

    DEFF Research Database (Denmark)

    Cheon, Seon Ah; Bal, Jyotiranjan; Song, Yunkyoung

    2012-01-01

    Lag1p and Lac1p catalyse ceramide synthesis in Saccharomyces cerevisiae. This study shows that Lag1 family proteins are generally required for polarized growth in hemiascomycetous yeast. However, in contrast to S. cerevisiae where these proteins are functionally redundant, C. albicans Lag1p (CaLag1......p) and Lac1p (CaLac1p) are functionally distinct. Lack of CaLag1p, but not CaLac1p, caused severe defects in the growth and hyphal morphogenesis of C. albicans. Deletion of CaLAG1 decreased expression of the hypha-specific HWP1 and ECE1 genes. Moreover, overexpression of CaLAG1 induced pseudohyphal....... albicans....

  7. Mutagenicity of ultraviolet A radiation in the lacI transgene in Big Blue mouse embryonic fibroblasts.

    Science.gov (United States)

    Kim, Sang-in; Pfeifer, Gerd P; Besaratinia, Ahmad

    2007-04-01

    Sunlight ultraviolet A (UVA) irradiation has been implicated in the etiology of human skin cancer. A genotoxic mode of action for UVA radiation has been suggested that involves photosensitization reactions giving rise to promutagenic DNA lesions. We investigated the mutagenicity of UVA in the lacI transgene in Big Blue mouse embryonic fibroblasts. UVA irradiation of these cells at a physiologically relevant dose of 18J/cm(2) caused a 2.8-fold increase in the lacI mutant frequency relative to control, i.e., 12.12+/-1.84 versus 4.39+/-1.99 x 10(-5) (mean+/-S.D.). DNA sequencing analysis showed that of 100 UVA-induced mutant plaques and 54 spontaneously arisen control plaques, 97 and 51, respectively, contained a minimum of one mutation along the lacI transgene. The vast majority of both induced- and spontaneous mutations were single base substitutions, although less frequently, there were also single and multiple base deletions and insertions, and tandem base substitutions. Detailed mutation spectrometry analysis revealed that G:C-->T:A transversions, the signature mutations of oxidative DNA damage, were significantly induced by UVA irradiation (Pnotion that intracellular photosensitization reactions causing promutagenic oxidative DNA damage are involved in UVA genotoxicity.

  8. Curvature of the spectral energy distribution, the inverse Compton component and the jet in Fermi 2LAC blazars

    Science.gov (United States)

    Xue, R.; Luo, D.; Du, L. M.; Wang, Z. R.; Xie, Z. H.; Yi, T. F.; Xiong, D. R.; Xu, Y. B.; Liu, W. G.; Yu, X. L.

    2016-12-01

    We fitted the spectral energy distributions (SEDs) of members of a large sample of Fermi 2LAC blazars to synchrotron and inverse Compton (IC) models. Our main results are as follows. (I) As suggested by previous works, the correlation between the peak frequency and curvature can be explained by statistical or stochastic particle acceleration mechanisms. For BL Lacs, we found a linear correlation between the synchrotron peak frequency and its curvature. The slope of the correlation is consistent with stochastic acceleration mechanisms and confirms the results of previous studies. For flat-spectrum radio quasars (FSRQs), we also found a linear correlation, but in this case the slope cannot be explained by previous theoretical models. (II) We found a significant correlation between IC luminosity and synchrotron luminosity. The slope of the correlation for FSRQs is consistent with the external Compton (EC) process. The slope of the correlation for BL Lacs is consistent with the synchrotron self-Compton (SSC) process. (III) We found several significant correlations between IC curvature and various basic parameters of blazars (black hole mass, broad-line luminosity, the Lorentz factor of the jet). We also found significant correlations between the bolometric luminosity and these basic parameters of blazars, which suggests that the origin of jets is a mixture of the mechanisms proposed by Blandford & Znajek and by Blandford & Payne.

  9. Effect of the partial NaCl substitution by other chloride salts on the volatile profile during the ripening of dry-cured lacón

    Energy Technology Data Exchange (ETDEWEB)

    Dominguez, R.; Munekata, P.E.; Cittadini, A.; Lorenzo, J.M.

    2016-07-01

    The influence of three salting treatments (treatment II: 50% NaCl-50% KCl; III: 45% NaCl-25% KCl-20% CaCl2-10% MgCl2; IV: 30% NaCl-50% KCl-15% CaCl2-5% MgCl2) on the formation of volatile compounds throughout the process was studied and compared to those of a control “lacón” (treatment I: 100% NaCl). There was an intense formation of volatile compounds throughout the processing, particularly during the dry-ripening stage. The most abundant chemical family in all the formulations, in the final product was hydrocarbons followed by aldehydes. The total volatile compound release was more intense in the control “lacóns” (1164 AU×106 ·g–1dry matter) than in “lacóns” from formulations II, III and IV (817–891 AU×106 ·g−1dry matter). The “lacóns” from formulation I showed the highest amounts of aldehydes. The “lacóns” from formulations I and II presented the highest amounts of hydrocarbons. The main conclusion is that the replacement of NaCl produces changes in the volatile profile and could be affect the aroma of “lacón”. (Author)

  10. Complete genome sequence of hypervirulent and outbreak-associated Acinetobacter baumannii strain LAC-4: epidemiology, resistance genetic determinants and potential virulence factors

    Science.gov (United States)

    Ou, Hong-Yu; Kuang, Shan N.; He, Xinyi; Molgora, Brenda M.; Ewing, Peter J.; Deng, Zixin; Osby, Melanie; Chen, Wangxue; Xu, H. Howard

    2015-01-01

    Acinetobacter baumannii is an important human pathogen due to its multi-drug resistance. In this study, the genome of an ST10 outbreak A. baumannii isolate LAC-4 was completely sequenced to better understand its epidemiology, antibiotic resistance genetic determinants and potential virulence factors. Compared with 20 other complete genomes of A. baumannii, LAC-4 genome harbors at least 12 copies of five distinct insertion sequences. It contains 12 and 14 copies of two novel IS elements, ISAba25 and ISAba26, respectively. Additionally, three novel composite transposons were identified: Tn6250, Tn6251 and Tn6252, two of which contain resistance genes. The antibiotic resistance genetic determinants on the LAC-4 genome correlate well with observed antimicrobial susceptibility patterns. Moreover, twelve genomic islands (GI) were identified in LAC-4 genome. Among them, the 33.4-kb GI12 contains a large number of genes which constitute the K (capsule) locus. LAC-4 harbors several unique putative virulence factor loci. Furthermore, LAC-4 and all 19 other outbreak isolates were found to harbor a heme oxygenase gene (hemO)-containing gene cluster. The sequencing of the first complete genome of an ST10 A. baumannii clinical strain should accelerate our understanding of the epidemiology, mechanisms of resistance and virulence of A. baumannii. PMID:25728466

  11. Regulation of the Escherichia coli L-arabinose operon studied by gel electrophoresis DNA binding assay.

    Science.gov (United States)

    Hendrickson, W; Schleif, R F

    1984-09-25

    DNA binding properties of the proteins required for induction of the Escherichia coli L-arabinose operon were measured using a polyacrylamide gel electrophoresis assay. The mechanisms of induction and repression were studied by observing the multiple interactions of RNA polymerase, cyclic AMP receptor protein and araC protein with short DNA fragments containing either the araC or araBAD promoter regions. These studies show that binding of araC protein to the operator site, araO1, directly blocks RNA polymerase binding at the araC promoter, pC. We find that cyclic AMP receptor protein and araC protein do not bind co-operatively at their respective sites to linear DNA fragments containing the pBAD promoter. Nevertheless, both these positive effectors must be present on the DNA to stimulate binding of RNA polymerase. Additionally, binding of the proteins to the DNA is not sufficient; araC protein must also be in the inducing state, for RNA polymerase to bind. Equilibrium binding constraints and kinetics were determined for araC protein binding to the araI and the araO1 sites. In the presence of inducer, L-arabinose, araC protein binds with equal affinity to DNA fragments containing either of these sites. In the presence of anti-inducer, D-fucose, the affinity for both sites is reduced 40-fold. The apparent equilibrium binding constants for both states of the protein vary in parallel with the buffer salt concentration. This result suggests that the inducing and repressing forms of araC protein displace a similar number of cations upon binding DNA.

  12. The cabABC Operon Essential for Biofilm and Rugose Colony Development in Vibrio vulnificus.

    Directory of Open Access Journals (Sweden)

    Jin Hwan Park

    2015-09-01

    Full Text Available A transcriptome analysis identified Vibrio vulnificus cabABC genes which were preferentially expressed in biofilms. The cabABC genes were transcribed as a single operon. The cabA gene was induced by elevated 3',5'-cyclic diguanylic acid (c-di-GMP and encoded a calcium-binding protein CabA. Comparison of the biofilms produced by the cabA mutant and its parent strain JN111 in microtiter plates using crystal-violet staining demonstrated that CabA contributed to biofilm formation in a calcium-dependent manner under elevated c-di-GMP conditions. Genetic and biochemical analyses revealed that CabA was secreted to the cell exterior through functional CabB and CabC, distributed throughout the biofilm matrix, and produced as the biofilm matured. These results, together with the observation that CabA also contributes to the development of rugose colony morphology, indicated that CabA is a matrix-associated protein required for maturation, rather than adhesion involved in the initial attachment, of biofilms. Microscopic comparison of the structure of biofilms produced by JN111 and the cabA mutant demonstrated that CabA is an extracellular matrix component essential for the development of the mature biofilm structures in flow cells and on oyster shells. Exogenously providing purified CabA restored the biofilm- and rugose colony-forming abilities of the cabA mutant when calcium was available. Circular dichroism and size exclusion analyses revealed that calcium binding induces CabA conformational changes which may lead to multimerization. Extracellular complementation experiments revealed that CabA can assemble a functional matrix only when exopolysaccharides coexist. Consequently, the combined results suggested that CabA is a structural protein of the extracellular matrix and multimerizes to a conformation functional in building robust biofilms, which may render V. vulnificus to survive in hostile environments and reach a concentrated infective dose.

  13. The cabABC Operon Essential for Biofilm and Rugose Colony Development in Vibrio vulnificus

    Science.gov (United States)

    Park, Jin Hwan; Jo, Youmi; Jang, Song Yee; Kwon, Haenaem; Irie, Yasuhiko; Parsek, Matthew R.; Kim, Myung Hee; Choi, Sang Ho

    2015-01-01

    A transcriptome analysis identified Vibrio vulnificus cabABC genes which were preferentially expressed in biofilms. The cabABC genes were transcribed as a single operon. The cabA gene was induced by elevated 3′,5′-cyclic diguanylic acid (c-di-GMP) and encoded a calcium-binding protein CabA. Comparison of the biofilms produced by the cabA mutant and its parent strain JN111 in microtiter plates using crystal-violet staining demonstrated that CabA contributed to biofilm formation in a calcium-dependent manner under elevated c-di-GMP conditions. Genetic and biochemical analyses revealed that CabA was secreted to the cell exterior through functional CabB and CabC, distributed throughout the biofilm matrix, and produced as the biofilm matured. These results, together with the observation that CabA also contributes to the development of rugose colony morphology, indicated that CabA is a matrix-associated protein required for maturation, rather than adhesion involved in the initial attachment, of biofilms. Microscopic comparison of the structure of biofilms produced by JN111 and the cabA mutant demonstrated that CabA is an extracellular matrix component essential for the development of the mature biofilm structures in flow cells and on oyster shells. Exogenously providing purified CabA restored the biofilm- and rugose colony-forming abilities of the cabA mutant when calcium was available. Circular dichroism and size exclusion analyses revealed that calcium binding induces CabA conformational changes which may lead to multimerization. Extracellular complementation experiments revealed that CabA can assemble a functional matrix only when exopolysaccharides coexist. Consequently, the combined results suggested that CabA is a structural protein of the extracellular matrix and multimerizes to a conformation functional in building robust biofilms, which may render V. vulnificus to survive in hostile environments and reach a concentrated infective dose. PMID:26406498

  14. Biomolecular Mechanisms of Mercury Transfers and Transformations by Proteins of the Mer Operon

    Science.gov (United States)

    Miller, S. M.; Hong, B.; Nauss, R.; Momany, C.; Summers, A. O.; Feng, X.; Harwood, I.; Stroud, R.

    2008-12-01

    Aerobic bacteria exhibiting resistance to the toxic effects of Hg(II) and organomercurials [RHg(I), e.g. MeHg(I)] and are widely found in both pristine and mercury contaminated environments. Resistance, afforded by a plasmid- or transposon-associated mer operon, involves an unusual pathway where Hg(II) and organomercurials [RHg(I)] undergo facilitated entry into the bacterial cytoplasm via an integral membrane transport protein (MerT) and are then "detoxified" by the concerted effort of two enzymes, organomercurial lyase (MerB), which catalyzes dealkylation (i.e., demethylation) of RHg(I) to Hg(II) and a hydrocarbon, and mercuric ion reductase (MerA), which catalyzes reduction of Hg(II) to Hg(0) as the ultimate detoxification for the organism. With a widespread distribution, these bacterial transformations play a significant role in the fate of mercury in the environment. Our focus is on elucidation of the molecular mechanisms for the transport and catalytic transformations of RHg(I) and Hg(II) by these proteins and the factors that influence the overall efficiency of the process. Current efforts are focused primarily on elucidating details of RHg(I) binding and dealkylation by MerB as well as the mechanism for transfer of the Hg(II) product to MerA. Key findings include the demonstration of a non-cysteine residue as essential for the catalytic activity and demonstration that direct transfer of Hg(II) to MerA proceeds more rapidly and more completely than transfer to small MW thiols such as cysteines or glutathione. Reuslts of these studies as well as an overview of our current understanding of the whole system will be presented.

  15. A four-gene operon in Bacillus cereus produces two rare spore-decorating sugars.

    Science.gov (United States)

    Li, Zi; Mukherjee, Thiya; Bowler, Kyle; Namdari, Sholeh; Snow, Zachary; Prestridge, Sarah; Carlton, Alexandra; Bar-Peled, Maor

    2017-05-05

    Bacterial glycan structures on cell surfaces are critical for cell-cell recognition and adhesion and in host-pathogen interactions. Accordingly, unraveling the sugar composition of bacterial cell surfaces can shed light on bacterial growth and pathogenesis. Here, we found that two rare sugars with a 3-C-methyl-6-deoxyhexose structure were linked to spore glycans in Bacillus cereus ATCC 14579 and ATCC 10876. Moreover, we identified a four-gene operon in B. cereus ATCC 14579 that encodes proteins with the following sequential enzyme activities as determined by mass spectrometry and one- and two-dimensional NMR methods: CTP:glucose-1-phosphate cytidylyltransferase, CDP-Glc 4,6-dehydratase, NADH-dependent SAM:C-methyltransferase, and NADPH-dependent CDP-3-C-methyl-6-deoxyhexose 4-reductase. The last enzyme predominantly yielded CDP-3-C-methyl-6-deoxygulose (CDP-cereose) and likely generated a 4-epimer CDP-3-C-methyl-6-deoxyallose (CDP-cillose). Some members of the B. cereus sensu lato group produce CDP-3-C-methyl-6-deoxy sugars for the formation of cereose-containing glycans on spores, whereas others such as Bacillus anthracis do not. Gene knockouts of the Bacillus C-methyltransferase and the 4-reductase confirmed their involvement in the formation of cereose-containing glycan on B. cereus spores. We also found that cereose represented 0.2-1% spore dry weight. Moreover, mutants lacking cereose germinated faster than the wild type, yet the mutants exhibited no changes in sporulation or spore resistance to heat. The findings reported here may provide new insights into the roles of the uncommon 3-C-methyl-6-deoxy sugars in cell-surface recognition and host-pathogen interactions of the genus Bacillus. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  16. Curli functional amyloid systems are phylogenetically widespread and display large diversity in operon and protein structure.

    Directory of Open Access Journals (Sweden)

    Morten S Dueholm

    Full Text Available Escherichia coli and a few other members of the Enterobacteriales can produce functional amyloids known as curli. These extracellular fibrils are involved in biofilm formation and studies have shown that they may act as virulence factors during infections. It is not known whether curli fibrils are restricted to the Enterobacteriales or if they are phylogenetically widespread. The growing number of genome-sequenced bacteria spanning many phylogenetic groups allows a reliable bioinformatic investigation of the phylogenetic diversity of the curli system. Here we show that the curli system is phylogenetically much more widespread than initially assumed, spanning at least four phyla. Curli fibrils may consequently be encountered frequently in environmental as well as pathogenic biofilms, which was supported by identification of curli genes in public metagenomes from a diverse range of habitats. Identification and comparison of curli subunit (CsgA/B homologs show that these proteins allow a high degree of freedom in their primary protein structure, although a modular structure of tightly spaced repeat regions containing conserved glutamine, asparagine and glycine residues has to be preserved. In addition, a high degree of variability within the operon structure of curli subunits between bacterial taxa suggests that the curli fibrils might have evolved to fulfill specific functions. Variations in the genetic organization of curli genes are also seen among different bacterial genera. This suggests that some genera may utilize alternative regulatory pathways for curli expression. Comparison of phylogenetic trees of Csg proteins and the 16S rRNA genes of the corresponding bacteria showed remarkably similar overall topography, suggesting that horizontal gene transfer is a minor player in the spreading of the curli system.

  17. Monitoring of the Lac Bam Wetland Extent Using Dual-Polarized X-Band SAR Data

    Directory of Open Access Journals (Sweden)

    Linda Moser

    2016-04-01

    Full Text Available Wetlands in semi-arid Africa are vital as water resource for local inhabitants and for biodiversity, but they are prone to strong seasonal fluctuations. Lac Bam is the largest natural freshwater lake in Burkina Faso, its water is mixed with patches of floating or flooded vegetation, and very turbid and sediment-rich. These characteristics as well as the usual cloud cover during the rainy season can limit the suitability of optical remote sensing data for monitoring purposes. This study demonstrates the applicability of weather-independent dual-polarimetric Synthetic Aperture Radar (SAR data for the analysis of spatio-temporal wetland dynamics. A TerraSAR-X repeat-pass time series of dual-co-polarized HH-VV StripMap data—with intervals of 11 days, covering two years (2013–2015 from the rainy to the dry season—was processed to normalized Kennaugh elements and classified mono-temporally and multi-temporally. Land cover time series and seasonal duration maps were generated for the following four classes: open water, flooded/floating vegetation, irrigated cultivation, and land (non-wetland. The added value of dual-polarimetric SAR data is demonstrated by significantly higher multitemporal classification accuracies, where the overall accuracy (88.5% exceeds the classification accuracy using single-polarimetric SAR intensity data (82.2%. For relevant change classes involving flooded vegetation and irrigated fields dual-polarimetric data (accuracies: 75%–97% are favored to single-polarimetric data (42%–87%. This study contributes to a better understanding of the dynamics of semi-arid African wetlands in terms of water areas including water with flooded vegetation, and the location and timing of irrigated cultivations.

  18. Analysis of geomagnetic secular variations 10 000 to 30 000 years bp, Lac du Bouchet, France

    Science.gov (United States)

    Smith, G.; Creer, K. M.

    1986-09-01

    Cores of the bottom sediments from Lac du Bouchet, in the Haute Loire, France (44.9° N, 3.8° E) have been taken using Mackereth type pneumatic piston corers. The sediments have been dated by palynological control back to 15 000 years bp (years before present), and by radiocarbon age determinations using both conventional and accelerator methods. The depth/time transform provisionally used here dates the sequence from 10 000 to 30 000 years bp. The stacked records of demagnetised remanent magnetisation from eight cores have been examined. Fourier and maximum entropy method spectral analyses show good agreement. Inclination and declination spectra are different in that the dominant inclination periods tend to fall in the negative part of the complex spectrum, while the dominant declination periods tend to fall in the positive part. The VGP path traced out by the remanent magnetisation vector shows predominantly clockwise looping, consistent with essentially westward drifting geomagnetic sources. The detailed form of the VGP path is affected by the degree of smoothing, but clockwise looping always predominates averaging ˜ 67% over the whole time interval investigated. A band of frequencies between ˜ 0.9 and ˜ 0.3 cycles per thousand years is associated with the strongest bias towards clockwise rotation (˜ 80% to 90%) while a band between ˜ 0.3 and 0.1 cycles per thousand years is associated with only ˜ 50% clockwise rotation. Individual core records show some negative inclinations at horizons where inclination minima occur suggesting that 'excursions' should be regarded as extreme values of secular variation rather than aborted polarity reversals of the main field.

  19. Prediction of operon-like gene clusters in the Arabidopsis thaliana genome based on co-expression analysis of neighboring genes.

    Science.gov (United States)

    Wada, Masayoshi; Takahashi, Hiroki; Altaf-Ul-Amin, Md; Nakamura, Kensuke; Hirai, Masami Y; Ohta, Daisaku; Kanaya, Shigehiko

    2012-07-15

    Operon-like arrangements of genes occur in eukaryotes ranging from yeasts and filamentous fungi to nematodes, plants, and mammals. In plants, several examples of operon-like gene clusters involved in metabolic pathways have recently been characterized, e.g. the cyclic hydroxamic acid pathways in maize, the avenacin biosynthesis gene clusters in oat, the thalianol pathway in Arabidopsis thaliana, and the diterpenoid momilactone cluster in rice. Such operon-like gene clusters are defined by their co-regulation or neighboring positions within immediate vicinity of chromosomal regions. A comprehensive analysis of the expression of neighboring genes therefore accounts a crucial step to reveal the complete set of operon-like gene clusters within a genome. Genome-wide prediction of operon-like gene clusters should contribute to functional annotation efforts and provide novel insight into evolutionary aspects acquiring certain biological functions as well. We predicted co-expressed gene clusters by comparing the Pearson correlation coefficient of neighboring genes and randomly selected gene pairs, based on a statistical method that takes false discovery rate (FDR) into consideration for 1469 microarray gene expression datasets of A. thaliana. We estimated that A. thaliana contains 100 operon-like gene clusters in total. We predicted 34 statistically significant gene clusters consisting of 3 to 22 genes each, based on a stringent FDR threshold of 0.1. Functional relationships among genes in individual clusters were estimated by sequence similarity and functional annotation of genes. Duplicated gene pairs (determined based on BLAST with a cutoff of Emetabolism, containing P450 genes restricted to the Brassica family and predicted to be involved in secondary metabolism. Operon-like clusters tend to include genes encoding bio-machinery associated with ribosomes, the ubiquitin/proteasome system, secondary metabolic pathways, lipid and fatty-acid metabolism, and the lipid

  20. Molecular level biodegradation of phenol and its derivatives through dmp operon of Pseudomonas putida: A bio-molecular modeling and docking analysis.

    Science.gov (United States)

    Ray, Sujay; Banerjee, Arundhati

    2015-10-01

    Participation of Pseudomonas putida-derived methyl phenol (dmp) operon and DmpR protein in the biodegradation of phenol or other harmful, organic, toxic pollutants was investigated at a molecular level. Documentation documents that P. putida has DmpR protein which positively regulates dmp operon in the presence of inducers; like phenols. From the operon, phenol hydroxylase encoded by dmpN gene, participates in degrading phenols after dmp operon is expressed. For the purpose, the 3-D models of the four domains from DmpR protein and of the DNA sequences from the two Upstream Activation Sequences (UAS) present at the promoter region of the operon were demonstrated using discrete molecular modeling techniques. The best modeled structures satisfying their stereo-chemical properties were selected in each of the cases. To stabilize the individual structures, energy optimization was performed. In the presence of inducers, probable interactions among domains and then the two independent DNA structures with the fourth domain were perused by manifold molecular docking simulations. The complex structures were made to be stable by minimizing their overall energy. Responsible amino acid residues, nucleotide bases and binding patterns for the biodegradation, were examined. In the presence of the inducers, the biodegradation process is initiated by the interaction of phe50 from the first protein domain with the inducers. Only after the interaction of the last domain with the DNA sequences individually, the operon is expressed. This novel residue level study is paramount for initiating transcription in the operon; thereby leading to expression of phenol hydroxylase followed by phenol biodegradation. Copyright © 2015. Published by Elsevier B.V.