Evolution and Biophysics of the Escherichia coli lac Operon
Ray, J. Christian; Igoshin, Oleg; Quan, Selwyn; Monds, Russell; Cooper, Tim; Balázsi, Gábor
2011-03-01
To understand, predict, and control the evolution of living organisms, we consider biophysical effects and molecular network architectures. The lactose utilization system of E. coli is among the most well-studied molecular networks in biology, making it an ideal candidate for such studies. Simulations show how the genetic architecture of the wild-type operon attenuates large metabolic intermediate fluctuations that are predicted to occur in an equivalent system with the component genes on separate operons. Quantification of gene expression in the lac operon evolved in growth conditions containing constant lactose, alternating with glucose, or constant glucose, shows characteristic gene expression patterns depending on conditions. We are simulating these conditions to show context-dependent biophysical sources and costs of different lac operon architectures.
Dynamic model of gene regulation for the lac operon
International Nuclear Information System (INIS)
Angelova, Maia; Ben-Halim, Asma
2011-01-01
Gene regulatory network is a collection of DNA which interact with each other and with other matter in the cell. The lac operon is an example of a relatively simple genetic network and is one of the best-studied structures in the Escherichia coli bacteria. In this work we consider a deterministic model of the lac operon with a noise term, representing the stochastic nature of the regulation. The model is written in terms of a system of simultaneous first order differential equations with delays. We investigate an analytical and numerical solution and analyse the range of values for the parameters corresponding to a stable solution.
Dynamic model of gene regulation for the lac operon
Energy Technology Data Exchange (ETDEWEB)
Angelova, Maia; Ben-Halim, Asma, E-mail: maia.angelova@northumbria.ac.uk, E-mail: asma.benhalim@northumbria.ac.uk [Intelligent Modelling Lab, School of Computing, Engineering and Information Sciences, Northumbria University, Newcastle upon Tyne NE2 1XE (United Kingdom)
2011-03-01
Gene regulatory network is a collection of DNA which interact with each other and with other matter in the cell. The lac operon is an example of a relatively simple genetic network and is one of the best-studied structures in the Escherichia coli bacteria. In this work we consider a deterministic model of the lac operon with a noise term, representing the stochastic nature of the regulation. The model is written in terms of a system of simultaneous first order differential equations with delays. We investigate an analytical and numerical solution and analyse the range of values for the parameters corresponding to a stable solution.
Solving a discrete model of the lac operon using Z3
Gutierrez, Natalia A.
2014-05-01
A discrete model for the Lcac Operon is solved using the SMT-solver Z3. Traditionally the Lac Operon is formulated in a continuous math model. This model is a system of ordinary differential equations. Here, it was considerated as a discrete model, based on a Boolean red. The biological problem of Lac Operon is enunciated as a problem of Boolean satisfiability, and it is solved using an STM-solver named Z3. Z3 is a powerful solver that allows understanding the basic dynamic of the Lac Operon in an easier and more efficient way. The multi-stability of the Lac Operon can be easily computed with Z3. The code that solves the Boolean red can be written in Python language or SMT-Lib language. Both languages were used in local version of the program as online version of Z3. For future investigations it is proposed to solve the Boolean red of Lac Operon using others SMT-solvers as cvc4, alt-ergo, mathsat and yices.
Narang, Atul; Oehler, Stefan
2017-05-01
The lac (lactose) operon (which processes β-galactosides) and the mel (melibiose) operon (which processes α-galactosides) of Escherichia coli have a close historical connection. A number of shared substrates and effectors of the permeases and regulatory proteins have been reported over the years. Until now, β-thiogalactosides like TMG (methyl-β-d-thiogalactopyranoside) and IPTG (isopropyl-β-d-thiogalactopyranoside) have not generally been considered to be inducers of the mel operon. The same is true for β-galactosides such as lactose [β-d-galactopyranosyl-(1→4)-d-glucose], which is a substrate but is not itself an inducer of the lac operon. This report shows that all three sugars can induce the mel operon significantly when they are accumulated in the cell by Lac permease. Strong induction by β-thiogalactosides is observed in the presence of Lac permease, and strong induction by lactose (more than 200-fold) is observed in the absence of β-galactosidase. This finding calls for reevaluation of TMG uptake experiments as assays for Lac permease that were performed with mel + strains. IMPORTANCE The typical textbook picture of bacterial operons is that of stand-alone units of genetic information that perform, in a regulated manner, well-defined cellular functions. Less attention is given to the extensive interactions that can be found between operons. Well-described examples of such interactions are the effector molecules shared by the lac and mel operons. Here, we show that this set has to be extended to include β-galactosides, which have been, until now, considered not to effect the expression of the mel operon. That they can be inducers of the mel operon as well as the lac operon has not been noted in decades of research because of the Escherichia coli genetic background used in previous studies. Copyright © 2017 American Society for Microbiology.
Marbach, Anja; Bettenbrock, Katja
2012-01-01
Most commonly used expression systems in bacteria are based on the Escherichia coli lac promoter. Furthermore, lac operon elements are used today in systems and synthetic biology. In the majority of the cases the gratuitous inducers IPTG or TMG are used. Here we report a systematic comparison of lac promoter induction by TMG and IPTG which focuses on the aspects inducer uptake, population heterogeneity and a potential influence of the transacetylase, LacA. We provide induction curves in E. coli LJ110 and in isogenic lacY and lacA mutant strains and we show that both inducers are substrates of the lactose permease at low inducer concentrations but can also enter cells independently of lactose permease if present at higher concentrations. Using a gfp reporter strain we compared TMG and IPTG induction at single cell level and showed that bimodal induction with IPTG occurred at approximately ten-fold lower concentrations than with TMG. Furthermore, we observed that lac operon induction is influenced by the transacetylase, LacA. By comparing two Plac-gfp reporter strains with and without a lacA deletion we could show that in the lacA(+) strain the fluorescence level decreased after few hours while the fluorescence further increased in the lacA(-) strain. The results indicate that through the activity of LacA the IPTG concentration can be reduced below an inducing threshold concentration-an influence that should be considered if low inducer amounts are used. Copyright © 2011 Elsevier B.V. All rights reserved.
Dynamics and bistability in a reduced model of the lac operon
Yildirim, Necmettin; Santillán, Moisés; Horike, Daisuke; Mackey, Michael C.
2004-06-01
It is known that the lac operon regulatory pathway is capable of showing bistable behavior. This is an important complex feature, arising from the nonlinearity of the involved mechanisms, which is essential to understand the dynamic behavior of this molecular regulatory system. To find which of the mechanisms involved in the regulation of the lac operon is the origin of bistability, we take a previously published model which accounts for the dynamics of mRNA, lactose, allolactose, permease and β-galactosidase involvement and simplify it by ignoring permease dynamics (assuming a constant permease concentration). To test the behavior of the reduced model, three existing sets of data on β-galactosidase levels as a function of time are simulated and we obtain a reasonable agreement between the data and the model predictions. The steady states of the reduced model were numerically and analytically analyzed and it was shown that it may indeed display bistability, depending on the extracellular lactose concentration and growth rate.
The effect of stochasticity on the lac operon: an evolutionary perspective.
Directory of Open Access Journals (Sweden)
Milan van Hoek
2007-06-01
Full Text Available The role of stochasticity on gene expression is widely discussed. Both potential advantages and disadvantages have been revealed. In some systems, noise in gene expression has been quantified, in among others the lac operon of Escherichia coli. Whether stochastic gene expression in this system is detrimental or beneficial for the cells is, however, still unclear. We are interested in the effects of stochasticity from an evolutionary point of view. We study this question in the lac operon, taking a computational approach: using a detailed, quantitative, spatial model, we evolve through a mutation-selection process the shape of the promoter function and therewith the effective amount of stochasticity. We find that noise values for lactose, the natural inducer, are much lower than for artificial, nonmetabolizable inducers, because these artificial inducers experience a stronger positive feedback. In the evolved promoter functions, noise due to stochasticity in gene expression, when induced by lactose, only plays a very minor role in short-term physiological adaptation, because other sources of population heterogeneity dominate. Finally, promoter functions evolved in the stochastic model evolve to higher repressed transcription rates than those evolved in a deterministic version of the model. This causes these promoter functions to experience less stochasticity in gene expression. We show that a high repression rate and hence high stochasticity increases the delay in lactose uptake in a variable environment. We conclude that the lac operon evolved such that the impact of stochastic gene expression is minor in its natural environment, but happens to respond with much stronger stochasticity when confronted with artificial inducers. In this particular system, we have shown that stochasticity is detrimental. Moreover, we demonstrate that in silico evolution in a quantitative model, by mutating the parameters of interest, is a promising way to unravel
DEFF Research Database (Denmark)
Solem, Christian; Købmann, Brian Jensen; Jensen, Peter Ruhdal
2008-01-01
The lactose transporter and β-galactosidase from Streptococcus thermophilus, encoded by the lacSZ operon, were introduced into the lactose-negative strain Lactococcus lactis MG1363 and the expression of the lacSZ operon was modulated by substitution of the native promoter with randomized synthetic...... promoters. A series of strains with various expression levels of lacSZ were examined for their fermentation of lactose. Strains with a high expression level were found to metabolize lactose in a similar manner to S. thermophilus, i.e. the galactose moiety of lactose was excreted to the growth medium...... and only glucose was metabolized in glycolysis. Interestingly, strains with low expression of the operon showed a mixed acid metabolism and co-metabolism of galactose and glucose. The lactose flux increased gradually with increasing expression of the lacSZ operon until an optimum was observed...
van Rooijen, R J; Dechering, K J; Niek, C; Wilmink, J; de Vos, W M
1993-02-01
Site-directed mutagenesis of the Lactococcus lactis lacR gene was performed to identify residues in the LacR repressor that are involved in the induction of lacABCDFEGX operon expression by tagatose-6-phosphate. A putative inducer binding domain located near the C-terminus was previously postulated based on homology studies with the Escherichia coli DeoR family of repressors, which all have a phosphorylated sugar as inducer. Residues within this domain and lysine residues that are charge conserved in the DeoR family were changed into alanine or arginine. The production of the LacR mutants K72A, K80A, K80R, D210A, K213A and K213R in the LacR-deficient L.lactis strain NZ3015 resulted in repressed phospho-beta-galactosidase (LacG) activities and decreased growth rates on lactose. Gel mobility shift assays showed that the complex between a DNA fragment carrying the lac operators and LacR mutants K72A, K80A, K213A and D210A did not dissociate in the presence of tagatose-6-phosphate, in contrast to wild type LacR. Other mutations (K62A/K63A, K72R, K73A, K73R, T212A, F214R, R216R and R216K) exhibited no gross effects on inducer response. The results strongly suggest that the lysines at positions 72, 80 and 213 and aspartic acid at position 210 are involved in the induction of lac operon expression by tagatose-6-phosphate.
Bistable behavior of the lac operon in E. coli when induced with a mixture of lactose and TMG
Directory of Open Access Journals (Sweden)
Orlando Díaz-Hernández
2010-07-01
Full Text Available In this work we investigate multistability in the lac operon of Escherichia coli when it is induced by a mixture of lactose and the non-metabolizable thiomethyl galactoside (TMG. In accordance with previously published experimental results and computer simulations, our simulations predict that: (1 when the system is induced by TMG, the system shows a discernible bistable behavior while, (2 when the system is induced by lactose, bistability does not disappear but excessively high concentrations of lactose would be required to observe it. Finally, our simulation results predict that when a mixture of lactose and TMG is used, the bistability region in the extracellular glucose concentration vs. extracellular lactose concentration parameter space changes in such a way that the model predictions regarding bistability could be tested experimentally. These experiments could help to solve a recent controversy regarding the existence of bistability in the lac operon under natural conditions.
Bistable behavior of the lac operon in E. coli when induced with a mixture of lactose and TMG.
Díaz-Hernández, Orlando; Santillán, Moisés
2010-01-01
In this work we investigate multistability in the lac operon of Escherichia coli when it is induced by a mixture of lactose and the non-metabolizable thiomethyl galactoside (TMG). In accordance with previously published experimental results and computer simulations, our simulations predict that: (1) when the system is induced by TMG, the system shows a discernible bistable behavior while, (2) when the system is induced by lactose, bistability does not disappear but excessively high concentrations of lactose would be required to observe it. Finally, our simulation results predict that when a mixture of lactose and TMG is used, the bistability region in the extracellular glucose concentration vs. extracellular lactose concentration parameter space changes in such a way that the model predictions regarding bistability could be tested experimentally. These experiments could help to solve a recent controversy regarding the existence of bistability in the lac operon under natural conditions.
Teaching the Big Ideas of Biology with Operon Models
Cooper, Robert A.
2015-01-01
This paper presents an activity that engages students in model-based reasoning, requiring them to predict the behavior of the trp and lac operons under different environmental conditions. Students are presented six scenarios for the "trp" operon and five for the "lac" operon. In most of the scenarios, specific mutations have…
Hopf Bifurcation and Delay-Induced Turing Instability in a Diffusive lac Operon Model
Cao, Xin; Song, Yongli; Zhang, Tonghua
In this paper, we investigate the dynamics of a lac operon model with delayed feedback and diffusion effect. If the system is without delay or the delay is small, the positive equilibrium is stable so that there are no spatial patterns formed; while the time delay is large enough the equilibrium becomes unstable so that rich spatiotemporal dynamics may occur. We have found that time delay can not only incur temporal oscillations but also induce imbalance in space. With different initial values, the system may have different spatial patterns, for instance, spirals with one head, four heads, nine heads, and even microspirals.
Interplay of Gene Expression Noise and Ultrasensitive Dynamics Affects Bacterial Operon Organization
Ray, J. Christian J; Igoshin, Oleg A.
2012-01-01
Bacterial chromosomes are organized into polycistronic cotranscribed operons, but the evolutionary pressures maintaining them are unclear. We hypothesized that operons alter gene expression noise characteristics, resulting in selection for or against maintaining operons depending on network architecture. Mathematical models for 6 functional classes of network modules showed that three classes exhibited decreased noise and 3 exhibited increased noise with same-operon cotranscription of interacting proteins. Noise reduction was often associated with a decreased chance of reaching an ultrasensitive threshold. Stochastic simulations of the lac operon demonstrated that the predicted effects of transcriptional coupling hold for a complex network module. We employed bioinformatic analysis to find overrepresentation of noise-minimizing operon organization compared with randomized controls. Among constitutively expressed physically interacting protein pairs, higher coupling frequencies appeared at lower expression levels, where noise effects are expected to be dominant. Our results thereby suggest an important role for gene expression noise, in many cases interacting with an ultrasensitive switch, in maintaining or selecting for operons in bacterial chromosomes. PMID:22956903
The use of lac-type promoters in control analysis
DEFF Research Database (Denmark)
Jensen, Peter Ruhdal; Westerhoff, H. v.; Michelsen, Ole
1993-01-01
experimentally by constructing E. coli strains, in which the chromosomal atp operon is transcribed from the lacUV5 and the tacI promoter. We measured the concentration of the c subunit of H+-ATPase, and found that the expression of this enzyme could be modulated between non-detectable levels and up to five times...... the wild-type level. Thus, in the absence of inducer, no expression of atp genes could be detected when the atp operon was controlled by the lacUV5 promoter, and we estimate that the expression was less than 0.0025 times the wild-type level. We show that the introduction of a lac Y mutation facilitated...
Induction of the lac carrier and an associated membrane protein in Escherichia coli
International Nuclear Information System (INIS)
Lagarias, D.M.
1985-01-01
Induction of the lac operon in wild type Escherichia coli strains results in synthesis of a 16 kilodalton inner membrane protein in addition to the known products of the lacZ, lacY and lacA genes. Cells carrying the lacY gene on a plasmid over produce this 16 kilodalton polypeptide as well as the Lac carrier, the membrane protein product of the lacY gene. However, [ 35 S]methionine labeling of minicells carrying the lacY plasmid shows that the 16 kDa protein is not synthesized from the plasmid DNA. The 16 kDa protein was purified and partially characterized. It is an acidic membrane protein of apparent molecular weight 15,800 whose amino terminal sequence (NH 2 -Met-Arg-Asn-Phe-Asp-Leu-) does not correspond to any nucleotide sequence known in lac operon DNA. Using antibody prepared to the purified 16 kDa protein, a quantitative analysis of conditions under which this protein is made was accomplished, and reveals that the amount of 16 kDa protein which appears in the membrane is proportional to lac operon expression. Hybridization of a synthetic oligonucleotide probe complementary to the 5' end of 16 kDa protein mRNA shows that its synthesis is regulated at the level of transcription. A description of attempts to clone this gene is given. Possible functional roles for the 16 kDa protein are discussed
UV induction of the LT-Toxin operon with respect to the genes lexA, recA, and umuD
International Nuclear Information System (INIS)
Tiganova, I.G.; Rusina, O.Yu.; Andreeva, I.V.; Brukhanskii, G.V.; Skavronskaya, A.G.
1994-01-01
UV induction of the elt operon (the LT-toxin operon in Escherichia coli) was demonstrated in experiments using fusion of elt::lac operons with the help of Mud1(Ap lac) phage. UV induction of the elt operon is lexA-dependent; thus, the possibility of SOS regulation of this process may be assumed. However, UV induction of the elt operon turned out to be recA-independent, which makes it impossible to consider this induction as a typical SOS response. UV induction of the elt operon is also observed in Salmonella typhimurium, which differs from E. coli in the product of umuD, which suggests that the UV induction of the elt operon is umuD independent
Interplay of protein and DNA structure revealed in simulations of the lac operon.
Directory of Open Access Journals (Sweden)
Luke Czapla
Full Text Available The E. coli Lac repressor is the classic textbook example of a protein that attaches to widely spaced sites along a genome and forces the intervening DNA into a loop. The short loops implicated in the regulation of the lac operon suggest the involvement of factors other than DNA and repressor in gene control. The molecular simulations presented here examine two likely structural contributions to the in-vivo looping of bacterial DNA: the distortions of the double helix introduced upon association of the highly abundant, nonspecific nucleoid protein HU and the large-scale deformations of the repressor detected in low-resolution experiments. The computations take account of the three-dimensional arrangements of nucleotides and amino acids found in crystal structures of DNA with the two proteins, the natural rest state and deformational properties of protein-free DNA, and the constraints on looping imposed by the conformation of the repressor and the orientation of bound DNA. The predicted looping propensities capture the complex, chain-length-dependent variation in repression efficacy extracted from gene expression studies and in vitro experiments and reveal unexpected chain-length-dependent variations in the uptake of HU, the deformation of repressor, and the folding of DNA. Both the opening of repressor and the presence of HU, at levels approximating those found in vivo, enhance the probability of loop formation. HU affects the global organization of the repressor and the opening of repressor influences the levels of HU binding to DNA. The length of the loop determines whether the DNA adopts antiparallel or parallel orientations on the repressor, whether the repressor is opened or closed, and how many HU molecules bind to the loop. The collective behavior of proteins and DNA is greater than the sum of the parts and hints of ways in which multiple proteins may coordinate the packaging and processing of genetic information.
Interplay of protein and DNA structure revealed in simulations of the lac operon.
Czapla, Luke; Grosner, Michael A; Swigon, David; Olson, Wilma K
2013-01-01
The E. coli Lac repressor is the classic textbook example of a protein that attaches to widely spaced sites along a genome and forces the intervening DNA into a loop. The short loops implicated in the regulation of the lac operon suggest the involvement of factors other than DNA and repressor in gene control. The molecular simulations presented here examine two likely structural contributions to the in-vivo looping of bacterial DNA: the distortions of the double helix introduced upon association of the highly abundant, nonspecific nucleoid protein HU and the large-scale deformations of the repressor detected in low-resolution experiments. The computations take account of the three-dimensional arrangements of nucleotides and amino acids found in crystal structures of DNA with the two proteins, the natural rest state and deformational properties of protein-free DNA, and the constraints on looping imposed by the conformation of the repressor and the orientation of bound DNA. The predicted looping propensities capture the complex, chain-length-dependent variation in repression efficacy extracted from gene expression studies and in vitro experiments and reveal unexpected chain-length-dependent variations in the uptake of HU, the deformation of repressor, and the folding of DNA. Both the opening of repressor and the presence of HU, at levels approximating those found in vivo, enhance the probability of loop formation. HU affects the global organization of the repressor and the opening of repressor influences the levels of HU binding to DNA. The length of the loop determines whether the DNA adopts antiparallel or parallel orientations on the repressor, whether the repressor is opened or closed, and how many HU molecules bind to the loop. The collective behavior of proteins and DNA is greater than the sum of the parts and hints of ways in which multiple proteins may coordinate the packaging and processing of genetic information.
Stefanski, Katherine M.
A central concept in genetics is the regulation of gene expression. Inducible gene expression is often taught in undergraduate biology courses using the lac operon of Escherichia coli (E. coli ). With national calls for reform in undergraduate biology education and a body of literature that supports the use of active learning techniques including hands-on learning and analogies we were motivated to develop a hands-on analogous model of the lac operon. The model was developed over two iterations and was administered to genetics students. To determine the model's worth as a learning tool a concept inventory (CI) was developed using rigorous protocols. Concept inventories are valuable tools which can be used to assess students' understanding of a topic and pinpoint commonly held misconceptions as well as the value of educational tools. Through in-class testing (n =115) the lac operon concept inventory (LOCI) was demonstrated to be valid, predictive, and reliable (? coefficient = 0.994). LOCI scores for students who participated in the hands-on activity (n = 67) were 7.5% higher (t = -2.281, P operon. We were able to determine the efficacy of the activity and identify misconceptions held by students about the lac operon because of the use of a valid and reliable CI.
Structure-guided approach to site-specific fluorophore labeling of the lac repressor LacI.
Directory of Open Access Journals (Sweden)
Kalle Kipper
Full Text Available The lactose operon repressor protein LacI has long served as a paradigm of the bacterial transcription factors. However, the mechanisms whereby LacI rapidly locates its cognate binding site on the bacterial chromosome are still elusive. Single-molecule fluorescence imaging approaches are well suited for the study of these mechanisms but rely on a functionally compatible fluorescence labeling of LacI. Particularly attractive for protein fluorescence labeling are synthetic fluorophores due to their small size and favorable photophysical characteristics. Synthetic fluorophores are often conjugated to natively occurring cysteine residues using maleimide chemistry. For a site-specific and functionally compatible labeling with maleimide fluorophores, the target protein often needs to be redesigned to remove unwanted native cysteines and to introduce cysteines at locations better suited for fluorophore attachment. Biochemical screens can then be employed to probe for the functional activity of the redesigned protein both before and after dye labeling. Here, we report a mutagenesis-based redesign of LacI to enable a functionally compatible labeling with maleimide fluorophores. To provide an easily accessible labeling site in LacI, we introduced a single cysteine residue at position 28 in the DNA-binding headpiece of LacI and replaced two native cysteines with alanines where derivatization with bulky substituents is known to compromise the protein's activity. We find that the redesigned LacI retains a robust activity in vitro and in vivo, provided that the third native cysteine at position 281 is retained in LacI. In a total internal reflection microscopy assay, we observed individual Cy3-labeled LacI molecules bound to immobilized DNA harboring the cognate O1 operator sequence, indicating that the dye-labeled LacI is functionally active. We have thus been able to generate a functional fluorescently labeled LacI that can be used to unravel mechanistic
Directory of Open Access Journals (Sweden)
Sandeepa M Eswarappa
Full Text Available The genus Salmonella includes many pathogens of great medical and veterinary importance. Bacteria belonging to this genus are very closely related to those belonging to the genus Escherichia. lacZYA operon and lacI are present in Escherichia coli, but not in Salmonella enterica. It has been proposed that Salmonella has lost lacZYA operon and lacI during evolution. In this study, we have investigated the physiological and evolutionary significance of the absence of lacI in Salmonella enterica. Using murine model of typhoid fever, we show that the expression of LacI causes a remarkable reduction in the virulence of Salmonella enterica. LacI also suppresses the ability of Salmonella enterica to proliferate inside murine macrophages. Microarray analysis revealed that LacI interferes with the expression of virulence genes of Salmonella pathogenicity island 2. This effect was confirmed by RT-PCR and Western blot analysis. Interestingly, we found that SBG0326 of Salmonella bongori is homologous to lacI of Escherichia coli. Salmonella bongori is the only other species of the genus Salmonella and it lacks the virulence genes of Salmonella pathogenicity island 2. Overall, our results demonstrate that LacI is an antivirulence factor of Salmonella enterica and suggest that absence of lacI has facilitated the acquisition of virulence genes of Salmonella pathogenicity island 2 in Salmonella enterica making it a successful systemic pathogen.
Chung, T; Resnik, E; Stueland, C; LaPorte, D C
1993-01-01
Although the genes of the aceBAK operon are expressed from the same promoter, the relative cellular levels of their products are approximately 0.3:1:0.003. Gene and operon fusions with lacZ were constructed to characterize this differential expression. The upshift in expression between aceB and aceA resulted from differences in translational efficiency. In contrast, inefficient translation and premature transcriptional termination contributed to the downshift in expression between aceA and ac...
Regulation and Adaptive Evolution of Lactose Operon Expression in Lactobacillus delbrueckii
Lapierre, Luciane; Mollet, Beat; Germond, Jacques-Edouard
2002-01-01
Lactobacillus delbrueckii subsp. bulgaricus and L. delbrueckii subsp. lactis are both used in the dairy industry as homofermentative lactic acid bacteria in the production of fermented milk products. After selective pressure for the fast fermentation of milk in the manufacture of yogurts, L. delbrueckii subsp. bulgaricus loses its ability to regulate lac operon expression. A series of mutations led to the constitutive expression of the lac genes. A complex of insertion sequence (IS) elements (ISL4 inside ISL5), inserted at the border of the lac promoter, induced the loss of the palindromic structure of one of the operators likely involved in the binding of regulatory factors. A lac repressor gene was discovered downstream of the β-galactosidase gene of L. delbrueckii subsp. lactis and was shown to be inactivated by several mutations in L. delbrueckii subsp. bulgaricus. Regulatory mechanisms of the lac gene expression of L. delbrueckii subsp. bulgaricus and L. delbrueckii subsp. lactis were compared by heterologous expression in Lactococcus lactis of the two lac promoters in front of a reporter gene (β-glucuronidase) in the presence or absence of the lac repressor gene. Insertion of the complex of IS elements in the lac promoter of L. delbrueckii subsp. bulgaricus increased the promoter's activity but did not prevent repressor binding; rather, it increased the affinity of the repressor for the promoter. Inactivation of the lac repressor by mutations was then necessary to induce the constitutive expression of the lac genes in L. delbrueckii subsp. bulgaricus. PMID:11807052
Asteri, Ioanna-Areti; Papadimitriou, Konstantinos; Boutou, Effrossyni; Anastasiou, Rania; Pot, Bruno; Vorgias, Constantinos E; Tsakalidou, Effie
2010-07-15
The pLAC1 plasmid of Lactobacillus acidipiscis ACA-DC 1533, a strain isolated from traditional Kopanisti cheese, was characterised. Nucleotide sequence analysis revealed a circular molecule of 3478bp with a G+C content of 37.2%. Ab initio annotation indicated four putative open reading frames (orfs). orf1 and orf4 were found to encode a replication initiation protein (Rep) and a mobilization protein (Mob), respectively. The deduced products of orf2 and orf3 revealed no significant homology to other known proteins. However, in silico examination of the plasmid sequence supported the existence of a novel operon that includes rep, orf2 and orf3 in pLAC1 and that this operon is highly conserved also in plasmids pLB925A02, pSMA23, pLC88 and pC7. RT-PCR experiments allowed us to verify that these three genes are co-transcribed as a single polycistronic mRNA species. Furthermore, phylogenetic analysis of pLAC1 Rep and Mob proteins demonstrated that they may have derived from different plasmid origins, suggesting that pLAC1 is a product of a modular evolution process. Comparative analysis of full length nucleotide sequences of pLAC1 and related Lactobacillus plasmids showed that pLAC1 shares a very similar replication backbone with pLB925A02, pSMA23 and pLC88. In contrast, mob of pLAC1 was almost identical with the respective gene of plasmids pLAB1000, pLB4 and pPB1. These findings lead to the conclusion that pLAC1 acquired mob probably via an ancestral recombination event. Our overall work highlights the importance of characterizing plasmids deriving from non-starter 'wild' isolates in order to better appreciate plasmid divergence and evolution of lactic acid bacteria. 2010 Elsevier B.V. All rights reserved.
Lac repressor: Crystallization of intact tetramer and its complexes with inducer and operator DNA
International Nuclear Information System (INIS)
Pace, H.C.; Lu, P.; Lewis, M.
1990-01-01
The intact lac repressor tetramer, which regulates expression of the lac operon in Escherichia coli, has been crystallized in the native form, with an inducer, and in a ternary complex with operator DNA and an anti-inducer. The crystals without DNA diffract to better than 3.5 angstrom. They belong to the monoclinic space group C2 and have cell dimensions a = 164.7 angstrom, b = 75.6 angstrom, and c = 161.2 angstrom, with α = γ = 90 degree and β = 125.5 degree. Cocrystals have been obtained with a number of different lac operator-related DNA fragments. The complex with a blunt-ended 16-base-pair strand yielded tetragonal bipyramids that diffract to 6.5 angstrom. These protein-DNA cocrystals crack upon exposure to the gratuitous inducer isopropyl β-D-thiogalactoside, suggesting a conformational change in the repressor-operator complex
Detecting uber-operons in prokaryotic genomes.
Che, Dongsheng; Li, Guojun; Mao, Fenglou; Wu, Hongwei; Xu, Ying
2006-01-01
We present a study on computational identification of uber-operons in a prokaryotic genome, each of which represents a group of operons that are evolutionarily or functionally associated through operons in other (reference) genomes. Uber-operons represent a rich set of footprints of operon evolution, whose full utilization could lead to new and more powerful tools for elucidation of biological pathways and networks than what operons have provided, and a better understanding of prokaryotic genome structures and evolution. Our prediction algorithm predicts uber-operons through identifying groups of functionally or transcriptionally related operons, whose gene sets are conserved across the target and multiple reference genomes. Using this algorithm, we have predicted uber-operons for each of a group of 91 genomes, using the other 90 genomes as references. In particular, we predicted 158 uber-operons in Escherichia coli K12 covering 1830 genes, and found that many of the uber-operons correspond to parts of known regulons or biological pathways or are involved in highly related biological processes based on their Gene Ontology (GO) assignments. For some of the predicted uber-operons that are not parts of known regulons or pathways, our analyses indicate that their genes are highly likely to work together in the same biological processes, suggesting the possibility of new regulons and pathways. We believe that our uber-operon prediction provides a highly useful capability and a rich information source for elucidation of complex biological processes, such as pathways in microbes. All the prediction results are available at our Uber-Operon Database: http://csbl.bmb.uga.edu/uber, the first of its kind.
Induction of the mar operon by miscellaneous groceries.
Rickard, A H; Lindsay, S; Lockwood, G B; Gilbert, P
2004-01-01
To investigate the potential of non-antibacterial consumer products to act as inducers of the multiple antibiotic resistance (mar) operon of Escherichia coli SPC105. Wells were cut into chemically defined agar medium (CDM) contained within Petri dishes. Molten agar slurries were prepared by mixing known quantities of 35 consumer products with molten CDM and these were pipetted into each well. Plates were overlaid with molten CDM (5 ml), containing 40 microg ml(-1) X-gal and approx. 1000 CFU ml(-1) of an overnight culture of E. coli SPC105 containing a chromosomal marOII::lacZ fusion. After incubation (37 degrees C, 24 h), plates were examined for zones of growth inhibition and the presence of a blue coloration, indicative of mar (marOII::lacZ) induction. Of the 35 products tested (nine herbs and spices, 19 food and drinks and seven household products), 24 (69%) of the items produced inhibitory zones and 22 (63%) of the items induced mar expression. Apple puree was inhibitory but did not induce marOII::lacZ. Mustard, chilli and garlic were shown to be powerful inducers of marOII::lacZ. Overall six products were shown to be powerful marOII::lacZ inducers. None of these made hygiene claims. In addition to induction by specific biocides and antibiotics, mar is induced by the exposure of bacteria to natural substances, many of which are common to a domiciliary setting. Concern that the overuse of antibacterials within consumer products might select for mar-mediated resistance is shortsighted and fails to recognize the ubiquity of inducers in our environment.
Interplay of Noisy Gene Expression and Dynamics Explains Patterns of Bacterial Operon Organization
Igoshin, Oleg
2011-03-01
Bacterial chromosomes are organized into operons -- sets of genes co-transcribed into polycistronic messenger RNA. Hypotheses explaining the emergence and maintenance of operons include proportional co-regulation, horizontal transfer of intact ``selfish'' operons, emergence via gene duplication, and co-production of physically interacting proteins to speed their association. We hypothesized an alternative: operons can reduce or increase intrinsic gene expression noise in a manner dependent on the post-translational interactions, thereby resulting in selection for or against operons in depending on the network architecture. We devised five classes of two-gene network modules and show that the effects of operons on intrinsic noise depend on class membership. Two classes exhibit decreased noise with co-transcription, two others reveal increased noise, and the remaining one does not show a significant difference. To test our modeling predictions we employed bioinformatic analysis to determine the relationship gene expression noise and operon organization. The results confirm the overrepresentation of noise-minimizing operon architectures and provide evidence against other hypotheses. Our results thereby suggest a central role for gene expression noise in selecting for or maintaining operons in bacterial chromosomes. This demonstrates how post-translational network dynamics may provide selective pressure for organizing bacterial chromosomes, and has practical consequences for designing synthetic gene networks. This work is supported by National Institutes of Health grant 1R01GM096189-01.
Stochastic simulations of the tetracycline operon
2011-01-01
Background The tetracycline operon is a self-regulated system. It is found naturally in bacteria where it confers resistance to antibiotic tetracycline. Because of the performance of the molecular elements of the tetracycline operon, these elements are widely used as parts of synthetic gene networks where the protein production can be efficiently turned on and off in response to the presence or the absence of tetracycline. In this paper, we investigate the dynamics of the tetracycline operon. To this end, we develop a mathematical model guided by experimental findings. Our model consists of biochemical reactions that capture the biomolecular interactions of this intriguing system. Having in mind that small biological systems are subjects to stochasticity, we use a stochastic algorithm to simulate the tetracycline operon behavior. A sensitivity analysis of two critical parameters embodied this system is also performed providing a useful understanding of the function of this system. Results Simulations generate a timeline of biomolecular events that confer resistance to bacteria against tetracycline. We monitor the amounts of intracellular TetR2 and TetA proteins, the two important regulatory and resistance molecules, as a function of intrecellular tetracycline. We find that lack of one of the promoters of the tetracycline operon has no influence on the total behavior of this system inferring that this promoter is not essential for Escherichia coli. Sensitivity analysis with respect to the binding strength of tetracycline to repressor and of repressor to operators suggests that these two parameters play a predominant role in the behavior of the system. The results of the simulations agree well with experimental observations such as tight repression, fast gene expression, induction with tetracycline, and small intracellular TetR2 amounts. Conclusions Computer simulations of the tetracycline operon afford augmented insight into the interplay between its molecular
Stochastic simulations of the tetracycline operon
Directory of Open Access Journals (Sweden)
Kaznessis Yiannis N
2011-01-01
Full Text Available Abstract Background The tetracycline operon is a self-regulated system. It is found naturally in bacteria where it confers resistance to antibiotic tetracycline. Because of the performance of the molecular elements of the tetracycline operon, these elements are widely used as parts of synthetic gene networks where the protein production can be efficiently turned on and off in response to the presence or the absence of tetracycline. In this paper, we investigate the dynamics of the tetracycline operon. To this end, we develop a mathematical model guided by experimental findings. Our model consists of biochemical reactions that capture the biomolecular interactions of this intriguing system. Having in mind that small biological systems are subjects to stochasticity, we use a stochastic algorithm to simulate the tetracycline operon behavior. A sensitivity analysis of two critical parameters embodied this system is also performed providing a useful understanding of the function of this system. Results Simulations generate a timeline of biomolecular events that confer resistance to bacteria against tetracycline. We monitor the amounts of intracellular TetR2 and TetA proteins, the two important regulatory and resistance molecules, as a function of intrecellular tetracycline. We find that lack of one of the promoters of the tetracycline operon has no influence on the total behavior of this system inferring that this promoter is not essential for Escherichia coli. Sensitivity analysis with respect to the binding strength of tetracycline to repressor and of repressor to operators suggests that these two parameters play a predominant role in the behavior of the system. The results of the simulations agree well with experimental observations such as tight repression, fast gene expression, induction with tetracycline, and small intracellular TetR2 amounts. Conclusions Computer simulations of the tetracycline operon afford augmented insight into the
Transcriptome dynamics-based operon prediction in prokaryotes.
Fortino, Vittorio; Smolander, Olli-Pekka; Auvinen, Petri; Tagliaferri, Roberto; Greco, Dario
2014-05-16
Inferring operon maps is crucial to understanding the regulatory networks of prokaryotic genomes. Recently, RNA-seq based transcriptome studies revealed that in many bacterial species the operon structure vary with the change of environmental conditions. Therefore, new computational solutions that use both static and dynamic data are necessary to create condition specific operon predictions. In this work, we propose a novel classification method that integrates RNA-seq based transcriptome profiles with genomic sequence features to accurately identify the operons that are expressed under a measured condition. The classifiers are trained on a small set of confirmed operons and then used to classify the remaining gene pairs of the organism studied. Finally, by linking consecutive gene pairs classified as operons, our computational approach produces condition-dependent operon maps. We evaluated our approach on various RNA-seq expression profiles of the bacteria Haemophilus somni, Porphyromonas gingivalis, Escherichia coli and Salmonella enterica. Our results demonstrate that, using features depending on both transcriptome dynamics and genome sequence characteristics, we can identify operon pairs with high accuracy. Moreover, the combination of DNA sequence and expression data results in more accurate predictions than each one alone. We present a computational strategy for the comprehensive analysis of condition-dependent operon maps in prokaryotes. Our method can be used to generate condition specific operon maps of many bacterial organisms for which high-resolution transcriptome data is available.
DEFF Research Database (Denmark)
Hansen, L. H.; Sørensen, S. J.; Jensen, Lars Bogø
1997-01-01
A 12-kb PstI fragment including the entire E. coli lactose operon (lacIPOZYA) was inserted in one copy into the chromosome of Pseudomonas putida, Pseudomonas fluorescens and an E. coli strain with lac(-) phenotype. This was made possible by improvements of an already existing mini-Tn5 transposon...... flanked by NotI sites needed in the mini-Tn5 delivery system; (b) the generation of E. coli nonlysogenic strains expressing the pi protein thus being capable of maintaining and delivering R6K-based mini-Tn5 vectors to other E. coli strains; (c) the successful insertion of the E. coli lactose operon...... into the P. fluorescens chromosome giving P. fluorescens the ability to grow on lactose; (d) evidence from Southern blotting that contradicts the assumption that the mini-Tn5 delivery system always creates one-copy inserts. These improvements allow insertion of large DNA fragments encoding highly expressed...
DEFF Research Database (Denmark)
Brøndsted, Lone; Atlung, Tove
1996-01-01
The expression and transcriptional regulation of the Escherichia coli cyx-appA operon and the appY gene has been investigated during different environmental conditions using single copy transcriptional lacZ fusions. The cyx-appA operon encodes acid phosphatase and a putative cytochrome oxidase...... of the cyx-appA operon. The nitrate repression was partially dependent on NarL. A high expression of the operon was obtained in glucose medium supplemented with formate, where E.coli obtains energy by fermentation. The formate induction was independent of the fhlA gene product. The results presented...... in this paper indicate a clear difference in the regulation of the cyx-appA operon compared to the cyd operon, encoding the cytochrome d oxidase complex. The results suggest that cytochrome x oxidase has a function at even more oxygen limiting conditions than cytochrome d oxidase. The expression of the app...
Shimada, Tomohiro; Kori, Ayako; Ishihama, Akira
2013-07-01
Escherichia coli is able to utilize d-ribose as its sole carbon source. The genes for the transport and initial-step metabolism of d-ribose form a single rbsDACBK operon. RbsABC forms the ABC-type high-affinity d-ribose transporter, while RbsD and RbsK are involved in the conversion of d-ribose into d-ribose 5-phosphate. In the absence of inducer d-ribose, the ribose operon is repressed by a LacI-type transcription factor RbsR, which is encoded by a gene located downstream of this ribose operon. At present, the rbs operon is believed to be the only target of regulation by RbsR. After Genomic SELEX screening, however, we have identified that RbsR binds not only to the rbs promoter but also to the promoters of a set of genes involved in purine nucleotide metabolism. Northern blotting analysis indicated that RbsR represses the purHD operon for de novo synthesis of purine nucleotide but activates the add and udk genes involved in the salvage pathway of purine nucleotide synthesis. Taken together, we propose that RbsR is a global regulator for switch control between the de novo synthesis of purine nucleotides and its salvage pathway. © 2013 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved.
Deng, Ziqing; Shan, Yue; Pan, Qing; Gao, Xiang; Yan, Aixin
2013-01-01
The gadE-mdtEF operon encodes a central acid resistance regulator GadE and two multidrug efflux proteins MdtEF. Although transcriptional regulation of gadE in the context of acid resistance under the aerobic growth environment of Escherichia coli has been extensively studied, regulation of the operon under the physiologically relevant environment of anaerobic growth and its effect on the expression of the multidrug efflux proteins MdtEF in the operon has not been disclosed. Our previous study revealed that anaerobic induction of the operon was dependent on ArcA, the response regulator of the ArcBA two-component system, in the M9 glucose minimal medium. However, the detailed regulatory mechanism remains unknown. In this study, we showed that anaerobic activation of mdtEF was driven by the 798 bp unusually long gadE promoter. Deletion of evgA, ydeO, rpoS, and gadX which has been shown to activate the gadE expression during acid stresses under aerobic condition did not have a significant effect on the anaerobic activation of the operon. Rather, anaerobic activation of the operon was largely dependent on the global regulator ArcA and a GTPase MnmE. Under aerobic condition, transcription of gadE was repressed by the global DNA silencer H-NS in M9 minimal medium. Interestingly, under anaerobic condition, while ΔarcA almost completely abolished transcription of gadE-mdtEF, further deletion of hns in ΔarcA mutant restored the transcription of the full-length PgadE-lacZ, and P1- and P3-lacZ fusions, suggesting an antagonistic effect of ArcA on the H-NS mediated repression. Taken together, we conclude that the anaerobic activation of the gadE-mdtEF was primarily mediated by the two-component system ArcBA through antagonizing the H-NS mediated repression.
Stationary phase expression of the arginine biosynthetic operon argCBH in Escherichia coli
Directory of Open Access Journals (Sweden)
Sun Yuan
2006-02-01
Full Text Available Abstract Background Arginine biosynthesis in Escherichia coli is elevated in response to nutrient limitation, stress or arginine restriction. Though control of the pathway in response to arginine limitation is largely modulated by the ArgR repressor, other factors may be involved in increased stationary phase and stress expression. Results In this study, we report that expression of the argCBH operon is induced in stationary phase cultures and is reduced in strains possessing a mutation in rpoS, which encodes an alternative sigma factor. Using strains carrying defined argR, and rpoS mutations, we evaluated the relative contributions of these two regulators to the expression of argH using operon-lacZ fusions. While ArgR was the main factor responsible for modulating expression of argCBH, RpoS was also required for full expression of this biosynthetic operon at low arginine concentrations (below 60 μM L-arginine, a level at which growth of an arginine auxotroph was limited by arginine. When the argCBH operon was fully de-repressed (arginine limited, levels of expression were only one third of those observed in ΔargR mutants, indicating that the argCBH operon is partially repressed by ArgR even in the absence of arginine. In addition, argCBH expression was 30-fold higher in ΔargR mutants relative to levels found in wild type, fully-repressed strains, and this expression was independent of RpoS. Conclusion The results of this study indicate that both derepression and positive control by RpoS are required for full control of arginine biosynthesis in stationary phase cultures of E. coli.
Energy Technology Data Exchange (ETDEWEB)
Price, Morgan N.; Arkin, Adam P.; Alm, Eric J.
2005-11-18
Operons are a major feature of all prokaryotic genomes, but how and why operon structures vary is not well understood. To elucidate the life-cycle of operons, we compared gene order between Escherichia coli K12 and its relatives and identified the recently formed and destroyed operons in E. coli. This allowed us to determine how operons form, how they become closely spaced, and how they die. Our findings suggest that operon evolution is driven by selection on gene expression patterns. First, both operon creation and operon destruction lead to large changes in gene expression patterns. For example, the removal of lysA and ruvA from ancestral operons that contained essential genes allowed their expression to respond to lysine levels and DNA damage, respectively. Second, some operons have undergone accelerated evolution, with multiple new genes being added during a brief period. Third, although most operons are closely spaced because of a neutral bias towards deletion and because of selection against large overlaps, highly expressed operons tend to be widely spaced because of regulatory fine-tuning by intervening sequences. Although operon evolution seems to be adaptive, it need not be optimal: new operons often comprise functionally unrelated genes that were already in proximity before the operon formed.
A Quantitative bgl Operon Model for E. coli Requires BglF Conformational Change for Sugar Transport
Chopra, Paras; Bender, Andreas
The bgl operon is responsible for the metabolism of β-glucoside sugars such as salicin or arbutin in E. coli. Its regulatory system involves both positive and negative feedback mechanisms and it can be assumed to be more complex than that of the more closely studied lac and trp operons. We have developed a quantitative model for the regulation of the bgl operon which is subject to in silico experiments investigating its behavior under different hypothetical conditions. Upon administration of 5mM salicin as an inducer our model shows 80-fold induction, which compares well with the 60-fold induction measured experimentally. Under practical conditions 5-10mM inducer are employed, which is in line with the minimum inducer concentration of 1mM required by our model. The necessity of BglF conformational change for sugar transport has been hypothesized previously, and in line with those hypotheses our model shows only minor induction if conformational change is not allowed. Overall, this first quantitative model for the bgl operon gives reasonable predictions that are close to experimental results (where measured). It will be further refined as values of the parameters are determined experimentally. The model was developed in Systems Biology Markup Language (SBML) and it is available from the authors and from the Biomodels repository [www.ebi.ac.uk/biomodels].
Directory of Open Access Journals (Sweden)
Qinna Cui
Full Text Available Gene duplication often provides selective advantages for the survival of microorganisms in adapting to varying environmental conditions. P. aeruginosa PAO1 possesses two seven-gene operons [phz1 (phzA1B1C1D1E1F1G1 and phz2 (phzA2B2C2D2E2F2G2] that are involved in the biosynthesis of phenazine-1-carboxylic acid and its derivatives. Although the two operons are highly homologous and their functions are well known, it is unclear how the two phz operons coordinate their expressions to maintain the phenazine biosynthesis. By constructing single and double deletion mutants of the two phz operons, we found that the phz1-deletion mutant produced the same or less amount of phenazine-1-carboxylic acid and pyocyanin in GA medium than the phz2-knockout mutant while the phz1-phz2 double knockout mutant did not produce any phenazines. By generating phzA1 and phzA2 translational and transcriptional fusions with a truncated lacZ reporter, we found that the expression of the phz1 operon increased significantly at the post-transcriptional level and did not alter at the transcriptional level in the absence of the phz2 operon. Surprisingly, the expression the phz2 operon increased significantly at the post-transcriptional level and only moderately at the transcriptional level in the absence of the phz1 operon. Our findings suggested that a complex cross-regulation existed between the phz1 and phz2 operons. By mediating the upregulation of one phz operon expression while the other was deleted, this crosstalk would maintain the homeostatic balance of phenazine biosynthesis in P. aeruginosa PAO1.
Directory of Open Access Journals (Sweden)
Ziqing eDeng
2013-07-01
Full Text Available The gadE-mdtEF operon encodes a central acid resistance regulator GadE and two multidrug efflux proteins MdtEF. Although transcriptional regulation of gadE in the context of acid resistance under the aerobic growth environment of E. coli has been extensively studied, regulation of the operon under the physiologically relevant environment of anaerobic growth and its effect on the expression of the multidrug efflux proteins MdtEF has not been disclosed. Our previous study revealed that anaerobic induction of the operon was dependent on ArcA, the response regulator of the ArcBA two-component system, in the M9 glucose minimal medium. However, the detailed regulatory mechanism remains unknown. In this study, we showed that anaerobic activation of mdtEF was driven by the 798bp unusually long gadE promoter. Deletion of evgA, ydeO, rpoS, and gadX which has been shown to activate the gadE expression during acid stresses under aerobic condition did not have a significant effect on the anaerobic activation of the operon. Rather, anaerobic activation of the operon was largely dependent on the global regulator ArcA and a GTPase MnmE. Under aerobic condition, transcription of gadE was repressed by the global DNA silencer H-NS in M9 minimal medium. Interestingly, under anaerobic condition, while ΔarcA almost completely abolished transcription of gadE-mdtEF, further deletion of hns in ΔarcA mutant restored the transcription of the full length PgadE-lacZ, and P1- and P3-lacZ fusions, suggesting an antagonistic effect of ArcA on the H-NS mediated repression. Taken together, we conclude that the anaerobic activation of the gadE-mdtEF was primarily mediated by the two-component system ArcBA through antagonizing the H-NS mediated repression.
Energy Technology Data Exchange (ETDEWEB)
Price, Morgan N.; Arkin, Adam P.; Alm, Eric J.
2007-03-15
Operons are a major feature of all prokaryotic genomes, buthow and why operon structures vary is not well understood. To elucidatethe life-cycle of operons, we compared gene order between Escherichiacoli K12 and its relatives and identified the recently formed anddestroyed operons in E. coli. This allowed us to determine how operonsform, how they become closely spaced, and how they die. Our findingssuggest that operon evolution may be driven by selection on geneexpression patterns. First, both operon creation and operon destructionlead to large changes in gene expression patterns. For example, theremoval of lysA and ruvA from ancestral operons that contained essentialgenes allowed their expression to respond to lysine levels and DNAdamage, respectively. Second, some operons have undergone acceleratedevolution, with multiple new genes being added during a brief period.Third, although genes within operons are usually closely spaced becauseof a neutral bias toward deletion and because of selection against largeoverlaps, genes in highly expressed operons tend to be widely spacedbecause of regulatory fine-tuning by intervening sequences. Althoughoperon evolution may be adaptive, it need not be optimal: new operonsoften comprise functionally unrelated genes that were already inproximity before the operon formed.
Fitness Effects of Network Non-Linearity Induced by Gene Expression Noise
Ray, Christian; Cooper, Tim; Balazsi, Gabor
2012-02-01
In the non-equilibrium dynamics of growing microbial cells, metabolic enzymes can create non-linearities in metabolite concentration because of non-linear degradation (utilization): an enzyme can saturate in the process of metabolite utilization. Increasing metabolite production past the saturation point then results in an ultrasensitive metabolite response. If the production rate of a metabolite depends on a second enzyme or other protein-mediated process, uncorrelated gene expression noise can thus cause transient metabolite concentration bursts. Such bursts are physiologically unnecessary and may represent a source of selection against the ultrasensitive switch, especially if the fluctuating metabolic intermediate is toxic. Selection may therefore favor correlated gene expression fluctuations for enzymes in the same pathway, such as by same-operon membership in bacteria. Using a modified experimental lac operon system, we are undertaking a combined theoretical-experimental approach to demonstrate that (i) the lac operon has an implicit ultrasensitive switch that we predict is avoided by gene expression correlations induced by same-operon membership; (ii) bacterial growth rates are sensitive to crossing the ultrasensitive threshold. Our results suggest that correlations in intrinsic gene expression noise are exploited by evolution to ameliorate the detrimental effects of nonlinearities in metabolite concentrations.
Habib, Cameron; Yu, Yiyang; Gozzi, Kevin; Ching, Carly; Shemesh, Moshe
2017-01-01
The soil bacterium Bacillus subtilis is often found in association with plants in the rhizosphere. Previously, plant polysaccharides have been shown to stimulate formation of root-associated multicellular communities, or biofilms, in this bacterium, yet the underlying mechanism is not fully understood. A five-gene gan operon (ganSPQAB) in B. subtilis has recently been shown to be involved in utilization of the plant-derived polysaccharide galactan. Despite these findings, molecular details about the regulation of the operon and the role of the operon in biofilm formation remain elusive. In this study, we performed comprehensive genetic analyses on the regulation of the gan operon. We show that this operon is regulated both by a LacI-like transcription repressor (GanR), which directly binds to pairs of inverted DNA repeats in the promoter region of the operon, and by the catabolite control protein A (CcpA). Derepression can be triggered by the presence of the inducer β-1,4-galactobiose, a hydrolysis product of galactan, or in situ when B. subtilis cells are associated with plant roots. In addition to the transcriptional regulation, the encoded ß-galactosidase GanA (by ganA), which hydrolyzes ß-1,4-galactobiose into galactose, is inhibited at the enzymatic level by the catalytic product galactose. Thus, the galactan utilization pathway is under complex regulation involving both positive and negative feedback mechanisms in B. subtilis. We discuss about the biological significance of such complex regulation as well as a hypothesis of biofilm induction by galactan via multiple mechanisms. PMID:28617843
Habib, Cameron; Yu, Yiyang; Gozzi, Kevin; Ching, Carly; Shemesh, Moshe; Chai, Yunrong
2017-01-01
The soil bacterium Bacillus subtilis is often found in association with plants in the rhizosphere. Previously, plant polysaccharides have been shown to stimulate formation of root-associated multicellular communities, or biofilms, in this bacterium, yet the underlying mechanism is not fully understood. A five-gene gan operon (ganSPQAB) in B. subtilis has recently been shown to be involved in utilization of the plant-derived polysaccharide galactan. Despite these findings, molecular details about the regulation of the operon and the role of the operon in biofilm formation remain elusive. In this study, we performed comprehensive genetic analyses on the regulation of the gan operon. We show that this operon is regulated both by a LacI-like transcription repressor (GanR), which directly binds to pairs of inverted DNA repeats in the promoter region of the operon, and by the catabolite control protein A (CcpA). Derepression can be triggered by the presence of the inducer β-1,4-galactobiose, a hydrolysis product of galactan, or in situ when B. subtilis cells are associated with plant roots. In addition to the transcriptional regulation, the encoded ß-galactosidase GanA (by ganA), which hydrolyzes ß-1,4-galactobiose into galactose, is inhibited at the enzymatic level by the catalytic product galactose. Thus, the galactan utilization pathway is under complex regulation involving both positive and negative feedback mechanisms in B. subtilis. We discuss about the biological significance of such complex regulation as well as a hypothesis of biofilm induction by galactan via multiple mechanisms.
DEFF Research Database (Denmark)
Hilden, Ida; Krath, Britta N.; Hove-Jensen, Bjarne
1995-01-01
The gcaD, prs, and ctc genes were shown to be organized as a tricistronic operon. The transcription of the prs gene, measured as phosphoribosyl diphosphate synthetase activity, and of the ctc gene, measured as β-galactosidase activity specified by a ctc-lacZ protein fusion, were dependent...
Evidence against the selfish operon theory.
Pál, Csaba; Hurst, Laurence D
2004-06-01
According to the selfish operon hypothesis, the clustering of genes and their subsequent organization into operons is beneficial for the constituent genes because it enables the horizontal gene transfer of weakly selected, functionally coupled genes. The majority of these are expected to be non-essential genes. From our analysis of the Escherichia coli genome, we conclude that the selfish operon hypothesis is unlikely to provide a general explanation for clustering nor can it account for the gene composition of operons. Contrary to expectations, essential genes with related functions have an especially strong tendency to cluster, even if they are not in operons. Moreover, essential genes are particularly abundant in operons.
Stochasticity or the fatal 'imperfection' of cloning
Indian Academy of Sciences (India)
Unknown
duced by a cell is the result of the integration of small quantal events (McAdams ... city in the case of de-repression of the lac operon has recently been .... Changes in the medium ..... eukaryotic gene networks: cell differentiation by graded to.
Teather, R M; Bramhall, J; Riede, I; Wright, J K; Fürst, M; Aichele, G; Wilhelm, U; Overath, P
1980-01-01
The previously described hybrid plasmid pC7 which carries lacI+O+delta(Z)Y+A+ on a 12.3 X 10(6)-Mr DNA fragment [Teather et al. (1978) Mol. Gen. Genet. 159, 239-248] was partially digested with the restriction endonuclease EcoRI under conditions reducing the recognition sequence to d(A-A-T-T) and ligated to the vector pB322. lac Y-carrying inserts of various sized (Mr 1.5-4.7 X 10(6)) were obtained. Hybrid plasmid pTE18 (2300-base-pair insert) carries part of the I (repressor) gene, the promotor-operator region, part of the Z (beta-galactosidase) gene, the Y (lactose carrier) gene and part of the A (transacetylase) gene. Upon induction of pTE18-harbouring strains the Y-gene product is expressed at a nearly constant rate for several generations and accumulates to a level of 12-16% of the total cytoplasmic membrane protein. Integration into the membrane leads to active carrier as judged by binding and transport measurements.
REMap: Operon Map of M. tuberculosis
Xia, Fang Fang; Stevens, Rick L.; Bishai, William R.; Lamichhane, Gyanu
2016-01-01
A map of the transcriptional organization of genes of an organism is a basic tool that is necessary to understand and facilitate a more accurate genetic manipulation of the organism. Operon maps are largely generated by computational prediction programs that rely on gene conservation and genome architecture and may not be physiologically relevant. With the widespread use of RNA sequencing (RNAseq), the prediction of operons based on actual transcriptome sequencing rather than computational genomics alone is much needed. Here, we report a validated operon map of Mycobacterium tuberculosis, developed using RNAseq data from both the exponential and stationary phases of growth. At least 58.4% of M. tuberculosis genes are organized into 749 operons. Our prediction algorithm, REMap (RNA Expression Mapping of operons), considers the many cases of transcription coverage of intergenic regions, and avoids dependencies on functional annotation and arbitrary assumptions about gene structure. As a result, we demonstrate that REMap is able to more accurately predict operons, especially those that contain long intergenic regions or functionally unrelated genes, than previous operon prediction programs. The REMap algorithm is publicly available as a user-friendly tool that can be readily modified to predict operons in other bacteria. PMID:27450008
ProOpDB: Prokaryotic Operon DataBase.
Taboada, Blanca; Ciria, Ricardo; Martinez-Guerrero, Cristian E; Merino, Enrique
2012-01-01
The Prokaryotic Operon DataBase (ProOpDB, http://operons.ibt.unam.mx/OperonPredictor) constitutes one of the most precise and complete repositories of operon predictions now available. Using our novel and highly accurate operon identification algorithm, we have predicted the operon structures of more than 1200 prokaryotic genomes. ProOpDB offers diverse alternatives by which a set of operon predictions can be retrieved including: (i) organism name, (ii) metabolic pathways, as defined by the KEGG database, (iii) gene orthology, as defined by the COG database, (iv) conserved protein domains, as defined by the Pfam database, (v) reference gene and (vi) reference operon, among others. In order to limit the operon output to non-redundant organisms, ProOpDB offers an efficient method to select the most representative organisms based on a precompiled phylogenetic distances matrix. In addition, the ProOpDB operon predictions are used directly as the input data of our Gene Context Tool to visualize their genomic context and retrieve the sequence of their corresponding 5' regulatory regions, as well as the nucleotide or amino acid sequences of their genes.
The relative value of operon predictions
Brouwer, Rutger W. W.; Kuipers, Oscar P.; van Hijum, Sacha A. F. T.
For most organisms, computational operon predictions are the only source of genome-wide operon information. Operon prediction methods described in literature are based on (a combination of) the following five criteria: (i) intergenic distance, (ii) conserved gene clusters, (iii) functional relation,
Directory of Open Access Journals (Sweden)
Altenbuchner Josef
2011-10-01
Full Text Available Abstract Background Several vector systems have been developed to express any gene desired to be studied in Bacillus subtilis. Among them, the transcriptionally regulated promoters involved in carbohydrate utilization are a research priority. Expression systems based on Bacillus promoters for xylose, maltose, and mannose utilization, as well as on the heterologous E. coli lactose promoter, have been successfully constructed. The promoter of the mtlAFD operon for utilization of mannitol is another promising candidate for its use in expression vectors. In this study, we investigated the regulation of the mtl genes in order to identify the elements needed to construct a strong mannitol inducible expression system in B. subtilis. Results Regulation of the promoters of mtlAFD operon (PmtlA and mtlR (PmtlR encoding the activator were investigated by fusion to lacZ. Identification of the PmtlA and PmtlR transcription start sites revealed the σA like promoter structures. Also, the operator of PmtlA was determined by shortening, nucleotide exchange, and alignment of PmtlA and PmtlR operator regions. Deletion of the mannitol-specific PTS genes (mtlAF resulted in PmtlA constitutive expression demonstrating the inhibitory effect of EIICBMtl and EIIAMtl on MtlR in the absence of mannitol. Disruption of mtlD made the cells sensitive to mannitol and glucitol. Both PmtlA and PmtlR were influenced by carbon catabolite repression (CCR. However, a CcpA deficient mutant showed only a slight reduction in PmtlR catabolite repression. Similarly, using PgroE as a constitutive promoter, putative cre sites of PmtlA and PmtlR slightly reduced the promoter activity in the presence of glucose. In contrast, glucose repression of PmtlA and PmtlR was completely abolished in a ΔptsG mutant and significantly reduced in a MtlR (H342D mutant. Conclusions The mtl operon promoter (PmtlA is a strong promoter that reached a maximum of 13,000 Miller units with lacZ as a reporter on
International Nuclear Information System (INIS)
Nohmi, Takehiko; Hakura, Atsushi; Watanabe, Masahiko; Yamada, Masami; Sofuni, Toshio; Nakai, Yasuharu; Murayama, Somay Y.
1993-01-01
Salmonella typhimurium, especially its derivatives containing pKM101 plasmid, has been widely used in the Ames test for the detection of environmental mutagens and carcinogens. It is known, however, that if the pKM101 plasmid is eliminated, S. typhimurium itself shows a much weaker mutagenic response to UV and some chemical mutagens than does Escherichia coli. In fact, certain potent base-change type mutagens, such as furylfuramide and aflatoxin B 1 , are nonmutagenic to S. typhimurium in the absence of pKM101, whereas they are strongly mutagenic to S. typhimurium in the presence of pKM101 plasmid as well as to E. coli. The low mutability can be restored to levels comparable to E. coli by introducing the plasmid carrying the E. coli umuDC operon or the pKM101 plasmid carrying mucAB operon. Salmonella typhimurium has an SOS regulatory system which resembles that of E. coli. Thus, it was suggested that S. typhimurium is deficient in the function of umuDC operon, which plays an essential role in UV and most chemical mutagenesis in E. coli. In order to clarify the implications of umuDC genes in mutagenesis and antimutagenesis in typhimurium, we have independently screened the umuDC-like genes of S. typhimurium TA1538. Consequently, we have cloned another umuDC-like operon which is 40% diverged from the aforementioned umuDC operon of S. typhimurium LT2 at the nucleotide level (16). We have termed the cloned DNA the samAB (Salmonella; mutagenesis) operon, and tentatively referred to the umuDC operon cloned from S. typhimurium LT2 (27,31) as the umuDC ST operon. Based on the results of the Southern hybridization experiment, we concluded that the two sets of umuDC-like operons reside in the same cells of S. typhimurium LT2 and TA1538. Our results also suggested that the umuDC ST operon reduces the UV-mutagenesis promoting ability of the samAB operon when the two operons are present on the same multi-copy number plasmid
Hirooka, Kazutake; Kodoi, Yusuke; Satomura, Takenori; Fujita, Yasutaro
2015-12-28
The Bacillus subtilis rhaEWRBMA (formerly yuxG-yulBCDE) operon consists of four genes encoding enzymes for l-rhamnose catabolism and the rhaR gene encoding a DeoR-type transcriptional regulator. DNase I footprinting analysis showed that the RhaR protein specifically binds to the regulatory region upstream of the rhaEW gene, in which two imperfect direct repeats are included. Gel retardation analysis revealed that the direct repeat farther upstream is essential for the high-affinity binding of RhaR and that the DNA binding of RhaR was effectively inhibited by L-rhamnulose-1-phosphate, an intermediate of L-rhamnose catabolism. Moreover, it was demonstrated that the CcpA/P-Ser-HPr complex, primarily governing the carbon catabolite control in B. subtilis, binds to the catabolite-responsive element, which overlaps the RhaR binding site. In vivo analysis of the rhaEW promoter-lacZ fusion in the background of ccpA deletion showed that the L-rhamnose-responsive induction of the rhaEW promoter was negated by the disruption of rhaA or rhaB but not rhaEW or rhaM, whereas rhaR disruption resulted in constitutive rhaEW promoter activity. These in vitro and in vivo results clearly indicate that RhaR represses the operon by binding to the operator site, which is detached by L-rhamnulose-1-phosphate formed from L-rhamnose through a sequence of isomerization by RhaA and phosphorylation by RhaB, leading to the derepression of the operon. In addition, the lacZ reporter analysis using the strains with or without the ccpA deletion under the background of rhaR disruption supported the involvement of CcpA in the carbon catabolite repression of the operon. Since L-rhamnose is a component of various plant-derived compounds, it is a potential carbon source for plant-associating bacteria. Moreover, it is suggested that L-rhamnose catabolism plays a significant role in some bacteria-plant interactions, e.g., invasion of plant pathogens and nodulation of rhizobia. Despite the physiological
Problem-Solving Test: Tryptophan Operon Mutants
Szeberenyi, Jozsef
2010-01-01
This paper presents a problem-solving test that deals with the regulation of the "trp" operon of "Escherichia coli." Two mutants of this operon are described: in mutant A, the operator region of the operon carries a point mutation so that it is unable to carry out its function; mutant B expresses a "trp" repressor protein unable to bind…
DEFF Research Database (Denmark)
Andreassen, Patrick Rosendahl; Fredberg, Sofie; Horan, Mattias
2014-01-01
The lac promoter is one of the most commonly used promoters for expression control of recombinant genes in E. coli. In the absence of galactosides, the lac promoter is repressed by its repressor protein LacI. Since the lac promoter is regulated by a repressor, overexpression of LacI is necessary...
2012-01-01
Background Mangotoxin is an antimetabolite toxin that is produced by strains of Pseudomonas syringae pv. syringae; mangotoxin-producing strains are primarily isolated from mango tissues with symptoms of bacterial apical necrosis. The toxin is an oligopeptide that inhibits ornithine N-acetyl transferase (OAT), a key enzyme in the biosynthetic pathway of the essential amino acids ornithine and arginine. The involvement of a putative nonribosomal peptide synthetase gene (mgoA) in mangotoxin production and virulence has been reported. Results In the present study, we performed a RT-PCR analysis, insertional inactivation mutagenesis, a promoter expression analysis and terminator localisation to study the gene cluster containing the mgoA gene. Additionally, we evaluated the importance of mgoC, mgoA and mgoD in mangotoxin production. A sequence analysis revealed an operon-like organisation. A promoter sequence was located upstream of the mgoB gene and was found to drive lacZ transcription. Two terminators were located downstream of the mgoD gene. RT-PCR experiments indicated that the four genes (mgoBCAD) constitute a transcriptional unit. This operon is similar in genetic organisation to those in the three other P. syringae pathovars for which complete genomes are available (P. syringae pv. syringae B728a, P. syringae pv. tomato DC3000 and P. syringae pv. phaseolicola 1448A). Interestingly, none of these three reference strains is capable of producing mangotoxin. Additionally, extract complementation resulted in a recovery of mangotoxin production when the defective mutant was complemented with wild-type extracts. Conclusions The results of this study confirm that mgoB, mgoC, mgoA and mgoD function as a transcriptional unit and operon. While this operon is composed of four genes, only the last three are directly involved in mangotoxin production. PMID:22251433
International Nuclear Information System (INIS)
Wolfe, A.M.; Pittsburgh, University, Pittsburgh, Pa.)
1980-01-01
The properties of BL Lacertae objects are examined in light of their recently realized similarities to quasars and associations with galactic radiation. The criteria typically used to define BL Lac objects are analyzed, with attention given to radio spectra, optical continual, radio and optical variability, optical polarization and emission lines, and evidence that BL Lac objects and optically violent variables represent the most compact and strongly variable sources among the general class of quasars is discussed. Connections between BL Lac objects and the galaxies in which they have been observed to be embedded are discussed and it is pointed out that no low-luminosity quasars have been found to be associated with first-ranked giant ellipticals. Future observations which may clarify the properties and relationships of BL Lac objects are indicated
Directory of Open Access Journals (Sweden)
Hiraku Takada
Full Text Available Escherichia coli contains seven rRNA operons, each consisting of the genes for three rRNAs (16S, 23S and 5S rRNA in this order and one or two tRNA genes in the spacer between 16S and 23S rRNA genes and one or two tRNA genes in the 3' proximal region. All of these rRNA and tRNA genes are transcribed from two promoters, P1 and P2, into single large precursors that are afterward processed to individual rRNAs and tRNAs by a set of RNases. In the course of Genomic SELEX screening of promoters recognized by RNA polymerase (RNAP holoenzyme containing RpoD sigma, a strong binding site was identified within 16S rRNA gene in each of all seven rRNA operons. The binding in vitro of RNAP RpoD holoenzyme to an internal promoter, referred to the promoter of riRNA (an internal RNA of the rRNA operon, within each 16S rRNA gene was confirmed by gel shift assay and AFM observation. Using this riRNA promoter within the rrnD operon as a representative, transcription in vitro was detected with use of the purified RpoD holoenzyme, confirming the presence of a constitutive promoter in this region. LacZ reporter assay indicated that this riRNA promoter is functional in vivo. The location of riRNA promoter in vivo as identified using a set of reporter plasmids agrees well with that identified in vitro. Based on transcription profile in vitro and Northern blot analysis in vivo, the majority of transcript initiated from this riRNA promoter was estimated to terminate near the beginning of 23S rRNA gene, indicating that riRNA leads to produce the spacer-coded tRNA. Under starved conditions, transcription of the rRNA operon is markedly repressed to reduce the intracellular level of ribosomes, but the levels of both riRNA and its processed tRNAGlu stayed unaffected, implying that riRNA plays a role in the continued steady-state synthesis of tRNAs from the spacers of rRNA operons. We then propose that the tRNA genes organized within the spacers of rRNA-tRNA composite operons
The Discovery of Low-Luminosity BL Lacs
Rector, Travis A.; Stocke, John T.
1995-12-01
Many of the properties of BL Lacs have become explicable in terms of the ``relativistic beaming'' hypothesis whereby BL Lacs are ``highly beamed'' FR-I radio galaxies (i.e. our line of sight to these objects is nearly along the jet axis). Further, radio-selected BL Lacs (RBLs) are believed to be seen nearly ``on-axis'' (the line-of-sight angle theta ~ 8deg ) while X-ray selected BL Lacs (XBLs) are seen at larger angles (theta ~ 30deg ; the X-ray emitting jet is believed to be less collimated). However, a major problem with this model was that a transition population between beamed BL Lacs and unbeamed FR-Is had not been detected. Low-luminosity BL Lacs may be such a transition population, and were predicted to exist by Browne and Marcha (1993). We present ROSAT HRI images, VLA radio maps and optical spectra which confirm the existence of low-luminosity BL Lacs, objects which were previously mis-identified in the EMSS catalog as clusters of galaxies. Thus our results strengthen the relativistic beaming hypothesis.
African Journals Online (AJOL)
Saad
F.S.T. Fès - Sais, Université Sidi Mohammed Abdallah Fès, B.P. 2202, Maroc. 2Laboratoire des ... d'étude en complément de la composition phytoplanctonique et des analyses de la physico-chimie des eaux à l'entrée, au ... L'analyse des paramètres physico-chimiques, au point central du lac, a montré que l'eau du lac.
Gyorfy, Zsuzsanna; Draskovits, Gabor; Vernyik, Viktor; Blattner, Frederick F.; Gaal, Tamas; Posfai, Gyorgy
2015-01-01
Ribosomal RNA (rrn) operons, characteristically present in several copies in bacterial genomes (7 in E. coli), play a central role in cellular physiology. We investigated the factors determining the optimal number of rrn operons in E. coli by constructing isogenic variants with 5–10 operons. We found that the total RNA and protein content, as well as the size of the cells reflected the number of rrn operons. While growth parameters showed only minor differences, competition experiments revealed a clear pattern: 7–8 copies were optimal under conditions of fluctuating, occasionally rich nutrient influx and lower numbers were favored in stable, nutrient-limited environments. We found that the advantages of quick adjustment to nutrient availability, rapid growth and economic regulation of ribosome number all contribute to the selection of the optimal rrn operon number. Our results suggest that the wt rrn operon number of E. coli reflects the natural, ‘feast and famine’ life-style of the bacterium, however, different copy numbers might be beneficial under different environmental conditions. Understanding the impact of the copy number of rrn operons on the fitness of the cell is an important step towards the creation of functional and robust genomes, the ultimate goal of synthetic biology. PMID:25618851
Metazoan operons accelerate recovery from growth arrested states
Zaslaver, Alon; Baugh, L. Ryan; Sternberg, Paul W.
2011-01-01
Summary Existing theories explain why operons are advantageous in prokaryotes, but their occurrence in metazoans is an enigma. Nematode operon genes, typically consisting of growth genes, are significantly up-regulated during recovery from growth-arrested states. This expression pattern is anti-correlated to non-operon genes consistent with a competition for transcriptional resources. We find that transcriptional resources are initially limiting during recovery, and that recovering animals are highly sensitive to any additional decrease in transcriptional resources. Operons become advantageous because by clustering growth genes into operons, fewer promoters compete for the limited transcriptional machinery, effectively increasing the concentration of transcriptional resources, and accelerating recovery. Mathematical modeling reveals how a moderate increase in transcriptional resources can substantially enhance transcription rate and recovery. This design principle occurs in different nematodes and the chordate C. intestinalis. As transition from arrest to rapid growth is shared by many metazoans, operons could have evolved to facilitate these processes. PMID:21663799
Transcriptional and post-transcriptional regulation of pst2 operon expression in Vibrio cholerae O1.
da C Leite, Daniel M; Barbosa, Livia C; Mantuano, Nathalia; Goulart, Carolina L; Veríssimo da Costa, Giovani C; Bisch, Paulo M; von Krüger, Wanda M A
2017-07-01
One of the most abundant proteins in V. cholerae O1 cells grown under inorganic phosphate (Pi) limitation is PstS, the periplasmic Pi-binding component of the high-affinity Pi transport system Pst2 (PstSCAB), encoded in pst2 operon (pstS-pstC2-pstA2-pstB2). Besides its role in Pi uptake, Pst2 has been also associated with V. cholerae virulence. However, the mechanisms regulating pst2 expression and the non-stoichiometric production of the Pst2 components under Pi-limitation are unknown. A computational-experimental approach was used to elucidate the regulatory mechanisms behind pst2 expression in V. cholerae O1. Bioinformatics analysis of pst2 operon nucleotide sequence revealed start codons for pstS and pstC genes distinct from those originally annotated, a regulatory region upstream pstS containing potential PhoB-binding sites and a pstS-pstC intergenic region longer than predicted. Analysis of nucleotide sequence between pstS-pstC revealed inverted repeats able to form stem-loop structures followed by a potential RNAse E-cleavage site. Another putative RNase E recognition site was identified within the pstA-pstB intergenic sequence. In silico predictions of pst2 operon expression regulation were subsequently tested using cells grown under Pi limitation by promoter-lacZ fusion, gel electrophoresis mobility shift assay and quantitative RT-PCR. The experimental and in silico results matched very well and led us to propose a pst2 promoter sequence upstream of pstS gene distinct from the previously annotated. Furthermore, V. cholerae O1 pst2 operon transcription is PhoB-dependent and generates a polycistronic mRNA molecule that is rapidly processed into minor transcripts of distinct stabilities. The most stable was the pstS-encoding mRNA, which correlates with PstS higher levels relative to other Pst2 components in Pi-starved cells. The relatively higher stability of pstS and pstB transcripts seems to rely on the secondary structures at their 3' untranslated regions
Directory of Open Access Journals (Sweden)
Chin M. Lee
2017-09-01
Full Text Available Gas vesicles (GVs are proteinaceous, gas-filled organelles used by some bacteria to enable upward movement into favorable air/liquid interfaces in aquatic environments. Serratia sp. ATCC39006 (S39006 was the first enterobacterium discovered to produce GVs naturally. The regulation of GV assembly in this host is complex and part of a wider regulatory network affecting various phenotypes, including antibiotic biosynthesis. To identify new regulators of GVs, a comprehensive mutant library containing 71,000 insertion mutants was generated by random transposon mutagenesis and 311 putative GV-defective mutants identified. Three of these mutants were found to have a transposon inserted in a LacI family transcription regulator gene (rbsR of the putative ribose operon. Each of these rbsR mutants was GV-defective; no GVs were visible by phase contrast microscopy (PCM or transmission electron microscopy (TEM. GV deficiency was caused by the reduction of gvpA1 and gvrA transcription (the first genes of the two contiguous operons in the GV gene locus. Our results also showed that a mutation in rbsR was highly pleiotropic; the production of two secondary metabolites (carbapenem and prodigiosin antibiotics was abolished. Interestingly, the intrinsic resistance to the carbapenem antibiotic was not affected by the rbsR mutation. In addition, the production of a siderophore, cellulase and plant virulence was reduced in the mutant, whereas it exhibited increased swimming and swarming motility. The RbsR protein was predicted to bind to regions upstream of at least 18 genes in S39006 including rbsD (the first gene of the ribose operon and gvrA. Electrophoretic mobility shift assays (EMSA confirmed that RbsR bound to DNA sequences upstream of rbsD, but not gvrA. The results of this study indicate that RbsR is a global regulator that affects the modulation of GV biogenesis, but also with complex pleiotropic physiological impacts in S39006.
Overexpression of Enterococcus faecalis elr operon protects from phagocytosis.
Cortes-Perez, Naima G; Dumoulin, Romain; Gaubert, Stéphane; Lacoux, Caroline; Bugli, Francesca; Martin, Rebeca; Chat, Sophie; Piquand, Kevin; Meylheuc, Thierry; Langella, Philippe; Sanguinetti, Maurizio; Posteraro, Brunella; Rigottier-Gois, Lionel; Serror, Pascale
2015-05-25
Mechanisms underlying the transition from commensalism to virulence in Enterococcus faecalis are not fully understood. We previously identified the enterococcal leucine-rich protein A (ElrA) as a virulence factor of E. faecalis. The elrA gene is part of an operon that comprises four other ORFs encoding putative surface proteins of unknown function. In this work, we compared the susceptibility to phagocytosis of three E. faecalis strains, including a wild-type (WT), a ΔelrA strain, and a strain overexpressing the whole elr operon in order to understand the role of this operon in E. faecalis virulence. While both WT and ΔelrA strains were efficiently phagocytized by RAW 264.7 mouse macrophages, the elr operon-overexpressing strain showed a decreased capability to be internalized by the phagocytic cells. Consistently, the strain overexpressing elr operon was less adherent to macrophages than the WT strain, suggesting that overexpression of the elr operon could confer E. faecalis with additional anti-adhesion properties. In addition, increased virulence of the elr operon-overexpressing strain was shown in a mouse peritonitis model. Altogether, our results indicate that overexpression of the elr operon facilitates the E. faecalis escape from host immune defenses.
Singh, Pratibha; Katoch, V M; Mohanty, K K; Chauhan, Devendra Singh
2016-04-01
Mycobacterium tuberculosis (M. tuberculosis) has four homologous mammalian cell entry (mce) operons (mce1-4) that encode exported proteins and have a possible role in the virulence mechanism of this pathogen. The expression of mce operon is considered to be complex and not completely understood. Although expression of mce operon at different in vitro growth phases has been studied earlier, its expression in different M. tuberculosis isolates under different growth phases is not yet studied. The present preliminary study was conducted on a limited number of isolates to know the trend of expression pattern of mce operon genes in different M. tuberculosis isolates under different growth stages. In this study, we monitored the transcriptional profile of selected mce operon genes (mce1A, mce1D, mce2A, mce2D, mce3A, mce3C) in different M.tuberculosis isolates (MDR1, MDR2, and sensitive isolate) at early exponential and stationary phases using real-time quantitative PCR. The expression ratio of all selected mce operon genes in all M. tuberculosis isolates was reduced at the initial phase and increased substantially at a later phase of growth. Higher expression of mce1 operon genes was found in all M. tuberculosis isolates as compared to other mce operon genes (mce2 and mce3 operons) at stationary growth phase. the higher expression of mce operon genes at stationary phase (as compared to early exponential phase) suggested growth phase dependent expression of mce operon genes. This indicated that the mce operon genes might have a role in M. tuberculosis survival and adaptation on the onset of adverse condition like stationary phase. Identification of differentially expressed genes will add to our understanding of the bacilli involved in adaptation to different growth conditions.
Indian Americans at Mille Lacs.
Holbert, Victoria L.; And Others
The Training Center for Community Programs prepared a report on the Mille Lacs (Chippewa) Reservation in Minnesota. Data for the report were from 2 separate sources: a survey conducted by the Training Center with the assistance of the Mille Lacs community action program (1967) and an attitudinal survey conducted by Victoria Holbert during 1969.…
In vivo expression of the lacY gene in two segments leads to functional lac permease
International Nuclear Information System (INIS)
Bibi, E.; Kaback, H.R.
1990-01-01
The lacY gene of Escherichia coli was cut into two approximately equal-size fragments with Afl II and subcloned individually or together under separate lac operator/promoters in plasmid pT7-5. Under these conditions, lac permease is expressed in two portions: (i) the N-terminal portion (the N terminus, the first six putative transmembrane helices, and most of putative loop 7) and (ii) the C-terminal portion (the last six putative transmembrane helices and the C terminus). Cells harboring pT7-5 encoding both fragments transport lactose at about 30% the rate of cells expressing intact permease to a comparable steady-state level of accumulation. In contrast, cells expressing either half of the permease independently do not transport lactose. As judged by [ 35 S]methionine labeling and immunoblotting, intact permease in completely absent from the membrane of cells expressing lacY fragments either individually or together. Thus, transport activity must result from an association between independently synthesized pieces of lac permease. When the gene fragments are expressed individually, the N-terminal portion of the permease is observed inconsistently, and the C-terminal portion is not observed. When the gene fragments are expressed together, polypeptides identified as the N- and C-terminal moieties of the permease are found in the membrane. It is concluded that the N- or C-terminal halves of lac permease are proteolyzed when synthesized independently and that association between the two complementing polypeptides leads to a more stable, catalytically active complex
A modified consumer inkjet for spatiotemporal control of gene expression.
Directory of Open Access Journals (Sweden)
Daniel J Cohen
Full Text Available This paper presents a low-cost inkjet dosing system capable of continuous, two-dimensional spatiotemporal regulation of gene expression via delivery of diffusible regulators to a custom-mounted gel culture of E. coli. A consumer-grade, inkjet printer was adapted for chemical printing; E. coli cultures were grown on 750 microm thick agar embedded in micro-wells machined into commercial compact discs. Spatio-temporal regulation of the lac operon was demonstrated via the printing of patterns of lactose and glucose directly into the cultures; X-Gal blue patterns were used for visual feedback. We demonstrate how the bistable nature of the lac operon's feedback, when perturbed by patterning lactose (inducer and glucose (inhibitor, can lead to coordination of cell expression patterns across a field in ways that mimic motifs seen in developmental biology. Examples of this include sharp boundaries and the generation of traveling waves of mRNA expression. To our knowledge, this is the first demonstration of reaction-diffusion effects in the well-studied lac operon. A finite element reaction-diffusion model of the lac operon is also presented which predicts pattern formation with good fidelity.
Yano, Koichi; Masuda, Kenta; Akanuma, Genki; Wada, Tetsuya; Matsumoto, Takashi; Shiwa, Yuh; Ishige, Taichiro; Yoshikawa, Hirofumi; Niki, Hironori; Inaoka, Takashi; Kawamura, Fujio
2016-01-01
The genome of Bacillus subtilis strain 168 encodes ten rRNA (rrn) operons. We previously reported that strains with only a single rrn operon had a decreased growth and sporulation frequency. We report here the isolation and characterization of suppressor mutants from seven strains that each have a single rrn operon (rrnO, A, J, I, E, D or B). The suppressor mutants for strain RIK656 with a single rrnO operon had a higher frequency of larger colonies. These suppressor mutants had not only increased growth rates, but also increased sporulation frequencies and ribosome levels compared to the parental mutant strain RIK656. Quantitative PCR analyses showed that all these suppressor mutants had an increased number of copies of the rrnO operon. Suppressor mutants were also isolated from the six other strains with single rrn operons (rrnA, J, I, E, D or B). Next generation and capillary sequencing showed that all of the suppressor mutants had tandem repeats of the chromosomal locus containing the remaining rrn operon (amplicon). These amplicons varied in size from approximately 9 to 179 kb. The amplifications were likely to be initiated by illegitimate recombination between non- or micro-homologous sequences, followed by unequal crossing-over during DNA replication. These results are consistent with our previous report that rrn operon copy number has a major role in cellular processes such as cell growth and sporulation.
Directory of Open Access Journals (Sweden)
Christiane E. Kupper
2012-05-01
Full Text Available The importance of glycans in biological systems is highlighted by their various functions in physiological and pathological processes. Many glycan epitopes on glycoproteins and glycolipids are based on N-acetyllactosamine units (LacNAc; Galβ1,4GlcNAc and often present on extended poly-LacNAc glycans ([Galβ1,4GlcNAc]n. Poly-LacNAc itself has been identified as a binding motif of galectins, an important class of lectins with functions in immune response and tumorigenesis. Therefore, the synthesis of natural and modified poly-LacNAc glycans is of specific interest for binding studies with galectins as well as for studies of their possible therapeutic applications. We present the oxidation by galactose oxidase and subsequent chemical or enzymatic modification of terminal galactose and N-acetylgalactosamine residues of poly-N-acetyllactosamine (poly-LacNAc oligomers and N,N-diacetyllactosamine (LacDiNAc by galactose oxidase. Product formation starting from different poly-LacNAc oligomers was characterised and optimised regarding formation of the C6-aldo product. Further modification of the aldehyde containing glycans, either by chemical conversion or enzymatic elongation, was established. Base-catalysed β-elimination, coupling of biotin–hydrazide with subsequent reduction to the corresponding hydrazine linkage, and coupling by reductive amination to an amino-functionalised poly-LacNAc oligomer were performed and the products characterised by LC–MS and NMR analysis. Remarkably, elongation of terminally oxidised poly-LacNAc glycans by β3GlcNAc- and β4Gal-transferase was also successful. In this way, a set of novel, modified poly-LacNAc oligomers containing terminally and/or internally modified galactose residues were obtained, which can be used for binding studies and various other applications.
D-Allose catabolism of Escherichia coli
DEFF Research Database (Denmark)
Poulsen, Tim S.; Chang, Ying-Ying; Hove-Jensen, Bjarne
1999-01-01
Genes involved in allose utilization of Escherichia coli K-12 are organized in at least two operons, alsRBACE and alsI, located next to each other on the chromosome but divergently transcribed. Mutants defective in alsI (allose 6-phosphate isomerase gene) and alsE (allulose 6-phosphate epimerase...... gene) were Als-. Transcription of the two allose operons, measured as β-galactosidase activity specified by alsI-lacZ+ or alsE-lacZ+ operon fusions, was induced by allose. Ribose also caused derepression of expression of the regulon under conditions in which ribose phosphate catabolism was impaired....
Operon Formation is Driven by Co-Regulation and Not by Horizontal Gene Transfer
Energy Technology Data Exchange (ETDEWEB)
Price, Morgan N.; Huang, Katherine H.; Arkin, Adam P.; Alm, Eric J.
2005-04-12
Although operons are often subject to horizontal gene transfer (HGT), non-HGT genes are particularly likely to be in operons. To resolve this apparent discrepancy and to determine whether HGT is involved in operon formation, we examined the evolutionary history of the genes and operons in Escherichia coli K12. We show that genes that have homologs in distantly related bacteria but not in close relatives of E. coli (indicating HGTi) form new operons at about the same rates as native genes. Furthermore, genes in new operons are no more likely than other genes to have phylogenetic trees that are inconsistent with the species tree. In contrast, essential genes and ubiquitous genes without paralogs (genes believed to undergo HGT rarely) often form new operons. We conclude that HGT is not associated with operon formation, but instead promotes the prevalence of pre-existing operons. To explain operon formation, we propose that new operons reduce the amount of regulatory information required to specify optimal expression patterns. Consistent with this hypothesis, operons have greater amounts of conserved regulatory sequences than do individually transcribed genes.
Expression of the entire polyhydroxybutyrate operon of Ralstonia eutropha in plants.
Mozes-Koch, Rita; Tanne, Edna; Brodezki, Alexandra; Yehuda, Ran; Gover, Ofer; Rabinowitch, Haim D; Sela, Ilan
2017-01-01
Previously we demonstrated that an entire bacterial operon (the PRN operon) is expressible in plants when driven by the Tomato -yellow-leaf-curl-virus (TYLCV) -derived universal vector IL-60.Petroleum-derived plastics are not degradable, and are therefore harmful to the environment. Fermentation of bacteria carrying operons for polyhydroxyalkanoates (PHAs) produces degradable bioplastics which are environmentally friendly. However, bacterial production of bioplastics is not cost-effective, and attention is turning to their production in plants. Such "green" plastics would be less expensive and environmentally friendly. Hence, attempts are being made to substitute petroleum-derived plastics with "green" plastics. However, transformation of plants with genes of operons producing bioplastics has deleterious effects. Transformation of plastids does not cause deleterious effects, however it is a complicated procedures. We have developed another TYLCV-based vector (SE100) and show that yet another bacterial operon (the phaCAB operon) when driven by SE100 is also expressed in plants. We employed the combination of SE100 and the phaCAB operon to drive the operon to the plastids and produce in plants a biodegradable plastic [polyhydroxybutyrate (PHB)].Here we indicate that the bacterial operon (phaCAB), when driven by the newly developed universal plant vector SE100 is directed to chloroplasts and produces in plants PHB, a leading PHA. The PHB-producing plants circumvent the need for complicated technical procedures. The viral vector system SE100 facilitated the production of the bio-plastic poly-3-hydroxybutyrate. This was achieved by using the full pha-CAB operon indicating that TYLCV based system can transcribe and translate genes from bacterial operons controlled by a single cis element. Our data hints to the participation of the chloroplasts in these processes.
International Nuclear Information System (INIS)
Lovett, C.M. Jr.; Love, P.E.; Yasbin, R.E.; Roberts, J.W.
1988-01-01
We quantitated the induction of the Bacillus subtilis Rec protein (the analog of Escherichia coli RecA protein) and the B. subtilis din-22 operon (representative of a set of DNA damage-inducible operons in B. subtilis) following DNA damage in Rec+ and DNA repair-deficient strains. After exposure to mitomycin C or UV irradiation, each of four distinct rec (recA1, recB2, recE4, and recM13) mutations reduced to the same extent the rates of both Rec protein induction (determined by densitometric scanning of immunoblot transfers) and din-22 operon induction (determined by assaying beta-galactosidase activity in din-22::Tn917-lacZ fusion strains). The induction deficiencies in recA1 and recE4 strains were partially complemented by the E. coli RecA protein, which was expressed on a plasmid in B. subtilis; the E. coli RecA protein had no effect on either induction event in Rec+, recB2, or recM13 strains. These results suggest that (i) the expression of both the B. subtilis Rec protein and the din-22 operon share a common regulatory component, (ii) the recA1 and recE4 mutations affect the regulation and/or activity of the B. subtilis Rec protein, and (iii) an SOS regulatory system like the E. coli system is highly conserved in B. subtilis. We also showed that the basal level of B. subtilis Rec protein is about 4,500 molecules per cell and that maximum induction by DNA damage causes an approximately fivefold increase in the rate of Rec protein accumulation
Nasrallah, Gheyath K; Gagnon, Elizabeth; Orton, Dennis J; Garduño, Rafael A
2011-11-01
HtpB, the chaperonin of the intracellular bacterial pathogen Legionella pneumophila , displays several virulence-related functions in vitro. To confirm HtpB's role in vivo, host infections with an htpB deletion mutant would be required. However, we previously reported that the htpAB operon (encoding co-chaperonin and chaperonin) is essential. We attempted here to delete htpAB in a L. pneumophila strain carrying the groE operon (encoding the Escherichia coli co-chaperonin and chaperonin). The groE operon was inserted into the chromosome of L. pneumophila Lp02, and then allelic replacement of htpAB with a gentamicin resistance cassette was attempted. Although numerous potential postallelic replacement transformants showed a correct selection phenotype, we still detected htpAB by PCR and full-size HtpB by immunoblot. Southern blot and PCR analysis indicated that the gentamicin resistance cassette had apparently integrated in a duplicated htpAB region. However, we showed by Southern blot that strain Lp02, and the Lp02 derivative carrying the groE operon, have only one copy of htpAB. These results confirmed that the htpAB operon cannot be deleted, not even in the presence of the groE operon, and suggested that attempts to delete htpAB under strong phenotypic selection result in aberrant genetic recombinations that could involve duplication of the htpAB locus.
Sequence and features of the tryptophan operon of Vibrio parahemolyticus.
Crawford, I P; Han, C Y; Silverman, M
1991-01-01
The nucleotide sequence of the trp operon of the marine enteric bacterium Vibrio parahemolyticus is presented. The gene order E, G, D, C(F), B, A is identical to that of other enterics. The structural genes of the operon are preceded by a long leader region encoding a 41-residue peptide containing five tryptophan residues. The organization of the leader region suggests that transcription of the operon is subject to attenuation control. The promoter-operator region of the V. parahemolyticus trp operon is almost identical to the corresponding promoter-operator of E. coli. The similarities suggest that promoter strength and operator function are identical in the two species, and that transcription initiation is regulated by repression. The operon appears to lack the internal promoter within trpD that is common in terrestrial enteric species.
The SOS-LUX-LAC-FLUORO-Toxicity-test on the International Space Station (ISS).
Rabbow, E; Rettberg, P; Baumstark-Khan, C; Horneck, G
2003-01-01
In the 21st century, an increasing number of astronauts will visit the International Space Station (ISS) for prolonged times. Therefore it is of utmost importance to provide necessary basic knowledge concerning risks to their health and their ability to work on the station and during extravehicular activities (EVA) in free space. It is the aim of one experiment of the German project TRIPLE-LUX (to be flown on the ISS) to provide an estimation of health risk resulting from exposure of the astronauts to the radiation in space inside the station as well as during extravehicular activities on one hand, and of exposure of astronauts to unavoidable or as yet unknown ISS-environmental genotoxic substances on the other. The project will (i) provide increased knowledge of the biological action of space radiation and enzymatic repair of DNA damage, (ii) uncover cellular mechanisms of synergistic interaction of microgravity and space radiation and (iii) examine the space craft milieu with highly specific biosensors. For these investigations, the bacterial biosensor SOS-LUX-LAC-FLUORO-Toxicity-test will be used, combining the SOS-LUX-Test invented at DLR Germany (Patent) with the commercially available LAC-FLUORO-Test. The SOS-LUX-Test comprises genetically modified bacteria transformed with the pBR322-derived plasmid pPLS-1. This plasmid carries the promoterless lux operon of Photobacterium leiognathi as a reporter element under control of the DNA-damage dependent SOS promoter of ColD as sensor element. This system reacts to radiation and other agents that induce DNA damages with a dose dependent measurable emission of bioluminescence of the transformed bacteria. The analogous LAC-FLUORO-Test has been developed for the detection of cellular responses to cytotoxins. It is based on the constitutive expression of green fluorescent protein (GFP) mediated by the bacterial protein expression vector pGFPuv (Clontech, Palo Alto, USA). In response to cytotoxic agents, this system
Selfish operons: the evolutionary impact of gene clustering in prokaryotes and eukaryotes.
Lawrence, J
1999-12-01
The Selfish Operon Model postulates that the organization of bacterial genes into operons is beneficial to the constituent genes in that proximity allows horizontal cotransfer of all genes required for a selectable phenotype; eukaryotic operons formed for very different reasons. Horizontal transfer of selfish operons most probably promotes bacterial diversification.
Molecular analysis of the UV-inducible pili operon from Sulfolobus acidocaldarius
Wolferen, Marleen van; Ajon, Małgorzata; Driessen, Arnold J.M.; Albers, Sonja-Verena
2013-01-01
Upon ultraviolet (UV) stress, hyperthermophilic Sulfolobus species show a highly induced transcription of a gene cluster responsible for pili biogenesis: the UV-inducible pili operon (ups operon). This operon is involved in UV-induced pili assembly, cellular aggregation, and subsequent DNA exchange
Unprecedented high-resolution view of bacterial operon architecture revealed by RNA sequencing.
Conway, Tyrrell; Creecy, James P; Maddox, Scott M; Grissom, Joe E; Conkle, Trevor L; Shadid, Tyler M; Teramoto, Jun; San Miguel, Phillip; Shimada, Tomohiro; Ishihama, Akira; Mori, Hirotada; Wanner, Barry L
2014-07-08
We analyzed the transcriptome of Escherichia coli K-12 by strand-specific RNA sequencing at single-nucleotide resolution during steady-state (logarithmic-phase) growth and upon entry into stationary phase in glucose minimal medium. To generate high-resolution transcriptome maps, we developed an organizational schema which showed that in practice only three features are required to define operon architecture: the promoter, terminator, and deep RNA sequence read coverage. We precisely annotated 2,122 promoters and 1,774 terminators, defining 1,510 operons with an average of 1.98 genes per operon. Our analyses revealed an unprecedented view of E. coli operon architecture. A large proportion (36%) of operons are complex with internal promoters or terminators that generate multiple transcription units. For 43% of operons, we observed differential expression of polycistronic genes, despite being in the same operons, indicating that E. coli operon architecture allows fine-tuning of gene expression. We found that 276 of 370 convergent operons terminate inefficiently, generating complementary 3' transcript ends which overlap on average by 286 nucleotides, and 136 of 388 divergent operons have promoters arranged such that their 5' ends overlap on average by 168 nucleotides. We found 89 antisense transcripts of 397-nucleotide average length, 7 unannotated transcripts within intergenic regions, and 18 sense transcripts that completely overlap operons on the opposite strand. Of 519 overlapping transcripts, 75% correspond to sequences that are highly conserved in E. coli (>50 genomes). Our data extend recent studies showing unexpected transcriptome complexity in several bacteria and suggest that antisense RNA regulation is widespread. Importance: We precisely mapped the 5' and 3' ends of RNA transcripts across the E. coli K-12 genome by using a single-nucleotide analytical approach. Our resulting high-resolution transcriptome maps show that ca. one-third of E. coli operons are
The business of refractive laser assisted cataract surgery (ReLACS).
Berdahl, John P; Jensen, Matthew P
2014-01-01
Refractive Laser Assisted Cataract Surgery (ReLACS) combines the femtosecond laser with other noncovered tests and services in an attempt to reduce spectacle dependence in combination with cataract surgery. Significant interest is present among ophthalmologists who are considering adopting this technology, however significant capital outlays and continuing expenses can make the decision to adopt ReLACS foreboding. We review the financial considerations of ReLACS and review the trends seen in early adopters of this technology. Recent findings have shown that ReLACS is a growing segment of cataract surgery. Most practices who have implemented the technology have broken even and have a positive outlook on the financial return of implementing the ReLACS program. The average break-even analysis point for practices is around 230 cases a year. ReLACS is growing and appears to be a financial viable approach for many practices.
Adsorption Properties of Lac Dyes on Wool, Silk, and Nylon
Directory of Open Access Journals (Sweden)
Bo Wei
2013-01-01
Full Text Available There has been growing interest in the dyeing of textiles with natural dyes. The research about the adsorption properties of natural dyes can help to understand their adsorption mechanism and to control their dyeing process. This study is concerned with the kinetics and isotherms of adsorption of lac dyes on wool, silk, and nylon fibers. It was found that the adsorption kinetics of lac dyes on the three fibers followed the pseudosecond-order kinetic model, and the adsorption rate of lac dyes was the fastest for silk and the slowest for wool. The activation energies for the adsorption process on wool, silk, and nylon were found to be 107.15, 87.85, and 45.31 kJ/mol, respectively. The adsorption of lac dyes on the three fibers followed the Langmuir mechanism, indicating that the electrostatic interactions between lac dyes and those fibers occurred. The saturation values for lac adsorption on the three fibers decreased in the order of wool > silk > nylon; the Langmuir affinity constant of lac adsorption on nylon was much higher than those on wool and silk.
Evolution of mal ABC transporter operons in the Thermococcales and Thermotogales
Directory of Open Access Journals (Sweden)
Gogarten J Peter
2008-01-01
Full Text Available Abstract Background The mal genes that encode maltose transporters have undergone extensive lateral transfer among ancestors of the archaea Thermococcus litoralis and Pyrococcus furiosus. Bacterial hyperthermophiles of the order Thermotogales live among these archaea and so may have shared in these transfers. The genome sequence of Thermotoga maritima bears evidence of extensive acquisition of archaeal genes, so its ancestors clearly had the capacity to do so. We examined deep phylogenetic relationships among the mal genes of these hyperthermophiles and their close relatives to look for evidence of shared ancestry. Results We demonstrate that the two maltose ATP binding cassette (ABC transporter operons now found in Tc. litoralis and P. furiosus (termed mal and mdx genes, respectively are not closely related to one another. The Tc. litoralis and P. furiosus mal genes are most closely related to bacterial mal genes while their respective mdx genes are archaeal. The genes of the two mal operons in Tt. maritima are not related to genes in either of these archaeal operons. They are highly similar to one another and belong to a phylogenetic lineage that includes mal genes from the enteric bacteria. A unique domain of the enteric MalF membrane spanning proteins found also in these Thermotogales MalF homologs supports their relatively close relationship with these enteric proteins. Analyses of genome sequence data from other Thermotogales species, Fervidobacterium nodosum, Thermosipho melanesiensis, Thermotoga petrophila, Thermotoga lettingae, and Thermotoga neapolitana, revealed a third apparent mal operon, absent from the published genome sequence of Tt. maritima strain MSB8. This third operon, mal3, is more closely related to the Thermococcales' bacteria-derived mal genes than are mal1 and mal2. F. nodosum, Ts. melanesiensis, and Tt. lettingae have only one of the mal1-mal2 paralogs. The mal2 operon from an unknown species of Thermotoga appears to
Regulation of potassium dependent ATPase (kdp) operon of Deinococcus radiodurans.
Dani, Pratiksha; Ujaoney, Aman Kumar; Apte, Shree Kumar; Basu, Bhakti
2017-01-01
The genome of D. radiodurans harbors genes for structural and regulatory proteins of Kdp ATPase, in an operon pattern, on Mega plasmid 1. Organization of its two-component regulatory genes is unique. Here we demonstrate that both, the structural as well as regulatory components of the kdp operon of D. radiodurans are expressed quickly as the cells experience potassium limitation but are not expressed upon increase in osmolarity. The cognate DNA binding response regulator (RR) effects the expression of kdp operon during potassium deficiency through specific interaction with the kdp promoter. Deletion of the gene encoding RR protein renders the mutant D. radiodurans (ΔRR) unable to express kdp operon under potassium limitation. The ΔRR D. radiodurans displays no growth defect when grown on rich media or when exposed to oxidative or heat stress but shows reduced growth following gamma irradiation. The study elucidates the functional and regulatory aspects of the novel kdp operon of this extremophile, for the first time.
REMap: Operon map of M. tuberculosis based on RNA sequence data.
Pelly, Shaaretha; Winglee, Kathryn; Xia, Fang Fang; Stevens, Rick L; Bishai, William R; Lamichhane, Gyanu
2016-07-01
A map of the transcriptional organization of genes of an organism is a basic tool that is necessary to understand and facilitate a more accurate genetic manipulation of the organism. Operon maps are largely generated by computational prediction programs that rely on gene conservation and genome architecture and may not be physiologically relevant. With the widespread use of RNA sequencing (RNAseq), the prediction of operons based on actual transcriptome sequencing rather than computational genomics alone is much needed. Here, we report a validated operon map of Mycobacterium tuberculosis, developed using RNAseq data from both the exponential and stationary phases of growth. At least 58.4% of M. tuberculosis genes are organized into 749 operons. Our prediction algorithm, REMap (RNA Expression Mapping of operons), considers the many cases of transcription coverage of intergenic regions, and avoids dependencies on functional annotation and arbitrary assumptions about gene structure. As a result, we demonstrate that REMap is able to more accurately predict operons, especially those that contain long intergenic regions or functionally unrelated genes, than previous operon prediction programs. The REMap algorithm is publicly available as a user-friendly tool that can be readily modified to predict operons in other bacteria. Copyright © 2016 Elsevier Ltd. All rights reserved.
Vulnerabilities in Yersinia pestis caf operon are unveiled by a Salmonella vector.
Cao, Ling; Lim, Timothy; Jun, SangMu; Thornburg, Theresa; Avci, Recep; Yang, Xinghong
2012-01-01
During infection, Yersinia pestis uses its F1 capsule to enhance survival and cause virulence to mammalian host. Since F1 is produced in large quantities and secreted into the host tissues, it also serves as a major immune target. To hold this detrimental effect under proper control, Y. pestis expresses the caf operon (encoding the F1 capsule) in a temperature-dependent manner. However, additional properties of the caf operon limit its expression. By overexpressing the caf operon in wild-type Salmonella enterica serovar Typhimurium under a potent promoter, virulence of Salmonella was greatly attenuated both in vitro and in vivo. In contrast, expression of the caf operon under the regulation of its native promoter exhibited negligible impairment of Salmonellae virulence. In-depth investigation revealed all individual genes in the caf operon attenuated Salmonella when overexpressed. The deleterious effects of caf operon and the caf individual genes were further confirmed when they were overexpressed in Y. pestis KIM6+. This study suggests that by using a weak inducible promoter, the detrimental effects of the caf operon are minimally manifested in Y. pestis. Thus, through tight regulation of the caf operon, Y. pestis precisely balances its capsular anti-phagocytic properties with the detrimental effects of caf during interaction with mammalian host.
The Genomic Pattern of tDNA Operon Expression in E. coli.
Directory of Open Access Journals (Sweden)
2005-06-01
Full Text Available In fast-growing microorganisms, a tRNA concentration profile enriched in major isoacceptors selects for the biased usage of cognate codons. This optimizes translational rate for the least mass invested in the translational apparatus. Such translational streamlining is thought to be growth-regulated, but its genetic basis is poorly understood. First, we found in reanalysis of the E. coli tRNA profile that the degree to which it is translationally streamlined is nearly invariant with growth rate. Then, using least squares multiple regression, we partitioned tRNA isoacceptor pools to predicted tDNA operons from the E. coli K12 genome. Co-expression of tDNAs in operons explains the tRNA profile significantly better than tDNA gene dosage alone. Also, operon expression increases significantly with proximity to the origin of replication, oriC, at all growth rates. Genome location explains about 15% of expression variation in a form, at a given growth rate, that is consistent with replication-dependent gene concentration effects. Yet the change in the tRNA profile with growth rate is less than would be expected from such effects. We estimated per-copy expression rates for all tDNA operons that were consistent with independent estimates for rDNA operons. We also found that tDNA operon location, and the location dependence of expression, were significantly different in the leading and lagging strands. The operonic organization and genomic location of tDNA operons are significant factors influencing their expression. Nonrandom patterns of location and strandedness shown by tDNA operons in E. coli suggest that their genomic architecture may be under selection to satisfy physiological demand for tRNA expression at high growth rates.
Ancient Origin of the Tryptophan Operon and the Dynamics of Evolutionary Change†
Xie, Gary; Keyhani, Nemat O.; Bonner; Jensen, Roy A.
2003-01-01
The seven conserved enzymatic domains required for tryptophan (Trp) biosynthesis are encoded in seven genetic regions that are organized differently (whole-pathway operons, multiple partial-pathway operons, and dispersed genes) in prokaryotes. A comparative bioinformatics evaluation of the conservation and organization of the genes of Trp biosynthesis in prokaryotic operons should serve as an excellent model for assessing the feasibility of predicting the evolutionary histories of genes and operons associated with other biochemical pathways. These comparisons should provide a better understanding of possible explanations for differences in operon organization in different organisms at a genomics level. These analyses may also permit identification of some of the prevailing forces that dictated specific gene rearrangements during the course of evolution. Operons concerned with Trp biosynthesis in prokaryotes have been in a dynamic state of flux. Analysis of closely related organisms among the Bacteria at various phylogenetic nodes reveals many examples of operon scission, gene dispersal, gene fusion, gene scrambling, and gene loss from which the direction of evolutionary events can be deduced. Two milestone evolutionary events have been mapped to the 16S rRNA tree of Bacteria, one splitting the operon in two, and the other rejoining it by gene fusion. The Archaea, though less resolved due to a lesser genome representation, appear to exhibit more gene scrambling than the Bacteria. The trp operon appears to have been an ancient innovation; it was already present in the common ancestor of Bacteria and Archaea. Although the operon has been subjected, even in recent times, to dynamic changes in gene rearrangement, the ancestral gene order can be deduced with confidence. The evolutionary history of the genes of the pathway is discernible in rough outline as a vertical line of descent, with events of lateral gene transfer or paralogy enriching the analysis as interesting
Ancient origin of the tryptophan operon and the dynamics of evolutionary change.
Xie, Gary; Keyhani, Nemat O; Bonner, Carol A; Jensen, Roy A
2003-09-01
The seven conserved enzymatic domains required for tryptophan (Trp) biosynthesis are encoded in seven genetic regions that are organized differently (whole-pathway operons, multiple partial-pathway operons, and dispersed genes) in prokaryotes. A comparative bioinformatics evaluation of the conservation and organization of the genes of Trp biosynthesis in prokaryotic operons should serve as an excellent model for assessing the feasibility of predicting the evolutionary histories of genes and operons associated with other biochemical pathways. These comparisons should provide a better understanding of possible explanations for differences in operon organization in different organisms at a genomics level. These analyses may also permit identification of some of the prevailing forces that dictated specific gene rearrangements during the course of evolution. Operons concerned with Trp biosynthesis in prokaryotes have been in a dynamic state of flux. Analysis of closely related organisms among the Bacteria at various phylogenetic nodes reveals many examples of operon scission, gene dispersal, gene fusion, gene scrambling, and gene loss from which the direction of evolutionary events can be deduced. Two milestone evolutionary events have been mapped to the 16S rRNA tree of Bacteria, one splitting the operon in two, and the other rejoining it by gene fusion. The Archaea, though less resolved due to a lesser genome representation, appear to exhibit more gene scrambling than the Bacteria. The trp operon appears to have been an ancient innovation; it was already present in the common ancestor of Bacteria and Archaea. Although the operon has been subjected, even in recent times, to dynamic changes in gene rearrangement, the ancestral gene order can be deduced with confidence. The evolutionary history of the genes of the pathway is discernible in rough outline as a vertical line of descent, with events of lateral gene transfer or paralogy enriching the analysis as interesting
Molecular and functional analysis of the mce4 operon in Mycobacterium smegmatis.
García-Fernández, Julia; Papavinasasundaram, Kadamba; Galán, Beatriz; Sassetti, Christopher M; García, José L
2017-09-01
Mycobacterium smegmatis contains 6 homologous mce (mammalian cell entry) operons which have been proposed to encode ABC-like import systems. The mce operons encode up to 10 different proteins of unknown function that are not present in conventional ABC transporters. We have analysed the consequences of individually deleting each of the genes of the mce4 operon of M. smegmatis, which mediates the transport of cholesterol. None of the mce4 mutants were able to grow in cholesterol suggesting that all these genes are required for its uptake and that none of them can be replaced by the homologous genes of the other mce operons. This result suggests that different mce operons do not provide redundant capabilities and that M. smegmatis, in contrast with Mycobacterium tuberculosis, is not able to use alternative systems to import cholesterol in the analysed culture conditions. Either deletion of the entire mce4 operon or single point mutations that eliminate the transport function cause a phenotype similar to the one observed in a mutant lacking all 6 mce operons suggesting a pleiotropic role for this system. © 2017 Society for Applied Microbiology and John Wiley & Sons Ltd.
Rapid customised operon assembly by yeast recombinational cloning.
Liu, Michael A; Kenyon, Johanna J; Lee, Jason; Reeves, Peter R
2017-06-01
We have developed a system called the Operon Assembly Protocol (OAP), which takes advantage of the homologous recombination DNA repair pathway in Saccharomyces cerevisiae to assemble full-length operons from a series of overlapping PCR products into a specially engineered yeast-Escherichia coli shuttle vector. This flexible, streamlined system can be used to assemble several operon clones simultaneously, and each clone can be expressed in the same E. coli tester strain to facilitate direct functional comparisons. We demonstrated the utility of the OAP by assembling and expressing a series of E. coli O1A O-antigen gene cluster clones containing various gene deletions or replacements. We then used these constructs to assess the substrate preferences of several Wzx flippases, which are responsible for translocation of oligosaccharide repeat units (O units) across the inner membrane during O-antigen biosynthesis. We were able to identify several O unit structural features that appear to be important determinants of Wzx substrate preference. The OAP system should be broadly applicable for the genetic manipulation of any bacterial operon and can be modified for use in other host species. It could also have potential uses in fields such as glycoengineering.
Genetic and biochemical analysis of peptide transport in Escherichia coli
International Nuclear Information System (INIS)
Andrews, J.C.
1986-01-01
E. coli peptide transport mutants have been isolated based on their resistance to toxic tripeptides. These genetic defects were found to map in two distinct chromosomal locations. The transport systems which require expression of the trp-linked opp genes and the oppE gene(s) for activity were shown to have different substrate preferences. Growth of E. coli in medium containing leucine results in increased entry of exogenously supplied tripeptides into the bacterial cell. This leucine-mediated elevation of peptide transport required expression of the trp-linked opp operon and was accompanied by increased sensitivity to toxic tripeptides, by an enhanced capacity to utilize nutritional peptides, and by an increase in both the velocity and apparent steady-state level of L-(U- 14 C)alanyl-L-alanyl-L-alanine accumulation for E. coli grown in leucine-containing medium relative to these parameters of peptide transport measured with bacteria grown in media lacking leucine. Direct measurement of opp operon expression by pulse-labeling experiments demonstrated that growth of E. coli in the presence of leucine resulted in increased synthesis of the oppA-encoded periplasmic binding protein. The transcriptional regulation of the trp-linked opp operon of E. coli was investigated using λ placMu51-generated lac operon fusions. Synthesis of β-galactosidase by strains harboring oppA-lac, oppB-lac, and oppD-lac fusions occurred at a basal level when the fusion-containing strains were grown in minimal medium
Broad band energy distribution of UV-bright BL Lac objects
International Nuclear Information System (INIS)
Maraschi, L.; Tanzi, E.G.; Treves, A.
1984-01-01
IUE satellite data in the 1200-2000 and 1900-3200 A intervals of BL Lac objects are analyzed in terms of two discernible groups. A total of 25 BL Lac objects were observed, with differences between groups displayed in terms of the power slope of the energy of the UV emissions, i.e., slopes of 1 and 2. Comparisons of the spectra with those of quasars showed that quasars have a small spectral index in the 1000-6000 A band and no correlation exists between the spectral index and UV flux of the BL Lac objects. The comparisons underscore the lack of a thermal component for BL Lac objects. Steep spectral components in both BL Lac objects and highly polarized quasars emissions could both be due to synchrotron emission. Compton scattering of relativistic electrons off synchrotron photons could produce the X ray emissions. 44 references
Broad band energy distribution of UV-bright BL Lac objects
Energy Technology Data Exchange (ETDEWEB)
Maraschi, L.; Tanzi, E.G.; Treves, A.
1984-01-01
IUE satellite data in the 1200-2000 and 1900-3200 A intervals of BL Lac objects are analyzed in terms of two discernible groups. A total of 25 BL Lac objects were observed, with differences between groups displayed in terms of the power slope of the energy of the UV emissions, i.e., slopes of 1 and 2. Comparisons of the spectra with those of quasars showed that quasars have a small spectral index in the 1000-6000 A band and no correlation exists between the spectral index and UV flux of the BL Lac objects. The comparisons underscore the lack of a thermal component for BL Lac objects. Steep spectral components in both BL Lac objects and highly polarized quasars emissions could both be due to synchrotron emission. Compton scattering of relativistic electrons off synchrotron photons could produce the X ray emissions. 44 references.
Infrared polarimetry and photometry of BL Lac objects. 3
Energy Technology Data Exchange (ETDEWEB)
Holmes, P A; Brand, P W.J.L. [Edinburgh Univ. (UK). Dept. of Astronomy; Impey, C D [Hawaii Univ., Honolulu (USA). Inst. for Astronomy; Williams, P M [UKIRT, Hilo, HI (USA)
1984-10-15
The data presented here is part of a continuing monitoring programme of BL lac objects with J, H and K photometry and polarimetry. A total of 30 BL Lac objects have now been observed photometrically. Infrared polarimetry has also been obtained for 24 of these objects. The sample is sufficiently large to examine statistically, and several important correlations have emerged. Internight variations and wavelength dependence of polarization indicate that BL Lac objects, as a class, may be understood in terms of a relatively simple two-component model.
The comparison between LAC and ALA
Directory of Open Access Journals (Sweden)
Tzu-heng Chiu
2000-12-01
Full Text Available A good library association serves its members, improves the librarianship, and helps library institutions achieving their missions. This article describes the history, missions and goals, organization structure, membership, financial sources, professional activities, publication, and website of the Library Association of China (LAC and American Library Association (ALA, respectively. Considering social / cultural / political differences between Taiwan and the United Sates, the author then compares these two library associations from the eight factors mentioned above. At the end, suggestions for the LAC are proposed.[Article content in Chinese
Clustering environments of BL Lac objects
Wurtz, Ronald; Ellingson, Erica; Stocke, John T.; Yee, H. K. C.
1993-01-01
We report measurements of the amplitude of the BL Lac galaxy spatial covariance function, B(gb), for the fields of five BL Lacertae objects. We present evidence for rich clusters around MS 1207+39 and MS 1407+59, and confirm high richness for the cluster containing H0414+009. We discuss the ease of 3C 66 A and find evidence for a poor cluster based on an uncertain redshift of z = 0.444. These data suggest that at least some BL Lac objects are consistent with being FR 1 radio galaxies in rich clusters.
Fucose-Mediated Transcriptional Activation of the fcs Operon by FcsR in Streptococcus pneumoniae.
Manzoor, Irfan; Shafeeq, Sulman; Afzal, Muhammad; Kuipers, Oscar P
2015-01-01
In this study, we explore the impact of fucose on the transcriptome of S. pneumoniae D39. The expression of various genes and operons, including the fucose uptake PTS and utilization operon (fcs operon) was altered in the presence of fucose. By means of quantitative RT-PCR and β-galactosidase analysis, we demonstrate the role of the transcriptional regulator FcsR, present upstream of the fcs operon, as a transcriptional activator of the fcs operon. We also predict a 19-bp putative FcsR regulatory site (5'-ATTTGAACATTATTCAAGT-3') in the promoter region of the fcs operon. The functionality of this predicted FcsR regulatory site was further confirmed by promoter-truncation experiments, where deletion of half of the FscR regulatory site or full deletion led to the abolition of expression of the fcs operon. © 2015 S. Karger AG, Basel.
Louisiana SIP: LAC 33:III Ch. 7 - Table 2 - Ambient Air--Methods of Contaminant Measurements; SIP effective 1989-05-08 (LAc49) and 1989-08-14 (LAc50) to 2011-08-03 (LAd34 - Moved to Section 711 and revised [adds PM-2.5])
An insight into the regulation of mce4 operon of Mycobacterium tuberculosis.
Rathor, Nisha; Chandolia, Amita; Saini, Neeraj Kumar; Sinha, Rajesh; Pathak, Rakesh; Garima, Kushal; Singh, Satendra; Varma-Basil, Mandira; Bose, Mridula
2013-07-01
The mce4 operon is reported to be involved in cholesterol utilization and intracellular survival of Mycobacterium tuberculosis (M. tuberculosis). The regulatory mechanism of this important operon was unknown so far. Here we report detection of the promoter region and regulatory factors of the mce4 operon. The in silico analyzed putative promoter region was cloned in promoter selection vector and promoter strength was measured by O-Nitrophenyl-β-D-galactopyranosidase (ONPG) assay. The transcription start site was determined by 5' Rapid amplification of C terminal end (5'RACE). Surface stress, hypoxia and presence of cholesterol, were found to be stimulatory for mce4 operon promoter induction. Pull down assay coupled with 2D gel electrophoresis resolved many proteins; few prominent spots were processed for identification. MALDI TOF-TOF identified proteins of M. tuberculosis which supported the regulatory function of the identified promoter region and cholesterol utilization of mce4 operon. Since mce4 operon is involved in cholesterol utilization and intracellular survival of M. tuberculosis in the later phase of infection, identification of the promoter sequence as reported in the present communication may facilitate development of effective inhibitors to regulate expression of mce4 operon which may prove to be a good drug target to prevent latency in tuberculosis. Copyright © 2013 Elsevier Ltd. All rights reserved.
Delft, J.H.M. van; Bergmans, A.; Dam, F.J. van; Tates, A.D.; Howard, L.; Winton, D.J.; Baan, R.A.
1998-01-01
Comparison of results derived from transgenic animal gene-mutation assays with those from mutation analyses in endogenous genes is an important step in the validation of the former. We have used λlacZ transgenic mice to study alkylation-induced mutagenesis in vivo in (a) lacZ and hprt in spleen
CONDOP: an R package for CONdition-Dependent Operon Predictions.
Fortino, Vittorio; Tagliaferri, Roberto; Greco, Dario
2016-10-15
The use of high-throughput RNA sequencing to predict dynamic operon structures in prokaryotic genomes has recently gained popularity in bioinformatics. We provide the R implementation of a novel method that uses transcriptomic features extracted from RNA-seq transcriptome profiles to develop ensemble classifiers for condition-dependent operon predictions. The CONDOP package provides a deeper insight into RNA-seq data analysis and allows scientists to highlight the operon organization in the context of transcriptional regulation with a few lines of code. CONDOP is implemented in R and is freely available at CRAN. vittorio.fortino@helsinki.fiSupplementary information: Supplementary data are available at Bioinformatics online. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.
Opening Up Natural Resource Based Industries for Innovation (LAC ...
International Development Research Centre (IDRC) Digital Library (Canada)
Opening Up Natural Resource Based Industries for Innovation (LAC). Commodities based on natural resources account for at least half of the exports of two-thirds of the countries in Latin America and the Caribbean (LAC). There is growing concern, however, that existing natural resource-based industries are ...
The mbo operon is specific and essential for biosynthesis of mangotoxin in Pseudomonas syringae.
Carrión, Víctor J; Arrebola, Eva; Cazorla, Francisco M; Murillo, Jesús; de Vicente, Antonio
2012-01-01
Mangotoxin is an antimetabolite toxin produced by certain Pseudomonas syringae pv. syringae strains. This toxin is an oligopeptide that inhibits ornithine N-acetyl transferase, a key enzyme in the biosynthesis of ornithine and arginine. Previous studies have reported the involvement of the putative nonribosomal peptide synthetase MgoA in virulence and mangotoxin production. In this study, we analyse a new chromosomal region of P. syringae pv. syringae UMAF0158, which contains six coding sequences arranged as an operon (mbo operon). The mbo operon was detected in only mangotoxin-producing strains, and it was shown to be essential for the biosynthesis of this toxin. Mutants in each of the six ORFs of the mbo operon were partially or completely impaired in the production of the toxin. In addition, Pseudomonas spp. mangotoxin non-producer strains transformed with the mbo operon gained the ability to produce mangotoxin, indicating that this operon contains all the genetic information necessary for mangotoxin biosynthesis. The generation of a single transcript for the mbo operon was confirmed and supported by the allocation of a unique promoter and Rho-independent terminator. The phylogenetic analysis of the P. syringae strains harbouring the mbo operon revealed that these strains clustered together.
Huillet, Eugénie; Bridoux, Ludovic; Wanapaisan, Pagakrong; Rejasse, Agnès; Peng, Qi; Panbangred, Watanalai; Lereclus, Didier
2017-01-01
The Gram-positive pathogen Bacillus cereus is able to grow in chains of rod-shaped cells, but the regulation of chaining remains largely unknown. Here, we observe that glucose-grown cells of B. cereus ATCC 14579 form longer chains than those grown in the absence of glucose during the late exponential and transition growth phases, and identify that the clhAB2 operon is required for this chain lengthening phenotype. The clhAB2 operon is specific to the B. cereus group (i.e., B. thuringiensis, B. anthracis and B. cereus) and encodes two membrane proteins of unknown function, which are homologous to the Staphylococcus aureus CidA and CidB proteins involved in cell death control within glucose-grown cells. A deletion mutant (ΔclhAB2) was constructed and our quantitative image analyses show that ΔclhAB2 cells formed abnormal short chains regardless of the presence of glucose. We also found that glucose-grown cells of ΔclhAB2 were significantly wider than wild-type cells (1.47 μm ±CI95% 0.04 vs 1.19 μm ±CI95% 0.03, respectively), suggesting an alteration of the bacterial cell wall. Remarkably, ΔclhAB2 cells showed accelerated autolysis under autolysis-inducing conditions, compared to wild-type cells. Overall, our data suggest that the B. cereus clhAB2 operon modulates peptidoglycan hydrolase activity, which is required for proper cell shape and chain length during cell growth, and down-regulates autolysin activity. Lastly, we studied the transcription of clhAB2 using a lacZ transcriptional reporter in wild-type, ccpA and codY deletion-mutant strains. We found that the global transcriptional regulatory protein CodY is required for the basal level of clhAB2 expression under all conditions tested, including the transition growth phase while CcpA, the major global carbon regulator, is needed for the high-level expression of clhAB2 in glucose-grown cells.
Evolutionary behaviour of AGN: Investigations on BL Lac objects and Seyfert II galaxies
Beckmann, V.
2000-12-01
The evolution and nature of AGN is still one of the enigmatic questions in astrophysics. While large and complete Quasar samples are available, special classes of AGN, like BL Lac objects and Seyfert II galaxies, are still rare objects. In this work I present two new AGN samples. The first one is the HRX-BL Lac survey, resulting in a sample of X-ray selected BL Lac objects. This sample results from 223 BL Lac candidates based on a correlation of X-ray sources with radio sources. The identification of this sample is 98% complete. 77 objects have been identified as BL Lac objects and form the HRX-BL Lac complete sample, the largest homogeneous sample of BL Lac objects existing today. For this sample, redshifts are now known for 62 objects (81 %). In total I present 101 BL Lac objects in the enlarged HRX-BL Lac survey, for which redshift information is available for 84 objects. During the HRX-BL Lac survey I found several objects of special interest. 1ES 1517+656 turned out to be the brightest known BL Lac object in the universe. 1ES 0927+500 could be the first BL Lac object with a line detected in the X-ray region. RX J1211+2242 is probably the the counterpart of the up to now unidentified gamma-ray source 3EG J1212+2304. Additionally I present seven candidates for ultra high frequency peaked BL Lac objects. RX J1054+3855 and RX J1153+3517 are rare high redshift X-ray bright QSO or accreting binary systems with huge magnetic fields. For the BL Lac objects I suggest an unified scenario in which giant elliptical galaxies, formed by merging events of spiral galaxies at z > 2, start as powerful, radio dominated BL Lacs. As the jet gets less powerful, the BL Lacs start to get more X-ray dominated, showing less total luminosities (for z definition to objects with a calcium break up to 40%, but do not support for the HBL the idea of allowing emission lines in the spectra of BL Lac galaxies. A way to find high redshift BL Lac objects might be the identification of faint X
The pyrimidine operon pyrRPB-carA from Lactococcus lactis
DEFF Research Database (Denmark)
Martinussen, Jan; Schallert, J.; Andersen, Birgit
2001-01-01
The four genes pyrR, pyrP, pyrB, and carA were found to constitute an operon in Lactococcus lactis subsp, lactis MG1363. The functions of the different genes were established by mutational analysis. The first gene in the operon is the pyrimidine regulatory gene, pyrR, which is responsible...
DEFF Research Database (Denmark)
Garrett, Roger Antony; Aagaard, Claus Sindbjerg; Andersen, Morten
1994-01-01
Over the past decade our laboratory has had a strong interest in defining the phylogenetic status of the archaea. This has involved determining and analysing the sequences of operons of both rRNAs and RNA polymerases and it led to the discovery of the first archaeal rRNA intron. What follows...
N-acetylgalatosamine-mediated regulation of the aga operon by AgaR in Streptococcus pneumoniae
Directory of Open Access Journals (Sweden)
Muhammad Afzal
2016-09-01
Full Text Available Here, we analyze the transcriptomic response of Streptococcus pneumoniae D39 to N-acetylgalactosamine (NAGa. Transcriptome comparison of S. pneumoniae D39 grown NAGaM17 (0.5% NAGa + M17 to that grown in GM17 (0.5% Glucose + M17 revealed the elevated expression of various carbon metabolic genes/operons, including a PTS operon (denoted here as the aga operon, which is putatively involved in NAGa transport and utilization, in the presence of NAGa. We further studied the role of a GntR-family transcriptional regulator (denoted here as AgaR in the regulation of aga operon. Our transcriptome and RT-PCR data suggest the role of AgaR as a transcriptional repressor of the aga operon. We predicted a 20-bp operator site of AagR (5’- ATAATTAATATAACAACAAA -3’ in the promoter region of the aga operon (PbgaC, which was further verified by mutating the AgaR operator site in the respective promoter. The role of CcpA in the additional regulation of the aga operon was elucidated by further transcriptome analyses and confirmed by quantitative RT-PCR.
Evidence for an intermediate conformational state of LacY.
Jiang, Xiaoxu; Guan, Lan; Zhou, Yonggang; Hong, Wen-Xu; Zhang, Qinghai; Kaback, H Ronald
2012-03-20
LacY mutant Cys154 → Gly exhibits a periplasmic-closed crystal structure identical to the WT, but is periplasmic-open in the membrane. The mutant hardly catalyzes transport, but binds galactosides from either side of the membrane with the same affinity and is resistant to site-directed proteolysis relative to the pseudo-WT. Site-directed alkylation was also applied to 11 single-Cys mutants in Cys154 → Gly LacY in right-side-out membrane vesicles or after solubilization and purification in dodecyl-β-D-maltopyranoside (DDM). Unlike the pseudo-WT, Cys replacements on the periplasmic side of the Cys154 → Gly mutant label rapidly in the membrane without sugar, but labeling decreases markedly after the mutant proteins are purified. Thus, Cys154 → Gly LacY likely favors a higher-energy intermediate periplasmic-open conformation in situ, but collapses to a lower-energy periplasmic-closed conformation in DDM after purification. Notably, branched-chain or neopentyl glycol maltoside detergents stabilize Cys154 → Gly LacY in the membrane-embedded form.
Physico-Mechanical Properties of Coprocessed Excipient MicroceLac® 100 by DM(3) Approach.
Haware, Rahul V; Kancharla, Joseph P; Udupa, Aishwarya K; Staton, Scott; Gupta, Mali R; Al-Achi, Antoine; Stagner, William C
2015-11-01
To determine the effect of relative humidity (RH) and hydroxypropyl methylcellulose (HPMC) on the physico-mechanical properties of coprocessed MacroceLac(®) 100 using 'DM(3)' approach. Effects of RH and 5% w/w HPMC on MacroceLac(®) 100 Compressibility Index (CI) and tablet mechanical strength (TMS) were evaluated by 'DM(3)'. The 'DM(3)' approach evaluates material properties by combining 'design of experiments', material's 'macroscopic' properties, 'molecular' properties, and 'multivariate analysis' tools. A 4X4 full-factorial experimental design was used to study the relationship of MacroceLac(®) 100 molecular properties (moisture content, dehydration, crystallization, fusion enthalpy, and moisture uptake) and macroscopic particle size and shape on CI and TMS. A physical binary mixture (PBM) of similar composition to MacroceLac(®) 100 was also evaluated. Multivariate analysis of variance (MANOVA), principle component analysis, and partial least squares (PLS) were used to analyze the data. MANOVA CI ranking was: PBM-HPMC > PBM > MicroceLac(®)100 > MicroceLac(®)100-HPMC (p TMS values were lower than MicroceLac(®)100 and MicroceLac(®)100-HPMC (p TMS. Significant MicroceLac(®)100 changes occurred with % RH exposure affecting performance attributes. HPMC physical addition did not prevent molecular or macroscopic matrix changes.
Burkholderia contaminans Biofilm Regulating Operon and Its Distribution in Bacterial Genomes.
Voronina, Olga L; Kunda, Marina S; Ryzhova, Natalia N; Aksenova, Ekaterina I; Semenov, Andrey N; Romanova, Yulia M; Gintsburg, Alexandr L
2016-01-01
Biofilm formation by Burkholderia spp. is a principal cause of lung chronic infections in cystic fibrosis patients. A "lacking biofilm production" (LBP) strain B. contaminans GIMC4587:Bct370-19 has been obtained by insertion modification of clinical strain with plasposon mutagenesis. It has an interrupted transcriptional response regulator (RR) gene. The focus of our investigation was a two-component signal transduction system determination, including this RR. B. contaminans clinical and LBP strains were analyzed by whole genome sequencing and bioinformatics resources. A four-component operon (BiofilmReg) has a key role in biofilm formation. The relative location (i.e., by being separated by another gene) of RR and histidine kinase genes is unique in BiofilmReg. Orthologs were found in other members of the Burkholderiales order. Phylogenetic analysis of strains containing BiofilmReg operons demonstrated evidence for earlier inheritance of a three-component operon. During further evolution one lineage acquired a fourth gene, whereas others lost the third component of the operon. Mutations in sensor domains have created biodiversity which is advantageous for adaptation to various ecological niches. Different species Burkholderia and Achromobacter strains all demonstrated similar BiofilmReg operon structure. Therefore, there may be an opportunity to develop a common drug which is effective for treating all these causative agents.
Intelligent Local Avoided Collision (iLAC) MAC Protocol for Very High Speed Wireless Network
Hieu, Dinh Chi; Masuda, Akeo; Rabarijaona, Verotiana Hanitriniala; Shimamoto, Shigeru
Future wireless communication systems aim at very high data rates. As the medium access control (MAC) protocol plays the central role in determining the overall performance of the wireless system, designing a suitable MAC protocol is critical to fully exploit the benefit of high speed transmission that the physical layer (PHY) offers. In the latest 802.11n standard [2], the problem of long overhead has been addressed adequately but the issue of excessive colliding transmissions, especially in congested situation, remains untouched. The procedure of setting the backoff value is the heart of the 802.11 distributed coordination function (DCF) to avoid collision in which each station makes its own decision on how to avoid collision in the next transmission. However, collision avoidance is a problem that can not be solved by a single station. In this paper, we introduce a new MAC protocol called Intelligent Local Avoided Collision (iLAC) that redefines individual rationality in choosing the backoff counter value to avoid a colliding transmission. The distinguishing feature of iLAC is that it fundamentally changes this decision making process from collision avoidance to collaborative collision prevention. As a result, stations can avoid colliding transmissions with much greater precision. Analytical solution confirms the validity of this proposal and simulation results show that the proposed algorithm outperforms the conventional algorithms by a large margin.
Fucose-Mediated Transcriptional Activation of the fcs Operon by FcsR in Streptococcus pneumoniae
Manzoor, Irfan; Shafeeq, Sulman; Afzal, Muhammad; Kuipers, Oscar P
2015-01-01
In this study, we explore the impact of fucose on the transcriptome of S. pneumoniae D39. The expression of various genes and operons, including the fucose uptake PTS and utilization operon (fcs operon) was altered in the presence of fucose. By means of quantitative RT-PCR and β-galactosidase
The post-transcriptional operon
DEFF Research Database (Denmark)
Tenenbaum, Scott A.; Christiansen, Jan; Nielsen, Henrik
2011-01-01
model (PTO) is used to describe data from an assortment of methods (e.g. RIP-Chip, CLIP-Chip, miRNA profiling, ribosome profiling) that globally address the functionality of mRNA. Several examples of post-transcriptional operons have been documented in the literature and demonstrate the usefulness...... of the model in identifying new participants in cellular pathways as well as in deepening our understanding of cellular responses....
Role of leader peptide synthesis in tryptophanase operon expression in Escherichia coli K-12.
Stewart, V; Yanofsky, C
1986-01-01
We used site-directed mutagenesis to replace the Escherichia coli tryptophanase (tna) operon leader peptide start codon with AUC. This change greatly decreased the uninduced rate of tna operon expression, and it also lowered the response to inducer. We conclude that leader peptide synthesis plays an essential role in tna operon expression.
Infrared polarimetry and photometry of BL Lac objects
Energy Technology Data Exchange (ETDEWEB)
Impey, C D; Brand, P W.J.L. [Edinburgh Univ. (UK); Wolstencroft, R D; Williams, P M [Royal Observatory, Edinburgh (UK)
1982-07-01
Infrared polarimetry and photometry have been obtained for a sample of 18 BL Lac objects. The data covers a period of one year and is part of a continuing monitoring programme; all observations were in the J,H and K wavebands. Large and variable degrees of polarization are a common property of the sample. Two BL Lac objects show wavelength-dependent polarization, with the polarization increasing towards shorter wavelengths, and two objects show evidence for position angle rotations over a five-day period. The relationship between changes in polarized and total flux is also discussed. The BL Lac objects cover an enormous range of infrared luminosity; the three most luminous having Lsub(IR) > 10/sup 46/ erg s/sup -1/ and the other end of the range having infrared luminosities similar to normal elliptical galaxies. These are the first published infrared polarimetric observations for eight of the sample.
Directory of Open Access Journals (Sweden)
Juliana Teixeira de Magalhães
2005-06-01
Full Text Available Ribosomal operons are great tools for microbe community characterization and for microorganisms relationship study, particularly in the case of the acid lactic bacteria. The ribosomal operon of the probiotic strain Lactobacillus delbrueckii UFV H2b20 was partially characterized. A genomic library of this strain was constructed and the clones with partial ribosomal operon were sub-cloned using the shot-gun method for subsequent sequencing with the forward primer. The sequence analysis revealed that the 3' end of the rDNA 16S was following by the short spacer region 1 (16S-23S and that the 3' end of the rDNA 23S was following by the short spacer region 2 (23S-5S, which preceded the rDNA 5S. In the flanking region of the rDNA 5S gene of this operon rrn, a region encoding six tRNAs was detected.Operons ribossomais têm sido instrumentos importantes na caracterização de comunidades microbianas e no estudo de relacionamentos entre microrganismos, principalmente em bactérias do ácido láctico. Operons ribossomais da linhagem probiótica, Lactobacillus delbrueckii UFV H2b20, foram parcialmente caracterizados. Um banco genômico da linhagem foi construído e os clones, contendo parte do operon ribossomal, foram subclonados pelo método de "shot gun", para em seguida serem seqüenciados com primer "forward". As seqüências indicaram a presença da extremidade 3' do rDNA 16S seguida da região espaçadora curta 1 (16S-23S e a presença da extremidade 3' do rDNA 23S seguido da região espaçadora 2 (23S-5S, que por sua vez precedia o rDNA 5S. Adjacente ao gene rDNA 5S deste operon rrn uma região codificadora de 6 tRNAs foi detectada.
Reichel, J M; Bedenk, B T; Gassen, N C; Hafner, K; Bura, S A; Almeida-Correa, S; Genewsky, A; Dedic, N; Giesert, F; Agarwal, A; Nave, K-A; Rein, T; Czisch, M; Deussing, J M; Wotjak, C T
2016-10-01
Expression of the lacZ-sequence is a widely used reporter-tool to assess the transgenic and/or transfection efficacy of a target gene in mice. Once activated, lacZ is permanently expressed. However, protein accumulation is one of the hallmarks of neurodegenerative diseases. Furthermore, the protein product of the bacterial lacZ gene is ß-galactosidase, an analog to the mammalian senescence-associated ß-galactosidase, a molecular marker for aging. Therefore we studied the behavioral, structural and molecular consequences of lacZ expression in distinct neuronal sub-populations. lacZ expression in cortical glutamatergic neurons resulted in severe impairments in hippocampus-dependent memory accompanied by marked structural alterations throughout the CNS. In contrast, GFP expression or the expression of the ChR2/YFP fusion product in the same cell populations did not result in either cognitive or structural deficits. GABAergic lacZ expression caused significantly decreased hyper-arousal and mild cognitive deficits. Attenuated structural and behavioral consequences of lacZ expression could also be induced in adulthood, and lacZ transfection in neuronal cell cultures significantly decreased their viability. Our findings provide a strong caveat against the use of lacZ reporter mice for phenotyping studies and point to a particular sensitivity of the hippocampus formation to detrimental consequences of lacZ expression. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.
Optical Spectra Evolution of BL Lac Objects XW Bi1,∗ , BZ Wang2
Indian Academy of Sciences (India)
low-frequency peaked BL Lac objects (LBLs) is steeper than the high- frequency peaked BL Lac ... vision of BL Lac objects. Many investigators .... We are grateful to the Scientific Research Foundation of the Education Department of Yunnan ...
Flat radio-spectrum galaxies and BL Lacs I. Core properties
Dennett-Thorpe, J; Marcha, MJ
This paper concerns the relationship of BL Lacs and flat-spectrum weak emission-line galaxies. We compare the weak emission-line galaxies and the BL Lacs in a sample of 57 flat-spectrum objects (Marcha et al. 1996), using high-frequency radio and non-thermal optical flux densities, spectral indices
Regulation of gene expression: Cryptic β-glucoside (bgl operon of Escherichia coli as a paradigm
Directory of Open Access Journals (Sweden)
Dharmesh Harwani
2014-12-01
Full Text Available Bacteria have evolved various mechanisms to extract utilizable substrates from available resources and consequently acquire fitness advantage over competitors. One of the strategies is the exploitation of cryptic cellular functions encoded by genetic systems that are silent under laboratory conditions, such as the bgl (β-glucoside operon of E. coli. The bgl operon of Escherichia coli, involved in the uptake and utilization of aromatic β-glucosides salicin and arbutin, is maintained in a silent state in the wild type organism by the presence of structural elements in the regulatory region. This operon can be activated by mutations that disrupt these negative elements. The fact that the silent bgl operon is retained without accumulating deleterious mutations seems paradoxical from an evolutionary view point. Although this operon appears to be silent, specific physiological conditions might be able to regulate its expression and/or the operon might be carrying out function(s apart from the utilization of aromatic β-glucosides. This is consistent with the observations that the activated operon confers a Growth Advantage in Stationary Phase (GASP phenotype to Bgl+ cells and exerts its regulation on at least twelve downstream target genes.
Regulation of gene expression: cryptic β-glucoside (bgl) operon of Escherichia coli as a paradigm.
Harwani, Dharmesh
2014-01-01
Bacteria have evolved various mechanisms to extract utilizable substrates from available resources and consequently acquire fitness advantage over competitors. One of the strategies is the exploitation of cryptic cellular functions encoded by genetic systems that are silent under laboratory conditions, such as the bgl (β-glucoside) operon of E. coli. The bgl operon of Escherichia coli, involved in the uptake and utilization of aromatic β-glucosides salicin and arbutin, is maintained in a silent state in the wild type organism by the presence of structural elements in the regulatory region. This operon can be activated by mutations that disrupt these negative elements. The fact that the silent bgl operon is retained without accumulating deleterious mutations seems paradoxical from an evolutionary view point. Although this operon appears to be silent, specific physiological conditions might be able to regulate its expression and/or the operon might be carrying out function(s) apart from the utilization of aromatic β-glucosides. This is consistent with the observations that the activated operon confers a Growth Advantage in Stationary Phase (GASP) phenotype to Bgl(+) cells and exerts its regulation on at least twelve downstream target genes.
Operon Gene Order Is Optimized for Ordered Protein Complex Assembly
Wells, Jonathan N.; Bergendahl, L. Therese; Marsh, Joseph A.
2016-01-01
Summary The assembly of heteromeric protein complexes is an inherently stochastic process in which multiple genes are expressed separately into proteins, which must then somehow find each other within the cell. Here, we considered one of the ways by which prokaryotic organisms have attempted to maximize the efficiency of protein complex assembly: the organization of subunit-encoding genes into operons. Using structure-based assembly predictions, we show that operon gene order has been optimized to match the order in which protein subunits assemble. Exceptions to this are almost entirely highly expressed proteins for which assembly is less stochastic and for which precisely ordered translation offers less benefit. Overall, these results show that ordered protein complex assembly pathways are of significant biological importance and represent a major evolutionary constraint on operon gene organization. PMID:26804901
Incorporation of a horizontally transferred gene into an operon during cnidarian evolution.
Directory of Open Access Journals (Sweden)
Catherine E Dana
Full Text Available Genome sequencing has revealed examples of horizontally transferred genes, but we still know little about how such genes are incorporated into their host genomes. We have previously reported the identification of a gene (flp that appears to have entered the Hydra genome through horizontal transfer. Here we provide additional evidence in support of our original hypothesis that the transfer was from a unicellular organism, and we show that the transfer occurred in an ancestor of two medusozoan cnidarian species. In addition we show that the gene is part of a bicistronic operon in the Hydra genome. These findings identify a new animal phylum in which trans-spliced leader addition has led to the formation of operons, and define the requirements for evolution of an operon in Hydra. The identification of operons in Hydra also provides a tool that can be exploited in the construction of transgenic Hydra strains.
Baseline surveys of Lac Bay benthic and fish communities, Bonaire
Debrot, A.O.; Hylkema, A.; Vogelaar, W.; Meesters, H.W.G.; Engel, M.S.; Leon, R.; Prud'homme van Reine, W.F.; Nagelkerken, I.
2012-01-01
Lac Bay is a clear-water, 5 m deep shallow tropical lagoon of 7 km2 opening onto the wave and wind exposed east coast of the island of Bonaire, southern Caribbean. Over the last decades land reclamation by mangroves in Lac has been expanding the surface of turbid, saline backwaters into the bay at
The REX survey as a Tool to Test the Beaming Model for BL Lacs
Caccianiga, A.; della Ceca, R.; Gioia, I. M.; Maccacaro, T.; Wolter, A.
We present the preliminary properties of the BL Lacs discovered in the REX survey (Caccianiga et al. 1998). In particular, we discuss a few sources with optical spectral properties ``intermediate'' between those of BL Lacs and those of elliptical galaxies. These objects could harbour weak (in the optical band) sources of non-thermal continuum in their nuclei and, if confirmed, they could represent the faint tail of the BL Lac population. The existence of such ``weak'' BL Lacs is matter of discussion in recent literature (e.g. Marcha et al. 1996) and could lead to a revision of the defining criteria of a BL Lac and, consequently, of their cosmological and statistical properties.
The Radio-optical Spectra of BL Lacs and Possible Relatives
Dennett-Thorpe, J.
I consider the suggestion that, in a complete sample of flat-spectrum radio sources with available optical spectra (Marcha et al 1996), the strong emission line objects, or those with passive elliptical spectra are close relatives of the BL Lacs. New observations at four frequencies from 8 to 43GHz are presented, together with evidence for radio variability. Combined with other radio and optical data from the literature, we are able to construct the non-thermal SEDs and use these to address the questions: are the optically passive objects potentially `unrecognised' BL Lacs (either intrinsically weak and/or hidden by starlight)? What is the relationship between the surprising number of strong emission-line objects and the BL Lacs?
Structural organization of the transfer RNA operon I of Vibrio cholerae
Indian Academy of Sciences (India)
Nine major transfer RNA (tRNA) gene clusters were analysed in various Vibrio cholerae strains. Of these, only the tRNA operon I was found to differ significantly in V. cholerae classical (sixth pandemic) and El Tor (seventh pandemic) strains. Amongst the sixteen tRNA genes contained in this operon, genes for tRNA Gln3 ...
Highly divergent 16S rRNA sequences in ribosomal operons of Scytonema hyalinum (Cyanobacteria.
Directory of Open Access Journals (Sweden)
Jeffrey R Johansen
Full Text Available A highly divergent 16S rRNA gene was found in one of the five ribosomal operons present in a species complex currently circumscribed as Scytonema hyalinum (Nostocales, Cyanobacteria using clone libraries. If 16S rRNA sequence macroheterogeneity among ribosomal operons due to insertions, deletions or truncation is excluded, the sequence heterogeneity observed in S. hyalinum was the highest observed in any prokaryotic species thus far (7.3-9.0%. The secondary structure of the 16S rRNA molecules encoded by the two divergent operons was nearly identical, indicating possible functionality. The 23S rRNA gene was examined for a few strains in this complex, and it was also found to be highly divergent from the gene in Type 2 operons (8.7%, and likewise had nearly identical secondary structure between the Type 1 and Type 2 operons. Furthermore, the 16S-23S ITS showed marked differences consistent between operons among numerous strains. Both operons have promoter sequences that satisfy consensus requirements for functional prokaryotic transcription initiation. Horizontal gene transfer from another unknown heterocytous cyanobacterium is considered the most likely explanation for the origin of this molecule, but does not explain the ultimate origin of this sequence, which is very divergent from all 16S rRNA sequences found thus far in cyanobacteria. The divergent sequence is highly conserved among numerous strains of S. hyalinum, suggesting adaptive advantage and selective constraint of the divergent sequence.
Local gene regulation details a recognition code within the LacI transcriptional factor family.
Directory of Open Access Journals (Sweden)
Francisco M Camas
2010-11-01
Full Text Available The specific binding of regulatory proteins to DNA sequences exhibits no clear patterns of association between amino acids (AAs and nucleotides (NTs. This complexity of protein-DNA interactions raises the question of whether a simple set of wide-coverage recognition rules can ever be identified. Here, we analyzed this issue using the extensive LacI family of transcriptional factors (TFs. We searched for recognition patterns by introducing a new approach to phylogenetic footprinting, based on the pervasive presence of local regulation in prokaryotic transcriptional networks. We identified a set of specificity correlations--determined by two AAs of the TFs and two NTs in the binding sites--that is conserved throughout a dominant subgroup within the family regardless of the evolutionary distance, and that act as a relatively consistent recognition code. The proposed rules are confirmed with data of previous experimental studies and by events of convergent evolution in the phylogenetic tree. The presence of a code emphasizes the stable structural context of the LacI family, while defining a precise blueprint to reprogram TF specificity with many practical applications.
Identification of a locus controlling expression of luminescence genes in Vibrio harveyi.
Martin, M; Showalter, R; Silverman, M
1989-05-01
Mutagenesis with transposon mini-Mulac was used to identify loci containing genes for bioluminescence (lux) in the marine bacterium Vibrio harveyi. Transposon insertions which resulted in a Lux- phenotype were mapped to two unlinked regions of the genome. Region I contained the luxCDABE operon which was previously shown to encode the enzymes luciferase and fatty acid reductase, which are required for light production. The other locus, region II, which was identified for the first time in this study, appeared to have a regulatory function. In Northern blot analysis of mRNA from mutants with defects in this region, no transcription from the luxCDABE operon could be detected. Strains with transposon-generated lux::lacZ gene fusions were used to analyze control of the transcription of these regions. Expression of luminescence in the wild type was strongly influenced by the density of the culture, and in strains with the lacZ indicator gene coupled to the luxCDABE operon, beta-galactosidase synthesis was density dependent. So, transcription of this operon is responsive to a density-sensing mechanism. However, beta-galactosidase synthesis in strains with lacZ fused to the region II transcriptional unit did not respond to cell density. The organization and regulation of the lux genes of V. harveyi are discussed, particularly with regard to the contrasts observed with the lux system of the fish light-organ symbiont Vibrio fischeri.
Hustmyer, Christine M; Simpson, Chelsea A; Olney, Stephen G; Rusch, Douglas B; Bochman, Matthew L; van Kessel, Julia C
2018-06-01
Experimental studies of transcriptional regulation in bacteria require the ability to precisely measure changes in gene expression, often accomplished through the use of reporter genes. However, the boundaries of promoter sequences required for transcription are often unknown, thus complicating the construction of reporters and genetic analysis of transcriptional regulation. Here, we analyze reporter libraries to define the promoter boundaries of the luxCDABE bioluminescence operon and the betIBA-proXWV osmotic stress operon in Vibrio harveyi We describe a new method called r apid a rbitrary PCR i nsertion l ibraries (RAIL) that combines the power of arbitrary PCR and isothermal DNA assembly to rapidly clone promoter fragments of various lengths upstream of reporter genes to generate large libraries. To demonstrate the versatility and efficiency of RAIL, we analyzed the promoters driving expression of the luxCDABE and betIBA-proXWV operons and created libraries of DNA fragments from these loci fused to fluorescent reporters. Using flow cytometry sorting and deep sequencing, we identified the DNA regions necessary and sufficient for maximum gene expression for each promoter. These analyses uncovered previously unknown regulatory sequences and validated known transcription factor binding sites. We applied this high-throughput method to gfp , mCherry , and lacZ reporters and multiple promoters in V. harveyi We anticipate that the RAIL method will be easily applicable to other model systems for genetic, molecular, and cell biological applications. IMPORTANCE Gene reporter constructs have long been essential tools for studying gene regulation in bacteria, particularly following the recent advent of fluorescent gene reporters. We developed a new method that enables efficient construction of promoter fusions to reporter genes to study gene regulation. We demonstrate the versatility of this technique in the model bacterium Vibrio harveyi by constructing promoter libraries
Cop-like operon: Structure and organization in species of the Lactobacillale order
Directory of Open Access Journals (Sweden)
ANGÉLICA REYES
2006-01-01
Full Text Available Copper is an essential and toxic trace metal for bacteria and, therefore, must be tightly regulated in the cell. Enterococcus hirae is a broadly studied model for copper homeostasis. The intracellular copper levels in E. hirae are regulated by the cop operon, which is formed by four genes: copA and copB that encode ATPases for influx and efflux of copper, respectively; copZ that encodes a copper chaperone; and copY, a copper responsive repressor. Since the complete genome sequence for E. hirae is not available, it is possible that other genes may encode proteins involved in copper homeostasis. Here, we identified a cop-like operon in nine species of Lactobacillale order with a known genome sequence. All of them always encoded a CopY-like repressor and a copper ATPase. The alignment of the cop-like operon promoter region revealed two CopY binding sites, one of which was conserved in all strains, and the second was only present in species of Streptococcus genus and L. johnsonii. Additional proteins associated to copper metabolism, CutC and Cupredoxin, also were detected. This study allowed for the description of the structure and organization of the cop operon and discussion of a phylogenetic hypothesis based on the differences observed in this operon's organization and its regulation in Lactobacillale order.
RADIO-WEAK BL LAC OBJECTS IN THE FERMI ERA
Energy Technology Data Exchange (ETDEWEB)
Massaro, F.; Marchesini, E. J. [Dipartimento di Fisica, Università degli Studi di Torino (UniTO), via Pietro Giuria 1, I-10125 Torino (Italy); D’Abrusco, R.; Smith, Howard A. [Smithsonian Astrophysical Observatory, 60 Garden Street, 02138 Cambridge, MA (United States); Masetti, N. [INAF—Istituto di Astrofisica Spaziale e Fisica Cosmica di Bologna, via Gobetti 101, I-40129, Bologna (Italy); Andruchow, I. [Facultad de Ciencias Astronómicas y Geofísicas, Universidad Nacional de La Plata, Paseo del Bosque, B1900FWA, La Plata (Argentina)
2017-01-10
The existence of “radio-weak BL Lac objects” (RWBLs) has been an open question, and has remained unsolved since the discovery that quasars could be radio-quiet or radio-loud. Recently, several groups identified RWBL candidates, mostly found while searching for low-energy counterparts of the unidentified or unassociated gamma-ray sources listed in the Fermi catalogs. Confirming RWBLs is a challenging task since they could be confused with white dwarfs (WDs) or weak emission line quasars (WELQs) when there are not sufficient data to precisely draw their broadband spectral energy distribution, and their classification is mainly based on a featureless optical spectra. Motivated by the recent discovery that Fermi BL Lacs appear to have very peculiar mid-IR emission, we show that it is possible to distinguish between WDs, WELQs, and BL Lacs using the [3.4]–[4.6]–[12] μ m color–color plot built using the WISE magnitudes when the optical spectrum is available. On the basis of this analysis, we identify WISE J064459.38+603131 and WISE J141046.00+740511.2 as the first two genuine RWBLs, both potentially associated with Fermi sources. Finally, to strengthen our identification of these objects as true RWBLs, we present multifrequency observations for these two candidates to show that their spectral behavior is indeed consistent with that of the BL Lac population.
RADIO-WEAK BL LAC OBJECTS IN THE FERMI ERA
International Nuclear Information System (INIS)
Massaro, F.; Marchesini, E. J.; D’Abrusco, R.; Smith, Howard A.; Masetti, N.; Andruchow, I.
2017-01-01
The existence of “radio-weak BL Lac objects” (RWBLs) has been an open question, and has remained unsolved since the discovery that quasars could be radio-quiet or radio-loud. Recently, several groups identified RWBL candidates, mostly found while searching for low-energy counterparts of the unidentified or unassociated gamma-ray sources listed in the Fermi catalogs. Confirming RWBLs is a challenging task since they could be confused with white dwarfs (WDs) or weak emission line quasars (WELQs) when there are not sufficient data to precisely draw their broadband spectral energy distribution, and their classification is mainly based on a featureless optical spectra. Motivated by the recent discovery that Fermi BL Lacs appear to have very peculiar mid-IR emission, we show that it is possible to distinguish between WDs, WELQs, and BL Lacs using the [3.4]–[4.6]–[12] μ m color–color plot built using the WISE magnitudes when the optical spectrum is available. On the basis of this analysis, we identify WISE J064459.38+603131 and WISE J141046.00+740511.2 as the first two genuine RWBLs, both potentially associated with Fermi sources. Finally, to strengthen our identification of these objects as true RWBLs, we present multifrequency observations for these two candidates to show that their spectral behavior is indeed consistent with that of the BL Lac population.
Elucidation of Operon Structures across Closely Related Bacterial Genomes
Li, Guojun
2014-01-01
About half of the protein-coding genes in prokaryotic genomes are organized into operons to facilitate co-regulation during transcription. With the evolution of genomes, operon structures are undergoing changes which could coordinate diverse gene expression patterns in response to various stimuli during the life cycle of a bacterial cell. Here we developed a graph-based model to elucidate the diversity of operon structures across a set of closely related bacterial genomes. In the constructed graph, each node represents one orthologous gene group (OGG) and a pair of nodes will be connected if any two genes, from the corresponding two OGGs respectively, are located in the same operon as immediate neighbors in any of the considered genomes. Through identifying the connected components in the above graph, we found that genes in a connected component are likely to be functionally related and these identified components tend to form treelike topology, such as paths and stars, corresponding to different biological mechanisms in transcriptional regulation as follows. Specifically, (i) a path-structure component integrates genes encoding a protein complex, such as ribosome; and (ii) a star-structure component not only groups related genes together, but also reflects the key functional roles of the central node of this component, such as the ABC transporter with a transporter permease and substrate-binding proteins surrounding it. Most interestingly, the genes from organisms with highly diverse living environments, i.e., biomass degraders and animal pathogens of clostridia in our study, can be clearly classified into different topological groups on some connected components. PMID:24959722
Time-dependent inhomogeneous jet models for BL Lac objects
Marlowe, A. T.; Urry, C. M.; George, I. M.
1992-05-01
Relativistic beaming can explain many of the observed properties of BL Lac objects (e.g., rapid variability, high polarization, etc.). In particular, the broadband radio through X-ray spectra are well modeled by synchrotron-self Compton emission from an inhomogeneous relativistic jet. We have done a uniform analysis on several BL Lac objects using a simple but plausible inhomogeneous jet model. For all objects, we found that the assumed power-law distribution of the magnetic field and the electron density can be adjusted to match the observed BL Lac spectrum. While such models are typically unconstrained, consideration of spectral variability strongly restricts the allowed parameters, although to date the sampling has generally been too sparse to constrain the current models effectively. We investigate the time evolution of the inhomogeneous jet model for a simple perturbation propagating along the jet. The implications of this time evolution model and its relevance to observed data are discussed.
Ho, Wing Sze; Ou, Hong-Yu; Yeo, Chew Chieng; Thong, Kwai Lin
2015-03-17
Strains of Escherichia coli that are non-typeable by pulsed-field gel electrophoresis (PFGE) due to in-gel degradation can influence their molecular epidemiological data. The DNA degradation phenotype (Dnd(+)) is mediated by the dnd operon that encode enzymes catalyzing the phosphorothioation of DNA, rendering the modified DNA susceptible to oxidative cleavage during a PFGE run. In this study, a PCR assay was developed to detect the presence of the dnd operon in Dnd(+) E. coli strains and to improve their typeability. Investigations into the genetic environments of the dnd operon in various E. coli strains led to the discovery that the dnd operon is harboured in various diverse genomic islands. The dndBCDE genes (dnd operon) were detected in all Dnd(+) E. coli strains by PCR. The addition of thiourea improved the typeability of Dnd(+) E. coli strains to 100% using PFGE and the Dnd(+) phenotype can be observed in both clonal and genetically diverse E. coli strains. Genomic analysis of 101 dnd operons from genome sequences of Enterobacteriaceae revealed that the dnd operons of the same bacterial species were generally clustered together in the phylogenetic tree. Further analysis of dnd operons of 52 E. coli genomes together with their respective immediate genetic environments revealed a total of 7 types of genetic organizations, all of which were found to be associated with genomic islands designated dnd-encoding GIs. The dnd-encoding GIs displayed mosaic structure and the genomic context of the 7 islands (with 1 representative genome from each type of genetic organization) were also highly variable, suggesting multiple recombination events. This is also the first report where two dnd operons were found within a strain although the biological implication is unknown. Surprisingly, dnd operons were frequently found in pathogenic E. coli although their link with virulence has not been explored. Genomic islands likely play an important role in facilitating the horizontal
A novel marRAB operon contributes to the rifampicin resistance in Mycobacterium smegmatis.
Zhang, Haiwei; Gao, Long; Zhang, Jiaoling; Li, Weihui; Yang, Min; Zhang, Hua; Gao, Chunhui; He, Zheng-Guo
2014-01-01
The multiple-antibiotic resistance regulator (MarR) plays an important role in modulating bacterial antibiotic resistance. However, the regulatory model of the marRAB operon in mycobacteria remains to be characterized. Here we report that a MarR, encoded by Ms6508, and its marRAB operon specifically contribute to rifampicin (RIF) resistance in Mycobacterium smegmatis. We show that the MarR recognizes a conserved 21-bp palindromic motif and negatively regulates the expression of two ABC transporters in the operon, encoded by Ms6509-6510. Unlike other known drug efflux pumps, overexpression of these two ABC transporters unexpectedly increased RIF sensitivity and deletion of these two genes increased mycobacterial resistance to the antibiotic. No change can be detected for the sensitivity of recombinant mycobacterial strains to three other anti-TB drugs. Furthermore, HPLC experiments suggested that Ms6509-Ms6510 could pump RIF into the mycobacterial cells. These findings indicated that the mycobacterial MarR functions as a repressor and constitutively inhibits the expression of the marRAB operon, which specifically contributes to RIF resistance in M. smegmatis. Therefore, our data suggest a new regulatory mechanism of RIF resistance and also provide the new insight into the regulatory model of a marRAB operon in mycobacteria.
Cursino, Luciana; Galvani, Cheryl D; Athinuwat, Dusit; Zaini, Paulo A; Li, Yaxin; De La Fuente, Leonardo; Hoch, Harvey C; Burr, Thomas J; Mowery, Patricia
2011-10-01
Xylella fastidiosa is an important phytopathogenic bacterium that causes many serious plant diseases, including Pierce's disease of grapevines. Disease manifestation by X. fastidiosa is associated with the expression of several factors, including the type IV pili that are required for twitching motility. We provide evidence that an operon, named Pil-Chp, with genes homologous to those found in chemotaxis systems, regulates twitching motility. Transposon insertion into the pilL gene of the operon resulted in loss of twitching motility (pilL is homologous to cheA genes encoding kinases). The X. fastidiosa mutant maintained the type IV pili, indicating that the disrupted pilL or downstream operon genes are involved in pili function, and not biogenesis. The mutated X. fastidiosa produced less biofilm than wild-type cells, indicating that the operon contributes to biofilm formation. Finally, in planta the mutant produced delayed and less severe disease, indicating that the Pil-Chp operon contributes to the virulence of X. fastidiosa, presumably through its role in twitching motility.
Crisis in LAC : Infrastructure Investment, Employment and the Expectations of Stimulus
Schwartz, Jordan; Andres, Luis; Dragoiu, Georgeta
2009-01-01
Infrastructure investment is a central part of the stimulus plans of the Latin America and the Caribbean (LAC) region as it confronts the growing financial crisis. This paper estimates the potential effects on direct, indirect, and induced employment for different types of infrastructure projects with LAC-specific variables. The analysis finds that the direct and indirect short-term employ...
Predicting metabolic pathways by sub-network extraction.
Faust, Karoline; van Helden, Jacques
2012-01-01
Various methods result in groups of functionally related genes obtained from genomes (operons, regulons, syntheny groups, and phylogenetic profiles), transcriptomes (co-expression groups) and proteomes (modules of interacting proteins). When such groups contain two or more enzyme-coding genes, graph analysis methods can be applied to extract a metabolic pathway that interconnects them. We describe here the way to use the Pathway extraction tool available on the NeAT Web server ( http://rsat.ulb.ac.be/neat/ ) to piece together the metabolic pathway from a group of associated, enzyme-coding genes. The tool identifies the reactions that can be catalyzed by the products of the query genes (seed reactions), and applies sub-graph extraction algorithms to extract from a metabolic network a sub-network that connects the seed reactions. This sub-network represents the predicted metabolic pathway. We describe here the pathway prediction process in a step-by-step way, give hints about the main parametric choices, and illustrate how this tool can be used to extract metabolic pathways from bacterial genomes, on the basis of two study cases: the isoleucine-valine operon in Escherichia coli and a predicted operon in Cupriavidus (Ralstonia) metallidurans.
In vivo biocompatibility of p(HPMAm-lac)-PEG hydrogels hybridized with hyaluronan
Sabbieti, Maria Giovanna; Dubbini, Alessandra; Laus, Fulvio; Paggi, Emanuele; Marchegiani, Andrea; Capitani, Melania; Marchetti, Luigi; Dini, Fabrizio; Vermonden, Tina; Di Martino, Piera; Agas, Dimitrios; Censi, Roberta
2017-01-01
The present study reports on the biocompatibility in vivo after intramuscular and subcutaneous administration in Balb/c mice of vinyl sulphone bearing p(HPMAm-lac1-2)-PEG-p(HPMAm-lac1-2)/thiolated hyaluronic acid hydrogels, designed as novel injectable biomaterials for potential application in the
Can blueshifted Agn spectra explain B L Lac objects
International Nuclear Information System (INIS)
Basu, D.
2009-01-01
B L Lac spectra are almost completely devoid of any emission line, and absorption features are often present based on which redshifts are estimated. Several models have been proposed to explain the spectra, including the unification scheme currently most popular among astronomers. However, there appear to be ambiguities, uncertainties and contradictory results in this model, and many questions remain unanswered. Also, it involves the process of artificially enhancing the continuum to be concentrated to a high level, by the relativistically beaming jet action, in order to submerge the emission lines, partly or completely, to make them appear weak or invisible. Additionally, the sample based on which B L Lac objects have been included in the unification scheme is rather small to be statistically viable. In this context, we present an alternative and much simpler interpretation of the observed spectra of B L Lac objects, both emission and absorption, as blueshifted lines in Agn. Original spectra of fifty six objects available in the current literature are re-analyzed. Nine of these show only a single weak emission line and no absorption feature, while thirty five exhibit no emission feature but several absorption lines, and another twelve show more than one emission line and, in some cases, several absorption lines. It is demonstrated that emission lines in most B L Lac objects are blueshifted out of the visible region, and, hence, not seen at all. Emission lines, when seen, and absorption lines, are blueshifted and are identified with search lines of longer wavelengths that are naturally weak. Blue shifts, in emission and absorption features, are determined for all objects. Various considerations lead to the conclusion that the blue shift interpretation of B L Lac spectra is superior to and more important than the redshift interpretation. A possible explanation of observed blue shifts is presented in the scenario of the ejection process, a well-recognized mechanism
République de Djibouti : lac Assal [بحيرة عسل
Pouyllau , Stéphane
2009-01-01
Vue des berges sud-est du lac Assal (République de Djibouti) le 11 novembre 2009. Le Lac Assal est un lac salé endoréique situé au fond du golfe du Ghoubbet-el-Kharab. D'une superficie de 54 km2 et fermé de la mer par le volcan Ardoukôba, sont altitude est de -153m sous le niveau de la mer.
Multi-Wave Luminosity of High-Synchrotron-Peaked TeV BL Lacs ...
Indian Academy of Sciences (India)
LIR, Lγ) in the radio, near-infrared and γ-ray wave bands for HSP. TeV BL Lacs. The results show that there are significant intrinsic cor- relations between LR and Lγ and between LIR and Lγ in all states. (high/average/low), and suggest that for HSP TeV BL Lacs, the Syn- chrotron Self-Compton radiation (SSC) is the main ...
Contribution of the Chromosomal ccdAB Operon to Bacterial Drug Tolerance.
Gupta, Kritika; Tripathi, Arti; Sahu, Alishan; Varadarajan, Raghavan
2017-10-01
One of the first identified and best-studied toxin-antitoxin (TA) systems in Escherichia coli is the F-plasmid-based CcdAB system. This system is involved in plasmid maintenance through postsegregational killing. More recently, ccdAB homologs have been found on the chromosome, including in pathogenic strains of E. coli and other bacteria. However, the functional role of chromosomal ccdAB genes, if any, has remained unclear. We show that both the native ccd operon of the E. coli O157 strain ( ccd O157 ) and the ccd operon from the F plasmid ( ccd F ), when inserted on the E. coli chromosome, lead to protection from cell death under multiple antibiotic stress conditions through formation of persisters, with the O157 operon showing higher protection. While the plasmid-encoded CcdB toxin is a potent gyrase inhibitor and leads to bacterial cell death even under fully repressed conditions, the chromosomally encoded toxin leads to growth inhibition, except at high expression levels, where some cell death is seen. This was further confirmed by transiently activating the chromosomal ccd operon through overexpression of an active-site inactive mutant of F-plasmid-encoded CcdB. Both the ccd F and ccd O157 operons may share common mechanisms for activation under stress conditions, eventually leading to multidrug-tolerant persister cells. This study clearly demonstrates an important role for chromosomal ccd systems in bacterial persistence. IMPORTANCE A large number of free-living and pathogenic bacteria are known to harbor multiple toxin-antitoxin systems, on plasmids as well as on chromosomes. The F-plasmid CcdAB system has been extensively studied and is known to be involved in plasmid maintenance. However, little is known about the function of its chromosomal counterpart, found in several pathogenic E. coli strains. We show that the native chromosomal ccd operon of the E. coli O157 strain is involved in drug tolerance and confers protection from cell death under multiple
STRUCTURAL ASPECTS REGARDING TO THE IMAGE OF ICE HOTEL BALEA LAC BREND
Directory of Open Access Journals (Sweden)
Marian ZAHARIA
2008-06-01
Full Text Available Applying a poll-based survey provides important information regarding the tourist offer particulars in Bâlea Lac area. On the day the survey is performed its main advantage is also outlined: the fact that this information display a good accuracy, are obtained in a short time span and involving relatively low expenses. Data collection and centralization of the answers provided by interviewed tourists regarding tourism practice in the Bâlea Lac area have led to drawing up distributions that are presented in the paper. Based on the respective information, statistics methods adequate to the study of tourist opinion on the Bâlea Lac Ice Hotel brand image. Several issues have been outlined, regarding the types of respondents based on their category, Romanian or foreigners, from Romania and based on destination countries, function of: the type of stay; the means of information; their answers referring to their first arrival at Bâlea Lac; the degree of destination assessment; their opinion on host reception; their preference for Bâlea Lac; appreciating value for money; age groups; gender; social and professional standing. The image created through the attractions and services provided in the Bâlea Lac tourist area by tourism activities closely related to the Ice Hotel is well appreciated, so that they have opened up a rather favourable expectancy for those willing to come back and for those tempted to try and spend their holidays in the presented hotel.
Multi-wavelength studies of TeV γ-ray emitting BL Lac objects
International Nuclear Information System (INIS)
Kaufmann, Sarah Sabine
2012-01-01
The discovery of TeV γ-ray emission of BL Lac objects gave new insights in the particle acceleration and the emission processes of the highly relativistic jets. To shed light on the conditions in the high energetic jets of the TeV γ-ray emitting BL Lac objects, I have studied in great detail the spectral energy distribution (SED) of sources with different characteristics. BL Lac objects with exceptional very high energy spectra (soft and hard spectra) and with large differences in the emission peak frequencies, to cover the different classes of BL Lac objects, have been chosen. The basic aim of this thesis was, to study with new, simultaneous multi- avelength (MWL) observations, if the emission processes of these extreme cases of TeV BL Lac objects can be explained by the synchrotron Self-Compton (SSC) model which is well established for the class of BL Lac objects at lower energies. We proposed MWL observations in the optical, UV and X-ray regime, to be conducted simultaneous to very high energy observations with the H.E.S.S. experiment, to study the emission processes. Simultaneous observations are crucial, since BL Lac objects are variable at all wavebands. I have analysed the MWL observations and conducted detailed variability and spectral studies in each wavelength range. The different kind of absorption at each wavelength as well as the influence of the host galaxy of the AGN has been considered to obtain the intrinsic jet spectrum. I have then applied the commonly used theoretical jet model, the SSC model, to the SED. I conducted a MWL campaign on a BL Lac object with the softest TeV spectrum, PKS 2005-489, during which it was observed in a very bright X-ray state. The good spectral coverage of the emission peaks allowed a detailed study of the SSC model. The extreme BL Lac object 1ES 0229+200 exhibits a hard intrinsic TeV spectrum. With my MWL campaign I found a clear cut-off in the optical range and therefore a high minimum Lorentz factor is needed to
Multi-wavelength studies of TeV γ-ray emitting BL Lac objects
Energy Technology Data Exchange (ETDEWEB)
Kaufmann, Sarah Sabine
2012-12-21
The discovery of TeV γ-ray emission of BL Lac objects gave new insights in the particle acceleration and the emission processes of the highly relativistic jets. To shed light on the conditions in the high energetic jets of the TeV γ-ray emitting BL Lac objects, I have studied in great detail the spectral energy distribution (SED) of sources with different characteristics. BL Lac objects with exceptional very high energy spectra (soft and hard spectra) and with large differences in the emission peak frequencies, to cover the different classes of BL Lac objects, have been chosen. The basic aim of this thesis was, to study with new, simultaneous multi- avelength (MWL) observations, if the emission processes of these extreme cases of TeV BL Lac objects can be explained by the synchrotron Self-Compton (SSC) model which is well established for the class of BL Lac objects at lower energies. We proposed MWL observations in the optical, UV and X-ray regime, to be conducted simultaneous to very high energy observations with the H.E.S.S. experiment, to study the emission processes. Simultaneous observations are crucial, since BL Lac objects are variable at all wavebands. I have analysed the MWL observations and conducted detailed variability and spectral studies in each wavelength range. The different kind of absorption at each wavelength as well as the influence of the host galaxy of the AGN has been considered to obtain the intrinsic jet spectrum. I have then applied the commonly used theoretical jet model, the SSC model, to the SED. I conducted a MWL campaign on a BL Lac object with the softest TeV spectrum, PKS 2005-489, during which it was observed in a very bright X-ray state. The good spectral coverage of the emission peaks allowed a detailed study of the SSC model. The extreme BL Lac object 1ES 0229+200 exhibits a hard intrinsic TeV spectrum. With my MWL campaign I found a clear cut-off in the optical range and therefore a high minimum Lorentz factor is needed to
Complex genomic rearrangement in CCS-LacZ transgenic mice.
Stroud, Dina Myers; Darrow, Bruce J; Kim, Sang Do; Zhang, Jie; Jongbloed, Monique R M; Rentschler, Stacey; Moskowitz, Ivan P G; Seidman, Jonathan; Fishman, Glenn I
2007-02-01
The cardiac conduction system (CCS)-lacZ insertional mouse mutant strain genetically labels the developing and mature CCS. This pattern of expression is presumed to reflect the site of transgene integration rather than regulatory elements within the transgene proper. We sought to characterize the genomic structure of the integration locus and identify nearby gene(s) that might potentially confer the observed CCS-specific transcription. We found rearrangement of chromosome 7 between regions D1 and E1 with altered transcription of multiple genes in the D1 region. Several lines of evidence suggested that regulatory elements from at least one gene, Slco3A1, influenced CCS-restricted reporter gene expression. In embryonic hearts, Slco3A1 was expressed in a spatial pattern similar to the CCS-lacZ transgene and was similarly neuregulin-responsive. At later stages, however, expression patterns of the transgene and Slco3A1 diverged, suggesting that the Slco3A1 locus may be necessary, but not sufficient to confer CCS-specific transgene expression in the CCS-lacZ line. (c) 2007 Wiley-Liss, Inc.
Expression profile of mce4 operon of Mycobacterium tuberculosis following environmental stress.
Rathor, Nisha; Garima, Kushal; Sharma, Naresh Kumar; Narang, Anshika; Varma-Basil, Mandira; Bose, Mridula
2016-09-01
The mce4 operon is one of the four mce operons with eight genes (yrbE4A, yrbE4B, mce4A, mce4B, mce4C, mce4D, mce4E and mce4F) of Mycobacterium tuberculosis. It expresses in the later phase of infection and imports cholesterol for long term survival of the bacilli. To cause latent infection, M. tuberculosis undergoes metabolic reprogramming of its genes to survive in the hostile environment like low availability of oxygen and nutrition depletion inside the host. To analyze real time expression profile of mce4 operon under various stress conditions. M. tuberculosis H37Rv was exposed to surface stress (0.1% SDS for 30min and 90min in late log and stationary phase of culture), hypoxia (5, 10, 15 and 20days) and grown in the presence of either glycerol or cholesterol as sole source of carbon. The expression profile of genes of mce4 operon was analyzed by real time PCR. Surface stress induced expression of mce4C and yrbE4B in late log phase on 30min and 90min exposure respectively. The SDS exposure for 30min induced mce4C, mce4D and mce4F in stationary phase. All eight genes were induced significantly on 10th and 15th days of hypoxia and in the presence of cholesterol. Hypoxia and cholesterol are potent factors for the expression of mce4 operon of M. tuberculosis. Copyright © 2016. Published by Elsevier Ltd.
Prevalence of transcription promoters within archaeal operons and coding sequences.
Koide, Tie; Reiss, David J; Bare, J Christopher; Pang, Wyming Lee; Facciotti, Marc T; Schmid, Amy K; Pan, Min; Marzolf, Bruz; Van, Phu T; Lo, Fang-Yin; Pratap, Abhishek; Deutsch, Eric W; Peterson, Amelia; Martin, Dan; Baliga, Nitin S
2009-01-01
Despite the knowledge of complex prokaryotic-transcription mechanisms, generalized rules, such as the simplified organization of genes into operons with well-defined promoters and terminators, have had a significant role in systems analysis of regulatory logic in both bacteria and archaea. Here, we have investigated the prevalence of alternate regulatory mechanisms through genome-wide characterization of transcript structures of approximately 64% of all genes, including putative non-coding RNAs in Halobacterium salinarum NRC-1. Our integrative analysis of transcriptome dynamics and protein-DNA interaction data sets showed widespread environment-dependent modulation of operon architectures, transcription initiation and termination inside coding sequences, and extensive overlap in 3' ends of transcripts for many convergently transcribed genes. A significant fraction of these alternate transcriptional events correlate to binding locations of 11 transcription factors and regulators (TFs) inside operons and annotated genes-events usually considered spurious or non-functional. Using experimental validation, we illustrate the prevalence of overlapping genomic signals in archaeal transcription, casting doubt on the general perception of rigid boundaries between coding sequences and regulatory elements.
Development of a "Lac" Operon Concept Inventory (LOCI)
Stefanski, Katherine M.; Gardner, Grant E.; Seipelt-Thiemann, Rebecca L.
2016-01-01
Concept inventories (CIs) are valuable tools for educators that assess student achievement and identify misconceptions held by students. Results of student responses can be used to adjust or develop new instructional methods for a given topic. The regulation of gene expression in both prokaryotes and eukaryotes is an important concept in genetics…
clpC operon regulates cell architecture and sporulation in Bacillus anthracis.
Singh, Lalit K; Dhasmana, Neha; Sajid, Andaleeb; Kumar, Prasun; Bhaduri, Asani; Bharadwaj, Mitasha; Gandotra, Sheetal; Kalia, Vipin C; Das, Taposh K; Goel, Ajay K; Pomerantsev, Andrei P; Misra, Richa; Gerth, Ulf; Leppla, Stephen H; Singh, Yogendra
2015-03-01
The clpC operon is known to regulate several processes such as genetic competence, protein degradation and stress survival in bacteria. Here, we describe the role of clpC operon in Bacillus anthracis. We generated knockout strains of the clpC operon genes to investigate the impact of CtsR, McsA, McsB and ClpC deletion on essential processes of B. anthracis. We observed that growth, cell division, sporulation and germination were severely affected in mcsB and clpC deleted strains, while none of deletions affected toxin secretion. Growth defect in these strains was pronounced at elevated temperature. The growth pattern gets restored on complementation of mcsB and clpC in respective mutants. Electron microscopic examination revealed that mcsB and clpC deletion also causes defect in septum formation leading to cell elongation. These vegetative cell deformities were accompanied by inability of mutant strains to generate morphologically intact spores. Higher levels of polyhydroxybutyrate granules accumulation were also observed in these deletion strains, indicating a defect in sporulation process. Our results demonstrate, for the first time, the vital role played by McsB and ClpC in physiology of B. anthracis and open up further interest on this operon, which might be of importance to success of B. anthracis as pathogen. © 2014 Society for Applied Microbiology and John Wiley & Sons Ltd.
Jansen, M. D.; Bosch, T.; Jansen, W. T. M.; Schouls, L.; Jonker, M. J.; Boel, C. H. E.
2016-01-01
The distinct epidemiology of original hospital-associated methicillin-resistant Staphylococcus aureus (HA-MRSA) and early community-associated MRSA (CA-MRSA) is largely unexplained. S. aureus carries either five or six rRNA operon copies. Evidence is provided for a scenario in which MRSA has adapted to the hospital environment by rRNA operon loss (six to five copies) due to antibiotic pressure. Early CA-MRSA, in contrast, results from wild-type methicillin-susceptible S. aureus (MSSA) that acquired mecA without loss of an rRNA operon. Of the HA-MRSA isolates (n = 77), 67.5% had five rRNA operon copies, compared to 23.2% of the CA-MRSA isolates (n = 69) and 7.7% of MSSA isolates (n = 195) (P operon copies. For all subsets, a correlation between resistance profile and rRNA copy number was found. Furthermore, we showed that in vitro antibiotic pressure may result in rRNA operon copy loss. We also showed that without antibiotic pressure, S. aureus isolates containing six rRNA copies are more fit than isolates with five copies. We conclude that HA-MRSA and cystic fibrosis isolates most likely have adapted to an environment with high antibiotic pressure by the loss of an rRNA operon copy. This loss has facilitated resistance development, which promoted survival in these niches. However, strain fitness decreased, which explains their lack of success in the community. In contrast, CA-MRSA isolates retained six rRNA operon copies, rendering them fitter and thereby able to survive and spread in the community. PMID:27671073
CcpA affects expression of the groESL and dnaK operons in Lactobacillus plantarum
Directory of Open Access Journals (Sweden)
Marasco Rosangela
2006-11-01
Full Text Available Abstract Background Lactic acid bacteria (LAB are widely used in food industry and their growth performance is important for the quality of the fermented product. During industrial processes changes in temperature may represent an environmental stress to be overcome by starters and non-starters LAB. Studies on adaptation to heat shock have shown the involvement of the chaperon system-proteins in various Gram-positive bacteria. The corresponding operons, namely the dnaK and groESL operons, are controlled by a negative mechanism involving the HrcA repressor protein binding to the cis acting element CIRCE. Results We studied adaptation to heat shock in the lactic acid bacterium Lactobacillus plantarum. The LM3-2 strain, carrying a null mutation in the ccpA gene, encoding the catabolite control protein A (CcpA, showed a lower percent of survival to high temperature with respect to the LM3 wild type strain. Among proteins differentially expressed in the two strains, the GroES chaperon was more abundant in the wild type strain compared to the mutant strain under standard growth conditions. Transcriptional studies showed that class I heat shock operons were differentially expressed upon heat shock in both strains. Indeed, the dnaK and groESL operons were induced about two times more in the LM3 strain compared to the LM3-2 strain. Analysis of the regulatory region of the two operons showed the presence of cre sequences, putative binding sites for the CcpA protein. Conclusion The L. plantarum dnaK and groESL operons are characterized by the presence of the cis acting sequence CIRCE in the promoter region, suggesting a negative regulation by the HrcA/CIRCE system, which is a common type of control among the class I heat shock operons of Gram-positive bacteria. We found an additional system of regulation, based on a positive control exerted by the CcpA protein, which would interact with cre sequences present in the regulatory region of the dnaK and gro
Laccase 1 gene from Plutella xylostella (PxLac1) and its functions in humoral immune response.
Wang, Ze-Hua; Hu, Rong-Min; Ye, Xi-Qian; Huang, Jian-Hua; Chen, Xue-Xin; Shi, Min
Laccase (EC 1.10.3.2) is a phenoloxidase found in many insect species. The Laccase 1 gene from Plutella xylostella (PxLac1) was cloned, and its expression patterns and functions were determined using qPCR and RNAi methods. The results showed that the expression levels of PxLac1 were consistently high in all larval stages, and the most abundant was in the midgut during the 4th instar stage. Moreover, the expression of PxLac1 was up-regulated in response to bacterial infection, and decreased 24 h after being parasitized by Cotesia vestalis. Further analyses indicated that the effect of parasitization on PxLac1 was induced by active C. vestalis Bracovirus (CvBV). Haemocyte-free hemolymph phenoloxidase (PO) activity was suppressed when PxLac1 was treated with RNAi. Our results provide evidence for a connection between the Laccase 1 gene and insect immunity, and revealed that parasitoid polydnavirus suppresses host PO activity via PxLac1 regulation. Copyright © 2018. Published by Elsevier Ltd.
Transcription and translation of the rpsJ, rplN and rRNA operons of the tubercle bacillus.
Cortes, Teresa; Cox, Robert Ashley
2015-04-01
Several species of the genus Mycobacterium are human pathogens, notably the tubercle bacillus (Mycobacterium tuberculosis). The rate of proliferation of a bacterium is reflected in the rate of ribosome synthesis. This report describes a quantitative analysis of the early stages of the synthesis of ribosomes of M. tuberculosis. Specifically, the roles of three large operons, namely: the rrn operon (1.7 microns) encoding rrs (16S rRNA), rrl (23S rRNA) and rrf (5S rRNA); the rpsJ operon (1.93 microns), which encodes 11 ribosomal proteins; and the rplN operon (1.45 microns), which encodes 10 ribosomal proteins. A mathematical framework based on properties of population-average cells was developed to identify the number of transcripts of the rpsJ and rplN operons needed to maintain exponential growth. The values obtained were supported by RNaseq data. The motif 5'-gcagac-3' was found close to 5' end of transcripts of mycobacterial rplN operons, suggesting it may form part of the RpsH feedback binding site because the same motif is present in the ribosome within the region of rrs that forms the binding site for RpsH. Medical Research Council.
DEFF Research Database (Denmark)
Danielsen, S; Kilstrup, M; Barilla, K
1992-01-01
. A two-codon overlap between the two reading frames indicates that they constitute an operon. Transcription of the operon was found to be regulated by exogenous purines. Polypeptides specified by each of the two reading frames were expressed in minicells, and the codB gene product was found to be highly...
Oxygen sensitivity of the nifLA promoter of Klebsiella pneumoniae.
Kong, Q T; Wu, Q L; Ma, Z F; Shen, S C
1986-01-01
Oxygen sensitivity of the nifLA promoter of Klebsiella pneumoniae has been demonstrated. Studies on the oxygen regulation of nifB-lacZ and nifH-lacZ fusions in the presence of the nifLA operon, which contains either an intact or a deleted nifL gene, indicate that possibly both the nifL promoter and the nifL product are responsible for nif repression by oxygen.
Zhou, Yan Yan; Zhang, Hong Zhi; Liang, Wei Li; Zhang, Li Juan; Zhu, Jun; Kan, Biao
2013-10-01
The complex of the cyclic AMP receptor protein (CRP) and cAMP is an important transcriptional regulator of numerous genes in prokaryotes. The transport of mannitol through the phosphotransferase systems (PTS) is regulated by the CRP-cAMP complex. The aim of the study is to investigate how the CRP-cAMP complex acting on the mannitol PTS operon mtl of the Vibrio cholerae El Tor biotype. The crp mutant strain was generated by homologous recombination to assess the need of CRP to activate the mannitol PTS operon of V. cholerae El Tor. Electrophoretic mobility shift assays (EMSA) and the reporter plasmid pBBRlux were used to confirm the role that the CRP-cAMP complex playing on the mannitol PTS operon mtl. In this study, we confirmed that CRP is strictly needed for the activation of the mtl operon. We further experimentally identified five CRP binding sites within the promoter region upstream of the mannitol PTS operon mtl of the Vibrio cholerae El Tor biotype and found that these sites display different affinities for CRP and provide different contributions to the activation of the operon. The five binding sites collectively confer the strong activation of mannitol transfer by CRP in V. cholerae, indicating an elaborate and subtle CRP activation mechanism. Copyright © 2013 The Editorial Board of Biomedical and Environmental Sciences. Published by China CDC. All rights reserved.
Directory of Open Access Journals (Sweden)
Thomas Fischöder
2017-08-01
Full Text Available Repeats of the disaccharide unit N-acetyllactosamine (LacNAc occur as type 1 (Galβ1, 3GlcNAc and type 2 (Galβ1, 4GlcNAc glycosylation motifs on glycoproteins and glycolipids. The LacNAc motif acts as binding ligand for lectins and is involved in many biological recognition events. To the best of our knowledge, we present, for the first time, the synthesis of LacNAc type 1 oligomers using recombinant β1,3-galactosyltransferase from Escherichia coli and β1,3-N-acetylglucosaminyltranferase from Helicobacter pylori. Tetrasaccharide glycans presenting LacNAc type 1 repeats or LacNAc type 1 at the reducing or non-reducing end, respectively, were conjugated to bovine serum albumin as a protein scaffold by squarate linker chemistry. The resulting multivalent LacNAc type 1 presenting neo-glycoproteins were further studied for specific binding of the tumor-associated human galectin 3 (Gal-3 and its truncated counterpart Gal-3∆ in an enzyme-linked lectin assay (ELLA. We observed a significantly increased affinity of Gal-3∆ towards the multivalent neo-glycoprotein presenting LacNAc type 1 repeating units. This is the first evidence for differences in glycan selectivity of Gal-3∆ and Gal-3 and may be further utilized for tracing Gal-3∆ during tumor progression and therapy.
vanO, a new glycopeptide resistance operon in environmental Rhodococcus equi isolates
DEFF Research Database (Denmark)
Gudeta, Dereje Dadi; Moodley, Arshnee; Bortolaia, Valeria
2014-01-01
We describe sequence and gene organization of a new glycopeptide resistance operon (vanO) in Rhodococcus equi from soil. The vanO operon has low homology to enterococccal van operons and harbors a vanHOX cluster transcribed in opposite direction to the vanS-vanR regulatory system and comprised be...... between three open reading frames with unknown function. This finding has clinical interest since glycopeptides are used to treat R. equi infections and resistance has been reported in clinical isolates....
VizieR Online Data Catalog: The CLASS BL Lac sample (Marcha+, 2013)
Marcha, M. J. M.; Caccianiga, A.
2014-04-01
This paper presents a new sample of BL Lac objects selected from a deep (30mJy) radio survey of flat spectrum radio sources (the CLASS blazar survey). The sample is one of the largest well-defined samples in the low-power regime with a total of 130 sources of which 55 satisfy the 'classical' optical BL Lac selection criteria, and the rest have indistinguishable radio properties. The primary goal of this study is to establish the radio luminosity function (RLF) on firm statistical ground at low radio luminosities where previous samples have not been able to investigate. The gain of taking a peek at lower powers is the possibility to search for the flattening of the luminosity function which is a feature predicted by the beaming model but which has remained elusive to observational confirmation. In this study, we extend for the first time the BL Lac RLF down to very low radio powers ~1022W/Hz, i.e. two orders of magnitude below the RLF currently available in the literature. In the process, we confirm the importance of adopting a broader, and more physically meaningful set of classification criteria to avoid the systematic missing of low-luminosity BL Lacs. Thanks to the good statistics we confirm the existence of weak but significant positive cosmological evolution for the BL Lac population, and we detect, for the first time the flattening of the RLF at L~1025W/Hz in agreement with the predictions of the beaming model. (1 data file).
Structural characterization of the Salmonella typhimurium LT2 umu operon
International Nuclear Information System (INIS)
Thomas, S.M.; Crowne, H.M.; Pidsley, S.C.; Sedgwick, S.G.
1990-01-01
The umuDC operon of Escherichia coli encodes functions required for mutagenesis induced by radiation and a wide variety of chemicals. The closely related organism Salmonella typhimurium is markedly less mutable than E. coli, but a umu homolog has recently been identified and cloned from the LT2 subline. In this study the nucleotide sequence and structure of the S. typhimurium LT2 umu operon have been determined and its gene products have been identified so that the molecular basis of umu activity might be understood more fully. S. typhimurium LT2 umu consists of a smaller 417-base-pair (bp) umuD gene ending 2 bp upstream of a larger 1,266-bp umuC gene. The only apparent structural difference between the two operons is the lack of gene overlap. An SOS box identical to that found in E. coli is present in the promoter region upstream of umuD. The calculated molecular masses of the umuD and umuC gene products were 15.3 and 47.8 kilodaltons, respectively, which agree with figures determined by transpositional disruption and maxicell analysis. The S. typhimurium and E. coli umuD sequences were 68% homologous and encoded products with 71% amino acid identity; the umuC sequences were 71% homologous and encoded products with 83% amino acid identity. Furthermore, the potential UmuD cleavage site and associated catalytic sites could be identified. Thus the very different mutagenic responses of S. typhimurium LT2 and E. coli cannot be accounted for by gross differences in operon structure or gene products. Rather, the ability of the cloned S. typhimurium umuD gene to give stronger complementation of E. coli umuD77 mutants in the absence of a functional umuC gene suggests that Salmonella UmuC protein normally constrains UmuD protein activity
Footprints of Optimal Protein Assembly Strategies in the Operonic Structure of Prokaryotes
Directory of Open Access Journals (Sweden)
Jan Ewald
2015-04-01
Full Text Available In this work, we investigate optimality principles behind synthesis strategies for protein complexes using a dynamic optimization approach. We show that the cellular capacity of protein synthesis has a strong influence on optimal synthesis strategies reaching from a simultaneous to a sequential synthesis of the subunits of a protein complex. Sequential synthesis is preferred if protein synthesis is strongly limited, whereas a simultaneous synthesis is optimal in situations with a high protein synthesis capacity. We confirm the predictions of our optimization approach through the analysis of the operonic organization of protein complexes in several hundred prokaryotes. Thereby, we are able to show that cellular protein synthesis capacity is a driving force in the dissolution of operons comprising the subunits of a protein complex. Thus, we also provide a tested hypothesis explaining why the subunits of many prokaryotic protein complexes are distributed across several operons despite the presumably less precise co-regulation.
Afzal, Muhammad; Shafeeq, Sulman; Henriques-Normark, Birgitta; Kuipers, Oscar P
2015-01-01
In this study, the regulatory mechanism of the ula (utilization of l-ascorbic acid) operon, putatively responsible for transport and utilization of ascorbic acid in Streptococcus pneumoniae strain D39, is studied. β-Galactosidase assay data demonstrate that expression of the ula operon is increased in the presence of ascorbic acid as compared with the effects of other sugar sources including glucose. The ula operon consists of nine genes, including a transcriptional regulator UlaR, and is transcribed as a single transcriptional unit. We demonstrate the role of the transcriptional regulator UlaR as a transcriptional activator of the ula operon in the presence of ascorbic acid and show that activation of the ula operon genes by UlaR is CcpA-independent. Furthermore, we predict a 16 bp regulatory site (5'-AACAGTCCGCTGTGTA-3') for UlaR in the promoter region of ulaA. Deletion of the half or full UlaR regulatory site in PulaA confirmed that the UlaR regulatory site present in PulaA is functional. © 2015 The Authors.
PRODUCTION HALIEUTIQUE DU LAC FAE (BASSIN DU SAN ...
African Journals Online (AJOL)
about 5.229 millions CFA for the shrimp production at the rate of 1500 Flkg. .... Figure 1 Lac Fae-Localisation geographique, zones de production, secteurs et ... embankment dam ; d : water intake for regulating the threshold level of water in the.
Decreases in average bacterial community rRNA operon copy number during succession.
Nemergut, Diana R; Knelman, Joseph E; Ferrenberg, Scott; Bilinski, Teresa; Melbourne, Brett; Jiang, Lin; Violle, Cyrille; Darcy, John L; Prest, Tiffany; Schmidt, Steven K; Townsend, Alan R
2016-05-01
Trait-based studies can help clarify the mechanisms driving patterns of microbial community assembly and coexistence. Here, we use a trait-based approach to explore the importance of rRNA operon copy number in microbial succession, building on prior evidence that organisms with higher copy numbers respond more rapidly to nutrient inputs. We set flasks of heterotrophic media into the environment and examined bacterial community assembly at seven time points. Communities were arrayed along a geographic gradient to introduce stochasticity via dispersal processes and were analyzed using 16 S rRNA gene pyrosequencing, and rRNA operon copy number was modeled using ancestral trait reconstruction. We found that taxonomic composition was similar between communities at the beginning of the experiment and then diverged through time; as well, phylogenetic clustering within communities decreased over time. The average rRNA operon copy number decreased over the experiment, and variance in rRNA operon copy number was lowest both early and late in succession. We then analyzed bacterial community data from other soil and sediment primary and secondary successional sequences from three markedly different ecosystem types. Our results demonstrate that decreases in average copy number are a consistent feature of communities across various drivers of ecological succession. Importantly, our work supports the scaling of the copy number trait over multiple levels of biological organization, ranging from cells to populations and communities, with implications for both microbial ecology and evolution.
Riyanti, Eny Ida; Rogers, Peter L
2009-01-01
Keuntungan fermentasi etanol pada suhu tinggi mendorong penelitian perakitan bakteri termofilik etalogenik. Selain itu, kemampuan bakteri termofilik dalam penggunaan gula pentosa hasil degradasi biomasa memberi peluang untuk menekan biaya produksi bioetanol. Tujuan dari penelitian ini adalah untuk mengkonstruksi pet (production of ethanol) operon dengan menggunakan shuttle vector pMK18 dan melihat ekspresinya dalam bakteri mesofilik dan termofilik. Konstruksi dan ekspresi pet operon dengan me...
Weaver, T.L.; Neff, B.P.; Ellis, J.M.
2005-01-01
Lac Vieux Desert is a prominent 6.6 square-mile lake that straddles the Michigan-Wisconsin border and forms the headwaters of the Wisconsin River. For generations, the Lac Vieux Desert Band of Lake Superior Chippewa Indians have used Lac Vieux Desert and the surrounding area for growing and harvesting wild rice, and hunting and fishing. The Lac Vieux Desert Band is concerned about the impact of lake-stage regulation on hydrology and ecology, and the impact on water quality of development along and near the shore, and recreational watercraft use and sport fishing. In 2005, the U.S. Geological Survey completed a water-resources investigation of the Lac Vieux Desert watershed in cooperation with the Lac Vieux Desert Band of Lake Superior Chippewa Indians.Water quality of Lac Vieux Desert is typical of many lakes in the northern United States. Trophic State Index calculations classify Lac Vieux Desert as a highly productive eutrophic lake. The pH of water in Lac Vieux Desert ranged from 6.5 to 9.5, and specific conductance ranged from 62 to 114 µs/cm. Chloride concentration was less than 1.5 mg/L, indicating little effect from septic-tank or road-salt input. Results indicate that the water can be classified as soft, with hardness concentrations reported as calcium carbonate ranging from 29 to 49 mg/L. Concentrations of calcium, magnesium, chloride, and other dissolved solids ranged from 47 to 77 mg/L. Alkalinity of Lac Vieux Desert ranged from 27 to 38 mg/L.Pervasive aquatic blooms, including a bloom noted during the September 2003 sampling, are apparently common in late summer. Biological productivity at Lac Vieux Desert does not appear to have changed appreciably between 1973 and 2004. In the current study, total phosphorus concentrations ranged from 0.01 to 0.064 mg/L and dissolved nitrite plus nitrate nitrogen concentrations ranged from at, or below detection limit to 0.052 mg/L. Overabundance of nutrients in Lac Vieux Desert, particularly nitrogen and phosphorus
Yadav, Kavita; Kumar, Chanchal; Archana, G; Kumar, G Naresh
2014-10-01
Mineral phosphate solubilization by bacteria is mediated through secretion of organic acids, among which citrate is one of the most effective. To overproduce citrate in bacterial systems, an artificial citrate operon comprising of genes encoding NADH-insensitive citrate synthase of E. coli and Salmonella typhimurium sodium-dependent citrate transporter was constructed. In order to improve its mineral phosphate solubilizing (MPS) ability, the citrate operon was incorporated into E. hormaechei DHRSS. The artificial citrate operon transformant secreted 7.2 mM citric acid whereas in the native strain, it was undetectable. The transformant released 0.82 mM phosphate in flask studies in buffered medium containing rock phosphate as sole P source. In fermenter studies, similar phenotype was observed under aerobic conditions. However, under microaerobic conditions, no citrate was detected and P release was not observed. Therefore, an artificial citrate gene cluster containing Vitreoscilla hemoglobin (vgb) gene under its native promoter, along with artificial citrate operon under constitutive tac promoter, was constructed and transformed into E. hormaechei DHRSS. This transformant secreted 9 mM citric acid under microaerobic conditions and released 1.0 mM P. Thus, incorporation of citrate operon along with vgb gene improves MPS ability of E. hormaechei DHRSS under buffered, microaerobic conditions mimicking rhizospheric environment.
DEFF Research Database (Denmark)
Givskov, M; Eberl, L; Christiansen, Gunna
1995-01-01
. Expression of flagella is demonstrated to follow a growth-phase-dependent pattern. Cloning, complementation studies and DNA-sequencing analysis has identified a genetic region in Serratia liquefaciens which exhibits extensive homology to the Escherichia coli flhD flagellar master operon. Interruption...... of the chromosomal flhD operon in S. liquefaciens results in non-flagellated and phospholipase-negative cells, but the synthesis of other exoenzymes is not affected. By placing the flhD operon under the control of a foreign inducible promoter we have shown that increased transcription through the flhD operon leads...
Brucella BioR Regulator Defines a Complex Regulatory Mechanism for Bacterial Biotin Metabolism
Xu, Jie; Zhang, Huimin; Srinivas, Swaminath
2013-01-01
The enzyme cofactor biotin (vitamin H or B7) is an energetically expensive molecule whose de novo biosynthesis requires 20 ATP equivalents. It seems quite likely that diverse mechanisms have evolved to tightly regulate its biosynthesis. Unlike the model regulator BirA, a bifunctional biotin protein ligase with the capability of repressing the biotin biosynthetic pathway, BioR has been recently reported by us as an alternative machinery and a new type of GntR family transcriptional factor that can repress the expression of the bioBFDAZ operon in the plant pathogen Agrobacterium tumefaciens. However, quite unusually, a closely related human pathogen, Brucella melitensis, has four putative BioR-binding sites (both bioR and bioY possess one site in the promoter region, whereas the bioBFDAZ [bio] operon contains two tandem BioR boxes). This raised the question of whether BioR mediates the complex regulatory network of biotin metabolism. Here, we report that this is the case. The B. melitensis BioR ortholog was overexpressed and purified to homogeneity, and its solution structure was found to be dimeric. Functional complementation in a bioR isogenic mutant of A. tumefaciens elucidated that Brucella BioR is a functional repressor. Electrophoretic mobility shift assays demonstrated that the four predicted BioR sites of Brucella plus the BioR site of A. tumefaciens can all interact with the Brucella BioR protein. In a reporter strain that we developed on the basis of a double mutant of A. tumefaciens (the ΔbioR ΔbioBFDA mutant), the β-galactosidase (β-Gal) activity of three plasmid-borne transcriptional fusions (bioBbme-lacZ, bioYbme-lacZ, and bioRbme-lacZ) was dramatically decreased upon overexpression of Brucella bioR. Real-time quantitative PCR analyses showed that the expression of bioBFDA and bioY is significantly elevated upon removal of bioR from B. melitensis. Together, we conclude that Brucella BioR is not only a negative autoregulator but also a repressor of
Spectroscopy of optically selected BL Lac objects and their γ-ray emission
Energy Technology Data Exchange (ETDEWEB)
Sandrinelli, A.; Treves, A.; Farina, E. P.; Landoni, M. [Università degli Studi dell' Insubria, Via Valleggio 11, I-22100 Como (Italy); Falomo, R. [INAF-Osservatorio Astronomico di Padova, Vicolo dell Osservatorio 5, I-35122 Padova (Italy); Foschini, L.; Sbarufatti, B., E-mail: angela.sandrinelli@brera.inaf.it [INAF-Osservatorio Astronomico di Brera, Via Emilio Bianchi 46, I-23807 Merate (Italy)
2013-12-01
We present Very Large Telescope optical spectroscopy of nine BL Lac objects of unknown redshift belonging to the list of optically selected radio-loud BL Lac candidates. We explore their spectroscopic properties and possible link with gamma-ray emission. From the new observations we determine the redshifts of four objects from faint emission lines or from absorption features of their host galaxies. In three cases we find narrow intervening absorptions from which a lower limit to the redshift is inferred. For the remaining two featureless sources, lower limits to the redshift are deduced from the absence of spectral lines. A search for γ counterpart emission shows that six out of the nine candidates are Fermi γ-ray emitters and we find two new detections. Our analysis suggests that most of the BL Lac objects still lacking redshift information are most likely located at high redshifts.
THE CONTRIBUTION OF FERMI -2LAC BLAZARS TO DIFFUSE TEV–PEV NEUTRINO FLUX
Energy Technology Data Exchange (ETDEWEB)
Aartsen, M. G. [Department of Physics, University of Adelaide, Adelaide, 5005 (Australia); Abraham, K. [Physik-department, Technische Universität München, D-85748 Garching (Germany); Ackermann, M. [DESY, D-15735 Zeuthen (Germany); Adams, J. [Dept. of Physics and Astronomy, University of Canterbury, Private Bag 4800, Christchurch (New Zealand); Aguilar, J. A.; Ansseau, I. [Université Libre de Bruxelles, Science Faculty CP230, B-1050 Brussels (Belgium); Ahlers, M. [Dept. of Physics and Wisconsin IceCube Particle Astrophysics Center, University of Wisconsin, Madison, WI 53706 (United States); Ahrens, M. [Oskar Klein Centre and Dept. of Physics, Stockholm University, SE-10691 Stockholm (Sweden); Altmann, D.; Anton, G. [Erlangen Centre for Astroparticle Physics, Friedrich-Alexander-Universität Erlangen-Nürnberg, D-91058 Erlangen (Germany); Andeen, K. [Department of Physics, Marquette University, Milwaukee, WI, 53201 (United States); Anderson, T.; Arlen, T. C. [Dept. of Physics, Pennsylvania State University, University Park, PA 16802 (United States); Archinger, M.; Baum, V. [Institute of Physics, University of Mainz, Staudinger Weg 7, D-55099 Mainz (Germany); Arguelles, C.; Axani, S. [Dept. of Physics, Massachusetts Institute of Technology, Cambridge, MA 02139 (United States); Auffenberg, J. [III. Physikalisches Institut, RWTH Aachen University, D-52056 Aachen (Germany); Bai, X. [Physics Department, South Dakota School of Mines and Technology, Rapid City, SD 57701 (United States); Barwick, S. W., E-mail: thorsten.gluesenkamp@fau.de [Dept. of Physics and Astronomy, University of California, Irvine, CA 92697 (United States); Collaboration: IceCube Collaboration; and others
2017-01-20
The recent discovery of a diffuse cosmic neutrino flux extending up to PeV energies raises the question of which astrophysical sources generate this signal. Blazars are one class of extragalactic sources which may produce such high-energy neutrinos. We present a likelihood analysis searching for cumulative neutrino emission from blazars in the 2nd Fermi -LAT AGN catalog (2LAC) using IceCube neutrino data set 2009-12, which was optimized for the detection of individual sources. In contrast to those in previous searches with IceCube, the populations investigated contain up to hundreds of sources, the largest one being the entire blazar sample in the 2LAC catalog. No significant excess is observed, and upper limits for the cumulative flux from these populations are obtained. These constrain the maximum contribution of 2LAC blazars to the observed astrophysical neutrino flux to 27% or less between around 10 TeV and 2 PeV, assuming the equipartition of flavors on Earth and a single power-law spectrum with a spectral index of −2.5. We can still exclude the fact that 2LAC blazars (and their subpopulations) emit more than 50% of the observed neutrinos up to a spectral index as hard as −2.2 in the same energy range. Our result takes into account the fact that the neutrino source count distribution is unknown, and it does not assume strict proportionality of the neutrino flux to the measured 2LAC γ -ray signal for each source. Additionally, we constrain recent models for neutrino emission by blazars.
Huertas, Mónica G; Zárate, Lina; Acosta, Iván C; Posada, Leonardo; Cruz, Diana P; Lozano, Marcela; Zambrano, María M
2014-12-01
Klebsiella pneumoniae is an opportunistic pathogen important in hospital-acquired infections, which are complicated by the rise of drug-resistant strains and the capacity of cells to adhere to surfaces and form biofilms. In this work, we carried out an analysis of the genes in the K. pneumoniae yfiRNB operon, previously implicated in biofilm formation. The results indicated that in addition to the previously reported effect on type 3 fimbriae expression, this operon also affected biofilm formation due to changes in cellulose as part of the extracellular matrix. Deletion of yfiR resulted in enhanced biofilm formation and an altered colony phenotype indicative of cellulose overproduction when grown on solid indicator media. Extraction of polysaccharides and treatment with cellulase were consistent with the presence of cellulose in biofilms. The enhanced cellulose production did not, however, correlate with virulence as assessed using a Caenorhabditis elegans assay. In addition, cells bearing mutations in genes of the yfiRNB operon varied with respect to the WT control in terms of susceptibility to the antibiotics amikacin, ciprofloxacin, imipenem and meropenem. These results indicated that the yfiRNB operon is implicated in the production of exopolysaccharides that alter cell surface characteristics and the capacity to form biofilms--a phenotype that does not necessarily correlate with properties related with survival, such as resistance to antibiotics. © 2014 The Authors.
METHODICAL APPROACHES TO THE CREATION MOOC (EXPERIENCE LAC
Directory of Open Access Journals (Sweden)
Larysa Nozdrina
2016-03-01
Full Text Available The article presents a number of problems, determining the current state of development of the domestic market of massive open online courses (MOOC. Considering the aim of the research, there is described national experience in this area, proposed and substantiated a number of the criteria and methodological approaches to the implementation of MOOC in higher education. The development of MOOC in the Lviv Academy of Commerce (LAC is reviewed as example. The main factors which determine the success of this educational innovation in the domestic market and are put under the research are software platforms, multimedia software for creating video lectures, course structure and support the learning process. The results of study which have been analyzed in this course can have a positive impact on the functioning of the market MOOC in Ukrainian universities. The article focuses on finding the ways of improving the process of developing and implementing MOOC in higher education in the example of LAC where Web-center on the MOODLE platform is used for e-learning. Further research should focus on the development of institutional mechanisms to ensure the effective design, implementation and operation of the MOOC in the universities in Ukraine. Particular attention during learning in massive open online course should be aimed at improving the educational process and to strengthen student's motivation in MOOC. Experience of MOOC's development in LAC can be useful at creating similar courses at other institutions of higher education in the different platforms, both MOODLE, and on the others
Eucaryotic operon genes can define highly conserved syntenies
Czech Academy of Sciences Publication Activity Database
Trachtulec, Zdeněk
2004-01-01
Roč. 50, - (2004), s. 1-6 ISSN 0015-5500 R&D Projects: GA ČR GA204/01/0997; GA MŠk LN00A079 Institutional research plan: CEZ:AV0Z5052915 Keywords : eukaryotic operon * conserved synteny Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 0.507, year: 2004
Carrión, Víctor J; Gutiérrez-Barranquero, José A; Arrebola, Eva; Bardaji, Leire; Codina, Juan C; de Vicente, Antonio; Cazorla, Francisco M; Murillo, Jesús
2013-02-01
Mangotoxin production was first described in Pseudomonas syringae pv. syringae strains. A phenotypic characterization of 94 P. syringae strains was carried out to determine the genetic evolution of the mangotoxin biosynthetic operon (mbo). We designed a PCR primer pair specific for the mbo operon to examine its distribution within the P. syringae complex. These primers amplified a 692-bp DNA fragment from 52 mangotoxin-producing strains and from 7 non-mangotoxin-producing strains that harbor the mbo operon, whereas 35 non-mangotoxin-producing strains did not yield any amplification. This, together with the analysis of draft genomes, allowed the identification of the mbo operon in five pathovars (pathovars aptata, avellanae, japonica, pisi, and syringae), all of which belong to genomospecies 1, suggesting a limited distribution of the mbo genes in the P. syringae complex. Phylogenetic analyses using partial sequences from housekeeping genes differentiated three groups within genomospecies 1. All of the strains containing the mbo operon clustered in groups I and II, whereas those lacking the operon clustered in group III; however, the relative branching order of these three groups is dependent on the genes used to construct the phylogeny. The mbo operon maintains synteny and is inserted in the same genomic location, with high sequence conservation around the insertion point, for all the strains in groups I and II. These data support the idea that the mbo operon was acquired horizontally and only once by the ancestor of groups I and II from genomospecies 1 within the P. syringae complex.
Schwab, Stefan; Souza, Emanuel M; Yates, Marshall G; Persuhn, Darlene C; Steffens, M Berenice R; Chubatsu, Leda S; Pedrosa, Fábio O; Rigo, Liu U
2007-01-01
Herbaspirillum seropedicae is an endophytic bacterium that fixes nitrogen under microaerophilic conditions. The putative promoter sequences glnAp1 (sigma70-dependent) and glnAp2 (sigma54), and two NtrC-binding sites were identified upstream from the glnA, ntrB and ntrC genes of this microorganism. To study their transcriptional regulation, we used lacZ fusions to the H. seropedicae glnA gene, and the glnA-ntrB and ntrB-ntrC intergenic regions. Expression of glnA was up-regulated under low ammonium, but no transcription activity was detected from the intergenic regions under any condition tested, suggesting that glnA, ntrB and ntrC are co-transcribed from the promoters upstream of glnA. Ammonium regulation was lost in the ntrC mutant strain. A point mutation was introduced in the conserved -25/-24 dinucleotide (GG-->TT) of the putative sigma54-dependent promoter (glnAp2). Contrary to the wild-type promoter, glnA expression with the mutant glnAp2 promoter was repressed in the wild-type strain under low ammonium levels, but this repression was abolished in an ntrC background. Together our results indicate that the H. seropedicae glnAntrBC operon is regulated from two functional promoters upstream from glnA, which are oppositely regulated by the NtrC protein.
A geological survey of the Lac du Bonnet batholith, Manitoba
International Nuclear Information System (INIS)
McCrank, G.F.D.
1985-02-01
This report presents the results of a geological survey of the Lac du Bonnet batholith in Manitoba. The survey consisted of field mapping of the lithologies and the joint systems throughout the batholith, and the examination of lineaments identified on aerial photographs and Landsat imagery. Petrographic descriptions and a map of the lithologies, an analysis of the fracture systems and a lineament map are presented. The results of various regional geophysical surveys were used as an aid to the interpretation of the batholith's contacts and in the interpretation of lineaments as possible faults. A comparison of the Lac du Bonnet Batholith with the Eye-Dashwa Lakes Pluton near Atikokan, Ontario is also presented
Sahukhal, Gyan S; Batte, Justin L; Elasri, Mohamed O
2015-02-01
Staphylococcus aureus is an important human pathogen that causes nosocomial and community-acquired infections. One of the most important aspects of staphylococcal infections is biofilm development within the host, which renders the bacterium resistant to the host's immune response and antimicrobial agents. Biofilm development is very complex and involves several regulators that ensure cell survival on surfaces within the extracellular polymeric matrix. Previously, we identified the msaABCR operon as an additional positive regulator of biofilm formation. In this study, we define the regulatory pathway by which msaABCR controls biofilm formation. We demonstrate that the msaABCR operon is a negative regulator of proteases. The control of protease production mediates the processing of the major autolysin, Atl, and thus regulates the rate of autolysis. In the absence of the msaABCR operon, Atl is processed by proteases at a high rate, leading to increased cell death and a defect in biofilm maturation. We conclude that the msaABCR operon plays a key role in maintaining the balance between autolysis and growth within the staphylococcal biofilm. © FEMS 2015. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
Afzal, Muhammad; Shafeeq, Sulman; Henriques-Normark, Birgitta; Kuipers, Oscar P
In this study, the regulatory mechanism of the ula (utilization of l-ascorbic acid) operon, putatively responsible for transport and utilization of ascorbic acid in Streptococcus pneumoniae strain D39, is studied. β-Galactosidase assay data demonstrate that expression of the ula operon is increased
Berrocal, Liliana; Fuentes, Juan A; Trombert, A Nicole; Jofré, Matías R; Villagra, Nicolás A; Valenzuela, Luis M; Mora, Guido C
2015-07-07
Salmonella enterica serovar Typhi (S. Typhi) stg operon, encoding a chaperone/usher fimbria (CU), contributes to an increased adherence to human epithelial cells. However, one report suggests that the presence of the Stg fimbria impairs the monocyte--bacteria association, as deduced by the lower level of invasion to macrophage-like cells observed when the stg fimbrial cluster was overexpressed. Nevertheless, since other CU fimbrial structures increase the entry of S. Typhi into macrophages, and considering that transcriptomic analyses revealed that stg operon is indeed expressed in macrophages, we reassessed the role of the stg operon in the interaction between S. Typhi strain STH2370 and human cells, including macrophage-like cells and mononuclear cells directly taken from human peripheral blood. We compared S. Typhi STH2370 WT, a Chilean clinical strain, and the S. Typhi STH2370 Δstg mutant with respect to association and invasion using epithelial and macrophage-like cells. We observed that deletion of stg operon reduced the association and invasion of S. Typhi, in both cellular types. The presence of the cloned stg operon restored the WT phenotype in all the cases. Moreover, we compared Salmonella enterica sv. Typhimurium 14028s (S. Typhimurium, a serovar lacking stg operon) and S. Typhimurium heterologously expressing S. Typhi stg. We found that the latter presents an increased cell disruption of polarized epithelial cells and an increased association in both epithelial and macrophage-like cells. S. Typhi stg operon encodes a functional adhesin that participates in the interaction bacteria-eukaryotic cells, including epithelial cells and macrophages-like cells. The phenotypes associated to stg operon include increased association and consequent invasion in bacteria-eukaryotic cells, and cell disruption.
Kim, Moonjeong; Kim, Kwang-Sun
2017-07-06
The YmdB protein, an inhibitor of biofilm formation and an inducer of apramycin susceptibility in Escherichia coli (E. coli), is part of a putative operon. However, transcription of this operon and its subsequent effects on biological pathways has not been fully studied. Here, we characterized the operon in terms of promoter activity, transcription and function. Promoter activity assays identified two new growth- and cold-shock-responsive upstream (PymdA) and inner (PclsC) promoters, respectively. Moreover, investigation of the operon-derived transcripts identified different polycistronic transcripts harboring multiple heterogeneous 3΄ ends. Overexpression of YmdA or ClsC proteins inhibited biofilm formation and affected apramycin susceptibility, a process dependent on the sucA gene, suggesting that the operon genes or their encoded proteins are functionally linked. Additional investigation of the effects of polycistronic transcripts on the response of E. coli cells to apramycin revealed that transcripts containing ymdA (-213 to +27) are required for apramycin susceptibility. Thus, ymdAB-clsC is a new stress-responsive operon that plays a role in inhibiting undesired biofilm forming and antibiotic-resistant bacterial populations. © FEMS 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
CLUSTERING OF γ-RAY-SELECTED 2LAC FERMI BLAZARS
Energy Technology Data Exchange (ETDEWEB)
Allevato, V.; Finoguenov, A. [Department of Physics, University of Helsinki, Gustaf Hällströmin katu 2a, FI-00014 Helsinki (Finland); Cappelluti, N. [University of Maryland, Baltimore County, 1000 Hilltop Circle, Baltimore, MD 21250 (United States)
2014-12-20
We present the first measurement of the projected correlation function of 485 γ-ray-selected blazars, divided into 175 BL Lacertae (BL Lacs) and 310 flat-spectrum radio quasars (FSRQs) detected in the 2 year all-sky survey by the Fermi-Large Area Telescope. We find that Fermi BL Lacs and FSRQs reside in massive dark matter halos (DMHs) with log M{sub h} = 13.35{sub −0.14}{sup +0.20} and log M{sub h} = 13.40{sub −0.19}{sup +0.15} h {sup –1} M {sub ☉}, respectively, at low (z ∼ 0.4) and high (z ∼ 1.2) redshift. In terms of clustering properties, these results suggest that BL Lacs and FSRQs are similar objects residing in the same dense environment typical of galaxy groups, despite their different spectral energy distributions, power, and accretion rates. We find no difference in the typical bias and hosting halo mass between Fermi blazars and radio-loud active galactic nuclei (AGNs), supporting the unification scheme simply equating radio-loud objects with misaligned blazar counterparts. This similarity in terms of the typical environment they preferentially live in, suggests that blazars tend to occupy the center of DMHs, as already pointed out for radio-loud AGNs. This implies, in light of several projects looking for the γ-ray emission from DM annihilation in galaxy clusters, a strong contamination from blazars to the expected signal from DM annihilation.
Valdivia-Anistro, Jorge A.; Eguiarte-Fruns, Luis E.; Delgado-Sapién, Gabriela; Márquez-Zacarías, Pedro; Gasca-Pineda, Jaime; Learned, Jennifer; Elser, James J.; Olmedo-Alvarez, Gabriela; Souza, Valeria
2016-01-01
The ribosomal RNA (rrn) operon is a key suite of genes related to the production of protein synthesis machinery and thus to bacterial growth physiology. Experimental evidence has suggested an intrinsic relationship between the number of copies of this operon and environmental resource availability, especially the availability of phosphorus (P), because bacteria that live in oligotrophic ecosystems usually have few rrn operons and a slow growth rate. The Cuatro Ciénegas Basin (CCB) is a complex aquatic ecosystem that contains an unusually high microbial diversity that is able to persist under highly oligotrophic conditions. These environmental conditions impose a variety of strong selective pressures that shape the genome dynamics of their inhabitants. The genus Bacillus is one of the most abundant cultivable bacterial groups in the CCB and usually possesses a relatively large number of rrn operon copies (6–15 copies). The main goal of this study was to analyze the variation in the number of rrn operon copies of Bacillus in the CCB and to assess their growth-related properties as well as their stoichiometric balance (N and P content). We defined 18 phylogenetic groups within the Bacilli clade and documented a range of from six to 14 copies of the rrn operon. The growth dynamic of these Bacilli was heterogeneous and did not show a direct relation to the number of operon copies. Physiologically, our results were not consistent with the Growth Rate Hypothesis, since the copies of the rrn operon were decoupled from growth rate. However, we speculate that the diversity of the growth properties of these Bacilli as well as the low P content of their cells in an ample range of rrn copy number is an adaptive response to oligotrophy of the CCB and could represent an ecological mechanism that allows these taxa to coexist. These findings increase the knowledge of the variability in the number of copies of the rrn operon in the genus Bacillus and give insights about the
Louisiana SIP: LAC 33:III Ch 21 Subchap J, 2147--Limiting Volatile Organic Compound (VOC) Emissions from Reactor Processes and Distillation Operations in Synthetic Organic Chemical manufacturing Industry (SOCMI); SIP effective 1998-02-02 (LAc74) more...
The Global Regulator Spx Functions in the Control of Organosulfur Metabolism in Bacillus subtilis†
Choi, Soon-Yong; Reyes, Dindo; Leelakriangsak, Montira; Zuber, Peter
2006-01-01
Spx is a global transcriptional regulator of the oxidative stress response in Bacillus subtilis. Its target is RNA polymerase, where it contacts the α subunit C-terminal domain. Recently, evidence was presented that Spx participates in sulfate-dependent control of organosulfur utilization operons, including the ytmI, yxeI, ssu, and yrrT operons. The yrrT operon includes the genes that function in cysteine synthesis from S-adenosylmethionine through intermediates S-adenosylhomocysteine, ribosylhomocysteine, homocysteine, and cystathionine. These operons are also negatively controlled by CymR, the repressor of cysteine biosynthesis operons. All of the operons are repressed in media containing cysteine or sulfate but are derepressed in medium containing the alternative sulfur source, methionine. Spx was found to negatively control the expression of these operons in sulfate medium, in part, by stimulating the expression of the cymR gene. In addition, microarray analysis, monitoring of yrrT-lacZ fusion expression, and in vitro transcription studies indicate that Spx directly activates yrrT operon expression during growth in medium containing methionine as sole sulfur source. These experiments have uncovered additional roles for Spx in the control of gene expression during unperturbed, steady-state growth. PMID:16885442
Genome Engineering of the 2,3-Butanediol Biosynthetic Pathway for Tight Regulation in Cyanobacteria.
Nozzi, Nicole E; Atsumi, Shota
2015-11-20
Cyanobacteria have gained popularity among the metabolic engineering community as a tractable photosynthetic host for renewable chemical production. However, though a number of successfully engineered production systems have been reported, long-term genetic stability remains an issue for cyanobacterial systems. The genetic engineering toolbox for cyanobacteria is largely lacking inducible systems for expression control. The characterization of tight regulation systems for use in cyanobacteria may help to alleviate this problem. In this work we explore the function of the IPTG inducible promoter P(L)lacO1 in the model cyanobacterium Synechococcus elongatus PCC 7942 as well as the effect of gene order within an operon on pathway expression. According to our experiments, P(L)lacO1 functions well as an inducible promoter in S. elongatus. Additionally, we found that gene order within an operon can strongly influence control of expression of each gene.
KIEL, JAKW; BOELS, JM; BELDMAN, G; VENEMA, G
Although it has never been reported that Bacillus subtilis is capable of accumulating glycogen, we have isolated a region from the chromosome of B. subtilis containing a glycogen operon. The operon is located directly downstream from trnB, which maps at 275 degrees on the B. subtilis chromosome. It
The BL Lac objects PKS 1144-379
International Nuclear Information System (INIS)
Nicolson, G.D.; Glass, I.S.; Feast, M.W.; Andrews, P.J.
1979-01-01
The highly variable radio source PKS 1144-379 has been monitored at 13 cm and 6 cm over a period of 3 years. It has been identified with an object whose photographic image is star-like. From infrared photometry, UBVRsub(KC)Isub(KC) photometry and spectroscopy, it is concluded that PKS 1144-379 is a BL Lac object with msub(v) approximately = 16.2. (author)
Goh, Yong Jun; Klaenhammer, Todd R
2013-01-01
Glycogen metabolism contributes to energy storage and various physiological functions in some prokaryotes, including colonization persistence. A role for glycogen metabolism is proposed on the survival and fitness of Lactobacillus acidophilus, a probiotic microbe, in the human gastrointestinal environment. L.?acidophilus?NCFM possesses a glycogen metabolism (glg) operon consisting of glgBCDAP - amy - pgm genes. Expression of the glg operon and glycogen accumulation were carbon source- and gro...
Molecular mechanisms of plasmid-determined mercury and cadmium resistances in bacteria
International Nuclear Information System (INIS)
Nucifora, G.
1989-01-01
The structural basis for induction of the broad spectrum mercurial resistance operon of pDU1358 with inorganic mercury and with phenylmercury acetate was addressed by DNA sequencing analysis (that showed that a major difference occurred in the 3' 29 base pairs of the ital merR gene compared to the merR genes of Tn501 and R100) and by lac-fusion transcription experiments regulated by merR in trans. The lac-fusion results were compared with those from a narrow spectrum operon, and the pDU1358 merR deleted at the 3' end. A hybrid mer operon containing the merR gene from pDU1358 and lacking the merB gene was inducible by both phenylmercury and inorganic Hg 2+ , showing that organomercurial lyase is not needed for induction by organomercurials. A mutant form of pDU1358 merR missing the C-terminal 17 amino acids responded to inorganic Hg 2+ but not to phenylmercury, indicating that the C-terminal region of the MerR protein of the pDU1358 mer operon is required for the recognition of phenylmercury acetate. The down regulation of the mer operon by the merD gene was also measured in trans with complementing mer operons of pDU1358 or R100 or merD - mutants. In the presence of the merD gene, beta-galactosidase activity was lowered by 2 to 4 fold. The merD gene gene product was visualized by autoradiography. The Cd 2+ resistance determinant cadA of S. aureus was investigated. The nucleotide sequence of the DNA fragment containing the cadA determinant revealed two open reading frames the larger one of which is essential for expression of cadmium resistance
Gtl2lacZ, an insertional mutation on mouse chromosome 12 with parental origin-dependent phenotype.
Schuster-Gossler, K; Simon-Chazottes, D; Guenet, J L; Zachgo, J; Gossler, A
1996-01-01
We have produced a transgenic mouse line, Gtl2lacZ (Gene trap locus 2), that carries an insertional mutation with a dominant modified pattern of inheritance:heterozygous Gtl2lacZ mice that inherited the transgene from the father show a proportionate dwarfism phenotype, whereas the penetrance and expressivity of the phenotype is strongly reduced in Gtl2lacZ mice that inherited the transgene from the mother. On a mixed genetic background this pattern of inheritance was reversible upon transmission of the transgene through the germ line of the opposite sex. On a predominantly 129/Sv genetic background, however, transgene passage through the female germ line modified the transgene effect, such that the penetrance of the mutation was drastically reduced and the phenotype was no longer obvious after subsequent male germ line transmission. Expression of the transgene, however, was neither affected by genetic background nor by parental legacy. Gtl2lacZ maps to mouse Chromosome 12 in a region that displays imprinting effects associated with maternal and paternal disomy. Our results suggest that the transgene insertion in Gtl2lacZ mice affects an endogenous gene(s) required for fetal and postnatal growth and that this gene(s) is predominantly paternally expressed.
Two Paralogous Families of a Two-Gene Subtilisin Operon Are Widely Distributed in Oral Treponemes
Correia, Frederick F.; Plummer, Alvin R.; Ellen, Richard P.; Wyss, Chris; Boches, Susan K.; Galvin, Jamie L.; Paster, Bruce J.; Dewhirst, Floyd E.
2003-01-01
Certain oral treponemes express a highly proteolytic phenotype and have been associated with periodontal diseases. The periodontal pathogen Treponema denticola produces dentilisin, a serine protease of the subtilisin family. The two-gene operon prcA-prtP is required for expression of active dentilisin (PrtP), a putative lipoprotein attached to the treponeme's outer membrane or sheath. The purpose of this study was to examine the diversity and structure of treponemal subtilisin-like proteases in order to better understand their distribution and function. The complete sequences of five prcA-prtP operons were determined for Treponema lecithinolyticum, “Treponema vincentii,” and two canine species. Partial operon sequences were obtained for T. socranskii subsp. 04 as well as 450- to 1,000-base fragments of prtP genes from four additional treponeme strains. Phylogenetic analysis demonstrated that the sequences fall into two paralogous families. The first family includes the sequence from T. denticola. Treponemes possessing this operon family express chymotrypsin-like protease activity and can cleave the substrate N-succinyl-alanyl-alanyl-prolyl-phenylalanine-p-nitroanilide (SAAPFNA). Treponemes possessing the second paralog family do not possess chymotrypsin-like activity or cleave SAAPFNA. Despite examination of a range of protein and peptide substrates, the specificity of the second protease family remains unknown. Each of the fully sequenced prcA and prtP genes contains a 5′ hydrophobic leader sequence with a treponeme lipobox. The two paralogous families of treponeme subtilisins represent a new subgroup within the subtilisin family of proteases and are the only subtilisin lipoprotein family. The present study demonstrated that the subtilisin paralogs comprising a two-gene operon are widely distributed among treponemes. PMID:14617650
Jans, Christoph; Follador, Rainer; Hochstrasser, Mira; Lacroix, Christophe; Meile, Leo; Stevens, Marc J A
2013-03-22
Streptococcus infantarius subsp. infantarius (Sii) belongs to the Streptococcus bovis/Streptococcus equinus complex associated with several human and animal infections. Sii is a predominant bacterium in spontaneously fermented milk products in Africa. The genome sequence of Sii strain CJ18 was compared with that of other Streptococcus species to identify dairy adaptations including genome decay such as in Streptococcus thermophilus, traits for its competitiveness in spontaneous milk fermentation and to assess potential health risks for consumers. The genome of Sii CJ18 harbors several unique regions in comparison to Sii ATCC BAA-102T, among others an enlarged exo- and capsular polysaccharide operon; Streptococcus thermophilus-associated genes; a region containing metabolic and hypothetical genes mostly unique to CJ18 and the dairy isolate Streptococcus gallolyticus subsp. macedonicus; and a second oligopeptide transport operon. Dairy adaptations in CJ18 are reflected by a high percentage of pseudogenes (4.9%) representing genome decay which includes the inactivation of the lactose phosphotransferase system (lacIIABC) by multiple transposases integration. The presence of lacS and lacZ genes is the major dairy adaptation affecting lactose metabolism pathways also due to the disruption of lacIIABC.We constructed mutant strains of lacS, lacZ and lacIIABC and analyzed the resulting strains of CJ18 to confirm the redirection of lactose metabolism via LacS and LacZ.Natural competence genes are conserved in both Sii strains, but CJ18 contains a lower number of CRISPR spacers which indicates a reduced defense capability against alien DNA. No classical streptococcal virulence factors were detected in both Sii strains apart from those involved in adhesion which should be considered niche factors. Sii-specific virulence factors are not described. Several Sii-specific regions encoding uncharacterized proteins provide new leads for virulence analyses and investigation of the
2013-01-01
Background Streptococcus infantarius subsp. infantarius (Sii) belongs to the Streptococcus bovis/Streptococcus equinus complex associated with several human and animal infections. Sii is a predominant bacterium in spontaneously fermented milk products in Africa. The genome sequence of Sii strain CJ18 was compared with that of other Streptococcus species to identify dairy adaptations including genome decay such as in Streptococcus thermophilus, traits for its competitiveness in spontaneous milk fermentation and to assess potential health risks for consumers. Results The genome of Sii CJ18 harbors several unique regions in comparison to Sii ATCC BAA-102T, among others an enlarged exo- and capsular polysaccharide operon; Streptococcus thermophilus-associated genes; a region containing metabolic and hypothetical genes mostly unique to CJ18 and the dairy isolate Streptococcus gallolyticus subsp. macedonicus; and a second oligopeptide transport operon. Dairy adaptations in CJ18 are reflected by a high percentage of pseudogenes (4.9%) representing genome decay which includes the inactivation of the lactose phosphotransferase system (lacIIABC) by multiple transposases integration. The presence of lacS and lacZ genes is the major dairy adaptation affecting lactose metabolism pathways also due to the disruption of lacIIABC. We constructed mutant strains of lacS, lacZ and lacIIABC and analyzed the resulting strains of CJ18 to confirm the redirection of lactose metabolism via LacS and LacZ. Natural competence genes are conserved in both Sii strains, but CJ18 contains a lower number of CRISPR spacers which indicates a reduced defense capability against alien DNA. No classical streptococcal virulence factors were detected in both Sii strains apart from those involved in adhesion which should be considered niche factors. Sii-specific virulence factors are not described. Several Sii-specific regions encoding uncharacterized proteins provide new leads for virulence analyses and
Boyd, D A; Mulvey, M R
2013-02-01
To date no complete genetic structure of acquired DNA harbouring a d-Ala-d-Ser operon in an Enterococcus is known. We wished to characterize the acquired DNA harbouring the vanE operon located in the Enterococcus faecalis N00-410 chromosome. Whole genome sequencing of E. faecalis N00-410 was conducted by massively parallel sequencing. Two sequence contigs harbouring the vanE region were linked by PCR and the acquired DNA harbouring the vanE operon was completely characterized. Excision/integration of the region was determined by PCR and transfer attempted by conjugation. The regions flanking the vanE operon were analysed and a total of 42 open reading frames were identified in a region flanked by inverted terminal and direct repeats (Tn6202). Tn6202 could be excised from the chromosome, circularized and the target site rejoined, but transfer could not be demonstrated. The vanE operon was found on the putative integrative and conjugative element Tn6202 in the E. faecalis N00-410 chromosome. This represents the first characterization of acquired DNA harbouring a D-Ala-D-Ser operon.
Directory of Open Access Journals (Sweden)
Yao Nie
Full Text Available Pullulanase plays an important role in specific hydrolysis of branch points in amylopectin and is generally employed as an important enzyme in starch-processing industry. So far, however, the production level of pullulanase is still somewhat low from wide-type strains and even heterologous expression systems. Here the gene encoding Bacillus naganoensis pullulanase was amplified and cloned. For expression of the protein, two recombinant systems, Escherichia coli BL21(DE3/pET-20b(+-pul and E. coli BL21(DE3/pET-22b(+-pul, were constructed, both bearing T7 promoter and signal peptide sequence, but different in the existance of lac operator and lacI gene encoding lac repressor. Recombinant pullulanase was initially expressed with the activity of up to 14 U/mL by E. coli BL21(DE3/pET-20b(+-pul with IPTG induction in LB medium, but its expression level reduced continually with the extension of cryopreservation time and basal expression was observed. However, E. coli BL21(DE3/pET-22b(+-pul , involving lac operator downstream of T7 promoter to regulate foreign gene transcription, exhibited pullulanase activity consistently without detected basal expression. By investigating the effect of lac operator, basal expression of foreign protein was found to cause expression instability and negative effect on production of target protein. Thus double-repression strategy was proposed that lac operators in both chromosome and plasmid were bound with lac repressor to repress T7 RNA polymerase synthesis and target protein expression before induction. Consequently, the total activity of pullulanase was remarkably increased to 580 U/mL with auto-induction by lac operator-involved E. coli BL21(DE3/pET-22b(+-pul. When adding 0.6% glycine in culture, the extracellular production of pullulanase was significantly improved with the extracellular activity of 502 U/mL, which is a relatively higher level achieved to date for extracellular production of pullulanase. The
Sequence analysis of the Legionella micdadei groELS operon
DEFF Research Database (Denmark)
Hindersson, P; Høiby, N; Bangsborg, Jette Marie
1991-01-01
shock expression signals were identified upstream of the L. micdadei groEL gene. Further upstream, a poly-T region, also a feature of the sigma 32-regulated Escherichia coli groELS heat shock operon, was found. Despite the high degree of homology of the expression signals in E. coli and L. micdadei...
Sahukhal, Gyan S; Elasri, Mohamed O
2014-06-11
Community-acquired, methicillin-resistant Staphylococcus aureus strains often cause localized infections in immunocompromised hosts, but some strains show enhanced virulence leading to severe infections even among healthy individuals with no predisposing risk factors. The genetic basis for this enhanced virulence has yet to be determined. S. aureus possesses a wide variety of virulence factors, the expression of which is carefully coordinated by a variety of regulators. Several virulence regulators have been well characterized, but others have yet to be thoroughly investigated. Previously, we identified the msa gene as a regulator of several virulence genes, biofilm development, and antibiotic resistance. We also found evidence of the involvement of upstream genes in msa function. To investigate the mechanism of regulation of the msa gene (renamed msaC), we examined the upstream genes whose expression was affected by its deletion. We showed that msaC is part of a newly defined four-gene operon (msaABCR), in which msaC is a non-protein-coding RNA that is essential for the function of the operon. Furthermore, we found that an antisense RNA (msaR) is complementary to the 5' end of the msaB gene and is expressed in a growth phase-dependent manner suggesting that it is involved in regulation of the operon. These findings allow us to define a new operon that regulates fundamental phenotypes in S. aureus such as biofilm development and virulence. Characterization of the msaABCR operon will allow us to investigate the mechanism of function of this operon and the role of the individual genes in regulation and interaction with its targets. This study identifies a new element in the complex regulatory circuits in S. aureus, and our findings may be therapeutically relevant.
Variabilité journalière de la qualité physico-chimique du lac M'koa ...
African Journals Online (AJOL)
d'enrichissement en matières organique, azote et phosphore capables d'influer sur la teneur de saturation en oxygène dissous. La Figure 4 montre des lavandiers communément appelés "fanico" exerçant leur activité quotidienne au lac. Cette activité est source d'enrichissement des eaux du lac. M'koa en phosphore et ...
Structural organization of the transfer RNA operon I of Vibrio cholerae
Indian Academy of Sciences (India)
Unknown
[Ghatak A, Majumdar A and Ghosh R K 2005 Structural organization of the transfer RNA operon I of Vibrio cholerae: Differences ..... clonal relationship are of utmost importance. ... rately derived from environmental, nontoxigenic, non-O1.
International Nuclear Information System (INIS)
Cupples, C.G.; Miller, J.H.
1989-01-01
We describe the construction of six strains of Escherichia coli with different mutations at the same coding position in the lacZ gene, which specifies the active site glutamic acid residue at position 461 in beta'-galactosidase. Each strain is Lac- and reverts to Lac+ only by restoring the glutamic acid codon. The strains have been designed so that each reverts via one of the six base substitutions. The set of strains allows detection of each transition and transversion simply by monitoring the Lac- to Lac+ frequency, as demonstrated here with characterized mutagens and mutator alleles. These strains are useful for rapidly determining the mutagenic specificity of mutagens at a single site, for detecting low levels of stimulation of certain base substitutions, for monitoring specific base changes in response to various experimental conditions or strain backgrounds, and for isolating new mutator strains
Characterization of the Leptospira interrogans S10-spc-alpha operon
Zuerner, R. L.; Hartskeerl, R. A.; van de Kemp, H.; Bal, A. E.
2000-01-01
A ribosomal protein gene cluster from the spirochaete Leptospira interrogans was characterized. This locus is homologous to the Escherichia coli S10, spc, and alpha operons. Analysis of L. interrogans RNA showed that the ribosomal protein genes within this cluster are co-transcribed, thus forming an
Qureshi, Nadia K; Yin, Shaohui; Boyle-Vavra, Susan
2014-01-01
Vancomycin is often the preferred treatment for invasive methicillin-resistant Staphylococcus aureus (MRSA) infection. With the increase in incidence of MRSA infections, the use of vancomycin has increased and, as feared, isolates of vancomycin-resistant Staphylococcus aureus (VRSA) have emerged. VRSA isolates have acquired the entercoccal vanA operon contained on transposon (Tn) 1546 residing on a conjugal plasmid. VraTSR is a vancomycin and β-lactam-inducible three-component regulatory system encoded on the S. aureus chromosome that modulates the cell-wall stress response to cell-wall acting antibiotics. Mutation in vraTSR has shown to increase susceptibility to β-lactams and vancomycin in clinical VISA strains and in recombinant strain COLVA-200 which expresses a plasmid borne vanA operon. To date, the role of VraTSR in vanA operon expression in VRSA has not been demonstrated. In this study, the vraTSR operon was deleted from the first clinical VRSA strain (VRS1) by transduction with phage harvested from a USA300 vraTSR operon deletion strain. The absence of the vraTSR operon and presence of the vanA operon were confirmed in the transductant (VRS1Δvra) by PCR. Broth MIC determinations, demonstrated that the vancomycin MIC of VRS1Δvra (64 µg/ml) decreased by 16-fold compared with VRS1 (1024 µg/ml). The effect of the vraTSR operon deletion on expression of the van gene cluster (vanA, vanX and vanR) was examined by quantitative RT-PCR using relative quantification. A 2-5-fold decreased expression of the vanA operon genes occured in strain VRS1Δvra at stationary growth phase compared with the parent strain, VRS1. Both vancomycin resistance and vancomycin-induced expression of vanA and vanR were restored by complementation with a plasmid harboring the vraTSR operon. These findings demonstrate that expression in S. aureus of the horizontally acquired enterococcal vanA gene cluster is enhanced by the staphylococcal three-component cell wall stress regulatory
Donskykh, G. I.; Ryabov, M. I.; Sukharev, A. I.; Aller, M.
2014-01-01
We investigated the monitoring data of extragalactic source BL Lac. This monitoring was held withUniversityofMichigan26-meter radio telescope. To study flux density of extragalactic source BL Lac at frequencies of 14.5, 8 and 4.8 GHz, the wavelet analysis and singular spectrum analysis were used. Calculating the integral wavelet spectra allowed revealing long-term components (~7-8 years) and short-term components (~ 1-4 years) in BL Lac. Studying of VLBI radio maps (by the program Mojave) ...
International Nuclear Information System (INIS)
2004-08-01
This paper addresses activity a) an analysis of international CDM experiences and its potential contribution to the LAC region. The paper begins with a section describing the basic principles of the CDM and retrieves the lessons learned from the first two years of the CDM operation. This is followed by a more detailed review in section 2 of the on-going baseline and monitoring methodology approval process. In section 3, the development value of the CDM is explored. Section 4 describes the current CDM markets, while section 5 reviews the response of host countries to the CDM outside the LAC region. Section 6 describes the various capacity building programs established by Annex 1 countries to support the CDM. In each of the first 6 sections, implications for the LAC region are identified. Section 7 brings these conclusions together into a concise summary. (The author)
Directory of Open Access Journals (Sweden)
Arkin Adam P
2006-01-01
Full Text Available Abstract Background Differentially expressed genes are typically identified by analyzing the variation between replicate measurements. These procedures implicitly assume that there are no systematic errors in the data even though several sources of systematic error are known. Results OpWise estimates the amount of systematic error in bacterial microarray data by assuming that genes in the same operon have matching expression patterns. OpWise then performs a Bayesian analysis of a linear model to estimate significance. In simulations, OpWise corrects for systematic error and is robust to deviations from its assumptions. In several bacterial data sets, significant amounts of systematic error are present, and replicate-based approaches overstate the confidence of the changers dramatically, while OpWise does not. Finally, OpWise can identify additional changers by assigning genes higher confidence if they are consistent with other genes in the same operon. Conclusion Although microarray data can contain large amounts of systematic error, operons provide an external standard and allow for reasonable estimates of significance. OpWise is available at http://microbesonline.org/OpWise.
Bacterial clade with the ribosomal RNA operon on a small plasmid rather than the chromosome.
Anda, Mizue; Ohtsubo, Yoshiyuki; Okubo, Takashi; Sugawara, Masayuki; Nagata, Yuji; Tsuda, Masataka; Minamisawa, Kiwamu; Mitsui, Hisayuki
2015-11-17
rRNA is essential for life because of its functional importance in protein synthesis. The rRNA (rrn) operon encoding 16S, 23S, and 5S rRNAs is located on the "main" chromosome in all bacteria documented to date and is frequently used as a marker of chromosomes. Here, our genome analysis of a plant-associated alphaproteobacterium, Aureimonas sp. AU20, indicates that this strain has its sole rrn operon on a small (9.4 kb), high-copy-number replicon. We designated this unusual replicon carrying the rrn operon on the background of an rrn-lacking chromosome (RLC) as the rrn-plasmid. Four of 12 strains close to AU20 also had this RLC/rrn-plasmid organization. Phylogenetic analysis showed that those strains having the RLC/rrn-plasmid organization represented one clade within the genus Aureimonas. Our finding introduces a previously unaddressed viewpoint into studies of genetics, genomics, and evolution in microbiology and biology in general.
Dixit, R; Trivedi, P K; Nath, P; Sane, P V
1999-09-01
Chloroplast genes are typically organized into polycistronic transcription units that give rise to complex sets of mono- and oligo-cistronic overlapping RNAs through a series of processing steps. The psbB operon contains genes for the PSII (psbB, psbT, psbH) and cytochrome b(6)f (petB and petD) complexes which are needed in different amounts during chloroplast biogenesis. The functional significance of gene organization in this polycistronic unit, containing information for two different complexes, is not known and is of interest. To determine the organization and expression of these complexes, studies have been carried out on crop plants by different groups, but not much information is known about trees. We present the nucleotide sequences of PSII genes and RNA profiles of the genes located in the psbB operon from Populus deltoides, a tree species. Although the gene organization of this operon in P. deltoides is similar to that in other species, a few variations have been observed in the processing scheme.
Matsuda, M; Kuribayashi, T; Yamamoto, S; Millar, B C; Moore, J E
2016-01-01
An arsenate susceptibility test was performed with transformed and cultured Escherichia coli DH5α cells, which carried recombinant DNA of full-length arsenic (ars) operon, namely a putative membrane permease, ArsP; a transcriptional repressor, ArsR; an arsenate reductase, ArsC; and an arsenical-resistance membrane transporter, Acr3, from the Japanese urease-positive thermophilic Campylobacter lari (UPTC) CF89-12. The E. coli DH5α transformant showed reduced susceptibility to arsenate (~1536 μg/mL), compared to the control. Thus, these ars four-genes from the UPTC CF89-12 strain cells could confer a reduced susceptibility to arsenate in the transformed and E. coli DH5α cells. E. coli transformants with truncated ars operons, acr3 (acr3) and arsC-acr3 (∆arsC-acr3), of the ars operon, showed an MIC value of 384 μg/mL (~384 μg/mL), similar to the E. coli cells which carried the pGEM-T vector (control). Reverse transcription PCR confirmed in vivo transcription of recombinant full-length ars operon and deletion variants (∆acr3 and ∆arsC-acr3) in the transformed E. coli cells.
Stöve, J; Fiedler, J; Huch, K; Günther, K-P; Puhl, W; Brenner, R
2002-03-01
Our aim was to investigate the maintenance of the transfection status of non-viral transfected chondrocytes in an alginate culture system. Chondrocytes harvested from rabbit knees were isolated by sequential digestion and cultivated in monolayer culture. At 60-70% cell density, chondrocytes were transfected with different transfection systems (FuGENE6, CaCl2, Lipofectin). A lac Z expression vector (pcDNA 3.1/Myc-His+ lacZ) was used as a reporter system. In order to improve transfection rates, hyaluronidase (4 U/ml) was used prior and during the transfection procedure. Thereafter, transfected cells were either kept in monolayer culture or embedded in alginate beads and kept in culture for up to the next 30 weeks. Transfection efficiency was maximal using FuGENE6TM/DNA at a ratio of 3:2 and hyaluronidase (4 U/ml). Transfection efficiency reached up to 40.8% (+/- 3.2%) after 36 h. In alginate beads lac Z positive cells declined to 8.5% +/- 3.3% after 4 weeks and to 4.6% +/- 3.2% after 12 weeks of culturing. After 30 weeks 3% of chondrocytes still expressed lac Z. In contrast, during culturing in monolayer, no lac Z expression was detectable after 4 weeks. Differentiation status of the chondrocytes was confirmed by histology and immunohistochemistry methods. After successful gene transfer to rabbit chondrocytes the alginate system made it possible to culture lipofected chondrocytes phenotypically stable. Genetically engineered chondrocytes express the lac Z reporter gene over a period of at least 30 weeks. This transfection and culture system provides a promising tool to further investigate the over-expression of growth factors and enzyme inhibitors. Copyright 2002 OsteoArthritis Research Society International.
Mutagenic effect of the decay of 32P incorporated in mRNA
International Nuclear Information System (INIS)
Zakharov, I.A.; Korolev, V.G.; Gracheva, L.M.
1978-01-01
32 P decay in mRNA transcribed using the Escherichia coli lactose operone leads to an authentic increase of Lac - mutants frequency as compared to the check. The principle possibility of the realization of directed mutagenesis using molecules labeled with radioactive isotopes connected with certain RNA units is shown
Selected topics from classical bacterial genetics.
Raleigh, Elisabeth A; Elbing, Karen; Brent, Roger
2002-08-01
Current cloning technology exploits many facts learned from classical bacterial genetics. This unit covers those that are critical to understanding the techniques described in this book. Topics include antibiotics, the LAC operon, the F factor, nonsense suppressors, genetic markers, genotype and phenotype, DNA restriction, modification and methylation and recombination.
Hong, Hyun; Lim, Daejin; Kim, Geun-Joong; Park, Seung-Hwan; Sik Kim, Hyeon; Hong, Yeongjin; Choy, Hyon E; Min, Jung-Joon
2014-01-01
Tumor-specific expression of antitumor drugs can be achieved using attenuated Salmonella typhimurium harboring the PBAD promoter, which is induced by L-arabinose. However, L-arabinose does not accumulate because it is metabolized to D-xylulose-5-P by enzymes encoded by the ara operon in Salmonellae. To address this problem, we developed an engineered strain of S. typhimurium in which the ara operon is deleted. Linear DNA transformation was performed using λ red recombinase to exchange the ara operon with linear DNA carrying an antibiotic-resistance gene with homology to regions adjacent to the ara operon. The ara operon-deleted strain and its parental strain were transformed with a plasmid encoding Renilla luciferase variant 8 (RLuc8) or cytolysin A (clyA) under the control of the PBAD promoter. Luciferase assays demonstrated that RLuc8 expression was 49-fold higher in the ara operon-deleted S. typhimurium than in the parental strain after the addition of L-arabinose. In vivo bioluminescence imaging showed that the tumor tissue targeted by the ara operon-deleted Salmonella had a stronger imaging signal (~30-fold) than that targeted by the parental strain. Mice with murine colon cancer (CT26) that had been injected with the ara operon-deleted S. typhimurium expressing clyA showed significant tumor suppression. The present report demonstrates that deletion of the ara operon of S. typhimurium enhances L-arabinose accumulation and thereby drives PBAD-promoted expression of cytotoxic agents and imaging agents. This is a promising approach for tumor therapy and imaging.
Adhikary, Hemanta; Sanghavi, Paulomi B.; Macwan, Silviya R.; Archana, Gattupalli; Naresh Kumar, G.
2014-01-01
Citric acid is a strong acid with good cation chelating ability and can be very efficient in solubilizing mineral phosphates. Only a few phosphate solubilizing bacteria and fungi are known to secrete citric acids. In this work, we incorporated artificial citrate operon containing NADH insensitive citrate synthase (gltA1) and citrate transporter (citC) genes into the genome of six-plant growth promoting P. fluorescens strains viz., PfO-1, Pf5, CHAO1, P109, ATCC13525 and Fp315 using MiniTn7 transposon gene delivery system. Comprehensive biochemical characterization of the genomic integrants and their comparison with plasmid transformants of the same operon in M9 minimal medium reveals the highest amount of ∼7.6±0.41 mM citric and 29.95±2.8 mM gluconic acid secretion along with ∼43.2±3.24 mM intracellular citrate without affecting the growth of these P. fluorescens strains. All genomic integrants showed enhanced citric and gluconic acid secretion on Tris-Cl rock phosphate (TRP) buffered medium, which was sufficient to release 200–1000 µM Pi in TRP medium. This study demonstrates that MPS ability could be achieved in natural fluorescent pseudomonads by incorporation of artificial citrate operon not only as plasmid but also by genomic integration. PMID:25259527
Ray, Sujay; Banerjee, Arundhati
2015-10-01
Participation of Pseudomonas putida-derived methyl phenol (dmp) operon and DmpR protein in the biodegradation of phenol or other harmful, organic, toxic pollutants was investigated at a molecular level. Documentation documents that P. putida has DmpR protein which positively regulates dmp operon in the presence of inducers; like phenols. From the operon, phenol hydroxylase encoded by dmpN gene, participates in degrading phenols after dmp operon is expressed. For the purpose, the 3-D models of the four domains from DmpR protein and of the DNA sequences from the two Upstream Activation Sequences (UAS) present at the promoter region of the operon were demonstrated using discrete molecular modeling techniques. The best modeled structures satisfying their stereo-chemical properties were selected in each of the cases. To stabilize the individual structures, energy optimization was performed. In the presence of inducers, probable interactions among domains and then the two independent DNA structures with the fourth domain were perused by manifold molecular docking simulations. The complex structures were made to be stable by minimizing their overall energy. Responsible amino acid residues, nucleotide bases and binding patterns for the biodegradation, were examined. In the presence of the inducers, the biodegradation process is initiated by the interaction of phe50 from the first protein domain with the inducers. Only after the interaction of the last domain with the DNA sequences individually, the operon is expressed. This novel residue level study is paramount for initiating transcription in the operon; thereby leading to expression of phenol hydroxylase followed by phenol biodegradation. Copyright © 2015. Published by Elsevier B.V.
Transcription of the extended hyp-operon in Nostoc sp. strain PCC 7120
Agervald, Åsa; Stensjö, Karin; Holmqvist, Marie; Lindblad, Peter
2008-01-01
Background The maturation of hydrogenases into active enzymes is a complex process and e.g. a correctly assembled active site requires the involvement of at least seven proteins, encoded by hypABCDEF and a hydrogenase specific protease, encoded either by hupW or hoxW. The N2-fixing cyanobacterium Nostoc sp. strain PCC 7120 may contain both an uptake and a bidirectional hydrogenase. The present study addresses the presence and expression of hyp-genes in Nostoc sp. strain PCC 7120. Results RT-PCRs demonstrated that the six hyp-genes together with one ORF may be transcribed as a single operon. Transcriptional start points (TSPs) were identified 280 bp upstream from hypF and 445 bp upstream of hypC, respectively, demonstrating the existence of several transcripts. In addition, five upstream ORFs located in between hupSL, encoding the small and large subunits of the uptake hydrogenase, and the hyp-operon, and two downstream ORFs from the hyp-genes were shown to be part of the same transcript unit. A third TSP was identified 45 bp upstream of asr0689, the first of five ORFs in this operon. The ORFs are annotated as encoding unknown proteins, with the exception of alr0692 which is identified as a NifU-like protein. Orthologues of the four ORFs asr0689-alr0692, with a highly conserved genomic arrangement positioned between hupSL, and the hyp genes are found in several other N2-fixing cyanobacteria, but are absent in non N2-fixing cyanobacteria with only the bidirectional hydrogenase. Short conserved sequences were found in six intergenic regions of the extended hyp-operon, appearing between 11 and 79 times in the genome. Conclusion This study demonstrated that five ORFs upstream of the hyp-gene cluster are co-transcribed with the hyp-genes, and identified three TSPs in the extended hyp-gene cluster in Nostoc sp. strain PCC 7120. This may indicate a function related to the assembly of a functional uptake hydrogenase, hypothetically in the assembly of the small subunit of
RepA and RepB exert plasmid incompatibility repressing the transcription of the repABC operon.
Pérez-Oseguera, Angeles; Cevallos, Miguel A
2013-11-01
Rhizobium etli CFN42 has a multipartite genome composed of one chromosome and six large plasmids with low copy numbers, all belonging to the repABC plasmid family. All elements essential for replication and segregation of these plasmids are encoded within the repABC operon. RepA and RepB direct plasmid segregation and are involved in the transcriptional regulation of the operon, and RepC is the initiator protein of the plasmid. Here we show that in addition to RepA (repressor) and RepB (corepressor), full transcriptional repression of the operon located in the symbiotic plasmid (pRetCFN42d) of this strain requires parS, the centromere-like sequence, and the operator sequence. However, the co-expression of RepA and RepB is sufficient to induce the displacement of the parental plasmid. RepA is a Walker-type ATPase that self associates in vivo and in vitro and binds specifically to the operator region in its RepA-ADP form. In contrast, RepA-ATP is capable of binding to non-specific DNA. RepA and RepB form high molecular weight DNA-protein complexes in the presence of ATP and ADP. RepA carrying ATP-pocket motif mutations induce full repression of the repABC operon without the participation of RepB and parS. These mutants specifically bind the operator sequence in their ATP or ADP bound forms. In addition, their expression in trans exerts plasmid incompatibility against the parental plasmid. RepA and RepB expressed in trans induce plasmid incompatibility because of their ability to repress the repABC operon and not only by their capacity to distort the plasmid segregation process. Copyright © 2013 Elsevier Inc. All rights reserved.
Control of MarRAB Operon in Escherichia coli via Autoactivation and Autorepression
Prajapat, Mahendra Kumar; Jain, Kirti; Saini, Supreet
2015-01-01
Choice of network topology for gene regulation has been a question of interest for a long time. How do simple and more complex topologies arise? In this work, we analyze the topology of the marRAB operon in Escherichia coli, which is associated with control of expression of genes associated with conferring resistance to low-level antibiotics to the bacterium. Among the 2102 promoters in E. coli, the marRAB promoter is the only one that encodes for an autoactivator and an autorepressor. What advantages does this topology confer to the bacterium? In this work, we demonstrate that, compared to control by a single regulator, the marRAB regulatory arrangement has the least control cost associated with modulating gene expression in response to environmental stimuli. In addition, the presence of dual regulators allows the regulon to exhibit a diverse range of dynamics, a feature that is not observed in genes controlled by a single regulator. PMID:26445450
Directory of Open Access Journals (Sweden)
Terezinha Knöbl
2006-06-01
Full Text Available The occurrence of fim, pap and sfa operons in Escherichia coli isolated from breeders with salpingitis and chicks with omphalitis was evaluated. Analysis of 100 E. coli isolates, by colony hybridization tests, showed that 78 (78% were fim+, one (1% was sfa+, seven (7% were fim+ associated with pap+, eigth (8% were fim+ and sfa+, one (1% was fim+pap+sfa+ and five (5% isolates did not hybridize with any probe. These results suggest that fim adhesion-encoding operon plays an important role in pathogenesis of E. coli infection in chickens with salpingitis and omphalitis.Ocorrência dos operons fim, pap e sfa em amostras de Escherichia coli isoladas de reprodutoras com salpingite e pintinhos com onfalite foi avaliada. A análise de 100 amostras através dos testes de hibridização de colônia mostrou que 78 (78% amostras eram fim+, uma (1% era sfa+, sete (7% eram fim+ associada a pap+, oito (8% eram fim+ e uma (1% era fim+pap+sfa+ e cinco (5% amostras não hibridizaram com nenhuma sonda. Estes resultados sugerem que o operon fim pode ter um importante papel na patogenia da infecção de Escherichia coli em reprodutoras com salpingite e pintinhos com onfalite.
International Nuclear Information System (INIS)
Widenhorn, K.A.; Boos, W.; Somers, J.M.; Kay, W.W.
1988-01-01
The tricarboxylate transport operon (tctI) was cloned in Escherichia coli as a 12-kilobase (kb) fragment from an EcoRI library of the Salmonella typhimurium chromosome in λgtWES. It was further subcloned as a 12-kb fragment into pACYC184 and as an 8-kb fragment into pBR322. By insertional mutagenesis mediated by λTn5, restriction mapping, and phenotypic testing, the tctI operon was localized to a 4.5-kb region. The tctC gene which encodes a periplasmic binding protein (C-protein) was located near the center of the insert. E. coli/tctI clones on either multicopy or single-copy vectors grew on the same tricarboxylates as S. typhimurium, although unusually long growth lags were observed. E. coli/tctI clones exhibited similar [ 14 C] fluorocitrate transport kinetics to those of S. typhimurium, whereas E. coli alone was virtually impermeable to [ 14 C] fluorocitrate. The periplasmic C proteins (C1 and C2 isoelectric forms) were produced in prodigious quantities from the cloned strains. Motile E. coli/tctI clones were not chemotactic toward citrate, whereas tctI deletion mutants of S. typhimurium were. Taken together, these observations indicate that tctI is not an operon involved in chemotaxis
Exploring the sequence-function relationship in transcriptional regulation by the lac O1 operator.
Maity, Tuhin S; Jha, Ramesh K; Strauss, Charlie E M; Dunbar, John
2012-07-01
Understanding how binding of a transcription factor to an operator is influenced by the operator sequence is an ongoing quest. It facilitates discovery of alternative binding sites as well as tuning of transcriptional regulation. We investigated the behavior of the Escherichia coli Lac repressor (LacI) protein with a large set of lac O(1) operator variants. The 114 variants examined contained a mean of 2.9 (range 0-4) mutations at positions -4, -2, +2 and +4 in the minimally required 17 bp operator. The relative affinity of LacI for the operators was examined by quantifying expression of a GFP reporter gene and Rosetta structural modeling. The combinations of mutations in the operator sequence created a wide range of regulatory behaviors. We observed variations in the GFP fluorescent signal among the operator variants of more than an order of magnitude under both uninduced and induced conditions. We found that a single nucleotide change may result in changes of up to six- and 12-fold in uninduced and induced GFP signals, respectively. Among the four positions mutated, we found that nucleotide G at position -4 is strongly correlated with strong repression. By Rosetta modeling, we found a significant correlation between the calculated binding energy and the experimentally observed transcriptional repression strength for many operators. However, exceptions were also observed, underscoring the necessity for further improvement in biophysical models of protein-DNA interactions. © 2012 The Authors Journal compilation © 2012 FEBS.
Mutagenic effect of the decay of /sup 32/P incorporated in mRNA
Energy Technology Data Exchange (ETDEWEB)
Zakharov, I A; Korolev, V G; Gracheva, L M [AN SSSR, Leningrad. Inst. Yadernoj Fiziki
1978-10-01
/sup 32/P decay in mRNA transcribed using the Escherichia coli lactose operone leads to an authentic increase of Lac/sup -/ mutants frequency as compared to the check. The principle possibility of the realization of directed mutagenesis using molecules labeled with radioactive isotopes connected with certain RNA units is shown.
DEFF Research Database (Denmark)
Eberl, L; Winson, MK; Sternberg, C
1996-01-01
The velocity with which a swarming colony of Serratia liquefaciens colonizes the surface of a suitable solid substratum was controlled by modulating the expression of the flhD master operon. In liquid medium, the stimulation of flhD expression resulted in filamentous, multinucleate, and hyperflag......The velocity with which a swarming colony of Serratia liquefaciens colonizes the surface of a suitable solid substratum was controlled by modulating the expression of the flhD master operon. In liquid medium, the stimulation of flhD expression resulted in filamentous, multinucleate......, and hyperflagellated cells that were indistinguishable from swarm cells isolated from the edge of a swarm colony. Thus, expression of the flhD master operon appears to play a central role in the process of swarm cell differentiation....
Structural Insight into the Gene Expression Profiling of the hcn Operon in Pseudomonas aeruginosa.
Chowdhury, Nilkanta; Bagchi, Angshuman
2017-07-01
Pseudomonas aeruginosa is a common opportunistic human pathogen. It generally attacks immunosuppressed patients like AIDS, cancer, cystic fibrosis, etc. The virulence of P. aeruginosa is mediated by various virulence factors. One of such potential virulence factors is HCN synthesized by HCN synthase enzyme, which is encoded by the hcnABC operon. The expressions of the genes of this operon are regulated by three transcriptional regulators, viz., LasR, ANR, and RhlR. In our previous work, we analyzed the molecular details of the functionalities of LasR. In this work, we focused on ANR. ANR is a regulatory protein which belongs to the FNR family and works in anaerobic condition. ANR binds to the promoter DNA, named ANR box, as a dimer. The dimerization of this ANR protein is regulated by Fe 4 S 4 , an iron-sulfur cluster. This dimer of ANR (ANR-Fe 4 S 4 /ANR-Fe 4 S 4 ) recognizes and binds the promoter DNA sequence and regulates the transcription of this hcnABC operon. Till date, the biomolecular details of the interactions of ANR dimer with the promoter DNA are not fully understood. Thus, we built the molecular model of ANR-Fe 4 S 4 /ANR-Fe 4 S 4 . We docked the complex with the corresponding promoter DNA region. We analyzed the mode of interactions with the promoter DNA under different conditions. Thus, we tried to analyze the functionality of the ANR protein during the expressions of the genes of the hcnABC operon. So far, this is the first report to detail the molecular mechanism of the gene expression in P. aeruginosa.
Ahmad, Zuleeza; Harvey, Richard M; Paton, James C; Standish, Alistair J; Morona, Renato
2018-01-01
Streptococcus pneumoniae is the leading cause of community-acquired pneumonia in all ages worldwide, and with ever-increasing antibiotic resistance, the understanding of its pathogenesis and spread is as important as ever. Recently, we reported the presence of a Low Molecular Weight Tyrosine Phosphatase (LMWPTP) Spd1837 in the pneumococcus. This protein is encoded in an operon, OM001 with two other genes, with previous work implicating this operon as important for pneumococcal virulence. Thus, we set out to investigate the role of the individual genes in the operon during pneumococcal pathogenesis. As LMWPTPs play a major role in capsular polysaccharide (CPS) biosynthesis in many bacteria, we tested the effect of mutating spd1837 and its adjacent genes, spd1836 and spd1838 on CPS levels. Our results suggest that individual deletion of the genes, including the LMWPTP, did not modulate CPS levels, in multiple conditions, and in different strain backgrounds. Following in vivo studies, Spd1836 was identified as a novel virulence factor during pneumococcal invasive disease, in both the lungs and blood, with this protein alone responsible for the effects of operon's role in virulence. We also showed that a deletion in spd1836, spd1838 or the overall OM001 operon reduced survival in human saliva during the conditions that mimic transmission compared to the wildtype strain. With studies suggesting that survival in human saliva may be important for transmission, this study identifies Spd1836 and Spd1838 as transmission factors, potentially facilitating the spread of the pneumococcus from person to person. Overall, this study hopes to further our understanding of the bacterial transmission that precedes disease and outbreaks.
76 FR 68124 - Television Broadcasting Services; Fond du Lac, WI
2011-11-03
... FEDERAL COMMUNICATIONS COMMISSION 47 CFR Part 73 [MB Docket No. 09-115, RM-11543; DA 11-1502] Television Broadcasting Services; Fond du Lac, WI AGENCY: Federal Communications Commission. ACTION: Proposed rule. SUMMARY: In this document, the Commission denies a petition for reconsideration of an August 12...
Lianhua, Ye; Yunchao, Huang; Guangqiang, Zhao; Kun, Yang; Xing, Liu; Fengli, Guo
2014-12-01
The intercellular adhesion gene (ica) of Staphylococcus epidermidis is a key factor for bacterial aggregation. This study explored the effect of ica on the formation of bacterial biofilm on polyvinyl chloride (PVC) surfaces. Genes related to bacterial biofilm formation, including 16S rRNA, autolysin (atlE), fibrinogen binding protein gene (fbe), and ica were identified and sequenced from 112 clinical isolates of iatrogenic S. epidermidis by polymerase chain reaction (PCR) and gene sequencing. Based on the sequencing result, ica operon-positive (icaADB+/atlE+/fbe+) and ica operon-negative (icaADB-/atlE+/fbe+) strains were separated and co-cultivated with PVC material. After 6, 12, 18, 24, and 30 h of co-culture, the thickness of the bacterial biofilm and quantity of bacterial colony on the PVC surface were measured under the confocal laser scanning microscope and scanning electron microscope. The positive rate of S. epidermidis-specific 16SrRNA in 112 iatrogenic strains was 100% (112/112). The genotype of ica-positive (icaADB+/atlE+/fbe+) strains accounted for 57.1% (64/112), and genotype of ica-negative (icaADB-/atlE+/fbe+) strains accounted for 37.5% (42/112). During 30 h of co-culture, no obvious bacterial biofilm formed on the surface of PVC in the ica-positive group, however, mature bacterial biofilm structure formed after 24 h. For all time points, thickness of bacterial biofilm and quantity of bacterial colony on PVC surfaces in the ica operon-positive group were significantly higher than those in ica operon-negative group (poperon-negative and ica operon-positive strains. The ica operon plays an important role in bacterial biofilm formation and bacterial multiplication on PVC material.
Wada, Masayoshi; Takahashi, Hiroki; Altaf-Ul-Amin, Md; Nakamura, Kensuke; Hirai, Masami Y; Ohta, Daisaku; Kanaya, Shigehiko
2012-07-15
Operon-like arrangements of genes occur in eukaryotes ranging from yeasts and filamentous fungi to nematodes, plants, and mammals. In plants, several examples of operon-like gene clusters involved in metabolic pathways have recently been characterized, e.g. the cyclic hydroxamic acid pathways in maize, the avenacin biosynthesis gene clusters in oat, the thalianol pathway in Arabidopsis thaliana, and the diterpenoid momilactone cluster in rice. Such operon-like gene clusters are defined by their co-regulation or neighboring positions within immediate vicinity of chromosomal regions. A comprehensive analysis of the expression of neighboring genes therefore accounts a crucial step to reveal the complete set of operon-like gene clusters within a genome. Genome-wide prediction of operon-like gene clusters should contribute to functional annotation efforts and provide novel insight into evolutionary aspects acquiring certain biological functions as well. We predicted co-expressed gene clusters by comparing the Pearson correlation coefficient of neighboring genes and randomly selected gene pairs, based on a statistical method that takes false discovery rate (FDR) into consideration for 1469 microarray gene expression datasets of A. thaliana. We estimated that A. thaliana contains 100 operon-like gene clusters in total. We predicted 34 statistically significant gene clusters consisting of 3 to 22 genes each, based on a stringent FDR threshold of 0.1. Functional relationships among genes in individual clusters were estimated by sequence similarity and functional annotation of genes. Duplicated gene pairs (determined based on BLAST with a cutoff of EOperon-like clusters tend to include genes encoding bio-machinery associated with ribosomes, the ubiquitin/proteasome system, secondary metabolic pathways, lipid and fatty-acid metabolism, and the lipid transfer system. Copyright © 2012 Elsevier B.V. All rights reserved.
Influence of salt content and processing time on sensory characteristics of cooked "lacón".
Purriños, Laura; Bermúdez, Roberto; Temperán, Sara; Franco, Daniel; Carballo, Javier; Lorenzo, José M
2011-04-01
The influence of salt content and processing time on the sensory properties of cooked "lacón" were determined. "Lacón" is a traditional dry-cured and ripened meat product made in the north-west of Spain from the fore leg of the pig, following a similar process to that of dry-cured ham. Six batches of "lacón" were salted with different amounts of salt (LS (3 days of salting), MS (4 days of salting) and HS (5 days of salting)) and ripened during two times (56 and 84 days of dry-ripening). Cured odour in all batches studied, red colour and rancid odour in MS and HS batches, flavour intensity in MS batch and fat yellowness, rancid flavour and hardness in the HS batch were significantly different with respect to the time of processing. Appearance, odour, flavour and texture were not significantly affected by the salt content (P>0.05). However, the saltiness score showed significant differences with respect to the salt levels in all studied batches (56 and 84 days of process). The principal component analysis showed that physicochemical traits were the most important ones concerning the quality of dry-cured "lacón" and offered a good separation of the mean samples according to the dry ripening days and salt level. © 2010 The American Meat Science Association. Published by Elsevier Ltd. All rights reserved.
Srichaisupakit, Akkaraphol; Ohashi, Takao; Fujiyama, Kazuhito
2014-09-01
Campylobacter jejuni is a human enteropathogenic bacterium possessing an N-glycosylation system. In this work, a protein glycosylation (pgl) operon conferring prokaryotic N-glycosylation in C. jejuni JCM 2013 was cloned and identified. Fourteen open reading frames (ORFs) were found in the pgl operon. The operon organization was similar to that of C. jejuni NCTC 11168, with 98% and 99% identities in overall nucleotide sequence and amino acid sequence, respectively. The pgl operon was heterologously co-expressed with model protein CmeA in the Escherichia coli BL21 ΔwaaL mutant. The immuno- and lectin-blotting analysis indicated the protein glycosylation on the recombinant CmeA. In addition, to analyze the glycan composition, the recombinant CmeA was purified and subjected to in-gel trypsin digestion followed by mass spectrometry analysis. The mass spectrometry analysis showed the presence of the N-acetylhexosamine residue at the reducing end but not the predicted di-N-acetylbacillosamine (diNAcBac) residue. Further glycan structural study using the conventional fluorophore-labeling method revealed the GalNAcα-GalNAcα-(Hex-)HexNAc-HexNAc-HexNAc-HexNAc structure. Transcriptional analysis showed that UDP-diNAcBac synthases and diNAcBac transferase are transcribed but might not function in the constructed system. In conclusion, a pgl operon from C. jejuni JCM 2013 successfully functioned in E. coli, resulting in the observed prokaryotic glycosylation. Copyright © 2014 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.
Ou, Hong-Yu; Kuang, Shan N.; He, Xinyi; Molgora, Brenda M.; Ewing, Peter J.; Deng, Zixin; Osby, Melanie; Chen, Wangxue; Xu, H. Howard
2015-01-01
Acinetobacter baumannii is an important human pathogen due to its multi-drug resistance. In this study, the genome of an ST10 outbreak A. baumannii isolate LAC-4 was completely sequenced to better understand its epidemiology, antibiotic resistance genetic determinants and potential virulence factors. Compared with 20 other complete genomes of A. baumannii, LAC-4 genome harbors at least 12 copies of five distinct insertion sequences. It contains 12 and 14 copies of two novel IS elements, ISAba25 and ISAba26, respectively. Additionally, three novel composite transposons were identified: Tn6250, Tn6251 and Tn6252, two of which contain resistance genes. The antibiotic resistance genetic determinants on the LAC-4 genome correlate well with observed antimicrobial susceptibility patterns. Moreover, twelve genomic islands (GI) were identified in LAC-4 genome. Among them, the 33.4-kb GI12 contains a large number of genes which constitute the K (capsule) locus. LAC-4 harbors several unique putative virulence factor loci. Furthermore, LAC-4 and all 19 other outbreak isolates were found to harbor a heme oxygenase gene (hemO)-containing gene cluster. The sequencing of the first complete genome of an ST10 A. baumannii clinical strain should accelerate our understanding of the epidemiology, mechanisms of resistance and virulence of A. baumannii. PMID:25728466
The REX survey as a tool to test the beaming model for BL Lacs
Caccianiga, A; MacCacaro, T; Wolter, A; Gioia, I M
1999-01-01
In the context of the beaming model (BM) BL Lac and FR I radio galaxies are thought to be the same class of sources seen at different angles. If this picture is correct, we expect to find some transition objects with intermediate properties between the two classes. To date, this intermediate population of objects is missing, probably due to the limiting fluxes of the current X-ray/radio surveys and/or to the criteria used to separate BL Lacs from normal elliptical galaxies. As pointed out by Browne and Marcha (1993), the detection of the transition objects requires particular attention since the "weak" BL Lac nucleus is hidden by the light of the host elliptical galaxy. A useful criterion often used to assess the presence of a non-thermal source, in addition to the stellar emission of the host galaxy, is the Ca contrast at 4000 AA (K/sub 4000/). This quantity, which is defined as the relative depression of the spectrum across 4000 AA, is a typical feature observed in a "normal" elliptical galaxy; the samples ...
Constraining the red shifts of TeV BL Lac objects
Qin, Longhua; Wang, Jiancheng; Yan, Dahai; Yang, Chuyuan; Yuan, Zunli; Zhou, Ming
2018-01-01
We present a model-dependent method to estimate the red shifts of three TeV BL Lac objects (BL Lacs) through fitting their (quasi-)simultaneous multi-waveband spectral energy distributions (SEDs) with a one-zone leptonic synchrotron self-Compton model. Considering the impact of electron energy distributions (EEDs) on the results, we use three types of EEDs to fit the SEDs: a power-law EED with exponential cut-off (PLC), a log-parabola (PLLP) EED and the broken power-law (BPL) EED. We also use a parameter α to describe the uncertainties of the extragalactic background light models, as in Abdo et al. We then use a Markov chain Monte Carlo method to explore the multi-dimensional parameter space and obtain the uncertainties of the model parameters based on the observational data. We apply our method to obtain the red shifts of three TeV BL Lac objects in the marginalized 68 per cent confidence, and find that the PLC EED does not fit the SEDs. For 3C66A, the red shift is 0.14-0.31 and 0.16-0.32 in the BPL and PLLP EEDs. For PKS1424+240, the red shift is 0.55-0.68 and 0.55-0.67 in the BPL and PLLP EEDs. For PG1553+113, the red shift is 0.22-0.48 and 0.22-0.39 in the BPL and PLLP EEDs. We also estimate the red shift of PKS1424+240 in the high stage to be 0.46-0.67 in the PLLP EED, roughly consistent with that in the low stage.
Infrared polarimetry and photometry of BL Lac objects
International Nuclear Information System (INIS)
Impey, C.D.; Williams, P.M.
1984-01-01
Photometry and polarimetry in the JHK wavebands have now been obtained for 25 BL Lac objects. Several new objects have been monitored for periods of up to five days, and accumulated data is sufficient for a statistical analysis of polarization properties. The selection effects operating on this sample are examined first. A power-law spectrum is consistent with the spectra of all but three objects. A number of important new results are reported. (author)
Chukhutsina, Volha; Bersanini, Luca; Aro, Eva-Mari; van Amerongen, Herbert
2015-05-01
Photosystem II (PSII) complexes drive the water-splitting reaction necessary to transform sunlight into chemical energy. However, too much light can damage and disrupt PSII. In cyanobacteria, the flv4-2 operon encodes three proteins (Flv2, Flv4, and Sll0218), which safeguard PSII activity under air-level CO2 and in high light conditions. However, the exact mechanism of action of these proteins has not been clarified yet. We demonstrate that the PSII electron transfer properties are influenced by the flv4-2 operon-encoded proteins. Accelerated secondary charge separation kinetics was observed upon expression/overexpression of the flv4-2 operon. This is likely induced by docking of the Flv2/Flv4 heterodimer in the vicinity of the QB pocket of PSII, which, in turn, increases the QB redox potential and consequently stabilizes forward electron transfer. The alternative electron transfer route constituted by Flv2/Flv4 sequesters electrons from QB(-) guaranteeing the dissipation of excess excitation energy in PSII under stressful conditions. In addition, we demonstrate that in the absence of the flv4-2 operon-encoded proteins, about 20% of the phycobilisome antenna becomes detached from the reaction centers, thus decreasing light harvesting. Phycobilisome detachment is a consequence of a decreased relative content of PSII dimers, a feature observed in the absence of the Sll0218 protein. Copyright © 2015 The Author. Published by Elsevier Inc. All rights reserved.
DEFF Research Database (Denmark)
Guo, Yang; Kragelund, Birthe Brandt; White, Malcolm F.
2015-01-01
encoding proteins of unknown function and forming an operon with ORF207 (gp19). SIRV2 gp17 was found to be a single-stranded DNA (ssDNA) binding protein different in structure from all previously characterized ssDNA binding proteins. Mutagenesis of a few conserved basic residues suggested a U......-shaped binding path for ssDNA. The recombinant gp18 showed an ssDNA annealing activity often associated with helicases and recombinases. To gain insight into the biological role of the entire operon, we characterized SIRV2 gp19 and showed it to possess a 5'→3' ssDNA exonuclease activity, in addition...... for rudiviruses and the close interaction among the ssDNA binding, annealing and nuclease proteins strongly point to a role of the gene operon in genome maturation and/or DNA recombination that may function in viral DNA replication/repair....
Transformation of lacZ using different promoters in the commercially ...
African Journals Online (AJOL)
Yomi
2012-01-26
Jan 26, 2012 ... forced growth under unnatural conditions. In order to ... yezoensis include the gluc, cat, GUS and GFP genes. (Cheney et al. ... bacterial lacZ gene encodes the β-galactosidase enzyme which is capable of .... Table 1. Effect of viral promoters on transient β-galactosidase activity in microparticle bombarded G.
Generation and evaluation of an IPTG-regulated version of Vav-gene promoter for mouse transgenesis.
Directory of Open Access Journals (Sweden)
Francesca Grespi
2011-03-01
Full Text Available Different bacteria-derived systems for regulatable gene expression have been developed for the use in mammalian cells and some were also successfully adopted for in vivo use in vertebrate model organisms. However, certain limitations apply to most of these systems, including leakiness of transgene expression, inefficient transgene silencing or activation, as well as limited tissue accessibility of transgene-inducers or their unfavourable pharmacokinetics. In this study, we evaluated the suitability of the lac-operon/lac-repressor (lacO/lacI system for the regulation of the well-established Vav-gene promoter that allows inducible transgene expression in different haematopoietic lineages in mice. Using the fluorescence marker protein Venus as a reporter, we observed that the lacO/lacI system could be amended to modulate transgene-expression in haematopoietic cells. However, reporter expression was not uniform and the lacO elements introduced into the Vav-gene promoter only conferred limited repression and reversion of lacI-mediated gene silencing after administration of IPTG. Although further optimization of the system is required, the lacO-modified version of the Vav-gene promoter may be adopted as a tool where low basal gene-expression and limited transient induction of protein expression are desired, e.g. for the activation of oncogenes or transgenes that act in a dominant-negative manner.
Giommi, P.; Menna, M. T.; Padovani, P.
1999-01-01
We have assembled a multi-frequency database by cross-correlating the NVSS catalog of radio sources with the RASSBSC list of soft X-ray sources, obtaining optical magnitude estimates from the Palomar and UK Schmidt surveys as provided by the APM and COSMOS on-line services. By exploiting the nearly unique broad-band properties of High-Energy Peaked (HBL) BL Lacs we have statistically identified a sample of 218 objects that is expected to include about 85% of BL Lacs and that is therefore seve...
Roy, Ajit; Ranjan, Akash
2016-02-23
Members of the Multiple antibiotic resistance Regulator (MarR) family of DNA binding proteins regulate transcription of a wide array of genes required for virulence and pathogenicity of bacteria. The present study reports the molecular characterization of HosA (Homologue of SlyA), a MarR protein, with respect to its target gene, DNA recognition motif, and nature of its ligand. Through a comparative genomics approach, we demonstrate that hosA is in synteny with nonoxidative hydroxyarylic acid decarboxylase (HAD) operon and is present exclusively within the mutS-rpoS polymorphic region in nine different genera of Enterobacteriaceae family. Using molecular biology and biochemical approach, we demonstrate that HosA binds to a palindromic sequence downstream to the transcription start site of divergently transcribed nonoxidative HAD operon and represses its expression. Furthermore, in silico analysis showed that the recognition motif for HosA is highly conserved in the upstream region of divergently transcribed operon in different genera of Enterobacteriaceae family. A systematic chemical search for the physiological ligand revealed that 4-hydroxybenzoic acid (4-HBA) interacts with HosA and derepresses HosA mediated repression of the nonoxidative HAD operon. Based on our study, we propose a model for molecular mechanism underlying the regulation of nonoxidative HAD operon by HosA in Enterobacteriaceae family.
International Nuclear Information System (INIS)
Sanctis, Daniele de; Rêgo, Ana T.; Marçal, David; McVey, Colin E.; Carrondo, Maria A.; Enguita, Francisco J.
2007-01-01
The sorbitol operon regulator from K. pneumoniae has been overexpressed in E. coli, purified and crystallized. Diffraction data were collected to 3.2 Å. The sorbitol operon regulator (SorC) regulates the metabolism of l-sorbose in Klebsiella pneumonia. SorC was overexpressed in Escherichia coli and purified, and crystals were obtained of a tetrameric form. A single crystal showed X-ray diffraction to 3.20 Å. The crystal belongs to space group P2 1 2 1 2 1 , with unit-cell parameters a = 91.6, b = 113.3, c = 184.1 Å. Analysis of the molecular-replacement solution indicates the presence of four SorC molecules in the asymmetric unit
Transcription of the extended hyp-operon in Nostoc sp. strain PCC 7120
Directory of Open Access Journals (Sweden)
Lindblad Peter
2008-04-01
Full Text Available Abstract Background The maturation of hydrogenases into active enzymes is a complex process and e.g. a correctly assembled active site requires the involvement of at least seven proteins, encoded by hypABCDEF and a hydrogenase specific protease, encoded either by hupW or hoxW. The N2-fixing cyanobacterium Nostoc sp. strain PCC 7120 may contain both an uptake and a bidirectional hydrogenase. The present study addresses the presence and expression of hyp-genes in Nostoc sp. strain PCC 7120. Results RT-PCRs demonstrated that the six hyp-genes together with one ORF may be transcribed as a single operon. Transcriptional start points (TSPs were identified 280 bp upstream from hypF and 445 bp upstream of hypC, respectively, demonstrating the existence of several transcripts. In addition, five upstream ORFs located in between hupSL, encoding the small and large subunits of the uptake hydrogenase, and the hyp-operon, and two downstream ORFs from the hyp-genes were shown to be part of the same transcript unit. A third TSP was identified 45 bp upstream of asr0689, the first of five ORFs in this operon. The ORFs are annotated as encoding unknown proteins, with the exception of alr0692 which is identified as a NifU-like protein. Orthologues of the four ORFs asr0689-alr0692, with a highly conserved genomic arrangement positioned between hupSL, and the hyp genes are found in several other N2-fixing cyanobacteria, but are absent in non N2-fixing cyanobacteria with only the bidirectional hydrogenase. Short conserved sequences were found in six intergenic regions of the extended hyp-operon, appearing between 11 and 79 times in the genome. Conclusion This study demonstrated that five ORFs upstream of the hyp-gene cluster are co-transcribed with the hyp-genes, and identified three TSPs in the extended hyp-gene cluster in Nostoc sp. strain PCC 7120. This may indicate a function related to the assembly of a functional uptake hydrogenase, hypothetically in the
International Nuclear Information System (INIS)
Stevenson, D.R.; Kozak, E.T.; Davison, C.C.; Gascoyne, M.; Broadfoot, R.A.
1996-06-01
The hydrogeologic characteristics of the granitic Lac du Bonnet batholith in southeastern Manitoba have been studied since 1978, as part of AECL's program to assess the concept of disposing of Canada's nuclear fuel waste deep within plutonic rocks of the Canadian Shield (Davison et al. 1994a). These studies have included an extensive program of drilling, logging, testing, sampling and monitoring in 19 deep surface boreholes drilled at Grid areas located across the Lac du Bonnet batholith, at the Whiteshell Laboratory (WL), and in surface and underground boreholes at the Underground Research Laboratory (URL). Based on these investigations domains of low permeability, sparsely fractured rock (SFR) have been identified in the Lac du Bonnet batholith
Directory of Open Access Journals (Sweden)
Olivier Dangles
Full Text Available Biodiversity loss and climate change are both globally significant issues that must be addressed through collaboration across countries and disciplines. With the December 2015 COP21 climate conference in Paris and the recent creation of the Intergovernmental Platform on Biodiversity and Ecosystem Services (IPBES, it has become critical to evaluate the capacity for global research networks to develop at the interface between biodiversity and climate change. In the context of the European Union (EU strategy to stand as a world leader in tackling global challenges, the European Commission has promoted ties between the EU and Latin America and the Caribbean (LAC in science, technology and innovation. However, it is not clear how these significant interactions impact scientific cooperation at the interface of biodiversity and climate change. We looked at research collaborations between two major regions-the European Research Area (ERA and LAC-that addressed both biodiversity and climate change. We analysed the temporal evolution of these collaborations, whether they were led by ERA or LAC teams, and which research domains they covered. We surveyed publications listed on the Web of Science that were authored by researchers from both the ERA and LAC and that were published between 2003 and 2013. We also run similar analyses on other topics and other continents to provide baseline comparisons. Our results revealed a steady increase in scientific co-authorships between ERA and LAC countries as a result of the increasingly complex web of relationships that has been weaved among scientists from the two regions. The ERA-LAC co-authorship increase for biodiversity and climate change was higher than those reported for other topics and for collaboration with other continents. We also found strong differences in international collaboration patterns within the LAC: co-publications were fewest from researchers in low- and lower-middle-income countries and most
Dangles, Olivier; Loirat, Jean; Freour, Claire; Serre, Sandrine; Vacher, Jean; Le Roux, Xavier
2016-01-01
Biodiversity loss and climate change are both globally significant issues that must be addressed through collaboration across countries and disciplines. With the December 2015 COP21 climate conference in Paris and the recent creation of the Intergovernmental Platform on Biodiversity and Ecosystem Services (IPBES), it has become critical to evaluate the capacity for global research networks to develop at the interface between biodiversity and climate change. In the context of the European Union (EU) strategy to stand as a world leader in tackling global challenges, the European Commission has promoted ties between the EU and Latin America and the Caribbean (LAC) in science, technology and innovation. However, it is not clear how these significant interactions impact scientific cooperation at the interface of biodiversity and climate change. We looked at research collaborations between two major regions-the European Research Area (ERA) and LAC-that addressed both biodiversity and climate change. We analysed the temporal evolution of these collaborations, whether they were led by ERA or LAC teams, and which research domains they covered. We surveyed publications listed on the Web of Science that were authored by researchers from both the ERA and LAC and that were published between 2003 and 2013. We also run similar analyses on other topics and other continents to provide baseline comparisons. Our results revealed a steady increase in scientific co-authorships between ERA and LAC countries as a result of the increasingly complex web of relationships that has been weaved among scientists from the two regions. The ERA-LAC co-authorship increase for biodiversity and climate change was higher than those reported for other topics and for collaboration with other continents. We also found strong differences in international collaboration patterns within the LAC: co-publications were fewest from researchers in low- and lower-middle-income countries and most prevalent from
Role of translation in the UTP-modulated attenuation at the pyrBI operon of Escherichia coli
DEFF Research Database (Denmark)
Clemmesen, Kåre; Bonekamp, Fons; Karlström, Olle
1985-01-01
B leader peptide. In addition a gene fusion encoding a hybrid protein with -galactosidase activity was formed between the pyrB start and the rest of lacZ. This gene fusion is expressed from the lac promoter and the transcript is subject to facultative termination at the pyrBI attenuator. Different variants...... of the lacZ start were used that either contained a stop codon or directed the translation toward the attenuator in any of the alternative reading frames. The following results were obtained. No significant read-through of transcription over the pyrB attenuator was seen when the leader translation ended 49...... nucleotide residues, or more, upstream of the attenuator symmetry, but a UTP-modulated attenuation was established if the leader translation was allowed to proceed across the attenuator as for the putative leader peptide or in a frame-shifted version. The regulation, however, was not as great...
[Fond du Lac archeological resources within the Draft Area Recommendation Report
International Nuclear Information System (INIS)
Danz, D.L.
1986-01-01
Research into archaeological resources of the Fond du Lac Band within the DOE proposed high-level nuclear waste sites resulted in the discovery of four traditional ancestral sites. A number of ancestral sites that are located within other proposed repository sites were also discovered
Quintard, Kévin; Dewitte, Amélie; Reboul, Angéline; Madec, Edwige; Bontemps-Gallo, Sébastien; Dondeyne, Jacqueline; Marceau, Michaël; Simonet, Michel
2015-01-01
The opgGH operon encodes glucosyltransferases that synthesize osmoregulated periplasmic glucans (OPGs) from UDP-glucose, using acyl carrier protein (ACP) as a cofactor. OPGs are required for motility, biofilm formation, and virulence in various bacteria. OpgH also sequesters FtsZ in order to regulate cell size according to nutrient availability. Yersinia pestis (the agent of flea-borne plague) lost the opgGH operon during its emergence from the enteropathogen Yersinia pseudotuberculosis. When expressed in OPG-negative strains of Escherichia coli and Dickeya dadantii, opgGH from Y. pseudotuberculosis restored OPGs synthesis, motility, and virulence. However, Y. pseudotuberculosis did not produce OPGs (i) under various growth conditions or (ii) when overexpressing its opgGH operon, its galUF operon (governing UDP-glucose), or the opgGH operon or Acp from E. coli. A ΔopgGH Y. pseudotuberculosis strain showed normal motility, biofilm formation, resistance to polymyxin and macrophages, and virulence but was smaller. Consistently, Y. pestis was smaller than Y. pseudotuberculosis when cultured at ≥37°C, except when the plague bacillus expressed opgGH. Y. pestis expressing opgGH grew normally in serum and within macrophages and was fully virulent in mice, suggesting that small cell size was not advantageous in the mammalian host. Lastly, Y. pestis expressing opgGH was able to infect Xenopsylla cheopis fleas normally. Our results suggest an evolutionary scenario whereby an ancestral Yersinia strain lost a factor required for OPG biosynthesis but kept opgGH (to regulate cell size). The opgGH operon was presumably then lost because OpgH-dependent cell size control became unnecessary. PMID:26150539
Quintard, Kévin; Dewitte, Amélie; Reboul, Angéline; Madec, Edwige; Bontemps-Gallo, Sébastien; Dondeyne, Jacqueline; Marceau, Michaël; Simonet, Michel; Lacroix, Jean-Marie; Sebbane, Florent
2015-09-01
The opgGH operon encodes glucosyltransferases that synthesize osmoregulated periplasmic glucans (OPGs) from UDP-glucose, using acyl carrier protein (ACP) as a cofactor. OPGs are required for motility, biofilm formation, and virulence in various bacteria. OpgH also sequesters FtsZ in order to regulate cell size according to nutrient availability. Yersinia pestis (the agent of flea-borne plague) lost the opgGH operon during its emergence from the enteropathogen Yersinia pseudotuberculosis. When expressed in OPG-negative strains of Escherichia coli and Dickeya dadantii, opgGH from Y. pseudotuberculosis restored OPGs synthesis, motility, and virulence. However, Y. pseudotuberculosis did not produce OPGs (i) under various growth conditions or (ii) when overexpressing its opgGH operon, its galUF operon (governing UDP-glucose), or the opgGH operon or Acp from E. coli. A ΔopgGH Y. pseudotuberculosis strain showed normal motility, biofilm formation, resistance to polymyxin and macrophages, and virulence but was smaller. Consistently, Y. pestis was smaller than Y. pseudotuberculosis when cultured at ≥ 37°C, except when the plague bacillus expressed opgGH. Y. pestis expressing opgGH grew normally in serum and within macrophages and was fully virulent in mice, suggesting that small cell size was not advantageous in the mammalian host. Lastly, Y. pestis expressing opgGH was able to infect Xenopsylla cheopis fleas normally. Our results suggest an evolutionary scenario whereby an ancestral Yersinia strain lost a factor required for OPG biosynthesis but kept opgGH (to regulate cell size). The opgGH operon was presumably then lost because OpgH-dependent cell size control became unnecessary. Copyright © 2015, American Society for Microbiology. All Rights Reserved.
Radiocarbon measurements at LAC-UFF: Recent performance
Energy Technology Data Exchange (ETDEWEB)
Linares, Roberto, E-mail: rlinares@if.uff.br [Laboratório de Radiocarbono, Universidade Federal Fluminense, Av. Gal. Milton Tavares de Souza, s/n, Niterói 24230-346 (Brazil); Macario, Kita D. [Laboratório de Radiocarbono, Universidade Federal Fluminense, Av. Gal. Milton Tavares de Souza, s/n, Niterói 24230-346 (Brazil); Santos, Guaciara M. [Earth System Science, University of California, Irvine, B321 Croul Hall, Irvine, CA 92697-3100 (United States); Carvalho, Carla [Laboratório de Radiocarbono, Universidade Federal Fluminense, Av. Gal. Milton Tavares de Souza, s/n, Niterói 24230-346 (Brazil); Departamento de Geoquímica, Universidade Federal Fluminense, Outeiro São João Batista, s/n, Niterói 24020-141 (Brazil); Santos, Hellen C. dos; Gomes, Paulo R.S.; Castro, Maikel D.; Oliveira, Fabiana M.; Alves, Eduardo Q. [Laboratório de Radiocarbono, Universidade Federal Fluminense, Av. Gal. Milton Tavares de Souza, s/n, Niterói 24230-346 (Brazil)
2015-10-15
In 2012 a single stage accelerator mass spectrometer from NEC was installed at the Radiocarbon Laboratory of Universidade Federal Fluminense (LAC-UFF), Niterói, Brazil. Here, we present a status report of our facility. We discuss some modifications applied to our combustion protocol in an attempt to reduce our procedural blank, mostly to processed organic samples. Measurements of reference materials indicate low precision and accuracy that are partially related to beam optics through the acceleration tube. We observed that once the beam current intensity increases the measured {sup 13}C{sup +}/{sup 12}C{sup +} becomes erratic. Therefore, in order to maintain the AMS-δ{sup 13}C values within reasonable values, so that fractionation corrections using the spectrometer {sup 13}C{sup +}/{sup 12}C{sup +} values does not affect the final {sup 14}C results, we are forced to limit the {sup 12}C{sup −} beam intensity to ⩽30 μA. This requirement was confirmed during our accuracy tests, when measuring selected annual tree-rings wood samples from a Parana pine (Araucaria angustifolia) between 1927 and 1997 previously measured at the Keck Carbon Cycle AMS Facility (KCCAMS), at the University of California, Irvine (UCI). At the LAC-UFF tree-ring wood samples were processed and measured in 4 different batches during a period of about 5 months. The {sup 14}C results were later compared to the high-precision data obtained at KCCAMS/UCI and reached a good agreement. Recently a problem associated with graphitization yield were finally identified and new measurements with secondary standards are promising.
Effet des conditions climatiques sur le niveau du lac Sidi Ali (Moyen Atlas, Maroc)
Sayad, Ahmed; Chakiri, Saïd; Martin, Claude; Bejjaji, Zohra; Echarfaoui, Hassan
2012-01-01
Le lac Sidi Ali est un lac naturel d'altitude (2070-2080 m), sans exutoire superficiel, déterminé par le barrage d'une coulée basaltique. Doté d'un bassin versant apparent de 15,6 km2, il est alimenté par des eaux de ruissellement et par des sources karstiques. Son niveau subit des variations très fortes, annuelles et interannuelles, sous le contrôle des conditions climatiques, et en particulier des pluies et de l'évapotranspiration. Les périodes de sécheresse qui ont marqué les trois dernièr...
Differential decay of RNA of the CFA/I fimbrial operon and control of relative gene expression.
Jordi, B J; op den Camp, I E; de Haan, L A; van der Zeijst, B A; Gaastra, W
1993-01-01
CFA/I fimbriae on human enterotoxigenic Escherichia coli are composed of the CfaB protein, the product of the second gene of the CFA/I operon. We show here that CfaB is expressed at a higher level than other proteins of the CFA/I operon. mRNA encoding the CfaB protein is much more abundant than mRNA encoding CfaA, the first protein, together with CfaB or mRNA encoding CfaA only. Only one promoter, upstream of cfaA, is present. These data indicate that a primary transcript containing cfaA and ...
NEW HIGH- z FERMI BL LACS WITH THE PHOTOMETRIC DROPOUT TECHNIQUE
Energy Technology Data Exchange (ETDEWEB)
Kaur, A.; Ajello, M.; Hartmann, D. H.; Paliya, V. S. [Department of Physics and Astronomy, Clemson University, SC 29634-0978 (United States); Rau, A.; Greiner, J.; Bolmer, J.; Schady, P. [Max-Planck-Institut für extraterrestrische Physik, Giessenbachstraße 1, D-85748 Garching (Germany); Domínguez, A., E-mail: akaur@g.clemson.edu [Grupo de Altas Energías, Universidad Complutense, E-28040 Madrid (Spain)
2017-01-01
Determining redshifts for BL Lacertae (BL Lac) objects using the traditional spectroscopic method is challenging due to the absence of strong emission lines in their optical spectra. We employ the photometric dropout technique to determine redshifts for this class of blazars using the combined 13 broadband filters from Swift -UVOT and the multi-channel imager GROND at the MPG 2.2 m telescope at ESO's La Silla Observatory. The wavelength range covered by these 13 filters extends from far-ultraviolet to the near-infrared. We report results on 40 new Fermi- detected BL Lacs with the photometric redshift determinations for five sources, with 3FGL J1918.2–4110 being the most distant in our sample at z = 2.16. Reliable upper limits are provided for 20 sources in this sample. Using the highest energy photons for these Fermi -LAT sources, we evaluate the consistency with the gamma-ray horizon due to the extragalactic background light.
cas du lac Fetzara, région de Annaba
African Journals Online (AJOL)
ruissellement, elles acquièrent une nouvelle composition différente de celle des eaux de pluie. Les apports par les précipitations météoriques. Chaque mois pluvieux a fait l'objet d'une analyse chimique et une moyenne des concentrations des eaux apportées au lac a été estimée. La quantité des éléments apportés par.
Computing Optical Variable Periods of BL Lac Object S5 0716+ 714 ...
Indian Academy of Sciences (India)
Computing Optical Variable Periods of BL Lac Object S5 0716+ 714 ... The study of long-term periodical variation is an important way to get the charac- ... continuous Fourier transform together, define a window function, and finally obtain.
Zhuo, Tao; Rou, Wei; Song, Xue; Guo, Jing; Fan, Xiaojing; Kamau, Gicharu Gibson; Zou, Huasong
2015-10-23
The carA and carB genes code the small and large subunits of carbamoyl-phosphate synthase (CPS) that responsible for arginine and pyrimidine production. The purpose of this work was to study the gene organization and expression pattern of carAB operon, and the biological functions of carA and carB genes in Xanthomonas citri subsp. citri. RT-PCR method was employed to identify the full length of carAB operon transcript in X. citri subsp. citri. The promoter of carAB operon was predicted and analyzed its activity by fusing a GUS reporter gene. The swimming motility was tested on 0.25% agar NY plates with 1% glucose. Biofilm was measured by cell adhesion to polyvinyl chloride 96-well plate. The results indicated that carAB operon was composed of five gene members carA-orf-carB-greA-rpfE. A single promoter was predicted from the nucleotide sequence upstream of carAB operon, and its sensitivity to glutamic acid, uracil and arginine was confirmed by fusing a GUS reporter gene. Deletion mutagenesis of carB gene resulted in reduced abilities in swimming on soft solid media and in forming biofilm on polystyrene microtiter plates. From these results, we concluded that carAB operon was involved in multiple biological processes in X. citri subsp. citri.
Nagel, Raimund; Turrini, Paula C G; Nett, Ryan S; Leach, Jan E; Verdier, Valérie; Van Sluys, Marie-Anne; Peters, Reuben J
2017-05-01
Phytopathogens have developed elaborate mechanisms to attenuate the defense response of their host plants, including convergent evolution of complex pathways for production of the GA phytohormones, which were actually first isolated from the rice fungal pathogen Gibberella fujikuroi. The rice bacterial pathogen Xanthomonas oryzae pv. oryzicola (Xoc) has been demonstrated to contain a biosynthetic operon with cyclases capable of producing the universal GA precursor ent-kaurene. Genetic (knock-out) studies indicate that the derived diterpenoid serves as a virulence factor for this rice leaf streak pathogen, serving to reduce the jasmonic acid-mediated defense response. Here the functions of the remaining genes in the Xoc operon are elucidated and the distribution of the operon in X. oryzae is investigated in over 100 isolates. The Xoc operon leads to production of the bioactive GA 4 , an additional step beyond production of the penultimate precursor GA 9 mediated by the homologous operons recently characterized from rhizobia. Moreover, this GA biosynthetic operon was found to be widespread in Xoc (> 90%), but absent in the other major X. oryzae pathovar. These results indicate selective pressure for production of GA 4 in the distinct lifestyle of Xoc, and the importance of GA to both fungal and bacterial pathogens of rice. © 2017 The Authors. New Phytologist © 2017 New Phytologist Trust.
Effect of different saccharides on growth, sporulation rate and d ...
African Journals Online (AJOL)
MFCS
2012-05-17
May 17, 2012 ... general, high sporulation rate was related with high growth rate and high viable cell count (>1.5 x 1012 cfu/ml). .... The sterile culture medium (180 ml) in a 1000 ml Erlenmeyer flask was ... The column temperature was set at 85°C. A series of ..... inactivation of certain sugar-metabolizing operons, such as lac ...
The atlA operon of Streptococcus mutans: role in autolysin maturation and cell surface biogenesis.
Ahn, Sang-Joon; Burne, Robert A
2006-10-01
The Smu0630 protein (AtlA) was recently shown to be involved in cell separation, biofilm formation, and autolysis. Here, transcriptional studies revealed that atlA is part of a multigene operon under the control of at least three promoters. The morphology and biofilm-forming capacity of a nonpolar altA mutant could be restored to that of the wild-type strain by adding purified AtlA protein to the medium. A series of truncated derivatives of AtlA revealed that full activity required the C terminus and repeat regions. AtlA was cell associated and readily extractable from with sodium dodecyl sulfate. Of particular interest, the surface protein profile of AtlA-deficient strains was dramatically altered compared to the wild-type strain, as was the nature of the association of the multifunctional adhesin P1 with the cell wall. In addition, AtlA-deficient strains failed to develop competence as effectively as the parental strain. Mutation of thmA, which can be cotranscribed with atlA and encodes a putative pore-forming protein, resulted in a phenotype very similar to that of the AtlA-deficient strain. ThmA was also shown to be required for efficient processing of AtlA to its mature form, and treatment of the thmA mutant strain with full-length AtlA protein did not restore normal cell separation and biofilm formation. The effects of mutating other genes in the operon on cell division, biofilm formation, or AtlA biogenesis were not as profound. This study reveals that AtlA is a surface-associated protein that plays a critical role in the network connecting cell surface biogenesis, biofilm formation, genetic competence, and autolysis.
DEFF Research Database (Denmark)
Eberl, L; Winson, MK; Sternberg, C
1996-01-01
The velocity with which a swarming colony of Serratia liquefaciens colonizes the surface of a suitable solid substratum was controlled by modulating the expression of the flhD master operon. In liquid medium, the stimulation of flhD expression resulted in filamentous, multinucleate......, and hyperflagellated cells that were indistinguishable from swarm cells isolated from the edge of a swarm colony. Thus, expression of the flhD master operon appears to play a central role in the process of swarm cell differentiation....
Infrared polarimetry and photometry of BL Lac objects. 2
Energy Technology Data Exchange (ETDEWEB)
Impey, C D [Hawaii Univ., Honolulu (USA). Inst. for Astronomy; Brand, P W.J.L. [Edinburgh Univ. (UK). Dept. of Astronomy; Wolstencroft, R D [Royal Observatory, Edinburgh (UK); Williams, P M [United Kingdom Infrared Telescope Unit, Hilo, Hawaii (USA)
1984-07-15
Photometry and polarimetry in the JHK wavebands have now been obtained for 25 BL Lac objects. Several new objects have been monitored for periods of up to five days, and accumulated data is sufficient for a statistical analysis of polarization properties. The selection effects operating on this sample are examined first. A power-law spectrum is consistent with the spectra of all but three objects. A number of important new results are reported.
A source of artifact in the lacZ reversion assay in Escherichia coli.
Hoffmann, George R; Gray, Carol L; Lange, Paulina B; Marando, Christie I
2015-06-01
The lacZ reversion assay in Escherichia coli measures point mutations that occur by specific base substitutions and frameshift mutations. The tester strains cannot use lactose as a carbon source (Lac(-)), and revertants are easily detected by growth on lactose medium (Lac(+)). Six strains identify the six possible base substitutions, and five strains measure +G, -G, -CG, +A and -A frameshifts. Strong mutagens give dose-dependent increases in numbers of revertants per plate and revertant frequencies. Testing compounds that are arguably nonmutagens or weakly mutagenic, we often noted statistically significant dose-dependent increases in revertant frequency that were not accompanied by an absolute increase in numbers of revertants. The increase in frequency was wholly ascribable to a declining number of viable cells owing to toxicity. Analysis of the conditions revealed that the frequency of spontaneous revertants is higher when there are fewer viable cells per plate. The phenomenon resembles "adaptive" or "stress" mutagenesis, whereby lactose revertants accumulate in Lac(-) bacteria under starvation conditions in the absence of catabolite repression. Adaptive mutation is observed after long incubation and might be expected to be irrelevant in a standard assay using 48-h incubation. However, we found that elevated revertant frequencies occur under typical assay conditions when the bacterial lawn is thin, and this can cause increases in revertant frequency that mimic chemical mutagenesis when treatments are toxic but not mutagenic. Responses that resemble chemical mutagenesis were observed in the absence of mutagenic treatment in strains that revert by different frameshift mutations. The magnitude of the artifact is affected by cell density, dilution, culture age, incubation time, catabolite repression and the age and composition of media. Although the specific reversion assay is effective for quickly distinguishing classes of mutations induced by potent mutagens, its
Kim, Dae Hun; Ko, Kwan Soo
2015-07-01
To investigate pmrCAB sequence divergence in 5 species of Acinetobacter baumannii complex, a total of 80 isolates from a Korean hospital were explored. We evaluated nucleotide and amino acid polymorphisms of pmrCAB operon, and phylogenetic trees were constructed for each gene of prmCAB operon. Colistin and polymyxin B susceptibility was determined for all isolates, and multilocus sequence typing was also performed for A. baumannii isolates. Our results showed that each species of A. baumannii complex has divergent pmrCAB operon sequences. We identified a distinct pmrCAB allele allied with Acinetobacter nosocomialis in gene trees. Different grouping in each gene tree suggests sporadic recombination or emergence of pmrCAB genes among Acinetobacter species. Sequence polymorphisms among Acinetobacter species might not be associated with colistin resistance. We revealed that a distinct pmrCAB allele may be widespread across the continents such as North America and Asia and that sporadic genetic recombination or emergence of pmrCAB genes might occur. Copyright © 2015 Elsevier Inc. All rights reserved.
Fate of the H-NS-repressed bgl operon in evolution of Escherichia coli.
Directory of Open Access Journals (Sweden)
T Sabari Sankar
2009-03-01
Full Text Available In the enterobacterial species Escherichia coli and Salmonella enterica, expression of horizontally acquired genes with a higher than average AT content is repressed by the nucleoid-associated protein H-NS. A classical example of an H-NS-repressed locus is the bgl (aryl-beta,D-glucoside operon of E. coli. This locus is "cryptic," as no laboratory growth conditions are known to relieve repression of bgl by H-NS in E. coli K12. However, repression can be relieved by spontaneous mutations. Here, we investigated the phylogeny of the bgl operon. Typing of bgl in a representative collection of E. coli demonstrated that it evolved clonally and that it is present in strains of the phylogenetic groups A, B1, and B2, while it is presumably replaced by a cluster of ORFans in the phylogenetic group D. Interestingly, the bgl operon is mutated in 20% of the strains of phylogenetic groups A and B1, suggesting erosion of bgl in these groups. However, bgl is functional in almost all B2 isolates and, in approximately 50% of them, it is weakly expressed at laboratory growth conditions. Homologs of bgl genes exist in Klebsiella, Enterobacter, and Erwinia species and also in low GC-content Gram-positive bacteria, while absent in E. albertii and Salmonella sp. This suggests horizontal transfer of bgl genes to an ancestral Enterobacterium. Conservation and weak expression of bgl in isolates of phylogenetic group B2 may indicate a functional role of bgl in extraintestinal pathogenic E. coli.
DEFF Research Database (Denmark)
Andersen, Paal Skytt; Martinussen, Jan; Hammer, Karin
1996-01-01
Three genes encoding enzymes involved in the biosynthesis of pyrimidines have been found to constitute an operon in Lactococcus lactis. Two of the genes are the well-known pyr genes pyrDb and pyrF, encoding dihydroorotate dehydrogenase and orotidine monophosphate decarboxylase, respectively....... The third gene encodes a protein which was shown to be necessary for the activity of the pyrDb-encoded dihydroorotate dehydrogenase; we propose to name the gene pyrK. The pyrK-encoded protein is homologous to a number of proteins which are involved in electron transfer. The lactococcal pyrKDbF operon...... is highly homologous to the corresponding part of the much-larger pyr operon of Bacillus subtilis. orf2, the pyrK homolog in B. subtilis, has also been shown to be necessary for pyrimidine biosynthesis (A.E. Kahler and R.L. Switzer, J. Bacteriol. 178:5013-5016, 1996). Four genes adjacent to the operon, i...
Energy Technology Data Exchange (ETDEWEB)
Dominguez, R.; Munekata, P.E.; Cittadini, A.; Lorenzo, J.M.
2016-07-01
The influence of three salting treatments (treatment II: 50% NaCl-50% KCl; III: 45% NaCl-25% KCl-20% CaCl2-10% MgCl2; IV: 30% NaCl-50% KCl-15% CaCl2-5% MgCl2) on the formation of volatile compounds throughout the process was studied and compared to those of a control “lacón” (treatment I: 100% NaCl). There was an intense formation of volatile compounds throughout the processing, particularly during the dry-ripening stage. The most abundant chemical family in all the formulations, in the final product was hydrocarbons followed by aldehydes. The total volatile compound release was more intense in the control “lacóns” (1164 AU×106 ·g–1dry matter) than in “lacóns” from formulations II, III and IV (817–891 AU×106 ·g−1dry matter). The “lacóns” from formulation I showed the highest amounts of aldehydes. The “lacóns” from formulations I and II presented the highest amounts of hydrocarbons. The main conclusion is that the replacement of NaCl produces changes in the volatile profile and could be affect the aroma of “lacón”. (Author)
Analyses de la dégradation du lac Kinkony pour la conservation du ...
African Journals Online (AJOL)
Le lac Kinkony fait partie des habitats clefs pour la biodiversité du Complexe des ... provide favoured habitat for numerous endemic and endangered avian, fish ... on fauna is essential for developing regional conservation and natural resource ...
Queiroz, Adriano; Medina-Cleghorn, Daniel; Marjanovic, Olivera; Nomura, Daniel K; Riley, Lee W
2015-11-01
Mycobacterium tuberculosis disrupted in a 13-gene operon (mce1) accumulates free mycolic acids (FM) in its cell wall and causes accelerated death in mice. Here, to more comprehensively analyze differences in their cell wall lipid composition, we used an untargeted metabolomics approach to compare the lipid profiles of wild-type and mce1 operon mutant strains. By liquid chromatography-mass spectrometry, we identified >400 distinct lipids significantly altered in the mce1 mutant compared to wild type. These lipids included decreased levels of saccharolipids and glycerophospholipids, and increased levels of alpha-, methoxy- and keto mycolic acids (MA), and hydroxyphthioceranic acid. The mutant showed reduced expression of mmpL8, mmpL10, stf0, pks2 and papA2 genes involved in transport and metabolism of lipids recognized to induce proinflammatory response; these lipids were found to be decreased in the mutant. In contrast, the transcripts of mmpL3, fasI, kasA, kasB, acpM and RV3451 involved in MA transport and metabolism increased; MA inhibits inflammatory response in macrophages. Since the mce1 operon is known to be regulated in intracellular M. tuberculosis, we speculate that the differences we observed in cell wall lipid metabolism and composition may affect host response to M. tuberculosis infection and determine the clinical outcome of such an infection. © FEMS 2015. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
DEFF Research Database (Denmark)
Eberl, L; Christiansen, Gunna; Molin, S
1996-01-01
The velocity with which a swarming colony of Serratia liquefaciens colonizes the surface of a suitable solid substratum was controlled by modulating the expression of the flhD master operon. In liquid medium, the stimulation of flhD expression resulted in filamentous, multinucleate, and hyperflag......The velocity with which a swarming colony of Serratia liquefaciens colonizes the surface of a suitable solid substratum was controlled by modulating the expression of the flhD master operon. In liquid medium, the stimulation of flhD expression resulted in filamentous, multinucleate...
Directory of Open Access Journals (Sweden)
Potrich D.P.
2001-01-01
Full Text Available A 40-kb DNA region containing the major cluster of nif genes has been isolated from the Azospirillum brasilense Sp7 genome. In this region three nif operons have been identified: nifHDKorf1Y, nifENXorf3orf5fdxAnifQ and orf2nifUSVorf4. The operons containing nifENX and nifUSV genes are separated from the structural nifHDKorf1Y operon by about 5 kb and 10 kb, respectively. The present study shows the sequence analysis of the 6045-bp DNA region containing the nifENX genes. The deduced amino acid sequences from the open reading frames were compared to the nif gene products of other diazotrophic bacteria and indicate the presence of seven ORFs, all reading in the same direction as that of the nifHDKorf1Y operon. Consensus sigma54 and NifA-binding sites are present only in the promoter region upstream of the nifE gene. This promoter is activated by NifA protein and is approximately two-times less active than the nifH promoter, as indicated by the ß-galactosidase assays. This result suggests the differential expression of the nif genes and their respective products in Azospirillum.
Deaner, Matthew; Holzman, Allison; Alper, Hal S
2018-04-16
Metabolic engineering typically utilizes a suboptimal step-wise gene target optimization approach to parse a highly connected and regulated cellular metabolism. While the endonuclease-null CRISPR/Cas system has enabled gene expression perturbations without genetic modification, it has been mostly limited to small sets of gene targets in eukaryotes due to inefficient methods to assemble and express large sgRNA operons. In this work, we develop a TEF1p-tRNA expression system and demonstrate that the use of tRNAs as splicing elements flanking sgRNAs provides higher efficiency than both Pol III and ribozyme-based expression across a variety of single sgRNA and multiplexed contexts. Next, we devise and validate a scheme to allow modular construction of tRNA-sgRNA (TST) operons using an iterative Type IIs digestion/ligation extension approach, termed CRISPR-Ligation Extension of sgRNA Operons (LEGO). This approach enables facile construction of large TST operons. We demonstrate this utility by constructing a metabolic rewiring prototype for 2,3-butanediol production in 2 distinct yeast strain backgrounds. These results demonstrate that our approach can act as a surrogate for traditional genetic modification on a much shorter design-cycle timescale. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Analysis of catRABC operon for catechol degradation from phenol-degrading Rhodococcus erythropolis
Czech Academy of Sciences Publication Activity Database
Veselý, Martin; Knoppová, Monika; Nešvera, Jan; Pátek, Miroslav
2007-01-01
Roč. 76, - (2007), s. 159-168 ISSN 0175-7598 R&D Projects: GA ČR GA526/04/0542 Institutional research plan: CEZ:AV0Z50200510 Keywords : rhodococcus erythropolis * catrabc operon * catechol degradation Subject RIV: EE - Microbiology, Virology Impact factor: 2.475, year: 2007
X-ray emission from BL Lac objects: Comparison to the synchrotron self-Compton models
International Nuclear Information System (INIS)
Schwartz, D.A.; Madejski, G.; Ku, W.H.-M.
1982-01-01
As one part of our joint study of the X-ray properties of BL Lac objects, the authors compare the measured X-ray flux densities with those predicted using the synchrotron self-Compton (SSC) formalism (Jones et al. 1974). Naive application of the formalism predicts X-ray fluxes from 10 -3 to 10 5 those observed. They therefore ask what we can learn by simply assuming the SSC mechanism, and looking for ways to reconcile the observed and measured X-ray fluxes. This paper reports investigation of beaming factors due to relativistic ejection of a radiation source which is isotropic in its own rest frame. The authors conclude that large Lorentz factors, GAMMA approximately > 10, do not apply to BL Lac objects as a class. (Auth.)
Osipiuk, J; Joachimiak, A
1997-09-12
We propose that the dnaK operon of Thermus thermophilus HB8 is composed of three functionally linked genes: dnaK, grpE, and dnaJ. The dnaK and dnaJ gene products are most closely related to their cyanobacterial homologs. The DnaK protein sequence places T. thermophilus in the plastid Hsp70 subfamily. In contrast, the grpE translated sequence is most similar to GrpE from Clostridium acetobutylicum, a Gram-positive anaerobic bacterium. A single promoter region, with homology to the Escherichia coli consensus promoter sequences recognized by the sigma70 and sigma32 transcription factors, precedes the postulated operon. This promoter is heat-shock inducible. The dnaK mRNA level increased more than 30 times upon 10 min of heat shock (from 70 degrees C to 85 degrees C). A strong transcription terminating sequence was found between the dnaK and grpE genes. The individual genes were cloned into pET expression vectors and the thermophilic proteins were overproduced at high levels in E. coli and purified to homogeneity. The recombinant T. thermophilus DnaK protein was shown to have a weak ATP-hydrolytic activity, with an optimum at 90 degrees C. The ATPase was stimulated by the presence of GrpE and DnaJ. Another open reading frame, coding for ClpB heat-shock protein, was found downstream of the dnaK operon.
Synthetic operon for (R,R)-2,3-butanediol production in Bacillus subtilis and Escherichia coli.
de Oliveira, Rafael R; Nicholson, Wayne L
2016-01-01
To reduce dependence on petroleum, an alternative route to production of the chemical feedstock 2,3-butanediol (2,3-BD) from renewable lignocellulosic sources is desirable. In this communication, the genes encoding the pathway from pyruvate to 2,3-BD (alsS, alsD, and bdhA encoding acetolactate synthase, acetolactate decarboxylase, and butanediol dehydrogenase, respectively) from Bacillus subtilis were engineered into a single tricistronic operon under control of the isopropyl β-D-1-thiogalactopyranoside (IPTG)-inducible Pspac promoter in a shuttle plasmid capable of replication and expression in either B. subtilis or Escherichia coli. We describe the construction and performance of a shuttle plasmid carrying the IPTG-inducible synthetic operon alsSDbdhA coding for 2,3-BD pathway capable of (i) expression in two important representative model microorganisms, the gram-positive B. subtilis and the gram-negative E. coli; (ii) increasing 2,3-BD production in B. subtilis; and (iii) successfully introducing the B. subtilis 2,3-BD pathway into E. coli. The synthetic alsSDbdhA operon constructed using B. subtilis native genes not only increased the 2,3-BD production in its native host but also efficiently expressed the pathway in the heterologous organism E. coli. Construction of an efficient shuttle plasmid will allow investigation of 2,3-BD production performance in related organisms with industrial potential for production of bio-based chemicals.
Zheng, Zhaojuan; Lin, Xi; Jiang, Ting; Ye, Weihua; Ouyang, Jia
2016-08-01
To investigate the xylose operon and properties of xylose isomerase and xylulokinase in Bacillus coagulans that can effectively ferment xylose to lactic acid. The xylose operon is widely present in B. coagulans. It is composed of four putative ORFs. Novel xylA and xylB from B. coagulans NL01 were cloned and expressed in Escherichia coli. Sequence of xylose isomerase was more conserved than that of xylulokinase. Both the enzymes exhibited maximum activities at pH 7-8 but with a high temperature maximum of 80-85 °C, divalent metal ion was prerequisite for their activation. Xylose isomerase and xylulokinase were most effectively activated by Ni(2+) and Co(2+), respectively. Genomic analysis of xylose operon has contributed to understanding xylose metabolism in B. coagulans and the novel xylose isomerase and xylulokinase might provide new alternatives for metabolic engineering of other strains to improve their fermentation performance on xylose.
Highly divergent 16S rRNA sequences in ribosomal operons of Scytonema hyalinum (Cyanobacteria)
Czech Academy of Sciences Publication Activity Database
Johansen, J. R.; Mareš, Jan; Pietrasiak, N.; Bohunická, M.; Zima Jr., J.; Štenclová, Lenka; Hauer, T.
2017-01-01
Roč. 12, č. 10 (2017), č. článku e0186393. E-ISSN 1932-6203 Institutional support: RVO:60077344 Keywords : rRNA operon * heterogenita * Scytonema hyalinum Subject RIV: EF - Botanics OBOR OECD: Microbiology Impact factor: 2.806, year: 2016
A geological reconnaissance study of the Lac du Bonnet batholith
International Nuclear Information System (INIS)
Tammemagi, H.Y.; Kerford, P.S.; Requeima, J.C.; Temple, C.A.
1980-02-01
A geological reconnaissance survey was carried out of the Lac du Bonnet batholith, southeastern Manitoba, as part of the concept verification phase of the nuclear fuel waste disposal program for Canada. This report summarizes available geological information, presents the results of field mapping and discusses the geochemical analyses of rock samples. The geological and structural aspects of the batholith are described as well as its regional setting and possible genesis. (auth)
Kinetic Analysis of Lactose Exchange in Proteoliposomes Reconstituted with Purified lac Permease
Lolkema, Julius S.; Carrasco, Nancy; Kaback, H. Ronald
1991-01-01
Lactose exchange catalyzed by purified lac permease reconstituted into proteoliposomes was analyzed with unequal concentrations of lactose on either side of the membrane and at low pH so as to prevent equilibration of the two pools. Exchange with external concentrations below 1.0 mM is a
Probing BL Lac and Cluster Evolution via a Wide-angle, Deep X-ray Selected Sample
Perlman, E.; Jones, L.; White, N.; Angelini, L.; Giommi, P.; McHardy, I.; Wegner, G.
1994-12-01
The WARPS survey (Wide-Angle ROSAT Pointed Survey) has been constructed from the archive of all public ROSAT PSPC observations, and is a subset of the WGACAT catalog. WARPS will include a complete sample of >= 100 BL Lacs at F_x >= 10(-13) erg s(-1) cm(-2) . A second selection technique will identify ~ 100 clusters at 0.15 = 0.304 +/- 0.062 for XBLs but = 0.60 +/- 0.05 for RBLs. Models of the X-ray luminosity function (XLF) are also poorly constrained. WARPS will allow us to compute an accurate XLF, decreasing the error bars above by over a factor of two. We will also test for low-luminosity BL Lacs, whose non-thermal nuclear sources are dim compared to the host galaxy. Browne and Marcha (1993) claim the EMSS missed most of these objects and is incomplete. If their predictions are correct, 20-40% of the BL Lacs we find will fall in this category, enabling us to probe the evolution and internal workings of BL Lacs at lower luminosities than ever before. By removing likely QSOs before optical spectroscopy, WARPS requires only modest amounts of telescope time. It will extend measurement of the cluster XLF both to higher redshifts (z>0.5) and lower luminosities (LX<1x10(44) erg s(-1) ) than previous measurements, confirming or rejecting the 3sigma detection of negative evolution found in the EMSS, and constraining Cold Dark Matter cosmologies. Faint NELGs are a recently discovered major contributor to the X-ray background. They are a mixture of Sy2s, starbursts and galaxies of unknown type. Detailed classification and evolution of their XLF will be determined for the first time.
Prokhorova, Irina V.; Osterman, Ilya A.; Burakovsky, Dmitry E.; Serebryakova, Marina V.; Galyamina, Maria A.; Pobeguts, Olga V.; Altukhov, Ilya; Kovalchuk, Sergey; Alexeev, Dmitry G.; Govorun, Vadim M.; Bogdanov, Alexey A.; Sergiev, Petr V.; Dontsova, Olga A.
2013-11-01
Ribosomes contain a number of modifications in rRNA, the function of which is unclear. Here we show - using proteomic analysis and dual fluorescence reporter in vivo assays - that m2G966 and m5C967 in 16S rRNA of Escherichia coli ribosomes are necessary for correct attenuation of tryptophan (trp) operon. Expression of trp operon is upregulated in the strain where RsmD and RsmB methyltransferases were deleted, which results in the lack of m2G966 and m5C967 modifications. The upregulation requires the trpL attenuator, but is independent of the promotor of trp operon, ribosome binding site of the trpE gene, which follows trp attenuator and even Trp codons in the trpL sequence. Suboptimal translation initiation efficiency in the rsmB/rsmD knockout strain is likely to cause a delay in translation relative to transcription which causes misregulation of attenuation control of trp operon.
Entcheva, P; Liebl, W; Johann, A; Hartsch, T; Streit, W R
2001-01-01
Enrichment cultures of microbial consortia enable the diverse metabolic and catabolic activities of these populations to be studied on a molecular level and to be explored as potential sources for biotechnology processes. We have used a combined approach of enrichment culture and direct cloning to construct cosmid libraries with large (>30-kb) inserts from microbial consortia. Enrichment cultures were inoculated with samples from five environments, and high amounts of avidin were added to the cultures to favor growth of biotin-producing microbes. DNA was extracted from three of these enrichment cultures and used to construct cosmid libraries; each library consisted of between 6,000 and 35,000 clones, with an average insert size of 30 to 40 kb. The inserts contained a diverse population of genomic DNA fragments isolated from the consortia organisms. These three libraries were used to complement the Escherichia coli biotin auxotrophic strain ATCC 33767 Delta(bio-uvrB). Initial screens resulted in the isolation of seven different complementing cosmid clones, carrying biotin biosynthesis operons. Biotin biosynthesis capabilities and growth under defined conditions of four of these clones were studied. Biotin measured in the different culture supernatants ranged from 42 to 3,800 pg/ml/optical density unit. Sequencing the identified biotin synthesis genes revealed high similarities to bio operons from gram-negative bacteria. In addition, random sequencing identified other interesting open reading frames, as well as two operons, the histidine utilization operon (hut), and the cluster of genes involved in biosynthesis of molybdopterin cofactors in bacteria (moaABCDE).
Frías, José E; Flores, Enrique
2015-07-01
Nitrate is widely used as a nitrogen source by cyanobacteria, in which the nitrate assimilation structural genes frequently constitute the so-called nirA operon. This operon contains the genes encoding nitrite reductase (nirA), a nitrate/nitrite transporter (frequently an ABC-type transporter; nrtABCD), and nitrate reductase (narB). In the model filamentous cyanobacterium Anabaena sp. strain PCC 7120, which can fix N2 in specialized cells termed heterocysts, the nirA operon is expressed at high levels only in media containing nitrate or nitrite and lacking ammonium, a preferred nitrogen source. Here we examined the genes downstream of the nirA operon in Anabaena and found that a small open reading frame of unknown function, alr0613, can be cotranscribed with the operon. The next gene in the genome, alr0614 (narM), showed an expression pattern similar to that of the nirA operon, implying correlated expression of narM and the operon. A mutant of narM with an insertion mutation failed to produce nitrate reductase activity, consistent with the idea that NarM is required for the maturation of NarB. Both narM and narB mutants were impaired in the nitrate-dependent induction of the nirA operon, suggesting that nitrite is an inducer of the operon in Anabaena. It has previously been shown that the nitrite reductase protein NirA requires NirB, a protein likely involved in protein-protein interactions, to attain maximum activity. Bacterial two-hybrid analysis confirmed possible NirA-NirB and NarB-NarM interactions, suggesting that the development of both nitrite reductase and nitrate reductase activities in cyanobacteria involves physical interaction of the corresponding enzymes with their cognate partners, NirB and NarM, respectively. Nitrate is an important source of nitrogen for many microorganisms that is utilized through the nitrate assimilation system, which includes nitrate/nitrite membrane transporters and the nitrate and nitrite reductases. Many cyanobacteria
Tadmor, Arbel
2009-03-01
In this work a biophysical model of Escherichia coli is presented that predicts growth rate and an effective cellular composition from an effective, coarse-grained representation of its genome. We assume that E. coli is in a state of balanced exponential steady-state growth, growing in a temporally and spatially constant environment, rich in resources. We apply this model to a series of past measurements, where the growth rate and rRNA-to-protein ratio have been measured for seven E. coli strains with an rRNA operon copy number ranging from one to seven (the wild-type copy number). These experiments show that growth rate markedly decreases for strains with fewer than six copies. Using the model, we were able to reproduce these measurements. We show that the model that best fits these data suggests that the volume fraction of macromolecules inside E. coli is not fixed when the rRNA operon copy number is varied. Moreover, the model predicts that increasing the copy number beyond seven results in a cytoplasm densely packed with ribosomes and proteins. Assuming that under such overcrowded conditions prolonged diffusion times tend to weaken binding affinities, the model predicts that growth rate will not increase substantially beyond the wild-type growth rate, as indicated by other experiments. Our model therefore suggests that changing the rRNA operon copy number of wild-type E. coli cells growing in a constant rich environment does not substantially increase their growth rate. Other observations regarding strains with an altered rRNA operon copy number, such as nucleoid compaction and the rRNA operon feedback response, appear to be qualitatively consistent with this model. In addition, we discuss possible design principles suggested by the model and propose further experiments to test its validity.
Álvarez, Ricardo; Neumann, German; Frávega, Jorge; Díaz, Fernando; Tejías, Cristóbal; Collao, Bernardo; Fuentes, Juan A; Paredes-Sabja, Daniel; Calderón, Iván L; Gil, Fernando
2015-02-27
It has been proposed that some antibiotics exert additional damage through reactive oxygen species (ROS) production. Since H₂S protects neurons and cardiac muscle from oxidative stress, it has been hypothesized that bacterial H₂S might, similarly, be a cellular protector against antibiotics. In Enterobacteriaceae, H₂S can be produced by the cysJIH pathway, which uses sulfate as the sulfur source. CysB, in turn, is a positive regulator of cysJIH. At present, the role of S. Typhimurium cysJIH operon in the protection to reactive oxygen species (ROS) induced by antimicrobial compounds remains to be elucidated. In this work, we evaluated the role of cysJIH and cysB in ROS accumulation, superoxide dismutase (SOD) activity, reduced thiol accumulation, and H₂S accumulation in S. Typhimurium, cultured in either sulfate or cysteine as the sole sulfur source. Furthermore, we assessed the effects of the addition of ceftriaxone (CEF) and menadione (MEN) in these same parameters. In sulfate as the sole sulfur source, we found that the cysJIH operon and the cysB gene were required to full growth in minimal media, independently on the addition of CEF or MEN. Most importantly, both cysJIH and cysB contributed to diminish ROS levels, increase the SOD activity, increase the reduced thiols, and increase the H₂S levels in presence of CEF or MEN. Moreover, the cysJIH operon exhibited a CysB-dependent upregulation in presence of these two antimicrobials compounds. On the other hand, when cysteine was used as the sole sulfur source, we found that cysJIH operon was completely negligible, were only cysB exhibited similar phenotypes than the described for sulfate as sulfur source. Unexpectedly, CysB downregulated cysJIH operon when cysteine was used instead of sulfate, suggesting a complex regulation of this system. Copyright © 2015 Elsevier Inc. All rights reserved.
The ntp operon encoding the Na+V-ATPase of the thermophile Caloramator fervidus
Ubbink-Kok, Trees; Nijland, Jeroen; Slotboom, Dirk-Jan; Lolkema, Juke S.
2006-01-01
The V-type ATPase of the thermophile Caloramator fervidus is an ATP-driven Na+ pump. The nucleotide sequence of the ntpFIKECGABD operon containing the structural genes coding for the nine subunits of the enzyme complex was determined. The identity of the proteins in two pairs of subunits (D, E and
Mfd translocase is necessary and sufficient for transcription-coupled repair in Escherichia coli.
Adebali, Ogun; Sancar, Aziz; Selby, Christopher P
2017-11-10
Nucleotide excision repair in Escherichia coli is stimulated by transcription, specifically in the transcribed strand. Previously, it was shown that this transcription-coupled repair (TCR) is mediated by the Mfd translocase. Recently, it was proposed that in fact the majority of TCR in E. coli is catalyzed by a second pathway ("backtracking-mediated TCR") that is dependent on the UvrD helicase and the guanosine pentaphosphate (ppGpp) alarmone/stringent response regulator. Recently, we reported that as measured by the excision repair-sequencing (XR-seq), UvrD plays no role in TCR genome-wide. Here, we tested the role of ppGpp and UvrD in TCR genome-wide and in the lacZ operon using the XR-seq method, which directly measures repair. We found that the mfd mutation abolishes TCR genome-wide and in the lacZ operon. In contrast, the relA - spoT - mutant deficient in ppGpp synthesis carries out normal TCR. We conclude that UvrD and ppGpp play no role in TCR in E. coli . © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.
DEFF Research Database (Denmark)
Cheon, Seon Ah; Bal, Jyotiranjan; Song, Yunkyoung
2012-01-01
p) and Lac1p (CaLac1p) are functionally distinct. Lack of CaLag1p, but not CaLac1p, caused severe defects in the growth and hyphal morphogenesis of C. albicans. Deletion of CaLAG1 decreased expression of the hypha-specific HWP1 and ECE1 genes. Moreover, overexpression of CaLAG1 induced pseudohyphal...... growth in this organism under non-hypha-inducing conditions, suggesting that CaLag1p is necessary for relaying signals to induce hypha-specific gene expression. Analysis of ceramide and sphingolipid composition revealed that CaLag1p predominantly synthesizes ceramides with C24:0/C26:0 fatty acid moieties...
DNA-damaging agents stimulate gene expression at specific loci in Escherichia coli
Energy Technology Data Exchange (ETDEWEB)
Kenyon, C.J.; Walker, G.C.
1988-05-01
Operon fusions in Escherichia coli were obtained that showed increased beta-galactosidase expression in response to treatment with the DNA-damaging agent mitomycin C. These fusions were generated by using the Mud(ApR, lac) vector to insert the lactose structural genes randomly into the bacterial chromosome. Induction of beta-galactosidase in these strains, which carried fusions of lac to these din (damage-inducible) loci, was (i) triggered by UV light as well as by mitomycin C and (ii) abolished by either a recA- or a lexA- mutation. Similar characteristics of induction were observed when the lactose genes were fused to a prophage lambda promoter by using Mud(ApR, lac). These results indicate that E. coli contains a set of genes that, like prophage lambda genes, are expressed in response to DNA-damaging agents and regulated by the recA and lexA gene products. These din genes map at five bacterial loci. One din::Mud(ApR, lac) insertion results in a UV-sensitive phenotype and may be within the uvrA transcriptional unit.
Moinier, Danielle; Slyemi, Djamila; Byrne, Deborah; Lignon, Sabrina; Lebrun, Régine; Talla, Emmanuel; Bonnefoy, Violaine
2014-10-01
The genetic organization of the aioBA operon, encoding the arsenite oxidase of the moderately acidophilic and facultative chemoautotrophic bacterium Thiomonas arsenitoxydans, is different from that of the aioBA operon in the other arsenite oxidizers, in that it encodes AioF, a metalloprotein belonging to the ArsR/SmtB family. AioF is stabilized by arsenite, arsenate, or antimonite but not molybdate. Arsenic is tightly attached to AioF, likely by cysteine residues. When loaded with arsenite or arsenate, AioF is able to bind specifically to the regulatory region of the aio operon at two distinct positions. In Thiomonas arsenitoxydans, the promoters of aioX and aioB are convergent, suggesting that transcriptional interference occurs. These results indicate that the regulation of the aioBA operon is more complex in Thiomonas arsenitoxydans than in the other aioBA containing arsenite oxidizers and that the arsenic binding protein AioF is involved in this regulation. On the basis of these data, a model to explain the tight control of aioBA expression by arsenic in Thiomonas arsenitoxydans is proposed. Copyright © 2014, American Society for Microbiology. All Rights Reserved.
Optical polarimetry of quasi-stellar and BL Lac objects
International Nuclear Information System (INIS)
Wills, D.; Wills, B.J.; Breger, M.; Hsu, J.
1980-01-01
We report observations of 39 extragalactic objects, using a new polarimeter at McDonald Observatory. Most of the observations were made in January and June 1980. Some new BL Lac objects were found, and some of the previously known members of this class were also observed. Polarization exceeding 3--4 times the formal rms uncertainties was found in about ten QSO's. Rapid changes of polarization and/or position angle occurred in some of the BL Lacertae objects, usually with <0.1-mag change in the total light
Ghosh, Semanti; Bagchi, Angshuman
2015-12-01
Sulfur metabolism is one of the oldest known redox geochemical cycles in our atmosphere. These redox processes utilize different sulfur anions and the reactions are performed by the gene products of dsr operon from phylogenetically diverse sets of microorganisms. The operon is involved in the maintenance of environmental sulfur balance. Interestingly, the dsr operon is found to be present in both sulfur anion oxidizing and reducing microorganisms and in both types of organisms DsrAB protein complex plays a vital role. Though there are various reports regarding the genetics of dsr operon there are practically no reports dealing with the structural aspects of sulfur metabolism by dsr operon. In our present study, we tried to compare the mechanisms of sulfur anion oxidation and reduction by Allochromatium vinosum and Desulfovibrio vulgaris respectively through DsrAB protein complex. We analyzed the modes of bindings of sulfur anions to the DsrAB protein complex and observed that for sulfur anion oxidizers, sulfide and thiosulfate are the best substrates whereas for reducers sulfate and sulfite have the best binding abilities. We analyzed the binding interaction pattern of the DsrA and DsrB proteins while forming the DsrAB protein complexes in Desulfovibrio vulgaris and Allochromatium vinosum. To our knowledge this is the first report that analyzes the differences in binding patterns of sulfur substrates with DsrAB protein from these two microorganisms. This study would therefore be essential to predict the biochemical mechanism of sulfur anion oxidation and reduction by these two microorganisms i.e., Desulfovibrio vulgaris (sulfur anion reducer) and Allochromatium vinosum (sulfur anion oxidizer). Our observations also highlight the mechanism of sulfur geochemical cycle which has important implications in future study of sulfur metabolism as it has a huge application in waste remediation and production of industrial bio-products viz. vitamins, bio-polyesters and bio
Purified reconstituted lac carrier protein from Escherichia coli is fully functional.
Viitanen, P; Garcia, M L; Kaback, H R
1984-03-01
Proteoliposomes reconstituted with lac carrier protein purified from the plasma membrane of Escherichia coli catalyze each of the translocation reactions typical of the beta-galactoside transport system (i.e., active transport, counterflow, facilitated influx and efflux) with turnover numbers and apparent Km values comparable to those observed in right-side-out membrane vesicles. Furthermore, detailed kinetic studies show that the reconstituted system exhibits properties analogous to those observed in membrane vesicles. Imposition of a membrane potential (delta psi, interior negative) causes a marked decrease in apparent Km (by a factor of 7 to 10) with a smaller increase in Vmax (approximately equal to 3-fold). At submaximal values of delta psi, the reconstituted carrier exhibits biphasic kinetics, with one component manifesting the kinetic parameters of active transport and the other exhibiting the characteristics of facilitated diffusion. Finally, at low lactose concentrations, the initial velocity of influx varies linearly with the square of the proton electro-chemical gradient. The results provide quantitative support for the contention that a single polypeptide species, the product of the lac y gene, is responsible for each of the transport reactions typical of the beta-galactoside transport system.
Alteri, Christopher J; Himpsl, Stephanie D; Zhu, Kevin; Hershey, Haley L; Musili, Ninette; Miller, Jessa E; Mobley, Harry L T
2017-11-01
Type VI secretion systems (T6SS) function to deliver lethal payloads into target cells. Many studies have shown that protection against a single, lethal T6SS effector protein requires a cognate antidote immunity protein, both of which are often encoded together in a two-gene operon. The T6SS and an effector-immunity pair is sufficient for both killing and immunity. HereIn this paper we describe a T6SS effector operon that differs from conventional effector-immunity pairs in that eight genes are necessary for lethal effector function, yet can be countered by a single immunity protein. In this study, we investigated the role that the PefE T6SS immunity protein plays in recognition between two strains harboring nearly identical effector operons. Interestingly, despite containing seven of eight identical effector proteins, the less conserved immunity proteins only provided protection against their native effectors, suggesting that specificity and recognition could be dependent on variation within an immunity protein and one effector gene product. The variable effector gene product, PefD, is encoded upstream from pefE, and displays toxic activity that can be countered by PefE independent of T6SS-activity. Interestingly, while the entire pef operon was necessary to exert toxic activity via the T6SS in P. mirabilis, production of PefD and PefE alone was unable to exert this effector activity. Chimeric PefE proteins constructed from two P. mirabilis strains were used to localize immunity function to three amino acids. A promiscuous immunity protein was created using site-directed mutagenesis to change these residues from one variant to another. These findings support the notion that subtle differences between conserved effectors are sufficient for T6SS-mediated kin discrimination and that PefD requires additional factors to function as a T6SS-dependent effector.
Jwanoswki, Kathleen; Wells, Christina; Bruce, Terri; Rutt, Jennifer; Banks, Tabitha; McNealy, Tamara L
2017-01-01
Legionella pneumophila contaminates man-made water systems and creates numerous exposure risks for Legionnaires' Disease. Because copper/silver ionization is commonly used to control L. pneumophila, its mechanisms of metal response and detoxification are of significant interest. Here we describe an L. pneumophila operon with significant similarity to the GIG operon of Cupriavidus metallidurans. The Legionella GIG operon is present in a subset of strains and has been acquired as part of the ICE-βox 65-kB integrative conjugative element. We assessed GIG promoter activity following exposure of L. pneumophila to multiple concentrations of HAuCl4, CuSO4 and AgNO3. At 37°C, control stationary phase cultures exhibited GIG promoter activity. This activity increased significantly in response to 20 and 50uM HAuCl4 and CuSO4 but not in response to AgNO3. Conversely, at 26°C, cultures exhibited decreased promoter response to copper. GIG promoter activity was also induced by HAuCl4 or CuSO4 during early biofilm establishment at both temperatures. When an L. pneumophila GIG promoter construct was transformed into E. coli DH5α, cultures showed baseline expression levels that did not increase following metal addition. Analysis of L. pneumophila transcriptional regulatory mutants suggested that GIG up-regulation in the presence of metal ions may be influenced by the stationary phase sigma factor, RpoS.
Directory of Open Access Journals (Sweden)
Kathleen Jwanoswki
Full Text Available Legionella pneumophila contaminates man-made water systems and creates numerous exposure risks for Legionnaires' Disease. Because copper/silver ionization is commonly used to control L. pneumophila, its mechanisms of metal response and detoxification are of significant interest. Here we describe an L. pneumophila operon with significant similarity to the GIG operon of Cupriavidus metallidurans. The Legionella GIG operon is present in a subset of strains and has been acquired as part of the ICE-βox 65-kB integrative conjugative element. We assessed GIG promoter activity following exposure of L. pneumophila to multiple concentrations of HAuCl4, CuSO4 and AgNO3. At 37°C, control stationary phase cultures exhibited GIG promoter activity. This activity increased significantly in response to 20 and 50uM HAuCl4 and CuSO4 but not in response to AgNO3. Conversely, at 26°C, cultures exhibited decreased promoter response to copper. GIG promoter activity was also induced by HAuCl4 or CuSO4 during early biofilm establishment at both temperatures. When an L. pneumophila GIG promoter construct was transformed into E. coli DH5α, cultures showed baseline expression levels that did not increase following metal addition. Analysis of L. pneumophila transcriptional regulatory mutants suggested that GIG up-regulation in the presence of metal ions may be influenced by the stationary phase sigma factor, RpoS.
DEFF Research Database (Denmark)
Rømer, M U; Christiansen, J; Brünner, N
1995-01-01
The small cell lung cancer cell lines GLC-2 and DMS 456 were genetically labeled with the lacZ gene and examined for invasive and metastatic potential in META/Bom nude mice. The lacZ gene encodes the enzyme beta-D- galactosidase, and cells expressing this enzyme were identified by staining...... with the chromogenic substrate X-gal. lacZ expressing cells were investigated after subcutaneous (s.c.) inoculation and intravenous (i.v.) injection. The X-gal detection of beta-D-galactosidase activity proved to be a rapid and easy means for specific and highly sensitive identification of metastases. All primary s.......c. tumors stained by X-gal. The primary tumors of GLC-2 regularly demonstrated local invasive growth and produced multiple metastases in several organs. In contrast, primary DMS 456 tumors only occasionally demonstrated local invasion and very rarely generated secondary foci. No experimental metastases were...
Absorption in the spectra of quasi stellar objects and BL Lac objects
International Nuclear Information System (INIS)
Perry, J.J.; Burbidge, E.M.; Burbidge, G.R.
1978-06-01
An extensive review is given of the observations of absorption in the spectra of QSOs and BL Lac objects. In Table Ia we summarize all of the information available up to May 1, 1978 on objects which show absorption. Following discussion of the observations in Section II, possible interpretations are critically discussed. (orig.) [de
Role of Tellurite Resistance Operon in Filamentous Growth of Yersinia pestis in Macrophages.
Ponnusamy, Duraisamy; Clinkenbeard, Kenneth D
2015-01-01
Yersinia pestis initiates infection by parasitism of host macrophages. In response to macrophage infections, intracellular Y. pestis can assume a filamentous cellular morphology which may mediate resistance to host cell innate immune responses. We previously observed the expression of Y. pestis tellurite resistance proteins TerD and TerE from the terZABCDE operon during macrophage infections. Others have observed a filamentous response associated with expression of tellurite resistance operon in Escherichia coli exposed to tellurite. Therefore, in this study we examine the potential role of Y. pestis tellurite resistance operon in filamentous cellular morphology during macrophage infections. In vitro treatment of Y. pestis culture with sodium tellurite (Na2TeO3) caused the bacterial cells to assume a filamentous phenotype similar to the filamentous phenotype observed during macrophage infections. A deletion mutant for genes terZAB abolished the filamentous morphologic response to tellurite exposure or intracellular parasitism, but without affecting tellurite resistance. However, a terZABCDE deletion mutant abolished both filamentous morphologic response and tellurite resistance. Complementation of the terZABCDE deletion mutant with terCDE, but not terZAB, partially restored tellurite resistance. When the terZABCDE deletion mutant was complemented with terZAB or terCDE, Y. pestis exhibited filamentous morphology during macrophage infections as well as while these complemented genes were being expressed under an in vitro condition. Further in E. coli, expression of Y. pestis terZAB, but not terCDE, conferred a filamentous phenotype. These findings support the role of Y. pestis terZAB mediation of the filamentous response phenotype; whereas, terCDE confers tellurite resistance. Although the beneficial role of filamentous morphological responses by Y. pestis during macrophage infections is yet to be fully defined, it may be a bacterial adaptive strategy to macrophage
Wang, Dong; Wang, Qin; Qiu, Yimin; Nomura, Christopher T; Li, Junhui; Chen, Shouwen
The bacitracin synthetase gene cluster in Bacillus licheniformis DW2 is composed of the bacABC operon encoding a non-ribosomal peptide synthetase and bacT encoding a thioesterase. Although the bacitracin gene cluster has been well studied, little is known about how this gene cluster is regulated. This study provides insight into how the transcription factors Spo0A and AbrB regulate bacitracin biosynthesis. Deletion of spo0A resulted in drastically reduced expression of bacA and bacT, and subsequently bacitracin production. On the other hand, the expression of bacA and bacT increased significantly in B. licheniformis DW2ΔabrB and DW2Δ0AΔabrB compared to the wild-type strain DW2. The bacitracin yields on cell numbers (U/CFU) in DW2ΔabrB and DW2Δ0A/pHY300-0A-sad67 were 17.5% and 14.9% higher than that of the wild-type strain. An electrophoretic mobility shift assay (EMSA) further confirmed that AbrB could directly bind to the promoter regions of bacA and bacT. These results indicate that AbrB acts as a repressor of bacitracin biosynthesis by inhibiting bacA and bacT expression, while Spo0A indirectly promotes bacitracin biosynthesis by repressing abrB expression. Copyright © 2017 Institut Pasteur. Published by Elsevier Masson SAS. All rights reserved.
Kim, Seong Keun; Lee, Dae-Hee; Kim, Oh Cheol; Kim, Jihyun F; Yoon, Sung Ho
2017-09-15
Most inducible expression systems suffer from growth defects, leaky basal induction, and inhomogeneous expression levels within a host cell population. These difficulties are most prominent with the overproduction of membrane proteins that are toxic to host cells. Here, we developed an Escherichia coli inducible expression system for membrane protein production based on titrated expression of a mutant lac repressor (mLacI). Performance of the mLacI inducible system was evaluated in conjunction with commonly used lac operator-based expression vectors using a T7 or tac promoter. Remarkably, expression of a target gene can be titrated by the dose-dependent addition of l-rhamnose, and the expression levels were homogeneous in the cell population. The developed system was successfully applied to overexpress three membrane proteins that were otherwise difficult to produce in E. coli. This gene expression control system can be easily applied to a broad range of existing protein expression systems and should be useful in constructing genetic circuits that require precise output signals.
Takala, T M; Saris, P E J; Tynkkynen, S S H
2003-01-01
A new food-grade host/vector system for Lactobacillus casei based on lactose selection was constructed. The wild-type non-starter host Lb. casei strain E utilizes lactose via a plasmid-encoded phosphotransferase system. For food-grade cloning, a stable lactose-deficient mutant was constructed by deleting a 141-bp fragment from the phospho-beta-galactosidase gene lacG via gene replacement. The deletion resulted in an inactive phospho-beta-galactosidase enzyme with an internal in-frame deletion of 47 amino acids. A complementation plasmid was constructed containing a replicon from Lactococcus lactis, the lacG gene from Lb. casei, and the constitutive promoter of pepR for lacG expression from Lb. rhamnosus. The expression of the lacG gene from the resulting food-grade plasmid pLEB600 restored the ability of the lactose-negative mutant strain to grow on lactose to the wild-type level. The vector pLEB600 was used for expression of the proline iminopeptidase gene pepI from Lb. helveticus in Lb. casei. The results show that the food-grade expression system reported in this paper can be used for expression of foreign genes in Lb. casei.
Computing Optical Variable Periods of BL Lac Object S5 0716+714 ...
Indian Academy of Sciences (India)
2016-01-27
Jan 27, 2016 ... From a large volume of literature, we have collected effective observation of BL Lac object S5 0716+714 in the optical band, and constructed its long-term light curve from 1994 to 2006 AD. The light curve shows that S5 0716+714 is very active and exhibits very complicated non-sinusoidal variations.
Prodigiosin pigment of Serratia marcescens is associated with increased biomass production.
Haddix, Pryce L; Shanks, Robert M Q
2018-04-03
Serratia marcescens is a gram-negative, facultatively-anaerobic bacterium and opportunistic pathogen which produces the red pigment prodigiosin. We employed both batch culture and chemostat growth methods to investigate prodigiosin function in the producing organism. Pigmentation correlated with an increased rate of ATP production during population lag phase. Results with a lacZ transcriptional fusion to the prodigiosin (pig) biosynthetic operon revealed that operon transcription is activated by low cellular levels of ATP at high cell density. Furthermore, these data enabled estimation of the ATP per cell minimum value at which the operon is induced. Pigmented cells were found to accumulate ATP more rapidly and to multiply more quickly than non-pigmented cells during the high density growth phase. Finally, results with both batch and chemostat culture revealed that pigmented cells grow to approximately twice the biomass yield as non-pigmented S. marcescens bacteria. Prodigiosin production may, therefore, provide a growth advantage at ambient temperatures.
Inactivation of protein translocation by cold-sensitive mutations in the yajC-secDF operon
Nouwen, N; Driessen, AJM
2005-01-01
Most mutations in the yajC-secDF operon identified via genetic screens confer a cold-sensitive growth phenotype. Here we report that two of these mutations confer this cold-sensitive phenotype by inactivating the SecDF-YajC complex in protein translocation.
Muhr, Enrico; Leicht, Oliver; González Sierra, Silvia; Thanbichler, Martin; Heider, Johann
2015-01-01
The β-proteobacterium Aromatoleum aromaticum degrades the aromatic ketone acetophenone, a key intermediate of anaerobic ethylbenzene metabolism, either aerobically or anaerobically via a complex ATP-dependent acetophenone carboxylase and a benzoylacetate-CoA ligase. The genes coding for these enzymes (apcABCDE and bal) are organized in an apparent operon and are expressed in the presence of the substrate acetophenone. To study the conditions under which this operon is expressed in more detail, we constructed a reporter strain by inserting a gene fusion of apcA, the first gene of the apc-bal operon, with the gene for the fluorescent protein mCherry into the chromosome of A. aromaticum. The fusion protein indeed accumulated consistently with the expression pattern of the acetophenone-metabolic enzymes under various growth conditions. After evaluating and quantifying the data by fluorescence microscopy, fluorescence-based flow cytometry and immunoblot analysis, mCherry production was found to be proportional to the applied acetophenone concentrations. The reporter strain allowed quantification of acetophenone within a concentration range of 50 μM (detection limit) to 250 μM after 12 and 24 h. Moreover, production of the Apc-mCherry fusion protein in the reporter strain was highly specific and responded to acetophenone and both enantiomers of 1-phenylethanol, which are easily converted to acetophenone. Other analogous substrates showed either a significantly weaker response or none at all. Therefore, the reporter strain provides a basis for the development of a specific bioreporter system for acetophenone with an application potential reaching from environmental monitoring to petroleum prospecting.
Transcriptional activation of the tad type IVb pilus operon by PypB in Yersinia enterocolitica.
Schilling, Jennifer; Wagner, Karin; Seekircher, Stephanie; Greune, Lilo; Humberg, Verena; Schmidt, M Alexander; Heusipp, Gerhard
2010-07-01
Type IV pili are virulence factors in various bacteria and mediate, among other functions, the colonization of diverse surfaces. Various subclasses of type IV pili have been identified, but information on pilus expression, biogenesis, and the associated phenotypes is sparse for the genus Yersinia. We recently described the identification of PypB as a transcriptional regulator in Yersinia enterocolitica. Here we show that the pypB gene is associated with the tad locus, a genomic island that is widespread among bacterial and archaeal species. The genetic linkage of pypB with the tad locus is conserved throughout the yersiniae but is not found among other bacteria carrying the tad locus. We show that the genes of the tad locus form an operon in Y. enterocolitica that is controlled by PypB and that pypB is part of this operon. The tad genes encode functions necessary for the biogenesis of the Flp subfamily of type IVb pili initially described for Aggregatibacter actinomycetemcomitans to mediate a tight-adherence phenotype. In Y. enterocolitica, the Flp pilin protein shows some peculiarities in its amino acid sequence that imply similarities as well as differences compared to typical motifs found in the Flp subtype of type IVb pili. Flp is expressed and processed after PypB overproduction, resulting in microcolony formation but not in increased adherence to biotic or abiotic surfaces. Our data describe the transcriptional regulation of the tad type IVb pilus operon by PypB in Y. enterocolitica but fail to show most previously described phenotypes associated with this type of pilus in other bacteria.
Using the Markov chain Monte Carlo method to study the physical properties of GeV-TeV BL Lac objects
Qin, Longhua; Wang, Jiancheng; Yang, Chuyuan; Yuan, Zunli; Mao, Jirong; Kang, Shiju
2018-01-01
We fit the spectral energy distributions (SEDs) of 46 GeV-TeV BL Lac objects in the frame of leptonic one-zone synchrotron self-Compton (SSC) model and investigate the physical properties of these objects. We use the Markov chain Monte Carlo (MCMC) method to obtain the basic parameters, such as magnetic field (B), the break energy of the relativistic electron distribution (γ ^' }b), and the electron energy spectral index. Based on the modeling results, we support the following scenarios for GeV-TeV BL Lac objects. (1) Some sources have large Doppler factors, implying other radiation mechanism should be considered. (2) Compared with flat spectrum quasars (FSRQs), GeV-TeV BL Lac objects have weaker magnetic fields and larger Doppler factors, which cause the ineffective cooling and shift the SEDs to higher bands. Their jet powers are around 4.0 × 1045 erg s-1, compared with radiation power, 5.0 × 1042 erg s-1, indicating that only a small fraction of jet power is transformed into the emission power. (3) For some BL Lacs with large Doppler factors, their jet components could have two substructures, e.g., the fast core and the slow sheath. For most GeV-TeV BL Lacs, Kelvin-Helmholtz instabilities are suppressed by their higher magnetic fields, leading to micro-variability or intro-day variability in the optical bands. (4) Combined with a sample of FSRQs, an anti-correlation between the peak luminosity, Lpk, and the peak frequency, νpk, is obtained, favoring the blazar sequence scenario. In addition, an anti-correlation between the jet power, Pjet, and the break Lorentz factor, γb, also supports the blazar sequence.
Venema, Konraad; Kok, Jan; Marugg, Joey D.; Toonen, Marjolein Y.; Ledeboer, Aat M.; Venema, Gerhardus; Chikindas, Michael L.
The bacteriocin pediocin PA-1 operon of Pediococcus acidilactici PAC1.0 encompasses four genes: pedA, pedB, pedC and pedD. Transcription of the operon results in the formation of two overlapping transcripts, probably originating from a single promoter upstream of pedA. The major transcript comprises
Tomiyama, M P O; Werle, C H; Milanez, G P; Nóbrega, D B; Pereira, J P; Calarga, A P; Flores, F; Brocchi, M
2015-12-29
Salmonella enterica subsp enterica serovar 4,5,12:i:- has been responsible for many recent Salmonella outbreaks worldwide. Several studies indicate that this serovar originated from S. enterica subsp enterica serovar Typhimurium, by the loss of the flagellar phase II gene (fljB) and adjacent sequences. However, at least two different clones of S. enterica 4,5,12:i:- exist that differs in the molecular events responsible for fljB deletion. The aim of this study was to test the stability of the fljBA operon responsible for the flagellar phase variation under different growth conditions in order to verify if its deletion is a frequent event that could explain the origin and dissemination of this serovar. In fact, coding sequences for transposons are present near this operon and in some strains, such as S. enterica Typhimurium LT2, the Fels-2 prophage gene is inserted near this operon. The presence of mobile DNA could confer instability to this region. In order to examine this, the cat (chloramphenicol acetyltransferase) gene was inserted adjacent to the fljBA operon so that deletions involving this genomic region could be identified. After growing S. enterica chloramphenicol-resistant strains under different conditions, more than 104 colonies were tested for the loss of chloramphenicol resistance. However, none of the colonies were sensitive to chloramphenicol. These data suggest that the origin of S. enterica serovar 4,5,12:i:- from Typhimurium by fljBA deletion is not a frequent event. The origin and dissemination of 4,5,12:i:- raise several questions about the role of flagellar phase variation in virulence.
Discovery of Intermediates of lacZ β-Galactosidase Catalyzed Hydrolysis Using dDNP NMR
DEFF Research Database (Denmark)
Kjeldsen, Christian; Ardenkjær-Larsen, Jan Henrik; Duus, Jens Ø.
2018-01-01
Using dissolution dynamic nuclear polarization, the sensitivity of single scan solution state 13C NMR can be improved up to 4 orders of magnitude. In this study, the enzyme lacZ β-galactosidase from Escherichia coli was subjected to hyperpolarized substrate, and previously unknown reaction...
Discovery of Intermediates of lacZ beta-Galactosidase Catalyzed Hydrolysis Using dDNP NMR
DEFF Research Database (Denmark)
Kjeldsen, Christian; Ardenkjær-Larsen, Jan Henrik; Duus, Jens Øllgaard
2018-01-01
Using dissolution dynamic nuclear polarization, the sensitivity of single scan solution state C-13 NMR can be improved up to 4 orders of magnitude. In this study, the enzyme lacZ beta-galactosidase from Escherichia coli was subjected to hyperpolarized substrate, and previously unknown reaction...
Cen, Xu-Feng; Wang, Jing-Zhi; Zhao, Guo-Ping; Wang, Ying; Wang, Jin
2016-03-18
In the agl3EFGXYZ operon (SCO7167-SCO7162, abbreviated as agl3 operon) of Streptomyces coelicolor M145, agl3EFG genes encode a putative ABC-type carbohydrate transporter. The transcription of this operon has been proved to be repressed by Agl3R (SCO7168), a neighboring GntR-family regulator, and this repression can be released by growth on poor carbon sources. Here in this study, we prove that the transcription of agl3 operon is also directly repressed by GlnR, a central regulator governing the nitrogen metabolism in S. coelicolor. The electrophoretic mobility shift assay (EMSA) employing the agl3 promoter and mixtures of purified recombinant GlnR and Agl3R indicates that GlnR and Agl3R bind to different DNA sequences within the promoter region of agl3 operon, which is further confirmed by the DNase I footprinting assay. As Agl3R and GlnR have been demonstrated to sense the extracellular carbon and nitrogen supplies, respectively, it is hypothesized that the transcription of agl3 operon is stringently governed by the availabilities of extracellular carbon and nitrogen sources. Consistent with the hypothesis, the agl3 operon is further found to be derepressed only under the condition of poor carbon and rich nitrogen supplies, when both regulators are inactivated. It is believed that activation of the expression of agl3 operon may facilitate the absorption of extracellular carbohydrates to balance the ratio of intracellular carbon to nitrogen. Copyright © 2016 Elsevier Inc. All rights reserved.
Jeong, Daun; Yang, Jeongmo; Lee, Soojin; Kim, Borim; Um, Youngsoon; Kim, Youngrok; Ha, Kyoung-Su; Lee, Jinwon
2016-05-18
Klebsiella pneumoniae is known to produce 2,3-butanediol (2,3-BDO), a valuable chemical. In K. pneumoniae, the 2,3-BDO operon (budBAC) is involved in the production of 2,3-BDO. To observe the physiological role of the 2,3-BDO operon in a mixed acid fermentation, we constructed a budBAC-deleted strain (SGSB109). The production of extracellular metabolites, CO2 emission, carbon distribution, and NADH/NAD(+) balance of SGSB109 were compared with the parent strain (SGSB100). When comparing the carbon distribution at 15 hr, four significant differences were observed: in 2,3-BDO biosynthesis, lactate and acetate production (lactate and acetate production increased 2.3-fold and 4.1-fold in SGSB109 compared to SGSB100), CO2 emission (higher in SGSB100), and carbon substrate uptake (higher in SGSB100). Previous studies on the inactivation of the 2,3-BDO operon were focused on the increase of 1,3-propanediol production. Few studies have been done observing the role of 2,3-BDO biosynthesis. This study provides a prime insight into the role of 2,3-BDO biosynthesis of K. pneumoniae.
DEFF Research Database (Denmark)
Brünner, N; Thompson, E W; Spang-Thomsen, M
1992-01-01
in the animals by usual histological procedures would require extensive sectioning of the whole animal. To overcome this problem, we transduced human breast cancer cells with a replication-defective Moloney murine leukaemia retroviral vector (M-MuLV) containing both neoR (neomycin resistance) and lacZ genes...... but not the surrounding mouse tissue on either whole tissue blocks or histological sections. The staining procedure was highly sensitive, allowing detection of microfoci of human cancer cells, and quantitative estimation of the metastatic capacity of the cells. These results indicate that lacZ transduction of human...
Hoogewerf, Arlene J; Dyk, Lisa A Van; Buit, Tyler S; Roukema, David; Resseguie, Emily; Plaisier, Christina; Le, Nga; Heeringa, Lee; Griend, Douglas A Vander
2015-02-01
Sequencing of a cadmium resistance operon from a Staphylococcus aureus ATCC12600 plasmid revealed that it is identical to a cadCA operon found in MRSA strains. Compared to plasmid-cured and cadC-mutant strains, cadC-positive ATCC12600 cells had increased resistance to cadmium (1 mg ml(-1) cadmium sulfate) and zinc (4 mg ml(-1) zinc sulfate), but not to other metal ions. After growth in media containing 20 µg ml(-1) cadmium sulfate, cadC-mutant cells contained more intracellular cadmium than cadC-positive ATCC12600 cells, suggesting that cadC absence results in impaired cadmium efflux. Electrophoretic mobility shift assays were performed with CadC proteins encoded by the S. aureus ATCC12600 plasmid and by the cadC gene of pI258, which is known to act as a transcriptional repressor and shares only 47% protein sequence identity with ATCC12600 CadC. Mobility shifts occurred when pI258 CadC protein was incubated with the promoter DNA-regions from the pI258 and S. aureus ATCC12600 cadCA operons, but did not occur with S. aureus ATCC12600 CadC protein, indicating that the ATCC12600 CadC protein does not interact with promoter region DNA. This cadCA operon, found in MRSA strains and previously functionally uncharacterized, increases resistance to cadmium and zinc by an efflux mechanism, and CadC does not function as a transcriptional repressor. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Bonneau, Manon; Atyame, Celestine; Beji, Marwa; Justy, Fabienne; Cohen-Gonsaud, Martin; Sicard, Mathieu; Weill, Mylène
2018-01-22
Culex pipiens mosquitoes are infected with Wolbachia (wPip) that cause an important diversity of cytoplasmic incompatibilities (CIs). Functional transgenic studies have implicated the cidA-cidB operon from wPip and its homolog in wMel in CI between infected Drosophila males and uninfected females. However, the genetic basis of the CI diversity induced by different Wolbachia strains was unknown. We show here that the remarkable diversity of CI in the C. pipiens complex is due to the presence, in all tested wPip genomes, of several copies of the cidA-cidB operon, which undergoes diversification through recombination events. In 183 isofemale lines of C. pipiens collected worldwide, specific variations of the cidA-cidB gene repertoires are found to match crossing types. The diversification of cidA-cidB is consistent with the hypothesis of a toxin-antitoxin system in which the gene cidB co-diversifies with the gene cidA, particularly in putative domains of reciprocal interactions.
Directory of Open Access Journals (Sweden)
Johanna Rintahaka
Full Text Available A noticeable genomic feature of many piliated Gram-positive bacterial species is the presence of more than one pilus-encoding operon. Paradigmatically, the gut-adapted Lactobacillus rhamnosus GG strain contains two different fimbrial operons in its genome. However, whereas one of these operons (called spaCBA is encoding for the functionally mucus-/collagen-binding SpaCBA pilus, for the other operon (called spaFED any native expression of the SpaFED-called pili is still the subject of some uncertainty. Irrespective of such considerations, we decided it would be of relevance or interest to decipher the gross structure of this pilus type, and as well assess its functional capabilities for cellular adhesion and immunostimulation. For this, and by following the approach we had used previously to explicate the immuno-properties of SpaCBA pili, we constructed nisin-inducible expression clones producing either wild-type or SpaF pilin-deleted surface-assembled L. rhamnosus GG SpaFED pili on Lactococcus lactis cells. Using these piliated lactococcal constructs, we found that the pilin-polymerized architecture of a recombinant-produced SpaFED pilus coincides with sequence-based functional predictions of the related pilins, and in fact is prototypical of those other sortase-dependent pilus-like structures thus far characterized for piliated Gram-positive bacteria. Moreover, we confirmed that among the different pilin subunits encompassing spaFED operon-encoded pili, the SpaF pilin is a main adhesion determinant, and when present in the assembled structure can mediate pilus binding to mucus, certain extracellular matrix proteins, and different gut epithelial cell lines. However, somewhat unexpectedly, when recombinant SpaFED pili are surface-attached, we found that they could not potentiate the existing lactococcal cell-induced immune responses so elicited from intestinal- and immune-related cells, but rather instead, they could dampen them. Accordingly, we
Rintahaka, Johanna; Yu, Xia; Kant, Ravi; Palva, Airi; von Ossowski, Ingemar
2014-01-01
A noticeable genomic feature of many piliated Gram-positive bacterial species is the presence of more than one pilus-encoding operon. Paradigmatically, the gut-adapted Lactobacillus rhamnosus GG strain contains two different fimbrial operons in its genome. However, whereas one of these operons (called spaCBA) is encoding for the functionally mucus-/collagen-binding SpaCBA pilus, for the other operon (called spaFED) any native expression of the SpaFED-called pili is still the subject of some uncertainty. Irrespective of such considerations, we decided it would be of relevance or interest to decipher the gross structure of this pilus type, and as well assess its functional capabilities for cellular adhesion and immunostimulation. For this, and by following the approach we had used previously to explicate the immuno-properties of SpaCBA pili, we constructed nisin-inducible expression clones producing either wild-type or SpaF pilin-deleted surface-assembled L. rhamnosus GG SpaFED pili on Lactococcus lactis cells. Using these piliated lactococcal constructs, we found that the pilin-polymerized architecture of a recombinant-produced SpaFED pilus coincides with sequence-based functional predictions of the related pilins, and in fact is prototypical of those other sortase-dependent pilus-like structures thus far characterized for piliated Gram-positive bacteria. Moreover, we confirmed that among the different pilin subunits encompassing spaFED operon-encoded pili, the SpaF pilin is a main adhesion determinant, and when present in the assembled structure can mediate pilus binding to mucus, certain extracellular matrix proteins, and different gut epithelial cell lines. However, somewhat unexpectedly, when recombinant SpaFED pili are surface-attached, we found that they could not potentiate the existing lactococcal cell-induced immune responses so elicited from intestinal- and immune-related cells, but rather instead, they could dampen them. Accordingly, we have now provided
Highly divergent 16S rRNA sequences in ribosomal operons of Scytonema hyalinum (Cyanobacteria)
Czech Academy of Sciences Publication Activity Database
Johansen, J. R.; Mareš, Jan; Pietrasiak, N.; Bohunická, Markéta; Zima, Jan; Štenclová, L.; Hauer, Tomáš
2017-01-01
Roč. 12, č. 10 (2017), č. článku e0186393. E-ISSN 1932-6203 R&D Projects: GA ČR(CZ) GA15-11912S Institutional support: RVO:67985939 Keywords : rRNA operon * heterogenita * Scytonema hyalinum Subject RIV: EF - Botanics OBOR OECD: Plant sciences, botany Impact factor: 2.806, year: 2016
Andersson, U.; Molenaar, D.; Radstrom, P.; Vos, de W.M.
2005-01-01
Global regulatory circuits together with more specific local regulators play a notable role when cells are adapting to environmental changes. Lactococcus lactis is a lactic acid bacterium abundant in nature fermenting most mono- and disaccharides. Comparative genomics analysis of the operons
Buntin, Nirunya; Hongpattarakere, Tipparat; Ritari, Jarmo; Douillard, François P; Paulin, Lars; Boeren, Sjef; Shetty, Sudarshan A; de Vos, Willem M
2017-01-15
The draft genomes of Lactobacillus plantarum strains isolated from Asian fermented foods, infant feces, and shrimp intestines were sequenced and compared to those of well-studied strains. Among 28 strains of L. plantarum, variations in the genomic features involved in ecological adaptation were elucidated. The genome sizes ranged from approximately 3.1 to 3.5 Mb, of which about 2,932 to 3,345 protein-coding sequences (CDS) were predicted. The food-derived isolates contained a higher number of carbohydrate metabolism-associated genes than those from infant feces. This observation correlated to their phenotypic carbohydrate metabolic profile, indicating their ability to metabolize the largest range of sugars. Surprisingly, two strains (P14 and P76) isolated from fermented fish utilized inulin. β-Fructosidase, the inulin-degrading enzyme, was detected in the supernatants and cell wall extracts of both strains. No activity was observed in the cytoplasmic fraction, indicating that this key enzyme was either membrane-bound or extracellularly secreted. From genomic mining analysis, a predicted inulin operon of fosRABCDXE, which encodes β-fructosidase and many fructose transporting proteins, was found within the genomes of strains P14 and P76. Moreover, pts1BCA genes, encoding sucrose-specific IIBCA components involved in sucrose transport, were also identified. The proteomic analysis revealed the mechanism and functional characteristic of the fosRABCDXE operon involved in the inulin utilization of L. plantarum The expression levels of the fos operon and pst genes were upregulated at mid-log phase. FosE and the LPXTG-motif cell wall anchored β-fructosidase were induced to a high abundance when inulin was present as a carbon source. Inulin is a long-chain carbohydrate that may act as a prebiotic, which provides many health benefits to the host by selectively stimulating the growth and activity of beneficial bacteria in the colon. While certain lactobacilli can catabolize
The genus Hypostomus Lacépède, 1803, and its Surinam representatives (Siluriformes, Loricariidae)
Boeseman, M.
1968-01-01
CONTENTS Introduction................... 3 The generic name................. 4 The type species of Hypostomus Lacépède.......... 6 The identity of Acipenser plecostomus Linnaeus........ 9 The distribution and habitats of the Surinam species........ 12 The relationship of the Surinam
Zhang, Lihong; Liu, Xiaomeng; Li, Xinxin; Chen, Sanfeng
2015-10-01
To investigate the transcription and translation and nitrogenase activity of the nine N2-fixing-gene (nif) operon (nifBHDKENXhesAnifX) of Paenibacillus sp. WLY78 under the control of the T7 promoter in Escherichia coli BL21 under different conditions. The Paenibacillus nif operon under the control of the T7 promoter is significantly transcribed and effectively translated in E. coli BL21 when grown in medium containing organic N compounds (yeast extract and Tryptone) or NH4+ by using RT-PCR and Western blot analysis. Transcription and translation of foreign nif genes in E. coli are not inhibited by environmental organic or inorganic N compounds or O2. However, contrary to transcription and translation, nitrogenase activity is 4% lower in the recombinant E. coli 78-32 compared to the native Paenibacillus sp. WLY78. The Paenibacillus nif operon under the control of T7 promoter enables E. coli BL21 to synthesize active nitrogenase. This study shows how the nif gene operon can be transferred to non-N2-fixing bacteria or to eukaryotic organelles.
RbsR Activates Capsule but Represses the rbsUDK Operon in Staphylococcus aureus.
Lei, Mei G; Lee, Chia Y
2015-12-01
Staphylococcus aureus capsule is an important virulence factor that is regulated by a large number of regulators. Capsule genes are expressed from a major promoter upstream of the cap operon. A 10-bp inverted repeat (IR) located 13 bp upstream of the -35 region of the promoter was previously shown to affect capsule gene transcription. However, little is known about transcriptional activation of the cap promoter. To search for potential proteins which directly interact with the cap promoter region (Pcap), we directly analyzed the proteins interacting with the Pcap DNA fragment from shifted gel bands identified by electrophoretic mobility shift assay. One of these regulators, RbsR, was further characterized and found to positively regulate cap gene expression by specifically binding to the cap promoter region. Footprinting analyses showed that RbsR protected a DNA region encompassing the 10-bp IR. Our results further showed that rbsR was directly controlled by SigB and that RbsR was a repressor of the rbsUDK operon, involved in ribose uptake and phosphorylation. The repression of rbsUDK by RbsR could be derepressed by D-ribose. However, D-ribose did not affect RbsR activation of capsule. Staphylococcus aureus is an important human pathogen which produces a large number of virulence factors. We have been using capsule as a model virulence factor to study virulence regulation. Although many capsule regulators have been identified, the mechanism of regulation of most of these regulators is unknown. We show here that RbsR activates capsule by direct promoter binding and that SigB is required for the expression of rbsR. These results define a new pathway wherein SigB activates capsule through RbsR. Our results further demonstrate that RbsR inhibits the rbs operon involved in ribose utilization, thereby providing an example of coregulation of metabolism and virulence in S. aureus. Thus, this study further advances our understanding of staphylococcal virulence regulation
Role of P27 -P55 operon from Mycobacterium tuberculosis in the resistance to toxic compounds
Directory of Open Access Journals (Sweden)
Cataldi Angel A
2011-07-01
Full Text Available Abstract Background The P27-P55 (lprG-Rv1410c operon is crucial for the survival of Mycobacterium tuberculosis, the causative agent of human tuberculosis, during infection in mice. P55 encodes an efflux pump that has been shown to provide Mycobacterium smegmatis and Mycobacterium bovis BCG with resistance to several drugs, while P27 encodes a mannosylated glycoprotein previously described as an antigen that modulates the immune response against mycobacteria. The objective of this study was to determine the individual contribution of the proteins encoded in the P27-P55 operon to the resistance to toxic compounds and to the cell wall integrity of M. tuberculosis. Method In order to test the susceptibility of a mutant of M. tuberculosis H37Rv in the P27-P55 operon to malachite green, sodium dodecyl sulfate, ethidium bromide, and first-line antituberculosis drugs, this strain together with the wild type strain and a set of complemented strains were cultivated in the presence and in the absence of these drugs. In addition, the malachite green decolorization rate of each strain was obtained from decolorization curves of malachite green in PBS containing bacterial suspensions. Results The mutant strain decolorized malachite green faster than the wild type strain and was hypersensitive to both malachite green and ethidium bromide, and more susceptible to the first-line antituberculosis drugs: isoniazid and ethambutol. The pump inhibitor reserpine reversed M. tuberculosis resistance to ethidium bromide. These results suggest that P27-P55 functions through an efflux-pump like mechanism. In addition, deletion of the P27-P55 operon made M. tuberculosis susceptible to sodium dodecyl sulfate, suggesting that the lack of both proteins causes alterations in the cell wall permeability of the bacterium. Importantly, both P27 and P55 are required to restore the wild type phenotypes in the mutant. Conclusions The results clearly indicate that P27 and P55 are
Directory of Open Access Journals (Sweden)
Enrico eMuhr
2016-01-01
Full Text Available The β-proteobacterium Aromatoleum aromaticum degrades the aromatic ketone acetophenone, a key intermediate of anaerobic ethylbenzene metabolism, either aerobically or anaerobically via a complex ATP-dependent acetophenone carboxylase and a benzoylacetate-CoA ligase. The genes coding for these enzymes (apcABCDE and bal are organized in an apparent operon and are expressed in the presence of the substrate acetophenone. To study the conditions under which this operon is expressed in more detail, we constructed a reporter strain by inserting a gene fusion of apcA, the first gene of the apc-bal operon, with the gene for the fluorescent protein mCherry into the chromosomal DNA of A. aromaticum. The mCherry fusion protein indeed responded consistently with the expression pattern of the acetophenone-metabolic enzymes under various growth conditions. After evaluating and quantifying the data by fluorescence microscopy, fluorescence based flow cytometry and immunoblot analysis, the recorded amounts of mCherry production were found to be proportional to the applied acetophenone concentrations. The reporter strain allowed quantification of acetophenone within a concentration range of 50 µM (detection limit to 250 µM after 12 and 24 hours. Moreover, production of the Apc-mCherry fusion protein in the reporter strain was highly specific and responded to acetophenone and both enantiomers of 1-phenylethanol, which are easily converted to acetophenone. Other analogous substrates showed either a significantly weaker response or none at all. Therefore, the reporter strain provides a basis for the development of a specific bioreporter system for acetophenone with application potentials reaching from environmental monitoring to petroleum prospecting.
Directory of Open Access Journals (Sweden)
Alexander William Eastman
2015-01-01
Full Text Available Advances in sequencing technology have drastically increased the depth and feasibility of bacterial genome sequencing. However, little information is available that details the specific techniques and procedures employed during genome sequencing despite the large numbers of published genomes. Shotgun approaches employed by second-generation sequencing platforms has necessitated the development of robust bioinformatics tools for in silico assembly, and complete assembly is limited by the presence of repetitive DNA sequences and multi-copy operons. Typically, re-sequencing with multiple platforms and laborious, targeted Sanger sequencing are employed to finish a draft bacterial genome. Here we describe a novel strategy based on the identification and targeted sequencing of repetitive rDNA operons to expedite bacterial genome assembly and finishing. Our strategy was validated by finishing the genome of Paenibacillus polymyxa strain CR1, a bacterium with potential in sustainable agriculture and bio-based processes. An analysis of the 38 contigs contained in the P. polymyxa strain CR1 draft genome revealed 12 repetitive rDNA operons with varied intragenic and flanking regions of variable length, unanimously located at contig boundaries and within contig gaps. These highly similar but not identical rDNA operons were experimentally verified and sequenced simultaneously with multiple, specially designed primer sets. This approach also identified and corrected significant sequence rearrangement generated during the initial in silico assembly of sequencing reads. Our approach reduces the required effort associated with blind primer walking for contig assembly, increasing both the speed and feasibility of genome finishing. Our study further reinforces the notion that repetitive DNA elements are major limiting factors for genome finishing. Moreover, we provided a step-by-step workflow for genome finishing, which may guide future bacterial genome finishing
Gonzalez-Garcia, Ricardo Axayacatl; McCubbin, Tim; Wille, Annalena; Plan, Manuel; Nielsen, Lars Keld; Marcellin, Esteban
2017-07-17
Propionic acid is used primarily as a food preservative with smaller applications as a chemical building block for the production of many products including fabrics, cosmetics, drugs, and plastics. Biological production using propionibacteria would be competitive against chemical production through hydrocarboxylation of ethylene if native producers could be engineered to reach near-theoretical yield and good productivity. Unfortunately, engineering propionibacteria has proven very challenging. It has been suggested that activation of the sleeping beauty operon in Escherichia coli is sufficient to achieve propionic acid production. Optimising E. coli production should be much easier than engineering propionibacteria if tolerance issues can be addressed. Propionic acid is produced in E. coli via the sleeping beauty mutase operon under anaerobic conditions in rich medium via amino acid degradation. We observed that the sbm operon enhances amino acids degradation to propionic acid and allows E. coli to degrade isoleucine. However, we show here that the operon lacks an epimerase reaction that enables propionic acid production in minimal medium containing glucose as the sole carbon source. Production from glucose can be restored by engineering the system with a methylmalonyl-CoA epimerase from Propionibacterium acidipropionici (0.23 ± 0.02 mM). 1-Propanol production was also detected from the promiscuous activity of the native alcohol dehydrogenase (AdhE). We also show that aerobic conditions are favourable for propionic acid production. Finally, we increase titre 65 times using a combination of promoter engineering and process optimisation. The native sbm operon encodes an incomplete pathway. Production of propionic acid from glucose as sole carbon source is possible when the pathway is complemented with a methylmalonyl-CoA epimerase. Although propionic acid via the restored succinate dissimilation pathway is considered a fermentative process, the engineered pathway
Horne, Shelley M; Sayler, Joseph; Scarberry, Nicholas; Schroeder, Meredith; Lynnes, Ty; Prüß, Birgit M
2016-11-08
Heterogeneity and niche adaptation in bacterial biofilm involve changes to the genetic makeup of the bacteria and gene expression control. We hypothesized that i) spontaneous mutations in the flhD operon can either increase or decrease motility and that ii) the resulting motility heterogeneity in the biofilm might lead to a long-term increase in biofilm biomass. We allowed the highly motile E. coli K-12 strain MC1000 to form seven- and fourteen-day old biofilm, from which we recovered reduced motility isolates at a substantially greater frequency (5.4 %) than from a similar experiment with planktonic bacteria (0.1 %). Biofilms formed exclusively by MC1000 degraded after 2 weeks. In contrast, biofilms initiated with a 1:1 ratio of MC1000 and its isogenic flhD::kn mutant remained intact at 4 weeks and the two strains remained in equilibrium for at least two weeks. These data imply that an 'optimal' biofilm may contain a mixture of motile and non-motile bacteria. Twenty-eight of the non-motile MC1000 isolates contained an IS1 element in proximity to the translational start of FlhD or within the open reading frames for FlhD or FlhC. Two isolates had an IS2 and one isolate had an IS5 in the open reading frame for FlhD. An additional three isolates contained deletions that included the RNA polymerase binding site, five isolates contained point mutations and small deletions in the open reading frame for FlhC. The locations of all these mutations are consistent with the lack of motility and further downstream within the flhD operon than previously published IS elements that increased motility. We believe that the location of the mutation within the flhD operon determines whether the effect on motility is positive or negative. To test the second part of our hypothesis where motility heterogeneity in a biofilm may lead to a long-term increase in biofilm biomass, we quantified biofilm biomass by MC1000, MC1000 flhD::kn, and mixtures of the two strains at ratios of 1:1, 10
2011-01-01
Background Cyanobacteria harbor two [NiFe]-type hydrogenases consisting of a large and a small subunit, the Hup- and Hox-hydrogenase, respectively. Insertion of ligands and correct folding of nickel-iron hydrogenases require assistance of accessory maturation proteins (encoded by the hyp-genes). The intergenic region between the structural genes encoding the uptake hydrogenase (hupSL) and the accessory maturation proteins (hyp genes) in the cyanobacteria Nostoc PCC 7120 and N. punctiforme were analysed using molecular methods. Findings The five ORFs, located in between the uptake hydrogenase structural genes and the hyp-genes, can form a transcript with the hyp-genes. An identical genomic localization of these ORFs are found in other filamentous, N2-fixing cyanobacterial strains. In N. punctiforme and Nostoc PCC 7120 the ORFs upstream of the hyp-genes showed similar transcript level profiles as hupS (hydrogenase structural gene), nifD (nitrogenase structural gene), hypC and hypF (accessory hydrogenase maturation genes) after nitrogen depletion. In silico analyzes showed that these ORFs in N. punctiforme harbor the same conserved regions as their homologues in Nostoc PCC 7120 and that they, like their homologues in Nostoc PCC 7120, can be transcribed together with the hyp-genes forming a larger extended hyp-operon. DNA binding studies showed interactions of the transcriptional regulators CalA and CalB to the promoter regions of the extended hyp-operon in N. punctiforme and Nostoc PCC 7120. Conclusions The five ORFs upstream of the hyp-genes in several filamentous N2-fixing cyanobacteria have an identical genomic localization, in between the genes encoding the uptake hydrogenase and the maturation protein genes. In N. punctiforme and Nostoc PCC 7120 they are transcribed as one operon and may form transcripts together with the hyp-genes. The expression pattern of the five ORFs within the extended hyp-operon in both Nostoc punctiforme and Nostoc PCC 7120 is similar to
Observations of low and intermediate-frequency-peaked BL Lacs above 100 GeV with VERITAS
Directory of Open Access Journals (Sweden)
Errando M.
2013-12-01
Full Text Available Most of the ~ 50 blazars detected to date at TeV energies (E > 0.1 TeV are high-frequency-peaked BL Lacs (HBLs. Only a handful episodic detections of low- and intermediate-frequency-peaked BL Lacs (LBL/IBLs, with synchrotron peak frequencies in the infrared and optical regime have been reported by ground-based gamma-ray telescopes, typically during high-flux states. The VERITAS array located in southern Arizona has observed five known TeV LBL/IBLs since 2009: 3C 66A, WComae, PKS 1424+240, S5 0716+714 and BL Lacertae, with exposures of 5-10 hours/year, which so far resulted in the detection of a bright, sub-hour timescale gamma-ray flare of BL Lacertae in June 2011. We also report the detection and characterization of two new IBLs: VER J0521+211 and B2 1215+30.
Dynamical Black Hole Masses of BL Lac Objects from the Sloan Digital Sky Survey
Plotkin, Richard M.; Markoff, Sera; Trager, Scott C.; Anderson, Scott F.
2012-01-01
We measure black hole masses for 71 BL Lac objects from the Sloan Digital Sky Survey (SDSS) with redshifts out to z ∼ 0.4. We perform spectral decompositions of their nuclei from their host galaxies and measure their stellar velocity dispersions. Black hole masses are then derived from the black
The LAC Test: A New Look at Auditory Conceptualization and Literacy Development K-12.
Lindamood, Charles; And Others
The Lindamood Auditory Conceptualization (LAC) Test was constructed with the recognition that the process of decoding involves an integration of the auditory, visual, and motor senses. Requiring the manipulation of colored blocks to indicate conceptualization of test patterns spoken by the examiner, subtest 1 entails coding of identity, number,…
Caractérisation des sables et morphologie du fond du lac du ...
African Journals Online (AJOL)
Une analyse sédimentologique et minéralogique réalisée sur un cycle hydrologique entre octobre 2004 et août 2005 a permis d\\'évaluer les charges solides en suspension et de caractériser les sédiments du lac du barrage de Taabo. La concentration moyenne en matières en suspension (12 mg.L-1) et la turbidité ...
Caractérisation des sables et morphologie du fond du lac du ...
African Journals Online (AJOL)
Administrateur
Une analyse sédimentologique et minéralogique réalisée sur un cycle hydrologique entre octobre 2004 et août 2005 a permis d'évaluer les charges solides en suspension et de caractériser les sédiments du lac du barrage de Taabo. La concentration moyenne en matières en suspension (12 mg.L-1) et la turbidité ...
Directory of Open Access Journals (Sweden)
Domínguez, R.
2016-06-01
Full Text Available The influence of three salting treatments (treatment II: 50% NaCl-50% KCl; III: 45% NaCl-25% KCl-20% CaCl2-10% MgCl2; IV: 30% NaCl-50% KCl-15% CaCl2-5% MgCl2 on the formation of volatile compounds throughout the process was studied and compared to those of a control “lacón” (treatment I: 100% NaCl. There was an intense formation of volatile compounds throughout the processing, particularly during the dry-ripening stage. The most abundant chemical family in all the formulations, in the final product was hydrocarbons followed by aldehydes. The total volatile compound release was more intense in the control “lacóns” (1164 AU_106·g-1dry matter than in “lacóns” from formulations II, III and IV (817-891 AUx106·g-1dry matter. The “lacóns” from formulation I showed the highest amounts of aldehydes. The “lacóns” from formulations I and II presented the highest amounts of hydrocarbons. The main conclusion is that the replacement of NaCl produces changes in the volatile profile and could be affect the aroma of “lacón”.Se estudió la influencia de tres tratamientos de salado (tratamiento II: 50 % NaCl-50 % KCl; III: 45 % NaCl-25 % KCl-20 % CaCl2-10 % MgCl2; IV: 30 % NaCl-50 % KCl-15 % CaCl2-5 % MgCl2 en la formación de compuestos volátiles durante la elaboración de lacón, en comparación con un control (tratamiento I: 100 % NaCl. Hubo una intensa formación de compuestos volátiles durante el procesado, principalmente durante la fase de secado-maduración. La familia química más abundante en el producto final fueron los hidrocarbonos, seguidos por los aldehídos. La liberación de volátiles fue más intensa en los lacones control (1164 AU_106·g-1 materia seca que en los otros lacones (817-891 AUx106· g-1 materia seca. Los lacones de la formulación I mostraron las mayores cantidades de aldehídos, y los lacones de las formulaciones I y II presentaron los mayores contenidos de hidrocarburos. La principal conclusi
Du Lac de Geneve au Lac Baikal: deux metropoles en construction
Directory of Open Access Journals (Sweden)
Guy Mettan
2006-08-01
Full Text Available En apparence, Geneve et Irkutsk n'ont rien en commun. A part une amitie reciproque et la proximite d'un lac, il est difficile de trouver des points communs entre la Suisse francophone, dont Geneve est la ville le plus importante, et la Siberie centrale, dont Irkutsk, est la capitale. Et pourtant les deux regions, malgre les differences de taille, de densite de la population, de climat, d'economie et de traditions culturelles, sont confrontees au meme probleme: elles sont trop petites et trop limitees pour assurer, avec leurs seuls moyens, leur avenir et elles doivent imperativement s'unir a des villes voisines pour renforcer leur statut de metropole regionale et s'imposer face aux regions et aux pays concurrents.C'est ainsi qu'Irkutsk projette de s'unir aux villes voisines d'Angarsk et de Chelekhov pour constituer une megapole au c?ur de la Siberie, tandis qu'a Geneve le debat fait rage pour trouver des solutions a l'exiguite geographique et a l'insuffisance des moyens face aux grandes regions metropolitaines de France, d'Italie et d'Allemagne.Ce debat est propre a toute la Suisse. Malgre sa petitesse, la Suisse est divisee en 26 cantons. Ces unites administratives sont jugees trop couteuses, trop petites, trop lourdes et trop compliquees pour assurer l'avenir economique et meme politique du pays. De nombreux groupes de reflexion proposent donc de reduire ce nombre a 3, 5 ou 10 grandes provinces selon les cas. En Suisse, romande, il y a dix ans, des mouvements politiques ont meme lance l'idee de fusionner les cantons de Vaud (dont Lausanne est la capitale et de Geneve. Mais l'echec a ete fracassant : le peuple des deux cantons a refuse cette option a 80% des voix. On cherche donc d'autres solutions.Les discussions s'orientent desormais autour de la constitution d'une grande metropole lemanique qui regrouperait les deux grandes villes de Geneve et Lausanne et les villes plus petites de Montreux, Vevey, Nyon ainsi que la ville francaise d
Di Cesare, Andrea; Cabello-Yeves, Pedro J; Chrismas, Nathan A M; Sánchez-Baracaldo, Patricia; Salcher, Michaela M; Callieri, Cristiana
2018-04-16
Many cyanobacteria are capable of fixing atmospheric nitrogen, playing a crucial role in biogeochemical cycling. Little is known about freshwater unicellular cyanobacteria Synechococcus spp. at the genomic level, despite being recognised of considerable ecological importance in aquatic ecosystems. So far, it has not been shown whether these unicellular picocyanobacteria have the potential for nitrogen fixation. Here, we present the draft-genome of the new pink-pigmented Synechococcus-like strain Vulcanococcus limneticus. sp. nov., isolated from the volcanic Lake Albano (Central Italy). The novel species Vulcanococcus limneticus sp. nov. falls inside the sub-cluster 5.2, close to the estuarine/marine strains in a maximum-likelihood phylogenetic tree generated with 259 marker genes with representatives from marine, brackish, euryhaline and freshwater habitats. V.limneticus sp. nov. possesses a complete nitrogenase and nif operon. In an experimental setup under nitrogen limiting and non-limiting conditions, growth was observed in both cases. However, the nitrogenase genes (nifHDK) were not transcribed, i.e., V.limneticus sp. nov. did not fix nitrogen, but instead degraded the phycobilisomes to produce sufficient amounts of ammonia. Moreover, the strain encoded many other pathways to incorporate ammonia, nitrate and sulphate, which are energetically less expensive for the cell than fixing nitrogen. The association of the nif operon to a genomic island, the relatively high amount of mobile genetic elements (52 transposases) and the lower observed GC content of V.limneticus sp. nov. nif operon (60.54%) compared to the average of the strain (68.35%) support the theory that this planktonic strain may have obtained, at some point of its evolution, the nif operon by horizontal gene transfer (HGT) from a filamentous or heterocystous cyanobacterium. In this study, we describe the novel species Vulcanococcus limneticus sp. nov., which possesses a complete nif operon for
International Nuclear Information System (INIS)
Kim, Sang-in; Pfeifer, Gerd P.; Besaratinia, Ahmad
2007-01-01
Sunlight ultraviolet A (UVA) irradiation has been implicated in the etiology of human skin cancer. A genotoxic mode of action for UVA radiation has been suggested that involves photosensitization reactions giving rise to promutagenic DNA lesions. We investigated the mutagenicity of UVA in the lacI transgene in Big Blue mouse embryonic fibroblasts. UVA irradiation of these cells at a physiologically relevant dose of 18 J/cm 2 caused a 2.8-fold increase in the lacI mutant frequency relative to control, i.e., 12.12 ± 1.84 versus 4.39 ± 1.99 x 10 -5 (mean ± S.D.). DNA sequencing analysis showed that of 100 UVA-induced mutant plaques and 54 spontaneously arisen control plaques, 97 and 51, respectively, contained a minimum of one mutation along the lacI transgene. The vast majority of both induced- and spontaneous mutations were single base substitutions, although less frequently, there were also single and multiple base deletions and insertions, and tandem base substitutions. Detailed mutation spectrometry analysis revealed that G:C → T:A transversions, the signature mutations of oxidative DNA damage, were significantly induced by UVA irradiation (P -5 ; P < 0.00001). These findings are in complete agreement with those previously observed in the cII transgene of the same model system, and reaffirm the notion that intracellular photosensitization reactions causing promutagenic oxidative DNA damage are involved in UVA genotoxicity
Ge, Hao; Wu, Pingping; Qian, Hong; Xie, Xiaoliang Sunney
2018-03-01
Within an isogenic population, even in the same extracellular environment, individual cells can exhibit various phenotypic states. The exact role of stochastic gene-state switching regulating the transition among these phenotypic states in a single cell is not fully understood, especially in the presence of positive feedback. Recent high-precision single-cell measurements showed that, at least in bacteria, switching in gene states is slow relative to the typical rates of active transcription and translation. Hence using the lac operon as an archetype, in such a region of operon-state switching, we present a fluctuating-rate model for this classical gene regulation module, incorporating the more realistic operon-state switching mechanism that was recently elucidated. We found that the positive feedback mechanism induces bistability (referred to as deterministic bistability), and that the parameter range for its occurrence is significantly broadened by stochastic operon-state switching. We further show that in the absence of positive feedback, operon-state switching must be extremely slow to trigger bistability by itself. However, in the presence of positive feedback, which stabilizes the induced state, the relatively slow operon-state switching kinetics within the physiological region are sufficient to stabilize the uninduced state, together generating a broadened parameter region of bistability (referred to as stochastic bistability). We illustrate the opposite phenotype-transition rate dependence upon the operon-state switching rates in the two types of bistability, with the aid of a recently proposed rate formula for fluctuating-rate models. The rate formula also predicts a maximal transition rate in the intermediate region of operon-state switching, which is validated by numerical simulations in our model. Overall, our findings suggest a biological function of transcriptional "variations" among genetically identical cells, for the emergence of bistability and
Directory of Open Access Journals (Sweden)
Astha Agarwal
2013-01-01
Full Text Available Background & objectives: All colonizing and invasive staphylococcal isolates may not produce biofilm but may turn biofilm producers in certain situations due to change in environmental factors. This study was done to test the hypothesis that non biofilm producing clinical staphylococci isolates turn biofilm producers in presence of sodium chloride (isotonic and high concentration of glucose, irrespective of presence or absence of ica operon. Methods: Clinical isolates of 100 invasive, 50 colonizing and 50 commensal staphylococci were tested for biofilm production by microtiter plate method in different culture media (trypticase soy broth alone or supplemented with 0.9% NaCl/ 5 or 10% glucose. All isolates were tested for the presence of ica ADBC genes by PCR. Results: Biofilm production significantly increased in the presence of glucose and saline, most, when both glucose and saline were used together. All the ica positive staphylococcal isolates and some ica negative isolates turned biofilm producer in at least one of the tested culture conditions. Those remained biofilm negative in different culture conditions were all ica negative. Interpretation & conclusions: The present results showed that the use of glucose or NaCl or combination of both enhanced biofilm producing capacity of staphylococcal isolates irrespective of presence or absence of ica operon.
Aoto, Kazushi; Sandell, Lisa L; Butler Tjaden, Naomi E; Yuen, Kobe C; Watt, Kristin E Noack; Black, Brian L; Durnin, Michael; Trainor, Paul A
2015-06-01
Neural crest cells (NCC) comprise a multipotent, migratory stem cell and progenitor population that gives rise to numerous cell and tissue types within a developing embryo, including craniofacial bone and cartilage, neurons and glia of the peripheral nervous system, and melanocytes within the skin. Here we describe two novel stable transgenic mouse lines suitable for lineage tracing and analysis of gene function in NCC. Firstly, using the F10N enhancer of the Mef2c gene (Mef2c-F10N) linked to LacZ, we generated transgenic mice (Mef2c-F10N-LacZ) that express LacZ in the majority, if not all migrating NCC that delaminate from the neural tube. Mef2c-F10N-LacZ then continues to be expressed primarily in neurogenic, gliogenic and melanocytic NCC and their derivatives, but not in ectomesenchymal derivatives. Secondly, we used the same Mef2c-F10N enhancer together with Cre recombinase to generate transgenic mice (Mef2c-F10N-Cre) that can be used to indelibly label, or alter gene function in, migrating NCC and their derivatives. At early stages of development, Mef2c-F10N-LacZ and Mef2c-F10N-Cre label NCC in a pattern similar to Wnt1-Cre mice, with the exception that Mef2c-F10N-LacZ and Mef2c-F10N-Cre specifically label NCC that have delaminated from the neural plate, while premigratory NCC are not labeled. Thus, our Mef2c-F10N-LacZ and Mef2c-F10N-Cre transgenic mice provide new resources for tracing migratory NCC and analyzing gene function in migrating and differentiating NCC independently of NCC formation. Copyright © 2015 Elsevier Inc. All rights reserved.
Lescat, Mathilde; Reibel, Florence; Pintard, Coralie; Dion, Sara; Glodt, Jérémy; Gateau, Cecile; Launay, Adrien; Ledda, Alice; Cruveiller, Stephane; Cruvellier, Stephane; Tourret, Jérôme; Tenaillon, Olivier
2014-01-01
The Escherichia coli species is divided in phylogenetic groups that differ in their virulence and commensal distribution. Strains belonging to the B2 group are involved in extra-intestinal pathologies but also appear to be more prevalent as commensals among human occidental populations. To investigate the genetic specificities of B2 sub-group, we used 128 sequenced genomes and identified genes of the core genome that showed marked difference between B2 and non-B2 genomes. We focused on the gene and its surrounding region with the strongest divergence between B2 and non-B2, the antiporter gene nhaA. This gene is part of the nhaAR operon, which is in the core genome but flanked by mobile regions, and is involved in growth at high pH and high sodium concentrations. Consistently, we found that a panel of non-B2 strains grew faster than B2 at high pH and high sodium concentrations. However, we could not identify differences in expression of the nhaAR operon using fluorescence reporter plasmids. Furthermore, the operon deletion had no differential impact between B2 and non-B2 strains, and did not result in a fitness modification in a murine model of gut colonization. Nevertheless, sequence analysis and experiments in a murine model of septicemia revealed that recombination in nhaA among B2 strains was observed in strains with low virulence. Finally, nhaA and nhaAR operon deletions drastically decreased virulence in one B2 strain. This effect of nhaAR deletion appeared to be stronger than deletion of all pathogenicity islands. Thus, a population genetic approach allowed us to identify an operon in the core genome without strong effect in commensalism but with an important role in extra-intestinal virulence, a landmark of the B2 strains.
Development of a Positive-readout Mouse Model of siRNA Pharmacodynamics
Directory of Open Access Journals (Sweden)
Mark Stevenson
2013-01-01
Full Text Available Development of RNAi-based therapeutics has the potential to revolutionize treatment options for a range of human diseases. However, as with gene therapy, a major barrier to progress is the lack of methods to achieve and measure efficient delivery for systemic administration. We have developed a positive-readout pharmacodynamic transgenic reporter mouse model allowing noninvasive real-time assessment of siRNA activity. The model combines a luciferase reporter gene under the control of regulatory elements from the lac operon of Escherichia coli. Introduction of siRNA targeting lac repressor results in increased luciferase expression in cells where siRNA is biologically active. Five founder luciferase-expressing and three founder Lac-expressing lines were generated and characterized. Mating of ubiquitously expressing luciferase and lac lines generated progeny in which luciferase expression was significantly reduced compared with the parental line. Administration of isopropyl β-D-1-thiogalactopyranoside either in drinking water or given intraperitoneally increased luciferase expression in eight of the mice examined, which fell rapidly when withdrawn. Intraperitoneal administration of siRNA targeting lac in combination with Lipofectamine 2000 resulted in increased luciferase expression in the liver while control nontargeting siRNA had no effect. We believe a sensitive positive readout pharmacodynamics reporter model will be of use to the research community in RNAi-based vector development.
Eisenhut, Marion; Georg, Jens; Klähn, Stephan; Sakurai, Isamu; Mustila, Henna; Zhang, Pengpeng; Hess, Wolfgang R; Aro, Eva-Mari
2012-09-28
The functional relevance of natural cis-antisense transcripts is mostly unknown. Here we have characterized the association of three antisense RNAs and one intergenically encoded noncoding RNA with an operon that plays a crucial role in photoprotection of photosystem II under low carbon conditions in the cyanobacterium Synechocystis sp. PCC 6803. Cyanobacteria show strong gene expression dynamics in response to a shift of cells from high carbon to low levels of inorganic carbon (C(i)), but the regulatory mechanisms are poorly understood. Among the most up-regulated genes in Synechocystis are flv4, sll0218, and flv2, which are organized in the flv4-2 operon. The flavodiiron proteins encoded by this operon open up an alternative electron transfer route, likely starting from the Q(B) site in photosystem II, under photooxidative stress conditions. Our expression analysis of cells shifted from high carbon to low carbon demonstrated an inversely correlated transcript accumulation of the flv4-2 operon mRNA and one antisense RNA to flv4, designated as As1_flv4. Overexpression of As1_flv4 led to a decrease in flv4-2 mRNA. The promoter activity of as1_flv4 was transiently stimulated by C(i) limitation and negatively regulated by the AbrB-like transcription regulator Sll0822, whereas the flv4-2 operon was positively regulated by the transcription factor NdhR. The results indicate that the tightly regulated antisense RNA As1_flv4 establishes a transient threshold for flv4-2 expression in the early phase after a change in C(i) conditions. Thus, it prevents unfavorable synthesis of the proteins from the flv4-2 operon.
Eisenhut, Marion; Georg, Jens; Klähn, Stephan; Sakurai, Isamu; Mustila, Henna; Zhang, Pengpeng; Hess, Wolfgang R.; Aro, Eva-Mari
2012-01-01
The functional relevance of natural cis-antisense transcripts is mostly unknown. Here we have characterized the association of three antisense RNAs and one intergenically encoded noncoding RNA with an operon that plays a crucial role in photoprotection of photosystem II under low carbon conditions in the cyanobacterium Synechocystis sp. PCC 6803. Cyanobacteria show strong gene expression dynamics in response to a shift of cells from high carbon to low levels of inorganic carbon (Ci), but the regulatory mechanisms are poorly understood. Among the most up-regulated genes in Synechocystis are flv4, sll0218, and flv2, which are organized in the flv4-2 operon. The flavodiiron proteins encoded by this operon open up an alternative electron transfer route, likely starting from the QB site in photosystem II, under photooxidative stress conditions. Our expression analysis of cells shifted from high carbon to low carbon demonstrated an inversely correlated transcript accumulation of the flv4-2 operon mRNA and one antisense RNA to flv4, designated as As1_flv4. Overexpression of As1_flv4 led to a decrease in flv4-2 mRNA. The promoter activity of as1_flv4 was transiently stimulated by Ci limitation and negatively regulated by the AbrB-like transcription regulator Sll0822, whereas the flv4-2 operon was positively regulated by the transcription factor NdhR. The results indicate that the tightly regulated antisense RNA As1_flv4 establishes a transient threshold for flv4-2 expression in the early phase after a change in Ci conditions. Thus, it prevents unfavorable synthesis of the proteins from the flv4-2 operon. PMID:22854963
National Oceanic and Atmospheric Administration, Department of Commerce — The National Lacustrine Core Repository (LacCore), operated by the University of Minnesota is a partner in the Index to Marine and Lacustrine Geological Samples...
Pathway discovery in metabolic networks by subgraph extraction.
Faust, Karoline; Dupont, Pierre; Callut, Jérôme; van Helden, Jacques
2010-05-01
Subgraph extraction is a powerful technique to predict pathways from biological networks and a set of query items (e.g. genes, proteins, compounds, etc.). It can be applied to a variety of different data types, such as gene expression, protein levels, operons or phylogenetic profiles. In this article, we investigate different approaches to extract relevant pathways from metabolic networks. Although these approaches have been adapted to metabolic networks, they are generic enough to be adjusted to other biological networks as well. We comparatively evaluated seven sub-network extraction approaches on 71 known metabolic pathways from Saccharomyces cerevisiae and a metabolic network obtained from MetaCyc. The best performing approach is a novel hybrid strategy, which combines a random walk-based reduction of the graph with a shortest paths-based algorithm, and which recovers the reference pathways with an accuracy of approximately 77%. Most of the presented algorithms are available as part of the network analysis tool set (NeAT). The kWalks method is released under the GPL3 license.
Hunt, Debbie M; Sweeney, Nathan P; Mori, Luisa; Whalan, Rachael H; Comas, Iñaki; Norman, Laura; Cortes, Teresa; Arnvig, Kristine B; Davis, Elaine O; Stapleton, Melanie R; Green, Jeffrey; Buxton, Roger S
2012-05-01
The ESX-1 secretion system of Mycobacterium tuberculosis has to be precisely regulated since the secreted proteins, although required for a successful virulent infection, are highly antigenic and their continued secretion would alert the immune system to the infection. The transcription of a five-gene operon containing espACD-Rv3613c-Rv3612c, which is required for ESX-1 secretion and is essential for virulence, was shown to be positively regulated by the EspR transcription factor. Thus, transcription from the start site, found to be located 67 bp upstream of espA, was dependent upon EspR enhancer-like sequences far upstream (between 884 and 1,004 bp), which we term the espA activating region (EAR). The EAR contains one of the known binding sites for EspR, providing the first in vivo evidence that transcriptional activation at the espA promoter occurs by EspR binding to the EAR and looping out DNA between this site and the promoter. Regulation of transcription of this operon thus takes place over long regions of the chromosome. This regulation may differ in some members of the M. tuberculosis complex, including Mycobacterium bovis, since deletions of the intergenic region have removed the upstream sequence containing the EAR, resulting in lowered espA expression. Consequent differences in expression of ESX-1 in these bacteria may contribute to their various pathologies and host ranges. The virulence-critical nature of this operon means that transcription factors controlling its expression are possible drug targets.
Mechler, Lukas; Bonetti, Eve-Julie; Reichert, Sebastian; Flötenmeyer, Matthias; Schrenzel, Jacques; Bertram, Ralph; François, Patrice; Götz, Friedrich
2016-05-01
Understanding the mechanisms of how bacteria become tolerant toward antibiotics during clinical therapy is a very important object. In a previous study, we showed that increased daptomycin (DAP) tolerance of Staphylococcus aureus was due to a point mutation in pitA (inorganic phosphate transporter) that led to intracellular accumulation of both inorganic phosphate (Pi) and polyphosphate (polyP). DAP tolerance in the pitA6 mutant differs from classical resistance mechanisms since there is no increase in the MIC. In this follow-up study, we demonstrate that DAP tolerance in the pitA6 mutant is not triggered by the accumulation of polyP. Transcriptome analysis revealed that 234 genes were at least 2.0-fold differentially expressed in the mutant. Particularly, genes involved in protein biosynthesis, carbohydrate and lipid metabolism, and replication and maintenance of DNA were downregulated. However, the most important change was the upregulation of the dlt operon, which is induced by the accumulation of intracellular Pi The GraXRS system, known as an activator of the dlt operon (d-alanylation of teichoic acids) and of the mprF gene (multiple peptide resistance factor), is not involved in DAP tolerance of the pitA6 mutant. In conclusion, DAP tolerance of the pitA6 mutant is due to an upregulation of the dlt operon, triggered directly or indirectly by the accumulation of Pi. Copyright © 2016, American Society for Microbiology. All Rights Reserved.
Fluit, A.C.; Jansen, M.D.; Bosch, T.; Jansen, W.T.M.; Schouls, L.; Jonker, M.J.; Boel, C.H.E.
2016-01-01
The distinct epidemiology of original hospital-associated methicillin-resistant Staphylococcus aureus (HA-MRSA) and early community-associated MRSA (CA-MRSA) is largely unexplained. S. aureus carries either five or six rRNA operon copies. Evidence is provided for a scenario in which MRSA has adapted
Jones, Perry M.; Tomasek, Abigail A.
2015-01-01
The U.S. Geological Survey, in cooperation with the Fond du Lac Band of Lake Superior Chippewa, assessed hydraulic properties of geologic material, recharge, and evapotranspiration, and the effects of ditching on the groundwater resources in the Stoney Brook watershed in the Fond du Lac Reservation. Geologic, groundwater, and surface-water data were collected during 2006–9 to estimate hydrologic properties in the watershed. Streamflow and groundwater levels in the shallow glacial deposits in the Stoney Brook watershed were analyzed to estimate groundwater-flow directions, groundwater recharge, and evapotranspiration within the watershed and to assess the effect of ditches on surrounding groundwater resources. Groundwater, streamflow, and precipitation data collected during the study (2006–9) can be used to update the U.S. Department of Agriculture’s Natural Resource Conservation Service and Fond du Lac Resource Management Division surface-water models, which are used to evaluate the effect of proposed adjustments to the ditching system on streamflow on wild rice production and aquatic habitats.
DEFF Research Database (Denmark)
Nicoloff, Hervé; Elagöz, Aram; Arsène-Ploetze, Florence
2005-01-01
Carbamoyl phosphate is a precursor for both arginine and pyrimidine biosynthesis. In Lactobacillus plantarum, carbamoyl phosphate is synthesized from glutamine, ATP, and carbon dioxide by two sets of identified genes encoding carbamoyl phosphate synthase (CPS). The expression of the carAB operon...... to the pyr mRNA attenuation site in response to intracellular UMP/phosphoribosyl pyrophosphate pools. Intracellular pyrimidine triphosphate nucleoside pools were lower in mutant FB335 (carAB deletion) harboring only CPS-P than in the wild-type strain harboring both CPS-A and CPS-P. Thus, CPS-P activity...... compared to wild-type levels. Low pyrimidine-independent expression of the pyr operon was obtained by antiterminator site-directed mutagenesis. The resulting AE1023 strain had reduced UTP and CTP pools and had the phenotype of a high-CO2-requiring auxotroph, since it was able to synthesize sufficient...
The NuSTAR view on Hard-TeV BL Lacs
Costamante, L.; Bonnoli, G.; Tavecchio, F.; Ghisellini, G.; Tagliaferri, G.; Khangulyan, D.
2018-05-01
Hard-TeV BL Lacs are a new type of blazars characterized by a hard intrinsic TeV spectrum, locating the peak of their gamma-ray emission in the spectral energy distribution (SED) above 2-10 TeV. Such high energies are problematic for the Compton emission, using a standard one-zone leptonic model. We study six examples of this new type of BL Lacs in the hard X-ray band with NuSTAR. Together with simultaneous observations with the Neil Gehrels Swift Observatory, we fully constrain the peak of the synchrotron emission in their SED, and test the leptonic synchrotron self-Compton (SSC) model. We confirm the extreme nature of 5 objects also in the synchrotron emission. We do not find evidence of additional emission components in the hard X-ray band. We find that a one-zone SSC model can in principle reproduce the extreme properties of both peaks in the SED, from X-ray up to TeV energies, but at the cost of i) extreme electron energies with very low radiative efficiency, ii) conditions heavily out of equipartition (by 3 to 5 orders of magnitude), and iii) not accounting for the simultaneous UV data, which then should belong to a different emission component, possibly the same as the far-IR (WISE) data. We find evidence of this separation of the UV and X-ray emission in at least two objects. In any case, the TeV electrons must not "see" the UV or lower-energy photons, even if coming from different zones/populations, or the increased radiative cooling would steepen the VHE spectrum.
Ansaldi, Mireille; Simon, Gwénola; Lepelletier, Michèle; Méjean, Vincent
2000-01-01
In the presence of trimethylamine N-oxide (TMAO), the TorS-TorR two-component regulatory system induces the torCAD operon, which encodes the TMAO respiratory system of Escherichia coli. The sensor protein TorS detects TMAO and transphosphorylates the response regulator TorR which, in turn, activates transcription of torCAD. The torR gene and the torCAD operon are divergently transcribed, and the short torR-torC intergenic region contains four direct repeats (the tor boxes) which proved to be ...
Horizontal transfers of two types of puf operons among phototrophic members of the Roseobacter clade
Czech Academy of Sciences Publication Activity Database
Koblížek, Michal; Moulisová, Vladimíra; Muroňová, Markéta; Oborník, Miroslav
2015-01-01
Roč. 60, č. 1 (2015), s. 37-43 ISSN 0015-5632 R&D Projects: GA MŠk ED2.1.00/03.0110; GA ČR GAP501/10/0221; GA ČR GBP501/12/G055 Institutional support: RVO:61388971 Keywords : Rosebacter * horizontal transfer * puf operon s Subject RIV: EE - Microbiology, Virology Impact factor: 1.335, year: 2015
Purification and crystallization of Phd, the antitoxin of the phd/doc operon
International Nuclear Information System (INIS)
Garcia-Pino, Abel; Sterckx, Yann; Vandenbussche, Guy; Loris, Remy
2010-01-01
The antitoxin Phd from the phd/doc operon of bacteriophage P1 was crystallized in two distinct crystal forms. The antitoxin Phd from the phd/doc module of bacteriophage P1 was crystallized in two distinct crystal forms. Crystals of His-tagged Phd contain a C-terminally truncated version of the protein and diffract to 2.20 Å resolution. Crystals of untagged Phd purified from the Phd–Doc complex diffract to 2.25 Å resolution. These crystals are partially merohedrally twinned and contain the full-length version of the protein
fbpABC gene cluster in Neisseria meningitidis is transcribed as an operon.
Khun, H H; Deved, V; Wong, H; Lee, B C
2000-12-01
The neisserial fbpABC locus has been proposed to constitute a single transcriptional unit. To confirm this operonic arrangement, transcription assays using reverse transcriptase PCR amplification were conducted with Neisseria meningitidis. The presence of fbpAB and fbpBC transcripts obtained by priming cDNA synthesis with an fbpC-sequence-specific oligonucleotide indicates that fbpABC is organized as a single expression unit. The ratio of fbpA to fbpABC mRNA was approximately between 10- to 20-fold, as determined by real-time quantitative PCR.
Attenuation in the rph-pyrE operon of Escherichia coli and processing of the dicistronic mRNA
DEFF Research Database (Denmark)
Poulsen, Peter; Jensen, Kaj Frank
1992-01-01
We have substituted on a plasmid the native promoter of the Escherichia coli rph-pyrE operon with an inducible transcription-initiation signal. The plasmid was used to study the mRNA chains derived from the operon at different intracellular concentrations of UTP and as a function of time following...... induction of transcription. The results showed that dicistronic rph-pyrE mRNA was formed when the UTP pool was low, and that a monocistronic rph mRNA was the major transcription product in high-UTP pools, thus supporting an UTP-controlled attenuation mechanism for regulation of pyrE gene expression. However......, the dicistronic rph-pyrE transcript was rapidly processed into two monocistronic mRNA units, and a cleavage site was mapped near the attenuator in the intercistronic region, close to the site where transcription was terminated in high-UTP pools. Furthermore, the major 3' end of the pyrE mRNA was mapped near...
International Nuclear Information System (INIS)
Kondo, Y.; Worrall, D.M.; Mushotzky, R.F.; Hackney, R.L.; Hackney, K.R.H.; Oke, J.B.; Yee, H.K.C.; Neugebauer, G.; Matthews, K.; Feldman, P.A.; Brown, R.L.
1981-01-01
Quasi-simultaneous observations of the BL Lac object Mrk 501 were performed for the first time at X-ray, ultraviolet, visible infrared, and radio frequencies. As the BL Lac objects are known to vary in their flux, such a ''quasi-instantaneous'' spectral energy profile is necessary in order to describe properly the energy generation mechanism. The observed spectral slope from the X-ray to UV regions is positive and continuous, but that from the mid-UV to visible light region becomes gradually flat and possibly turns down toward lower frequencies; the optical-radio emission cannot be accounted for by a single power law. Several theoretical models have been considered for the emission mechanism. In some cases quantitative comparison with the data is not practical. However, most of the models are, at least, not inconsistent with the observations. A quantitative comparison has been peformed with the synchroton self-Compton model; the total spectrum is found consistent with this model. The spectrum from visible light to X-ray is consistent with synchrotron radiation or with inverse-Compton scattering by a hot thermal cloud of electrons. The continuity of the spectral slope from X-ray to UV implied by the current data suggests that the previous estimates of the total luminosity of this BL Lac object has been underestimated by a factor of about 3 or 4
Données préliminaires sur la diversité du zooplancton du lac Nokoué
African Journals Online (AJOL)
SARAH
31 juil. 2017 ... contribuera davantage à la compréhension de la dynamique de cette communauté biologique du lac. Mots clés ... dans une perspective de gestion durable de la .... ramenés au Laboratoire de Contrôle de Qualité des Eaux.
Directory of Open Access Journals (Sweden)
Mariana Noelia Viale
2014-01-01
Full Text Available The lprG-p55 operon of Mycobacterium tuberculosis and Mycobacterium bovis is involved in the transport of toxic compounds. P55 is an efflux pump that provides resistance to several drugs, while LprG is a lipoprotein that modulates the host's immune response against mycobacteria. The knockout mutation of this operon severely reduces the replication of both mycobacterial species during infection in mice and increases susceptibility to toxic compounds. In order to gain insight into the function of LprG in the Mycobacterium avium complex, in this study, we assayed the effect of the deletion of lprG gene in the D4ER strain of Mycobacterium avium subsp. avium. The replacement of lprG gene with a hygromycin cassette caused a polar effect on the expression of p55. Also, a twofold decrease in ethidium bromide susceptibility was observed and the resistance to the antibiotics rifampicin, amikacin, linezolid, and rifabutin was impaired in the mutant strain. In addition, the mutation decreased the virulence of the bacteria in macrophages in vitro and in a mice model in vivo. These findings clearly indicate that functional LprG and P55 are necessary for the correct transport of toxic compounds and for the survival of MAA in vitro and in vivo.
Downstream element determines RNase Y cleavage of the saePQRS operon in Staphylococcus aureus.
Marincola, Gabriella; Wolz, Christiane
2017-06-02
In gram-positive bacteria, RNase J1, RNase J2 and RNase Y are thought to be major contributors to mRNA degradation and maturation. In Staphylococcus aureus, RNase Y activity is restricted to regulating the mRNA decay of only certain transcripts. Here the saePQRS operon was used as a model to analyze RNase Y specificity in living cells. A RNase Y cleavage site is located in an intergenic region between saeP and saeQ. This cleavage resulted in rapid degradation of the upstream fragment and stabilization of the downstream fragment. Thereby, the expression ratio of the different components of the operon was shifted towards saeRS, emphasizing the regulatory role of RNase Y activity. To assess cleavage specificity different regions surrounding the sae CS were cloned upstream of truncated gfp, and processing was analyzed in vivo using probes up- and downstream of CS. RNase Y cleavage was not determined by the cleavage site sequence. Instead a 24-bp double-stranded recognition structure was identified that was required to initiate cleavage 6 nt upstream. The results indicate that RNase Y activity is determined by secondary structure recognition determinants, which guide cleavage from a distance. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.
Conjugative Plasmid Transfer in Xylella fastidiosa Is Dependent on tra and trb Operon Functions
Burbank, Lindsey P.; Van Horn, Christopher R.
2017-01-01
The insect-transmitted plant pathogen Xylella fastidiosa is capable of efficient horizontal gene transfer (HGT) and recombination. Natural transformation occurs at high rates in X. fastidiosa, but there also is evidence that certain strains of X. fastidiosa carry native plasmids equipped with transfer and mobilization genes, suggesting conjugation as an additional mechanism of HGT in some instances. Two operons, tra and trb, putatively encoding a conjugative type IV secretion system, are foun...
Qin, Tian; Ken-Ichiro, Iida; Ren, Hong Yu; Zhou, Hai Jian; Yoshida, Shin-Ichi
2016-06-01
To understand the mechanism of invasion by Legionella dumoffii. The L. dumoffii strain Tex-KL was mutated using the Tn903 derivative, Tn903dIIlacZ. After screening 799 transposon insertion mutants, we isolated one defective mutant. We then constructed the gene-disrupted mutant, KL16, and studied its invasion of and intracellular growth in HeLa and A549 cells, and in A/J mice survival experiments. The structure of traC-traD operon was analyzed by RT-PCR. The transposon insertion was in a gene homologous to Salmonella typhi traC, which is required for the assembly of F pilin into the mature F pilus structure and for conjugal DNA transmission. Results from RT-PCR suggested that the traC-traD region formed an operon. We found that when the traC gene was disrupted, invasion and intracellular growth of L. dumoffii Tex-KL were impaired in human epithelial cells. When mice were infected by intranasal inoculation with a traC deficient mutant, their survival significantly increased when compared to mice infected with the wild-type strain.. Our results indicated that the traC-traD operon is required for the invasion and intracellular growth abilities of L. dumoffii Tex-KL in epithelial cells. Copyright © 2016 The Editorial Board of Biomedical and Environmental Sciences. Published by China CDC. All rights reserved.
Reproducible gene targeting in recalcitrant Escherichia coli isolates
Directory of Open Access Journals (Sweden)
De Greve Henri
2011-06-01
Full Text Available Abstract Background A number of allele replacement methods can be used to mutate bacterial genes. For instance, the Red recombinase system of phage Lambda has been used very efficiently to inactivate chromosomal genes in E. coli K-12, through recombination between regions of homology. However, this method does not work reproducibly in some clinical E. coli isolates. Findings The procedure was modified by using longer homologous regions (85 bp and 500-600 bp, to inactivate genes in the uropathogenic E. coli strain UTI89. An lrhA regulator mutant, and deletions of the lac operon as well as the complete type 1 fimbrial gene cluster, were obtained reproducibly. The modified method is also functional in other recalcitrant E. coli, like the avian pathogenic E. coli strain APEC1. The lrhA regulator and lac operon deletion mutants of APEC1 were successfully constructed in the same way as the UTI89 mutants. In other avian pathogenic E. coli strains (APEC3E, APEC11A and APEC16A it was very difficult or impossible to construct these mutants, with the original Red recombinase-based method, with a Red recombinase-based method using longer (85 bp homologous regions or with our modified protocol, using 500 - 600 bp homologous regions. Conclusions The method using 500-600 bp homologous regions can be used reliably in some clinical isolates, to delete single genes or entire operons by homologous recombination. However, it does not invariably show a greater efficiency in obtaining mutants, when compared to the original Red-mediated gene targeting method or to the gene targeting method with 85 bp homologous regions. Therefore the length of the homology regions is not the only limiting factor for the construction of mutants in these recalcitrant strains.
Effet des conditions climatiques sur le niveau du lac Sidi Ali (Moyen Atlas, Maroc
Directory of Open Access Journals (Sweden)
Claude Martin
2011-11-01
Full Text Available Le lac Sidi Ali est un lac naturel d'altitude (2070-2080 m, sans exutoire superficiel, déterminé par le barrage d'une coulée basaltique. Doté d'un bassin versant apparent de 15,6 km2, il est alimenté par des eaux de ruissellement et par des sources karstiques. Son niveau subit des variations très fortes, annuelles et interannuelles, sous le contrôle des conditions climatiques, et en particulier des pluies et de l'évapotranspiration. Les périodes de sécheresse qui ont marqué les trois dernières décennies, se sont traduites par un abaissement du niveau de près de 7 m. Mais les précipitations abondantes des années 2008-09 et 2009-10 ont provoqué une nette remontée. Une régression multiple d'assez bonne qualité (r = 0,87 lie la variation annuelle du niveau (d'août à août à différents paramètres (conditions climatiques et niveau initial du lac.Lake Sidi Ali is a natural lake at high altitude (2070-2080 m, without surface outlet, determined by the dam of a basalt flow. With an apparent catchment of 15.6 km2, it is fed by runoff and karst springs. Its level shows strong annual and interannual variations, depending on weather conditions, particularly rainfall and evapotranspiration. Droughts that have marked the last three decades have resulted in a lowering of about 7 m of the water level. But heavy rainfall that occurred in 2008-09 and 2009-10 caused a marked rise. A multiple regression of sufficient quality (r = 0.87 binds the annual change (from august to august at differents parameters (weather conditions and initial level of the lake.
Induction of specific Escherichia coli genes by sublethal treatments with alkylating agents.
Volkert, M R; Nguyen, D C
1984-01-01
Fusions of the lac operon to genes induced by treatment with sublethal levels of alkylating agents have been selected from random insertions of the Mu-dl(ApRlac) phage by screening for induction of beta-galactosidase activity in the presence of methyl methanesulfonate. Genetic analysis reveals that these fusions resulted from insertion of Mu-dl(ApRlac) into two regions of the chromosome. One region (aidA) is near his and, based on phenotypic effects, appears to represent insertion into the al...
Genome engineering using a synthetic gene circuit in Bacillus subtilis.
Jeong, Da-Eun; Park, Seung-Hwan; Pan, Jae-Gu; Kim, Eui-Joong; Choi, Soo-Keun
2015-03-31
Genome engineering without leaving foreign DNA behind requires an efficient counter-selectable marker system. Here, we developed a genome engineering method in Bacillus subtilis using a synthetic gene circuit as a counter-selectable marker system. The system contained two repressible promoters (B. subtilis xylA (Pxyl) and spac (Pspac)) and two repressor genes (lacI and xylR). Pxyl-lacI was integrated into the B. subtilis genome with a target gene containing a desired mutation. The xylR and Pspac-chloramphenicol resistant genes (cat) were located on a helper plasmid. In the presence of xylose, repression of XylR by xylose induced LacI expression, the LacIs repressed the Pspac promoter and the cells become chloramphenicol sensitive. Thus, to survive in the presence of chloramphenicol, the cell must delete Pxyl-lacI by recombination between the wild-type and mutated target genes. The recombination leads to mutation of the target gene. The remaining helper plasmid was removed easily under the chloramphenicol absent condition. In this study, we showed base insertion, deletion and point mutation of the B. subtilis genome without leaving any foreign DNA behind. Additionally, we successfully deleted a 2-kb gene (amyE) and a 38-kb operon (ppsABCDE). This method will be useful to construct designer Bacillus strains for various industrial applications. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.
UV spectrum of the BL Lac object PKS 0521-36
Energy Technology Data Exchange (ETDEWEB)
Danziger, I.J. (European Southern Observatory, Garching (Germany, F.R.)); Bergeron, J. (Centre National de la Recherche Scientifique, 75 - Paris (France). Inst. d' Astrophysique); Fosbury, R.A.E. (Royal Greenwich Observatory, Hailsham (UK)); Maraschi, L.; Treves, A. (Consiglio Nazionale delle Ricerche, Milan (Italy). Lab. di Fisica Cosmica; Milan Univ. (Italy). Ist. di Fisica); Tanzi, E.G. (Consiglio Nazionale delle Ricerche, Milan (Italy). Lab. di Fisica Cosmica)
1983-05-01
Ultraviolet observations (1200 to 3000 A) with the IUE satellite of the BL Lac object PKS 0521-36 are presented. The only emission line which appears clearly in the spectrum is Ly..cap alpha.., which is asymmetric with a component displaced approx. 3000 km s/sup -1/ to the red. The intensity of the line and the upper limits on other lines are compared with the model calculations on QSOs and Seyfert nuclei by Kwan and Krolik. The continuous energy distribution is discussed, combining non-simultaneous observations from the ultraviolet to the infrared. The spectral range of the non-thermal source from far IR to far UV can be described by a single power law of index -1.5.
Shaar, R.; Tauxe, L.; Agnon, A.; Ben-Yosef, E.; Hassul, E.
2015-12-01
The rich archaeological heritage of Israel and nearby Levantine countries provides a unique opportunity for archaeomagnetic investigation in high resolution. Here we present a summary of our ongoing effort to reconstruct geomagnetic variations of the past several millennia in the Levant at decadal to millennial resolution. This effort at the Southern Levant, namely the "Levantine Archaeomagnetic Compilation" (LAC), presently consists of data from over 650 well-dated archaeological objects including pottery, slag, ovens, and furnaces. In this talk we review the methodological challenges in achieving a robust master secular variation curve with realistic error estimations from a large number of different datasets. We present the current status of the compilation, including the southern and western Levant LAC data (Israel, Cyprus, and Jordan) and other published north-eastern Levant data (Syria and southern Turkey), and outline the main findings emerging from these data. The main feature apparent from the new compilation is an extraordinary intensity high that developed over the Levant region during the first two millennia BCE. The climax of this event is a double peak intensity maximum starting at ca. 1000 BCE and ending at ca. 735 BCE, accompanied with at least two events of geomagnetic spikes. Paleomagnetic directions from this period demonstrate anomalies of up to 20 degrees far from the averaged GAD field. This leads us to postulate that the maximum in the intensity is a manifestation of an intense mid-latitude local positive geomagnetic anomaly that persisted for over two centuries.
International Nuclear Information System (INIS)
Sukharev, A.L.
2015-01-01
This work presents the results of the analysis of long-term monitoring (over 40 years) changes in radio fluxes of the two extragalactic sources - 3C 446, and BL Lac. Observations at frequencies of 14.5, 8, 4.8 GHz were obtained in the Michigan Radio Astronomy Observatory (UMRAO). With using Fourier filtering were selected 0- C (short-period), and the trend component of flux variations that were analyzed separately with using the wavelet-analysis method. Each of these components is associated with certain physical processes in the 'core-accretion disk-jet' system. Were constructed time-frequency wavelet-spectra showing the changes of the frequency composition of the investigated data over time. For the trend component values of the main periods of -4-9 years (3C 446) and -8 years (BL Lac), for 0- C component -0.8-3 years (3C 446) and -0.6-4 years (BL Lac) and they appear in the temporal and structural changes of the jet. On the basis of calculating the global wavelet-spectra in the frequency range identified main phases activity of radio sources. Obtained comparison between the dynamics of jets (Mojave VLBI images), and change the frequency spectral structure of the studied data. With bandpass wavelet filtering, flux components corresponding to the main periods in the spectra, were identified and also found the delay between the observation frequencies in spectral bands of these periods
The dev Operon Regulates the Timing of Sporulation during Myxococcus xanthus Development.
Rajagopalan, Ramya; Kroos, Lee
2017-05-15
Myxococcus xanthus undergoes multicellular development when starved. Thousands of rod-shaped cells coordinate their movements and aggregate into mounds in which cells differentiate into spores. Mutations in the dev operon impair development. The dev operon encompasses a clustered regularly interspaced short palindromic repeat-associated (CRISPR-Cas) system. Null mutations in devI , a small gene at the beginning of the dev operon, suppress the developmental defects caused by null mutations in the downstream devR and devS genes but failed to suppress defects caused by a small in-frame deletion in devT We provide evidence that the original mutant has a second-site mutation. We show that devT null mutants exhibit developmental defects indistinguishable from devR and devS null mutants, and a null mutation in devI suppresses the defects of a devT null mutation. The similarity of DevTRS proteins to components of the CRISPR-associated complex for antiviral defense (Cascade), together with our molecular characterization of dev mutants, support a model in which DevTRS form a Cascade-like subcomplex that negatively autoregulates dev transcript accumulation and prevents DevI overproduction that would strongly inhibit sporulation. Our results also suggest that DevI transiently inhibits sporulation when regulated normally. The mechanism of transient inhibition may involve MrpC, a key transcription factor, whose translation appears to be weakly inhibited by DevI. Finally, our characterization of a devI devS mutant indicates that very little exo transcript is required for sporulation, which is surprising since Exo proteins help form the polysaccharide spore coat. IMPORTANCE CRISPR-Cas systems typically function as adaptive immune systems in bacteria. The dev CRISPR-Cas system of M. xanthus has been proposed to prevent bacteriophage infection during development, but how dev controls sporulation has been elusive. Recent evidence supported a model in which DevR and DevS prevent
Singh, Kamna; Senadheera, Dilani B.; Lévesque, Céline M.
2015-01-01
ABSTRACT In bacteria, copper homeostasis is closely monitored to ensure proper cellular functions while avoiding cell damage. Most Gram-positive bacteria utilize the copYABZ operon for copper homeostasis, where copA and copB encode copper-transporting P-type ATPases, whereas copY and copZ regulate the expression of the cop operon. Streptococcus mutans is a biofilm-forming oral pathogen that harbors a putative copper-transporting copYAZ operon. Here, we characterized the role of copYAZ operon in the physiology of S. mutans and delineated the mechanisms of copper-induced toxicity in this bacterium. We observed that copper induced toxicity in S. mutans cells by generating oxidative stress and disrupting their membrane potential. Deletion of the copYAZ operon in S. mutans strain UA159 resulted in reduced cell viability under copper, acid, and oxidative stress relative to the viability of the wild type under these conditions. Furthermore, the ability of S. mutans to form biofilms and develop genetic competence was impaired under copper stress. Briefly, copper stress significantly reduced cell adherence and total biofilm biomass, concomitantly repressing the transcription of the gtfB, gtfC, gtfD, gbpB, and gbpC genes, whose products have roles in maintaining the structural and/or functional integrity of the S. mutans biofilm. Furthermore, supplementation with copper or loss of copYAZ resulted in significant reductions in transformability and in the transcription of competence-associated genes. Copper transport assays revealed that the ΔcopYAZ strain accrued significantly large amounts of intracellular copper compared with the amount of copper accumulation in the wild-type strain, thereby demonstrating a role for CopYAZ in the copper efflux of S. mutans. The complementation of the CopYAZ system restored copper expulsion, membrane potential, and stress tolerance in the copYAZ-null mutant. Taking these results collectively, we have established the function of the S. mutans
Singh, Kamna; Senadheera, Dilani B; Lévesque, Céline M; Cvitkovitch, Dennis G
2015-08-01
In bacteria, copper homeostasis is closely monitored to ensure proper cellular functions while avoiding cell damage. Most Gram-positive bacteria utilize the copYABZ operon for copper homeostasis, where copA and copB encode copper-transporting P-type ATPases, whereas copY and copZ regulate the expression of the cop operon. Streptococcus mutans is a biofilm-forming oral pathogen that harbors a putative copper-transporting copYAZ operon. Here, we characterized the role of copYAZ operon in the physiology of S. mutans and delineated the mechanisms of copper-induced toxicity in this bacterium. We observed that copper induced toxicity in S. mutans cells by generating oxidative stress and disrupting their membrane potential. Deletion of the copYAZ operon in S. mutans strain UA159 resulted in reduced cell viability under copper, acid, and oxidative stress relative to the viability of the wild type under these conditions. Furthermore, the ability of S. mutans to form biofilms and develop genetic competence was impaired under copper stress. Briefly, copper stress significantly reduced cell adherence and total biofilm biomass, concomitantly repressing the transcription of the gtfB, gtfC, gtfD, gbpB, and gbpC genes, whose products have roles in maintaining the structural and/or functional integrity of the S. mutans biofilm. Furthermore, supplementation with copper or loss of copYAZ resulted in significant reductions in transformability and in the transcription of competence-associated genes. Copper transport assays revealed that the ΔcopYAZ strain accrued significantly large amounts of intracellular copper compared with the amount of copper accumulation in the wild-type strain, thereby demonstrating a role for CopYAZ in the copper efflux of S. mutans. The complementation of the CopYAZ system restored copper expulsion, membrane potential, and stress tolerance in the copYAZ-null mutant. Taking these results collectively, we have established the function of the S. mutans Cop
Fish communities in man-made lakes = Peuplements ichtyologiques des lacs de barrage
Jackson, P.N.B.; Marshall, B.E.; Paugy, Didier
1988-01-01
Il existe actuellement des réservoirs artificiels sur de nombreuses rivières africaines. Leur construction a modifié les conditions écologiques (facteurs édaphiques, apports en éléments nutritifs) et changé la composition des peuplements ichtyologiques ... Le barrage lui-même peut être un obstacle pour des poissons tels que les anguilles ou les mulets migrants depuis la mer et entraîner la disparition des espèces en amont ... Les lacs de barrage ont une vaste zone pélagique favorable au déve...
Évaluation du niveau de pollution par les métaux lourds des lacs ...
African Journals Online (AJOL)
La présente étude a pour objectif principal d'évaluer le niveau de pollution métallique des lacs Bini et Dang (Ngaoundéré, Cameroun) à travers l'analyse des eaux et des sédiments de surface. La concentration des métaux lourds (Ni, Cr, Fe, Pb, Cd, Zn) a été mesurée par spectrophotométrie d'absorption atomique.
DEFF Research Database (Denmark)
Jochimsen, Bjarne; Lolle, Signe; McSorley, Fern R.
2011-01-01
Organophosphonate utilization by Escherichia coli requires the 14 cistrons of the phnCDEFGHIJKLMNOP operon, of which the carbon-phosphorus lyase has been postulated to consist of the seven polypeptides specified by phnG to phnM. A 5,660-bp DNA fragment encompassing phnGHIJKLM is cloned, followed...
In vitro transcription accurately predicts lac repressor phenotype in vivo in Escherichia coli
Directory of Open Access Journals (Sweden)
Matthew Almond Sochor
2014-07-01
Full Text Available A multitude of studies have looked at the in vivo and in vitro behavior of the lac repressor binding to DNA and effector molecules in order to study transcriptional repression, however these studies are not always reconcilable. Here we use in vitro transcription to directly mimic the in vivo system in order to build a self consistent set of experiments to directly compare in vivo and in vitro genetic repression. A thermodynamic model of the lac repressor binding to operator DNA and effector is used to link DNA occupancy to either normalized in vitro mRNA product or normalized in vivo fluorescence of a regulated gene, YFP. An accurate measurement of repressor, DNA and effector concentrations were made both in vivo and in vitro allowing for direct modeling of the entire thermodynamic equilibrium. In vivo repression profiles are accurately predicted from the given in vitro parameters when molecular crowding is considered. Interestingly, our measured repressor–operator DNA affinity differs significantly from previous in vitro measurements. The literature values are unable to replicate in vivo binding data. We therefore conclude that the repressor-DNA affinity is much weaker than previously thought. This finding would suggest that in vitro techniques that are specifically designed to mimic the in vivo process may be necessary to replicate the native system.
Sundararaman, Balaji; Palaniyandi, Kannan; Venkatesan, Arunkumar; Narayanan, Sujatha
2014-11-01
Regulation of gene expression is one of the mechanisms of virulence in pathogenic organisms. In this context, we would like to understand the gene regulation of acetamidase enzyme of Mycobacterium smegmatis, which is the first reported inducible enzyme in mycobacteria. The acetamidase is highly inducible and the expression of this enzyme is increased 100-fold when the substrate acetamide is added. The acetamidase structural gene (amiE) is found immediately downstream of three predicted open reading frames (ORFs). Three of these genes along with a divergently expressed ORF are predicted to form an operon and involved in the regulation of acetamidase enzyme. Here we report expression, purification and functional characterization of AmiA which is one of these predicted ORFs. Electrophoretic mobility shift assays showed that AmiA binds to the region between the amiA and amiD near the predicted promoter (P2). Over-expression of AmiA significantly lowered the expression of acetamidase compared to the wild type as demonstrated by qRT-PCR and SDS-PAGE. We conclude that AmiA binds near P2 promoter and acts as a repressor in the regulation of acetamidase operon. The described work is a further step forward toward broadening the knowledge on understanding of the complex gene regulatory mechanism of Mycobacterium sp. Copyright © 2014 Elsevier GmbH. All rights reserved.
Michael, Victoria; Frank, Oliver; Bartling, Pascal; Scheuner, Carmen; Göker, Markus; Brinkmann, Henner; Petersen, Jörn
2016-10-01
Alphaproteobacteria of the metabolically versatile Roseobacter group (Rhodobacteraceae) are abundant in marine ecosystems and represent dominant primary colonizers of submerged surfaces. Motility and attachment are the prerequisite for the characteristic 'swim-or-stick' lifestyle of many representatives such as Phaeobacter inhibens DSM 17395. It has recently been shown that plasmid curing of its 65-kb RepA-I-type replicon with >20 genes for exopolysaccharide biosynthesis including a rhamnose operon results in nearly complete loss of motility and biofilm formation. The current study is based on the assumption that homologous biofilm plasmids are widely distributed. We analyzed 33 roseobacters that represent the phylogenetic diversity of this lineage and documented attachment as well as swimming motility for 60% of the strains. All strong biofilm formers were also motile, which is in agreement with the proposed mechanism of surface attachment. We established transposon mutants for the four genes of the rhamnose operon from P. inhibens and proved its crucial role in biofilm formation. In the Roseobacter group, two-thirds of the predicted biofilm plasmids represent the RepA-I type and their physiological role was experimentally validated via plasmid curing for four additional strains. Horizontal transfer of these replicons was documented by a comparison of the RepA-I phylogeny with the species tree. A gene content analysis of 35 RepA-I plasmids revealed a core set of genes, including the rhamnose operon and a specific ABC transporter for polysaccharide export. Taken together, our data show that RepA-I-type biofilm plasmids are essential for the sessile mode of life in the majority of cultivated roseobacters.
Qureshi, Nadia; Chawla, Swati; Likitvivatanavong, Supaporn; Lee, Han Lim
2014-01-01
The management and control of mosquito vectors of human disease currently rely primarily on chemical insecticides. However, larvicidal treatments can be effective, and if based on biological insecticides, they can also ameliorate the risk posed to human health by chemical insecticides. The aerobic bacteria Bacillus thuringiensis and Lysinibacillus sphaericus have been used for vector control for a number of decades. But a more cost-effective use would be an anaerobic bacterium because of the ease with which these can be cultured. More recently, the anaerobic bacterium Clostridium bifermentans subsp. malaysia has been reported to have high mosquitocidal activity, and a number of proteins were identified as potentially mosquitocidal. However, the cloned proteins showed no mosquitocidal activity. We show here that four toxins encoded by the Cry operon, Cry16A, Cry17A, Cbm17.1, and Cbm17.2, are all required for toxicity, and these toxins collectively show remarkable selectivity for Aedes rather than Anopheles mosquitoes, even though C. bifermentans subsp. malaysia is more toxic to Anopheles. Hence, toxins that target Anopheles are different from those expressed by the Cry operon. PMID:25002432
Residues in the H+ Translocation Site Define the pKa for Sugar Binding to LacY†
Smirnova, Irina; Kasho, Vladimir; Sugihara, Junichi; Choe, Jun-Yong; Kaback, H. Ronald
2009-01-01
A remarkably high pKa of approximately 10.5 has been determined for sugar-binding affinity to the lactose permease of Escherichia coli (LacY), indicating that, under physiological conditions, substrate binds to fully protonated LacY. We have now systematically tested site-directed replacements for the residues involved in sugar binding, as well as H+ translocation and coupling, in order to determine which residues may be responsible for this alkaline pKa. Mutations in the sugar-binding site (Glu126, Trp151, Glu269) markedly decrease affinity for sugar but do not alter the pKa for binding. In contrast, replacements for residues involved in H+ translocation (Arg302, Tyr236, His322, Asp240, Glu325, Lys319) exhibit pKa values for sugar binding that are either shifted toward neutral pH or independent of pH. Values for the apparent dissociation constant for sugar binding (Kdapp) increase greatly for all mutants except neutral replacements for Glu325 or Lys319, which are characterized by remarkably high affinity sugar binding (i.e., low Kdapp) from pH 5.5 to pH 11. The pH dependence of the on- and off-rate constants for sugar binding measured directly by stopped-flow fluorometry implicates koff as a major factor for the affinity change at alkaline pH and confirms the effects of pH on Kdapp inferred from steady-state fluorometry. These results indicate that the high pKa for sugar binding by wild-type LacY cannot be ascribed to any single amino acid residue but appears to reside within a complex of residues involved in H+ translocation. There is structural evidence for water bound in this complex, and the water could be the site of protonation responsible for the pH dependence of sugar binding. PMID:19689129
Directory of Open Access Journals (Sweden)
Xia Wang
Full Text Available Biological nitrogen fixation is a complex process requiring multiple genes working in concert. To date, the Klebsiella pneumoniae nif gene cluster, divided into seven operons, is one of the most studied systems. Its nitrogen fixation capacity is subject to complex cascade regulation and physiological limitations. In this report, the entire K. pneumoniae nif gene cluster was reassembled as operon-based BioBrick parts in Escherichia coli. It provided ~100% activity of native K. pneumoniae system. Based on the expression levels of these BioBrick parts, a T7 RNA polymerase-LacI expression system was used to replace the σ(54-dependent promoters located upstream of nif operons. Expression patterns of nif operons were critical for the maximum activity of the recombinant system. By mimicking these expression levels with variable-strength T7-dependent promoters, ~42% of the nitrogenase activity of the σ(54-dependent nif system was achieved in E. coli. When the newly constructed T7-dependent nif system was challenged with different genetic and physiological conditions, it bypassed the original complex regulatory circuits, with minor physiological limitations. Therefore, we have successfully replaced the nif regulatory elements with a simple expression system that may provide the first step for further research of introducing nif genes into eukaryotic organelles, which has considerable potentials in agro-biotechnology.
77 FR 27245 - Big Stone National Wildlife Refuge, Big Stone and Lac Qui Parle Counties, MN
2012-05-09
... DEPARTMENT OF THE INTERIOR Fish and Wildlife Service [FWS-R3-R-2012-N069; FXRS1265030000S3-123-FF03R06000] Big Stone National Wildlife Refuge, Big Stone and Lac Qui Parle Counties, MN AGENCY: Fish and... plan (CCP) and environmental assessment (EA) for Big Stone National Wildlife Refuge (Refuge, NWR) for...
An Analysis of Periodic Components in BL Lac Object S5 0716 +714 with MUSIC Method
Tang, J.
2012-01-01
Multiple signal classification (MUSIC) algorithms are introduced to the estimation of the period of variation of BL Lac objects.The principle of MUSIC spectral analysis method and theoretical analysis of the resolution of frequency spectrum using analog signals are included. From a lot of literatures, we have collected a lot of effective observation data of BL Lac object S5 0716 + 714 in V, R, I bands from 1994 to 2008. The light variation periods of S5 0716 +714 are obtained by means of the MUSIC spectral analysis method and periodogram spectral analysis method. There exist two major periods: (3.33±0.08) years and (1.24±0.01) years for all bands. The estimation of the period of variation of the algorithm based on the MUSIC spectral analysis method is compared with that of the algorithm based on the periodogram spectral analysis method. It is a super-resolution algorithm with small data length, and could be used to detect the period of variation of weak signals.
Rasamoelina-Andriamanivo, H; Duboz, R; Lancelot, R; Maminiaina, O F; Jourdan, M; Rakotondramaro, T M C; Rakotonjanahary, S N; de Almeida, R Servan; Rakotondravao; Durand, B; Chevalier, V
2014-07-01
Madagascar's 36.5-million-head poultry industry holds a foremost place in its economy and the livelihood of its people. Unfortunately, regular Newcastle disease outbreaks associated with high mortality causes high losses for smallholders and threatens their livelihood. Therefore, Madagascar is seeking concrete, achievable and sustainable methods for the surveillance and the control of Newcastle disease. In this paper, we present and analyze the results of a field study conducted in Madagascar between December 2009 and December 2010. The study area was the Lac Alaotra region, a landlocked area in the north-eastern part of the country's center. Poultry trading is suspected of playing a major role in the spread of avian diseases, especially in developing countries characterized by many live-bird markets and middlemen. Therefore, the goals of our study were to: (i) describe and analyze smallholders' poultry trading network in the Lake Alaotra region using social network analysis; (ii) assess the role of the network in the spread of Newcastle disease; and (iii) propose the implementation of a targeted disease surveillance based on the characteristics of the poultry trading network. We focused our field study on the harvesting of two data sets. The first is a complete description of the poultry trading network in the landlocked area of Lac Alaotra, including a description of the poultry movements between groups of villages. The second set of data measures the occurrence of outbreaks in the same area by combining a participatory approach with an event-based surveillance method. These data were used to determine the attributes of the network, and to statistically assess the association between the position of nodes and the occurrence of outbreaks. By using social network analysis techniques combined with a classification method and a logistic model, we finally identified 3 nodes (set of villages), of the 387 in the initial network, to focus on for surveillance and control
Hierarchical analysis of dependency in metabolic networks.
Gagneur, Julien; Jackson, David B; Casari, Georg
2003-05-22
Elucidation of metabolic networks for an increasing number of organisms reveals that even small networks can contain thousands of reactions and chemical species. The intimate connectivity between components complicates their decomposition into biologically meaningful sub-networks. Moreover, traditional higher-order representations of metabolic networks as metabolic pathways, suffers from the lack of rigorous definition, yielding pathways of disparate content and size. We introduce a hierarchical representation that emphasizes the gross organization of metabolic networks in largely independent pathways and sub-systems at several levels of independence. The approach highlights the coupling of different pathways and the shared compounds responsible for those couplings. By assessing our results on Escherichia coli (E.coli metabolic reactions, Genetic Circuits Research Group, University of California, San Diego, http://gcrg.ucsd.edu/organisms/ecoli.html, 'model v 1.01. reactions') against accepted biochemical annotations, we provide the first systematic synopsis of an organism's metabolism. Comparison with operons of E.coli shows that low-level clusters are reflected in genome organization and gene regulation. Source code, data sets and supplementary information are available at http://www.mas.ecp.fr/labo/equipe/gagneur/hierarchy/hierarchy.html
Valdes, Kayla M.; Sundar, Ganesh S.; Vega, Luis A.; Belew, Ashton T.; Islam, Emrul; Binet, Rachel; El-Sayed, Najib M.
2016-01-01
Bacterial pathogens rely on the availability of nutrients for survival in the host environment. The phosphoenolpyruvate-phosphotransferase system (PTS) is a global regulatory network connecting sugar uptake with signal transduction. Since the fructose PTS has been shown to impact virulence in several streptococci, including the human pathogen Streptococcus pyogenes (the group A Streptococcus [GAS]), we characterized its role in carbon metabolism and pathogenesis in the M1T1 strain 5448. Growth in fructose as a sole carbon source resulted in 103 genes affected transcriptionally, where the fru locus (fruRBA) was the most induced. Reverse transcriptase PCR showed that fruRBA formed an operon which was repressed by FruR in the absence of fructose, in addition to being under carbon catabolic repression. Growth assays and carbon utilization profiles revealed that although the entire fru operon was required for growth in fructose, FruA was the main transporter for fructose and also was involved in the utilization of three additional PTS sugars: cellobiose, mannitol, and N-acetyl-d-galactosamine. The inactivation of sloR, a fruA homolog that also was upregulated in the presence of fructose, failed to reveal a role as a secondary fructose transporter. Whereas the ability of both ΔfruR and ΔfruB mutants to survive in the presence of whole human blood or neutrophils was impaired, the phenotype was not reproduced in murine whole blood, and those mutants were not attenuated in a mouse intraperitoneal infection. Since the ΔfruA mutant exhibited no phenotype in the human or mouse assays, we propose that FruR and FruB are important for GAS survival in a human-specific environment. PMID:26787724
Sutherland, K; del Río, J C
2014-04-18
A variety of lac resin samples obtained from artists' suppliers, industrial manufacturers, and museum collections were analysed using gas chromatography mass spectrometry (GCMS) and reactive pyrolysis GCMS with quaternary ammonium reagents. These techniques allowed a detailed chemical characterisation of microgram-sized samples, based on the detection and identification of derivatives of the hydroxy aliphatic and cyclic (sesquiterpene) acids that compose the resin. Differences in composition could be related to the nature of the resin, e.g. wax-containing (unrefined), bleached, or aged samples. Furthermore, differences in the relative abundances of aliphatic hydroxyacids appear to be associated with the biological source of the resin. The diagnostic value of newly characterised lac components, including 8-hydroxyacids, is discussed here for the first time. Identification of derivatised components was aided by AMDIS deconvolution software, and discrimination of samples was enhanced by statistical evaluation of data using principal component analysis. The robustness of the analyses, together with the minimal sample size required, make these very powerful approaches for the characterisation of lac resin in museum objects. The value of such analyses for enhancing the understanding of museum collections is illustrated by two case studies of objects in the collection of the Philadelphia Museum of Art: a restorer's varnish on a painting by Luca Signorelli, and a pictorial inlay in an early nineteenth-century High Chest by George Dyer. Copyright © 2014 Elsevier B.V. All rights reserved.
Lac du Flambeau Band of Lake Superior Chippewa Indians Strategic Energy Plan
Energy Technology Data Exchange (ETDEWEB)
Bryan Hoover
2009-11-16
This plan discusses the current energy use on the Lac du Flambeau Reservation, the current status of the Tribe's energy program, as well as the issues and concerns with energy on the reservation. This plan also identifies and outlines energy opportunities, goals, and objectives for the Tribe to accomplish. The overall goal of this plan is to address the energy situation of the reservation in a holistic manner for the maximum benefit to the Tribe. This plan is an evolving document that will be re-evaluated as the Tribe's energy situation changes.
Search for relation between flares and photometric variability outside of flares in EV Lac
International Nuclear Information System (INIS)
Rojzman, G.Sh.
1984-01-01
The observations of the flare star EV Lac in July-September 1981 have confirmed the existence of photometric variability outside the flares during the night. It was found that, as a rule, a slow increase of brightness in U and B bands during 1-2 hours preceded the flares. It is suggested that the variability outside the flares is the result of the variability of chpomospheric emission lines and continuum that are emitted by the chromospheric preflare formations
DEFF Research Database (Denmark)
Eberl, Leo; Sternberg, Claus; Givskov, Michael Christian
1994-01-01
specific sites situated in the promoter region of the parCBA operon. The two ParA proteins that are produced as a result of independent translation initiation at two different start codons within the same open reading frame were overexpressed in Escherichia coli and partially purified. Both forms...
Directory of Open Access Journals (Sweden)
CHAMPIGNEULLE A.
2003-01-01
Full Text Available La démographie d’une population de truite (Salmo trutta L. a été étudiée, dans un contexte de repeuplements en alevins nourris, sur le Redon, un affluent du lac Léman. On trouve sur le Redon une situation typique de nombreux affluents du Léman : une zone aval ouverte sur le lac mais rapidement interrompue par un obstacle empêchant la remontée des truites de lac. Des relâchers d’alevins nourris issus d’œufs de géniteurs sauvages de truite de lac ou de géniteurs domestiques, pratiqués en fin de printemps-début été à des densités de 40-60 ind./100 m2, fournissent un recrutement additionnel important pouvant constituer la part dominante du peuplement automnal en 0 +, puis 1 +. Sur les zones ouvertes à la pêche, colonisées ou non par la truite de lac, la densité de la population automnale en place s’effondre entre le stade 1 + et les stades > 1 +. Les résultats comparatifs entre zones ouvertes ou fermées à la pêche indiquent que la pêche peut être un facteur de mortalité important. La dynamique comparée des truites d’origine lacustre ou sédentaire suggère l’existence d’un taux de sédentarisation plus faible pour les 1 + issus de truites de lac comparativement aux 1 + issus de la fraie de truites sédentaires en zone de réserve. Une expérimentation suggère l’existence de mouvements de dévalaison ayant lieu avant octobre et touchant préférentiellement les 0 + d’origine lacustre ayant eu la croissance initiale la plus forte. L’étude montre que : - des alevins nourris d’origine lacustre ou domestique, relâchés en fin de printemps-début été, fournissent des géniteurs de truite de lac remontant dans la rivière de relâcher, avec cependant une proportion moindre (4 fois dans le cas de l’origine domestique comparativement à l’origine lacustre. Malgré leur forte contribution aux stades de juvéniles 0 + et 1 +, les alevins domestiques de pisciculture contribuent peu aux retours de g
Role of the ganSPQAB Operon in Degradation of Galactan by Bacillus subtilis.
Watzlawick, Hildegard; Morabbi Heravi, Kambiz; Altenbuchner, Josef
2016-10-15
Bacillus subtilis possesses different enzymes for the utilization of plant cell wall polysaccharides. This includes a gene cluster containing galactan degradation genes (ganA and ganB), two transporter component genes (ganQ and ganP), and the sugar-binding lipoprotein-encoding gene ganS (previously known as cycB). These genes form an operon that is regulated by GanR. The degradation of galactan by B. subtilis begins with the activity of extracellular GanB. GanB is an endo-β-1,4-galactanase and is a member of glycoside hydrolase (GH) family 53. This enzyme was active on high-molecular-weight arabinose-free galactan and mainly produced galactotetraose as well as galactotriose and galactobiose. These galacto-oligosaccharides may enter the cell via the GanQP transmembrane proteins of the galactan ABC transporter. The specificity of the galactan ABC transporter depends on the sugar-binding lipoprotein, GanS. Purified GanS was shown to bind galactotetraose and galactotriose using thermal shift assay. The energy for this transport is provided by MsmX, an ATP-binding protein. The transported galacto-oligosaccharides are further degraded by GanA. GanA is a β-galactosidase that belongs to GH family 42. The GanA enzyme was able to hydrolyze short-chain β-1,4-galacto-oligosaccharides as well as synthetic β-galactopyranosides into galactose. Thermal shift assay as well as electrophoretic mobility shift assay demonstrated that galactobiose is the inducer of the galactan operon regulated by GanR. DNase I footprinting revealed that the GanR protein binds to an operator overlapping the -35 box of the σ(A)-type promoter of Pgan, which is located upstream of ganS IMPORTANCE: Bacillus subtilis is a Gram-positive soil bacterium that utilizes different types of carbohydrates, such as pectin, as carbon sources. So far, most of the pectin degradation systems and enzymes have been thoroughly studied in B. subtilis Nevertheless, the B. subtilis utilization system of galactan, which is
Caldelari, I; Loeliger, B; Langen, H; Glauser, M P; Moreillon, P
2000-10-01
Penicillin tolerance is an incompletely understood phenomenon that allows bacteria to resist drug-induced killing. Tolerance was studied with independent Streptococcus gordonii mutants generated by cyclic exposure to 500 times the MIC of penicillin. Parent cultures lost 4 to 5 log(10) CFU/ml of viable counts/24 h. In contrast, each of four independent mutant cultures lost bacteria and were encoded by an operon that was >80% similar to the arginine-deiminase (arc) operon of these organisms. Partial nucleotide sequencing and insertion inactivation of the S. gordonii arc locus indicated that tolerance was not a direct consequence of arc alteration. On the other hand, genetic transformation of tolerance by Tol1 DNA always conferred arc deregulation. In nontolerant recipients, arc was repressed during exponential growth and up-regulated during postexponential growth. In tolerant transformants, arc was constitutively expressed. Tol1 DNA transformed tolerance at the same rate as transformation of a point mutation (10(-2) to 10(-3)). The tolerance mutation mapped on a specific chromosomal fragment but was physically distant from arc. Importantly, arc deregulation was observed in most (6 of 10) of additional independent penicillin-tolerant mutants. Thus, although not exclusive, the association between arc deregulation and tolerance was not fortuitous. Since penicillin selection mimicked the antibiotic pressure operating in the clinical environment, arc deregulation might be an important correlate of naturally occurring tolerance and help in understanding the mechanism(s) underlying this clinically problematic phenotype.
The 4.5 S RNA gene of Escherichia coli is essential for cell growth
DEFF Research Database (Denmark)
Brown, S; Fournier, M J
1984-01-01
The Escherichia coli gene coding for the metabolically stable 4.5 S RNA (ffs) has been shown to be required for cell viability. Essentiality was demonstrated by examining the recombination behavior of substitution mutations of ffs generated in vitro. Substitution mutants of ffs are able to replace...... the chromosomal allele only in the presence of a second, intact copy of ffs. Independent evidence of essentiality and the finding that 4.5 S RNA is important for protein synthetic activity came from characterization of cells dependent on the lac operon inducer isopropyl-beta-D-thiogalactoside for ffs gene...... expression. Here, a strain dependent on isopropyl-beta-D-thiogalactoside for 4.5 S RNA synthesis was developed by inactivation of the chromosomal ffs allele and lysogenization by a lambda phage containing 4.5 S DNA fused to a hybrid trp-lac promoter. Withdrawal of the thiogalactoside leads to a deficiency...
The UV spectrum of the BL Lac object PKS 0521-36
International Nuclear Information System (INIS)
Danziger, I.J.; Bergeron, J.; Maraschi, L.; Treves, A.; Milan Univ.; Tanzi, E.G.
1983-01-01
Ultraviolet observations (1200 to 3000 A) with the IUE satellite of the BL Lac object PKS 0521-36 are presented. The only emission line which appears clearly in the spectrum is Lyα, which is asymmetric with a component displaced approx. 3000 km s - 1 to the red. The intensity of the line and the upper limits on other lines are compared with the model calculations on QSOs and Seyfert nuclei by Kwan and Krolik. The continuous energy distribution is discussed, combining non-simultaneous observations from the ultraviolet to the infrared. The spectral range of the non-thermal source from far IR to far UV can be described by a single power law of index -1.5. (author)
Vanderlinde, Elizabeth M.; Magnus, Samantha A.; Tambalo, Dinah D.; Koval, Susan F.; Yost, Christopher K.
2011-01-01
The bacterial cell envelope is of critical importance to the function and survival of the cell; it acts as a barrier against harmful toxins while allowing the flow of nutrients into the cell. It also serves as a point of physical contact between a bacterial cell and its host. Hence, the cell envelope of Rhizobium leguminosarum is critical to cell survival under both free-living and symbiotic conditions. Transposon mutagenesis of R. leguminosarum strain 3841 followed by a screen to isolate mutants with defective cell envelopes led to the identification of a novel conserved operon (RL3499-RL3502) consisting of a putative moxR-like AAA+ ATPase, a hypothetical protein with a domain of unknown function (designated domain of unknown function 58), and two hypothetical transmembrane proteins. Mutation of genes within this operon resulted in increased sensitivity to membrane-disruptive agents such as detergents, hydrophobic antibiotics, and alkaline pH. On minimal media, the mutants retain their rod shape but are roughly 3 times larger than the wild type. On media containing glycine or peptides such as yeast extract, the mutants form large, distorted spheres and are incapable of sustained growth under these culture conditions. Expression of the operon is maximal during the stationary phase of growth and is reduced in a chvG mutant, indicating a role for this sensor kinase in regulation of the operon. Our findings provide the first functional insight into these genes of unknown function, suggesting a possible role in cell envelope development in Rhizobium leguminosarum. Given the broad conservation of these genes among the Alphaproteobacteria, the results of this study may also provide insight into the physiological role of these genes in other Alphaproteobacteria, including the animal pathogen Brucella. PMID:21357485
Directory of Open Access Journals (Sweden)
Emily M Zygiel
Full Text Available M13 and other members of the Ff class of filamentous bacteriophages have been extensively employed in myriad applications. The Ph.D. series of phage-displayed peptide libraries were constructed from the M13-based vector M13KE. As a direct descendent of M13mp19, M13KE contains the lacZα insert in the intergenic region between genes IV and II, where it interrupts the replication enhancer of the (+ strand origin. Phage carrying this 816-nucleotide insert are viable, but propagate in E. coli at a reduced rate compared to wild-type M13 phage, presumably due to a replication defect caused by the insert. We have previously reported thirteen compensatory mutations in the 5'-untranslated region of gene II, which encodes the replication initiator protein gIIp. Here we report several additional mutations in M13KE that restore a wild-type propagation rate. Several clones from constrained-loop variable peptide libraries were found to have ejected the majority of lacZα gene in order to reconstruct the replication enhancer, albeit with a small scar. In addition, new point mutations in the gene II 5'-untranslated region or the gene IV coding sequence have been spontaneously observed or synthetically engineered. Through phage propagation assays, we demonstrate that all these genetic modifications compensate for the replication defect in M13KE and restore the wild-type propagation rate. We discuss the mechanisms by which the insertion and ejection of the lacZα gene, as well as the mutations in the regulatory region of gene II, influence the efficiency of replication initiation at the (+ strand origin. We also examine the presence and relevance of fast-propagating mutants in phage-displayed peptide libraries.
Goh, Yong Jun; Klaenhammer, Todd R
2013-01-01
Glycogen metabolism contributes to energy storage and various physiological functions in some prokaryotes, including colonization persistence. A role for glycogen metabolism is proposed on the survival and fitness of Lactobacillus acidophilus, a probiotic microbe, in the human gastrointestinal environment. L. acidophilus NCFM possesses a glycogen metabolism (glg) operon consisting of glgBCDAP-amy-pgm genes. Expression of the glg operon and glycogen accumulation were carbon source- and growth phase-dependent, and were repressed by glucose. The highest intracellular glycogen content was observed in early log-phase cells grown on trehalose, which was followed by a drastic decrease of glycogen content prior to entering stationary phase. In raffinose-grown cells, however, glycogen accumulation gradually declined following early log phase and was maintained at stable levels throughout stationary phase. Raffinose also induced an overall higher temporal glg expression throughout growth compared with trehalose. Isogenic ΔglgA (glycogen synthase) and ΔglgB (glycogen-branching enzyme) mutants are glycogen-deficient and exhibited growth defects on raffinose. The latter observation suggests a reciprocal relationship between glycogen synthesis and raffinose metabolism. Deletion of glgB or glgP (glycogen phosphorylase) resulted in defective growth and increased bile sensitivity. The data indicate that glycogen metabolism is involved in growth maintenance, bile tolerance and complex carbohydrate utilization in L. acidophilus. PMID:23879596
Debrot, A.O.; Bemmelen, van R.S.A.; Ligon, J.
2013-01-01
The mangrove and seagrass lagoon of Lac Bay on Bonaire covers an area of roughly 700 ha. It is home to endangered green sea turtles, Chelonia mydas, and the Caribbean queen conch, Strombus gigas, and is a roosting and breeding area for several birds. Based on its nature values this 7 km2 bay has
UV light-induced mutability in Salmonella strains containing the umuDC or the mucAB operon
International Nuclear Information System (INIS)
Herrera, G.; Urios, A.; Aleixandre, V.; Blanco, M.
1988-01-01
Multicopy plasmids carrying either the umuDC operon of Escherichia coli or its analog mucAB operon, were introduced into Ames Salmonella strains in order to analyze the influence of UmuDC and MucAB proteins on repair and mutability after UV irradiation. It was found that in uvr + bacteria, plasmid pICV80:mucAB increased the frequency of UV-induced His + revertants whereas pSE117:umuDC caused a smaller increase in UV mutagenesis. In ΔuvrB bacteria, the protective role of pSE117 against UV killing was weak, and there was a great reduction in the mutant yield. In contrast, in these cells, pICV80 led to a large increase in both cell survival and mutation frequency. These results suggest that in Salmonella, as in E. coli, MucAB proteins mediate UV mutagenesis more efficiently than UmuDC proteins do. Plasmid pICV84:umuD + C - significantly increased UV mutagenesis of TA2659:ΔuvrB cells whereas in them, pICV77:mucA + B - had no effect on mutability indicating the presence in Salmonella TA2659 of a gene functionally homologous to umuC. 18 refs.; 1 figure; 3 tabs
An Analysis of Light Periods of BL Lac Object S5 0716+714 with the MUSIC Algorithm
Tang, Jie
2012-07-01
The multiple signal classification (MUSIC) algorithm is introduced to the estimation of light periods of BL Lac objects. The principle of the MUSIC algorithm is given, together with a testing on its spectral resolution by using a simulative signal. From a lot of literature, we have collected a large number of effective observational data of the BL Lac object S5 0716+714 in the three optical wavebands V, R, and I from 1994 to 2008. The light periods of S5 0716+714 are obtained by means of the MUSIC algorithm and average periodogram algorithm, respectively. It is found that there exist two major periodic components, one is the period of (3.33±0.08) yr, another is the period of (1.24±0.01) yr. The comparison of the performances of periodicity analysis of two algorithms indicates that the MUSIC algorithm has a smaller requirement on the sample length, as well as a good spectral resolution and anti-noise ability, to improve the accuracy of periodicity analysis in the case of short sample length.
International Nuclear Information System (INIS)
Colgate, S.A.; Petschek, A.G.
1978-01-01
The full radiation spectrum of quasars and BL Lac objects is interpreted as due to a dependent combination of a soft plasma oscillation source at 2ν/sub P/ and bremsstrahlung. Previous work of the plasma oscillation radiation is extended into the radio part of the spectrum and it is shown how the high brightness temperature observations of BL Lac objects [kT/sub b/ (100 MHz) approximate = 3 x 10 5 mc 2 ] are a reasonable consequence of a lower external plasma density and ejection as required for the observed lack of emission lines. Two extreme cases are considered, the one where the plasma oscillations are suddenly extinguished and only stimulated Compton scattering remains and a second case of a constant source of plasma oscillations but a graded surface density. The first case gives 1/100 of the required brightness temperature and the second gives 100 times too large a brightness temperature and also a x 10 too large a radius. It is believed reasonable to invoke a combination of both processes to explain the observed radio spectrum. This model circumvents the self-Compton x-ray flux difficulty of incoherent synchrotron emission
Hydrogen production by Escherichia coli {delta}hycA {delta}lacI using cheese whey as substrate
Energy Technology Data Exchange (ETDEWEB)
Rosales-Colunga, Luis Manuel; Ordonez, Leandro G.; De Leon-Rodriguez, Antonio (Division de Biologia Molecular, Instituto Potosino de Investigacion Cientifica y Tecnologica, Camino a la Presa San Jose 2055, Col. Lomas 4a secc. CP 78216, San Luis Potosi, SLP. Mexico); Razo-Flores, Elias; Alatriste-Mondragon, Felipe (Division de Ciencias Ambientales, Instituto Potosino de Investigacion Cientifica y Tecnologica, Camino a la Presa San Jose 2055, Col. Lomas 4a secc. CP 78216, San Luis Potosi, SLP. Mexico)
2010-01-15
This study reports a fermentative hydrogen production by Escherichia coli using cheese whey as substrate. To improve the biohydrogen production, an E. coli {delta}hycA {delta}lacI strain (WDHL) was constructed. The absence of hycA and lacI genes had a positive effect on the biohydrogen production. The strain produced 22% more biohydrogen in a shorter time than the wild-type (WT) strain. A Box-Behnken experimental design was used to optimize pH, temperature and substrate concentration. The optimal initial conditions for biohydrogen production by WDHL strain were pH 7.5, 37 C and 20 g/L of cheese whey. The specific production rate was improved from 3.29 mL H{sub 2}/optical density at 600 nm (OD{sub 600nm}) unit-h produced by WDHL under non-optimal conditions to 5.88 mL H{sub 2}/OD{sub 600nm} unit-h under optimal conditions. Using optimal initial conditions, galactose can be metabolized by WDHL strain. The maximum yield obtained was 2.74 mol H{sub 2}/mol lactose consumed, which is comparable with the yield reached in other hydrogen production processes with Clostridium sp. or mixed cultures. (author)
Nuryastuti, Titik; van der Mei, Henny C.; Busscher, Henk J.; Kuijer, Roel; Aman, Abu T.; Krom, Bastiaan P.
Phenotypic variation of Staphylococcus epidermidis involving the slime related ica operon results in heterogeneity in surface characteristics of individual bacteria in axenic cultures. Five clinical S. epidermidis isolates demonstrated phenotypic variation, i.e. both black and red colonies on Congo
Directory of Open Access Journals (Sweden)
RUHLÉ C.
1990-10-01
Full Text Available Le déclin de la population de truites migratrices du lac de Constance a débuté vers 1950 quand un barrage a été construit sur le Rhin, affluent principal de ce lac, coupant ainsi l'accès aux plus importantes frayères. Ceci a suffi de prétexte pour renoncer à une longueur de capture garantissant la reproduction naturelle. Par la suite, la population en train de diminuer a servi de justification pour des déversements importants de truites arc-en-ciel. Un désintérêt croissant pour le maintien de frayères dans les affluents secondaires a, finalement, contribué à la baisse des captures de 12.000 kg à 3.000 kg entre 1950 et 1980.Les mesures réalisées au cours des dernières années pour restaurer la population de truites lacustres ont du succès. Il s'agit surtout de : — la détermination d'une nouvelle longueur de capture ainsi que de périodes de protection respectant la reproduction des truites migrant à longue et à courte distance,— l'élevage de stocks de géniteurs, — les déversements forcés et effectués surtout en affluents (au lieu du lac,— l'interdiction d'immersions de truites arc-en-ciel,— l'abolition de barrages. Le succès se manifeste par un nombre croissant de truites observées frayant dans les affluents ainsi que par des captures de plus en plus nombreuses faites par la pêche professionnelle.
2013-01-17
... DEPARTMENT OF THE INTERIOR Fish and Wildlife Service [FWS-R3-R-2012-N259; FXRS1265030000-134-FF03R06000] Big Stone National Wildlife Refuge, Big Stone and Lac Qui Parle Counties, MN; Final Comprehensive... significant impact (FONSI) for the environmental assessment (EA) for Big Stone National Wildlife Refuge...
CSIR Research Space (South Africa)
Olakanmi, EO
2013-06-01
Full Text Available at the substrate and build up a coating. To circumvent the processing problems associated with cold-spray (CS) deposition of low-temperature, corrosion-resistant Al-12 wt.%Si coatings, a preliminary investigation detailing the effect of laser power on its LACS...
The diluvial rains of Saguenay-Lac-Saint-Jean : status one year after
International Nuclear Information System (INIS)
Henri, N.; Beauchemin, G.; Alonso, M.; Gelinas, M.
1997-01-01
The status of damages and reconstruction in the Saguenay-Lac-Saint-Jean region, one year after the catastrophic torrential rain storm of July 1996 was presented. Numerous detailed maps and photographs of the principal washed-out, destroyed and damaged regions were presented, along with maps and photographs of the same areas after reconstruction, repair and landscaping. The maps show the different river beds, urban, and rural districts that were subjected to the catastrophic washouts, landslides and soil collapses. The report also includes a summary of the repair costs by municipal regions and the financial aid received by the region to help in the reconstruction effort. tabs., figs
Role of the Escherichia coli glnALG operon in regulation of ammonium transport
International Nuclear Information System (INIS)
Jayakuman, A.; Schulman, I.; MacNeil, D.; Barnes, E.M. Jr.
1986-01-01
Escherichia coli expresses a specific ammonium (methylammonium) transport system (Amt) when cultured with glutamate or glutamine as the nitrogen source. Over 95% of this Amt activity is repressed by growth of wild-type cells on media containing ammonia. The control of Amt expression was studied with strains containing specific mutations in the glnALG operon. GlnA - (glutamine synthetase deficient) mutants, which contain polar mutations on glnL and glnG genes and therefore have the Reg - phenotype (fail to turn on nitrogen-regulated operons such as histidase), expressed less than 10% of the Amt activity observed for the parental strain. Similarly, low levels of Amt were found in GlnG mutants having the GlnA + Reg - phenotype. However, GlnA - RegC mutants (a phenotype constitutive for histidase) contained over 70% of the parental Amt activity. At steady-state levels, GlnA - RegC mutants accumulated chemically unaltered [ 14 C]methylammonium against a 60- to 80-fold concentration gradient, whereas the labeled substrate was trapped within parental cells as γ-glutamylmethylamide. GlnL Reg - mutants (normal glutamine synthetase regulation) had less than 4% of the Amt activity observed for the parental strain. However, the Amt activity of GlnL RegC mutants was slightly higher than that of the parental strain and was not repressed during growth of cells in media containing ammonia. These findings demonstrate that glutamine synthetase is not required for Amt in E. coli. The loss of Amt in certain GlnA - strains is due to polar effects on glnL nd glnG genes, whose products are involved in expression of nitrogen-regulated genes, including that for Amt
Salmonella enterica, a bacterial, food-borne pathogen of humans, can contaminate raw fruits and vegetables. Causing much public concern, the bacteria can survive in water used to wash produce. The ability to survive the low-osmolarity of the wash waters is attributed to the OpgGH operon that leads...
Meng, Lin; Hong, Shan; Liu, Henan; Huang, Haipeng; Sun, Hao; Xu, Tong; Jiang, Juquan
2014-11-01
The novel species Halomonas zhaodongensis NEAU-ST10-25(T) recently identified by our group is a moderate halophile which can grow at the range of 0-2.5 M NaCl (optimum 0.5 M) and pH 6-12 (optimum pH 9). To explore its halo-alkaline tolerant mechanism, genomic DNA was screened from NEAU-ST10-25(T) in this study for Na(+)(Li(+))/H(+) antiporter genes by selection in Escherichia coli KNabc lacking three major Na(+)(Li(+))/H(+) antiporters. One mrp operon could confer tolerance of E. coli KNabc to 0.8 M NaCl and 100 mM LiCl, and an alkaline pH. This operon was previously mainly designated mrp (also mnh, pha or sha) due to its multiple resistance and pH-related activity. Here, we will also use mrp to designate the homolog from H. zhaodongensis (Hz_mrp). Sequence analysis and protein alignment showed that Hz_mrp should belong to Group 1 mrp operons. Further phylogenetic analysis reveals that Hz_Mrp system should represent a novel sub-class of Group 1 Mrp systems. This was confirmed by a significant difference in pH-dependent activity profile or the specificity and affinity for the transported monovalent cations between Hz_Mrp system and all the known Mrp systems. Therefore, we propose that Hz_Mrp should be categorized as a novel Group 1 Mrp system.
Archana, G.; Naresh Kumar, G.
2014-01-01
Oxalate secretion was achieved in Pseudomonas fluorescens ATCC 13525 by incorporation of genes encoding Aspergillus niger oxaloacetate acetyl hydrolase (oah), Fomitopsis plaustris oxalate transporter (FpOAR) and Vitreoscilla hemoglobin (vgb) in various combinations. Pf (pKCN2) transformant containing oah alone accumulated 19 mM oxalic acid intracellularly but secreted 1.2 mM. However, in the presence of an artificial oxalate operon containing oah and FpOAR genes in plasmid pKCN4, Pf (pKCN4) secreted 13.6 mM oxalate in the medium while 3.6 mM remained inside. This transformant solubilized 509 μM of phosphorus from rock phosphate in alfisol which is 4.5 fold higher than the Pf (pKCN2) transformant. Genomic integrants of P. fluorescens (Pf int1 and Pf int2) containing artificial oxalate operon (plac-FpOAR-oah) and artificial oxalate gene cluster (plac-FpOAR-oah, vgb, egfp) secreted 4.8 mM and 5.4 mM oxalic acid, released 329 μM and 351 μM P, respectively, in alfisol. The integrants showed enhanced root colonization, improved growth and increased P content of Vigna radiata plants. This study demonstrates oxalic acid secretion in P. fluorescens by incorporation of an artificial operon constituted of genes for oxalate synthesis and transport, which imparts mineral phosphate solubilizing ability to the organism leading to enhanced growth and P content of V. radiata in alfisol soil. PMID:24705024
Directory of Open Access Journals (Sweden)
Kavita Yadav
Full Text Available Oxalate secretion was achieved in Pseudomonas fluorescens ATCC 13525 by incorporation of genes encoding Aspergillus niger oxaloacetate acetyl hydrolase (oah, Fomitopsis plaustris oxalate transporter (FpOAR and Vitreoscilla hemoglobin (vgb in various combinations. Pf (pKCN2 transformant containing oah alone accumulated 19 mM oxalic acid intracellularly but secreted 1.2 mM. However, in the presence of an artificial oxalate operon containing oah and FpOAR genes in plasmid pKCN4, Pf (pKCN4 secreted 13.6 mM oxalate in the medium while 3.6 mM remained inside. This transformant solubilized 509 μM of phosphorus from rock phosphate in alfisol which is 4.5 fold higher than the Pf (pKCN2 transformant. Genomic integrants of P. fluorescens (Pf int1 and Pf int2 containing artificial oxalate operon (plac-FpOAR-oah and artificial oxalate gene cluster (plac-FpOAR-oah, vgb, egfp secreted 4.8 mM and 5.4 mM oxalic acid, released 329 μM and 351 μM P, respectively, in alfisol. The integrants showed enhanced root colonization, improved growth and increased P content of Vigna radiata plants. This study demonstrates oxalic acid secretion in P. fluorescens by incorporation of an artificial operon constituted of genes for oxalate synthesis and transport, which imparts mineral phosphate solubilizing ability to the organism leading to enhanced growth and P content of V. radiata in alfisol soil.
Directory of Open Access Journals (Sweden)
Boerrigter Michaël
2004-01-01
Full Text Available Abstract Background Peroxisome proliferators are considered rodent carcinogens that are putative human non-carcinogens based on the presumed absence of direct genetic toxicity in rodent and human cells and the resistance of human cells to the induction of peroxisomes by peroxisome proliferators. The highly sensitive lacZ plasmid-based transgenic mouse mutation assay was employed to investigate the mutagenicity of several peroxisome proliferators based on several lines of evidence suggesting that these agents may in fact exert a genotoxic effect. Methods Male and female lacZ-plasmid based transgenic mice were treated at 4 months of age with 6 doses of 2,333 mg di-2-ethylhexyl phthalate (DHEP, 200 mg Wyeth-14,643, or 90 mg clofibrate per kg of bodyweight, respectively, over a two-week period. Control animals were treated with the respective vehicles only (35% propyl glycol for DEHP and Wyeth-14,643 treatment controls and sterile water for clofibrate treatment controls. The mutant frequency in liver, kidney and spleen DNA was determined as the proportion of retrieved mutant and wild-type lacZ plasmids expressed in Escherichia Coli C host cells employing a positive selection system for mutant plasmids. Results Exposure to DEHP or Wyeth-14,643 significantly increased the mutant frequency in liver, but not in kidney or spleen, of both female and male mice. Treatment with clofibrate did not lead to an increased mutant frequency in any of the organs studied. Conclusion The results indicate that some peroxisome proliferators display an organ-specific mutagenicity in lacZ plasmid-based transgenic mice consistent with historical observations of organ- and compound-specific carcinogenicity.
Bersanini, Luca; Allahverdiyeva, Yagut; Battchikova, Natalia; Heinz, Steffen; Lespinasse, Maija; Ruohisto, Essi; Mustila, Henna; Nickelsen, Jörg; Vass, Imre; Aro, Eva-Mari
2017-03-01
In Synechocystis sp. PCC 6803, the flv4-2 operon encodes the flavodiiron proteins Flv2 and Flv4 together with a small protein, Sll0218, providing photoprotection for Photosystem II (PSII). Here, the distinct roles of Flv2/Flv4 and Sll0218 were addressed, using a number of flv4-2 operon mutants. In the ∆sll0218 mutant, the presence of Flv2/Flv4 rescued PSII functionality as compared with ∆sll0218-flv2, where neither Sll0218 nor the Flv2/Flv4 heterodimer are expressed. Nevertheless, both the ∆sll0218 and ∆sll0218-flv2 mutants demonstrated deficiency in accumulation of PSII proteins suggesting a role for Sll0218 in PSII stabilization, which was further supported by photoinhibition experiments. Moreover, the accumulation of PSII assembly intermediates occurred in Sll0218-lacking mutants. The YFP-tagged Sll0218 protein localized in a few spots per cell at the external side of the thylakoid membrane, and biochemical membrane fractionation revealed clear enrichment of Sll0218 in the PratA-defined membranes, where the early biogenesis steps of PSII occur. Further, the characteristic antenna uncoupling feature of the ∆flv4-2 operon mutants is shown to be related to PSII destabilization in the absence of Sll0218. It is concluded that the Flv2/Flv4 heterodimer supports PSII functionality, while the Sll0218 protein assists PSII assembly and stabilization, including optimization of light harvesting. © 2016 The Authors. Plant, Cell & Enviroment Published by John Wiley & Sons Ltd.
Yakhnin, Helen; Yakhnin, Alexander V; Babitzke, Paul
2015-08-18
Ribosomal protein genes are often controlled by autoregulatory mechanisms in which a protein encoded in the operon can either bind to newly synthesized rRNA during rapid growth or to a similar target in its mRNA during poor growth conditions. The rplJL operon encodes the ribosomal L10(L12)4 complex. In Escherichia coli L10(L12)4 represses its translation by binding to the rplJL leader transcript. We identified three RNA structures in the Bacillus subtilis rplJL leader transcript that function as an anti-antiterminator, antiterminator or intrinsic terminator. Expression studies with transcriptional and translational fusions indicated that L10(L12)4 represses rplJL expression at the transcriptional level. RNA binding studies demonstrated that L10(L12)4 stabilizes the anti-antiterminator structure, while in vitro transcription results indicated that L10(L12)4 promotes termination. Disruption of anti-antiterminator, antiterminator or terminator function by competitor oligonucleotides in vitro and by mutations in vivo demonstrated that each structure functions as predicted. Thus, rplJL expression is regulated by an autogenous transcription attenuation mechanism in which L10(L12)4 binding to the anti-antiterminator structure promotes termination. We also found that translation of a leader peptide increases rplJL expression, presumably by inhibiting Rho-dependent termination. Thus, the rplJL operon of B. subtilis is regulated by transcription attenuation and antitermination mechanisms. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.
The atlA Operon of Streptococcus mutans: Role in Autolysin Maturation and Cell Surface Biogenesis
Ahn, Sang-Joon; Burne, Robert A.
2006-01-01
The Smu0630 protein (AtlA) was recently shown to be involved in cell separation, biofilm formation, and autolysis. Here, transcriptional studies revealed that atlA is part of a multigene operon under the control of at least three promoters. The morphology and biofilm-forming capacity of a nonpolar altA mutant could be restored to that of the wild-type strain by adding purified AtlA protein to the medium. A series of truncated derivatives of AtlA revealed that full activity required the C term...
Polarization burst in the BL Lac object AO 0235 + 164
Energy Technology Data Exchange (ETDEWEB)
Impey, C D; Brand, P W.J.L. [Edinburgh Univ. (UK). Dept. of Astronomy; Tapia, S [Steward Observatory, Tucson, AZ (USA)
1982-01-01
Simultaneous infrared and optical polarimetry and photometry have been obtained for AO 0235 + 164 covering a five night period. The object underwent a polarization burst during which the 2.2 ..mu..m polarization rose from 17.5 to 28.7 per cent and fell again to 14.9 per cent. At its peak the degree of optical polarization was 43.9 per cent, the highest linear polarization observed in a BL Lac object. The data show the degree of polarization to increase towards shorter wavelengths, and the effect is inconsistent with either dilution by a galactic component or simple one-component synchrotron models. The large changes in polarization are not accompanied by large changes in flux, a result which is difficult to explain using conventional models of these objects. Other implications of the luminosity, polarization and variability are discussed.
Souliotis, V.L.; Delft, J.H.M. van; Steenwinkel, M.-J.S.T.; Baan, R.A.; Kyrtopoulos, S.A.
1998-01-01
Groups of λlacZ transgenic mice were treated i.p. with N-nitrosodimethylamine (NDMA) as single doses of 5 mg/kg or 10 mg/kg or as 10 daily doses of 1 mg/kg and changes in DNA N7- or O6-methylguanine or the repair enzyme O6-alkylguanine-DNA alkyltransferase (AGT) were followed for up to 14 days in
Directory of Open Access Journals (Sweden)
Silvia Dossena
2013-12-01
Full Text Available One of the most pressing challenges in the post genomic era is the identification and characterization of protein-protein interactions (PPIs, as these are essential in understanding the cellular physiology of health and disease. Experimental techniques suitable for characterizing PPIs (X-ray crystallography or nuclear magnetic resonance spectroscopy, among others are usually laborious, time-consuming and often difficult to apply to membrane proteins, and therefore require accurate prediction of the candidate interacting partners. High-throughput experimental methods (yeast two-hybrid and affinity purification succumb to the same shortcomings, and can also lead to high rates of false positive and negative results. Therefore, reliable tools for predicting PPIs are needed. The use of the operon structure in the eukaryote Caenorhabditis elegans genome is a valuable, though underserved, tool for identifying physically or functionally interacting proteins. Based on the concept that genes organized in the same operon may encode physically or functionally related proteins, this algorithm is easy to be applied and, importantly, gives a limited number of candidate partners of a given protein, allowing for focused experimental verification. Moreover, this approach can be successfully used to predict PPIs in the human system, including those of membrane proteins.
Directory of Open Access Journals (Sweden)
TONN W. M.
1995-04-01
Full Text Available Les deux processus qui déterminent la structure des communautés dans les habitats insulaires sont l'immigration d'espèces vers une communauté et l'extinction de celles qui étaient présentes auparavant. Bien que l'immigration et l'extinction se produisent généralement à des échelles supérieures à celles qu'il est possible d'étudier avec des expériences plannifiées, les écologistes peuvent améliorer leur compréhension de ces processus par l'analyse des distributions observées ; l'isolation, le caractère discret et la réplication des systèmes insulaires présentent des avantages pour réaliser de telles analyses. Comme pour les communautés observées sur de vraies îles, la structure des peuplements de poissons dans les petits lacs forestiers est le résultat de l'immigration et de l'extinction. L'importance relative de ces processus peut dépendre des caractéristiques d'habitat des lacs et des espèces présentes, ainsi que du cadre régional et historique des lacs étudiés. Dans une région donnée, la composition des peuplements locaux de poissons peut être reliée à un ensemble particulier de conditions d'habitat et, dans la mesure où ces facteurs peuvent être liés à l'immigration et à l'extinction, il devrait être possible d'analyser les relations peuplement-environnement pour en déduire l'importance relative de ces processus dans la formation de peuplements locaux dans et entre les régions et les continents. Nous avons réalisé des analyses à large échelle des relations peuplement-environnement des petits lacs forestiers de quatre régions tempérées d'Europe et d'Amérique du Nord ; l'utilisation d'une série d'analyses canonique partielle des correspondances nous a permis de distinguer la variation due aux relations peuplements-environnement d'un ensemble de facteurs associés à l'immigration contre l'extinction. Les isolations passées et présentes varient selon les lacs et les régions, comme la
International Nuclear Information System (INIS)
Sambruna, R.M.; Ghisellini, G.; Hooper, E.; Kollgaard, R.I.; Pesce, J.E.; Urry, C.M.
1999-01-01
We present ASCA observations of the radio-selected BL Lacertae objects 1749+096 (z=0.32) and 2200+420 (BL Lac, z=0.069) performed in 1995 September and November, respectively. The ASCA spectra of both sources can be described as a first approximation by a power law with photon index Γ∼2. This is flatter than for most X-ray endash selected BL Lacs observed with ASCA, in agreement with the predictions of current blazar unification models. While 1749+096 exhibits tentative evidence for spectral flattening at low energies, a concave continuum is detected for 2200+420: the steep low-energy component is consistent with the high-energy tail of the synchrotron emission responsible for the longer wavelengths, while the harder tail at higher energies is the onset of the Compton component. The two BL Lacs were observed with ground-based telescopes from radio to TeV energies contemporaneously with ASCA. The spectral energy distributions are consistent with synchrotron self-Compton emission from a single homogeneous region shortward of the IR/optical wavelengths, with a second component in the radio domain related to a more extended emission region. For 2200+420, comparing the 1995 November state with the optical/GeV flare of 1997 July, we find that models requiring inverse Compton scattering of external photons provide a viable mechanism for the production of the highest (GeV) energies during the flare. In particular, an increase of the external radiation density and of the power injected in the jet can reproduce the flat γ-ray continuum observed in 1997 July. A directly testable prediction of this model is that the line luminosity in 2200+420 should vary shortly after (∼1 month) a nonthermal synchrotron flare. copyright copyright 1999. The American Astronomical Society
International Nuclear Information System (INIS)
Torres, Rodrigo; Chim, Nicholas; Sankaran, Banumathi; Pujol, Céline; Bliska, James B.; Goulding, Celia W.
2011-01-01
Comparison of the 2.45 Å resolution crystal structure of homotrimeric RipC, a putative citrate lyase β subunit from Y. pestis, with structural homologs reveals conserved RipC residues that are implicated in CoA binding. Yersinia pestis remains a threat, with outbreaks of plague occurring in rural areas and its emergence as a weapon of bioterrorism; thus, an improved understanding of its various pathogenicity pathways is warranted. The rip (required for intracellular proliferation) virulence operon is required for Y. pestis survival in interferon-γ-treated macrophages and has been implicated in lowering macrophage-produced nitric oxide levels. RipC, one of three gene products from the rip operon, is annotated as a citrate lyase β subunit. Furthermore, the Y. pestis genome lacks genes that encode citrate lyase α and γ subunits, suggesting a unique functional role of RipC in the Y. pestisrip-mediated survival pathway. Here, the 2.45 Å resolution crystal structure of RipC revealed a homotrimer in which each monomer consists of a (β/α) 8 TIM-barrel fold. Furthermore, the trimeric state was confirmed in solution by size-exclusion chromatography. Through sequence and structure comparisons with homologous proteins, it is proposed that RipC is a putative CoA- or CoA-derivative binding protein
Characterization of the orf1glnKamtB operon of Herbaspirillum seropedicae.
Noindorf, Lilian; Rego, Fabiane G M; Baura, Valter A; Monteiro, Rose A; Wassem, Roseli; Cruz, Leonardo M; Rigo, Liu U; Souza, Emanuel M; Steffens, Maria B R; Pedrosa, Fabio O; Chubatsu, Leda S
2006-03-01
Herbaspirillum seropedicae is an endophytic nitrogen-fixing bacterium that colonizes economically important grasses. In this organism, the amtB gene is co-transcribed with two other genes: glnK that codes for a PII-like protein and orf1 that codes for a probable periplasmatic protein of unknown function. The expression of the orf1glnKamtB operon is increased under nitrogen-limiting conditions and is dependent on NtrC. An amtB mutant failed to transport methylammonium. Post-translational control of nitrogenase was also partially impaired in this mutant, since a complete switch-off of nitrogenase after ammonium addition was not observed. This result suggests that the AmtB protein is involved in the signaling pathway for the reversible inactivation of nitrogenase in H. seropedicae.
Sato, Takuya; Nonoyama, Shouta; Kimura, Akane; Nagata, Yuji; Ohtsubo, Yoshiyuki; Tsuda, Masataka
2017-08-15
Iron and heme play very important roles in various metabolic functions in bacteria, and their intracellular homeostasis is maintained because high concentrations of free forms of these molecules greatly facilitate the Fenton reaction-mediated production of large amounts of reactive oxygen species that severely damage various biomolecules. The ferric uptake regulator (Fur) from Burkholderia multivorans ATCC 17616 is an iron-responsive global transcriptional regulator, and its fur deletant exhibits pleiotropic phenotypes. In this study, we found that the phenotypes of the fur deletant were suppressed by an additional mutation in hemP The transcription of hemP was negatively regulated by Fur under iron-replete conditions and was constitutive in the fur deletant. Growth of a hemP deletant was severely impaired in a medium containing hemin as the sole iron source, demonstrating the important role of HemP in hemin utilization. HemP was required as a transcriptional activator that specifically binds the promoter-containing region upstream of a Fur-repressive hmuRSTUV operon, which encodes the proteins for hemin uptake. A hmuR deletant was still able to grow using hemin as the sole iron source, albeit at a rate clearly lower than that of the wild-type strain. These results strongly suggested (i) the involvement of HmuR in hemin uptake and (ii) the presence in ATCC 17616 of at least part of other unknown hemin uptake systems whose expression depends on the HemP function. Our in vitro analysis also indicated high-affinity binding of HemP to hemin, and such a property might modulate transcriptional activation of the hmu operon. IMPORTANCE Although the hmuRSTUV genes for the utilization of hemin as a sole iron source have been identified in a few Burkholderia strains, the regulatory expression of these genes has remained unknown. Our analysis in this study using B. multivorans ATCC 17616 showed that its HemP protein is required for expression of the hmuRSTUV operon, and the
Peslier, Anne H.; Brandon, Alan D.; Schaffer, Lillian Aurora; O'Reilly, Suzanne Yvette; Griffin, William L.; Morris, Richard V.; Graff, Trevor G.; Agresti, David G.
2014-01-01
The mantle lithosphere beneath the cratonic part of continents is the deepest (> 200 km) and oldest (>2-3 Ga) on Earth, remaining a conundrum as to how these cratonic roots could have resisted delamination by asthenospheric convection over time. Water, or trace H incorporated in mineral defects, could be a key player in the evolution of continental lithosphere because it influences melting and rheology of the mantle. Mantle xenoliths from the Lac de Gras kimberlite in the Slave craton were analyzed by FTIR. The cratonic mantle beneath Lac de Gras is stratified with shallow (water contents extending to higher values than those from the shallow ones. The FTIR spectra of olivines from the shallow samples have more prominent Group II OH bands compared to the olivines from the deep samples, consistent with a more oxidized mantle environment. The range of olivine water content is similar to that observed in Kaapvaal craton peridotites at the same depths (129-184 km) but does not extend to as high values as those from Udachnaya (Siberian craton). The Slave, Kaapvaal and Siberian cratons will be compared in terms of water content distribution, controls and role in cratonic root longevity.
Directory of Open Access Journals (Sweden)
Keyhani Nemat O
2004-06-01
Full Text Available Abstract Background The growing conviction that lateral gene transfer plays a significant role in prokaryote genealogy opens up a need for comprehensive evaluations of gene-enzyme systems on a case-by-case basis. Genes of tryptophan biosynthesis are frequently organized as whole-pathway operons, an attribute that is expected to facilitate multi-gene transfer in a single step. We have asked whether events of lateral gene transfer are sufficient to have obscured our ability to track the vertical genealogy that underpins tryptophan biosynthesis. Results In 47 complete-genome Bacteria, the genes encoding the seven catalytic domains that participate in primary tryptophan biosynthesis were distinguished from any paralogs or xenologs engaged in other specialized functions. A reliable list of orthologs with carefully ascertained functional roles has thus been assembled and should be valuable as an annotation resource. The protein domains associated with primary tryptophan biosynthesis were then concatenated, yielding single amino-acid sequence strings that represent the entire tryptophan pathway. Lateral gene transfer of several whole-pathway trp operons was demonstrated by use of phylogenetic analysis. Lateral gene transfer of partial-pathway trp operons was also shown, with newly recruited genes functioning either in primary biosynthesis (rarely or specialized metabolism (more frequently. Conclusions (i Concatenated tryptophan protein trees are congruent with 16S rRNA subtrees provided that the genomes represented are of sufficiently close phylogenetic spacing. There are currently seven tryptophan congruency groups in the Bacteria. Recognition of a succession of others can be expected in the near future, but ultimately these should coalesce to a single grouping that parallels the 16S rRNA tree (except for cases of lateral gene transfer. (ii The vertical trace of evolution for tryptophan biosynthesis can be deduced. The daunting complexities engendered
Visualization of the Dynamics of Gene Expression in the Living Mouse
Directory of Open Access Journals (Sweden)
Amy Ryan
2004-01-01
Full Text Available Reporter genes can monitor the status and activity of recombinant genomes in a diverse array of organisms, from bacteria and yeast to plants and animals. We have combined luciferase reporter genes with a conditional gene expression system based on regulatory elements from the lac Operon of Escherichia coli to visualize the dynamics of gene expression in realtime in the living mouse. Using this technology, we have determined the rate of gene induction and repression, the level of target gene activity in response to different doses of inducer, and the schedule of induction during early embryogenesis of both the endogenous and the experimentally manipulated programs of mammalian gene expression associated with the HD/Hdh locus. The combination of in vivo imaging and lac regulation is a powerful tool for generating conditional transgenic mice that can be screened rapidly for optimal regulation and expression patterns, and for monitoring the induction and repression of regulated genes noninvasively in the living animal.
p21-LacZ reporter mice reflect p53-dependent toxic insult
International Nuclear Information System (INIS)
Vasey, Douglas B.; Wolf, C. Roland; MacArtney, Thomas; Brown, Ken; Whitelaw, C. Bruce A.
2008-01-01
There is an urgent need to discover less toxic and more selective drugs to treat disease. The use of transgenic mice that report on toxic insult-induced transcription can provide a valuable tool in this regard. To exemplify this strategy, we have generated transgenic mice carrying a p21-LacZ transgene. Transgene activity reflected endogenous p21 gene activation in various tissues, displayed compound-specific spatial expression signatures in the brain and immune tissues and enabled p53-dependent and p53-independent responses to be identified. We discuss the application of these mice in delineating the molecular events in normal cellular growth and disease and for the evaluation of drug toxicity
Berendsen, Erwin M.; Koning, Rosella A.; Boekhorst, Jos; de Jong, Anne; Kuipers, Oscar P.; Wells-Bennik, Marjon H. J.
2016-01-01
Bacterial endospore formers can produce spores that are resistant to many food processing conditions, including heat. Some spores may survive heating processes aimed at production of commercially sterile foods. Recently, it was shown that a spoVA operon, designated spoVA2mob, present on a Tn1546 transposon in Bacillus subtilis, leads to profoundly increased wet heat resistance of B. subtilis spores. Such Tn1546 transposon elements including the spoVA2mob operon were also found in several strains of Bacillus amyloliquefaciens and Bacillus licheniformis, and these strains were shown to produce spores with significantly higher resistances to wet heat than their counterparts lacking this transposon. In this study, the locations and compositions of Tn1546 transposons encompassing the spoVA2mob operons in B. amyloliquefaciens and B. licheniformis were analyzed. Introduction of these spoVA2mob operons into B. subtilis 168 (producing spores that are not highly heat resistant) rendered mutant 168 strains that produced high-level heat resistant spores, demonstrating that these elements in B. amyloliquefaciens and B. licheniformis are responsible for high level heat resistance of spores. Assessment of growth of the nine strains of each species between 5.2°C and 57.7°C showed some differences between strains, especially at lower temperatures, but all strains were able to grow at 57.7°C. Strains of B. amyloliquefaciens and B. licheniformis that contain the Tn1546 elements (and produce high-level heat resistant spores) grew at temperatures similar to those of their Tn1546-negative counterparts that produce low-level heat resistant spores. The findings presented in this study allow for detection of B. amyloliquefaciens and B. licheniformis strains that produce highly heat resistant spores in the food chain. PMID:27994575
Directory of Open Access Journals (Sweden)
Bianca Schwartbeck
2016-11-01
Full Text Available Cystic fibrosis (CF is associated with chronic bacterial airway infections leading to lung insufficiency and decreased life expectancy. Staphylococcus aureus is one of the most prevalent pathogens isolated from the airways of CF patients. Mucoid colony morphology has been described for Pseudomonas aeruginosa, the most common pathogen in CF, but not for S. aureus. From the airways of 8 of 313 CF patients (2.5% mucoid S. aureus isolates (n = 115 were cultured with a mean persistence of 29 months (range 1 month, 126 months. In contrast to non-mucoid S. aureus, mucoid isolates were strong biofilm formers. The upstream region of the ica operon, which encodes the proteins responsible for the synthesis of the polysaccharide intercellular adhesin (PIA, of mucoid isolates was sequenced. Spa-types of mucoid and non-mucoid strains were identical, but differed between patients. Mucoid isolates carried a 5 bp deletion in the intergenic region between icaR and icaA. During long-term persistence, from two patients subsequent non-mucoid isolates (n = 12 with 5 bp deletions were cultured, which did not produce biofilm. Sequencing of the entire ica operon identified compensatory mutations in various ica-genes including icaA (n = 7, icaD (n = 3 and icaC (n = 2. Six sequential isolates of each of these two patients with non-mucoid and mucoid phenotypes were subjected to whole genome sequencing revealing a very close relationship of the individual patient's isolates. Transformation of strains with vectors expressing the respective wild-type genes restored mucoidy. In contrast to the non-mucoid phenotype, mucoid strains were protected against neutrophilic killing and survived better under starvation conditions. In conclusion, the special conditions present in CF airways seem to facilitate ongoing mutations in the ica operon during S. aureus persistence.
The ultraviolet to X-ray continua of BL Lac objects
International Nuclear Information System (INIS)
George, I.M.; Warwick, R.S.; McHardy, I.M.
1988-01-01
The results from EXOSAT observations of three X-ray bright BL Lacertae objects, Mrk 501, 1218 + 304 and Mrk 180 are presented. All three sources have soft power-law X-ray spectra with low-energy cut-offs consistent with absorption in the line-of-sight gas column density through our own galaxy. The three objects also exhibit significant spectral variability in the X-ray band on time-scales ranging from a few days to a year. In each case, X-ray flux and spectral index appear to be correlated, in the sense that the X-ray spectrum hardens as the source brightens. The intrinsic ultraviolet to X-ray spectrum of these and several other X-ray bright BL Lac objects can be modelled as a power-law continuum of energy index ∼1.0 below about 0.1 keV, above which the spectral slope steepens. (author)
The transcriptional and gene regulatory network of Lactococcus lactis MG1363 during growth in milk.
Directory of Open Access Journals (Sweden)
Anne de Jong
Full Text Available In the present study we examine the changes in the expression of genes of Lactococcus lactis subspecies cremoris MG1363 during growth in milk. To reveal which specific classes of genes (pathways, operons, regulons, COGs are important, we performed a transcriptome time series experiment. Global analysis of gene expression over time showed that L. lactis adapted quickly to the environmental changes. Using upstream sequences of genes with correlated gene expression profiles, we uncovered a substantial number of putative DNA binding motifs that may be relevant for L. lactis fermentative growth in milk. All available novel and literature-derived data were integrated into network reconstruction building blocks, which were used to reconstruct and visualize the L. lactis gene regulatory network. This network enables easy mining in the chrono-transcriptomics data. A freely available website at http://milkts.molgenrug.nl gives full access to all transcriptome data, to the reconstructed network and to the individual network building blocks.
Varmanen, P; Savijoki, K; Avall, S; Palva, A; Tynkkynen, S
2000-01-01
A peptidase gene expressing X-prolyl dipeptidyl aminopeptidase (PepX) activity was cloned from Lactobacillus rhamnosus 1/6 by using the chromogenic substrate L-glycyl-L-prolyl-beta-naphthylamide for screening of a genomic library in Escherichia coli. The nucleotide sequence of a 3.5-kb HindIII fragment expressing the peptidase activity revealed one complete open reading frame (ORF) of 2,391 nucleotides. The 797-amino-acid protein encoded by this ORF was shown to be 40, 39, and 36% identical with PepXs from Lactobacillus helveticus, Lactobacillus delbrueckii, and Lactococcus lactis, respectively. By Northern analysis with a pepX-specific probe, transcripts of 4.5 and 7.0 kb were detected, indicating that pepX is part of a polycistronic operon in L. rhamnosus. Cloning and sequencing of the upstream region of pepX revealed the presence of two ORFs of 360 and 1,338 bp that were shown to be able to encode proteins with high homology to GlnR and GlnA proteins, respectively. By multiple primer extension analyses, the only functional promoter in the pepX region was located 25 nucleotides upstream of glnR. Northern analysis with glnA- and pepX-specific probes indicated that transcription from glnR promoter results in a 2.0-kb dicistronic glnR-glnA transcript and also in a longer read-through polycistronic transcript of 7.0 kb that was detected with both probes in samples from cells in exponential growth phase. The glnA gene was disrupted by a single-crossover recombinant event using a nonreplicative plasmid carrying an internal part of glnA. In the disruption mutant, glnRA-specific transcription was derepressed 10-fold compared to the wild type, but the 7.0-kb transcript was no longer detectable with either the glnA- or pepX-specific probe, demonstrating that pepX is indeed part of glnRA operon in L. rhamnosus. Reverse transcription-PCR analysis further supported this operon structure. An extended stem-loop structure was identified immediately upstream of pepX in the gln
Aims: To investigate the function of the master flagellar operon flhDC in the fish pathogen Yersinia ruckeri and compare the effect of flhD mutation to a naturally occurring mutation causing loss-of-motility in emergent biotype 2 (BT2) strains. Methods and Results: In this study isogenic Y. ruckeri ...
Mohamaddoust, Reza; Haghighat, Abolfazl Toroghi; Sharif, Mohamad Javad Motahari; Capanni, Niccolo
2011-01-01
Wireless sensor networks (WSN) are currently being applied to energy conservation applications such as light control. We propose a design for such a system called a lighting automatic control system (LACS). The LACS system contains a centralized or distributed architecture determined by application requirements and space usage. The system optimizes the calculations and communications for lighting intensity, incorporates user illumination requirements according to their activities and performs adjustments based on external lighting effects in external sensor and external sensor-less architectures. Methods are proposed for reducing the number of sensors required and increasing the lifetime of those used, for considerably reduced energy consumption. Additionally we suggest methods for improving uniformity of illuminance distribution on a workplane's surface, which improves user satisfaction. Finally simulation results are presented to verify the effectiveness of our design.
A. Dees; P. Melotti; R. Vicenzi; A. Roncarati
2010-01-01
Micropterus salmoides (Lacépède) was originally present into the waters of the eastern United States of America, northern Mexico and southern Canada. This species can be distinguished from the other black basses by the fact that its mouth extends to and beyond the edge of the eye and the first and the second dorsal fins are almost separated by a deep dip and there are no scales on the soft rayed of the second dorsal fin.
Kondo, D. M.; Worrall, D. M.; Mushotzky, R. F.; Hackney, R. L.; Hackney, K. H.; Oke, J. B.; Yee, H.; Neugebauer, G.; Matthews, K.; Feldman, P. A.
1980-01-01
Quasi-simultaneous observations of the BL Lacertae (Lac) objects MK 501 were performed for the first time at X-ray, ultraviolet, visible, infrared, and radio frequencies. The observed spectral slope from the X-ray to UV regions is positive and continuous, but that from the mid UV to visible light region becomes gradually flat and possibly turns down toward lower frequencies; the optical radio emission can not be accounted for by a single power law. Several theoretical models were considered for the emission mechanism. A quantitative comparison was performed with the synchrotron-self-Compton model; the total spectrum is found consistent with this model. The spectrum from visible light to X-ray is consistent with synchrotron radiation or with inverse-Compton scattering by a hot thermal cloud of electrons. The continuity of the spectral slope from X-ray to UV implied by the current data suggests that the previous estimates of the total luminosity of this BL Lac object is underestimated by a factor of about three or four.
DEFF Research Database (Denmark)
Wadskov-Hansen, Steen Lüders; Martinussen, Jan; Hammer, Karin
2000-01-01
establishing the ability of the encoded protein to synthesize UDP. The pyrH gene in L. lactis is flanked downstream by frr1 encoding ribosomal recycling factor 1 and upstream by an open reading frame, orfA, of unknown function. The three genes were shown to constitute an operon transcribed in the direction orf......A-pyrH-frr1 from a promoter immediately in front of orfA. This operon belongs to an evolutionary highly conserved gene cluster, since the organization of pyrH on the chromosomal level in L. lactis shows a high resemblance to that found in Bacillus subtilis as well as in Escherichia coli and several other...
Thermal cracking in Lac du Bonnet granite during slow heating to 205 degrees celsius
International Nuclear Information System (INIS)
Chernis, P.J.; Robertson, P.B.
1993-09-01
Acoustic emissions (AE) were recorded as drill core samples of Lac du Bonnet granite were slowly heated to between 66 and 205 degrees celsius to evaluate the effects of temperature on the properties of rock samples. Longitudinal and shear velocities of the samples were measured, and Young's moduli, shear moduli and Poisson's ratios were calculated. No significant AE activity was detected until temperatures reached approximately 73-80 degrees celsius. Above this 'threshold' temperature, calculated rock properties decreased, and at 205 degrees celsius calculated Young's modulus, shear modulus, and Poisson's ratio were reduced by 30, 26, and 29% respectively
Rozo, Zayda Lorena Corredor; Márquez-Ortiz, Ricaurte Alejandro; Castro, Betsy Esperanza; Gómez, Natasha Vanegas; Escobar-Pérez, Javier
2017-07-01
Staphylococcus aureus pandemic clone USA300 has, in addition to its constitutive arginine catabolism (arc) gene cluster, an arginine catabolism mobile element (ACME) carrying another such cluster, which gives this clone advantages in colonisation and infection. Gene arcR, which encodes an oxygen-sensitive transcriptional regulator, is inside ACME and downstream of the constitutive arc gene cluster, and this situation may have an impact on its activation. Different relative expression behaviours are proven here for arcRACME and the arcACME operon compared to the constitutive ones. We also show that the artificially expressed recombinant ArcRACME protein binds to the promoter region of the arcACME operon; this mechanism can be related to a positive feedback model, which may be responsible for increased anaerobic survival of the USA300 clone during infection-related processes.
MEIJER, WG
1994-01-01
During autotrophic growth of Xanthobacter flavus, energy derived from the oxidation of hydrogen methanol or formate is used to drive the assimilation of CO2 via the Calvin cycle. The genes encoding the Calvin cycle enzymes are organized in the cbb operon, which is expressed only during autotrophic
Yi, Jia; Xiao, Shui Bing; Zeng, Zhi Xiong; Lu, Jin Fang; Liu, Lu Yi; Laghari, Zubair Ahmed; Nie, Pin; Yu, Hong Bing; Xie, Hai Xia
2016-08-01
Edwardsiella tarda is an important Gram-negative pathogen that employs a type III secretion system (T3SS) to deliver effectors into host cells to facilitate bacterial survival and replication. These effectors are translocated into host cells through a translocon complex composed of three secreted proteins, namely, EseB, EseC, and EseD. The secretion of EseB and EseD requires a chaperone protein called EscC, whereas the secretion of EseC requires the chaperone EscA. In this study, we identified a novel protein (EseE) that also regulates the secretion of EseC. An eseE deletion mutant secreted much less EseC into supernatants, accompanied by increased EseC levels within bacterial cells. We also demonstrated that EseE interacted directly with EseC in a pulldown assay. Interestingly, EseC, EseE, and EscA were able to form a ternary complex, as revealed by pulldown and gel filtration assays. Of particular importance, the deletion of eseE resulted in decreased levels of EseB and EseD proteins in both the bacterial pellet and supernatant fraction. Furthermore, real-time PCR assays showed that EseE positively regulated the transcription of the translocon operon escC-eseE, comprising escC, eseB, escA, eseC, eseD, and eseE These effects of EseE on the translocon components/operon appeared to have a functional consequence, since the ΔeseE strain was outcompeted by wild-type E. tarda in a mixed infection in blue gourami fish. Collectively, our results demonstrate that EseE not only functions as a chaperone for EseC but also acts as a positive regulator controlling the expression of the translocon operon escC-eseE, thus contributing to the pathogenesis of E. tarda in fish. Copyright © 2016, American Society for Microbiology. All Rights Reserved.
Bondi, M.; Dallacasa, D.; Stanghellini, C.; Marchã, M. J. M.
We obtained two-epoch VLBA observations at 5 GHz of a list of radio galaxies drawn from the 200 mJy sample (Marcha et al. 1996). The objects selected for milli-arcsecond scale observations are classified, on the basis of their optical spectroscopic and polarimetric properties, as BL Lac objects, normal weak line radio galaxies, broad line radio galaxies, and transition objects (those with intermediate properties). We present preliminary results on the radio polarization properties, on the milli-arcsecond scale, of objects with different optical properties and discuss structural variations detected from the two epochs.
DEFF Research Database (Denmark)
Larsen, Jesper; Kuhnert, Peter; Frey, Joachim
2007-01-01
subclades, thus reaffirming the hypothesis of vertical inheritance of the leukotoxin operon. The presence of individual 5' flanking regions in M. haemolytica + M. glucosida and M. granulomatis reflects later genome rearrangements within each subclade. The evolution of the novel 5' flanking region in M...
Shuel, Michelle L; Karlowsky, Kathleen E; Law, Dennis K S; Tsang, Raymond S W
2011-12-01
Population biology of Haemophilus influenzae can be studied by multilocus sequence typing (MLST), and isolates are assigned sequence types (STs) based on nucleotide sequence variations in seven housekeeping genes, including fucK. However, the ST cannot be assigned if one of the housekeeping genes is absent or cannot be detected by the current protocol. Occasionally, strains of H. influenzae have been reported to lack the fucK gene. In this study, we examined the prevalence of this mutation among our collection of H. influenzae isolates. Of the 704 isolates studied, including 282 encapsulated and 422 nonencapsulated isolates, nine were not typeable by MLST owing to failure to detect the fucK gene. All nine fucK-negative isolates were nonencapsulated and belonged to various biotypes. DNA sequencing of the fucose operon region confirmed complete deletion of genes in the operon in seven of the nine isolates, while in the remaining two isolates, some of the genes were found intact or in parts. The significance of these findings is discussed.
Largemouth bass (Micropterus salmoides Lacépède: reproduction management and larval rearing in Italy
Directory of Open Access Journals (Sweden)
A. Dees
2010-01-01
Full Text Available Micropterus salmoides (Lacépède was originally present into the waters of the eastern United States of America, northern Mexico and southern Canada. This species can be distinguished from the other black basses by the fact that its mouth extends to and beyond the edge of the eye and the first and the second dorsal fins are almost separated by a deep dip and there are no scales on the soft rayed of the second dorsal fin.
Directory of Open Access Journals (Sweden)
CRETENOY L.
1997-04-01
Full Text Available La capture de plus de 400 larves de Coregonus lavaretus à 7 dates différentes dans le lac d'Annecy de mars à avril 1996 a permis d'étudier conjointement leur croissance et l'évolution de leur régime alimentaire. Les larves capturées ont une taille comprise entre 8,5 et 20 mm et un stade larvaire allant de 0 à 4, ces deux paramètres étant fortement liés. À mesure qu'elles grandissent, les larves qui consomment d'abord préférentiellement les stades larvaires des copépodes, puis leurs stades adultes, se nourrissent ensuite majoritairement de cladocères. La comparaison des structures de taille des proies ingérées et du zooplancton présent dans le lac conduit à évoquer la notion d'expérience acquise par les larves pour expliquer cette dérive alimentaire.
Aggregation of topological motifs in the Escherichia coli transcriptional regulatory network
Directory of Open Access Journals (Sweden)
Barabási Albert-László
2004-01-01
Full Text Available Abstract Background Transcriptional regulation of cellular functions is carried out through a complex network of interactions among transcription factors and the promoter regions of genes and operons regulated by them.To better understand the system-level function of such networks simplification of their architecture was previously achieved by identifying the motifs present in the network, which are small, overrepresented, topologically distinct regulatory interaction patterns (subgraphs. However, the interaction of such motifs with each other, and their form of integration into the full network has not been previously examined. Results By studying the transcriptional regulatory network of the bacterium, Escherichia coli, we demonstrate that the two previously identified motif types in the network (i.e., feed-forward loops and bi-fan motifs do not exist in isolation, but rather aggregate into homologous motif clusters that largely overlap with known biological functions. Moreover, these clusters further coalesce into a supercluster, thus establishing distinct topological hierarchies that show global statistical properties similar to the whole network. Targeted removal of motif links disintegrates the network into small, isolated clusters, while random disruptions of equal number of links do not cause such an effect. Conclusion Individual motifs aggregate into homologous motif clusters and a supercluster forming the backbone of the E. coli transcriptional regulatory network and play a central role in defining its global topological organization.
DEFF Research Database (Denmark)
Mygind, T; Birkelund, Svend; Christiansen, Gunna
1998-01-01
To investigate the intraspecies heterogeneity within the 16S rRNA gene of Mycoplasma hominis, five isolates with diverse antigenic profiles, variable/identical P120 hypervariable domains, and different 16S rRNA gene RFLP patterns were analysed. The 16S rRNA gene from the rrnB operon was amplified...
Conjugative Plasmid Transfer in Xylella fastidiosa Is Dependent on tra and trb Operon Functions.
Burbank, Lindsey P; Van Horn, Christopher R
2017-11-01
The insect-transmitted plant pathogen Xylella fastidiosa is capable of efficient horizontal gene transfer (HGT) and recombination. Natural transformation occurs at high rates in X. fastidiosa , but there also is evidence that certain strains of X. fastidiosa carry native plasmids equipped with transfer and mobilization genes, suggesting conjugation as an additional mechanism of HGT in some instances. Two operons, tra and trb , putatively encoding a conjugative type IV secretion system, are found in some but not all X. fastidiosa isolates, often on native plasmids. X. fastidiosa strains that carry the conjugative transfer genes can belong to different subspecies and frequently differ in host ranges. Using X. fastidiosa strain M23 ( X. fastidiosa subsp. fastidiosa ) or Dixon ( X. fastidiosa subsp. multiplex ) as the donor strain and Temecula ( X. fastidiosa subsp. fastidiosa ) as the recipient strain, plasmid transfer was characterized using the mobilizable broad-host-range vector pBBR5pemIK. Transfer of plasmid pBBR5pemIK was observed under in vitro conditions with both donor strains and was dependent on both tra and trb operon functions. A conjugative mechanism likely contributes to gene transfer between diverse strains of X. fastidiosa , possibly facilitating adaptation to new environments or different hosts. IMPORTANCE Xylella fastidiosa is an important plant pathogen worldwide, infecting a wide range of different plant species. The emergence of new diseases caused by X. fastidiosa , or host switching of existing strains, is thought to be primarily due to the high frequency of HGT and recombination in this pathogen. Transfer of plasmids by a conjugative mechanism enables movement of larger amounts of genetic material at one time, compared with other routes of gene transfer such as natural transformation. Establishing the prevalence and functionality of this mechanism in X. fastidiosa contributes to a better understanding of HGT, adaptation, and disease emergence
Directory of Open Access Journals (Sweden)
F.L.B. Cavalieri
2009-08-01
Full Text Available Foram avaliados os efeitos de duas fontes de gordura, Lac100® (Yakult, fonte de ácido graxo ômega-6, e linhaça em grão (Linum usitatissimum (LIN, fonte de ácido graxo ômega-3, sobre a digestibilidade aparente da matéria seca (DMS, proteína bruta (DPB, fibra em detergente neutro (DFDN, fibra em detergente ácido (DFDA e extrato etéreo (DEE, e concentrações sanguíneas de HDL, LDL, VLDL, colesterol, triglicerídeos, glicose, cálcio, fósforo, N-ureico e progesterona. Foram utilizadas 10 vacas da raça Holandesa em lactação, distribuídas nos dois tratamentos, em um delineamento estatístico inteiramente casualizado. Os animais alimentados com Lac100® apresentaram maiores valores de DFDN (57,44% vs. 50,80% e DEE (77,70% vs. 72,18% quando comparados aos alimentados com LIN. Os animais alimentados com Lac100® apresentaram maiores concentrações de LDL (111,00 vs. 45,46mg/dL, HDL (82,27 vs. 64,93mg/dL e colesterol total (203,60 vs. 116,13mg/dL e menor concentração de N-ureico (13,22 vs. 15,19mg/dL em relação aos animais alimentados com linhaça em grão. As concentrações sanguíneas de glicose, cálcio, fósforo e progesterona não foram alteradas. Os resultados sugerem que a fonte de gordura na dieta modifica a DFDN e a DEE e, as concentrações sanguíneas de LDL, HDL e colesterol total em vacas em lactação.The effect of two sources of fat, calcium salts of soybean oil, Lac100® (Yakult, a source of omega-6 fatty acids or whole flaxseed (Linum usitatissiumum, a source of omega-3 fatty acids were evaluated to determine the apparent digestibility of dry matter (DDM, crude protein (DCP, neutral detergent fiber (DNDF, acid detergent fiber (DADF, and ether extract (DEE; and blood concentrations of HDL, LDL, VLDL, cholesterol, triglycerides, glucose, calcium, phosphorus, N-urea, and progesterone. Ten lactating Holstein cows were allocated in two treatments and a completely randomized design was used. Cows fed Lac100® had higher
Multi-epoch intranight optical monitoring of eight radio-quiet BL Lac candidates
Kumar, P.; Gopal-Krishna; Stalin, C. S.; Chand, H.; Srianand, R.; Petitjean, P.
2017-10-01
For a new sample of eight weak-line quasars (WLQs) we report a sensitive search in 20 intranight monitoring sessions, for blazar-like optical flux variations on hour-like and longer time-scale (day/month/year-like). The sample consists exclusively of the WLQs that are not radio-loud and either have been classified as 'radio-weak probable BL Lac candidates' and/or are known to have exhibited at least one episode of large, blazar-like optical variability. Whereas only a hint of intranight variability is seen for two of these WLQs, J104833.5+620305.0 (z = 0.219) and J133219.6+622715.9 (z = 3.15), statistically significant internight variability at a few per cent level is detected for three of the sources, including the radio-intermediate WLQ J133219.6+622715.9 (z = 3.15) and the well-known bona fide radio-quiet WLQs J121221.5+534128.0 (z = 3.10) and WLQ J153259.9-003944.1 (z = 4.62). In the rest frame, this variability is intraday and in the far-ultraviolet band. On the time-scale of a decade, we find for three of the WLQs large brightness changes, amounting to 1.655 ± 0.009, 0.163 ± 0.010 and 0.144 ± 0.018 mag, for J104833.5+620305.0, J123743.1+630144.9 and J232428.4+144324.4, respectively. Whereas the latter two are confirmed radio-quiet WLQs, the extragalactic nature of J104833.5+620305.0 remains to be well established, thanks to the absence of any feature(s) in its available optical spectra. This study forms a part of our ongoing campaign of intranight optical monitoring of radio-quiet WLQs, in order to improve the understanding of this enigmatic class of active galactic nuclei and to look among them for a possible tiny, elusive population of radio-quiet BL Lacs.
Allen, Jeremy P; Hathway, Gareth J; Clarke, Neil J; Jowett, Mike I; Topps, Stephanie; Kendrick, Keith M; Humphrey, Patrick P A; Wilkinson, Lawrence S; Emson, Piers C
2003-05-01
The peptide somatostatin can modulate the functional output of the basal ganglia. The exact sites and mechanisms of this action, however, are poorly understood, and the physiological context in which somatostatin acts is unknown. Somatostatin acts as a neuromodulator via a family of five 7-transmembrane G protein-coupled receptors, SSTR1-5, one of which, SSTR2, is known to be functional in the striatum. We have investigated the role of SSTR2 in basal ganglia function using mice in which Sstr2 has been inactivated and replaced by the lacZ reporter gene. Analysis of Sstr2lacZ expression in the brain by beta-galactosidase histochemistry demonstrated a widespread pattern of expression. By comparison to previously published in situ hybridization and immunohistochemical data, Sstr2lacZ expression was shown to accurately recapitulate that of Sstr2 and thus provided a highly sensitive model to investigate cell-type-specific expression of Sstr2. In the striatum, Sstr2 expression was identified in medium spiny projection neurons restricted to the matrix compartment and in cholinergic interneurons. Sstr2 expression was not detected in any other nuclei of the basal ganglia except for a sparse number of nondopaminergic neurons in the substantia nigra. Microdialysis in the striatum showed Sstr2-null mice were selectively refractory to somatostatin-induced dopamine and glutamate release. In behavioural tests, Sstr2-null mice showed normal levels of locomotor activity and normal coordination in undemanding tasks. However, in beam-walking, a test of fine motor control, Sstr2-null mice were severely impaired. Together these data implicate an important neuromodulatory role for SSTR2 in the striatum.
International Nuclear Information System (INIS)
Piette, J.; Decuyper-Debergh, D.; Gamper, H.
1985-01-01
Double-stranded M13 phage DNA (M13 mp10 replicative form) was photoreacted with 4'-hydroxymethyl-4,5',8-trimethylpsoralen, using light of wavelength greater than 320 nm or greater than 390 nm to generate predominantly crosslinks or monoadducts, respectively. The damaged DNAs were scored for inactivation and mutagenesis after transfection into Escherichia coli. The appearance of light-blue or colorless plaques on indicator medium showed that mutation had occurred in the lac insert of the viral DNA. A comparison of the consequences of the two phototreatments with psoralen supports the idea that crosslinks are both more lethal and more mutagenic than monoadducts. Numerous mutant clones partially or totally deficient in beta-galactosidase were plaque-purified and amplified. The viral DNA of each clone was sequenced by the dideoxy chain-terminating procedure. All of the observed base-pair changes were mapped to the lac promoter region and consisted of 3 transition, 14 transversion, and 6 single base-pair frame-shift mutations. The predominant mutation was a T.A----G.C transversion
DEFF Research Database (Denmark)
Revelles, O.; Espinosa-Urgel, M.; Molin, Søren
2004-01-01
-aminovaleric acid and then further degraded to glutaric acid via the action of the davDT gene products. We show that the davDT genes form an operon transcribed from a single sigma(70)-dependent promoter. The relatively high level of basal expression from the davD promoter increased about fourfold in response...
Mohamaddoust, Reza; Haghighat, Abolfazl Toroghi; Sharif, Mohamad Javad Motahari; Capanni, Niccolo
2011-01-01
Wireless sensor networks (WSN) are currently being applied to energy conservation applications such as light control. We propose a design for such a system called a Lighting Automatic Control System (LACS). The LACS system contains a centralized or distributed architecture determined by application requirements and space usage. The system optimizes the calculations and communications for lighting intensity, incorporates user illumination requirements according to their activities and performs adjustments based on external lighting effects in external sensor and external sensor-less architectures. Methods are proposed for reducing the number of sensors required and increasing the lifetime of those used, for considerably reduced energy consumption. Additionally we suggest methods for improving uniformity of illuminance distribution on a workplane’s surface, which improves user satisfaction. Finally simulation results are presented to verify the effectiveness of our design. PMID:22164114
Spectroscopy of 10 γ -Ray BL Lac Objects at High Redshift
Energy Technology Data Exchange (ETDEWEB)
Paiano, Simona; Falomo, Renato [INAF, Osservatorio Astronomico di Padova, Vicolo dell’Osservatorio 5, I-35122 Padova (Italy); Landoni, Marco [INAF, Osservatorio Astronomico di Brera, Via E. Bianchi 46, I-23807 Merate (Italy); Treves, Aldo [Università degli Studi dell’Insubria, Via Valleggio 11, I-22100 Como (Italy); Scarpa, Riccardo [Instituto de Astrofisica de Canarias, C/O Via Lactea, s/n E-38205 La Laguna, Tenerife (Spain)
2017-08-01
We present optical spectra with high signal-to-noise ratio of 10 BL Lac objects detected at GeV energies by the Fermi satellite (3FGL catalog), which previous observations suggested are at relatively high redshift. The new observations, obtained at the 10 m Gran Telescopio Canarias, allowed us to find the redshift for J0814.5+2943 ( z = 0.703), and we can set a spectroscopic lower limit for J0008.0+4713 ( z > 1.659) and J1107.7+0222 ( z > 1.0735) on the basis of Mg ii intervening absorption features. In addition we confirm the redshifts for J0505.5+0416 ( z = 0.423) and J1450+5200 ( z > 2.470). Finally we contradict the previous z estimates for five objects (J0049.7+0237, J0243.5+7119, J0802.0+1005, J1109.4+2411, and J2116.1+3339).
Role of radiation therapy in bladder cancer in the Saguenay-Lac Saint-Jean area
International Nuclear Information System (INIS)
Brochet, F.; Barrette, L.R.
1998-01-01
Bladder cancer is more frequent in Quebec, especially in Saguenay-Lac Saint-Jean than in other Canadian provinces and in the USA. From 1983 to 1996, only 78 patients presenting with bladder cancer received external beam radiation therapy. Sixty-eight were treated with curative intent Overall survival rates were 70% at 3 years, 66% at 5 years, and 40% at 10 years. Retrospective analysis of these cases and literature review show that preoperative radiation therapy is useful in the management of bladder cancer, especially in T3 tumors. It is also useful for patients whose tumor objectively responds to radiation therapy, without an increase in morbidity. (authors)
Evaluation of critical indicators in the process of acquiring supplies and services LAC-UFPE
Caetano, V. F.; Ferreira, C. V.; dos Santos, M. J.; Honorato, F. A.
2015-01-01
In laboratories linked to public universities and accredited by the NBR ISO/IEC 17025, to meet efficiently item 4.6 (procurement of supplies and services) is a challenge that can be accomplished by programming based on historical purchases and services. In this study, we evaluated the critical procurement items to meet the quality management system of the LAC-UFPE: reagents, certified reference material, of equipment parts, maintenance and calibration of equipment and instruments. It was found that the most critical item is the certified reference material, the purchase or repair of which must be expedited within 125 days prior to the receipt to occur within the desired period.
Analysis of spontaneous deletions and gene amplification in the lac region of Escherichia coli
International Nuclear Information System (INIS)
Albertini, A.M.; Hofer, M.; Calos, M.P.; Tlsty, T.D.; Miller, J.H.
1983-01-01
Spontaneous rearrangements, such as large deletions and duplications, have important implications for the structure of the genome. It is therefore of great interest to analyze these events at the molecular level. We have constructed derivatives of a lacI-Z fusion strain, which allow us to study deletions in a more systematic manner than was previously possible. These derivatives have been used to investigate how frequently larger deletions (> 700 bp) occur between short homologies on both recA and recA - strains and to determine the effect of the lengths of the short homologies and of the distance between homologies on the frequency of deletion formation. 38 references, 11 figures
Geology and age of the Lac a la Perdrix fenite, southern Gatineau district, Quebec
International Nuclear Information System (INIS)
Hogarth, D.D.
1996-01-01
The Lac a Ia Perdrix fenite lies in the Central Metasedimentary Belt of the Grenville Province. This 30 m wide fenite, adjacent to a narrow calciocarbonatite sill, replaces diopside-oligoclase gneiss and is composed of magnesio-arfvedsonite, aegirine, microcline, albite, and fluorapatite. Near the contact with carbonatite, it contains appreciable monazite and barite whereas aegirine virtually disappears. Fenitization probably took place early in the igneous stage of carbonatite development. A Pb/U monazite age of 1026 ± 2 Ma is thought to date fenite formation. Together with published data, this age shows that carbonatite intruded metamorphic rocks near the close of the Grenville Orogeny. (author). 33 refs., 4 tabs., 5 figs
Geology and age of the Lac a la Perdrix fenite, southern Gatineau district, Quebec
Energy Technology Data Exchange (ETDEWEB)
Hogarth, D D [Ottawa Univ., ON (Canada). Dept. of Geology; VanBreemen, O [Geological Survey of Canada, Ottawa, ON (Canada)
1997-12-31
The Lac a Ia Perdrix fenite lies in the Central Metasedimentary Belt of the Grenville Province. This 30 m wide fenite, adjacent to a narrow calciocarbonatite sill, replaces diopside-oligoclase gneiss and is composed of magnesio-arfvedsonite, aegirine, microcline, albite, and fluorapatite. Near the contact with carbonatite, it contains appreciable monazite and barite whereas aegirine virtually disappears. Fenitization probably took place early in the igneous stage of carbonatite development. A Pb/U monazite age of 1026 {+-} 2 Ma is thought to date fenite formation. Together with published data, this age shows that carbonatite intruded metamorphic rocks near the close of the Grenville Orogeny. (author). 33 refs., 4 tabs., 5 figs.
Directory of Open Access Journals (Sweden)
Uzma Qaisar
Full Text Available The Pseudomonas aeruginosa fimbrial structures encoded by the cup gene clusters (cupB and cupC contribute to its attachment to abiotic surfaces and biofilm formation. The P. aeruginosa pvcABCD gene cluster encodes enzymes that synthesize a novel isonitrile functionalized cumarin, paerucumarin. Paerucumarin has already been characterized chemically, but this is the first report elucidating its role in bacterial biology. We examined the relationship between the pvc operon and the cup gene clusters in the P. aeruginosa strain MPAO1. Mutations within the pvc genes compromised biofilm development and significantly reduced the expression of cupB1-6 and cupC1-3, as well as different genes of the cupB/cupC two-component regulatory systems, roc1/roc2. Adjacent to pvc is the transcriptional regulator ptxR. A ptxR mutation in MPAO1 significantly reduced the expression of the pvc genes, the cupB/cupC genes, and the roc1/roc2 genes. Overexpression of the intact chromosomally-encoded pvc operon by a ptxR plasmid significantly enhanced cupB2, cupC2, rocS1, and rocS2 expression and biofilm development. Exogenously added paerucumarin significantly increased the expression of cupB2, cupC2, rocS1 and rocS2 in the pvcA mutant. Our results suggest that pvc influences P. aeruginosa biofilm development through the cup gene clusters in a pathway that involves paerucumarin, PtxR, and different cup regulators.
Purriños, Laura; Franco, Daniel; Carballo, Javier; Lorenzo, José M
2012-12-01
The effect of the length of salting time on volatile compounds throughout the manufacture of dry-cured "lacón" was studied using a purge-and-trap extraction and GC/MS analysis. For this study, six treatments of "lacón" were salted with different amounts of salt (LS (3 days of salting), MS (4 days of salting) and HS (5 days of salting)). The total area of volatile compounds increased significantly (Psalting time increased. Significant differences were found for the total area of all aldehydes for each salting time at the end of process. Hexanal presented the most relative abundance, showing highest content in HS treatments while LS treatments showed the lowest one at the end of salting, post-salting and drying-ripening stage. The influence of salting time on the content of 3-Octen-2-one was significant on salting stage (Psalting time affected (Psalting and at the end of drying-ripening stage. The salting time affected significantly (Psalt level (P>0.05) was detected on total hydrocarbons and total furans at the end of process. Copyright © 2012 Elsevier Ltd. All rights reserved.
Azzolina, B A; Yuan, X; Anderson, M S; El-Sherbeini, M
2001-04-01
We have cloned the Pseudomonas aeruginosa cell wall biosynthesis and cell division gene cluster that corresponds to the mra operon in the 2-min region of the Escherichia coli chromosome. The organization of the two chromosomal regions in P. aeruginosa and E. coli is remarkably similar with the following gene order: pbp3/pbpB, murE, murF, mraY, murD, ftsW, murG, murC, ddlB, ftsQ, ftsA, ftsZ, and envA/LpxC. All of the above P. aeruginosa genes are transcribed from the same strand of DNA with very small, if any, intragenic regions, indicating that these genes may constitute a single operon. All five amino acid ligases, MurC, MurD, MurE, MurF, and DdlB, in addition to MurG and MraY were cloned in expression vectors. The four recombinant P. aeruginosa Mur ligases, MurC, MurD, MurE, and MurF were overproduced in E. coli and purified as active enzymes. Copyright 2001 Academic Press.
Induction of lacI- mutations in Escherichia coli cells after single and split-dose irradiation
International Nuclear Information System (INIS)
Kozubek, S.; Ryznar, L.
1992-01-01
In the lacI system of Escherichia coli, X-ray mutagenesis follows a linear-quadratic curve with suppression; the survival curve is exponential. Dose fractionation leads to nearly complete repair of premutational lesions during an incubation interval of 3.5 h. Repair starts with a delay of 1.5-2 h, suggesting the involvement of an inducible repair/mutation fixation system. The dose-dependence of mutagenesis is described by a simple model assuming two hits being required. A probable explanation might be that the premutagenic lesions consist of two closely spaced lesions on the opposite strands of the DNA molecule. (author)
Structural evidence for induced fit and a mechanism for sugar/H+ symport in LacY
DEFF Research Database (Denmark)
Mirza, Osman Asghar; Guan, Lan; Verner, Gill
2006-01-01
Cation-coupled active transport is an essential cellular process found ubiquitously in all living organisms. Here, we present two novel ligand-free X-ray structures of the lactose permease (LacY) of Escherichia coli determined at acidic and neutral pH, and propose a model for the mechanism...... of coupling between lactose and H+ translocation. No sugar-binding site is observed in the absence of ligand, and deprotonation of the key residue Glu269 is associated with ligand binding. Thus, substrate induces formation of the sugar-binding site, as well as the initial step in H+ transduction....
Induction of UMUC+ gene expression in Escherichia coli irradiated by near ultraviolet light
International Nuclear Information System (INIS)
Sato, N.; Ohnishi, T.; Tano, K.; Nozu, K.; Yamamoto, K.
1985-01-01
The induction of umu + gene expression caused by irradiation with near ultraviolet light (BLB; black light blue) was studied in Escherichia coli K-12 strains with special reference to the effects of SOS repair deficiencies. The umuC + gene expression was measured as the enzymic activity of β-galactosidase which is regulated by the promoter of the umuC + operon carried in a plasmid DNA carrying a promoter of umuC + operon, a umuD + gene and a umuC + -lacZ + gene fusion. A high induction of the umuC + gene expression was observed in the uvrA cells in the case of BLB or UV irradiation as compared with the parental wild-type cells. Caffeine inhibited the induction of the umuC + gene expression due to BLB or UV irradiation in both strains. There was very little induction in lexA and recA mutants. In contrast with UV irradiation, there was no killing of cells by BLB irradiation in any strain (wild, uvrA, lexA and recA). Possible implications of the experimental results were discussed. (author)
Dash, Hirak R; Basu, Subham; Das, Surajit
2017-04-01
Biofilm-forming mercury-resistant marine bacterium Bacillus cereus BW-201B has been explored to evident that the bacterial biofilm-EPS (exopolymers) trap inorganic mercury but subsequently release EPS-bound mercury for induction of mer operon-mediated volatilization of inorganic mercury. The isolate was able to tolerate 50 ppm of mercury and forms biofilm in presence of mercury. mer operon-mediated volatilization was confirmed, and -SH was found to be the key functional group of bacterial EPS responsible for mercury binding. Biofilm-EPS-bound mercury was found to be internalized to the bacterial system as confirmed by reversible conformational change of -SH group and increased expression level of merA gene in a timescale experiment. Biofilm-EPS trapped Hg after 24 h of incubation, and by 96 h, the volatilization process reaches to its optimum confirming the internalization of EPS-bound mercury to the bacterial cells. Biofilm disintegration at the same time corroborates the results.
ANTI-CORRELATED OPTICAL FLUX AND POLARIZATION VARIABILITY IN BL LAC
Energy Technology Data Exchange (ETDEWEB)
Gaur, Haritma [Inter-University Centre for Astronomy and Astrophysics (IUCAA), Ganeshkhind, Pune 411 007 (India); Gupta, Alok C. [Aryabhatta Research Institute of Observational Sciences (ARIES), Manora Peak, Nainital 263 129 (India); Wiita, Paul J. [Department of Physics, The College of New Jersey, P.O. Box 7718, Ewing, NJ 08628-0718 (United States); Uemura, Makoto; Itoh, Ryosuke; Sasada, Mahito, E-mail: haritma@iucaa.ernet.in [Hiroshima Astrophysical Science Center, Hiroshima University, Kagamiyama 1-3-1, Higashi-Hiroshima 739-8526 (Japan)
2014-01-20
We present the results of photometric (V band) and polarimetric observations of the blazar BL Lac during 2008-2010 using TRISPEC attached to the KANATA 1.5 m telescope in Japan. The data reveal a great deal of variability ranging from days to months with detection of strong variations in fractional polarization. The V band flux strongly anticorrelates with the degree of polarization during the first of two observing seasons but not during the second. The direction of the electric vector, however, remained roughly constant during all of our observations. These results are consistent with a model with at least two emission regions being present, with the more variable component having a polarization direction nearly perpendicular to that of the relatively quiescent region so that a rising flux can produce a decline in degree of polarization. We also computed models involving helical jet structures and single transverse shocks in jets and show that they might also be able to agree with the anticorrelations between flux and fractional polarization.
Konopleva, Maria N; Khrulnova, Svetlana A; Baranova, Ancha; Ekimov, Leonid V; Bazhenov, Sergey V; Goryanin, Ignatiy I; Manukhov, Ilya V
2016-05-13
Lux-operon of psychrophilic bacteria Aliivibrio logei contains two copies of luxR and is regulated by Type I quorum sensing (QS). Activation of lux-operon of psychrophilic bacteria A. logei by LuxR1 requires about 100 times higher concentrations of autoinducer (AI) than the activation by LuxR2. On the other hand, LuxR1 does not require GroEL/ES chaperonin for its folding and cannot be degraded by protease Lon, while LuxR2 sensitive to Lon and requires GroEL/ES. Here we show that at 10(-5) - 10(-4)М concentrations of AI a combination of luxR1 and luxR2 products is capable of activating the Pr-promoters of A. logei lux-operon in Escherichia coli independently of GroEL/ES and protease Lon. The presence of LuxR1 assists LuxR2 in gro(-) cells when AI was added at high concentration, while at low concentration of AI in a cell LuxR1 decreases the LuxR2 activity. These observations may be explained by the formation of LuxR1/LuxR2 heterodimers that act in complex with AI independently from GroEL/ES and protease Lon. This study expands current understanding of QS regulation in A. logei as it implies cooperative regulation of lux-operon by LuxR1 and LuxR2 proteins. Copyright © 2016 Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Álvarez-Morales Ariel
2011-05-01
Full Text Available Abstract Background Pseudomonas syringae pv. phaseolicola, the causal agent of halo blight disease in beans, produces a toxin known as phaseolotoxin, in whose synthesis participate a group of genes organized within the genome in a region known as the "Pht cluster". This region, which is thought to have been acquired by horizontal gene transfer, includes 5 transcriptional units, two monocistronic (argK, phtL and three polycistronic (phtA, phtD, phtM, whose expression is temperature dependent. So far, the regulatory mechanisms involved in phaseolotoxin synthesis have not been elucidated and the only well-established fact is the requirement of low temperatures for its synthesis. In this work, we searched for regulatory proteins that could be involved in phaseolotoxin synthesis, focusing on the regulation of the phtD operon. Results In this study we identified the global regulator IHF (Integration Host Factor, which binds to the promoter region of the phtD operon, exerting a negative effect on the expression of this operon. This is the first regulatory protein identified as part of the phaseolotoxin synthesis system. Our findings suggest that the Pht cluster was similarly regulated in the ancestral cluster by IHF or similar protein, and integrated into the global regulatory mechanism of P. syringae pv. phaseolicola, after the horizontal gene transfer event by using the host IHF protein. Conclusion This study identifies the IHF protein as one element involved in the regulation of phaseolotoxin synthesis in P. syringae pv. phaseolicola NPS3121 and provides new insights into the regulatory mechanisms involved in phaseolotoxin production.
Mathematical Biology Modules Based on Modern Molecular Biology and Modern Discrete Mathematics
Davies, Robin; Hodge, Terrell; Enyedi, Alexander
2010-01-01
We describe an ongoing collaborative curriculum materials development project between Sweet Briar College and Western Michigan University, with support from the National Science Foundation. We present a collection of modules under development that can be used in existing mathematics and biology courses, and we address a critical national need to introduce students to mathematical methods beyond the interface of biology with calculus. Based on ongoing research, and designed to use the project-based-learning approach, the modules highlight applications of modern discrete mathematics and algebraic statistics to pressing problems in molecular biology. For the majority of projects, calculus is not a required prerequisite and, due to the modest amount of mathematical background needed for some of the modules, the materials can be used for an early introduction to mathematical modeling. At the same time, most modules are connected with topics in linear and abstract algebra, algebraic geometry, and probability, and they can be used as meaningful applied introductions into the relevant advanced-level mathematics courses. Open-source software is used to facilitate the relevant computations. As a detailed example, we outline a module that focuses on Boolean models of the lac operon network. PMID:20810955
Mathematical biology modules based on modern molecular biology and modern discrete mathematics.
Robeva, Raina; Davies, Robin; Hodge, Terrell; Enyedi, Alexander
2010-01-01
We describe an ongoing collaborative curriculum materials development project between Sweet Briar College and Western Michigan University, with support from the National Science Foundation. We present a collection of modules under development that can be used in existing mathematics and biology courses, and we address a critical national need to introduce students to mathematical methods beyond the interface of biology with calculus. Based on ongoing research, and designed to use the project-based-learning approach, the modules highlight applications of modern discrete mathematics and algebraic statistics to pressing problems in molecular biology. For the majority of projects, calculus is not a required prerequisite and, due to the modest amount of mathematical background needed for some of the modules, the materials can be used for an early introduction to mathematical modeling. At the same time, most modules are connected with topics in linear and abstract algebra, algebraic geometry, and probability, and they can be used as meaningful applied introductions into the relevant advanced-level mathematics courses. Open-source software is used to facilitate the relevant computations. As a detailed example, we outline a module that focuses on Boolean models of the lac operon network.
Panitz, J C; Zverlov, V V; Pham, V T T; Stürzl, S; Schieder, D; Schwarz, W H
2014-02-01
A new solventogenic bacterium, strain GT6, was isolated from standing water sediment. 16S-rRNA gene analysis revealed that GT6 belongs to the heterogeneous Clostridium tetanomorphum group of bacteria exhibiting 99% sequence identity with C. tetanomorphum 4474(T). GT6 can utilize a wide range of carbohydrate substrates including glucose, fructose, maltose, xylose and glycerol to produce mainly n-butanol without any acetone. Additional products of GT6 metabolism were ethanol, butyric acid, acetic acid, and trace amounts of 1,3-propanediol. Medium and substrate composition, and culture conditions such as pH and temperature influenced product formation. The major fermentation product from glycerol was n-butanol with a final concentration of up to 11.5 g/L. 3% (v/v) glycerol lead to a total solvent concentration of 14 g/L within 72 h. Growth was not inhibited by glycerol concentrations as high as 15% (v/v). The solventogenesis genes crt, bcd, etfA/B and hbd composing the bcs (butyryl-CoA synthesis) operon of C. tetanomorphum GT6 were sequenced. They occur in a genomic arrangement identical to those in other solventogenic clostridia. Furthermore, the sequence of a potential regulator gene highly similar to that of the NADH-sensing Rex family of regulatory genes was found upstream of the bcs operon. Potential binding sites for Rex have been identified in the promoter region of the bcs operon of solvent producing clostridia as well as upstream of other genes involved in NADH oxidation. This indicates a fundamental role of Rex in the regulation of fermentation products in anaerobic, and especially in solventogenic bacteria. Copyright © 2013 Elsevier GmbH. All rights reserved.
HIV-1 Tat regulates the expression of the dcw operon and stimulates the proliferation of bacteria.
Wei, Jinsong; Zhang, Yumin; Knapp, Pamela E; Zhao, Tianyong
2016-01-01
Infections of pathogenic bacteria are very common in acquired immunodeficiency syndrome (AIDS) patients. However, the biological effects of HIV-1 Tat on bacteria are incompletely understood. In this study, HIV-1 Tat was expressed in Escherichia coli and Pseudomonas aeruginosa (PA01) to investigate its biological effects on bacteria. Bacterial cells expressing either HIV-1 Tat1-86 (Tat1-86) or HIV-1 Tat1-72 (Tat1-72) grow significantly faster than those with either only an empty vector or an unrelated control (GFP or Rluc). Supplementation of purified HIV-1 Tat1-86 or Tat1-101 protein into bacterial culture medium stimulated the growth of both E. coli and PA01. The expression profile of certain cell division-associated genes, such as those in the division cell wall (dcw) operon (ftsA, ftsQ, ftsW and ftsZ), yafO and zipA, was altered in HIV-1 Tat1-86 expressing E. coli BL21(DE3). Furthermore, the expression of firefly luciferase (Fluc) reporter gene, when engineered for control by the dcw promoter and terminator, was enhanced by HIV-1 Tat in E. coli, confirming that HIV-1 Tat transcriptionally regulates the expression of the dcw operon. The finding that HIV-1 Tat stimulates bacterial growth whether it is produced intracellularly or applied extracellularly may have relevance for HIV patients who are highly susceptible to opportunistic bacterial infections. Contents category: Viruses -Retroviruses. The GenBank accession number for the sequence of HIV-1 Tat1-86 is AF324439.1. Copyright © 2015 Elsevier Ltd. All rights reserved.
Zhu, Y; Lin, E C
1988-05-01
L-Fucose is used by Escherichia coli through an inducible pathway mediated by a fucP-encoded permease, a fucI-encoded isomerase, a fucK-encoded kinase, and a fucA-encoded aldolase. The adolase catalyzes the formation of dihydroxyacetone phosphate and L-lactaldehyde. Anaerobically, lactaldehyde is converted by a fucO-encoded oxidoreductase to L-1,2-propanediol, which is excreted. The fuc genes belong to a regulon comprising four linked operons: fucO, fucA, fucPIK, and fucR. The positive regulator encoded by fucR responds to fuculose 1-phosphate as the effector. Mutants serially selected for aerobic growth on propanediol became constitutive in fucO and fucA [fucO(Con) fucA(Con)], but noninducible in fucPIK [fucPIK(Non)]. An external suppressor mutation that restored growth on fucose caused constitutive expression of fucPIK. Results from this study indicate that this suppressor mutation occurred in crp, which encodes the cyclic AMP-binding (or receptor) protein. When the suppressor allele (crp-201) was transduced into wild-type strains, the recipient became fucose negative and fucose sensitive (with glycerol as the carbon and energy source) because of impaired expression of fucA. The fucPIK operon became hyperinducible. The growth rate on maltose was significantly reduced, but growth on L-rhamnose, D-galactose, L-arabinose, glycerol, or glycerol 3-phosphate was close to normal. Lysogenization of fuc+ crp-201 cells by a lambda bacteriophage bearing crp+ restored normal growth ability on fucose. In contrast, lysogenization of [fucO(Con)fucA(Con)fucPIK(Non)crp-201] cells by the same phage retarded their growth on fucose.
Munoz, R.; Caylor, E.; Yost, C. L.; Drake, C.; Ladwig, J. L.; Myrbo, A.; Howes, T.
2014-12-01
Wild rice (Zizania palustris L.) is an aquatic grass with spiritual and subsistence significance to Native people of the Great Lakes region of North America. Mud Lake (Mashkiigwaagamaag), located on the Fond du Lac Band of Lake Superior Chippewa Reservation in Carlton County, Minnesota, USA, once supported an extensive population of wild rice (manoomin). However, early 20th century attempts to ditch and drain surrounding wetlands for landuse intensification severely altered the natural hydrological system that supports wild rice. Fond du Lac Resource Management (FDLRM) technicians are currently working to increase the wild rice population in Mud Lake. As part of these efforts, this phytolith study was undertaken to better understand how wild rice abundance has fluctuated over the past 400 years, with particular emphasis on the 19th and 20th centuries. Phytoliths are microscopic opal silica plant remains that are incorporated into soils and lake sediments after the plant-parts that contain them decay. Wild rice produces phytolith morphotypes that are unequivocally diagnostic. Mud Lake core MNMN-MUD11-1C-1P-1 (46°43'38.39"N, 92°42'2.45"W) was piston cored by LacCore (National Lacustrine Core Facility) and FDLRM technicians on 24 May 2011. Initial core descriptions, multi-sensor core logging, phytolith sampling and phytolith extractions were completed during the summer of 2014 at LacCore. Wild rice phytolith identification and quantification was conducted on twelve samples using brightfield microscopy at 400x magnification. Wild rice phytolith concentration values ranged from 68 to 2,300 phytoliths/cm3. Wild rice accumulation rates ranged from 9 to 383 phytoliths/ cm2/yr, peaking in 1952 AD. Wild rice abundance in Mud Lake appears to be influenced by a complex set of variables that include anthropogenic disturbance, climatic events and aquatic plant community succession.
Boeseman, M.
1969-01-01
Two new Surinam species of Hypostomus Lacépède are described, and their relationship is discussed; a group of three forms from eastern Surinam and (French) Guyane (gymnorhynchus-complex) is reconsidered; the species H. plecostomus (Linnaeus) is reported to hitherto survive in the lacustrine
NMR studies on the structure and dynamics of lac operator DNA
International Nuclear Information System (INIS)
Lee, S.C.
1985-01-01
Nuclear Magnetic Resonance spectroscopy was used to elucidate the relationships between structure, dynamics and function of the gene regulatory sequence corresponding to the lactose operon operator of Escherichia coli. The length of the DNA fragments examined varied from 13 to 36 base pair, containing all or part of the operator sequence. These DNA fragments are either derived genetically or synthesized chemically. Resonances of the imino protons were assigned by one dimensional inter-base pair nuclear Overhauser enhancement (NOE) measurements. Imino proton exchange rates were measured by saturation recovery methods. Results from the kinetic measurements show an interesting dynamic heterogeneity with a maximum opening rate centered about a GTG/CAC sequence which correlates with the biological function of the operator DNA. This particular three base pair sequence occurs frequently and often symmetrically in prokaryotic nd eukaryotic DNA sites where one anticipates specific protein interaction for gene regulation. The observed sequence dependent imino proton exchange rate may be a reflection of variation of the local structure of regulatory DNA. The results also indicate that the observed imino proton exchange rates are length dependent
Zeng, Lin; Chakraborty, Brinta; Farivar, Tanaz; Burne, Robert A
2017-11-01
The glucose/mannose-phosphotransferase system (PTS) permease EII Man encoded by manLMN in the dental caries pathogen Streptococcus mutans has a dominant influence on sugar-specific, CcpA-independent catabolite repression (CR). Mutations in manL affect energy metabolism and virulence-associated traits, including biofilm formation, acid tolerance, and competence. Using promoter::reporter fusions, expression of the manLMN and the fruRKI operons, encoding a transcriptional regulator, a fructose-1-phosphate kinase and a fructose-PTS permease EII Fru , respectively, was monitored in response to carbohydrate source and in mutants lacking CcpA, FruR, and components of EII Man Expression of genes for EII Man and EII Fru was directly regulated by CcpA and CR, as evinced by in vivo and in vitro methods. Unexpectedly, not only was the fruRKI operon negatively regulated by FruR, but also so was manLMN Carbohydrate transport by EII Man had a negative influence on expression of manLMN but not fruRKI In agreement with the proposed role of FruR in regulating these PTS operons, loss of fruR or fruK substantially altered growth on a number of carbohydrates, including fructose. RNA deep sequencing revealed profound changes in gene regulation caused by deletion of fruK or fruR Collectively, these findings demonstrate intimate interconnection of the regulation of two major PTS permeases in S. mutans and reveal novel and important contributions of fructose metabolism to global regulation of gene expression. IMPORTANCE The ability of Streptococcus mutans and other streptococcal pathogens to survive and cause human diseases is directly dependent upon their capacity to metabolize a variety of carbohydrates, including glucose and fructose. Our research reveals that metabolism of fructose has broad influences on the regulation of utilization of glucose and other sugars, and mutants with changes in certain genes involved in fructose metabolism display profoundly different abilities to grow and
Directory of Open Access Journals (Sweden)
Opsata Mona
2010-08-01
Full Text Available Abstract Background The class IIa bacteriocin, pediocin PA-1, has clear potential as food preservative and in the medical field to be used against Gram negative pathogen species as Enterococcus faecalis and Listeria monocytogenes. Resistance towards class IIa bacteriocins appear in laboratory and characterization of these phenotypes is important for their application. To gain insight into bacteriocin resistance we studied mutants of E. faecalis V583 resistant to pediocin PA-1 by use of transcriptomic analyses. Results Mutants of E. faecalis V583 resistant to pediocin PA-1 were isolated, and their gene expression profiles were analyzed and compared to the wild type using whole-genome microarray. Significantly altered transcription was detected from about 200 genes; most of them encoding proteins involved in energy metabolism and transport. Glycolytic genes were down-regulated in the mutants, but most of the genes showing differential expression were up-regulated. The data indicate that the mutants were relieved from glucose repression and putative catabolic responsive elements (cre could be identified in the upstream regions of 70% of the differentially expressed genes. Bacteriocin resistance was caused by reduced expression of the mpt operon encoding the mannose-specific phosphoenolpyruvate:carbohydrate phosphotransferase system (PTS, and the same transcriptional changes were seen in a mptD-inactivated mutant. This mutant also had decreased transcription of the whole mpt operon, showing that the PTS is involved in its own transcriptional regulation. Conclusion Our data confirm the important role of mannose PTS in class IIa bacteriocin sensitivity and we demonstrate its importance involving global carbon catabolite control.
Yang, Mingyi; Aamodt, Randi M; Dalhus, Bjørn; Balasingham, Seetha; Helle, Ina; Andersen, Pernille; Tønjum, Tone; Alseth, Ingrun; Rognes, Torbjørn; Bjørås, Magnar
2011-06-10
The ada operon of Mycobacterium tuberculosis, which encodes a composite protein of AdaA and AlkA and a separate AdaB/Ogt protein, was characterized. M. tuberculosis treated with N-methyl-N'-nitro-N-nitrosoguanidine induced transcription of the adaA-alkA and adaB genes, suggesting that M. tuberculosis mount an inducible response to methylating agents. Survival assays of the methyltransferase defective Escherichia coli mutant KT233 (ada ogt), showed that expression of the adaB gene rescued the alkylation sensitivity. Further, adaB but not adaA-alkA complemented the hypermutator phenotype of KT233. Purified AdaA-AlkA and AdaB possessed methyltransferase activity. These data suggested that AdaB counteract the cytotoxic and mutagenic effect of O(6)-methylguanine, while AdaA-AlkA most likely transfers methyl groups from innocuous methylphosphotriesters. AdaA-AlkA did not possess alkylbase DNA glycosylase activity nor rescue the alkylation sensitivity of the E. coli mutant BK2118 (tag alkA). We propose that AdaA-AlkA is a positive regulator of the adaptive response in M. tuberculosis. It thus appears that the ada operon of M. tuberculosis suppresses the mutagenic effect of alkylation but not the cytotoxic effect of lesions such as 3-methylpurines. Collectively, these data indicate that M. tuberculosis hypermutator strains with defective adaptive response genes might sustain robustness to cytotoxic alkylation DNA damage and confer a selective advantage contributing to host adaptation. Copyright © 2011 Elsevier B.V. All rights reserved.
Transcription analysis of the Streptomyces coelicolor A3(2) rrnA operon
DEFF Research Database (Denmark)
van Wezel, G P; Krab, I M; Douthwaite, S
1994-01-01
Transcription start sites and processing sites of the Streptomyces coelicolor A3(2) rrnA operon have been investigated by a combination of in vivo and in vitro transcription analyses. The data from these approaches are consistent with the existence of four in vivo transcription sites, corresponding...... to the promoters P1-P4. The transcription start sites are located at -597, -416, -334 and -254 relative to the start of the 16S rRNA gene. Two putative processing sites were identified, one of which is similar to a sequence reported earlier in S. coelicolor and other eubacteria. The P1 promoter is likely...... common to P2, P3 and P4 is not similar to any other known consensus promoter sequence. In fast-growing mycelium, P2 appears to be the most frequently used promoter. Transcription from all of the rrnA promoters decreased during the transition from exponential to stationary phase, although transcription...