Hsia, Te-Chun; Huang, Yi-Ping; Jiang, Yi-Wen; Chen, Hsin-Yu; Cheng, Zheng-Yu; Hsiao, Yung-Ting; Chen, Cheng-Yen; Peng, Shu-Fen; Chueh, Fu-Shin; Chou, Yu-Cheng; Chung, Jing-Gung
2018-04-01
Some lung cancer patients treated with gefitinib develop resistance to this drug resulting in unsatisfactory treatment outcomes. Phenethyl isothiocyanate (PEITC), present in our common cruciferous vegetables, exhibits anticancer activities in many human cancer cell lines. Currently, there is no available information on the possible modification of gefitinib resistance of lung cancer in vitro by PEITC. Thus, the effects of PEITC on gefitinib resistant lung cancer NCI-H460 cells were investigated in vitro. The total cell viability, apoptotic cell death, production of reactive oxygen species (ROS) and Ca 2+ , levels of mitochondria membrane potential (ΔΨ m ) and caspase-3, -8 and -9 activities were measured by flow cytometry assay. PEITC induced chromatin condensation was examined by DAPI staining. PEITC-induced cell morphological changes, decreased total viable cell number and induced apoptotic cell death in NCI-H460 and NCI-H460/G cells. PEITC decreased ROS production in NCI-H460 cells, but increased production in NCI-H460/G cells. PEITC increased Ca 2+ production, decreased the levels of ΔΨ m and increased caspase-3, -8 and -9 activities in both NCI-H460 and NCI-H460/G cells. Western blotting was used to examine the effect of apoptotic cell death associated protein expression in NCI-H460 NCI-H460/G cells after exposure to PEITC. Results showed that PEITC increased expression of cleaved caspase-3, PARP, GADD153, Endo G and pro-apoptotic protein Bax in NCI-H460/G cells. Based on these results, we suggest that PEITC induces apoptotic cell death via the caspase- and mitochondria-dependent pathway in NCI-H460/G cells. Copyright© 2018, International Institute of Anticancer Research (Dr. George J. Delinasios), All rights reserved.
Directory of Open Access Journals (Sweden)
Sarah Fernandes Teixeira
2013-12-01
Full Text Available OBJECTIVE: To test the effectiveness of combining conventional antineoplastic drugs (cisplatin and etoposide with metformin in the treatment of non-small cell lung cancer in the NCI-H460 cell line, in order to develop new therapeutic options with high efficacy and low toxicity.METHODS: We used the 3-(4,5-dimethylthiazol-2-yl-2,5-diphenyltetrazolium bromide (MTT assay and calculated the combination index for the drugs studied.RESULTS: We found that the use of metformin as monotherapy reduced the metabolic viability of the cell line studied. Combining metformin with cisplatin or etoposide produced a synergistic effect and was more effective than was the use of cisplatin or etoposide as monotherapy.CONCLUSIONS: Metformin, due to its independent effects on liver kinase B1, had antiproliferative effects on the NCI-H460 cell line. When metformin was combined with cisplatin or etoposide, the cell death rate was even higher.
Wattanathamsan, Onsurang; Treesuwan, Surassawadee; Sritularak, Boonchoo; Pongrakhananon, Varisa
2018-03-01
The life-threatening potential of lung cancer has increased over the years due to its acquisition of chemotherapeutic resistance, especially to cisplatin, a first-line therapy. In response to this development, researchers have turned their attention to several compounds derived from natural origins, including cypripedin (CYP), a phenanthrenequinone substance extracted from Dendrobium densiflorum. The aim of the present study was to investigate the ability of CYP to induce apoptosis and enhance cisplatin-mediated death of human lung cancer NCI-H460 cells using cell viability and apoptosis assays. The induction of apoptosis by CYP was observed at a concentration of > 50 μM with the appearance of morphological changes, including DNA condensation and chromatin fragmentation. Together with, CYP was able to activate caspase-3 and downregulate the anti-apoptotic proteins Bcl-2 and Bcl-xL. Also, a non-cytotoxic dose of CYP synergistically potentiated the effect of cisplatin in non-small cell lung cancer line H460 cells, which clearly exhibited the apoptotic phenotype. Western blot analysis revealed that the underlying mechanism involved the downregulation of anti-apoptotic Bcl-xL, whereas the levels of other apoptotic regulatory proteins were not altered. This study provides interesting information on the potent effect of CYP as a chemotherapeutic sensitizer that could be further developed to improve the clinical outcomes of lung cancer patients.
Chlorella vulgaris Induces Apoptosis of Human Non-Small Cell Lung Carcinoma (NSCLC) Cells.
Zhang, Zhi-Dong; Liang, Kai; Li, Kun; Wang, Guo-Quan; Zhang, Ke-Wei; Cai, Lei; Zhai, Shui-Ting; Chou, Kuo-Chen
2017-01-01
Chlorella vulgaris (C. vulgaris), a unicellular green microalga, has been widely used as a food supplement and reported to have antioxidant and anticancer properties. The current study was designed to assess the cytotoxic, apoptotic, and DNA-damaging effects of C. vulgaris growth factor (CGF), hot water C. vulgaris extracts, inlung tumor A549 and NCI-H460 cell lines. A549 cells, NCI-H460 cells, and normal human fibroblasts were treated with CGF at various concentrations (0-300 μg/ml) for 24 hr. The comet assay and γH2AX assay showed DNA damage in A549 and NCI-H460 cells upon CGF exposure. Evaluation of apoptosis by the TUNEL assay and DNA fragmentation analysis by agarose gel electrophoresis showed that CGF induced apoptosis in A549 and NCI-H460 cells. Chlorella vulgaris hot water extract induced apoptosis and DNA damage in human lung carcinoma cells. CGF can thus be considered a potential cytotoxic or genotoxic drug for treatment of lung carcinoma. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.
Directory of Open Access Journals (Sweden)
Xiaoyan Zhang
2013-05-01
Full Text Available Objective(s: Although tumor necrosis factor-related apoptosis-inducing ligand (TRAIL can selectively induce apoptosis in tumor cells, more than half of tumors including non-small cell lung cancer (NSCLC exhibit TRAIL-resistance. The purpose of this study was to determine whether subtoxic-dose cisplatin and TRAIL could synergistically enhance apoptosis on NSCLC cells and investigate its underlying mechanisms. Materials and Methods:NCI-H460 and A549 cells were treated with TRAIL alone, cisplatin alone or combination treatment in this study. The cytotoxicity was evaluated according to Sulforhodamine B assay, and apoptosis was examined using Hoechst 33342 staining and flow cytometry. The mRNA and protein levels of TRAIL receptors and apoptotic proteins including caspase-8, caspase-9, Bcl-2 and Bax were determined by RT-PCR and Western blotting, respectively. Results:Our results showed that NCI-H460 cells were sensitive to TRAIL, whereas A549 cells were resistant. However, subtoxic-dose cisplatin could enhance the both cells to TRAIL-mediated cell proliferation inhibition and apoptosis. The underlying mechanisms might be associated with the down-regulation of DcR2 and up-regulation of Caspase-8, Caspase-9 and Bax. Conclusion:Subtoxic-dose cisplatin could enhance both TRAIL- sensitive and TRAIL- resistant NSCLC cells to TRAIL-mediated apoptosis. These findings motivated further studies to evaluate such a combinatory therapeutic strategy against NSCLC in the animal models.
Choi, Seon Young; Kim, Hang-Rae; Ryu, Pan Dong; Lee, So Yeong
2017-02-21
Side-population (SP) cells that exclude anti-cancer drugs have been found in various tumor cell lines. Moreover, SP cells have a higher proliferative potential and drug resistance than main population cells (Non-SP cells). Also, several ion channels are responsible for the drug resistance and proliferation of SP cells in cancer. To confirm the expression and function of voltage-gated potassium (Kv) channels of SP cells, these cells, as well as highly expressed ATP-binding cassette (ABC) transporters and stemness genes, were isolated from a gefitinib-resistant human lung adenocarcinoma cell line (NCI-H460), using Hoechst 33342 efflux. In the present study, we found that mRNA expression of Kv channels in SP cells was different compared to Non-SP cells, and the resistance of SP cells to gefitinib was weakened with a combination treatment of gefitinib and Kv channel blockers or a Kv7 opener, compared to single-treatment gefitinib, through inhibition of the Ras-Raf signaling pathway. The findings indicate that Kv channels in SP cells could be new targets for reducing the resistance to gefitinib.
International Nuclear Information System (INIS)
Liao, Hui-Fen; Kuo Cheng-Deng; Yang, Yuh-Cheng; Lin, Chin-Ping; Tai, Hung-Chi; Chen, Yu-Jen; Chen, Yu-Yawn
2005-01-01
Resveratrol, a polyphenol in red wine, possesses many pharmacological activities including cardio-protection, chemoprevention, anti-tumor effects, and nuclear factor-kappa B (NF-κB) inactivation. The present study was designed to evaluate the effects and possible mechanism of resveratrol in enhancing radiosensitivity of lung cancer cells. Human non-small cell lung cancer NCI-H838 cells were irradiated with or without resveratrol pretreatment. The surviving fraction and sensitizer enhancement ratio (SER) were estimated by using a colony formation assay and linear-quadratic model. The cell-cycle distribution was evaluated by using prospidium iodide staining and flow cytometry. An enzyme-linked immunosorbent assay (ELISA)-based assay with immobilized oligonucleotide was performed to assess the DNA binding activity of NF-κB. Resveratrol had no direct growth-inhibitory effect on NCI-H838 cells treated for 24 hours with doses up to 25 μM. Pretreatment with resveratrol significantly enhanced cell killing by radiation, with an SER up to 2.2. Radiation activated NF-κB, an effect reversed by resveratrol pretreatment. Resveratrol resulted in a decrease of cells in the G 0 /G 1 phase and an increase in the S phase. Our results demonstrate that resveratrol enhances the radiosensitivity of NCI-H838 cells accompanied by NF-κB inhibition and S-phase arrest. (author)
Srinual, Songpol; Chanvorachote, Pithi; Pongrakhananon, Varisa
2017-04-01
Cancer stem cells (CSCs) have been reported as a major cause of cancer metastasis and the failure of cancer treatment. Cumulative studies have indicated that protein kinase B (Akt) and its downstream signaling pathway, including CSC markers, play a critical role in the aggressive behavior of this cancer. In this study, we investigated whether vanillin, a major component in Vanilla planifolia seed, could suppress cancer stemness phenotypes and related proteins in the human non-small cell lung cancer NCI‑H460 cell line. A non-toxic concentration of vanillin suppressed spheroid and colony formation, two hallmarks of the cancer stemness phenotype, in vitro in NCI‑H460 cells. Western blot analysis revealed that the CSC markers CD133 and ALDH1A1 and the associated transcription factors, Oct4 and Nanog, were extensively downregulated by vanillin. Vanillin also attenuated the expression and activity of Akt, a transcription regulator upstream of CSCs, an action that was confirmed by treatment with the Akt inhibitor perifosine. Furthermore, the ubiquitination of Akt was elevated in response to vanillin treatment prior to proteasomal degradation. This finding indicates that vanillin can inhibit cancer stem cell-like behavior in NCI‑H460 cells through the induction of Akt-proteasomal degradation and reduction of downstream CSC transcription factors. This inhibitory effect of vanillin may be an alternative approach in the treatment against lung cancer metastasis and its resistance to chemotherapy.
Kang, Kyoung Ah; Piao, Mei Jing; Madduma Hewage, Susara Ruwan Kumara; Ryu, Yea Seong; Oh, Min Chang; Kwon, Taeg Kyu; Chae, Sungwook; Hyun, Jin Won
2016-07-01
Fisetin (3,3',4',7-tetrahydroxyflavone), a dietary flavonoid compound, is currently being investigated for its anticancer effect in various cancer models, including lung cancer. Recent studies show that fisetin induces cell growth inhibition and apoptosis in the human non-small cell lung cancer line NCI-H460. In this study, we investigated whether fisetin can induce endoplasmic reticulum (ER) stress-mediated apoptosis in NCI-H460 cells. Fisetin induced mitochondrial reactive oxygen species (ROS) and characteristic signs of ER stress: ER staining; mitochondrial Ca(2+) overload; expression of ER stress-related proteins; glucose-regulated protein (GRP)-78, phosphorylation of protein kinase RNA (PKR)-like endoplasmic reticulum kinase (PERK) and phosphorylation of eukaryotic initiation factor-2 α subunit; cleavage of activating transcription factor-6; phosphorylation of inositol-requiring kinase-1 and splicing of X-box transcription factor-1; induction of C/EBP homologous protein and cleaved caspase-12. siRNA-mediated knockdown of CHOP and ATF-6 attenuated fisetin-induced apoptotic cell death. In addition, fisetin induced phosphorylation of ERK, JNK, and p38 MAPK. Moreover, silencing of the MAPK signaling pathway prevented apoptotic cell death. In summary, our results indicate that, in NCI-H460 cells, fisetin induces apoptosis and ER stress that is mediated by induction of the MAPK signaling pathway.
The In Vitro Anti-Tumor Activity of Phycocyanin against Non-Small Cell Lung Cancer Cells
Directory of Open Access Journals (Sweden)
Shuai Hao
2018-05-01
Full Text Available Phycocyanin, a type of functional food colorant, is shown to have a potent anti-cancer property. Non-small cell lung cancer (NSCLC is one of the most aggressive form of cancers with few effective therapeutic options. Previous studies have demonstrated that phycocyanin exerts a growth inhibitory effect on NSCLC A549 cells. However, its biological function and underlying regulatory mechanism on other cells still remain unknown. Here, we investigated the in vitro function of phycocyanin on three typical NSCLC cell lines, NCI-H1299, NCI-H460, and LTEP-A2, for the first time. The results showed that phycocyanin could significantly induce apoptosis, cell cycle arrest, as well as suppress cell migration, proliferation, and the colony formation ability of NSCLC cells through regulating multiple key genes. Strikingly, phycocyanin was discovered to affect the cell phenotype through regulating the NF-κB signaling of NSCLC cells. Our findings demonstrated the anti-neoplastic function of phycocyanin and provided valuable information for the regulation of phycocyanin in NSCLC cells.
International Nuclear Information System (INIS)
He Wenqian; Liu Zhonghua
2007-01-01
Objective: To study the effect of bcl-2 antisense oligodexynucleotides on chemotherapy efficacy of Vp-16 on human small cell lung cancer cell line NCI-H69. Methods: Cultured NCI-H69 cells were derided into 4 groups: bcl-2 antisense oligodexynucleotides (ASODN) added, sense oligodexynucleotides (SODN) added, nonsense oligodexynucleotides (NSODN) added and control (no nucleotides added), the oligodexynucleotides were transfected into the cultured cells with oligofectamine. The cellular expression of Bcl-2 protein 72h later was examined with Western-Blot. The four different groups of cultured tumor cells were treated with etopside(Vp-16) at different concentrations (0, 0.25, 0.5, 1.0, 2.0 and 4.0 μg/ml) for 48hr then the cell survival fraction was assessed with MTY test. Results: The apoptotic rate of cells in the ASODN group was significantly higher than that of the control group, also, the survival fraction of cells in ASODN group was significantly lower than that of the control group. The Bcl-2 protein expression in ASODN group was significantly lower than that in the control group, but no inhibition was observed in SODN and NSODN groups. Conclusion: The bcl-2 ASODN could enhance the sensitivity to chemotherapy with Vp-16 in small cell lung cancer cell line NCI-H69 by effectively blocking bcl-2 gene expression. (authors)
Analysis of 125I-[Tyr3] octreotide receptors of NCI-H466 cell line
International Nuclear Information System (INIS)
Sun Junjie; Fan Wo; Xu Yujie; Zhang Youjiu; Zhu Ran
2002-01-01
Objective: To study the affinity of small cell lung carcinoma to [Tyr 3 ] octreotide (TOC). Methods: Taking 125 I-[Tyr 3 ] octreotide (labeled by chloramine-T method), as the ligand, small cell lung carcinoma NCI-H466 cell line was inspected for the receptor-binding points and affinity constant. Results: The radio-chemical purity of 125 I-TOC purified through sephadex G-10 was higher than 95%. Receptor analysis study showed that the expression of somatostatin receptors on NCI-H446 cells was numerous (Bmax = 1.17 x 10 5 /cell) with strong affinity to 125 I-TOC (Kd = 0.56 nM). Conclusion: Labeled TOC could be used for small cell lung carcinoma receptor imaging and radio-pharmaceutical therapy
Wang, Huan-qin; Jin, Jian-jun; Wang, Jing
2014-01-01
Arctigenin, a dibenzylbutyrolactone lignan, enhances cisplatin-mediated cell apoptosis in cancer cells. Here, we sought to investigate the effects of arctigenin on cisplatin-treated non-small-cell lung cancer (NSCLC) H460 cells. The 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide assay and annexin-V/propidium iodide staining were performed to analyze the proliferation and apoptosis of H460 cells. Arctigenin dose-dependently suppressed cell proliferation and potentiated cell apoptosis, coupled with increased cleavage of caspase-3 and poly(ADP-ribose) polymerase. Moreover, arctigenin sensitized H460 cells to cisplatin-induced proliferation inhibition and apoptosis. Arctigenin alone or in combination with cisplatin had a significantly lower amount of survivin. Ectopic expression of survivin decreased cell apoptosis induced by arctigenin (P arctigenin (P arctigenin has a therapeutic potential in combina-tion with chemotherapeutic agents for NSLC. © 2013 Wiley Periodicals, Inc.
Radiosensitizing effect of PSMC5, a 19S proteasome ATPase, in H460 lung cancer cells
International Nuclear Information System (INIS)
Yim, Ji-Hye; Yun, Hong Shik; Lee, Su-Jae; Baek, Jeong-Hwa; Lee, Chang-Woo; Song, Ji-Young; Um, Hong-Duck; Park, Jong Kuk; Kim, Jae-Sung; Park, In-Chul; Hwang, Sang-Gu
2016-01-01
The function of PSMC5 (proteasome 26S subunit, ATPase 5) in tumors, particularly with respect to cancer radioresistance, is not known. Here, we identified PSMC5 as a novel radiosensitivity biomarker, demonstrating that radiosensitive H460 cells were converted to a radioresistance phenotype by PSMC5 depletion. Exposure of H460 cells to radiation induced a marked accumulation of cell death-promoting reactive oxygen species, but this effect was blocked in radiation-treated H460 PSMC5-knockdown cells through downregulation of the p53-p21 pathway. Interestingly, PSMC5 depletion in H460 cells enhanced both AKT activation and MDM2 transcription, thereby promoting the degradation of p53 and p21 proteins. Furthermore, specific inhibition of AKT with triciribine or knockdown of MDM2 with small interfering RNA largely restored p21 expression in PSMC5-knockdown H460 cells. Our data suggest that PSMC5 facilitates the damaging effects of radiation in radiation-responsive H460 cancer cells and therefore may serve as a prognostic indicator for radiotherapy and molecular targeted therapy in lung cancer patients. - Highlights: • PSMC5 is a radiation-sensitive biomarker in H460 cells. • PSMC5 depletion inhibits radiation-induced apoptosis in H460 cells. • PSMC5 knockdown blocks ROS generation through inhibition of the p53-p21 pathway. • PSMC5 knockdown enhances p21 degradation via AKT-dependent MDM2 stabilization.
Li, Yan; Zhang, Li-Ping; Dai, Fang; Yan, Wen-Jing; Wang, Hai-Bo; Tu, Zhi-Shan; Zhou, Bo
2015-09-09
Curcumin, derived from the dietary spice turmeric, holds promise for cancer prevention. This prompts much interest in investigating the action mechanisms of curcumin and its analogues. Two symmetrical hexamethoxy-diarylpentadienones (1 and 2) as cucumin analogues were reported to possess significantly enhanced cytotoxicity compared with the parent molecule. However, the detailed mechanisms remain unclear. In this study, compounds 1 and 2 were identified as the G2/M cell cycle arrest agents to mediate the cytotoxicity toward NCI-H460 cells via Michael acceptor-dependent redox intervention. Compared with curcumin, they could more easily induce a burst of reactive oxygen species (ROS) and collapse of the redox buffering system. One possible reason is that they could more effectively target intracellular TrxR to convert this antioxidant enzyme into a ROS promoter. Additionally, they caused up-regulation of p53 and p21 and down-regulation of redox-sensitive Cdc25C along with cyclin B1/Cdk1 in a Michael acceptor- and ROS-dependent fashion. Interestingly, in comparison with compound 2, compound 1 displayed a relatively weak ability to generate ROS but increased cell cycle arrest activity and cytotoxicity probably due to its Michael acceptor-dependent microtubule-destabilizing effect and greater GST-inhibitory activity, as well as its enhanced cellular uptake. This work provides useful information for understanding Michael acceptor-dependent and redox-mediated cytotoxic mechanisms of curcumin and its active analogues.
Moody, Terry W.; Switzer, Christopher; Santana-Flores, Wilmarie; Ridnour, Lisa A.; Berna, Marc; Thill, Michelle; Jensen, Robert T.; Sparatore, Anna; Del Soldato, Piero; Yeh, Grace C; Roberts, David D.; Giaccone, Giuseppe; Wink, David A.
2009-01-01
The effects of dithiolethione-modified valproate, diclofenac and sulindac on non-small cell lung cancer (NSCLC) cells were investigated. Sulfur(S)-valproate and S-diclofenac at 1 μg/ml concentrations significantly reduced prostaglandin (PG)E2 levels in NSCLC cell lines A549 and NCI-H1299 as did the COX-2 inhibitor DuP-697. In vitro, S-valproate, S-diclofenac and S-sulindac half-maximally inhibited the clonal growth of NCI-H1299 cells at 6, 6 and 15 μg/ml, respectively. Using the MTT assay, 10...
Breviscapine suppresses the growth of non-small cell lung cancer
Indian Academy of Sciences (India)
Breviscapine (BVP) has previously been shown to inhibit the proliferation of hepatocellular carcinoma cells.However, little is known about the effects of BVP on non-small cell lung cancer (NSCLC) growth. Here, we aimedto study the effects of BVP on human NSCLC growth. We employed A549, NCL-H460 and A549 cells ...
Anti-tumor effect of bisphosphonate (YM529 on non-small cell lung cancer cell lines
Directory of Open Access Journals (Sweden)
Date Hiroshi
2007-01-01
Full Text Available Abstract Background YM529 is a newly developed nitrogen-containing bisphosphonate (BP classified as a third-generation BP that shows a 100-fold greater potency against bone resorption than pamidronate, a second-generation BP. This agent is, therefore expected to be extremely useful clinically for the treatment of osteoporosis and hypercalcemia. Recently, YM529 as well as other third-generation BPs have also been shown to exert anti-tumor effects against various types of cancer cells both in vitro or/and in vivo. In this study, we investigate the anti-tumor effect of YM529 on non-small cell lung cancer (NSCLC. Methods Direct anti-tumor effect of YM529 against 8 NSCLC cell lines (adenocarcinoma: H23, H1299, NCI-H1819, NCI-H2009, H44, A549, adenosquamous cell carcinoma: NCI-H125, squamous cell carcinoma: NCI-H157 were measured by MTS assay and calculated inhibition concentration 50 % (IC50 values. YM529 induced apoptosis of NCI-H1819 was examined by DNA fragmentation of 2 % agarose gel electrophoresis and flowcytometric analysis (sub-G1 method. We examined where YM529 given effect to apoptosis of NSCLC cells in signaling pathway of the mevalonate pathway by western blotting analysis. Results We found that there was direct anti-tumor effect of YM529 on 8 NSCLC cell lines in a dose-dependent manner and their IC50 values were 2.1 to 7.9 μM and YM529 induced apoptosis and G1 arrest cell cycle with dose-dependent manner and YM529 caused down regulation of phospholyration of ERK1/2 in signaling pathways of NSCLC cell line (NCI-H1819. Conclusion Our study demonstrate that YM529 showed direct anti-tumor effect on NSCLC cell lines in vitro, which supports the possibility that third-generation BPs including YM529 can be one of therapeutic options for NSCLC.
LENUS (Irish Health Repository)
Alam, Mahmood
2012-02-03
BACKGROUND: Cyclooxygenase-2 enzyme (COX-2) is overexpressed in human non-small cell lung cancer (NSCLC) but is not expressed in small cell lung cancer. Selective COX-2 inhibitors have been shown to induce apoptosis in NSCLC cells, an effect which is associated with the regulation of intracellular MAP kinase (MAPK) signal pathways. Our aims were to characterize the effects of COX-2 inhibition by rofecoxib on apoptosis in human NSCLC and small cell lung cancer cell lines. METHODS: The human NSCLC cell line NCI-H2126 and small cell lung cancer cell line DMS-79 were used. Constitutive COX-2 protein levels were first determined by Western blot test. Levels of apoptosis were evaluated by using propidium iodide staining on FACScan analysis after incubation of NCI-H2126 and DMS-79 with p38 MAPK inhibitor SB202190 (25 ?microM), NF-kappaB inhibitor SN50 (75 microg\\/mL), and rofecoxib at 100 and 250 microM. All statistical analysis was performed by analysis of variance. RESULTS: Western blot test confirmed the presence of COX-2 enzyme in NCI-H2126 and absence in DMS-79. Interestingly, rofecoxib treatment demonstrated a dose-dependent increase in apoptosis in both cell lines. Given this finding, the effect of rofecoxib on NF-kappaB and p38 MAPK pathways was also examined. Apoptosis in both cell lines was unaltered by SN50, either alone or in combination with rofecoxib. A similar phenomenon was observed in NCI-H2126 cells treated with SB202190, either alone or in combination with rofecoxib. In contrast, p38 MAPK inhibition greatly upregulated DMS-79 apoptosis in a manner that was unaltered by the addition of rofecoxib. CONCLUSIONS: Rofecoxib led to a dose-dependent increase in apoptosis in both tumor cell lines. This effect occurred independently of COX-2, NF-kappaB, and p38 MAPK pathways in DMS-79 cells. As such, rofecoxib must act on alternative pathways to regulate apoptosis in human small cell lung cancer cells.
Directory of Open Access Journals (Sweden)
Lingling Tang
2018-02-01
Full Text Available Lung squamous cell carcinoma (LSCC is a common histological lung cancer subtype, but unlike lung adenocarcinoma, limited therapeutic options are available for treatment. Curcumin, a natural compound, may have anticancer effects in various cancer cells, but how it may be used to treat LSCC has not been well studied. Here, we applied curcumin to a human NCI-H292 LSCC cell line to test anticancer effects and explored underlying potential mechanisms of action. Curcumin treatment inhibited NCI-H292 cell growth and increased FOXA2 expression in a time-dependent manner. FOXA2 expression was decreased in LSCC tissues compared with adjacent normal tissues and knockdown of FOXA2 increased NCI-H292 cells proliferation. Inhibition of cell proliferation by curcumin was attenuated by FOXA2 knockdown. Moreover inhibition of STAT3 pathways by curcumin increased FOXA2 expression in NCI-H292 cells whereas a STAT3 activator (IL-6 significantly inhibited curcumin-induced FOXA2 expression. Also, SOCS1 and SOCS3, negative regulators of STAT3 activity, were upregulated by curcumin treatment. Thus, curcumin inhibited human NCI-H292 cells growth by increasing FOXA2 expression via regulation of STAT3 signaling pathways.
Proteasome inhibitors block DNA repair and radiosensitize non-small cell lung cancer.
Directory of Open Access Journals (Sweden)
Kyle R Cron
Full Text Available Despite optimal radiation therapy (RT, chemotherapy and/or surgery, a majority of patients with locally advanced non-small cell lung cancer (NSCLC fail treatment. To identify novel gene targets for improved tumor control, we performed whole genome RNAi screens to identify knockdowns that most reproducibly increase NSCLC cytotoxicity. These screens identified several proteasome subunits among top hits, including the topmost hit PSMA1, a component of the core 20 S proteasome. Radiation and proteasome inhibition showed synergistic effects. Proteasome inhibition resulted in an 80-90% decrease in homologous recombination (HR, a 50% decrease in expression of NF-κB-inducible HR genes BRCA1 and FANCD2, and a reduction of BRCA1, FANCD2 and RAD51 ionizing radiation-induced foci. IκBα RNAi knockdown rescued NSCLC radioresistance. Irradiation of mice with NCI-H460 xenografts after inducible PSMA1 shRNA knockdown markedly increased murine survival compared to either treatment alone. Proteasome inhibition is a promising strategy for NSCLC radiosensitization via inhibition of NF-κB-mediated expression of Fanconi Anemia/HR DNA repair genes.
International Nuclear Information System (INIS)
Toulany, Mahmoud; Mihatsch, Julia; Holler, Marina; Chaachouay, Hassan; Rodemann, H. Peter
2014-01-01
Background and purpose: Cisplatin activates ataxia-telangiectasia-mutated (ATM), a protein with roles in DNA repair, cell cycle progression and autophagy. We investigated the radiosensitizing effect of cisplatin with respect to its effect on ATM pathway activation. Material and methods: Non-small cell lung cancer cells (NSCLC) cell lines (A549, H460) and human fibroblast (ATM-deficient AT5, ATM-proficient 1BR3) cells were used. The effects of cisplatin combined with irradiation on ATM pathway activity, clonogenicity, DNA double-strand break (DNA-DSB) repair and cell cycle progression were analyzed with Western blotting, colony formation and γ-H2AX foci assays as well as FACS analysis, respectively. Results: Cisplatin radiosensitized H460 cells, but not A549 cells. Radiosensitization of H460 cells was not due to impaired DNA-DSB repair, increased apoptosis or cell cycle dysregulation. The lack of radiosensitization demonstrated for A549 cells was associated with cisplatin-mediated stimulation of ATM (S1981) and AMPKα (T172) phosphorylation and autophagy. However, in both cell lines inhibition of ATM and autophagy by KU-55933 and chloroquine diphosphate (CQ) respectively resulted in a significant radiosensitization. Combined treatment with the AMPK inhibitor compound-C led to radiosensitization of A549 but not of H460 cells. As compared to the treatment with KU-55933 alone, radiosensitivity of A549 cells was markedly stimulated by the combination of KU-55933 and cisplatin. However, the combination of CQ and cisplatin did not modulate the pattern of radiation sensitivity of A549 or H460 cells. In accordance with the results that cisplatin via stimulation of ATM activity can abrogate its radiosensitizing effect, ATM deficient cells were significantly sensitized to ionizing radiation by cisplatin. Conclusion: The results obtained indicate that ATM targeting can potentiate cisplatin-induced radiosensitization
Paracytosis of Haemophilus influenzae through cell layers of NCI-H292 lung epithelial cells
van Schilfgaarde, M.; van Alphen, L.; Eijk, P.; Everts, V.; Dankert, J.
1995-01-01
Haemophilus influenzae penetrates the respiratory epithelium during carriage and invasive disease, including respiratory tract infections. We developed an in vitro model system consisting of lung epithelial NCI-H292 cells on permeable supports to study the passage of H. influenzae through lung
Investigation of internalization and cytotoxicity of 125I-[Tyr3]-octreotide in NCI-H446 cell line
International Nuclear Information System (INIS)
Sun Junjie; Fan Wo; Xu Yujie; Zhang Youjiu; Zhu Ran; Hu Mingjiang
2004-01-01
Objective: To investigate the [Tyr 3 ]-octreotide (TOC) internalizing capacity of NCI-H446 cell line, and the cytotoxicity of 125 I-TOC in NCI-H446 cell line. To assess the therapeutic radiopharmaceutical potentiality of 125 I-TOC for the somatostatin receptor (SSTR) positive tumor. Methods: NCI-H446 cells were incubated together with 125 I-TOC for different periods of time, the amount of internalized 125 I-TOC and the 125 I-TOC bound on the cellular nucleus were detected with γ counter, respectively. The viability of the cells was analyzed by a 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay at different time points with various doses of 125 I-TOC, free 125 I and TOC. Results: 125 I-TOC was internalized into the nucleus and bound on the nucleus in a time-dependent manner. 125 I-TOC bound on the nucleus increased to the highest level at 24 h, the amount of nucleus bound 125 I-TOC at 24 h was 7 times higher than that at 0.5 h. Cytotoxicity of 125 I-TOC in SSTR positive NCI-H446 cells was also dose- and time-dependent. The supreme effect of cytotoxicity was found at 96 h with 74 kBq 125 I-TOC, the survival ratio of cells was reduced to (44.8 ± 7.2)%. Conclusions: 125 I-TOC can be internalized into SSTR positive cells mediated by SSTR. The NCI-H446 cells can be killed by Auger electron emitting from 125 I-TOC. Effect of cytotoxicity showed dose- and time-dependent
Directory of Open Access Journals (Sweden)
Allison A. Atnip
2017-02-01
Full Text Available Anthocyanins are the largest class of water soluble plant pigments and a common part of the human diet. They may have many potential health benefits, including antioxidant, anti-inflammatory, anti-cancer, and cardioprotective activities. However, anthocyanin metabolism is not well understood. Studies suggest that anthocyanins absorption may occur in the stomach, in which the acidic pH favors anthocyanin stability. A gastric epithelial cell line (NCI-N87 has been used to study the behavior of anthocyanins at a pH range of 3.0–7.4. This work examines the effects of time (0–3 h, concentration (50–1500 µM, and pH (3.0, 5.0, 7.4 on the transport and uptake of anthocyanins using NCI-N87 cells. Anthocyanins were transported from the apical to basolateral side of NCI-N87 cells in time and dose dependent manners. Over the treatment time of 3 h the rate of transport increased, especially with higher anthocyanin concentrations. The non-linear rate of transport may suggest an active mechanism for the transport of anthocyanins across the NCI-N87 monolayer. At apical pH 3.0, higher anthocyanin transport was observed compared to pH 5.0 and 7.4. Reduced transport of anthocyanins was found to occur at apical pH 5.0.
International Nuclear Information System (INIS)
Paudyal, P.; Paudyal, B.; Hanaoka, Hirofumi
2010-01-01
Non-small cell lung carcinomas (NSCLC) overexpress the Her2/neu gene in approximately 59% of cases. Trastuzumab, a humanized monoclonal antibody, interferes with Her2 signaling and is approved for the treatment of Her2/neu overexpressing breast cancer. However, its therapeutic use in Her2/neu overexpressing NSCLC remains obscure. The present study aimed to determine the role of 64 Cu-labeled trastuzumab positron emission tomography (PET) for non-invasive imaging of Her2/neu expression in NSCLC. Trastuzumab was conjugated with the bifunctional chelator 1, 4, 7, 10-tetraazacyclododecane-1, 4, 7, 10-tetraacetic acid (DOTA) and radiolabeled with 64 Cu. The molecular specificity of DOTA-trastuzumab was determined in NSCLC cell lines with Her2/neu overexpression (NCI-H2170) and negative expression (NCI-H520). Imaging of Her2/neu expression was performed in NCI-H2170 tumor-bearing mice with 64 Cu-DOTA-trastuzumab PET and 64 Cu-DOTA-immunoglobulin G (IgG). In vitro studies revealed specific binding of DOTA-trastuzumab in the Her2/neu positive NCI-H2170 cells, while no binding was seen in the Her2/neu negative NCI-H520 cell line. Biodistribution and PET studies revealed a significantly high accumulation of 64 Cu-DOTA-trastuzumab in the Her2/neu overexpressing NCI-H2170 tumor at 24 and 48 h post-injection (21.4±1.4% and 23.2±5.1% injection dose/gram (% ID/g), respectively). PET imaging of Her2/neu negative NCI-H520 tumors showed much less uptake of 64 Cu-DOTA-trastuzumab (4.0% ID/g). The NCI-H2170 tumor uptake of 64 Cu-DOTA-trastuzumab was significantly higher than that of 64 Cu-DOTA-IgG (P 64 Cu-DOTA-trastuzumab showed a very clear image of a Her2/neu positive tumor and appeared to be effective as a PET tracer for imaging of Her2/neu gene expression in NSCLC, suggesting its potential clinical use for identifying patients that might benefit from trastuzumab-based therapy. (author)
International Nuclear Information System (INIS)
Wang, Yingyan; Wang, Wei; Wang, Siyan; Wang, Jiarui; Shao, Shujuan; Wang, Qi
2008-01-01
Chemotherapy resistance remains a major obstacle for the treatment of small cell lung cancer (SCLC). Glucose-regulated protein 78 (GRP78), an endoplasmic reticulum chaperone, plays a critical role in chemotherapy resistance in some cancers. However, whether the suppression of the chaperone can enhance the sensitivity of chemotherapy in SCLC is still unclear. The SCLC NCI-H446 cells were divided into three groups: BAPTA-AM→A23187-treated group, A23187-treated group and control-group. Immunofluorescence, western blot and RT-PCR were used to assess the expression of GRP78 at both protein and mRNA levels. Cell apoptosis and the cell cycle distributions of the cells were analyzed by flow cytometry in order to evaluate the therapeutic sensitivity to VP-16. The expression of GRP78 at both protein and mRNA levels in the BAPTA-AM→A23187-treated cells dramatically decreased as compared to that in both A23187-treated and control groups. After treatment by VP-16, the percentage of apoptotic cells in BAPTA-AM→A23187-treated cells were: 33.4 ± 1.01%, 48.2 ± 1.77%, 53.0 ± 1.43%, 56.5 ± 2.13%, respectively, corresponding to the concentrations of BAPTA-AM 10, 15, 25, 40 μM, which was statistically significant high in comparison with the A23187-treated group and untreated-group (7.18 ± 1.03% and 27.8 ± 1.45%, respectively, p < 0.05). The results from analysis of cell cycle distribution showed that there was a significantly decreased in G 1 phase and a dramatically increased in S phase for the BAPTA-AM→A23187-treated cells as compared with the untreated cells. BAPTA-AM is a strong inhibitor of GRP78 in the NCI-H446 cell line, the down-regulation of GRP78 can significantly increase the sensitivity to VP-16. The suppression of GRP78 may offer a new surrogated therapeutic approach to the clinical management of lung cancer
Effects of Monoclonal Antibody Cetuximab on Proliferation of Non-small Cell Lung Cancer Cell lines
Directory of Open Access Journals (Sweden)
Zhen CHEN
2010-08-01
Full Text Available Background and objective The epidermal growth factor receptor (EGFR monoclonal antibody cetuximab has been used widely in non-small cell lung cancer patients. The aim of this study is to explore the effect of lung cancer cells (A549, H460, H1299, SPC-A-1 which were treated by cetuximab in vitro. Methods We studied the effects of increasing concentrations of cetuximab (1 nmol/L-625 nmol/L in four human lung cancer cell lines (A549, SPC-A-1, H460, H1229. CCK8 measured the inhibition of cell proliferation in each group. A549, SPC-A-1 were marked by PI and the statuses of apoptosis were observed. Western blot were used to detect the proliferation-related signaling protein and apoptosis-related protein in A549. Results The treatment with cetuximab resulted in the effect on cell proliferation and apoptosis in a time- and dosedependent manner. The expression of activated key enzymes (p-AKT, p-EGFR, p-MAPK in EGFR signaling transduction pathway were down-regulated more obviously. Conclusion Cetuximab is an effective targeted drug in the treatment of lung cancer cell lines, tissues, most likely to contribute to the inhibition of key enzymes in EGFR signaling transduction pathway.
Tang, Zheng-Hai; Cao, Wen-Xiang; Wang, Zhao-Yu; Lu, Jia-Hong; Liu, Bo; Chen, Xiuping; Lu, Jin-Jian
2017-08-01
Chelerythrine (CHE), a natural benzo[c]phenanthridine alkaloid, shows anti-cancer effect through a number of mechanisms. Herein, the effect and mechanism of the CHE-induced autophagy, a type II programmed cell death, in non-small cell lung cancer (NSCLC) cells were studied for the first time. CHE induced cell viability decrease, colony formation inhibition, and apoptosis in a concentration-dependent manner in NSCLC A549 and NCI-H1299 cells. In addition, CHE triggered the expression of phosphatidylethanolamine-modified microtubule-associated protein light-chain 3 (LC3-II). The CHE-induced expression of LC3-II was further increased in the combination treatment with chloroquine (CQ), an autophagy inhibitor, and large amounts of red-puncta were observed in the CHE-treated A549 cells with stable expression of mRFP-EGFP-LC3, indicating that CHE induces autophagy flux. Silence of beclin 1 reversed the CHE-induced expression of LC3-II. Inhibition of autophagy remarkably reversed the CHE-induced cell viability decrease and apoptosis in NCI-H1299 cells but not in A549 cells. Furthermore, CHE triggered reactive oxygen species (ROS) generation in both cell lines. A decreased level of ROS through pretreatment with N-acetyl-L-cysteine reversed the CHE-induced cell viability decrease, apoptosis, and autophagy. Taken together, CHE induced distinctive autophagy in A549 (accompanied autophagy) and NCI-H1299 (pro-death autophagy) cells and a decreased level of ROS reversed the effect of CHE in NSCLC cells in terms of cell viability, apoptosis, and autophagy. Copyright © 2017 The Authors. Published by Elsevier B.V. All rights reserved.
International Nuclear Information System (INIS)
Liu, Zhiguo; Wang, Yi; Sun, Yusheng; Ren, Luqing; Huang, Yi; Cai, Yuepiao; Weng, Qiaoyou; Shen, Xueqian; Li, Xiaokun; Liang, Guang
2013-01-01
Recent advances have highlighted the importance of the endoplasmic reticulum (ER) in cell death processes. Pharmacological interventions that effectively enhance tumor cell death through activating ER stress have attracted a great deal of attention for anti-cancer therapy. A bio-evaluation on 113 curcumin analogs against four cancer cell lines was performed through MTT assay. Furthermore, real time cell assay and flow cytometer were used to evaluate the apoptotic induction of (1E,4E)-1,5-bis(5-bromo-2-ethoxyphenyl)penta-1,4-dien-3-one (B82). Western blot, RT-qPCR, and siRNA were then utilized to confirm whether B82-induced apoptosis is mediated through activating ER stress pathway. Finally, the in vivo anti-tumor effect of B82 was evaluated. B82 exhibited strong anti-tumor activity in non-small cell lung cancer (NSCLC) H460 cells. Treatment with B82 significantly induced apoptosis in H460 cells in vitro and inhibited H460 tumor growth in vivo. Further studies demonstrated that the B82-induced apoptosis is mediated by activating ER stress both in vitro and in vivo. A new monocarbonyl analog of curcumin, B82, exhibited anti-tumor effects on H460 cells via an ER stress-mediated mechanism. B82 could be further explored as a potential anticancer agent for the treatment of NSCLC
Moody, Terry W; Switzer, Christopher; Santana-Flores, Wilmarie; Ridnour, Lisa A; Berna, Marc; Thill, Michelle; Jensen, Robert T; Sparatore, Anna; Del Soldato, Piero; Yeh, Grace C; Roberts, David D; Giaccone, Giuseppe; Wink, David A
2010-05-01
The effects of dithiolethione modified valproate, diclofenac and sulindac on non-small cell lung cancer (NSCLC) cells were investigated. Sulfur(S)-valproate and S-diclofenac at 1 microg/ml concentrations significantly reduced prostaglandin (PG)E(2) levels in NSCLC cell lines A549 and NCI-H1299 as did the COX-2 inhibitor DuP-697. In vitro, S-valproate, S-diclofenac and S-sulindac half-maximally inhibited the clonal growth of NCI-H1299 cells at 6, 6 and 15 microg/ml, respectively. Using the MTT assay, 10 microg/ml S-valproate, NO-aspirin and Cay10404, a selective COX-2 inhibitor, but not SC-560, a selective COX-1 inhibitor, inhibited the growth of A549 cells. In vivo, 18mg/kg i.p. of S-valproate and S-diclofenac, but not S-sulindac, significantly inhibited A549 or NCI-H1299 xenograft proliferation in nude mice, but had no effect on the nude mouse body weight. The mechanism by which S-valproate and S-diclofenac inhibited the growth of NSCLC cells was investigated. Nitric oxide-aspirin but not S-valproate caused apoptosis of NSCLC cells. By Western blot, S-valproate and S-diclofenac increased E-cadherin but reduced vimentin and ZEB1 (a transcriptional suppressor of E-cadherin) protein expression in NSCLC cells. Because S-valproate and S-diclofenac inhibit the growth of NSCLC cells and reduce PGE(2) levels, they may prove beneficial in the chemoprevention and/or therapy of NSCLC. Published by Elsevier Ireland Ltd.
Lee, Youn Ju; Lim, Taeho; Han, Min Su; Lee, Sun-Hwa; Baek, Suk-Hwan; Nan, Hong-Yan; Lee, Chuhee
2017-02-01
TAM receptor tyrosine kinases (RTKs), Tyro3, Axl and MerTK, transduce diverse signals responsible for cell survival, growth, proliferation and anti-apoptosis. In the present study, we demonstrated the effect of luteolin, a flavonoid with antioxidant, anti-inflammatory and anticancer activities, on the expression and activation of TAM RTKs and the association with its cytotoxicity in non-small cell lung cancer (NSCLC) cells. We observed the cytotoxic effect of luteolin in parental A549 and H460 cells as well as in cisplatin-resistant A549/CisR and H460/CisR cells. Exposure of these cells to luteolin also resulted in a dose‑dependent decrease in clonogenic ability. Next, luteolin was found to decrease the protein levels of all three TAM RTKs in the A549 and A549/CisR cells in a dose‑dependent manner. In a similar manner, in H460 and H460/CisR cells, the protein levels of Axl and Tyro3 were decreased following luteolin treatment. In addition, Axl promoter activity was decreased by luteolin, indicating that luteolin suppresses Axl expression at the transcriptional level. We next found that luteolin abrogated Axl phosphorylation in response to growth arrest-specific 6 (Gas6), its ligand, implying the inhibitory effect of luteolin on Gas6-induced Axl activation. Ectopic expression of Axl was observed to attenuate the antiproliferative effect of luteolin, while knockdown of the Axl protein level using a gold nanoparticle-assisted gene delivery system increased its cytotoxicity. In contrast to the inhibitory effect of luteolin on the expression of TAM RTKs, interleukin-8 (IL-8) production was not decreased by luteolin in H460 and H460/CisR cells, while IL-8 production/cell was increased. Collectively, our data suggest that TAM RTKs, but not IL-8, are promising therapeutic targets of luteolin to abrogate cell proliferation and to overcome chemoresistance in NSCLC cells.
Pereira, Joana M; Peixoto, Vanessa; Teixeira, Alexandra; Sousa, Diana; Barros, Lillian; Ferreira, Isabel C F R; Vasconcelos, M Helena
2018-06-05
The cell growth inhibitory activity of the hydroethanolic extract of Achillea millefolium was studied in human tumor cell lines (NCI-H460 and HCT-15) and its mechanism of action was investigated. The GI 50 concentration was determined with the sulforhodamine B assay and cell cycle and apoptosis were analyzed by flow cytometry following incubation with PI or Annexin V FITC/PI, respectively. The expression levels of proteins involved in cell cycle and apoptosis were analyzed by Western blot. The extracts were characterized regarding their phenolic composition by LC-DAD-ESI/MS. 3,5-O-Dicaffeoylquinic acid, followed by 5-O-caffeoylquinic acid, were the main phenolic acids, while, luteolin-O-acetylhexoside and apigenin-O-acetylhexoside were the main flavonoids. This extract decreased the growth of the tested cell lines, being more potent in HCT-15 and then in NCI-H460 cells. Two different concentrations of the extract (75 and 100 μg/mL) caused alterations in cell cycle profile and increased apoptosis levels in HCT-15 and NCI-H460 cells. Moreover, the extract caused an increase in p53 and p21 expression in NCI-H460 cells (which have wt p53), and reduced XIAP levels in HCT-15 cells (with mutant p53). This work enhances the importance of A. millefolium as source of bioactive phenolic compounds, particularly of XIAP inhibitors. Copyright © 2018 Elsevier Ltd. All rights reserved.
Antiproliferative Activity and Chemical Constituents of Hypericum dyeri. Rehder
International Nuclear Information System (INIS)
Ali, M.; Arfan, M.; Zaman, K.
2013-01-01
The antiproliferative activity of hexane (F1), ethyl acetate (F2), butanol (F3) and water (F4) extracts of Hypericum dyeri were tested in vitro for their anti- proliferative (anticancer) activity on the cell lines: HT-29 human colon adenocarcinoma, NCI-H460 human non-small cell lung carcinoma, MCF-7 human breast cancer, OVCAR-3 human ovarian adenocarcinoma and RXF-393 human renal cell carcinoma with etoposide as positive control. Among the various extracts the F1 showed relatively potent anti-proliferative activity (IC50, 17.20 +- 4.80 micro g/mL) on NCI-H460 human non-small cell lung carcinoma cell growth. Six compounds were also isolated for the first time from this source. These phytochemicals were identified as 1-Octatriacontanol (1), Hexacosyl tetracosanoate (2), Geddic acid (3), Octacosanoic acid (4), Ceric acid (5) and Sitosterol (6) on the basis of spectroscopic studies such as 1H NMR ,13C NMR, 2D NMR and Mass spectroscopy as well as established with help of reported literature. (author)
Lee, Ra H; Jeon, Young-Joo; Cho, Jin H; Jang, Jeong-Yun; Kong, Il-Keun; Kim, Seok-Ho; Kim, MinSeok S; Chung, Hak-Jae; Oh, Keon B; Park, Seon-Min; Shin, Jae-Cheon; Seo, Jae-Min; Ko, Sungho; Shim, Jung-Hyun; Chae, Jung-Il
2017-01-01
Esculetin, a coumarin derivative, is a phenolic compound isolated from Artemisia capillaris, Citrus limonia, and Euphorbia lathyris. Although it has been reported to have anti-inflammatory, anti-oxidant, and anti-proliferative activities in several human cancers, its anti-proliferative activity against non-small-cell lung carcinoma (NSCLC) and the molecular mechanisms involved have not been adequately elucidated. In this study, we used two NSCLC cell lines (NCI-H358 and NCI-H1299) to investigate the anti-proliferative activity and apoptotic effect of esculetin. Our data showed that esculetin-treated cells exhibited reduced proliferation and apoptotic cell morphologies. Intriguingly, the transcription factor specificity protein 1 (Sp1) was significantly suppressed by esculetin in a dose- and time-dependent manner. Furthermore, the levels of p27 and p21, two key regulators of the cell cycle, were up-regulated by the esculetin-mediated down-regulation of Sp1; the level of a third cell-cycle regulator, survivin, was decreased, resulting in caspase-dependent apoptosis. Therefore, we conclude that esculetin could be a potent anti-proliferative agent in patients with NSCLC.
Reversal of cisplatin resistance in non-small cell lung cancer stem cells by Taxus chinensis var.
Jiang, Y Q; Xu, X P; Guo, Q M; Xu, X C; Liu, Q Y; An, S H; Xu, J L; Su, F; Tai, J B
2016-09-02
Drug resistance in cells is a major impedance to successful treatment of lung cancer. Taxus chinensis var. inhibits the growth of tumor cells and promotes the synthesis of interleukins 1 and 2 and tumor necrosis factor, enhancing immune function. In this study, T. chinensis var.-induced cell death was analyzed in lung cancer cells (H460) enriched for stem cell growth in a defined serum-free medium. Taxus-treated stem cells were also analyzed for Rhodamine 123 (Rh-123) expression by flow cytometry, and used as a standard functional indicator of MDR. The molecular basis of T. chinensis var.-mediated drug resistance was established by real-time PCR analysis of ABCC1, ABCB1, and lung resistance-related protein (LRP) mRNA, and western blot analysis of MRP1, MDR1, and LRP. Our results revealed that stem cells treated with higher doses of T. chinensis var. showed significantly lower growth inhibition rates than did H460 cells (P var. and cisplatin was also significantly inhibited (P var. (P var.-treated stem cells showed significant downregulation of the ABCC1, ABCB1, and LRP mRNA and MRP1, MDR1, and LRP (P var.-mediated downregulation of MRP1, MDR1, and LRP might contribute to the reversal of drug resistance in non-small cell lung cancer stem cells.
International Nuclear Information System (INIS)
Wang Yong; Wang Yan; Du Liqing; Yang Qingshan; Wang Yueying; Fan Feiyue
2009-01-01
Objective: To investigate the possible radiosensitive effect of human Lactotransferrin (hLF) high expression in lung cancer cell, we hereby constructed and transfected a recombinant vector pBC1 containing exogenous hLF gene. Methods: Firstly the recombinant plasmid pBC1-hLF was transferred into H460 and the hLF expression was evaluated by western blotting. Then we test the cell viability, apoptosis and clone formation after radiation along with the standard hLF treatment control. Results: The results showed that the hLF gene had been successfully transfect into H460 cells and hLF high expression can reduce the clone formation after radiation (P<0.01), and inhibit the cell proliferation with induced apoptosis (P<0.01). And the sensitization ratio of hLF treated and pBC1-hLF transfected were 1.29, 1.59. Conclusion: Our primary data shows that hLF high expression can radio sensitize the H460 cell in vitro. (authors)
Wang, Qian; Acharya, Narayan; Liu, Zhongwei; Zhou, Xianmei; Cromie, Meghan; Zhu, Jia; Gao, Weimin
2018-05-10
Experience-based herbal medicine as a complementary to modern western medicine has triggered an array of studies in quest of novel anticancer drugs. Scutellaria barbata D. Don (SB) is commonly used to treat different types of cancers, but its molecular mechanism of action is not clearly understood. In this study, we attempted to elucidate the mode of action of a traditional Chinese medicine prescription with a total of 14 components, named Lian-Jia-San-Jie-Fang (LJSJF, in Chinese), where SB works as the "principle" against non-small cell lung cancer (NSCLC) cells. Four different NSCLC cell lines (A549, H460, H1650, and H1975) were used. Cytotoxicity, in vitro tumorigenicity, gene expression, and protein expression were analyzed by MTT assay, soft agar assay, real-time PCR, and Western blots, respectively. Among the 14 components in LJSJF, SB was the only one to possess cytotoxic effects at its pharmacologically relevant doses. Additionally, we observed synergistically dose-dependent cytotoxic effects of SB in combination with other LJSJF components. After SB or LJSJF treatment, significant reductions in colony number and/or size were observed in A549 and H460; a notable dose-dependent decrease in EGFR was observed in A549, H460, and H1650; significant downregulation in EGFR and its downstream signaling targets mTOR and p38MAPK were also observed in A549 and H460; and p53 and p21 were significantly increased while survivin, cyclin D1, and MDM2 were significantly decreased in A549. Additionally, p53, p21, and Mettl7b were decreased, but p73 was increased in H460. Neither EGFR nor p53 was changed in H1975. Therefore, SB or LJSJF may induce cytotoxic effects by regulating multiple and/or distinct apoptotic pathways in different NSCLC cells. LJSJF exerts more pronounced cytotoxic effects against NSCLC cells than SB does by synergistically regulating the underlining molecular mechanisms including EGFR and/or p53 signaling pathways. Copyright © 2018 Elsevier B.V. All
Energy Technology Data Exchange (ETDEWEB)
Wu, Tzu-Chin [Chest Clinic, Chung Shan Medical University Hospital, Taichung, Taiwan (China); Lin, Yi-Chin [Department of Nutritional Science, Chung Shan Medical University, Taichung, Taiwan (China); Chen, Hsiao-Ling [Department of Health and Nutrition Biotechnology, Asia University, Taichung, Taiwan (China); Huang, Pei-Ru; Liu, Shang-Yu [Department of Nutritional Science, Chung Shan Medical University, Taichung, Taiwan (China); Yeh, Shu-Lan, E-mail: suzyyeh@csmu.edu.tw [Department of Nutritional Science, Chung Shan Medical University, Taichung, Taiwan (China); Department of Nutrition, Chung Shan Medical University Hospital, Taichung, Taiwan (China)
2016-02-01
Genistein has been shown to enhance the antitumor activity of trichostatin A (TSA) in human lung carcinoma A549 cells. However, whether the combined treatment exerts the same effect in other lung cancer cells is unclear. In the present study we first compared the enhancing effect of genistein on the antitumor effect of TSA in ABC-1, NCI-H460 (H460) and A549 cells. Second, we investigated whether the effects of genistein are associated with increased histone/non-histone protein acetylation. We found that the enhancing effect of genistein on cell-growth-arrest in ABC-1 cells (p53 mutant) was less than in A549 and H460 cells. Genistein enhanced TSA induced apoptosis in A549 and H460 cells rather than in ABC-1 cells. After silencing p53 expression in A549 and H460 cells, the enhancing effect of genistein was diminished. In addition, genistein increased TSA-induced histone H3/H4 acetylation in A549 and H460 cells. Genistein also increased p53 acetylation in H460 cells. The inhibitor of acetyltransferase, anacardic acid, diminished the enhancing effect of genistein on all TSA-induced histone/p53 acetylation and apoptosis. Genistein in combination with TSA increased the expression of p300 protein, an acetyltransferase, in A549 and NCI-H460 cells. Furthermore, we demonstrated that genistein also enhanced the antitumor effect of genistein in A549-tumor-bearing mice. Taken together, these results suggest that the enhancing effects of genistein on TSA-induced apoptosis in lung cancer cells were p53-dependent and were associated with histone/non-histone protein acetylation. - Highlights: • Genistein enhances the antitumor effect of TSA through p53-associated pathways. • Genistein enhances TSA-induced histone acetylation commonly. • An acetyltransferase inhibitor diminishes the antitumor effect of genistein + TSA. • TSA in combination with genistein increases the expression of p300. • Genistein given by i.p. injection increases the antitumor effect of TSA in vivo.
International Nuclear Information System (INIS)
Wu, Tzu-Chin; Lin, Yi-Chin; Chen, Hsiao-Ling; Huang, Pei-Ru; Liu, Shang-Yu; Yeh, Shu-Lan
2016-01-01
Genistein has been shown to enhance the antitumor activity of trichostatin A (TSA) in human lung carcinoma A549 cells. However, whether the combined treatment exerts the same effect in other lung cancer cells is unclear. In the present study we first compared the enhancing effect of genistein on the antitumor effect of TSA in ABC-1, NCI-H460 (H460) and A549 cells. Second, we investigated whether the effects of genistein are associated with increased histone/non-histone protein acetylation. We found that the enhancing effect of genistein on cell-growth-arrest in ABC-1 cells (p53 mutant) was less than in A549 and H460 cells. Genistein enhanced TSA induced apoptosis in A549 and H460 cells rather than in ABC-1 cells. After silencing p53 expression in A549 and H460 cells, the enhancing effect of genistein was diminished. In addition, genistein increased TSA-induced histone H3/H4 acetylation in A549 and H460 cells. Genistein also increased p53 acetylation in H460 cells. The inhibitor of acetyltransferase, anacardic acid, diminished the enhancing effect of genistein on all TSA-induced histone/p53 acetylation and apoptosis. Genistein in combination with TSA increased the expression of p300 protein, an acetyltransferase, in A549 and NCI-H460 cells. Furthermore, we demonstrated that genistein also enhanced the antitumor effect of genistein in A549-tumor-bearing mice. Taken together, these results suggest that the enhancing effects of genistein on TSA-induced apoptosis in lung cancer cells were p53-dependent and were associated with histone/non-histone protein acetylation. - Highlights: • Genistein enhances the antitumor effect of TSA through p53-associated pathways. • Genistein enhances TSA-induced histone acetylation commonly. • An acetyltransferase inhibitor diminishes the antitumor effect of genistein + TSA. • TSA in combination with genistein increases the expression of p300. • Genistein given by i.p. injection increases the antitumor effect of TSA in vivo.
International Nuclear Information System (INIS)
Ali, Waqas; Raza, Muhammad Usman; Iqbal, Samir M; Moghaddam, Fatemeh Jalvhei; Bui, Loan; Sayles, Bailey; Kim, Young-Tae
2016-01-01
Tumor cells are malignant derivatives of normal cells. There are characteristic differences in the mechanophysical properties of normal and tumor cells, and these differences stem from the changes that occur in the cell cytoskeleton during cancer progression. There is a need for viable whole blood processing techniques for rapid and reliable tumor cell detection that do not require tagging. Micropore biosensors have previously been used to differentiate tumor cells from normal cells and we have used a micropore-based electromechanical transducer to differentiate one type of tumor cells from the other types. This device generated electrical signals that were characteristic of the cell properties. Three non-small cell lung cancer (NSCLC) cell lines, NCl-H1155, A549 and NCI-H460, were successfully differentiated. NCI-H1155, due to their comparatively smaller size, were found to be the quickest in translocating through the micropore. Their translocation through a 15 μm micropore caused electrical pulses with an average translocation time of 101 ± 9.4 μs and an average peak amplitude of 3.71 ± 0.42 μA, whereas translocation of A549 and NCI-H460 caused pulses with average translocation times of 126 ± 17.9 μs and 148 ± 13.7 μs and average peak amplitudes of 4.58 ± 0.61 μA and 5.27 ± 0.66 μA, respectively. This transformation of the differences in cell properties into differences in the electrical profiles (i.e. the differences in peak amplitudes and translocation times) with this electromechanical transducer is a quantitative way to differentiate these lung cancer cells. The solid-state micropore device processed whole biological samples without any pre-processing requirements and is thus ideal for point-of-care applications. (paper)
A new in vitro screening system for anticancer drugs for the treatment of non-small cell lung cancer
International Nuclear Information System (INIS)
Hanauske, U.; Hanauske, A.R.; Clark, G.M.; Tsen, D.; Buchok, J.; Hoff, D.D. von
1989-01-01
We have evaluated a semiautomated radiometric assay (BACTEC 460 system) for screening of activity of anticancer drugs against human non-small cell lung cancer cell lines. Cells from seven cell lines were exposed to standard antineoplastic agents at four different concentrations using a 1-h incubation. Alpha 2-interferon was tested using a continuous incubation. In vitro drug activity was analyzed as a function of the clinically achievable serum concentration. Our results indicate that two cell lines (CALU-3, SK-MES-1) exhibit in vitro drug sensitivity patterns closest to those observed in clinical studies. These two cell lines might therefore be most useful for screening new anticancer compounds for activity against non-small cell lung cancer. The radiometric assay is a semiautomated system which has advantages over other, more time-consuming screening systems
Chang, Hong-Bin; Chen, Bing-Huei
2015-01-01
The objectives of this study were to explore the inhibition mechanism of lung cancer cells A549 and H460 by curcuminoid extracts and nanoemulsions prepared from Curcuma longa Linnaeus. In addition, human bronchus epithelial cell line BEAS-2B (normal cell) was selected for comparison. A high-performance liquid chromatography (HPLC) method was developed to separate and quantify the various curcuminoids in C. longa extract, including curcumin (1,714.5 μg/mL), demethoxycurcumin (1,147.4 μg/mL), and bisdemethoxycurcumin (190.2 μg/mL). A high-stability nanoemulsion composed of Tween 80, water, and curcuminoid extract was prepared, with mean particle size being 12.6 nm. The cell cycle was retarded at G2/M for both the curcuminoid extract and nanoemulsion treatments; however, the inhibition pathway may be different. H460 cells were more susceptible to apoptosis than A549 cells for both curcuminoid extract and nanoemulsion treatments. Growth of BEAS-2B remained unaffected for both the curcuminoid extract and nanoemulsion treatments, with a concentration range from 1 to 4 μg/mL. Also, the activities of caspase-3, caspase-8, and caspase-9 followed a dose-dependent increase for both A549 and H460 cells for both the treatments, accompanied by a dose-dependent increase in cytochrome C expression and a dose-dependent decrease in CDK1 expression. Interestingly, a dose-dependent increase in cyclin B expression was shown for A549 cells for both the treatments, while a reversed trend was found for H460 cells. Both mitochondria and death receptor pathways may be responsible for apoptosis of both A549 and H460 cells.
Chen, Jun; Han, Han; Wang, Bin; Shi, Liying
2016-07-01
The Sendai virus strain Tianjin is a novel genotype of the Sendai virus. In previous studies, ultraviolet-inactivated Sendai virus strain Tianjin (UV-Tianjin) demonstrated antitumor effects on human breast cancer cells. The aim of the present study was to investigate the in vitro antitumor effects of UV-Tianjin on the human cervical carcinoma HeLa, human small cell lung cancer NCI-H446 and human hepatocellular carcinoma Hep 3B cell lines, and the possible underlying mechanisms of these antitumor effects. A 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide assay revealed that UV-Tianjin treatment inhibited the proliferation of HeLa, NCI-H446 and Hep 3B cells in a dose- and time-dependent manner. Hoechst and Annexin V-fluorescein isothiocyanate/propidium iodide double staining indicated that UV-Tianjin induced dose-dependent apoptosis in all three cell lines with the most significant effect observed in the HeLa cell line. In the HeLa cell line, UV-Tianjin-induced apoptosis was further confirmed by the disruption of the mitochondria membrane potential and the activation of caspases, as demonstrated by fluorescent cationic dye and colorimetric assays, respectively. In addition, western blot analysis revealed that UV-Tianjin treatment resulted in significant upregulation of cytochrome c , apoptosis protease activating factor-1, Fas, Fas ligand and Fas-associated protein with death domain, and activated caspase-9, -8 and -3 in HeLa cells. Based on these results, it is hypothesized that UV-Tianjin exhibits anticancer activity in HeLa, NCI-H446 and Hep 3B cell lines via the induction of apoptosis. In conclusion, the results of the present study indicate that in the HeLa cell line, intrinsic and extrinsic apoptotic pathways may be involved in UV-Tianjin-induced apoptosis.
Deben, Christophe; Deschoolmeester, Vanessa; De Waele, Jorrit; Jacobs, Julie; Van den Bossche, Jolien; Wouters, An; Peeters, Marc; Rolfo, Christian; Smits, Evelien; Lardon, Filip; Pauwels, Patrick
2018-04-21
The compound APR-246 (PRIMA-1 MET ) is a known reactivator of (mutant) p53 and inducer of oxidative stress which can sensitize cancer cells to platinum-based chemotherapeutics. However, the effect of a hypoxic tumor environment has been largely overlooked in this interaction. This study focusses on the role of hypoxia-inducible factor-1α (HIF-1α) and the p53 tumor suppressor protein in hypoxia-induced cisplatin resistance in non-small cell lung cancer (NSCLC) cells and the potential of APR-246 to overcome this resistance. We observed that hypoxia-induced cisplatin resistance only occurred in the p53 mutant NCI-H2228 Q331 * cell line, and not in the wild type A549 and mutant NCI-H1975 R273H cell lines. Cisplatin reduced HIF-1α protein levels in NCI-H2228 Q331 * cells, leading to a shift in expression from HIF-1α-dependent to p53-dependent transcription targets under hypoxia. APR-246 was able to overcome hypoxia-induced cisplatin resistance in NCI-H2228 Q331 * cells in a synergistic manner without affecting mutant p53 Q331 * transcriptional activity, but significantly depleting total glutathione levels more efficiently under hypoxic conditions. Synergism was dependent on the presence of mutant p53 Q331 * and the induction of reactive oxygen species, with depletion of one or the other leading to loss of synergism. Our data further support the rationale of combining APR-246 with cisplatin in NSCLC, since their synergistic interaction is retained or enforced under hypoxic conditions in the presence of mutant p53.
Directory of Open Access Journals (Sweden)
Christophe Deben
2018-04-01
Full Text Available The compound APR-246 (PRIMA-1MET is a known reactivator of (mutant p53 and inducer of oxidative stress which can sensitize cancer cells to platinum-based chemotherapeutics. However, the effect of a hypoxic tumor environment has been largely overlooked in this interaction. This study focusses on the role of hypoxia-inducible factor-1α (HIF-1α and the p53 tumor suppressor protein in hypoxia-induced cisplatin resistance in non-small cell lung cancer (NSCLC cells and the potential of APR-246 to overcome this resistance. We observed that hypoxia-induced cisplatin resistance only occurred in the p53 mutant NCI-H2228Q331* cell line, and not in the wild type A549 and mutant NCI-H1975R273H cell lines. Cisplatin reduced HIF-1α protein levels in NCI-H2228Q331* cells, leading to a shift in expression from HIF-1α-dependent to p53-dependent transcription targets under hypoxia. APR-246 was able to overcome hypoxia-induced cisplatin resistance in NCI-H2228Q331* cells in a synergistic manner without affecting mutant p53Q331* transcriptional activity, but significantly depleting total glutathione levels more efficiently under hypoxic conditions. Synergism was dependent on the presence of mutant p53Q331* and the induction of reactive oxygen species, with depletion of one or the other leading to loss of synergism. Our data further support the rationale of combining APR-246 with cisplatin in NSCLC, since their synergistic interaction is retained or enforced under hypoxic conditions in the presence of mutant p53.
Directory of Open Access Journals (Sweden)
Sikdar Sourav
2014-03-01
Full Text Available Objectives: In homeopathy, it is claimed that more homeopathically-diluted potencies render more protective/curative effects against any disease condition. Potentized forms of Condurango are used successfully to treat digestive problems, as well as esophageal and stomach cancers. However, the comparative efficacies of Condurango 6C and 30C, one diluted below and one above Avogadro’s limit (lacking original drug molecule, respectively, have not been critically analyzed for their cell-killing (apoptosis efficacy against lung cancer cells in vitro, and signalling cascades have not been studied. Hence, the present study was undertaken. Methods: 3-(4,5-dimethylthiazol-2-yl-2,5-diphenylte- trazolium bromide (MTT assays were conducted on H460-non-small-cell lung cancer (NSCLC cells by using a succussed ethyl alcohol vehicle (placebo as a control. Studies on cellular morphology, cell cycle regulation, generation of reactive oxygen species (ROS, changes in mitochondrial membrane potential (MMP, and DNA-damage were made, and expressions of related signaling markers were studied. The observations were done in a “blinded” manner. Results: Both Condurango 6C and 30C induced apoptosis via cell cycle arrest at subG0/G1 and altered expressions of certain apoptotic markers significantly in H460 cells. The drugs induced oxidative stress through ROS elevation and MMP depolarization at 18-24 hours. These events presumably activated a caspase-3-mediated signalling cascade, as evidenced by reverse transcriptase- polymerase chain reaction (RT-PCR, western blot and immunofluorescence studies at a late phase (48 hours in which cells were pushed towards apoptosis. Conclusion: Condurango 30C had greater apoptotic effect than Condurango 6C as claimed in the homeopathic doctrine.
Wang, De-Shen; Patel, Atish; Shukla, Suneet; Zhang, Yun-Kai; Wang, Yi-Jun; Kathawala, Rishil J; Robey, Robert W; Zhang, Li; Yang, Dong-Hua; Talele, Tanaji T; Bates, Susan E; Ambudkar, Suresh V; Xu, Rui-Hua; Chen, Zhe-Sheng
2014-06-30
ABCG2 is a potential biomarker causing multidrug resistance (MDR) in Non-Small Cell Lung Cancer (NSCLC). We conducted this study to investigate whether Icotinib, a small-molecule inhibitor of EGFR tyrosine kinase, could interact with ABCG2 transporter in NSCLC. Our results showed that Icotinib reversed ABCG2-mediated MDR by antagonizing the drug efflux function of ABCG2. Icotinib stimulated the ATPase activity in a concentration-dependent manner and inhibited the photolabeling of ABCG2 with [125I]-Iodoarylazidoprazosin, demonstrating that it interacts at the drug-binding pocket. Homology modeling predicted the binding conformation of Icotinib at Asn629 centroid-based grid of ABCG2. However, Icotinib at reversal concentration did not affect the expression levels of AKT and ABCG2. Furthermore, a combination of Icotinib and topotecan exhibited significant synergistic anticancer activity against NCI-H460/MX20 tumor xenografts. However, the inhibition of transport activity of ABCG2 was insufficient to overcome pemetrexed resistance in NCI-H460/MX20 cells, which was due to the co-upregulated thymidylate synthase (TS) and ABCG2 expression. This is the first report to show that the up-regulation of TS in ABCG2-overexpressing cell line NCI-H460/MX20 may play a role of resistance to pemetrexate. Our findings suggested different possible strategies of overcoming the resistance of topotecan and pemetrexed in the NSCLC patients.
Bystander effects in radiotherapy of non-small cell lung cancer
International Nuclear Information System (INIS)
McKenzie, D.R.
2011-01-01
Full text: School of Physics, The University of Sydney, Australia Objectives The bystander effect causes a response in unirradiated cells that are in communication with cells that receive a radiation dose. In recent work we have shown that there are 3 types bystander effect and that the expression of these effects follows a Ii course. The aim of this work is to identify the conditions for the three types of bystander effects in radiotherapy of non-small cell II cancer. A human non small cell lung cancer cell line (NCI-H460) was irradiated with a 6 MV photon beam produced from a Varian I i near accelerator to doses of 2, 4, 6 and 8 Gy. These cells v termed donor cells. At selected time intervals after exposure (5,15 and 60 min), the medium was transferred to receiver cells of the cell line in separate flasks. The clonogenic survival fraction of the receiver cells was determined following 5 days of incubation comparing cells receiving transfer of medium from exposed cells to cell receiving transfer from sham exposed cells. The experimental design controlled for the density of cells in the donor flask, the e of irradiation on the medium alone and on the donor cell metabolites. The results show a strong time course for the bystander signal expression, which is dependent on the density of cells in the donor receiver flasks. Sub lethal doses of radiation resulted in a proliferative response at short time intervals after exposure [15 min] but a toxic response when medium transfer was carried out after 60 min. A higher cell density in the donor flasks produces an increased response in the receiver flasks for the same volume of medium transferred. The latter response corresponds to Bystander Effect type 1 in which a reduced survival is observed in cells receiving medium from cells that receive a high but not lethal dose. The proliferative response, corresponding to Bystander Effect type 3 is more general and is not strongly dependent on dose. Following a lethal dose of
Directory of Open Access Journals (Sweden)
Chang HB
2015-08-01
Full Text Available Hong-Bin Chang,1 Bing-Huei Chen1,21Department of Food Science, 2Graduate Institute of Medicine, Fu Jen Catholic University, Taipei, TaiwanAbstract: The objectives of this study were to explore the inhibition mechanism of lung cancer cells A549 and H460 by curcuminoid extracts and nanoemulsions prepared from Curcuma longa Linnaeus. In addition, human bronchus epithelial cell line BEAS-2B (normal cell was selected for comparison. A high-performance liquid chromatography (HPLC method was developed to separate and quantify the various curcuminoids in C. longa extract, including curcumin (1,714.5 µg/mL, demethoxycurcumin (1,147.4 µg/mL, and bisdemethoxycurcumin (190.2 µg/mL. A high-stability nanoemulsion composed of Tween 80, water, and curcuminoid extract was prepared, with mean particle size being 12.6 nm. The cell cycle was retarded at G2/M for both the curcuminoid extract and nanoemulsion treatments; however, the inhibition pathway may be different. H460 cells were more susceptible to apoptosis than A549 cells for both curcuminoid extract and nanoemulsion treatments. Growth of BEAS-2B remained unaffected for both the curcuminoid extract and nanoemulsion treatments, with a concentration range from 1 to 4 µg/mL. Also, the activities of caspase-3, caspase-8, and caspase-9 followed a dose-dependent increase for both A549 and H460 cells for both the treatments, accompanied by a dose-dependent increase in cytochrome C expression and a dose-dependent decrease in CDK1 expression. Interestingly, a dose-dependent increase in cyclin B expression was shown for A549 cells for both the treatments, while a reversed trend was found for H460 cells. Both mitochondria and death receptor pathways may be responsible for apoptosis of both A549 and H460 cells.Keywords: curcuminoid extract, curcuminoid nanoemulsion, Curcuma longa Linnaeus, lung cancer cell, cell cycle, apoptosis mechanism
Radiosensitization of C225 on human non-small cell lung cancer cell line H-520
International Nuclear Information System (INIS)
Zhang Yingdong; Wang Junjie; Liu Feng; Zhao Yong
2008-01-01
Objective: To investigate the efficacy of C225 (cetuximab), a chimeric human-mouse anti-epithelial growth factor receptor monoclonal antibody, combined with 60 Co gamma irradiation against human non-small cell lung cancer cell line H-520. Methods: H-520 cells were treated either with different dose of 60 Co irradiation (1,2,4,6,8 and 10 Gy)alone or together with C225 (100 nmol/L). Colony forming capacity was determined to create the survival curve 10 days after the treatment. Cells in different groups were harvested 72 hours after irradiation for apoptosis analysis or 48 hours after irradiation for cell cycle analysis by flow cytometry assay. Results: The clone number in combinational treatment group was less than that in irradiation only group, which suggested that the cell survival rate in the combinational treatment group was significantly decreased comparing with irradiation only group (F=6.36, P O + G 1 phases for C225 treatment, in G 2 + M phases for 60 Co irradiation, and in both G 0 + G 1 and G 2 + M phases for C225 in combination with 60 Co irradiation. Conclusions: C225 has radiosensitizing effects on H-520 cells, which may through the enhancement of 60 Co irradiation-induced cell death and cell cycle arrest. This study provides a supportive evidence for clinical treatment in non-small cell lung cancer. (authors)
International Nuclear Information System (INIS)
Rathos, Maggie J; Khanwalkar, Harshal; Joshi, Kavita; Manohar, Sonal M; Joshi, Kalpana S
2013-01-01
In the present study, we show that the combination of doxorubicin with the cyclin-dependent kinase inhibitor P276-00 was synergistic at suboptimal doses in the non-small cell lung carcinoma (NSCLC) cell lines and induces extensive apoptosis than either drug alone in H-460 human NSCLC cells. Synergistic effects of P276-00 and doxorubicin on growth inhibition was studied using the Propidium Iodide (PI) assay. The doses showing the best synergistic effect was determined and these doses were used for further mechanistic studies such as western blotting, cell cycle analysis and RT-PCR. The in vivo efficacy of the combination was evaluated using the H-460 xenograft model. The combination of 100 nM doxorubicin followed by 1200 nM P276-00 showed synergistic effect in the p53-positive and p53-mutated cell lines H-460 and H23 respectively as compared to the p53-null cell line H1299. Abrogation of doxorubicin-induced G2/M arrest and induction of apoptosis was observed in the combination treatment. This was associated with induction of tumor suppressor protein p53 and reduction of anti-apoptotic protein Bcl-2. Furthermore, doxorubicin alone greatly induced COX-2, a NF-κB target and Cdk-1, a target of P276-00, which was downregulated by P276-00 in the combination. Doxorubicin when combined with P276-00 in a sequence-specific manner significantly inhibited tumor growth, compared with either doxorubicin or P276-00 alone in H-460 xenograft model. These findings suggest that this combination may increase the therapeutic index over doxorubicin alone and reduce systemic toxicity of doxorubicin most likely via an inhibition of doxorubicin-induced chemoresistance involving NF-κB signaling and inhibition of Cdk-1 which is involved in cell cycle progression
International Nuclear Information System (INIS)
Cho, Christina; Horzempa, Carol; Jones, David; McKeown-Longo, Paula J.
2016-01-01
Fibronectin is a mechanically sensitive protein which is organized in the extracellular matrix as a network of interacting fibrils. The lung tumor stroma is enriched for fibronectin which is thought to contribute to metastasis and drug resistance. Fibronectin is an elastic, multi-modular protein made up of individually folded domains, some of which can stretch in response to increased mechanical tension. Very little is known about the relationship of fibronectin’s unfolded domains to lung cancer resistance to chemotherapy. In the present study, we evaluated the impact of unfolding the first Type III domain of fibronectin (FnIII-1c) on TNF-related apoptosis inducing ligand (TRAIL) resistance. NCI-H460 non-small cell lung cancer cells were treated with FnIII-1c then assessed for TRAIL-induced apoptosis. Subsequent analysis of FnIII-1c-mediated signaling pathways was also completed. Human non-small cell lung cancer tissue sections were assessed for the expression of vitronectin by immunohistochemistry. FnIII-1c inhibited TRAIL-induced activation of caspase 8 and subsequent apoptosis in NCI-H460 lung cancer cells. FnIII-1c treatment was associated with the activation of the phosphatidylinositol-3-kinase/alpha serine/threonine kinase (PI3K/Akt) pathway and the αvβ5 integrin receptor for vitronectin, both of which were required for TRAIL resistance. Immunohistochemical staining of sections from non-small cell lung cancers showed that vitronectin was localized around blood vessels and in the tumor-stroma interface. Unfolding of Type III domains within the fibronectin matrix may promote TRAIL resistance through the activation of a PI3K/Akt/αvβ5 signaling axis and point to a novel mechanism by which changes in secondary structure of fibronectin contribute to cancer cell resistance to apoptosis
Zeng, Huawei; Taussig, David P; Cheng, Wen-Hsing; Johnson, LuAnn K; Hakkak, Reza
2017-01-01
Butyrate, an intestinal microbiota metabolite of dietary fiber, exhibits chemoprevention effects on colon cancer development. However, the mechanistic action of butyrate remains to be determined. We hypothesize that butyrate inhibits cancerous cell proliferation but to a lesser extent in noncancerous cells through regulating apoptosis and cellular-signaling pathways. We tested this hypothesis by exposing cancerous HCT116 or non-cancerous NCM460 colon cells to physiologically relevant doses of butyrate. Cellular responses to butyrate were characterized by Western analysis, fluorescent microscopy, acetylation, and DNA fragmentation analyses. Butyrate inhibited cell proliferation, and led to an induction of apoptosis, genomic DNA fragmentation in HCT116 cells, but to a lesser extent in NCM460 cells. Although butyrate increased H3 histone deacetylation and p21 tumor suppressor expression in both cell types, p21 protein level was greater with intense expression around the nuclei in HCT116 cells when compared with that in NCM460 cells. Furthermore, butyrate treatment increased the phosphorylation of extracellular-regulated kinase 1/2 (p-ERK1/2), a survival signal, in NCM460 cells while it decreased p-ERK1/2 in HCT116 cells. Taken together, the activation of survival signaling in NCM460 cells and apoptotic potential in HCT116 cells may confer the increased sensitivity of cancerous colon cells to butyrate in comparison with noncancerous colon cells.
Petpiroon, Nareerat; Sritularak, Boonchoo; Chanvorachote, Pithi
2017-12-29
The conversion of the epithelial phenotype of cancer cells into cells with a mesenchymal phenotype-so-called epithelial-mesenchymal transition (EMT)-has been shown to enhance the capacity of the cells to disseminate throughout the body. EMT is therefore becoming a potential target for anti-cancer drug discovery. Here, we showed that phoyunnanin E, a compound isolated from Dendrobium venustum, possesses anti-migration activity and addressed its mechanism of action. The cytotoxic and proliferative effects of phoyunnanin E on human non-small cell lung cancer-derived H460, H292, and A549 cells and human keratinocyte HaCaT cells were investigated by MTT assay. The effect of phoyunnanin E on EMT was evaluated by determining the colony formation and EMT markers. The migration and invasion of H460, H292, A549 and HaCaT cells was evaluated by wound healing assay and transwell invasion assay, respectively. EMT markers, integrins and migration-associated proteins were examined by western blot analysis. Phoyunnanin E at the concentrations of 5 and 10 μM, which are non-toxic to H460, H292, A549 and HaCaT cells showed good potential to inhibit the migratory activity of three types of human lung cancer cells. The anti-migration effect of phoyunnanin E was shown to relate to the suppressed EMT phenotypes, including growth in anchorage-independent condition, cell motility, and EMT-specific protein markers (N-cadherin, vimentin, slug, and snail). In addition to EMT suppression, we found that phoyunnanin E treatment with 5 and 10 μM could decrease the cellular level of integrin αv and integrin β3, these integrins are frequently up-regulated in highly metastatic tumor cells. We further characterized the regulatory proteins in cell migration and found that the cells treated with phoyunnanin E exhibited a significantly lower level of phosphorylated focal adhesion kinase (p-FAK) and phosphorylated ATP-dependent tyrosine kinase (p-AKT), and their downstream effectors (including
International Nuclear Information System (INIS)
Tang, Zheng-Hai; Cao, Wen-Xiang; Su, Min-Xia; Chen, Xiuping; Lu, Jin-Jian
2017-01-01
Osimertinib (OSI), also known as AZD9291, is a third-generation epidermal growth factor receptor (EGFR) tyrosine kinase inhibitor that has been approved for the treatment of non-small cell lung cancer (NSCLC) patients harboring EGFR T790M mutation. Herein, we indicated for the first time that OSI increased the accumulations of cytoplasmic vacuoles, the expression of phosphatidylethanolamine-modified microtubule-associated protein light-chain 3 (LC3-II), and the formation of GFP-LC3 puncta in various cancer cells. The OSI-induced expression of LC3-II was further increased when combined treatment with chloroquine (CQ), an autophagy inhibitor, and the mRFP-EGFP-LC3 plasmid-transfected cells exposed to OSI led to the production of more red-fluorescent puncta than green-fluorescent puncta, indicating OSI induced autophagic flux in the NSCLC cells. Knockdown of EGFR showed no effect on the OSI-induced expression of LC3-II in NCI-H1975 cells. In addition, OSI increased reactive oxygen species (ROS) generation and scavenge of ROS via pretreatment with N-acetyl-L-cysteine (NAC), catalase (CAT), or vitamin E (Vita E) significantly inhibited OSI-induced the accumulations of cytoplasmic vacuoles, the expression of LC3-II, as well as the formation of GFP-LC3 puncta. Combinative treatment with CQ could not remarkably change the OSI-induced cell viability decrease, whereas the OSI-induced cell viability decrease and apoptosis could be reversed through pretreatment with NAC, CAT, and Vita E, respectively. Taken together, this is the first report that OSI induces an accompanied autophagy and the generation of ROS is critical for the OSI-induced autophagy, cell viability decrease, and apoptosis in NSCLC cells. - Highlights: • Osimertinib induced the expressions of cytoplasmic vacuoles and autophagic markers in different cancer cells. • Osimertinib induced autophagic flux in NSCLC NCI-H1975 and HCC827 cell lines. • ROS generation contributed to osimertinib-induced cytoplasmic
Energy Technology Data Exchange (ETDEWEB)
Tang, Zheng-Hai; Cao, Wen-Xiang; Su, Min-Xia; Chen, Xiuping; Lu, Jin-Jian, E-mail: jinjianlu@umac.mo
2017-04-15
Osimertinib (OSI), also known as AZD9291, is a third-generation epidermal growth factor receptor (EGFR) tyrosine kinase inhibitor that has been approved for the treatment of non-small cell lung cancer (NSCLC) patients harboring EGFR T790M mutation. Herein, we indicated for the first time that OSI increased the accumulations of cytoplasmic vacuoles, the expression of phosphatidylethanolamine-modified microtubule-associated protein light-chain 3 (LC3-II), and the formation of GFP-LC3 puncta in various cancer cells. The OSI-induced expression of LC3-II was further increased when combined treatment with chloroquine (CQ), an autophagy inhibitor, and the mRFP-EGFP-LC3 plasmid-transfected cells exposed to OSI led to the production of more red-fluorescent puncta than green-fluorescent puncta, indicating OSI induced autophagic flux in the NSCLC cells. Knockdown of EGFR showed no effect on the OSI-induced expression of LC3-II in NCI-H1975 cells. In addition, OSI increased reactive oxygen species (ROS) generation and scavenge of ROS via pretreatment with N-acetyl-L-cysteine (NAC), catalase (CAT), or vitamin E (Vita E) significantly inhibited OSI-induced the accumulations of cytoplasmic vacuoles, the expression of LC3-II, as well as the formation of GFP-LC3 puncta. Combinative treatment with CQ could not remarkably change the OSI-induced cell viability decrease, whereas the OSI-induced cell viability decrease and apoptosis could be reversed through pretreatment with NAC, CAT, and Vita E, respectively. Taken together, this is the first report that OSI induces an accompanied autophagy and the generation of ROS is critical for the OSI-induced autophagy, cell viability decrease, and apoptosis in NSCLC cells. - Highlights: • Osimertinib induced the expressions of cytoplasmic vacuoles and autophagic markers in different cancer cells. • Osimertinib induced autophagic flux in NSCLC NCI-H1975 and HCC827 cell lines. • ROS generation contributed to osimertinib-induced cytoplasmic
Directory of Open Access Journals (Sweden)
Hussein A N Al-Wadei
Full Text Available Lung cancer is the leading cause of cancer death; 80-85% of lung cancer cases are non-small cell lung cancer (NSCLC. Smoking is a documented risk factor for the development of this cancer. Although nicotine does not have the ability to initiate carcinogenic events, recent studies have implicated nicotine in growth stimulation of NSCLC. Using three NSCLC cell lines (NCI-H322, NCI-H441 and NCI-H1299, we identified the cooperation of nicotinic acetylcholine receptors (nAChRs and β-adrenergic receptors (β-ARs as principal regulators of these effects. Proliferation was measured by thymidine incorporation and MTT assays, and Western blots were used to monitor the upregulation of the nAChRs and activation of signaling molecules. Noradrenaline and GABA were measured by immunoassays. Nicotine-treated NSCLC cells showed significant induction of the α7nAChR and α4nAChR, along with significant inductions of p-CREB and p-ERK1/2 accompanied by increases in the stress neurotransmitter noradrenaline, which in turn led to the observed increase in DNA synthesis and cell proliferation. Effects on cell proliferation and signaling proteins were reversed by the α7nAChR antagonist α-BTX or the β-blocker propranolol. Nicotine treatment also down-regulated expression of the GABA synthesizing enzyme GAD 65 and the level of endogenous GABA, while treatment of NSCLC cells with GABA inhibited cell proliferation. Interestingly, GABA acts by reducing β-adrenergic activated cAMP signaling. Our findings suggest that nicotine-induced activation of this autocrine noradrenaline-initiated signaling cascade and concomitant deficiency in inhibitory GABA, similar to modulation of these neurotransmitters in the nicotine-addicted brain, may contribute to the development of NSCLC in smokers. Our data suggest that exposure to nicotine either by tobacco smoke or nicotine supplements facilitates growth and progression of NSCLC and that pharmacological intervention by β blocker may
Hu, Rongkuan; Huffman, Kenneth E; Chu, Michael; Zhang, Yajie; Minna, John D; Yu, Yonghao
2016-02-05
Lung cancer is the leading cause of cancer-related deaths for men and women in the United States, with non-small cell lung cancer (NSCLC) representing 85% of all diagnoses. Late stage detection, metastatic disease and lack of actionable biomarkers contribute to the high mortality rate. Proteins in the extracellular space are known to be critically involved in regulating every stage of the pathogenesis of lung cancer. To investigate the mechanism by which secreted proteins contribute to the pathogenesis of NSCLC, we performed quantitative secretomic analysis of two isogenic NSCLC cell lines (NCI-H1993 and NCI-H2073) and an immortalized human bronchial epithelial cell line (HBEC3-KT) as control. H1993 was derived from a chemo-naïve metastatic tumor, while H2073 was derived from the primary tumor after etoposide/cisplatin therapy. From the conditioned media of these three cell lines, we identified and quantified 2713 proteins, including a series of proteins involved in regulating inflammatory response, programmed cell death and cell motion. Gene Ontology (GO) analysis indicates that a number of proteins overexpressed in H1993 media are involved in biological processes related to cancer metastasis, including cell motion, cell-cell adhesion and cell migration. RNA interference (RNAi)-mediated knock down of a number of these proteins, including SULT2B1, CEACAM5, SPRR3, AGR2, S100P, and S100A14, leads to dramatically reduced migration of these cells. In addition, meta-analysis of survival data indicates NSCLC patients whose tumors express higher levels of several of these secreted proteins, including SULT2B1, CEACAM5, SPRR3, S100P, and S100A14, have a worse prognosis. Collectively, our results provide a potential molecular link between deregulated secretome and NSCLC cell migration/metastasis. In addition, the identification of these aberrantly secreted proteins might facilitate the development of biomarkers for early detection of this devastating disease.
Directory of Open Access Journals (Sweden)
Jiang X
2012-02-01
Full Text Available Danbo Yang1, Sang Van2, Yingyi Shu1, Xiaoqing Liu1, Yangfeng Ge1, Xinguo Jiang3, Yi Jin2, Lei Yu1,21Biomedical Engineering and Technology Institute, Institutes for Advanced Interdisciplinary Research, East China Normal University, Shanghai, People’s Republic of China; 2Biomedical Group, Nitto Denko Technical Corporation, CA, USA; 3School of Pharmacy, Fudan University, Shanghai, People’s Republic of ChinaAim: This work is intended to develop and evaluate a biopolymeric poly(L-γ-glutamyl-glutamine (PGG–docetaxel (DTX conjugate that can spontaneously self-assemble in aqueous solutions to become nanoparticles.Methods: DTX was covalently attached to hydrophilic PGG by direct esterification, and the conjugate was characterized by proton nuclear magnetic resonance spectroscopy, molecular weight gel permeation chromatography, solubility, size distribution and morphology, and hemolysis. Conjugated DTX was found to have 2000 times improved water solubility compared with free DTX. Dynamic light scattering, transmission electron microscopy, and atomic force microscopy revealed the particle size, distribution and morphology of the PGG–DTX conjugate. In addition, the conjugate was further tested for in vitro cytotoxicity and in vivo antitumor efficacy on the human non-small cell lung cancer cell line NCI-H460.Results: Conjugated DTX was found to have 2000 times improved water solubility compared with free DTX. The conjugate formed nanoparticles with an average diameter of 30 nm in spherical shape and unimodal particle size distribution. The conjugate exhibited about 2% hemolysis at 10 mg/mL, compared with 56% for Tween 80® at 0.4 mg/mL, and 33% for Cremophor EL® at 10 mg/mL. In addition, the conjugate was further tested for in vitro cytotoxicity and in vivo antitumor efficacy on the human non-small cell lung cancer cell line NCI-H460. As expected, conjugated DTX exhibited lower cytotoxicity compared to that of free DTX, in concentration
Directory of Open Access Journals (Sweden)
Qianqian Wang
2018-03-01
Full Text Available Protein arginine methyltransferase 5 (PRMT5 is able to regulate gene transcription by catalyzing the symmetrical dimethylation of arginine residue of histone, which plays a key role in tumorigenesis. Many efforts have been taken in discovering small-molecular inhibitors against PRMT5, but very few were reported and most of them were SAM-competitive. EPZ015666 is a recently reported PRMT5 inhibitor with a new binding site, which is different from S-adenosylmethionine (SAM-binding pocket. This new binding site provides a new clue for the design and discovery of potent and specific PRMT5 inhibitors. In this study, the structure-based virtual screening targeting this site was firstly performed to identify potential PRMT5 inhibitors. Then, the bioactivity of the candidate compound was studied. MTT results showed that compound T1551 decreased cell viability of A549 and H460 non-small cell lung cancer cell lines. By inhibiting the methyltransferase activity of PRMT5, T1551 reduced the global level of H4R3 symmetric dimethylation (H4R3me2s. T1551 also downregulated the expression of oncogene FGFR3 and eIF4E, and disturbed the activation of related PI3K/AKT/mTOR and ERK signaling in A549 cell. Finally, we investigated the conformational spaces and identified collective motions important for description of T1551/PRMT5 complex by using molecular dynamics simulation and normal mode analysis methods. This study provides a novel non-SAM-competitive hit compound for developing small molecules targeting PRMT5 in non-small cell lung cancer.
Lu, Xing; Wu, Yi-Ming; Yang, Jing-Mei; Ma, Feng-E; Li, Liang-Ping; Chen, Sheng; Zhang, Ye; Ni, Qing-Ling; Pan, Ying-Ming; Hong, Xue; Peng, Yan
2018-05-10
A series of 2(1H)-quinolinone derivatives and their rhodium (III) complexes were designed and synthesized. All the rhodium (III) complexes exhibited higher in vitro cytotoxicity for Hep G2, HeLa 229, MGC80-3, and NCI-H460 human tumor cell lines than their ligands and cisplatin, and among them complex 9 was found to be selectively cytotoxic to tumor cells. Further investigation revealed that complex 9 caused cell cycle arrest at the G2/M phase and induced apoptosis, and inhibited the proliferation of Hep G2 cells by impeding the phosphorylation of epidermal growth factor receptor (EGFR) and its downstream enzymes. Complex 9 also up-regulated the proapoptotic proteins Bak, Bax, and Bim, which altogether activated caspase-3/9 to initiate cell apoptosis. Notably, complex 9 effectively inhibited tumor growth in the NCI-H460 xenograft mouse model with less adverse effect than cisplatin. Copyright © 2018 Elsevier Masson SAS. All rights reserved.
Directory of Open Access Journals (Sweden)
Kyung Eun Choi
2014-07-01
Full Text Available Our previous findings have demonstrated that bee venom (BV has anti-cancer activity in several cancer cells. However, the effects of BV on lung cancer cell growth have not been reported. Cell viability was determined with trypan blue uptake, soft agar formation as well as DAPI and TUNEL assay. Cell death related protein expression was determined with Western blotting. An EMSA was used for nuclear factor kappaB (NF-κB activity assay. BV (1–5 μg/mL inhibited growth of lung cancer cells by induction of apoptosis in a dose dependent manner in lung cancer cell lines A549 and NCI-H460. Consistent with apoptotic cell death, expression of DR3 and DR6 was significantly increased. However, deletion of DRs by small interfering RNA significantly reversed BV induced cell growth inhibitory effects. Expression of pro-apoptotic proteins (caspase-3 and Bax was concomitantly increased, but the NF-κB activity and expression of Bcl-2 were inhibited. A combination treatment of tumor necrosis factor (TNF-like weak inducer of apoptosis, TNF-related apoptosis-inducing ligand, docetaxel and cisplatin, with BV synergistically inhibited both A549 and NCI-H460 lung cancer cell growth with further down regulation of NF-κB activity. These results show that BV induces apoptotic cell death in lung cancer cells through the enhancement of DR3 expression and inhibition of NF-κB pathway.
Jiang, Li; Luo, Man; Liu, Dan; Chen, Bojiang; Zhang, Wen; Mai, Lin; Zeng, Jing; Huang, Na; Huang, Yi; Mo, Xianming; Li, Weimin
2013-06-01
The pro-apoptotic Bcl-2 protein BAD initiated apoptosis in human cells and has been identified as a prognostic marker in non-small cell lung cancer (NSCLC). In this study, we aimed to explore the functions of BAD in NSCLC. Overexpression of BAD was performed by transfecting different NSCLC cell lines with wild-type BAD. Cell proliferation, cell cycle, apoptosis, and invasion were characterized in vitro. Tumorigenicity was analyzed in vivo. Western blot was performed to determine the effects of BAD overexpression on the Bcl-2 family proteins and apoptosis-related proteins. Overexpression of BAD significantly inhibited cell proliferation in H1299, H292, and SPC-A1 but not in SK-MES-1 and H460 cell lines in vitro. BAD overexpression also reduced the tumorigenicity of H1299/SPC-A1 cell in vivo. However, no appreciable effects on cell cycle distribution and invasion were observed in all these cell lines. BAD overexpression also induced apoptosis in all cell types, in which process expression of mitochondrial cytochrom c (cyto-c) and caspase 3 were increased, whereas Bcl-xl, Bcl-2, Bax and caspase 8 expressions did not changed. These findings indicated that a mitochondrial pathway, in which process cyto-c was released from mitochondrial to activate caspase 3, was involved in BAD overexpression-mediated apoptosis. Our data suggested that increased expression of BAD enhance apoptosis and has negative influence on cell proliferation and tumor growth in NSCLC. Bad is a new potential target for tumor interventions.
Small Molecular TRAIL Inducer ONC201 Induces Death in Lung Cancer Cells: A Preclinical Study
Feng, Yuan; Zhou, Jihong; Li, Zhanhua; Jiang, Ying; Zhou, Ying
2016-01-01
Tumor necrosis factor (TNF)-related apoptosis-inducing ligand (TRAIL) selectively targets cancer cells. The present preclinical study investigated the anti-cancer efficiency of ONC201, a first-in-class small molecule TRAIL inducer, in lung cancer cells. We showed that ONC201 was cytotoxic and anti-proliferative in both established (A549 and H460 lines) and primary human lung cancer cells. It was yet non-cytotoxic to normal lung epithelial cells. Further, ONC201 induced exogenous apoptosis act...
International Nuclear Information System (INIS)
Li, Qingchang; Dong, Qianze; Wang, Enhua
2012-01-01
Highlights: ► Rsf-1 expression is elevated in non-small cell lung cancers. ► Rsf-1 depletion inhibits proliferation and increased apoptosis in lung cancer cells. ► Rsf-1 depletion decreases the level of cyclinD1 and phosphor-ERK expression. -- Abstract: Rsf-1 (HBXAP) was recently reported to be overexpressed in various cancers and associated with the malignant behavior of cancer cells. However, the expression of Rsf-1 in primary lung cancer and its biological roles in non-small cell lung cancer (NSCLC) have not been reported. The molecular mechanism of Rsf-1 in cancer aggressiveness remains ambiguous. In the present study, we analyzed the expression pattern of Rsf-1 in NSCLC tissues and found that Rsf-1 was overexpressed at both the mRNA and protein levels. There was a significant association between Rsf-1 overexpression and TNM stage (p = 0.0220) and poor differentiation (p = 0.0013). Furthermore, knockdown of Rsf-1 expression in H1299 and H460 cells with high endogenous Rsf-1 expression resulted in a decrease of colony formation ability and inhibition of cell cycle progression. Rsf-1 knockdown also induced apoptosis in these cell lines. Further analysis showed that Rsf-1 knockdown decreased cyclin D1 expression and phospho-ERK levels. In conclusion, Rsf-1 is overexpressed in NSCLC and contributes to malignant cell growth by cyclin D1 and ERK modulation, which makes Rsf-1 a candidate therapeutic target in lung cancer.
Cancer - lung - non-small cell; Non-small cell lung cancer; NSCLC; Adenocarcinoma - lung; Squamous cell carcinoma - lung ... Research shows that smoking marijuana may help cancer cells grow. But there is no direct link between ...
Directory of Open Access Journals (Sweden)
Nan Hua
Full Text Available Lung cancers express the cholinergic autocrine loop, which facilitates the progression of cancer cells. The antagonists of mAChRs have been demonstrated to depress the growth of small cell lung cancers (SCLCs. In this study we intended to investigate the growth inhibitory effect of R2HBJJ, a novel muscarinic antagonist, on non-small cell lung cancer (NSCLC cells and the possible mechanisms. The competitive binding assay revealed that R2HBJJ had a high affinity to M3 and M1 AChRs. R2HBJJ presented a strong anticholinergic activity on carbachol-induced contraction of guinea-pig trachea. R2HBJJ markedly suppressed the growth of NSCLC cells, such as H1299, H460 and H157. In H1299 cells, both R2HBJJ and its leading compound R2-PHC displayed significant anti-proliferative activity as M3 receptor antagonist darifenacin. Exogenous replenish of ACh could attenuate R2HBJJ-induced growth inhibition. Silencing M3 receptor or ChAT by specific-siRNAs resulted in a growth inhibition of 55.5% and 37.9% on H1299 cells 96 h post transfection, respectively. Further studies revealed that treatment with R2HBJJ arrested the cell cycle in G0/G1 by down-regulation of cyclin D1-CDK4/6-Rb. Therefore, the current study reveals that NSCLC cells express an autocrine and paracrine cholinergic system which stimulates the growth of NSCLC cells. R2HBJJ, as a novel mAChRs antagonist, can block the local cholinergic loop by antagonizing predominantly M3 receptors and inhibit NSCLC cell growth, which suggest that M3 receptor antagonist might be a potential chemotherapeutic regimen for NSCLC.
Xia, Rongmu; Xu, Gang; Huang, Yue; Sheng, Xin; Xu, Xianlin; Lu, Hongling
2018-05-15
The present study aimed to investigate the ability of hesperidin to suppress the migration and invasion of A549 cells, and to investigate the role of the SDF-1/CXCR-4 cascade in this suppression. We performed a Transwell migration assay to measure the migratory capability of A549 cells treated with 0.5% DMSO, SDF-1α, AMD3100 or hesperidin. The SDF-1 level in the culture medium was determined by an enzyme-linked immunosorbent assay (ELISA) to detect whether different concentrations of hesperidin affected SDF-1 secretion. A wound-healing assay was performed to determine the effects of different concentrations of hesperidin on the migration inhibition of A549, H460 and H1975 cells. Additionally, the effect of various hesperidin concentrations on the rate of A549 cell invasion and migration was examined with and without Matrigel in Transwell assays, respectively. Western blot analysis was used to evaluate the protein levels of CXCR-4, MMP-9, CK-19, Vimentin, p65, p-p65, p-IκB, IκB, p-Akt and Akt. RT-qPCR was used to detect the mRNA levels of CXCR-4, MMP-9, CK-19, Vimentin, p65, IκB, SDF-1 and Akt. The Transwell migration assay indicated that SDF-1α promoted A549 cell migration, while AMD3100 and hesperidin significantly inhibited the migratory capability. The wound-healing assay demonstrated that hesperidin treatment significantly reduced the rate of wound closure compared with the control group in a dose-dependent manner. Similarly, the migration and invasive abilities of A549 cells, H460 and H1975 cells treated with hesperidin were significantly decreased compared with the control group. The ELISA data suggested that hesperidin attenuated the secretion of SDF-1 from A549 cells in a dose-dependent manner. Furthermore, western blot analysis indicated that SDF-1α treatment significantly increased the levels of CXCR-4, p-p65, p-IκB and p-Akt in A549 cells. In contrast, AMD3100 or hesperidin reversed the effect induced by SDF-1α through decreasing the expression
Zhang, Jing-Xi; Han, Yi-Ping; Bai, Chong; Li, Qiang
2015-01-01
Previous studies have shown that Astragalus polysaccharide (APS) can be applied to anti-cancer. However, the mechanism by which APS mediate this effect is unclear. In the present study, APS-mediated NSCLC cell apoptosis was investigated through the regulation of the notch signaling pathway. The cell viability was detected by the CCK8 assay. The mRNA and protein expression of notch1/3 and tumor suppressors were analyzed by RT-PCR and western blotting, respectively. The mRNA and protein of notch1 and notch3 were significantly up-regulated in tumor tissues as compared to non-tumor adjacent tissues. Treatment of human NSCLC cells with APS induced cell death in a dose-and time-dependent manner by using CCK8 assay. The mRNA and protein expression of notch1 and notch3 were significantly lower in NSCLC cells with APS treatment than that in control group. Moreover, western blotting analysis showed that treatment of H460 cells with APS significantly increased the pro-apoptotic Bax and caspase 8 levels, decreased the anti-apoptotic Bcl-2 level. Furthermore, p53, p21 and p16 were obviously up-regulated by APS treatment in H460 cell. This study demonstrated that APS-treated could inhibit proliferation and promote cell apoptosis, at least partially, through suppressing the expression of notch1 and notch3 and up-regulating the expression of tumor suppressors in H460 NSCLC cell lines.
Permissivity of the NCI-60 cancer cell lines to oncolytic Vaccinia Virus GLV-1h68
International Nuclear Information System (INIS)
Ascierto, Maria Libera; Bedognetti, Davide; Uccellini, Lorenzo; Rossano, Fabio; Ascierto, Paolo A; Stroncek, David F; Restifo, Nicholas P; Wang, Ena; Szalay, Aladar A; Marincola, Francesco M; Worschech, Andrea; Yu, Zhiya; Adams, Sharon; Reinboth, Jennifer; Chen, Nanhai G; Pos, Zoltan; Roychoudhuri, Rahul; Di Pasquale, Giovanni
2011-01-01
Oncolytic viral therapy represents an alternative therapeutic strategy for the treatment of cancer. We previously described GLV-1h68, a modified Vaccinia Virus with exclusive tropism for tumor cells, and we observed a cell line-specific relationship between the ability of GLV-1h68 to replicate in vitro and its ability to colonize and eliminate tumor in vivo. In the current study we surveyed the in vitro permissivity to GLV-1h68 replication of the NCI-60 panel of cell lines. Selected cell lines were also tested for permissivity to another Vaccinia Virus and a vesicular stomatitis virus (VSV) strain. In order to identify correlates of permissity to viral infection, we measured transcriptional profiles of the cell lines prior infection. We observed highly heterogeneous permissivity to VACV infection amongst the cell lines. The heterogeneity of permissivity was independent of tissue with the exception of B cell derivation. Cell lines were also tested for permissivity to another Vaccinia Virus and a vesicular stomatitis virus (VSV) strain and a significant correlation was found suggesting a common permissive phenotype. While no clear transcriptional pattern could be identified as predictor of permissivity to infection, some associations were observed suggesting multifactorial basis permissivity to viral infection. Our findings have implications for the design of oncolytic therapies for cancer and offer insights into the nature of permissivity of tumor cells to viral infection
Directory of Open Access Journals (Sweden)
Chon-Kit Chou
2018-06-01
Full Text Available Unfolded protein response (UPR is a cytoprotective mechanism that alleviates the protein-folding burden in eukaryotic organisms. Moderate activation of UPR is required for maintaining endoplasmic reticulum (ER homeostasis and profoundly contributes to tumorigenesis. Defects in UPR signaling are implicated in the attenuation of various malignant phenotypes including cell proliferation, migration, and invasion, as well as angiogenesis. This suggests UPR as a promising target in cancer therapy. The pharmacological effects of the plant Scindapsus cf. hederaceus on human cancer cell lines is not understood. In this study, we identified an ethyl acetate extract from Scindapsus cf. hederaceus (SH-EAE, which markedly altered the protein expression of UPR-related genes in human non-small cell lung cancer (NSCLC cells. Treatment with the SH-EAE led to the dose-dependent suppression of colony forming ability of both H1299 and H460 cells, but not markedly in normal bronchial epithelial BEAS-2B cells. SH-EAE treatment also attenuated the migration and invasion ability of H1299 and H460 cells. Moreover, SH-EAE strikingly suppressed the protein expression of two ER stress sensors, including inositol requiring enzyme-1α (IRE-1α and protein kinase R-like ER kinase (PERK, and antagonized the induction of C/EBP homologous protein (CHOP expression by thapsigargin, an ER stress inducer. SH-EAE induced the formation of massive vacuoles which are probably derived from ER. Importantly, SH-EAE impaired the formation of intersegmental vessels (ISV in zebrafish larvae, an index of angiogenesis, but had no apparent effect on the rate of larval development. Together, our findings demonstrate, for the first time, that the ability of SH-EAE specifically targets the two sensors of UPR, with significant anti-proliferation and anti-migration activities as a crude extract in human NSCLC cells. Our finding also indicates potential applications of SH-EAE in preventing UPR
DNA fingerprinting of the NCI-60 cell line panel.
Lorenzi, Philip L; Reinhold, William C; Varma, Sudhir; Hutchinson, Amy A; Pommier, Yves; Chanock, Stephen J; Weinstein, John N
2009-04-01
The National Cancer Institute's NCI-60 cell line panel, the most extensively characterized set of cells in existence and a public resource, is frequently used as a screening tool for drug discovery. Because many laboratories around the world rely on data from the NCI-60 cells, confirmation of their genetic identities represents an essential step in validating results from them. Given the consequences of cell line contamination or misidentification, quality control measures should routinely include DNA fingerprinting. We have, therefore, used standard DNA microsatellite short tandem repeats to profile the NCI-60, and the resulting DNA fingerprints are provided here as a reference. Consistent with previous reports, the fingerprints suggest that several NCI-60 lines have common origins: the melanoma lines MDA-MB-435, MDA-N, and M14; the central nervous system lines U251 and SNB-19; the ovarian lines OVCAR-8 and OVCAR-8/ADR (also called NCI/ADR); and the prostate lines DU-145, DU-145 (ATCC), and RC0.1. Those lines also show that the ability to connect two fingerprints to the same origin is not affected by stable transfection or by the development of multidrug resistance. As expected, DNA fingerprints were not able to distinguish different tissues-of-origin. The fingerprints serve principally as a barcodes.
Directory of Open Access Journals (Sweden)
Ze-Qun Jiang
2018-02-01
Full Text Available Luteolin (LTL exerts remarkable tumor suppressive activity on various types of cancers, including non-small cell lung cancer (NSCLC. However, it is not completely understood whether the mechanism of its action against NSCLC is related to microRNAs (miRNAs. In the present study, we investigated the anti-tumor effects of LTL on NSCLC in vitro and in vivo. The results revealed that LTL could inhibit cell proliferation and induce apoptosis in both A549 and H460 cells. In a H460 xenograft tumor model of nude mice, LTL significantly suppressed tumor growth, inhibited cell proliferation, and induced apoptosis. miRNA microarray and quantitative PCR (qPCR analysis indicated that miR-34a-5p was dramatically upregulated upon LTL treatment in tumor tissues. Furthermore, MDM4 was proved to be a direct target of miR-34a-5p by luciferase reporter gene assay. LTL treatment was associated with increased p53 and p21 protein expressions and decreased MDM4 protein expression in both NSCLC cells and tumor tissues. When miR-34a-5p was inhibited in vitro, the protein expressions of Bcl-2 and MDM4 were recovered, while that of p53, p21, and Bax were attenuated. Moreover, caspase-3 and caspase-9 activation induced by LHL treatment in vitro were also suppressed by miR-34a-5p inhibition. Overall, LTL could inhibit tumorigenesis and induce apoptosis of NSCLC cells by upregulation of miR-34a-5p via targeting MDM4. These findings provide novel insight into the molecular functions of LTL that suggest its potential as a therapeutic agent for human NSCLC.
International Nuclear Information System (INIS)
Zhang, Xiaochun; Fang, Bingliang; Mohan, Radhe; Chang, Joe Y.
2012-01-01
Background: Treatment resistance resulting from the presence of cancer stem cells (CSCs) remains a challenge in cancer treatment. Little is known about possible markers of CSCs in treatment-resistant non-small cell lung cancer (NSCLC). We explored the coxsackie-adenovirus receptor (CAR) as one such marker of CSCs in models of treatment-resistant NSCLC. Materials and methods: Resistant H460 and A549 cell lines were established by repeated exposure to paclitaxel or fractionated radiation. CSC markers were measured by Western blotting and flow cytometry. We also established stable CAR-overexpressing and stable shRNA-CAR-knockdown cell lines and assessed their survival, invasiveness, and tumorigenic capabilities with clonogenic, telomerase, Matrigel, and tumor formation assays. Results: CAR expression was associated with CSC phenotype both in vitro and in vivo. CAR-overexpressing cells were more treatment-resistant, self-renewing, and tumorigenic than were parental cells, and shRNA-mediated knockdown of CAR expression was sufficient to inhibit these functions. CAR expression also correlated with the epithelial–mesenchymal transition. Conclusions: We showed for the first time that CAR is a marker of CSCs and may affect the activities of CSCs in treatment-resistant NSCLC. CAR may prove to be a target for CSC treatment and a predictor of treatment response in patients with NSCLC.
Abdallah, Amira Elsayed Mahmoud; Mohareb, Rafat Milad; Khalil, Eid Metwally; Elshamy, Menna Alla Mohamed Abd Elaleem
2017-01-01
The 2-amino-3-cyano-4,5,6,7-tetrahydrobenzo[b]thiophene was the key starting compound used to synthesize new thiazole, pyrimidine, pyran, pyridine and thiazine derivatives. The cytotoxicity of the synthesized compounds was studied towards the three cancer cell lines namely MCF-7 (breast adenocarcinoma), NCI-H460 (non-small cell lung cancer) and SF-268 (central nervous system (CNS) cancer) in addition to the normal cell line (WI-38) using doxorubicin as the reference drug. The study showed that compounds 5, 9a, 15b, 17c, 18 and 21b were the most potent compounds.
Wang, Hao; Meng, Ai-Min; Li, Sheng-Hua; Zhou, Xiao-Liang
2017-07-01
Carcinoembryonic antigen (CEA) is a biomarker and therapy target for non‑small cell lung cancer (NSCLC), which is the most common type of lung cancer. Nanobodies with high target specificity are promising candidates to function as anti‑CEA probes. In the present study, the targeting effects of an anti‑CEA nanobody obtained from phage display were investigated using technetium‑99 m (99mTc) and fluorescence labeling. In vitro binding and immunofluorescent staining assays, as well as in vivo blood clearance and biodistribution assays were performed. High specificity and affinity of the nanobody for CEA‑positive H460 cells was observed in vitro. The pharmacokinetics assay of the 99mTc‑nanobody in Wistar rats demonstrated that the nanobody had appropriate T1/2α and T1/2β, which were 20.2 and 143.5 min, respectively. The biodistribution assay using H460 xenograft‑bearing nude mice demonstrated a high ratio of signal in tumor compared with background, which confirmed that the nanobody may be useful as a molecular probe for CEA‑positive cancer, particularly in NSCLC.
Energy Technology Data Exchange (ETDEWEB)
Du, Shisuo; Bouquet, Sophie; Lo, Chen-Hao; Pellicciotta, Ilenia; Bolourchi, Shiva [Department of Radiation Oncology, New York University School of Medicine, New York, New York (United States); Parry, Renate [Varian Medical Systems, Palo Alto, California (United States); Barcellos-Hoff, Mary Helen, E-mail: mhbarcellos-hoff@nyumc.org [Department of Radiation Oncology, New York University School of Medicine, New York, New York (United States)
2015-01-01
Purpose: To determine whether transforming growth factor (TGF)-β inhibition increases the response to radiation therapy in human and mouse non–small-cell lung carcinoma (NSCLC) cells in vitro and in vivo. Methods and Materials: TGF-β–mediated growth response and pathway activation were examined in human NSCLC NCI-H1299, NCI-H292, and A549 cell lines and murine Lewis lung cancer (LLC) cells. Cells were treated in vitro with LY364947, a small-molecule inhibitor of the TGF-β type 1 receptor kinase, or with the pan-isoform TGF-β neutralizing monoclonal antibody 1D11 before radiation exposure. The DNA damage response was assessed by ataxia telangiectasia mutated (ATM) or Trp53 protein phosphorylation, γH2AX foci formation, or comet assay in irradiated cells. Radiation sensitivity was determined by clonogenic assay. Mice bearing syngeneic subcutaneous LLC tumors were treated with 5 fractions of 6 Gy and/or neutralizing or control antibody. Results: The NCI-H1299, A549, and LLC NSCLC cell lines pretreated with LY364947 before radiation exposure exhibited compromised DNA damage response, indicated by decreased ATM and p53 phosphorylation, reduced γH2AX foci, and increased radiosensitivity. The NCI-H292 cells were unresponsive. Transforming growth factor-β signaling inhibition in irradiated LLC cells resulted in unresolved DNA damage. Subcutaneous LLC tumors in mice treated with TGF-β neutralizing antibody exhibited fewer γH2AX foci after irradiation and significantly greater tumor growth delay in combination with fractionated radiation. Conclusions: Inhibition of TGF-β before radiation attenuated DNA damage recognition and increased radiosensitivity in most NSCLC cells in vitro and promoted radiation-induced tumor control in vivo. These data support the rationale for concurrent TGF-β inhibition and RT to provide therapeutic benefit in NSCLC.
Rajavel, Tamilselvam; Packiyaraj, Pandian; Suryanarayanan, Venkatesan; Singh, Sanjeev Kumar; Ruckmani, Kandasamy; Pandima Devi, Kasi
2018-02-01
β-Sitosterol (BS), a major bioactive constituent present in plants and vegetables has shown potent anticancer effect against many human cancer cells, but the underlying mechanism remain elusive on NSCLC cancers. We found that BS significantly inhibited the growth of A549 cells without harming normal human lung and PBMC cells. Further, BS treatment triggered apoptosis via ROS mediated mitochondrial dysregulation as evidenced by caspase-3 & 9 activation, Annexin-V/PI positive cells, PARP inactivation, loss of MMP, Bcl-2-Bax ratio alteration and cytochrome c release. Moreover, generation of ROS species and subsequent DNA stand break were found upon BS treatment which was reversed by addition of ROS scavenger (NAC). Indeed BS treatment increased p53 expression and its phosphorylation at Ser15, while silencing the p53 expression by pifithrin-α, BS induced apoptosis was reduced in A549 cells. Furthermore, BS induced apoptosis was also observed in NCI-H460 cells (p53 wild) but not in the NCI-H23 cells (p53 mutant). Down-regulation of Trx/Trx1 reductase contributed to the BS induced ROS accumulation and mitochondrial mediated apoptotic cell death in A549 and NCI-H460 cells. Taken together, our findings provide evidence for the novel anti-cancer mechanism of BS which could be developed as a promising chemotherapeutic drug against NSCLC cancers.
Directory of Open Access Journals (Sweden)
Richard Daifuku
2018-04-01
Full Text Available 5-aza-2′,2′-difluorodeoxycytidine (NUC013 has been shown to be significantly safer and more effective than decitabine in xenograft models of human leukemia and colon cancer. However, it suffers from a similar short half-life as other DNA methyltransferase inhibitors with a 5-azacytosine base, which is problematic for nucleosides that primarily target tumor cells in S phase. Because of the relative instability of 5-azanucleosides, a prodrug approach was developed to improve the pharmacology of NUC013. NUC013 was conjugated with trimethylsilanol (TMS at the 3′ and 5′ position of the sugar, rendering the molecule hydrophobic and producing 3′,5′-di-trimethylsilyl-2′,2′-difluoro-5-azadeoxycytidine (NUC041. NUC041 was designed to be formulated in a hydrophobic vehicle, protecting it from deamination and hydrolysis. In contact with blood, the TMS moieties are readily hydrolyzed to release NUC013. The half-life of NUC013 administered intravenously in mice is 20.1 min, while that of NUC013 derived from intramuscular NUC041 formulated in a pegylated-phospholipid depot is 3.4 h. In a NCI-H460 xenograft of non-small cell lung cancer, NUC013 was shown to significantly inhibit tumor growth and improve survival. Treatment with NUC041 also led to significant tumor growth inhibition. However, NUC041-treated mice had significantly more tumors ulcerate than either NUC013 treated mice or saline control mice, and such ulceration occurred at significantly lower tumor volumes. In these nude mice, tumor regression was likely mediated by the derepression of the tumor suppressor gene p53 and resultant activation of natural killer (NK cells.
Bano, Shaista; Siddiqui, Bina Shaheen; Farooq, Ahsana Dar; Begum, Sabira; Siddiqui, Faheema; Kashif, Muhammad; Azhar, Mudassar
2017-12-01
Several Euphorbia species have been used in folklore as cancer remedies, however, scientific studies on the cytotoxicity (in vitro studies) of Euphorbia caducifolia are lacking. In present study, anticancer potential of E. caducifolia aerial parts ethanol extract and its fractions were evaluated against human lung (NCI-H460), breast (MCF-7), prostate (PC-3) and cervical (HeLa) cancer cell lines, using sulphorhodamine-B in vitro cytotoxicity (in vitro studies) assay. The ethanol extract demonstrated growth inhibitory effect against all aforementioned cancer cell lines with IC 50 , 19-135 μg/mL and LC 50 , ~220 μg/mL, and its petroleum ether fraction obtained on bioactivity guided fraction showed highest activity with IC 50 , 28-70 μg/mL and LC 50 , 71 μg/mL against NCI-H460 and MCF-7 cell lines. Its phytochemicals were analysed by gas chromatography-mass spectrometry (GC-MS). The present study provides scientific justification for its traditional use against cancer.
Barr, Martin P.; Gray, Steven G.; Hoffmann, Andreas C.; Hilger, Ralf A.; Thomale, Juergen; O’Flaherty, John D.; Fennell, Dean A.; Richard, Derek; O’Leary, John J.; O’Byrne, Kenneth J.
2013-01-01
Introduction Inherent and acquired cisplatin resistance reduces the effectiveness of this agent in the management of non-small cell lung cancer (NSCLC). Understanding the molecular mechanisms underlying this process may result in the development of novel agents to enhance the sensitivity of cisplatin. Methods An isogenic model of cisplatin resistance was generated in a panel of NSCLC cell lines (A549, SKMES-1, MOR, H460). Over a period of twelve months, cisplatin resistant (CisR) cell lines were derived from original, age-matched parent cells (PT) and subsequently characterized. Proliferation (MTT) and clonogenic survival assays (crystal violet) were carried out between PT and CisR cells. Cellular response to cisplatin-induced apoptosis and cell cycle distribution were examined by FACS analysis. A panel of cancer stem cell and pluripotent markers was examined in addition to the EMT proteins, c-Met and β-catenin. Cisplatin-DNA adduct formation, DNA damage (γH2AX) and cellular platinum uptake (ICP-MS) was also assessed. Results Characterisation studies demonstrated a decreased proliferative capacity of lung tumour cells in response to cisplatin, increased resistance to cisplatin-induced cell death, accumulation of resistant cells in the G0/G1 phase of the cell cycle and enhanced clonogenic survival ability. Moreover, resistant cells displayed a putative stem-like signature with increased expression of CD133+/CD44+cells and increased ALDH activity relative to their corresponding parental cells. The stem cell markers, Nanog, Oct-4 and SOX-2, were significantly upregulated as were the EMT markers, c-Met and β-catenin. While resistant sublines demonstrated decreased uptake of cisplatin in response to treatment, reduced cisplatin-GpG DNA adduct formation and significantly decreased γH2AX foci were observed compared to parental cell lines. Conclusion Our results identified cisplatin resistant subpopulations of NSCLC cells with a putative stem-like signature, providing
Directory of Open Access Journals (Sweden)
Martin P Barr
Full Text Available Inherent and acquired cisplatin resistance reduces the effectiveness of this agent in the management of non-small cell lung cancer (NSCLC. Understanding the molecular mechanisms underlying this process may result in the development of novel agents to enhance the sensitivity of cisplatin.An isogenic model of cisplatin resistance was generated in a panel of NSCLC cell lines (A549, SKMES-1, MOR, H460. Over a period of twelve months, cisplatin resistant (CisR cell lines were derived from original, age-matched parent cells (PT and subsequently characterized. Proliferation (MTT and clonogenic survival assays (crystal violet were carried out between PT and CisR cells. Cellular response to cisplatin-induced apoptosis and cell cycle distribution were examined by FACS analysis. A panel of cancer stem cell and pluripotent markers was examined in addition to the EMT proteins, c-Met and β-catenin. Cisplatin-DNA adduct formation, DNA damage (γH2AX and cellular platinum uptake (ICP-MS was also assessed.Characterisation studies demonstrated a decreased proliferative capacity of lung tumour cells in response to cisplatin, increased resistance to cisplatin-induced cell death, accumulation of resistant cells in the G0/G1 phase of the cell cycle and enhanced clonogenic survival ability. Moreover, resistant cells displayed a putative stem-like signature with increased expression of CD133+/CD44+cells and increased ALDH activity relative to their corresponding parental cells. The stem cell markers, Nanog, Oct-4 and SOX-2, were significantly upregulated as were the EMT markers, c-Met and β-catenin. While resistant sublines demonstrated decreased uptake of cisplatin in response to treatment, reduced cisplatin-GpG DNA adduct formation and significantly decreased γH2AX foci were observed compared to parental cell lines.Our results identified cisplatin resistant subpopulations of NSCLC cells with a putative stem-like signature, providing a further understanding of the
Growth inhibitory effects of miR-221 and miR-222 in non-small cell lung cancer cells
International Nuclear Information System (INIS)
Yamashita, Ryo; Sato, Mitsuo; Kakumu, Tomohiko; Hase, Tetsunari; Yogo, Naoyuki; Maruyama, Eiichi; Sekido, Yoshitaka; Kondo, Masashi; Hasegawa, Yoshinori
2015-01-01
Both pro- and anti-oncogenic roles of miR-221 and miR-222 microRNAs are reported in several types of human cancers. A previous study suggested their oncogenic role in invasiveness in lung cancer, albeit only one cell line (H460) was used. To further evaluate involvement of miR-221 and miR-222 in lung cancer, we investigated the effects of miR-221 and miR-222 overexpression on six lung cancer cell lines, including H460, as well as one immortalized normal human bronchial epithelial cell line, HBEC4. miR-221 and miR-222 induced epithelial-to-mesenchymal transition (EMT)-like changes in a minority of HBEC4 cells but, unexpectedly, both the microRNAs rather suppressed their invasiveness. Consistent with the prior report, miR-221 and miR-222 promoted growth in H460; however, miR-221 suppressed growth in four other cell lines with no effects in one, and miR-222 suppressed growth in three cell lines but promoted growth in two. These are the first results to show tumor-suppressive effects of miR-221 and miR-222 in lung cancer cells, and we focused on clarifying the mechanisms. Cell cycle and apoptosis analyses revealed that growth suppression by miR-221 and miR-222 occurred through intra-S-phase arrest and/or apoptosis. Finally, lung cancer cell lines transfected with miR-221 or miR-222 became more sensitive to the S-phase targeting drugs, possibly due to an increased S-phase population. In conclusion, our data are the first to show tumor-suppressive effects of miR-221 and miR-222 on lung cancer, warranting testing their potential as therapeutics for the disease
International Nuclear Information System (INIS)
Spindola, Humberto M.; Carvalho, Joao E. de; Ruiz, Ana Lucia T.G.; Rodrigues, Rodney A. F.; Denny, Carina; Sousa, Ilza M. de Oliveira; Foglio, Mary Ann; Tamashiro, Jorge Y.
2009-01-01
Activity guided fractionation of Pterodon pubescens Benth. methylene chloride-soluble fraction afforded novel 6α-acetoxi 7β-hydroxy-vouacapan 1 and four known diterpene furans 2, 3, 4, 5. The compounds were evaluated for in vitro cytotoxic activities against human normal cells and tumour cell lines UACC-62 (melanoma), MCF-7 (breast), NCI-H460 (lung, non-small cells), OVCAR-03 (ovarian), PC-3 (prostate), HT-29 (colon), 786-0 (renal), K562 (leukemia) and NCI-ADR/RES (ovarian expressing phenotype multiple drugs resistance). Results were expressed by three concentration dependent parameters GI 50 (concentration that produces 50% growth inhibition), TGI (concentration that produces total growth inhibition or cytostatic effect) and LC 50 (concentration that produces .50% growth, a cytotoxicity parameter). Also, in vitro cytotoxicity was evaluated against 3T3 cell line (mouse embryonic fibroblasts). Antiproliferative properties of compounds 1, 4 and 5 are herein reported for the first time. These compounds showed selectivity in a concentration-dependent way against human PC-3. Compound 1 demonstrated selectivity 26 fold more potent than the positive control, doxorubicin, for PC-3 (prostrate) cell line based on GI 50 values, causing cytostatic effect (TGI value) at a concentration fifteen times less than positive control. Moreover comparison of 50% lethal concentration (LC 50 value) with positive control (doxorubicin) suggested that compound 1 was less toxic. (author)
Zeng, Huawei; Trujillo, Olivia N; Moyer, Mary P; Botnen, James H
2011-01-01
Sulforaphane (SFN) is a naturally occurring chemopreventive agent; the induction of cell cycle arrest and apoptosis is a key mechanism by which SFN exerts its colon cancer prevention. However, little is known about the differential effects of SFN on colon cancer and normal cells. In this study, we demonstrated that SFN (15 μmol/L) exposure (72 h) inhibited cell proliferation by up to 95% in colon cancer cells (HCT116) and by 52% in normal colon mucosa-derived (NCM460) cells. Our data also showed that SFN exposure (5 and 10 μmol/L) led to the reduction of G1 phase cell distribution and an induction of apoptosis in HCT116 cells, but to a much lesser extent in NCM460 cells. Furthermore, the examination of mitogen-activated protein kinase (MAPK) signaling status revealed that SFN upregulated the phosphorylation of extracellular-regulated kinase 1/2 (ERK1/2) in NCM460 cells but not in HCT116 cells. In contrast, SFN enhanced the phosphorylation of stress-activated protein kinase (SAPK) and decreased cellular myelocytomatosis oncogene (c-Myc) expression in HCT116 cells but not NCM460 cells. Taken together, the activation of survival signaling in NCM460 cells and apoptotic signaling in HCT116 cells may play a critical role in SFN's stronger potential of inhibiting cell proliferation in colon cancer cells than in normal colon cells. Copyright © 2011, Taylor & Francis Group, LLC
Nicotine transport in lung and non-lung epithelial cells.
Takano, Mikihisa; Kamei, Hidetaka; Nagahiro, Machi; Kawami, Masashi; Yumoto, Ryoko
2017-11-01
Nicotine is rapidly absorbed from the lung alveoli into systemic circulation during cigarette smoking. However, mechanism underlying nicotine transport in alveolar epithelial cells is not well understood to date. In the present study, we characterized nicotine uptake in lung epithelial cell lines A549 and NCI-H441 and in non-lung epithelial cell lines HepG2 and MCF-7. Characteristics of [ 3 H]nicotine uptake was studied using these cell lines. Nicotine uptake in A549 cells occurred in a time- and temperature-dependent manner and showed saturation kinetics, with a Km value of 0.31mM. Treatment with some organic cations such as diphenhydramine and pyrilamine inhibited nicotine uptake, whereas treatment with organic cations such as carnitine and tetraethylammonium did not affect nicotine uptake. Extracellular pH markedly affected nicotine uptake, with high nicotine uptake being observed at high pH up to 11.0. Modulation of intracellular pH with ammonium chloride also affected nicotine uptake. Treatment with valinomycin, a potassium ionophore, did not significantly affect nicotine uptake, indicating that nicotine uptake is an electroneutral process. For comparison, we assessed the characteristics of nicotine uptake in another lung epithelial cell line NCI-H441 and in non-lung epithelial cell lines HepG2 and MCF-7. Interestingly, these cell lines showed similar characteristics of nicotine uptake with respect to pH dependency and inhibition by various organic cations. The present findings suggest that a similar or the same pH-dependent transport system is involved in nicotine uptake in these cell lines. A novel molecular mechanism of nicotine transport is proposed. Copyright © 2017 Elsevier Inc. All rights reserved.
Detection of EGFR mutations with mutation-specific antibodies in stage IV non-small-cell lung cancer
Directory of Open Access Journals (Sweden)
Viteri Santiago
2010-12-01
Full Text Available Abstract Background Immunohistochemistry (IHC with mutation-specific antibodies may be an ancillary method of detecting EGFR mutations in lung cancer patients. Methods EGFR mutation status was analyzed by DNA assays, and compared with IHC results in five non-small-cell lung cancer (NSCLC cell lines and tumor samples from 78 stage IV NSCLC patients. Results IHC correctly identified del 19 in the H1650 and PC9 cell lines, L858R in H1975, and wild-type EGFR in H460 and A549, as well as wild-type EGFR in tumor samples from 22 patients. IHC with the mAb against EGFR with del 19 was highly positive for the protein in all 17 patients with a 15-bp (ELREA deletion in exon 19, whereas in patients with other deletions, IHC was weakly positive in 3 cases and negative in 9 cases. IHC with the mAb against the L858R mutation showed high positivity for the protein in 25/27 (93% patients with exon 21 EGFR mutations (all with L858R but did not identify the L861Q mutation in the remaining two patients. Conclusions IHC with mutation-specific mAbs against EGFR is a promising method for detecting EGFR mutations in NSCLC patients. However these mAbs should be validated with additional studies to clarify their possible role in routine clinical practice for screening EGFR mutations in NSCLC patients.
Higgins, Brian; Kolinsky, Kenneth; Smith, Melissa; Beck, Gordon; Rashed, Mohammad; Adames, Violeta; Linn, Michael; Wheeldon, Eric; Gand, Laurent; Birnboeck, Herbert; Hoffmann, Gerhard
2004-06-01
Our objective was the preclinical assessment of the pharmacokinetics, monotherapy and combined antitumor activity of the epidermal growth factor receptor (HER1/EGFR) tyrosine kinase inhibitor erlotinib in athymic nude mice bearing non-small cell lung cancer (NSCLC) xenograft models. Immunohistochemistry determined the HER1/EGFR status of the NSCLC tumor models. Pharmacokinetic studies assessed plasma drug concentrations of erlotinib in tumor- and non-tumor-bearing athymic nude mice. These were followed by maximum tolerated dose (MTD) studies for erlotinib and each chemotherapy. Erlotinib was then assessed alone and in combination with these chemotherapies in the NSCLC xenograft models. Complete necropsies were performed on most of the animals in each study to further assess antitumor or toxic effects. Erlotinib monotherapy dose-dependently inhibited tumor growth in the H460a tumor model, correlating with circulating levels of drug. There was antitumor activity at the MTD with each agent tested in both the H460a and A549 tumor models (erlotinib 100 mg/kg: 71 and 93% tumor growth inhibition; gemcitabine 120 mg/kg: 93 and 75% tumor growth inhibition; cisplatin 6 mg/kg: 81 and 88% tumor growth inhibition). When each compound was given at a fraction of the MTD, tumor growth inhibition was suboptimal. Combinations of gemcitabine or cisplatin with erlotinib were assessed at 25% of the MTD to determine efficacy. In both NSCLC models, doses of gemcitabine (30 mg/kg) or cisplatin (1.5 mg/kg) with erlotinib (25 mg/kg) at 25% of the MTD were well tolerated. For the slow growing A549 tumor, there was significant tumor growth inhibition in the gemcitabine/erlotinib and cisplatin/erlotinib combinations (above 100 and 98%, respectively), with partial regressions. For the faster growing H460a tumor, there was significant but less remarkable tumor growth inhibition in these same combinations (86 and 53% respectively). These results show that in NSCLC xenograft tumors with similar
Directory of Open Access Journals (Sweden)
Ricardo C. Calhelha
2014-01-01
Full Text Available With a complex chemical composition rich in phenolic compounds, propolis (resinous substance collected by Apis mellifera from various tree buds exhibits a broad spectrum of biological activities. Recently, in vitro and in vivo data suggest that propolis has anticancer properties, but is the cytoxicity of propolis specific for tumor cells? To answer this question, the cytotoxicity of phenolic extracts from Portuguese propolis of different origins was evaluated using human tumor cell lines (MCF7—breast adenocarcinoma, NCI-H460—non-small cell lung carcinoma, HCT15—colon carcinoma, HeLa—cervical carcinoma, and HepG2—hepatocellular carcinoma, and non-tumor primary cells (PLP2. The studied propolis presented high cytotoxic potential for human tumor cell lines, mostly for HCT15. Nevertheless, excluding HCT15 cell line, the extracts at the GI50 obtained for tumor cell lines showed, in general, cytotoxicity for normal cells (PLP2. Propolis phenolic extracts comprise phytochemicals that should be further studied for their bioactive properties against human colon carcinoma. In the other cases, the proximity of the in vitro cytotoxic doses for tumor and normal cell lines should be confirmed by in vivo tests and may highlight the need for selection of specific compounds within the propolis extract.
CellMiner: a relational database and query tool for the NCI-60 cancer cell lines
Directory of Open Access Journals (Sweden)
Reinhold William C
2009-06-01
Full Text Available Abstract Background Advances in the high-throughput omic technologies have made it possible to profile cells in a large number of ways at the DNA, RNA, protein, chromosomal, functional, and pharmacological levels. A persistent problem is that some classes of molecular data are labeled with gene identifiers, others with transcript or protein identifiers, and still others with chromosomal locations. What has lagged behind is the ability to integrate the resulting data to uncover complex relationships and patterns. Those issues are reflected in full form by molecular profile data on the panel of 60 diverse human cancer cell lines (the NCI-60 used since 1990 by the U.S. National Cancer Institute to screen compounds for anticancer activity. To our knowledge, CellMiner is the first online database resource for integration of the diverse molecular types of NCI-60 and related meta data. Description CellMiner enables scientists to perform advanced querying of molecular information on NCI-60 (and additional types through a single web interface. CellMiner is a freely available tool that organizes and stores raw and normalized data that represent multiple types of molecular characterizations at the DNA, RNA, protein, and pharmacological levels. Annotations for each project, along with associated metadata on the samples and datasets, are stored in a MySQL database and linked to the molecular profile data. Data can be queried and downloaded along with comprehensive information on experimental and analytic methods for each data set. A Data Intersection tool allows selection of a list of genes (proteins in common between two or more data sets and outputs the data for those genes (proteins in the respective sets. In addition to its role as an integrative resource for the NCI-60, the CellMiner package also serves as a shell for incorporation of molecular profile data on other cell or tissue sample types. Conclusion CellMiner is a relational database tool for
20 CFR 655.460 - Non-applicability of the Equal Access to Justice Act.
2010-04-01
... Justice Act. 655.460 Section 655.460 Employees' Benefits EMPLOYMENT AND TRAINING ADMINISTRATION... Attestations § 655.460 Non-applicability of the Equal Access to Justice Act. A proceeding under subpart D or E of this part is not subject to the Equal Access to Justice Act, as amended, 5 U.S.C. 504. In such a...
Seo, Kyung Hye; Ryu, Hyung Won; Park, Mi Jin; Park, Ki Hun; Kim, Jin Hyo; Lee, Mi-Ja; Kang, Hyeon Jung; Kim, Sun Lim; Lee, Jin Hwan; Seo, Woo Duck
2015-11-01
Mangosenone F (MSF), a natural xanthone, was isolated form Carcinia mangotana, and a few studies have reported its glycosidase inhibitor effect. In this study we investigated the anti lung cancer effect of MSF both in vitro and in vivo. MSF inhibited cancer cell cytotoxicity and induced and induced apoptosis via reactive oxygen species (ROS) generation in NCI-H460. MSF treatment also showed in pronounced release of apoptogenic cytochrome c from the mitochondria to the cytosol, downregulation of Bcl-2 and Bcl-xL, and upregulation of Bax, suggesting that caspase-mediated pathways were involved in MSF-induced apoptosis. ROS activation of the mitogen-activated protein kinase signaling pathway was shown to play a predominant role in the apoptosis mechanism of MSF. Compared with cisplatin treatment, MSF treatment showed significantly increased inhibition of the growth of NCI-H460 cells xenografted in nude mice. Together, these results indicate the potential of MSF as a candidate natural anticancer drug by promoting ROS production. Copyright © 2015 John Wiley & Sons, Ltd.
Bystander effects of exposure to low-dose-rate 125I seeds on human lung cancers cells in vitro
International Nuclear Information System (INIS)
Jia Rongfei; Chen Honghong; Yu Lei; Zhao Meijia; Shao Chunlin; Cheng Wenying
2007-01-01
The bystander effects induced by continuous low-dose-rate (LDR) 125 I seeds radiation on damage of human lung cancer cells were investigated. Human adenocarcinoma cell line A549 and human small cell lung cancer cell line NCI-H446, which have different sensitivities to high-dose rate (HDR) external irradiation, were exposed directly to 125 I seeds in vitro and co-cultured with unirradiated cells for 24 h. Using cytokinesis-blocking micronucleus method and γ H2AX fluorescence immunoassay, bystander effects induced by 2Gy and 4Gy 125 I seed irradiation on micronucleus formation and DNA double-strand breaks (DSBs) of human lung cancer cells were detected and evaluated. The results showed that irradiation with 125 I seeds can induce medium-mediated bystander effects in A549 cells and NCI-H446 cells, exhibiting that both micronuclei formation and γ H2AX focus formation in bystander cells were increased significantly compared with non-irradiated cells. The extent of DNA damage induced by bystander effects was correlated with accumulated radiation dose and radiosensitive of tumor cells. NCI-H446 cells that were sensitive to HDR γ irradiation were more sensitive to continuous LDR irradiation and bystander effects than A549. However, a comparison between the bystander effects and direct effects elicits the intensity of bystander responses of A549 cells was higher than that of NCI-H446 cells. A dose-related reduction in bystander responses was observed both in A549 cells and NCI-H446 cells, suggesting that the signaling factors involved in the bystander signaling pathways may decrease with the increase of cell damages. (authors)
Zhu, Wei; Chen, Hui; Wang, Yulan; Wang, Jiang; Peng, Xia; Chen, Xianjie; Gao, Yinglei; Li, Chunpu; He, Yulong; Ai, Jing; Geng, Meiyu; Zheng, Mingyue; Liu, Hong
2017-07-27
A novel series of pyridin-3-amine derivatives were designed, synthesized, and evaluated as multitargeted protein kinase inhibitors for the treatment of non-small cell lung cancer (NSCLC). Hit 1 was first disclosed by in silico screening against fibroblast growth factor receptors (FGFR), which was subsequently validated by in vitro experiments. The structure-activity relationship (SAR) of its analogues was then explored to afford novel FGFR inhibitors 2a-2p and 3a-3q. Among them, 3m showed potent inhibition against FGFR1, 2, and 3. Interestingly, compound 3m not only inhibited various phosphorylation and downstream signaling across different oncogenic forms in FGFR-overactivated cancer cells but also showed nanomolar level inhibition against several other NSCLC-related oncogene kinases, including RET, EGFR, EGFR/T790M/L858R, DDR2, and ALK. Finally, in vivo pharmacology evaluations of 3m showed significant antitumor activity (TGI = 66.1%) in NCI-H1581 NSCLC xenografts with a good pharmacokinetic profile.
International Nuclear Information System (INIS)
Sun Jin; Liu Lu; Zhu Xiaoli; Chen Daozhen; Gao Wen; Jiang Xinyu; Huang Ying
2008-01-01
Objective: 17-allylamino-17-demethoxygeldanamycin (17-AAG) has been developed as a novel heat shock protein 90 (HSP90) inhibitor being used in clinical trials. HSP90 is known as a molecular target for tumor therapy. The goal of this study was to investigate the inhibitive effects of 131 I labeled 17-AAG on human non-small cell lung cancer in xenograft-bearing nude mice. Methods: 17-AAG was labeled with 131 I. Twenty-eight BALB/c nude mice bearing H460 human non-small cell lung carcinoma tumor xenograft were randomly divided into seven groups, one control group and six treatment groups according to the route of administration (via tail vein injection or intratumoral injection) and the doses of injected radio-activity (5.5 MBq x 2 with 8 d interval, 11.0 MBq and 5.5 MBq). Two additional mice were treated with intratumoral injection of Na 131 I solution that was served as seintigraphic imaging controls. In each group two mice underwent scintigraphy at 2 h, 6 h, 24 h, 2 d, 3 d, 7 d, 10 d and 16 d. After 16 d the tumor inhibition rate was calculated. Then all of the mice were sacrificed and the tumor tissues were obtained for histological examination and immunohistochemical assay. Results: Persistent accumulation of 131 I-17-AAG in the tumors was seen on seintigraphic images. Tumor inhibiting effect was demonstrated in all treatment groups with varying degrees. The highest tumor inhibition rate (86.77 ± 4.57)% was shown in the group with interval intratumoral injection (5.5 MBq x 2). There was no significant difference of tumor inhibition rates between 5.5 MBq x 2 group (via tail vein injection) and 11.0 MBq group( via tail vein injection, q=1.67, P>0.05). While among the other treatment groups, there was significant difference in tumor inhibition rates( q=3.16-24.34, all P 131 I-17-AAG may effectively inhibit the tumor growth and expression of HSP90α antigen expression in non-small cell lung cancer bearing nude mice. The more prominent anti-tumor effect may be
Vorinostat increases carboplatin and paclitaxel activity in non-small cell lung cancer cells
Owonikoko, Taofeek K.; Ramalingam, Suresh S.; Kanterewicz, Beatriz; Balius, Trent; Belani, Chandra P.; Hershberger, Pamela A.
2010-01-01
We observed a 53% response rate in non-small cell lung cancer (NSCLC) patients treated with vorinostat plus paclitaxel/carboplatin in a Phase I trial. Studies were undertaken to investigate the mechanism (s) underlying this activity. Growth inhibition was assessed in NSCLC cells by MTT assay after 72 h of continuous drug exposure. Vorinostat (1 µM) inhibited growth by: 17±7% in A549, 28±6% in 128-88T, 39±8% in Calu1, and 41±7% in 201T cells. Vorinostat addition to carboplatin or paclitaxel le...
Data Sets from Major NCI Initiaves
The NCI Data Catalog includes links to data collections produced by major NCI initiatives and other widely used data sets, including animal models, human tumor cell lines, epidemiology data sets, genomics data sets from TCGA, TARGET, COSMIC, GSK, NCI60.
Immune-based Therapies for Non-small Cell Lung Cancer.
Rafei, Hind; El-Bahesh, Ehab; Finianos, Antoine; Nassereddine, Samah; Tabbara, Imad
2017-02-01
Lung cancer is the leading cause of cancer-related death worldwide. Treatment of non-small cell lung cancer has evolved tremendously over the past decade. Specifically, immune checkpoint inhibitors have become an increasingly interesting target of pharmacological blockade. These immune inhibitors have shown promising results in front-line therapy and after failure of multiple lines, as well as in monotherapy and combination with other therapies. Vaccination in non-small cell lung cancer is also an emerging field of research that holds promising results for the future of immunotherapy in non-small cell lung cancer. This review presents a concise update on the most recent data regarding the role of checkpoint inhibitors as well as vaccination in non-small cell lung cancer. Copyright© 2017, International Institute of Anticancer Research (Dr. George J. Delinasios), All rights reserved.
Global Proteome Analysis of the NCI-60 Cell Line Panel
Directory of Open Access Journals (Sweden)
Amin Moghaddas Gholami
2013-08-01
Full Text Available The NCI-60 cell line collection is a very widely used panel for the study of cellular mechanisms of cancer in general and in vitro drug action in particular. It is a model system for the tissue types and genetic diversity of human cancers and has been extensively molecularly characterized. Here, we present a quantitative proteome and kinome profile of the NCI-60 panel covering, in total, 10,350 proteins (including 375 protein kinases and including a core cancer proteome of 5,578 proteins that were consistently quantified across all tissue types. Bioinformatic analysis revealed strong cell line clusters according to tissue type and disclosed hundreds of differentially regulated proteins representing potential biomarkers for numerous tumor properties. Integration with public transcriptome data showed considerable similarity between mRNA and protein expression. Modeling of proteome and drug-response profiles for 108 FDA-approved drugs identified known and potential protein markers for drug sensitivity and resistance. To enable community access to this unique resource, we incorporated it into a public database for comparative and integrative analysis (http://wzw.tum.de/proteomics/nci60.
Directory of Open Access Journals (Sweden)
Xiao-hong Kang
2017-04-01
Full Text Available Background/Aims: Mcl-1, an anti-apoptotic Bcl-2 family member, is often overexpressed in non-small cell lung cancer (NSCLC. Bufalin has been reported to induce apoptosis in various tumor cells. However, there is no report showing that bufalin could downregulate Mcl-1 expression in NSCLC. Methods: Cell proliferation was analyzed by cell counting kit-8 (CCK-8 assay in H1975 cells. Cell apoptosis was detected by flow cytometry. Mcl-1 mRNA was detected by RT-PCR. The expression of apoptosis-associated proteins in H1975 cells was detected by western blotting. The levels of Mcl-1 ubiquitination and NOXA were analyzed by Immunoprecipitation assay. Results: Cell growth was inhibited by bufalin in a time and dose-dependent manner. Bufalin induced apoptosis in NSCLC cells by activating caspase cascades and downregulating Mcl-1 expression. However, overexpression of Mcl-1 diminished bufalin-induced apoptosis. Furthermore, bufalin did not reduce Mcl-1 mRNA expression in H1975 cells, but strongly promoted Mcl-1 protein degradation. Proteasome inhibitor MG132 markedly prevented the degradation of Mcl-1 and blocked bufalin-induced Mcl-1 reduction. Bufalin did not significantly affect NOXA protein levels, but downregulated the expression of p-GSK-3β. GSK-3 inhibitor and GSK-3β siRNA resulted in increased levels of Mcl-1 and reversed the bufalin-induced Mcl-1 degradation. Conclusion: Bufalin induced cell apoptosis in H1975 cells may be through downregulation of Mcl-1. Proteasomal degradation of Mcl-1 via GSK-3β activation was involved in bufalin-induced apoptosis.
Flavonoid Composition and Antitumor Activity of Bee Bread Collected in Northeast Portugal
Directory of Open Access Journals (Sweden)
Filipa Sobral
2017-02-01
Full Text Available Bee bread (BB is a fermented mixture of plant pollen, honey, and bee saliva that worker bees use as food for larvae, and for young bees to produce royal jelly. In the present study, five BB samples, collected from Apis mellifera iberiensis hives located in different apiaries near Bragança, in the northeast region of Portugal, and one BB commercial sample were characterized by high-performance liquid chromatography coupled to a diode array detector and electrospray mass spectrometry (HPLC-DAD-ESI/MS in terms of phenolic compounds, such as flavonoid glycoside derivatives. Furthermore, the samples were screened, using in vitro assays, against different human tumor cell lines, MCF-7 (breast adenocarcinoma, NCI-H460 (non-small cell lung cancer, HeLa (cervical carcinoma and HepG2 (hepatocellular carcinoma, and also against non-tumor liver cells (porcine liver cells, PLP2. The main phenolic compounds found were flavonol derivatives, mainly quercetin, kaempferol, myricetin, isorhamnetin and herbacetrin glycoside derivatives. Thirty-two compounds were identified in the six BB samples, presenting BB1 and BB3 with the highest contents (6802 and 6480 µg/g extract, respectively and the highest number of identified compounds. Two isorhamnetin glycoside derivatives, isrohamnetin-O-hexosyl-O-rutinoside and isorhamnetin-O-pentosyl-hexoside, were the most abundant compounds present in BB1; on the other hand, quercetin-3-O-rhamnoside was the most abundant flavonol in BB3. However, it was not possible to establish a correlation between the flavonoids and the observed low to moderate cytotoxicity (ranging from >400 to 68 µg/mL, in which HeLa and NCI-H460 cell lines were the most susceptible to the inhibition. To the authors’ knowledge, this is the first report characterizing glycosidic flavonoids in BB samples, contributing to the chemical knowledge of this less explored bee product.
Erlotinib in previously treated non-small-cell lung cancer
International Nuclear Information System (INIS)
Smrdel, U.; Kovac, V.
2006-01-01
Background. Erlotinib is a novel biological anti-tumour agent in the treatment of advanced non small cell lung cancer. It represents the molecularly-targeted therapy which has been studied extensively. Case report. We present a case of a patient who suffered from advanced non-small-cell lung cancer. After the progress of disease following a prior chemotherapy he was treated with erlotinib with remarkable effect which was shown at chest x ray and symptoms were quite reduced. Conclusions. In selected patients with advanced non-small-cell lung cancer Erlotinib improves survival and symptom control as it results in presented case. (author)
Kumar, Amit; Ghate, Vinayak; Kim, Min-Jeong; Zhou, Weibiao; Khoo, Gek Hoon; Yuk, Hyun-Gyun
2017-05-01
The objective of this study was to investigate the effect of 460 nm light-emitting diode (LED) on the inactivation of foodborne bacteria. Additionally, the change in the endogenous metabolic profile of LED illuminated cells was analyzed to understand the bacterial response to the LED illumination. Six different species of bacteria (Bacillus cereus, Listeria monocytogenes, Staphylococcus aureus, Escherichia coli O157:H7, Pseudomonas aeruginosa and Salmonella Typhimurium) were illuminated with 460 nm LED to a maximum dose of 4080 J/cm 2 at 4, 10 and 25 °C. Inactivation curves were modeled using Hom model. Metabolic profiling of the non-illuminated and illuminated cells was performed using a Liquid chromatography-mass spectrometry system. Results indicate that the 460 nm LED significantly (p illuminated cells indicated that several metabolites e.g. 11-deoxycortisol, actinonin, coformycin, tyramine, chitobiose etc. were regulated during LED illumination. These results elucidate the effectiveness of 460 nm LED against foodborne bacteria and hence, its suitability as a novel antimicrobial control method to ensure food safety. Copyright © 2016 Elsevier Ltd. All rights reserved.
Overexpression of SAMD9 suppresses tumorigenesis and progression during non small cell lung cancer
Energy Technology Data Exchange (ETDEWEB)
Ma, Qing; Yu, Tao; Ren, Yao-Yao; Gong, Ting; Zhong, Dian-Sheng, E-mail: zhongdsyx@126.com
2014-11-07
Highlights: • SAMD9 is down-regulated in human non-small cell lung cancer (NSCLC). • Knockdown of SAMD9 expression is increased the invasion, migration and proliferation in H1299 cells in vitro. • Overexpression of SAMD9 suppressed proliferation and invasion in A549 cells in vitro. • Depletion of SAMD9 increases tumor formation in vivo. - Abstract: The Sterile Alpha Motif Domain-containing 9 (SAMD9) gene has been recently emphasized during the discovery that it is expressed at a lower level in aggressive fibromatosis and some cases of breast and colon cancer, however, the underlying mechanisms are poorly understood. Here, we found that SAMD9 is down-regulated in human non-small cell lung cancer (NSCLC). Furthermore, knockdown of SAMD9 expression is increased the invasion, migration and proliferation in H1299 cells in vitro and overexpression of SAMD9 suppressed proliferation and invasion in A549 cells. Finally, depletion of SAMD9 increases tumor formation in vivo. Our results may provide a strategy for blocking NSCLC tumorigenesis and progression.
Directory of Open Access Journals (Sweden)
Joana Fonseca
2016-07-01
Full Text Available We previously reported that prenylated chalcone 2 (PC2, the O-prenyl derivative (2 of 2′-hydroxy-3,4,4′,5,6′-pentamethoxychalcone (1, induced cytotoxicity of tumor cells via disruption of p53-MDM2 interaction. However, the cellular changes through which PC2 exerts its cytotoxic activity and its antitumor potential, remain to be addressed. In the present work, we aimed to (i characterize the effect of PC2 on mitotic progression and the underlying mechanism; and to (ii explore this information to evaluate its ability to sensitize tumor cells to paclitaxel in a combination regimen. PC2 was able to arrest breast adenocarcinoma MCF-7 and non-small cell lung cancer NCI-H460 cells in mitosis. All mitosis-arrested cells showed collapsed mitotic spindles with randomly distributed chromosomes, and activated spindle assembly checkpoint. Live-cell imaging revealed that the compound induced a prolonged delay (up to 14 h in mitosis, culminating in massive cell death by blebbing. Importantly, PC2 in combination with paclitaxel enhanced the effect on cell growth inhibition as determined by cell viability and proliferation assays. Our findings demonstrate that the cytotoxicity induced by PC2 is mediated through antimitotic activity as a result of mitotic spindle damage. The enhancement effects of PC2 on chemosensitivity of cancer cells to paclitaxel encourage further validation of the clinical potential of this combination.
Sun, E L; Liu, C X; Ma, Z X; Mou, X Y; Mu, X A; Ni, Y H; Li, X L; Zhang, D; Ju, Y R
2017-01-01
Small cell lung cancer (SCLC) is characterized by rapid growth rate and a tendency to metastasize to distinct sites of patients' bodies. The human serine/threonine kinase 33 (STK33) gene has shown its potency as a therapeutic target for prevention of lung carcinomas including non-small cell lung cancer (NSCLC), but its function in the oncogenesis and development of SCLC remains unrevealed. In the current study, it was hypothesized that STK33 played a key role in the proliferation, survival, and invasion of SCLC cells. The expression of STK33 in human SCLC cell lines NCI-H466 and DMS153 was inhibited by specific shRNA. The cell proliferation, cell apoptosis, and cell invasion of the cells were assessed with a series of in vitro assays. To explore the mechanism through which STK33 gene exerted its function in the carcinogenesis of SCLC cells, the effect of STK33 knockdown on the activity of S6K1/RPS6/BAD signaling was detected. Then the results were further confirmed with STK33 inhibitor ML281 and in vivo assays. The results demonstrated that inhibition of STK33 in SCLC cells suppressed the cell proliferation and invasion while induced cell apoptosis. Associated with the change in the phenotypic features, knockdown of STK33 also decreased the phosphorylation of RPS6 and BAD while increased the expression of cleaved caspase 9, indicating that apoptosis induced by STK33 suppression was mediated via mitochondrial pathway. Similar to the results of STK33 knockdown, incubating NCI-H466 cells with STK33 inhibitor also reduced the cell viability by suppressing RPS6/BAD pathways. Additionally, STK33 knockdown also inhibited tumor growth and RPS6/BAD activity in mice models. Findings outlined in our study were different from that in NSCLC to some extent: knockdown of STK33 in SCLC cells induced the apoptosis through mitochondrial pathway but independent of S6K1 function, inferring that the function of STK33 might be cancer type specific.
13 CFR 130.460 - Budget justification.
2010-01-01
... 13 Business Credit and Assistance 1 2010-01-01 2010-01-01 false Budget justification. 130.460 Section 130.460 Business Credit and Assistance SMALL BUSINESS ADMINISTRATION SMALL BUSINESS DEVELOPMENT...) Cost principles. Principles for determining allowable costs are contained in OMB Circulars A-21 (cost...
Treatment of stage III non-small cell lung cancer and limited-disease small-cell lung cancer
El Sharouni, S.Y.
2009-01-01
This thesis concerns the treatment of stage III non-small cell lung cancer (NSCLC) and limited disease small-cell lung cancer (SCLC). We described a systematic review on the clinical results of radiotherapy, combined or not with chemotherapy, for inoperable NSCLC stage III with the aim to define the
Gamma-aminobutyric acid, a potential tumor suppressor for small airway-derived lung adenocarcinoma.
Schuller, Hildegard M; Al-Wadei, Hussein A N; Majidi, Mourad
2008-10-01
Pulmonary adenocarcinoma (PAC) is the leading type of lung cancer in smokers and non-smokers that arises in most cases from small airway epithelial cells. PAC has a high mortality due to its aggressive behavior and resistance to cancer therapeutics. We have shown previously that the proliferation of human PAC cells NCI-H322 and immortalized human small airway epithelial cells HPL1D is stimulated by cyclic adenosine monophosphate (cAMP)/protein kinase A-dependent phosphorylation of cyclic adenosine monophosphate response element-binding (CREB) protein and transactivation of the epidermal growth factor receptor and that this pathway is activated by beta-1-adrenoreceptors (beta(1)-ARs) and the non-genomic estrogen receptor beta. Our current in vitro studies with HPL1D and NCI-H322 cells showed that signaling via the gamma-amino butyric acid receptor (GABA(B)R) strongly inhibited base level and isoproterenol-induced cAMP, p-CREB, cyclic adenosine monophosphate response element-luciferase activity and p-extracellular regulated kinase-1 (ERK1)/2 and effectively blocked DNA synthesis and cell migration. The inhibitory effects of gamma-amino butyric acid (GABA) were disinhibited by the GABA(B)R antagonist CGP-35348 or GABA(B)R knockdown. Immunohistochemical investigation of hamster lungs showed significant underexpression of GABA in animals with small airway-derived PACs induced by the nicotine-derived carcinogen 4-(methylnitrosamino)-1-(3-pyridyl)-1-butanone (NNK). These findings suggest that GABA may have tumor suppressor function in small airway epithelia and the PACs derived from them and that downregulation of GABA by NNK may contribute to the development of this cancer in smokers. Our findings suggest that marker-guided treatment with GABA or a GABA(B)R agonist of individuals with downregulated pulmonary GABA may provide a novel targeted approach for the prevention of PAC in smokers.
Hedgehog Pathway Inhibitor HhAntag691 Is a Potent Inhibitor of ABCG2/BCRP and ABCB1/Pgp
Directory of Open Access Journals (Sweden)
Yimao Zhang
2009-01-01
Full Text Available HhAntag691 (GDC-0449, a low-molecular weight inhibitor of the tumor-promoting hedgehog (Hh signaling pathway, has been used to treat medulloblastoma in animal models and has recently entered clinical trials for a variety of solid tumors. Here, we show that HhAntag691 inhibits multiple ATP-binding cassette (ABC transporters. ATP-binding cassette transporters are within a family of membrane proteins, the overexpression of which is associated with multidrug resistance, a major impediment to successful cancer treatment. HhAntag691 is a potent inhibitor of two ABC transporters, ABCG2/BCRP and ABCB1/Pgp, and is a mild inhibitor of ABCC1/MRP1. In ABCG2-overexpressing HEK293 cells, HhAntag691 increased retention of the fluorescent ABCG2 substrate BODIPY-prazosin and resensitized these cells to mitoxantrone, an antineoplastic ABCG2 substrate. In Madin-Darby canine kidney II cells engineered to overexpress Pgp or MRP1, HhAntag691 increased the retention of calcein-AM and resensitized them to colchicine. HhAntag691 also resensitized human non-small cell lung carcinoma cells NCI-H460/par and NCI-H460/MX20, which overexpress ABCG2 in response to mitoxantrone, to mitoxantrone, and to topotecan or SN-38. The IC50 values of HhAntag691 for inhibition of ABCG2 and Pgp were ∼1.4 and ∼3.0 µM, respectively. Because ABC transporters are highly expressed at the blood-brain barrier and on many tumor cells, they contribute significantly to treatment failure of many types of cancer, particularly of those within the neuraxis. In addition to its effect on Hh signaling, the ability of HhAntag691 and related compounds to inhibit two key ABC transporters could contribute to their effectiveness in treating malignancies.
Clinical potential of necitumumab in non-small cell lung carcinoma
Directory of Open Access Journals (Sweden)
Genova C
2016-08-01
Full Text Available Carlo Genova,1–3 Fred R Hirsch1 1Division of Medical Oncology, Department of Medicine, University of Colorado Cancer Center, Aurora, CO, USA; 2Lung Cancer Unit, IRCCS AOU San Martino IST, 3Department of Internal Medicine, School of Medicine, University of Genoa, Genoa, Italy Abstract: Despite significant progress, new therapeutic approaches for advanced non-small cell lung cancer (NSCLC are highly needed, particularly for the treatment of patients with squamous cell carcinoma. The epidermal growth factor receptor (EGFR is often overexpressed in NSCLC and represents a relevant target for specific treatments. Although EGFR mutations are more frequent in non-squamous histology, the receptor itself is more often overexpressed in squamous NSCLC. Necitumumab is a human monoclonal antibody that is able to inhibit the EGFR pathway and cause antibody-dependent cell cytotoxicity. This drug has been studied in combination with first-line chemotherapy for advanced NSCLC in two Phase III trials, and a significant survival benefit was reported in squamous NSCLC (SQUIRE trial; by contrast, necitumumab did not prove itself beneficial in non-squamous histotype (INSPIRE trial. On the basis of the SQUIRE results, necitumumab was approved in combination with cisplatin and gemcitabine as a first-line treatment for advanced squamous NSCLC, both in the US and Europe, where its availability is limited to patients with EGFR-expressing tumors. The aim of this review is to describe the tolerability and the efficacy of necitumumab by searching the available published data and define its potential role in the current landscape of NSCLC treatment. Keywords: necitumumab, EGFR, non-small cell lung cancer, monoclonal antibody, H-score
NCI Holds on to Defelice Cup | Poster
NCI kept the Defelice Cup trophy this year after beating Leidos Biomedical Research, 15 to 9, at the 10th annual Ronald H. Defelice Golf Tournament held on Columbus Day. Sixteen players on each team battled it out at the yearly contractor vs. government tournament held at Rattlewood Golf Course in Mount Airy, Md. NCI leads the series 6–4. “The score was the highest NCI margin
Zeng, Huawei; Briske-Anderson, Mary; Wu, Min; Moyer, Mary P
2012-01-01
Methylselenol is hypothesized to be a critical selenium metabolite for anticancer action, and differential chemopreventive effects of methylselenol on cancerous and noncancerous cells may play an important role. In this study, the submicromolar concentrations of methylselenol were generated by incubating methionase with seleno-L methionine, and colon-cancer-derived HCT-116 cells and noncancerous colon NCM460 cells were exposed to methylselenol. Methylselenol exposure inhibited cell growth and led to an increase in G1 and G2 fractions with a concomitant drop in S-phase and an induction of apoptosis in HCT116, but to a much lesser extent in NCM460 colon cells. Similarly, the examination of mitogen-activated protein kinase (MAPK) and cellular myelocytomatosis oncogene (c-Myc) signaling status revealed that methylselenol inhibited the phosphorylation of extracellular-regulated kinase1/2 and p38 mitogen-activated protein kinase and the expression of c-Myc in HCT116 cells, but also to a lesser extent in NCM460 cells. The other finding is that methylselenol inhibits sarcoma kinase phosphorylation in HCT116 cells. In contrast, methylselenol upregulated the phosphorylation of sarcoma and focal adhesion kinase survival signals in the noncancerous NCM460 cells. Collectively, methylselenol's stronger potential of inhibiting cell proliferation/survival signals in the cancerous HCT116 cells when compared with that in noncancerous NCM460 cells may partly explain the potential of methylselenol's anticancer action.
Definitive Radiotherapy of Non-Small Cell Lung Cancer
International Nuclear Information System (INIS)
Lee, Jong Young; Park, Kyung Ran
1995-01-01
Purpose : The effect of dose escalation of up to 6500 cGy on local control and survival was investigated in locally advanced non-small cell lung cancer. Materials and Methods : Ninety eight patients with biopsy-proven unresectable non-small cell lung cancer without distant metastases or medically inoperable patients with lower-stage were treated with definitive radiotherapy alone. Group A were treated by thoracic irradiation, 6000 cGy or less in total tumor dose with daily fractions of 180 to 200 cGy: and group B was treated with 6500 cGy of same daily fractions. Results : The actuarial overall survival rate for the entire group was 54% at 1 year, 26.6% at 2 years and 16.4% at 3 years with a median survival time of 13 months. Statistically significant prognostic factors that affect survival rate were stage and N-stage. However, no improvement in local control and survival has been seen with higher dose radiotherapy(group B). Conclusion : Dose escalation of up to 6500 cGy was no effect on local control and survival rate. To increase the survival rate of non-small cell lung cancer hyperfractionated radiotherapy or concurrent chemoradiotherapy should be considered
Yang, Ching-Yao; Lin, Mong-Wei; Chang, Yih-Leong; Wu, Chen-Tu
2017-12-12
Globo H is a tumor-associated carbohydrate antigen exclusively expressed in cancer cells rather than normal tissue. Globo H has been found on many cancers of epithelial origins, and become an attractive target for cancer vaccine. We aimed to study the expression of Globo H in non-small cell lung cancer (NSCLC) patients, and correlated its expression with common driver mutations, clinical outcomes, and status of immune checkpoint, programmed death-ligand 1 (PD-L1). The study enrolled 228 patients with surgically resected stage I NSCLC, including 139 patients with adenocarcinoma (ADC) and 89 patients with squamous cell carcinoma (SqCC). Using immunohistochemistry, tumors with moderate to strong membranous staining in ⩾ 1% tumor cells per section were scored as positive Globo H expression. Driver mutations including EGFR, KRAS, BRAF were detected by direct sequencing, while ALK, PI3KCA, FGFR1 and PD-L1 expression was detected by immunohistochemical (IHC) staining. Positive Globo H expression was detected in 88 of the 228 (38.6%) patients. These included 51 of 139 (36.7%) patients with ADC and 37 of 89 (41.6%) patients with SqCC. Positive Globo H expression was significantly associated with EGFR mutation and PD-L1 expression in the ADC group, and PI3KCA overexpression in the SqCC group. The survival analysis showed that Globo H expression was not an independent prognostic factor in stage I NSCLC. Globo H expression was correlated with specific driver mutations in ADC and SqCC NSCLC tumors, as well as PD-L1 status. Immunotherapy targeting Globo H may have potential application in lung cancer treatment.
Role of Insulin-Like Growth Factor-1 Signaling Pathway in Cisplatin-Resistant Lung Cancer Cells
Energy Technology Data Exchange (ETDEWEB)
Sun Yunguang [Department of Radiation Oncology, Vanderbilt University Medical Center, Nashville, TN (United States); Zheng Siyuan [Department of Biomedical Informatics, Vanderbilt University Medical Center, Nashville, TN (United States); Torossian, Artour; Speirs, Christina K.; Schleicher, Stephen; Giacalone, Nicholas J. [Department of Radiation Oncology, Vanderbilt University Medical Center, Nashville, TN (United States); Carbone, David P. [Department of Hematology and Oncology, Vanderbilt University Medical Center, Nashville, TN (United States); Zhao Zhongming, E-mail: zhongming.zhao@vanderbilt.edu [Department of Biomedical Informatics, Vanderbilt University Medical Center, Nashville, TN (United States); Lu Bo, E-mail: bo.lu@vanderbilt.edu [Department of Radiation Oncology, Vanderbilt University Medical Center, Nashville, TN (United States)
2012-03-01
Purpose: The development of drug-resistant phenotypes has been a major obstacle to cisplatin use in non-small-cell lung cancer. We aimed to identify some of the molecular mechanisms that underlie cisplatin resistance using microarray expression analysis. Methods and Materials: H460 cells were treated with cisplatin. The differences between cisplatin-resistant lung cancer cells and parental H460 cells were studied using Western blot, MTS, and clonogenic assays, in vivo tumor implantation, and microarray analysis. The cisplatin-R cells were treated with human recombinant insulin-like growth factor (IGF) binding protein-3 and siRNA targeting IGF-1 receptor. Results: Cisplatin-R cells illustrated greater expression of the markers CD133 and aldehyde dehydrogenase, more rapid in vivo tumor growth, more resistance to cisplatin- and etoposide-induced apoptosis, and greater survival after treatment with cisplatin or radiation than the parental H460 cells. Also, cisplatin-R demonstrated decreased expression of insulin-like growth factor binding protein-3 and increased activation of IGF-1 receptor signaling compared with parental H460 cells in the presence of IGF-1. Human recombinant IGF binding protein-3 reversed cisplatin resistance in cisplatin-R cells and targeting of IGF-1 receptor using siRNA resulted in sensitization of cisplatin-R-cells to cisplatin and radiation. Conclusions: The IGF-1 signaling pathway contributes to cisplatin-R to cisplatin and radiation. Thus, this pathway represents a potential target for improved lung cancer response to treatment.
2012-01-19
... DEPARTMENT OF HEALTH AND HUMAN SERVICES National Institutes of Health Proposed Collection; Comment Request: Solar Cell: A Mobile UV Manager for Smart Phones (NCI) SUMMARY: In compliance with the... Manager for Smart Phones (NCI). Type of Information Collection Request: New. Need and Use of Information...
Energy Technology Data Exchange (ETDEWEB)
Sun, Haiyan; Kamkaew, Anyanee; Jiang, Dawei; Yang, Yunan [University of Wisconsin-Madison, Department of Radiology, Madison, WI (United States); England, Christopher G.; Hernandez, Reinier; Graves, Stephen A.; Barnhart, Todd E. [University of Wisconsin-Madison, Department of Medical Physics, Madison, WI (United States); Majewski, Rebecca L. [University of Wisconsin-Madison, Department of Biomedical Engineering, Madison, WI (United States); Cai, Weibo [University of Wisconsin-Madison, Department of Radiology, Madison, WI (United States); University of Wisconsin-Madison, Department of Medical Physics, Madison, WI (United States); University of Wisconsin-Madison, Department of Biomedical Engineering, Madison, WI (United States); University of Wisconsin Carbone Cancer Center, Madison, WI (United States)
2016-11-15
Overexpression of CD146 in solid tumors has been linked to disease progression, invasion, and metastasis. We describe the generation of a {sup 64}Cu-labeled CD146-specific antibody and its use for quantitative immunoPET imaging of CD146 expression in six lung cancer models. The anti-CD146 antibody (YY146) was conjugated to 1,4,7-triazacyclononane-triacetic acid (NOTA) and radiolabeled with {sup 64}Cu. CD146 expression was evaluated in six human lung cancer cell lines (A549, NCI-H358, NCI-H522, HCC4006, H23, and NCI-H460) by flow cytometry and quantitative western blot studies. The biodistribution and tumor uptake of {sup 64}Cu-NOTA-YY146 was assessed by sequential PET imaging in athymic nude mice bearing subcutaneous lung cancer xenografts. The correlation between CD146 expression and tumor uptake of {sup 64}Cu-NOTA-YY146 was evaluated by graphical software while ex vivo biodistribution and immunohistochemistry studies were performed to validate the accuracy of PET data and spatial expression of CD146. Flow cytometry and western blot studies showed similar findings with H460 and H23 cells showing high levels of expression of CD146. Small differences in CD146 expression levels were found among A549, H4006, H522, and H358 cells. Tumor uptake of {sup 64}Cu-NOTA-YY146 was highest in CD146-expressing H460 and H23 tumors, peaking at 20.1 ± 2.86 and 11.6 ± 2.34 %ID/g at 48 h after injection (n = 4). Tumor uptake was lowest in the H522 model (4.1 ± 0.98 %ID/g at 48 h after injection; n = 4), while H4006, A549 and H358 exhibited similar uptake of {sup 64}Cu-NOTA-YY146. A positive correlation was found between tumor uptake of {sup 64}Cu-NOTA-YY146 (%ID/g) and relative CD146 expression (r {sup 2} = 0.98, p < 0.01). Ex vivo biodistribution confirmed the accuracy of the PET data. The strong correlation between tumor uptake of {sup 64}Cu-NOTA-YY146 and CD146 expression demonstrates the potential use of this radiotracer for imaging tumors that elicit varying levels of CD146
2012-12-13
Recurrent Non-small Cell Lung Cancer; Squamous Cell Lung Cancer; Stage IIIA Non-small Cell Lung Cancer; Stage IIIB Non-small Cell Lung Cancer; Stage IV Non-small Cell Lung Cancer; Unspecified Adult Solid Tumor, Protocol Specific
Expression of G-protein inwardly rectifying potassium channels (GIRKs in lung cancer cell lines
Directory of Open Access Journals (Sweden)
Schuller Hildegard M
2005-08-01
Full Text Available Abstract Background Previous data from our laboratory has indicated that there is a functional link between the β-adrenergic receptor signaling pathway and the G-protein inwardly rectifying potassium channel (GIRK1 in human breast cancer cell lines. We wanted to determine if GIRK channels were expressed in lung cancers and if a similar link exists in lung cancer. Methods GIRK1-4 expression and levels were determined by reverse transcription polymerase chain reaction (RT-PCR and real-time PCR. GIRK protein levels were determined by western blots and cell proliferation was determined by a 5-bromo-2'-deoxyuridine (BrdU assay. Results GIRK1 mRNA was expressed in three of six small cell lung cancer (SCLC cell lines, and either GIRK2, 3 or 4 mRNA expression was detected in all six SCLC cell lines. Treatment of NCI-H69 with β2-adrenergic antagonist ICI 118,551 (100 μM daily for seven days led to slight decreases of GIRK1 mRNA expression levels. Treatment of NCI-H69 with the β-adrenergic agonist isoproterenol (10 μM decreased growth rates in these cells. The GIRK inhibitor U50488H (2 μM also inhibited proliferation, and this decrease was potentiated by isoproterenol. In the SCLC cell lines that demonstrated GIRK1 mRNA expression, we also saw GIRK1 protein expression. We feel these may be important regulatory pathways since no expression of mRNA of the GIRK channels (1 & 2 was found in hamster pulmonary neuroendocrine cells, a suggested cell of origin for SCLC, nor was GIRK1 or 2 expression found in human small airway epithelial cells. GIRK (1,2,3,4 mRNA expression was also seen in A549 adenocarcinoma and NCI-H727 carcinoid cell lines. GIRK1 mRNA expression was not found in tissue samples from adenocarcinoma or squamous cancer patients, nor was it found in NCI-H322 or NCI-H441 adenocarcinoma cell lines. GIRK (1,3,4 mRNA expression was seen in three squamous cell lines, GIRK2 was only expressed in one squamous cell line. However, GIRK1 protein
Li, Yali; Yang, Fangfang; Zheng, Weidong; Hu, Mingxing; Wang, Juanxiu; Ma, Sisi; Deng, Yuanle; Luo, Yi; Ye, Tinghong; Yin, Wenya
2016-05-01
Most conventional treatments on non-small cell lung carcinoma always accompany with awful side effects, and the incidence and mortality rates of this cancer are increasing rapidly worldwide. The objective of this study was to examine the anticancer effects of extract of Punica granatum (pomegranate) leaves extract (PLE) on the non-small cell lung carcinoma cell line A549, H1299 and mouse Lewis lung carcinoma cell line LL/2 in vitro, and explore its mechanisms of action. Our results have shown that PLE inhibited cell proliferation in non-small cell lung carcinoma cell line in a concentration- and time-dependent manner. Flow cytometry (FCM) assay showed that PLE affected H1299 cell survival by arresting cell cycle progression in G2/M phase in a dose-dependent manner and inducing apoptosis. Moreover, PLE could also decrease the reactive oxygen species (ROS) and the mitochondrial membrane potential (ΔYm), indicating that PLE may induce apoptosis via mitochondria-mediated apoptotic pathway. Furthermore, PLE blocked H1299 cell migration and invasion, and the reduction of matrix metalloproteinase (MMP) MMP-2 and MMP-9 expression were also observed in vitro. These results suggested that PLE could be an effective and safe chemotherapeutic agent in non-small cell lung carcinoma treatment by inhibiting proliferation, inducing apoptosis, cell cycle arrest and impairing cell migration and invasion. Copyright © 2016 Elsevier Masson SAS. All rights reserved.
Directory of Open Access Journals (Sweden)
Jeng-Feng Chiou
2011-01-01
Full Text Available This study was carried out to provide a platform for the pre-clinical evaluation of anti-cancer properties of a unique CAM (complementary and alternative medicine agent, Antrodia camphorata alcohol extract (ACAE, in a mouse model with the advantageous non-invasive in vivo bioluminescence molecular imaging technology. In vitro analyses on the proliferation, migration/invasion, cell cycle and apoptosis were performed on ACAE-treated non-small cell lung cancer cells, H441GL and control CGL1 cells. In vivo, immune-deficient mice were inoculated subcutaneously with H441GL followed by oral gavages of ACAE. The effect of ACAE on tumor progression was monitored by non-invasive bioluminescence imaging. The proliferation and migration/invasion of H441GL cells were inhibited by ACAE in a dose-dependent manner. In addition, ACAE induced cell cycle arrest at G0/G1 phase and apoptosis in H441GL cells as shown by flow cytometric analysis, Annexin-V immunoflourescence and DNA fragmentation. In vivo bioluminescence imaging revealed that tumorigenesis was significantly retarded by oral treatment of ACAE in a dose-dependent fashion. Based on our experimental data, ACAE contains anti-cancer properties and could be considered as a potential CAM agent in future clinical evaluation.
ERK phosphorylation is predictive of resistance to IGF-1R inhibition in small cell lung cancer.
Zinn, Rebekah L; Gardner, Eric E; Marchionni, Luigi; Murphy, Sara C; Dobromilskaya, Irina; Hann, Christine L; Rudin, Charles M
2013-06-01
New therapies are critically needed to improve the outcome for patients with small cell lung cancer (SCLC). Insulin-like growth factor 1 receptor (IGF-1R) inhibition is a potential treatment strategy for SCLC: the IGF-1R pathway is commonly upregulated in SCLC and has been associated with inhibition of apoptosis and stimulation of proliferation through downstream signaling pathways, including phosphatidylinositol-3-kinase-Akt and mitogen-activated protein kinase. To evaluate potential determinants of response to IGF-1R inhibition, we assessed the relative sensitivity of 19 SCLC cell lines to OSI-906, a small molecule inhibitor of IGF-1R, and the closely related insulin receptor. Approximately one third of these cell lines were sensitive to OSI-906, with an IC50 OSI-906. Interestingly, OSI-906 sensitive lines expressed significantly lower levels of baseline phospho-ERK relative to resistant lines (P = 0.006). OSI-906 treatment resulted in dose-dependent inhibition of phospho-IGF-1R and phospho-Akt in both sensitive and resistant cell lines, but induced apoptosis and cell-cycle arrest only in sensitive lines. We tested the in vivo efficacy of OSI-906 using an NCI-H187 xenograft model and two SCLC patient xenografts in mice. OSI-906 treatment resulted in 50% tumor growth inhibition in NCI-H187 and 30% inhibition in the primary patient xenograft models compared with mock-treated animals. Taken together our data support IGF-1R inhibition as a viable treatment strategy for a defined subset of SCLC and suggest that low pretreatment levels of phospho-ERK may be indicative of sensitivity to this therapeutic approach. ©2013 AACR
Institute of Scientific and Technical Information of China (English)
Huijie Zhao; Lei Zhu; Yujuan Jin; Hongbin Ji; Xiumin Yan; Xueliang Zhu
2012-01-01
In this study,we identified five miRNAs highly expressed in the small-cell lung cancer (SCLC) cell line NCI-H209.Among them,the expression levels of miR-375 were dramatically elevated in all SCLC cell lines examined,coincident with the expression of the transcription factor achaete-scute complex homolog 1 (ASCL1).Moreover,miR-375 was upregulated and correlated with ASCL1 in the cell lines generated from mouse SCLC-like tumors as well.Dual-luciferase assays further showed that ASCL1 activated the expression of miR-375 by binding to the three E-box elements in the miR-375 promoter.These results imply a role of ASCL1 in SCLC via the upregulation of miR-375.
Acacetin enhances the therapeutic efficacy of doxorubicin in non-small-cell lung carcinoma cells.
Directory of Open Access Journals (Sweden)
Reenu Punia
Full Text Available Anthracyclines are efficient and potent agents to treat broad range of cancers but cytotoxicity induced by them limits their use in therapeutics. Use of plant-derived agents help to prevent or delay the process of cancer progression and their combination increases the anti-cancer potential of mainstream compound. However, multidrug resistance is major cause of treatment failure in cancer patients.In this study, combination treatments of fisetin or acacetin with doxorubicin were explored for their potential synergistic effect on non-small-cell lung carcinoma (NSCLC cells.During this study, NSCLC model cell lines A549 and H1299 were used to determine the combinatorial effect of phytochemicals namly acacetin and fisetin with doxorubicin.The effects of individual compounds and their combination on cell viability, clonogenic potential and cell cycle progression were studied. Efflux of doxorubicin was measured by spectrofluorophotometer, whereas accumulation inside the cells was analyzed by flow cytometry and confocal microscopy. Expression of MDR1 was checked by semi-quantitative PCR.The results showed that the cell viability of A549 and H1299 cells were significantly decreased in time- and dose-dependent manner, although A549 cells showed more sensitivity toward doxorubicin than H1299 cells. Mostly, combination of doxorubicin showed good synergy with acacetin in both the cell lines whereas, fisetin exerted synergistic effect only at 72 h of treatment in H1299 cells. Acacetin with doxorubicin caused G2/M arrest by downregulating CDK-cyclin complex in A549 cells. Acacetin-doxorubicin combination decreased the clonogenic potential of A549 and H1299 cells upto 82% and 59%, respectively, as compared to control. Acacetin also decreased efflux of doxorubicin by 59% after 30 mins of exposure to A549 cells and further increased accumulation of doxorubicin inside the cells upto 55% in 2 h. The modulatory effect of acacetin-doxorubicin combination on
Directory of Open Access Journals (Sweden)
Sung-Min Chun
Full Text Available Histone modification plays a pivotal role on gene regulation, as regarded as global epigenetic markers, especially in tumor related genes. Hence, chemical approaches targeting histone-modifying enzymes have emerged onto the main stage of anticancer drug discovery. Here, we investigated the therapeutic potentials and mechanistic roles of the recently developed histone deacetylase inhibitor, CG200745, in non-small cell lung cancer cells. Treatment with CG200745 increased the global level of histone acetylation, resulting in the inhibition of cell proliferation. ChIP-on-chip analysis with an H4K16ac antibody showed altered H4K16 acetylation on genes critical for cell growth inhibition, although decreased at the transcription start site of a subset of genes. Altered H4K16ac was associated with changes in mRNA expression of the corresponding genes, which were further validated in quantitative RT-PCR and western blotting assays. Our results demonstrated that CG200745 causes NSCLC cell growth inhibition through epigenetic modification of critical genes in cancer cell survival, providing pivotal clues as a promising chemotherapeutics against lung cancer.
Chun, Sung-Min; Lee, Ji-Young; Choi, Jene; Lee, Je-Hwan; Hwang, Jung Jin; Kim, Chung-Soo; Suh, Young-Ah; Jang, Se Jin
2015-01-01
Histone modification plays a pivotal role on gene regulation, as regarded as global epigenetic markers, especially in tumor related genes. Hence, chemical approaches targeting histone-modifying enzymes have emerged onto the main stage of anticancer drug discovery. Here, we investigated the therapeutic potentials and mechanistic roles of the recently developed histone deacetylase inhibitor, CG200745, in non-small cell lung cancer cells. Treatment with CG200745 increased the global level of histone acetylation, resulting in the inhibition of cell proliferation. ChIP-on-chip analysis with an H4K16ac antibody showed altered H4K16 acetylation on genes critical for cell growth inhibition, although decreased at the transcription start site of a subset of genes. Altered H4K16ac was associated with changes in mRNA expression of the corresponding genes, which were further validated in quantitative RT-PCR and western blotting assays. Our results demonstrated that CG200745 causes NSCLC cell growth inhibition through epigenetic modification of critical genes in cancer cell survival, providing pivotal clues as a promising chemotherapeutics against lung cancer.
Kaku, Yoshiko; Tsuchiya, Ayako; Kanno, Takeshi; Nakano, Takashi; Nishizaki, Tomoyuki
2015-09-01
The present study investigated 1,2-diarachidonoyl-sn-glycero-3-phosphoethanolamine (DAPE)-induced cell death in malignant pleural mesothelioma (MPM) cells. DAPE reduced cell viability in NCI-H28, NCI-H2052, NCI-H2452, and MSTO-211H MPM cell lines in a concentration (1-100μM)-dependent manner. In the flow cytometry using propidium iodide (PI) and annexin V (AV), DAPE significantly increased the population of PI-positive and AV-negative cells, corresponding to primary necrosis, and that of PI-positive and AV-positive cells, corresponding to late apoptosis/secondary necrosis, in NCI-H28 cells. DAPE-induced reduction of NCI-H28 cell viability was partially inhibited by necrostatin-1, an inhibitor of RIP1 kinase to induce necroptosis, or knocking-down RIP1. DAPE generated reactive oxygen species (ROS) followed by disruption of mitochondrial membrane potentials in NCI-H28 cells. DAPE-induced mitochondrial damage was attenuated by cyclosporin A, an inhibitor of cyclophilin D (CypD). DAPE did not affect expression and mitochondrial localization of p53 protein in NCI-H28 cells. DAPE significantly decreased intracellular ATP concentrations in NCI-H28 cells. Overall, the results of the present study indicate that DAPE induces necroptosis and necrosis of MPM cells; the former is mediated by RIP1 kinase and the latter is caused by generating ROS and opening CypD-dependent mitochondrial permeability transition pore, to reduce intracellular ATP concentrations. Copyright © 2015 Elsevier Inc. All rights reserved.
International Nuclear Information System (INIS)
Zamora, P.O.; Bender, H.; Biersack, H.J.; Knapp, F.F. Jr.
1995-01-01
The purpose of this study was to evaluate the therapeutic efficacy of Re-188-RC-160 in experimental models of human small cell lung carcinomas which mimic the clinical presentation. In the experimental model, cells from the human small cell lung carcinoma cell line NCI-H69 cells were inoculated into the thoracic cavity of athymic mice and rats. Subsequently, the biodistribution of Re-188-RC-160 after injection into the pleural cavity, a radiolabeled somatostatin analogue, was monitored as was the effect on the subsequent growth of tumors. The results presented here, and which are a part of a larger series of studies, suggest that Re-188-RC-160 can be effectively used in this animal model to restrict the growth of small cell lung carcinoma in the thoracic cavity
Cytotoxic Effects of Fascaplysin against Small Cell Lung Cancer Cell Lines
Hamilton, Gerhard
2014-01-01
Fascaplysin, the natural product of a marine sponge, exhibits anticancer activity against a broad range of tumor cells, presumably through interaction with DNA, and/or as a highly selective cyclin-dependent kinase 4 (CDK4) inhibitor. In this study, cytotoxic activity of fascaplysin against a panel of small cell lung cancer (SCLC) cell lines and putative synergism with chemotherapeutics was investigated. SCLC responds to first-line chemotherapy with platinum-based drugs/etoposide, but relapses early with topotecan remaining as the single approved therapeutic agent. Fascaplysin was found to show high cytotoxicity against SCLC cells and to induce cell cycle arrest in G1/0 at lower and S-phase at higher concentrations, respectively. The compound generated reactive oxygen species (ROS) and induced apoptotic cell death in the chemoresistant NCI-H417 SCLC cell line. Furthermore, fascaplysin revealed marked synergism with the topoisomerase I-directed camptothecin and 10-hydroxy-camptothecin. The Poly(ADP-ribose)-Polymerase 1 (PARP1) inhibitor BYK 204165 antagonized the cytotoxic activity of fascaplysin, pointing to the involvement of DNA repair in response to the anticancer activity of the drug. In conclusion, fascaplysin seems to be suitable for treatment of SCLC, based on high cytotoxic activity through multiple routes of action, affecting topoisomerase I, integrity of DNA and generation of ROS. PMID:24608973
Naman, C Benjamin; Almaliti, Jehad; Armstrong, Lorene; Caro-Díaz, Eduardo J; Pierce, Marsha L; Glukhov, Evgenia; Fenner, Amanda; Spadafora, Carmenza; Debonsi, Hosana M; Dorrestein, Pieter C; Murray, Thomas F; Gerwick, William H
2017-08-25
A recent untargeted metabolomics investigation into the chemical profile of 10 organic extracts from cf. Symploca spp. revealed several interesting chemical leads for further natural product drug discovery. Subsequent target-directed isolation efforts with one of these, a Panamanian marine cyanobacterium cf. Symploca sp., yielded a phenethylamide metabolite that terminates in a relatively rare gem-dichlorovinylidene moiety, caracolamide A (1), along with a known isotactic polymethoxy-1-alkene (2). Detailed NMR and HRESIMS analyses were used to determine the structures of these molecules, and compound 1 was confirmed by a three-step synthesis. Pure compound 1 was shown to have in vitro calcium influx and calcium channel oscillation modulatory activity when tested as low as 10 pM using cultured murine cortical neurons, but was not cytotoxic to NCI-H460 human non-small-cell lung cancer cells in vitro (IC 50 > 10 μM).
Directory of Open Access Journals (Sweden)
Meng Hang
2015-06-01
Full Text Available The present study was done to determine whether kaempferol, a natural polyphenol of the flavonoid family, affects Epithelial-Mesenchymal Transition (EMT in non-small cell lung cancer cells. Kaempferol not only inhibited cancer cell proliferation and migration in a dose-dependent manner but also modulated the expression of EMT-related proteins E-cadherin and vimentin which are indispensible to cellular motility, invasiveness and metastasis. These results indicate that kaempferol suppresses non-small cell lung cancer migration by modulating the expression of EMT proteins. Therefore, kaempferol may be useful as a potential anticancer agent for non-small cell lung cancer.
PKC 412 sensitizes U1810 non-small cell lung cancer cells to DNA damage
International Nuclear Information System (INIS)
Hemstroem, Therese H.; Joseph, Bertrand; Schulte, Gunnar; Lewensohn, Rolf; Zhivotovsky, Boris
2005-01-01
Non-small cell lung carcinoma (NSCLC) is characterized by resistance to drug-induced apoptosis, which might explain the survival of lung cancer cells following treatment. Recently we have shown that the broad-range kinase inhibitor staurosporine (STS) reactivates the apoptotic machinery in U1810 NSCLC cells [Joseph et al., Oncogene 21 (2002) 65]. Lately, several STS analogs that are more specific in kinase inhibition have been suggested for tumor treatment. In this study the apoptosis-inducing ability of the STS analogs PKC 412 and Ro 31-8220 used alone or in combination with DNA-damaging agents in U1810 cells was investigated. In these cells Ro 31-8220 neither induced apoptosis when used alone, nor sensitized cells to etoposide treatment. PKC 412 as a single agent induced death of a small number of U1810 cells, whereas it efficiently triggered a dose- and time-dependent apoptosis in U1285 small cell lung carcinoma cells. In both cell types PKC 412 triggered release of mitochondrial proteins followed by caspase activation. However, concomitant activation of a caspase-independent pathway was essential to kill NSCLC cells. Importantly, PKC 412 was able to sensitize etoposide- and radiation-induced death of U1810 cells. The best sensitization was achieved when PKC 412 was administered 24 h after treatments. In U1810 cells, Ro 31-8220 decreased PMA-induced ERK phosphorylation as efficiently as PKC 412, indicating that the failure of Ro 31-8220 to induce apoptosis was not due to weaker inhibition of conventional and novel PKC isoforms. However, Ro 31-8220 increased the basal level of ERK and Akt phosphorylation in both cell lines, whereas Akt phosphorylation was suppressed in the U1810 cells, which might influence apoptosis. These results suggest that PKC 412 could be a useful tool in increasing the efficiency of therapy of NSCLC
Mohareb, Rafat M; Mohamed, Abeer A; Abdallah, Amira E M
2016-01-01
The reaction of ethyl cyanoacetate with o-phenylenediamine gave the 2-cyanomethylbenzo[c]imidazole (1). The latter compound was used as the key starting material to synthesise biologically active heterocyclic derivatives. Thus, the reaction of 1 with cyclohexanone and either of benzaldehyde, 4-methoxybenzaldehyde or 4-chlorobenzaldehyde gave the annulated derivatives 2a-c, respectively. The antitumor evaluations of the newly synthesized products against the three cancer cell lines MCF-7 (breast adeno-carcinoma), NCI-H460 (non-small cell lung cancer) and SF-268 (CNS cancer) showed that compounds 2b, 6, 11b, 11c, 12b, 16a, 16b and 18a exhibited optimal cytotoxic effect against cancer cell lines, with IC50 values in the nM range. Bioactive compounds are often toxic to shrimp larvae. Thus, in order to monitor these chemicals in vivo lethality to shrimp larvae (Artemia salina), Brine-Shrimp Lethality Assay was used. Compounds 11b, 12b and 16b showed no toxicity against the tested organisms.
NCI's Role in Immunotherapy Research
... Reporting & Auditing Grant Transfer Grant Closeout Contracts & Small Business Training Cancer Training at NCI (Intramural) Resources for ... promising immunotherapies to the clinic more efficiently and cost effectively. For ... of the checkpoint inhibitor pembrolizumab in patients with ...
Hedgehog Pathway Inhibition Radiosensitizes Non-Small Cell Lung Cancers
Energy Technology Data Exchange (ETDEWEB)
Zeng, Jing; Aziz, Khaled; Chettiar, Sivarajan T. [Department of Radiation Oncology and Molecular Radiation Sciences, The Johns Hopkins University School of Medicine, Baltimore, Maryland (United States); Aftab, Blake T. [Department of Medical Oncology, The Johns Hopkins University School of Medicine, Baltimore, Maryland (United States); Armour, Michael; Gajula, Rajendra; Gandhi, Nishant; Salih, Tarek; Herman, Joseph M.; Wong, John [Department of Radiation Oncology and Molecular Radiation Sciences, The Johns Hopkins University School of Medicine, Baltimore, Maryland (United States); Rudin, Charles M. [Department of Medical Oncology, The Johns Hopkins University School of Medicine, Baltimore, Maryland (United States); Tran, Phuoc T. [Department of Radiation Oncology and Molecular Radiation Sciences, The Johns Hopkins University School of Medicine, Baltimore, Maryland (United States); Department of Medical Oncology, The Johns Hopkins University School of Medicine, Baltimore, Maryland (United States); Hales, Russell K., E-mail: rhales1@jhmi.edu [Department of Radiation Oncology and Molecular Radiation Sciences, The Johns Hopkins University School of Medicine, Baltimore, Maryland (United States)
2013-05-01
Purpose: Despite improvements in chemoradiation, local control remains a major clinical problem in locally advanced non-small cell lung cancer. The Hedgehog pathway has been implicated in tumor recurrence by promoting survival of tumorigenic precursors and through effects on tumor-associated stroma. Whether Hedgehog inhibition can affect radiation efficacy in vivo has not been reported. Methods and Materials: We evaluated the effects of a targeted Hedgehog inhibitor (HhAntag) and radiation on clonogenic survival of human non-small cell lung cancer lines in vitro. Using an A549 cell line xenograft model, we examined tumor growth, proliferation, apoptosis, and gene expression changes after concomitant HhAntag and radiation. In a transgenic mouse model of Kras{sup G12D}-induced and Twist1-induced lung adenocarcinoma, we assessed tumor response to radiation and HhAntag by serial micro-computed tomography (CT) scanning. Results: In 4 human lung cancer lines in vitro, HhAntag showed little or no effect on radiosensitivity. By contrast, in both the human tumor xenograft and murine inducible transgenic models, HhAntag enhanced radiation efficacy and delayed tumor growth. By use of the human xenograft model to differentiate tumor and stromal effects, mouse stromal cells, but not human tumor cells, showed significant and consistent downregulation of Hedgehog pathway gene expression. This was associated with increased tumor cell apoptosis. Conclusions: Targeted Hedgehog pathway inhibition can increase in vivo radiation efficacy in lung cancer preclinical models. This effect is associated with pathway suppression in tumor-associated stroma. These data support clinical testing of Hedgehog inhibitors as a component of multimodality therapy for locally advanced non-small cell lung cancer.
p53-Independent thermosensitization by mitomycin C in human non-small cell lung carcinoma cells
International Nuclear Information System (INIS)
Jin, Z.-H.; Matsumoto, H.; Hayashi, S.; Shioura, H.; Kitai, R.; Kano, E.; Hatashita, M.
2003-01-01
The combined treatment with hyperthermia and chemotherapeutic drugs such as cisplatin (CDDP), doxorubicin (DOX) and mitomycin C (MMC) has been widely adopted as a strategy of interdisciplinary cancer therapy to obtain greater therapeutic benefits. However, the involved mechanisms of the interactive cytotoxic effects of hyperthermia and MMC remain unclear. To elucidate the relationship between p53 functions and the interactive effects of the combined treatment with mild-hyperthermia and MMC, we examined the potentiation of cytotoxic effects, the induction of apoptosis, the changes in cell cycles and the accumulation of Hsp72 after the combined treatment with hyperthermia at 42 degree C and MMC using human non-small cell lung carcinoma H1299 transfectants with either null, wild-type (wt) or mutant (m) p53 gene. H1299/null, H1299/wtp53 and H1299/mp53 cells showed similar sensitivities to either hyperthermia at 42 degree C alone or MMC alone. The combined treatment resulted in a synergistically enhanced cytotoxicity in H1299 transfectants in a p53-independent manner. The mechanisms involved an enhancement of heat-induced apoptosis and a modulation of the cell cycle distribution by the combined treatment. The accumulation of Hsp72 was not suppressed by the combined treatment, as is not the case of the combined treatment with hyperthermia and either CDDP (1) or bleomycin (2). Our findings demonstrate a p53-independent mechanism for a synergistically cytotoxic enhancement by the combined treatment with mild-hyperthermia and MMC
2017-04-12
Cachexia; Fatigue; Pulmonary Complications; Radiation Toxicity; Recurrent Non-small Cell Lung Cancer; Stage IIIA Non-small Cell Lung Cancer; Stage IIIB Non-small Cell Lung Cancer; Stage IV Non-small Cell Lung Cancer
International Nuclear Information System (INIS)
Azad, Arun; Bukczynska, Patricia; Jackson, Susan; Haput, Ygal; Cullinane, Carleen; McArthur, Grant A.; Solomon, Benjamin
2014-01-01
Purpose: To examine the effects of combined blockade of DNA-dependent protein kinase (DNA-PK) and poly(adenosine diphosphate-ribose) polymerase-1 (PARP-1) on accelerated senescence in irradiated H460 and A549 non-small cell lung cancer cells. Methods and Materials: The effects of KU5788 and AG014699 (inhibitors of DNA-PK and PARP-1, respectively) on clonogenic survival, DNA double-strand breaks (DSBs), apoptosis, mitotic catastrophe, and accelerated senescence in irradiated cells were examined in vitro. For in vivo experiments, H460 xenografts established in athymic nude mice were treated with BEZ235 (a DNA-PK, ATM, and phosphatidylinositol 3-kinase/mammalian target of rapamycin inhibitor) and AG014699 to determine effects on proliferation, DNA DSBs, and accelerated senescence after radiation. Results: Compared with either inhibitor alone, combination treatment with KU57788 and AG014699 reduced postradiation clonogenic survival and significantly increased persistence of Gamma-H2AX (γH2AX) foci in irradiated H460 and A549 cells. Notably, these effects coincided with the induction of accelerated senescence in irradiated cells as reflected by positive β-galactosidase staining, G2-M cell-cycle arrest, enlarged and flattened cellular morphology, increased p21 expression, and senescence-associated cytokine secretion. In irradiated H460 xenografts, concurrent therapy with BEZ235 and AG014699 resulted in sustained Gamma-H2AX (γH2AX) staining and prominent β-galactosidase activity. Conclusion: Combined DNA-PK and PARP-1 blockade increased tumor cell radiosensitivity and enhanced the prosenescent properties of ionizing radiation in vitro and in vivo. These data provide a rationale for further preclinical and clinical testing of this therapeutic combination
Energy Technology Data Exchange (ETDEWEB)
Azad, Arun, E-mail: arun.azad@bccancer.bc.ca [Division of Cancer Research, Peter MacCallum Cancer Centre, East Melbourne, Victoria (Australia); Department of Pathology, St. Vincent' s Hospital, University of Melbourne, Parkville, Victoria (Australia); Bukczynska, Patricia; Jackson, Susan [Division of Cancer Research, Peter MacCallum Cancer Centre, East Melbourne, Victoria (Australia); Haput, Ygal; Cullinane, Carleen [Division of Cancer Research, Peter MacCallum Cancer Centre, East Melbourne, Victoria (Australia); Sir Peter MacCallum Department of Oncology, University of Melbourne, Parkville, Victoria (Australia); McArthur, Grant A.; Solomon, Benjamin [Division of Cancer Research, Peter MacCallum Cancer Centre, East Melbourne, Victoria (Australia); Division of Cancer Medicine, Peter MacCallum Cancer Centre, East Melbourne, Victoria (Australia); Department of Medicine, St. Vincent' s Hospital, University of Melbourne, Parkville, Victoria (Australia); Sir Peter MacCallum Department of Oncology, University of Melbourne, Parkville, Victoria (Australia)
2014-02-01
Purpose: To examine the effects of combined blockade of DNA-dependent protein kinase (DNA-PK) and poly(adenosine diphosphate-ribose) polymerase-1 (PARP-1) on accelerated senescence in irradiated H460 and A549 non-small cell lung cancer cells. Methods and Materials: The effects of KU5788 and AG014699 (inhibitors of DNA-PK and PARP-1, respectively) on clonogenic survival, DNA double-strand breaks (DSBs), apoptosis, mitotic catastrophe, and accelerated senescence in irradiated cells were examined in vitro. For in vivo experiments, H460 xenografts established in athymic nude mice were treated with BEZ235 (a DNA-PK, ATM, and phosphatidylinositol 3-kinase/mammalian target of rapamycin inhibitor) and AG014699 to determine effects on proliferation, DNA DSBs, and accelerated senescence after radiation. Results: Compared with either inhibitor alone, combination treatment with KU57788 and AG014699 reduced postradiation clonogenic survival and significantly increased persistence of Gamma-H2AX (γH2AX) foci in irradiated H460 and A549 cells. Notably, these effects coincided with the induction of accelerated senescence in irradiated cells as reflected by positive β-galactosidase staining, G2-M cell-cycle arrest, enlarged and flattened cellular morphology, increased p21 expression, and senescence-associated cytokine secretion. In irradiated H460 xenografts, concurrent therapy with BEZ235 and AG014699 resulted in sustained Gamma-H2AX (γH2AX) staining and prominent β-galactosidase activity. Conclusion: Combined DNA-PK and PARP-1 blockade increased tumor cell radiosensitivity and enhanced the prosenescent properties of ionizing radiation in vitro and in vivo. These data provide a rationale for further preclinical and clinical testing of this therapeutic combination.
Lentivirus-mediated knockdown of NLK inhibits small-cell lung cancer growth and metastasis
Directory of Open Access Journals (Sweden)
Lv MT
2016-11-01
Full Text Available Mutian Lv,1 Yaming Li,1 Xin Tian,2 Shundong Dai,3,4 Jing Sun,5 Guojiang Jin,6 Shenyi Jiang7 1Department of Nuclear Medicine, 2Molecular Oncology Laboratory of Cancer Research Institute, The First Affiliated Hospital of China Medical University, 3Department of Pathology, The First Affiliated Hospital, College of Basic Medical Sciences of China Medical University, 4Department of Pathology, Institute of Pathology and Pathophysiology, 5Department of Immunology and Biotherapy, Liaoning Cancer Hospital and Institute, 6Department of Laboratory Medicine, 7Department of Rheumatology, The First Affiliated Hospital of China Medical University, Shenyang, People’s Republic of China Abstract: Nemo-like kinase (NLK, an evolutionarily conserved serine/threonine kinase, has been recognized as a critical regulator of various cancers. In this study, we investigated the role of NLK in human small-cell lung cancer (SCLC, which is the most aggressive form of lung cancer. NLK expression was evaluated by quantitative real-time polymerase chain reaction in 20 paired fresh SCLC tissue samples and found to be noticeably elevated in tumor tissues. Lentivirus-mediated RNAi efficiently suppressed NLK expression in NCI-H446 cells, resulting in a significant reduction in cell viability and proliferation in vitro. Moreover, knockdown of NLK led to cell cycle arrest at the S-phase via suppression of Cyclin A, CDK2, and CDC25A, which could contribute to cell growth inhibition. Furthermore, knockdown of NLK decreased the migration of NCI-H446 cells and downregulated matrix metalloproteinase 9. Treatment with NLK short hairpin RNA significantly reduced SCLC tumor growth in vivo. In conclusion, this study suggests that NLK plays an important role in the growth and metastasis of SCLC and may serve as a potential therapeutic target for the treatment of SCLC. Keywords: NLK, SCLC, RNAi, proliferation, migration
International Nuclear Information System (INIS)
Zhi, Xiuyi; Giroux-Leprieur, Etienne; Wislez, Marie; Hu, Mu; Zhang, Yi; Shi, Huaiyin; Du, Kaiqi; Wang, Lei
2015-01-01
Human RNA polymerase II (RNAPII)-associated factor 1 complex (hPAF1C) plays a crucial role in protein-coding gene transcription. Overexpression of hPAF1C has been implicated in the initiation and progression of various human cancers. However, the molecular pathways involved in tumorigenesis through hPAF1C remain to be elucidated. The current study suggested hPAF1C expression as a prognostic biomarker for early stage non-small cell lung cancer (NSCLC) and patients with low hPAF1C expression levels had significantly better overall survival. Furthermore, the expression of hPAF1C was found to be positively correlated with c-MYC expression in patient tumor samples and in cancer cell lines. Mechanistic studies indicated that hPAF1C could promote lung cancer cell proliferation through regulating c-MYC transcription. These results demonstrated the prognostic value of hPAF1C in early-stage NSCLC and the role of hPAF1C in the transcriptional regulation of c-MYC oncogene during NSCLC tumorigenesis. - Highlights: • hPAF1C expression is a prognostic biomarker for early stage non-small cell lung cancer. • The expression of hPAF1C was positively correlated with c-MYC in tumor samples of patients and in several NSCLC cell lines. • hPAF1C could promote lung cancer cell proliferation through regulating c-MYC transcription.
Directory of Open Access Journals (Sweden)
Yu-Ru Lee
Full Text Available Poly (ADP-ribose polymerase-1 (PARP-1 and telomerase, as well as DNA damage response pathways are targets for anticancer drug development, and specific inhibitors are currently under clinical investigation. The purpose of this work is to evaluate anticancer activities of anthraquinone-derived tricyclic and tetracyclic small molecules and their structure-activity relationships with PARP-1 inhibition in non-small cell lung cancer (NSCLC and NSCLC-overexpressing Oct4 and Nanog clone, which show high-expression of PARP-1 and more resistance to anticancer drug. We applied our library selected compounds to NCI's 60 human cancer cell-lines (NCI-60 in order to generate systematic profiling data. Based on our analysis, it is hypothesized that these drugs might be, directly and indirectly, target components to induce mitochondrial permeability transition and the release of pro-apoptotic factors as potential anti-NSCLC or PARP inhibitor candidates. Altogether, the most active NSC747854 showed its cytotoxicity and dose-dependent PARP inhibitory manner, thus it emerges as a promising structure for anti-cancer therapy with no significant negative influence on normal cells. Our studies present evidence that telomere maintenance should be taken into consideration in efforts not only to overcome drug resistance, but also to optimize the use of telomere-based therapeutics. These findings will be of great value to facilitate structure-based design of selective PARP inhibitors, in general, and telomerase inhibitors, in particular. Together, the data presented here expand our insight into the PARP inhibitors and support the resource-demanding lead optimization of structurally related small molecules for human cancer therapy.
Yu, Dah-Shyong; Huang, Kuo-Feng; Chou, Shih-Jie; Chen, Tsung-Chih; Lee, Chia-Chung; Chen, Chun-Liang; Chiou, Shih-Hwa; Huang, Hsu-Shan
2013-01-01
Poly (ADP-ribose) polymerase-1 (PARP-1) and telomerase, as well as DNA damage response pathways are targets for anticancer drug development, and specific inhibitors are currently under clinical investigation. The purpose of this work is to evaluate anticancer activities of anthraquinone-derived tricyclic and tetracyclic small molecules and their structure-activity relationships with PARP-1 inhibition in non-small cell lung cancer (NSCLC) and NSCLC-overexpressing Oct4 and Nanog clone, which show high-expression of PARP-1 and more resistance to anticancer drug. We applied our library selected compounds to NCI's 60 human cancer cell-lines (NCI-60) in order to generate systematic profiling data. Based on our analysis, it is hypothesized that these drugs might be, directly and indirectly, target components to induce mitochondrial permeability transition and the release of pro-apoptotic factors as potential anti-NSCLC or PARP inhibitor candidates. Altogether, the most active NSC747854 showed its cytotoxicity and dose-dependent PARP inhibitory manner, thus it emerges as a promising structure for anti-cancer therapy with no significant negative influence on normal cells. Our studies present evidence that telomere maintenance should be taken into consideration in efforts not only to overcome drug resistance, but also to optimize the use of telomere-based therapeutics. These findings will be of great value to facilitate structure-based design of selective PARP inhibitors, in general, and telomerase inhibitors, in particular. Together, the data presented here expand our insight into the PARP inhibitors and support the resource-demanding lead optimization of structurally related small molecules for human cancer therapy. PMID:23451039
Biologic characteristics of the side population of human small cell lung cancer cell line H446.
Wang, Bo; Yang, Huan; Huang, Yu-Zheng; Yan, Ru-Hong; Liu, Fen-Ju; Zhang, Jun-Ning
2010-03-01
Recently, the theory of cancer stem cells (CSCs) has presented new targets and orientations for tumor therapy. The major difficulties in researching CSCs include their isolation and purification. The aim of this study is to identify and characterize the side population (SP) cells in small cell lung cancer (SCLC) cell line H446, which lays the foundation for the isolation and purification of CSCs. Fluorescence-activated cell sorting (FACS) was used to sort SP and non-SP (NSP) cells from H446. Both subgroups were cultivated to survey the capacity to form into suspended tumor cell spheres. Reverse transcription-polymerase chain reaction (RT-PCR) and real-time PCR were used to evaluate the expression levels of the mRNA of CD133, ABCG2, and nucleostemin in both subgroups. The capacity of proliferation and the differences in drug resistance of both subgroups and unsorted cells were tested by the MTT method. The differentiation ability of both subgroups was determined by FACS. Proliferation was determined by subcutaneous tumor formation in nude mice. The percent of Hoechst 33342 negative cells was about (5.1 +/- 0.2)% in H446 by fluorescence microscopy. The percent of SP cells was (6.3 +/- 0.1)% by flow cytometry. SP cells had a stronger capability of forming into tumor spheres than NSP cells. The mRNA expression levels of ABCG2, CD133, and nucleostemin in SP cells were 21.60 +/- 0.26, 7.10 +/- 0.14, and 1.02 +/- 0.08 folds higher than that in NSP cells (P 0.05, respectively). In vivo, SP cells showed better proliferative ability and tougher viability when treated with drugs. SP cells can differentiate into NSP cells, but NSP cells cannot differentiate into SP cells. SP cells had a greater ability to form tumors. The H446 cell line contained some SP cells with stem cell properties. CD133 and ABCG2 may be cancer stem cell markers of SCLC.
Tracking the Evolution of Non-Small-Cell Lung Cancer
DEFF Research Database (Denmark)
Jamal-Hanjani, Mariam; Wilson, Gareth A.; McGranahan, Nicholas
2017-01-01
Background Among patients with non-small-cell lung cancer (NSCLC), data on intratumor heterogeneity and cancer genome evolution have been limited to small retrospective cohorts. We wanted to prospectively investigate intratumor heterogeneity in relation to clinical outcome and to determine...... as a prognostic predictor. (Funded by Cancer Research UK and others; TRACERx ClinicalTrials.gov number, NCT01888601 .)....
Non-Small Cell Lung Cancer Cells Expressing CD44 Are Enriched for Stem Cell-Like Properties
Leung, Elaine Lai-Han; Fiscus, Ronald R.; Tung, James W.; Tin, Vicky Pui-Chi; Cheng, Lik Cheung; Sihoe, Alan Dart-Loon; Fink, Louis M.; Ma, Yupo; Wong, Maria Pik
2010-01-01
Background The cancer stem cell theory hypothesizes that cancers are perpetuated by cancer stem cells (CSC) or tumor initiating cells (TIC) possessing self-renewal and other stem cell-like properties while differentiated non-stem/initiating cells have a finite life span. To investigate whether the hypothesis is applicable to lung cancer, identification of lung CSC and demonstration of these capacities is essential. Methodology/Principal Finding The expression profiles of five stem cell markers (CD34, CD44, CD133, BMI1 and OCT4) were screened by flow cytometry in 10 lung cancer cell lines. CD44 was further investigated by testing for in vitro and in vivo tumorigenecity. Formation of spheroid bodies and in vivo tumor initiation ability were demonstrated in CD44+ cells of 4 cell lines. Serial in vivo tumor transplantability in nude mice was demonstrated using H1299 cell line. The primary xenografts initiated from CD44+ cells consisted of mixed CD44+ and CD44− cells in similar ratio as the parental H1299 cell line, supporting in vivo differentiation. Semi-quantitative Real-Time PCR (RT-PCR) showed that both freshly sorted CD44+ and CD44+ cells derived from CD44+-initiated tumors expressed the pluripotency genes OCT4/POU5F1, NANOG, SOX2. These stemness markers were not expressed by CD44− cells. Furthermore, freshly sorted CD44+ cells were more resistant to cisplatin treatment with lower apoptosis levels than CD44− cells. Immunohistochemical analysis of 141 resected non-small cell lung cancers showed tumor cell expression of CD44 in 50.4% of tumors while no CD34, and CD133 expression was observed in tumor cells. CD44 expression was associated with squamous cell carcinoma but unexpectedly, a longer survival was observed in CD44-expressing adenocarcinomas. Conclusion/Significance Overall, our results demonstrated that stem cell-like properties are enriched in CD44-expressing subpopulations of some lung cancer cell lines. Further investigation is required to clarify
Cytotoxic Effects of Fascaplysin against Small Cell Lung Cancer Cell Lines
Directory of Open Access Journals (Sweden)
Gerhard Hamilton
2014-03-01
Full Text Available Fascaplysin, the natural product of a marine sponge, exhibits anticancer activity against a broad range of tumor cells, presumably through interaction with DNA, and/or as a highly selective cyclin-dependent kinase 4 (CDK4 inhibitor. In this study, cytotoxic activity of fascaplysin against a panel of small cell lung cancer (SCLC cell lines and putative synergism with chemotherapeutics was investigated. SCLC responds to first-line chemotherapy with platinum-based drugs/etoposide, but relapses early with topotecan remaining as the single approved therapeutic agent. Fascaplysin was found to show high cytotoxicity against SCLC cells and to induce cell cycle arrest in G1/0 at lower and S-phase at higher concentrations, respectively. The compound generated reactive oxygen species (ROS and induced apoptotic cell death in the chemoresistant NCI-H417 SCLC cell line. Furthermore, fascaplysin revealed marked synergism with the topoisomerase I-directed camptothecin and 10-hydroxy-camptothecin. The Poly(ADP-ribose-Polymerase 1 (PARP1 inhibitor BYK 204165 antagonized the cytotoxic activity of fascaplysin, pointing to the involvement of DNA repair in response to the anticancer activity of the drug. In conclusion, fascaplysin seems to be suitable for treatment of SCLC, based on high cytotoxic activity through multiple routes of action, affecting topoisomerase I, integrity of DNA and generation of ROS.
Small Molecular TRAIL Inducer ONC201 Induces Death in Lung Cancer Cells: A Preclinical Study.
Feng, Yuan; Zhou, Jihong; Li, Zhanhua; Jiang, Ying; Zhou, Ying
2016-01-01
Tumor necrosis factor (TNF)-related apoptosis-inducing ligand (TRAIL) selectively targets cancer cells. The present preclinical study investigated the anti-cancer efficiency of ONC201, a first-in-class small molecule TRAIL inducer, in lung cancer cells. We showed that ONC201 was cytotoxic and anti-proliferative in both established (A549 and H460 lines) and primary human lung cancer cells. It was yet non-cytotoxic to normal lung epithelial cells. Further, ONC201 induced exogenous apoptosis activation in lung cancer cells, which was evidenced by TRAIL/death receptor-5 (DR5) induction and caspase-8 activation. The caspase-8 inhibitor or TRAIL/DR5 siRNA knockdown alleviated ONC201's cytotoxicity against lung cancer cells. Molecularly, ONC201 in-activated Akt-S6K1 and Erk signalings in lung cancer cells, causing Foxo3a nuclear translocation. For the in vivo studies, intraperitoneal injection of ONC201 at well-tolerated doses significantly inhibited xenografted A549 tumor growth in severe combined immunodeficient (SCID) mice. Further, ONC201 administration induced TRAIL/DR5 expression, yet inactivated Akt-S6K1 and Erk in tumor tissues. These results of the study demonstrates the potent anti-lung cancer activity by ONC201.
Small Molecular TRAIL Inducer ONC201 Induces Death in Lung Cancer Cells: A Preclinical Study.
Directory of Open Access Journals (Sweden)
Yuan Feng
Full Text Available Tumor necrosis factor (TNF-related apoptosis-inducing ligand (TRAIL selectively targets cancer cells. The present preclinical study investigated the anti-cancer efficiency of ONC201, a first-in-class small molecule TRAIL inducer, in lung cancer cells. We showed that ONC201 was cytotoxic and anti-proliferative in both established (A549 and H460 lines and primary human lung cancer cells. It was yet non-cytotoxic to normal lung epithelial cells. Further, ONC201 induced exogenous apoptosis activation in lung cancer cells, which was evidenced by TRAIL/death receptor-5 (DR5 induction and caspase-8 activation. The caspase-8 inhibitor or TRAIL/DR5 siRNA knockdown alleviated ONC201's cytotoxicity against lung cancer cells. Molecularly, ONC201 in-activated Akt-S6K1 and Erk signalings in lung cancer cells, causing Foxo3a nuclear translocation. For the in vivo studies, intraperitoneal injection of ONC201 at well-tolerated doses significantly inhibited xenografted A549 tumor growth in severe combined immunodeficient (SCID mice. Further, ONC201 administration induced TRAIL/DR5 expression, yet inactivated Akt-S6K1 and Erk in tumor tissues. These results of the study demonstrates the potent anti-lung cancer activity by ONC201.
Acetyl-CoA Carboxylase-α Inhibitor TOFA Induces Human Cancer Cell Apoptosis
Wang, Chun; Xu, Canxin; Sun, Mingwei; Luo, Dixian; Liao, Duan-fang; Cao, Deliang
2009-01-01
Acetyl-CoA carboxylase-α (ACCA) is a rate-limiting enzyme in long chain fatty acid synthesis, playing a critical role in cellular energy storage and lipid synthesis. ACCA is upregulated in multiple types of human cancers and small interfering RNA-mediated ACCA silencing in human breast and prostate cancer cells results in oxidative stress and apoptosis. This study reports for the first time that TOFA (5-tetradecyloxy-2-furoic acid), an allosteric inhibitor of ACCA, is cytotoxic to lung cancer cells NCI-H460 and colon carcinoma cells HCT-8 and HCT-15, with an IC50 at approximately 5.0, 5.0, and 4.5 μg/ml, respectively. TOFA at 1.0–20.0 μg/ml effectively blocked fatty acid synthesis and induced cell death in a dose-dependent manner. The cell death was characterized with PARP cleavage, DNA fragmentation, and annexin-V staining, all of which are the features of the apoptosis. Supplementing simultaneously the cells with palmitic acids (100 μM), the end-products of the fatty acid synthesis pathway, prevented the apoptosis induced by TOFA. Taken together, these data suggest that TOFA is a potent cytotoxic agent to lung and colon cancer cells, inducing apoptosis through disturbing their fatty acid synthesis. PMID:19450551
Acetyl-CoA carboxylase-alpha inhibitor TOFA induces human cancer cell apoptosis.
Wang, Chun; Xu, Canxin; Sun, Mingwei; Luo, Dixian; Liao, Duan-Fang; Cao, Deliang
2009-07-31
Acetyl-CoA carboxylase-alpha (ACCA) is a rate-limiting enzyme in long chain fatty acid synthesis, playing a critical role in cellular energy storage and lipid synthesis. ACCA is upregulated in multiple types of human cancers and small interfering RNA-mediated ACCA silencing in human breast and prostate cancer cells results in oxidative stress and apoptosis. This study reports for the first time that TOFA (5-tetradecyloxy-2-furoic acid), an allosteric inhibitor of ACCA, is cytotoxic to lung cancer cells NCI-H460 and colon carcinoma cells HCT-8 and HCT-15, with an IC(50) at approximately 5.0, 5.0, and 4.5 microg/ml, respectively. TOFA at 1.0-20.0 microg/ml effectively blocked fatty acid synthesis and induced cell death in a dose-dependent manner. The cell death was characterized with PARP cleavage, DNA fragmentation, and annexin-V staining, all of which are the features of the apoptosis. Supplementing simultaneously the cells with palmitic acids (100 microM), the end-products of the fatty acid synthesis pathway, prevented the apoptosis induced by TOFA. Taken together, these data suggest that TOFA is a potent cytotoxic agent to lung and colon cancer cells, inducing apoptosis through disturbing their fatty acid synthesis.
The role of maintenance pemetrexed in the treatment of non-small-cell lung cancer
Rafii, S
2010-01-01
Saeed Rafii, Michael H CullenDepartment of Medical Oncology, Queen Elizabeth Hospital, University Hospital Birmingham, Edgbaston, Birmingham, B15 2TH, United KingdomAbstract: Until recently, the weight of evidence has supported the discontinuation of chemotherapy in advanced non-small-cell lung cancer (NSCLC) after 4–6 cycles of induction therapy. This allows patients with limited life expectancy a “treatment holiday.” A minority of cases then go on to r...
Nrf2 mediates redox adaptation in NOX4-overexpressed non-small cell lung cancer cells
Energy Technology Data Exchange (ETDEWEB)
Wu, Qipeng; Yao, Bei; Li, Ning; Ma, Lei; Deng, Yanchao; Yang, Yang; Zeng, Cheng; Yang, Zhicheng [Department of Clinical Pharmacy, School of Pharmacy, Guangdong Pharmaceutical University, Guangzhou 510006 (China); Liu, Bing, E-mail: liubing520@gdpu.edu.cn [Department of Clinical Pharmacy, School of Pharmacy, Guangdong Pharmaceutical University, Guangzhou 510006 (China); Guangdong Key Laboratory of Pharmaceutical Bioactive Substances, Guangdong Pharmaceutical University, Guangzhou 510006 (China)
2017-03-15
The redox adaptation mechanisms in cancer cells are very complex and remain largely unclear. Our previous studies have confirmed that NADPH oxidase 4 (NOX4) is abundantly expressed in non-small cell lung cancer (NSCLC) and confers apoptosis resistance on NSCLC cells. However, the comprehensive mechanisms for NOX4-mediated oxidative resistance of cancer cells remain still undentified. The present study found that NOX4-derived H{sub 2}O{sub 2} enhanced the nuclear factor erythroid 2-related factor 2 (Nrf2) stability via disruption of redox-dependent proteasomal degradation and stimulated its activity through activation of PI3K signaling. Specifically, the results showed that ectopic NOX4 expression did not induce apoptosis of A549 cells; however, inhibition of Nrf2 resulted in obvious apoptotic death of NOX4-overexpressed A549 cells, accompanied by a significant increase in H{sub 2}O{sub 2} level and decrease in GSH content. Besides, inhibition of Nrf2 could suppress cell growth and efficiently reverse the enhancement effect of NOX4 on cell growth. The in vivo data confirmed that inhibition of Nrf2 could interfere apoptosis resistance in NOX4-overexpressed A549 tumors and led to cell growth inhibition. In conclusion, these results reveal that Nrf2 is critically involved in redox adaptation regulation in NOX4-overexpressed NSCLC cells. Therefore, NOX4 and Nrf2 may be promising combination targets against malignant progression of NSCLC. - Highlights: • NOX4-derived H{sub 2}O{sub 2} upregulates Nrf2 expression and activity in NSCLC. • Nrf2 confers apoptosis resistance in NOX4-overexpressed NSCLC cells. • Inhibition of Nrf2 reverses the enhancement effect of NOX4 on cell growth.
Mooi, W. J.; van Zandwijk, N.; Dingemans, K. P.; Koolen, M. G.; Wagenvoort, C. A.
1986-01-01
We studied 14 lung tumours which on light microscopy had posed difficulties on classification as either small cell or non-small cell carcinomas. The light and electron microscopical features were compared with patient follow-up data. Electron microscopy showed neuroendocrine granules in 12 cases,
Directory of Open Access Journals (Sweden)
Richa Dubey
Full Text Available STAT6 transcription factor has become a potential molecule for therapeutic intervention because it regulates broad range of cellular processes in a large variety of cell types. Although some target genes and interacting partners of STAT6 have been identified, its exact mechanism of action needs to be elucidated. In this study, we sought to further characterize the molecular interactions, networks, and functions of STAT6 by profiling the mRNA expression of STAT6 silenced human lung cells (NCI-H460 using microarrays. Our analysis revealed 273 differentially expressed genes after STAT6 silencing. Analysis of the gene expression data with Ingenuity Pathway Analysis (IPA software revealed Gene expression, Cell death, Lipid metabolism as the functions associated with highest rated network. Cholesterol biosynthesis was among the most enriched pathways in IPA as well as in PANTHER analysis. These results have been validated by real-time PCR and cholesterol assay using scrambled siRNA as a negative control. Similar findings were also observed with human type II pulmonary alveolar epithelial cells, A549. In the present study we have, for the first time, shown the inverse relationship of STAT6 with the cholesterol biosynthesis in lung cancer cells. The present findings are potentially significant to advance the understanding and design of therapeutics for the pathological conditions where both STAT6 and cholesterol biosynthesis are implicated viz. asthma, atherosclerosis etc.
Inhibitory effect and molecular mechanism of mesenchymal stem cells on NSCLC cells.
Pan, Mengwu; Hou, Lingling; Zhang, Jingsi; Zhao, Diandian; Hua, Jilei; Wang, Ziling; He, Jinsheng; Jiang, Hong; Hu, Honggang; Zhang, Lishu
2018-04-01
Non-small-cell lung cancer (NSCLC) is still the main threat of cancer-associated death. Current treatment of NSCLC has limited effectiveness, and unfortunately, the prognosis of NSCLC remains poor. Therefore, a novel strategy for cancer therapy is urgently needed. Stem cell therapy has significant potential for cancer treatment. Mesenchymal stem cells (MSCs) with capacity for self-renewal and differentiation into various cells types exhibit the feature of homing to tumor site and immunosuppression, have been explored as a new treatment for various cancers. Studies revealed that the broad repertoire of trophic factors secreted by MSCs extensively involved in the interplay between MSCs and tumor cells. In this study, we confirmed that MSCs do have the paracrine effect on proliferation and migration of NSCLC cells (A549, NCI-H460, and SK-MES-1). Co-culture system and conditioned medium experiments results showed that soluble factors secreted by MSCs inhibited the proliferation of NSCLC cells in vitro. The scratch assay showed that conditioned medium of MSCs could suppress the migration of NSCLC cells in vitro. Western blot results showed that the expression of proteins relevant to cell proliferation, anti-apoptosis, and migration was remarkably decreased via MAPK/eIF4E signaling pathway. We speculated that soluble factors secreted by MSCs might be responsible for inhibitory mechanism of NSCLC cells. By Human Gene Expression Microarray Assay and recombinant Vascular Endothelial Growth Factor 165 (VEGF165) neutralizing experiment, we verified that VEGF might be responsible for the down-regulation of proteins related to cell proliferation, anti-apoptosis, and migration by suppressing translation initiation factor eIF4E via MAPK signaling pathway. Taken together, our study demonstrated that a possible trophic factor secreted by MSCs could manipulate translation initiation of NSCLC cells via MAPK signaling pathway, and significantly affect the fate of tumor cells, which
Murray-Stewart, Tracy; Applegren, Nancy B; Devereux, Wendy; Hacker, Amy; Smith, Renee; Wang, Yanlin; Casero, Robert A
2003-07-15
Spermidine/spermine N (1)-acetyltransferase (SSAT) activity is typically highly inducible in non-small-cell lung carcinomas in response to treatment with anti-tumour polyamine analogues, and this induction is associated with subsequent cell death. In contrast, cells of the small-cell lung carcinoma (SCLC) phenotype generally do not respond to these compounds with an increase in SSAT activity, and usually are only moderately affected with respect to growth. The goal of the present study was to produce an SSAT-overexpressing SCLC cell line to further investigate the role of SSAT in response to these anti-tumour analogues. To accomplish this, NCI-H82 SCLC cells were stably transfected with plasmids containing either the SSAT genomic sequence or the corresponding cDNA sequence. Individual clones were selected based on their ability to show induced SSAT activity in response to exposure to a polyamine analogue, and an increase in the steady-state SSAT mRNA level. Cells transfected with the genomic sequence exhibited a significant increase in basal SSAT mRNA expression, as well as enhanced SSAT activity, intracellular polyamine pool depletion and growth inhibition following treatment with the analogue N (1), N (11)-bis(ethyl)norspermine. Cells containing the transfected cDNA also exhibited an increase in the basal SSAT mRNA level, but remained phenotypically similar to vector control cells with respect to their response to analogue exposure. These studies indicate that both the genomic SSAT sequence and polyamine analogue exposure play a role in the transcriptional and post-transcriptional regulation and subsequent induction of SSAT activity in these cells. Furthermore, this is the first production of a cell line capable of SSAT protein induction from a generally unresponsive parent line.
Survival outcomes for oligometastasis in resected non-small cell lung cancer.
Shimada, Yoshihisa; Saji, Hisashi; Kakihana, Masatoshi; Kajiwara, Naohiro; Ohira, Tatsuo; Ikeda, Norihiko
2015-10-01
We investigated the factors associated with post-recurrence survival and the treatment for non-small-cell lung cancer patients with postoperative distant recurrence, especially oligometastasis. We reviewed the data of 272 patients with distant recurrence who underwent resection of non-small-cell lung cancer from January 2000 through December 2011. The type of distant recurrence was classified as oligometastasis (n = 76, 28%) or polymetastasis (n = 196, 72%). Forty-seven (62%) patients with oligometastasis received local therapy (surgery 5, radiotherapy 9, sequential local and systemic therapy 28, chemoradiotherapy 5). Multivariate analysis revealed older age, non-adenocarcinoma, shorter disease-free interval, no pulmonary metastasis, liver metastases, bone metastases, and polymetastasis had significant associations with unfavorable post-recurrence survival. Subgroup analysis of patients with oligometastasis showed histology and disease-free interval had a great impact on survival. Smoking history and histology were associated with survival in patients with lung oligometastasis, whereas systemic treatment and longer disease-free interval were related to increased post-recurrence survival in those with brain oligometastasis. This study showed that an oligometastatic state per se was a significant favorable factor. Optimization of personalized systemic treatment and adding local treatment are important in the management of patients with non-small-cell lung cancer and oligometastasis. © The Author(s) 2015.
Directory of Open Access Journals (Sweden)
Sif Holmboe
Full Text Available Cancer stem cells represent the putative tumor-driving subpopulation thought to account for drug resistance, relapse, and metastatic spread of epithelial and other cancer types. Accordingly, cell surface markers for therapeutic delivery to cancer stem cells are subject of intense research. Somatostatin receptor 2 and nucleolin are known to be overexpressed by various cancer types, which have elicited comprehensive efforts to explore their therapeutic utilization. Here, we evaluated somatostatin receptor 2 targeting and nucleolin targeting for therapeutic delivery to cancer stem cells from lung cancer. Nucleolin is expressed highly but not selectively, while somatostatin receptor 2 is expressed selectively but not highly by cancer cells. The non-small cell lung cancer cell lines A549 and H1299, displayed average levels of both surface molecules as judged based on analysis of a larger cell line panel. H1299 compared to A549 cells showed significantly elevated sphere-forming capacity, indicating higher cancer stem cell content, thus qualifying as suitable test system. Nucleolin-targeting 57Co-DOTA-AS1411 aptamer showed efficient internalization by cancer cells and, remarkably, at even higher efficiency by cancer stem cells. In contrast, somatostatin receptor 2 expression levels were not sufficiently high in H1299 cells to confer efficient uptake by either non-cancer stem cells or cancer stem cells. The data provides indication that the nucleolin-targeting AS1411 aptamer might be used for therapeutic delivery to non-small cell lung cancer stem cells.
Energy Technology Data Exchange (ETDEWEB)
Harder, Samantha J.; Isabelle, Martin; DeVorkin, Lindsay; Smazynski, Julian; Beckham, Wayne; Brolo, Alexandre; Lum, Julian; Jirasek, Andrew [BC Cancer Agency/ Vancouver Island Cancer Centre, Gloucestershire Hospitals NHS Foundation Trust, BC Cancer Agency/ Vancouver Island Cancer Centre, BC Cancer Agency/ Vancouver Island Cancer Centre, BC Cancer Agency/ Vancouver Island Cancer Centre, University of Victoria/ Department of Chemistry, BC Cancer Agency/ Vancouver Island Cancer Centre, University of British Columbia Okanagan (Canada)
2016-08-15
Purpose: This study presents the novel application of Raman spectroscopy (RS) to identify biochemical signatures of radiation response in human non-small cell lung cancer (NSCLC) xenografts, irradiated in vivo. Methods: Human NSCLC cells (H460) were subcutaneously injected into the flanks of 12 mice. Tumours were treated with single fraction radiation doses (0, 5 or 15 Gy) and harvested at 3 days post irradiation. A Renishaw inVia Raman microscope coupled to a 785 nm laser was used to collect Raman spectral maps for each tumour. Immunohistochemistry (IHC) staining for CAIX was used to visualize hypoxia, and co-registration between IHC fluorescence and Raman images was carried out. Results: Principal component analysis revealed radiation induced spectral signatures linked to changes in protein, nucleic acid, lipid and carbohydrates. In particular, a marked increase in glycogen for irradiated tumours was observed. Spatial mapping revealed intra-tumoural heterogeneity in the distribution of glycogen within the tumour, suggesting tumour response to radiation is not globally uniform. Furthermore, co-registration of Raman glycogen maps with CAIX IHC staining showed a correlation between glycogen rich and hypoxic regions of the tissue. Conclusions: We identify glycogen as a unique radiation induced response in NSCLC tumour xenografts, which may reflect inherent metabolic changes associated with radiation response in tissue. This study provides unique insight into the biochemical response of tumours, irradiated in vivo, and demonstrates the potential of RS for detecting radiobiological responses in tumours.
International Nuclear Information System (INIS)
Harder, Samantha J.; Isabelle, Martin; DeVorkin, Lindsay; Smazynski, Julian; Beckham, Wayne; Brolo, Alexandre; Lum, Julian; Jirasek, Andrew
2016-01-01
Purpose: This study presents the novel application of Raman spectroscopy (RS) to identify biochemical signatures of radiation response in human non-small cell lung cancer (NSCLC) xenografts, irradiated in vivo. Methods: Human NSCLC cells (H460) were subcutaneously injected into the flanks of 12 mice. Tumours were treated with single fraction radiation doses (0, 5 or 15 Gy) and harvested at 3 days post irradiation. A Renishaw inVia Raman microscope coupled to a 785 nm laser was used to collect Raman spectral maps for each tumour. Immunohistochemistry (IHC) staining for CAIX was used to visualize hypoxia, and co-registration between IHC fluorescence and Raman images was carried out. Results: Principal component analysis revealed radiation induced spectral signatures linked to changes in protein, nucleic acid, lipid and carbohydrates. In particular, a marked increase in glycogen for irradiated tumours was observed. Spatial mapping revealed intra-tumoural heterogeneity in the distribution of glycogen within the tumour, suggesting tumour response to radiation is not globally uniform. Furthermore, co-registration of Raman glycogen maps with CAIX IHC staining showed a correlation between glycogen rich and hypoxic regions of the tissue. Conclusions: We identify glycogen as a unique radiation induced response in NSCLC tumour xenografts, which may reflect inherent metabolic changes associated with radiation response in tissue. This study provides unique insight into the biochemical response of tumours, irradiated in vivo, and demonstrates the potential of RS for detecting radiobiological responses in tumours.
Gigantol Inhibits Epithelial to Mesenchymal Process in Human Lung Cancer Cells
Directory of Open Access Journals (Sweden)
Thitita Unahabhokha
2016-01-01
Full Text Available Lung cancer remains a leading public health problem as evidenced by its increasing death rate. The main cause of death in lung cancer patients is cancer metastasis. The metastatic behavior of lung cancer cells becomes enhanced when cancer cells undergo epithelial to mesenchymal transition (EMT. Gigantol, a bibenzyl compound extracted from the Thai orchid, Dendrobium draconis, has been shown to have promising therapeutic potential against cancer cells, which leads to the hypothesis that gigantol may be able to inhibit the fundamental EMT process in cancer cells. This study has demonstrated for the first time that gigantol possesses the ability to suppress EMT in non-small cell lung cancer H460 cells. Western blot analysis has revealed that gigantol attenuates the activity of ATP-dependent tyrosine kinase (AKT, thereby inhibiting the expression of the major EMT transcription factor, Slug, by both decreasing its transcription and increasing its degradation. The inhibitory effects of gigantol on EMT result in a decrease in the level of migration in H460 lung cancer cells. The results of this study emphasize the potential of gigantol for further development against lung cancer metastasis.
International Nuclear Information System (INIS)
Park, Jong Ho; Zo, Jae Ill; Paik, Hee Jong; Kim, Mi Hee
1996-12-01
The main purpose of this research was to identify of the p53 and 3p gene alteration in non-small cell lung cancer patients residing in Korea. Furthermore, we analyzed the relationship between the p53 and 3p gene alterations and the clinicopathologic results of lung cancer patients. And we have investigated the role of PCR-LOH in analyzing tumor samples for LOH of defined chromosomal loci. We have used the 40 samples obtained from the lung cancer patients who were diagnosed and operated curatively at Korea Cancer Center Hospital. We have isolated the high molecular weight. DNA from the tumors and normal tissues. And we have amplified the DNA with PCR method and used the microsatellite assay method to detect the altered p53 and 3p gene. The conclusions were as follow: 1) The 3p gene alteration was observed in 9/39 (23.1%) and p53 gene alteration was observed in 15/40 (37.5%) of resected non-small cell lung cancer. 2) There was no correlations between the 3p or p53 gene alterations and prognosis of patients, but further study is necessary. 3) PCR-LOH is a very useful tool for analyzing small amount of tumor samples for loss of heterozygosity of defined chromosomal loci. (author). 10 refs
Peptide receptor chemoradionuclide therapy in small cell carcinoma: from bench to bedside
International Nuclear Information System (INIS)
Lewin, Jeremy; Rao, Aparna; Mileshkin, Linda; Cullinane, Carleen; Akhurst, Tim; Eu, Peter; Waldeck, Kelly; Watkins, D.N.; Hicks, Rodney J.
2015-01-01
Small cell cancers (SmCC), whether pulmonary (SCLC) or extrapulmonary, have a poor prognosis unless localised at diagnosis. Given a proportion of these cancers express somatostatin receptor subtype 2 (SSTR2), we aimed to investigate the efficacy of targeted peptide receptor chemoradionuclide therapy (PRCRT). In this preclinical study, we used a SCLC xenograft mouse model with high expression of SSTR2 to investigate the effect of peptide receptor radionuclide therapy (PRRT) with chemotherapy compared to either alone. We subsequently explored the clinical utility in a patient with SmCC with high SSTR expression treated with PRCRT. Robust expression of SSTR2 in NCI-H69 SCLC xenografts was documented by 68 Ga-DOTA-octreotate (GaTate) (tumour to background uptake ratio = 35). The combination of PRRT using 177 Lu-DOTA-octreotate (LuTate) with carboplatin/etoposide (C/E) chemotherapy was more effective than either LuTate or C/E alone for regression of the NCI-H69 model (p value < 0.05). PRCRT was associated with significantly prolonged survival versus PRRT (p value = 0.0001) or chemotherapy alone (p value = 0.0058). In the subsequent case study, a patient with relapsed SmCC with high SSTR2 expression on GaTate PET underwent PRCRT with radiosensitising etoposide with evidence of a complete metabolic response for 4 months. Given the limited treatment options in this setting, PRCRT is a promising therapeutic option for SSTR2-expressing SmCC. (orig.)
Peptide receptor chemoradionuclide therapy in small cell carcinoma: from bench to bedside
Energy Technology Data Exchange (ETDEWEB)
Lewin, Jeremy; Rao, Aparna; Mileshkin, Linda [Division of Hematology and Medical Oncology, East Melbourne, VIC (Australia); Cullinane, Carleen [Division of Cancer Research, East Melbourne, VIC (Australia); The University of Melbourne, Sir Peter MacCallum Department of Oncology, Melbourne, VIC (Australia); Akhurst, Tim; Eu, Peter [Centre for Cancer Imaging, Peter MacCallum Cancer Centre, East Melbourne, VIC (Australia); Waldeck, Kelly [Division of Cancer Research, East Melbourne, VIC (Australia); Watkins, D.N. [Monash University, Monash Institute of Medical Research, Clayton, VIC (Australia); Hicks, Rodney J. [Centre for Cancer Imaging, Peter MacCallum Cancer Centre, East Melbourne, VIC (Australia); The University of Melbourne, Sir Peter MacCallum Department of Oncology, Melbourne, VIC (Australia)
2015-01-15
Small cell cancers (SmCC), whether pulmonary (SCLC) or extrapulmonary, have a poor prognosis unless localised at diagnosis. Given a proportion of these cancers express somatostatin receptor subtype 2 (SSTR2), we aimed to investigate the efficacy of targeted peptide receptor chemoradionuclide therapy (PRCRT). In this preclinical study, we used a SCLC xenograft mouse model with high expression of SSTR2 to investigate the effect of peptide receptor radionuclide therapy (PRRT) with chemotherapy compared to either alone. We subsequently explored the clinical utility in a patient with SmCC with high SSTR expression treated with PRCRT. Robust expression of SSTR2 in NCI-H69 SCLC xenografts was documented by {sup 68}Ga-DOTA-octreotate (GaTate) (tumour to background uptake ratio = 35). The combination of PRRT using {sup 177}Lu-DOTA-octreotate (LuTate) with carboplatin/etoposide (C/E) chemotherapy was more effective than either LuTate or C/E alone for regression of the NCI-H69 model (p value < 0.05). PRCRT was associated with significantly prolonged survival versus PRRT (p value = 0.0001) or chemotherapy alone (p value = 0.0058). In the subsequent case study, a patient with relapsed SmCC with high SSTR2 expression on GaTate PET underwent PRCRT with radiosensitising etoposide with evidence of a complete metabolic response for 4 months. Given the limited treatment options in this setting, PRCRT is a promising therapeutic option for SSTR2-expressing SmCC. (orig.)
Ko, Jen-Chung; Chiu, Hsien-Chun; Syu, Jhan-Jhang; Jian, Yi-Jun; Chen, Chien-Yu; Jian, Yun-Ting; Huang, Yi-Jhen; Wo, Ting-Yu; Lin, Yun-Wei
2014-03-01
Tamoxifen is a triphenylethylene nonsteroidal estrogen receptor (ER) antagonist used worldwide as an adjuvant hormone therapeutic agent in the treatment of breast cancer. However, the molecular mechanism of tamoxifen-induced cytotoxicity in non-small cell lung cancer (NSCLC) cells has not been identified. Thymidine phosphorylase (TP) is an enzyme of the pyrimidine salvage pathway which is upregulated in cancers. In this study, tamoxifen treatment inhibited cell survival in two NSCLC cells, H520 and H1975. Treatment with tamoxifen decreased TP mRNA and protein levels through AKT inactivation. Furthermore, expression of constitutively active AKT (AKT-CA) vectors significantly rescued the decreased TP protein and mRNA levels in tamoxifen-treated NSCLC cells. In contrast, combination treatment with PI3K inhibitors (LY294002 or wortmannin) and tamoxifen further decreased the TP expression and cell viability of NSCLC cells. Knocking down TP expression by transfection with small interfering RNA of TP enhanced the cytotoxicity and cell growth inhibition of tamoxifen. Erlotinib (Tarceva, OSI-774), an orally available small molecular inhibitor of epidermal growth factor receptor (EGFR) tyrosine kinase, is approved for clinical treatment of NSCLC. Compared to a single agent alone, tamoxifen combined with erlotinib resulted in cytotoxicity and cell growth inhibition synergistically in NSCLC cells, accompanied with reduced activation of phospho-AKT and phospho-ERK1/2, and reduced TP protein levels. These findings may have implications for the rational design of future drug regimens incorporating tamoxifen and erlotinib for the treatment of NSCLC. Copyright © 2014 Elsevier Inc. All rights reserved.
Galectin-3 and cyclin D1 expression in non-small cell lung cancer
Directory of Open Access Journals (Sweden)
Gołecki Marcin
2011-10-01
correlation between cyclin D1 and galectin-3 expression (R Spearman -0.458, p = 0.0011. In squamous cell lung cancer we didn't observed correlations between these both examinated markers (R = -0.158, p = 0.460, and in adenocarcinoma the negative correlation was very strong (R = -0.829 p = 0.000132. Conclusions We didn't reveal any important correlations between clinicopathological findings and galectin-3 and cyclin D1 expression and in non small cell lung cancer. We didn't observed also prognostic value of cyclin D1 or galectin-3 expression. But we showed higher cyclin D1 expression in galectin-3 negative tumor tissues. We revealed also differences in correlations between galectin-3 and cyclin D1 expression in two main histopathological types of NSCLC.
Yoshino, Hironori; Iwabuchi, Miyu; Kazama, Yuka; Furukawa, Maho; Kashiwakura, Ikuo
2018-04-01
Retinoic acid-inducible gene-I (RIG-I)-like receptors (RLRs) are pattern-recognition receptors that recognize pathogen-associated molecular patterns and induce antiviral immune responses. Recent studies have demonstrated that RLR activation induces antitumor immunity and cytotoxicity against different types of cancer, including lung cancer. However a previous report has demonstrated that ionizing radiation exerts a limited effect on RLR in human monocytic cell-derived macrophages, suggesting that RLR agonists may be used as effective immunostimulants during radiation therapy. However, it is unclear whether ionizing radiation affects the cytotoxicity of RLR agonists against cancer cells. Therefore, in the present study the effects of cotreatment with ionizing radiation and RLR agonists on cytotoxicity against human non-small cell lung cancer cells A549 and H1299 was investigated. Treatment with RLR agonist poly(I:C)/LyoVec™ [poly(I:C)] exerted cytotoxic effects against human non-small cell lung cancer. The cytotoxic effects of poly(I:C) were enhanced by cotreatment with ionizing radiation, and poly(I:C) pretreatment resulted in the radiosensitization of non-small cell lung cancer. Furthermore, cotreatment of A549 and H1299 cells with poly(I:C) and ionizing radiation effectively induced apoptosis in a caspase-dependent manner compared with treatment with poly(I:C) or ionizing radiation alone. These results indicate that RLR agonists and ionizing radiation cotreatment effectively exert cytotoxic effects against human non-small cell lung cancer through caspase-mediated apoptosis.
Energy Technology Data Exchange (ETDEWEB)
Chen, Susie; Wang Hongyan; Ng, Wooi Loon; Curran, Walter J. [Department of Radiation Oncology, School of Medicine and the Winship Cancer Institute, Emory University, Atlanta, GA (United States); Wang Ya, E-mail: ywang94@emory.edu [Department of Radiation Oncology, School of Medicine and the Winship Cancer Institute, Emory University, Atlanta, GA (United States)
2011-12-01
Purpose: Previously, we showed that ectopic miR-101 could sensitize human tumor cells to radiation by targeting ATM and DNA-PK catalytic subunit (DNA-PKcs) to inhibit DNA repair, as the endogenous miR-101 levels are low in tumors in general. However, the heterogeneity of human cancers may result in an exception. The purpose of this study was to test the hypothesis that a few tumor cell lines with a high level of endogenous miR-101 would prove less response to ectopic miR-101. Methods and Materials: Fourteeen non-small-cell lung cancer (NSCLC) cell lines and one immortalized non-malignant lung epithelial cell line (NL20) were used for comparing endogenous miR-101 levels by real-time reverse transcription-polymerase chain reaction. Based on the different miR-101 levels, four cell lines with different miR-101 levels were chosen for transfection with a green fluorescent protein-lentiviral plasmid encoding miR-101. The target protein levels were measured by using Western blotting. The radiosensitizing effects of ectopic miR-101 on these NSCLC cell lines were determined by a clonogenic assay and xenograft mouse model. Results: The endogenous miR-101 level was similar or lower in 13 NSCLC cell lines but was 11-fold higher in one cell line (H157) than in NL20 cells. Although ectopic miR-101 efficiently decreased the ATM and DNA-PKcs levels and increased the radiosensitization level in H1299, H1975, and A549 cells, it did not change the levels of the miR-101 targets or radiosensitivity in H157 cells. Similar results were observed in xenograft mice. Conclusions: A small number of NSCLC cell lines could have a high level of endogenous miR-101. The ectopic miR-101 was able to radiosensitize most NSCLC cells, except for the NSCLC cell lines that had a much higher endogenous miR-101 level. These results suggest that when we choose one miRNA as a therapeutic tool, the endogenous level of the miRNA in each tumor should be considered.
NCI Takes Back the Defelice Cup at Ninth Annual Golf Tournament | Poster
By Ashley DeVine, Staff Writer After being down by a point in the morning, NCI reclaimed the Defelice Cup trophy from Leidos Biomedical Research, with a final score of 12 ½ to 11 ½, at the ninth annual Ronald H. Defelice Golf Tournament, held Oct. 13. “The tightest matches in the nine-year history of this cup competition resulted in a narrow victory for NCI and allowed NCI to
Directory of Open Access Journals (Sweden)
Xianglan XUAN
2013-01-01
Full Text Available Background and objective Previous studies have reported that Met might be related to gefitinib resistance in non-small cell lung cancer (NSCLC. The present study aims to explore the mechanism of hepatocyte growth factor (HGF-induced gefitinib resistance in different gene types of sensitive NSCLC in vitro. Methods The PC-9 and H292 cell lines were chosen and induced by HGF. The cell survival was measured using MTT assay, the cell cycle distribution was measured using PI assay, and cell apoptosis with an Annexin V-PE assay, respectively. The c-Met and p-Met protein expression was determined via Western blot analysis. Results Gefitinib inhibited the growth of PC-9 and H292 cells in a dose-dependent manner. The concentration-survival curves of both cell lines shifted to the right when induced with HGF. HGF did not affect PC-9 and H292 cell proliferation. The cell also had a higher cell survival rate when treated with HGF and gefitinib compared with that under gefitinib alone (P<0.05. The apoptotic rate and cell cycle progression showed no significant difference between the HG and G group (P>0.05. HGF stimulated Met phosphorylation in the PC-9 and H292 cells. Gefitinib inhibited the HGF-induced Met phosphorylation in PC-9 cells, but not in H292 cells. Conclusion HGF induces gefitinib resistance in PC-9 and H292 cells. HGF-induced Met phosphorylation may be an important mechanism of gefitinib resistance in sensitive NSCLC.
CT-guided intratumoral gene therapy in non-small-cell lung cancer
International Nuclear Information System (INIS)
Kauczor, H.U.; Heussel, C.P.; Thelen, M.; Schuler, M.; Huber, C.; Weymarn, A. von; Bongartz, G.; Rochlitz, C.
1999-01-01
The objective of this study was to prove the principle of CT-guided gene therapy by intratumoral injection of a tumor suppressor gene as an alternative treatment approach of incurable non-small-cell lung cancer. In a prospective clinical phase I trial six patients with non-small-cell lung cancer and a mutation of the tumor suppressor gene p53 were treated by CT-guided intratumoral gene therapy. Ten milliliters of a vector solution (replication-defective adenovirus with complete wild-type p53 cDNA) were injected under CT guidance. In four cases the vector solution was completely applied to the tumor center, whereas in two cases 2 ml aliquots were injected into different tumor areas. For the procedure the scan room had been approved as a biosafety cabinet. Gene transfer was assessed by reverse transcription and polymerase chain reaction in biopsy specimens obtained under CT guidance 24-48 h after therapy. Potential therapeutic efficacy was evaluated on day 28 after treatment using spiral CT. The CT-guided gene therapy was easily performed in all six patients without intervention-related complications. Besides flu-like symptoms, no significant adverse effects of gene therapy were noted. Three of the four patients with central injection exhibited gene transfer in the posttreatment biopsy. Gene transfer could not be proven in the two patients with multiple 2 ml injections. After 28 days, four of the six patients showed stable disease at the treated tumor site, whereas other tumor manifestations progressed. Computed tomography-guided injections are an adequate and easy-to-perform procedure for intratumoral gene therapy. (orig.)
Chemotherapy related toxicity in locally advanced non-small cell lung cancer
Directory of Open Access Journals (Sweden)
Bahl Amit
2006-01-01
Full Text Available Background: For inoperable non-small cell lung cancer combined chemotherapy and radiotherapy plays an important role as a therapeutic modality. The aim of the present study was to analyze neoadjuvant chemotherapy related acute toxicity in locally advanced lung cancer (stage IIIA and IIIB in Indian patients using Cisplatin and Etoposide combination chemotherapy. Material and methods: Forty patients of locally advanced Non small cell lung cancer received three cycles neoadjuvant chemotherapy using Injection Cisplatin and Etoposide. The patients were taken for Radical radiotherapy to a dose of 60 Gray over 30 fractions in conventional fractionation after completing chemotherapy. Chemotherapy associated toxicity was assessed using common toxicity criteria (CTC v2.0 Results: Forty patients were available for final evaluation. Median age of presentation of patients was fifty-six years. Thirteen patients had Non small cell lung cancer stage IIIA while twenty-seven patients had Stage IIIB disease. Anemia was the most common hematological toxicity observed (seen in 81% of patients. Nausea and vomiting were the most common non -hematological toxicity seen. Sensory neuropathy was seen in 38%of patients. 88% patients developed alopecia. Seven patients developed febrile neutropenias. Conclusion: Neo-adjuvant chemotherapy using Cisplatin and Etoposide continues to be a basic regimen in the Indian set up despite availability of higher molecules, since it is cost effective, well tolerated and therapeutically effective. Blood transfusions, growth factors and supportive care can be used effectively to over come toxicity associated with this regimen.
MicroRNA-944 Affects Cell Growth by Targeting EPHA7 in Non-Small Cell Lung Cancer
Minxia Liu; Kecheng Zhou; Yi Cao
2016-01-01
MicroRNAs (miRNAs) have critical roles in lung tumorigenesis and development. To determine aberrantly expressed miRNAs involved in non-small cell lung cancer (NSCLC) and investigate pathophysiological functions and mechanisms, we firstly carried out small RNA deep sequencing in NSCLC cell lines (EPLC-32M1, A549 and 801D) and a human immortalized cell line 16HBE, we then studied miRNA function by cell proliferation and apoptosis. cDNA microarray, luciferase reporter assay and miRNA transfectio...
2012-01-27
... DEPARTMENT OF HEALTH AND HUMAN SERVICES National Institutes of Health Proposed Collection; Comment Request; Solar Cell: A Mobile UV Manager for Smart Phones (NCI) SUMMARY: In compliance with the... Manager for Smart Phones [[Page 4335
NCI International EBV-Gastric Cancer Consortium
A collaboration among NCI and extramural investigators, established by DCEG in 2006, that utilizes data and biospecimens from completed and ongoing case series and observational studies of gastric cancer to replicate and extend findings from previous studies hindered by small numbers of EBV-positive cases, and to stimulate multidisciplinary research in this area.
The role of gallium-67 tumour scintigraphy in patients with small, non-cleaved cell lymphoma
International Nuclear Information System (INIS)
Sandrock, D.; Lastoria, S.; Neumann, R.D.; Magrath, I.T.
1993-01-01
Two hundred and thirty-four scintigraphic studies were performed in 34 patients (27 men, 7 women, age 17.3±7.7 years) with small, non-cleaved cell lymphoma who had follow-up for 3-96 months (mean 21.6±21.7 months). Whole-body scintigraphy was performed 48-72 h following i.v. injection of 370 MBq gallium-67 citrate. 'Gold standards' for truth determinations were surgery, autopsy, histology, axial X-ray computed tomography, magnetic resonance imaging, ultrasonography and clinical follow-up. Overall, 181 of 234 studies were true negative. Eighty proven sites of disease had true positive 67 Ga uptake (in 21 patients/37 studies). Nineteen sites (in 12 patients/15 studies) were false positive. In addition, 31 benign lesions were detected and interpreted correctly in terms of non-malignancy. Ten lymphoma sites (in 6 patients/10 studies) were missed by scintigraphy. Overall, sensitivity of gallium scintigraphy was 89% when calculated by sites and 79% when calculated by studies. Corresponding specificities were 91% and 92%, respectively. Positive predictive values were 81% (sites) and 71% (studies), and negative predictive values 95% (sites and studies). Thus, gallium scintigraphy proved to be a sensitive and specific method for staging and follow-up in patients with small, non-cleaved cell lymphoma. (orig.)
FOXD3 suppresses tumor growth and angiogenesis in non-small cell lung cancer
International Nuclear Information System (INIS)
Yan, Jun-Hai; Zhao, Chun-Liu; Ding, Lan-Bao; Zhou, Xi
2015-01-01
The transcription factor forkhead box D3 (FOXD3), widely studied as a transcriptional repressor in embryogenesis, participates in the carcinogenesis of many cancers. However, the expression pattern and role of FOXD3 in non-small cell lung cancer (NSCLC) have not been well characterized. We report that FOXD3 is significantly downregulated in NSCLC cell lines and clinical tissues. FOXD3 overexpression significantly inhibits cell growth and results in G1 cell cycle arrest in NSCLC A549 and H1299 cells. In a xenograft tumor model, FOXD3 overexpression inhibits tumor growth and angiogenesis. Remarkably, expression of vascular endothelial growth factor (VEGF) was reduced in FOXD3 overexpression models both in vitro and in vivo. These findings suggest that FOXD3 plays a potential tumor suppressor role in NSCLC progression and represents a promising clinical prognostic marker and therapeutic target for this disease. - Highlights: • FOXD3 is downregulated in NSCLC cell lines and tissues. • FOXD3 overexpression inhibited cell proliferation in NSCLC cells. • FOXD3 overexpression led to decreased angiogenesis in NSCLC cells in vitro and in vivo.
FOXD3 suppresses tumor growth and angiogenesis in non-small cell lung cancer
Energy Technology Data Exchange (ETDEWEB)
Yan, Jun-Hai; Zhao, Chun-Liu [Department of Respiratory Medicine, Luwan Branch of Ruijin Hospital, Shanghai Jiaotong University School of Medicine, Shanghai 20020 (China); Ding, Lan-Bao [Department of Nuclear Medicine, Shanghai 10th People' s Hospital, Tongji University School of Medicine, Shanghai 200072 (China); Zhou, Xi, E-mail: modelmap@139.com [Department of Respiratory Medicine, Luwan Branch of Ruijin Hospital, Shanghai Jiaotong University School of Medicine, Shanghai 20020 (China)
2015-10-09
The transcription factor forkhead box D3 (FOXD3), widely studied as a transcriptional repressor in embryogenesis, participates in the carcinogenesis of many cancers. However, the expression pattern and role of FOXD3 in non-small cell lung cancer (NSCLC) have not been well characterized. We report that FOXD3 is significantly downregulated in NSCLC cell lines and clinical tissues. FOXD3 overexpression significantly inhibits cell growth and results in G1 cell cycle arrest in NSCLC A549 and H1299 cells. In a xenograft tumor model, FOXD3 overexpression inhibits tumor growth and angiogenesis. Remarkably, expression of vascular endothelial growth factor (VEGF) was reduced in FOXD3 overexpression models both in vitro and in vivo. These findings suggest that FOXD3 plays a potential tumor suppressor role in NSCLC progression and represents a promising clinical prognostic marker and therapeutic target for this disease. - Highlights: • FOXD3 is downregulated in NSCLC cell lines and tissues. • FOXD3 overexpression inhibited cell proliferation in NSCLC cells. • FOXD3 overexpression led to decreased angiogenesis in NSCLC cells in vitro and in vivo.
DEFF Research Database (Denmark)
Kuhre, Rune Ehrenreich; Albrechtsen, Nicolai Jacob Wewer; Windeløv, Johanne Agerlin
2014-01-01
and whether this varied with the six different locations. We also analyzed the amidation in 3 GLP-1 secreting cell lines (GLUTag, NCI-H716 and STC-1). To our surprise there were marked differences between the 3 species with respect to the concentration of GLP-1 in gut. In the mouse, concentrations increased...... sites, whereas rats and pigs on average had around 2.5 and 4 times higher levels of amidated compared to non-amidated GLP-1, although the ratio varied depending upon the location. GLUTag, NCI-H716 and STC-1 cells all exhibited partial amidation with 2-4 times higher levels of amidated compared to non...
High NOTCH activity induces radiation resistance in non small cell lung cancer
International Nuclear Information System (INIS)
Theys, Jan; Yahyanejad, Sanaz; Habets, Roger; Span, Paul; Dubois, Ludwig; Paesmans, Kim; Kattenbeld, Bo; Cleutjens, Jack; Groot, Arjan J.; Schuurbiers, Olga C.J.; Lambin, Philippe; Bussink, Jan; Vooijs, Marc
2013-01-01
Background and purpose: Patients with advanced NSCLC have survival rates <15%. The NOTCH pathway plays an important role during lung development and physiology but is often deregulated in lung cancer, making it a potential therapeutic target. We investigated NOTCH signaling in NSCLC and hypothesized that high NOTCH activity contributes to radiation resistance. Materials and methods: NOTCH signaling in NSCLC patient samples was investigated using quantitative RT-PCR. H460 NSCLC cells with either high or blocked NOTCH activity were generated and their radiation sensitivity monitored using clonogenic assays. In vivo, xenograft tumors were irradiated and response assessed using growth delay. Microenvironmental parameters were analyzed by immunohistochemistry. Results: Patients with high NOTCH activity in tumors showed significantly worse disease-free survival. In vitro, NOTCH activity did not affect the proliferation or intrinsic radiosensitivity of NSCLC cells. In contrast, xenografts with blocked NOTCH activity grew slower than wild type tumors. Tumors with high NOTCH activity grew significantly faster, were more hypoxic and showed a radioresistant phenotype. Conclusions: We demonstrate an important role for NOTCH in tumor growth and correlate high NOTCH activity with poor prognosis and radioresistance. Blocking NOTCH activity in NSCLC might be a promising intervention to improve outcome after radiotherapy
Effect of cryoablation sequential chemotherapy on patients with advanced non-small cell lung cancer
Directory of Open Access Journals (Sweden)
Shu-Hui Yao
2016-03-01
Full Text Available Objective: To evaluate the effect of cryoablation sequential chemotherapy on patients with advanced non-small cell lung cancer. Methods: A total of 39 cases with advanced non-small cell lung cancer who received cryoablation sequential chemotherapy and 39 cases with advanced non-small cell lung cancer who received chemotherapy alone were selected and enrolled in sequential group and control group, disease progression and survival of two groups were followed up, and contents of tumor markers and angiogenesis molecules in serum as well as contents of T-lymphocyte subsets in peripheral blood were detected. Results: Progressionfree survival and median overall survival (mOS of sequential group were longer than those of control group, and cumulative cases of tumor progression at various points in time were significantly less than those of control group (P<0.05; 1 month after treatment, serum tumor markers CEA, CYFRA21-1 and NSE contents, serum angiogenesis molecules PCDGF, VEGF and HDGF contents as well as CD3+CD4-CD8+CD28-T cell content in peripheral blood of sequential group were significantly lower than those of control group (P<0.05, and contents of CD3+CD4+CD8-T cell and CD3+CD4-CD8+CD28+T cell in peripheral blood were higher than those of control group (P<0.05. Conclusions: Cryoablation sequential chemotherapy can improve the prognosis of patients with advanced non-small cell lung cancer, delay disease progression, prolong survival time, inhibit angiogenesis and improve immune function.
Proportion and clinical features of never-smokers with non-small cell lung cancer.
Cho, Jaeyoung; Choi, Sun Mi; Lee, Jinwoo; Lee, Chang-Hoon; Lee, Sang-Min; Kim, Dong-Wan; Yim, Jae-Joon; Kim, Young Tae; Yoo, Chul-Gyu; Kim, Young Whan; Han, Sung Koo; Park, Young Sik
2017-02-08
The proportion of never-smokers with non-small cell lung cancer (NSCLC) is increasing, but that in Korea has not been well addressed in a large population. We aimed to evaluate the proportion and clinical features of never-smokers with NSCLC in a large single institution. We analyzed clinical data of 1860 consecutive patients who were newly diagnosed with NSCLC between June 2011 and December 2014. Of the 1860 NSCLC patients, 707 (38.0%) were never-smokers. The proportions of women (83.7% vs. 5.6%) and adenocarcinoma (89.8% vs. 44.9%) were higher among never-smokers than among ever-smokers. Significantly more never-smokers were diagnosed at a younger median age (65 vs. 68 years, P smokers. Epidermal growth factor receptor mutations (57.8% vs. 24.4%, P never-smokers, whereas Kirsten rat sarcoma viral oncogene homolog mutations (5.8% vs. 9.6%, P = 0.021) were less frequently encountered in never-smokers than in ever-smokers. Never-smokers showed longer survival after adjusting for the favorable effects of younger age, female sex, adenocarcinoma histology, better performance status, early stage disease, being asymptomatic at diagnosis, received antitumor treatment, and the presence of driver mutations (hazard ratio, 0.624; 95% confidence interval, 0.460-0.848; P = 0.003). More than one-third of the Korean patients with NSCLC were never-smokers. NSCLC in never-smokers had different clinical characteristics and major driver mutations and resulted in longer overall survival compared with NSCLC in ever-smokers.
Recent advances in the treatment of non-small cell and small cell lung cancer.
Stinchcombe, Thomas E
2014-01-01
Recent presentations at the American Society of Clinical Oncology (ASCO) meeting from 30 May to 3 June, 2014, will impact routine clinical care and the development of clinical trials in non-small cell lung cancer (NSCLC) and extensive stage small cell lung cancer (ES-SCLC). Patients with activating epidermal growth factor receptor (EGFR) mutations, defined as exon 19 and exon 21 L858R point mutations, experience a high objective response rate and prolonged progression-free survival with EGFR tyrosine kinase inhibitors. However, inevitably, patients experience disease progression and the most common mechanism of acquired resistance is an EGFR exon 20 T790M mutation. Several agents (AZD9291, CO-1686 and HM61713) have demonstrated impressive activity in patients with T790M resistance mutations. Additional data on the efficacy of first-line therapy with afatinib and the combination of erlotinib and bevacizumab for patients with EGFR mutant NSCLC were presented. The results of a phase III trial of crizotinib compared to platinum-pemetrexed in the first-line setting, and a phase I trial and expansion cohort of ceritinib, provided additional efficacy and toxicity data for patients with anaplastic lymphoma kinase rearranged NSCLC. A phase III trial of cisplatin and gemcitabine, with and without necitumumab, revealed an improvement in overall survival with the addition of necitumumab in patients with squamous NSCLC. In the second-line setting, a phase III trial of docetaxel with ramucirumab or placebo revealed an improvement in overall survival with the addition of ramucirumab. In extensive stage small cell lung cancer phase III trials of consolidative thoracic radiation therapy and prophylactic cranial radiation failed to reveal an improvement in overall survival.
Radiotherapy for stage I-II non-small cell lung cancer
International Nuclear Information System (INIS)
Okamoto, Yoshiaki; Murakami, Masao; Mizowaki, Takashi; Nakajima, Toshifumi; Kuroda, Yasumasa
1999-01-01
Surgery has been regarded as the standard treatment for patients with non-small cell lung cancer in the early stage, while radiotherapy has become an effective alternative for medically inoperable patients and those who refuse surgery. We reviewed the records of 31 patients with stage I-II non-small cell lung cancer treated by radiotherapy between 1980 and 1997. There were 15 patients in stage I and 16 in stage II. The variables analyzed for influence on cause-specific survival and loco-regional control were: age, performance status, clinical stage, tumor size, tumor site, radiation field, radiation dose, and combination with chemotherapy. The overall and cause-specific 1-, 2-, 3-, and 5-years survival rates were 71% and 77%; 63% and 73%; 34% and 48%; and 17% and 32%, respectively. Five-year survival rate for patients with peripheral tumor in the lung was 72%, with 70% loco-regional control, while the 5-year survival rate of patients whose tumor originated in the central region was 20%, with 25% loco-regional control. These differences had marginal significance on univariate analysis (P=0.07), but only tumor site (central vs peripheral) showed marginal significant influence on cause-specific survival (P=0.08) and loco-regional control (P=0.07) on multivariate analysis. There were no fatal complications, including radiation-induced myelopathy. The present series showed satisfactory results with definitive radiotherapy for patients with medically inoperable stage I-II non-small cell lung cancer, with results similar to those in recent reports of radiotherapy. The only significant variable was that patients with peripheral tumors had a better prognosis than patients with central tumors. (author)
[Clinic significance of nm23, collage IV and PCNA expression in non-small cell lung cancer].
Yu, Q; Ma, L; Jing, S; Xu, Y; Geng, D
2001-12-20
To study the significance of nm23, collagen IV and PCNA expressions in non-small cell lung cancer. Expressions of the nm23, collagen IV and PCNA in 84 cases of non-small cell lung cancer were examined with SP immunohistochemical technique. Of the 84 cases, there were squamous cell carcinoma 42, adenocarcinoma 42, stage I 27, stage II 24, stage III 24, and stage IV 9. Statistical analysis was performed with Chi-Square test. Expressions of the nm23, collagen IV and PCNA in 84 cases of non-small cell lung cancer were 60. 7% ( 51/ 84) , 75. 0% ( 63/ 84) and 53. 6% ( 45/ 84) respectively. There was negative correlation between the lymph node metastasis and the expressions of nm23 and collagen IV in squamous cell carcinoma, and the expressions of collagen IV and PCNA were associated with tumor differentiation. No correlation was found between TNM stage and expressions of nm23, collagen IV and PCNA. The results indicate that nm23, collagen IV and PCNA participate the modulation of metastasis of non-small cell lung cancer and that they may be used to evaluate the potential of metastasis.
International Nuclear Information System (INIS)
Duan Weiming; Xu Yaxiang; Dong Yujin; Cao Lili; Tong Jian; Zhou Xinwen
2013-01-01
miR-34a is transcriptionally induced by the tumor suppressor gene p53, which is often downregulated in non-small cell lung cancer (NSCLC). To address whether the downstream signal of miR-34a is sufficient to induce apoptosis and to alter cellular radiosensitivity, a chemical synthetic miR-34a mimic was delivered into A549 and H1299 cells, with or without co-treatment of γ-irradiation. Results showed that ectopic expression of miR-34a induced dose-dependent cell growth inhibition and apoptosis in a p53-independent manner in both NSCLC cell lines. Interestingly, LyGDI was discovered as a new target gene of miR-34a, and downregulation of LyGDI promoted Rac1 activation and membrane translocation, resulting in cell apoptosis. Furthermore, restoration of miR-34a indirectly reduced cyclooxygenase-2 (COX-2) expression. Taken together, these results demonstrate that restoration of miR-34a expression enhances radiation-induced apoptosis, partly by suppressing the LyGDI signaling pathway, and miR-34a could possibly be used as a radiosensitizer for non-small cell lung cancer therapy. (author)
Directory of Open Access Journals (Sweden)
Kocdor H
2015-07-01
Full Text Available Hilal Kocdor,1,2 Halil Ates,1 Suleyman Aydin,3 Ruksan Cehreli,1 Firat Soyarat,2 Pinar Kemanli,2 Duygu Harmanci,2 Hakan Cengiz,2 Mehmet Ali Kocdor4 1Institute of Oncology, Dokuz Eylul University, 2Department of Molecular Medicine, Institute of Health Sciences, Dokuz Eylul University, Izmir Turkey; 3Department of Biochemistry, Firat University School of Medicine, Elazig, 4Department of Surgery, School of Medicine, Dokuz Eylul University, Izmir, Turkey Background: Exposure to exogenous zinc results in increased apoptosis, growth inhibition, and altered oxidative stress in cancer cells. Previous studies also suggested that zinc sensitizes some cancer cells to cytotoxic agents depending on the p53 status. Therefore, zinc supplementation may show anticancer efficacy solely and may increase docetaxel-induced cytotoxicity in non-small-cell lung cancer cells.Methods: Here, we report the effects of several concentrations of zinc combined with docetaxel on p53-wild-type (A549 and p53-null (H1299 cells. We evaluated cellular viability, apoptosis, and cell cycle progression as well as oxidative stress parameters, including superoxide dismutase, glutathione peroxidase, and malondialdehyde levels.Results: Zinc reduced the viability of A549 cells and increased the apoptotic response in both cell lines in a dose-dependent manner. Zinc also amplified the docetaxel effects and reduced its inhibitory concentration 50 (IC50 values. The superoxide dismutase levels increased in all treatment groups; however, glutathione peroxidase was slightly increased in the combination treatments. Zinc also caused malondialdehyde elevations at 50 µM and 100 µM.Conclusion: Zinc has anticancer efficacy against non-small-cell lung cancer cells in the presence of functionally active p53 and enhances docetaxel efficacy in both p53-wild-type and p53-deficient cancer cells. Keywords: lung cancer, zinc, docetaxel, A549, H1299
Role of Insulin-Like Growth Factor-1 Signaling Pathway in Cisplatin-Resistant Lung Cancer Cells
International Nuclear Information System (INIS)
Sun Yunguang; Zheng Siyuan; Torossian, Artour; Speirs, Christina K.; Schleicher, Stephen; Giacalone, Nicholas J.; Carbone, David P.; Zhao Zhongming; Lu Bo
2012-01-01
Purpose: The development of drug-resistant phenotypes has been a major obstacle to cisplatin use in non–small-cell lung cancer. We aimed to identify some of the molecular mechanisms that underlie cisplatin resistance using microarray expression analysis. Methods and Materials: H460 cells were treated with cisplatin. The differences between cisplatin-resistant lung cancer cells and parental H460 cells were studied using Western blot, MTS, and clonogenic assays, in vivo tumor implantation, and microarray analysis. The cisplatin-R cells were treated with human recombinant insulin-like growth factor (IGF) binding protein-3 and siRNA targeting IGF-1 receptor. Results: Cisplatin-R cells illustrated greater expression of the markers CD133 and aldehyde dehydrogenase, more rapid in vivo tumor growth, more resistance to cisplatin- and etoposide-induced apoptosis, and greater survival after treatment with cisplatin or radiation than the parental H460 cells. Also, cisplatin-R demonstrated decreased expression of insulin-like growth factor binding protein-3 and increased activation of IGF-1 receptor signaling compared with parental H460 cells in the presence of IGF-1. Human recombinant IGF binding protein-3 reversed cisplatin resistance in cisplatin-R cells and targeting of IGF-1 receptor using siRNA resulted in sensitization of cisplatin-R-cells to cisplatin and radiation. Conclusions: The IGF-1 signaling pathway contributes to cisplatin-R to cisplatin and radiation. Thus, this pathway represents a potential target for improved lung cancer response to treatment.
NCI-60 whole exome sequencing and pharmacological CellMiner analyses.
Directory of Open Access Journals (Sweden)
William C Reinhold
Full Text Available Exome sequencing provides unprecedented insights into cancer biology and pharmacological response. Here we assess these two parameters for the NCI-60, which is among the richest genomic and pharmacological publicly available cancer cell line databases. Homozygous genetic variants that putatively affect protein function were identified in 1,199 genes (approximately 6% of all genes. Variants that are either enriched or depleted compared to non-cancerous genomes, and thus may be influential in cancer progression and differential drug response were identified for 2,546 genes. Potential gene knockouts are made available. Assessment of cell line response to 19,940 compounds, including 110 FDA-approved drugs, reveals ≈80-fold range in resistance versus sensitivity response across cell lines. 103,422 gene variants were significantly correlated with at least one compound (at p<0.0002. These include genes of known pharmacological importance such as IGF1R, BRAF, RAD52, MTOR, STAT2 and TSC2 as well as a large number of candidate genes such as NOM1, TLL2, and XDH. We introduce two new web-based CellMiner applications that enable exploration of variant-to-compound relationships for a broad range of researchers, especially those without bioinformatics support. The first tool, "Genetic variant versus drug visualization", provides a visualization of significant correlations between drug activity-gene variant combinations. Examples are given for the known vemurafenib-BRAF, and novel ifosfamide-RAD52 pairings. The second, "Genetic variant summation" allows an assessment of cumulative genetic variations for up to 150 combined genes together; and is designed to identify the variant burden for molecular pathways or functional grouping of genes. An example of its use is provided for the EGFR-ERBB2 pathway gene variant data and the identification of correlated EGFR, ERBB2, MTOR, BRAF, MEK and ERK inhibitors. The new tools are implemented as an updated web-based Cell
Metabolic Response to NAD Depletion across Cell Lines Is Highly Variable.
Xiao, Yang; Kwong, Mandy; Daemen, Anneleen; Belvin, Marcia; Liang, Xiaorong; Hatzivassiliou, Georgia; O'Brien, Thomas
2016-01-01
Nicotinamide adenine dinucleotide (NAD) is a cofactor involved in a wide range of cellular metabolic processes and is a key metabolite required for tumor growth. NAMPT, nicotinamide phosphoribosyltransferase, which converts nicotinamide (NAM) to nicotinamide mononucleotide (NMN), the immediate precursor of NAD, is an attractive therapeutic target as inhibition of NAMPT reduces cellular NAD levels and inhibits tumor growth in vivo. However, there is limited understanding of the metabolic response to NAD depletion across cancer cell lines and whether all cell lines respond in a uniform manner. To explore this we selected two non-small cell lung carcinoma cell lines that are sensitive to the NAMPT inhibitor GNE-617 (A549, NCI-H1334), one that shows intermediate sensitivity (NCI-H441), and one that is insensitive (LC-KJ). Even though NAD was reduced in all cell lines there was surprising heterogeneity in their metabolic response. Both sensitive cell lines reduced glycolysis and levels of di- and tri-nucleotides and modestly increased oxidative phosphorylation, but they differed in their ability to combat oxidative stress. H1334 cells activated the stress kinase AMPK, whereas A549 cells were unable to activate AMPK as they contain a mutation in LKB1, which prevents activation of AMPK. However, A549 cells increased utilization of the Pentose Phosphate pathway (PPP) and had lower reactive oxygen species (ROS) levels than H1334 cells, indicating that A549 cells are better able to modulate an increase in oxidative stress. Inherent resistance of LC-KJ cells is associated with higher baseline levels of NADPH and a delayed reduction of NAD upon NAMPT inhibition. Our data reveals that cell lines show heterogeneous response to NAD depletion and that the underlying molecular and genetic framework in cells can influence the metabolic response to NAMPT inhibition.
Metabolic Response to NAD Depletion across Cell Lines Is Highly Variable.
Directory of Open Access Journals (Sweden)
Yang Xiao
Full Text Available Nicotinamide adenine dinucleotide (NAD is a cofactor involved in a wide range of cellular metabolic processes and is a key metabolite required for tumor growth. NAMPT, nicotinamide phosphoribosyltransferase, which converts nicotinamide (NAM to nicotinamide mononucleotide (NMN, the immediate precursor of NAD, is an attractive therapeutic target as inhibition of NAMPT reduces cellular NAD levels and inhibits tumor growth in vivo. However, there is limited understanding of the metabolic response to NAD depletion across cancer cell lines and whether all cell lines respond in a uniform manner. To explore this we selected two non-small cell lung carcinoma cell lines that are sensitive to the NAMPT inhibitor GNE-617 (A549, NCI-H1334, one that shows intermediate sensitivity (NCI-H441, and one that is insensitive (LC-KJ. Even though NAD was reduced in all cell lines there was surprising heterogeneity in their metabolic response. Both sensitive cell lines reduced glycolysis and levels of di- and tri-nucleotides and modestly increased oxidative phosphorylation, but they differed in their ability to combat oxidative stress. H1334 cells activated the stress kinase AMPK, whereas A549 cells were unable to activate AMPK as they contain a mutation in LKB1, which prevents activation of AMPK. However, A549 cells increased utilization of the Pentose Phosphate pathway (PPP and had lower reactive oxygen species (ROS levels than H1334 cells, indicating that A549 cells are better able to modulate an increase in oxidative stress. Inherent resistance of LC-KJ cells is associated with higher baseline levels of NADPH and a delayed reduction of NAD upon NAMPT inhibition. Our data reveals that cell lines show heterogeneous response to NAD depletion and that the underlying molecular and genetic framework in cells can influence the metabolic response to NAMPT inhibition.
Drug development for breast, colorectal, and non-small cell lung cancers from 1979 to 2014.
Nixon, Nancy A; Khan, Omar F; Imam, Hasiba; Tang, Patricia A; Monzon, Jose; Li, Haocheng; Sun, Gavin; Ezeife, Doreen; Parimi, Sunil; Dowden, Scot; Tam, Vincent C
2017-12-01
Understanding the drug development pathway is critical for streamlining the development of effective cancer treatments. The objective of the current study was to delineate the drug development timeline and attrition rate of different drug classes for common cancer disease sites. Drugs entering clinical trials for breast, colorectal, and non-small cell lung cancer were identified using a pharmaceutical business intelligence database. Data regarding drug characteristics, clinical trials, and approval dates were obtained from the database, clinical trial registries, PubMed, and regulatory Web sites. A total of 411 drugs met the inclusion criteria for breast cancer, 246 drugs met the inclusion criteria for colorectal cancer, and 315 drugs met the inclusion criteria for non-small cell lung cancer. Attrition rates were 83.9% for breast cancer, 87.0% for colorectal cancer, and 92.0% for non-small cell lung cancer drugs. In the case of non-small cell lung cancer, there was a trend toward higher attrition rates for targeted monoclonal antibodies compared with other agents. No tumor site-specific differences were noted with regard to cytotoxic chemotherapy, immunomodulatory, or small molecule kinase inhibitor drugs. Drugs classified as "others" in breast cancer had lower attrition rates, primarily due to the higher success of hormonal medications. Mean drug development times were 8.9 years for breast cancer, 6.7 years for colorectal cancer, and 6.6 years for non-small cell lung cancer. Overall oncologic drug attrition rates remain high, and drugs are more likely to fail in later-stage clinical trials. The refinement of early-phase trial design may permit the selection of drugs that are more likely to succeed in the phase 3 setting. Cancer 2017;123:4672-4679. © 2017 American Cancer Society. © 2017 American Cancer Society.
International Nuclear Information System (INIS)
Li, Yuexia; Li, Xiaohui; Liu, Gang; Sun, Rongqing; Wang, Lirui; Wang, Jing; Wang, Hongmin
2015-01-01
Highlights: • TIPE2 is down-regulated in NSCLC tissues. • TIPE2 inhibits NSCLC cell proliferation, colony formation and invasion. • TIPE2 reduces the anti-apoptotic Bcl-XL protein and mesenchymal marker N-cadherin expression. - Abstract: The present study aims to investigate the expression pattern of TIPE2 protein and its clinical significance in human non-small cell lung cancer (NSCLC). We investigated the expression levels of TIPE2 in 96 NSCLC tumor samples by immunohistochemistry and then analyzed its clinical significance. Furthermore, the role of TIPE2 on the biological properties of the NSCLC cell line H1299 and A549 was experimentally tested in vitro and in vivo. We found that the expression level of TIPE2 was significantly higher in normal lung tissues compared with NSCLC tissues (P < 0.001), and TIPE2 downregulation was significantly correlated with advanced TNM stage (P = 0.006). TIPE2 expression was lower in lung cancer cell lines than normal bronchial cell line HBE. Transfection of TIPE2 plasmid was performed in H1299 and A549 cells. TIPE2 overexpression inhibited lung cancer cell proliferation, colony formation and cell invasive in vitro, and prevented lung tumor growth in vivo. In addition, TIPE2 transfection reduced the anti-apoptotic Bcl-XL protein and mesenchymal marker N-cadherin expression. Taken together, our results demonstrate that TIPE2 might serve as a tumor suppressor in NSCLC progression
Energy Technology Data Exchange (ETDEWEB)
Li, Yuexia [Intensive Care Unit, The First Affiliated Hospital of Zhengzhou University, Zhengzhou, Henan 450052 (China); Li, Xiaohui [Department of Cardiovascular Surgery, Henan Provincial People’s Hospital, Zhengzhou, Henan 450003 (China); Liu, Gang; Sun, Rongqing; Wang, Lirui [Intensive Care Unit, The First Affiliated Hospital of Zhengzhou University, Zhengzhou, Henan 450052 (China); Wang, Jing, E-mail: jing_wang1980@163.com [Department of Respiratory Medicine, The First Affiliated Hospital of Zhengzhou University, Zhengzhou, Henan 450052 (China); Wang, Hongmin, E-mail: hmwangzz@126.com [Department of Respiratory Medicine, The First Affiliated Hospital of Zhengzhou University, Zhengzhou, Henan 450052 (China)
2015-01-30
Highlights: • TIPE2 is down-regulated in NSCLC tissues. • TIPE2 inhibits NSCLC cell proliferation, colony formation and invasion. • TIPE2 reduces the anti-apoptotic Bcl-XL protein and mesenchymal marker N-cadherin expression. - Abstract: The present study aims to investigate the expression pattern of TIPE2 protein and its clinical significance in human non-small cell lung cancer (NSCLC). We investigated the expression levels of TIPE2 in 96 NSCLC tumor samples by immunohistochemistry and then analyzed its clinical significance. Furthermore, the role of TIPE2 on the biological properties of the NSCLC cell line H1299 and A549 was experimentally tested in vitro and in vivo. We found that the expression level of TIPE2 was significantly higher in normal lung tissues compared with NSCLC tissues (P < 0.001), and TIPE2 downregulation was significantly correlated with advanced TNM stage (P = 0.006). TIPE2 expression was lower in lung cancer cell lines than normal bronchial cell line HBE. Transfection of TIPE2 plasmid was performed in H1299 and A549 cells. TIPE2 overexpression inhibited lung cancer cell proliferation, colony formation and cell invasive in vitro, and prevented lung tumor growth in vivo. In addition, TIPE2 transfection reduced the anti-apoptotic Bcl-XL protein and mesenchymal marker N-cadherin expression. Taken together, our results demonstrate that TIPE2 might serve as a tumor suppressor in NSCLC progression.
Absence of death receptor translocation into lipid rafts in acquired TRAIL-resistant NSCLC cells.
Ouyang, Wen; Yang, Chunxu; Zhang, Simin; Liu, Yu; Yang, Bo; Zhang, Junhong; Zhou, Fuxiang; Zhou, Yunfeng; Xie, Conghua
2013-02-01
Resistance to tumor necrosis factor-related apoptosis-inducing ligand (TRAIL) is a major limitation for its clinical use. The mechanisms of TRAIL resistance have been mostly studied in the context of cell lines that are intrinsically resistant to TRAIL. However, little is known about the molecular alterations that contribute to the development of acquired resistance during treatment with TRAIL. In this study, we established H460R, an isogenic cell line with acquired TRAIL resistance, from the TRAIL‑sensitive human lung cancer cell line H460 to investigate the mechanisms of acquired resistance. The acquired TRAIL‑resistant H460R cells remained sensitive to cisplatin. The mRNA and protein expression levels of death receptor 4 (DR4) and death receptor 5 (DR5) were not altered in either of the TRAIL-treated cell lines. Nevertheless, tests in which the DR4 or DR5 gene was overexpressed or silenced suggest that death receptor expression is necessary but not sufficient for TRAIL‑induced apoptosis. Compared with parental TRAIL-sensitive H460 cells, H460R cells showed a decreased TRAIL-induced translocation of DR4/DR5 into lipid rafts. Further studies showed that nystatin partially prevented lipid raft aggregation and DR4 and DR5 clustering and reduced apoptosis in H460 cells again. Analysis of apoptotic molecules showed that more pro-caspase-8, FADD, caspase-3 and Bid, but less cFLIP in H460 cells than in H460R cells. Our findings suggest that the lack of death receptor redistribution negatively impacts DISC assembly in lipid rafts, which at least partially leads to the development of acquired resistance to TRAIL in H460R cells.
Sobral, Filipa; Sampaio, Andreia; Falcão, Soraia; Queiroz, Maria João R P; Calhelha, Ricardo C; Vilas-Boas, Miguel; Ferreira, Isabel C F R
2016-08-01
Bee venom (BV) or apitoxin is a complex mixture of substances with reported biological activity. In the present work, five bee venom samples obtained from Apis mellifera iberiensis from the Northeast Portugal (two different apiaries) were chemically characterized and evaluated for their antioxidant, anti-inflammatory and cytotoxic properties. The LC/DAD/ESI-MS(n) analysis of the samples showed that melittin was the most abundant compound, followed by phospholipase A2 and apamin. All the samples revealed antioxidant and anti-inflammatory activity but without a direct relation with any of the individual chemical components identified. The results highlight that there are specific concentrations (present in BV5) in which these compounds are more active. The BV samples showed similar cytotoxicity for all the tested tumour cell lines (MCF-7, NCI-H460, HeLa and HepG2), being MCF-7 and HeLa the most susceptible ones. Nevertheless, the studied samples seem to be suitable to treat breast, hepatocellular and cervical carcinoma because at the active concentrations, the samples were not toxic for non-tumour cells (PLP2). Regarding the non-small cell lung carcinoma, BV should be used under the toxic concentration for non-tumour cells. Overall, the present study corroborates the enormous bioactive potential of BV being the first report on samples from Portugal. Copyright © 2016 Elsevier Ltd. All rights reserved.
Durvalumab: a potential maintenance therapy in surgery-ineligible non-small-cell lung cancer
Directory of Open Access Journals (Sweden)
Shafique MR
2018-05-01
Full Text Available Michael R Shafique, Lary A Robinson, Scott Antonia Department of Thoracic Oncology, H Lee Moffitt Cancer Center and Research Institute, Tampa, FL, USA Abstract: Lung cancer is the most common cancer worldwide and the most common cause of cancer-related death. Non-small-cell lung cancer comprises ~87% of newly diagnosed cases of lung cancer, and nearly one-third of these patients have stage III disease. Despite improvements in the treatment of stage IV lung cancer, particularly with the introduction and dissemination of checkpoint inhibitors, very little progress has been made in the treatment of stage III lung cancer. In this article, we discuss the general staging criteria and treatment options for stage III lung cancer. We review how concurrent radiation and chemotherapy can have immunomodulatory effects, supporting the rationale for incorporating immunotherapy into existing treatment paradigms. Finally, we discuss the results of the PACIFIC trial and implications for the treatment of stage III lung cancer. In the PACIFIC trial, adding durvalumab as a maintenance therapy following the completion of chemoradiotherapy improved progression-free survival in patients with locally advanced unresectable stage III lung cancer. On the strength of these results, durvalumab has been approved by the US Food and Drug Administration for use in this setting, representing the first advance in the treatment of stage III lung cancer in nearly a decade. Keywords: non-small-cell lung cancer, maintenance therapy, staging, immunotherapy, chemoradiation, surgery-ineligible, durvalumab
Tumourigenic non-small-cell lung cancer mesenchymal circulating tumour cells: a clinical case study
Morrow, C. J.; Trapani, F.; Metcalf, R. L.; Bertolini, G.; Hodgkinson, C. L.; Khandelwal, G.; Kelly, P.; Galvin, M.; Carter, L.; Simpson, K. L.; Williamson, S.; Wirth, C.; Simms, N.; Frankliln, L.; Frese, K. K.
2016-01-01
Background Over the past decade, numerous reports describe the generation and increasing utility of non-small-cell lung cancer (NSCLC) patient-derived xenografts (PDX) from tissue biopsies. While PDX have proven useful for genetic profiling and preclinical drug testing, the requirement of a tissue biopsy limits the available patient population, particularly those with advanced oligometastatic disease. Conversely, ?liquid biopsies? such as circulating tumour cells (CTCs) are minimally invasive...
Exosomes derived from mesenchymal non-small cell lung cancer cells promote chemoresistance.
Lobb, Richard J; van Amerongen, Rosa; Wiegmans, Adrian; Ham, Sunyoung; Larsen, Jill E; Möller, Andreas
2017-08-01
Non-small cell lung cancer (NSCLC) is the most common lung cancer type and the most common cause of mortality in lung cancer patients. NSCLC is often associated with resistance to chemotherapeutics and together with rapid metastatic spread, results in limited treatment options and poor patient survival. NSCLCs are heterogeneous, and consist of epithelial and mesenchymal NSCLC cells. Mesenchymal NSCLC cells are thought to be responsible for the chemoresistance phenotype, but if and how this phenotype can be transferred to other NSCLC cells is currently not known. We hypothesised that small extracellular vesicles, exosomes, secreted by mesenchymal NSCLC cells could potentially transfer the chemoresistance phenotype to surrounding epithelial NSCLC cells. To explore this possibility, we used a unique human bronchial epithelial cell (HBEC) model in which the parental cells were transformed from an epithelial to mesenchymal phenotype by introducing oncogenic alterations common in NSCLC. We found that exosomes derived from the oncogenically transformed, mesenchymal HBECs could transfer chemoresistance to the parental, epithelial HBECs and increase ZEB1 mRNA, a master EMT transcription factor, in the recipient cells. Additionally, we demonstrate that exosomes from mesenchymal, but not epithelial HBECs contain the ZEB1 mRNA, thereby providing a potential mechanism for the induction of a mesenchymal phenotype in recipient cells. Together, this work demonstrates for the first time that exosomes derived from mesenchymal, oncogenically transformed lung cells can transfer chemoresistance and mesenchymal phenotypes to recipient cells, likely via the transfer of ZEB1 mRNA in exosomes. © 2017 UICC.
This invention describes the discovery that specific p53 isoform increase the number of inducible pluripotent stem cells (iPS). It is known that the activity of p53 regulates the self-renewal and pluripotency of normal and cancer stem cells, and also affects re-programming efficiency of iPS cells. This p53 isoform-based technology provides a more natural process of increasing iPS cell production than previous methods of decreasing p53. NCI seeks licensees for this technology.
Potential role of immunotherapy in advanced non-small-cell lung cancer
Directory of Open Access Journals (Sweden)
de Mello RA
2016-12-01
Full Text Available Ramon Andrade de Mello,1–3 Ana Flávia Veloso,4 Paulo Esrom Catarina,4 Sara Nadine,5 Georgios Antoniou6 1Department of Biomedical Sciences and Medicine, University of Algarve, Faro, 2Faculty of Medicine, University of Porto, Porto, Portugal; 3Research Center, Cearense School of Oncology, Instituto do Câncer do Ceará, 4Oncology & Hematology League, School of Medicine, State University of Ceará (UECE, Fortaleza, Brazil; 5Instituto de Ciências Biomédicas Abel Salazar (ICBAS, University of Porto, Porto, Portugal; 6Department of Medical Oncology, The Royal Marsden NHS Foundation Trust, London, UK Abstract: Immuno checkpoint inhibitors have ushered in a new era with respect to the treatment of advanced non-small-cell lung cancer. Many patients are not suitable for treatment with epidermal growth factor receptor tyrosine kinase inhibitors (eg, gefitinib, erlotinib, and afatinib or with anaplastic lymphoma kinase inhibitors (eg, crizotinib and ceritinib. As a result, anti-PD-1/PD-L1 and CTLA-4 inhibitors may play a novel role in the improvement of outcomes in a metastatic setting. The regulation of immune surveillance, immunoediting, and immunoescape mechanisms may play an interesting role in this regard either alone or in combination with current drugs. Here, we discuss advances in immunotherapy for the treatment of metastatic non-small-cell lung cancer as well as future perspectives within this framework. Keywords: immunotherapy, non-small-cell lung cancer, nivolumab, pembrolizumab, ipilimumab, clinical trials, PD1, PDL1, CTLA4
Kaptein, Ad A.; Yamaoka, Kazue; Snoei, Lucia; Kobayashi, Kunihiko; Uchida, Yuka; van der Kloot, Willem A.; Tabei, Toshio; Kleijn, Wim Chr; Koster, Mariska; Wijnands, Giel; Kaajan, Hans; Tran, Tommy; Inoue, Kenichi; van Klink, Rik; van Dooren-Coppens, Eva; Dik, Hans; Hayashi, Fumi; Willems, Luuk; Annema-Schmidt, Dunja; Annema, Jouke; van der Maat, Bas; van Kralingen, Klaas; Meirink, Corrie; Ogoshi, Kyoji; Aaronson, Neil; Nortier, Hans; Rabe, Klaus
2011-01-01
This study examined quality of life (QOL) and illness perceptions in Dutch and Japanese patients with non-small-cell lung cancer, thereby extending the body of knowledge on cultural differences and psychosocial aspects of this illness. 24 Dutch and 22 Japanese patients with non-small-cell lung
HIF-1α effects on angiogenic potential in human small cell lung carcinoma
Directory of Open Access Journals (Sweden)
Xia Wanli
2011-08-01
Full Text Available Abstract Background Hypoxia-inducible factor-1 alpha (HIF-1α maybe an important regulatory factor for angiogenesis of small cell lung cancer (SCLC. Our study aimed to investigate the effect of HIF-1α on angiogenic potential of SCLC including two points: One is the effect of HIF-1α on the angiogenesis of SCLC in vivo. The other is the regulation of angiogenic genes by HIF-1α in vitro and in vivo. Methods In vivo we used an alternative method to study the effect of HIF-1a on angiogenic potential of SCLC by buliding NCI-H446 cell transplantation tumor on the chick embryo chorioallantoic membrane (CAM surface. In vitro we used microarray to screen out the angiogenic genes regulated by HIF-1a and tested their expression level in CAM transplantation tumor by RT-PCR and Western-blot analysis. Results In vivo angiogenic response surrounding the SCLC transplantation tumors in chick embryo chorioallantoic membrane (CAM was promoted after exogenous HIF-1α transduction (p In vitro the changes of angiogenic genes expression induced by HIF-1α in NCI-H446 cells were analyzed by cDNA microarray experiments. HIF-1α upregulated the expression of angiogenic genes VEGF-A, TNFAIP6, PDGFC, FN1, MMP28, MMP14 to 6.76-, 6.69-, 2.26-, 2.31-, 4.39-, 2.97- fold respectively and glycolytic genes GLUT1, GLUT2 to2.98-, 3.74- fold respectively. In addition, the expression of these angiogenic factors were also upregulated by HIF-1α in the transplantion tumors in CAM as RT-PCR and Western-blot analysis indicated. Conclusions These results indicated that HIF-1α may enhance the angiogenic potential of SCLC by regulating some angiogenic genes such as VEGF-A, MMP28 etc. Therefore, HIF-1α may be a potential target for the gene targeted therapy of SCLC.
Directory of Open Access Journals (Sweden)
Deyan N. Davidov
2013-04-01
Full Text Available Objective: Single agent Docetaxel is a standard therapy for patients with non- small cell lung cancer after the failure of platinum- containing regimens. The aim of this study was to explore the efficacy and safety of Docetaxel monotherapy as second- line chemotherapy in pretreated patient with inoperable non- small cell lung cancer. Methods: From January 2005 to May 2008 thirty- six consecutive patients with locally advanced or metastatic morphologically proven stage IIIB/ IV non- small cell lung cancer entered the study after failure of previous platinum- based regimens. Treatment schedule consist of Docetaxel 75 mg/m2 administered every three weeks with repetition after 21 days with Dexamethasone premedication. Results: Overall response rate, median time to progression and median survival was 16,6 %, 4,5 months and 5,6 months respectively. The main hematological toxicity was neutropenia. Conclusions: That data suggest that single agent Docetaxel remain reasonable choices for the chemotherapy in pretreated patients with non- small cell lung cancer.
Epigenetic silencing of MicroRNA-503 regulates FANCA expression in non-small cell lung cancer cell.
Li, Ning; Zhang, Fangfang; Li, Suyun; Zhou, Suzhen
2014-02-21
It is reported that MicroRNA-503 (miR-503) regulates cell apoptosis, and thus modulates the resistance of non-small cell lung cancer cells (NSCLC) to cisplatin. However, the exact role of miR-503 in NSCLC remains unknown. In the present study, the level of miR-503 expression in NSCLC was evaluated using realtime PCR, and the DNA methylation status within miR-503 promoter was analyzed by Combined Bisulfite Restriction Analysis (COBRA) or bisulfite-treated DNA sequencing assays (BSP). We found that the expression of miR-503 was significantly decreased in NSCLC tissues compared to normal tissues. A statistically significant inverse association was found between miR-503 methylation status and expression of the miR-503 in tumor tissues (PFANCA) gene and represses its expression at the transcriptional level. Taken together, our results suggest that miR-503 regulates the resistance of non-small cell lung cancer cells to cisplatin at least in part by targeting FANCA. Copyright © 2014 Elsevier Inc. All rights reserved.
Enhanced Missing Proteins Detection in NCI60 Cell Lines Using an Integrative Search Engine Approach.
Guruceaga, Elizabeth; Garin-Muga, Alba; Prieto, Gorka; Bejarano, Bartolomé; Marcilla, Miguel; Marín-Vicente, Consuelo; Perez-Riverol, Yasset; Casal, J Ignacio; Vizcaíno, Juan Antonio; Corrales, Fernando J; Segura, Victor
2017-12-01
The Human Proteome Project (HPP) aims deciphering the complete map of the human proteome. In the past few years, significant efforts of the HPP teams have been dedicated to the experimental detection of the missing proteins, which lack reliable mass spectrometry evidence of their existence. In this endeavor, an in depth analysis of shotgun experiments might represent a valuable resource to select a biological matrix in design validation experiments. In this work, we used all the proteomic experiments from the NCI60 cell lines and applied an integrative approach based on the results obtained from Comet, Mascot, OMSSA, and X!Tandem. This workflow benefits from the complementarity of these search engines to increase the proteome coverage. Five missing proteins C-HPP guidelines compliant were identified, although further validation is needed. Moreover, 165 missing proteins were detected with only one unique peptide, and their functional analysis supported their participation in cellular pathways as was also proposed in other studies. Finally, we performed a combined analysis of the gene expression levels and the proteomic identifications from the common cell lines between the NCI60 and the CCLE project to suggest alternatives for further validation of missing protein observations.
Directory of Open Access Journals (Sweden)
Jun Ma
2015-08-01
Full Text Available Background/Aims: Non-small cell lung carcinoma (NSCLC is the most common type of lung cancer and the cause of most cancer-related deaths. The molecular mechanisms that are involved in NSCLC development are currently not well understood. Accumulating evidence shows that histone demethylases play important roles in the regulation of pathological developmental processes in many diseases, including various types of cancers. Methods: Mitochondrial membrane potential assays, migration and invasion assays, caspase-3 and caspase-9 activity assays and western blot analysis were used in this research. Results: We found that overexpression of KDM6B, a demethylase that acts on histone H3 at lysine 27 (H3K27, inhibited cell growth by initiating mitochondria-dependent apoptosis and by attenuating the invasion-metastasis cascade in NSCLC cells. Moreover, our results showed that KDM6B directly interacted with FOXO1 and that overexpression of KDM6B promoted nuclear accumulation of FOXO1. The effects of KDM6B on cell apoptosis and metastasis were weakened by knockdown of FOXO1 expression. On the contrary, knocking down expression of KDM6B inhibited cell apoptosis and promoted cell growth by mitigating the nuclear translocation of FOXO1 in NSCLC cells. Conclusions: These findings suggest that KDM6B may act in a pro-apoptotic role in NSCLC by causing the nuclear translocation of FOXO1.
Colon cancer proliferating desulfosinigrin in wasabi (Wasabia japonica).
Weil, Marvin J; Zhang, Yanjun; Nair, Muraleedharan G
2004-01-01
A reduced incidence of different types of cancer has been linked to consumption of Brassica vegetables, and there is evidence that glucosinolates (GSLs) and their hydrolysis products play a role in reducing cancer risk. Wasabi (Wasabia japonica) and horseradish (Armoracia rusticana), both Brassica vegetables, are widely used condiments both in Japanese cuisine and in the United States. Desulfosinigrin (DSS) (1) was isolated from a commercially available wasabi powder and from fresh wasabi roots. Sinigrin (2) was isolated from horseradish roots. DSS and sinigrin were evaluated for their inhibitory effects on cyclooxygenase-1 (COX-1) and cyclooxygenase-2 (COX-2) enzymes, on lipid peroxidation, and on the proliferation of human colon (HCT-116), breast (MCF-7), lung (NCIH460), and central nervous system (CNS, SF-268) cancer cell lines. DSS did not inhibit COX enzymes or lipid peroxidation at 250 microg/ml. Sinigrin inhibited lipid peroxidation by 71% at 250 microg/ml. However, DSS promoted the growth of HCT-116 (colon) and NCI H460 (lung) human cancer cells as determined by the MTT assay in a concentration-dependent manner. At 3.72 microg/ml, a 27% increase in the number of viable human HCT-116 colon cancer cells was observed; the corresponding increases at 7.50 and 15 microg/ml were 42 and 69%, respectively. At 60 microg/ml, DSS doubled the number of HCT-16 colon cancer cells. For NCI H460 human lung cancer cells, DSS at 60 microg/ml increased the cell number by 20%. Sinigrin showed no proliferating effect on the tumor cells tested. This is the first report of the tumor cell-proliferating activity by a desulfoglucosinolate, the biosynthetic precursor of GSLs found in Brassica spp.
DEFF Research Database (Denmark)
Pappot, H.; Pfeiffer, P.; Grøndahl Hansen, J.
1997-01-01
Spreading of cancer cells is dependent on the combined action of several proteolytic enzymes, such as serine proteases, comprising the urokinase pathway of plasminogen activation. Previous studies of lung cancer indicate that expression, localization and prognostic impact of the components...... of the plasminogen activation system differ in the different non-small cell lung cancer (NSCLC) types, whereas the expression of the components in small cell lung cancer (SCLC) has only sparingly been investigated. In the present study we investigate the presence of the components of the plasminogen activation...... that the plasminogen activation system could play a role in this type of cancer during invasion. In addition a difference in the levels of the components of the plasminogen activation system in NSCLC and SCLC is found, which could contribute to the differences in biology....
[Overexpression of liver kinase B1 inhibits the proliferation of lung cancer cells].
Li, Yang; Zhang, Libin; Wang, Ping
2017-01-01
Objective To explore the effect of overexpressed liver kinase B1(LKB1) on the proliferation of lung cancer cell lines. Methods The expression levels of LKB1 and PTEN in A549, NCI-H23, NCI-H157, XWLC-05, NCI-H446 lung cancer cells were detected by immunocytochemistry (ICC) and Western blotting. Plasmid pcDNA3.1 + -LKB1 and empty vector pcDNA3.1 + -null were separately transfected into the above five cell lines, and then the expression of LKB1 mRNA and protein were determined by quantitative real-time PCR and Western blotting, respectively. Finally, CCK-8 assay was used to analyze the proliferation ability of the transfected cells. Results LKB1 and PTEN were positive in NCI-H23 cells; LKB1 was negative while PTEN was positive in A549 and NCI-H446 cells; both LKB1 and PTEN were negative in NCI-H157 and XWLC-05 cells. Quantitative real-time PCR and Western blotting showed that the expression level of LKB1 significantly increased in the above cell lines transfected with plasmid pcDNA3.1 + -LKB1 compared with the ones with empty vector pcDNA3.1 + -null. Besides, CCK-8 assay showed that the overexpression of LKB1 in the lung cancer cells transfected with pcDNA3.1 + -LKB1 had an obvious inhibitory effect on cell proliferation. Conclusion The expression of LKB1 is down-regulated in most of the lung cell lines to different extent and the over-expression of LKB1 can remarkably inhibit the proliferation ability of lung cancer cell lines.
Effects of concomitant cisplatin and radiotherapy on inoperable non-small-cell lung cancer
Schaake-Koning, C.; van den Bogaert, W.; Dalesio, O.; Festen, J.; Hoogenhout, J.; van Houtte, P.; Kirkpatrick, A.; Koolen, M.; Maat, B.; Nijs, A.
1992-01-01
BACKGROUND AND METHODS: Cisplatin (cis-diamminedichloroplatinum) has been reported to enhance the cell-killing effect of radiation, an effect whose intensity varies with the schedule of administration. We randomly assigned 331 patients with nonmetastatic inoperable non-small-cell lung cancer to one
Analysis of the EGFR gene mutation in patients with non- small cell ...
African Journals Online (AJOL)
Tropical Journal of Pharmaceutical Research August 2016; 15 (8): 1637-1641 ... Keywords: Non-small cell lung cancer, Epidermal growth factor receptor (EGFR), Targeted therapy, ... inhibitors can be identified by molecular analysis of lung ...
Directory of Open Access Journals (Sweden)
Zhang-Hua Sun
2015-12-01
Full Text Available Four new meroterpenoids, guignardones P–S (1–4, and three known analogues (5–7 were isolated from the endophytic fungal strain Guignardia mangiferae A348. Their structures were elucidated on the basis of spectroscopic analysis and single crystal X-ray diffraction. All the isolated compounds were evaluated for their inhibitory effects on SF-268, MCF-7, and NCI-H460 human cancer cell lines. Compounds 2 and 4 exhibited weak inhibitions of cell proliferation against MCF-7 cell line.
Directory of Open Access Journals (Sweden)
Feng Wen
2017-07-01
Full Text Available Objective: To explore effect of Pemetrexed combined with cis-platinum chemotherapy on matrix metalloproteinase (MMPs, vascular esandothelial growth factor (VEGF, NK cells and immune function in patients with non-squamous non-small cell lung cancer. Method: A total of 86 cases of non-squamous non-small cell lung cancer patients were divided into control group (n=44 and observation group (n=42, control group was given docetaxel combined cisplatinum chemotherapy, pemetrexed combined cis-platinum chemotherapy, was applied for observation group. Compared MMP-2, MMP-9, VEGF, NK cells and immune function level before and after treatment in both groups. Results: MMP-2, MMP-9, VEGF, NK cells, CD3+, CD4+, CD8+, CD4+/CD8+ level in both groups before treatment was no significant difference. After treatment, MMP-2, MMP-9, VEGF, CD8+level in both groups was significant lower than before treatment intra-group, and observation was lower than control group, there was significant difference. After treatment, NK cells, CD3+, CD4+, CD8+, CD4+/CD8+ level in both groups was increased dramatically than before treatment of intra-group, moreover, NK cells, CD3+, CD4+, CD8+, CD4+/CD8+level in observation group after treatment was obvious higher than in control group after treatment, there was significant difference. Conclusion: Pemetrexed combined with cis-platinum chemotherapy for non-squamous non-small cell lung cancer could effectively decrease serum MMPs, VEGF level and increase NK cell level, regulate immune function, with definite clinical significance.
Directory of Open Access Journals (Sweden)
Wang HY
2016-05-01
Full Text Available Hsian-Yu Wang,1,2 Min-Kung Hsu,3,4 Kai-Hsuan Wang,1 Ching-Ping Tseng,2,4 Feng-Chi Chen,3,4 John T-A Hsu1,4 1Institute of Biotechnology and Pharmaceutical Research, National Health Research Institutes (NHRI, Zhunan, Miaoli County, 2Institute of Molecular Medicine and Bioengineering, National Chiao Tung University (NCTU, Hsinchu, 3Division of Biostatistics and Bioinformatics, Institute of Population Health Sciences, National Health Research Institutes (NHRI, Zhunan, Miaoli County, 4Department of Biological Science and Technology, National Chiao Tung University (NCTU, Hsinchu, Taiwan, Republic of China Background: Epidermal growth factor receptor (EGFR tyrosine kinase inhibitors (TKIs, such as gefitinib, erlotinib, and afatinib, have greatly improved treatment efficacy in non-small cell lung cancer (NSCLC patients with drug-sensitive EGFR mutations. However, in some TKI responders, the benefits of such targeted therapies are limited by the rapid development of resistance, and strategies to overcome this resistance are urgently needed. Studies of drug resistance in cancer cells typically involve long term in vitro induction to obtain stably acquired drug-resistant cells followed by elucidation of resistance mechanisms, but the immediate responses of cancer cells upon drug treatment have been ignored. The aim of this study was to investigate the immediate responses of NSCLC cells upon treatment with EGFR TKIs.Results: Both NSCLC cells, ie, PC9 and H1975, showed immediate enhanced adhesion-related responses as an apoptosis-countering mechanism upon first-time TKI treatment. By gene expression and pathway analysis, adhesion-related pathways were enriched in gefitinib-treated PC9 cells. Pathway inhibition by small-hairpin RNAs or small-molecule drugs revealed that within hours of EGFR TKI treatment, NSCLC cells used adhesion-related responses to combat the drugs. Importantly, we show here that the Src family inhibitor, dasatinib, dramatically inhibits
Non-small cell lung cancer in never smokers: a clinical entity to be identified.
Santoro, Ilka Lopes; Ramos, Roberta Pulcheri; Franceschini, Juliana; Jamnik, Sergio; Fernandes, Ana Luisa Godoy
2011-01-01
It has been recognized that patients with non-small cell lung cancer who are lifelong never-smokers constitute a distinct clinical entity. The aim of this study was to assess clinical risk factors for survival among never-smokers with non-small cell lung cancer. All consecutive non-small cell lung cancer patients diagnosed (n = 285) between May 2005 and May 2009 were included. The clinical characteristics of never-smokers and ever-smokers (former and current) were compared using chi-squared or Student's t tests. Survival curves were calculated using the Kaplan-Meier method, and log-rank tests were used for survival comparisons. A Cox proportional hazards regression analysis was evaluated by adjusting for age (continuous variable), gender (female vs. male), smoking status (never- vs. ever-smoker), the Karnofsky Performance Status Scale (continuous variable), histological type (adenocarcinoma vs. non-adenocarcinoma), AJCC staging (early vs. advanced staging), and treatment (chemotherapy and/or radiotherapy vs. the best treatment support). Of the 285 non-small cell lung cancer patients, 56 patients were never-smokers. Univariate analyses indicated that the never-smoker patients were more likely to be female (68% vs. 32%) and have adenocarcinoma (70% vs. 51%). Overall median survival was 15.7 months (95% CI: 13.2 to 18.2). The never-smoker patients had a better survival rate than their counterpart, the ever-smokers. Never-smoker status, higher Karnofsky Performance Status, early staging, and treatment were independent and favorable prognostic factors for survival after adjusting for age, gender, and adenocarcinoma in multivariate analysis. Epidemiological differences exist between never- and ever-smokers with lung cancer. Overall survival among never-smokers was found to be higher and independent of gender and histological type.
MiR-122 Induces Radiosensitization in Non-Small Cell Lung Cancer Cell Line
Directory of Open Access Journals (Sweden)
Debin Ma
2015-09-01
Full Text Available MiR-122 is a novel tumor suppresser and its expression induces cell cycle arrest, or apoptosis, and inhibits cell proliferation in multiple cancer cells, including non-small cell lung cancer (NSCLC cells. Radioresistance of cancer cell leads to the major drawback of radiotherapy for NSCLC and the induction of radiosensitization could be a useful strategy to fix this problem. The present work investigates the function of miR-122 in inducing radiosensitization in A549 cell, a type of NSCLC cells. MiR-122 induces the radiosensitization of A549 cells. MiR-122 also boosts the inhibitory activity of ionizing radiation (IR on cancer cell anchor-independent growth and invasion. Moreover, miR-122 reduced the expression of its targeted genes related to tumor-survival or cellular stress response. These results indicate that miR-122 would be a novel strategy for NSCLC radiation-therapy.
Approach for oligometastasis in non-small cell lung cancer.
Suzuki, Hidemi; Yoshino, Ichiro
2016-04-01
Non-small cell lung cancer (NSCLC) harboring a limited number of distant metastases, referred to as the oligometastatic state, has been indicated for surgery for the past several decades. However, whether the strategy of surgical treatment results in a survival benefit for such patients remains controversial. Experientially, however, thoracic surgeons often encounter long-term survivors among surgically resected oligometastatic NSCLC patients. In this article, the current situation of surgical approach and potential future perspective for oligometastatic NSCLC are reviewed.
2017-10-16
Caregiver; Psychological Impact of Cancer and Its Treatment; Recurrent Non-small Cell Lung Cancer; Stage IIA Non-small Cell Lung Cancer; Stage IIB Non-small Cell Lung Cancer; Stage IIIA Non-small Cell Lung Cancer; Stage IIIB Non-small Cell Lung Cancer; Stage IV Non-small Cell Lung Cancer
Ashwin, Bosco Christin Maria Arputham; Sivaraman, Gandhi; Stalin, Thambusamy; Yuvakkumar, Rathinam; Muthu Mareeswaran, Paulpandian
2018-05-03
The efficient fluorescent property of coumarin 460 (C460) is utilized to sense the Pd 2+ selectively and sensitively. Fabrication of a sensor strip using commercial adhesive tape is achieved and the detection of Pd 2+ is attempted using a handy UV torch. The naked eye detection in solution state using UV chamber is also attempted. The calculated high binding constant values support the strong stable complex formation of Pd 2+ with C460. The detection limit up to 2.5 × 10 -7 M is achieved using fluorescence spectrometer, which is considerably low from the WHO's recommendation. The response of coumarin 460 with various cations also studied. The quenching is further studied by the lifetime measurements. The binding mechanism is clearly explained by the 1 H NMR titration. The sensing mechanism is established as ICT. C460 strip's Pd 2+ quenching detection is further confirmed by solid-state PL study. The in-vitro response of Pd 2+ in a living cell is also studied using fluorescent imaging studies by means of HeLa cell lines and this probe is very compatible with biological environments. It could be applicable to sense trace amounts of a Pd 2+ ion from various industries. Compared with previous reports, this one is very cheap, sensitive, selective and suitable for biological systems. Copyright © 2018 Elsevier B.V. All rights reserved.
Antibody guided targeting of non-small cell lung cancer using 111In-labeled HMFG1 F(ab')2 fragments
International Nuclear Information System (INIS)
Kalofonos, H.P.; Sivolapenko, G.B.; Courtenay-Luck, N.S.
1988-01-01
Immunoscintigraphy using F(ab')2 fragments of tumor-associated monoclonal antibody HMFG1 was performed in 14 patients with primary and metastatic non-small cell carcinoma of lung cancer. The antibody was conjugated with diethylenetriamine pentaacetic acid and labeled with 111 In. Quality control studies showed efficient incorporation of 111 In onto antibody (5 mCi/mg), no significant loss of immunoreactivity, and in vitro and in vivo stability. The optimal time for imaging was between 48 and 72 h. Following i.v. administration, serum activity fell rapidly (t1/2a = 2.5 +/- 1.3 (SD) h; t1/2b = 42 +/- 4.5 h). The majority of the radioactivity was associated with the plasma and not with the blood cells. All patients had a significant concentration of 111 In in the liver (approximately 20% of the injected dose, 48 h postadministration). No toxicity was encountered. No human antimurine-IgG antibody was detected in any of the patients within 4 months of follow-up, even in patients receiving two administrations of F(ab')2 fragments. Localization of all primary lesions and the majority (80%) of metastatic lesions was achieved. Seven of 14 patients were also studied using a 111 In-labeled nonspecific antibody (Fab')2 fragment (4C4). In three patients the specificity index was higher than the other four (P less than 0.05). We conclude that although successful targeting of 111 In-labeled (Fab')2 fragments of HMFG1 can be achieved in patients with non-small cell carcinoma of lung, observable tumor localization can also be achieved using a nonspecific antibody
Ayako Tsuchiya; Yoshiko Kaku; Takashi Nakano; Tomoyuki Nishizaki
2015-01-01
1,2-Diarachidonoyl-sn-glycero-3-phosphoethanolamine (DAPE) induces both necrosis/necroptosis and apoptosis of NCI-H28 malignant pleural mesothelioma (MPM) cells. The present study was conducted to understand the mechanism for DAPE-induced apoptosis of NCI-H28 cells. DAPE induced caspase-independent apoptosis of NCI-H28 malignant pleural mesothelioma (MPM) cells, and the effect of DAPE was prevented by antioxidants or an inhibitor of NADPH oxidase (NOX). DAPE generated reactive oxygen species ...
Oligometastatic non-small-cell lung cancer: current treatment strategies
Directory of Open Access Journals (Sweden)
Richard PJ
2016-11-01
Full Text Available Patrick J Richard, Ramesh Rengan Department of Radiation Oncology, University of Washington, Seattle, WA, USA Abstract: The oligometastatic disease theory was initially described in 1995 by Hellman and Weichselbaum. Since then, much work has been performed to investigate its existence in many solid tumors. This has led to subclassifications of stage IV cancer, which could redefine our treatment approaches and the therapeutic outcomes for this historically “incurable” entity. With a high incidence of stage IV disease, non-small-cell lung cancer (NSCLC remains a difficult cancer to treat and cure. Recent work has proven the existence of an oligometastatic state in NSCLC in terms of properly selecting patients who may benefit from aggressive therapy and experience long-term overall survival. This review discusses the current treatment approaches used in oligometastatic NSCLC and provides the evidence and rationale for each approach. The prognostic factors of many trials are discussed, which can be used to properly select patients for aggressive treatment regimens. Future advances in both molecular profiling of NSCLC to find targetable mutations and investigating patient selection may increase the number of patients diagnosed with oligometastatic NSCLC. As this disease entity increases, it is of utmost importance for oncologists treating NSCLC to be aware of the current treatment strategies that exist and the potential advantages/disadvantages of each. Keywords: oligometastatic, non-small-cell lung cancer, oligoprogressive, treatment
Qiao, Tiankui; Zhou, Daoan; Chen, Wei; Wang, Xianglian
2004-12-20
To observe the effects of MVP chemotherapy combined with concurrent radiotherapy for stage IIIB-IV non-small cell lung cancer. Sixty-two patients with stage IIIB-IV non-small cell lung cancer were randomized into two groups, concurrent radiochemotherapy group and MVP che-motherapy group. All patients in two groups were treated with MVP regimen (mitomycin C 6 mg/m² on day 1, vindesine 2 mg/m² on days 1, 8, and cisplatin 80-100 mg/m²). Patients in concurrent radiochemotherapy group received concurrent radiotherapy (46-56 Gy in 5-6 weeks). All patients received 2-4 cycles of MVP chemotherapy. The response rate was 48.4% and 19.4% in concurrent radiochemotherapy group and MVP group respectively (P MVP group.. The results show that efficacy of MVP chemotherapy combined with concurrent radiotherapy is significantly higher than that of MVP chemotherapy alone for advanced non-small cell lung cancer.
Non-small cell lung cancer in never smokers: a clinical entity to be identified
Directory of Open Access Journals (Sweden)
Ilka Lopes Santoro
2011-01-01
Full Text Available OBJECTIVES: It has been recognized that patients with non-small cell lung cancer who are lifelong never-smokers constitute a distinct clinical entity. The aim of this study was to assess clinical risk factors for survival among neversmokers with non-small cell lung cancer. METHODS: All consecutive non-small cell lung cancer patients diagnosed (n = 285 between May 2005 and May 2009 were included. The clinical characteristics of never-smokers and ever-smokers (former and current were compared using chi-squared or Student's t tests. Survival curves were calculated using the Kaplan-Meier method, and log-rank tests were used for survival comparisons. A Cox proportional hazards regression analysis was evaluated by adjusting for age (continuous variable, gender (female vs. male, smoking status (never- vs. ever-smoker, the Karnofsky Performance Status Scale (continuous variable, histological type (adenocarcinoma vs. non-adenocarcinoma, AJCC staging (early vs. advanced staging, and treatment (chemotherapy and/or radiotherapy vs. the best treatment support. RESULTS: Of the 285 non-small cell lung cancer patients, 56 patients were never-smokers. Univariate analyses indicated that the never-smoker patients were more likely to be female (68% vs. 32% and have adenocarcinoma (70% vs. 51%. Overall median survival was 15.7 months (95% CI: 13.2 to 18.2. The never-smoker patients had a better survival rate than their counterpart, the ever-smokers. Never-smoker status, higher Karnofsky Performance Status, early staging, and treatment were independent and favorable prognostic factors for survival after adjusting for age, gender, and adenocarcinoma in multivariate analysis. CONCLUSIONS: Epidemiological differences exist between never- and ever-smokers with lung cancer. Overall survival among never-smokers was found to be higher and independent of gender and histological type.
Nintedanib plus docetaxel as second-line therapy in patients with non-small-cell lung cancer
DEFF Research Database (Denmark)
Popat, Sanjay; Mellemgaard, Anders; Fahrbach, Kyle
2015-01-01
BACKGROUND: Nintedanib plus docetaxel has proven an overall survival benefit over docetaxel monotherapy in second-line treatment of non-small-cell lung cancer of adenocarcinoma histology in the LUME-Lung 1 pivotal trial. No published trials have previously compared nintedanib plus docetaxel...... with advanced non-small-cell lung cancer of adenocarcinoma histology, results suggest that nintedanib plus docetaxel offers clinical benefit compared with docetaxel alone, when used as second-line treatment, and suggests that this combination may also add clinical benefit compared with erlotinib in this patient...
Pemetrexed in maintenance treatment of advanced non-squamous non-small-cell lung cancer
Directory of Open Access Journals (Sweden)
Minami S
2015-01-01
Full Text Available Seigo Minami,1 Takashi Kijima2 1Department of Respiratory Medicine, Osaka Police Hospital, 2Department of Respiratory Medicine, Allergy and Rheumatic Diseases, Osaka University Graduate School of Medicine, Osaka, Japan Abstract: Pemetrexed, a multitargeting antifolate cytotoxic drug, plays a leading role in front-line chemotherapy for patients with advanced non-squamous non-small-cell lung cancer (NSCLC. Following its approval as second-line monotherapy for locally advanced or metastatic non-squamous NSCLC, pemetrexed has established itself as the first-line regimen in combination with cisplatin, and its powerful antitumor effects and less cumulative toxicities were then taken advantage of in the JMEN and PARAMOUNT trials, respectively, to pioneer a new treatment strategy of switch and continuation maintenance monotherapy. These developments have brought about a marked paradigm shift, and made pemetrexed indispensable in the treatment for non-squamous NSCLC. So far, only three drugs have been approved for maintenance therapy; pemetrexed both by switch and continuation maintenance, erlotinib by switch maintenance, and bevacizumab by continuation maintenance. Compared with observation alone after defined cycles of the first-line chemotherapy, subsequent pemetrexed maintenance therapy has provided significantly longer survival and infrequent severe adverse events. The cost-effectiveness of pemetrexed maintenance therapy is controversial, as well as the other two maintenance drugs, bevacizumab and erlotinib. The latest attractive attention is a combination maintenance therapy. We may have to consider epidermal growth factor receptor (EGFR mutation status for selection of a combination pattern. A combination maintenance therapy of pemetrexed plus bevacizumab is potential for patients with wild-type EGFR status, while a EGFR tyrosine kinase inhibitor-containing combination is promising for patients with active EGFR mutation status. Pemetrexed will be
Effectiveness of palliative radiotherapy in patients with non-small cell lung cancer
International Nuclear Information System (INIS)
Chmielewska, E.; Jaskiewicz, P.
2001-01-01
Lung cancer is the most frequent malignant neoplasm in Poland. During the last 25 years it has become the first reason of death of men and the second of women in Poland. Patients with non-small cell lung cancer constitute 75% of all lung cancer patients. The therapy of choice for the advanced, non-small cell lung cancer is radiotherapy with palliative assumption. Many papers indicate that this therapy has no influence on long-term survival, hence it is aimed at reducing the symptoms. The therapy brings relief to 70-80% of patients. At present no other method with similar effectiveness is known. The aim of the is study was to assess the effectiveness of palliative radiotherapy as a treatment of the advanced, non-small cell lung cancel, applied as a remedy for the symptoms resulting from the growth of a lung tumour: Improvement of the quality of life and long-term survivals were assessed and prognostic factors were analysed. Between 1990 and 1995, 2330 patients with lung cancer attended the Outpatient Clinic of the Maria Sklodowska-Curie Memorial Cancer Center in Warsaw. There were 1948 patients with the non-small cell lung cancer. From this group 832 patients were qualified to palliative radiotherapy that included the primary tumour. The documentation was found for 803 patients and this group was analysed. The group constituted of 115 women (14.3%) and 688 men (85.7%), aged 28 to 91 (mean 61). In the majority of cases a significant advancement of the disease was found: stage III A in 388 patients (48.3%) and stage III B in 358 patients (44.6%). Retrospective analysis of the results of the treatment was carried out. The material contained information on 803 patients. The basis for the analysis was the survival time. It was measured from the starting date of the irradiation to the date of death or the date of the last available information that the patient lives. The survival probability was calculated with the Kaplan-Meier method. Multidimensional analysis of the
Effects of icotinib on advanced non-small cell lung cancer with different EGFR phenotypes.
Pan, Huiyun; Liu, Rong; Li, Shengjie; Fang, Hui; Wang, Ziwei; Huang, Sheng; Zhou, Jianying
2014-09-01
Icotinib is the first oral epidermal growth factor receptor (EGFR) tyrosine kinase receptor inhibitor, which has been proven to exert significant inhibitory effects on non-small cell lung cancer in vitro. Clinical evidence has showed that the efficacy of Icotinib on retreating advanced non-small cell lung cancer is comparable to Gefitinib. However, different phenotypes of EGFR can affect the therapeutic outcomes of EGFR tyrosine kinase receptor inhibitor. Therefore, our study focused on efficacy and safety of Icotinib in patients with advanced non-small cell lung cancer of different EGPR phenotypes. Clinical data of patients with advanced non-small cell lung cancer who received Icotinib treatment from August, 2011 to May, 2013 were retrospectively analyzed. Kaplan-Meier analysis was used for survival analysis and comparison. 18 wild-type EGFR and 51 mutant type were found in a total of 69 patients. Objective response rate of patients with mutant type EGFR was 54.9 % and disease control rate was 86.3 %. Objective response rate of wild-type patients was 11.1 % (P = 0.0013 vs mutant type), disease control rate was 50.0 % (P = 0.0017). Median progression-free survival (PFS) of mutant type and wild-type patients were 9.7 and 2.6 months, respectively (P Icotinib included rash, diarrhea, itching skin with occurrence rates of 24.6 % (17/69), 13.0 % (9/69), and 11.6 % (8/69), respectively. Most adverse reactions were grade I-II. Icotinib has great efficacy in EGFR mutated patients, making it an optimal regimen to treat EGFR mutated patients. Furthermore, most of adverse reactions associated with Icotinib treatment were tolerable.
Zhou, Yufei; Li, Shaoxia; Li, Jiangtao; Wang, Dongfeng; Li, Quanxing
2017-01-01
This study explored the ability of microRNA-135a (miR-135a) to influence cell proliferation, migration, invasion, apoptosis and tumor angiogenesis through the IGF-1/PI3K/Akt signaling pathway in non-small cell lung cancer (NSCLC). NSCLC tissues and adjacent normal tissues were collected from 138 NSCLC patients. Quantitative real-time polymerase chain reaction (qRT-PCR) was used to detect the expression levels of miR-135a and IGF-1, PI3K, Akt, VEGF, bFGF and IL-8 mRNA; western blotting was used to determine the expression levels of IGF-1, PI3K and Akt protein; and enzyme-linked immunosorbent assay (ELISA) was used to analyze the expression levels of VEGF, bFGF and IL-8 protein. Human NSCLC cell lines (A549, H460, and H1299) and the human bronchial epithelial cell line (HBE) were selected. A549 cells were assigned to blank, negative control (NC), miR-135a mimics, miR-135a inhibitors, IGF-1 siRNA and miR-135a inhibitors + IGF-1 siRNA groups. The following were performed: an MTT assay to assess cell proliferation, a scratch test to detect cell migration, a Transwell assay to measure cell invasion, and a flow cytometry to analyze cell apoptosis. The expression level of miR-135a was lower while those of IGF-1, PI3K and Akt mRNA were higher in NSCLC tissues than in the adjacent normal tissues. Dual-luciferase reporter assay indicated IGF-1 as a target of miR-135a. The in vitro results showed that compared with the blank group, cell proliferation, migration and invasion were suppressed, mRNA and protein levels of IGF-1, PI3K, Akt, VEGF, bFGF and IL-8 were reduced, and cell apoptosis was enhanced in the miR-135a mimics and IGF-1 siRNA groups. Compared with the IGF-1 siRNA group, cells in the miR-135a inhibitors + IGF-1 siRNA group demonstrated increased cell proliferation, migration and invasion, elevated mRNA and protein levels of IGF-1, PI3K, Akt, VEGF, bFGF and IL-8 and reduced cell apoptosis. These findings indicated that miR-135a promotes cell apoptosis and inhibits
Reduction of nitric oxide level enhances the radiosensitivity of hypoxic non-small cell lung cancer
International Nuclear Information System (INIS)
Saleem, Wael; Suzuki, Yoshiyuki; Mobaraki, Abdulelah; Yoshida, Yukari; Noda, Shinei; Saitoh, Jun-ichi; Nakano, Takashi
2011-01-01
The epidermal growth factor receptor (EGFR) tyrosine kinase inhibitor (E-TKI) resistance has emerged as an important clinical issue. To overcome this resistance, researchers have examined different modalities, either for use as a monotherapy or in combination with E-TKI therapy. In the present study, we investigated whether a decrease in nitric oxide (NO) levels affects the radiosensitization of non-small cell lung cancer (NSCLC) cell lines. A549 and H3255 NSCLC cells were examined. They were subjected to hypoxic conditions and monotherapy, or combined therapy using radiation and N G -monomethyl- L -arginine, monoacetate (LNMMA). Reductions in nitric oxide levels enhanced the radiosensitivity of both cell lines and significantly reduced the expression of both hypoxia-inducible factor-1α (HIF-1α) and EGFR in H3255 cells compared to A549 cells. Since NO is significantly associated with cell metabolism, we measured the levels of pyruvate dehydrogenase kinase-1 (PDK-1), reactive oxygen species, and oxygen and observed that the expression of PDK-1 was significantly reduced. This reduction was seen simultaneously after the silencing of HIF-1α; however, not following LNMMA treatment. The oxygen concentration was significantly increased in the treated cells, and their viability decreased in parallel. Reactive oxygen species were decreased after LNMMA and radiation treatment. Adding EGFR-TKI to cells with reduced NO levels further suppressed cell viability when combined with radiation. This study suggests that a reduction in the NO level might substantially overcome the radioresistance of mutant NSCLC cells. (author)
Progress in Tissue Specimens Alternative for the Driver Genes Testing of Non-small Cell Lung Cancer
Directory of Open Access Journals (Sweden)
Yan SUN
2015-06-01
Full Text Available Target treatment based on driver genes in advanced non-small cell lung cancer is very important currently. Tumor tissues is the gold standard for driver genes testing. However, most of patients could not get the gene information for lack of enough tissues. To explore the tissue specimens alternatives is a hot spot in clinical work. This report reviews the tissue specimen alternatives of driver gene testing in non-small cell lung cancer.
Factors predicting radiation pneumonitis in locally advanced non-small cell lung cancer
International Nuclear Information System (INIS)
Kim, Myung Soo; Lee, Ji Hae; Ha, Bo Ram; Lee, Re Na
2011-01-01
Thoracic radiotherapy is a major treatment modality of stage III non-small cell lung cancer. The normal lung tissue is sensitive to radiation and radiation pneumonitis is the most important dose-limiting complication of thoracic radiation therapy. This study was performed to identify the clinical and dosimetric parameters related to the risk of radiation pneumonitis after definitive radiotherapy in stage III non-small cell cancer patients. The medical records were reviewed for 49 patients who completed definitive radiation therapy for locally advanced non-small cell lung cancer from August 2000 to February 2010. Radiation therapy was delivered with the daily dose of 1.8 Gy to 2.0 Gy and the total radiation dose ranged from 50.0 Gy to 70.2 Gy (median, 61.2 Gy). Elective nodal irradiation was delivered at a dose of 45.0 Gy to 50.0 Gy. Seven patients (14.3%) were treated with radiation therapy alone and forty two patients (85.7%) were treated with chemotherapy either sequentially or concurrently. Twenty-five cases (51.0%) out of 49 cases experienced radiation pneumonitis. According to the radiation pneumonitis grade, 10 (20.4%) were grade 1, 9 (18.4%) were grade 2, 4 (8.2%) were grade 3, and 2 (4.1%) were grade 4. In the univariate analyses, no clinical factors including age, sex, performance status, smoking history, underlying lung disease, tumor location, total radiation dose and chemotherapy were associated with grade ≥2 radiation pneumonitis. In the subgroup analysis of the chemotherapy group, concurrent rather than sequential chemotherapy was significantly related to grade ≥2 radiation pneumonitis comparing sequential chemotherapy. In the univariate analysis with dosimetric factors, mean lung dose (MLD), V20, V30, V40, MLDipsi, V20ipsi, V30ipsi, and V40ipsi were associated with grade ≥2 radiation pneumonitis. In addition, multivariate analysis showed that MLD and V30 were independent predicting factors for grade ≥2 radiation pneumonitis. Concurrent
Antiproliferative Activity of Flavonoids from Croton sphaerogynus Baill. (Euphorbiaceae
Directory of Open Access Journals (Sweden)
Kátia Pereira dos Santos
2015-01-01
Full Text Available Croton sphaerogynus is a shrub from the Atlantic Rain Forest in southeastern Brazil. A lyophilized crude EtOH extract from leaves of C. sphaerogynus, obtained by maceration at room temperature (seven days, was suspended in methanol and partitioned with hexane. The purified MeOH phase was fractionated over Sephadex LH-20 yielding five fractions (F1–F5 containing flavonoids, as characterized by HPLC-DAD and HPLC-MS analyses. The antiproliferative activity of the crude EtOH extract, MeOH and hexane phases, and fractions F1–F5 was evaluated on in vitro cell lines NCI-H460 (nonsmall cell lung, MCF-7 (breast cancer, and U251 (glioma. The MeOH phase showed activity (mean log GI50 0.54 higher than the hexane phase and EtOH extract (mean log GI50 1.13 and 1.19, resp.. F1 exhibited activity against NCI-H460 (nonsmall cell lung (GI50 1.2 μg/mL, which could be accounted for the presence of flavonoids and/or diterpenes. F4 showed moderate activity (mean log GI50 1.05, while F5 showed weak activity (mean log GI50 1.36. It is suggested that the antiproliferative activity of the crude EtOH extract and MeOH phase is accounted for a synergistic combination of flavonoids and diterpenes.
Liu, Quan; Liu, Juan; Roschmann, Kristina Irene Lisolette; van Egmond, Danielle; Golebski, Korneliusz; Fokkens, Wytske Johanna; Wang, Dehui; van Drunen, Cornelis Maria
2013-04-11
HDAC inhibitors have been proposed as anticancer agents. However, their roles in innate genes expression remain not well known. Cathelicidin LL-37 is one of the few human bactericidal peptides, but the regulation of histone acetylation on LL-37 expression in airway epithelium remains largely unknown. Therefore, we investigated the effects of two non-selective HDACi, trichostatin A (TSA) and sodium butyrate (SB), on the expression of the cathelicidin LL-37 in human airway epithelial cells. LL37 in human NCI-H292 airway epithelial cells and the primary cultures of normal nasal epithelial cells(PNEC) in response to HDAC inhibitors with or without poly (I:C) stimulation was assessed using real-time PCR and western blot. In parallel, IL-6 expression was evaluated by ELISA. Our results showed that HDAC inhibitors up-regulated LL-37 gene expression independent of poly (I:C) stimulation in PNEC as well as in NCI-H292 cells. HDAC inhibitors increased LL37 protein expression in NCI-H292 cells but not in PNEC. In addition, HDAC inhibitors significantly inhibited poly (I:C)-induced IL-6 production in both of the epithelial cells. In conclusion, HDAC inhibitors directly up-regulated LL-37 gene expression in human airway epithelial cells.
Liu, Xianfang; Guo, Sen; Liu, Xiangguo; Su, Ling
2015-11-01
Epigenetic abnormalities are associated with non-small cell lung cancer (NSCLC) initiation and progression. Epigenetic drugs are being studied and in clinical trials. However, the molecular mechanism underlying the apoptosis by the epigenetic agents remains unclear. SUV39H1 is an important methyl-transferase for lysine 9 on histone H3 and usually related to gene transcriptional suppression, and chaetocin acts as the inhibitor of SUV39H1. We demonstrated here that chaetocin effectively suppressed the growth of multiple lung cancer cells through inducing apoptosis in a death receptor 5 (DR5)-dependent manner. Chaetocin treatment activated endoplasmic reticulum (ER) stress which gave rise to the up-regulation of ATF3 and CHOP. Furthermore, ATF3 and CHOP contributed to the induction of DR5 and subsequent apoptosis. When SUV39H1 was silenced with siRNA, the expression of ATF3, CHOP and DR5 was elevated. Thereafter, knockdown of SUV39H1 induced apoptosis in NSCLC cells. In summary, chaetocin pharmacologically inhibits the activity of SUV39H1 which provokes ER stress and results in up-regulation of ATF3 and CHOP, leading to DR5-dependent apoptosis eventually. These findings provide a novel interpretation on the anti-neoplastic activity of epigenetic drugs as a new therapeutic approach in NSCLC.
Directory of Open Access Journals (Sweden)
Li L
2016-03-01
Full Text Available Lei Li,1,* Dapeng Wu2,* 1Department of Pneumology, 2Department of Radiotherapy, Huaihe Hospital of Henan University, Kaifeng, Henan, People’s Republic of China *These authors contributed equally to this work Background: By analyzing published microRNA microarray studies, miR-32 was found to be markedly reduced in non-small-cell lung cancer (NSCLC tissues compared with that in nontumor tissues. However, little is known about its role and molecular mechanism involved in NSCLC development and progression. Here, we report the effect of miR-32 on NSCLC cell proliferation, epithelial–mesenchymal transition (EMT, and metastasis. Methods: Quantitative real-time PCR was performed to detect the expression level of miR-32 in primary NSCLC cases and cell lines. miR-32-overexpressing H1299 and A549 cells were constructed by lipofection transfection. MTT, transwell chamber, and Western blot assays were used to assess the effect of miR-32 on proliferation, EMT, and metastasis of NSCLC cells, respectively. Target prediction and luciferase reporter assays were performed to investigate the targets of miR-32. Tumor formation assay in vivo was performed to investigate the antitumor effect of miR-32. Results: An inverse correlation existed between miR-32 expression level and NSCLC cell proliferation, EMT, and metastasis, and upregulation of miR-32 repressed NSCLC cell proliferation, EMT, and metastasis. Moreover, we identified and validated that TWIST1 was a direct target of miR-32, and miR-32 regulated NSCLC cell proliferation, EMT, and metastasis, at least in part via modulation of TWIST1. The animal experiments showed that overexpression of miR-32 inhibited the growth of NSCLC tumors in vivo. Keywords: non-small-cell lung cancer, miR-32, TWIST1, proliferation, EMT, nude mice
Kim, Ki Young; Ahn, Jin Hee; Cheon, Hyae Gyeong
2007-09-01
Peroxisome proliferator-activated receptor (PPAR)-gamma ligands have been shown to inhibit human lung cancers by inducing apoptosis and differentiation. In the present study, we elucidated the apoptotic mechanism of PPARgamma activation in human lung cancers by using a novel PPARgamma agonist, 1-(trans-methylimino-N-oxy)-6-(2-morpholinoethoxy)-3-phenyl-(1H-indene-2-carboxylic acid ethyl ester (KR-62980), and rosiglitazone. PPARgamma activation selectively inhibited cell viability of non-small-cell lung cancer with little effect on small-cell lung cancer and normal lung cells. The cell death induced by PPARgamma activation presented apoptotic features of oligonucleosomal DNA fragmentation in A549 human non-small-cell lung cancer cell line. Reactive oxygen species (ROS) production was accompanied by increased expression of proline oxidase (POX), a redox enzyme expressed in mitochondria, upon incubation with the agonists. POX RNA interference treatment blocked PPARgamma-induced ROS formation and cytotoxicity, suggesting that POX plays a functional role in apoptosis through ROS formation. The apoptotic effects by the agonists were antagonized by bisphenol A diglycidyl ether, a PPARgamma antagonist, and by knockdown of PPARgamma expression, indicating the involvement of PPARgamma in these actions. The results of the present study suggest that PPARgamma activation induces apoptotic cell death in non-small-cell lung carcinoma mainly through ROS formation via POX induction.
Energy Technology Data Exchange (ETDEWEB)
Kim, In Gyu, E-mail: igkim@kaeri.re.kr [Department of Radiation Biology, Environmental Radiation Research Group, Korea Atomic Energy Research Institute, P.O. Box 105, Yuseong, Daejeon 305-600 (Korea, Republic of); Department of Radiation Biotechnology and Applied Radioisotope, University of Science and Technology (UST), 989-111 Daedeok-daero, Yuseong-gu, Daejeon 305-353 (Korea, Republic of); Kim, Seo Yoen [Department of Radiation Biology, Environmental Radiation Research Group, Korea Atomic Energy Research Institute, P.O. Box 105, Yuseong, Daejeon 305-600 (Korea, Republic of); Biomedical Translational Research Center, Korea Research Institute of Bioscience and Biotechnology, 125 Gwahak-ro, Yuseong-gu, Daejeon 305-806 (Korea, Republic of); Kim, Hyun A; Kim, Jeong Yul [Department of Radiation Biology, Environmental Radiation Research Group, Korea Atomic Energy Research Institute, P.O. Box 105, Yuseong, Daejeon 305-600 (Korea, Republic of); Lee, Jae Ha; Choi, Soo Im [Department of Radiation Biology, Environmental Radiation Research Group, Korea Atomic Energy Research Institute, P.O. Box 105, Yuseong, Daejeon 305-600 (Korea, Republic of); Department of Radiation Biotechnology and Applied Radioisotope, University of Science and Technology (UST), 989-111 Daedeok-daero, Yuseong-gu, Daejeon 305-353 (Korea, Republic of); Han, Jeong Ran; Kim, Kug Chan [Department of Radiation Biology, Environmental Radiation Research Group, Korea Atomic Energy Research Institute, P.O. Box 105, Yuseong, Daejeon 305-600 (Korea, Republic of); Cho, Eun Wie [Biomedical Translational Research Center, Korea Research Institute of Bioscience and Biotechnology, 125 Gwahak-ro, Yuseong-gu, Daejeon 305-806 (Korea, Republic of)
2014-01-03
Highlights: •DKK1 was expressed differently among non-small-cell lung cancer cell lines. •DKK1 negatively regulated ROMO1 gene expression. •Disturbance of DKK1 level induced the imbalance of cellular ROS. •DKK1/ROMO1-induced ROS imbalance is involved in cell survival in NSCLC. -- Abstract: Dickkopf1 (DKK1), a secreted protein involved in embryonic development, is a potent inhibitor of the Wnt signaling pathway and has been postulated to be a tumor suppressor or tumor promoter depending on the tumor type. In this study, we showed that DKK1 was expressed differently among non-small-cell lung cancer cell lines. The DKK1 expression level was much higher in A549 cells than in H460 cells. We revealed that blockage of DKK1 expression by silencing RNA in A549 cells caused up-regulation of intracellular reactive oxygen species (ROS) modulator (ROMO1) protein, followed by partial cell death, cell growth inhibition, and loss of epithelial–mesenchymal transition property caused by ROS, and it also increased γ-radiation sensitivity. DKK1 overexpression in H460 significantly inhibited cell survival with the decrease of ROMO1 level, which induced the decrease of cellular ROS. Thereafter, exogenous N-acetylcysteine, an antioxidant, or hydrogen peroxide, a pro-oxidant, partially rescued cells from death and growth inhibition. In each cell line, both overexpression and blockage of DKK1 not only elevated p-RB activation, which led to cell growth arrest, but also inactivated AKT/NF-kB, which increased radiation sensitivity and inhibited cell growth. This study is the first to demonstrate that strict modulation of DKK1 expression in different cell types partially maintains cell survival via tight regulation of the ROS-producing ROMO1 and radiation resistance.
International Nuclear Information System (INIS)
Kim, In Gyu; Kim, Seo Yoen; Kim, Hyun A; Kim, Jeong Yul; Lee, Jae Ha; Choi, Soo Im; Han, Jeong Ran; Kim, Kug Chan; Cho, Eun Wie
2014-01-01
Highlights: •DKK1 was expressed differently among non-small-cell lung cancer cell lines. •DKK1 negatively regulated ROMO1 gene expression. •Disturbance of DKK1 level induced the imbalance of cellular ROS. •DKK1/ROMO1-induced ROS imbalance is involved in cell survival in NSCLC. -- Abstract: Dickkopf1 (DKK1), a secreted protein involved in embryonic development, is a potent inhibitor of the Wnt signaling pathway and has been postulated to be a tumor suppressor or tumor promoter depending on the tumor type. In this study, we showed that DKK1 was expressed differently among non-small-cell lung cancer cell lines. The DKK1 expression level was much higher in A549 cells than in H460 cells. We revealed that blockage of DKK1 expression by silencing RNA in A549 cells caused up-regulation of intracellular reactive oxygen species (ROS) modulator (ROMO1) protein, followed by partial cell death, cell growth inhibition, and loss of epithelial–mesenchymal transition property caused by ROS, and it also increased γ-radiation sensitivity. DKK1 overexpression in H460 significantly inhibited cell survival with the decrease of ROMO1 level, which induced the decrease of cellular ROS. Thereafter, exogenous N-acetylcysteine, an antioxidant, or hydrogen peroxide, a pro-oxidant, partially rescued cells from death and growth inhibition. In each cell line, both overexpression and blockage of DKK1 not only elevated p-RB activation, which led to cell growth arrest, but also inactivated AKT/NF-kB, which increased radiation sensitivity and inhibited cell growth. This study is the first to demonstrate that strict modulation of DKK1 expression in different cell types partially maintains cell survival via tight regulation of the ROS-producing ROMO1 and radiation resistance
Directory of Open Access Journals (Sweden)
Khuder Sadik A
2005-05-01
Full Text Available Abstract Background Although 40–50% of non-small cell lung cancer (NSCLC tumors respond to cisplatin chemotherapy, there currently is no way to prospectively identify potential responders. The purpose of this study was to determine whether transcript abundance (TA levels of twelve selected DNA repair or multi-drug resistance genes (LIG1, ERCC2, ERCC3, DDIT3, ABCC1, ABCC4, ABCC5, ABCC10, GTF2H2, XPA, XPC and XRCC1 were associated with cisplatin chemoresistance and could therefore contribute to the development of a predictive marker. Standardized RT (StaRT-PCR, was employed to assess these genes in a set of NSCLC cell lines with a previously published range of sensitivity to cisplatin. Data were obtained in the form of target gene molecules relative to 106 β-actin (ACTB molecules. To cancel the effect of ACTB variation among the different cell lines individual gene expression values were incorporated into ratios of one gene to another. Each two-gene ratio was compared as a single variable to chemoresistance for each of eight NSCLC cell lines using multiple regression. In an effort to validate these results, six additional lines then were evaluated. Results Following validation, single variable models best correlated with chemoresistance (p ERCC2/XPC, ABCC5/GTF2H2, ERCC2/GTF2H2, XPA/XPC and XRCC1/XPC. All single variable models were examined hierarchically to achieve two variable models. The two variable model with the highest correlation was (ABCC5/GTF2H2, ERCC2/GTF2H2 with an R2 value of 0.96 (p Conclusion These results provide markers suitable for assessment of small fine needle aspirate biopsies in an effort to prospectively identify cisplatin resistant tumors.
Clinical Utility of Circulating Tumor Cells in ALK-Positive Non-Small-Cell Lung Cancer.
Faugeroux, Vincent; Pailler, Emma; Auger, Nathalie; Taylor, Melissa; Farace, Françoise
2014-01-01
The advent of rationally targeted therapies such as small-molecule tyrosine kinase inhibitors (TKIs) has considerably transformed the therapeutic management of a subset of patients with non-small-cell lung cancer (NSCLC) harboring defined molecular abnormalities. When such genetic molecular alterations are detected the use of specific TKI has demonstrated better results (overall response rate, progression free survival) compared to systemic therapy. However, the detection of such molecular abnormalities is complicated by the difficulty in obtaining sufficient tumor material, in terms of quantity and quality, from a biopsy. Here, we described how circulating tumor cells (CTCs) can have a clinical utility in anaplastic lymphoma kinase (ALK) positive NSCLC patients to diagnose ALK-EML4 gene rearrangement and to guide therapeutic management of these patients. The ability to detect genetic abnormalities such ALK rearrangement in CTCs shows that these cells could offer new perspectives both for the diagnosis and the monitoring of ALK-positive patients eligible for treatment with ALK inhibitors.
Iso-suillin from Suillus flavus Induces Apoptosis in Human Small Cell Lung Cancer H446 Cell Line.
Zhao, Jun-Xia; Zhang, Qing-Shuang; Chen, Ying; Yao, Sheng-Jie; Yan, Yong-Xin; Wang, Ying; Zhang, Jin-Xiu; Wang, Li-An
2016-05-20
The suillin isoform iso-suillin is a natural substance isolated from a petroleum ether extract of the fruiting bodies of the mushroom Suillus flavus. Previous studies have found its inhibition effect on some cancer cells, and we aimed to study its effects on human small cell lung cancer H446 cell line. Cell viability was measured by 3-(4,5-dimethyl-2-thiazolyl)-2,5-diphenyl-2-H-tetrazolium bromide assay. Cellular morphological changes (apoptosis and necrosis) were evaluated using an electron microscope and Hoechst 33258 staining detected by the inverted microscope. Flow cytometry was used to detect cell apoptosis, cell cycle distribution, and mitochondrial membrane potential. Protein expression was determined by Western blotting analysis. Here, we describe the ability of iso-suillin to inhibit the growth of H446 cells in time- and dose-dependent way. Iso-suillin had no obvious impact on normal human lymphocyte proliferation at low concentrations (9.09, 18.17, or 36.35 μmol/L) but promoted lymphocyte proliferation at a high concentration (72.70 μmol/L). After treatment of different concentrations of iso-suillin (6.82, 13.63, or 20.45 μmol/L), the apoptosis rate of H446 cells increased with increasing concentrations of iso-suillin (16.70%, 35.54%, and 49.20%, respectively, all P iso-suillin could induce H446 cell apoptosis through the mitochondrial pathway and the death-receptor pathway. Therefore, iso-suillin might have a potential application as a novel drug for lung cancer treatment.
Directory of Open Access Journals (Sweden)
Hatim I. Alghamdi
2018-03-01
Full Text Available Lung cancer ranks as the top cancer worldwide in terms of incidence and constitutes a major health problem. About 90% of lung cancer cases are diagnosed at advance stage where treatment is not available. Despite evidence that lung cancer screening improves survival, guidelines for lung cancer screening are still a subject for debate. In Saudi Arabia, only 14% of lung cancers are diagnosed at early stage and researches on survival and its predictors are lacking. This overview analysis was conducted on predictors of lung cancer mortality according to the two major cancer types, small-cell lung cancers (SCLCs and non-small cell lung cancers (NSCLCs in Saudi Arabia. A secondary data analysis was performed on small-cell lung cancers (SCLCs and Non-small cell lung cancers (NSCLCs registered in the Saudi Cancer Registry (SCR for the period 2009–2013 to estimate predictors of mortality for both lung cancer types. A total of 404 cases (197 SCLC and 207 NSCLC were included in the analysis, all Saudi nationals. A total of 213 (52.75% deaths occurred among lung cancer patients, 108 (54.82% among SCLCs and 105 (50.72% among NCSLCs. Three quarter of patients are diagnosis with advance stage for both SCLC & NSCLC. Univariate analysis revealed higher mean age at diagnosis in dead patients compared to alive patients for SCLCs (p = 0.04; but not NSCLCs, a lower mortality for NSCLCs diagnosed in 2013 (p = 0.025 and a significant difference in stage of tumor (p = 0.006 and (p = 0.035 for both SCLC and NSCLC respectively. In multiple logistic regression, stage of tumor was a strong predictor of mortality, where distant metastasis increased morality by 6-fold (OR = 5.87, 95% CI: 2.01 – 17.19 in SCLC and by 3-fold (OR = 3.29, 95% CI: 1.22 – 8.85 in NSCLC, compared to localized tumors. Those with NSCLC who were diagnosed in 2013 were less likely to die by 64% compared to NSCLC diagnosed in 2009 (OR = 0.36, 95% CI: 0.14 – 0.93. Age, sex, topography
Alghamdi, Hatim I; Alshehri, Ali F; Farhat, Ghada N
2018-03-01
Lung cancer ranks as the top cancer worldwide in terms of incidence and constitutes a major health problem. About 90% of lung cancer cases are diagnosed at advance stage where treatment is not available. Despite evidence that lung cancer screening improves survival, guidelines for lung cancer screening are still a subject for debate. In Saudi Arabia, only 14% of lung cancers are diagnosed at early stage and researches on survival and its predictors are lacking. This overview analysis was conducted on predictors of lung cancer mortality according to the two major cancer types, small-cell lung cancers (SCLCs) and non-small cell lung cancers (NSCLCs) in Saudi Arabia. A secondary data analysis was performed on small-cell lung cancers (SCLCs) and Non-small cell lung cancers (NSCLCs) registered in the Saudi Cancer Registry (SCR) for the period 2009-2013 to estimate predictors of mortality for both lung cancer types. A total of 404 cases (197 SCLC and 207 NSCLC) were included in the analysis, all Saudi nationals. A total of 213 (52.75%) deaths occurred among lung cancer patients, 108 (54.82%) among SCLCs and 105 (50.72%) among NCSLCs. Three quarter of patients are diagnosis with advance stage for both SCLC & NSCLC. Univariate analysis revealed higher mean age at diagnosis in dead patients compared to alive patients for SCLCs (p=0.04); but not NSCLCs, a lower mortality for NSCLCs diagnosed in 2013 (p=0.025) and a significant difference in stage of tumor (p=0.006) and (p=0.035) for both SCLC and NSCLC respectively. In multiple logistic regression, stage of tumor was a strong predictor of mortality, where distant metastasis increased morality by 6-fold (OR=5.87, 95% CI: 2.01 - 17.19) in SCLC and by 3-fold (OR=3.29, 95% CI: 1.22 - 8.85) in NSCLC, compared to localized tumors. Those with NSCLC who were diagnosed in 2013 were less likely to die by 64% compared to NSCLC diagnosed in 2009 (OR=0.36, 95% CI: 0.14 - 0.93). Age, sex, topography and laterality were not associated with
Exosomal proteins as prognostic biomarkers in non-small cell lung cancer
DEFF Research Database (Denmark)
Sandfeld-Paulsen, B; Aggerholm-Pedersen, N; Bæk, R
2016-01-01
BACKGROUND: Use of exosomes as biomarkers in non-small cell lung cancer (NSCLC) is an intriguing approach in the liquid-biopsy era. Exosomes are nano-sized vesicles with membrane-bound proteins that reflect their originating cell. Prognostic biomarkers are needed to improve patient selection...... Bonferroni correction. Results were adjusted for clinico-pathological characteristics, stage, histology, age, sex and performance status. CONCLUSION: We illustrate the promising aspects associated with the use of exosomal membrane-bound proteins as a biomarker and demonstrate that they are a strong...
Results of surgical treatment of T4 non-small cell lung cancer
Pitz, CCM; de la Riviere, AB; van Swieten, HA; Westermann, CJJ; Lammers, JWJ; van den Bosch, JMM
2003-01-01
Objective: Because of location and invasion of surrounding structures, the role of surgical treatment for T4 tumors remains unclear. Extended resections carry a high mortality and should be restricted for selected patients. This study clarifies the selection process in non-small cell T4 tumors with
Molecular imaging of hypoxia in non-small-cell lung cancer
International Nuclear Information System (INIS)
Yip, Connie; Blower, Philip J.; Goh, Vicky; Landau, David B.; Cook, Gary J.R.
2015-01-01
Non-small-cell lung cancer (NSCLC) is the commonest cancer worldwide but survival remains poor with a high risk of relapse, particularly after nonsurgical treatment. Hypoxia is present in a variety of solid tumours, including NSCLC. It is associated with treatment resistance and a poor prognosis, although when recognised may be amenable to different treatment strategies. Thus, noninvasive assessment of intratumoral hypoxia could be used to stratify patients for modification of subsequent treatment to improve tumour control. Molecular imaging approaches targeting hypoxic cells have shown some early success in the clinical setting. This review evaluates the evidence for hypoxia imaging using PET in NSCLC and explores its potential clinical utility. (orig.)
Molecular imaging of hypoxia in non-small-cell lung cancer
Energy Technology Data Exchange (ETDEWEB)
Yip, Connie [King' s College London, St Thomas' Hospital, Department of Cancer Imaging, Division of Imaging Sciences and Biomedical Engineering, London (United Kingdom); National Cancer Centre, Department of Radiation Oncology, Singapore (Singapore); St Thomas' Hospital, Imaging 2, London (United Kingdom); Blower, Philip J. [King' s College London, St Thomas' Hospital, Department of Imaging Chemistry and Biology, Division of Imaging Sciences and Biomedical Engineering, London (United Kingdom); Goh, Vicky [King' s College London, St Thomas' Hospital, Department of Cancer Imaging, Division of Imaging Sciences and Biomedical Engineering, London (United Kingdom); St Thomas' Hospital, Department of Radiology, Guy' s and St Thomas' NHS Foundation Trust, London (United Kingdom); Landau, David B. [King' s College London, St Thomas' Hospital, Department of Cancer Imaging, Division of Imaging Sciences and Biomedical Engineering, London (United Kingdom); St Thomas' Hospital, Department of Clinical Oncology, Guy' s and St Thomas' NHS Foundation Trust, London (United Kingdom); Cook, Gary J.R. [King' s College London, St Thomas' Hospital, Department of Cancer Imaging, Division of Imaging Sciences and Biomedical Engineering, London (United Kingdom); St Thomas' Hospital, Clinical PET Imaging Centre, Guy' s and St Thomas' NHS Foundation Trust, London (United Kingdom)
2015-05-01
Non-small-cell lung cancer (NSCLC) is the commonest cancer worldwide but survival remains poor with a high risk of relapse, particularly after nonsurgical treatment. Hypoxia is present in a variety of solid tumours, including NSCLC. It is associated with treatment resistance and a poor prognosis, although when recognised may be amenable to different treatment strategies. Thus, noninvasive assessment of intratumoral hypoxia could be used to stratify patients for modification of subsequent treatment to improve tumour control. Molecular imaging approaches targeting hypoxic cells have shown some early success in the clinical setting. This review evaluates the evidence for hypoxia imaging using PET in NSCLC and explores its potential clinical utility. (orig.)
Guimarães, Rafaela; Barros, Lillian; Calhelha, Ricardo C; Carvalho, Ana Maria; Queiroz, Maria João R P; Ferreira, Isabel C F R
2014-03-01
Arbutus unedo, Prunus spinosa, Rosa micrantha and Rosa canina are good sources of phenolic compounds, including anthocyanins. These compounds have potent antioxidant properties, which have been related to anticancer activity. Herein, the in vitro antioxidant and antitumor properties of enriched phenolic extracts (non-anthocyanin phenolic compounds enriched extract- PE and anthocyanins enriched extract- AE) of the mentioned wild fruits were evaluated and compared. PE gave higher bioactive properties than the corresponding AE. It was observed a high capacity of A. unedo phenolic extract to inhibit lipid peroxidation in animal brain homogenates (EC50 = 7.21 μg/mL), as also a high antitumor potential against NCI-H460 human cell line (non-small lung cancer; GI50 = 37.68 μg/mL), which could be related to the presence of galloyl derivatives (exclusively found in this species). The bioactivity of the studied wild fruits proved to be more related to the phenolic compounds profile than to the amounts present in each extract, and could be considered in the design of new formulations of dietary supplements or functional foods.
DEFF Research Database (Denmark)
Jakobsen, Jan Nyrop; Santoni-Rugiu, Eric; Sørensen, Jens Benn
2014-01-01
BACKGROUND: Antibodies targeting epidermal growth factor receptor (EGFR), such as cetuximab, may potentially improve outcome in non-small cell lung cancer (NSCLC) patients with high EGFR expression. The EGFR expression may be heterogeneously distributed within tumors, and small biopsies may thus...
Cole, Aidan J.; McGarry, Conor K.; Butterworth, Karl T.; McMahon, Stephen J.; Hounsell, Alan R.; Prise, Kevin M.; O'Sullivan, Joe M.
2013-12-01
Respiratory motion introduces complex spatio-temporal variations in the dosimetry of radiotherapy and may contribute towards uncertainties in radiotherapy planning. This study investigates the potential radiobiological implications occurring due to tumour motion in areas of geometric miss in lung cancer radiotherapy. A bespoke phantom and motor-driven platform to replicate respiratory motion and study the consequences on tumour cell survival in vitro was constructed. Human non-small-cell lung cancer cell lines H460 and H1299 were irradiated in modulated radiotherapy configurations in the presence and absence of respiratory motion. Clonogenic survival was calculated for irradiated and shielded regions. Direction of motion, replication of dosimetry by multi-leaf collimator (MLC) manipulation and oscillating lead shielding were investigated to confirm differences in cell survival. Respiratory motion was shown to significantly increase survival for out-of-field regions for H460/H1299 cell lines when compared with static irradiation (p < 0.001). Significantly higher survival was found in the in-field region for the H460 cell line (p < 0.030). Oscillating lead shielding also produced these significant differences. Respiratory motion and oscillatory delivery of radiation dose to human tumour cells has a significant impact on in- and out-of-field survival in the presence of non-uniform irradiation in this in vitro set-up. This may have important radiobiological consequences for modulated radiotherapy in lung cancer.
Single-cell intracellular nano-pH probes†
Özel, Rıfat Emrah; Lohith, Akshar; Mak, Wai Han; Pourmand, Nader
2016-01-01
Within a large clonal population, such as cancerous tumor entities, cells are not identical, and the differences between intracellular pH levels of individual cells may be important indicators of heterogeneity that could be relevant in clinical practice, especially in personalized medicine. Therefore, the detection of the intracellular pH at the single-cell level is of great importance to identify and study outlier cells. However, quantitative and real-time measurements of the intracellular pH of individual cells within a cell population is challenging with existing technologies, and there is a need to engineer new methodologies. In this paper, we discuss the use of nanopipette technology to overcome the limitations of intracellular pH measurements at the single-cell level. We have developed a nano-pH probe through physisorption of chitosan onto hydroxylated quartz nanopipettes with extremely small pore sizes (~100 nm). The dynamic pH range of the nano-pH probe was from 2.6 to 10.7 with a sensitivity of 0.09 units. We have performed single-cell intracellular pH measurements using non-cancerous and cancerous cell lines, including human fibroblasts, HeLa, MDA-MB-231 and MCF-7, with the pH nanoprobe. We have further demonstrated the real-time continuous single-cell pH measurement capability of the sensor, showing the cellular pH response to pharmaceutical manipulations. These findings suggest that the chitosan-functionalized nanopore is a powerful nano-tool for pH sensing at the single-cell level with high temporal and spatial resolution. PMID:27708772
Single-cell intracellular nano-pH probes.
Özel, Rıfat Emrah; Lohith, Akshar; Mak, Wai Han; Pourmand, Nader
2015-01-01
Within a large clonal population, such as cancerous tumor entities, cells are not identical, and the differences between intracellular pH levels of individual cells may be important indicators of heterogeneity that could be relevant in clinical practice, especially in personalized medicine. Therefore, the detection of the intracellular pH at the single-cell level is of great importance to identify and study outlier cells. However, quantitative and real-time measurements of the intracellular pH of individual cells within a cell population is challenging with existing technologies, and there is a need to engineer new methodologies. In this paper, we discuss the use of nanopipette technology to overcome the limitations of intracellular pH measurements at the single-cell level. We have developed a nano-pH probe through physisorption of chitosan onto hydroxylated quartz nanopipettes with extremely small pore sizes (~100 nm). The dynamic pH range of the nano-pH probe was from 2.6 to 10.7 with a sensitivity of 0.09 units. We have performed single-cell intracellular pH measurements using non-cancerous and cancerous cell lines, including human fibroblasts, HeLa, MDA-MB-231 and MCF-7, with the pH nanoprobe. We have further demonstrated the real-time continuous single-cell pH measurement capability of the sensor, showing the cellular pH response to pharmaceutical manipulations. These findings suggest that the chitosan-functionalized nanopore is a powerful nano-tool for pH sensing at the single-cell level with high temporal and spatial resolution.
Directory of Open Access Journals (Sweden)
Lixia Fan
Full Text Available Non-small cell lung cancer is one of the most common cancers and the leading cause of cancer death worldwide. Genetic variants in regulatory regions of some miRNAs might be involved in non-small cell lung cancer susceptibility and survival. rs12220909 (G/C genetic polymorphism in miR-4293 has been shown to be associated with decreased risk of esophageal squamous cell carcinoma. However, the influence of rs12220909 genetic variation on non-small cell lung cancer susceptibility has not been reported. In order to evaluate the potential association between miR-4293 rs12220909 and non-small cell lung cancer risk in a Chinese population, we performed a case-control study among 998 non-small cell lung cancer cases and 1471 controls. The data shows that miR-4293 rs12220909 was significantly associated with decreased susceptibility to non-small cell lung cancer (GC vs.GG: OR = 0.681, 95%CI = 0.555-0.835, P = 2.19E-4; GG vs. GC+CC: OR = 0.687, 95%CI = 0.564-0.837, P = 1.95E-4, which indicates that rs12220909 in miR-4293 may play a significant role in the development of non-small cell lung cancer.
Yang, Guangdie; Yao, Yinan; Zhou, Jianya; Zhao, Qiong
2012-06-01
Epidermal growth factor receptor (EGFR) is one of the most promising targets for non-small cell lung cancer (NSCLC). Our study demonstrated the antitumor effects of icotinib hydrochloride, a highly selective epidermal growth factor receptor tyrosine kinase inhibitor (EGFR TKI), in two EGFR-mutated lung cancer cell lines compared to A549, a cell line without EGFR mutations. We incubated PC-9 and HCC827 human lung cancer cell lines both with (E746-A750) mutations with various concentrations of icotinib and gefitinib for 48 h. Cell proliferation and migration were determined using a real-time cell invasion and migration assay and cytotoxicity assay. Apoptosis was assessed by measuring Annexin V staining using flow cytometry. The antitumor effects of icotinib compared to gefitinib were similar and were most effective in reducing the proliferation of EGFR-mutated cells compared to non-mutated controls. Our results suggest the possibility of icotinib as a new therapeutic agent of EGFR-mutated cancer cells, which has the potential to be used in the first-line treatment of EGFR-mutated NSCLC.
Directory of Open Access Journals (Sweden)
Eastman Alan
2011-05-01
Full Text Available Abstract Background The Mre11/Rad50/Nbs1 (MRN complex is a regulator of cell cycle checkpoints and DNA repair. Defects in MRN can lead to defective S-phase arrest when cells are damaged. Such defects may elicit sensitivity to selected drugs providing a chemical synthetic lethal interaction that could be used to target therapy to tumors with these defects. The goal of this study was to identify these defects in the NCI60 panel of cell lines and identify compounds that might elicit selective cytotoxicity. Methods We screened the NCI60 panel in search of cell lines that express low levels of MRN proteins, or that fail to arrest in S-phase in response to the topisomerase I inhibitor SN38. The NCI COMPARE program was used to discover compounds that preferentially target cells with these phenotypes. Results HCT116 cells were initially identified as defective in MRN and S phase arrest. Transfection with Mre11 also elevated Rad50 and Nbs1, and rescued the defective S-phase arrest. Cells of the NCI60 panel exhibited a large range of protein expression but a strong correlation existed between Mre11, Rad50 and Nbs1 consistent with complex formation determining protein stability. Mre11 mRNA correlated best with protein level suggesting it was the primary determinant of the overall level of the complex. Three other cell lines failed to arrest in response to SN38, two of which also had low MRN. However, other cell lines with low MRN still arrested suggesting low MRN does not predict an inability to arrest. Many compounds, including a family of benzothiazoles, correlated with the failure to arrest in S phase. The activity of benzothiazoles has been attributed to metabolic activation and DNA alkylation, but we note several cell lines in which sensitivity does not correlate with metabolism. We propose that the checkpoint defect imposes an additional mechanism of sensitivity on cells. Conclusions We have identified cells with possible defects in the MRN complex
International Nuclear Information System (INIS)
Garner, Kristen M; Eastman, Alan
2011-01-01
The Mre11/Rad50/Nbs1 (MRN) complex is a regulator of cell cycle checkpoints and DNA repair. Defects in MRN can lead to defective S-phase arrest when cells are damaged. Such defects may elicit sensitivity to selected drugs providing a chemical synthetic lethal interaction that could be used to target therapy to tumors with these defects. The goal of this study was to identify these defects in the NCI60 panel of cell lines and identify compounds that might elicit selective cytotoxicity. We screened the NCI60 panel in search of cell lines that express low levels of MRN proteins, or that fail to arrest in S-phase in response to the topisomerase I inhibitor SN38. The NCI COMPARE program was used to discover compounds that preferentially target cells with these phenotypes. HCT116 cells were initially identified as defective in MRN and S phase arrest. Transfection with Mre11 also elevated Rad50 and Nbs1, and rescued the defective S-phase arrest. Cells of the NCI60 panel exhibited a large range of protein expression but a strong correlation existed between Mre11, Rad50 and Nbs1 consistent with complex formation determining protein stability. Mre11 mRNA correlated best with protein level suggesting it was the primary determinant of the overall level of the complex. Three other cell lines failed to arrest in response to SN38, two of which also had low MRN. However, other cell lines with low MRN still arrested suggesting low MRN does not predict an inability to arrest. Many compounds, including a family of benzothiazoles, correlated with the failure to arrest in S phase. The activity of benzothiazoles has been attributed to metabolic activation and DNA alkylation, but we note several cell lines in which sensitivity does not correlate with metabolism. We propose that the checkpoint defect imposes an additional mechanism of sensitivity on cells. We have identified cells with possible defects in the MRN complex and S phase arrest, and a series of compounds that may
Zhou, Fang; Du, Jin; Wang, Jianjun
2017-04-01
Albendazole (ABZ) has an anti-tumor ability and inhibits HIF-1α activity. HIF-1α is associated with glycolysis and vascular endothelial cell growth factor (VEGF) expression, which plays an important role in cancer progression. These clues indicate that ABZ exerts an anti-cancer effect by regulating glycolysis and VEGF expression. The aim of this study is to clarify the effects of ABZ on non-small cell lung cancer (NSCLC) cells and explore the underlying molecular mechanisms. The expression levels of HIF-1α and VEGF were detected using western blot analysis, and the effect of ABZ on glycolysis was evaluated by measuring the relative activities of hexokinase (HK), pyruvate kinase (PK), and lactate dehydrogenase (LDH) and detecting the production of lactate in A549 and H1299 cells. The results showed that ABZ decreased the expression levels of HIF-1α and VEGF and suppressed glycolysis in under hypoxia, but not normoxic condition. Inhibiting HIF-1α also suppressed glycolysis and VEGF expression. Additionally, ABZ inhibited the volume and weight, decreased the relative activities of HK, PK, and LDH, and reduced the levels of HIF-1α and VEGF of A549 xenografts in mouse models. In conclusion, ABZ inhibited growth of NSCLC cells by suppressing HIF-1α-dependent glycolysis and VEGF expression.
Radiation response of human lung cancer cells with inherent and acquired resistance to cisplatin
International Nuclear Information System (INIS)
Twentyman, P.R.; Wright, K.A.; Rhodes, T.
1991-01-01
We have derived sublines of three human lung cancer cell lines with acquired resistance to cisplatin. The cisplatin resistant sublines of NCI-H69 (small cell), COR-L23 (large cell), and MOR (adenocarcinoma) show 5.3 fold, 3.1 fold, and 3.8 fold resistance, respectively, determined in a 6-day MTT assay. Although the parent lines show a wide range of glutathione content per cell, the sublines each show similar values to their corresponding parent line. Radiation response curves have been obtained using a soft agar clonogenic assay. Values obtained for the parent lines (95% CL in parentheses) were: NCI-H69: Do = 0.99 Gy (0.87-1.16), n = 2.9 (1.6-5.2), GSH = 14 ng/10(4) cells; COR-L23: Do = 1.23 Gy (1.05-1.49), n = 1.3 (0.7-2.2), GSH = 47 ng/10(4) cells; MOR: Do = 1.66 Gy (1.48-1.88), n = 3.0 (1.9-4.8), GSH = 86 ng/10(4) cells. The cisplatin resistant variants of NCI-H69 and COR-L23 showed 31% and 63% increases, respectively, in Do compared to their parent lines, whereas no change in radiation response was seen in MOR. In this panel of lines, therefore, although there is a correlation between glutathione content and radiosensitivity of the parent cell lines, acquired resistance to cisplatin is not accompanied by increased glutathione content. However, two of the three cisplatin resistant lines do show a significantly reduced radiosensitivity
Decision support systems for incurable non-small cell lung cancer: A systematic review
Révész, D. (D.); Engelhardt, E.G. (E. G.); Tamminga, J.J. (J. J.); F.M.N.H. Schramel (Franz); B.D. Onwuteaka-Philipsen (Bregje); E.M.W. van de Garde (Ewoudt); E.W. Steyerberg (Ewout); Jansma, E.P. (E. P.); H.C. de Vet (Henrica C); V.M.H. Coupé (Veerle)
2017-01-01
textabstractBackground: Individually tailored cancer treatment is essential to ensure optimal treatment and resource use. Treatments for incurable metastatic non-small cell lung cancer (NSCLC) are evolving rapidly, and decision support systems (DSS) for this patient population have been developed to
Decision support systems for incurable non-small cell lung cancer : a systematic review
Révész, D; Engelhardt, E G; Tamminga, J J; Schramel, Franz M N H; Onwuteaka-Philipsen, B.D.; van de Garde, E M W; Steyerberg, E.W.; Jansma, E P; de Vet, Henrica C W; Coupé, V.M.H.
2017-01-01
BACKGROUND: Individually tailored cancer treatment is essential to ensure optimal treatment and resource use. Treatments for incurable metastatic non-small cell lung cancer (NSCLC) are evolving rapidly, and decision support systems (DSS) for this patient population have been developed to balance
Jiang, Y; Chen, X; Tian, W; Yin, X; Wang, J; Yang, H
2014-01-01
Background: Many studies have indicated an important implication of radiation-induced bystander effects (RIBEs) in cancer radiotherapy, but the detailed signalling remains unclear. Methods: The roles of tumour growth factor-beta1 (TGF-β1) and miR-21 in medium-mediated RIBEs in H1299 non-small-cell lung cancer cells were investigated using DNA damage, changes in proliferation and levels of reactive oxygen species (ROS) as end points. SB431542, a specific inhibitor of TGF-β type 1 receptor kinases, was used to inhibit TGF-β1 pathways in irradiated and bystander cells. Exogenous miR-21 regulation was achieved through inhibitor or mimic transfection. Results: Compared with relative sham-radiation-conditioned medium, radiation-conditioned medium (RCM) from irradiated cells 1 h post radiation (1-h RCM) caused an increase in ROS levels and DNA damage in bystander cells, while 18-h RCM induced cell cycle delay and proliferation inhibition. All these effects were eliminated by TGF-βR1 inhibition. One-hour RCM upregulated miR-21 expression in bystander cells, and miR-21 inhibitor abolished bystander oxidative stress and DNA damage. Eighteen-hour RCM downregulated miR-21 of bystander cells, and miR-21 mimic eliminated bystander proliferation inhibition. Furthermore, the dysregulation of miR-21 was attenuated by TGF-βR1 inhibition. Conclusions: The TGF-β1–miR-21–ROS pathway of bystander cells has an important mediating role in RIBEs in H1299 cells. PMID:24992582
Bmi-1 expression modulates non-small cell lung cancer progression
Xiong, Dan; Ye, Yunlin; Fu, Yujie; Wang, Jinglong; Kuang, Bohua; Wang, Hongbo; Wang, Xiumin; Zu, Lidong; Xiao, Gang; Hao, Mingang; Wang, Jianhua
2015-01-01
Previous studies indicate that the role of B lymphoma Mo-MLV insertion region 1 homolog (Bmi-1) is responsible for multiple cancer progression. However, Bmi-1 in controlling gene expression in non-small cell lung cancer (NSCLC) development is not well explored. Here we report that the Bmi-1 level is highly increased in primary NSCLC tissues compared to matched adjacent non-cancerous tissues and required for lung tumor growth in xenograft model. Furthermore, we also demonstrate that Bmi-1 level is lower in matched involved lymph node cancerous tissues than the respective primary NSCLC tissues. We find that Bmi-1 does not affect cell cycle and apoptosis in lung cancer cell lines as it does not affect the expression of p16/p19, Pten, AKT and P-AKT. Mechanistic analyses note that reduction of Bmi-1 expression inversely regulates invasion and metastasis of NSCLC cells in vitro and in vivo, followed by induction of epithelial-mesenchymal transition (EMT). Using genome microarray assays, we find that RNAi-mediated silence of Bmi-1 modulates some important molecular genetics or signaling pathways, potentially associated with NSCLC development. Taken together, our findings disclose for the first time that Bmi-1 level accumulates strongly in early stage and then declines in late stage, which is potentially important for NSCLC cell invasion and metastasis during progression. PMID:25880371
Mu, Xiaodong; Zhang, Ye; Qu, Xiujuan; Hou, Kezuo; Kang, Jian; Hu, Xuejun; Liu, Yunpeng
2013-01-01
Epidermal growth factor receptor (EGFR) is one of the most promising targets for non-small-cell lung cancer (NSCLC). Icotinib, a highly selective EGFR tyrosine kinase inhibitor (EGFR-TKI), has shown promising clinical efficacy and safety in patients with NSCLC. The exact molecular mechanism of icotinib remains unclear. In this study, we first investigated the antiproliferative effect of icotinib on NSCLC cells. Icotinib significantly inhibited proliferation of the EGFR-mutated lung cancer HCC827 cells. The IC50 values at 48 and 72 h were 0.67 and 0.07 μ M, respectively. Flow cytometric analysis showed that icotinib caused the G1 phase arrest and increased the rate of apoptosis in HCC827 cells. The levels of cyclin D1 and cyclin A2 were decreased. The apoptotic process was associated with activation of caspase-3, -8, and poly(ADP-ribose) polymerase (PARP). Further study revealed that icotinib inhibited phosphorylation of EGFR, Akt, and extracellular signal-regulated kinase. In addition, icotinib upregulated ubiquitin ligase Cbl-b expression. These observations suggest that icotinib-induced upregulation of Cbl-b is responsible, at least in part, for the antitumor effect of icotinib via the inhibition of phosphoinositide 3-kinase (PI3K)/Akt and mitogen-activated protein kinase pathways in EGFR-mutated NSCLC cells.
Directory of Open Access Journals (Sweden)
Ayako Tsuchiya
2015-11-01
Full Text Available 1,2-Diarachidonoyl-sn-glycero-3-phosphoethanolamine (DAPE induces both necrosis/necroptosis and apoptosis of NCI-H28 malignant pleural mesothelioma (MPM cells. The present study was conducted to understand the mechanism for DAPE-induced apoptosis of NCI-H28 cells. DAPE induced caspase-independent apoptosis of NCI-H28 malignant pleural mesothelioma (MPM cells, and the effect of DAPE was prevented by antioxidants or an inhibitor of NADPH oxidase (NOX. DAPE generated reactive oxygen species (ROS and inhibited activity of thioredoxin (Trx reductase (TrxR. DAPE decreased an association of apoptosis signal-regulating kinase 1 (ASK1 with thioredoxin (Trx, thereby releasing ASK1. DAPE activated p38 mitogen-activated protein kinase (MAPK, which was inhibited by an antioxidant or knocking-down ASK1. In addition, DAPE-induced NCI-H28 cell death was also prevented by knocking-down ASK1. Taken together, the results of the present study indicate that DAPE stimulates NOX-mediated ROS production and suppresses TrxR activity, resulting in the decrease of reduced Trx and the dissociation of ASK1 from a complex with Trx, allowing sequential activation of ASK1 and p38 MAPK, to induce apoptosis of NCI-H28 MPM cells.
Tsuchiya, Ayako; Kaku, Yoshiko; Nakano, Takashi; Nishizaki, Tomoyuki
2015-11-01
1,2-Diarachidonoyl-sn-glycero-3-phosphoethanolamine (DAPE) induces both necrosis/necroptosis and apoptosis of NCI-H28 malignant pleural mesothelioma (MPM) cells. The present study was conducted to understand the mechanism for DAPE-induced apoptosis of NCI-H28 cells. DAPE induced caspase-independent apoptosis of NCI-H28 malignant pleural mesothelioma (MPM) cells, and the effect of DAPE was prevented by antioxidants or an inhibitor of NADPH oxidase (NOX). DAPE generated reactive oxygen species (ROS) and inhibited activity of thioredoxin (Trx) reductase (TrxR). DAPE decreased an association of apoptosis signal-regulating kinase 1 (ASK1) with thioredoxin (Trx), thereby releasing ASK1. DAPE activated p38 mitogen-activated protein kinase (MAPK), which was inhibited by an antioxidant or knocking-down ASK1. In addition, DAPE-induced NCI-H28 cell death was also prevented by knocking-down ASK1. Taken together, the results of the present study indicate that DAPE stimulates NOX-mediated ROS production and suppresses TrxR activity, resulting in the decrease of reduced Trx and the dissociation of ASK1 from a complex with Trx, allowing sequential activation of ASK1 and p38 MAPK, to induce apoptosis of NCI-H28 MPM cells. Copyright © 2015 The Authors. Production and hosting by Elsevier B.V. All rights reserved.
First-Line Nivolumab in Stage IV or Recurrent Non-Small-Cell Lung Cancer.
Carbone, D.P.; Reck, M.; Paz-Ares, L.; Creelan, B.; Horn, L.; Steins, M.; Felip, E.; Heuvel, M. van den; Ciuleanu, T.E.; Badin, F.; Ready, N.; Hiltermann, T.J.N.; Nair, S.; Juergens, R.; Peters, S.; Minenza, E.; Wrangle, J.M.; Rodriguez-Abreu, D.; Borghaei, H.; umenschein GR, J.r. Bl; Villaruz, L.C.; Havel, L.; Krejci, J.; rral Jaime, J. Co; Chang, H.; Geese, W.J.; Bhagavatheeswaran, P.; Chen, A.C.; Socinski, M.A.
2017-01-01
BACKGROUND: Nivolumab has been associated with longer overall survival than docetaxel among patients with previously treated non-small-cell lung cancer (NSCLC). In an open-label phase 3 trial, we compared first-line nivolumab with chemotherapy in patients with programmed death ligand 1
First-Line Nivolumab in Stage IV or Recurrent Non-Small-Cell Lung Cancer
Carbone, D. P.; Reck, M.; Paz-Ares, L.; Creelan, B.; Horn, L.; Steins, M.; Felip, E.; van den Heuvel, M. M.; Ciuleanu, T. -E.; Badin, F.; Ready, N.; Hiltermann, T. J. N.; Nair, S; Juergens, R.; Peters, S.; Minenza, E.; Wrangle, J. M.; Rodriguez-Abreu, D.; Borghaei, H.; Blumenschein, G. R.; Villaruz, L. C.; Havel, L.; Krejci, J.; Corral Jaime, J.; Chang, C. -H.; Geese, W. J.; Bhagavatheeswaran, P.; Chen, Alexander C.; Socinski, M. A.
2017-01-01
BACKGROUND Nivolumab has been associated with longer overall survival than docetaxel among patients with previously treated non-small-cell lung cancer (NSCLC). In an open-label phase 3 trial, we compared first-line nivolumab with chemotherapy in patients with programmed death ligand 1
Meng, Lanfang; Xiu, Yan; Li, Yanli; Xu, Xiaobo; Li, Shanqun; Li, Xiao; Pak, Koon Y; Shi, Hongcheng; Cheng, Dengfeng
2015-07-01
This study attempted to evaluate the feasibility of (99m)Tc-labeled glucarate ((99m)Tc-GLA) imaging in non-small cell lung cancer (NSCLC) and the potential tumor uptake mechanism. Cell lysates from two NSCLC cell lines, H292 and H1975, were immunoblotted with anti-glucose transporter 5 (GLUT5) antibody for Western blotting. Thereafter, the two cell lines were used to examine cellular uptake of (99m)Tc-GLA with or without fructose. SPECT/CT imaging studies were performed on small animals bearing H292 and H1975 tumors. Biodistribution studies were also conducted to achieve accurate tissue uptake of this tracer in two tumor models. Hematoxylin & eosin (H&E) staining and GLUT5, Ki67 and cytokeratin-7 (CK-7) immunohistochemistry (IHC) analysis were further investigated on tumor tissues. In Western blotting, H292 cells showed higher levels of GLUT5 compared to the H1975 cells. Meanwhile, the in vitro cell assays indicated GLUT5-dependent uptake of (99m)Tc-GLA in H292 and H1975 cells. The fructose competition assays showed a significant decrease in (99m)Tc-GLA uptake by H292 and H1975 cells when fructose was added. The (99m)Tc-GLA accumulation was as much as two-fold higher in H292 implanted tumors than in H1975 implanted tumors. (99m)Tc-GLA exhibited rapid clearance pharmacokinetics and reasonable uptake in human NSCLC H292 (1.69±0.37 ID%/g) and H1975 (0.89±0.06 ID%/g) implanted tumors at 30min post injection. Finally, the expression of GLUT5, Ki67 and CK-7 on tumor tissues also exhibited positive correlation with the in vitro cell test results and in vivo SPECT/CT imaging results in xenograft tumors. Both in vitro and ex vivo studies demonstrated that the uptake of (99m)Tc-GLA in NSCLC is highly related to GLUT5 expression. Imaging and further IHC results support that (99m)Tc-GLA could be a promising SPECT imaging agent for NSCLC diagnosis and prognosis evaluation. Copyright © 2015 Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Takashi Kawaguchi
1999-01-01
Full Text Available This study was designed to examine the effects of adrenomedullin (AM on airway epithelial cells. Primary cultures of guinea-pig tracheal epithelial cells and the human bronchiolar epithelial cell line NCI-H441 were used. Intracellular cyclic adenosine monophosphate (cAMP, cyclic guanosine monophosphate (cGMP, prostaglandin E2 (PGE2, and stable end-products of nitric oxide were assayed. Adrenomedullin (10−6 mol/L stimulated cAMP production in guinea-pig epithelial cells. Indomethacin (10−5 mol/L significantly decreased the basal level of intracellular cAMP in guinea-pig epithelial cells, but not in NCI-H441 cells. However, AM did not stimulate production of PGE2, a major product that can increase cAMP formation. In the case of NCI-H441 cells, AM (10−8 – 10−6 mol/L did not significantly affect intracellular cGMP levels or nitrite content in conditioned medium. Adrenomedullin and calcitonin gene-related peptide (CGRP each stimulated cAMP production in NCI-H441 cells, but AM-stimulated cAMP production was antagonized by the CGRP fragment CGRP8–37. These findings suggest that AM stimulates cAMP production and functionally competes with CGRP for binding sites in airway epithelial cells, at least in human epithelial cells, but that it does not stimulate the release of PGE2 and nitric oxide. Though cyclooxygenase products contribute to some extent to cAMP formation in guinea-pigs, AM independently stimulates intracellular cAMP formation in airway epithelial cells.
Radiation therapy alone for early stage non-small cell carcinoma of the lung
International Nuclear Information System (INIS)
Chun, Ha Chung; Lee, Myung Za
2002-01-01
To evaluate the outcome of early stage non-small cell lung cancer patients who were treated with radiation therapy along and define the optimal radiotherapeutic regimen for these patients. A retrospective review was performed on patients with sage I or II non-small cell carcinoma of the lung that were treated at our institution between June, 1987 and May, 2000. A total of 21 patients treated definitively with radiation therapy alone were included in this study. The age of the patients ranged from 53 to 81 years with a median of 66 years. All the patients were male. The medical reasons for inoperability were lack of pulmonary reserve, cardiovascular disease, poor performance status, old age, and patient refusal in the decreasing order. Pathological evidence was not adequate to characterize the non-small cell subtype in two patients. Of the remaining 19 patients, 16 had squamous cell carcinoma and 3 had adenocarcinoma. Treatment was given with conventional fractionation, once a day, five times a week. The doses to the primary site ranged from 56 Gy to 69 Gy. No patients were lost to follow-up. The overall survival rates for the entire group at 2, 3 and 5 years were 41, 30 and 21%, respectively. The cause specific survivals at 2, 3 and 5 years were 55, 36 and 25%, respectively. An intercurrent disease was the cause of death in two patients. The cumulative local failure rate at 5 years was 43%. Nine of the 21 patients had treatment failures after the curative radiotherapy was attempted. Local recurrences as the first site of failure were documented in 7 patients. Therefore, local failure alone represented 78% of the total failures. Those patients whose tumor sizes were less than 4 cm had a significantly better 5 year disease free survival than those with tumors greater than 4 cm (0% vs 36%). Those patients with a Karnofsky performance status less than 70 did not differ significantly with respect to actuarial survival when compared to those with a status greater than 70
Energy Technology Data Exchange (ETDEWEB)
Lang, Yaoguo; Xu, Shidong; Ma, Jianqun; Wu, Jun [Department of Thoracic Surgery, Harbin Medical University Cancer Hospital, 150 Haping Road, Harbin, Heilongjiang 150081 (China); Jin, Shi; Cao, Shoubo [Department of Medical Oncology, Harbin Medical University Cancer Hospital, 150 Haping Road, Harbin, Heilongjiang 150081 (China); Yu, Yan, E-mail: yuyan@hrbmu.edu.cn [Department of Medical Oncology, Harbin Medical University Cancer Hospital, 150 Haping Road, Harbin, Heilongjiang 150081 (China)
2014-07-18
Highlights: • MiR-429 expression is upregulated in non-small cell lung cancer (NSCLC). • MiR-429 inhibits PTEN, RASSF8 and TIMP2 expression. • MiR-429 promotes metastasis and proliferation. • We report important regulatory mechanisms involved in NSCLC progression. • MiR-429 is a potential therapeutic target and diagnostic marker. - Abstract: Lung cancer is the major cause of cancer death globally. MicroRNAs are evolutionally conserved small noncoding RNAs that are critical for the regulation of gene expression. Aberrant expression of microRNA (miRNA) has been implicated in cancer initiation and progression. In this study, we demonstrated that the expression of miR-429 are often upregulated in non-small cell lung cancer (NSCLC) compared with normal lung tissues, and its expression level is also increased in NSCLC cell lines compared with normal lung cells. Overexpression of miR-429 in A549 NSCLC cells significantly promoted cell proliferation, migration and invasion, whereas inhibition of miR-429 inhibits these effects. Furthermore, we demonstrated that miR-429 down-regulates PTEN, RASSF8 and TIMP2 expression by directly targeting the 3′-untranslated region of these target genes. Taken together, our results suggest that miR-429 plays an important role in promoting the proliferation and metastasis of NSCLC cells and is a potential target for NSCLC therapy.
International Nuclear Information System (INIS)
Mi, Shanwei; Xiang, Gang; Yuwen, Daolu; Gao, Jian; Guo, Wenjie; Wu, Xuefeng; Wu, Xudong; Sun, Yang; Su, Yongqian; Shen, Yan; Xu, Qiang
2016-01-01
Resistance to cisplatin is a major obstacle for the success of non-small cell lung cancer therapy. The mechanisms underlying cisplatin resistance are not fully understood. In this study, we found that the increase of basal auotophagy accompanied the development of cisplatin resistance. Meanwhile the blockade of the Akt/mTOR pathway occurred in the process. Inhibition of this pathway was induced by cisplatin treatment in the resistant non-small cell lung carcinoma cells. Andrographolide, a natural diterpenoid, promoted the activation of the Akt/mTOR signaling by downregulating PTEN and suppressed autophagy, which subsequently resensitized the resistant cells to cisplatin-mediated apoptosis. Cisplatin treatment in combination with andrographolide significantly prevented the growth of the resistant cells in vivo. These results highlight the involvement of autophagy in cisplatin-resistance development and suggest that inhibition of autophagy via tuning the Akt/mTOR signaling could be a promising strategy in the therapy for cisplatin-resistant non-small cell lung cancer. - Highlights: • The increase of basal auotophagy accompanied the development of cisplatin resistance in NSCLC cells. • Cisplatin induced the blockade of the Akt/mTOR pathway. • Andrographolide promoted the activation of the Akt/mTOR signaling. • Andrographolide downregulated PTEN expression. • Cisplatin treatment in combination with andrographolide resensitized the resistant cells to cisplatin.
Energy Technology Data Exchange (ETDEWEB)
Mi, Shanwei; Xiang, Gang [State Key Laboratory of Pharmaceutical Biotechnology, School of Life Sciences, Nanjing University, Nanjing 210093 (China); Yuwen, Daolu [Department of Clinical Oncology, The First Affiliated Hospital of Nanjing Medical University, Nanjing 210029 (China); Gao, Jian; Guo, Wenjie; Wu, Xuefeng; Wu, Xudong; Sun, Yang [State Key Laboratory of Pharmaceutical Biotechnology, School of Life Sciences, Nanjing University, Nanjing 210093 (China); Su, Yongqian [Department of Clinical Oncology, The First Affiliated Hospital of Nanjing Medical University, Nanjing 210029 (China); Shen, Yan, E-mail: shenyan@nju.edu.cn [State Key Laboratory of Pharmaceutical Biotechnology, School of Life Sciences, Nanjing University, Nanjing 210093 (China); Xu, Qiang, E-mail: molpharm@163.com [State Key Laboratory of Pharmaceutical Biotechnology, School of Life Sciences, Nanjing University, Nanjing 210093 (China)
2016-11-01
Resistance to cisplatin is a major obstacle for the success of non-small cell lung cancer therapy. The mechanisms underlying cisplatin resistance are not fully understood. In this study, we found that the increase of basal auotophagy accompanied the development of cisplatin resistance. Meanwhile the blockade of the Akt/mTOR pathway occurred in the process. Inhibition of this pathway was induced by cisplatin treatment in the resistant non-small cell lung carcinoma cells. Andrographolide, a natural diterpenoid, promoted the activation of the Akt/mTOR signaling by downregulating PTEN and suppressed autophagy, which subsequently resensitized the resistant cells to cisplatin-mediated apoptosis. Cisplatin treatment in combination with andrographolide significantly prevented the growth of the resistant cells in vivo. These results highlight the involvement of autophagy in cisplatin-resistance development and suggest that inhibition of autophagy via tuning the Akt/mTOR signaling could be a promising strategy in the therapy for cisplatin-resistant non-small cell lung cancer. - Highlights: • The increase of basal auotophagy accompanied the development of cisplatin resistance in NSCLC cells. • Cisplatin induced the blockade of the Akt/mTOR pathway. • Andrographolide promoted the activation of the Akt/mTOR signaling. • Andrographolide downregulated PTEN expression. • Cisplatin treatment in combination with andrographolide resensitized the resistant cells to cisplatin.
Reddy, Pulakuntla Swetha; Lokhande, Kiran Bharat; Nagar, Shuchi; Reddy, Vaddi Damodara; Murthy, P Sushma; Swamy, K Venkateswara
2018-02-27
Gefitinib (lressa) is the most prescribed drug, highly effective to treat of non-small cell lung cancer; primarily it was considered targeted therapy is a kinase inhibitor. The non-small cell lung cancer caused by the mutation in the Epithelial Growth Factor Receptor (EGFR) gene, Iressa works by blocking the EGFR protein that helps the cancer cell growth. EGFR protein has lead to the development of anticancer therapeutics directed against EGFR inhibitor including Gefitinib for non-small cell lung cancer. To explore research on Gefitinib and its derivatives interaction with crystal structure EGFR to understand the better molecular insights interaction strategies. Molecular modeling of ligands (Gefitinib and its derivatives) was carried out by Avogadro software till atomic angle stable confirmation obtained. The partial charges for the ligands were assigned as per standard protocol for molecular docking. All docking simulations were performed with AutoDockVina. Virtual screening carried out based on binding energy and hydrogen bonding affinity. Molecular dynamics (MD) and Simulation EGFR was done using GROMACS 5.1.1 software to explore the interaction stability in a cell. The stable conformation for EGFR protein trajectories were captured at various time intervals 0-20ns. Few compounds screen based on high affinity as the inhibitor for EGFR may inhibit the cell cycle signalling in non-small cell lung cancer. These result suggested that a computer aided screening approach of a Gefitinib derivatives compounds with regard to their binding to EGFR for identifying novel drugs for the treatment of non-small cell lung cancer. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.
Therapeutic effect analysis of three dimensional conformal radiotherapy non-small cell lung cancer
International Nuclear Information System (INIS)
Yao Zhijun; Cao Yongzhen; Zhang Wenxue; Liang Feng
2012-01-01
Objective: To analyse the treatment effect of non-small cell lung cancer of three dimensional conformal radiotherapy (3D-CRT) and to study the effect of patient survival related factors. Methods: Retrospective analysis was mack for 136 cases of non-small cell lung cancer, all accept 3D-CRT, through the case data collection and long-term follow-up, using the single factor and multiple factor analysis survival time and its influencing factors. Results: The recent curative effects of 136 cases of patients with three dimensional conformal radiotherapy: Complete response (CR) 14.7% (20/136), partial response (PR) 60.3 (82/136), stable disease(SD) 19.9% (27/136), progression disease (PD) 5.1% (7/136), total effective rate is 75% (102/136). One, two, three, five year survival rate is 79.4%, 45.4%, 22.1%, 12.5%. Side effects: Class 1 radiated esophagitis 35 cases, Class 2 radiated esophagitis 16 cases, Class 3 and above radiated esophagitis 0 case. Class I radiated pneumonia 20 cases, Class 2 radiated pneumonia 9 cases, Class 3 radiated pneumonia 0 case. Single factor analysis shows the influence of gender, age, pathology, phase, dose, and first-phase curative effect to the survival time are of a statistical significance, Multiple factor analysis showed KPS score, phase, dose, first-phase curative effect are the survival time independent factors. Conclusion: 3D-CRT for patients with non-small cell lung carcinoma is a safe, effective treatment method, Side effects are relatively low, and the patients survival time is long after radiotherapy. (authors)
Targeted therapy for localized non-small-cell lung cancer: a review
Directory of Open Access Journals (Sweden)
Paleiron N
2016-07-01
Full Text Available Nicolas Paleiron,1 Olivier Bylicki,2 Michel André,1 Emilie Rivière,1 Frederic Grassin,1 Gilles Robinet,3 Christos Chouaïd4 On behalf of the GFPC Group 1Chest Department, HIA Clermont Tonnerre, Brest, 2Chest Department, HIA Percy, Clamart, 3Chest Department, CHU de Brest, Brest, 4GRC OncoEst, Université Paris XII, Paris, France Abstract: Targeted therapies have markedly improved the management of patients with advanced non-small-cell lung cancer (NSCLC, but their efficacy in localized NSCLC is less well established. The aim of this review is to analyze trials of targeted therapies in localized NSCLC. In patients with wild-type EGFR, tyrosine kinase inhibitors have shown no efficacy in Phase III trials. Few data are available for EGFR-mutated localized NSCLC, as routine biological profiling is not recommended. Available studies are small, often retrospectives, and/or conducted in a single-center making it difficult to draw firm conclusions. Ongoing prospective Phase III trials are comparing adjuvant tyrosine kinase inhibitor administration versus adjuvant chemotherapy. By analogy with the indication of bevacizumab in advanced NSCLC, use of antiangiogenic agents in the perioperative setting is currently restricted to nonsquamous NSCLC. Several trials of adjuvant or neoadjuvant bevacizumab are planned or ongoing, but for the moment there is no evidence of efficacy. Data on perioperative use of biomarkers in early-stage NSCLC come mainly from small, retrospective, uncontrolled studies. Assessment of customized adjuvant or neoadjuvant therapy in localized NSCLC (with or without oncogenic driver mutations is a major challenge. Keywords: targeted therapy, non-small-cell lung cancer, adjuvant, neo-adjuvant, surgery
Help NCI at Frederick “Knock Out Hunger” | Poster
NCI at Frederick is once again participating in the Feds Feed Families initiative, an annual food drive that addresses severe shortages of non-perishable items in food banks across D.C., Maryland, and Virginia during the summer months, when giving is at its lowest.
2018-04-25
EGFR Activating Mutation; EGFR Exon 19 Deletion Mutation; EGFR NP_005219.2:p.G719X; EGFR NP_005219.2:p.L858R; EGFR NP_005219.2:p.L861Q; EGFR T790M Mutation Negative; Recurrent Non-Small Cell Lung Carcinoma; Stage III Non-Small Cell Lung Cancer AJCC v7; Stage IIIA Non-Small Cell Lung Cancer AJCC v7; Stage IIIB Non-Small Cell Lung Cancer AJCC v7; Stage IV Non-Small Cell Lung Cancer AJCC v7
TUSC3 induces autophagy in human non-small cell lung cancer cells through Wnt/?-catenin signaling
Peng, Yun; Cao, Jun; Yao, Xiao-Yi; Wang, Jian-Xin; Zhong, Mei-Zuo; Gan, Ping-Ping; Li, Jian-Huang
2017-01-01
We investigated the effects of tumor suppressor candidate 3 (TUSC3) on autophagy in human non-small cell lung cancer (NSCLC) cells. A total of 118 NSCLC patients (88 males and 30 females) who underwent surgery at our institute were enrolled in the study. Immunohistochemical analysis revealed that TUSC3 protein expression was lower in NSCLC specimens than adjacent normal tissue. Correspondingly, there was greater methylation of TUSC3 in NSCLC than adjacent normal tissue. After transient transf...
2010-10-01
... 42 Public Health 4 2010-10-01 2010-10-01 false Marketing. 460.82 Section 460.82 Public Health... Administrative Requirements § 460.82 Marketing. (a) Information that a PACE organization must include in its marketing materials. (1) A PACE organization must inform the public about its program and give prospective...
Directory of Open Access Journals (Sweden)
Xiao Ma
2015-01-01
Full Text Available Introduction. Glucose-regulated protein 78 (78 kDa, GRP78, which is also known as immunoglobulin heavy chain binding protein (BIP, is a major chaperone in the endoplasmic reticulum (ER. The expression and clinical significance of GRP78 in the serum of non-small cell lung cancer patients have not yet been clearly described. The aims of the present study were to investigate the expression of GRP78 in the serum of non-small cell lung cancer patients, the relationships with clinicopathological parameters, and the potential implications for survival. Patients and Methods. A total of 163 peripheral blood samples from non-small cell lung cancer patients were prospectively collected at the Department of Thoracic Surgery, Fudan University Shanghai Cancer, China. Clinical characteristics data, including age, gender, stage, overall survival (OS time, and relapse-free survival (RFS time, were also collected. Serum GRP78 levels were measured using a commercially available ELISA kit. The associations between GRP78 levels and clinicopathological characteristics and survival were examined using Student’s t-test, Kaplan-Meier, or Cox regression analyses. Results. The mean ± standard error (SE value of GRP78 was 326.5 ± 49.77 pg/mL. This level was significantly lower compared with the level in late-stage non-small cell lung cancer patients (1227 ± 223.6, p=0.0001. There were no significant correlations with the clinicopathological parameters. No significant difference was found between high GRP78 expression and low GRP78 expression with regard to RFS (p=0.1585. However, the OS of patients with higher GRP78 expression was significantly poorer (p=0.0334. Conclusions. GRP78 was expressed in non-small cell lung cancer patients and was highly enriched in late-stage lung cancer. GRP78 may have an important role in the carcinogenesis of non-small cell lung cancer and may be a prognostic marker for non-small cell lung cancer.
International Nuclear Information System (INIS)
Park, Jong Kuk; Park, Seon Ho; Hong, Sung Hee; Um, Hong Duck; Yoo, Young Do
2008-01-01
Cancer cell is characterized by various distinctive functions difference from normal cell. The one of specific properties of cancer is invasion and metastasis. Invasion and metastasis is a multi-step process involving over-expression of proteolytic enzymes such as matrix metalloproteinases (MMPs) and critically dependent on the ability of cells to move away from the primary tumor to gain access to the vascular or lymphatic systems which disperses cells to distant sites, where they can grow in a permissive microenvironment at a secondary location. All of these processes are critically dependent upon the ability of cancer cells to breach the basement membrane and to migrate through neighboring tissues. Cancer cell invasion is an important, tightly regulated process that is related with development, immune response and wound healing. This invasive response is dependent on activation of signaling pathways that result in both short-term and long-term cellular responses. The gene expressions of the cancer cell invasion related-proteolytic enzymes are regulated at the transcriptional level (through AP-1 and NF-kB via mitogen activated protein kinases (MAPKs) and PI3K-Akt pathways) and post-transcriptional levels, and the protein level via their activators or inhibitors, and their cell surface localization. Therefore, the related proteins such as MMPs, MAPK, PI3K, Akt and their regulatory pathway have been considered as promising targets for anti-cancer drugs. In previous reports, Intercellular adherin molecule-3 (ICAM-3) showed increase of radio-resistance and proliferation. We have made ICAM-3 overexpressed cancer cells which shows elevated level of invasion compared with normal cancer cells and its invasion capacity was down regulated with treatment of specific inhibitor for PI3K. These results suggest that ICAM-3 related invasion is associated with PI3K signaling pathway
The small GTPase RhoH is an atypical regulator of haematopoietic cells
Directory of Open Access Journals (Sweden)
Kubatzky Katharina F
2008-09-01
Full Text Available Abstract Rho GTPases are a distinct subfamily of the superfamily of Ras GTPases. The best-characterised members are RhoA, Rac and Cdc42 that regulate many diverse actions such as actin cytoskeleton reorganisation, adhesion, motility as well as cell proliferation, differentiation and gene transcription. Among the 20 members of that family, only Rac2 and RhoH show an expression restricted to the haematopoietic lineage. RhoH was first discovered in 1995 as a fusion transcript with the transcriptional repressor LAZ3/BCL6. It was therefore initially named translation three four (TTF but later on renamed RhoH due to its close relationship to the Ras/Rho family of GTPases. Since then, RhoH has been implicated in human cancer as the gene is subject to somatic hypermutation and by the detection of RHOH as a translocation partner for LAZ3/BCL6 or other genes in human lymphomas. Underexpression of RhoH is found in hairy cell leukaemia and acute myeloid leukaemia. Some of the amino acids that are crucial for GTPase activity are mutated in RhoH so that the protein is a GTPase-deficient, so-called atypical Rho GTPase. Therefore other mechanisms of regulating RhoH activity have been described. These include regulation at the mRNA level and tyrosine phosphorylation of the protein's unique ITAM-like motif. The C-terminal CaaX box of RhoH is mainly a target for farnesyl-transferase but can also be modified by geranylgeranyl-transferase. Isoprenylation of RhoH and changes in subcellular localisation may be an additional factor to fine-tune signalling. Little is currently known about its signalling, regulation or interaction partners. Recent studies have shown that RhoH negatively influences the proliferation and homing of murine haematopoietic progenitor cells, presumably by acting as an antagonist for Rac1. In leukocytes, RhoH is needed to keep the cells in a resting, non-adhesive state, but the exact mechanism has yet to be elucidated. RhoH has also been
EGFR targeted therapy in non-small cell lung cancer: potential role of cetuximab
Directory of Open Access Journals (Sweden)
Chad A Reade
2009-05-01
Full Text Available Chad A Reade1, Apar Kishor Ganti1,21Department of Internal Medicine, University of Nebraska Medical Center, Omaha, NE, USA; 2Section of Oncology-Hematology, Department of internal Medicine, VA Medical Center, Omaha, NE, USAAbstract: Chemotherapy alone has limited ability to significantly improve survival in non-small lung cancer (NSCLC beyond what has already been achieved. The epidermal growth factor (EGF pathway plays a vital role in the pathogenesis and progression of NSCLC. Two classes of drugs inhibit the EGF receptor (EGFR pathway: small molecules that inhibit the intracellular tyrosine kinase activity of the receptor, and monoclonal antibodies that target the extracellular domain in the ligand-binding region. Cetuximab is a human – mouse chimeric immunoglobulin G1 class monoclonal antibody directed against EGFR. Preclinical studies with cetuximab suggested that there was inhibition of growth of human NSCLC cell lines. Cetuximab is currently the focus of intense investigation in various patient populations with NSCLC. This review focuses on clinical trials of cetuximab in NSCLC and identifies future directions with this agent.Keywords: non-small cell lung cancer, EGFR, cetuximab, monoclonal antibodies
International Nuclear Information System (INIS)
Chen, H.H.; Jia, R.F.; Yu, L.; Zhao, M.J.; Shao, C.L.; Cheng, W.Y.
2008-01-01
Purpose: To investigate bystander effects of low-dose-rate (LDR) 125 I seed irradiation on human lung cancer cells in vitro. Methods and Materials: A549 and NCI-H446 cell lines of differing radiosensitivity were directly exposed to LDR 125 I seeds irradiation for 2 or 4 Gy and then cocultured with nonirradiated cells for 24 hours. Induction of micronucleus (MN), γH2AX foci, and apoptosis were assayed. Results: After 2 and 4 Gy irradiation, micronucleus formation rate (MFR) and apoptotic rate of A549 and NCI-H446 cells were increased, and the MFR and apoptotic rate of NCI-H446 cells was 2.1-2.8 times higher than that of A549 cells. After coculturing nonirradiated bystander cells with 125 I seed irradiated cells for 24 hours, MFR and the mean number of γH2AX foci/cells of bystander A549 and NCI-H446 cells were similar and significantly higher than those of control (p 125 I seeds could induce bystander effects, which potentiate the killing action on tumor cells and compensate for the influence of nonuniform distribution of radiation dosage on therapeutic outcomes
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC460 (Link to dictyBase) - - - - SLC460Z (Link to Original site) - - SLC4...60Z 333 - - - - Show SLC460 Library SL (Link to library) Clone ID SLC460 (Link to dictyBase) At...las ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC4...60Q.Seq.d/ Representative seq. ID SLC460Z (Link to Original site) R...epresentative DNA sequence >SLC460 (SLC460Q) /CSM/SL/SLC4-C/SLC460Q.Seq.d/ XXXXXXXXXXAATTATTATTGTGTAATTCCTGT
2010-04-01
... 21 Food and Drugs 6 2010-04-01 2010-04-01 false Penicillin. 558.460 Section 558.460 Food and Drugs... Animal Feeds § 558.460 Penicillin. (a) Specifications. As penicillin procaine G or feed grade penicillin.... (1) It is used as follows: Penicillin in grams per ton Combination in grams per ton Indications for...
International Nuclear Information System (INIS)
Bokobza, Sivan M.; Jiang, Yanyan; Weber, Anika M.; Devery, Aoife M.; Ryan, Anderson J.
2014-01-01
Purpose: To evaluate the combination of radiation and an epidermal growth factor receptor (EGFR) tyrosine kinase inhibitor (TKI) in preclinical models of human non-small cell lung cancer. Methods and Materials: Sensitivity to an EGFR TKI (gefitinib) or radiation was assessed using proliferation assays and clonogenic survival assays. Effects on receptor signal transduction pathways (pEGFR, pAKT, pMAPK) and apoptosis (percentage of cleaved PARP Poly (ADP-ribose) polymerase (PARP)) were assessed by Western blotting. Radiation-induced DNA damage was assessed by γH2AX immunofluorescence. Established (≥100 mm 3 ) EGFR-mutated (HCC287) or EGFR wild-type (A549) subcutaneous xenografts were treated with radiation (10 Gy, day 1) or gefitinib (50 mg/kg, orally, on days 1-3) or both. Results: In non-small cell lung cancer (NSCLC) cell lines with activating EGFR mutations (PC9 or HCC827), gefitinib treatment markedly reduced pEGFR, pAKT, and pMAPK levels and was associated with an increase in cleaved PARP but not in γH2AX foci. Radiation treatment increased the mean number of γH2AX foci per cell but did not significantly affect EGFR signaling. In contrast, NSCLC cell lines with EGFR T790M (H1975) or wild-type EGFR (A549) were insensitive to gefitinib treatment. The combination of gefitinib and radiation treatment in cell culture produced additive cell killing with no evidence of synergy. In xenograft models, a short course of gefitinib (3 days) did not significantly increase the activity of radiation treatment in wild-type EGFR (A549) tumors (P=.27), whereas this combination markedly increased the activity of radiation (P<.001) or gefitinib alone (P=.002) in EGFR-mutated HCC827 tumors, producing sustained tumor regressions. Conclusions: Gefitinib treatment increases clonogenic cell killing by radiation but only in cell lines sensitive to gefitinib alone. Our data suggest additive rather than synergistic interactions between gefitinib and radiation and that a
Lung cancer radiosensitization by CMNa in vitro and in vivo
International Nuclear Information System (INIS)
Zhang Xia; Ouyang Xienong; Ji Hongbing; Chen Zhonghua; Yang Rujun
2005-01-01
Objective: To probe into the radiosensitization effect of CMNa on lung tumor cell lines after γ-irradiation combined with γ-knife to treat patients suffering from lung cancer. Methods: 1. Cells of small cell lung cancer cell line NCI-H446 and non-small cell lung cancer cell line NCI-H596 irradiated with 60 Co γ-rays combined with or without CMNa were counted using trypan blue exclusion methods, and cell survival rate curves were depicted. 2. Patients suffering from lung cancer at different clinical stages were treated using γ-knife combined with or without CMNa, and the curative effect was evaluated 6 weeks after one cycle of treatment. Results: CMNa could significantly increase the sensitivity of lung cancer cell lines to γ-irradiation. Curative effect increased significantly by γ-knife treatment combined with CMNa i. e., the CR+PR rates for these two groups were 47.22% and 37.67% separately (P 0.05). Conclusion: CMNa could significantly increase the radiation sensitivity of lung cancer cell line cells in vitro and tumors in vivo, therefore, it could be used as a radiosensitization agent in clinical treatment of lung cancer. (authors)
NCI Alliance for Nanotechnology in Cancer
The NCI Alliance for Nanotechnology in Cancer funds the Cancer Nanotechnology Training Centers collectively with the NCI Cancer Training Center. Find out about the funded Centers, to date, that train our next generation of scientists in the field of Canc
Anticancer effects of saponin and saponin–phospholipid complex of Panax notoginseng grown in Vietnam
Thu Dang Kim; Hai Nguyen Thanh; Duong Nguyen Thuy; Loi Vu Duc; Thu Vu Thi; Hung Vu Manh; Patcharee Boonsiri; Tung Bui Thanh
2016-01-01
Objective: To evaluate the antitumor activity both in vitro and in vivo of saponin–phospholipid complex of Panax notoginseng. Methods: The in vitro cytotoxic effect of saponins extract and saponin–phospholipid complex against human lung cancer NCI-H460 and breast cancer cell lines BT474 was examined using MTS assay. For in vivo evaluation of antitumor potential, saponin and saponin–phospholipid complex were administered orally in rats induced mammary carcinogenesis by 7,12-dimethylbenz(a)a...
Proton Beam Therapy of Stage II and III Non-Small-Cell Lung Cancer
Energy Technology Data Exchange (ETDEWEB)
Nakayama, Hidetsugu, E-mail: hnakayam@tokyo-med.ac.jp [Proton Medical Research Center, University of Tsukuba Graduate School of Comprehensive Human Sciences, Tsukuba, Ibaraki (Japan); Department of Radiation Oncology, Tokyo Medical University, Shinjuku, Tokyo (Japan); Satoh, Hiroaki [Department of Respiratory Medicine, University of Tsukuba Graduate School of Comprehensive Human Sciences, Tsukuba, Ibaraki (Japan); Sugahara, Shinji [Proton Medical Research Center, University of Tsukuba Graduate School of Comprehensive Human Sciences, Tsukuba, Ibaraki (Japan); Department of Radiation Oncology, Tokyo Medical University, Shinjuku, Tokyo (Japan); Kurishima, Koichi [Department of Respiratory Medicine, University of Tsukuba Graduate School of Comprehensive Human Sciences, Tsukuba, Ibaraki (Japan); Tsuboi, Koji; Sakurai, Hideyuki [Proton Medical Research Center, University of Tsukuba Graduate School of Comprehensive Human Sciences, Tsukuba, Ibaraki (Japan); Ishikawa, Shigemi [Department of Thoracic Surgery, University of Tsukuba Graduate School of Comprehensive Human Sciences, Tsukuba, Ibaraki (Japan); Tokuuye, Koichi [Proton Medical Research Center, University of Tsukuba Graduate School of Comprehensive Human Sciences, Tsukuba, Ibaraki (Japan); Department of Radiation Oncology, Tokyo Medical University, Shinjuku, Tokyo (Japan)
2011-11-15
Purpose: The present retrospective study assessed the role of proton beam therapy (PBT) in the treatment of patients with Stage II or III non-small-cell lung cancer who were inoperable or ineligible for chemotherapy because of co-existing disease or refusal. Patients and Methods: Between November 2001 and July 2008, PBT was given to 35 patients (5 patients with Stage II, 12 with Stage IIIA, and 18 with Stage IIIB) whose median age was 70.3 years (range, 47.4-85.4). The median proton dose given was 78.3 Gy (range, 67.1-91.3) (relative biologic effectiveness). Results: Local progression-free survival for Stage II-III patients was 93.3% at 1 year and 65.9% at 2 years during a median observation period of 16.9 months. Four patients (11.4%) developed local recurrence, 13 (37.1%) developed regional recurrence, and 7 (20.0%) developed distant metastases. The progression-free survival rate for Stage II-III patients was 59.6% at 1 year and 29.2% at 2 years. The overall survival rate of Stage II-III patients was 81.8% at 1 year and 58.9% at 2 years. Grade 3 or greater toxicity was not observed. A total of 15 patients (42.9%) developed Grade 1 and 6 (17.1%) Grade 2 toxicity. Conclusion: PBT for Stage II-III non-small-cell lung cancer without chemotherapy resulted in good local control and low toxicity. PBT has a definite role in the treatment of patients with Stage II-III non-small-cell lung cancer who are unsuitable for surgery or chemotherapy.
Directory of Open Access Journals (Sweden)
Leyre Larzabal
Full Text Available Cancer stem cells (CSCs are thought to be responsible for tumor initiation and recurrence after chemotherapy. Targeting CSCs and non-CSCs with specific compounds may be an effective approach to reduce lung cancer growth and metastasis. The aim of this study was to investigate the effect of salinomycin, a selective inhibitor of CSCs, with or without combination with paclitaxel, in a metastatic model. To evaluate the effect of these drugs in metastasis and tumor microenvironment we took advantage of the immunocompetent and highly metastatic LLC mouse model. Aldefluor assays were used to analyze the ALDH+/- populations in murine LLC and human H460 and H1299 lung cancer cells. Salinomycin reduced the proportion of ALDH+ CSCs in LLC cells, whereas paclitaxel increased such population. The same effect was observed for the H460 and H1299 cell lines. Salinomycin reduced the tumorsphere formation capacity of LLC by more than 7-fold, but paclitaxel showed no effect. In in vivo experiments, paclitaxel reduced primary tumor volume but increased the number of metastatic nodules (p<0.05, whereas salinomycin had no effect on primary tumors but reduced lung metastasis (p<0.05. Combination of both drugs did not improve the effect of single therapies. ALDH1A1, SOX2, CXCR4 and SDF-1 mRNA levels were higher in metastatic lesions than in primary tumors, and were significantly elevated in both locations by paclitaxel treatment. On the contrary, such levels were reduced (or in some cases did not change when mice were administered with salinomycin. The number of F4/80+ and CD11b+ cells was also reduced upon administration of both drugs, but particularly in metastasis. These results show that salinomycin targets ALDH+ lung CSCs, which has important therapeutic effects in vivo by reducing metastatic lesions. In contrast, paclitaxel (although reducing primary tumor growth promotes the selection of ALDH+ cells that likely modify the lung microenvironment to foster
de Dios, N Rodríguez; Sanz, X; Foro, P; Membrive, I; Reig, A; Ortiz, A; Jiménez, R; Algara, M
2017-04-01
To report interim results from a single-institution study conducted to assess accelerated hypofractionated radiotherapy (AHRT) delivered with 3D conformal radiotherapy in two groups of patients with non-small cell lung cancer: (1) patients with early stage disease unable to tolerate surgery and ineligible for stereotactic body radiation therapy, and (2) patients with locally advanced disease unsuitable for concurrent chemoradiotherapy. A total of 83 patients (51 stage I-II, 32 stage III) were included. Radiotherapy targets included the primary tumor and positive mediastinal areas identified on the pre-treatment PET-CT. Mean age was 77.8 ± 7.8 years. ECOG performance status (PS) was ≥2 in 50.6 % of cases. Radiotherapy was delivered in daily fractions of 2.75 Gy to a total dose of 66 Gy (BED 10 84 Gy). Acute and late toxicities were evaluated according to NCI CTC criteria. At a median follow-up of 42 months, median overall survival (OS) and cause-specific survival (CSS) were 23 and 36 months, respectively. On the multivariate analysis, PS [HR 4.14, p = 0.0001)], stage [HR 2.51, p = 0.005)], and maximum standardized uptake values (SUVmax) [HR 1.04, p = 0.04)] were independent risk factors for OS. PS [HR 5.2, p = 0.0001)] and stage [HR 6.3, p = 0.0001)] were also associated with CSS. No cases of severe acute or late treatment-related toxicities were observed. OS and CSS rates in patients treated with AHRT for stage I-II and stage III NSCLC were good. Treatment was well tolerated with no grade three or higher treatment-related toxicity. PS, stage, and SUV max were predictive for OS and CSS.
MicroRNA-944 Affects Cell Growth by Targeting EPHA7 in Non-Small Cell Lung Cancer
Directory of Open Access Journals (Sweden)
Minxia Liu
2016-09-01
Full Text Available MicroRNAs (miRNAs have critical roles in lung tumorigenesis and development. To determine aberrantly expressed miRNAs involved in non-small cell lung cancer (NSCLC and investigate pathophysiological functions and mechanisms, we firstly carried out small RNA deep sequencing in NSCLC cell lines (EPLC-32M1, A549 and 801D and a human immortalized cell line 16HBE, we then studied miRNA function by cell proliferation and apoptosis. cDNA microarray, luciferase reporter assay and miRNA transfection were used to investigate interaction between the miRNA and target gene. miR-944 was significantly down-regulated in NSCLC and had many putative targets. Moreover, the forced expression of miR-944 significantly inhibited the proliferation of NSCLC cells in vitro. By integrating mRNA expression data and miR-944-target prediction, we disclosed that EPHA7 was a potential target of miR-944, which was further verified by luciferase reporter assay and microRNA transfection. Our data indicated that miR-944 targets EPHA7 in NSCLC and regulates NSCLC cell proliferation, which may offer a new mechanism underlying the development and progression of NSCLC.
MicroRNA-944 Affects Cell Growth by Targeting EPHA7 in Non-Small Cell Lung Cancer.
Liu, Minxia; Zhou, Kecheng; Cao, Yi
2016-09-26
MicroRNAs (miRNAs) have critical roles in lung tumorigenesis and development. To determine aberrantly expressed miRNAs involved in non-small cell lung cancer (NSCLC) and investigate pathophysiological functions and mechanisms, we firstly carried out small RNA deep sequencing in NSCLC cell lines (EPLC-32M1, A549 and 801D) and a human immortalized cell line 16HBE, we then studied miRNA function by cell proliferation and apoptosis. cDNA microarray, luciferase reporter assay and miRNA transfection were used to investigate interaction between the miRNA and target gene. miR-944 was significantly down-regulated in NSCLC and had many putative targets. Moreover, the forced expression of miR-944 significantly inhibited the proliferation of NSCLC cells in vitro. By integrating mRNA expression data and miR-944-target prediction, we disclosed that EPHA7 was a potential target of miR-944, which was further verified by luciferase reporter assay and microRNA transfection. Our data indicated that miR-944 targets EPHA7 in NSCLC and regulates NSCLC cell proliferation, which may offer a new mechanism underlying the development and progression of NSCLC.
Induction of apoptosis in non-small cell lung carcinoma A549 cells by PGD₂ metabolite, 15d-PGJ₂.
Wang, Jun-Jie; Mak, Oi-Tong
2011-11-01
PGD2 (prostaglandin D2) is a mediator in various pathophysiological processes, including inflammation and tumorigenesis. PGD2 can be converted into active metabolites and is known to activate two distinct receptors, DP (PGD2 receptor) and CRTH2/DP2 (chemoattractant receptor-homologous molecule expressed on Th2 cells). In the past, PGD2 was thought to be involved principally in the process of inflammation. However, in recent years, several studies have shown that PGD2 has anti-proliferative ability against tumorigenesis and can induce cellular apoptosis via activation of the caspase-dependent pathway in human colorectal cancer cells, leukaemia cells and eosinophils. In the lung, where PGD2 is highly released when sensitized mast cells are challenged with allergen, the mechanism of PGD2-induced apoptosis is unclear. In the present study, A549 cells, a type of NSCLC (non-small cell lung carcinoma), were treated with PGD2 under various conditions, including while blocking DP and CRTH2/DP2 with the selective antagonists BWA868C and ramatroban respectively. We report here that PGD2 induces A549 cell death through the intrinsic apoptotic pathway, although the process does not appear to involve either DP or CRTH2/DP2. Similar results were also found with H2199 cells, another type of NSCLC. We found that PGD2 metabolites induce apoptosis effectively and that 15d-PGJ2 (15-deoxy-Δ12,14-prostaglandin J2) is a likely candidate for the principal apoptotic inducer in PGD2-induced apoptosis in NSCLC A549 cells.
Directory of Open Access Journals (Sweden)
Xiaodong Mu
2013-01-01
Full Text Available Epidermal growth factor receptor (EGFR is one of the most promising targets for non-small-cell lung cancer (NSCLC. Icotinib, a highly selective EGFR tyrosine kinase inhibitor (EGFR-TKI, has shown promising clinical efficacy and safety in patients with NSCLC. The exact molecular mechanism of icotinib remains unclear. In this study, we first investigated the antiproliferative effect of icotinib on NSCLC cells. Icotinib significantly inhibited proliferation of the EGFR-mutated lung cancer HCC827 cells. The IC50 values at 48 and 72 h were 0.67 and 0.07 μM, respectively. Flow cytometric analysis showed that icotinib caused the G1 phase arrest and increased the rate of apoptosis in HCC827 cells. The levels of cyclin D1 and cyclin A2 were decreased. The apoptotic process was associated with activation of caspase-3, -8, and poly(ADP-ribose polymerase (PARP. Further study revealed that icotinib inhibited phosphorylation of EGFR, Akt, and extracellular signal-regulated kinase. In addition, icotinib upregulated ubiquitin ligase Cbl-b expression. These observations suggest that icotinib-induced upregulation of Cbl-b is responsible, at least in part, for the antitumor effect of icotinib via the inhibition of phosphoinositide 3-kinase (PI3K/Akt and mitogen-activated protein kinase pathways in EGFR-mutated NSCLC cells.
Chun, Sung-Min; Lee, Ji-Young; Choi, Jene; Lee, Je-Hwan; Hwang, Jung Jin; Kim, Chung-Soo; Suh, Young-Ah; Jang, Se Jin
2015-01-01
Histone modification plays a pivotal role on gene regulation, as regarded as global epigenetic markers, especially in tumor related genes. Hence, chemical approaches targeting histone-modifying enzymes have emerged onto the main stage of anticancer drug discovery. Here, we investigated the therapeutic potentials and mechanistic roles of the recently developed histone deacetylase inhibitor, CG200745, in non-small cell lung cancer cells. Treatment with CG200745 increased the global level of his...
Assesment of prognostic factors in radical radiotherapy for patients with non-small cell lung cancer
International Nuclear Information System (INIS)
Chmielewska, E.
2000-01-01
Lung cancer is still the most severe problem of oncology throughout the word. In Poland there are some 20 000 new cases per annum, among them non-small cell lung cancer accounts for about 16 000 cases. The basic method of therapy of non-small cell lung cancers is surgery; however, in Polish conditions only about 15% of patients qualify for it. Therefore, there remains a large group of patients who are potential candidates for radiotherapy. Evaluation of a group of patients qualified for radical radiotherapy according to uniform rules, treated with the same protocol and assesed by the same group of physicians. The obtained results of therapy allow to evaluate the usefulness of radical radiotherapy in patients with non-operable non-small cell lung cancer and serve as a basis of search for more effective radiotherapy protocols. The aim of the study is to attempt to define the prognostic, therapeutical, clinical-and population-related factors for survival and local control in patients with non-operable, non-small cell lung cancer. Between January 1, 1990, and December 31, 1995, there were 2330 patients with non-small cell lung in the Ambulatory of the Cancer Centre in Warsaw. Basing on the results of clinical examination and additional examination, 260 patients qualified for radical radiotherapy. In this group there were 31 women (12%) and 229 men (88%). In a majority of cases the stage of the disease was advanced: stage IIIA was found in 114 patients (44%), and stage IIIB in 73 patients (28%). Retrospective analysis of the results of treatment was carried out. The material covered 260 patients. The survival time and the time to local progression were the basis for the analysis. The survival probability was calculated whit the Kaplan-Meier method. Multidimensional analysis of the prognostic factors (age, clinical advancement of the disease, performance status, loss of weight, LDH and haemoglobin level, tumour size, pulmonary function, prior exploratory thoracotomy
Lifescience Database Archive (English)
Full Text Available SS (Link to library) SSF460 (Link to dictyBase) - - - Contig-U03803-1 SSF460Z (Link... to Original site) - - SSF460Z 453 - - - - Show SSF460 Library SS (Link to library) Clone ID SSF460 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SS/SSF4-C/SSF460Q.Seq.d/ Representative seq. ID SSF46...0Z (Link to Original site) Representative DNA sequence >SSF460 (SSF460Q) /CSM/SS/SSF4-C/SSF460Q.Seq.d/ XXXXX...s) Value SSM309 (SSM309Q) /CSM/SS/SSM3-A/SSM309Q.Seq.d/ 424 e-118 SSH196 (SSH196Q) /CSM/SS/SSH1-D/SSH196Q.Seq.d/ 424 e-118 SSF4
International Nuclear Information System (INIS)
Tucker, Susan L.; Jin Hekun; Wei Xiong
2010-01-01
Purpose: To compute the risk of radiation pneumonitis (RP) as a function of mean lung dose (MLD), with RP scored using three grading systems and analyzed at four threshold levels of toxicity in a large cohort of patients with non-small cell lung cancer (NSCLC) treated with definitive radiotherapy (RT). Methods and Materials: On the basis of medical records and radiographic images, RP was scored retrospectively in 442 patients with NSCLC who had ≥6 months of follow-up after the end of RT. The severity of RP was scored for each patient using the National Cancer Institute (NCI) Common Toxicity Criteria, version 2.0 (CTC2.0); the NCI Common Terminology Criteria for Adverse Events, version 3.0 (CTCAE3.0); and the grading system of the Radiation Therapy Oncology Group (RTOG). For each grading system and for each of four levels of toxicity (Grade ≥1, ≥2, ≥3, ≥4), the Lyman, logistic, and log-logistic normal tissue complication probability (NTCP) models were fitted to the data as functions of MLD. The parameter estimates from the model fits are listed in table form, and the RP risk estimates are presented graphically for the Lyman and log-logistic NTCP models. Results: The results presented here illustrate the impact of scoring system and level of toxicity on the relationship between MLD and RP risk. Conclusions: These results facilitate quantitative comparisons between our data and studies of RP risk reported by others, and several examples of such comparisons are provided.
Management of non-small cell lung cancer with oligometastasis.
Villaruz, Liza C; Kubicek, Gregory J; Socinski, Mark A
2012-08-01
Patients with oligometastatic Non-Small Cell Lung Cancer (NSCLC) present a potential opportunity for curative therapy; however, the challenge remains the definitive treatment of their localized disease and ablation of their limited overt metastatic sites of disease. In selecting patients with oligometastatic NSCLC for definitive therapy, proper staging through radiographic studies, including PET and brain MRI, and the pathologic staging of the mediastinal lymph nodes and potential sites of metastatic disease, are critical. With that in mind, the available literature suggests that in highly selected patients with solitary metastases to the brain, adrenals and other organs, long term survival may be achieved with combined definitive therapy of both the primary lung tumor and the solitary metastatic site.
Directory of Open Access Journals (Sweden)
Shao-Lun Lu
2016-08-01
Full Text Available Maintenance pemetrexed offers survival benefit with well-tolerated toxicities for advanced non-squamous non-small cell lung cancer (NSCLC. We present 3 consecutively enrolled patients with advanced non-squamous NSCLC, receiving stereotactic ablative radiotherapy (SABR for oligoprogressive disease during maintenance pemetrexed. All of them had sustained local control of thoracic oligoprogression after the SABR, while maintenance pemetrexed were kept for additionally long progression-free interval. SABR targeting oligoprogression with continued pemetrexed is an effective and safe approach to extend exposure of maintenance pemetrexed, thus maximizing the benefit from it.
International Nuclear Information System (INIS)
Kriegs, Malte; Gurtner, Kristin; Can, Yildiz; Brammer, Ingo; Rieckmann, Thorsten; Oertel, Reinhard; Wysocki, Marek; Dorniok, Franziska; Gal, Andreas; Grob, Tobias J.; Laban, Simon; Kasten-Pisula, Ulla; Petersen, Cordula; Baumann, Michael; Krause, Mechthild; Dikomey, Ekkehard
2015-01-01
Purpose: How EGF receptor (EGFR) inhibition induces cellular radiosensitization and with that increase in tumor control is still a matter of discussion. Since EGFR predominantly regulates cell cycle and proliferation, we studied whether a G1-arrest caused by EGFR inhibition may contribute to these effects. Materials and methods: We analyzed human non-small cell lung cancer (NSCLC) cell lines either wild type (wt) or mutated in p53 (A549, H460, vs. H1299, H3122) and HCT116 cells (p21 wt and negative). EGFR was inhibited by BIBX1382BS, erlotinib or cetuximab; p21 was knocked down by siRNA. Functional endpoints analyzed were cell signaling, proliferation, G1-arrest, cell survival as well as tumor control using an A549 tumor model. Results: When combined with IR, EGFR inhibition enhances the radiation-induced permanent G1 arrest, though solely in cells with intact p53/p21 signaling. This increase in G1-arrest was always associated with enhanced cellular radiosensitivity. Strikingly, this effect was abrogated when cells were re-stimulated, suggesting the initiation of dormancy. In line with this, only a small non-significant increase in tumor control was observed for A549 tumors treated with fractionated RT and EGFR inhibition. Conclusion: For NSCLC cells increase in radiosensitivity by EGFR inhibition results from enhanced G1-arrest. However, this effect does not lead to improved tumor control because cells can be released from this arrest by re-stimulation
[Construction of lentiviral mediated CyPA siRNA and its functions in non-small cell lung cancer].
FENG, Yan-ming; WU, Yi-ming; TU, Xin-ming; XU, Zheng-shun; WU, Wei-dong
2010-02-01
To construct a lentiviral-vector-mediated CyPA small interference RNA (siRNA) and study its function in non-small cell lung cancer. First, four target sequences were selected according to CyPA mRNA sequence, the complementary DNA contained both sense and antisense oligonucleotides were designed, synthesized and cloned into the pGCL-GFP vector, which contained U6 promoter and green fluorescent protein (GFP). The resulting lentiviral vector containing CyPA shRNA was named Lv-shCyPA, and it was confirmed by PCR and sequencing. Next, it was cotransfected by Lipofectamine 2000 along with pHelper1.0 and pHelper 2.0 into 293T cells to package lentivirus particles. At the same time, the packed virus infected non-small cell lung cancer cell (A549), the level of CyPA protein at 5 d after infection was detected by Western Blot to screen the target of CyPA. A549 were infected with Lv-shCyPA and grown as xenografts in severe combined immunodeficient mice. Cell cycle and apoptosis were measured by FCM. It was confirmed by PCR and DNA sequencing that lentiviral-vector-mediated CyPA siRNA (Lv-shCyPA) producing CyPA shRNA was constructed successfully. The titer of concentrated virus were 1 x 10(7) TU/ml. Flow cytometric analysis demonstrated G2-M phase (11.40% +/- 0.68%) was decreased relatively in A549/LvshCyPA compared with control groups (14.52% +/- 1.19%) (Ppathways may lead to new targeted therapies for non-small cell lung cancer.
Directory of Open Access Journals (Sweden)
Jason T Fong
Full Text Available The use of tyrosine kinase inhibitors (TKIs against EGFR/c-Met in non-small cell lung cancer (NSCLC has been shown to be effective in increasing patient progression free survival (PFS, but their efficacy is limited due to the development of resistance and tumor recurrence. Therefore, understanding the molecular mechanisms underlying development of drug resistance in NSCLC is necessary for developing novel and effective therapeutic approaches to improve patient outcome. This study aims to understand the mechanism of EGFR/c-Met tyrosine kinase inhibitor (TKI resistance in NSCLC. H2170 and H358 cell lines were made resistant to SU11274, a c-Met inhibitor, and erlotinib, an EGFR inhibitor, through step-wise increases in TKI exposure. The IC50 concentrations of resistant lines exhibited a 4-5 and 11-22-fold increase for SU11274 and erlotinib, respectively, when compared to parental lines. Furthermore, mTOR and Wnt signaling was studied in both cell lines to determine their roles in mediating TKI resistance. We observed a 2-4-fold upregulation of mTOR signaling proteins and a 2- to 8-fold upregulation of Wnt signaling proteins in H2170 erlotinib and SU11274 resistant cells. H2170 and H358 cells were further treated with the mTOR inhibitor everolimus and the Wnt inhibitor XAV939. H358 resistant cells were inhibited by 95% by a triple combination of everolimus, erlotinib and SU11274 in comparison to 34% by a double combination of these drugs. Parental H2170 cells displayed no sensitivity to XAV939, while resistant cells were significantly inhibited (39% by XAV939 as a single agent, as well as in combination with SU11274 and erlotinib. Similar results were obtained with H358 resistant cells. This study suggests a novel molecular mechanism of drug resistance in lung cancer.
Pongjit, Kanittha; Chanvorachote, Pithi
2011-12-01
Caveolin-1 (Cav-1) expression frequently found in lung cancer was linked with disease prognosis and progression. This study reveals for the first time that Cav-1 sensitizes cisplatin-induced lung carcinoma cell death by the mechanism involving oxidative stress modulation. We established stable Cav-1 overexpressed (H460/Cav-1) cells and investigated their cisplatin susceptibility in comparison with control-transfected cells and found that Cav-1 expression significantly enhanced cisplatin-mediated cell death. Results indicated that the different response to cisplatin between these cells was resulted from different level of superoxide anion induced by cisplatin. Inhibitory study revealed that superoxide anion inhibitor MnTBAP could inhibit cisplatin-mediated toxicity only in H460/Cav-1 cells while had no effect on H460 cells. Further, superoxide anion detected by DHE probe indicated that H460/Cav-1 cells generated significantly higher superoxide anion level in response to cisplatin than that of control cells. The role of Cav-1 in regulating cisplatin sensitivity was confirmed in shRNA-mediated Cav-1 down-regulated (H460/shCav-1) cells and the cells exhibited decreased cisplatin susceptibility and superoxide generation. In summary, these findings reveal novel aspects regarding role of Cav-1 in modulating oxidative stress induced by cisplatin, possibly providing new insights for cancer biology and cisplatin-based chemotherapy.
Clinical impact of ki-67 labeling index in non-small cell lung cancer
DEFF Research Database (Denmark)
Jakobsen, Jan Nyrop; Sørensen, Jens Benn
2013-01-01
The ki-67 index is a marker of proliferation in malignant tumors. Studies from the period 2000 to 2012 on the prognostic and predictive value of ki-67 labeling index (LI) in non-small cell cancer (NSCLC) are reviewed. Twenty-eight studies reported on the prognostic value of ki-67 index with various...
License Agreements | NCI Technology Transfer Center | TTC
NCI Technology Transfer Center (TTC) licenses the discoveries of NCI and nine other NIH Institutes so new technologies can be developed and commercialized, to convert them into public health benefits.
[Role of PET/CT in primitive non-small cell bronchopulmonary cancer].
Soumia, Fdil; Leila, Achachi; Mohamed, Raoufi; Laila, Herrak; Mustapha, Elftouh
2017-01-01
Bronchopulmonary cancer is a real public health problem. Morphological imaging plays a central role in its diagnosis, staging as well as post-therapeutic assessment but it has some limitations. Metabolic imaging is a more recent technique which allows to significantly improve the overall imagery performance. We conducted a retrospective, descriptive and analytical study at the Ibn Sina Hospital and at the Military Hospital of instruction Mohammed V in Rabat over a period of 18 months, between September 2014 and February 2016, in order to evaluate the role of Fluorodeoxyglucose-PET/CT in the staging and restaging of non-small cell bronchopulmonary cancer. Initial staging showed a vast majority of locally advanced and metastatic stages: stage IV (40%), Stage IIIB (36%), Stage IIIA (16%), Stage II (8%). PET-CT allowed to detect new sites which were not initially seen on CT scan in 24 cases: 15 new ganglion sites, 8 new adrenal sites and 6 sites of bone lesions. PET/CT allowed to modify initial tumor stage in 60% of cases: upstaging in 23 patients (46%) and downstaging in 7 patients(14%). The initial stage remained unchanged in 40% of patients. Our study confirms the data from the literature concerning the superiority of PET-CT in comparison with CT scan, but only in the optimization of the non-small cell bronchopulmonary cancer management, in particular in locoregional and distant staging.
Displays obligations for grants, contracts, training fellowships, intramural research, and management and support, including the number of grant awards, funding amounts, and percent of the total NCI budget.
Ali, A; Fahmy, S
2007-07-01
The objective was to evaluate ovarian dynamics and progesterone concentrations in cyclic (CYC, n=10) and non-cyclic (NCY, n=8) buffalo-cows during Ovsynch program. All cows received GnRH on day 0, PGF2alpha on day 7, and GnRH on day 9, and AI 14 h later. Ovarian structures were monitored by ultrasound and milk samples were collected for progesterone (P4) analysis. The first GnRH resulted in ovulation in CYC (90%) and NCY (62.5%) cows. By day 7, almost all cows had large follicle and lutein tissue. Luteolytic responses to PGF2alpha were 80 and 87.5% for CYC and NCY cows, respectively. Following second GnRH, ovulation occurred in 80% of CYC and 100% of NCY cows. Ovulation began earlier (12 h following second GnRH) and extended for longer (36 h) in NCY cows, when compared to CYC cows (36 and 12 h, respectively). The mean P4 levels increased from days 0 through 7 in CYC and NCY cows and levels were higher in CYC group. Conception rates were 60 and 37.5% in CYC and NYC cows, respectively. Early and asynchronous ovulation and luteal sub-function seemed to be a problem in NCY cows. Inseminating NCY cows twice, at 0 and 24 h of the second GnRH is recommended.
Ni, Xiao Yan; Sui, Hua Xiu; Liu, Yao; Ke, Shi Zhong; Wang, Yi Nan; Gao, Feng Guang
2012-08-01
The effects of TGF-β on dendritic cells (DCs) on the tumor microenvironment are not well understood. We report, here, the establishment of an in vitro lung cancer microenvironment by co-incubation of seminaphtharhodafluor (SNARF) labeled Lewis lung cancer (LLC) cells, carboxyfluorescein succinimidyl ester (CFSE) labeled fibroblasts and 4-chloromethyl-7-hydroxycoumarin (CMHC) labeled DCs. Raw 264.7, EL4 and NCI-H446 cells were able to synthesize TGF-β which was determined by flow cyto-metry and western blotting, respectively. Furthermore, TGF-β efficiently increased regulatory T-cell (Treg) expansion and upregulated DC B7H1 and GITRL expression. TGF-β and the co-incubation of LLC cells, fibroblasts with DCs could augment the expression of B7H1 and GITRL molecules of DCs. The data presented here indicate that the B7H1 and GITRL molecules may play an important role in TGF-β-induced Treg expansion of lung cancer microenvironment.
42 CFR 460.76 - Transportation services.
2010-10-01
... 42 Public Health 4 2010-10-01 2010-10-01 false Transportation services. 460.76 Section 460.76... ELDERLY (PACE) PACE Administrative Requirements § 460.76 Transportation services. (a) Safety, accessibility, and equipment. A PACE organization's transportation services must be safe, accessible, and...
Gao, Xiang; Han, Han
2018-06-01
Jolkinolide B (JB), a bioactive compound isolated from herbal medicine, has been found to inhibit tumor growth by altering glycolysis. However, whether glycolysis is influenced by JB in non-small cell lung cancer (NSCLC) cells and the mechanism remain unknown. The aim of the present study was to evaluate the effect of JB on the glycolysis in NSCLC cells and the underlying molecular mechanism. The results showed that JB treatment inhibited cell viability of A549 and H1299 cells in a concentration-dependent manner. JB reduced the glucose consumption, lactate production, and HK2 expression. The expressions of p-Akt and p-mTOR were also decreased by JB treatment. Knockdown of HK2 reduced glucose consumption and lactate production. Inhibition of the Akt/mTOR pathway decreased HK2 expression and inhibited glycolysis. In conclusion, the results indicated that JB inhibits glycolysis by down-regulating HK2 expression through inactivating the Akt/mTOR pathway in NSCLC cells, suggesting that JB might be a potential therapeutic agent for the treatment of NSCLC. © 2018 Wiley Periodicals, Inc.
Radiotherapy alone for elderly patients with stage III non-small cell lung cancer
International Nuclear Information System (INIS)
Nakano, Kikuo; Hiramoto, Takehiko; Kanehara, Masasi; Doi, Mihoko; Furonaka, Osamu; Miyazu, Yuka; Hada, Yosihiro
1999-01-01
We undertook a retrospective study of elderly patients with stage III non-small cell lung cancer who had been treated solely with radiotherapy during the period 1986 to 1995. Our study was designed to assess the influence of age on survival and malnutrition in patients aged 75 years or older (elderly group) and patients aged 74 years or younger (younger group). Radiotherapy alone resulted in a median survival period of 11.5 months in the younger group and 6.3 months in the elderly group (p=0.0043). With the Cox multivariate model, good performance status, age less than 75 years, and good response were significant favorable independent predictors. Furthermore, the elderly group patients more frequently died of respiratory infections and had lower prognostic nutritional indexes than the younger group patients before and after radiotherapy. These findings suggested elderly patients with stage III non-small cell lung cancer who had been treated with radiotherapy alone had a poor prognosis and that malnutrition caused by radiotherapy was a factor contributing to the risk of death from respiratory infection in such patients. (author)
42 CFR 460.208 - Financial statements.
2010-10-01
... 42 Public Health 4 2010-10-01 2010-10-01 false Financial statements. 460.208 Section 460.208... ELDERLY (PACE) Data Collection, Record Maintenance, and Reporting § 460.208 Financial statements. (a... must submit a certified financial statement that includes appropriate footnotes. (2) The financial...
Directory of Open Access Journals (Sweden)
Fei Long
2015-01-01
Full Text Available Lung cancer consists of two main subtypes: small-cell lung cancer (SCLC and non-small-cell lung cancer (NSCLC that are classified according to their physiological phenotypes. In this study, we have developed a network-based approach to identify molecular biomarkers that can distinguish SCLC from NSCLC. By identifying positive and negative coexpression gene pairs in normal lung tissues, SCLC, or NSCLC samples and using functional association information from the STRING network, we first construct a lung cancer-specific gene association network. From the network, we obtain gene modules in which genes are highly functionally associated with each other and are either positively or negatively coexpressed in the three conditions. Then, we identify gene modules that not only are differentially expressed between cancer and normal samples, but also show distinctive expression patterns between SCLC and NSCLC. Finally, we select genes inside those modules with discriminating coexpression patterns between the two lung cancer subtypes and predict them as candidate biomarkers that are of diagnostic use.
NCI calculations for understanding a physical phase transition in (C6H14N2)[Mn(H2O)6](SeO4)2
Naïli, Houcine; François, Michel; Norquist, Alexander J.; Rekik, Walid
2017-12-01
An organically templated manganese selenate, (C6H14N2)[Mn(H2O)6](SeO4)2, has been synthesized by slow evaporation and crystallographically characterized. The title compound crystallizes at room temperature in the monoclinic centrosymmetric space group P21/n, with the following unit cell parameters: a = 7.2373(4) Å; b = 12.5600(7) Å; c = 10.1945(7) Å; β = 91.155(4)°, V = 926.50(10) Å3and Z = 2. Its crystal structure is built of manganese(II) cations coordinated by six water molecules in octahedral geometry, disordered dabcodiium cations and selenate anions, resulting in an extensive hydrogen-bonding network. Differential scanning calorimetry (DSC) measurement indicated that the precursor undergoes a reversible phase transition at about 216 and 218 K during the cooling and heating processes respectively. Below this temperature the title compound is noncentrosymmetric with space group P21 and lattice parameters a = 7.2033(8) Å; b = 12.4981(13) Å; c = 10.0888(11) Å; β = 91.281(2)°, V = 908.04(17) Å3 and Z = 2. The disorder-order transformation of the C atoms of (C6H14N2)2+ cation may drive the structural phase transition. The low temperature phase obtained by breaking symmetry presents a fully ordered structure. The noncovalent interaction (NCI) method was used not only to locate, quantify, and visualize intermolecular interactions in the high and low temperature phases but also to confirm the phase transition detected by DSC measurement. The thermal decomposition of this new compound proceeds through four stages giving rise to the manganese oxide as final product at 850 °C.
2010-07-01
... 38 Pensions, Bonuses, and Veterans' Relief 1 2010-07-01 2010-07-01 false Death pension. 3.460 Section 3.460 Pensions, Bonuses, and Veterans' Relief DEPARTMENT OF VETERANS AFFAIRS ADJUDICATION Pension, Compensation, and Dependency and Indemnity Compensation Apportionments § 3.460 Death pension. Death pension...
42 CFR 460.72 - Physical environment.
2010-10-01
... 42 Public Health 4 2010-10-01 2010-10-01 false Physical environment. 460.72 Section 460.72 Public...) PACE Administrative Requirements § 460.72 Physical environment. (a) Space and equipment—(1) Safe design..., sanitary, functional, accessible, and comfortable environment for the delivery of services that protects...
42 CFR 460.74 - Infection control.
2010-10-01
... 42 Public Health 4 2010-10-01 2010-10-01 false Infection control. 460.74 Section 460.74 Public...) PACE Administrative Requirements § 460.74 Infection control. (a) Standard procedures. The PACE organization must follow accepted policies and standard procedures with respect to infection control, including...
Spotlight on necitumumab in the treatment of non-small-cell lung carcinoma
Directory of Open Access Journals (Sweden)
Thakur MK
2017-02-01
Full Text Available Manish K Thakur, Antoinette J Wozniak, Department of Oncology, Karmanos Cancer Center, Detroit, MI, USA Abstract: The treatment options for metastatic non-small-cell lung cancer (NSCLC have expanded dramatically in the last 10 years with the discovery of newer drugs and targeted therapy. Epidermal growth factor receptor (EGFR, when aberrantly activated, promotes cell growth and contributes in various ways to the malignant process. EGFR has become an important therapeutic target in a variety of malignancies. Small-molecule tyrosine kinase inhibitors (TKIs of EGFR are being used to treat advanced NSCLC and are particularly effective in the presence of EGFR mutations. Monoclonal antibodies have also been developed that block the EGFR at the cell surface and work in conjunction with chemotherapy. Necitumumab is a second-generation fully human IgG1 monoclonal antibody that has shown promise in metastatic NSCLC. The benefit has mostly been restricted to squamous cell lung cancer in the frontline setting. Considering that the survival advantage for these patients was modest, there is a need to discover biomarkers that will predict which patients will likely have the best outcomes. This review focuses on the development and clinical trial experience with necitumumab in NSCLC. Keywords: lung cancer, squamous cell, necitumumab, EGFR
MiR-107 and MiR-185 can induce cell cycle arrest in human non small cell lung cancer cell lines.
Directory of Open Access Journals (Sweden)
Yukari Takahashi
Full Text Available BACKGROUND: MicroRNAs (miRNAs are short single stranded noncoding RNAs that suppress gene expression through either translational repression or degradation of target mRNAs. The annealing between messenger RNAs and 5' seed region of miRNAs is believed to be essential for the specific suppression of target gene expression. One miRNA can have several hundred different targets in a cell. Rapidly accumulating evidence suggests that many miRNAs are involved in cell cycle regulation and consequentially play critical roles in carcinogenesis. METHODOLOGY/PRINCIPAL FINDINGS: Introduction of synthetic miR-107 or miR-185 suppressed growth of the human non-small cell lung cancer cell lines. Flow cytometry analysis revealed these miRNAs induce a G1 cell cycle arrest in H1299 cells and the suppression of cell cycle progression is stronger than that by Let-7 miRNA. By the gene expression analyses with oligonucleotide microarrays, we find hundreds of genes are affected by transfection of these miRNAs. Using miRNA-target prediction analyses and the array data, we listed up a set of likely targets of miR-107 and miR-185 for G1 cell cycle arrest and validate a subset of them using real-time RT-PCR and immunoblotting for CDK6. CONCLUSIONS/SIGNIFICANCE: We identified new cell cycle regulating miRNAs, miR-107 and miR-185, localized in frequently altered chromosomal regions in human lung cancers. Especially for miR-107, a large number of down-regulated genes are annotated with the gene ontology term 'cell cycle'. Our results suggest that these miRNAs may contribute to regulate cell cycle in human malignant tumors.
Nong, Jingying; Qin, Na; Wang, Jinghui; Yang, Xinjie; Zhang, Hui; Wu, Yuhua; Lv, Jialin; Zhang, Quan; Zhang, Shucai
2013-05-01
Icotinib hydrochloride is the third single target EGFR-TKI used in clinical treatment of advanced non-small cell lung cancer (NSCLC). Clinical research reports on its efficacy and survival in patients with Recurrent Advanced NSCLC are still little.The aim of this study is to evaluate the efficacy and survival of Icotinib hydrochloride for patients with advanced non-small cell lung cancer who failed to previous chemotherapy and explore the association of clinical features with the efficacy and survival. The clinical data of 60 NSCLC patients referred to the Beijing Chest Hospital, Capital Medical University from March 2009 to July 2012 were retrospectively analyzed. The overall response rate (ORR) was 45.0% and the disease control rate (DCR) was 80.0%. The median progression-free survival (PFS) time was 6.7 months. RR and PFS in female were superior to male (P=0.014, 0.013, respectively). RR, DCR in 2nd-line subgroup were superior to ≥3rd-line subgroup (P=0.020, 0.024, respectively). RR, DCR and PFS in EGFR mutation carriers were significantly superior to wild-type patients (P=0.006, Icotinib hydrochloride is effective especially in EGFR mutation carriers and well tolerated in patients with recurrent advanced non-small-cell lung cancer.
International Nuclear Information System (INIS)
Yuan, Bao-Zhu; Chapman, Joshua; Ding, Min; Wang, Junzhi; Jiang, Binghua; Rojanasakul, Yon; Reynolds, Steven H
2013-01-01
Malignant pleural mesothelioma (MPM) is an aggressive malignancy closely associated with asbestos exposure and extremely resistant to current treatments. It exhibits a steady increase in incidence, thus necessitating an urgent development of effective new treatments. Proteasome inhibitors (PIs) and TNFα-Related Apoptosis Inducing Ligand (TRAIL), have emerged as promising new anti-MPM agents. To develop effective new treatments, the proapoptotic effects of PIs, MG132 or Bortezomib, and TRAIL were investigated in MPM cell lines NCI-H2052, NCI-H2452 and NCI-H28, which represent three major histological types of human MPM. Treatment with 0.5-1 μM MG132 alone or 30 ng/mL Bortezomib alone induced a limited apoptosis in MPM cells associated with the elevated Mcl-1 protein level and hyperactive PI3K/Akt signaling. However, whereas 10–20 ng/ml TRAIL alone induced a limited apoptosis as well, TRAIL and PI combination triggered a robust apoptosis in all three MPM cell lines. The robust proapoptotic activity was found to be the consequence of a positive feedback mechanism-governed amplification of caspase activation and cleavage of both Mcl-1 and Akt proteins, and exhibited a relative selectivity in MPM cells than in non-tumorigenic Met-5A mesothelial cells. The combinatorial treatment using TRAIL and PI may represent an effective new treatment for MPMs
Directory of Open Access Journals (Sweden)
Xinyue Liang
2016-01-01
Full Text Available Hormesis and adaptive responses are 2 important biological effects of low-dose ionizing radiation (LDR. In normal tissue, LDR induces hormesis as evinced by increased cell proliferation; however, whether LDR also increases tumor cell proliferation needs to be investigated. In this study, cell proliferation was assayed by total cell numbers and the Cell Counting Kit 8 assay. Mitogen-activated protein kinases (MAPK/extracellular signal-regulated kinase (ERK and phosphatidylinositol 3′ -kinase(PI3K-Akt (PI3K/AKT phosphorylation were determined by Western blot analysis. Human embryonic lung fibroblast 2BS and lung cancer NCI-H446 cell lines were irradiated with LDR at different doses (20-100 mGy. In response to 20 to 75 mGy X-rays, cell proliferation was significantly increased in 2BS but not in NCI-H446 cells. In 2BS cells, LDR at 20 to 75 mGy also stimulated phosphorylation of MAPK/ERK pathway proteins including ERK, MEK, and Raf and of the PI3K/AKT pathway protein AKT. To test whether ERK1/2 and AKT pathway activation was involved in the stimulation of cell proliferation in 2BS cells, the MAPK/ERK and PI3K/AKT pathways were inhibited using their specific inhibitors, U0126 and LY294002. U0126 decreased the phosphorylation of ERK1/2, and LY294002 decreased the phosphorylation of AKT; each could significantly inhibit LDR-induced 2BS cell proliferation. However, LDR did not stimulate these kinases, and kinase inhibitors also did not affect cell proliferation in the NCI-H446 cells. These results suggest that LDR stimulates cell proliferation via the activation of both MAPK/ERK and PI3K/AKT signaling pathways in 2BS but not in NCI-H446 cells. This finding implies the potential for applying LDR to protect normal tissues from radiotherapy without diminishing the efficacy of tumor therapy.
2017-10-01
with Inoperable Stage I Non-Small Cell Lung Cancer PRINCIPAL INVESTIGATOR: Karen Kelly, MD CONTRACTING ORGANIZATION: University of California...Inhibitor plus Stereotactic Ablative Radiotherapy in Patients with Inoperable Stage I Non-Small Cell Lung Cancer 5b. GRANT NUMBER W81XWH-15-2-0063...immune checkpoint inhibitor MPDL3280A (atezolizumab) in early stage inoperable non-small cell lung cancer . The trial is comprised of a traditional 3 + 3
42 CFR 460.182 - Medicaid payment.
2010-10-01
... 42 Public Health 4 2010-10-01 2010-10-01 false Medicaid payment. 460.182 Section 460.182 Public Health CENTERS FOR MEDICARE & MEDICAID SERVICES, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED...) Payment § 460.182 Medicaid payment. (a) Under a PACE program agreement, the State administering agency...
Liu, Jin-kang; Wang, Xiao-yi; Xiong, Zeng; Zhou, Hui; Zhou, Jian-hua; Fu, Chun-yan; Li, Bo
2008-08-01
To construct a technological platform of 2-dimensional tumor microvascular architecture phenotype (2D-TAMP) expression. Thirty samples of non-small cell lung cancer (NSCLC) were collected after surgery. The corresponding sections of tumor tissue specimens to the slice of CT perfusion imaging were selected. Immunohistochemical staining,Gomori methenamine silver stain, and electron microscope observation were performed to build a technological platform of 2D-TMAP expression by detecting the morphology and the integrity of basement membrane of microvasculature, microvascular density, various microvascular subtype, the degree of the maturity and lumenization of microvasculature, and the characteristics of immunogenetics of microvasculature. The technological platform of 2D-TMAP expression was constructed successfully. There was heterogeneity in 2D-TMAP expression of non-small cell lung cancer. The microvascular of NSCLC had certain characteristics. 2D-TMAP is a key technology that can be used to observe the overall state of micro-environment in tumor growth.
42 CFR 460.152 - Enrollment process.
2010-10-01
... 42 Public Health 4 2010-10-01 2010-10-01 false Enrollment process. 460.152 Section 460.152 Public...) Participant Enrollment and Disenrollment § 460.152 Enrollment process. (a) Intake process. Intake is an intensive process during which PACE staff members make one or more visits to a potential participant's place...
Nguyen, Timothy K; Louie, Alexander V
2015-10-27
A 58-year-old gentleman presenting with a progressive headache, visual disturbance, decreased appetite, and weight loss was found to have a localized clear cell carcinoma of the kidney and synchronous Stage IV non-small cell lung cancer with a solitary brain metastasis. This case illustrates the challenges in distinguishing between primary and metastatic disease in a patient with both renal cell carcinoma and lung cancer. We highlight the uncertainties in the diagnosis and management of this unique clinical scenario and the potential implications on prognosis.
Nickel, Sabrina; Selo, Mohammed Ali; Fallack, Juliane; Clerkin, Caoimhe G; Huwer, Hanno; Schneider-Daum, Nicole; Lehr, Claus-Michael; Ehrhardt, Carsten
2017-12-01
Breast cancer resistance protein (BCRP/ABCG2) has previously been identified with high expression levels in human lung. The subcellular localisation and functional activity of the transporter in lung epithelia, however, remains poorly investigated. The aim of this project was to study BCRP expression and activity in freshly isolated human alveolar epithelial type 2 (AT2) and type 1-like (AT1-like) cells in primary culture, and to compare these findings with data obtained from the NCI-H441 cell line. BCRP expression levels in AT2 and AT1-like cells and in different passages of NCI-H441 cells were determined using q-PCR and immunoblot. Transporter localisation was confirmed by confocal laser scanning microscopy. Efflux and transport studies using the BCRP substrate BODIPY FL prazosin and the inhibitor Ko143 were carried out to assess BCRP activity in the different cell models. BCRP expression decreased during transdifferentiation from AT2 to AT1-like phenotype. Culturing NCI-H441 cells at an air-liquid interface or submersed did not change BCRP abundance, however, BCRP levels increased with passage number. BCRP was localised to the apical membrane and cytosol in NCI-H441 cells. In primary cells, the protein was found predominantly in the nucleus. Functional studies were consistent with expression data. BCRP is differently expressed in AT2 and AT1-like cells with lower abundance and activity in the latter ones. Nuclear BCRP might play a transcriptional role in distal lung epithelium. In NCI-H441 cells, BCRP is expressed in apical cell membranes and its activity is consistent with the localisation pattern.
NCI collaborates with Multiple Myeloma Research Foundation
The National Cancer Institute (NCI) announced a collaboration with the Multiple Myeloma Research Foundation (MMRF) to incorporate MMRF's wealth of genomic and clinical data on the disease into the NCI Genomic Data Commons (GDC), a publicly available datab
42 CFR 460.100 - Emergency care.
2010-10-01
... 42 Public Health 4 2010-10-01 2010-10-01 false Emergency care. 460.100 Section 460.100 Public...) PROGRAMS OF ALL-INCLUSIVE CARE FOR THE ELDERLY (PACE) PROGRAMS OF ALL-INCLUSIVE CARE FOR THE ELDERLY (PACE) PACE Services § 460.100 Emergency care. (a) Written plan. A PACE organization must establish and...
42 CFR 460.62 - Governing body.
2010-10-01
... 42 Public Health 4 2010-10-01 2010-10-01 false Governing body. 460.62 Section 460.62 Public Health... Administrative Requirements § 460.62 Governing body. (a) Governing body. A PACE organization must be operating under the control of an identifiable governing body (for example, a board of directors) or a designated...
Cost and effectiveness studies in non-small cell lung cancer
Directory of Open Access Journals (Sweden)
Pinar Yalcin-Balcik
2015-02-01
Full Text Available Lung cancer disease diagnosis and treatment is costly. As the numbers of inflicted rise so does the economic burden assumed for this cancer type. When the treatment expenditures are considered for all types of cancer, the lung cancer is thought to occupy a 20% share. The disease examined in two basic groups as small-cell lung cancer and non-small cell lung cancer (NSCLC is the most frequently encountered type of its kind nationally and in the World. This study considers the cost, effectiveness and cost effectiveness of platinum based chemotherapy medications with active ingredients pemetrexed and gemcitabine used for NSCLC. A review of studies relevant to the advanced stage NSCLC where majority of patients are positioned is foreseen to be useful to the decision makers since policy makers, regulating authorities and physicians require more information due to increased overall finance and costs, as well as treatment cost effectiveness. Furthermore, due to the entry attempt of pemetrexed active ingredient to the list of reimbursed medications for the first stage lung cancer treatment, it is assumed that a review of studies containing pemetrexed and gemcitabine will draw the attention of decision makers at the Social Security Instutition. [TAF Prev Med Bull 2015; 14(1.000: 55-64
Concurrent chemo-radiotherapy for stage III non-small cell lung cancer
Energy Technology Data Exchange (ETDEWEB)
Inoue, Ryuji; Takada, Yoshiki; Obayashi, Kayoko; Kado, Tetsuji; Yamamoto, Hiroyuki; Hirota, Saeko; Soejima, Toshinori; Suzuki, Yasushi; Mimura, Fumitoshi [Hyogo Medical Center for Adult Disease, Akashi (Japan)
1994-12-01
In patients with unresectable stage III non-small cell lung cancer, we performed chemotherapy and concurrent thoracic radiotherapy. Thirty-five registered patients were intravenously treated with cisplatin (80mg/m{sup 2}) on day 1 and vindesine (3mg/m{sup 2}) on days 1, 3 and were irradiated from days 1 to 10 with single doses of 2.5 Gy up to a total dosage of 20 Gy. Each course lasted 28 days. Patients received 3 courses, and a total dosage of 60 Gy was delivered. Response to this treatment was evaluable in terms of results in 35 patients. Twenty-two patients showed partial response (response rate 62.9%), 10 had no change, and 3 cases had progressive disease. In 7.5 to 37.8 months observation, three PR patients are alive for more than 24 months without recurrence, but eight PR patients died of local relapse, and the median survival time was 15.7 months. Throughout this treatment course, grade 4 leukopenia was noted in 66% and grade 3 thrombocytopenia was observed in 3%. However all were reversible condition and no treatment-related death was observed. However, two cases died due to complications of pulmonary abscess, which occurred in the area of radiation pulmonary fibrosis about one year later after treatment. Although this concurrent chemo-radiotherapy is a tolerable treatment for non-small cell lung cancer and obtained a good response rate, it did not improve the survival rate. (author).
Concurrent chemo-radiotherapy for stage III non-small cell lung cancer
International Nuclear Information System (INIS)
Inoue, Ryuji; Takada, Yoshiki; Obayashi, Kayoko; Kado, Tetsuji; Yamamoto, Hiroyuki; Hirota, Saeko; Soejima, Toshinori; Suzuki, Yasushi; Mimura, Fumitoshi
1994-01-01
In patients with unresectable stage III non-small cell lung cancer, we performed chemotherapy and concurrent thoracic radiotherapy. Thirty-five registered patients were intravenously treated with cisplatin (80mg/m 2 ) on day 1 and vindesine (3mg/m 2 ) on days 1, 3 and were irradiated from days 1 to 10 with single doses of 2.5 Gy up to a total dosage of 20 Gy. Each course lasted 28 days. Patients received 3 courses, and a total dosage of 60 Gy was delivered. Response to this treatment was evaluable in terms of results in 35 patients. Twenty-two patients showed partial response (response rate 62.9%), 10 had no change, and 3 cases had progressive disease. In 7.5 to 37.8 months observation, three PR patients are alive for more than 24 months without recurrence, but eight PR patients died of local relapse, and the median survival time was 15.7 months. Throughout this treatment course, grade 4 leukopenia was noted in 66% and grade 3 thrombocytopenia was observed in 3%. However all were reversible condition and no treatment-related death was observed. However, two cases died due to complications of pulmonary abscess, which occurred in the area of radiation pulmonary fibrosis about one year later after treatment. Although this concurrent chemo-radiotherapy is a tolerable treatment for non-small cell lung cancer and obtained a good response rate, it did not improve the survival rate. (author)
Liu, Guohui; Wang, Chunbo; E, Mingyan
2017-12-20
Non-small cell lung cancer is one of the most commom malignant tumor being harmful to people's life and health. Most of the patients have developed to the last stage which not suitable for surgical indications, so radiation and chemotherapy is the main treatment strategy. In recent years, with the theory of anti-angiogenesis therapy for malignant tumors, apatinib as a promising novel medicine to treat malignant tumors, represents synergistic antitumor effects in combination with radiotherapy. The underlying mechanisms may include make blood vessel normalization, alleviating inner hypoxia, and angiogenic factors regulation. Apatinib in combination with radiotherapy may become a new and effective treatment strategy of non-small cell lung cancer.
Treatment of non-small-cell lung cancer in elderly patients
International Nuclear Information System (INIS)
Berzinec, P.
2017-01-01
Lung cancer is globally the leading cause of cancer-related deaths. Majority of lung cancer cases is diagnosed in elderly patients, aged ≥65 years. In Slovakia, 54% of new lung cancer cases are diagnosed in patients aged ≥65 years, and about 40% in patients aged ≥70 years. An experts panel created by EORTC (European Organisation for Research and Treatment of Cancer) and ISGO (International Society for Geriatric Oncology) published in 2014 updated recommendations for treatment of elderly patients with non-small-cell lung cancer. The brief overview of these recommendations, including a view of the new data published since 2014, is given in this article. (author)
2010-01-01
... 16 Commercial Practices 1 2010-01-01 2010-01-01 false Tax claims. 460.22 Section 460.22 Commercial Practices FEDERAL TRADE COMMISSION TRADE REGULATION RULES LABELING AND ADVERTISING OF HOME INSULATION § 460.22 Tax claims. Do not say or imply that your product qualifies for a tax benefit unless it is true. ...
Bianconi, Francesco; Fravolini, Mario Luca; Bello-Cerezo, Raquel; Minestrini, Matteo; Scialpi, Michele; Palumbo, Barbara
2018-04-01
We retrospectively investigated the prognostic potential (correlation with overall survival) of 9 shape and 21 textural features from non-contrast-enhanced computed tomography (CT) in patients with non-small-cell lung cancer. We considered a public dataset of 203 individuals with inoperable, histologically- or cytologically-confirmed NSCLC. Three-dimensional shape and textural features from CT were computed using proprietary code and their prognostic potential evaluated through four different statistical protocols. Volume and grey-level run length matrix (GLRLM) run length non-uniformity were the only two features to pass all four protocols. Both features correlated negatively with overall survival. The results also showed a strong dependence on the evaluation protocol used. Tumour volume and GLRLM run-length non-uniformity from CT were the best predictor of survival in patients with non-small-cell lung cancer. We did not find enough evidence to claim a relationship with survival for the other features. Copyright© 2018, International Institute of Anticancer Research (Dr. George J. Delinasios), All rights reserved.
Shams, Hoda Z; Mohareb, Rafat M; Helal, Maher H; Mahmoud, Amira E
2010-12-27
The reaction of 2-amino-3-cyano-4,5,6,7-tetrahydrobenzo[b]thiophene with ethyl cyanoacetate gave 2-cyano-N-(3-cyano-4,5,6,7-tetrahydrobenzo[b]thiophen-2-yl)-acetamide. The latter was used to synthesize different heterocyclic derivatives comprising thiophene, thiazole, pyrazole, pyridine, pyrimidine, and coumarin rings. The mechanistic and synthetic pathways depended on regioselective attack and/or cyclization by the cyanoacetamido moiety in the key precursor on various chemical reagents. The competition of the reaction pathways including dipolar cyclization, dinucleophilic-bielectrophilic attack, β-attack, Gewald-type attack, and condensation reactions led to the diversity of the synthesized products. The antitumor activities of the synthesized products were studied and evaluated. Most of the compounds revealed high inhibitory effects when screened in vitro for their antiproliferative activity. Three human cancer cell lines, namely, breast adenocarcinoma (MCF-7), non-small cell lung cancer (NCI-H460) and CNS cancer (SF-268) were used in the screening tests. The simplicity of the synthetic procedures which mainly involved one-pot reactions under mild reaction conditions, the convenience of yield production and the diversity of the reactive sites in the produced systems play a valuable role for further heterocyclic transformations and further biological investigations.
Koskimaki, Jacob E; Karagiannis, Emmanouil D; Tang, Benjamin C; Hammers, Hans; Watkins, D Neil; Pili, Roberto; Popel, Aleksander S
2010-02-01
Angiogenesis is the formation of neovasculature from a pre-existing vascular network. Progression of solid tumors including lung cancer is angiogenesis-dependent. We previously introduced a bioinformatics-based methodology to identify endogenous anti-angiogenic peptide sequences, and validated these predictions in vitro in human umbilical vein endothelial cell (HUVEC) proliferation and migration assays. One family of peptides with high activity is derived from the alpha-fibrils of type IV collagen. Based on the results from the in vitro screening, we have evaluated the ability of a 20 amino acid peptide derived from the alpha5 fibril of type IV collagen, pentastatin-1, to suppress vessel growth in an angioreactor-based directed in vivo angiogenesis assay (DIVAA). In addition, pentastatin-1 suppressed tumor growth with intraperitoneal peptide administration in a small cell lung cancer (SCLC) xenograft model in nude mice using the NCI-H82 human cancer cell line. Pentastatin-1 decreased the invasion of vessels into angioreactors in vivo in a dose dependent manner. The peptide also decreased the rate of tumor growth and microvascular density in vivo in a small cell lung cancer xenograft model. The peptide treatment significantly decreased the invasion of microvessels in angioreactors and the rate of tumor growth in the xenograft model, indicating potential treatment for angiogenesis-dependent disease, and for translational development as a therapeutic agent for lung cancer.
International Nuclear Information System (INIS)
Koskimaki, Jacob E; Karagiannis, Emmanouil D; Tang, Benjamin C; Hammers, Hans; Watkins, D Neil; Pili, Roberto; Popel, Aleksander S
2010-01-01
Angiogenesis is the formation of neovasculature from a pre-existing vascular network. Progression of solid tumors including lung cancer is angiogenesis-dependent. We previously introduced a bioinformatics-based methodology to identify endogenous anti-angiogenic peptide sequences, and validated these predictions in vitro in human umbilical vein endothelial cell (HUVEC) proliferation and migration assays. One family of peptides with high activity is derived from the α-fibrils of type IV collagen. Based on the results from the in vitro screening, we have evaluated the ability of a 20 amino acid peptide derived from the α5 fibril of type IV collagen, pentastatin-1, to suppress vessel growth in an angioreactor-based directed in vivo angiogenesis assay (DIVAA). In addition, pentastatin-1 suppressed tumor growth with intraperitoneal peptide administration in a small cell lung cancer (SCLC) xenograft model in nude mice using the NCI-H82 human cancer cell line. Pentastatin-1 decreased the invasion of vessels into angioreactors in vivo in a dose dependent manner. The peptide also decreased the rate of tumor growth and microvascular density in vivo in a small cell lung cancer xenograft model. The peptide treatment significantly decreased the invasion of microvessels in angioreactors and the rate of tumor growth in the xenograft model, indicating potential treatment for angiogenesis-dependent disease, and for translational development as a therapeutic agent for lung cancer
PD-L1 expression in non-small cell lung cancer : Correlations with genetic alterations
Scheel, Andreas H.; Ansen, Sascha; Schultheis, Anne M.; Scheffler, Matthias; Fischer, Rieke N.; Michels, Sebastian; Hellmich, Martin; George, Julie; Zander, Thomas; Brockmann, Michael; Stoelben, Erich; Groen, Harry; Timens, Wim; Perner, Sven; von Bergwelt-Baildon, Michael; Buettner, Reinhard; Wolf, Juergen
2016-01-01
Inhibition of the PD-1/PD-L1 pathway may induce anticancer immune responses in non-small cell lung cancer (NSCLC). Two PD-L1 immunohistochemistry (IHC) assays have been approved as companion diagnostic tests for therapeutic anti-PD-1 antibodies. However, many aspects of PD-L1 prevalence and
Wei WANG; Ping CHEN; Xianglin PI; Anlan WANG; Xiaoping WEN; Dong HUANG
2008-01-01
Background and objective As other tumors, unresectabe lung cancer can cause many psychological problems to the patients, such as depression and anxiety. The present paper aims to evaluate the status of depression before and after knowing the state of illness in patients with non-small cell lung cancer of stage Ⅲ. Methods 43 casesof newly diagnosed non-small cell lung cancer (NSCLC) with stage Ⅲ were enrolled in the study. All the patients were distributed into three groups and given different...
Directory of Open Access Journals (Sweden)
Lu-Kai Wang
Full Text Available Non-small cell lung cancers (NSCLCs cause high mortality worldwide, and the cancer progression can be activated by several genetic events causing receptor dysregulation, including mutation or amplification. MicroRNAs are a group of small non-coding RNA molecules that function in gene silencing and have emerged as the fine-tuning regulators during cancer progression. MiR-133a is known as a key regulator in skeletal and cardiac myogenesis, and it acts as a tumor suppressor in various cancers. This study demonstrates that miR-133a expression negatively correlates with cell invasiveness in both transformed normal bronchial epithelial cells and lung cancer cell lines. The oncogenic receptors in lung cancer cells, including insulin-like growth factor 1 receptor (IGF-1R, TGF-beta receptor type-1 (TGFBR1, and epidermal growth factor receptor (EGFR, are direct targets of miR-133a. MiR-133a can inhibit cell invasiveness and cell growth through suppressing the expressions of IGF-1R, TGFBR1 and EGFR, which then influences the downstream signaling in lung cancer cell lines. The cell invasive ability is suppressed in IGF-1R- and TGFBR1-repressed cells and this phenomenon is mediated through AKT signaling in highly invasive cell lines. In addition, by using the in vivo animal model, we find that ectopically-expressing miR-133a dramatically suppresses the metastatic ability of lung cancer cells. Accordingly, patients with NSCLCs who have higher expression levels of miR-133a have longer survival rates compared with those who have lower miR-133a expression levels. In summary, we identified the tumor suppressor role of miR-133a in lung cancer outcome prognosis, and we demonstrated that it targets several membrane receptors, which generally produce an activating signaling network during the progression of lung cancer.
The potential diagnostic power of circulating tumor cell analysis for non-small-cell lung cancer.
Ross, Kirsty; Pailler, Emma; Faugeroux, Vincent; Taylor, Melissa; Oulhen, Marianne; Auger, Nathalie; Planchard, David; Soria, Jean-Charles; Lindsay, Colin R; Besse, Benjamin; Vielh, Philippe; Farace, Françoise
2015-01-01
In non-small-cell lung cancer (NSCLC), genotyping tumor biopsies for targetable somatic alterations has become routine practice. However, serial biopsies have limitations: they may be technically difficult or impossible and could incur serious risks to patients. Circulating tumor cells (CTCs) offer an alternative source for tumor analysis that is easily accessible and presents the potential to identify predictive biomarkers to tailor therapies on a personalized basis. Examined here is our current knowledge of CTC detection and characterization in NSCLC and their potential role in EGFR-mutant, ALK-rearranged and ROS1-rearranged patients. This is followed by discussion of the ongoing issues such as the question of CTC partnership as diagnostic tools in NSCLC.
Mu, Xiaodong; Zhang, Ye; Qu, Xiujuan; Hou, Kezuo; Kang, Jian; Hu, Xuejun; Liu, Yunpeng
2013-01-01
Epidermal growth factor receptor (EGFR) is one of the most promising targets for non-small-cell lung cancer (NSCLC). Icotinib, a highly selective EGFR tyrosine kinase inhibitor (EGFR-TKI), has shown promising clinical efficacy and safety in patients with NSCLC. The exact molecular mechanism of icotinib remains unclear. In this study, we first investigated the antiproliferative effect of icotinib on NSCLC cells. Icotinib significantly inhibited proliferation of the EGFR-mutated lung cancer HCC...
Armstrong, Richard A; Gearing, Marla; Bigio, Eileen H; Cruz-Sanchez, Felix F; Duyckaerts, Charles; Mackenzie, Ian R A; Perry, Robert H; Skullerud, Kari; Yokoo, Hideaki; Cairns, Nigel J
2011-11-01
Neuronal intermediate filament inclusion disease (NIFID), a rare form of frontotemporal lobar degeneration (FTLD), is characterized neuropathologically by focal atrophy of the frontal and temporal lobes, neuronal loss, gliosis, and neuronal cytoplasmic inclusions (NCI) containing epitopes of ubiquitin and neuronal intermediate filament (IF) proteins. Recently, the 'fused in sarcoma' (FUS) protein (encoded by the FUS gene) has been shown to be a component of the inclusions of NIFID. To further characterize FUS proteinopathy in NIFID, we studied the spatial patterns of the FUS-immunoreactive NCI in frontal and temporal cortex of 10 cases. In the cerebral cortex, sectors CA1/2 of the hippocampus, and the dentate gyrus (DG), the FUS-immunoreactive NCI were frequently clustered and the clusters were regularly distributed parallel to the tissue boundary. In a proportion of cortical gyri, cluster size of the NCI approximated to those of the columns of cells was associated with the cortico-cortical projections. There were no significant differences in the frequency of different types of spatial patterns with disease duration or disease stage. Clusters of NCI in the upper and lower cortex were significantly larger using FUS compared with phosphorylated, neurofilament heavy polypeptide (NEFH) or α-internexin (INA) immunohistochemistry (IHC). We concluded: (1) FUS-immunoreactive NCI exhibit similar spatial patterns to analogous inclusions in the tauopathies and synucleinopathies, (2) clusters of FUS-immunoreactive NCI are larger than those revealed by NEFH or ΙΝΑ, and (3) the spatial patterns of the FUS-immunoreactive NCI suggest the degeneration of the cortico-cortical projections in NIFID.
Postoperative Radiation Therapy in Resected N2 Stage Non-Small Cell Lung Cancer
International Nuclear Information System (INIS)
Lee, Chang Geol
1993-01-01
A total of forty patients with resected N2 stage non-small cell lung cancer treated with postoperative adjuvant radiation therapy between Jan. 1975 and Dec. 1990 at the Department of Radiation Oncology, Yonsei University College of Medicine, Yonsei Cancer Center were retrospectively analysed to evaluate whether postoperative radiation therapy improves survival. Patterns of failure and prognostic factors affecting survival were also analysed. The 5 year overall and disease free survival rate were 26.3%, 27.3% and median survival 23.5 months. The 5 year survival rates by T-stage were T1 66.7%, T2 25.6% and T3 12.5%. Loco-regional failure rate was 14.3% and distant metastasis rate was 42.9% and both 2.9%. Statistically significant factor affecting distant failure rate was number of positive lymph nodes(>= 4). This retrospective study suggests that postoperative radiation therapy in resected N2 stage non-small cell lung cancer can reduce loco-regional recurrence and may improve survival rate as compared with other studies which were treated by surgery alone. Further study of systemic control is also needed due to high rate of distant metastasis
Directory of Open Access Journals (Sweden)
Taisuke Matsuo
Full Text Available Small cell lung cancer (SCLC is aggressive, with rapid growth and frequent bone metastasis; however, its detailed molecular mechanism remains poorly understood. Here, we report the critical role of early growth factor 4 (EGR4, a DNA-binding, zinc-finger transcription factor, in cell proliferation of SCLC. EGR4 overexpression in HEK293T cells conferred significant upregulation of specific splice variants of the parathyroid hormone-related protein (PTHrP gene, resulting in enhancement of the secretion of PTHrP protein, a known mediator of osteolytic bone metastasis. More importantly, depletion of EGR4 expression by siRNA significantly suppressed growth of the SCLC cell lines, SBC-5, SBC-3 and NCI-H1048. On the other hand, introduction of EGR4 into NIH3T3 cells significantly enhanced cell growth. We identified four EGR4 target genes, SAMD5, RAB15, SYNPO and DLX5, which were the most significantly downregulated genes upon depletion of EGR4 expression in all of the SCLC cells examined, and demonstrated the direct recruitment of EGR4 to their promoters by ChIP and luciferase reporter analysis. Notably, knockdown of the expression of these genes by siRNA remarkably suppressed the growth of all the SCLC cells. Taken together, our findings suggest that EGR4 likely regulates the bone metastasis and proliferation of SCLC cells via transcriptional regulation of several target genes, and may therefore be a promising target for the development of anticancer drugs for SCLC patients.
Rivera, Gildardo; Ahmad Shah, Syed Shoaib; Arrieta-Baez, Daniel; Palos, Isidro; Mongue, Antonio; Sánchez-Torres, Luvia Enid
2017-01-01
Quinoxalines display diverse and interesting pharmacological activities as antibacterial, antiviral, antiparasitic and anticancer agents. Particularly, their 1ˏ4-di-N-oxide derivatives have proved to be cytotoxic agents that are active under hypoxic conditions as that of solid tumours. A new series of quinoxaline 1ˏ4-di-N-oxide substitutes at 7-position with esters group were synthetized and characterized by infrared (IR), proton nuclear magnetic resonance (1H-NMR), spectroscopy, and elemental analysis. Seventeen derivatives (M1-M3, E1-E8, P1-P3 and DR1-DR3) were selected and evaluated for antitumor activities using the NCI-60 human tumor cell lines screen. Results showed that E7, P3 and E6 were the most active compounds against the cell lines tested. Substitutions at 7-position with esters group not necessarily affect the biological activity, but the nature of the esters group could exert an influence on the selectivity. Additionally, substitutions at 2-position influenced the cytotoxic activity of the compounds. PMID:29201086
DEFF Research Database (Denmark)
Jakobsen, Jan Nyrop; Sørensen, Jens Benn
2012-01-01
Biomarker expression is increasingly being used to customize treatment in non-small cell lung cancer (NSCLC). The choice of systemic treatment usually depends on biomarker expression in the initial diagnostic biopsy taken before initiation of first-line treatment. Chemotherapy induces DNA damages...
Local pH Monitoring of Small Cluster of Cells using a Fiber-Optic Dual-Core Micro-Probe.
Chen, Sisi; Yang, Qingbo; Xiao, Hai; Shi, Honglan; Ma, Yinfa
2017-03-31
Biological studies of tissues and cells have enabled numerous discoveries, but these studies still bear potential risks of invalidation because of cell heterogeneity. Through high-accuracy techniques, recent studies have demonstrated that discrepancies do exist between the results from low-number-cell studies and cell-population-based results. Thus the urgent need to re-evaluate key principles on limited number of cells has been provoked. In this study, a novel designed dual-core fiber-optic pH micro-probe was fabricated and demonstrated for niche environment pH sensing with high spatial resolution. An organic-modified silicate (OrMoSils) sol-gel thin layer was functionalized by entrapping a pH indicator, 2', 7'-Bis (2-carbonylethyl)-5(6)-carboxyfluorescein (BCECF), on a ~70 μm sized probe tip. Good linear correlation between fluorescence ratio of I 560 nm /I 640 nm and intercellular pH values was obtained within a biological-relevant pH range from 6.20 to 7.92 (R 2 = 0.9834), and with a pH resolution of 0.035 ± 0.005 pH units. The probe's horizontal spatial resolution was demonstrated to be less than 2mm. Moreover, the probe was evaluated by measuring the localized extracellular pH changes of cultured human lung cancer cells (A549) when exposed to titanium dioxide nanoparticles (TiO 2 NPs). Results showed that the probe has superior capability for fast, local, and continual monitoring of a small cluster of cells, which provides researchers a fast and accurate technique to conduct local pH measurements for cell heterogeneity-related studies.
Directory of Open Access Journals (Sweden)
Tomoaki Sonoda
Full Text Available In non-small cell lung cancer (NSCLC with an epidermal growth factor receptor (EGFR mutation, 50%–65% of cases acquire resistance after treatment with EGFR-tyrosine kinase inhibitors (EGFR-TKIs because of an EGFR T790M point mutation and 3%–14% of these cases transformed to small cell lung cancer (SCLC. Generally, the EGFR T790M secondary mutation develops with ongoing ATP competitive inhibition. We present a case of a 76-year-old woman with lung adenocarcinoma harboring an EGFR-L858R mutation who received first-line gefitinib and developed SCLC transformation. She was administered several chemotherapy agents, including a platinum doublet. The primary lesion that showed SCLC transformation had reconverted to adenocarcinoma with EGFR L858R and T790M mutations at the time of a second re-biopsy. Therefore, she was administered osimertinib, which resulted in clinical remission. This case suggested that serial biopsies are necessary even after SCLC transformation. Keywords: NSCLC, EGFR mutation, SCLC transformation, T790M, Osimertinib
Gibbin, Emma M; Putnam, Hollie M; Davy, Simon K; Gates, Ruth D
2014-06-01
Regulating intracellular pH (pHi) is critical for optimising the metabolic activity of corals, yet the mechanisms involved in pH regulation and the buffering capacity within coral cells are not well understood. Our study investigated how the presence of symbiotic dinoflagellates affects the response of pHi to PCO2-driven seawater acidification in cells isolated from Pocillopora damicornis. Using the fluorescent dye BCECF-AM, in conjunction with confocal microscopy, we simultaneously characterised the pHi response in host coral cells and their dinoflagellate symbionts, in symbiotic and non-symbiotic states under saturating light, with and without the photosynthetic inhibitor DCMU. Each treatment was run under control (pH 7.8) and CO2-acidified seawater conditions (decreasing pH from 7.8 to 6.8). After 105 min of CO2 addition, by which time the external pH (pHe) had declined to 6.8, the dinoflagellate symbionts had increased their pHi by 0.5 pH units above control levels when in the absence of DCMU. In contrast, in both symbiotic and non-symbiotic host coral cells, 15 min of CO2 addition (0.2 pH unit drop in pHe) led to cytoplasmic acidosis equivalent to 0.3-0.4 pH units irrespective of whether DCMU was present. Despite further seawater acidification over the duration of the experiment, the pHi of non-symbiotic coral cells did not change, though in host cells containing a symbiont cell the pHi recovered to control levels when photsynthesis was not inhibited. This recovery was negated when cells were incubated with DCMU. Our results reveal that photosynthetic activity of the endosymbiont is tightly coupled with the ability of the host cell to recover from cellular acidosis after exposure to high CO2/low pH. © 2014. Published by The Company of Biologists Ltd.
Ying Swan Ho; Lian Yee Yip; Nurhidayah Basri; Vivian Su Hui Chong; Chin Chye Teo; Eddy Tan; Kah Ling Lim; Gek San Tan; Xulei Yang; Si Yong Yeo; Mariko Si Yue Koh; Anantham Devanand; Angela Takano; Eng Huat Tan; Daniel Shao Weng Tan
2016-01-01
Cytology and histology forms the cornerstone for the diagnosis of non-small cell lung cancer (NSCLC) but obtaining sufficient tumour cells or tissue biopsies for these tests remains a challenge. We investigate the lipidome of lung pleural effusion (PE) for unique metabolic signatures to discriminate benign versus malignant PE and EGFR versus non-EGFR malignant subgroups to identify novel diagnostic markers that is independent of tumour cell availability. Using liquid chromatography mass spect...
Maciag, Anna E; Chakrapani, Harinath; Saavedra, Joseph E; Morris, Nicole L; Holland, Ryan J; Kosak, Ken M; Shami, Paul J; Anderson, Lucy M; Keefer, Larry K
2011-02-01
Non-small-cell lung cancer is among the most common and deadly forms of human malignancies. Early detection is unusual, and there are no curative therapies in most cases. Diazeniumdiolate-based nitric oxide (NO)-releasing prodrugs are a growing class of promising NO-based therapeutics. Here, we show that O(2)-(2,4-dinitrophenyl)-1-[(4-ethoxycarbonyl)piperazin-1-yl]diazen-1-ium-1,2-diolate (JS-K) is a potent cytotoxic agent against a subset of human non-small-cell lung cancer cell lines both in vitro and as xenografts in mice. JS-K treatment led to 75% reduction in the growth of H1703 lung adenocarcinoma cells in vivo. Differences in sensitivity to JS-K in different lung cancer cell lines seem to be related to their endogenous levels of reactive oxygen species (ROS)/reactive nitrogen species (RNS). Other related factors, levels of peroxiredoxin 1 (PRX1) and 8-oxo-deoxyguanosine glycosylase (OGG1), also correlated with drug sensitivity. Treatment of the lung adenocarcinoma cells with JS-K resulted in oxidative/nitrosative stress in cells with high basal levels of ROS/RNS, which, combined with the arylating properties of the compound, was reflected in glutathione depletion and alteration in cellular redox potential, mitochondrial membrane permeabilization, and cytochrome c release. Inactivation of manganese superoxide dismutase by nitration was associated with increased superoxide and significant DNA damage. Apoptosis followed these events. Taken together, the data suggest that diazeniumdiolate-based NO-releasing prodrugs may have application as a personalized therapy for lung cancers characterized by high levels of ROS/RNS. PRX1 and OGG1 proteins, which can be easily measured, could function as biomarkers for identifying tumors sensitive to the therapy.
Curative radiotherapy in non-small cell carcinoma of the lung
International Nuclear Information System (INIS)
Talton, B.M.; Constable, W.C.; Kersh, C.R.
1990-01-01
Recent reports suggest radiotherapy administered to the 5000-6000 cGy level can result in significant long-term survival in non-small cell carcinoma of the lung. This is particularly true for many cases that are technically operable but for medical or other reasons thoracotomy cannot be performed. Such patients drawn from Southern Appalachia where the principal industry is coal mining are the subject of this report. In this region coal miners pneumoconiosis (black lung) is common as well as other chronic respiratory disorders resulting in poor tolerance for surgery. Three hundred and eleven cases of non-small cell carcinoma were irradiated during the 4 years of 1980 through 1983. This group consisted of 77 patients with clinical Stage T1, T2, T3 all N0, M0 tumors, the majority of which were technically operable but upon whom no thoracotomy was performed because of medical reasons or patient refusal. All are available for 5-year study. Each of these patients was uniformly irradiated to 6000 cGy target dose in 30 fractions over 6 weeks using standard techniques.Comparison with reported surgical series treated for cure show little difference in survival up to 2 years. Thereafter, the survival curves diverge with radiotherapy patients dying at a somewhat higher rate although by 4 years both survival curves slope similarly. A possible explanation for this difference is the advantage thoracotomy offers in early case selection allowing exclusion of advance cases from surgical reports whereas radiotherapy must include patients with occult local metastasis not identifiable on clinical grounds. This experience, among other reports include evidence that radiotherapy can result in long-term survival or cure with minimal morbidity in lung cancer patients in whom surgery carries excessive risk
Koulaxouzidis, Georgios; Karagkiouzis, Grigorios; Konstantinou, Marios; Gkiozos, Ioannis; Syrigos, Konstantinos
2013-04-22
The extent of mediastinal lymph node assessment during surgery for non-small cell cancer remains controversial. Different techniques are used, ranging from simple visual inspection of the unopened mediastinum to an extended bilateral lymph node dissection. Furthermore, different terms are used to define these techniques. Sampling is the removal of one or more lymph nodes under the guidance of pre-operative findings. Systematic (full) nodal dissection is the removal of all mediastinal tissue containing the lymph nodes systematically within anatomical landmarks. A Medline search was conducted to identify articles in the English language that addressed the role of mediastinal lymph node resection in the treatment of non-small cell lung cancer. Opinions as to the reasons for favoring full lymphatic dissection include complete resection, improved nodal staging and better local control due to resection of undetected micrometastasis. Arguments against routine full lymphatic dissection are increased morbidity, increase in operative time, and lack of evidence of improved survival. For complete resection of non-small cell lung cancer, many authors recommend a systematic nodal dissection as the standard approach during surgery, and suggest that this provides both adequate nodal staging and guarantees complete resection. Whether extending the lymph node dissection influences survival or recurrence rate is still not known. There are valid arguments in favor in terms not only of an improved local control but also of an improved long-term survival. However, the impact of lymph node dissection on long-term survival should be further assessed by large-scale multicenter randomized trials.
Ishikawa, Rie; Amano, Yosuke; Kawakami, Masanori; Sunohara, Mitsuhiro; Watanabe, Kousuke; Kage, Hidenori; Ohishi, Nobuya; Yatomi, Yutaka; Nakajima, Jun; Fukayama, Masashi; Nagase, Takahide; Takai, Daiya
2016-02-01
Stage IA non-small-cell lung cancer cases have been recognized as having a low risk of relapse; however, occasionally, relapse may occur. To predict clinical outcome in Stage IA non-small-cell lung cancer patients, we searched for chimeric transcripts that can be used as biomarkers and identified a novel chimeric transcript, RUNX1-GLRX5, comprising RUNX1, a transcription factor, and GLRX5. This chimera was detected in approximately half of the investigated Stage IA non-small-cell lung cancer patients (44/104 cases, 42.3%). Although there was no significant difference in the overall survival rate between RUNX1-GLRX5-positive and -negative cases (P = 0.088), a significantly lower relapse rate was observed in the RUNX1-GLRX5-positive cases (P = 0.039), indicating that this chimera can be used as a biomarker for good prognosis in Stage IA patients. Detection of the RUNX1-GLRX5 chimeric transcript may therefore be useful for the determination of a postoperative treatment plan for Stage IA non-small-cell lung cancer patients. © The Author 2015. Published by Oxford University Press.
Quality of life of inoperable non-small cell lung carcinoma
International Nuclear Information System (INIS)
Minet, P.; Chevalier, P.; Gras, A.; Dejardin-Closon, M.T.; Bartsch, P.; Raets, D.; Lennes, G.
1987-01-01
Eighty one patients with inoperable non-small cell lung carcinoma (NSCLC) were entered in a randomized phase II trial comparing split-dose irradiation alone to combined treatment radiotherapy and polychemotherapy (C.A.P. + V.D.S.). The quality of life and the survival of the patients were studied. The authors have defined three classes of quality of life responses based on the time elapsed before the performance status index drops. A higher quality of life failure rate was observed in the combined treatment group (p non-significant) but the time elapsed before the Karnofsky index drops is longer in the combined treatment group for the quality of life 'no change' subgroup (p = 0.15). Survival and quality adjusted survival are similar in both treatment groups. The same conclusion holds for retrospective stratified treatment groups. The authors conclude that as far as the quality of life is concerned, polychemotherapy combined with the particular split-dose irradiation schedule used is an effective treatment of inoperable NSCLC. (Auth.)
2010-01-01
... 14 Aeronautics and Space 4 2010-01-01 2010-01-01 false Security. 460.53 Section 460.53 Aeronautics and Space COMMERCIAL SPACE TRANSPORTATION, FEDERAL AVIATION ADMINISTRATION, DEPARTMENT OF....53 Security. An operator must implement security requirements to prevent any space flight participant...
International Nuclear Information System (INIS)
Shang Wenjun; Zhou Yaohong; Wang Xiaoli; Wu Yizhi; Li Jun
2010-01-01
Objective: To study the relationship between of serum concentrations of CYFRA21-1 and to pathological staging in patients with non-small cell lung cancer. Methods: Serum concentrations of CYFRA21-1 were determined with IRMA in 224 patients with non-small cell lung cancer. Results: The serum CYFRA21-1 levels in patients with non-small cell lung carcinoma increased gradually as the tumor size enlarged. Levels in patients of T2 and T3 stages were significantly higher than those in patients of T1 stage, but the difference between those in patients of T2 stage and T3 stage were not significant. The serum CYFRA21-1 levels also increased as the number of lymph nodes with metastasis increased. Differences of serum levels of CYFRA21-1 in patients of consecutive lymph node stages were all significant. Conclusion: Preoperative detection of the serum concentration of CYFRA21-1 in patient with non-small cell lung cancer has important clinical significance on the judgement of T, N stages. (authors)
SHP1-mediated cell cycle redistribution inhibits radiosensitivity of non-small cell lung cancer
International Nuclear Information System (INIS)
Cao, Rubo; Ding, Qian; Li, Pindong; Xue, Jun; Zou, Zhenwei; Huang, Jing; Peng, Gang
2013-01-01
Radioresistance is the common cause for radiotherapy failure in non-small cell lung cancer (NSCLC), and the degree of radiosensitivity of tumor cells is different during different cell cycle phases. The objective of the present study was to investigate the effects of cell cycle redistribution in the establishment of radioresistance in NSCLC, as well as the signaling pathway of SH2 containing Tyrosine Phosphatase (SHP1). A NSCLC subtype cell line, radioresistant A549 (A549S1), was induced by high-dose hypofractionated ionizing radiations. Radiosensitivity-related parameters, cell cycle distribution and expression of cell cycle-related proteins and SHP1 were investigated. siRNA was designed to down-regulate SHP1expression. Compared with native A549 cells, the proportion of cells in the S phase was increased, and cells in the G0/G1 phase were consequently decreased, however, the proportion of cells in the G2/M phase did not change in A549S1 cells. Moreover, the expression of SHP1, CDK4 and CylinD1 were significantly increased, while p16 was significantly down-regulated in A549S1 cells compared with native A549 cells. Furthermore, inhibition of SHP1 by siRNA increased the radiosensitivity of A549S1 cells, induced a G0/G1 phase arrest, down-regulated CDK4 and CylinD1expressions, and up-regulated p16 expression. SHP1 decreases the radiosensitivity of NSCLC cells through affecting cell cycle distribution. This finding could unravel the molecular mechanism involved in NSCLC radioresistance
International Nuclear Information System (INIS)
Kobyakov, Dmitriy Sergeevich; Avdalyan, Ashot Merudzhanovich; Lazarev, Aleksandr Fedorovich; Lushnikova, Elena Leonidovna; Nepomnyashchikh, Lev Moiseevich
2014-01-01
To evaluate the relation between argyrophilic nucleolar organizer region (AgNOR)-associated proteins and clinicopathological parameters and survival in non-small-cell lung cancer (NSCLC). A total of 207 surgical specimens diagnosed as NSCLC were included in this study. Double-staining procedures were performed using antigen Ki-67 (clone MIB-1) and silver nitrate by immunohistochemical and AgNOR-staining methods. The AgNOR area in MIB-1-positive cells of NSCLC is related to clinicopathological parameters under the TNM (tumor, node, and metastasis) system. The survival of patients with small AgNOR area in MIB-1-positive cells is better than that of patients with large AgNOR area. Molecular, biological (AgNOR area in MIB-1-positive cells), and clinicopathological (greatest tumor dimension, metastases to regional lymph nodes, histology, and differentiation) parameters are independent prognostic factors of NSCLC. The AgNOR area in MIB-1-positive cells is related to clinicopathological parameters and survival in NSCLC
Socioeconomic position and surgery for early-stage non-small-cell lung cancer
DEFF Research Database (Denmark)
Kærgaard Starr, Laila; Osler, Merete; Steding-Jessen, Marianne
2013-01-01
Register 2001-2008 (date of diagnosis, histology, stage, and treatment), the Central Population Register (vital status), the Integrated Database for Labour Market Research (socioeconomic position), and the Danish Hospital Discharge Register (comorbidity). Logistic regression analyses were performed overall......AIM: To examine possible associations between socioeconomic position and surgical treatment of patients with early-stage non-small-cell lung cancer (NSCLC). METHODS: In a register-based clinical cohort study, patients with early-stage (stages I-IIIa) NSCLC were identified in the Danish Lung Cancer...
Small-Molecule-Directed Hepatocyte-Like Cell Differentiation of Human Pluripotent Stem Cells.
Mathapati, Santosh; Siller, Richard; Impellizzeri, Agata A R; Lycke, Max; Vegheim, Karianne; Almaas, Runar; Sullivan, Gareth J
2016-08-17
Hepatocyte-like cells (HLCs) generated in vitro from human pluripotent stem cells (hPSCs) provide an invaluable resource for basic research, regenerative medicine, drug screening, toxicology, and modeling of liver disease and development. This unit describes a small-molecule-driven protocol for in vitro differentiation of hPSCs into HLCs without the use of growth factors. hPSCs are coaxed through a developmentally relevant route via the primitive streak to definitive endoderm (DE) using the small molecule CHIR99021 (a Wnt agonist), replacing the conventional growth factors Wnt3A and activin A. The small-molecule-derived DE is then differentiated to hepatoblast-like cells in the presence of dimethyl sulfoxide. The resulting hepatoblasts are then differentiated to HLCs with N-hexanoic-Tyr, Ile-6 aminohexanoic amide (Dihexa, a hepatocyte growth factor agonist) and dexamethasone. The protocol provides an efficient and reproducible procedure for differentiation of hPSCs into HLCs utilizing small molecules. © 2016 by John Wiley & Sons, Inc. Copyright © 2016 John Wiley & Sons, Inc.
The CXCR4/SDF-1 chemokine receptor axis: a new target therapeutic for non-small cell lung cancer.
Otsuka, Shannon; Bebb, Gwyn
2008-12-01
Chemokines are proinflammatory chemoattractant cytokines that regulate cell trafficking and adhesion. The CXCR4 chemokine receptor and its ligand, stromal cell derived factor (SDF-1), constitute a chemokine/receptor axis that has attracted great interest because of an increasing understanding of its role in cancer, including lung cancer. The CXCR4/SDF-1 complex activates several pathways that mediate chemotaxis, migration and secretion of angiopoietic factors. Neutralization of SDF-1 by anti-SDF-1 or anti-CXCR4 monoclonal antibody in preclinical in vivo studies results in a significant decrease of non-small cell lung cancer metastases. Since anti-SDF-1/CXCR4 strategies have already been developed for use in combating human immunodeficiency virus infections, it is likely that these approaches will be used in clinical trials in non-small cell lung cancer in the very near future.
Hwang, Jung-Ah; Lee, Bo Bin; Kim, Yujin; Hong, Seung-Hyun; Kim, Young-Ho; Han, Joungho; Shim, Young Mog; Yoon, Chae-Yeong; Lee, Yeon-Su; Kim, Duk-Hwan
2015-06-01
This study was aimed at understanding the clinicopathological significance of HOXA9 hypermethylation in non-small cell lung cancer (NSCLC). HOXA9 hypermethylation was characterized in six lung cancer cell lines, and its clinicopathological significance was analyzed using methylation-specific PCR in 271 formalin-fixed paraffin-embedded tissues and 27 fresh-frozen tumor and matched normal tissues from 298 NSCLC patients, and Ki-67 expression was analyzed using immunohistochemistry. The promoter region of HOXA9 was highly methylated in six lung cancer cell lines, but not in normal bronchial epithelial cells. The loss of expression was restored by treatment of the cells with a demethylating agent, 5-aza-2'-deoxycytidine (5-Aza-dC). Transient transfection of HOXA9 into H23 lung cancer cells resulted in the inhibition of cell migration but not proliferation. Conversely, sequence-specific siRNA-mediated knockdown of HOXA9 enhanced cell migration. The mRNA levels of HOXA9 in 27 fresh-frozen tumor tissues were significantly lower than in matched normal tissues (Precurrence-free survival (hazard ratio=3.98, 95% confidence interval = 1.07-17.09, P=0.01) in never-smokers, after adjusting for age, sex, tumor size, adjuvant therapy, pathologic stage, and histology. In conclusion, the present study suggests that HOXA9 inhibits migration of lung cancer cells and its hypermethylation is an independent prognostic factor for recurrence-free survival in never-smokers with NSCLC. © 2014 Wiley Periodicals, Inc.
DEFF Research Database (Denmark)
Krzakowski, Maciej; Ramlau, Rodryg; Jassem, Jacek
2010-01-01
To compare vinflunine (VFL) to docetaxel in patients with stage IIIB/IV non-small-cell lung cancer (NSCLC) who have experienced treatment failure with first-line platinum-based chemotherapy.......To compare vinflunine (VFL) to docetaxel in patients with stage IIIB/IV non-small-cell lung cancer (NSCLC) who have experienced treatment failure with first-line platinum-based chemotherapy....
CRADA Payment Options | NCI Technology Transfer Center | TTC
NCI TTC CRADA PAYMENT OPTIONS: Electronic Payments by Wire Transfer via Fedwire, Mail a check to the Institute or Center, or Automated Clearing House (ACH)/Electronic Funds Transfer (ETF) payments via Pay.gov (NCI ONLY).
Directory of Open Access Journals (Sweden)
Suvankar Das
2018-01-01
Full Text Available Twenty-five piperidines were studied as potential radical scavengers and antitumor agents. Quantitative interaction of compounds with ctDNA using spectroscopic techniques was also evaluated. Our results demonstrate that the evaluated piperidines possesses different abilities to scavenge the radical 2,2-diphenyl-1-picrylhydrazyl (DPPH and the anion radical superoxide (·O2−. The piperidine 19 was the most potent radical DPPH scavenger, while the most effective to ·O2− scavenger was piperidine 10. In general, U251, MCF7, NCI/ADR-RES, NCI-H460 and HT29 cells were least sensitive to the tested compounds and all compounds were considerably more toxic to the studied cancer cell lines than to the normal cell line HaCaT. The binding mode of the compounds and ctDNA was preferably via intercalation. In addition, these results were confirmed based on theoretical studies. Finally, a linear and exponential correlation between interaction constant (Kb and GI50 for several human cancer cell was observed.
Long-Term Excess Mortality for Survivors of Non-small Cell Lung Cancer in the Netherlands
Janssen-Heijnen, Maryska L.; van Steenbergen, Liza N.; Steyerberg, Ewout; Visser, Otto; De Ruysscher, Dirk K.; Groen, Harry J.
Introduction: Most patients diagnosed with non-small cell lung cancer (NSCLC) die within the first few years after diagnosis. However, only little is known about those who have survived these first years. We aimed to study conditional 5-year relative survival rates for NSCLC patients during
The miR-599 promotes non-small cell lung cancer cell invasion via SATB2
International Nuclear Information System (INIS)
Tian, Wenjun; Wang, Guanghai; Liu, Yiqing; Huang, Zhenglan; Zhang, Caiqing; Ning, Kang; Yu, Cuixiang; Shen, Yajuan; Wang, Minghui; Li, Yuantang; Wang, Yong; Zhang, Bingchang; Zhao, Yaoran
2017-01-01
MicroRNAs (miRNAs) play important roles in the pathogenesis of many types of cancers by negatively regulating gene expression at posttranscriptional level. Here, we identified that miR-599 is up-regulated in non-small cell lung cancer (NSCLC) patients. It promoted NSCLC cell proliferation by negatively regulating SATB2. In NSCLC cell lines, CCK-8 proliferation assay indicated that the cell proliferation is promoted by miR-599 mimics. Transwell assay showed that miR-599 mimics promoted the invasion and migration of NSCLC cells. Luciferase assays confirmed that miR-599 directly binds to the 3'untranslated region of SATB2, and western blotting showed that miR-599 suppresses the expression of SATB2 at the protein level. This study indicates that miR-599 promotes proliferation and invasion of NSCLC cell lines via SATB2. The miR-599 may represent a potential therapeutic target for NSCLC treatment. - Highlights: • miR-599 is up-regulated in NSCLC. • miR-599 promotes the proliferation and invasion of NSCLC cells. • miR-599 inhibitors inhibits the proliferation and invasion of NSCLC cells. • miR-599 targets 3′ UTR of SATB2 in NSCLC cells. • miR-599 inhibits SATB2 in NSCLC cells.
Directory of Open Access Journals (Sweden)
S. Suresh Kumar
2014-12-01
Full Text Available Human pluripotent stem cells, including human embryonic stem cells (hESCs and human induced pluripotent stem cells (hiPSCs, hold promise as novel therapeutic tools for diabetes treatment because of their self-renewal capacity and ability to differentiate into beta (β-cells. Small and large molecules play important roles in each stage of β-cell differentiation from both hESCs and hiPSCs. The small and large molecules that are described in this review have significantly advanced efforts to cure diabetic disease. Lately, effective protocols have been implemented to induce hESCs and human mesenchymal stem cells (hMSCs to differentiate into functional β-cells. Several small molecules, proteins, and growth factors promote pancreatic differentiation from hESCs and hMSCs. These small molecules (e.g., cyclopamine, wortmannin, retinoic acid, and sodium butyrate and large molecules (e.g. activin A, betacellulin, bone morphogentic protein (BMP4, epidermal growth factor (EGF, fibroblast growth factor (FGF, keratinocyte growth factor (KGF, hepatocyte growth factor (HGF, noggin, transforming growth factor (TGF-α, and WNT3A are thought to contribute from the initial stages of definitive endoderm formation to the final stages of maturation of functional endocrine cells. We discuss the importance of such small and large molecules in uniquely optimized protocols of β-cell differentiation from stem cells. A global understanding of various small and large molecules and their functions will help to establish an efficient protocol for β-cell differentiation.
Kumar, S. Suresh; Alarfaj, Abdullah A.; Munusamy, Murugan A.; Singh, A. J. A. Ranjith; Peng, I-Chia; Priya, Sivan Padma; Hamat, Rukman Awang; Higuchi, Akon
2014-01-01
Human pluripotent stem cells, including human embryonic stem cells (hESCs) and human induced pluripotent stem cells (hiPSCs), hold promise as novel therapeutic tools for diabetes treatment because of their self-renewal capacity and ability to differentiate into beta (β)-cells. Small and large molecules play important roles in each stage of β-cell differentiation from both hESCs and hiPSCs. The small and large molecules that are described in this review have significantly advanced efforts to cure diabetic disease. Lately, effective protocols have been implemented to induce hESCs and human mesenchymal stem cells (hMSCs) to differentiate into functional β-cells. Several small molecules, proteins, and growth factors promote pancreatic differentiation from hESCs and hMSCs. These small molecules (e.g., cyclopamine, wortmannin, retinoic acid, and sodium butyrate) and large molecules (e.g. activin A, betacellulin, bone morphogentic protein (BMP4), epidermal growth factor (EGF), fibroblast growth factor (FGF), keratinocyte growth factor (KGF), hepatocyte growth factor (HGF), noggin, transforming growth factor (TGF-α), and WNT3A) are thought to contribute from the initial stages of definitive endoderm formation to the final stages of maturation of functional endocrine cells. We discuss the importance of such small and large molecules in uniquely optimized protocols of β-cell differentiation from stem cells. A global understanding of various small and large molecules and their functions will help to establish an efficient protocol for β-cell differentiation. PMID:25526563
Lifescience Database Archive (English)
Full Text Available AF (Link to library) AFA460 (Link to dictyBase) - - - Contig-U15574-1 AFA460Z (Link... to Original site) - - AFA460Z 170 - - - - Show AFA460 Library AF (Link to library) Clone ID AFA460 (Link to dict...yBase) Atlas ID - NBRP ID - dictyBase ID - Link to Contig Contig-U15574-1 Original site URL http://dict...date 2001. 6. 2 Translated Amino Acid sequence ---QIHQTIQVVKITLSSASSSSSSSSSSILNKTRICTYINSNSTHSLXXNIYKYKLPK T...it* Frame B: ---QIHQTIQVVKITLSSASSSSSSSSSSILNKTRICTYINSNSTHSLXXNIYKYKLPK Frame C:
Wang, Jiarui; Zhang, Jinhui; Zhang, Lichuan; Zhao, Long; Fan, Sufang; Yang, Zhonghai; Gao, Fei; Kong, Ying; Xiao, Gary Guishan; Wang, Qi
2011-11-01
This study aimed to determine the relationship between the endogenous levels of P-glycoprotein (P-gp), multidrug resistance-associated protein (MRP), lung resistance-related protein (LRP), glutathione-s-transferase-π (GST‑π) and topoisomerase IIα (TopoIIα) and intrinsic drug resistance in four human lung cancer cell lines, SK-MES-1, SPCA-1, NCI-H-460 and NCI-H-446, of different histological types. The expression of P-gp, MRP, LRP, GST-π and TopoIIα was measured by immunofluorescence, Western blotting and RT-PCR. Drug resistance to cisplatin, doxorubicin and VP-16 was determined using MTT assays. The correlation between expression of the resistance-related proteins and their roles in the resistance to drugs in these cancer cell lines was analyzed. We found that the endogenous levels of P-gp, MRP, LRP, GST-π and TopoIIα in the four cell lines varied. The level of GST-π in the SK-MES-1 cells was the highest, whereas the level of P-gp in the SPCA-1 cells was the lowest. The chemoresistance to cisplatin, doxorubicin and VP-16 in the four cell lines was different. The SPCA-1 cell line was most resistance to cisplatin; SK-MES-1 was most resistance to VP-16; whereas SK-MES-1 was most sensitive to doxorubicin. There was a positive correlation between GST-π expression and resistance to cisplatin, between TopoIIα expression and resistance to VP-16; and a negative correlation was noted between TopoIIα expression and resistance to doxorubicin. In summary, the endogenous expression of P-gp, MRP, LRP, GST-π and TopoIIα was different in the four human lung cancer cell lines of different histological types, and this variance may be associated with the variation in chemosensitivity to cisplatin, doxorubicin and VP-16. Among the related proteins, GST-π may be useful for the prediction of the intrinsic resistance to cisplatin, whereas TopoIIα may be useful to predict resistance to doxorubicin and VP-16 in human lung cancer cell lines.
High frequency of p 16 promoter methylation in non-small cell lung carcinomas from Chile
Directory of Open Access Journals (Sweden)
LEDA M GUZMAN
2007-01-01
Full Text Available The inactivation of tumour suppressor genes by aberrant methylation of promoter regions has been described as a frequent event in neoplasia development, including lung cancer. The p16 gene is a tumour suppressor gene involved in the regulation of cell cycle progression that has been reported to be inactivated by promoter methylation in lung carcinomas at variable frequencies around the world in a smoking habit dependent manner. The purpose of this study was to investigate the methylation status of the promoter region of the p16 gene in 74 non-small cell lung carcinomas from Chile. The frequency of p16 gene inactivation by promoter methylation was determined as 79.7% (59/74. When we considered histological type, we observed that p16 promoter methylation was significantly higher in squamous cell carcinomas (30/33, 91% compared with adenocarcinomas (21/30, 70% (p=0.029. In addition, no association between p16 promoter methylation and gender, age or smoking habit was found (p=0.202, 0.202 and 0.147 respectively. Our results suggest that p16 promoter hypermethylation is a very frequent event in non-small cell lung carcinomas from Chile and could be smoking habit-independent
International Nuclear Information System (INIS)
Tai, Cheng-Jeng; Lee, Horng-Mo; Deng, Win-Ping; Wu, Alexander TH; Chiou, Jeng-Feng; Jan, Hsun-Jin; Wei, Hon-Jian; Hsu, Chung-Huei; Lin, Che-Tong; Chiu, Wen-Ta; Wu, Cheng-Wen
2010-01-01
Invasiveness and metastasis are the most common characteristics of non small cell lung cancer (NSCLC) and causes of tumour-related morbidity and mortality. Mitogen-activated protein kinases (MAPKs) signalling pathways have been shown to play critical roles in tumorigenesis. However, the precise pathological role(s) of mitogen-activated protein kinase phosphatase-1 (MKP-1) in different cancers has been controversial such that the up-regulation of MKP-1 in different cancers does not always correlate to a better prognosis. In this study, we showed that the induction of MKP-1 lead to a significant retardation of proliferation and metastasis in NSCLC cells. We also established that rosiglitazone (a PPARγ agonist) elevated MKP-1 expression level in NSCLC cells and inhibited tumour metastasis. Both wildtype and dominant negative forms of MKP-1 were constitutively expressed in NSCLC cell line H441GL. The migration and invasion abilities of these cells were examined in vitro. MKP-1 modulating agents such as rosiglitazone and triptolide were used to demonstrate MKP-1's role in tumorigenesis. Bioluminescent imaging was utilized to study tumorigenesis of MKP-1 over-expressing H441GL cells and anti-metastatic effect of rosiglitazone. Over-expression of MKP-1 reduced NSCLC cell proliferation rate as well as cell invasive and migratory abilities, evident by the reduced expression levels of MMP-2 and CXCR4. Mice inoculated with MKP-1 over-expressing H441 cells did not develop NSCLC while their control wildtype H441 inoculated littermates developed NSCLC and bone metastasis. Pharmacologically, rosiglitazone, a peroxisome proliferator activated receptor-γ (PPARγ) agonist appeared to induce MKP-1 expression while reduce MMP-2 and CXCR4 expression. H441GL-inoculated mice receiving daily oral rosiglitazone treatment demonstrated a significant inhibition of bone metastasis when compared to mice receiving sham treatment. We found that rosiglitazone treatment impeded the ability
A Meta-Analysis of Platinum Plus Gemcitabine or Vinorelbine for Advanced Non-small Cell Lung Cancer
Directory of Open Access Journals (Sweden)
Guanghui GAO
2009-01-01
Full Text Available Background and objective Platinum plus the third-generation agent doublet chemotherapy is the standard regimens and first line chemotherapy for advanced non-small cell lung cancer (NSCLC. The aim of this study is to determine the benefits and harms of platinum plus gemcitabine or vinorelbine for advanced NSCLC. Methods Thedatabases PubMed, CENTRAL, EMBASE and Chinese Biomedical Literature database were retrieved by using the key words "non small cell lung cancer" or "Carcinoma, Non Small Cell Lung" so as to search the studies about the randomized controlled clinical trials (RCT that had compared the gemcitabine plus platinum versus vinorelbine plus platinum for advanced NSCLC. A meta-analysis was conducted. Results Nine randomized controlled trials, with total 2 186 patients,were included. The overall response rate and one-year survival rate of the gemcitabine group were not significantly different from that of vinorelbine regimen (RR=0.91, 95%CI: 0.81-1.03, P =0.15; RR=1.06, 95%CI: 0.96-1.18, P =0.27, respectively. The incidence rate of grade 3-4 netropenia, constipation, phlebitis and grade 1-4 neuropathy were higher in vinorelbine group, just like higher incidence rate of grade 3-4 thrombocytopenia in the gemcitabine group. Conclusion The curative effects of the gemcitabine or vinorelbine plus platinum regimens are similar. The choice of gemcitabine or vinorelbine depends on the toxicity of the drugs and patients' tolerance.
Radionuclide imaging of small-cell lung cancer (SCLC) using 99mTc-labeled neurotensin peptide 8-13
International Nuclear Information System (INIS)
Zhang Kaijun; An Rui; Gao Zairong; Zhang Yongxue; Aruva, Mohan R.
2006-01-01
Objectives: To prepare 99m technetium ( 99m Tc)-labeled neurotensin (NT) peptide and to evaluate the feasibility of imaging oncogene NT receptors overexpressed in human small-cell lung cancer (SCLC) cells. Methods: The NT analogue (Nα-His)Ac-NT(8-13) was synthesized such that histidine was attached at the N-terminus. The analogue was labeled with [ 99m Tc(H 2 O) 3 (CO) 3 ] at pH 7. 99m Tc-(Nα-His)Ac-NT(8-13) in vitro stability was determined by challenging it with 100 times the molar excess of DTPA, human serum albumin (HSA) and cysteine. The affinity, 99m Tc-(Nα-His)Ac-NT(8-13) binding to SCLC cell line NCI-H446, was studied in vitro. Biodistribution and imaging with 99m Tc-(Nα-His)Ac-NT(8-13) were performed at 4 and 12 h postinjection, and tissue distribution and imaging after receptor blocking were carried out at 4 h in nude mice bearing human SCLC tumor. Blood clearance was determined in normal mice. Results: The affinity constant (K d ) of 99m Tc-(Nα-His)Ac-NT(8-13) to SCLC cells was 0.56 nmol/L. When challenged with 100 times the molar excess of DTPA, HSA or cysteine, more than 97±1.8% radioactivity remained as 99m Tc-(Nα-His)Ac-NT(8-13). Tumor-to-muscle ratio was 3.35±1.01 at 4 h and 4.20±1.35 at 12 h postinjection. The excretory route of 99m Tc-(Nα-His)Ac-NT(8-13) was chiefly through the renal pathway. In the receptor-blocking group treated with unlabeled (Nα-His)Ac-NT(8-13), tumor-to-muscle ratio at 4 h was 1.25±0.55. Conclusion: The results suggest that 99m Tc-(Nα-His)Ac-NT(8-13) specifically binds to the SCLC cells and made 99m Tc-(Nα-His)Ac-NT(8-13) a desirable compound for further studies in planar or SPECT imaging of oncogene receptors overexpressed in SCLC cells
Han, Zhaoguo; Xiao, Yadi; Wang, Kai; Yan, Ji; Xiao, Zunyu; Fang, Fang; Jin, Zhongnan; Liu, Yang; Sun, Xilin; Shen, Baozhong
2018-05-18
Rationale: Elevated expression of the c-Met receptor plays a crucial role in cancers. In non-small cell lung cancer (NSCLC), aberrant activation of c-Met signaling pathway contributes to tumorigenesis and cancer progression, and may mediate acquired resistance to epidermal growth factor receptor-targeted therapy. c-Met is therefore emerging as a promising therapeutic target for treating NSCLC, and the methods for noninvasive in vivo assessment of c-Met expression will improve NSCLC treatment and diagnosis. Methods: A new peptide-based (cMBP) radiotracer targeting c-Met, 99m Tc-hydrazine nicotinamide (HYNIC)-cMBP, was developed for single photon emission computed tomography (SPECT) imaging. Cell uptake assays were performed on two NSCLC cell lines with different c-Met expression: H1993 (high expression) and H1299 (no expression). In vivo tumor specificity was assessed by SPECT imaging in tumor-bearing mice at 0.5, 1, 2 and 4 h after injection of the probe. Blocking assays, biodistribution and autoradiography were also conducted to determine probe specificity. Results: 99m Tc-HYNIC-cMBP was prepared with high efficiency and showed higher uptake in H1993 cells than H1299 cells. Biodistribution and autoradiography also showed significantly higher accumulation of 99m Tc-HYNIC-cMBP in H1993 tumors than H1299 (H1993: 4.74±1.43 %ID/g and H1299: 1.00±0.37 %ID/g at 0.5h, pc-Met was demonstrated by competitive block with excess un-radiolabeled peptide. Conclusion: We developed a novel SPECT tracer, 99m Tc-HYNIC-cMBP, for c-Met-targeted imaging in NSCLC that specifically bound to c-Met with favorable pharmacokinetics in vitro and in vivo. Copyright © 2018 by the Society of Nuclear Medicine and Molecular Imaging, Inc.
A phase II study of gemcitabine in the treatment of non small cell lung cancer
LeChevalier, T; Gottfried, M; Gatzemeier, U; Shepherd, F; Weynants, P; Cottier, B; Groen, HJM; Rosso, R; Mattson, K; CortesFunes, H; Tonato, M; Burkes, RL; Voi, M; Ponzio, A
Gemcitabine is a novel pyrimidine nucleoside whose activity has been demonstrated on solid tumors. We report here the results of a multicentre phase II trial of gemcitabine in chemonaive patients with inoperable non small cell lung cancer (NSCLC). Gemcitabine was given weekly at a dose of 1,250
NCI Visuals Online contains images from the collections of the National Cancer Institute's Office of Communications and Public Liaison, including general biomedical and science-related images, cancer-specific scientific and patient care-related images, and portraits of directors and staff of the National Cancer Institute.
Tumor therapy with 125I-octreotide and 125I-UdR
International Nuclear Information System (INIS)
Fan, W.; Zhu, R.; Yang, C.; Sun, J.J.; Xu, Y.J.; Zhang, Y.J.; Wu, M.J.; Wang, D.J.
2005-01-01
Purpose: To determine the tumor cell damage effect with Auger-electron emitter 125 I in different chemical states. Methods: (1) [Tyr 3 ] octreotide (TOC) and UdR are labeled with 125 I,respectively. (2) Receptor analysis of 125 I-TOC on small cell lung cancer (SCLC) NCI-H446 cell lines is performed comparing with normal lymph cells. NCI-H446 cells added various dose of 125 I-TOC are incubated for different time with 125 I-Nal and non-labeled TOC as control. The capacity of NCI-H446 cell lines bound and internalization of 125 I TOC are determined. The radiation damage of tumor cells is measured by MTF methods. (3) The killing effects of 125 I-UdR in human pancreatic cancer cell line Bax-Pc and Sca-BER bladder carcinoma cells are evaluated with the similar methods. I-UdR penetrating into the Sca-BER cell nucleus is observed with confocal microscope. The grow suppression and clonogenic formation of Sca-BER cells after incubation with 125 I-UdR are analyzed. Proliferation fraction and S phase cell fraction of Sca-BER cell added 125 I-UdR is measured with flow cytometric analysis. Results: (1) Kd=(0.56∼2.0) x 10 -11 mol/L and B max =(1.17∼2.0) x 10 5 cell site are obtained by receptor analysis of 125 I-TOC on NCI-H446 cells. Comparatively, the difference between total binding and non-specific binding is low and there is no saturation of specific binding for normal lymphocyte. About 50% of 125 I-TOC is internalized into the NCI-H446 cell nucleus at 24h after incubation. The damige of NCI-H446 cells by 125 I-TOC is clearly observed. (2) The penetration amount of 125 I-UdR into cell nucleus increases with the incubate time when the concentration of 125 I-UdR is in the range of 10∼500 kBq/mL and reaches the peak fraction of 94% at 36 h after incubation. The radioactivity of 125 I-UdR is then achieved equelibration and no more increased with time. The linear correlation with γ=0.867∼0.978 between the concentration of 125 I-UdR in cell nucleus and the incubation time
42 CFR 460.46 - Civil money penalties.
2010-10-01
... 42 Public Health 4 2010-10-01 2010-10-01 false Civil money penalties. 460.46 Section 460.46 Public...) Sanctions, Enforcement Actions, and Termination § 460.46 Civil money penalties. (a) CMS may impose civil money penalties up to the following maximum amounts: (1) For each violation regarding enrollment or...
DEFF Research Database (Denmark)
Jakobsen, Jan Nyrop; Santoni-Rugiu, Eric; Sørensen, Jens Benn
2014-01-01
BACKGROUND: Thymidylate synthase (TS) is a potential predictive marker for efficacy of treatment with pemetrexed. The current study aimed at investigating whether TS expression changes during non-pemetrexed chemotherapy of non-small cell lung cancer (NSCLC), thus making rebiopsy necessary for dec...
International Nuclear Information System (INIS)
Chun, Ha Chung; Lee, Myung Za
1991-01-01
Twenty five patients with unresectable non-small cell carcinoma of the lung have been treated with hyperfractionated radiotherapy with concomitant boost technique since September, 1989. Those patients with history of previous surgery or chemotherapy, pleural effusion or significant weight loss (greater than 10% of body weight) were excluded from the study. Initially, 27 Gy were delivered in 15 fractions in 3 weeks to the large field. Thereafter, large field received 1.8 Gy and cone down boost field received 1.4Gy with twice a day fractinations up to 49.4Gy. After 49.4Gy, only boost field was treated twice a day with 1.8 and 1.4 Gy. Total tumor doses were 62.2Gy for 12 patients and 65.4Gy for remaining 13 patients. Follow up period was ranged from 6 to 24 month. Actuarial survival rates at 6, 12, and 18 month were 88%, 62%, and 38%, respectively. Corresponding disease free survival rates were 88%, 41%, and 21%, respectively. Actuarial cumulative local failure rates at 9,12 and 15 month were 36%, 42%, and 59%, respectively. No significant increase of acute or late complications including radiation pneumonitis was noted with maximum follow up of 24 month. Although the longer follow up is needed, it is worthwhile to try the prospective randomized study to evaluate the efficacy of hyperfractionated radiotherapy with concomitant boost technique for unresectable non-small cell lung cancers in view of excellent tolerance of this treatment. In the future, further increase of total radiation dose might be necessary to improve local control for non-small cell lung cancer
Directory of Open Access Journals (Sweden)
Yang LI
2008-10-01
Full Text Available Background and objective CCR7 is closely related with the lymph node metastasis of non-small cell lung cancer. The objective of this work is to investigate the expressions of chemokine receptor CCR7, hypoxiainducible factor 1α (HIF-1α and hypoxia inducible factor 2α (HIF-2α protein in non small cell lung cancer and the relationships of their expression, and to study the mechanism of CCR7 upregulation in NSCLC. Methods T he levels of expressions of CCR7, HIF-1α and HIF-2α protein were detected in 94 specimens of human primary non small cell lung cancer by immunohistochemical S-P method. Human lung adenocarcinoma cell line A549 cells were transfected by lipofection with HIF-1α siRNA、HIF-2α siRNA, the change of CCR7 was observed by RT-PCR and immunofluorescence staining. Correlations between the expression of CCR7 and HIF-1α, HIF-2α were respectively analyzed. Results Immunohistochemistry showed that CCR7 was distributed in cytoplasm and/or membrane of tumor cells, HIF-1α, HIF-2α was distributed in nucleus and/or cytoplasm of tumor cells. The levels of expressions of CCR7, HIF-1α and HIF-2α protein were found to be 75.53% (71/94, 54.25% (51/ 94 and 70.21% (66/94 in non small celllung cancer, respectively. the levels of expression of CCR7 protein were closely related to the clinical stages (P 0.05. Furthermore, A significant correlation were found among CCR7, Hif-1α and HIF-2α (r =0.272, P <0.01 (r=0.225, P <0.05. In addition, the expression of CCR7 mRNA and protein levels were decreased in the transfected specificHIF-1α, HIF-2αsiRNA group (P <0.05. Conclusion CCR7 expression is significantly associated with non small cell lung cancer invasion and metastasis. The upregulation of CCR7 is regulated by HIF-1α and HIF-2α in non small cell lung cancer.
Genomic profiling toward precision medicine in non-small cell lung cancer: getting beyond EGFR
Directory of Open Access Journals (Sweden)
Richer AL
2015-02-01
Full Text Available Amanda L Richer,1 Jacqueline M Friel,1 Vashti M Carson,2 Landon J Inge,1 Timothy G Whitsett2 1Norton Thoracic Institute, St Joseph’s Hospital and Medical Center, 2Cancer and Cell Biology Division, Translational Genomics Research Institute, Phoenix, AZ, USA Abstract: Lung cancer remains the leading cause of cancer-related mortality worldwide. The application of next-generation genomic technologies has offered a more comprehensive look at the mutational landscape across the different subtypes of non-small cell lung cancer (NSCLC. A number of recurrent mutations such as TP53, KRAS, and epidermal growth factor receptor (EGFR have been identified in NSCLC. While targeted therapeutic successes have been demonstrated in the therapeutic targeting of EGFR and ALK, the majority of NSCLC tumors do not harbor these genomic events. This review looks at the current treatment paradigms for lung adenocarcinomas and squamous cell carcinomas, examining genomic aberrations that dictate therapy selection, as well as novel therapeutic strategies for tumors harboring mutations in KRAS, TP53, and LKB1 which, to date, have been considered “undruggable”. A more thorough understanding of the molecular alterations that govern NSCLC tumorigenesis, aided by next-generation sequencing, will lead to targeted therapeutic options expected to dramatically reduce the high mortality rate observed in lung cancer. Keywords: non-small cell lung cancer, precision medicine, epidermal growth factor receptor, Kirsten rat sarcoma viral oncogene homolog, serine/threonine kinase 11, tumor protein p53
Lecca, Paola; Morpurgo, Daniele
2012-01-01
Reaction-diffusion based models have been widely used in the literature for modeling the growth of solid tumors. Many of the current models treat both diffusion/consumption of nutrients and cell proliferation. The majority of these models use classical transport/mass conservation equations for describing the distribution of molecular species in tumor spheroids, and the Fick's law for describing the flux of uncharged molecules (i.e oxygen, glucose). Commonly, the equations for the cell movement and proliferation are first order differential equations describing the rate of change of the velocity of the cells with respect to the spatial coordinates as a function of the nutrient's gradient. Several modifications of these equations have been developed in the last decade to explicitly indicate that the tumor includes cells, interstitial fluids and extracellular matrix: these variants provided a model of tumor as a multiphase material with these as the different phases. Most of the current reaction-diffusion tumor models are deterministic and do not model the diffusion as a local state-dependent process in a non-homogeneous medium at the micro- and meso-scale of the intra- and inter-cellular processes, respectively. Furthermore, a stochastic reaction-diffusion model in which diffusive transport of the molecular species of nutrients and chemotherapy drugs as well as the interactions of the tumor cells with these species is a novel approach. The application of this approach to he scase of non-small cell lung cancer treated with gemcitabine is also novel. We present a stochastic reaction-diffusion model of non-small cell lung cancer growth in the specification formalism of the tool Redi, we recently developed for simulating reaction-diffusion systems. We also describe how a spatial gradient of nutrients and oncological drugs affects the tumor progression. Our model is based on a generalization of the Fick's first diffusion law that allows to model diffusive transport in non
42 CFR 460.60 - PACE organizational structure.
2010-10-01
... 42 Public Health 4 2010-10-01 2010-10-01 false PACE organizational structure. 460.60 Section 460... ELDERLY (PACE) PACE Administrative Requirements § 460.60 PACE organizational structure. (a) A PACE organization must be, or be a distinct part of, one of the following: (1) An entity of city, county, State, or...
46 CFR 153.460 - Fire protection systems.
2010-10-01
... 46 Shipping 5 2010-10-01 2010-10-01 false Fire protection systems. 153.460 Section 153.460... Requirements for Flammable Or Combustible Cargoes § 153.460 Fire protection systems. Each self-propelled ship... protection system listed beside the cargo in Table 1 and described in the footnotes to Table 1. (b) The...
2010-01-01
cell lines (NCI-N417, NCI-H345, NCI-N592) were found to convert exogenous NT into the fragments NT1 –8 and NT9–13, reflecting the presence of...secrete NT. However, exogenous NT was degraded primarily to NT1 –11, consistent with the presence of neutral endopeptidase 3.4.24.11 in these cells . This...TITLE: Prostate Cancer Cell Growth: Stimulatory Role of Neurotensin and Mechanism of Inhibition by Flavonoids as Related to Protein Kinase C
Histone methylation-mediated silencing of miR-139 enhances invasion of non-small-cell lung cancer
International Nuclear Information System (INIS)
Watanabe, Kousuke; Amano, Yosuke; Ishikawa, Rie; Sunohara, Mitsuhiro; Kage, Hidenori; Ichinose, Junji; Sano, Atsushi; Nakajima, Jun; Fukayama, Masashi; Yatomi, Yutaka; Nagase, Takahide; Ohishi, Nobuya; Takai, Daiya
2015-01-01
MicroRNA expression is frequently altered in human cancers, and some microRNAs act as oncogenes or tumor suppressors. MiR-139-5p (denoted thereafter as miR-139) has recently been reported to function as a tumor suppressor in several types of human cancer (hepatocellular carcinoma, colorectal cancer, breast cancer, and gastric cancer), but its function in non-small-cell lung cancer (NSCLC) and the mechanism of its suppression have not been studied in detail. MiR-139 was suppressed frequently in primary NSCLCs. MiR-139 is located within the intron of PDE2A and its expression was significantly correlated with the expression of PDE2A. A chromatin immunoprecipitation assay revealed that miR-139 was epigenetically silenced by histone H3 lysine 27 trimethylation (H3K27me3) of its host gene PDE2A and this process was independent of promoter DNA methylation. Pharmacological inhibition of both histone methylation and deacetylation-induced miR-139 with its host gene PDE2A. Ectopic expression of miR-139 in lung cancer cell lines did not affect the proliferation nor the migration but significantly suppressed the invasion through the extracellular matrix. In primary NSCLCs, decreased expression of miR-139 was significantly associated with distant lymph node metastasis and histological invasiveness (lymphatic invasion and vascular invasion) on both univariate and multivariate analyses. Collectively, these results suggest that H3K27me3-mediated silencing of miR-139 enhances an invasive and metastatic phenotype of NSCLC
International Nuclear Information System (INIS)
Kim, Chae Kyun; Chung, June Key; Lee, Yong Jin; Hong, Mee Kyoung; Jeong, Jae Min; Lee, Dong Soo; Lee, Myung Chul
2002-01-01
To clarify the difference in glucose uptake between human cancer cells and monocytes, we studied ( 18 F) fluorodeoxyglucose (FDG) uptake in three human colon cancer cell lines (SNU-C2A, SNU-C4, SNU-C5), one human lung cancer cell line (NCI-H522), and human peripheral blood monocytes. The FDG uptake of both cancer cells and monocytes was increased in glucose-free medium, but decreased in the medium containing 16.7 mM glucose (hyperglycemic). The level of Glut1 mRNA decreased in human colon cancer cells and NCI-H522 under hyperglycemic condition. Glut1 protein expression was also decreased in the four human cancer cell lines under hyperglycemic condition, whereas it was consistently undetectable in monocytes. SNU-C2A, SNU-C4 and NCI-H522 showed a similar level of hexokinase activity (7.5-10.8 mU/mg), while SNU-C5 and moncytes showed lower range of hexokinase activity (4.3-6.5 mU/mg). These data suggest that glucose uptake is regulated by different mechanisms in human cancer cells and monocytes
Liao, Chi-Ren; Kuo, Yueh-Hsiung; Ho, Yu-Ling; Wang, Ching-Ying; Yang, Chang-Syun; Lin, Cheng-Wen; Chang, Yuan-Shiun
2014-07-04
Elaeagnus oldhamii Maxim. is a commonly used traditional herbal medicine. In Taiwan the leaves of E. oldhamii Maxim. are mainly used for treating lung disorders. Twenty five compounds were isolated from the leaves of E. oldhamii Maxim. in the present study. These included oleanolic acid (1), 3-O-(Z)-coumaroyl oleanolic acid (2), 3-O-(E)-coumaroyl oleanolic acid (3), 3-O-caffeoyl oleanolic acid (4), ursolic acid (5), 3-O-(Z)-coumaroyl ursolic acid (6), 3-O-(E)-coumaroyl ursolic acid (7), 3-O-caffeoyl ursolic acid (8), 3β, 13β-dihydroxyolean-11-en-28-oic acid (9), 3β, 13β-dihydroxyurs-11-en-28-oic acid (10), uvaol (11), betulin (12), lupeol (13), kaempferol (14), aromadendrin (15), epigallocatechin (16), cis-tiliroside (17), trans-tiliroside (18), isoamericanol B (19), trans-p-coumaric acid (20), protocatechuic acid (21), salicylic acid (22), trans-ferulic acid (23), syringic acid (24) and 3-O-methylgallic acid (25). Of the 25 isolated compounds, 21 compounds were identified for the first time in E. oldhamii Maxim. These included compounds 1, 4, 5 and 8-25. These 25 compounds were evaluated for their inhibitory activity against the growth of non-small cell lung cancer A549 cells by the MTT assay, and the corresponding structure-activity relationships were discussed. Among these 25 compounds, compound 6 displayed the best activity against the A549 cell line in vitro (CC50=8.56±0.57 μg/mL, at 48 h of MTT asssay). Furthermore, compound 2, 4, 8 and 18 exhibited in vitro cytotoxicity against the A549 cell line with the CC50 values of less than 20 μg/mL at 48 h of MTT asssay. These five compounds 2, 4, 6, 8 and 18 exhibited better cytotoxic activity compared with cisplatin (positive control, CC50 value of 14.87±1.94 μg/mL, at 48 h of MTT asssay). The result suggested that the five compounds might be responsible for its clinical anti-lung cancer effect.
Outcome following radiotherapy for loco-regionally recurrent non-small cell lung cancer
International Nuclear Information System (INIS)
Foo, K.; Yeghiaian-Alvandi, R.; Foroudi, F.
2005-01-01
Local and regional recurrence of non-small cell lung cancer is reported to occur in 13-20% of treatment failures after resection. Reported post-recurrent median survival following radiotherapy ranges from 9 to 14 months. This study examines survival following radiotherapy alone for patients with loco-regionally recurring non-small cell lung cancer after initial surgery. Fifty-five patients, receiving radiotherapy at Westmead Hospital between 1979 and 1997, were eligible for study. Data were collected retrospectively by reviewing patient records. The end-point was overall survival. Symptom control was also recorded. Prognostic factors for analysis included age, sex, original presenting stage, disease-free interval (DFI), performance status, site of recurrence, treatment intent and dose. The median overall survival was 11.5 months (95% confidence interval: 8.1-13.0). Survival following treatment with radical intent was 26 months compared to 10.5 months for patients treated with palliative intent (P = 0.025). There was no significant difference in survival for short (<2 years) or long DFI, performance status, radiation dose, age, sex, site of recurrence or stage. Most patients (55%) had partial or complete resolution of symptoms. Radiotherapy results in overall post-recurrence median survival of nearly 1 year, consistent with previous published data. Radical treatment intent predicts better prognosis as a result of patient selection and higher dose. Radiotherapy is effective at palliating symptoms of this disease Copyright (2005) Blackwell Publishing Asia Pty Ltd
Directory of Open Access Journals (Sweden)
Giulia Donadel
2017-10-01
Full Text Available Background: Diabetes mellitus (DM is a multifactorial disease orphan of a cure. Regenerative medicine has been proposed as novel strategy for DM therapy. Human fibroblast growth factor (FGF-2b controls β-cell clusters via autocrine action, and human placental lactogen (hPL-A increases functional β-cells. We hypothesized whether FGF-2b/hPL-A treatment induces β-cell differentiation from ductal/non-endocrine precursor(s by modulating specific genes expression. Methods: Human pancreatic ductal-cells (PANC-1 and non-endocrine pancreatic cells were treated with FGF-2b plus hPL-A at 500 ng/mL. Cytofluorimetry and Immunofluorescence have been performed to detect expression of endocrine, ductal and acinar markers. Bromodeoxyuridine incorporation and annexin-V quantified cells proliferation and apoptosis. Insulin secretion was assessed by RIA kit, and electron microscopy analyzed islet-like clusters. Results: Increase in PANC-1 duct cells de-differentiation into islet-like aggregates was observed after FGF-2b/hPL-A treatment showing ultrastructure typical of islets-aggregates. These clusters, after stimulation with FGF-2b/hPL-A, had significant (p < 0.05 increase in insulin, C-peptide, pancreatic and duodenal homeobox 1 (PDX-1, Nkx2.2, Nkx6.1, somatostatin, glucagon, and glucose transporter 2 (Glut-2, compared with control cells. Markers of PANC-1 (Cytokeratin-19, MUC-1, CA19-9 were decreased (p < 0.05. These aggregates after treatment with FGF-2b/hPL-A significantly reduced levels of apoptosis. Conclusions: FGF-2b and hPL-A are promising candidates for regenerative therapy in DM by inducing de-differentiation of stem cells modulating pivotal endocrine genes.
42 CFR 460.106 - Plan of care.
2010-10-01
... 42 Public Health 4 2010-10-01 2010-10-01 false Plan of care. 460.106 Section 460.106 Public Health... ALL-INCLUSIVE CARE FOR THE ELDERLY (PACE) PROGRAMS OF ALL-INCLUSIVE CARE FOR THE ELDERLY (PACE) PACE Services § 460.106 Plan of care. (a) Basic requirement. The interdisciplinary team must promptly develop a...
Cytoplasmic RAP1 mediates cisplatin resistance of non-small cell lung cancer.
Xiao, Lu; Lan, Xiaoying; Shi, Xianping; Zhao, Kai; Wang, Dongrui; Wang, Xuejun; Li, Faqian; Huang, Hongbiao; Liu, Jinbao
2017-05-18
Cytotoxic chemotherapy agents (e.g., cisplatin) are the first-line drugs to treat non-small cell lung cancer (NSCLC) but NSCLC develops resistance to the agent, limiting therapeutic efficacy. Despite many approaches to identifying the underlying mechanism for cisplatin resistance, there remains a lack of effective targets in the population that resist cisplatin treatment. In this study, we sought to investigate the role of cytoplasmic RAP1, a previously identified positive regulator of NF-κB signaling, in the development of cisplatin resistance in NSCLC cells. We found that the expression of cytoplasmic RAP1 was significantly higher in high-grade NSCLC tissues than in low-grade NSCLC; compared with a normal pulmonary epithelial cell line, the A549 NSCLC cells exhibited more cytoplasmic RAP1 expression as well as increased NF-κB activity; cisplatin treatment resulted in a further increase of cytoplasmic RAP1 in A549 cells; overexpression of RAP1 desensitized the A549 cells to cisplatin, and conversely, RAP1 depletion in the NSCLC cells reduced their proliferation and increased their sensitivity to cisplatin, indicating that RAP1 is required for cell growth and has a key mediating role in the development of cisplatin resistance in NSCLC cells. The RAP1-mediated cisplatin resistance was associated with the activation of NF-κB signaling and the upregulation of the antiapoptosis factor BCL-2. Intriguingly, in the small portion of RAP1-depleted cells that survived cisplatin treatment, no induction of NF-κB activity and BCL-2 expression was observed. Furthermore, in established cisplatin-resistant A549 cells, RAP1 depletion caused BCL2 depletion, caspase activation and dramatic lethality to the cells. Hence, our results demonstrate that the cytoplasmic RAP1-NF-κB-BCL2 axis represents a key pathway to cisplatin resistance in NSCLC cells, identifying RAP1 as a marker and a potential therapeutic target for cisplatin resistance of NSCLC.
Silencing of Taxol-Sensitizer Genes in Cancer Cells: Lack of Sensitization Effects
International Nuclear Information System (INIS)
Huang, Shang-Lang; Chao, Chuck C.-K.
2015-01-01
A previous genome-wide screening analysis identified a panel of genes that sensitize the human non-small-cell lung carcinoma cell line NCI-H1155 to taxol. However, whether the identified genes sensitize other cancer cells to taxol has not been examined. Here, we silenced the taxol-sensitizer genes identified (acrbp, atp6v0d2, fgd4, hs6st2, psma6, and tubgcp2) in nine other cancer cell types (including lung, cervical, ovarian, and hepatocellular carcinoma cell lines) that showed reduced cell viability in the presence of a sub-lethal concentration of taxol. Surprisingly, none of the genes studied increased sensitivity to taxol in the tested panel of cell lines. As observed in H1155 cells, SKOV3 cells displayed induction of five of the six genes studied in response to a cell killing dose of taxol. The other cell types were much less responsive to taxol. Notably, four of the five inducible taxol-sensitizer genes tested (acrbp, atp6v0d2, psma6, and tubgcp2) were upregulated in a taxol-resistant ovarian cancer cell line. These results indicate that the previously identified taxol-sensitizer loci are not conserved genetic targets involved in inhibiting cell proliferation in response to taxol. Our findings also suggest that regulation of taxol-sensitizer genes by taxol may be critical for acquired cell resistance to the drug
Silencing of Taxol-Sensitizer Genes in Cancer Cells: Lack of Sensitization Effects
Energy Technology Data Exchange (ETDEWEB)
Huang, Shang-Lang [Department of Biochemistry and Molecular Biology, College of Medicine, Chang Gung University, Taoyuan 333, Taiwan (China); Chao, Chuck C.-K., E-mail: cckchao@mail.cgu.edu.tw [Department of Biochemistry and Molecular Biology, College of Medicine, Chang Gung University, Taoyuan 333, Taiwan (China); Graduate Institute of Biomedical Sciences, College of Medicine, Chang Gung University, Taoyuan 333, Taiwan (China); Department of Medical Research and Development, Chang Gung Memorial Hospital, Taoyuan 333, Taiwan (China)
2015-06-16
A previous genome-wide screening analysis identified a panel of genes that sensitize the human non-small-cell lung carcinoma cell line NCI-H1155 to taxol. However, whether the identified genes sensitize other cancer cells to taxol has not been examined. Here, we silenced the taxol-sensitizer genes identified (acrbp, atp6v0d2, fgd4, hs6st2, psma6, and tubgcp2) in nine other cancer cell types (including lung, cervical, ovarian, and hepatocellular carcinoma cell lines) that showed reduced cell viability in the presence of a sub-lethal concentration of taxol. Surprisingly, none of the genes studied increased sensitivity to taxol in the tested panel of cell lines. As observed in H1155 cells, SKOV3 cells displayed induction of five of the six genes studied in response to a cell killing dose of taxol. The other cell types were much less responsive to taxol. Notably, four of the five inducible taxol-sensitizer genes tested (acrbp, atp6v0d2, psma6, and tubgcp2) were upregulated in a taxol-resistant ovarian cancer cell line. These results indicate that the previously identified taxol-sensitizer loci are not conserved genetic targets involved in inhibiting cell proliferation in response to taxol. Our findings also suggest that regulation of taxol-sensitizer genes by taxol may be critical for acquired cell resistance to the drug.
Overmeyer, Jean H; Young, Ashley M; Bhanot, Haymanti; Maltese, William A
2011-01-01
Abstract Background Methuosis is a unique form of non-apoptotic cell death triggered by alterations in the trafficking of clathrin-independent endosomes, ultimately leading to extreme vacuolization and rupture of the cell. Results Here we describe a novel chalcone-like molecule, 3-(2-methyl-1H- indol-3-yl)-1-(4-pyridinyl)-2-propen-1-one (MIPP) that induces cell death with the hallmarks of methuosis. MIPP causes rapid accumulation of vacuoles derived from macropinosomes, based on time-lapse mi...
16 CFR 460.8 - R-value tolerances.
2010-01-01
... 16 Commercial Practices 1 2010-01-01 2010-01-01 false R-value tolerances. 460.8 Section 460.8... INSULATION § 460.8 R-value tolerances. If you are a manufacturer of home insulation, no individual specimen of the insulation you sell can have an R-value more than 10% below the R-value shown in a label, fact...
Msi2 Regulates the Aggressiveness of Non Small Cell Lung Cancer (NSCLC)
2016-10-01
DOD Career Development Award LC140074 (to Y.B.); UNM Core Funding (C.F.M., F.A.S., and S.R.); NCI Grants CA181287 and R21CA191425 (to E.A.G.); a Ruth...Suppl 1:S14-23. 4. Meerbrey KL, et al. (2011) The pINDUCER lentiviral toolkit for inducible RNA interference in vitro and in vivo. Proc Natl Acad Sci U
2010-01-01
... 16 Commercial Practices 1 2010-01-01 2010-01-01 false Labels. 460.12 Section 460.12 Commercial....12 Labels. If you are a manufacturer, you must label all packages of your insulation. The labels must... chart. Labels for these products must state the minimum net weight of the insulation in the package. You...
A. van der Gaast (Ate); C.H.H. Schoenmakers (Christian); T.C. Kok (Tjebbe); B.G. Blijenberg (Bert); W.C.J. Hop (Wim); T.A.W. Splinter (Ted)
1994-01-01
textabstractIn this study, we evaluated the prognostic value of the tumour marker, tissue polypeptide-specific antigen (TPS), in 203 patients with non-small cell lung cancer (NSCLC), and related this to several other known prognostic factors. TPS was significantly correlated with lactate
SSX2-4 expression in early-stage non-small cell lung cancer
DEFF Research Database (Denmark)
Greve, K B V; Pøhl, M; Olsen, K E
2014-01-01
The expression of cancer/testis antigens SSX2, SSX3, and SSX4 in non-small cell lung cancers (NSCLC) was examined, since they are considered promising targets for cancer immunotherapy due to their immunogenicity and testis-restricted normal tissue expression. We characterized three SSX antibodies...... was only detected in 5 of 143 early-stage NSCLCs, which is rare compared to other cancer/testis antigens (e.g. MAGE-A and GAGE). However, further studies are needed to determine whether SSX can be used as a prognostic or predictive biomarker in NSCLC....
Xue, Yuyuan; Liang, Wanshan; Li, Yuan; Wu, Ying; Peng, Xinwen; Qiu, Xueqing; Liu, Jinbin; Sun, Runcang
2016-12-28
A water-soluble, ratiometric fluorescent pH probe, L-SRhB, was synthesized via grafting spirolactam Rhodamine B (SRhB) to lignosulfonate (LS). As the ring-opening product of L-SRhB, FL-SRhB was also prepared. The pH-response experiment indicated that L-SRhB showed a rapid response to pH changes from 4.60 to 6.20 with a pK a of 5.35, which indicated that L-SRhB has the potential for pH detection of acidic organelle. In addition, the two probes were internalized successfully by living cells through the endocytosis pathway and could distinguish normal cells from cancer cells by different cell staining rates. In addition, L-SRhB showed obvious cytotoxicity to cancer cells, whereas it was nontoxic to normal cells in the same condition. L-SRhB might have potential in cancer therapy. L-SRhB might be a promising ratiometric fluorescent pH sensor and bioimaging dye for the recognition of cancer cells. The results also provided a new perspective to the high-value utilization of lignin.
International Fellows of NCI at Frederick | Poster
Each year, the Employee Diversity Team (EDT) acknowledges members of the NCI at Frederick Community for their achievements and contributions towards the mission of facility. Historically, the team has profiled the “Women of NCI at Frederick,” but this year, the team decided to instead shed light on the diverse and successful individuals who make up the international fellows community.
International Nuclear Information System (INIS)
Kuwabara, Kazuaki; Matsuda, Shinya; Fushimi, Kiyohide; Anan, Makoto; Ishikawa, Koichi B.; Horiguchi, Hiromasa; Hayashida, Kenshi; Fujimori, Kenji
2009-01-01
Many reports exist regarding the economic evaluation of evolving chemotherapeutic regimens or diagnostic images for lung cancer (LC) patients. However, it is not clear whether clinical information, such as pathological diagnosis or cancer stage, should be considered as a risk adjustment in lung cancer. This study compared the cost and practice patterns between small cell lung carcinoma (SCLC) and non-small cell lung carcinoma (NSCLC) patients. 6,060 LC patients treated at 58 academic hospitals and 14,507 at 257 community hospitals were analyzed. Study variables included demographic variables, comorbid status, cancer stage, use of imaging and surgical procedures, type of adjuvant therapy (chemotherapy, radiation or chemoradiation), use of ten chemotherapeutic agents, length of stay (LOS), and total charges (TC; US$1=100 yen) in SCLC and NSCLC patients. The impact of pathological diagnosis on LOS and TC was investigated using multivariate analysis. We identified 3,571 SCLC and 16,996 NSCLC patients. The proportion of demographic and practice-process variables differed significantly between SCLC and NSCLC patients, including diagnostic imaging, adjuvant therapy and surgical procedures. Median LOS and TC were 20 days and US$6,015 for SCLC and 18 days and US$6,993 for NSCLC patients, respectively (p<0.001 for each variable). Regression analysis revealed that pathological diagnosis was not correlated with TC. Physicians should acknowledge that pathological diagnosis dose not accounts for any variation in cost of LC patients but that should remain as an indicator of appropriate care like selection of chemotherapeutic agents. (author)
Living with a diagnosis of non-small cell lung cancer: patients' lived experiences.
LENUS (Irish Health Repository)
McCarthy, Ita
2012-01-31
The aim of this study was to explore patients\\' experience of living with non-small cell lung cancer (NSCLC). Patients diagnosed with NSCLC know that their treatment is not with curative intent and can expect distressing symptoms. In this phenomenological study, six adults with a diagnosis of NSCLC were interviewed. Data was analysed guided by van Manen\\'s six-step process. Four main themes were interpreted: \\'Maintaining my life\\'; \\'The enemy within\\'; \\'Staying on the train\\
Directory of Open Access Journals (Sweden)
Yuan CX
2015-03-01
Full Text Available Chun-Xiu Yuan,1,2 Zhi-Wei Zhou,2,3 Yin-Xue Yang,4 Zhi-Xu He,3 Xueji Zhang,5 Dong Wang,6 Tianxing Yang,7 Si-Yuan Pan,8 Xiao-Wu Chen,9 Shu-Feng Zhou2 1Department of Oncology, General Hospital, Ningxia Medical University, Yinchuan, People’s Republic of China; 2Department of Pharmaceutical Science, College of Pharmacy, University of South Florida, Tampa, FL, USA; 3Guizhou Provincial Key Laboratory for Regenerative Medicine, Stem Cell and Tissue Engineering Research Center and Sino-US Joint Laboratory for Medical Sciences, Guiyang Medical University, Guiyang, 4Department of Colorectal Surgery, General Hospital, Ningxia Medical University, Yinchuan, 5Research Center for Bioengineering and Sensing Technology, University of Science and Technology Beijing, 6Cancer Center, Daping Hospital and Research Institute of Surgery, Third Military Medical University, Chongqing, People’s Republic of China; 7Department of Internal Medicine, University of Utah and Salt Lake Veterans Affairs Medical Center, Salt Lake City, UT, USA; 8Department of Pharmacology, School of Chinese Materia Medica, Beijing University of Chinese Medicine, Beijing, 9Department of General Surgery, The First People’s Hospital of Shunde, Southern Medical University, Shunde, People’s Republic of China Abstract: Gastric cancer is the second leading cause of cancer-related death worldwide, with a poor response to current chemotherapy. Danusertib is a pan-inhibitor of the Aurora kinases and a third-generation Bcr-Abl tyrosine kinase inhibitor with potent anticancer effects, but its antitumor effect and underlying mechanisms in the treatment of human gastric cancer are unknown. This study aimed to investigate the effects of danusertib on cell growth, apoptosis, autophagy, and epithelial to mesenchymal transition and the molecular mechanisms involved in human gastric cancer AGS and NCI-N78 cells. The results showed that danusertib had potent growth-inhibitory, apoptosis-inducing, and
Ko, Jen-Chung; Wang, Tai-Jing; Chang, Po-Yuan; Syu, Jhan-Jhang; Chen, Jyh-Cheng; Chen, Chien-Yu; Jian, Yun-Ting; Jian, Yi-Jun; Zheng, Hao-Yu; Chen, Wen-Ching; Lin, Yun-Wei
2015-10-01
Minocycline is a semisynthetic tetracycline derivative; it has anti-inflammatory and anti-cancer effects distinct from its antimicrobial function. However, the molecular mechanism of minocycline-induced cytotoxicity in non-small cell lung cancer (NSCLC) cells has not been identified. Rad51 plays a central role in homologous recombination and high levels of Rad51 expression are observed in chemo- or radioresistant carcinomas. Our previous studies have shown that the MKK1/2-ERK1/2 signal pathway maintains the expression of Rad51 in NSCLC cells. In this study, minocycline treatment inhibited cell viability and proliferation of two NSCLC cells, A549 and H1975. Treatment with minocycline decreased Rad51 mRNA and protein levels through MKK1/2-ERK1/2 inactivation. Furthermore, expression of constitutively active MKK1 (MKK1-CA) vectors significantly rescued the decreased Rad51 protein and mRNA levels in minocycline-treated NSCLC cells. However, combined treatment with MKK1/2 inhibitor U0126 and minocycline further decreased the Rad51 expression and cell viability of NSCLC cells. Knocking down Rad51 expression by transfection with small interfering RNA of Rad51 enhanced the cytotoxicity and cell growth inhibition of minocycline. Mitomycin C (MMC) is typically used as a first or second line regimen to treat NSCLC. Compared to a single agent alone, MMC combined with minocycline resulted in cytotoxicity and cell growth inhibition synergistically in NSCLC cells, accompanied with reduced activation of phospho-ERK1/2, and reduced Rad51 protein levels. Overexpression of MKK1-CA or Flag-tagged Rad51 could reverse the minocycline and MMC-induced synergistic cytotoxicity. These findings may have implications for the rational design of future drug regimens incorporating minocycline and MMC for the treatment of NSCLC. Copyright © 2015 Elsevier Inc. All rights reserved.
Consensus for EGFR mutation testing in non-small cell lung cancer: results from a European workshop
DEFF Research Database (Denmark)
Pirker, Robert; Herth, Felix J F; Kerr, Keith M
2010-01-01
Activating somatic mutations of the tyrosine kinase domain of epidermal growth factor receptor (EGFR) have recently been characterized in a subset of patients with advanced non-small cell lung cancer (NSCLC). Patients harboring these mutations in their tumors show excellent response to EGFR tyros...
Results of concomitant cisplatin and radiotherapy in non-operable non small-cell lung cancer
International Nuclear Information System (INIS)
Antoine, E.; Mazeron, J.J.
1993-01-01
The Radiotherapy and Lung Cancer Cooperative Groups of the EORTC performed a randomized study in patients with non-metastatic inoperable non small-cell lung cancer to compare the results of radiotherapy alone (radiation was administered for two wk at a dose of 3 Gy given 10 times followed by a three-wk rest period and then radiotherapy for two more wk at a dose of 2.5 Gy given 10 times) with radiotherapy on the same schedule combined with cisplatin given either on the first day of each treatment week at a dose of 30 mg/m 2 , or daily before radiotherapy at a dose of 6 mg/m 2 . Preliminary results showed a significantly improved three-yr survival rate in the radiotherapy-daily cisplatin group as compared with the radiotherapy group (16% versus 2%; P = 0.009) and without major increase in toxicity. This survival benefit was due to improved control of local disease; survival without local recurrence was 31% at two yr in the radiotherapy-daily cisplatin group as compared with 19% in the radiotherapy (P = 0.003)
Screening and staging for non-small cell lung cancer by serum laser Raman spectroscopy.
Wang, Hong; Zhang, Shaohong; Wan, Limei; Sun, Hong; Tan, Jie; Su, Qiucheng
2018-08-05
Lung cancer is the leading cause of cancer-related death worldwide. Current clinical screening methods to detect lung cancer are expensive and associated with many complications. Raman spectroscopy is a spectroscopic technique that offers a convenient method to gain molecular information about biological samples. In this study, we measured the serum Raman spectral intensity of healthy volunteers and patients with different stages of non-small cell lung cancer. The purpose of this study was to evaluate the application of serum laser Raman spectroscopy as a low cost alternative method in the screening and staging of non-small cell lung cancer (NSCLC). The Raman spectra of the sera of peripheral venous blood were measured with a LabRAM HR 800 confocal Micro Raman spectrometer for individuals from five groups including 14 healthy volunteers (control group), 23 patients with stage I NSCLC (stage I group), 24 patients with stage II NSCLC (stage II group), 19 patients with stage III NSCLC (stage III group), 11 patients with stage IV NSCLC (stage IV group). Each serum sample was measured 3 times at different spots and the average spectra represented the signal of Raman spectra in each case. The Raman spectrum signal data of the five groups were statistically analyzed by analysis of variance (ANOVA), principal component analysis (PCA), linear discriminant analysis (LDA), and cross-validation. Raman spectral intensity was sequentially reduced in serum samples from control group, stage I group, stage II group and stage III/IV group. The strongest peak intensity was observed in the control group, and the weakest one was found in the stage III/IV group at bands of 848 cm -1 , 999 cm -1 , 1152 cm -1 , 1446 cm -1 and 1658 cm -1 (P Raman spectroscopy can effectively identify patients with stage I, stage II or stage III/IV Non-Small Cell Lung cancer using patient serum samples. Copyright © 2018 Elsevier B.V. All rights reserved.
Hendriks, Hans R; Govaerts, Anne-Sophie; Fichtner, Iduna; Burtles, Sally; Westwell, Andrew D; Peters, Godefridus J
2017-07-11
The European NCI compounds programme, a joint initiative of the EORTC Research Branch, Cancer Research Campaign and the US National Cancer Institute, was initiated in 1993. The objective was to help the NCI in reducing the backlog of in vivo testing of potential anticancer compounds, synthesised in Europe that emerged from the NCI in vitro 60-cell screen. Over a period of more than twenty years the EORTC-Cancer Research Campaign panel reviewed ∼2000 compounds of which 95 were selected for further evaluation. Selected compounds were stepwise developed with clear go/no go decision points using a pharmacologically directed programme. This approach eliminated quickly compounds with unsuitable pharmacological properties. A few compounds went into Phase I clinical evaluation. The lessons learned and many of the principles outlined in the paper can easily be applied to current and future drug discovery and development programmes. Changes in the review panel, restrictions regarding numbers and types of compounds tested in the NCI in vitro screen and the appearance of targeted agents led to the discontinuation of the European NCI programme in 2017 and its transformation into an academic platform of excellence for anticancer drug discovery and development within the EORTC-PAMM group. This group remains open for advice and collaboration with interested parties in the field of cancer pharmacology.
Directory of Open Access Journals (Sweden)
Li-Ping Yang1
2017-06-01
Full Text Available Objective: To investigate the effect of bevacizumab combined with carboplatin therapy for malignant pleural effusion of non-small cell lung cancer on tumor markers, angiogenesis molecules and invasive growth molecules. Methods: A total of 68 patients who were diagnosed with non-small cell lung cancer complicated by pleural effusion in the Affiliated T.C.M Hospital of Southwest Medical University between June 2013 and August 2016 were selected and randomly divided into two groups, the combined group received bevacizumab combined with carboplatin chemotherapy, and the carboplatin group received carboplatin chemotherapy. Before treatment as well as 3 cycles and 6 cycles after treatment, the contents of tumor markers, angiogenesis molecules and invasive growth molecules in pleural effusion were examined. Results: 3 cycles and 6 cycles after treatment, CEA, SCCAg, CYFRA21-1, sHLA-G, VEGF, VEGFR, PTN, MMP7 and MMP10 contents in pleural effusion of both groups of patients were significantly lower than those before treatment while TIMP1 and TIMP2 contents were significantly higher than those before treatment, and CEA, SCCAg, CYFRA21-1, sHLA-G, VEGF, VEGFR, PTN, MMP7 and MMP10 contents in pleural effusion of combined group were significantly lower than those of carboplatin group while TIMP1 and TIMP2 contents were significantly higher than those of carboplatin group. Conclusion: Bevacizumab combined with carboplatin therapy for malignant pleural effusion of non-small cell lung cancer can effectively kill cancer cells, and inhibit angiogenesis and cell invasion.
New targeted treatments for non-small-cell lung cancer – role of nivolumab
Directory of Open Access Journals (Sweden)
Zago G
2016-08-01
Full Text Available Giulia Zago,1,2,* Mirte Muller,1,* Michel van den Heuvel,1 Paul Baas1 1Department of Thoracic Oncology, The Netherlands Cancer Institute, Antoni van Leeuwenhoek (NKI-AvL, Amsterdam, the Netherlands; 2Medical Oncology 2, Istituto Oncologico Veneto (IOV, Padova, Italy *These authors contributed equally to this work Abstract: Non-small-cell lung cancer (NSCLC is often diagnosed at an advanced stage of disease, where it is no longer amenable to curative treatment. During the last decades, the survival has only improved significantly for lung cancer patients who have tumors harboring a driver mutation. Therefore, there is a clear unmet need for effective therapies for patients with no mutation. Immunotherapy has emerged as an effective treatment for different cancer types. Nivolumab, a monoclonal inhibitory antibody against PD-1 receptor, can prolong survival of NSCLC patients, with a manageable toxicity profile. In two Phase III trials, nivolumab was compared to docetaxel in patients with, respectively, squamous (CheckMate 017 and non-squamous NSCLC (CheckMate 057. In both trials, nivolumab significantly reduced the risk of death compared to docetaxel (41% and 27% lower risk of death for squamous and non-squamous NSCLC, respectively. Therefore, nivolumab has been approved in the US and in Europe as second-line treatment for advanced NSCLC. Unfortunately, accurate predictive factors for patient selection are lacking, making it difficult to decide who will benefit and who will not. Currently, there are many ongoing trials that evaluate the efficacy of nivolumab in different settings and in combination with other agents. This paper reviews the present literature about the role of nivolumab in the treatment of NSCLC. Particular attention has been given to efficacy studies, toxicity profile, and current and emerging predictive factors. Keywords: nivolumab, advanced non-small-cell lung cancer, immunotherapy, anti-PD-1
NCI at Frederick Ebola Response Team | Poster
Editor’s note: This article was adapted from the Employee Diversity Team’s display case exhibit “Recognizing the NCI at Frederick Ebola Response Team,” in the lobby of Building 549. The Poster staff recognizes that this article does not include everyone who was involved in the response to the Ebola crisis, both at NCI at Frederick and in Africa. When the Ebola crisis broke out
Mission & Role | NCI Technology Transfer Center | TTC
The NCI TTC serves as the focal point for implementing the Federal Technology Transfer Act to utilize patents as incentive for commercial development of technologies and to establish research collaborations and licensing among academia, federal laboratories, non-profit organizations, and industry. The TTC supports technology development activities for the National Cancer Institute and nine other NIH Institutes and Centers. TTC staff negotiate co-development agreements and licenses with universities, non-profit organizations, and pharmaceutical and biotechnology companies to ensure compliance with Federal statutes, regulations and the policies of the National Institutes of Health. TTC also reviews employee invention reports and makes recommendations concerning filing of domestic and foreign patent applications. | [google6f4cd5334ac394ab.html
A negative regulation loop of long noncoding RNA HOTAIR and p53 in non-small-cell lung cancer
Directory of Open Access Journals (Sweden)
Zhai N
2016-09-01
Full Text Available Nailiang Zhai,1 Yongfu Xia,1 Rui Yin,2 Jinping Liu,3 Fuquan Gao1 1Department of Respiratory Medicine, Affiliated Hospital of Binzhou Medical University, 2Department of Respiratory Medicine, People’s Hospital of Binzhou City, 3Department of Pharmacology, Binzhou Medical University, Binzhou, Shandong, People’s Republic of China Abstract: Non-small-cell lung cancer (NSCLC is one of the leading causes of cancer-related death worldwide, and the 5-year survival rate is still low despite advances in diagnosis and therapeutics. A long noncoding RNA (lncRNA HOX antisense intergenic RNA (HOTAIR has been revealed to play important roles in NSCLC carcinogenesis but the detailed mechanisms are still unclear. In the current study, we aimed to investigate the regulation between the lncRNA HOTAIR and p53 in the NSCLC patient samples and cell lines. Our results showed that HOTAIR expression was significantly higher in the cancer tissues than that in the adjacent normal tissue, and was negatively correlated with p53 functionality rather than expression. When p53 was overexpressed in A549 cells, the lncRNA HOTAIR expression was downregulated, and the cell proliferation rate and cell invasion capacity decreased as a consequence. We identified two binding sites of p53 on the promoter region of HOTAIR, where the p53 protein would bind to and suppress the HOTAIR mRNA transcription. Inversely, overexpression of lncRNA HOTAIR inhibited the expression of p53 in A549 cells. Mechanistic studies revealed that HOTAIR modified the promoter of p53 and enhanced histone H3 lysine 27 trimethylation (H3K27me3. These studies identified a specific negative regulation loop of lncRNA HOTAIR and p53 in NSCLC cells, which revealed a new understanding of tumorigenesis in p53 dysfunction NSCLC cells. Keywords: NSCLC, LncRNA HOTAIR, p53, negative loop
IJUE. Tema 3. Les competències de la Unió Europea
Torres Pérez, María
2018-01-01
PowerPoint del Tema 3 de la asignatura "Institucions Jurídiques de la Unió Europea". Curso académico 2017-2018. Tema 3. Les competències de la Unió Europea. 1. L’atribució de competències a la Unió Europea. 2. La delimitació de les competències a la Unió Europea. 3. Els principis que regeixen l’exercici de les competències. 4. L’exercici de les competències de la Unió per “alguns Estats membres”.
Xu, Lu-Lu; Guo, Shu-Liang; Ma, Su-Ren; Luo, Yong-Ai
2012-01-01
Mammalian mediator (MED) is a multi-protein coactivator that has been identified by several research groups. The involvement of the MED complex subunit 19 (MED 19) in the metastasis of lung adenocarcinoma cell line (H1299), which expresses the MED 19 subunit, was here investigated. When MED 19 expression was decreased by RNA interference H1299 cells demonstrated reduced clone formation, arrest in the S phase of the cell cycle, and lowered metastatic capacity. Thus, MED 19 appears to play important roles in the biological behavior of non-small cell lung carcinoma cells. These findings may be important for the development of novel lung carcinoma treatments.
Proportion and clinical features of never-smokers with non-small cell lung cancer
Cho, Jaeyoung; Choi, Sun Mi; Lee, Jinwoo; Lee, Chang-Hoon; Lee, Sang-Min; Kim, Dong-Wan; Yim, Jae-Joon; Kim, Young Tae; Yoo, Chul-Gyu; Kim, Young Whan; Han, Sung Koo; Park, Young Sik
2017-01-01
Background The proportion of never-smokers with non-small cell lung cancer (NSCLC) is increasing, but that in Korea has not been well addressed in a large population. We aimed to evaluate the proportion and clinical features of never-smokers with NSCLC in a large single institution. Methods We analyzed clinical data of 1860 consecutive patients who were newly diagnosed with NSCLC between June 2011 and December 2014. Results Of the 1860 NSCLC patients, 707 (38.0%) were never-smokers. The propo...
DEFF Research Database (Denmark)
Nissen, K.K.; Vogel, Ulla Birgitte; Nexo, B.A.
2009-01-01
the correlations between the responses of the NCI60 cells to different anticancer drugs and their respective alleles of five DNA polymorphisms located in a cancer-related chromosomal area. One polymorphism, located in the 5' noncoding region of the gene ASE-1, alias CD3EAP, proved to be associated with drug...
Irradiation specifically sensitises solid tumour cell lines to TRAIL mediated apoptosis
International Nuclear Information System (INIS)
Marini, Patrizia; Schmid, Angelika; Jendrossek, Verena; Faltin, Heidrun; Daniel, Peter T; Budach, Wilfried; Belka, Claus
2005-01-01
TRAIL (tumor necrosis factor related apoptosis inducing ligand) is an apoptosis inducing ligand with high specificity for malignant cell systems. Combined treatment modalities using TRAIL and cytotoxic drugs revealed highly additive effects in different tumour cell lines. Little is known about the efficacy and underlying mechanistic effects of a combined therapy using TRAIL and ionising radiation in solid tumour cell systems. Additionally, little is known about the effect of TRAIL combined with radiation on normal tissues. Tumour cell systems derived from breast- (MDA MB231), lung- (NCI H460) colorectal- (Colo 205, HCT-15) and head and neck cancer (FaDu, SCC-4) were treated with a combination of TRAIL and irradiation using two different time schedules. Normal tissue cultures from breast, prostate, renal and bronchial epithelia, small muscle cells, endothelial cells, hepatocytes and fibroblasts were tested accordingly. Apoptosis was determined by fluorescence microscopy and western blot determination of PARP processing. Upregulation of death receptors was quantified by flow cytometry. The combined treatment of TRAIL with irradiation strongly increased apoptosis induction in all treated tumour cell lines compared to treatment with TRAIL or irradiation alone. The synergistic effect was most prominent after sequential application of TRAIL after irradiation. Upregulation of TRAIL receptor DR5 after irradiation was observed in four of six tumour cell lines but did not correlate to tumour cell sensitisation to TRAIL. TRAIL did not show toxicity in normal tissue cell systems. In addition, pre-irradiation did not sensitise all nine tested human normal tissue cell cultures to TRAIL. Based on the in vitro data, TRAIL represents a very promising candidate for combination with radiotherapy. Sequential application of ionising radiation followed by TRAIL is associated with an synergistic induction of cell death in a large panel of solid tumour cell lines. However, TRAIL receptor
Cetuximab and biomarkers in non-small-cell lung carcinoma
Directory of Open Access Journals (Sweden)
Patil N
2012-07-01
Full Text Available Nitin Patil, Mohammed Abba, Heike AllgayerDepartment of Experimental Surgery, Medical Faculty Mannheim, University of Heidelberg and Molecular Oncology of Solid Tumors Unit, German Cancer Research Center (DKFZ, Heidelberg, GermanyAbstract: Cancer progression is a highly complex process that is driven by a constellation of deregulated signaling pathways and key molecular events. In non-small-cell lung cancer (NSCLC, as in several other cancer types, the epidermal growth factor receptor (EGFR and its downstream signaling components represent a key axis that has been found not only to trigger cancer progression but also to support advanced disease leading to metastasis. Two major therapeutic approaches comprising monoclonal antibodies and small molecule tyrosine kinase inhibitors have so far been used to target this pathway, with a combination of positive, negative, and inconsequential results, as judged by patient survival indices. Since these drugs are expensive and not all patients derive benefits from taking them, it has become both pertinent and paramount to identify biomarkers that can predict not only beneficial response but also resistance. This review focuses on the chimeric monoclonal antibody, cetuximab, its application in the treatment of NSCLC, and the biomarkers that may guide its use in the clinical setting. A special emphasis is placed on the EGFR, including its structural and mechanistic attributes.Keywords: NSCLC, cetuximab, biomarker, cancer progression
Role of Autophagy and Apoptosis in Non-Small-Cell Lung Cancer
Liu, Guangbo; Pei, Fen; Yang, Fengqing; Li, Lingxiao; Amin, Amit Dipak; Liu, Songnian; Buchan, J. Ross; Cho, William C.
2017-01-01
Non-small-cell lung cancer (NSCLC) constitutes 85% of all lung cancers, and is the leading cause of cancer-related death worldwide. The poor prognosis and resistance to both radiation and chemotherapy warrant further investigation into the molecular mechanisms of NSCLC and the development of new, more efficacious therapeutics. The processes of autophagy and apoptosis, which induce degradation of proteins and organelles or cell death upon cellular stress, are crucial in the pathophysiology of NSCLC. The close interplay between autophagy and apoptosis through shared signaling pathways complicates our understanding of how NSCLC pathophysiology is regulated. The apoptotic effect of autophagy is controversial as both inhibitory and stimulatory effects have been reported in NSCLC. In addition, crosstalk of proteins regulating both autophagy and apoptosis exists. Here, we review the recent advances of the relationship between autophagy and apoptosis in NSCLC, aiming to provide few insights into the discovery of novel pathogenic factors and the development of new cancer therapeutics. PMID:28208579
Energy Technology Data Exchange (ETDEWEB)
Chvetsov, A; Schwartz, J; Mayr, N [University of Washington, Seattle, WA (United States); Yartsev, S [London Health Sciences Centre, London, Ontario (Canada)
2014-06-01
Purpose: To show that a distribution of cell surviving fractions S{sub 2} in a heterogeneous group of patients can be derived from tumor-volume variation curves during radiotherapy for non-small cell lung cancer. Methods: Our analysis was based on two data sets of tumor-volume variation curves for heterogeneous groups of 17 patients treated for nonsmall cell lung cancer with conventional dose fractionation. The data sets were obtained previously at two independent institutions by using megavoltage (MV) computed tomography (CT). Statistical distributions of cell surviving fractions S{sup 2} and cell clearance half-lives of lethally damaged cells T1/2 have been reconstructed in each patient group by using a version of the two-level cell population tumor response model and a simulated annealing algorithm. The reconstructed statistical distributions of the cell surviving fractions have been compared to the distributions measured using predictive assays in vitro. Results: Non-small cell lung cancer presents certain difficulties for modeling surviving fractions using tumor-volume variation curves because of relatively large fractional hypoxic volume, low gradient of tumor-volume response, and possible uncertainties due to breathing motion. Despite these difficulties, cell surviving fractions S{sub 2} for non-small cell lung cancer derived from tumor-volume variation measured at different institutions have similar probability density functions (PDFs) with mean values of 0.30 and 0.43 and standard deviations of 0.13 and 0.18, respectively. The PDFs for cell surviving fractions S{sup 2} reconstructed from tumor volume variation agree with the PDF measured in vitro. Comparison of the reconstructed cell surviving fractions with patient survival data shows that the patient survival time decreases as the cell surviving fraction increases. Conclusion: The data obtained in this work suggests that the cell surviving fractions S{sub 2} can be reconstructed from the tumor volume
International Nuclear Information System (INIS)
Chvetsov, A; Schwartz, J; Mayr, N; Yartsev, S
2014-01-01
Purpose: To show that a distribution of cell surviving fractions S 2 in a heterogeneous group of patients can be derived from tumor-volume variation curves during radiotherapy for non-small cell lung cancer. Methods: Our analysis was based on two data sets of tumor-volume variation curves for heterogeneous groups of 17 patients treated for nonsmall cell lung cancer with conventional dose fractionation. The data sets were obtained previously at two independent institutions by using megavoltage (MV) computed tomography (CT). Statistical distributions of cell surviving fractions S 2 and cell clearance half-lives of lethally damaged cells T1/2 have been reconstructed in each patient group by using a version of the two-level cell population tumor response model and a simulated annealing algorithm. The reconstructed statistical distributions of the cell surviving fractions have been compared to the distributions measured using predictive assays in vitro. Results: Non-small cell lung cancer presents certain difficulties for modeling surviving fractions using tumor-volume variation curves because of relatively large fractional hypoxic volume, low gradient of tumor-volume response, and possible uncertainties due to breathing motion. Despite these difficulties, cell surviving fractions S 2 for non-small cell lung cancer derived from tumor-volume variation measured at different institutions have similar probability density functions (PDFs) with mean values of 0.30 and 0.43 and standard deviations of 0.13 and 0.18, respectively. The PDFs for cell surviving fractions S 2 reconstructed from tumor volume variation agree with the PDF measured in vitro. Comparison of the reconstructed cell surviving fractions with patient survival data shows that the patient survival time decreases as the cell surviving fraction increases. Conclusion: The data obtained in this work suggests that the cell surviving fractions S 2 can be reconstructed from the tumor volume variation curves measured
An NCI perspective on creating sustainable biospecimen resources.
Vaught, Jimmie; Rogers, Joyce; Myers, Kimberly; Lim, Mark David; Lockhart, Nicole; Moore, Helen; Sawyer, Sherilyn; Furman, Jeffrey L; Compton, Carolyn
2011-01-01
High-quality biospecimens with appropriate clinical annotation are critical in the era of personalized medicine. It is now widely recognized that biospecimen resources need to be developed and operated under established scientific, technical, business, and ethical/legal standards. To date, such standards have not been widely practiced, resulting in variable biospecimen quality that may compromise research efforts. The National Cancer Institute (NCI) Office of Biorepositories and Biospecimen Research (OBBR) was established in 2005 to coordinate NCI's biospecimen resource activities and address those issues that affect access to the high-quality specimens and data necessary for its research enterprises as well as the broader translational research field. OBBR and the NCI Biorepository Coordinating Committee developed NCI's "Best Practices for Biospecimen Resources" after consultation with a broad array of experts. A Biospecimen Research Network was established to fund research to develop additional evidence-based practices. Although these initiatives will improve the overall availability of high-quality specimens and data for cancer research, OBBR has been authorized to implement a national biobanking effort, cancer HUman Biobank (caHUB). caHUB will address systematically the gaps in knowledge needed to improve the state-of-the-science and strengthen the standards for human biobanking. This commentary outlines the progressive efforts by NCI in technical, governance, and economic considerations that will be important as the new caHUB enterprise is undertaken.
Rong JIANG; Chun-hua MA; Zi-long ZHU; Jin-duo LI; Bin WANG; Li-wei SUN; Yuan LÜ
2014-01-01
Objective To observe a new technology for the detection and enumeration of cerebrospinal fluid (CSF) circulating tumor cells (CTCs) in the diagnosis of non-small cell lung cancer (NSCLC) with meningeal metastasis (MM). Methods Five cases of NSCLC with MM that were diagnosed by CSF cytology were selected, and 20 ml CSF samples were obtained by lumbar puncture for every patient. The tumor marker immunostaining-fluorescence in situ hybridization (TM-iFISH) technology was adapted to detect...
The clinical results of stereotactic irradiation for stage IA non-small-cell lung cancer
International Nuclear Information System (INIS)
Matsuura, Kanji; Kodama, Hisayuki; Murakami, Yuji; Kenjo, Masahiro; Kaneyasu, Yuko; Wadasaki, Koichi; Ito, Katsuhide; Kimura, Tomoki; Akagi, Yukio
2006-01-01
Discussed are the results in the title in authors' hospital. Subjects are 15 patients with the stage IA non-small cell lung cancer (10 males and 5 females; median age, 77 y; 11 cases of adenocarcinoma and 4 of squamous cell carcinoma), whose progress could be followed for 6 months or longer after the stereotactic irradiation during the period of July 1999 to 2006. The 8-9-gated irradiation therapy on the primary cancer alone was conducted with Varian Clinac 2300 (6MV-Xray) with the 3D planning equipment of PHILIPS Pinnacle. For some patients, the spirometer was used to monitor the voluntary breath-hold and body was fixed by vacuum fixer. Doses were 56 (4 Gy x 14) Gy in 3 cases, 60 (7.5 Gy x 8) Gy in 2, 50 (10 Gy x 5) Gy in 1 and 48 (12 Gy x 4) Gy in 9. Kaplan-Meier method was used for calculating the local control and survival rates. The former was 93% and the latter, 86% (1 year), 78% (2 y) and 39% (3 y). Three-year survival rate was 100% in 5 cases without other cancer and 18% in 10 with the cancers. Recurrence was seen in 3 cases and remote metastases, 7. Pneumonitis less than Grade 2 was in 11 cases. The stereotactic irradiation was thus found safe and effective in the stage IA non-small cell lung cancer. (T.I.)
Ressonàncies en plasmons sobre grafè
Alcaraz Iranzo, David
2014-01-01
Treball final de màster oficial fet en col·laboració amb Universitat Autònoma de Barcelona (UAB), Universitat de Barcelona (UB) i Institut de Ciències Fotòniques (ICFO) [ANGLÈS] Graphene is used as a novel, versatile plasmonic material. The most common way to implement resonant light-plasmon coupling is to etch graphene into periodic nanostructures, which is invasive. Here, we study a non-invasive way to engineer graphene plasmon resonances, based on periodic doping profiles. The plasmon r...
V. Surmont; J.G.J.V. Aerts (Joachim); K.Y. Tan; F.M.N.H. Schramel (Franz); R. Vernhout (Rene); H.C. Hoogsteden (Henk); R.J. van Klaveren (Rob)
2009-01-01
textabstractBackground. sequential chemotherapy can maintain dose intensity and preclude cumulative toxicity by increasing drug diversity. Purpose. to investigate the toxicity and efficacy of the sequential regimen of gemcitabine followed by paclitaxel in first line advanced stage non-small cell
Clinical outcome of stage III non-small-cell lung cancer patients after definitive radiotherapy.
Nakamura, Tatsuya; Fuwa, Nobukazu; Kodaira, Takeshi; Tachibana, Hiroyuki; Tomoda, Takuya; Nakahara, Rie; Inokuchi, Haruo
2008-01-01
Primarily combined radiotherapy and chemotherapy are used to treat unresectable non-small-cell lung cancer; however, the results are not satisfactory. In this study treatment results were retrospectively analyzed and the prognostic factors related to survival were identified. From March 1999 to January 2004, 102 patients with stage IIIA/IIIB non-small-cell lung cancer received definitive radiotherapy with or without chemotherapy. Radiotherapy involved a daily dose of 1.8-2.0 Gy five times a week; 60 Gy was set as the total dose. Maximal chemotherapy was given to patients with normal kidney, liver, and bone marrow functions. The 5-year overall survival rate was 22.2%; the median survival was 18 months. The median follow-up of surviving patients was 53 months. The complete or partial response rate was 85%. At the time of the last follow-up, 21 patients were alive and 81 patients had died, including 5 patients who had died due to radiation pneumonitis. There were significant differences in survival and in the fatal radiation pneumonitis rate between patients with superior lobe lesions and those with middle or inferior lobe lesions. Patients whose primary tumor is located in the superior lobe appear to have a better clinical outcome.
42 CFR 460.98 - Service delivery.
2010-10-01
... 42 Public Health 4 2010-10-01 2010-10-01 false Service delivery. 460.98 Section 460.98 Public Health CENTERS FOR MEDICARE & MEDICAID SERVICES, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED..., national origin, religion, sex, age, sexual orientation, mental or physical disability, or source of...
Seo, Young Ho
2015-10-01
Heat shock protein 90 (Hsp90) is a ATP dependent molecular chaperone and has emerged as an attractive therapeutic target in the war on cancer due to its role in regulating maturation and stabilization of numerous oncogenic proteins. In this study, we discovered that 2',4'-dimethoxychalcone (1b) disrupted Hsp90 chaperoning function and inhibited the growth of iressa-resistant non-small cell lung cancer (NSCLC, H1975). The result suggested that 2',4'-dimethoxychalcone (1b) could serve as a potential therapeutic lead to circumvent the drug resistance acquired by EGFR mutation and Met amplification.
Travis, Adam R.; Liau, Virginia A.; Agrawal, Amanda C.; Cliffel, David E.
2017-11-01
This work uses linear and looped RGDfV sequences attached to the surface of small (1.8 nm in diameter) gold nanoparticles (AuNPs) to enhance the radiosensitizating effects of Cilengitide, a cyclic RGDf ( NMe)V pentapeptide that targets αvβ3 integrin which is overexpressed in certain cancers. Following synthesis and purification, the AuNPs were evaluated in vitro against HUVEC, H460, and MCF7 cells in clonogenic assays using a 137Cs irradiator. Untargeted AuNPs induced no significant dose enhancement factors (DEFs) in any of the cell types when compared to radiation treatment alone, whereas all evaluated AuNPs functionalized with targeting peptides performed at least as well as controls (irradiation after Cilengitide treatment). The observed DEFs also suggest that cyclizing the linear peptides into more spatially constrained, looped structures may facilitate target binding. These greater dose enhancements merit future in vivo studies of drug-AuNP conjugates to assess the ability of the nanostructures to provide an improved therapeutic benefit over treatment with drug candidates and radiation alone. [Figure not available: see fulltext.
Klimaszewska-Wisniewska, Anna; Halas-Wisniewska, Marta; Tadrowski, Tadeusz; Gagat, Maciej; Grzanka, Dariusz; Grzanka, Alina
2016-01-01
The use of the dietary polyphenols as chemosensitizing agents to enhance the efficacy of conventional cytostatic drugs has recently gained the attention of scientists and clinicians as a plausible approach for overcoming the limitations of chemotherapy (e.g. drug resistance and cytotoxicity). The aim of this study was to investigate whether a naturally occurring diet-based flavonoid, fisetin, at physiologically attainable concentrations, could act synergistically with clinically achievable doses of paclitaxel to produce growth inhibitory and/or pro-death effects on A549 non-small cell lung cancer cells, and if it does, what mechanisms might be involved. The drug-drug interactions were analyzed based on the combination index method of Chou and Talalay and the data from MTT assays. To provide some insights into the mechanism underlying the synergistic action of fisetin and paclitaxel, selected morphological, biochemical and molecular parameters were examined, including the morphology of cell nuclei and mitotic spindles, the pattern of LC3-II immunostaining, the formation of autophagic vacuoles at the electron and fluorescence microscopic level, the disruption of cell membrane asymmetry/integrity, cell cycle progression and the expression level of LC3-II, Bax, Bcl-2 and caspase-3 mRNA. Here, we reported the first experimental evidence for the existence of synergism between fisetin and paclitaxel in the in vitro model of non-small cell lung cancer. This synergism was, at least partially, ascribed to the induction of mitotic catastrophe. The switch from the cytoprotective autophagy to the autophagic cell death was also implicated in the mechanism of the synergistic action of fisetin and paclitaxel in the A549 cells. In addition, we revealed that the synergism between fisetin and paclitaxel was cell line-specific as well as that fisetin synergizes with arsenic trioxide, but not with mitoxantrone and methotrexate in the A549 cells. Our results provide rationale for
Directory of Open Access Journals (Sweden)
Richard Simo Tagne
2015-04-01
Full Text Available Objective: To investigate the anticancer and antioxidant potential of methanol bark extract of Ziziphus mauritiana (Z. mauritiana, which is used by traditional healers to cure some cases of cancer in Cameroon. Methods: The methanol crude extract of Z. mauritiana has the antiproliferative activity on four cancer cell lines and its antioxidant activity. The extract was partitioned in five different solvents, and each fraction was tested. The effect of the most antiproliferative fraction on cell cycle was determined. Bio-guided fractionation was performed on the fraction with the highest antiproliferative and the highest antioxidant activities. Results: Z. mauritiana methanol extract was active on all tested cells, and showed promising antioxidant activity. All fractions except hexane fraction were active with the dichloromethane fraction being the most active and showed S and G2-M phase arrest (P<0.01 on cell cycle progression of NCI-H460 and MCF-7, respectively. Bio-guided fractionation of the dichloromethane fraction led to lupeol and betulinic acid. The greatest antioxidant activity was recorded with ethyl acetate fraction and its fractionation led to catechin and epigallocatechin. Conclusions: Overall, this study showed that Z. mauritiana barks has benefits as a chemoprevention agent cancer.
42 CFR 460.18 - CMS evaluation of applications.
2010-10-01
... 42 Public Health 4 2010-10-01 2010-10-01 false CMS evaluation of applications. 460.18 Section 460... ELDERLY (PACE) PACE Organization Application and Waiver Process § 460.18 CMS evaluation of applications. CMS evaluates an application for approval as a PACE organization on the basis of the following...
CT radiogenomic characterization of EGFR, K-RAS, and ALK mutations in non-small cell lung cancer
Energy Technology Data Exchange (ETDEWEB)
Rizzo, Stefania; Rampinelli, Cristiano [European Institute of Oncology, Department of Radiology, Milan (Italy); Petrella, Francesco; Spaggiari, Lorenzo [European Institute of Oncology, Department of Thoracic Surgery, Milan (Italy); Buscarino, Valentina; De Maria, Federica [University of Milan, Department of Health Sciences, Milan (Italy); Raimondi, Sara [European Institute of Oncology, Department of Epidemiology and Biostatistics, Milan (Italy); Barberis, Massimo; Fumagalli, Caterina [European Institute of Oncology, Department of Pathology, Milan (Italy); Spitaleri, Gianluca; De Marinis, Filippo [European Institute of Oncology, Department of Thoracic Oncology, Milan (Italy); Bellomi, Massimo [European Institute of Oncology, Department of Radiology, Milan (Italy); University of Milan, Department of Health Sciences, Milan (Italy)
2016-01-15
To assess the association between CT features and EGFR, ALK, KRAS mutations in non-small cell lung cancer. Patients undergoing chest CT and testing for the above gene mutations were included. Qualitative evaluation of CTs included: lobe; lesion diameter; shape; margins; ground-glass opacity; density; cavitation; air bronchogram; pleural thickening; intratumoral necrosis; nodules in tumour lobe; nodules in non-tumour lobes; pleural retraction; location; calcifications; emphysema; fibrosis; pleural contact; pleural effusion. Statistical analysis was performed to assess association of features with each gene mutation. ROC curves for gene mutations were drawn; the corresponding area under the curve was calculated. P-values <0.05 were considered significant. Of 285 patients, 60/280 (21.43 %) were positive for EGFR mutation; 31/270 (11.48 %) for ALK rearrangement; 64/240 (26.67 %) for KRAS mutation. EGFR mutation was associated with air bronchogram, pleural retraction, females, non-smokers, small lesion size, and absence of fibrosis. ALK rearrangements were associated with age and pleural effusion. KRAS mutation was associated with round shape, nodules in non-tumour lobes, and smoking. This study disclosed associations between CT features and alterations of EGFR (air bronchogram, pleural retraction, small lesion size, absence of fibrosis), ALK (pleural effusion) and KRAS (round lesion shape, nodules in non-tumour lobes). (orig.)
In vitro incorporation studies of 99mTc-alendronate sodium at different bone cell lines
International Nuclear Information System (INIS)
Evren Gundogdu; Derya Ilem-Ozdemir; Makbule Asikoglu
2014-01-01
Bisphosphonates can be labeled with Technetium-99m ( 99m Tc) and are used for bone imaging because of their good localization in the skeleton and rapid clearance from soft tissues. Over the last decades bone scintigraphy has been used extensively in the evaluation of oncological patients to provide information about the sites of bone lesions, their prognosis and the effectiveness of therapy by showing the sequential changes in tracer uptake. Since the lesion visualization and lesion/bone ratio are important utilities for a bone scanning radiopharmaceutic; in this study incorporation of 99m Tc labeled alendronate sodium ( 99m Tc-ALD) was evaluated in U 2 OS (human bone osteosarcoma) and NCI-H209 (human bone carcinoma) cell lines. ALD was directly labeled by 99m Tc, radiochemical purity and stability of the complex were analyzed by radioactive thin layer chromatography and radioactive high performance liquid chromatography studies. For cell incorporation study, NCI-H209 and U 2 OS cell lines were used with standard cell culture methods. The six well plates were used for all experiments and the integrity of each cell monolayer was checked by measuring its transepithelial electrical resistance (TEER) with an epithelial voltammeter. Results confirmed that ALD was successfully radiolabeled with 99m Tc. 99m Tc-ALD incorporated with NCI-H209 and U 2 OS cells. The uptake percentages of 99m Tc-ALD in NCI-H209 and U 2 OS cell lines were found significantly different. Since 99m Tc-ALD highly uptake in cancer cell line, the results demonstrated that radiolabeled ALD may be a promising agent for bone cancer diagnosis. (author)
Energy Technology Data Exchange (ETDEWEB)
Kim, Chae Kyun; Chung, June Key; Lee, Yong Jin; Hong, Mee Kyoung; Jeong, Jae Min; Lee, Dong Soo; Lee, Myung Chul [College of Medicine, Seoul National Univ., Seoul (Korea, Republic of)
2002-04-01
To clarify the difference in glucose uptake between human cancer cells and monocytes, we studied ({sup 18}F) fluorodeoxyglucose (FDG) uptake in three human colon cancer cell lines (SNU-C2A, SNU-C4, SNU-C5), one human lung cancer cell line (NCI-H522), and human peripheral blood monocytes. The FDG uptake of both cancer cells and monocytes was increased in glucose-free medium, but decreased in the medium containing 16.7 mM glucose (hyperglycemic). The level of Glut1 mRNA decreased in human colon cancer cells and NCI-H522 under hyperglycemic condition. Glut1 protein expression was also decreased in the four human cancer cell lines under hyperglycemic condition, whereas it was consistently undetectable in monocytes. SNU-C2A, SNU-C4 and NCI-H522 showed a similar level of hexokinase activity (7.5-10.8 mU/mg), while SNU-C5 and moncytes showed lower range of hexokinase activity (4.3-6.5 mU/mg). These data suggest that glucose uptake is regulated by different mechanisms in human cancer cells and monocytes.
Advances of Drug Resistance Marker of Gemcitabine for Non-small Cell Lung Cancer
Directory of Open Access Journals (Sweden)
Baorui LIU
2011-05-01
Full Text Available With the development of pharmacogenomics and pharmacogenetics, personal therapy based on genes has become one of the most effective ways to enhance chemotherapeutic effect on non-small cell lung cancer (NSCLC patients. Much attention has been paid to validate the predictive biomarkers of chemotherapy in order to guide chemotherapy and enhance effect in general. Gemcitabine is one of the common agents treating NSCLC recently. This review is mainly about the recent reports on potential biomarkers of Gemcitabine in tailored therapy of NSCLC.
Radiotherapy of elderly patients with non-small-cell lung cancer
International Nuclear Information System (INIS)
Nakano, Kikuo; Hiramoto, Takehiko; Kumagai, Kazuhiko; Tukamoto, Yuji; Furonaka, Makoto; Hayakawa, Masanobu; Nakamura, Kenji
1996-01-01
Treatment results of patients aged 75 years or older (elderly group) with non-small-cell lung cancer were compared with those of patients aged 74 years or younger (younger group). In patients with stage III disease, radiotherapy alone resulted in a median survival of 11.5 months in the younger group and 5.5 months in the elderly group. There was a significant difference in survival rate between the two groups (P=0.0008). Moreover, the elderly group patients more frequently died of pneumonia and radiation pneumonitis than the younger group patients. However, results of radiotherapy were similar in the two groups of patients with stage I and II disease. Accordingly, these findings suggested that radiotherapy is an appropriate treatment modality for elderly lung cancer patients, but that individualized radiotherapy is needed for those with locally advanced stage. (author)
Placenta-specific protein 1 promotes cell proliferation and invasion in non-small cell lung cancer
Yang, Li; Zha, Tian-Qi; He, Xiang; Chen, Liang; Zhu, Quan; Wu, Wei-Bing; Nie, Feng-Qi; Wang, Qian; Zang, Chong-Shuang; Zhang, Mei-Ling; He, Jing; Li, Wei; Jiang, Wen; Lu, Kai-Hua
2018-01-01
Pulmonary carcinoma-associated proteins have emerged as crucial players in governing fundamental biological processes such as cell proliferation, apoptosis and metastasis in human cancers. Placenta-specific protein 1 (PLAC1) is a cancer-related protein, which is activated and upregulated in a variety of malignant tissues, including prostate cancer, gastric adenocarcinoma, colorectal, epithelial ovarian and breast cancer. However, its biological role and clinical significance in non-small cell lung cancer (NSCLC) development and progression are still unknown. In the present study, we found that PLAC1 was significantly upregulated in NSCLC tissues, and its expression level was associated with advanced pathological stage and it was also correlated with shorter progression-free survival of lung cancer patients. Furthermore, knockdown of PLAC1 expression by siRNA inhibited cell proliferation, induced apoptosis and impaired invasive ability in NSCLC cells partly via regulation of epithelial-mesenchymal transition (EMT)-related protein expression. Our findings present that increased PLAC1 could be identified as a negative prognostic biomarker in NSCLC and regulate cell proliferation and invasion. Thus, we conclusively demonstrated that PLAC1 plays a key role in NSCLC development and progression, which may provide novel insights on the function of tumor-related gene-driven tumorigenesis. PMID:29138842
42 CFR 460.20 - Notice of CMS determination.
2010-10-01
... 42 Public Health 4 2010-10-01 2010-10-01 false Notice of CMS determination. 460.20 Section 460.20... ELDERLY (PACE) PACE Organization Application and Waiver Process § 460.20 Notice of CMS determination. (a... application to CMS, CMS takes one of the following actions: (1) Approves the application. (2) Denies the...
DEFF Research Database (Denmark)
Rossi, Antonio; Chiodini, Paolo; Sun, Jong-Mu
2014-01-01
BACKGROUND: Platinum-based chemotherapy is the standard first-line treatment for patients with advanced non-small-cell lung cancer. However, the optimum number of treatment cycles remains controversial. Therefore, we did a systematic review and meta-analysis of individual patient data to compare ...
Non-Small Cell Carcinoma Biomarker Testing: The Pathologist's Perspective.
Directory of Open Access Journals (Sweden)
Elisa eBrega
2014-07-01
Full Text Available Biomarker testing has become standard of care for patients diagnosed with non-small cell lung cancer. Although it can be successfully performed in circulating tu-mor cells, at present, the vast majority of investigations are carried out using di-rect tumor sampling, either through aspiration methods, which render most often isolated cells, or tissue sampling, that could range from minute biopsies to large resections. Consequently, pathologists play a central role in this process. Recent evidence suggests that refining NSCLC diagnosis might be clinically signifi-cant, particularly in cases of lung adenocarcinomas (ADC, which in turn, has prompted a new proposal for the histologic classification of such pulmonary neo-plasms. These changes, in conjunction with the mandatory incorporation of biomarker testing in routine NSCLC tissue processing, have directly affected the pathologist’s role in lung cancer work-up. This new role pathologists must play is complex and demanding, and requires a close interaction with surgeons, oncologists, radiologists and molecular pathologists. Pathologists often find themselves as the central figure in the coordination of a process, that involves assuring that the tumor samples are properly fixed, but without disruption of the DNA structure, obtaining the proper diagnosis with a minimum of tissue waste, providing pre-analytical evaluation of tumor samples selected for biomarker testing, which includes assessment of the proportion of tumor to normal tissues, as well as cell viability, and assuring that this entire pro-cess happens in a timely fashion. Therefore, it is part of the pathologist’s respon-sibilities to assure that the samples received in their laboratories, be processed in a manner that allows for optimal biomarker testing. This article goal is to discuss the essential role pathologists must play NSCLC bi-omarker testing, as well as to provide a summarized review of the main NSCLC bi-omarkers of
International Nuclear Information System (INIS)
Guo Wanfeng; Lin Ruxian; Huang Jian; Guo Guozhen; Wang Shengqi
2005-01-01
Objective: The response of tumor cell to radiation is accompanied by complex change in patterns of gene expression. It is highly probable that a better understanding of molecular and genetic changes can help to sensitize the radioresistant tumor cells. Methods: Oligonucleotide microarray provides a powerful tool for high-throughput identifying a wider range of genes involved in the radioresistance. Therefore, the authors designed one oligonucleotide microarray according to the biological effect of IR. By using different radiosensitive lung cancer cell lines, the authors identified genes showing altered expression in lung cancer cell lines. To provide independent confirmation of microarray data, semi-quantitative RT-PCR was performed on a selection of genes. Results: In radioresistant A549 cell lines, a total of 18 genes were selected as having significant fold-changes compared to NCI-H446, 8 genes were up-regulated and 10 genes were down-regulated. Subsequently, A549 and NCI-H446 cells were delivered by ionizing radiation. In A549 cell line, we found 22 (19 up-regulated and 3 down-regulated) and 26 (8 up-regulated and 18 down-regulated) differentially expressed genes at 6h and 24h after ionizing radiation. In NCI-H446 cell line, we identified 17 (9 up-regulated and 8 down-regulated) and 18 (6 up-regulated and 12 down-regulated) differentially expressed genes at 6 h and 24 h after ionizing radiation. The authors tested seven genes (MDM2, p53, XRCC5, Bcl-2, PIM2, NFKBIA and Cyclin B1) for RT-PCR, and found that the results were in good agreement with those from the microarray data except for NFKBIA gene, even though the value for each mRNA level might be different between the two measurements. In present study, the authors identified some genes with cell proliferation and anti-apoptosis, such as MdM2, BCL-2, PKCz and PIM2 expression levels increased in A549 cells and decreased in NCI-H446 cells after radiation, and other genes with DNA repair, such as XRCC5, ERCC5
Swarm Intelligence-Enhanced Detection of Non-Small-Cell Lung Cancer Using Tumor-Educated Platelets.
Best, Myron G; Sol, Nik; In 't Veld, Sjors G J G; Vancura, Adrienne; Muller, Mirte; Niemeijer, Anna-Larissa N; Fejes, Aniko V; Tjon Kon Fat, Lee-Ann; Huis In 't Veld, Anna E; Leurs, Cyra; Le Large, Tessa Y; Meijer, Laura L; Kooi, Irsan E; Rustenburg, François; Schellen, Pepijn; Verschueren, Heleen; Post, Edward; Wedekind, Laurine E; Bracht, Jillian; Esenkbrink, Michelle; Wils, Leon; Favaro, Francesca; Schoonhoven, Jilian D; Tannous, Jihane; Meijers-Heijboer, Hanne; Kazemier, Geert; Giovannetti, Elisa; Reijneveld, Jaap C; Idema, Sander; Killestein, Joep; Heger, Michal; de Jager, Saskia C; Urbanus, Rolf T; Hoefer, Imo E; Pasterkamp, Gerard; Mannhalter, Christine; Gomez-Arroyo, Jose; Bogaard, Harm-Jan; Noske, David P; Vandertop, W Peter; van den Broek, Daan; Ylstra, Bauke; Nilsson, R Jonas A; Wesseling, Pieter; Karachaliou, Niki; Rosell, Rafael; Lee-Lewandrowski, Elizabeth; Lewandrowski, Kent B; Tannous, Bakhos A; de Langen, Adrianus J; Smit, Egbert F; van den Heuvel, Michel M; Wurdinger, Thomas
2017-08-14
Blood-based liquid biopsies, including tumor-educated blood platelets (TEPs), have emerged as promising biomarker sources for non-invasive detection of cancer. Here we demonstrate that particle-swarm optimization (PSO)-enhanced algorithms enable efficient selection of RNA biomarker panels from platelet RNA-sequencing libraries (n = 779). This resulted in accurate TEP-based detection of early- and late-stage non-small-cell lung cancer (n = 518 late-stage validation cohort, accuracy, 88%; AUC, 0.94; 95% CI, 0.92-0.96; p swarm intelligence may also benefit the optimization of diagnostics readout of other liquid biopsy biosources. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.
21 CFR 522.460 - Cloprostenol sodium.
2010-04-01
... 21 Food and Drugs 6 2010-04-01 2010-04-01 false Cloprostenol sodium. 522.460 Section 522.460 Food... Cloprostenol sodium. (a)(1) Specifications. Each milliliter of the aqueous solution contains 263 micrograms of cloprostenol sodium (equivalent to 250 micrograms of cloprostenol) in a sodium citrate, anhydrous citric acid...
Ko, Jen-Chung; Chen, Jyh-Cheng; Wang, Tai-Jing; Zheng, Hao-Yu; Chen, Wen-Ching; Chang, Po-Yuan; Lin, Yun-Wei
2016-04-01
Astaxanthin has been demonstrated to exhibit a wide range of beneficial effects, including anti-inflammatory and anti-cancer properties. However, the molecular mechanism of astaxanthin-induced cytotoxicity in non-small cell lung cancer (NSCLC) cells has not been identified. Rad51 plays a central role in homologous recombination, and studies show that chemo-resistant carcinomas exhibit high levels of Rad51 expression. In this study, astaxanthin treatment inhibited cell viability and proliferation of two NSCLC cells, A549 and H1703. Astaxanthin treatment (2.5-20 μM) decreased Rad51 expression and phospho-AKT(Ser473) protein level in a time and dose-dependent manner. Furthermore, expression of constitutively active AKT (AKT-CA) vector rescued the decreased Rad51 mRNA and protein levels in astaxanthin-treated NSCLC cells. Combined treatment with phosphatidylinositol 3-kinase (PI3K) inhibitors (LY294002 or wortmannin) further decreased the Rad51 expression in astaxanthin-exposed A549 and H1703 cells. Knockdown of Rad51 expression by transfection with si-Rad51 RNA or cotreatment with LY294002 further enhanced the cytotoxicity and cell growth inhibition of astaxanthin. Additionally, mitomycin C (MMC) as an anti-tumor antibiotic is widely used in clinical NSCLC chemotherapy. Combination of MMC and astaxanthin synergistically resulted in cytotoxicity and cell growth inhibition in NSCLC cells, accompanied with reduced phospho-AKT(Ser473) level and Rad51 expression. Overexpression of AKT-CA or Flag-tagged Rad51 reversed the astaxanthin and MMC-induced synergistic cytotoxicity. In contrast, pretreatment with LY294002 further decreased the cell viability in astaxanthin and MMC co-treated cells. In conclusion, astaxanthin enhances MMC-induced cytotoxicity by decreasing Rad51 expression and AKT activation. These findings may provide rationale to combine astaxanthin with MMC for the treatment of NSCLC. Copyright © 2016 Elsevier Inc. All rights reserved.
16 CFR 460.11 - Rounding off R-values.
2010-01-01
... 16 Commercial Practices 1 2010-01-01 2010-01-01 false Rounding off R-values. 460.11 Section 460.11... INSULATION § 460.11 Rounding off R-values. R-values shown in labels, fact sheets, ads, or other promotional materials must be rounded to the nearest tenth. However, R-values of 10 or more may be rounded to the...
Stereotactic Body Radiotherapy for Centrally Located Non-small Cell Lung Cancer
Directory of Open Access Journals (Sweden)
Yuming WAN
2018-05-01
Full Text Available A few study has proven that about 90% of local control rates might be benefit from stereotactic body radiotherapy (SBRT for patients with medically inoperable stage I non-small cell lung cancer (NSCLC, it is reported SBRT associated overall survival and tumor specific survival is comparable with those treated with surgery. SBRT has been accepted as the first line treatment for inoperable patients with peripheral located stage I NSCLC. However, the role of SBRT in centrally located lesions is controversial for potential toxic effects from the adjacent anatomical structure. This paper will review the definition, indication, dose regimens, dose-volume constraints for organs at risk, radiation technology, treatment side effect of centrally located NSCLC treated with SBRT and stereotactic body proton therapy.
A small molecular pH-dependent fluorescent probe for cancer cell imaging in living cell.
Ma, Junbao; Li, Wenqi; Li, Juanjuan; Shi, Rongguang; Yin, Gui; Wang, Ruiyong
2018-05-15
A novel pH-dependent two-photon fluorescent molecular probe ABMP has been prepared based on the fluorophore of 2, 4, 6-trisubstituted pyridine. The probe has an absorption wavelength at 354 nm and corresponding emission wavelength at 475 nm with the working pH range from 2.20 to 7.00, especially owning a good liner response from pH = 2.40 to pH = 4.00. ABMP also has excellent reversibility, photostability and selectivity which promotes its ability in analytical application. The probe can be excited with a two-photon fluorescence microscopy and the fluorescence cell imaging indicated that the probe can distinguish Hela cancer cells out of normal cells with a two-photon fluorescence microscopy which suggested its potential application in tumor cell detection. Copyright © 2018 Elsevier B.V. All rights reserved.
Kollipara, Pushpa Saranya; Kim, Jung Hyun; Won, Dohee; Lee, Sang Min; Sung, Ha Chang; Chang, Hyun Sok; Lee, Kang Tae; Lee, Kang Sik; Park, Mi Hee; Song, Min Jong; Song, Ho Sueb; Hong, Jin Tae
2014-03-01
In the present study we experimented on a multimodal therapeutic approach, such as combining chemotherapy agent (Bee venom) with cellular (NK-92MI) immunotherapy. Previously bee venom has been found to show anti-cancer effect in various cancer cell lines. In lung cancer cells bee venom showed an IC(50) value of 3 μg/ml in both cell lines. The co-culture of NK-92MI cell lines with lung cancer cells also show a decrease in viability upto 50 % at 48 h time point. Hence we used bee venom treated NK-92MI cells to co-culture with NSCLC cells and found that there is a further decrease in cell viability upto 70 and 75 % in A549 and NCI-H460 cell lines respectively. We further investigated the expression of various apoptotic and anti-apoptotic proteins and found that Bax, cleaved caspase-3 and -8 were increasing where as Bcl-2 and cIAP-2 was decreasing. The expression of various death receptor proteins like DR3, DR6 and Fas was also increasing. Concomitantly the expression of various death receptor ligands (TNFalpha, Apo3L and FasL) was also increasing of NK-92MI cells after co-culture. Further the DNA binding activity and luciferase activity of NF-κB was also inhibited after co-culture with bee venom treated NK-92MI cell lines. The knock down of death receptors with si-RNA has reversed the decrease in cell viability and NF-κB activity after co-culture with bee venom treated NK-92MI cells. Thus this new approach can enhance the anti-cancer effect of bee venom at a much lower concentration.
Shi, Yuankai; Zhang, Li; Liu, Xiaoqing; Zhou, Caicun; Zhang, Li; Zhang, Shucai; Wang, Dong; Li, Qiang; Qin, Shukui; Hu, Chunhong; Zhang, Yiping; Chen, Jianhua; Cheng, Ying; Feng, Jifeng; Zhang, Helong; Song, Yong; Wu, Yi-Long; Xu, Nong; Zhou, Jianying; Luo, Rongcheng; Bai, Chunxue; Jin, Yening; Liu, Wenchao; Wei, Zhaohui; Tan, Fenlai; Wang, Yinxiang; Ding, Lieming; Dai, Hong; Jiao, Shunchang; Wang, Jie; Liang, Li; Zhang, Weimin; Sun, Yan
2013-09-01
Icotinib, an oral EGFR tyrosine kinase inhibitor, had shown antitumour activity and favourable toxicity in early-phase clinical trials. We aimed to investigate whether icotinib is non-inferior to gefitinib in patients with non-small-cell lung cancer. In this randomised, double-blind, phase 3 non-inferiority trial we enrolled patients with advanced non-small-cell lung cancer from 27 sites in China. Eligible patients were those aged 18-75 years who had not responded to one or more platinum-based chemotherapy regimen. Patients were randomly assigned (1:1), using minimisation methods, to receive icotinib (125 mg, three times per day) or gefitinib (250 mg, once per day) until disease progression or unacceptable toxicity. The primary endpoint was progression-free survival, analysed in the full analysis set. We analysed EGFR status if tissue samples were available. All investigators, clinicians, and participants were masked to patient distribution. The non-inferiority margin was 1·14; non-inferiority would be established if the upper limit of the 95% CI for the hazard ratio (HR) of gefitinib versus icotinib was less than this margin. This study is registered with ClinicalTrials.gov, number NCT01040780, and the Chinese Clinical Trial Registry, number ChiCTR-TRC-09000506. 400 eligible patients were enrolled between Feb 26, 2009, and Nov 13, 2009; one patient was enrolled by mistake and removed from the study, 200 were assigned to icotinib and 199 to gefitinib. 395 patients were included in the full analysis set (icotinib, n=199; gefitinib, n=196). Icotinib was non-inferior to gefitinib in terms of progression-free survival (HR 0·84, 95% CI 0·67-1·05; median progression-free survival 4·6 months [95% CI 3·5-6·3] vs 3·4 months [2·3-3·8]; p=0·13). The most common adverse events were rash (81 [41%] of 200 patients in the icotinib group vs 98 [49%] of 199 patients in the gefitinib group) and diarrhoea (43 [22%] vs 58 [29%]). Patients given icotinib had less drug
Treating advanced non-small-cell lung cancer in Chinese patients: focus on icotinib
Liang, Jun-Li; Ren, Xiao-Cang; Lin, Qiang
2014-01-01
Icotinib hydrochloride is an orally administered small-molecule reversible tyrosine kinase inhibitor that has been independently researched and developed and has independent intellectual property rights in the People’s Republic of China. Clinical trials have demonstrated that the response to icotinib among advanced non-small-cell lung cancer (NSCLC) patients who received at least one platinum-based chemotherapy regimen was not inferior to gefitinib. Since being launched August 2011 in the People’s Republic of China, icotinib has been widely used in clinics, and has become an important treatment option for Chinese patients with advanced NSCLC. The present study presents the Phase I, II, and III clinical trials of icotinib and discusses current clinical applications in the People’s Republic of China and future research directions. PMID:24876785
Energy Technology Data Exchange (ETDEWEB)
Calvo, F.O.; Ryan, R.J.; Woloschak, G.E.
1986-03-01
Small follicle (1-3 mm) porcine granulosa cells (SFPGF) were isolated by puncture, aspiration and cultured under standard conditions in DMEM, HEPES, BSA, MIX. At the start of culture, cells were stimulated with 100ng hFSH/ml. At various times afterwards total cellular RNA was prepared using guanidine-hydrochloride solubilization, phenol extraction and precipitation from 3M NaOAc, pH 6.0. RNA was 5'-end labelled with /sup 32/P in a kinase reaction and hybridized to an excess of clone-specific DNA immobilized on nitrocellulose filters using stringent hybridization and wash conditions. After autoradiography the RNA hybridized to the DNA blot filter were quantitated by microdensitometry. Hybridization to parent plasmid was negative. RNA derived from control cultures showed patterns of hybridization similar to those obtained from freshly obtained cells. Results of these experiments demonstrate hFSh induction of RNA specific for transferrin receptor, ..cap alpha..-interferon, H-ras, and K-ras. Increased RNA levels were apparent within 10 min of treatment and had declined by 180 min. Expression of actin, p53 and for RNAs declined by 10 min of hFSH addition but was enhanced by 160 min. Levels of ..beta..-interferon, myc, mos, abl and yb RNAs were not detectable under these conditions. These results demonstrate specific gene modulation in SFPGC cultured with hFSH.
Wan, Xiaomeng; Min, Yuanzeng; Bludau, Herdis; Keith, Andrew; Sheiko, Sergei S; Jordan, Rainer; Wang, Andrew Z; Sokolsky-Papkov, Marina; Kabanov, Alexander V
2018-03-27
Nanoparticle-based systems for concurrent delivery of multiple drugs can improve outcomes of cancer treatments, but face challenges because of differential solubility and fairly low threshold for incorporation of many drugs. Here we demonstrate that this approach can be used to greatly improve the treatment outcomes of etoposide (ETO) and platinum drug combination ("EP/PE") therapy that is the backbone for treatment of prevalent and deadly small cell lung cancer (SCLC). A polymeric micelle system based on amphiphilic block copolymer poly(2-oxazoline)s (POx) poly(2-methyl-2-oxazoline- block-2-butyl-2-oxazoline- block-2-methyl-2-oxazoline) (P(MeOx- b-BuOx- b-MeOx) is used along with an alkylated cisplatin prodrug to enable co-formulation of EP/PE in a single high-capacity vehicle. A broad range of drug mixing ratios and exceptionally high two-drug loading of over 50% wt. drug in dispersed phase is demonstrated. The highly loaded POx micelles have worm-like morphology, unprecedented for drug loaded polymeric micelles reported so far, which usually form spheres upon drug loading. The drugs co-loading in the micelles result in a slowed-down release, improved pharmacokinetics, and increased tumor distribution of both drugs. A superior antitumor activity of co-loaded EP/PE drug micelles compared to single drug micelles or their combination as well as free drug combination was demonstrated using several animal models of SCLC and non-small cell lung cancer.
International Nuclear Information System (INIS)
Berlangieri, S.U.; Scott, A.M.; Knight, S.; Fitt, G.J.; Hess, E.M.; Pathmaraj, K.; Hennessy, O.F.; Tochon-Danguy, H.J.; Chan, J.G.; Egan, G.F.; Sinclair, R.A.; Clarke, C.P.; McKay, W.J.; St Vincents Hospital, Fitzroy, VIC
1998-01-01
Full text: Positron emission tomography (PET) using F-18 fluorodeoxyglucose (FDG), as a metabolic tumour marker, has been proposed for staging of oncological disease. To determine its role in the mediastinal staging of lung cancer, a prospective comparison of FDG PET with surgery was performed in patients with suspected non-small cell lung carcinoma. The analysis group consists of 70 patients, 49 men and 21 women, mean age 64 yrs (range 41-83 yrs). The PET study was acquired on a Siemens 951/31R scanner over 3 bed positions, 45 minutes following 400MBq FDG. The emission scan was attenuation corrected using measured transmission data. The FDG PET were interpreted by a nuclear physician blinded to the clinical data and the results of the patients' CT scan. On PET, nodes were graded qualitatively on a 5 point scale with scores 4 or greater, positive for tumour involvement. Surgical specimens were obtained in all patients by thoracotomy or mediastinoscopy. The PET metabolic studies and pathology were mapped according to the American Thoracic Society nodal classification resulting in a total of 277 nodal stations evaluated. The PET studies analysed N2 or N3 tumour involvement by nodal station in comparison to histology of pathological specimens or direct visual assessment of the nodal stations at surgery. All patients had proven non-small cell lung carcinoma, except two, in whom, a tissue confirmation of the suspected diagnosis was not attained. PET excluded tumour in 237 of 246 nodal stations (specificity 96%). PET correctly identified 23 of 31 nodal stations with disease (sensitivity 74%). PET correctly staged 260 of 277 nodal stations (accuracy 94%) for disease. FDG PET is an accurate non-invasive functional imaging modality for the mediastinal staging of non-small cell lung cancer and has an important clinical role in the preoperative staging of lung cancer patients
CIMAvax-EGF®: Therapeutic Vaccine Against Non-small Cell Lung Cancer in Advanced Stages
Directory of Open Access Journals (Sweden)
Diana Rosa Fernández Ruiz
2017-02-01
Full Text Available Biotechnology is one of the scientific activities deployed by the Cuban State, which shows greater results and impact on the of the Cuban population health. It has increased the therapeutic repertoire in dealing with oncological diseases with products such as CIMAvax-EGF®, the first therapeutic vaccine of its kind, from the Molecular Immunology Center, against non-small cell lung cancer in advanced stages IIIB IV. The application of this product already extends to Primary Health Care with encouraging results, by prolonging the survival of patients with higher quality of life.
Hussain, Althaf I; Cordeiro, Melissa; Sevilla, Elizabeth; Liu, Jonathan
2010-05-14
Currently MedImmune manufactures cold-adapted (ca) live, attenuated influenza vaccine (LAIV) from specific-pathogen free (SPF) chicken eggs. Difficulties in production scale-up and potential exposure of chicken flocks to avian influenza viruses especially in the event of a pandemic influenza outbreak have prompted evaluation and development of alternative non-egg based influenza vaccine manufacturing technologies. As part of MedImmune's effort to develop the live attenuated influenza vaccine (LAIV) using cell culture production technologies we have investigated the use of high yielding, cloned MDCK cells as a substrate for vaccine production by assessing host range and virus replication of influenza virus produced from both SPF egg and MDCK cell production technologies. In addition to cloned MDCK cells the indicator cell lines used to evaluate the impact of producing LAIV in cells on host range and replication included two human cell lines: human lung carcinoma (A549) cells and human muco-epidermoid bronchiolar carcinoma (NCI H292) cells. The influenza viruses used to infect the indicators cell lines represented both the egg and cell culture manufacturing processes and included virus strains that composed the 2006-2007 influenza seasonal trivalent vaccine (A/New Caledonia/20/99 (H1N1), A/Wisconsin/67/05 (H3N2) and B/Malaysia/2506/04). Results from this study demonstrate remarkable similarity between influenza viruses representing the current commercial egg produced and developmental MDCK cell produced vaccine production platforms. MedImmune's high yielding cloned MDCK cells used for the cell culture based vaccine production were highly permissive to both egg and cell produced ca attenuated influenza viruses. Both the A549 and NCI H292 cells regardless of production system were less permissive to influenza A and B viruses than the MDCK cells. Irrespective of the indicator cell line used the replication properties were similar between egg and the cell produced
Fluorogenic RNA Mango aptamers for imaging small non-coding RNAs in mammalian cells.
Autour, Alexis; C Y Jeng, Sunny; D Cawte, Adam; Abdolahzadeh, Amir; Galli, Angela; Panchapakesan, Shanker S S; Rueda, David; Ryckelynck, Michael; Unrau, Peter J
2018-02-13
Despite having many key roles in cellular biology, directly imaging biologically important RNAs has been hindered by a lack of fluorescent tools equivalent to the fluorescent proteins available to study cellular proteins. Ideal RNA labelling systems must preserve biological function, have photophysical properties similar to existing fluorescent proteins, and be compatible with established live and fixed cell protein labelling strategies. Here, we report a microfluidics-based selection of three new high-affinity RNA Mango fluorogenic aptamers. Two of these are as bright or brighter than enhanced GFP when bound to TO1-Biotin. Furthermore, we show that the new Mangos can accurately image the subcellular localization of three small non-coding RNAs (5S, U6, and a box C/D scaRNA) in fixed and live mammalian cells. These new aptamers have many potential applications to study RNA function and dynamics both in vitro and in mammalian cells.
Directory of Open Access Journals (Sweden)
Jingying NONG
2013-05-01
Full Text Available Background and objective Icotinib hydrochloride is the third single target EGFR-TKI used in clinical treatment of advanced non-small cell lung cancer (NSCLC. Clinical research reports on its efficacy and survival in patients with Recurrent Advanced NSCLC are still little.The aim of this study is to evaluate the efficacy and survival of Icotinib hydrochloride for patients with advanced non-small cell lung cancer who failed to previous chemotherapy and explore the association of clinical features with the efficacy and survival. Methods The clinical data of 60 NSCLC patients referred to the Beijing Chest Hospital, Capital Medical University from March 2009 to July 2012 were retrospectively analyzed. Results The overall response rate (ORR was 45.0% and the disease control rate (DCR was 80.0%. The median progression-free survival (PFS time was 6.7 months. RR and PFS in female were superior to male (P=0.014, 0.013, respectively. RR, DCR in 2nd-line subgroup were superior to ≥3rd-line subgroup (P=0.020, 0.024, respectively. RR, DCR and PFS in EGFR mutation carriers were significantly superior to wild-type patients (P=0.006, <0.001, 0.002, respectively . There was no statistical difference in RR and PFS between those age <65 and ≥65 or PS<2 and PS≥2. There was no statistical difference in RR and DCR between exon 19 deletion and exon 21 mutations, while the former had much longer PFS (P=0.020. EGFR mutation and exon 19 deletion are the independent prognostic factors to significantly improve the PFS (P=0.009, 0.012, respectively. The side effects were generally mild and consisted of rash and diarrhea. Conclusion Icotinib hydrochloride is effective especially in EGFR mutation carriers and well tolerated in patients with recurrent advanced non-small-cell lung cancer.
International Nuclear Information System (INIS)
Lee, Ho Jun; Lee, Hyung Sik; Hur, Won Joo; Lee, Ki Nam; Choi, Pill Jo
1998-01-01
We retrospectively analyzed the impact of subpleural lesions of early stage non-small cell lung cancer on the patterns of failure to support selection of postoperative adjuvant therapy. The study included 91 patients who underwent surgery for early stage non-small cell lung cancer at Donga University hospital from Dec 1990 to Sep 1996. Twenty five patients were excluded due to postoperative mortality (four patients, 4.4%) and stage III (21 patients). Of 66 patients, 22 patients were subpleural lesions (15 patients in stage I, and seven patients in stage II). Postoperative adjuvant radiation therapy was given to seven patients with T2N1 disease. The median follow-up duration was 29.5 months (range; 8-84 months). The overall survival rate was 69.5% at 3 years. For all patients who presented with (22 patients) and without (44 patients) subpleural lesions, 3-year overall survival rates were 35.5% and 84.6%, respectively (p=0.0017). For stage I patients who presented with (15 patients) and without (29 patients) subpleural lesions, 3-year overall survival rates were 33.1% and 92.3%, respectively (p=0.001). For stage II patients who presented with (7 patients) and without (15 patients) subpleural lesions, 3-year overall survival rates were 53.3% and 45.7%, respectively (p=0.911). For patients with T2NO disease (34 patients) who presented with (11 patients) and without (23 patients) subpleural lesions, 3-year overall survival rates were 27.3% and 90.3%,respectively (p=0.009).These observations suggest that the subpleural lesion play an important role as a prognostic factor for early stage non-small cell lung cancer. Especially for T2NO disease, patients with subpleural lesions showed significantly lower survival rate than those without that
Learning From Trials on Radiation Dose in Non-Small Cell Lung Cancer
Energy Technology Data Exchange (ETDEWEB)
Bradley, Jeffrey, E-mail: jbradley@wustl.edu [Department of Radiation Oncology, Washington University School of Medicine, St. Louis, Missouri (United States); Hu, Chen [Division of Oncology, Johns Hopkins University School of Medicine, Baltimore, Maryland (United States)
2016-11-15
In this issue of the International Journal of Radiation Oncology • Biology • Physics, Taylor et al present a meta-analysis of published data supporting 2 findings: (1) radiation dose escalation seems to benefit patients who receive radiation alone for non-small cell lung cancer; and (2) radiation dose escalation has a detrimental effect on overall survival in the setting of concurrent chemotherapy. The latter finding is supported by data but has perplexed the oncology community. Perhaps these findings are not perplexing at all. Perhaps it is simply another lesson in the major principle in radiation oncology, to minimize radiation dose to normal tissues.
Zhou, Dongbo; Xie, Mingxuan; He, Baimei; Gao, Ying; Yu, Qiao; He, Bixiu; Chen, Qiong
2017-01-01
Non-small-cell lung cancer (NSCLC) is a leading cause of cancer mortality worldwide. The most common subtypes of NSCLC are adenocarcinoma (AC) and squamous cell carcinoma (SCC). However, the pathophysiological mechanisms contributing to AC and SCC are still largely unknown, especially the roles of long non-coding RNAs (lncRNAs). The present study identified differentially expressed lncRNAs between lung AC and SCC by re-annotation of NSCLC microarray data analysis profiling. The potential func...
NCI Pediatric Preclinical Testing Consortium
NCI has awarded grants to five research teams to participate in its Pediatric Preclinical Testing Consortium, which is intended to help to prioritize which agents to pursue in pediatric clinical trials.
Directory of Open Access Journals (Sweden)
Yilong WU
2009-12-01
Full Text Available Background and objective Erlotinib is a targeted treatment for advanced non-small cell lung cancer. Smoking status may be one of influencing factors of the efficacy of erlotinib. The aim of this study is to explore the impact of smoking status on the efficacy of erlotinib in patients with advanced non-small cell lung cancer. Methods Patients with nonsmall cell lung cancer who had been previously treated with at least one course of platinum based chemotherapy received 150 mg oral doses of erlotinib once daily until disease progression. Response rate, progression-free survival, overall survival were analyzed in the different smoking status groups. Kaplan-Meier method was used to analyze the survival rate. Results Fortyeight patients were enrolled into the study from December 2005 to September 2006. We followed up these patients until 28th December, 2008. Median follow up time was 30 months. The compliance rate was 100%. The response rate was 32.1% in the smoking group and 35% in the never smoking group (P=0.836; The median progression-free survival was 3 months and 9 months, respectively (P=0.033. The median overall survival was 5 months and 17 months, respectively (P=0.162. Conclusion Erlotinib is an effective drug for advanced non-small cell lung cancer patients with different smoking status. Progressionfree survival is better in the never smoking patients than the smoking patients.
Green tea extract induces protective autophagy in A549 non-small lung cancer cell line.
Izdebska, Magdalena; Klimaszewska-Wiśniewska, Anna; Hałas, Marta; Gagat, Maciej; Grzanka, Alina
2015-12-31
For many decades, polyphenols, including green tea extract catechins, have been reported to exert multiple anti-tumor activities. However, to date the mechanisms of their action have not been completely elucidated. Thus, the aim of this study was to assess the effect of green tea extract on non-small lung cancer A549 cells. A549 cells following treatment with GTE were analyzed using the inverted light and fluorescence microscope. In order to evaluate cell sensitivity and cell death, the MTT assay and Tali image-based cytometer were used, respectively. Ultrastructural alterations were assessed using a transmission electron microscope. The obtained data suggested that GTE, even at the highest dose employed (150 μM), was not toxic to A549 cells. Likewise, the treatment with GTE resulted in only a very small dose-dependent increase in the population of apoptotic cells. However, enhanced accumulation of vacuole-like structures in response to GTE was seen at the light and electron microscopic level. Furthermore, an increase in the acidic vesicular organelles and LC3-II puncta formation was observed under the fluorescence microscope, following GTE treatment. The analysis of the functional status of autophagy revealed that GTE-induced autophagy may provide self-protection against its own cytotoxicity, since we observed that the blockage of autophagy by bafilomycin A1 decreased the viability of A549 cells and potentiated necrotic cell death induction in response to GTE treatment. Collectively, our results revealed that A549 cells are insensitive to both low and high concentrations of the green tea extract, probably due to the induction of cytoprotective autophagy. These data suggest that a potential utility of GTE in lung cancer therapy may lie in its synergistic combinations with drugs or small molecules that target autophagy, rather than in monotherapy.
Green tea extract induces protective autophagy in A549 non-small lung cancer cell line
Directory of Open Access Journals (Sweden)
Magdalena Izdebska
2015-12-01
Full Text Available Background and objectives: For many decades, polyphenols, including green tea extract catechins, have been reported to exert multiple anti-tumor activities. However, to date the mechanisms of their action have not been completely elucidated. Thus, the aim of this study was to assess the effect of green tea extract on non-small lung cancer A549 cells. Material and methods: A549 cells following treatment with GTE were analyzed using the inverted light and fluorescence microscope. In order to evaluate cell sensitivity and cell death, the MTT assay and Tali image-based cytometer were used, respectively. Ultrastructural alterations were assessed using a transmission electron microscope.Results: The obtained data suggested that GTE, even at the highest dose employed (150 μM, was not toxic to A549 cells. Likewise, the treatment with GTE resulted in only a very small dose-dependent increase in the population of apoptotic cells. However, enhanced accumulation of vacuole-like structures in response to GTE was seen at the light and electron microscopic level. Furthermore, an increase in the acidic vesicular organelles and LC3-II puncta formation was observed under the fluorescence microscope, following GTE treatment. The analysis of the functional status of autophagy revealed that GTE-induced autophagy may provide self-protection against its own cytotoxicity, since we observed that the blockage of autophagy by bafilomycin A1 decreased the viability of A549 cells and potentiated necrotic cell death induction in response to GTE treatment.Conclusion: Collectively, our results revealed that A549 cells are insensitive to both low and high concentrations of the green tea extract, probably due to the induction of cytoprotective autophagy. These data suggest that a potential utility of GTE in lung cancer therapy may lie in its synergistic combinations with drugs or small molecules that target autophagy, rather than in monotherapy.
Pemetrexed in maintenance treatment of advanced non-squamous non-small-cell lung cancer.
Minami, Seigo; Kijima, Takashi
2015-01-01
Pemetrexed, a multitargeting antifolate cytotoxic drug, plays a leading role in front-line chemotherapy for patients with advanced non-squamous non-small-cell lung cancer (NSCLC). Following its approval as second-line monotherapy for locally advanced or metastatic non-squamous NSCLC, pemetrexed has established itself as the first-line regimen in combination with cisplatin, and its powerful antitumor effects and less cumulative toxicities were then taken advantage of in the JMEN and PARAMOUNT trials, respectively, to pioneer a new treatment strategy of switch and continuation maintenance monotherapy. These developments have brought about a marked paradigm shift, and made pemetrexed indispensable in the treatment for non-squamous NSCLC. So far, only three drugs have been approved for maintenance therapy; pemetrexed both by switch and continuation maintenance, erlotinib by switch maintenance, and bevacizumab by continuation maintenance. Compared with observation alone after defined cycles of the first-line chemotherapy, subsequent pemetrexed maintenance therapy has provided significantly longer survival and infrequent severe adverse events. The cost-effectiveness of pemetrexed maintenance therapy is controversial, as well as the other two maintenance drugs, bevacizumab and erlotinib. The latest attractive attention is a combination maintenance therapy. We may have to consider epidermal growth factor receptor (EGFR) mutation status for selection of a combination pattern. A combination maintenance therapy of pemetrexed plus bevacizumab is potential for patients with wild-type EGFR status, while a EGFR tyrosine kinase inhibitor-containing combination is promising for patients with active EGFR mutation status. Pemetrexed will be a pivotal drug when a combination maintenance therapy is used in practice. For future maintenance therapy, we need to explore reliable predictive selection or exclusion markers that can predict who will really benefit from maintenance therapy.
Immunohistochemistry for predictive biomarkers in non-small cell lung cancer.
Mino-Kenudson, Mari
2017-10-01
In the era of targeted therapy, predictive biomarker testing has become increasingly important for non-small cell lung cancer. Of multiple predictive biomarker testing methods, immunohistochemistry (IHC) is widely available and technically less challenging, can provide clinically meaningful results with a rapid turn-around-time and is more cost efficient than molecular platforms. In fact, several IHC assays for predictive biomarkers have already been implemented in routine pathology practice. In this review, we will discuss: (I) the details of anaplastic lymphoma kinase (ALK) and proto-oncogene tyrosine-protein kinase ROS (ROS1) IHC assays including the performance of multiple antibody clones, pros and cons of IHC platforms and various scoring systems to design an optimal algorithm for predictive biomarker testing; (II) issues associated with programmed death-ligand 1 (PD-L1) IHC assays; (III) appropriate pre-analytical tissue handling and selection of optimal tissue samples for predictive biomarker IHC.
A novel imidazopyridine PI3K inhibitor with anticancer activity in non-small cell lung cancer cells.
Lee, Hyunseung; Kim, Soo Jung; Jung, Kyung Hee; Son, Mi Kwon; Yan, Hong Hua; Hong, Sungwoo; Hong, Soon-Sun
2013-08-01
Lung cancer is the leading cause of cancer-related mortality in the world, and non-small cell lung cancer (NSCLC) accounts for approximately 85% of all cases. Since more than 60% of NSCLC cases express the epidermal growth factor receptor (EGFR), EGFR tyrosine kinase inhibitors are used to treat NSCLC. However, due to the acquired resistance associated with EGFR-targeted therapy, other strategies for the treatment of NSCLC are urgently needed. Therefore, we investigated the anticancer effects of a novel phosphatidylinositol 3-kinase α (PI3Kα) inhibitor, HS-173, in human NSCLC cell lines. HS-173 demonstrated anti-proliferative effects in NSCLC cells and effectively inhibited the PI3K signaling pathway in a dose‑dependent manner. In addition, it induced cell cycle arrest at G2/M phase as well as apoptosis. Taken together, our results demonstrate that HS-173 exhibits anticancer activities, including the induction of apoptosis, by blocking the PI3K/Akt/mTOR pathway in human NSCLC cell lines. We, therefore, suggest that this novel drug could potentially be used for targeted NSCLC therapy.
Pivonello, Claudia; Rousaki, Panagoula; Negri, Mariarosaria; Sarnataro, Maddalena; Napolitano, Maria; Marino, Federica Zito; Patalano, Roberta; De Martino, Maria Cristina; Sciammarella, Concetta; Faggiano, Antongiulio; Rocco, Gaetano; Franco, Renato; Kaltsas, Gregory A; Colao, Annamaria; Pivonello, Rosario
2017-06-01
Somatostatin analogues and mTOR inhibitors have been used as medical therapy in lung carcinoids with variable results. No data are available on dopamine agonists as treatment for lung carcinoids. The main aim of the current study was to evaluate the effect of the combined treatment of somatostatin analogue octreotide and the dopamine agonist cabergoline with mTOR inhibitors in an in vitro model of typical lung carcinoids: the NCI-H727 cell line. In NCI-H727 cell line, reverse transcriptase-quantitative polymerase chain reaction and immunofluorescence were assessed to characterize the expression of the somatostatin receptor 2 and 5, dopamine receptor 2 and mTOR pathway components. Fifteen typical lung carcinoids tissue samples have been used for somatostatin receptor 2, dopamine receptor 2, and the main mTOR pathway component p70S6K expression and localization by immunohistochemistry. Cell viability, fluorescence-activated cell sorting analysis and western blot have been assessed to test the pharmacological effects of octreotide, cabergoline and mTOR inhibitors, and to evaluate the activation of specific cell signaling pathways in NCI-H727 cell line. NCI-H727 cell line expressed somatostatin receptor 2, somatostatin receptor 5 and dopamine receptor 2 and all mTOR pathway components at messenger and protein levels. Somatostatin receptor 2, dopamine receptor 2, and p70S6K (non phosphorylated and phosphorylated) proteins were expressed in most typical lung carcinoids tissue samples. Octreotide and cabergoline did not reduce cell viability as single agents but, when combined with mTOR inhibitors, they potentiate mTOR inhibitors effect after long-term exposure, reducing Akt and ERK phosphorylation, mTOR escape mechanisms, and increasing the expression DNA-damage-inducible transcript 4, an mTOR suppressor. In conclusion, the single use of octreotide and cabergoline is not sufficient to block cell viability but the combined approach of these agents with mTOR inhibitors
Overmeyer, Jean H; Young, Ashley M; Bhanot, Haymanti; Maltese, William A
2011-06-06
Methuosis is a unique form of non-apoptotic cell death triggered by alterations in the trafficking of clathrin-independent endosomes, ultimately leading to extreme vacuolization and rupture of the cell. Here we describe a novel chalcone-like molecule, 3-(2-methyl-1H- indol-3-yl)-1-(4-pyridinyl)-2-propen-1-one (MIPP) that induces cell death with the hallmarks of methuosis. MIPP causes rapid accumulation of vacuoles derived from macropinosomes, based on time-lapse microscopy and labeling with extracellular fluid phase tracers. Vacuolization can be blocked by the cholesterol-interacting compound, filipin, consistent with the origin of the vacuoles from non-clathrin endocytic compartments. Although the vacuoles rapidly acquire some characteristics of late endosomes (Rab7, LAMP1), they remain distinct from lysosomal and autophagosomal compartments, suggestive of a block at the late endosome/lysosome boundary. MIPP appears to target steps in the endosomal trafficking pathway involving Rab5 and Rab7, as evidenced by changes in the activation states of these GTPases. These effects are specific, as other GTPases (Rac1, Arf6) are unaffected by the compound. Cells treated with MIPP lose viability within 2-3 days, but their nuclei show no evidence of apoptotic changes. Inhibition of caspase activity does not protect the cells, consistent with a non-apoptotic death mechanism. U251 glioblastoma cells selected for temozolomide resistance showed sensitivity to MIPP-induced methuosis that was comparable to the parental cell line. MIPP might serve as a prototype for new drugs that could be used to induce non-apoptotic death in cancers that have become refractory to agents that work through DNA damage and apoptotic mechanisms.
Directory of Open Access Journals (Sweden)
Bhanot Haymanti
2011-06-01
Full Text Available Abstract Background Methuosis is a unique form of non-apoptotic cell death triggered by alterations in the trafficking of clathrin-independent endosomes, ultimately leading to extreme vacuolization and rupture of the cell. Results Here we describe a novel chalcone-like molecule, 3-(2-methyl-1H- indol-3-yl-1-(4-pyridinyl-2-propen-1-one (MIPP that induces cell death with the hallmarks of methuosis. MIPP causes rapid accumulation of vacuoles derived from macropinosomes, based on time-lapse microscopy and labeling with extracellular fluid phase tracers. Vacuolization can be blocked by the cholesterol-interacting compound, filipin, consistent with the origin of the vacuoles from non-clathrin endocytic compartments. Although the vacuoles rapidly acquire some characteristics of late endosomes (Rab7, LAMP1, they remain distinct from lysosomal and autophagosomal compartments, suggestive of a block at the late endosome/lysosome boundary. MIPP appears to target steps in the endosomal trafficking pathway involving Rab5 and Rab7, as evidenced by changes in the activation states of these GTPases. These effects are specific, as other GTPases (Rac1, Arf6 are unaffected by the compound. Cells treated with MIPP lose viability within 2-3 days, but their nuclei show no evidence of apoptotic changes. Inhibition of caspase activity does not protect the cells, consistent with a non-apoptotic death mechanism. U251 glioblastoma cells selected for temozolomide resistance showed sensitivity to MIPP-induced methuosis that was comparable to the parental cell line. Conclusions MIPP might serve as a prototype for new drugs that could be used to induce non-apoptotic death in cancers that have become refractory to agents that work through DNA damage and apoptotic mechanisms.
International Nuclear Information System (INIS)
Tomono, Takumi; Kajita, Masahiro; Yano, Kentaro; Ogihara, Takuo
2016-01-01
P-glycoprotein (P-gp) is an ATP-binding cassette protein involved in cancer multi-drug resistance (MDR). It has been reported that infection with some bacteria and viruses induces changes in the activities of various drug-metabolizing enzymes and transporters, including P-gp. Although human adenoviruses (Ad) cause the common cold, the effect of Ad infection on MDR in cancer has not been established. In this study, we investigated whether Ad infection is a cause of MDR in A549, H441 and HCC827 non-small-cell lung cancer (NSCLC) cell lines, using an Ad vector system. We found that Ad vector infection of NSCLC cell lines induced P-gp mRNA expression, and the extent of induction was dependent on the number of Ad vector virus particles and the infection time. Heat-treated Ad vector, which is not infectious, did not alter P-gp mRNA expression. Uptake experiments with doxorubicin (DOX), a P-gp substrate, revealed that DOX accumulation was significantly decreased in Ad vector-infected A549 cells. The decrease of DOX uptake was blocked by verapamil, a P-gp inhibitor. Our results indicated that Ad vector infection of NSCLC cells caused MDR mediated by P-gp overexpression. The Ad vector genome sequence is similar to that of human Ad, and therefore human Ad infection of lung cancer patients may lead to chemoresistance in the clinical environment. -- Highlights: •Adenovirus vector infection induced P-gp mRNA expression in three NSCLC cell lines. •Adenovirus vector infection enhanced P-gp-mediated doxorubicin efflux from the cells. •The increase of P-gp was not mediated by nuclear receptors (PXR, CAR) or COX-2.
Energy Technology Data Exchange (ETDEWEB)
Tomono, Takumi [Laboratory of Clinical Pharmacokinetics, Graduate School of Pharmaceutical Sciences, Takasaki University of Health and Welfare, 60 Nakaorui-machi, Takasaki-shi, Gunma 370-0033 (Japan); Kajita, Masahiro [Laboratory of Molecular Pharmaceutics and Technology, Faculty of Pharmacy, Takasaki University of Health and Welfare, 60 Nakaorui-machi, Takasaki-shi, Gunma 370-0033 (Japan); Yano, Kentaro [Laboratory of Biopharmaceutics, Faculty of Pharmacy, Takasaki University of Health and Welfare, 60 Nakaorui-machi, Takasaki-shi, Gunma 370-0033 (Japan); Ogihara, Takuo, E-mail: togihara@takasaki-u.ac.jp [Laboratory of Clinical Pharmacokinetics, Graduate School of Pharmaceutical Sciences, Takasaki University of Health and Welfare, 60 Nakaorui-machi, Takasaki-shi, Gunma 370-0033 (Japan)
2016-08-05
P-glycoprotein (P-gp) is an ATP-binding cassette protein involved in cancer multi-drug resistance (MDR). It has been reported that infection with some bacteria and viruses induces changes in the activities of various drug-metabolizing enzymes and transporters, including P-gp. Although human adenoviruses (Ad) cause the common cold, the effect of Ad infection on MDR in cancer has not been established. In this study, we investigated whether Ad infection is a cause of MDR in A549, H441 and HCC827 non-small-cell lung cancer (NSCLC) cell lines, using an Ad vector system. We found that Ad vector infection of NSCLC cell lines induced P-gp mRNA expression, and the extent of induction was dependent on the number of Ad vector virus particles and the infection time. Heat-treated Ad vector, which is not infectious, did not alter P-gp mRNA expression. Uptake experiments with doxorubicin (DOX), a P-gp substrate, revealed that DOX accumulation was significantly decreased in Ad vector-infected A549 cells. The decrease of DOX uptake was blocked by verapamil, a P-gp inhibitor. Our results indicated that Ad vector infection of NSCLC cells caused MDR mediated by P-gp overexpression. The Ad vector genome sequence is similar to that of human Ad, and therefore human Ad infection of lung cancer patients may lead to chemoresistance in the clinical environment. -- Highlights: •Adenovirus vector infection induced P-gp mRNA expression in three NSCLC cell lines. •Adenovirus vector infection enhanced P-gp-mediated doxorubicin efflux from the cells. •The increase of P-gp was not mediated by nuclear receptors (PXR, CAR) or COX-2.
International Nuclear Information System (INIS)
Chowaniecova, G.
2014-01-01
Introduction: Advanced non-small cell lung cancer with present epidermal growth factor receptor (EGFR) sensitising mutation is standardly treated with tyrosine kinase inhibitors (TKI). During treatment a resistance to TKI develops, disease progresses. We differ primary and secondary resistance. The most effective treatment after TKI failure is not definitively proven. Standard chemotherapy is usually introduced, eventually it is possible to use other TKI in the next lines. Case: The author presents a case of 60-year old patient with lung adenocarcinoma with EGFR sensitising mutation, where primary resistance to TKI was observed. Chemotherapy after progression was introduced. Planned therapy with afatnib was not carried out due to deterioration of patient´s condition. Conclusion: Presented case of EGFR mutation-positive patient represents an example of not very frequent primary resistance to TKI. Mechanisms of primary resistance are not well understood. Treatment after first line TKI failure in non-small cell lung cancer with EGFR mutation represents a challenge for medical research. (author)
Galetta, D; Rossi, A; Pisconti, S; Millaku, A; Colucci, G
2010-11-01
Lung cancer is the most common cancer worldwide with non-small cell lung cancer (NSCLC), including squamous carcinoma, adenocarcinoma and large cell carcinoma, accounting for about 85% of all lung cancer types with most of the patients presenting with advanced disease at the time of diagnosis. In this setting first-line platinum-based chemotherapy for no more than 4-6 cycles are recommended. After these cycles of treatment, non-progressing patients enter in the so called "watch and wait" period in which no further therapy is administered until there is disease progression. In order to improve the advanced NSCLC outcomes, the efficacy of further treatment in the "watch and wait" period was investigated. This is the "maintenance therapy". Recently, the results coming from randomized phase III trials investigating two new agents, pemetrexed and erlotinib, in this setting led to their registration for maintenance therapy. Here, we report and discuss these results. Copyright © 2010 Elsevier Ltd. All rights reserved.
International Nuclear Information System (INIS)
Eo, Jae Seon; Lee, Won Woo; Chung, Jin Haeng; So, Young; Lee, Dong Soo; Chung, June Key; Lee, Myung Chul; Kim, Sang Eun
2004-01-01
The whole body FDG PET suffers from poor diagnostic competency in differentiation of mediastinal lymph node (LN) in non-small cell lung cancer. In addition to LN FDG uptake. We considered myocardial FDG uptake in mediastinal lymph node staging. Thirty-nine non-small cell lung cancer patients (male: female = 32: 7, age = 63±11 years) who underwent preoperative whole body FDG PET were enrolled. There were 18 squamous cell cancer, 13 adenocarcinoma, and 8 others. Maximum standard uptake values (maxSUVs) of myocardium and LNs using lean body weight were measured and compared with pathological results. Among 187 LNs which were confirmed postoperatively, 31 were malignant, and 156 benign. Of 31 malignant LNs, only 11 were visible on FDG PET (sensitivity : 35.5% = 11/31) but majority of 20 nonvisible metastatic LNs had relevant cause of false negative (11 peribroncheal, 3 mucine producing adenocarcinoma, or 6 low amount of tumor cells). Of 156 benign LNs, 137 were nonvisible (specificity : 87.8% 137/156) and 19 visible. Under subgroup analysis of 30 visible LNs on whole body FDG PET (11 malignant, and 19 benign), maxSUV of myocardium (p = 0.020) as well as maxSUV of LN (p = 0.002) were significant predictor of malignant LN in multivariate analysis. Using the ROC curve, a cut-off value of LN maxSUV > 2.4 provided sensitivity of 81.8% and specificity of 63.2% (AUC 0.775, 95% confidence interval = 0.586 to 0.906). Meanwhile, the composite criterion of LN maxSUV plus square root of myocardial maxSUV > 4.65 provided slightly improved diagnostic competencies (sensitivity 90.9%, specificity 84.2%, AUC 0.876, 95% confidence interval 0.704 to 0.966) (p = 0.08). Taking into consideration myocardial FDG uptake may improve the diagnostic competency of whole body FDG PET in differentiation of mediastinal LNs of non-small cell lung cancer