WorldWideScience

Sample records for ncbi biosystems database

  1. The NCBI BioSystems database.

    Science.gov (United States)

    Geer, Lewis Y; Marchler-Bauer, Aron; Geer, Renata C; Han, Lianyi; He, Jane; He, Siqian; Liu, Chunlei; Shi, Wenyao; Bryant, Stephen H

    2010-01-01

    The NCBI BioSystems database, found at http://www.ncbi.nlm.nih.gov/biosystems/, centralizes and cross-links existing biological systems databases, increasing their utility and target audience by integrating their pathways and systems into NCBI resources. This integration allows users of NCBI's Entrez databases to quickly categorize proteins, genes and small molecules by metabolic pathway, disease state or other BioSystem type, without requiring time-consuming inference of biological relationships from the literature or multiple experimental datasets.

  2. BioSystems

    Data.gov (United States)

    U.S. Department of Health & Human Services — The NCBI BioSystems Database provides integrated access to biological systems and their component genes, proteins, and small molecules, as well as literature...

  3. NCBI2RDF: Enabling Full RDF-Based Access to NCBI Databases

    Directory of Open Access Journals (Sweden)

    Alberto Anguita

    2013-01-01

    Full Text Available RDF has become the standard technology for enabling interoperability among heterogeneous biomedical databases. The NCBI provides access to a large set of life sciences databases through a common interface called Entrez. However, the latter does not provide RDF-based access to such databases, and, therefore, they cannot be integrated with other RDF-compliant databases and accessed via SPARQL query interfaces. This paper presents the NCBI2RDF system, aimed at providing RDF-based access to the complete NCBI data repository. This API creates a virtual endpoint for servicing SPARQL queries over different NCBI repositories and presenting to users the query results in SPARQL results format, thus enabling this data to be integrated and/or stored with other RDF-compliant repositories. SPARQL queries are dynamically resolved, decomposed, and forwarded to the NCBI-provided E-utilities programmatic interface to access the NCBI data. Furthermore, we show how our approach increases the expressiveness of the native NCBI querying system, allowing several databases to be accessed simultaneously. This feature significantly boosts productivity when working with complex queries and saves time and effort to biomedical researchers. Our approach has been validated with a large number of SPARQL queries, thus proving its reliability and enhanced capabilities in biomedical environments.

  4. NCBI2RDF: Enabling Full RDF-Based Access to NCBI Databases

    Science.gov (United States)

    Anguita, Alberto; García-Remesal, Miguel; de la Iglesia, Diana; Maojo, Victor

    2013-01-01

    RDF has become the standard technology for enabling interoperability among heterogeneous biomedical databases. The NCBI provides access to a large set of life sciences databases through a common interface called Entrez. However, the latter does not provide RDF-based access to such databases, and, therefore, they cannot be integrated with other RDF-compliant databases and accessed via SPARQL query interfaces. This paper presents the NCBI2RDF system, aimed at providing RDF-based access to the complete NCBI data repository. This API creates a virtual endpoint for servicing SPARQL queries over different NCBI repositories and presenting to users the query results in SPARQL results format, thus enabling this data to be integrated and/or stored with other RDF-compliant repositories. SPARQL queries are dynamically resolved, decomposed, and forwarded to the NCBI-provided E-utilities programmatic interface to access the NCBI data. Furthermore, we show how our approach increases the expressiveness of the native NCBI querying system, allowing several databases to be accessed simultaneously. This feature significantly boosts productivity when working with complex queries and saves time and effort to biomedical researchers. Our approach has been validated with a large number of SPARQL queries, thus proving its reliability and enhanced capabilities in biomedical environments. PMID:23984425

  5. NCBI2RDF: enabling full RDF-based access to NCBI databases.

    Science.gov (United States)

    Anguita, Alberto; García-Remesal, Miguel; de la Iglesia, Diana; Maojo, Victor

    2013-01-01

    RDF has become the standard technology for enabling interoperability among heterogeneous biomedical databases. The NCBI provides access to a large set of life sciences databases through a common interface called Entrez. However, the latter does not provide RDF-based access to such databases, and, therefore, they cannot be integrated with other RDF-compliant databases and accessed via SPARQL query interfaces. This paper presents the NCBI2RDF system, aimed at providing RDF-based access to the complete NCBI data repository. This API creates a virtual endpoint for servicing SPARQL queries over different NCBI repositories and presenting to users the query results in SPARQL results format, thus enabling this data to be integrated and/or stored with other RDF-compliant repositories. SPARQL queries are dynamically resolved, decomposed, and forwarded to the NCBI-provided E-utilities programmatic interface to access the NCBI data. Furthermore, we show how our approach increases the expressiveness of the native NCBI querying system, allowing several databases to be accessed simultaneously. This feature significantly boosts productivity when working with complex queries and saves time and effort to biomedical researchers. Our approach has been validated with a large number of SPARQL queries, thus proving its reliability and enhanced capabilities in biomedical environments.

  6. BIOSPIDA: A Relational Database Translator for NCBI.

    Science.gov (United States)

    Hagen, Matthew S; Lee, Eva K

    2010-11-13

    As the volume and availability of biological databases continue widespread growth, it has become increasingly difficult for research scientists to identify all relevant information for biological entities of interest. Details of nucleotide sequences, gene expression, molecular interactions, and three-dimensional structures are maintained across many different databases. To retrieve all necessary information requires an integrated system that can query multiple databases with minimized overhead. This paper introduces a universal parser and relational schema translator that can be utilized for all NCBI databases in Abstract Syntax Notation (ASN.1). The data models for OMIM, Entrez-Gene, Pubmed, MMDB and GenBank have been successfully converted into relational databases and all are easily linkable helping to answer complex biological questions. These tools facilitate research scientists to locally integrate databases from NCBI without significant workload or development time.

  7. The World Bacterial Biogeography and Biodiversity through Databases: A Case Study of NCBI Nucleotide Database and GBIF Database

    Directory of Open Access Journals (Sweden)

    Okba Selama

    2013-01-01

    Full Text Available Databases are an essential tool and resource within the field of bioinformatics. The primary aim of this study was to generate an overview of global bacterial biodiversity and biogeography using available data from the two largest public online databases, NCBI Nucleotide and GBIF. The secondary aim was to highlight the contribution each geographic area has to each database. The basis for data analysis of this study was the metadata provided by both databases, mainly, the taxonomy and the geographical area origin of isolation of the microorganism (record. These were directly obtained from GBIF through the online interface, while E-utilities and Python were used in combination with a programmatic web service access to obtain data from the NCBI Nucleotide Database. Results indicate that the American continent, and more specifically the USA, is the top contributor, while Africa and Antarctica are less well represented. This highlights the imbalance of exploration within these areas rather than any reduction in biodiversity. This study describes a novel approach to generating global scale patterns of bacterial biodiversity and biogeography and indicates that the Proteobacteria are the most abundant and widely distributed phylum within both databases.

  8. Biosystems Engineering in Portugal

    OpenAIRE

    Marques da Silva, José Rafael; Silva, Luis Leopoldo; Cruz, Vasco Fitas

    2008-01-01

    The paper gives the definition of Biosystems Engineering in Portugal; Possible revisions of the core curriculum presented in the FEANI report; the current situation of Biosystems Engineering in Portugal; The impacts of the transition to Biosystems Engineering; The need for a transition to Biosystems Engineering;Opportunities to the Biosystems Engineer in the labour market.

  9. Fungal genome resources at NCBI

    Science.gov (United States)

    Robbertse, B.; Tatusova, T.

    2011-01-01

    The National Center for Biotechnology Information (NCBI) is well known for the nucleotide sequence archive, GenBank and sequence analysis tool BLAST. However, NCBI integrates many types of biomolecular data from variety of sources and makes it available to the scientific community as interactive web resources as well as organized releases of bulk data. These tools are available to explore and compare fungal genomes. Searching all databases with Fungi [organism] at http://www.ncbi.nlm.nih.gov/ is the quickest way to find resources of interest with fungal entries. Some tools though are resources specific and can be indirectly accessed from a particular database in the Entrez system. These include graphical viewers and comparative analysis tools such as TaxPlot, TaxMap and UniGene DDD (found via UniGene Homepage). Gene and BioProject pages also serve as portals to external data such as community annotation websites, BioGrid and UniProt. There are many different ways of accessing genomic data at NCBI. Depending on the focus and goal of research projects or the level of interest, a user would select a particular route for accessing genomic databases and resources. This review article describes methods of accessing fungal genome data and provides examples that illustrate the use of analysis tools. PMID:22737589

  10. NCBI Bookshelf: books and documents in life sciences and health care.

    Science.gov (United States)

    Hoeppner, Marilu A

    2013-01-01

    Bookshelf (http://www.ncbi.nlm.nih.gov/books/) is a full-text electronic literature resource of books and documents in life sciences and health care at the National Center for Biotechnology Information (NCBI). Created in 1999 with a single book as an encyclopedic reference for resources such as PubMed and GenBank, it has grown to its current size of >1300 titles. Unlike other NCBI databases, such as GenBank and Gene, which have a strict data structure, books come in all forms; they are diverse in publication types, formats, sizes and authoring models. The Bookshelf data format is XML tagged in the NCBI Book DTD (Document Type Definition), modeled after the National Library of Medicine journal article DTDs. The book DTD has been used for systematically tagging the diverse data formats of books, a move that has set the foundation for the growth of this resource. Books at NCBI followed the route of journal articles in the PubMed Central project, using the PubMed Central architectural framework, workflows and processes. Through integration with other NCBI molecular databases, books at NCBI can be used to provide reference information for biological data and facilitate its discovery. This article describes Bookshelf at NCBI: its growth, data handling and retrieval and integration with molecular databases.

  11. Phenomena of synchronized response in biosystems and the possible mechanism.

    Science.gov (United States)

    Xu, Jingjing; Yang, Fan; Han, Danhong; Xu, Shengyong

    2018-02-05

    Phenomena of synchronized response is common among organs, tissues and cells in biosystems. We have analyzed and discussed three examples of synchronization in biosystems, including the direction-changing movement of paramecia, the prey behavior of flytraps, and the simultaneous discharge of electric eels. These phenomena and discussions support an electrical communication mechanism that in biosystems, the electrical signals are mainly soliton-like electromagnetic pulses, which are generated by the transient transmembrane ionic current through the ion channels and propagate along the dielectric membrane-based softmaterial waveguide network to complete synchronized responses. This transmission model implies that a uniform electrical communication mechanism might have been naturally developed in biosystem. Copyright © 2018 Elsevier Inc. All rights reserved.

  12. ORION-VIRCAT: a tool for mapping ICTV and NCBI taxonomies.

    Science.gov (United States)

    Valdivia-Granda, Willy; Larson, Francis

    2009-01-01

    Viruses, viroids and prions are the smallest infectious biological entities that depend on their host for replication. The number of pathogenic viruses is considerably large and their impact in human global health is well documented. Currently, the International Committee on the Taxonomy of Viruses (ICTV) has classified approximately 4379 virus species while the National Center for Biotechnology Information Viral Genomes Resource (NCBI-VGR) database has mapped 617 705 proteins to eight large taxonomic groups. Despite these efforts, an automated approach for mapping the ICTV master list and its officially accepted virus naming to the NCBI-VGR's taxonomical classification is not available. Due to metagenomic sequencing, it is likely that the discovery and naming of new viral species will increase by at least ten fold. Unfortunately, existing viral databases are not adequately prepared to scale, maintain and annotate automatically ultra-high throughput sequences and place this information into specific taxonomic categories. ORION-VIRCAT is a scalable and interoperable object-relational database designed to serve as a resource for the integration and verification of taxonomical classifications generated by the ICTV and NCBI-VGR. The current release (v1.0) of ORION-VIRCAT is implemented in PostgreSQL and it has been extended to ORACLE, MySQL and SyBase. ORION-VIRCAT automatically mapped and joined 617 705 entries from the NCBI-VGR to the viral naming of the ICTV. This detailed analysis revealed that 399 095 entries from the NCBI-VGR can be mapped to the ICTV classification and that one Order, 10 families, 35 genera and 503 species listed in the ICTV disagree with the the NCBI-VGR classification schema. Nevertheless, we were eable to correct several discrepancies mapping 234 000 additional entries.Database URL:http://www.orionbiosciences.com/research/orion-vircat.html.

  13. Human Performance and Biosystems

    Science.gov (United States)

    2013-03-08

    Fuel Cells • Artificial Photosynthesis Overview of Topic Areas 3003 Human Performance/Biosystems • Photo-Electro-Magnetic Stimulation of...1) Electronic transport in bacterial nanowires was demonstrated using nanofabrication enabled approaches (2) Identified the biophysical... bacterial nanowires and outer-membrane vesicles enhancing the electron transfer and respiration of individual cells Outlook The first demonstration

  14. Health effects of low-dose radiation: Molecular, cellular, and biosystem response

    International Nuclear Information System (INIS)

    Pollycove, M.; Paperiello, C.J.

    1997-01-01

    Since the fifties, the prime concern of radiation protection has been protecting DNA from damage. UNSCEAR initiated a focus on biosystem response to damage with its 1994 report, ''Adaptive Responses to Radiation of Cells and Organisms''. The DNA damage-control biosystem is physiologically operative on both metabolic and radiation induced damage, both effected predominantly by free radicals. These adaptive responses are suppressed by high-dose and stimulated by low dose radiation. Increased biosystem efficiently reduces the number of mutations that accumulate during a lifetime and decrease DNA damage-control with resultant aging and malignancy. Several statistically significant epidemiologic studies have shown risk decrements of cancer mortality and mortality from all causes in populations exposed to low-dose radiation. Further biologic and epidemiologic research is needed to establish a valid threshold below which risk decrements occur. (author)

  15. Workflow and web application for annotating NCBI BioProject transcriptome data.

    Science.gov (United States)

    Vera Alvarez, Roberto; Medeiros Vidal, Newton; Garzón-Martínez, Gina A; Barrero, Luz S; Landsman, David; Mariño-Ramírez, Leonardo

    2017-01-01

    The volume of transcriptome data is growing exponentially due to rapid improvement of experimental technologies. In response, large central resources such as those of the National Center for Biotechnology Information (NCBI) are continually adapting their computational infrastructure to accommodate this large influx of data. New and specialized databases, such as Transcriptome Shotgun Assembly Sequence Database (TSA) and Sequence Read Archive (SRA), have been created to aid the development and expansion of centralized repositories. Although the central resource databases are under continual development, they do not include automatic pipelines to increase annotation of newly deposited data. Therefore, third-party applications are required to achieve that aim. Here, we present an automatic workflow and web application for the annotation of transcriptome data. The workflow creates secondary data such as sequencing reads and BLAST alignments, which are available through the web application. They are based on freely available bioinformatics tools and scripts developed in-house. The interactive web application provides a search engine and several browser utilities. Graphical views of transcript alignments are available through SeqViewer, an embedded tool developed by NCBI for viewing biological sequence data. The web application is tightly integrated with other NCBI web applications and tools to extend the functionality of data processing and interconnectivity. We present a case study for the species Physalis peruviana with data generated from BioProject ID 67621. URL: http://www.ncbi.nlm.nih.gov/projects/physalis/. Published by Oxford University Press 2017. This work is written by US Government employees and is in the public domain in the US.

  16. The Kernel Estimation in Biosystems Engineering

    Directory of Open Access Journals (Sweden)

    Esperanza Ayuga Téllez

    2008-04-01

    Full Text Available In many fields of biosystems engineering, it is common to find works in which statistical information is analysed that violates the basic hypotheses necessary for the conventional forecasting methods. For those situations, it is necessary to find alternative methods that allow the statistical analysis considering those infringements. Non-parametric function estimation includes methods that fit a target function locally, using data from a small neighbourhood of the point. Weak assumptions, such as continuity and differentiability of the target function, are rather used than "a priori" assumption of the global target function shape (e.g., linear or quadratic. In this paper a few basic rules of decision are enunciated, for the application of the non-parametric estimation method. These statistical rules set up the first step to build an interface usermethod for the consistent application of kernel estimation for not expert users. To reach this aim, univariate and multivariate estimation methods and density function were analysed, as well as regression estimators. In some cases the models to be applied in different situations, based on simulations, were defined. Different biosystems engineering applications of the kernel estimation are also analysed in this review.

  17. muBLASTP: database-indexed protein sequence search on multicore CPUs.

    Science.gov (United States)

    Zhang, Jing; Misra, Sanchit; Wang, Hao; Feng, Wu-Chun

    2016-11-04

    The Basic Local Alignment Search Tool (BLAST) is a fundamental program in the life sciences that searches databases for sequences that are most similar to a query sequence. Currently, the BLAST algorithm utilizes a query-indexed approach. Although many approaches suggest that sequence search with a database index can achieve much higher throughput (e.g., BLAT, SSAHA, and CAFE), they cannot deliver the same level of sensitivity as the query-indexed BLAST, i.e., NCBI BLAST, or they can only support nucleotide sequence search, e.g., MegaBLAST. Due to different challenges and characteristics between query indexing and database indexing, the existing techniques for query-indexed search cannot be used into database indexed search. muBLASTP, a novel database-indexed BLAST for protein sequence search, delivers identical hits returned to NCBI BLAST. On Intel Haswell multicore CPUs, for a single query, the single-threaded muBLASTP achieves up to a 4.41-fold speedup for alignment stages, and up to a 1.75-fold end-to-end speedup over single-threaded NCBI BLAST. For a batch of queries, the multithreaded muBLASTP achieves up to a 5.7-fold speedups for alignment stages, and up to a 4.56-fold end-to-end speedup over multithreaded NCBI BLAST. With a newly designed index structure for protein database and associated optimizations in BLASTP algorithm, we re-factored BLASTP algorithm for modern multicore processors that achieves much higher throughput with acceptable memory footprint for the database index.

  18. Industrial biosystems engineering and biorefinery systems.

    Science.gov (United States)

    Chen, Shulin

    2008-06-01

    The concept of Industrial Biosystems Engineering (IBsE) was suggested as a new engineering branch to be developed for meeting the needs for science, technology and professionals by the upcoming bioeconomy. With emphasis on systems, IBsE builds upon the interfaces between systems biology, bioprocessing, and systems engineering. This paper discussed the background, the suggested definition, the theoretical framework and methodologies of this new discipline as well as its challenges and future development.

  19. Towards Viral Genome Annotation Standards, Report from the 2010 NCBI Annotation Workshop.

    Science.gov (United States)

    Brister, James Rodney; Bao, Yiming; Kuiken, Carla; Lefkowitz, Elliot J; Le Mercier, Philippe; Leplae, Raphael; Madupu, Ramana; Scheuermann, Richard H; Schobel, Seth; Seto, Donald; Shrivastava, Susmita; Sterk, Peter; Zeng, Qiandong; Klimke, William; Tatusova, Tatiana

    2010-10-01

    Improvements in DNA sequencing technologies portend a new era in virology and could possibly lead to a giant leap in our understanding of viral evolution and ecology. Yet, as viral genome sequences begin to fill the world's biological databases, it is critically important to recognize that the scientific promise of this era is dependent on consistent and comprehensive genome annotation. With this in mind, the NCBI Genome Annotation Workshop recently hosted a study group tasked with developing sequence, function, and metadata annotation standards for viral genomes. This report describes the issues involved in viral genome annotation and reviews policy recommendations presented at the NCBI Annotation Workshop.

  20. Towards Viral Genome Annotation Standards, Report from the 2010 NCBI Annotation Workshop

    Directory of Open Access Journals (Sweden)

    Qiandong Zeng

    2010-10-01

    Full Text Available Improvements in DNA sequencing technologies portend a new era in virology and could possibly lead to a giant leap in our understanding of viral evolution and ecology. Yet, as viral genome sequences begin to fill the world’s biological databases, it is critically important to recognize that the scientific promise of this era is dependent on consistent and comprehensive genome annotation. With this in mind, the NCBI Genome Annotation Workshop recently hosted a study group tasked with developing sequence, function, and metadata annotation standards for viral genomes. This report describes the issues involved in viral genome annotation and reviews policy recommendations presented at the NCBI Annotation Workshop.

  1. The NIF LinkOut broker: a web resource to facilitate federated data integration using NCBI identifiers.

    Science.gov (United States)

    Marenco, Luis; Ascoli, Giorgio A; Martone, Maryann E; Shepherd, Gordon M; Miller, Perry L

    2008-09-01

    This paper describes the NIF LinkOut Broker (NLB) that has been built as part of the Neuroscience Information Framework (NIF) project. The NLB is designed to coordinate the assembly of links to neuroscience information items (e.g., experimental data, knowledge bases, and software tools) that are (1) accessible via the Web, and (2) related to entries in the National Center for Biotechnology Information's (NCBI's) Entrez system. The NLB collects these links from each resource and passes them to the NCBI which incorporates them into its Entrez LinkOut service. In this way, an Entrez user looking at a specific Entrez entry can LinkOut directly to related neuroscience information. The information stored in the NLB can also be utilized in other ways. A second approach, which is operational on a pilot basis, is for the NLB Web server to create dynamically its own Web page of LinkOut links for each NCBI identifier in the NLB database. This approach can allow other resources (in addition to the NCBI Entrez) to LinkOut to related neuroscience information. The paper describes the current NLB system and discusses certain design issues that arose during its implementation.

  2. Third cycle university studies in Europe in the field of agricultural engineering and in the emerging discipline of biosystems engineering.

    Science.gov (United States)

    Ayuga, F; Briassoulis, D; Aguado, P; Farkas, I; Griepentrog, H; Lorencowicz, E

    2010-01-01

    The main objectives of European Thematic Network entitled 'Education and Research in Agricultural for Biosystems Engineering in Europe (ERABEE-TN)' is to initiate and contribute to the structural development and the assurance of the quality assessment of the emerging discipline of Biosystems Engineering in Europe. ERABEE is co-financed by the European Community in the framework of the LLP Programme. The partnership consists of 35 participants from 27 Erasmus countries, out of which 33 are Higher Education Area Institutions (EDU) and 2 are Student Associations (ASS). 13 Erasmus participants (e.g. Thematic Networks, Professional Associations, and Institutions from Brazil, Croatia, Russia and Serbia) are also involved in the Thematic Network through synergies. To date, very few Biosystems Engineering programs exist in Europe and those that are initiated are at a very primitive stage of development. The innovative and novel goal of the Thematic Network is to promote this critical transition, which requires major restructuring in Europe, exploiting along this direction the outcomes accomplished by its predecessor; the USAEE-TN (University Studies in Agricultural Engineering in Europe). It also aims at enhancing the compatibility among the new programmes of Biosystems Engineering, aiding their recognition and accreditation at European and International level and facilitating greater mobility of skilled personnel, researchers and students. One of the technical objectives of ERABEE is dealing with mapping and promoting the third cycle studies (including European PhDs) and supporting the integration of research at the 1st and 2nd cycle regarding European Biosystems Engineering university studies. During the winter 2008 - spring 2009 period, members of ERABEE conducted a survey on the contemporary status of doctoral studies in Europe, and on a possible scheme for promotion of cooperation and synergies in the framework of the third cycle of studies and the European Doctorate

  3. Production of biofuels and biochemicals by in vitro synthetic biosystems: Opportunities and challenges.

    Science.gov (United States)

    Zhang, Yi-Heng Percival

    2015-11-15

    The largest obstacle to the cost-competitive production of low-value and high-impact biofuels and biochemicals (called biocommodities) is high production costs catalyzed by microbes due to their inherent weaknesses, such as low product yield, slow reaction rate, high separation cost, intolerance to toxic products, and so on. This predominant whole-cell platform suffers from a mismatch between the primary goal of living microbes - cell proliferation and the desired biomanufacturing goal - desired products (not cell mass most times). In vitro synthetic biosystems consist of numerous enzymes as building bricks, enzyme complexes as building modules, and/or (biomimetic) coenzymes, which are assembled into synthetic enzymatic pathways for implementing complicated bioreactions. They emerge as an alternative solution for accomplishing a desired biotransformation without concerns of cell proliferation, complicated cellular regulation, and side-product formation. In addition to the most important advantage - high product yield, in vitro synthetic biosystems feature several other biomanufacturing advantages, such as fast reaction rate, easy product separation, open process control, broad reaction condition, tolerance to toxic substrates or products, and so on. In this perspective review, the general design rules of in vitro synthetic pathways are presented with eight supporting examples: hydrogen, n-butanol, isobutanol, electricity, starch, lactate,1,3-propanediol, and poly-3-hydroxylbutyrate. Also, a detailed economic analysis for enzymatic hydrogen production from carbohydrates is presented to illustrate some advantages of this system and the remaining challenges. Great market potentials will motivate worldwide efforts from multiple disciplines (i.e., chemistry, biology and engineering) to address the remaining obstacles pertaining to cost and stability of enzymes and coenzymes, standardized building parts and modules, biomimetic coenzymes, biosystem optimization, and scale

  4. Improving taxonomic accuracy for fungi in public sequence databases: applying ‘one name one species’ in well-defined genera with Trichoderma/Hypocrea as a test case

    Science.gov (United States)

    Strope, Pooja K; Chaverri, Priscila; Gazis, Romina; Ciufo, Stacy; Domrachev, Michael; Schoch, Conrad L

    2017-01-01

    Abstract The ITS (nuclear ribosomal internal transcribed spacer) RefSeq database at the National Center for Biotechnology Information (NCBI) is dedicated to the clear association between name, specimen and sequence data. This database is focused on sequences obtained from type material stored in public collections. While the initial ITS sequence curation effort together with numerous fungal taxonomy experts attempted to cover as many orders as possible, we extended our latest focus to the family and genus ranks. We focused on Trichoderma for several reasons, mainly because the asexual and sexual synonyms were well documented, and a list of proposed names and type material were recently proposed and published. In this case study the recent taxonomic information was applied to do a complete taxonomic audit for the genus Trichoderma in the NCBI Taxonomy database. A name status report is available here: https://www.ncbi.nlm.nih.gov/Taxonomy/TaxIdentifier/tax_identifier.cgi. As a result, the ITS RefSeq Targeted Loci database at NCBI has been augmented with more sequences from type and verified material from Trichoderma species. Additionally, to aid in the cross referencing of data from single loci and genomes we have collected a list of quality records of the RPB2 gene obtained from type material in GenBank that could help validate future submissions. During the process of curation misidentified genomes were discovered, and sequence records from type material were found hidden under previous classifications. Source metadata curation, although more cumbersome, proved to be useful as confirmation of the type material designation. Database URL: http://www.ncbi.nlm.nih.gov/bioproject/PRJNA177353 PMID:29220466

  5. Protein-based nanostructures as carriers for photo-physically active molecules in biosystems

    OpenAIRE

    Delcanale, Pietro

    2017-01-01

    In nature, many proteins function as carriers, being able to bind, transport and possibly release a ligand within a biological system. Protein-based carriers are interesting systems for drug delivery, with the remarkable advantage of being water-soluble and, as inherent components of biosystems, highly bio-compatible. This work focuses on the use of protein-based carriers for the delivery of hydrophobic photo-physically active molecules, whose structure and chemical properties lead to spontan...

  6. Validation of the Applied Biosystems RapidFinder Shiga Toxin-Producing E. coli (STEC) Detection Workflow.

    Science.gov (United States)

    Cloke, Jonathan; Matheny, Sharon; Swimley, Michelle; Tebbs, Robert; Burrell, Angelia; Flannery, Jonathan; Bastin, Benjamin; Bird, Patrick; Benzinger, M Joseph; Crowley, Erin; Agin, James; Goins, David; Salfinger, Yvonne; Brodsky, Michael; Fernandez, Maria Cristina

    2016-11-01

    The Applied Biosystems™ RapidFinder™ STEC Detection Workflow (Thermo Fisher Scientific) is a complete protocol for the rapid qualitative detection of Escherichia coli (E. coli) O157:H7 and the "Big 6" non-O157 Shiga-like toxin-producing E. coli (STEC) serotypes (defined as serogroups: O26, O45, O103, O111, O121, and O145). The RapidFinder STEC Detection Workflow makes use of either the automated preparation of PCR-ready DNA using the Applied Biosystems PrepSEQ™ Nucleic Acid Extraction Kit in conjunction with the Applied Biosystems MagMAX™ Express 96-well magnetic particle processor or the Applied Biosystems PrepSEQ Rapid Spin kit for manual preparation of PCR-ready DNA. Two separate assays comprise the RapidFinder STEC Detection Workflow, the Applied Biosystems RapidFinder STEC Screening Assay and the Applied Biosystems RapidFinder STEC Confirmation Assay. The RapidFinder STEC Screening Assay includes primers and probes to detect the presence of stx1 (Shiga toxin 1), stx2 (Shiga toxin 2), eae (intimin), and E. coli O157 gene targets. The RapidFinder STEC Confirmation Assay includes primers and probes for the "Big 6" non-O157 STEC and E. coli O157:H7. The use of these two assays in tandem allows a user to detect accurately the presence of the "Big 6" STECs and E. coli O157:H7. The performance of the RapidFinder STEC Detection Workflow was evaluated in a method comparison study, in inclusivity and exclusivity studies, and in a robustness evaluation. The assays were compared to the U.S. Department of Agriculture (USDA), Food Safety and Inspection Service (FSIS) Microbiology Laboratory Guidebook (MLG) 5.09: Detection, Isolation and Identification of Escherichia coli O157:H7 from Meat Products and Carcass and Environmental Sponges for raw ground beef (73% lean) and USDA/FSIS-MLG 5B.05: Detection, Isolation and Identification of Escherichia coli non-O157:H7 from Meat Products and Carcass and Environmental Sponges for raw beef trim. No statistically significant

  7. Controlled structure and properties of silicate nanoparticle networks for incorporation of biosystem components

    International Nuclear Information System (INIS)

    Sakai-Kato, Kumiko; Kawanishi, Toru; Hasegawa, Toshiaki; Takaoka, Akio; Kato, Masaru; Toyo'oka, Toshimasa; Utsunomiya-Tate, Naoko

    2011-01-01

    Inorganic nanoparticles are of technological interest in many fields. We created silicate nanoparticle hydrogels that effectively incorporated biomolecules that are unstable and involved in complicated reactions. The size of the silicate nanoparticles strongly affected both the physical characteristics of the resulting hydrogel and the activity of biomolecules incorporated within the hydrogel. We used high-resolution transmission electron microscopy (TEM) to analyze in detail the hydrogel network patterns formed by the silicate nanoparticles. We obtained clear nanostructured images of biomolecule-nanoparticle composite hydrogels. The TEM images also showed that larger silicate nanoparticles (22 nm) formed more loosely associated silicate networks than did smaller silicate nanoparticles (7 nm). The loosely associated networks formed from larger silicate nanoparticles might facilitate substrate diffusion through the network, thus promoting the observed increased activity of the entrapped biomolecules. This doubled the activity of the incorporated biosystems compared with that of biosystems prepared by our own previously reported method. We propose a reaction scheme to explain the formation of the silicate nanoparticle networks. The successful incorporation of biomolecules into the nanoparticle hydrogels, along with the high level of activity exhibited by the biomolecules required for complicated reaction within the gels, demonstrates the nanocomposites' potential for use in medical applications.

  8. LINE FUSION GENES: a database of LINE expression in human genes

    Directory of Open Access Journals (Sweden)

    Park Hong-Seog

    2006-06-01

    Full Text Available Abstract Background Long Interspersed Nuclear Elements (LINEs are the most abundant retrotransposons in humans. About 79% of human genes are estimated to contain at least one segment of LINE per transcription unit. Recent studies have shown that LINE elements can affect protein sequences, splicing patterns and expression of human genes. Description We have developed a database, LINE FUSION GENES, for elucidating LINE expression throughout the human gene database. We searched the 28,171 genes listed in the NCBI database for LINE elements and analyzed their structures and expression patterns. The results show that the mRNA sequences of 1,329 genes were affected by LINE expression. The LINE expression types were classified on the basis of LINEs in the 5' UTR, exon or 3' UTR sequences of the mRNAs. Our database provides further information, such as the tissue distribution and chromosomal location of the genes, and the domain structure that is changed by LINE integration. We have linked all the accession numbers to the NCBI data bank to provide mRNA sequences for subsequent users. Conclusion We believe that our work will interest genome scientists and might help them to gain insight into the implications of LINE expression for human evolution and disease. Availability http://www.primate.or.kr/line

  9. Research activities in the first two cycles of European Biosystems engineering university studies - Situation in the Netherlands

    NARCIS (Netherlands)

    Hofstee, J.W.

    2009-01-01

    Wageningen University has implemented the bachelor – master model by 2003. The biosystems related programmes of Wageningen University are the BSc Agrotechnology and the MSc Agricultural and Bioresource Engineering. The bachelor programme has a size of 180 credits and the master programme a size of

  10. Clone DB: an integrated NCBI resource for clone-associated data

    Science.gov (United States)

    Schneider, Valerie A.; Chen, Hsiu-Chuan; Clausen, Cliff; Meric, Peter A.; Zhou, Zhigang; Bouk, Nathan; Husain, Nora; Maglott, Donna R.; Church, Deanna M.

    2013-01-01

    The National Center for Biotechnology Information (NCBI) Clone DB (http://www.ncbi.nlm.nih.gov/clone/) is an integrated resource providing information about and facilitating access to clones, which serve as valuable research reagents in many fields, including genome sequencing and variation analysis. Clone DB represents an expansion and replacement of the former NCBI Clone Registry and has records for genomic and cell-based libraries and clones representing more than 100 different eukaryotic taxa. Records provide details of library construction, associated sequences, map positions and information about resource distribution. Clone DB is indexed in the NCBI Entrez system and can be queried by fields that include organism, clone name, gene name and sequence identifier. Whenever possible, genomic clones are mapped to reference assemblies and their map positions provided in clone records. Clones mapping to specific genomic regions can also be searched for using the NCBI Clone Finder tool, which accepts queries based on sequence coordinates or features such as gene or transcript names. Clone DB makes reports of library, clone and placement data on its FTP site available for download. With Clone DB, users now have available to them a centralized resource that provides them with the tools they will need to make use of these important research reagents. PMID:23193260

  11. NCBI BLAST+ integrated into Galaxy.

    Science.gov (United States)

    Cock, Peter J A; Chilton, John M; Grüning, Björn; Johnson, James E; Soranzo, Nicola

    2015-01-01

    The NCBI BLAST suite has become ubiquitous in modern molecular biology and is used for small tasks such as checking capillary sequencing results of single PCR products, genome annotation or even larger scale pan-genome analyses. For early adopters of the Galaxy web-based biomedical data analysis platform, integrating BLAST into Galaxy was a natural step for sequence comparison workflows. The command line NCBI BLAST+ tool suite was wrapped for use within Galaxy. Appropriate datatypes were defined as needed. The integration of the BLAST+ tool suite into Galaxy has the goal of making common BLAST tasks easy and advanced tasks possible. This project is an informal international collaborative effort, and is deployed and used on Galaxy servers worldwide. Several examples of applications are described here.

  12. Abstracts of the 17. world congress of the International Commission of Agriculture and Biosystems Engineering (CIGR) : sustainable biosystems through engineering

    Energy Technology Data Exchange (ETDEWEB)

    Savoie, P.; Villeneuve, J.; Morisette, R. [Agriculture and Agri-Food Canada, Quebec City, PQ (Canada). Soils and Crops Research and Development Centre] (eds.)

    2010-07-01

    This international conference provided a forum to discuss methods to produce agricultural products more efficiently through improvements in engineering and technology. It was attended by engineers and scientists working from different perspectives on biosystems. Beyond food, farms and forests can provide fibre, bio-products and renewable energy. Seven sections of CIGR were organized in the following technical sessions: (1) land and water engineering, (2) farm buildings, equipment, structures and environment, (3) equipment engineering for plants, (4) energy in agriculture, (5) management, ergonomics and systems engineering, (6) post harvest technology and process engineering, and (7) information systems. The Canadian Society of Bioengineering (CSBE) merged its technical program within the 7 sections of CIGR. Four other groups also held their activities during the conference. The American Society of Agricultural and Biological Engineers (ASABE) organized its 9th international drainage symposium and the American Ecological Engineering Society (AEES) held its 10th annual meeting. The International Network for Information Technology in Agriculture (INFITA), and the 8th world congress on computers in agriculture also joined CIGR 2010.

  13. ATGC database and ATGC-COGs: an updated resource for micro- and macro-evolutionary studies of prokaryotic genomes and protein family annotation.

    Science.gov (United States)

    Kristensen, David M; Wolf, Yuri I; Koonin, Eugene V

    2017-01-04

    The Alignable Tight Genomic Clusters (ATGCs) database is a collection of closely related bacterial and archaeal genomes that provides several tools to aid research into evolutionary processes in the microbial world. Each ATGC is a taxonomy-independent cluster of 2 or more completely sequenced genomes that meet the objective criteria of a high degree of local gene order (synteny) and a small number of synonymous substitutions in the protein-coding genes. As such, each ATGC is suited for analysis of microevolutionary variations within a cohesive group of organisms (e.g. species), whereas the entire collection of ATGCs is useful for macroevolutionary studies. The ATGC database includes many forms of pre-computed data, in particular ATGC-COGs (Clusters of Orthologous Genes), multiple sequence alignments, a set of 'index' orthologs representing the most well-conserved members of each ATGC-COG, the phylogenetic tree of the organisms within each ATGC, etc. Although the ATGC database contains several million proteins from thousands of genomes organized into hundreds of clusters (roughly a 4-fold increase since the last version of the ATGC database), it is now built with completely automated methods and will be regularly updated following new releases of the NCBI RefSeq database. The ATGC database is hosted jointly at the University of Iowa at dmk-brain.ecn.uiowa.edu/ATGC/ and the NCBI at ftp.ncbi.nlm.nih.gov/pub/kristensen/ATGC/atgc_home.html. Published by Oxford University Press on behalf of Nucleic Acids Research 2016. This work is written by (a) US Government employee(s) and is in the public domain in the US.

  14. PseudoMLSA: a database for multigenic sequence analysis of Pseudomonas species

    Directory of Open Access Journals (Sweden)

    Lalucat Jorge

    2010-04-01

    Full Text Available Abstract Background The genus Pseudomonas comprises more than 100 species of environmental, clinical, agricultural, and biotechnological interest. Although, the recommended method for discriminating bacterial species is DNA-DNA hybridisation, alternative techniques based on multigenic sequence analysis are becoming a common practice in bacterial species discrimination studies. Since there is not a general criterion for determining which genes are more useful for species resolution; the number of strains and genes analysed is increasing continuously. As a result, sequences of different genes are dispersed throughout several databases. This sequence information needs to be collected in a common database, in order to be useful for future identification-based projects. Description The PseudoMLSA Database is a comprehensive database of multiple gene sequences from strains of Pseudomonas species. The core of the database is composed of selected gene sequences from all Pseudomonas type strains validly assigned to the genus through 2008. The database is aimed to be useful for MultiLocus Sequence Analysis (MLSA procedures, for the identification and characterisation of any Pseudomonas bacterial isolate. The sequences are available for download via a direct connection to the National Center for Biotechnology Information (NCBI. Additionally, the database includes an online BLAST interface for flexible nucleotide queries and similarity searches with the user's datasets, and provides a user-friendly output for easily parsing, navigating, and analysing BLAST results. Conclusions The PseudoMLSA database amasses strains and sequence information of validly described Pseudomonas species, and allows free querying of the database via a user-friendly, web-based interface available at http://www.uib.es/microbiologiaBD/Welcome.html. The web-based platform enables easy retrieval at strain or gene sequence information level; including references to published peer

  15. Fiscal 1997 research report on development of use technology of bio-resources such as complex biosystem (Development of use and production technologies of complex biosystems); 1997 nendo fukugo seibutsukei nado seibutsu shigen riyo gijutsu kaihatsu seika hokokusho (fukugo seibutsukei riyo seisan gijutsu no kaihatsu)

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1998-03-01

    This report summarizes the fiscal 1997 research results on production technology of functional materials, and the research study result for utilizing substance production and decomposition by complex biosystem for industries. For detecting technique of microorganisms in soil, staining by CFDA-AM was suitable, and allowed visualization of sulfate- reducing bacteria during culture. For research on functional analysis technology, study was made on atomic force microscope technology to detect microorganisms in environment and observe their fine structures. For research on detection, separation and cultivation technology of difficult-to-culture microorganisms, a molecular genetic analysis method of microbial communities and a determination method of their viability were selected. For functional substance production technology, study was made on technical utilization of bioflocculant produced by microbial consortia as environment-friendly oil removal reagent, and on gene transfer control in microbial consortia. For the research study for the project, survey was made on useful substances produced by complex biosystem. (NEDO)

  16. The NIH genetic testing registry: a new, centralized database of genetic tests to enable access to comprehensive information and improve transparency.

    Science.gov (United States)

    Rubinstein, Wendy S; Maglott, Donna R; Lee, Jennifer M; Kattman, Brandi L; Malheiro, Adriana J; Ovetsky, Michael; Hem, Vichet; Gorelenkov, Viatcheslav; Song, Guangfeng; Wallin, Craig; Husain, Nora; Chitipiralla, Shanmuga; Katz, Kenneth S; Hoffman, Douglas; Jang, Wonhee; Johnson, Mark; Karmanov, Fedor; Ukrainchik, Alexander; Denisenko, Mikhail; Fomous, Cathy; Hudson, Kathy; Ostell, James M

    2013-01-01

    The National Institutes of Health Genetic Testing Registry (GTR; available online at http://www.ncbi.nlm.nih.gov/gtr/) maintains comprehensive information about testing offered worldwide for disorders with a genetic basis. Information is voluntarily submitted by test providers. The database provides details of each test (e.g. its purpose, target populations, methods, what it measures, analytical validity, clinical validity, clinical utility, ordering information) and laboratory (e.g. location, contact information, certifications and licenses). Each test is assigned a stable identifier of the format GTR000000000, which is versioned when the submitter updates information. Data submitted by test providers are integrated with basic information maintained in National Center for Biotechnology Information's databases and presented on the web and through FTP (ftp.ncbi.nih.gov/pub/GTR/_README.html).

  17. Disbiome database: linking the microbiome to disease.

    Science.gov (United States)

    Janssens, Yorick; Nielandt, Joachim; Bronselaer, Antoon; Debunne, Nathan; Verbeke, Frederick; Wynendaele, Evelien; Van Immerseel, Filip; Vandewynckel, Yves-Paul; De Tré, Guy; De Spiegeleer, Bart

    2018-06-04

    Recent research has provided fascinating indications and evidence that the host health is linked to its microbial inhabitants. Due to the development of high-throughput sequencing technologies, more and more data covering microbial composition changes in different disease types are emerging. However, this information is dispersed over a wide variety of medical and biomedical disciplines. Disbiome is a database which collects and presents published microbiota-disease information in a standardized way. The diseases are classified using the MedDRA classification system and the micro-organisms are linked to their NCBI and SILVA taxonomy. Finally, each study included in the Disbiome database is assessed for its reporting quality using a standardized questionnaire. Disbiome is the first database giving a clear, concise and up-to-date overview of microbial composition differences in diseases, together with the relevant information of the studies published. The strength of this database lies within the combination of the presence of references to other databases, which enables both specific and diverse search strategies within the Disbiome database, and the human annotation which ensures a simple and structured presentation of the available data.

  18. Electro-Quasistatic Simulations in Bio-Systems Engineering and Medical Engineering

    Directory of Open Access Journals (Sweden)

    U. van Rienen

    2005-01-01

    Full Text Available Slowly varying electromagnetic fields play a key role in various applications in bio-systems and medical engineering. Examples are the electric activity of neurons on neurochips used as biosensors, the stimulating electric fields of implanted electrodes used for deep brain stimulation in patients with Morbus Parkinson and the stimulation of the auditory nerves in deaf patients, respectively. In order to simulate the neuronal activity on a chip it is necessary to couple Maxwell's and Hodgkin-Huxley's equations. First numerical results for a neuron coupling to a single electrode are presented. They show a promising qualitative agreement with the experimentally recorded signals. Further, simulations are presented on electrodes for deep brain stimulation in animal experiments where the question of electrode ageing and energy deposition in the surrounding tissue are of major interest. As a last example, electric simulations for a simple cochlea model are presented comparing the field in the skull bones for different electrode types and stimulations in different positions.

  19. Intelligent Access to Sequence and Structure Databases (IASSD) - an interface for accessing information from major web databases.

    Science.gov (United States)

    Ganguli, Sayak; Gupta, Manoj Kumar; Basu, Protip; Banik, Rahul; Singh, Pankaj Kumar; Vishal, Vineet; Bera, Abhisek Ranjan; Chakraborty, Hirak Jyoti; Das, Sasti Gopal

    2014-01-01

    With the advent of age of big data and advances in high throughput technology accessing data has become one of the most important step in the entire knowledge discovery process. Most users are not able to decipher the query result that is obtained when non specific keywords or a combination of keywords are used. Intelligent access to sequence and structure databases (IASSD) is a desktop application for windows operating system. It is written in Java and utilizes the web service description language (wsdl) files and Jar files of E-utilities of various databases such as National Centre for Biotechnology Information (NCBI) and Protein Data Bank (PDB). Apart from that IASSD allows the user to view protein structure using a JMOL application which supports conditional editing. The Jar file is freely available through e-mail from the corresponding author.

  20. The effects of socioeconomic status, clinical factors, and genetic ancestry on pulmonary tuberculosis disease in northeastern Mexico.

    Directory of Open Access Journals (Sweden)

    Bonnie N Young

    Full Text Available Diverse socioeconomic and clinical factors influence susceptibility to tuberculosis (TB disease in Mexico. The role of genetic factors, particularly those that differ between the parental groups that admixed in Mexico, is unclear. The objectives of this study are to identify the socioeconomic and clinical predictors of the transition from latent TB infection (LTBI to pulmonary TB disease in an urban population in northeastern Mexico, and to examine whether genetic ancestry plays an independent role in this transition. We recruited 97 pulmonary TB disease patients and 97 LTBI individuals from a public hospital in Monterrey, Nuevo León. Socioeconomic and clinical variables were collected from interviews and medical records, and genetic ancestry was estimated for a subset of 142 study participants from 291,917 single nucleotide polymorphisms (SNPs. We examined crude associations between the variables and TB disease status. Significant predictors from crude association tests were analyzed using multivariable logistic regression. We also compared genetic ancestry between LTBI individuals and TB disease patients at 1,314 SNPs in 273 genes from the TB biosystem in the NCBI BioSystems database. In crude association tests, 12 socioeconomic and clinical variables were associated with TB disease. Multivariable logistic regression analyses indicated that marital status, diabetes, and smoking were independently associated with TB status. Genetic ancestry was not associated with TB disease in either crude or multivariable analyses. Separate analyses showed that LTBI individuals recruited from hospital staff had significantly higher European genetic ancestry than LTBI individuals recruited from the clinics and waiting rooms. Genetic ancestry differed between individuals with LTBI and TB disease at SNPs located in two genes in the TB biosystem. These results indicate that Monterrey may be structured with respect to genetic ancestry, and that genetic

  1. The effects of socioeconomic status, clinical factors, and genetic ancestry on pulmonary tuberculosis disease in northeastern Mexico.

    Science.gov (United States)

    Young, Bonnie N; Rendón, Adrian; Rosas-Taraco, Adrian; Baker, Jack; Healy, Meghan; Gross, Jessica M; Long, Jeffrey; Burgos, Marcos; Hunley, Keith L

    2014-01-01

    Diverse socioeconomic and clinical factors influence susceptibility to tuberculosis (TB) disease in Mexico. The role of genetic factors, particularly those that differ between the parental groups that admixed in Mexico, is unclear. The objectives of this study are to identify the socioeconomic and clinical predictors of the transition from latent TB infection (LTBI) to pulmonary TB disease in an urban population in northeastern Mexico, and to examine whether genetic ancestry plays an independent role in this transition. We recruited 97 pulmonary TB disease patients and 97 LTBI individuals from a public hospital in Monterrey, Nuevo León. Socioeconomic and clinical variables were collected from interviews and medical records, and genetic ancestry was estimated for a subset of 142 study participants from 291,917 single nucleotide polymorphisms (SNPs). We examined crude associations between the variables and TB disease status. Significant predictors from crude association tests were analyzed using multivariable logistic regression. We also compared genetic ancestry between LTBI individuals and TB disease patients at 1,314 SNPs in 273 genes from the TB biosystem in the NCBI BioSystems database. In crude association tests, 12 socioeconomic and clinical variables were associated with TB disease. Multivariable logistic regression analyses indicated that marital status, diabetes, and smoking were independently associated with TB status. Genetic ancestry was not associated with TB disease in either crude or multivariable analyses. Separate analyses showed that LTBI individuals recruited from hospital staff had significantly higher European genetic ancestry than LTBI individuals recruited from the clinics and waiting rooms. Genetic ancestry differed between individuals with LTBI and TB disease at SNPs located in two genes in the TB biosystem. These results indicate that Monterrey may be structured with respect to genetic ancestry, and that genetic differences in TB

  2. Fiscal 1997 industrial technology R and D project. Research report on development of use technology of bio- resources such as complex biosystem (Development of use and production technologies of complex biosystems); 1997 nendo fukugo seibutsukei nado seibutsu shigen riyo gijutsu kaihatsu seika hokokusho. Fukugo seibutsukei riyo seisan gijutsu no kaihatsu

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1998-03-01

    This project aims to establish production technology of functional substances, oil degradation and purification technology, and use technology of unused oil fraction through development of cultivation control technology of complex biosystems. For functional material production technology, as functional substances some specific marine bacteria inhibitors, antibreeding substances of microalgae, and UV absorption substances were isolated. The productivity of korormicin as specific inhibitor against marine bacteria was improved considerably by cultivation method. For research on molecular genetic analysis technology, a new identification technology and a simple automatic analysis system of microeucaryotes using genes were developed. For global environment purification technology such as efficient degradation of pollutants, study was made on cultivation control technology of phenol- degrading consortia, population dynamics of oil-degrading microbial consortia and a restoration method of oil pollution by complex biosystem at lower temperature, and the demonstration experiment of oil degradation were carried out. (NEDO)

  3. VerSeDa: vertebrate secretome database.

    Science.gov (United States)

    Cortazar, Ana R; Oguiza, José A; Aransay, Ana M; Lavín, José L

    2017-01-01

    Based on the current tools, de novo secretome (full set of proteins secreted by an organism) prediction is a time consuming bioinformatic task that requires a multifactorial analysis in order to obtain reliable in silico predictions. Hence, to accelerate this process and offer researchers a reliable repository where secretome information can be obtained for vertebrates and model organisms, we have developed VerSeDa (Vertebrate Secretome Database). This freely available database stores information about proteins that are predicted to be secreted through the classical and non-classical mechanisms, for the wide range of vertebrate species deposited at the NCBI, UCSC and ENSEMBL sites. To our knowledge, VerSeDa is the only state-of-the-art database designed to store secretome data from multiple vertebrate genomes, thus, saving an important amount of time spent in the prediction of protein features that can be retrieved from this repository directly. VerSeDa is freely available at http://genomics.cicbiogune.es/VerSeDa/index.php. © The Author(s) 2017. Published by Oxford University Press.

  4. AllergenOnline: A peer-reviewed, curated allergen database to assess novel food proteins for potential cross-reactivity.

    Science.gov (United States)

    Goodman, Richard E; Ebisawa, Motohiro; Ferreira, Fatima; Sampson, Hugh A; van Ree, Ronald; Vieths, Stefan; Baumert, Joseph L; Bohle, Barbara; Lalithambika, Sreedevi; Wise, John; Taylor, Steve L

    2016-05-01

    Increasingly regulators are demanding evaluation of potential allergenicity of foods prior to marketing. Primary risks are the transfer of allergens or potentially cross-reactive proteins into new foods. AllergenOnline was developed in 2005 as a peer-reviewed bioinformatics platform to evaluate risks of new dietary proteins in genetically modified organisms (GMO) and novel foods. The process used to identify suspected allergens and evaluate the evidence of allergenicity was refined between 2010 and 2015. Candidate proteins are identified from the NCBI database using keyword searches, the WHO/IUIS nomenclature database and peer reviewed publications. Criteria to classify proteins as allergens are described. Characteristics of the protein, the source and human subjects, test methods and results are evaluated by our expert panel and archived. Food, inhalant, salivary, venom, and contact allergens are included. Users access allergen sequences through links to the NCBI database and relevant references are listed online. Version 16 includes 1956 sequences from 778 taxonomic-protein groups that are accepted with evidence of allergic serum IgE-binding and/or biological activity. AllergenOnline provides a useful peer-reviewed tool for identifying the primary potential risks of allergy for GMOs and novel foods based on criteria described by the Codex Alimentarius Commission (2003). © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  5. Building a genome database using an object-oriented approach.

    Science.gov (United States)

    Barbasiewicz, Anna; Liu, Lin; Lang, B Franz; Burger, Gertraud

    2002-01-01

    GOBASE is a relational database that integrates data associated with mitochondria and chloroplasts. The most important data in GOBASE, i. e., molecular sequences and taxonomic information, are obtained from the public sequence data repository at the National Center for Biotechnology Information (NCBI), and are validated by our experts. Maintaining a curated genomic database comes with a towering labor cost, due to the shear volume of available genomic sequences and the plethora of annotation errors and omissions in records retrieved from public repositories. Here we describe our approach to increase automation of the database population process, thereby reducing manual intervention. As a first step, we used Unified Modeling Language (UML) to construct a list of potential errors. Each case was evaluated independently, and an expert solution was devised, and represented as a diagram. Subsequently, the UML diagrams were used as templates for writing object-oriented automation programs in the Java programming language.

  6. National Center for Biotechnology Information

    Science.gov (United States)

    ... to NCBI Sign Out NCBI National Center for Biotechnology Information Search database All Databases Assembly Biocollections BioProject ... Search Welcome to NCBI The National Center for Biotechnology Information advances science and health by providing access ...

  7. WGDB: Wood Gene Database with search interface.

    Science.gov (United States)

    Goyal, Neha; Ginwal, H S

    2014-01-01

    Wood quality can be defined in terms of particular end use with the involvement of several traits. Over the last fifteen years researchers have assessed the wood quality traits in forest trees. The wood quality was categorized as: cell wall biochemical traits, fibre properties include the microfibril angle, density and stiffness in loblolly pine [1]. The user friendly and an open-access database has been developed named Wood Gene Database (WGDB) for describing the wood genes along the information of protein and published research articles. It contains 720 wood genes from species namely Pinus, Deodar, fast growing trees namely Poplar, Eucalyptus. WGDB designed to encompass the majority of publicly accessible genes codes for cellulose, hemicellulose and lignin in tree species which are responsive to wood formation and quality. It is an interactive platform for collecting, managing and searching the specific wood genes; it also enables the data mining relate to the genomic information specifically in Arabidopsis thaliana, Populus trichocarpa, Eucalyptus grandis, Pinus taeda, Pinus radiata, Cedrus deodara, Cedrus atlantica. For user convenience, this database is cross linked with public databases namely NCBI, EMBL & Dendrome with the search engine Google for making it more informative and provides bioinformatics tools named BLAST,COBALT. The database is freely available on www.wgdb.in.

  8. A Taxonomic Search Engine: federating taxonomic databases using web services.

    Science.gov (United States)

    Page, Roderic D M

    2005-03-09

    The taxonomic name of an organism is a key link between different databases that store information on that organism. However, in the absence of a single, comprehensive database of organism names, individual databases lack an easy means of checking the correctness of a name. Furthermore, the same organism may have more than one name, and the same name may apply to more than one organism. The Taxonomic Search Engine (TSE) is a web application written in PHP that queries multiple taxonomic databases (ITIS, Index Fungorum, IPNI, NCBI, and uBIO) and summarises the results in a consistent format. It supports "drill-down" queries to retrieve a specific record. The TSE can optionally suggest alternative spellings the user can try. It also acts as a Life Science Identifier (LSID) authority for the source taxonomic databases, providing globally unique identifiers (and associated metadata) for each name. The Taxonomic Search Engine is available at http://darwin.zoology.gla.ac.uk/~rpage/portal/ and provides a simple demonstration of the potential of the federated approach to providing access to taxonomic names.

  9. Kalium: a database of potassium channel toxins from scorpion venom.

    Science.gov (United States)

    Kuzmenkov, Alexey I; Krylov, Nikolay A; Chugunov, Anton O; Grishin, Eugene V; Vassilevski, Alexander A

    2016-01-01

    Kalium (http://kaliumdb.org/) is a manually curated database that accumulates data on potassium channel toxins purified from scorpion venom (KTx). This database is an open-access resource, and provides easy access to pages of other databases of interest, such as UniProt, PDB, NCBI Taxonomy Browser, and PubMed. General achievements of Kalium are a strict and easy regulation of KTx classification based on the unified nomenclature supported by researchers in the field, removal of peptides with partial sequence and entries supported by transcriptomic information only, classification of β-family toxins, and addition of a novel λ-family. Molecules presented in the database can be processed by the Clustal Omega server using a one-click option. Molecular masses of mature peptides are calculated and available activity data are compiled for all KTx. We believe that Kalium is not only of high interest to professional toxinologists, but also of general utility to the scientific community.Database URL:http://kaliumdb.org/. © The Author(s) 2016. Published by Oxford University Press.

  10. BioWarehouse: a bioinformatics database warehouse toolkit.

    Science.gov (United States)

    Lee, Thomas J; Pouliot, Yannick; Wagner, Valerie; Gupta, Priyanka; Stringer-Calvert, David W J; Tenenbaum, Jessica D; Karp, Peter D

    2006-03-23

    This article addresses the problem of interoperation of heterogeneous bioinformatics databases. We introduce BioWarehouse, an open source toolkit for constructing bioinformatics database warehouses using the MySQL and Oracle relational database managers. BioWarehouse integrates its component databases into a common representational framework within a single database management system, thus enabling multi-database queries using the Structured Query Language (SQL) but also facilitating a variety of database integration tasks such as comparative analysis and data mining. BioWarehouse currently supports the integration of a pathway-centric set of databases including ENZYME, KEGG, and BioCyc, and in addition the UniProt, GenBank, NCBI Taxonomy, and CMR databases, and the Gene Ontology. Loader tools, written in the C and JAVA languages, parse and load these databases into a relational database schema. The loaders also apply a degree of semantic normalization to their respective source data, decreasing semantic heterogeneity. The schema supports the following bioinformatics datatypes: chemical compounds, biochemical reactions, metabolic pathways, proteins, genes, nucleic acid sequences, features on protein and nucleic-acid sequences, organisms, organism taxonomies, and controlled vocabularies. As an application example, we applied BioWarehouse to determine the fraction of biochemically characterized enzyme activities for which no sequences exist in the public sequence databases. The answer is that no sequence exists for 36% of enzyme activities for which EC numbers have been assigned. These gaps in sequence data significantly limit the accuracy of genome annotation and metabolic pathway prediction, and are a barrier for metabolic engineering. Complex queries of this type provide examples of the value of the data warehousing approach to bioinformatics research. BioWarehouse embodies significant progress on the database integration problem for bioinformatics.

  11. WPBMB Entrez: An interface to NCBI Entrez for Wordpress.

    Science.gov (United States)

    Gohara, David W

    2018-03-01

    Research-oriented websites are an important means for the timely communication of information. These websites fall under a number of categories including: research laboratories, training grant and program projects, and online service portals. Invariably there is content on a site, such as publication listings, that require frequent updating. A number of content management systems exist to aid in the task of developing and managing a website, each with their strengths and weaknesses. One popular choice is Wordpress, a free, open source and actively developed application for the creation of web content. During a recent site redesign for our department, the need arose to ensure publications were up to date for each of the research labs and department as a whole. Several plugins for Wordpress offer this type of functionality, but in many cases the plugins are either no longer maintained, are missing features that would require the use of several, possibly incompatible, plugins or lack features for layout on a webpage. WPBMB Entrez was developed to address these needs. WPBMB Entrez utilizes a subset of NCBI Entrez and RCSB databases to maintain up to date records of publications, and publication related information on Wordpress-based websites. The core functionality uses the same search query syntax as on the NCBI Entrez site, including advanced query syntaxes. The plugin is extensible allowing for rapid development and addition of new data sources as the need arises. WPBMB Entrez was designed to be easy to use, yet flexible enough to address more complex usage scenarios. Features of the plugin include: an easy to use interface, design customization, multiple templates for displaying publication results, a caching mechanism to reduce page load times, supports multiple distinct queries and retrieval modes, and the ability to aggregate multiple queries into unified lists. Additionally, developer documentation is provided to aid in customization of the plugin. WPBMB Entrez

  12. BioWarehouse: a bioinformatics database warehouse toolkit

    Directory of Open Access Journals (Sweden)

    Stringer-Calvert David WJ

    2006-03-01

    Full Text Available Abstract Background This article addresses the problem of interoperation of heterogeneous bioinformatics databases. Results We introduce BioWarehouse, an open source toolkit for constructing bioinformatics database warehouses using the MySQL and Oracle relational database managers. BioWarehouse integrates its component databases into a common representational framework within a single database management system, thus enabling multi-database queries using the Structured Query Language (SQL but also facilitating a variety of database integration tasks such as comparative analysis and data mining. BioWarehouse currently supports the integration of a pathway-centric set of databases including ENZYME, KEGG, and BioCyc, and in addition the UniProt, GenBank, NCBI Taxonomy, and CMR databases, and the Gene Ontology. Loader tools, written in the C and JAVA languages, parse and load these databases into a relational database schema. The loaders also apply a degree of semantic normalization to their respective source data, decreasing semantic heterogeneity. The schema supports the following bioinformatics datatypes: chemical compounds, biochemical reactions, metabolic pathways, proteins, genes, nucleic acid sequences, features on protein and nucleic-acid sequences, organisms, organism taxonomies, and controlled vocabularies. As an application example, we applied BioWarehouse to determine the fraction of biochemically characterized enzyme activities for which no sequences exist in the public sequence databases. The answer is that no sequence exists for 36% of enzyme activities for which EC numbers have been assigned. These gaps in sequence data significantly limit the accuracy of genome annotation and metabolic pathway prediction, and are a barrier for metabolic engineering. Complex queries of this type provide examples of the value of the data warehousing approach to bioinformatics research. Conclusion BioWarehouse embodies significant progress on the

  13. A Taxonomic Search Engine: Federating taxonomic databases using web services

    Directory of Open Access Journals (Sweden)

    Page Roderic DM

    2005-03-01

    Full Text Available Abstract Background The taxonomic name of an organism is a key link between different databases that store information on that organism. However, in the absence of a single, comprehensive database of organism names, individual databases lack an easy means of checking the correctness of a name. Furthermore, the same organism may have more than one name, and the same name may apply to more than one organism. Results The Taxonomic Search Engine (TSE is a web application written in PHP that queries multiple taxonomic databases (ITIS, Index Fungorum, IPNI, NCBI, and uBIO and summarises the results in a consistent format. It supports "drill-down" queries to retrieve a specific record. The TSE can optionally suggest alternative spellings the user can try. It also acts as a Life Science Identifier (LSID authority for the source taxonomic databases, providing globally unique identifiers (and associated metadata for each name. Conclusion The Taxonomic Search Engine is available at http://darwin.zoology.gla.ac.uk/~rpage/portal/ and provides a simple demonstration of the potential of the federated approach to providing access to taxonomic names.

  14. Stemcell Information: SKIP000788 [SKIP Stemcell Database[Archive

    Lifescience Database Archive (English)

    Full Text Available n JA, Hallmayer J, Dolmetsch RE Nature--Nature 2011--2011 471--471 7337--7337 230-4--230-4 http://www.ncbi.nlm.nih.gov/pubmed/21307850--http://www.ncbi.nlm.nih.gov/pubmed/21307850 -- ...

  15. NCBI Mass Sequence Downloader–Large dataset downloading made easy

    Directory of Open Access Journals (Sweden)

    F. Pina-Martins

    2016-01-01

    Source code is licensed under the GPLv3, and is supported on Linux, Windows and Mac OSX. Available at https://github.com/ElsevierSoftwareX/SOFTX-D-15-00072.git, https://github.com/StuntsPT/NCBI_Mass_Downloader

  16. Proceedings of the 8. International Symposium on Microbial Ecology : microbial biosystems : new frontiers

    International Nuclear Information System (INIS)

    Bell, C.R.; Brylinsky, M.; Johnson-Green, P.

    2000-01-01

    A wide range of disciplines were presented at this conference which reflected the importance of microbial ecology and provided an understanding of the factors that determine the growth and activities of microorganisms. The conference attracted 1444 delegates from 54 countries. The research emerging from the rapidly expanding frontier of microbial ecosystems was presented in 62 oral presentation and 817 poster presentations. The two volumes of these proceedings presented a total of 27 areas in microbial ecology, some of which included terrestrial biosystems, aquatic, estuarine, surface and subsurface microbial ecology. Other topics included bioremediation, microbial ecology in industry and microbial ecology of oil fields. Some of the papers highlighted the research that is underway to determine the feasibility of using microorganisms for enhanced oil recovery (EOR). Research has shown that microbial EOR can increase production at lower costs than conventional oil recovery. The use of bacteria has also proven to be a feasible treatment method in the biodegradation of hydrocarbons associated with oil spills. refs., tabs., figs

  17. Ab initio O(N) elongation-counterpoise method for BSSE-corrected interaction energy analyses in biosystems

    Energy Technology Data Exchange (ETDEWEB)

    Orimoto, Yuuichi; Xie, Peng; Liu, Kai [Department of Material Sciences, Faculty of Engineering Sciences, Kyushu University, 6-1 Kasuga-Park, Fukuoka 816-8580 (Japan); Yamamoto, Ryohei [Department of Molecular and Material Sciences, Interdisciplinary Graduate School of Engineering Sciences, Kyushu University, 6-1 Kasuga-Park, Fukuoka 816-8580 (Japan); Imamura, Akira [Hiroshima Kokusai Gakuin University, 6-20-1 Nakano, Aki-ku, Hiroshima 739-0321 (Japan); Aoki, Yuriko, E-mail: aoki.yuriko.397@m.kyushu-u.ac.jp [Department of Material Sciences, Faculty of Engineering Sciences, Kyushu University, 6-1 Kasuga-Park, Fukuoka 816-8580 (Japan); Japan Science and Technology Agency, CREST, 4-1-8 Hon-chou, Kawaguchi, Saitama 332-0012 (Japan)

    2015-03-14

    An Elongation-counterpoise (ELG-CP) method was developed for performing accurate and efficient interaction energy analysis and correcting the basis set superposition error (BSSE) in biosystems. The method was achieved by combining our developed ab initio O(N) elongation method with the conventional counterpoise method proposed for solving the BSSE problem. As a test, the ELG-CP method was applied to the analysis of the DNAs’ inter-strands interaction energies with respect to the alkylation-induced base pair mismatch phenomenon that causes a transition from G⋯C to A⋯T. It was found that the ELG-CP method showed high efficiency (nearly linear-scaling) and high accuracy with a negligibly small energy error in the total energy calculations (in the order of 10{sup −7}–10{sup −8} hartree/atom) as compared with the conventional method during the counterpoise treatment. Furthermore, the magnitude of the BSSE was found to be ca. −290 kcal/mol for the calculation of a DNA model with 21 base pairs. This emphasizes the importance of BSSE correction when a limited size basis set is used to study the DNA models and compare small energy differences between them. In this work, we quantitatively estimated the inter-strands interaction energy for each possible step in the transition process from G⋯C to A⋯T by the ELG-CP method. It was found that the base pair replacement in the process only affects the interaction energy for a limited area around the mismatch position with a few adjacent base pairs. From the interaction energy point of view, our results showed that a base pair sliding mechanism possibly occurs after the alkylation of guanine to gain the maximum possible number of hydrogen bonds between the bases. In addition, the steps leading to the A⋯T replacement accompanied with replications were found to be unfavorable processes corresponding to ca. 10 kcal/mol loss in stabilization energy. The present study indicated that the ELG-CP method is promising for

  18. Elucidation of functions of micro-organisms and animals in forest biosystem. Shinrin seitaikei ni okeru biseibutsu oyobi dobutsu no kino no kaimei

    Energy Technology Data Exchange (ETDEWEB)

    1991-10-25

    This paper describes a report on elucidating functions of micro-organisms and animals in a forest biosystem. Classification of forest micro-organisms and elucidation of their physiology, ecology, and roles in the biosystem: Characteristics of tree root putterfaction bacteria, which cause withering of windbreaks in the Ishigaki Island, Japan were elucidated, and identifying the culture hyphae has become possible. Chemicals effective for their control were discovered, which enable their extermination. Investigations on soil molds using artificial acid rains clarified that the exterminating agents display their effects when sprinkled repeatedly over an extended period even in low concentrations. Classification of forest animals and elucidation of their physiology, ecology, and interactions among animals: A method was developed to photograph three-dimensionally the shapes of perforations made by earthworms using a soft X-ray and analyze them using a computer, which is being used for investigation. The perforation pattern is complex, and the hole diameters are in proportion with sizes of earthworms. Taxonomic studies on the Japanese lesser grain borers are close to completion. Damping-off of certain kinds of plantr exhibited parasitism of a kind of grain borerr and mycobionts without exceptions. An artificial burrow was devised for ecological investigation on field mice. 1 tab.

  19. MultitaskProtDB: a database of multitasking proteins.

    Science.gov (United States)

    Hernández, Sergio; Ferragut, Gabriela; Amela, Isaac; Perez-Pons, JosepAntoni; Piñol, Jaume; Mozo-Villarias, Angel; Cedano, Juan; Querol, Enrique

    2014-01-01

    We have compiled MultitaskProtDB, available online at http://wallace.uab.es/multitask, to provide a repository where the many multitasking proteins found in the literature can be stored. Multitasking or moonlighting is the capability of some proteins to execute two or more biological functions. Usually, multitasking proteins are experimentally revealed by serendipity. This ability of proteins to perform multitasking functions helps us to understand one of the ways used by cells to perform many complex functions with a limited number of genes. Even so, the study of this phenomenon is complex because, among other things, there is no database of moonlighting proteins. The existence of such a tool facilitates the collection and dissemination of these important data. This work reports the database, MultitaskProtDB, which is designed as a friendly user web page containing >288 multitasking proteins with their NCBI and UniProt accession numbers, canonical and additional biological functions, monomeric/oligomeric states, PDB codes when available and bibliographic references. This database also serves to gain insight into some characteristics of multitasking proteins such as frequencies of the different pairs of functions, phylogenetic conservation and so forth.

  20. Can Vrancea earthquakes be accurately predicted from unusual bio-system behavior and seismic-electromagnetic records?

    International Nuclear Information System (INIS)

    Enescu, D.; Chitaru, C.; Enescu, B.D.

    1999-01-01

    The relevance of bio-seismic research for the short-term prediction of strong Vrancea earthquakes is underscored. An unusual animal behavior before and during Vrancea earthquakes is described and illustrated in the individual case of the major earthquake of March 4, 1977. Several hypotheses to account for the uncommon behavior of bio-systems in relation to earthquakes in general and strong Vrancea earthquakes in particular are discussed in the second section. It is reminded that promising preliminary results concerning the identification of seismic-electromagnetic precursor signals have been obtained in the Vrancea seismogenic area using special, highly sensitive equipment. The need to correlate bio-seismic and seismic-electromagnetic researches is evident. Further investigations are suggested and urgent steps are proposed in order to achieve a successful short-term prediction of strong Vrancea earthquakes. (authors)

  1. Ontological interpretation of biomedical database content.

    Science.gov (United States)

    Santana da Silva, Filipe; Jansen, Ludger; Freitas, Fred; Schulz, Stefan

    2017-06-26

    Biological databases store data about laboratory experiments, together with semantic annotations, in order to support data aggregation and retrieval. The exact meaning of such annotations in the context of a database record is often ambiguous. We address this problem by grounding implicit and explicit database content in a formal-ontological framework. By using a typical extract from the databases UniProt and Ensembl, annotated with content from GO, PR, ChEBI and NCBI Taxonomy, we created four ontological models (in OWL), which generate explicit, distinct interpretations under the BioTopLite2 (BTL2) upper-level ontology. The first three models interpret database entries as individuals (IND), defined classes (SUBC), and classes with dispositions (DISP), respectively; the fourth model (HYBR) is a combination of SUBC and DISP. For the evaluation of these four models, we consider (i) database content retrieval, using ontologies as query vocabulary; (ii) information completeness; and, (iii) DL complexity and decidability. The models were tested under these criteria against four competency questions (CQs). IND does not raise any ontological claim, besides asserting the existence of sample individuals and relations among them. Modelling patterns have to be created for each type of annotation referent. SUBC is interpreted regarding maximally fine-grained defined subclasses under the classes referred to by the data. DISP attempts to extract truly ontological statements from the database records, claiming the existence of dispositions. HYBR is a hybrid of SUBC and DISP and is more parsimonious regarding expressiveness and query answering complexity. For each of the four models, the four CQs were submitted as DL queries. This shows the ability to retrieve individuals with IND, and classes in SUBC and HYBR. DISP does not retrieve anything because the axioms with disposition are embedded in General Class Inclusion (GCI) statements. Ambiguity of biological database content is

  2. SoyDB: a knowledge database of soybean transcription factors

    Directory of Open Access Journals (Sweden)

    Valliyodan Babu

    2010-01-01

    Full Text Available Abstract Background Transcription factors play the crucial rule of regulating gene expression and influence almost all biological processes. Systematically identifying and annotating transcription factors can greatly aid further understanding their functions and mechanisms. In this article, we present SoyDB, a user friendly database containing comprehensive knowledge of soybean transcription factors. Description The soybean genome was recently sequenced by the Department of Energy-Joint Genome Institute (DOE-JGI and is publicly available. Mining of this sequence identified 5,671 soybean genes as putative transcription factors. These genes were comprehensively annotated as an aid to the soybean research community. We developed SoyDB - a knowledge database for all the transcription factors in the soybean genome. The database contains protein sequences, predicted tertiary structures, putative DNA binding sites, domains, homologous templates in the Protein Data Bank (PDB, protein family classifications, multiple sequence alignments, consensus protein sequence motifs, web logo of each family, and web links to the soybean transcription factor database PlantTFDB, known EST sequences, and other general protein databases including Swiss-Prot, Gene Ontology, KEGG, EMBL, TAIR, InterPro, SMART, PROSITE, NCBI, and Pfam. The database can be accessed via an interactive and convenient web server, which supports full-text search, PSI-BLAST sequence search, database browsing by protein family, and automatic classification of a new protein sequence into one of 64 annotated transcription factor families by hidden Markov models. Conclusions A comprehensive soybean transcription factor database was constructed and made publicly accessible at http://casp.rnet.missouri.edu/soydb/.

  3. NCBI disease corpus: a resource for disease name recognition and concept normalization.

    Science.gov (United States)

    Doğan, Rezarta Islamaj; Leaman, Robert; Lu, Zhiyong

    2014-02-01

    Information encoded in natural language in biomedical literature publications is only useful if efficient and reliable ways of accessing and analyzing that information are available. Natural language processing and text mining tools are therefore essential for extracting valuable information, however, the development of powerful, highly effective tools to automatically detect central biomedical concepts such as diseases is conditional on the availability of annotated corpora. This paper presents the disease name and concept annotations of the NCBI disease corpus, a collection of 793 PubMed abstracts fully annotated at the mention and concept level to serve as a research resource for the biomedical natural language processing community. Each PubMed abstract was manually annotated by two annotators with disease mentions and their corresponding concepts in Medical Subject Headings (MeSH®) or Online Mendelian Inheritance in Man (OMIM®). Manual curation was performed using PubTator, which allowed the use of pre-annotations as a pre-step to manual annotations. Fourteen annotators were randomly paired and differing annotations were discussed for reaching a consensus in two annotation phases. In this setting, a high inter-annotator agreement was observed. Finally, all results were checked against annotations of the rest of the corpus to assure corpus-wide consistency. The public release of the NCBI disease corpus contains 6892 disease mentions, which are mapped to 790 unique disease concepts. Of these, 88% link to a MeSH identifier, while the rest contain an OMIM identifier. We were able to link 91% of the mentions to a single disease concept, while the rest are described as a combination of concepts. In order to help researchers use the corpus to design and test disease identification methods, we have prepared the corpus as training, testing and development sets. To demonstrate its utility, we conducted a benchmarking experiment where we compared three different

  4. Characterization of binding and mobility of metals and xenobiotics in continuous flow and soil biosystems

    International Nuclear Information System (INIS)

    Sunovska, A.

    2016-01-01

    The main aim of the dissertation thesis was to contribute to development of analytical tools and approaches application in characterization of binding and mobility of heavy metals and organic compounds (xenobiotics) in continuous flow and soil biosystems. Within the solution of this aim, a wide range of analytical methods (gamma-spectrometry, UV-VIS spectrophotometry, AAS, X-ray fluorescence spectrometry, ion chromatography, and stripping volt-amperometry) and approaches (mathematical modelling - methods of nonlinear regression and in silico prediction modelling; chemometrics and statistical analysis of the data; single-step extraction methods, and lysimetry) were applied. In the first step of thesis solution, alternative sorbents of biological origin (biomass of microalgae, freshwater mosses, and waste biomass of hop) were obtained and physico-chemically characterized mainly in order to prediction of sorption capacities of Cd and synthetic dyes thioflavine T (TT), malachite green (MG) or methylene blue (MB) removal from single component or binary aqueous solutions and under conditions of batch or continuous flow systems. For these purposes, mathematical models of adsorption isotherms and models originated from chromatographic separation methods by application of methods of nonlinear regression analysis were used. In the second part of the work, methods of multivariate analysis in the evaluation of processes of synthetic dyes TT and MB binding in terms of the finding of relationships between sorption-desorption variables describing the stability of the bond and parameters defining the physic-chemical properties of river sediments and the environment of real or model waters were applied. In the last part of the work, a special laboratory lysimeter system was designed and applied within the soil biosystem defined by: soil additive (SA) derived from sewage sludge representing the source of microelements Zn and Cu agriculturally used soil soil solution root system of

  5. Characterization of binding and mobility of metals and xenobiotics in continuous flow and soil biosystems

    International Nuclear Information System (INIS)

    Sunovska, A.

    2016-01-01

    The main aim of the dissertation thesis was to contribute to development of analytical tools and approaches application in characterization of binding and mobility of heavy metals and organic compounds (xenobiotics) in continuous flow and soil biosystems. Within the solution of this aim, a wide range of analytical methods (gamma-spectrometry, UV-VIS spectrophotometry, AAS, X-ray fluorescence spectrometry, ion chromatography, and stripping volt-amperometry) and approaches (mathematical modelling - methods of nonlinear regression and in silico prediction modelling; chemometrics and statistical analysis of the data; single-step extraction methods, and lysimetry) were applied. In the first step of thesis solution, alternative sorbents of biological origin (biomass of microalgae, freshwater mosses, and waste biomass of hop) were obtained and physico-chemically characterized mainly in order to prediction of sorption capacities of Cd and synthetic dyes thioflavine T (TT), malachite green (MG) or methylene blue (MB) removal from single component or binary aqueous solutions and under conditions of batch or continuous flow systems. For these purposes, mathematical models of adsorption isotherms and models originated from chromatographic separation methods by application of methods of nonlinear regression analysis were used. In the second part of the work, methods of multivariate analysis in the evaluation of processes of synthetic dyes TT and MB binding in terms of the finding of relationships between sorption-desorption variables describing the stability of the bond and parameters defining the physic-chemical properties of river sediments and the environment of real or model waters were applied. In the last part of the work, a special laboratory lysimeter system was designed and applied within the soil biosystem defined by: soil additive (SA) derived from sewage sludge representing the source of microelements Zn and Cu <-> agriculturally used soil <-> soil solution <-> root

  6. Novel LOVD databases for hereditary breast cancer and colorectal cancer genes in the Chinese population.

    Science.gov (United States)

    Pan, Min; Cong, Peikuan; Wang, Yue; Lin, Changsong; Yuan, Ying; Dong, Jian; Banerjee, Santasree; Zhang, Tao; Chen, Yanling; Zhang, Ting; Chen, Mingqing; Hu, Peter; Zheng, Shu; Zhang, Jin; Qi, Ming

    2011-12-01

    The Human Variome Project (HVP) is an international consortium of clinicians, geneticists, and researchers from over 30 countries, aiming to facilitate the establishment and maintenance of standards, systems, and infrastructure for the worldwide collection and sharing of all genetic variations effecting human disease. The HVP-China Node will build new and supplement existing databases of genetic diseases. As the first effort, we have created a novel variant database of BRCA1 and BRCA2, mismatch repair genes (MMR), and APC genes for breast cancer, Lynch syndrome, and familial adenomatous polyposis (FAP), respectively, in the Chinese population using the Leiden Open Variation Database (LOVD) format. We searched PubMed and some Chinese search engines to collect all the variants of these genes in the Chinese population that have already been detected and reported. There are some differences in the gene variants between the Chinese population and that of other ethnicities. The database is available online at http://www.genomed.org/LOVD/. Our database will appear to users who survey other LOVD databases (e.g., by Google search, or by NCBI GeneTests search). Remote submissions are accepted, and the information is updated monthly. © 2011 Wiley Periodicals, Inc.

  7. Identification and correction of abnormal, incomplete and mispredicted proteins in public databases

    Directory of Open Access Journals (Sweden)

    Bányai László

    2008-08-01

    Full Text Available Abstract Background Despite significant improvements in computational annotation of genomes, sequences of abnormal, incomplete or incorrectly predicted genes and proteins remain abundant in public databases. Since the majority of incomplete, abnormal or mispredicted entries are not annotated as such, these errors seriously affect the reliability of these databases. Here we describe the MisPred approach that may provide an efficient means for the quality control of databases. The current version of the MisPred approach uses five distinct routines for identifying abnormal, incomplete or mispredicted entries based on the principle that a sequence is likely to be incorrect if some of its features conflict with our current knowledge about protein-coding genes and proteins: (i conflict between the predicted subcellular localization of proteins and the absence of the corresponding sequence signals; (ii presence of extracellular and cytoplasmic domains and the absence of transmembrane segments; (iii co-occurrence of extracellular and nuclear domains; (iv violation of domain integrity; (v chimeras encoded by two or more genes located on different chromosomes. Results Analyses of predicted EnsEMBL protein sequences of nine deuterostome (Homo sapiens, Mus musculus, Rattus norvegicus, Monodelphis domestica, Gallus gallus, Xenopus tropicalis, Fugu rubripes, Danio rerio and Ciona intestinalis and two protostome species (Caenorhabditis elegans and Drosophila melanogaster have revealed that the absence of expected signal peptides and violation of domain integrity account for the majority of mispredictions. Analyses of sequences predicted by NCBI's GNOMON annotation pipeline show that the rates of mispredictions are comparable to those of EnsEMBL. Interestingly, even the manually curated UniProtKB/Swiss-Prot dataset is contaminated with mispredicted or abnormal proteins, although to a much lesser extent than UniProtKB/TrEMBL or the EnsEMBL or GNOMON

  8. A Reference Viral Database (RVDB) To Enhance Bioinformatics Analysis of High-Throughput Sequencing for Novel Virus Detection.

    Science.gov (United States)

    Goodacre, Norman; Aljanahi, Aisha; Nandakumar, Subhiksha; Mikailov, Mike; Khan, Arifa S

    2018-01-01

    Detection of distantly related viruses by high-throughput sequencing (HTS) is bioinformatically challenging because of the lack of a public database containing all viral sequences, without abundant nonviral sequences, which can extend runtime and obscure viral hits. Our reference viral database (RVDB) includes all viral, virus-related, and virus-like nucleotide sequences (excluding bacterial viruses), regardless of length, and with overall reduced cellular sequences. Semantic selection criteria (SEM-I) were used to select viral sequences from GenBank, resulting in a first-generation viral database (VDB). This database was manually and computationally reviewed, resulting in refined, semantic selection criteria (SEM-R), which were applied to a new download of updated GenBank sequences to create a second-generation VDB. Viral entries in the latter were clustered at 98% by CD-HIT-EST to reduce redundancy while retaining high viral sequence diversity. The viral identity of the clustered representative sequences (creps) was confirmed by BLAST searches in NCBI databases and HMMER searches in PFAM and DFAM databases. The resulting RVDB contained a broad representation of viral families, sequence diversity, and a reduced cellular content; it includes full-length and partial sequences and endogenous nonretroviral elements, endogenous retroviruses, and retrotransposons. Testing of RVDBv10.2, with an in-house HTS transcriptomic data set indicated a significantly faster run for virus detection than interrogating the entirety of the NCBI nonredundant nucleotide database, which contains all viral sequences but also nonviral sequences. RVDB is publically available for facilitating HTS analysis, particularly for novel virus detection. It is meant to be updated on a regular basis to include new viral sequences added to GenBank. IMPORTANCE To facilitate bioinformatics analysis of high-throughput sequencing (HTS) data for the detection of both known and novel viruses, we have

  9. ARCPHdb: A comprehensive protein database for SF1 and SF2 helicase from archaea.

    Science.gov (United States)

    Moukhtar, Mirna; Chaar, Wafi; Abdel-Razzak, Ziad; Khalil, Mohamad; Taha, Samir; Chamieh, Hala

    2017-01-01

    Superfamily 1 and Superfamily 2 helicases, two of the largest helicase protein families, play vital roles in many biological processes including replication, transcription and translation. Study of helicase proteins in the model microorganisms of archaea have largely contributed to the understanding of their function, architecture and assembly. Based on a large phylogenomics approach, we have identified and classified all SF1 and SF2 protein families in ninety five sequenced archaea genomes. Here we developed an online webserver linked to a specialized protein database named ARCPHdb to provide access for SF1 and SF2 helicase families from archaea. ARCPHdb was implemented using MySQL relational database. Web interfaces were developed using Netbeans. Data were stored according to UniProt accession numbers, NCBI Ref Seq ID, PDB IDs and Entrez Databases. A user-friendly interactive web interface has been developed to browse, search and download archaeal helicase protein sequences, their available 3D structure models, and related documentation available in the literature provided by ARCPHdb. The database provides direct links to matching external databases. The ARCPHdb is the first online database to compile all protein information on SF1 and SF2 helicase from archaea in one platform. This database provides essential resource information for all researchers interested in the field. Copyright © 2016 Elsevier Ltd. All rights reserved.

  10. MitoSatPlant: mitochondrial microsatellites database of viridiplantae.

    Science.gov (United States)

    Kumar, Manjeet; Kapil, Aditi; Shanker, Asheesh

    2014-11-01

    Microsatellites also known as simple sequence repeats (SSRs) consist of 1-6 nucleotide long repeating units. The importance of mitochondrial SSRs (mtSSRs) in fields like population genetics, plant phylogenetics and genome mapping motivated us to develop MitoSatPlant, a repository of plant mtSSRs. It contains information for perfect, imperfect and compound SSRs mined from 92 mitochondrial genomes of green plants, available at NCBI (as of 1 Feb 2014). A total of 72,798 SSRs were found, of which PCR primers were designed for 72,495 SSRs. Among all sequences, tetranucleotide repeats (26,802) were found to be most abundant whereas hexanucleotide repeats (2751) were detected with least frequency. MitoSatPlant was developed using SQL server 2008 and can be accessed through a front end designed in ASP.Net. It is an easy to use, user-friendly database and will prove to be a useful resource for plant scientists. To the best of our knowledge MitoSatPlant is the only database available for plant mtSSRs and can be freely accessed at http://compubio.in/mitosatplant/. Copyright © 2014 Elsevier B.V. and Mitochondria Research Society. All rights reserved.

  11. Integration of curated databases to identify genotype-phenotype associations

    Directory of Open Access Journals (Sweden)

    Li Jianrong

    2006-10-01

    Full Text Available Abstract Background The ability to rapidly characterize an unknown microorganism is critical in both responding to infectious disease and biodefense. To do this, we need some way of anticipating an organism's phenotype based on the molecules encoded by its genome. However, the link between molecular composition (i.e. genotype and phenotype for microbes is not obvious. While there have been several studies that address this challenge, none have yet proposed a large-scale method integrating curated biological information. Here we utilize a systematic approach to discover genotype-phenotype associations that combines phenotypic information from a biomedical informatics database, GIDEON, with the molecular information contained in National Center for Biotechnology Information's Clusters of Orthologous Groups database (NCBI COGs. Results Integrating the information in the two databases, we are able to correlate the presence or absence of a given protein in a microbe with its phenotype as measured by certain morphological characteristics or survival in a particular growth media. With a 0.8 correlation score threshold, 66% of the associations found were confirmed by the literature and at a 0.9 correlation threshold, 86% were positively verified. Conclusion Our results suggest possible phenotypic manifestations for proteins biochemically associated with sugar metabolism and electron transport. Moreover, we believe our approach can be extended to linking pathogenic phenotypes with functionally related proteins.

  12. Education resources of the National Center for Biotechnology Information.

    Science.gov (United States)

    Cooper, Peter S; Lipshultz, Dawn; Matten, Wayne T; McGinnis, Scott D; Pechous, Steven; Romiti, Monica L; Tao, Tao; Valjavec-Gratian, Majda; Sayers, Eric W

    2010-11-01

    The National Center for Biotechnology Information (NCBI) hosts 39 literature and molecular biology databases containing almost half a billion records. As the complexity of these data and associated resources and tools continues to expand, so does the need for educational resources to help investigators, clinicians, information specialists and the general public make use of the wealth of public data available at the NCBI. This review describes the educational resources available at NCBI via the NCBI Education page (www.ncbi.nlm.nih.gov/Education/). These resources include materials designed for new users, such as About NCBI and the NCBI Guide, as well as documentation, Frequently Asked Questions (FAQs) and writings on the NCBI Bookshelf such as the NCBI Help Manual and the NCBI Handbook. NCBI also provides teaching materials such as tutorials, problem sets and educational tools such as the Amino Acid Explorer, PSSM Viewer and Ebot. NCBI also offers training programs including the Discovery Workshops, webinars and tutorials at conferences. To help users keep up-to-date, NCBI produces the online NCBI News and offers RSS feeds and mailing lists, along with a presence on Facebook, Twitter and YouTube.

  13. search GenBank: interactive orchestration and ad-hoc choreography of Web services in the exploration of the biomedical resources of the National Center For Biotechnology Information.

    Science.gov (United States)

    Mrozek, Dariusz; Małysiak-Mrozek, Bożena; Siążnik, Artur

    2013-03-01

    Due to the growing number of biomedical entries in data repositories of the National Center for Biotechnology Information (NCBI), it is difficult to collect, manage and process all of these entries in one place by third-party software developers without significant investment in hardware and software infrastructure, its maintenance and administration. Web services allow development of software applications that integrate in one place the functionality and processing logic of distributed software components, without integrating the components themselves and without integrating the resources to which they have access. This is achieved by appropriate orchestration or choreography of available Web services and their shared functions. After the successful application of Web services in the business sector, this technology can now be used to build composite software tools that are oriented towards biomedical data processing. We have developed a new tool for efficient and dynamic data exploration in GenBank and other NCBI databases. A dedicated search GenBank system makes use of NCBI Web services and a package of Entrez Programming Utilities (eUtils) in order to provide extended searching capabilities in NCBI data repositories. In search GenBank users can use one of the three exploration paths: simple data searching based on the specified user's query, advanced data searching based on the specified user's query, and advanced data exploration with the use of macros. search GenBank orchestrates calls of particular tools available through the NCBI Web service providing requested functionality, while users interactively browse selected records in search GenBank and traverse between NCBI databases using available links. On the other hand, by building macros in the advanced data exploration mode, users create choreographies of eUtils calls, which can lead to the automatic discovery of related data in the specified databases. search GenBank extends standard capabilities of the

  14. CUDASW++: optimizing Smith-Waterman sequence database searches for CUDA-enabled graphics processing units

    Directory of Open Access Journals (Sweden)

    Maskell Douglas L

    2009-05-01

    Full Text Available Abstract Background The Smith-Waterman algorithm is one of the most widely used tools for searching biological sequence databases due to its high sensitivity. Unfortunately, the Smith-Waterman algorithm is computationally demanding, which is further compounded by the exponential growth of sequence databases. The recent emergence of many-core architectures, and their associated programming interfaces, provides an opportunity to accelerate sequence database searches using commonly available and inexpensive hardware. Findings Our CUDASW++ implementation (benchmarked on a single-GPU NVIDIA GeForce GTX 280 graphics card and a dual-GPU GeForce GTX 295 graphics card provides a significant performance improvement compared to other publicly available implementations, such as SWPS3, CBESW, SW-CUDA, and NCBI-BLAST. CUDASW++ supports query sequences of length up to 59K and for query sequences ranging in length from 144 to 5,478 in Swiss-Prot release 56.6, the single-GPU version achieves an average performance of 9.509 GCUPS with a lowest performance of 9.039 GCUPS and a highest performance of 9.660 GCUPS, and the dual-GPU version achieves an average performance of 14.484 GCUPS with a lowest performance of 10.660 GCUPS and a highest performance of 16.087 GCUPS. Conclusion CUDASW++ is publicly available open-source software. It provides a significant performance improvement for Smith-Waterman-based protein sequence database searches by fully exploiting the compute capability of commonly used CUDA-enabled low-cost GPUs.

  15. Database for content of mercury in Polish brown coal

    Science.gov (United States)

    Jastrząb, Krzysztof

    2018-01-01

    Poland is rated among the countries with largest level of mercury emission in Europe. According to information provided by the National Centre for Balancing and Management of Emissions (KOBiZE) more than 10.5 tons of mercury and its compounds were emitted into the atmosphere in 2015 from the area of Poland. Within the scope of the BazaHg project lasting from 2014 to 2015 and co-financed from the National Centre of Research and Development (NCBiR) a database was set up with specification of mercury content in Polish hard steam coal, coking coal and brown coal (lignite) grades. With regard to domestic brown coal the database comprises information on coal grades from Brown Coal Mines of `Bełchatów', `Adamów', `Turów' and `Sieniawa'. Currently the database contains 130 records with parameters of brown coal, where each record stands for technical analysis (content of moisture, ash and volatile particles), elemental analysis (CHNS), content of chlorine and mercury as well as net calorific value and combustion heat. Content of mercury in samples of brown coal grades under test ranged from 44 to 985 μg of Hg/kg with the average level of 345 μg of Hg/kg. The established database makes up a reliable and trustworthy source of information about content of mercury in Polish fossils. The foregoing details completed with information about consumption of coal by individual electric power stations and multiplied by appropriate emission coefficients may serve as the background to establish loads of mercury emitted into atmosphere from individual stations and by the entire sector of power engineering in total. It will also enable Polish central organizations and individual business entities to implement reasonable policy with respect of mercury emission into atmosphere.

  16. ATGC: a database of orthologous genes from closely related prokaryotic genomes and a research platform for microevolution of prokaryotes

    Energy Technology Data Exchange (ETDEWEB)

    Novichkov, Pavel S.; Ratnere, Igor; Wolf, Yuri I.; Koonin, Eugene V.; Dubchak, Inna

    2009-07-23

    The database of Alignable Tight Genomic Clusters (ATGCs) consists of closely related genomes of archaea and bacteria, and is a resource for research into prokaryotic microevolution. Construction of a data set with appropriate characteristics is a major hurdle for this type of studies. With the current rate of genome sequencing, it is difficult to follow the progress of the field and to determine which of the available genome sets meet the requirements of a given research project, in particular, with respect to the minimum and maximum levels of similarity between the included genomes. Additionally, extraction of specific content, such as genomic alignments or families of orthologs, from a selected set of genomes is a complicated and time-consuming process. The database addresses these problems by providing an intuitive and efficient web interface to browse precomputed ATGCs, select appropriate ones and access ATGC-derived data such as multiple alignments of orthologous proteins, matrices of pairwise intergenomic distances based on genome-wide analysis of synonymous and nonsynonymous substitution rates and others. The ATGC database will be regularly updated following new releases of the NCBI RefSeq. The database is hosted by the Genomics Division at Lawrence Berkeley National laboratory and is publicly available at http://atgc.lbl.gov.

  17. Stemcell Information: SKIP000887 [SKIP Stemcell Database[Archive

    Lifescience Database Archive (English)

    Full Text Available NICATIONS 2015 7 11471 ... http://www.ncbi.nlm.nih.gov/pubmed/27161380 ... ...Tumour resistance in induced pluripotent stem cells derived from naked mole-rats. Shingo Miyawaki, Hideyuki Okano et al. NATURE COMMU

  18. Stemcell Information: SKIP000385 [SKIP Stemcell Database[Archive

    Lifescience Database Archive (English)

    Full Text Available Teratoma formation ... Yes ... Yes ... National Research Institute for Child Health and Development htt...p://www.ncbi.nlm.nih.gov/geo/ Akihiro Umezawa 梅澤 明弘 Available National Research Institute for Child Health a

  19. Analysis of newly established EST databases reveals similarities between heart regeneration in newt and fish

    Directory of Open Access Journals (Sweden)

    Weis Patrick

    2010-01-01

    Full Text Available Abstract Background The newt Notophthalmus viridescens possesses the remarkable ability to respond to cardiac damage by formation of new myocardial tissue. Surprisingly little is known about changes in gene activities that occur during the course of regeneration. To begin to decipher the molecular processes, that underlie restoration of functional cardiac tissue, we generated an EST database from regenerating newt hearts and compared the transcriptional profile of selected candidates with genes deregulated during zebrafish heart regeneration. Results A cDNA library of 100,000 cDNA clones was generated from newt hearts 14 days after ventricular injury. Sequencing of 11520 cDNA clones resulted in 2894 assembled contigs. BLAST searches revealed 1695 sequences with potential homology to sequences from the NCBI database. BLAST searches to TrEMBL and Swiss-Prot databases assigned 1116 proteins to Gene Ontology terms. We also identified a relatively large set of 174 ORFs, which are likely to be unique for urodele amphibians. Expression analysis of newt-zebrafish homologues confirmed the deregulation of selected genes during heart regeneration. Sequences, BLAST results and GO annotations were visualized in a relational web based database followed by grouping of identified proteins into clusters of GO Terms. Comparison of data from regenerating zebrafish hearts identified biological processes, which were uniformly overrepresented during cardiac regeneration in newt and zebrafish. Conclusion We concluded that heart regeneration in newts and zebrafish led to the activation of similar sets of genes, which suggests that heart regeneration in both species might follow similar principles. The design of the newly established newt EST database allows identification of molecular pathways important for heart regeneration.

  20. Achievement report for fiscal 1997 on the development of technologies for utilizing biological resources such as complex biosystems. Development of complex biosystem analyzing technology; 1997 nendo fukugo seibutsukei nado seibutsu shigen riyo gijutsu kaihatsu seika hokokusho. Fukugo seibutsukei kaiseki gijutsu no kaihatsu

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1998-03-01

    The aim is to utilize the sophisticated functions of complex biosystems. In the research and development of technologies for effectively utilizing unexploited resources and substances such as seeweeds and algae, seaweeds are added to seawater to turn into a microbial suspension after the passage of two weeks, the suspension is next scattered on a carageenan culture medium, and then carageenan decomposing microbes are obtained. In the research and development of technologies for utilizing microbe/fauna-flora complex systems, technologies for exploring and analyzing microbes are studied. For this purpose, 48 kinds of sponges and 300 kinds of bacteria symbiotic with the sponges are sampled in Malaysia. Out of them, 15 exhibit enzyme inhibition and Artemia salina lethality activities. In the development of technologies for analyzing the functions of microbes engaged in the production of useful resources and substances for animals and plants, 150 kinds of micro-algae are subjected to screening using protease and chitinase inhibiting activities as the indexes, and it is found that an extract of Isochrysis galbana displays an intense inhibitory activity. The alga is cultured in quantities, the active component is isolated from 20g of dried alga, and its constitution is determined. (NEDO)

  1. Genetic Testing Registry

    Science.gov (United States)

    ... RefSeqGene UniGene All Genes & Expression Resources... Genetics & Medicine Bookshelf Database of Genotypes and Phenotypes (dbGaP) Genetic Testing ... ProtMap HomoloGene Protein Clusters All Homology Resources... Literature Bookshelf E-Utilities Journals in NCBI Databases MeSH Database ...

  2. PubMed searches: overview and strategies for clinicians.

    Science.gov (United States)

    Lindsey, Wesley T; Olin, Bernie R

    2013-04-01

    PubMed is a biomedical and life sciences database maintained by a division of the National Library of Medicine known as the National Center for Biotechnology Information (NCBI). It is a large resource with more than 5600 journals indexed and greater than 22 million total citations. Searches conducted in PubMed provide references that are more specific for the intended topic compared with other popular search engines. Effective PubMed searches allow the clinician to remain current on the latest clinical trials, systematic reviews, and practice guidelines. PubMed continues to evolve by allowing users to create a customized experience through the My NCBI portal, new arrangements and options in search filters, and supporting scholarly projects through exportation of citations to reference managing software. Prepackaged search options available in the Clinical Queries feature also allow users to efficiently search for clinical literature. PubMed also provides information regarding the source journals themselves through the Journals in NCBI Databases link. This article provides an overview of the PubMed database's structure and features as well as strategies for conducting an effective search.

  3. PReMod: a database of genome-wide mammalian cis-regulatory module predictions.

    Science.gov (United States)

    Ferretti, Vincent; Poitras, Christian; Bergeron, Dominique; Coulombe, Benoit; Robert, François; Blanchette, Mathieu

    2007-01-01

    We describe PReMod, a new database of genome-wide cis-regulatory module (CRM) predictions for both the human and the mouse genomes. The prediction algorithm, described previously in Blanchette et al. (2006) Genome Res., 16, 656-668, exploits the fact that many known CRMs are made of clusters of phylogenetically conserved and repeated transcription factors (TF) binding sites. Contrary to other existing databases, PReMod is not restricted to modules located proximal to genes, but in fact mostly contains distal predicted CRMs (pCRMs). Through its web interface, PReMod allows users to (i) identify pCRMs around a gene of interest; (ii) identify pCRMs that have binding sites for a given TF (or a set of TFs) or (iii) download the entire dataset for local analyses. Queries can also be refined by filtering for specific chromosomal regions, for specific regions relative to genes or for the presence of CpG islands. The output includes information about the binding sites predicted within the selected pCRMs, and a graphical display of their distribution within the pCRMs. It also provides a visual depiction of the chromosomal context of the selected pCRMs in terms of neighboring pCRMs and genes, all of which are linked to the UCSC Genome Browser and the NCBI. PReMod: http://genomequebec.mcgill.ca/PReMod.

  4. Avoiding inconsistencies over time and tracking difficulties in Applied Biosystems AB1700™/Panther™ probe-to-gene annotations

    Directory of Open Access Journals (Sweden)

    Benecke Arndt

    2005-12-01

    Full Text Available Abstract Background Significant inconsistencies between probe-to-gene annotations between different releases of probe set identifiers by commercial microarray platform solutions have been reported. Such inconsistencies lead to misleading or ambiguous interpretation of published gene expression results. Results We report here similar inconsistencies in the probe-to-gene annotation of Applied Biosystems AB1700 data, demonstrating that this is not an isolated concern. Moreover, the online information source PANTHER does not provide information required to track such inconsistencies, hence, even correctly annotated datasets, when resubmitted after PANTHER was updated to a new probe-to-gene annotation release, will generate differing results without any feedback on the origin of the change. Conclusion The importance of unequivocal annotation of microarray experiments can not be underestimated. Inconsistencies greatly diminish the usefulness of the technology. Novel methods in the analysis of transcriptome profiles often rely on large disparate datasets stemming from multiple sources. The predictive and analytic power of such approaches rapidly diminishes if only least-common subsets can be used for analysis. We present here the information that needs to be provided together with the raw AB1700 data, and the information required together with the biologic interpretation of such data to avoid inconsistencies and tracking difficulties.

  5. Molecular characterization of olive cultivars grown in Iraq using ...

    African Journals Online (AJOL)

    husam

    database for Iraqi olive cultivars, in breeding strategies and in correct cultivar identification. Key words: Olea europaea, genetic diversity ... cultivated fruit tree species in the Mediterranean basin. It is a predominant allogamous species .... carried out using an automatic DNA analyzer (Model 3100 Prism;. Applied Biosystems).

  6. Detection of a Usp-like gene in Calotropis procera plant from the de novo assembled genome contigs of the high-throughput sequencing dataset

    KAUST Repository

    Shokry, Ahmed M.; Al-Karim, Saleh; Ramadan, Ahmed M Ali; Gadallah, Nour; Al-Attas, Sanaa G.; Sabir, Jamal Sabir M; Hassan, Sabah Mohammed; Madkour, Loutfy H.; Bressan, Ray Anthony; Mahfouz, Magdy M.; Bahieldin, Ahmed M.

    2014-01-01

    acids sequence were identified from the NCBI conserved domain database (CDD) that provide insights into sequence structure/function relationships, as well as domain models imported from a number of external source databases (Pfam, SMART, COG, PRK

  7. Stemcell Information: SKIP000191 [SKIP Stemcell Database[Archive

    Lifescience Database Archive (English)

    Full Text Available 2848530--http://www.ncbi.nlm.nih.gov/pubmed/?term=23039195 -- 確定診断方法:スーパーコントロール|HIV : 実施 陰性|HTLV-1 : 未実施|HBV : 実施 陰性|HCV : 実施 陰性|病歴

  8. Stemcell Information: SKIP000193 [SKIP Stemcell Database[Archive

    Lifescience Database Archive (English)

    Full Text Available 2848530--http://www.ncbi.nlm.nih.gov/pubmed/?term=23039195 -- 確定診断方法:スーパーコントロール|HIV : 実施 陰性|HTLV-1 : 未実施|HBV : 実施 陰性|HCV : 実施 陰性|病歴

  9. Consensus coding sequence (CCDS) database: a standardized set of human and mouse protein-coding regions supported by expert curation.

    Science.gov (United States)

    Pujar, Shashikant; O'Leary, Nuala A; Farrell, Catherine M; Loveland, Jane E; Mudge, Jonathan M; Wallin, Craig; Girón, Carlos G; Diekhans, Mark; Barnes, If; Bennett, Ruth; Berry, Andrew E; Cox, Eric; Davidson, Claire; Goldfarb, Tamara; Gonzalez, Jose M; Hunt, Toby; Jackson, John; Joardar, Vinita; Kay, Mike P; Kodali, Vamsi K; Martin, Fergal J; McAndrews, Monica; McGarvey, Kelly M; Murphy, Michael; Rajput, Bhanu; Rangwala, Sanjida H; Riddick, Lillian D; Seal, Ruth L; Suner, Marie-Marthe; Webb, David; Zhu, Sophia; Aken, Bronwen L; Bruford, Elspeth A; Bult, Carol J; Frankish, Adam; Murphy, Terence; Pruitt, Kim D

    2018-01-04

    The Consensus Coding Sequence (CCDS) project provides a dataset of protein-coding regions that are identically annotated on the human and mouse reference genome assembly in genome annotations produced independently by NCBI and the Ensembl group at EMBL-EBI. This dataset is the product of an international collaboration that includes NCBI, Ensembl, HUGO Gene Nomenclature Committee, Mouse Genome Informatics and University of California, Santa Cruz. Identically annotated coding regions, which are generated using an automated pipeline and pass multiple quality assurance checks, are assigned a stable and tracked identifier (CCDS ID). Additionally, coordinated manual review by expert curators from the CCDS collaboration helps in maintaining the integrity and high quality of the dataset. The CCDS data are available through an interactive web page (https://www.ncbi.nlm.nih.gov/CCDS/CcdsBrowse.cgi) and an FTP site (ftp://ftp.ncbi.nlm.nih.gov/pub/CCDS/). In this paper, we outline the ongoing work, growth and stability of the CCDS dataset and provide updates on new collaboration members and new features added to the CCDS user interface. We also present expert curation scenarios, with specific examples highlighting the importance of an accurate reference genome assembly and the crucial role played by input from the research community. Published by Oxford University Press on behalf of Nucleic Acids Research 2017.

  10. The use of sequence-based SSR mining for the development of a vast collection of microsatellites in Aquilegia Formosa

    Science.gov (United States)

    Brandon Schlautman; Vera Pfeiffer; Juan Zalapa; Johanne Brunet

    2014-01-01

    Numerous microsatellite markers were developed for Aquilegia formosafrom sequences deposited within the Expressed Sequence Tag (EST), Genomic Survey Sequence (GSS), and Nucleotide databases in NCBI. Microsatellites (SSRs) were identified and primers were designed for 9 SSR containing sequences in the Nucleotide database, 3803 sequences in the EST...

  11. The Mitochondrial Protein Atlas: A Database of Experimentally Verified Information on the Human Mitochondrial Proteome.

    Science.gov (United States)

    Godin, Noa; Eichler, Jerry

    2017-09-01

    Given its central role in various biological systems, as well as its involvement in numerous pathologies, the mitochondrion is one of the best-studied organelles. However, although the mitochondrial genome has been extensively investigated, protein-level information remains partial, and in many cases, hypothetical. The Mitochondrial Protein Atlas (MPA; URL: lifeserv.bgu.ac.il/wb/jeichler/MPA ) is a database that provides a complete, manually curated inventory of only experimentally validated human mitochondrial proteins. The MPA presently contains 911 unique protein entries, each of which is associated with at least one experimentally validated and referenced mitochondrial localization. The MPA also contains experimentally validated and referenced information defining function, structure, involvement in pathologies, interactions with other MPA proteins, as well as the method(s) of analysis used in each instance. Connections to relevant external data sources are offered for each entry, including links to NCBI Gene, PubMed, and Protein Data Bank. The MPA offers a prototype for other information sources that allow for a distinction between what has been confirmed and what remains to be verified experimentally.

  12. ORFer--retrieval of protein sequences and open reading frames from GenBank and storage into relational databases or text files.

    Science.gov (United States)

    Büssow, Konrad; Hoffmann, Steve; Sievert, Volker

    2002-12-19

    Functional genomics involves the parallel experimentation with large sets of proteins. This requires management of large sets of open reading frames as a prerequisite of the cloning and recombinant expression of these proteins. A Java program was developed for retrieval of protein and nucleic acid sequences and annotations from NCBI GenBank, using the XML sequence format. Annotations retrieved by ORFer include sequence name, organism and also the completeness of the sequence. The program has a graphical user interface, although it can be used in a non-interactive mode. For protein sequences, the program also extracts the open reading frame sequence, if available, and checks its correct translation. ORFer accepts user input in the form of single or lists of GenBank GI identifiers or accession numbers. It can be used to extract complete sets of open reading frames and protein sequences from any kind of GenBank sequence entry, including complete genomes or chromosomes. Sequences are either stored with their features in a relational database or can be exported as text files in Fasta or tabulator delimited format. The ORFer program is freely available at http://www.proteinstrukturfabrik.de/orfer. The ORFer program allows for fast retrieval of DNA sequences, protein sequences and their open reading frames and sequence annotations from GenBank. Furthermore, storage of sequences and features in a relational database is supported. Such a database can supplement a laboratory information system (LIMS) with appropriate sequence information.

  13. Where the bugs are: analyzing distributions of bacterial phyla by descriptor keyword search in the nucleotide database.

    Science.gov (United States)

    Squartini, Andrea

    2011-07-26

    The associations between bacteria and environment underlie their preferential interactions with given physical or chemical conditions. Microbial ecology aims at extracting conserved patterns of occurrence of bacterial taxa in relation to defined habitats and contexts. In the present report the NCBI nucleotide sequence database is used as dataset to extract information relative to the distribution of each of the 24 phyla of the bacteria superkingdom and of the Archaea. Over two and a half million records are filtered in their cross-association with each of 48 sets of keywords, defined to cover natural or artificial habitats, interactions with plant, animal or human hosts, and physical-chemical conditions. The results are processed showing: (a) how the different descriptors enrich or deplete the proportions at which the phyla occur in the total database; (b) in which order of abundance do the different keywords score for each phylum (preferred habitats or conditions), and to which extent are phyla clustered to few descriptors (specific) or spread across many (cosmopolitan); (c) which keywords individuate the communities ranking highest for diversity and evenness. A number of cues emerge from the results, contributing to sharpen the picture on the functional systematic diversity of prokaryotes. Suggestions are given for a future automated service dedicated to refining and updating such kind of analyses via public bioinformatic engines.

  14. Oligonucleic Acid Drug List: monrd0022 [Oligonucleic Acid Drug Database[Archive

    Lifescience Database Archive (English)

    Full Text Available ration of eIF4E mRNA decreased in 13 of 19 cases. ... https://www.clinicaltrialsregister.eu/ctr-search/trial/20...10-022239-12/HU, https://www.clinicaltrialsregister.eu/ctr-search/trial/2010-022240-21/HU, https://www.ncbi.nlm.nih.gov/pubmed/27194579 ... P06730 4TPW

  15. Searching the protein structure database for ligand-binding site similarities using CPASS v.2

    Directory of Open Access Journals (Sweden)

    Caprez Adam

    2011-01-01

    Full Text Available Abstract Background A recent analysis of protein sequences deposited in the NCBI RefSeq database indicates that ~8.5 million protein sequences are encoded in prokaryotic and eukaryotic genomes, where ~30% are explicitly annotated as "hypothetical" or "uncharacterized" protein. Our Comparison of Protein Active-Site Structures (CPASS v.2 database and software compares the sequence and structural characteristics of experimentally determined ligand binding sites to infer a functional relationship in the absence of global sequence or structure similarity. CPASS is an important component of our Functional Annotation Screening Technology by NMR (FAST-NMR protocol and has been successfully applied to aid the annotation of a number of proteins of unknown function. Findings We report a major upgrade to our CPASS software and database that significantly improves its broad utility. CPASS v.2 is designed with a layered architecture to increase flexibility and portability that also enables job distribution over the Open Science Grid (OSG to increase speed. Similarly, the CPASS interface was enhanced to provide more user flexibility in submitting a CPASS query. CPASS v.2 now allows for both automatic and manual definition of ligand-binding sites and permits pair-wise, one versus all, one versus list, or list versus list comparisons. Solvent accessible surface area, ligand root-mean square difference, and Cβ distances have been incorporated into the CPASS similarity function to improve the quality of the results. The CPASS database has also been updated. Conclusions CPASS v.2 is more than an order of magnitude faster than the original implementation, and allows for multiple simultaneous job submissions. Similarly, the CPASS database of ligand-defined binding sites has increased in size by ~ 38%, dramatically increasing the likelihood of a positive search result. The modification to the CPASS similarity function is effective in reducing CPASS similarity scores

  16. Database Description - Trypanosomes Database | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available List Contact us Trypanosomes Database Database Description General information of database Database name Trypanosomes Database...stitute of Genetics Research Organization of Information and Systems Yata 1111, Mishima, Shizuoka 411-8540, JAPAN E mail: Database...y Name: Trypanosoma Taxonomy ID: 5690 Taxonomy Name: Homo sapiens Taxonomy ID: 9606 Database description The... Article title: Author name(s): Journal: External Links: Original website information Database maintenance s...DB (Protein Data Bank) KEGG PATHWAY Database DrugPort Entry list Available Query search Available Web servic

  17. Database Description - SKIP Stemcell Database | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available List Contact us SKIP Stemcell Database Database Description General information of database Database name SKIP Stemcell Database...rsity Journal Search: Contact address http://www.skip.med.keio.ac.jp/en/contact/ Database classification Human Genes and Diseases Dat...abase classification Stemcell Article Organism Taxonomy Name: Homo sapiens Taxonomy ID: 9606 Database...ks: Original website information Database maintenance site Center for Medical Genetics, School of medicine, ...lable Web services Not available URL of Web services - Need for user registration Not available About This Database Database

  18. Database Description - Arabidopsis Phenome Database | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available List Contact us Arabidopsis Phenome Database Database Description General information of database Database n... BioResource Center Hiroshi Masuya Database classification Plant databases - Arabidopsis thaliana Organism T...axonomy Name: Arabidopsis thaliana Taxonomy ID: 3702 Database description The Arabidopsis thaliana phenome i...heir effective application. We developed the new Arabidopsis Phenome Database integrating two novel database...seful materials for their experimental research. The other, the “Database of Curated Plant Phenome” focusing

  19. A Fast Approximate Algorithm for Mapping Long Reads to Large Reference Databases.

    Science.gov (United States)

    Jain, Chirag; Dilthey, Alexander; Koren, Sergey; Aluru, Srinivas; Phillippy, Adam M

    2018-04-30

    Emerging single-molecule sequencing technologies from Pacific Biosciences and Oxford Nanopore have revived interest in long-read mapping algorithms. Alignment-based seed-and-extend methods demonstrate good accuracy, but face limited scalability, while faster alignment-free methods typically trade decreased precision for efficiency. In this article, we combine a fast approximate read mapping algorithm based on minimizers with a novel MinHash identity estimation technique to achieve both scalability and precision. In contrast to prior methods, we develop a mathematical framework that defines the types of mapping targets we uncover, establish probabilistic estimates of p-value and sensitivity, and demonstrate tolerance for alignment error rates up to 20%. With this framework, our algorithm automatically adapts to different minimum length and identity requirements and provides both positional and identity estimates for each mapping reported. For mapping human PacBio reads to the hg38 reference, our method is 290 × faster than Burrows-Wheeler Aligner-MEM with a lower memory footprint and recall rate of 96%. We further demonstrate the scalability of our method by mapping noisy PacBio reads (each ≥5 kbp in length) to the complete NCBI RefSeq database containing 838 Gbp of sequence and >60,000 genomes.

  20. Metabolic alterations derived from absence of Two-Pore Channel 1 ...

    Indian Academy of Sciences (India)

    by 2-DE-MALDI-MS according to their biological function using the NCBI, PantherDB, and Uniprot databases. The SwissProt accession ... MALDI-TOF analysis of 2-DE spots for male left ventricle against mouse databases. ... did not resolve the proteins properly, and another at pH 4-7) for left ventricles of wild type mice.

  1. In silico approach to identification of a novel gene responsive to ...

    African Journals Online (AJOL)

    win7

    2015-06-10

    Jun 10, 2015 ... heatmap construction. The NCBI database ... and expression analysis. Total RNA was extracted from leaves of seedlings at different time .... tolerance by modulating the GA signal pathway in rice. Therefore, we performed ...

  2. Global Metabolic Reconstruction and Metabolic Gene Evolution in the Cattle Genome

    Science.gov (United States)

    Kim, Woonsu; Park, Hyesun; Seo, Seongwon

    2016-01-01

    The sequence of cattle genome provided a valuable opportunity to systematically link genetic and metabolic traits of cattle. The objectives of this study were 1) to reconstruct genome-scale cattle-specific metabolic pathways based on the most recent and updated cattle genome build and 2) to identify duplicated metabolic genes in the cattle genome for better understanding of metabolic adaptations in cattle. A bioinformatic pipeline of an organism for amalgamating genomic annotations from multiple sources was updated. Using this, an amalgamated cattle genome database based on UMD_3.1, was created. The amalgamated cattle genome database is composed of a total of 33,292 genes: 19,123 consensus genes between NCBI and Ensembl databases, 8,410 and 5,493 genes only found in NCBI or Ensembl, respectively, and 266 genes from NCBI scaffolds. A metabolic reconstruction of the cattle genome and cattle pathway genome database (PGDB) was also developed using Pathway Tools, followed by an intensive manual curation. The manual curation filled or revised 68 pathway holes, deleted 36 metabolic pathways, and added 23 metabolic pathways. Consequently, the curated cattle PGDB contains 304 metabolic pathways, 2,460 reactions including 2,371 enzymatic reactions, and 4,012 enzymes. Furthermore, this study identified eight duplicated genes in 12 metabolic pathways in the cattle genome compared to human and mouse. Some of these duplicated genes are related with specific hormone biosynthesis and detoxifications. The updated genome-scale metabolic reconstruction is a useful tool for understanding biology and metabolic characteristics in cattle. There has been significant improvements in the quality of cattle genome annotations and the MetaCyc database. The duplicated metabolic genes in the cattle genome compared to human and mouse implies evolutionary changes in the cattle genome and provides a useful information for further research on understanding metabolic adaptations of cattle. PMID

  3. The stability of ecosystems: A brief overview of the paradox of ...

    Indian Academy of Sciences (India)

    PRAKASH

    capacity; BioSystems doi: 10.1016/j.biosystems.2006.10.001. Roy S and Chattopadhyay J 2006b Enrichment and ecosystem stability: effect of toxic food; BioSystems, doi:10.1016/ j.biosystems.2006.07.009. Sterner R W and Elser J J 2002 Ecological stoichiometry: the biology of elements from molecules to the biosphere ...

  4. FoodMicrobionet: A database for the visualisation and exploration of food bacterial communities based on network analysis.

    Science.gov (United States)

    Parente, Eugenio; Cocolin, Luca; De Filippis, Francesca; Zotta, Teresa; Ferrocino, Ilario; O'Sullivan, Orla; Neviani, Erasmo; De Angelis, Maria; Cotter, Paul D; Ercolini, Danilo

    2016-02-16

    Amplicon targeted high-throughput sequencing has become a popular tool for the culture-independent analysis of microbial communities. Although the data obtained with this approach are portable and the number of sequences available in public databases is increasing, no tool has been developed yet for the analysis and presentation of data obtained in different studies. This work describes an approach for the development of a database for the rapid exploration and analysis of data on food microbial communities. Data from seventeen studies investigating the structure of bacterial communities in dairy, meat, sourdough and fermented vegetable products, obtained by 16S rRNA gene targeted high-throughput sequencing, were collated and analysed using Gephi, a network analysis software. The resulting database, which we named FoodMicrobionet, was used to analyse nodes and network properties and to build an interactive web-based visualisation. The latter allows the visual exploration of the relationships between Operational Taxonomic Units (OTUs) and samples and the identification of core- and sample-specific bacterial communities. It also provides additional search tools and hyperlinks for the rapid selection of food groups and OTUs and for rapid access to external resources (NCBI taxonomy, digital versions of the original articles). Microbial interaction network analysis was carried out using CoNet on datasets extracted from FoodMicrobionet: the complexity of interaction networks was much lower than that found for other bacterial communities (human microbiome, soil and other environments). This may reflect both a bias in the dataset (which was dominated by fermented foods and starter cultures) and the lower complexity of food bacterial communities. Although some technical challenges exist, and are discussed here, the net result is a valuable tool for the exploration of food bacterial communities by the scientific community and food industry. Copyright © 2015. Published by

  5. Database Description - Yeast Interacting Proteins Database | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available List Contact us Yeast Interacting Proteins Database Database Description General information of database Database... name Yeast Interacting Proteins Database Alternative name - DOI 10.18908/lsdba.nbdc00742-000 Creator C...-ken 277-8561 Tel: +81-4-7136-3989 FAX: +81-4-7136-3979 E-mail : Database classif...s cerevisiae Taxonomy ID: 4932 Database description Information on interactions and related information obta...l Acad Sci U S A. 2001 Apr 10;98(8):4569-74. Epub 2001 Mar 13. External Links: Original website information Database

  6. Update History of This Database - Trypanosomes Database | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available List Contact us Trypanosomes Database Update History of This Database Date Update contents 2014/05/07 The co...ntact information is corrected. The features and manner of utilization of the database are corrected. 2014/02/04 Trypanosomes Databas...e English archive site is opened. 2011/04/04 Trypanosomes Database ( http://www.tan...paku.org/tdb/ ) is opened. About This Database Database Description Download Lice...nse Update History of This Database Site Policy | Contact Us Update History of This Database - Trypanosomes Database | LSDB Archive ...

  7. Performance of Identifiler Direct and PowerPlex 16 HS on the Applied Biosystems 3730 DNA Analyzer for processing biological samples archived on FTA cards.

    Science.gov (United States)

    Laurin, Nancy; DeMoors, Anick; Frégeau, Chantal

    2012-09-01

    Direct amplification of STR loci from biological samples collected on FTA cards without prior DNA purification was evaluated using Identifiler Direct and PowerPlex 16 HS in conjunction with the use of a high throughput Applied Biosystems 3730 DNA Analyzer. In order to reduce the overall sample processing cost, reduced PCR volumes combined with various FTA disk sizes were tested. Optimized STR profiles were obtained using a 0.53 mm disk size in 10 μL PCR volume for both STR systems. These protocols proved effective in generating high quality profiles on the 3730 DNA Analyzer from both blood and buccal FTA samples. Reproducibility, concordance, robustness, sample stability and profile quality were assessed using a collection of blood and buccal samples on FTA cards from volunteer donors as well as from convicted offenders. The new developed protocols offer enhanced throughput capability and cost effectiveness without compromising the robustness and quality of the STR profiles obtained. These results support the use of these protocols for processing convicted offender samples submitted to the National DNA Data Bank of Canada. Similar protocols could be applied to the processing of casework reference samples or in paternity or family relationship testing. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.

  8. Morning sickness

    Science.gov (United States)

    ... for nausea and vomiting in early pregnancy. Cochrane Database Syst Rev . 2015;(9):CD007575. PMID: 26348534 www.ncbi.nlm.nih.gov/pubmed/26348534 . West EH, Hark L, Catalano PM. Nutrition during pregnancy. In: Gabbe SG, Niebyl JR, Simpson ...

  9. Update History of This Database - Arabidopsis Phenome Database | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available List Contact us Arabidopsis Phenome Database Update History of This Database Date Update contents 2017/02/27 Arabidopsis Phenome Data...base English archive site is opened. - Arabidopsis Phenome Database (http://jphenom...e.info/?page_id=95) is opened. About This Database Database Description Download License Update History of This Database... Site Policy | Contact Us Update History of This Database - Arabidopsis Phenome Database | LSDB Archive ...

  10. Refactoring databases evolutionary database design

    CERN Document Server

    Ambler, Scott W

    2006-01-01

    Refactoring has proven its value in a wide range of development projects–helping software professionals improve system designs, maintainability, extensibility, and performance. Now, for the first time, leading agile methodologist Scott Ambler and renowned consultant Pramodkumar Sadalage introduce powerful refactoring techniques specifically designed for database systems. Ambler and Sadalage demonstrate how small changes to table structures, data, stored procedures, and triggers can significantly enhance virtually any database design–without changing semantics. You’ll learn how to evolve database schemas in step with source code–and become far more effective in projects relying on iterative, agile methodologies. This comprehensive guide and reference helps you overcome the practical obstacles to refactoring real-world databases by covering every fundamental concept underlying database refactoring. Using start-to-finish examples, the authors walk you through refactoring simple standalone databas...

  11. Update History of This Database - SKIP Stemcell Database | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available List Contact us SKIP Stemcell Database Update History of This Database Date Update contents 2017/03/13 SKIP Stemcell Database... English archive site is opened. 2013/03/29 SKIP Stemcell Database ( https://www.skip.med.k...eio.ac.jp/SKIPSearch/top?lang=en ) is opened. About This Database Database Description Download License Update History of This Databa...se Site Policy | Contact Us Update History of This Database - SKIP Stemcell Database | LSDB Archive ...

  12. Database design and database administration for a kindergarten

    OpenAIRE

    Vítek, Daniel

    2009-01-01

    The bachelor thesis deals with creation of database design for a standard kindergarten, installation of the designed database into the database system Oracle Database 10g Express Edition and demonstration of the administration tasks in this database system. The verification of the database was proved by a developed access application.

  13. Sequence analysis of cereal sucrose synthase genes and isolation ...

    African Journals Online (AJOL)

    SERVER

    2007-10-18

    Oct 18, 2007 ... sequencing of sucrose synthase gene fragment from sor- ghum using primers designed at their conserved exons. MATERIALS AND METHODS. Multiple sequence alignment. Sucrose synthase gene sequences of various cereals like rice, maize, and barley were accessed from NCBI Genbank database.

  14. Database Description - Open TG-GATEs Pathological Image Database | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available List Contact us Open TG-GATEs Pathological Image Database Database Description General information of database Database... name Open TG-GATEs Pathological Image Database Alternative name - DOI 10.18908/lsdba.nbdc00954-0...iomedical Innovation 7-6-8, Saito-asagi, Ibaraki-city, Osaka 567-0085, Japan TEL:81-72-641-9826 Email: Database... classification Toxicogenomics Database Organism Taxonomy Name: Rattus norvegi... Article title: Author name(s): Journal: External Links: Original website information Database

  15. Update History of This Database - Yeast Interacting Proteins Database | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available List Contact us Yeast Interacting Proteins Database Update History of This Database Date Update contents 201...0/03/29 Yeast Interacting Proteins Database English archive site is opened. 2000/12/4 Yeast Interacting Proteins Database...( http://itolab.cb.k.u-tokyo.ac.jp/Y2H/ ) is released. About This Database Database Description... Download License Update History of This Database Site Policy | Contact Us Update History of This Database... - Yeast Interacting Proteins Database | LSDB Archive ...

  16. Ontology - MicrobeDB.jp | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available gzip) consists of some directories (see the following table). Data file File name: ontology....tar.gz File URL: ftp://ftp.biosciencedbc.jp/archive/microbedb/LATEST/ontology.tar.gz File size: 9...he NCBI Taxonomy and INSDC ontology files were obtained from the DDBJ web site. O...ples Data item Description ontology/meo/meo.ttl An ontology for describing organismal habitats (especially focused on microbes). onto...logy/meo/meo_fma_mapping.ttl An ontology mapping files t

  17. Analysis of SSR information in EST resources of sugarcane

    Science.gov (United States)

    Expressed sequence tags ( ESTs) offer the opportunity to exploit single, low -copy, conserved sequence motifs for the development of simple sequence repeats ( SSRs). The total of 262 113 ESTs of sugarcane (Saccharum officinarum) in the database of NCBI were downloaded and analyzed, which resulted in...

  18. Database Description - RMOS | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available base Description General information of database Database name RMOS Alternative nam...arch Unit Shoshi Kikuchi E-mail : Database classification Plant databases - Rice Microarray Data and other Gene Expression Database...s Organism Taxonomy Name: Oryza sativa Taxonomy ID: 4530 Database description The Ric...19&lang=en Whole data download - Referenced database Rice Expression Database (RED) Rice full-length cDNA Database... (KOME) Rice Genome Integrated Map Database (INE) Rice Mutant Panel Database (Tos17) Rice Genome Annotation Database

  19. KALIMER database development (database configuration and design methodology)

    International Nuclear Information System (INIS)

    Jeong, Kwan Seong; Kwon, Young Min; Lee, Young Bum; Chang, Won Pyo; Hahn, Do Hee

    2001-10-01

    KALIMER Database is an advanced database to utilize the integration management for Liquid Metal Reactor Design Technology Development using Web Applicatins. KALIMER Design database consists of Results Database, Inter-Office Communication (IOC), and 3D CAD database, Team Cooperation system, and Reserved Documents, Results Database is a research results database during phase II for Liquid Metal Reactor Design Technology Develpment of mid-term and long-term nuclear R and D. IOC is a linkage control system inter sub project to share and integrate the research results for KALIMER. 3D CAD Database is s schematic design overview for KALIMER. Team Cooperation System is to inform team member of research cooperation and meetings. Finally, KALIMER Reserved Documents is developed to manage collected data and several documents since project accomplishment. This report describes the features of Hardware and Software and the Database Design Methodology for KALIMER

  20. Database Description - SAHG | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available base Description General information of database Database name SAHG Alternative nam...h: Contact address Chie Motono Tel : +81-3-3599-8067 E-mail : Database classification Structure Databases - ...e databases - Protein properties Organism Taxonomy Name: Homo sapiens Taxonomy ID: 9606 Database description... Links: Original website information Database maintenance site The Molecular Profiling Research Center for D...stration Not available About This Database Database Description Download License Update History of This Database Site Policy | Contact Us Database Description - SAHG | LSDB Archive ...

  1. Stemcell Information: SKIP000474 [SKIP Stemcell Database[Archive

    Lifescience Database Archive (English)

    Full Text Available Gideon ... Fetus Unknown ... -- No MRC-iPS-62|MRC5-derived iPS cells| MRC5由来iPS細胞| human ES-like Res... SKIP000474 ... fetal lung fibroblast 胎児肺線維芽細胞 Unknown MRC-iPS-62 MRC-iPS-62 Gideon...459.x--10.1371/journal.pgen.1002085 Lectin microarray analysis of pluripotent and multipotent stem cells.--D...NA methylation dynamics in human induced pluripotent stem cells over time. Toyoda M, Yamazaki-Inoue M, Itaku...med/21155951--http://www.ncbi.nlm.nih.gov/pubmed/21637780 -- Some of clones of the same original cells have been used in the papers.

  2. Stemcell Information: SKIP000494 [SKIP Stemcell Database[Archive

    Lifescience Database Archive (English)

    Full Text Available eyes Snake eyes ... Fetus Unknown ... -- No MRC-iPS-83|MRC5-derived iPS cells| MRC5由来iPS細胞| human ES-... SKIP000494 ... fetal lung fibroblast 胎児肺線維芽細胞 Unknown MRC-iPS-83 MRC-iPS-83 Snake ....2010.01459.x--10.1371/journal.pgen.1002085 Lectin microarray analysis of pluripotent and multipotent stem cell...s.--DNA methylation dynamics in human induced pluripotent stem cells over time. Toyoda M, Yamazaki-Inoue ....gov/pubmed/21155951--http://www.ncbi.nlm.nih.gov/pubmed/21637780 -- Some of clones of the same original cells have been used in the papers.

  3. Stemcell Information: SKIP000498 [SKIP Stemcell Database[Archive

    Lifescience Database Archive (English)

    Full Text Available y Diggity ... Fetus Unknown ... -- No MRC-iPS-86|MRC5-derived iPS cells| MRC5由来iPS細胞| human ES-like R... SKIP000498 ... fetal lung fibroblast 胎児肺線維芽細胞 Unknown MRC-iPS-86 MRC-iPS-86 Diggit...01459.x--10.1371/journal.pgen.1002085 Lectin microarray analysis of pluripotent and multipotent stem cells.-...-DNA methylation dynamics in human induced pluripotent stem cells over time. Toyoda M, Yamazaki-Inoue M, Ita...ubmed/21155951--http://www.ncbi.nlm.nih.gov/pubmed/21637780 -- Some of clones of the same original cells have been used in the papers.

  4. Stemcell Information: SKIP000433 [SKIP Stemcell Database[Archive

    Lifescience Database Archive (English)

    Full Text Available pper Gobstopper ... Fetus Unknown ... -- No MRC-iPS-21|MRC5-derived iPS cells| MRC5由来iPS細胞| human ES-... SKIP000433 ... fetal lung fibroblast 胎児肺線維芽細胞 Unknown MRC-iPS-21 MRC-iPS-21 Gobsto....2010.01459.x--10.1371/journal.pgen.1002085 Lectin microarray analysis of pluripotent and multipotent stem cell...s.--DNA methylation dynamics in human induced pluripotent stem cells over time. Toyoda M, Yamazaki-Inoue ....gov/pubmed/21155951--http://www.ncbi.nlm.nih.gov/pubmed/21637780 -- Some of clones of the same original cells have been used in the papers.

  5. Stemcell Information: SKIP000478 [SKIP Stemcell Database[Archive

    Lifescience Database Archive (English)

    Full Text Available g ... Fetus Unknown ... -- No MRC-iPS-66|MRC5-derived iPS cells| MRC5由来iPS細胞| human ES-like Research ... SKIP000478 ... fetal lung fibroblast 胎児肺線維芽細胞 Unknown MRC-iPS-66 MRC-iPS-66 Tug Tu...-10.1371/journal.pgen.1002085 Lectin microarray analysis of pluripotent and multipotent stem cells.--DNA met...hylation dynamics in human induced pluripotent stem cells over time. Toyoda M, Yamazaki-Inoue M, Itakura Y, ...155951--http://www.ncbi.nlm.nih.gov/pubmed/21637780 -- Some of clones of the same original cells have been used in the papers.

  6. Stemcell Information: SKIP000457 [SKIP Stemcell Database[Archive

    Lifescience Database Archive (English)

    Full Text Available s Jimmies ... Fetus Unknown ... -- No MRC-iPS-45|MRC5-derived iPS cells| MRC5由来iPS細胞| human ES-like R... SKIP000457 ... fetal lung fibroblast 胎児肺線維芽細胞 Unknown MRC-iPS-45 MRC-iPS-45 Jimmie...01459.x--10.1371/journal.pgen.1002085 Lectin microarray analysis of pluripotent and multipotent stem cells.-...-DNA methylation dynamics in human induced pluripotent stem cells over time. Toyoda M, Yamazaki-Inoue M, Ita...ubmed/21155951--http://www.ncbi.nlm.nih.gov/pubmed/21637780 -- Some of clones of the same original cells have been used in the papers.

  7. Stemcell Information: SKIP000437 [SKIP Stemcell Database[Archive

    Lifescience Database Archive (English)

    Full Text Available c ... Fetus Unknown ... -- No MRC-iPS-25|MRC5-derived iPS cells| MRC5由来iPS細胞| human ES-like Research ... SKIP000437 ... fetal lung fibroblast 胎児肺線維芽細胞 Unknown MRC-iPS-25 MRC-iPS-25 Tic Ti...-10.1371/journal.pgen.1002085 Lectin microarray analysis of pluripotent and multipotent stem cells.--DNA met...hylation dynamics in human induced pluripotent stem cells over time. Toyoda M, Yamazaki-Inoue M, Itakura Y, ...155951--http://www.ncbi.nlm.nih.gov/pubmed/21637780 -- Some of clones of the same original cells have been used in the papers.

  8. Stemcell Information: SKIP000444 [SKIP Stemcell Database[Archive

    Lifescience Database Archive (English)

    Full Text Available b ... Fetus Unknown ... -- No MRC-iPS-32|MRC5-derived iPS cells| MRC5由来iPS細胞| human ES-like Research ... SKIP000444 ... fetal lung fibroblast 胎児肺線維芽細胞 Unknown MRC-iPS-32 MRC-iPS-32 Bob Bo....pgen.1002085 Lectin microarray analysis of pluripotent and multipotent stem cells.--DNA methylation dynamic...s in human induced pluripotent stem cells over time. Toyoda M, Yamazaki-Inoue M, Itakura Y, Kuno A, Ogawa T,...ww.ncbi.nlm.nih.gov/pubmed/21637780 -- Some of clones of the same original cells have been used in the papers.

  9. A novel class of fungal lipoxygenases

    NARCIS (Netherlands)

    Heshof, R.; Jylhä, S.; Haarmann, T.; Jørgensen, A.L.W.; Dalsgaard, T.K.; Graaff, de L.H.

    2014-01-01

    Lipoxygenases (LOXs) are well-studied enzymes in plants and mammals. However, fungal LOXs are less studied. In this study, we have compared fungal LOX protein sequences to all known characterized LOXs. For this, a script was written using Shell commands to extract sequences from the NCBI database

  10. Download this PDF file

    African Journals Online (AJOL)

    AISA

    MATERIALS AND METHODS. NEMATODE COLLECTION AND EXTRACTION ... of the PCR-product cut out of gel were performed according to the manufacturer's instructions1. All samples ... available in database of NCBI. (Genbank). 1Wizard SV Gel and PCR Clean-Up System, Promega Corporation, Madison USA, 2009 ...

  11. Database Description - PSCDB | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available abase Description General information of database Database name PSCDB Alternative n...rial Science and Technology (AIST) Takayuki Amemiya E-mail: Database classification Structure Databases - Protein structure Database...554-D558. External Links: Original website information Database maintenance site Graduate School of Informat...available URL of Web services - Need for user registration Not available About This Database Database Descri...ption Download License Update History of This Database Site Policy | Contact Us Database Description - PSCDB | LSDB Archive ...

  12. Database Description - ASTRA | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available abase Description General information of database Database name ASTRA Alternative n...tics Journal Search: Contact address Database classification Nucleotide Sequence Databases - Gene structure,...3702 Taxonomy Name: Oryza sativa Taxonomy ID: 4530 Database description The database represents classified p...(10):1211-6. External Links: Original website information Database maintenance site National Institute of Ad... for user registration Not available About This Database Database Description Dow

  13. Online Mendelian Inheritance in Man (OMIM).

    Science.gov (United States)

    Hamosh, A; Scott, A F; Amberger, J; Valle, D; McKusick, V A

    2000-01-01

    Online Mendelian Inheritance In Man (OMIM) is a public database of bibliographic information about human genes and genetic disorders. Begun by Dr. Victor McKusick as the authoritative reference Mendelian Inheritance in Man, it is now distributed electronically by the National Center for Biotechnology Information (NCBI). Material in OMIM is derived from the biomedical literature and is written by Dr. McKusick and his colleagues at Johns Hopkins University and elsewhere. Each OMIM entry has a full text summary of a genetic phenotype and/or gene and has copious links to other genetic resources such as DNA and protein sequence, PubMed references, mutation databases, approved gene nomenclature, and more. In addition, NCBI's neighboring feature allows users to identify related articles from PubMed selected on the basis of key words in the OMIM entry. Through its many features, OMIM is increasingly becoming a major gateway for clinicians, students, and basic researchers to the ever-growing literature and resources of human genetics. Copyright 2000 Wiley-Liss, Inc.

  14. Database Description - RPD | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available ase Description General information of database Database name RPD Alternative name Rice Proteome Database...titute of Crop Science, National Agriculture and Food Research Organization Setsuko Komatsu E-mail: Database... classification Proteomics Resources Plant databases - Rice Organism Taxonomy Name: Oryza sativa Taxonomy ID: 4530 Database... description Rice Proteome Database contains information on protei...and entered in the Rice Proteome Database. The database is searchable by keyword,

  15. Database Description - PLACE | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available abase Description General information of database Database name PLACE Alternative name A Database...Kannondai, Tsukuba, Ibaraki 305-8602, Japan National Institute of Agrobiological Sciences E-mail : Databas...e classification Plant databases Organism Taxonomy Name: Tracheophyta Taxonomy ID: 58023 Database...99, Vol.27, No.1 :297-300 External Links: Original website information Database maintenance site National In...- Need for user registration Not available About This Database Database Descripti

  16. Database Description - JSNP | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available base Description General information of database Database name JSNP Alternative nam...n Science and Technology Agency Creator Affiliation: Contact address E-mail : Database...sapiens Taxonomy ID: 9606 Database description A database of about 197,000 polymorphisms in Japanese populat...1):605-610 External Links: Original website information Database maintenance site Institute of Medical Scien...er registration Not available About This Database Database Description Download License Update History of This Database

  17. Database Description - RED | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available ase Description General information of database Database name RED Alternative name Rice Expression Database...enome Research Unit Shoshi Kikuchi E-mail : Database classification Plant databases - Rice Database classifi...cation Microarray, Gene Expression Organism Taxonomy Name: Oryza sativa Taxonomy ID: 4530 Database descripti... Article title: Rice Expression Database: the gateway to rice functional genomics...nt Science (2002) Dec 7 (12):563-564 External Links: Original website information Database maintenance site

  18. Database Description - ConfC | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available abase Description General information of database Database name ConfC Alternative name Database...amotsu Noguchi Tel: 042-495-8736 E-mail: Database classification Structure Database...s - Protein structure Structure Databases - Small molecules Structure Databases - Nucleic acid structure Database... services - Need for user registration - About This Database Database Description Download License Update History of This Database... Site Policy | Contact Us Database Description - ConfC | LSDB Archive ...

  19. Database management systems understanding and applying database technology

    CERN Document Server

    Gorman, Michael M

    1991-01-01

    Database Management Systems: Understanding and Applying Database Technology focuses on the processes, methodologies, techniques, and approaches involved in database management systems (DBMSs).The book first takes a look at ANSI database standards and DBMS applications and components. Discussion focus on application components and DBMS components, implementing the dynamic relationship application, problems and benefits of dynamic relationship DBMSs, nature of a dynamic relationship application, ANSI/NDL, and DBMS standards. The manuscript then ponders on logical database, interrogation, and phy

  20. Database Description - RMG | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available ase Description General information of database Database name RMG Alternative name ...raki 305-8602, Japan National Institute of Agrobiological Sciences E-mail : Database... classification Nucleotide Sequence Databases Organism Taxonomy Name: Oryza sativa Japonica Group Taxonomy ID: 39947 Database...rnal: Mol Genet Genomics (2002) 268: 434–445 External Links: Original website information Database...available URL of Web services - Need for user registration Not available About This Database Database Descri

  1. Proteomic analysis of human oral verrucous carcinoma | Wang ...

    African Journals Online (AJOL)

    Peptide mass fingerprints (PMFs) obtained by the MALDI-TOF analysis were applied to National Center for Biotechnology Information (NCBI), SWISS-PROT and MSDB databases using Mascot software. Then the 2-DE gel imaging showed that 74, 36 and 31 differential protein spots were found between OVC and OSCC, ...

  2. Evaluation of Three Automated Genome Annotations for Halorhabdus utahensis

    DEFF Research Database (Denmark)

    Bakke, Peter; Carney, Nick; DeLoache, Will

    2009-01-01

    in databases such as NCBI and used to validate subsequent annotation errors. We submitted the genome sequence of halophilic archaeon Halorhabdus utahensis to be analyzed by three genome annotation services. We have examined the output from each service in a variety of ways in order to compare the methodology...

  3. Relational databases

    CERN Document Server

    Bell, D A

    1986-01-01

    Relational Databases explores the major advances in relational databases and provides a balanced analysis of the state of the art in relational databases. Topics covered include capture and analysis of data placement requirements; distributed relational database systems; data dependency manipulation in database schemata; and relational database support for computer graphics and computer aided design. This book is divided into three sections and begins with an overview of the theory and practice of distributed systems, using the example of INGRES from Relational Technology as illustration. The

  4. Database Description - DGBY | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available base Description General information of database Database name DGBY Alternative name Database...EL: +81-29-838-8066 E-mail: Database classification Microarray Data and other Gene Expression Databases Orga...nism Taxonomy Name: Saccharomyces cerevisiae Taxonomy ID: 4932 Database descripti...-called phenomics). We uploaded these data on this website which is designated DGBY(Database for Gene expres...ma J, Ando A, Takagi H. Journal: Yeast. 2008 Mar;25(3):179-90. External Links: Original website information Database

  5. Database Description - KOME | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available base Description General information of database Database name KOME Alternative nam... Sciences Plant Genome Research Unit Shoshi Kikuchi E-mail : Database classification Plant databases - Rice ...Organism Taxonomy Name: Oryza sativa Taxonomy ID: 4530 Database description Information about approximately ...Hayashizaki Y, Kikuchi S. Journal: PLoS One. 2007 Nov 28; 2(11):e1235. External Links: Original website information Database...OS) Rice mutant panel database (Tos17) A Database of Plant Cis-acting Regulatory

  6. Oligonucleic Acid Drug List: monrd0025 [Oligonucleic Acid Drug Database[Archive

    Lifescience Database Archive (English)

    Full Text Available com/kynamro-drug.htm, http://www.kegg.jp/dbget-bin/www_bget?D08946, https://www.clinicaltrialsregister.eu/ct...r-search/trial/2004-003934-32/DE, https://www.clinicaltrialsregister.eu/ctr-searc...h/trial/2005-003449-15/GB, http://www.ncbi.nlm.nih.gov/pubmed/21210756 https://www.clinicaltrialsregister.eu.../ctr-search/trial/2005-003450-10/GB, https://www.clinicaltrialsregister.eu/ctr-search/trial/2007-005140-24/N...L, https://www.clinicaltrialsregister.eu/ctr-search/trial/2011-001480-42/ES, https://www.clinicaltrialsreg

  7. Databases

    Directory of Open Access Journals (Sweden)

    Nick Ryan

    2004-01-01

    Full Text Available Databases are deeply embedded in archaeology, underpinning and supporting many aspects of the subject. However, as well as providing a means for storing, retrieving and modifying data, databases themselves must be a result of a detailed analysis and design process. This article looks at this process, and shows how the characteristics of data models affect the process of database design and implementation. The impact of the Internet on the development of databases is examined, and the article concludes with a discussion of a range of issues associated with the recording and management of archaeological data.

  8. A framework for organizing cancer-related variations from existing databases, publications and NGS data using a High-performance Integrated Virtual Environment (HIVE).

    Science.gov (United States)

    Wu, Tsung-Jung; Shamsaddini, Amirhossein; Pan, Yang; Smith, Krista; Crichton, Daniel J; Simonyan, Vahan; Mazumder, Raja

    2014-01-01

    Years of sequence feature curation by UniProtKB/Swiss-Prot, PIR-PSD, NCBI-CDD, RefSeq and other database biocurators has led to a rich repository of information on functional sites of genes and proteins. This information along with variation-related annotation can be used to scan human short sequence reads from next-generation sequencing (NGS) pipelines for presence of non-synonymous single-nucleotide variations (nsSNVs) that affect functional sites. This and similar workflows are becoming more important because thousands of NGS data sets are being made available through projects such as The Cancer Genome Atlas (TCGA), and researchers want to evaluate their biomarkers in genomic data. BioMuta, an integrated sequence feature database, provides a framework for automated and manual curation and integration of cancer-related sequence features so that they can be used in NGS analysis pipelines. Sequence feature information in BioMuta is collected from the Catalogue of Somatic Mutations in Cancer (COSMIC), ClinVar, UniProtKB and through biocuration of information available from publications. Additionally, nsSNVs identified through automated analysis of NGS data from TCGA are also included in the database. Because of the petabytes of data and information present in NGS primary repositories, a platform HIVE (High-performance Integrated Virtual Environment) for storing, analyzing, computing and curating NGS data and associated metadata has been developed. Using HIVE, 31 979 nsSNVs were identified in TCGA-derived NGS data from breast cancer patients. All variations identified through this process are stored in a Curated Short Read archive, and the nsSNVs from the tumor samples are included in BioMuta. Currently, BioMuta has 26 cancer types with 13 896 small-scale and 308 986 large-scale study-derived variations. Integration of variation data allows identifications of novel or common nsSNVs that can be prioritized in validation studies. Database URL: BioMuta: http

  9. Database Description - SSBD | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available base Description General information of database Database name SSBD Alternative nam...ss 2-2-3 Minatojima-minamimachi, Chuo-ku, Kobe 650-0047, Japan, RIKEN Quantitative Biology Center Shuichi Onami E-mail: Database... classification Other Molecular Biology Databases Database classification Dynamic databa...elegans Taxonomy ID: 6239 Taxonomy Name: Escherichia coli Taxonomy ID: 562 Database description Systems Scie...i Onami Journal: Bioinformatics/April, 2015/Volume 31, Issue 7 External Links: Original website information Database

  10. Database Description - GETDB | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available abase Description General information of database Database name GETDB Alternative n...ame Gal4 Enhancer Trap Insertion Database DOI 10.18908/lsdba.nbdc00236-000 Creator Creator Name: Shigeo Haya... Chuo-ku, Kobe 650-0047 Tel: +81-78-306-3185 FAX: +81-78-306-3183 E-mail: Database classification Expression... Invertebrate genome database Organism Taxonomy Name: Drosophila melanogaster Taxonomy ID: 7227 Database des...riginal website information Database maintenance site Drosophila Genetic Resource

  11. JICST Factual DatabaseJICST Chemical Substance Safety Regulation Database

    Science.gov (United States)

    Abe, Atsushi; Sohma, Tohru

    JICST Chemical Substance Safety Regulation Database is based on the Database of Safety Laws for Chemical Compounds constructed by Japan Chemical Industry Ecology-Toxicology & Information Center (JETOC) sponsored by the Sience and Technology Agency in 1987. JICST has modified JETOC database system, added data and started the online service through JOlS-F (JICST Online Information Service-Factual database) in January 1990. JICST database comprises eighty-three laws and fourteen hundred compounds. The authors outline the database, data items, files and search commands. An example of online session is presented.

  12. DAVID Knowledgebase: a gene-centered database integrating heterogeneous gene annotation resources to facilitate high-throughput gene functional analysis

    Directory of Open Access Journals (Sweden)

    Baseler Michael W

    2007-11-01

    Full Text Available Abstract Background Due to the complex and distributed nature of biological research, our current biological knowledge is spread over many redundant annotation databases maintained by many independent groups. Analysts usually need to visit many of these bioinformatics databases in order to integrate comprehensive annotation information for their genes, which becomes one of the bottlenecks, particularly for the analytic task associated with a large gene list. Thus, a highly centralized and ready-to-use gene-annotation knowledgebase is in demand for high throughput gene functional analysis. Description The DAVID Knowledgebase is built around the DAVID Gene Concept, a single-linkage method to agglomerate tens of millions of gene/protein identifiers from a variety of public genomic resources into DAVID gene clusters. The grouping of such identifiers improves the cross-reference capability, particularly across NCBI and UniProt systems, enabling more than 40 publicly available functional annotation sources to be comprehensively integrated and centralized by the DAVID gene clusters. The simple, pair-wise, text format files which make up the DAVID Knowledgebase are freely downloadable for various data analysis uses. In addition, a well organized web interface allows users to query different types of heterogeneous annotations in a high-throughput manner. Conclusion The DAVID Knowledgebase is designed to facilitate high throughput gene functional analysis. For a given gene list, it not only provides the quick accessibility to a wide range of heterogeneous annotation data in a centralized location, but also enriches the level of biological information for an individual gene. Moreover, the entire DAVID Knowledgebase is freely downloadable or searchable at http://david.abcc.ncifcrf.gov/knowledgebase/.

  13. Database Description - KAIKOcDNA | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available List Contact us KAIKOcDNA Database Description General information of database Database name KAIKOcDNA Alter...National Institute of Agrobiological Sciences Akiya Jouraku E-mail : Database cla...ssification Nucleotide Sequence Databases Organism Taxonomy Name: Bombyx mori Taxonomy ID: 7091 Database des...rnal: G3 (Bethesda) / 2013, Sep / vol.9 External Links: Original website information Database maintenance si...available URL of Web services - Need for user registration Not available About This Database Database

  14. Download - Trypanosomes Database | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available List Contact us Trypanosomes Database Download First of all, please read the license of this database. Data ...1.4 KB) Simple search and download Downlaod via FTP FTP server is sometimes jammed. If it is, access [here]. About This Database Data...base Description Download License Update History of This Database Site Policy | Contact Us Download - Trypanosomes Database | LSDB Archive ...

  15. License - Arabidopsis Phenome Database | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available List Contact us Arabidopsis Phenome Database License License to Use This Database Last updated : 2017/02/27 You may use this database...cense specifies the license terms regarding the use of this database and the requirements you must follow in using this database.... The license for this database is specified in the Creative ...Commons Attribution-Share Alike 4.0 International . If you use data from this database, please be sure attribute this database...ative Commons Attribution-Share Alike 4.0 International is found here . With regard to this database, you ar

  16. Database Description - AcEST | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available abase Description General information of database Database name AcEST Alternative n...hi, Tokyo-to 192-0397 Tel: +81-42-677-1111(ext.3654) E-mail: Database classificat...eneris Taxonomy ID: 13818 Database description This is a database of EST sequences of Adiantum capillus-vene...(3): 223-227. External Links: Original website information Database maintenance site Plant Environmental Res...base Database Description Download License Update History of This Database Site Policy | Contact Us Database Description - AcEST | LSDB Archive ...

  17. License - SKIP Stemcell Database | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available List Contact us SKIP Stemcell Database License License to Use This Database Last updated : 2017/03/13 You may use this database...specifies the license terms regarding the use of this database and the requirements you must follow in using this database.... The license for this database is specified in the Creative Common...s Attribution-Share Alike 4.0 International . If you use data from this database, please be sure attribute this database...al ... . The summary of the Creative Commons Attribution-Share Alike 4.0 International is found here . With regard to this database

  18. KALIMER database development

    Energy Technology Data Exchange (ETDEWEB)

    Jeong, Kwan Seong; Lee, Yong Bum; Jeong, Hae Yong; Ha, Kwi Seok

    2003-03-01

    KALIMER database is an advanced database to utilize the integration management for liquid metal reactor design technology development using Web applications. KALIMER design database is composed of results database, Inter-Office Communication (IOC), 3D CAD database, and reserved documents database. Results database is a research results database during all phase for liquid metal reactor design technology development of mid-term and long-term nuclear R and D. IOC is a linkage control system inter sub project to share and integrate the research results for KALIMER. 3D CAD database is a schematic overview for KALIMER design structure. And reserved documents database is developed to manage several documents and reports since project accomplishment.

  19. KALIMER database development

    International Nuclear Information System (INIS)

    Jeong, Kwan Seong; Lee, Yong Bum; Jeong, Hae Yong; Ha, Kwi Seok

    2003-03-01

    KALIMER database is an advanced database to utilize the integration management for liquid metal reactor design technology development using Web applications. KALIMER design database is composed of results database, Inter-Office Communication (IOC), 3D CAD database, and reserved documents database. Results database is a research results database during all phase for liquid metal reactor design technology development of mid-term and long-term nuclear R and D. IOC is a linkage control system inter sub project to share and integrate the research results for KALIMER. 3D CAD database is a schematic overview for KALIMER design structure. And reserved documents database is developed to manage several documents and reports since project accomplishment

  20. Database Description - RPSD | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available base Description General information of database Database name RPSD Alternative nam...e Rice Protein Structure Database DOI 10.18908/lsdba.nbdc00749-000 Creator Creator Name: Toshimasa Yamazaki ... Ibaraki 305-8602, Japan National Institute of Agrobiological Sciences Toshimasa Yamazaki E-mail : Databas...e classification Structure Databases - Protein structure Organism Taxonomy Name: Or...or name(s): Journal: External Links: Original website information Database maintenance site National Institu

  1. Database Description - FANTOM5 | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available List Contact us FANTOM5 Database Description General information of database Database name FANTOM5 Alternati...me: Rattus norvegicus Taxonomy ID: 10116 Taxonomy Name: Macaca mulatta Taxonomy ID: 9544 Database descriptio...l Links: Original website information Database maintenance site RIKEN Center for Life Science Technologies, ...ilable Web services Not available URL of Web services - Need for user registration Not available About This Database Database... Description Download License Update History of This Database Site Policy | Contact Us Database Description - FANTOM5 | LSDB Archive ...

  2. NoSQL databases

    OpenAIRE

    Mrozek, Jakub

    2012-01-01

    This thesis deals with database systems referred to as NoSQL databases. In the second chapter, I explain basic terms and the theory of database systems. A short explanation is dedicated to database systems based on the relational data model and the SQL standardized query language. Chapter Three explains the concept and history of the NoSQL databases, and also presents database models, major features and the use of NoSQL databases in comparison with traditional database systems. In the fourth ...

  3. Influence of capillary barrier effect on biogas distribution at the base of passive methane oxidation biosystems: Parametric study.

    Science.gov (United States)

    Ahoughalandari, Bahar; Cabral, Alexandre R

    2017-05-01

    The efficiency of methane oxidation in passive methane oxidation biosystems (PMOBs) is influenced by, among other things, the intensity and distribution of the CH 4 loading at the base of the methane oxidation layer (MOL). Both the intensity and distribution are affected by the capillary barrier that results from the superposition of the two materials constituting the PMOB, namely the MOL and the gas distribution layer (GDL). The effect of capillary barriers on the unsaturated flow of water has been well documented in the literature. However, its effect on gas flow through PMOBs is still poorly documented. In this study, sets of numerical simulations were performed to evaluate the effect of unsaturated hydraulic characteristics of the MOL material on the value and distribution of moisture and hence, the ease and uniformity in the distribution of the upward flow of biogas along the GDL-MOL interface. The unsaturated hydraulic parameters of the materials used to construct the experimental field plot at the St-Nicephore landfill (Quebec, Canada) were adopted to build the reference simulation of the parametric study. The behavior of the upward flow of biogas for this particular material was analyzed based on its gas intrinsic permeability function, which was obtained in the laboratory. The parameters that most influenced the distribution and the ease of biogas flow at the base of the MOL were the saturated hydraulic conductivity and pore size distribution of the MOL material, whose effects were intensified as the slope of the interface increased. The effect of initial dry density was also assessed herein. Selection of the MOL material must be made bearing in mind that these three parameters are key in the effort to prevent unwanted restriction in the upward flow of biogas, which may result in the redirection of biogas towards the top of the slope, leading to high CH 4 fluxes (hotspots). In a well-designed PMOB, upward flow of biogas across the GDL-MOL interface is

  4. Evolution of the RNase P RNA structural domain in Leptospira spp

    NARCIS (Netherlands)

    Ravishankar, Vigneshwaran; Ahmed, Ahmed; Sivagnanam, Ulaganathan; Muthuraman, Krishnaraja; Karthikaichamy, Anbarasu; Wilson, Herald A.; Devendran, Ajay; Hartskeerl, Rudy A.; Raj, Stephen M. L.

    2014-01-01

    We have employed the RNase P RNA (RPR) gene, which is present as single copy in chromosome I of Leptospira spp. to investigate the phylogeny of structural domains present in the RNA subunit of the tRNA processing enzyme, RNase P. RPR gene sequences of 150 strains derived from NCBI database along

  5. Reconciled Rat and Human Metabolic Networks for Comparative Toxicogenomics and Biomarker Predictions

    Science.gov (United States)

    2017-02-08

    reconstructions for comparative systems analysis. PLoS Comput. Biol. 7, e1001116 (2011). 26. Bartell, J. A., Yen, P., Varga, J. J., Goldberg , J. B. & Papin, J. A...Rat Genome Database 2015: genomic, phenotypic and environmental variations and disease. Nucleic Acids Res. 43, D743–D750 (2015). 34. NCBI Resource

  6. Database Description - DMPD | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available base Description General information of database Database name DMPD Alternative nam...e Dynamic Macrophage Pathway CSML Database DOI 10.18908/lsdba.nbdc00558-000 Creator Creator Name: Masao Naga...ty of Tokyo 4-6-1 Shirokanedai, Minato-ku, Tokyo 108-8639 Tel: +81-3-5449-5615 FAX: +83-3-5449-5442 E-mail: Database...606 Taxonomy Name: Mammalia Taxonomy ID: 40674 Database description DMPD collects...e(s) Article title: Author name(s): Journal: External Links: Original website information Database maintenan

  7. Database Dump - fRNAdb | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available List Contact us fRNAdb Database Dump Data detail Data name Database Dump DOI 10.18908/lsdba.nbdc00452-002 De... data (tab separeted text) Data file File name: Database_Dump File URL: ftp://ftp....biosciencedbc.jp/archive/frnadb/LATEST/Database_Dump File size: 673 MB Simple search URL - Data acquisition...s. Data analysis method - Number of data entries 4 files - About This Database Database Description Download... License Update History of This Database Site Policy | Contact Us Database Dump - fRNAdb | LSDB Archive ...

  8. DOT Online Database

    Science.gov (United States)

    Page Home Table of Contents Contents Search Database Search Login Login Databases Advisory Circulars accessed by clicking below: Full-Text WebSearch Databases Database Records Date Advisory Circulars 2092 5 data collection and distribution policies. Document Database Website provided by MicroSearch

  9. Databases

    Digital Repository Service at National Institute of Oceanography (India)

    Kunte, P.D.

    Information on bibliographic as well as numeric/textual databases relevant to coastal geomorphology has been included in a tabular form. Databases cover a broad spectrum of related subjects like coastal environment and population aspects, coastline...

  10. Greenhouse gas (GHG) emission in organic farming. Approximate quantification of its generation at the organic garden of the School of Agricultural, Food and Biosystems Engineering (ETSIAAB) in the Technical University of Madrid (UPM)

    Science.gov (United States)

    Campos, Jorge; Barbado, Elena; Maldonado, Mariano; Andreu, Gemma; López de Fuentes, Pilar

    2016-04-01

    As it well-known, agricultural soil fertilization increases the rate of greenhouse gas (GHG) emission production such as CO2, CH4 and N2O. Participation share of this activity on the climate change is currently under study, as well as the mitigation possibilities. In this context, we considered that it would be interesting to know how this share is in the case of organic farming. In relation to this, a field experiment was carried out at the organic garden of the School of Agricultural, Food and Biosystems Engineering (ETSIAAB) in the Technical University of Madrid (UPM). The orchard included different management growing areas, corresponding to different schools of organic farming. Soil and gas samples were taken from these different sites. Gas samples were collected throughout the growing season from an accumulated atmosphere inside static chambers inserted into the soil. Then, these samples were carried to the laboratory and there analyzed. The results obtained allow knowing approximately how ecological fertilization contributes to air pollution due to greenhouse gases.

  11. Database Description - eSOL | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available base Description General information of database Database name eSOL Alternative nam...eator Affiliation: The Research and Development of Biological Databases Project, National Institute of Genet...nology 4259 Nagatsuta-cho, Midori-ku, Yokohama, Kanagawa 226-8501 Japan Email: Tel.: +81-45-924-5785 Database... classification Protein sequence databases - Protein properties Organism Taxonomy Name: Escherichia coli Taxonomy ID: 562 Database...i U S A. 2009 Mar 17;106(11):4201-6. External Links: Original website information Database maintenance site

  12. gb4gv: a genome browser for geminivirus

    Directory of Open Access Journals (Sweden)

    Eric S. Ho

    2017-04-01

    Full Text Available Background Geminiviruses (family Geminiviridae are prevalent plant viruses that imperil agriculture globally, causing serious damage to the livelihood of farmers, particularly in developing countries. The virus evolves rapidly, attributing to its single-stranded genome propensity, resulting in worldwide circulation of diverse and viable genomes. Genomics is a prominent approach taken by researchers in elucidating the infectious mechanism of the virus. Currently, the NCBI Viral Genome website is a popular repository of viral genomes that conveniently provides researchers a centralized data source of genomic information. However, unlike the genome of living organisms, viral genomes most often maintain peculiar characteristics that fit into no single genome architecture. By imposing a unified annotation scheme on the myriad of viral genomes may downplay their hallmark features. For example, the viron of begomoviruses prevailing in America encapsulates two similar-sized circular DNA components and both are required for systemic infection of plants. However, the bipartite components are kept separately in NCBI as individual genomes with no explicit association in linking them. Thus, our goal is to build a comprehensive Geminivirus genomics database, namely gb4gv, that not only preserves genomic characteristics of the virus, but also supplements biologically relevant annotations that help to interrogate this virus, for example, the targeted host, putative iterons, siRNA targets, etc. Methods We have employed manual and automatic methods to curate 508 genomes from four major genera of Geminiviridae, and 161 associated satellites obtained from NCBI RefSeq and PubMed databases. Results These data are available for free access without registration from our website. Besides genomic content, our website provides visualization capability inherited from UCSC Genome Browser. Discussion With the genomic information readily accessible, we hope that our database

  13. "Mr. Database" : Jim Gray and the History of Database Technologies.

    Science.gov (United States)

    Hanwahr, Nils C

    2017-12-01

    Although the widespread use of the term "Big Data" is comparatively recent, it invokes a phenomenon in the developments of database technology with distinct historical contexts. The database engineer Jim Gray, known as "Mr. Database" in Silicon Valley before his disappearance at sea in 2007, was involved in many of the crucial developments since the 1970s that constitute the foundation of exceedingly large and distributed databases. Jim Gray was involved in the development of relational database systems based on the concepts of Edgar F. Codd at IBM in the 1970s before he went on to develop principles of Transaction Processing that enable the parallel and highly distributed performance of databases today. He was also involved in creating forums for discourse between academia and industry, which influenced industry performance standards as well as database research agendas. As a co-founder of the San Francisco branch of Microsoft Research, Gray increasingly turned toward scientific applications of database technologies, e. g. leading the TerraServer project, an online database of satellite images. Inspired by Vannevar Bush's idea of the memex, Gray laid out his vision of a Personal Memex as well as a World Memex, eventually postulating a new era of data-based scientific discovery termed "Fourth Paradigm Science". This article gives an overview of Gray's contributions to the development of database technology as well as his research agendas and shows that central notions of Big Data have been occupying database engineers for much longer than the actual term has been in use.

  14. Mathematics for Databases

    NARCIS (Netherlands)

    ir. Sander van Laar

    2007-01-01

    A formal description of a database consists of the description of the relations (tables) of the database together with the constraints that must hold on the database. Furthermore the contents of a database can be retrieved using queries. These constraints and queries for databases can very well be

  15. Common contaminants in next-generation sequencing that hinder discovery of low-abundance microbes.

    Directory of Open Access Journals (Sweden)

    Martin Laurence

    Full Text Available Unbiased high-throughput sequencing of whole metagenome shotgun DNA libraries is a promising new approach to identifying microbes in clinical specimens, which, unlike other techniques, is not limited to known sequences. Unlike most sequencing applications, it is highly sensitive to laboratory contaminants as these will appear to originate from the clinical specimens. To assess the extent and diversity of sequence contaminants, we aligned 57 "1000 Genomes Project" sequencing runs from six centers against the four largest NCBI BLAST databases, detecting reads of diverse contaminant species in all runs and identifying the most common of these contaminant genera (Bradyrhizobium in assembled genomes from the NCBI Genome database. Many of these microorganisms have been reported as contaminants of ultrapure water systems. Studies aiming to identify novel microbes in clinical specimens will greatly benefit from not only preventive measures such as extensive UV irradiation of water and cross-validation using independent techniques, but also a concerted effort to sequence the complete genomes of common contaminants so that they may be subtracted computationally.

  16. MetaRNA-Seq: An Interactive Tool to Browse and Annotate Metadata from RNA-Seq Studies

    Directory of Open Access Journals (Sweden)

    Pankaj Kumar

    2015-01-01

    Full Text Available The number of RNA-Seq studies has grown in recent years. The design of RNA-Seq studies varies from very simple (e.g., two-condition case-control to very complicated (e.g., time series involving multiple samples at each time point with separate drug treatments. Most of these publically available RNA-Seq studies are deposited in NCBI databases, but their metadata are scattered throughout four different databases: Sequence Read Archive (SRA, Biosample, Bioprojects, and Gene Expression Omnibus (GEO. Although the NCBI web interface is able to provide all of the metadata information, it often requires significant effort to retrieve study- or project-level information by traversing through multiple hyperlinks and going to another page. Moreover, project- and study-level metadata lack manual or automatic curation by categories, such as disease type, time series, case-control, or replicate type, which are vital to comprehending any RNA-Seq study. Here we describe “MetaRNA-Seq,” a new tool for interactively browsing, searching, and annotating RNA-Seq metadata with the capability of semiautomatic curation at the study level.

  17. Database development and management

    CERN Document Server

    Chao, Lee

    2006-01-01

    Introduction to Database Systems Functions of a DatabaseDatabase Management SystemDatabase ComponentsDatabase Development ProcessConceptual Design and Data Modeling Introduction to Database Design Process Understanding Business ProcessEntity-Relationship Data Model Representing Business Process with Entity-RelationshipModelTable Structure and NormalizationIntroduction to TablesTable NormalizationTransforming Data Models to Relational Databases .DBMS Selection Transforming Data Models to Relational DatabasesEnforcing ConstraintsCreating Database for Business ProcessPhysical Design and Database

  18. Database reliability engineering designing and operating resilient database systems

    CERN Document Server

    Campbell, Laine

    2018-01-01

    The infrastructure-as-code revolution in IT is also affecting database administration. With this practical book, developers, system administrators, and junior to mid-level DBAs will learn how the modern practice of site reliability engineering applies to the craft of database architecture and operations. Authors Laine Campbell and Charity Majors provide a framework for professionals looking to join the ranks of today’s database reliability engineers (DBRE). You’ll begin by exploring core operational concepts that DBREs need to master. Then you’ll examine a wide range of database persistence options, including how to implement key technologies to provide resilient, scalable, and performant data storage and retrieval. With a firm foundation in database reliability engineering, you’ll be ready to dive into the architecture and operations of any modern database. This book covers: Service-level requirements and risk management Building and evolving an architecture for operational visibility ...

  19. Solving Relational Database Problems with ORDBMS in an Advanced Database Course

    Science.gov (United States)

    Wang, Ming

    2011-01-01

    This paper introduces how to use the object-relational database management system (ORDBMS) to solve relational database (RDB) problems in an advanced database course. The purpose of the paper is to provide a guideline for database instructors who desire to incorporate the ORDB technology in their traditional database courses. The paper presents…

  20. Generalized Database Management System Support for Numeric Database Environments.

    Science.gov (United States)

    Dominick, Wayne D.; Weathers, Peggy G.

    1982-01-01

    This overview of potential for utilizing database management systems (DBMS) within numeric database environments highlights: (1) major features, functions, and characteristics of DBMS; (2) applicability to numeric database environment needs and user needs; (3) current applications of DBMS technology; and (4) research-oriented and…

  1. Reticulamoeba Is a Long-Branched Granofilosean (Cercozoa) That Is Missing from Sequence Databases

    Science.gov (United States)

    Bass, David; Yabuki, Akinori; Santini, Sébastien; Romac, Sarah; Berney, Cédric

    2012-01-01

    We sequenced the 18S ribosomal RNA gene of seven isolates of the enigmatic marine amoeboflagellate Reticulamoeba Grell, which resolved into four genetically distinct Reticulamoeba lineages, two of which correspond to R. gemmipara Grell and R. minor Grell, another with a relatively large cell body forming lacunae, and another that has similarities to both R. minor and R. gemmipara but with a greater propensity to form cell clusters. These lineages together form a long-branched clade that branches within the cercozoan class Granofilosea (phylum Cercozoa), showing phylogenetic affinities with the genus Mesofila. The basic morphology of Reticulamoeba is a roundish or ovoid cell with a more or less irregular outline. Long and branched reticulopodia radiate from the cell. The reticulopodia bear granules that are bidirectionally motile. There is also a biflagellate dispersal stage. Reticulamoeba is frequently observed in coastal marine environmental samples. PCR primers specific to the Reticulamoeba clade confirm that it is a frequent member of benthic marine microbial communities, and is also found in brackish water sediments and freshwater biofilm. However, so far it has not been found in large molecular datasets such as the nucleotide database in NCBI GenBank, metagenomic datasets in Camera, and the marine microbial eukaryote sampling and sequencing consortium BioMarKs, although closely related lineages can be found in some of these datasets using a highly targeted approach. Therefore, although such datasets are very powerful tools in microbial ecology, they may, for several methodological reasons, fail to detect ecologically and evolutionary key lineages. PMID:23226495

  2. License - Trypanosomes Database | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available switchLanguage; BLAST Search Image Search Home About Archive Update History Data List Contact us Trypanoso... Attribution-Share Alike 2.1 Japan . If you use data from this database, please be sure attribute this database as follows: Trypanoso...nse Update History of This Database Site Policy | Contact Us License - Trypanosomes Database | LSDB Archive ...

  3. Screening of cellular proteins that interact with the classical swine ...

    Indian Academy of Sciences (India)

    In the current study, aiming to find more clues in understanding the molecular mechanisms of CSFV NS5A's function, the yeast two-hybrid (Y2H) system was adopted to screen for CSFV NS5A interactive proteins in the cDNA library of the swine umbilical vein endothelial cell (SUVEC). Alignment with the NCBI database ...

  4. Federal databases

    International Nuclear Information System (INIS)

    Welch, M.J.; Welles, B.W.

    1988-01-01

    Accident statistics on all modes of transportation are available as risk assessment analytical tools through several federal agencies. This paper reports on the examination of the accident databases by personal contact with the federal staff responsible for administration of the database programs. This activity, sponsored by the Department of Energy through Sandia National Laboratories, is an overview of the national accident data on highway, rail, air, and marine shipping. For each mode, the definition or reporting requirements of an accident are determined and the method of entering the accident data into the database is established. Availability of the database to others, ease of access, costs, and who to contact were prime questions to each of the database program managers. Additionally, how the agency uses the accident data was of major interest

  5. The YH database: the first Asian diploid genome database

    DEFF Research Database (Denmark)

    Li, Guoqing; Ma, Lijia; Song, Chao

    2009-01-01

    genome consensus. The YH database is currently one of the three personal genome database, organizing the original data and analysis results in a user-friendly interface, which is an endeavor to achieve fundamental goals for establishing personal medicine. The database is available at http://yh.genomics.org.cn....

  6. Database Description - tRNADB-CE | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available switchLanguage; BLAST Search Image Search Home About Archive Update History Data List Contact us tRNAD...B-CE Database Description General information of database Database name tRNADB-CE Alter...CC BY-SA Detail Background and funding Name: MEXT Integrated Database Project Reference(s) Article title: tRNAD... 2009 Jan;37(Database issue):D163-8. External Links: Article title: tRNADB-CE 2011: tRNA gene database curat...n Download License Update History of This Database Site Policy | Contact Us Database Description - tRNADB-CE | LSDB Archive ...

  7. Database Administrator

    Science.gov (United States)

    Moore, Pam

    2010-01-01

    The Internet and electronic commerce (e-commerce) generate lots of data. Data must be stored, organized, and managed. Database administrators, or DBAs, work with database software to find ways to do this. They identify user needs, set up computer databases, and test systems. They ensure that systems perform as they should and add people to the…

  8. Database Description - TMFunction | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available sidue (or mutant) in a protein. The experimental data are collected from the literature both by searching th...the sequence database, UniProt, structural database, PDB, and literature database

  9. PrimateLit Database

    Science.gov (United States)

    Primate Info Net Related Databases NCRR PrimateLit: A bibliographic database for primatology Top of any problems with this service. We welcome your feedback. The PrimateLit database is no longer being Resources, National Institutes of Health. The database is a collaborative project of the Wisconsin Primate

  10. Identification and Analysis of Jasmonate Pathway Genes in Coffea canephora (Robusta Coffee) by In Silico Approach.

    Science.gov (United States)

    Bharathi, Kosaraju; Sreenath, H L

    2017-07-01

    Coffea canephora is the commonly cultivated coffee species in the world along with Coffea arabica . Different pests and pathogens affect the production and quality of the coffee. Jasmonic acid (JA) is a plant hormone which plays an important role in plants growth, development, and defense mechanisms, particularly against insect pests. The key enzymes involved in the production of JA are lipoxygenase, allene oxide synthase, allene oxide cyclase, and 12-oxo-phytodienoic reductase. There is no report on the genes involved in JA pathway in coffee plants. We made an attempt to identify and analyze the genes coding for these enzymes in C. canephora . First, protein sequences of jasmonate pathway genes from model plant Arabidopsis thaliana were identified in the National Center for Biotechnology Information (NCBI) database. These protein sequences were used to search the web-based database Coffee Genome Hub to identify homologous protein sequences in C. canephora genome using Basic Local Alignment Search Tool (BLAST). Homologous protein sequences for key genes were identified in the C. canephora genome database. Protein sequences of the top matches were in turn used to search in NCBI database using BLAST tool to confirm the identity of the selected proteins and to identify closely related genes in species. The protein sequences from C. canephora database and the top matches in NCBI were aligned, and phylogenetic trees were constructed using MEGA6 software and identified the genetic distance of the respective genes. The study identified the four key genes of JA pathway in C. canephora , confirming the conserved nature of the pathway in coffee. The study expected to be useful to further explore the defense mechanisms of coffee plants. JA is a plant hormone that plays an important role in plant defense against insect pests. Genes coding for the 4 key enzymes involved in the production of JA viz., LOX, AOS, AOC, and OPR are identified in C. canephora (robusta coffee) by

  11. High Quality Unigenes and Microsatellite Markers from Tissue Specific Transcriptome and Development of a Database in Clusterbean (Cyamopsis tetragonoloba, L. Taub

    Directory of Open Access Journals (Sweden)

    Hukam C. Rawal

    2017-11-01

    Full Text Available Clusterbean (Cyamopsis tetragonoloba L. Taub, is an important industrial, vegetable and forage crop. This crop owes its commercial importance to the presence of guar gum (galactomannans in its endosperm which is used as a lubricant in a range of industries. Despite its relevance to agriculture and industry, genomic resources available in this crop are limited. Therefore, the present study was undertaken to generate RNA-Seq based transcriptome from leaf, shoot, and flower tissues. A total of 145 million high quality Illumina reads were assembled using Trinity into 127,706 transcripts and 48,007 non-redundant high quality (HQ unigenes. We annotated 79% unigenes against Plant Genes from the National Center for Biotechnology Information (NCBI, Swiss-Prot, Pfam, gene ontology (GO and KEGG databases. Among the annotated unigenes, 30,020 were assigned with 116,964 GO terms, 9984 with EC and 6111 with 137 KEGG pathways. At different fragments per kilobase of transcript per millions fragments sequenced (FPKM levels, genes were found expressed higher in flower tissue followed by shoot and leaf. Additionally, we identified 8687 potential simple sequence repeats (SSRs with an average frequency of one SSR per 8.75 kb. A total of 28 amplified SSRs in 21 clusterbean genotypes resulted in polymorphism in 13 markers with average polymorphic information content (PIC of 0.21. We also constructed a database named ‘ClustergeneDB’ for easy retrieval of unigenes and the microsatellite markers. The tissue specific genes identified and the molecular marker resources developed in this study is expected to aid in genetic improvement of clusterbean for its end use.

  12. License - Yeast Interacting Proteins Database | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available List Contact us Yeast Interacting Proteins Database License to Use This Database Last updated : 2010/02/15 You may use this database...nal License described below. The Standard License specifies the license terms regarding the use of this database... and the requirements you must follow in using this database. The Additional ...the Standard License. Standard License The Standard License for this database is the license specified in th...e Creative Commons Attribution-Share Alike 2.1 Japan . If you use data from this database

  13. NoSQL database scaling

    OpenAIRE

    Žardin, Norbert

    2017-01-01

    NoSQL database scaling is a decision, where system resources or financial expenses are traded for database performance or other benefits. By scaling a database, database performance and resource usage might increase or decrease, such changes might have a negative impact on an application that uses the database. In this work it is analyzed how database scaling affect database resource usage and performance. As a results, calculations are acquired, using which database scaling types and differe...

  14. Detection of a Usp-like gene in Calotropis procera plant from the de novo assembled genome contigs of the high-throughput sequencing dataset

    KAUST Repository

    Shokry, Ahmed M.

    2014-02-01

    The wild plant species Calotropis procera (C. procera) has many potential applications and beneficial uses in medicine, industry and ornamental field. It also represents an excellent source of genes for drought and salt tolerance. Genes encoding proteins that contain the conserved universal stress protein (USP) domain are known to provide organisms like bacteria, archaea, fungi, protozoa and plants with the ability to respond to a plethora of environmental stresses. However, information on the possible occurrence of Usp in C. procera is not available. In this study, we uncovered and characterized a one-class A Usp-like (UspA-like, NCBI accession No. KC954274) gene in this medicinal plant from the de novo assembled genome contigs of the high-throughput sequencing dataset. A number of GenBank accessions for Usp sequences were blasted with the recovered de novo assembled contigs. Homology modelling of the deduced amino acids (NCBI accession No. AGT02387) was further carried out using Swiss-Model, accessible via the EXPASY. Superimposition of C. procera USPA-like full sequence model on Thermus thermophilus USP UniProt protein (PDB accession No. Q5SJV7) was constructed using RasMol and Deep-View programs. The functional domains of the novel USPA-like amino acids sequence were identified from the NCBI conserved domain database (CDD) that provide insights into sequence structure/function relationships, as well as domain models imported from a number of external source databases (Pfam, SMART, COG, PRK, TIGRFAM). © 2014 Académie des sciences.

  15. DataBase on Demand

    International Nuclear Information System (INIS)

    Aparicio, R Gaspar; Gomez, D; Wojcik, D; Coz, I Coterillo

    2012-01-01

    At CERN a number of key database applications are running on user-managed MySQL database services. The database on demand project was born out of an idea to provide the CERN user community with an environment to develop and run database services outside of the actual centralised Oracle based database services. The Database on Demand (DBoD) empowers the user to perform certain actions that had been traditionally done by database administrators, DBA's, providing an enterprise platform for database applications. It also allows the CERN user community to run different database engines, e.g. presently open community version of MySQL and single instance Oracle database server. This article describes a technology approach to face this challenge, a service level agreement, the SLA that the project provides, and an evolution of possible scenarios.

  16. Full Data of Yeast Interacting Proteins Database (Original Version) - Yeast Interacting Proteins Database | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available List Contact us Yeast Interacting Proteins Database Full Data of Yeast Interacting Proteins Database (Origin...al Version) Data detail Data name Full Data of Yeast Interacting Proteins Database (Original Version) DOI 10....18908/lsdba.nbdc00742-004 Description of data contents The entire data in the Yeast Interacting Proteins Database...eir interactions are required. Several sources including YPD (Yeast Proteome Database, Costanzo, M. C., Hoga...ematic name in the SGD (Saccharomyces Genome Database; http://www.yeastgenome.org /). Bait gene name The gen

  17. Energy Consumption Database

    Science.gov (United States)

    Consumption Database The California Energy Commission has created this on-line database for informal reporting ) classifications. The database also provides easy downloading of energy consumption data into Microsoft Excel (XLSX

  18. Using a Semi-Realistic Database to Support a Database Course

    Science.gov (United States)

    Yue, Kwok-Bun

    2013-01-01

    A common problem for university relational database courses is to construct effective databases for instructions and assignments. Highly simplified "toy" databases are easily available for teaching, learning, and practicing. However, they do not reflect the complexity and practical considerations that students encounter in real-world…

  19. Data Mining Supercomputing with SAS JMP® Genomics

    Directory of Open Access Journals (Sweden)

    Richard S. Segall

    2011-02-01

    Full Text Available JMP® Genomics is statistical discovery software that can uncover meaningful patterns in high-throughput genomics and proteomics data. JMP® Genomics is designed for biologists, biostatisticians, statistical geneticists, and those engaged in analyzing the vast stores of data that are common in genomic research (SAS, 2009. Data mining was performed using JMP® Genomics on the two collections of microarray databases available from National Center for Biotechnology Information (NCBI for lung cancer and breast cancer. The Gene Expression Omnibus (GEO of NCBI serves as a public repository for a wide range of highthroughput experimental data, including the two collections of lung cancer and breast cancer that were used for this research. The results for applying data mining using software JMP® Genomics are shown in this paper with numerous screen shots.

  20. Fire test database

    International Nuclear Information System (INIS)

    Lee, J.A.

    1989-01-01

    This paper describes a project recently completed for EPRI by Impell. The purpose of the project was to develop a reference database of fire tests performed on non-typical fire rated assemblies. The database is designed for use by utility fire protection engineers to locate test reports for power plant fire rated assemblies. As utilities prepare to respond to Information Notice 88-04, the database will identify utilities, vendors or manufacturers who have specific fire test data. The database contains fire test report summaries for 729 tested configurations. For each summary, a contact is identified from whom a copy of the complete fire test report can be obtained. Five types of configurations are included: doors, dampers, seals, wraps and walls. The database is computerized. One version for IBM; one for Mac. Each database is accessed through user-friendly software which allows adding, deleting, browsing, etc. through the database. There are five major database files. One each for the five types of tested configurations. The contents of each provides significant information regarding the test method and the physical attributes of the tested configuration. 3 figs

  1. Artificial Radionuclides Database in the Pacific Ocean: HAM Database

    Directory of Open Access Journals (Sweden)

    Michio Aoyama

    2004-01-01

    Full Text Available The database “Historical Artificial Radionuclides in the Pacific Ocean and its Marginal Seas”, or HAM database, has been created. The database includes 90Sr, 137Cs, and 239,240Pu concentration data from the seawater of the Pacific Ocean and its marginal seas with some measurements from the sea surface to the bottom. The data in the HAM database were collected from about 90 literature citations, which include published papers; annual reports by the Hydrographic Department, Maritime Safety Agency, Japan; and unpublished data provided by individuals. The data of concentrations of 90Sr, 137Cs, and 239,240Pu have been accumulating since 1957–1998. The present HAM database includes 7737 records for 137Cs concentration data, 3972 records for 90Sr concentration data, and 2666 records for 239,240Pu concentration data. The spatial variation of sampling stations in the HAM database is heterogeneous, namely, more than 80% of the data for each radionuclide is from the Pacific Ocean and the Sea of Japan, while a relatively small portion of data is from the South Pacific. This HAM database will allow us to use these radionuclides as significant chemical tracers for oceanographic study as well as the assessment of environmental affects of anthropogenic radionuclides for these 5 decades. Furthermore, these radionuclides can be used to verify the oceanic general circulation models in the time scale of several decades.

  2. Databases and their application

    NARCIS (Netherlands)

    Grimm, E.C.; Bradshaw, R.H.W; Brewer, S.; Flantua, S.; Giesecke, T.; Lézine, A.M.; Takahara, H.; Williams, J.W.,Jr; Elias, S.A.; Mock, C.J.

    2013-01-01

    During the past 20 years, several pollen database cooperatives have been established. These databases are now constituent databases of the Neotoma Paleoecology Database, a public domain, multiproxy, relational database designed for Quaternary-Pliocene fossil data and modern surface samples. The

  3. Database Optimizing Services

    Directory of Open Access Journals (Sweden)

    Adrian GHENCEA

    2010-12-01

    Full Text Available Almost every organization has at its centre a database. The database provides support for conducting different activities, whether it is production, sales and marketing or internal operations. Every day, a database is accessed for help in strategic decisions. The satisfaction therefore of such needs is entailed with a high quality security and availability. Those needs can be realised using a DBMS (Database Management System which is, in fact, software for a database. Technically speaking, it is software which uses a standard method of cataloguing, recovery, and running different data queries. DBMS manages the input data, organizes it, and provides ways of modifying or extracting the data by its users or other programs. Managing the database is an operation that requires periodical updates, optimizing and monitoring.

  4. Update History of This Database - RED | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available switchLanguage; BLAST Search Image Search Home About Archive Update History Data ...List Contact us RED Update History of This Database Date Update contents 2015/12/21 Rice Expression Database English archi...s Database Database Description Download License Update History of This Database Site Policy | Contact Us Update History of This Database - RED | LSDB Archive ... ...ve site is opened. 2000/10/1 Rice Expression Database ( http://red.dna.affrc.go.jp/RED/ ) is opened. About Thi

  5. GRIP Database original data - GRIPDB | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available switchLanguage; BLAST Search Image Search Home About Archive Update History Data List Contact us GRI...PDB GRIP Database original data Data detail Data name GRIP Database original data DOI 10....18908/lsdba.nbdc01665-006 Description of data contents GRIP Database original data It consists of data table...s and sequences. Data file File name: gripdb_original_data.zip File URL: ftp://ftp.biosciencedbc.jp/archive/gripdb/LATEST/gri...e Database Description Download License Update History of This Database Site Policy | Contact Us GRIP Database original data - GRIPDB | LSDB Archive ...

  6. V-MitoSNP: visualization of human mitochondrial SNPs

    Directory of Open Access Journals (Sweden)

    Tsui Ke-Hung

    2006-08-01

    Full Text Available Abstract Background Mitochondrial single nucleotide polymorphisms (mtSNPs constitute important data when trying to shed some light on human diseases and cancers. Unfortunately, providing relevant mtSNP genotyping information in mtDNA databases in a neatly organized and transparent visual manner still remains a challenge. Amongst the many methods reported for SNP genotyping, determining the restriction fragment length polymorphisms (RFLPs is still one of the most convenient and cost-saving methods. In this study, we prepared the visualization of the mtDNA genome in a way, which integrates the RFLP genotyping information with mitochondria related cancers and diseases in a user-friendly, intuitive and interactive manner. The inherent problem associated with mtDNA sequences in BLAST of the NCBI database was also solved. Description V-MitoSNP provides complete mtSNP information for four different kinds of inputs: (1 color-coded visual input by selecting genes of interest on the genome graph, (2 keyword search by locus, disease and mtSNP rs# ID, (3 visualized input of nucleotide range by clicking the selected region of the mtDNA sequence, and (4 sequences mtBLAST. The V-MitoSNP output provides 500 bp (base pairs flanking sequences for each SNP coupled with the RFLP enzyme and the corresponding natural or mismatched primer sets. The output format enables users to see the SNP genotype pattern of the RFLP by virtual electrophoresis of each mtSNP. The rate of successful design of enzymes and primers for RFLPs in all mtSNPs was 99.1%. The RFLP information was validated by actual agarose electrophoresis and showed successful results for all mtSNPs tested. The mtBLAST function in V-MitoSNP provides the gene information within the input sequence rather than providing the complete mitochondrial chromosome as in the NCBI BLAST database. All mtSNPs with rs number entries in NCBI are integrated in the corresponding SNP in V-MitoSNP. Conclusion V-MitoSNP is a web

  7. Update History of This Database - RPD | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available switchLanguage; BLAST Search Image Search Home About Archive Update History Data ...List Contact us RPD Update History of This Database Date Update contents 2016/02/02 Rice Proteome Database English archi...s Database Database Description Download License Update History of This Database Site Policy | Contact Us Update History of This Database - RPD | LSDB Archive ... ...ve site is opened. 2003/01/07 Rice Proteome Database ( http://gene64.dna.affrc.go.jp/RPD/ ) is opened. About Thi

  8. Brasilia’s Database Administrators

    Directory of Open Access Journals (Sweden)

    Jane Adriana

    2016-06-01

    Full Text Available Database administration has gained an essential role in the management of new database technologies. Different data models are being created for supporting the enormous data volume, from the traditional relational database. These new models are called NoSQL (Not only SQL databases. The adoption of best practices and procedures, has become essential for the operation of database management systems. Thus, this paper investigates some of the techniques and tools used by database administrators. The study highlights features and particularities in databases within the area of Brasilia, the Capital of Brazil. The results point to which new technologies regarding database management are currently the most relevant, as well as the central issues in this area.

  9. NREL: U.S. Life Cycle Inventory Database - About the LCI Database Project

    Science.gov (United States)

    About the LCI Database Project The U.S. Life Cycle Inventory (LCI) Database is a publicly available database that allows users to objectively review and compare analysis results that are based on similar source of critically reviewed LCI data through its LCI Database Project. NREL's High-Performance

  10. Biofuel Database

    Science.gov (United States)

    Biofuel Database (Web, free access)   This database brings together structural, biological, and thermodynamic data for enzymes that are either in current use or are being considered for use in the production of biofuels.

  11. NIRS database of the original research database

    International Nuclear Information System (INIS)

    Morita, Kyoko

    1991-01-01

    Recently, library staffs arranged and compiled the original research papers that have been written by researchers for 33 years since National Institute of Radiological Sciences (NIRS) established. This papers describes how the internal database of original research papers has been created. This is a small sample of hand-made database. This has been cumulating by staffs who have any knowledge about computer machine or computer programming. (author)

  12. Teaching Case: Adapting the Access Northwind Database to Support a Database Course

    Science.gov (United States)

    Dyer, John N.; Rogers, Camille

    2015-01-01

    A common problem encountered when teaching database courses is that few large illustrative databases exist to support teaching and learning. Most database textbooks have small "toy" databases that are chapter objective specific, and thus do not support application over the complete domain of design, implementation and management concepts…

  13. Community Database

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — This excel spreadsheet is the result of merging at the port level of several of the in-house fisheries databases in combination with other demographic databases such...

  14. Applications of GIS and database technologies to manage a Karst Feature Database

    Science.gov (United States)

    Gao, Y.; Tipping, R.G.; Alexander, E.C.

    2006-01-01

    This paper describes the management of a Karst Feature Database (KFD) in Minnesota. Two sets of applications in both GIS and Database Management System (DBMS) have been developed for the KFD of Minnesota. These applications were used to manage and to enhance the usability of the KFD. Structured Query Language (SQL) was used to manipulate transactions of the database and to facilitate the functionality of the user interfaces. The Database Administrator (DBA) authorized users with different access permissions to enhance the security of the database. Database consistency and recovery are accomplished by creating data logs and maintaining backups on a regular basis. The working database provides guidelines and management tools for future studies of karst features in Minnesota. The methodology of designing this DBMS is applicable to develop GIS-based databases to analyze and manage geomorphic and hydrologic datasets at both regional and local scales. The short-term goal of this research is to develop a regional KFD for the Upper Mississippi Valley Karst and the long-term goal is to expand this database to manage and study karst features at national and global scales.

  15. Open Geoscience Database

    Science.gov (United States)

    Bashev, A.

    2012-04-01

    Currently there is an enormous amount of various geoscience databases. Unfortunately the only users of the majority of the databases are their elaborators. There are several reasons for that: incompaitability, specificity of tasks and objects and so on. However the main obstacles for wide usage of geoscience databases are complexity for elaborators and complication for users. The complexity of architecture leads to high costs that block the public access. The complication prevents users from understanding when and how to use the database. Only databases, associated with GoogleMaps don't have these drawbacks, but they could be hardly named "geoscience" Nevertheless, open and simple geoscience database is necessary at least for educational purposes (see our abstract for ESSI20/EOS12). We developed a database and web interface to work with them and now it is accessible at maps.sch192.ru. In this database a result is a value of a parameter (no matter which) in a station with a certain position, associated with metadata: the date when the result was obtained; the type of a station (lake, soil etc); the contributor that sent the result. Each contributor has its own profile, that allows to estimate the reliability of the data. The results can be represented on GoogleMaps space image as a point in a certain position, coloured according to the value of the parameter. There are default colour scales and each registered user can create the own scale. The results can be also extracted in *.csv file. For both types of representation one could select the data by date, object type, parameter type, area and contributor. The data are uploaded in *.csv format: Name of the station; Lattitude(dd.dddddd); Longitude(ddd.dddddd); Station type; Parameter type; Parameter value; Date(yyyy-mm-dd). The contributor is recognised while entering. This is the minimal set of features that is required to connect a value of a parameter with a position and see the results. All the complicated data

  16. Detection of Perkinsus marinus in the oyster Crassostrea rhizophorae in southern Bahia by proteomic analysis

    Directory of Open Access Journals (Sweden)

    Thiago Ramos Pinto

    2017-01-01

    Full Text Available This study reports the presence of the pathogen Perkinsus marinus, notifiable to the World Organization for Animal Health (Office International des Èpizooties = OIE in the oyster Crassostrea rhizophorae in southern Bahia via proteomic analysis. We analyzed Crassostrea brasiliana from a long-line cultivation system and C. rhizophorae from an adjacent mangrove in Porto do Campo, Camamu Bay, Bahia, Brazil. The collections (n = 100 were performed in October 2012. In the laboratory, the oysters were measured and opened to remove the meat, which was steeped in dry ice. For extraction of proteins, adaptation of a protocol used for mussels was used, after which separation in the first dimension was taken by isoelectric focusing (IEF. The peptides were transferred to a Mass Spectrometer. The obtained spectra were analyzed with the ProteinLynx Global Server 4.2 software tool and also by MASCOT (Matrix Science and compared to the databases of the SWISSPROT and NCBI, respectively. The identification was evidenced by beta-tubulin, Perkinsus marinus ATCC 50983 and protein homology code in the database NCBI = gi | 294889481. This is the first record of P. marinus in Bahia and the fourth in Brazil.

  17. Inleiding database-systemen

    NARCIS (Netherlands)

    Pels, H.J.; Lans, van der R.F.; Pels, H.J.; Meersman, R.A.

    1993-01-01

    Dit artikel introduceert de voornaamste begrippen die een rol spelen rond databases en het geeft een overzicht van de doelstellingen, de functies en de componenten van database-systemen. Hoewel de functie van een database intuitief vrij duidelijk is, is het toch een in technologisch opzicht complex

  18. Integration of Biodiversity Databases in Taiwan and Linkage to Global Databases

    Directory of Open Access Journals (Sweden)

    Kwang-Tsao Shao

    2007-03-01

    Full Text Available The biodiversity databases in Taiwan were dispersed to various institutions and colleges with limited amount of data by 2001. The Natural Resources and Ecology GIS Database sponsored by the Council of Agriculture, which is part of the National Geographic Information System planned by the Ministry of Interior, was the most well established biodiversity database in Taiwan. But thisThis database was, however, mainly collectingcollected the distribution data of terrestrial animals and plants within the Taiwan area. In 2001, GBIF was formed, and Taiwan joined as one of the an Associate Participant and started, starting the establishment and integration of animal and plant species databases; therefore, TaiBIF was able to co-operate with GBIF. The information of Catalog of Life, specimens, and alien species were integrated by the Darwin core. The standard. These metadata standards allowed the biodiversity information of Taiwan to connect with global databases.

  19. Database Replication

    CERN Document Server

    Kemme, Bettina

    2010-01-01

    Database replication is widely used for fault-tolerance, scalability and performance. The failure of one database replica does not stop the system from working as available replicas can take over the tasks of the failed replica. Scalability can be achieved by distributing the load across all replicas, and adding new replicas should the load increase. Finally, database replication can provide fast local access, even if clients are geographically distributed clients, if data copies are located close to clients. Despite its advantages, replication is not a straightforward technique to apply, and

  20. Update History of This Database - PLACE | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available switchLanguage; BLAST Search Image Search Home About Archive Update History Data ...List Contact us PLACE Update History of This Database Date Update contents 2016/08/22 The contact address is...s Database Database Description Download License Update History of Thi...s Database Site Policy | Contact Us Update History of This Database - PLACE | LSDB Archive ... ... changed. 2014/10/20 The URLs of the database maintenance site and the portal site are changed. 2014/07/17 PLACE English archi

  1. Database Publication Practices

    DEFF Research Database (Denmark)

    Bernstein, P.A.; DeWitt, D.; Heuer, A.

    2005-01-01

    There has been a growing interest in improving the publication processes for database research papers. This panel reports on recent changes in those processes and presents an initial cut at historical data for the VLDB Journal and ACM Transactions on Database Systems.......There has been a growing interest in improving the publication processes for database research papers. This panel reports on recent changes in those processes and presents an initial cut at historical data for the VLDB Journal and ACM Transactions on Database Systems....

  2. The MAR databases: development and implementation of databases specific for marine metagenomics.

    Science.gov (United States)

    Klemetsen, Terje; Raknes, Inge A; Fu, Juan; Agafonov, Alexander; Balasundaram, Sudhagar V; Tartari, Giacomo; Robertsen, Espen; Willassen, Nils P

    2018-01-04

    We introduce the marine databases; MarRef, MarDB and MarCat (https://mmp.sfb.uit.no/databases/), which are publicly available resources that promote marine research and innovation. These data resources, which have been implemented in the Marine Metagenomics Portal (MMP) (https://mmp.sfb.uit.no/), are collections of richly annotated and manually curated contextual (metadata) and sequence databases representing three tiers of accuracy. While MarRef is a database for completely sequenced marine prokaryotic genomes, which represent a marine prokaryote reference genome database, MarDB includes all incomplete sequenced prokaryotic genomes regardless level of completeness. The last database, MarCat, represents a gene (protein) catalog of uncultivable (and cultivable) marine genes and proteins derived from marine metagenomics samples. The first versions of MarRef and MarDB contain 612 and 3726 records, respectively. Each record is built up of 106 metadata fields including attributes for sampling, sequencing, assembly and annotation in addition to the organism and taxonomic information. Currently, MarCat contains 1227 records with 55 metadata fields. Ontologies and controlled vocabularies are used in the contextual databases to enhance consistency. The user-friendly web interface lets the visitors browse, filter and search in the contextual databases and perform BLAST searches against the corresponding sequence databases. All contextual and sequence databases are freely accessible and downloadable from https://s1.sfb.uit.no/public/mar/. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  3. Update History of This Database - DMPD | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available switchLanguage; BLAST Search Image Search Home About Archive Update History Data ...List Contact us DMPD Update History of This Database Date Update contents 2010/03/29 DMPD English archive si....jp/macrophage/ ) is released. About This Database Database Description Download License Update History of Thi...s Database Site Policy | Contact Us Update History of This Database - DMPD | LSDB Archive ...

  4. Development of a personalized training system using the Lung Image Database Consortium and Image Database resource Initiative Database.

    Science.gov (United States)

    Lin, Hongli; Wang, Weisheng; Luo, Jiawei; Yang, Xuedong

    2014-12-01

    The aim of this study was to develop a personalized training system using the Lung Image Database Consortium (LIDC) and Image Database resource Initiative (IDRI) Database, because collecting, annotating, and marking a large number of appropriate computed tomography (CT) scans, and providing the capability of dynamically selecting suitable training cases based on the performance levels of trainees and the characteristics of cases are critical for developing a efficient training system. A novel approach is proposed to develop a personalized radiology training system for the interpretation of lung nodules in CT scans using the Lung Image Database Consortium (LIDC) and Image Database Resource Initiative (IDRI) database, which provides a Content-Boosted Collaborative Filtering (CBCF) algorithm for predicting the difficulty level of each case of each trainee when selecting suitable cases to meet individual needs, and a diagnostic simulation tool to enable trainees to analyze and diagnose lung nodules with the help of an image processing tool and a nodule retrieval tool. Preliminary evaluation of the system shows that developing a personalized training system for interpretation of lung nodules is needed and useful to enhance the professional skills of trainees. The approach of developing personalized training systems using the LIDC/IDRL database is a feasible solution to the challenges of constructing specific training program in terms of cost and training efficiency. Copyright © 2014 AUR. Published by Elsevier Inc. All rights reserved.

  5. Update History of This Database - KOME | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available List Contact us KOME Update History of This Database Date Update contents 2014/10/22 The URL of the whole da...site is opened. 2003/07/18 KOME ( http://cdna01.dna.affrc.go.jp/cDNA/ ) is opened. About This Database Dat...abase Description Download License Update History of This Database Site Policy | Contact Us Update History of This Database - KOME | LSDB Archive ...

  6. Update History of This Database - PSCDB | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available List Contact us PSCDB Update History of This Database Date Update contents 2016/11/30 PSCDB English archive ...site is opened. 2011/11/13 PSCDB ( http://idp1.force.cs.is.nagoya-u.ac.jp/pscdb/ ) is opened. About This Database Database... Description Download License Update History of This Database Site Policy | Contact Us Update History of This Database - PSCDB | LSDB Archive ...

  7. Mycobacteriophage genome database.

    Science.gov (United States)

    Joseph, Jerrine; Rajendran, Vasanthi; Hassan, Sameer; Kumar, Vanaja

    2011-01-01

    Mycobacteriophage genome database (MGDB) is an exclusive repository of the 64 completely sequenced mycobacteriophages with annotated information. It is a comprehensive compilation of the various gene parameters captured from several databases pooled together to empower mycobacteriophage researchers. The MGDB (Version No.1.0) comprises of 6086 genes from 64 mycobacteriophages classified into 72 families based on ACLAME database. Manual curation was aided by information available from public databases which was enriched further by analysis. Its web interface allows browsing as well as querying the classification. The main objective is to collect and organize the complexity inherent to mycobacteriophage protein classification in a rational way. The other objective is to browse the existing and new genomes and describe their functional annotation. The database is available for free at http://mpgdb.ibioinformatics.org/mpgdb.php.

  8. Logical database design principles

    CERN Document Server

    Garmany, John; Clark, Terry

    2005-01-01

    INTRODUCTION TO LOGICAL DATABASE DESIGNUnderstanding a Database Database Architectures Relational Databases Creating the Database System Development Life Cycle (SDLC)Systems Planning: Assessment and Feasibility System Analysis: RequirementsSystem Analysis: Requirements Checklist Models Tracking and Schedules Design Modeling Functional Decomposition DiagramData Flow Diagrams Data Dictionary Logical Structures and Decision Trees System Design: LogicalSYSTEM DESIGN AND IMPLEMENTATION The ER ApproachEntities and Entity Types Attribute Domains AttributesSet-Valued AttributesWeak Entities Constraint

  9. The role of the peptides at the origin of life

    DEFF Research Database (Denmark)

    Toxværd, Søren

    2017-01-01

    The peptides in biosystems are polymers of L-amino acids, but they racemize slowly by an active isomerization kinetics. The chemical reactions in biosystems are, however, reversible and here we show by a thermodynamics analysis and by comprehensive Molecular Dynamics simulations of models of pept...... homochirality in the presence of a hydrophobic compact core in a peptide of hundreds of chiral units and at a low water activity, and thus the establishment of homochirality at the origin of life and aging of proteins in biosystems might be strongly connected....

  10. Specialist Bibliographic Databases.

    Science.gov (United States)

    Gasparyan, Armen Yuri; Yessirkepov, Marlen; Voronov, Alexander A; Trukhachev, Vladimir I; Kostyukova, Elena I; Gerasimov, Alexey N; Kitas, George D

    2016-05-01

    Specialist bibliographic databases offer essential online tools for researchers and authors who work on specific subjects and perform comprehensive and systematic syntheses of evidence. This article presents examples of the established specialist databases, which may be of interest to those engaged in multidisciplinary science communication. Access to most specialist databases is through subscription schemes and membership in professional associations. Several aggregators of information and database vendors, such as EBSCOhost and ProQuest, facilitate advanced searches supported by specialist keyword thesauri. Searches of items through specialist databases are complementary to those through multidisciplinary research platforms, such as PubMed, Web of Science, and Google Scholar. Familiarizing with the functional characteristics of biomedical and nonbiomedical bibliographic search tools is mandatory for researchers, authors, editors, and publishers. The database users are offered updates of the indexed journal lists, abstracts, author profiles, and links to other metadata. Editors and publishers may find particularly useful source selection criteria and apply for coverage of their peer-reviewed journals and grey literature sources. These criteria are aimed at accepting relevant sources with established editorial policies and quality controls.

  11. Specialist Bibliographic Databases

    Science.gov (United States)

    2016-01-01

    Specialist bibliographic databases offer essential online tools for researchers and authors who work on specific subjects and perform comprehensive and systematic syntheses of evidence. This article presents examples of the established specialist databases, which may be of interest to those engaged in multidisciplinary science communication. Access to most specialist databases is through subscription schemes and membership in professional associations. Several aggregators of information and database vendors, such as EBSCOhost and ProQuest, facilitate advanced searches supported by specialist keyword thesauri. Searches of items through specialist databases are complementary to those through multidisciplinary research platforms, such as PubMed, Web of Science, and Google Scholar. Familiarizing with the functional characteristics of biomedical and nonbiomedical bibliographic search tools is mandatory for researchers, authors, editors, and publishers. The database users are offered updates of the indexed journal lists, abstracts, author profiles, and links to other metadata. Editors and publishers may find particularly useful source selection criteria and apply for coverage of their peer-reviewed journals and grey literature sources. These criteria are aimed at accepting relevant sources with established editorial policies and quality controls. PMID:27134485

  12. Directory of IAEA databases

    International Nuclear Information System (INIS)

    1992-12-01

    This second edition of the Directory of IAEA Databases has been prepared within the Division of Scientific and Technical Information (NESI). Its main objective is to describe the computerized information sources available to staff members. This directory contains all databases produced at the IAEA, including databases stored on the mainframe, LAN's and PC's. All IAEA Division Directors have been requested to register the existence of their databases with NESI. For the second edition database owners were requested to review the existing entries for their databases and answer four additional questions. The four additional questions concerned the type of database (e.g. Bibliographic, Text, Statistical etc.), the category of database (e.g. Administrative, Nuclear Data etc.), the available documentation and the type of media used for distribution. In the individual entries on the following pages the answers to the first two questions (type and category) is always listed, but the answers to the second two questions (documentation and media) is only listed when information has been made available

  13. Update History of This Database - SAHG | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available switchLanguage; BLAST Search Image Search Home About Archive Update History Data ...List Contact us SAHG Update History of This Database Date Update contents 2016/05/09 SAHG English archive si...te is opened. 2009/10 SAHG ( http://bird.cbrc.jp/sahg ) is opened. About This Database Database Description ...Download License Update History of This Database Site Policy | Contact Us Update History of This Database - SAHG | LSDB Archive ...

  14. Update History of This Database - RMOS | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available switchLanguage; BLAST Search Image Search Home About Archive Update History Data ...List Contact us RMOS Update History of This Database Date Update contents 2015/10/27 RMOS English archive si...12 RMOS (http://cdna01.dna.affrc.go.jp/RMOS/) is opened. About This Database Database Description Download License Update Hi...story of This Database Site Policy | Contact Us Update History of This Database - RMOS | LSDB Archive ...

  15. An Interoperable Cartographic Database

    OpenAIRE

    Slobodanka Ključanin; Zdravko Galić

    2007-01-01

    The concept of producing a prototype of interoperable cartographic database is explored in this paper, including the possibilities of integration of different geospatial data into the database management system and their visualization on the Internet. The implementation includes vectorization of the concept of a single map page, creation of the cartographic database in an object-relation database, spatial analysis, definition and visualization of the database content in the form of a map on t...

  16. Software listing: CHEMTOX database

    International Nuclear Information System (INIS)

    Moskowitz, P.D.

    1993-01-01

    Initially launched in 1983, the CHEMTOX Database was among the first microcomputer databases containing hazardous chemical information. The database is used in many industries and government agencies in more than 17 countries. Updated quarterly, the CHEMTOX Database provides detailed environmental and safety information on 7500-plus hazardous substances covered by dozens of regulatory and advisory sources. This brief listing describes the method of accessing data and provides ordering information for those wishing to obtain the CHEMTOX Database

  17. Database Dictionary for Ethiopian National Ground-Water DAtabase (ENGDA) Data Fields

    Science.gov (United States)

    Kuniansky, Eve L.; Litke, David W.; Tucci, Patrick

    2007-01-01

    Introduction This document describes the data fields that are used for both field forms and the Ethiopian National Ground-water Database (ENGDA) tables associated with information stored about production wells, springs, test holes, test wells, and water level or water-quality observation wells. Several different words are used in this database dictionary and in the ENGDA database to describe a narrow shaft constructed in the ground. The most general term is borehole, which is applicable to any type of hole. A well is a borehole specifically constructed to extract water from the ground; however, for this data dictionary and for the ENGDA database, the words well and borehole are used interchangeably. A production well is defined as any well used for water supply and includes hand-dug wells, small-diameter bored wells equipped with hand pumps, or large-diameter bored wells equipped with large-capacity motorized pumps. Test holes are borings made to collect information about the subsurface with continuous core or non-continuous core and/or where geophysical logs are collected. Test holes are not converted into wells. A test well is a well constructed for hydraulic testing of an aquifer in order to plan a larger ground-water production system. A water-level or water-quality observation well is a well that is used to collect information about an aquifer and not used for water supply. A spring is any naturally flowing, local, ground-water discharge site. The database dictionary is designed to help define all fields on both field data collection forms (provided in attachment 2 of this report) and for the ENGDA software screen entry forms (described in Litke, 2007). The data entered into each screen entry field are stored in relational database tables within the computer database. The organization of the database dictionary is designed based on field data collection and the field forms, because this is what the majority of people will use. After each field, however, the

  18. Update History of This Database - SSBD | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available switchLanguage; BLAST Search Image Search Home About Archive Update History Data ...List Contact us SSBD Update History of This Database Date Update contents 2016/07/25 SSBD English archive si...tion Download License Update History of This Database Site Policy | Contact Us Update History of This Database - SSBD | LSDB Archive ... ...te is opened. 2013/09/03 SSBD ( http://ssbd.qbic.riken.jp/ ) is opened. About This Database Database Descrip

  19. FANTOM: Functional and taxonomic analysis of metagenomes

    Directory of Open Access Journals (Sweden)

    Sanli Kemal

    2013-02-01

    Full Text Available Abstract Background Interpretation of quantitative metagenomics data is important for our understanding of ecosystem functioning and assessing differences between various environmental samples. There is a need for an easy to use tool to explore the often complex metagenomics data in taxonomic and functional context. Results Here we introduce FANTOM, a tool that allows for exploratory and comparative analysis of metagenomics abundance data integrated with metadata information and biological databases. Importantly, FANTOM can make use of any hierarchical database and it comes supplied with NCBI taxonomic hierarchies as well as KEGG Orthology, COG, PFAM and TIGRFAM databases. Conclusions The software is implemented in Python, is platform independent, and is available at http://www.sysbio.se/Fantom.

  20. An Interoperable Cartographic Database

    Directory of Open Access Journals (Sweden)

    Slobodanka Ključanin

    2007-05-01

    Full Text Available The concept of producing a prototype of interoperable cartographic database is explored in this paper, including the possibilities of integration of different geospatial data into the database management system and their visualization on the Internet. The implementation includes vectorization of the concept of a single map page, creation of the cartographic database in an object-relation database, spatial analysis, definition and visualization of the database content in the form of a map on the Internet. 

  1. An improved Greengenes taxonomy with explicit ranks for ecological and evolutionary analyses of bacteria and archaea.

    Science.gov (United States)

    McDonald, Daniel; Price, Morgan N; Goodrich, Julia; Nawrocki, Eric P; DeSantis, Todd Z; Probst, Alexander; Andersen, Gary L; Knight, Rob; Hugenholtz, Philip

    2012-03-01

    Reference phylogenies are crucial for providing a taxonomic framework for interpretation of marker gene and metagenomic surveys, which continue to reveal novel species at a remarkable rate. Greengenes is a dedicated full-length 16S rRNA gene database that provides users with a curated taxonomy based on de novo tree inference. We developed a 'taxonomy to tree' approach for transferring group names from an existing taxonomy to a tree topology, and used it to apply the Greengenes, National Center for Biotechnology Information (NCBI) and cyanoDB (Cyanobacteria only) taxonomies to a de novo tree comprising 408,315 sequences. We also incorporated explicit rank information provided by the NCBI taxonomy to group names (by prefixing rank designations) for better user orientation and classification consistency. The resulting merged taxonomy improved the classification of 75% of the sequences by one or more ranks relative to the original NCBI taxonomy with the most pronounced improvements occurring in under-classified environmental sequences. We also assessed candidate phyla (divisions) currently defined by NCBI and present recommendations for consolidation of 34 redundantly named groups. All intermediate results from the pipeline, which includes tree inference, jackknifing and transfer of a donor taxonomy to a recipient tree (tax2tree) are available for download. The improved Greengenes taxonomy should provide important infrastructure for a wide range of megasequencing projects studying ecosystems on scales ranging from our own bodies (the Human Microbiome Project) to the entire planet (the Earth Microbiome Project). The implementation of the software can be obtained from http://sourceforge.net/projects/tax2tree/.

  2. Extending Database Integration Technology

    National Research Council Canada - National Science Library

    Buneman, Peter

    1999-01-01

    Formal approaches to the semantics of databases and database languages can have immediate and practical consequences in extending database integration technologies to include a vastly greater range...

  3. Database specification for the Worldwide Port System (WPS) Regional Integrated Cargo Database (ICDB)

    Energy Technology Data Exchange (ETDEWEB)

    Faby, E.Z.; Fluker, J.; Hancock, B.R.; Grubb, J.W.; Russell, D.L. [Univ. of Tennessee, Knoxville, TN (United States); Loftis, J.P.; Shipe, P.C.; Truett, L.F. [Oak Ridge National Lab., TN (United States)

    1994-03-01

    This Database Specification for the Worldwide Port System (WPS) Regional Integrated Cargo Database (ICDB) describes the database organization and storage allocation, provides the detailed data model of the logical and physical designs, and provides information for the construction of parts of the database such as tables, data elements, and associated dictionaries and diagrams.

  4. Specialist Bibliographic Databases

    OpenAIRE

    Gasparyan, Armen Yuri; Yessirkepov, Marlen; Voronov, Alexander A.; Trukhachev, Vladimir I.; Kostyukova, Elena I.; Gerasimov, Alexey N.; Kitas, George D.

    2016-01-01

    Specialist bibliographic databases offer essential online tools for researchers and authors who work on specific subjects and perform comprehensive and systematic syntheses of evidence. This article presents examples of the established specialist databases, which may be of interest to those engaged in multidisciplinary science communication. Access to most specialist databases is through subscription schemes and membership in professional associations. Several aggregators of information and d...

  5. Nuclear power economic database

    International Nuclear Information System (INIS)

    Ding Xiaoming; Li Lin; Zhao Shiping

    1996-01-01

    Nuclear power economic database (NPEDB), based on ORACLE V6.0, consists of three parts, i.e., economic data base of nuclear power station, economic data base of nuclear fuel cycle and economic database of nuclear power planning and nuclear environment. Economic database of nuclear power station includes data of general economics, technique, capital cost and benefit, etc. Economic database of nuclear fuel cycle includes data of technique and nuclear fuel price. Economic database of nuclear power planning and nuclear environment includes data of energy history, forecast, energy balance, electric power and energy facilities

  6. Keyword Search in Databases

    CERN Document Server

    Yu, Jeffrey Xu; Chang, Lijun

    2009-01-01

    It has become highly desirable to provide users with flexible ways to query/search information over databases as simple as keyword search like Google search. This book surveys the recent developments on keyword search over databases, and focuses on finding structural information among objects in a database using a set of keywords. Such structural information to be returned can be either trees or subgraphs representing how the objects, that contain the required keywords, are interconnected in a relational database or in an XML database. The structural keyword search is completely different from

  7. Update History of This Database - AT Atlas | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available List Contact us AT Atlas Update History of This Database Date Update contents 2013/12/16 The email address i... ( http://www.tanpaku.org/atatlas/ ) is opened. About This Database Database Description Download License Update History of This Data...base Site Policy | Contact Us Update History of This Database - AT Atlas | LSDB Archive ...

  8. How to improve your PubMed/MEDLINE searches: 3. advanced searching, MeSH and My NCBI.

    Science.gov (United States)

    Fatehi, Farhad; Gray, Leonard C; Wootton, Richard

    2014-03-01

    Although the basic PubMed search is often helpful, the results may sometimes be non-specific. For more control over the search process you can use the Advanced Search Builder interface. This allows a targeted search in specific fields, with the convenience of being able to select the intended search field from a list. It also provides a history of your previous searches. The search history is useful to develop a complex search query by combining several previous searches using Boolean operators. For indexing the articles in MEDLINE, the NLM uses a controlled vocabulary system called MeSH. This standardised vocabulary solves the problem of authors, researchers and librarians who may use different terms for the same concept. To be efficient in a PubMed search, you should start by identifying the most appropriate MeSH terms and use them in your search where possible. My NCBI is a personal workspace facility available through PubMed and makes it possible to customise the PubMed interface. It provides various capabilities that can enhance your search performance.

  9. 600 MW nuclear power database

    International Nuclear Information System (INIS)

    Cao Ruiding; Chen Guorong; Chen Xianfeng; Zhang Yishu

    1996-01-01

    600 MW Nuclear power database, based on ORACLE 6.0, consists of three parts, i.e. nuclear power plant database, nuclear power position database and nuclear power equipment database. In the database, there are a great deal of technique data and picture of nuclear power, provided by engineering designing units and individual. The database can give help to the designers of nuclear power

  10. Hazard Analysis Database Report

    Energy Technology Data Exchange (ETDEWEB)

    GAULT, G.W.

    1999-10-13

    The Hazard Analysis Database was developed in conjunction with the hazard analysis activities conducted in accordance with DOE-STD-3009-94, Preparation Guide for US Department of Energy Nonreactor Nuclear Facility Safety Analysis Reports, for the Tank Waste Remediation System (TWRS) Final Safety Analysis Report (FSAR). The FSAR is part of the approved TWRS Authorization Basis (AB). This document describes, identifies, and defines the contents and structure of the TWRS FSAR Hazard Analysis Database and documents the configuration control changes made to the database. The TWRS Hazard Analysis Database contains the collection of information generated during the initial hazard evaluations and the subsequent hazard and accident analysis activities. The database supports the preparation of Chapters 3,4, and 5 of the TWRS FSAR and the USQ process and consists of two major, interrelated data sets: (1) Hazard Evaluation Database--Data from the results of the hazard evaluations; and (2) Hazard Topography Database--Data from the system familiarization and hazard identification.

  11. Collecting Taxes Database

    Data.gov (United States)

    US Agency for International Development — The Collecting Taxes Database contains performance and structural indicators about national tax systems. The database contains quantitative revenue performance...

  12. Accessing and using chemical databases

    DEFF Research Database (Denmark)

    Nikolov, Nikolai Georgiev; Pavlov, Todor; Niemelä, Jay Russell

    2013-01-01

    Computer-based representation of chemicals makes it possible to organize data in chemical databases-collections of chemical structures and associated properties. Databases are widely used wherever efficient processing of chemical information is needed, including search, storage, retrieval......, and dissemination. Structure and functionality of chemical databases are considered. The typical kinds of information found in a chemical database are considered-identification, structural, and associated data. Functionality of chemical databases is presented, with examples of search and access types. More details...... are included about the OASIS database and platform and the Danish (Q)SAR Database online. Various types of chemical database resources are discussed, together with a list of examples....

  13. Column-oriented database management systems

    OpenAIRE

    Možina, David

    2013-01-01

    In the following thesis I will present column-oriented database. Among other things, I will answer on a question why there is a need for a column-oriented database. In recent years there have been a lot of attention regarding a column-oriented database, even if the existence of a columnar database management systems dates back in the early seventies of the last century. I will compare both systems for a database management – a colum-oriented database system and a row-oriented database system ...

  14. Trans-algorithmic nature of learning in biological systems.

    Science.gov (United States)

    Shimansky, Yury P

    2018-05-02

    Learning ability is a vitally important, distinctive property of biological systems, which provides dynamic stability in non-stationary environments. Although several different types of learning have been successfully modeled using a universal computer, in general, learning cannot be described by an algorithm. In other words, algorithmic approach to describing the functioning of biological systems is not sufficient for adequate grasping of what is life. Since biosystems are parts of the physical world, one might hope that adding some physical mechanisms and principles to the concept of algorithm could provide extra possibilities for describing learning in its full generality. However, a straightforward approach to that through the so-called physical hypercomputation so far has not been successful. Here an alternative approach is proposed. Biosystems are described as achieving enumeration of possible physical compositions though random incremental modifications inflicted on them by active operating resources (AORs) in the environment. Biosystems learn through algorithmic regulation of the intensity of the above modifications according to a specific optimality criterion. From the perspective of external observers, biosystems move in the space of different algorithms driven by random modifications imposed by the environmental AORs. A particular algorithm is only a snapshot of that motion, while the motion itself is essentially trans-algorithmic. In this conceptual framework, death of unfit members of a population, for example, is viewed as a trans-algorithmic modification made in the population as a biosystem by environmental AORs. Numerous examples of AOR utilization in biosystems of different complexity, from viruses to multicellular organisms, are provided.

  15. Database Description - Society Catalog | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available ion of the academic societies in Japan (organization name, website URL, contact a...sing a category tree or a society website's thumbnail. This database is useful especially when the users are... External Links: Original website information Database maintenance site National Bioscience Database Center *The original web...site was terminated. URL of the original website - Operation start date 2008/06 Last update

  16. Update History of This Database - RMG | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available switchLanguage; BLAST Search Image Search Home About Archive Update History Data ...List Contact us RMG Update History of This Database Date Update contents 2016/08/22 The contact address is c...dna.affrc.go.jp/ ) is opened. About This Database Database Description Download License Update Hi...story of This Database Site Policy | Contact Us Update History of This Database - RMG | LSDB Archive ... ... URL of the portal site is changed. 2013/08/07 RMG archive site is opened. 2002/09/25 RMG ( http://rmg.rice.

  17. Update History of This Database - DGBY | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available switchLanguage; BLAST Search Image Search Home About Archive Update History Data ...List Contact us DGBY Update History of This Database Date Update contents 2014/10/20 The URL of the portal s...aro.affrc.go.jp/yakudachi/yeast/index.html ) is opened. About This Database Database Description Download License Update Hi...story of This Database Site Policy | Contact Us Update History of This Database - DGBY | LSDB Archive ... ... Expression of attribution in License is updated. 2012/03/08 DGBY English archive site is opened. 2006/10/02

  18. Update History of This Database - KAIKOcDNA | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available switchLanguage; BLAST Search Image Search Home About Archive Update History Data ...List Contact us KAIKOcDNA Update History of This Database Date Update contents 2014/10/20 The URL of the dat... database ( http://sgp.dna.affrc.go.jp/EST/ ) is opened. About This Database Database Description Download License Update Hi...story of This Database Site Policy | Contact Us Update History of This Database - KAIKOcDNA | LSDB Archive ... ...abase maintenance site is changed. 2014/10/08 KAIKOcDNA English archive site is opened. 2004/04/12 KAIKOcDNA

  19. Dietary Supplement Ingredient Database

    Science.gov (United States)

    ... and US Department of Agriculture Dietary Supplement Ingredient Database Toggle navigation Menu Home About DSID Mission Current ... values can be saved to build a small database or add to an existing database for national, ...

  20. Studying the Immunomodulatory Effects of Small Molecule Ras-Inhibitors in Animal Models of Rheumatoid Arthritis

    Science.gov (United States)

    2017-10-01

    Capacity cDNA Reverse Transcription Kit (Applied Biosystems, Thermo Fisher Scientific, Inc.), according to the manufacturer’s instructions. The quantita...Instrument (Applied Biosystems), as recommended by the manufacturers, in reactions containing 50–100 ng cDNA . All reactions were done in triplicates and

  1. Studying the Immunomodulatory Effects of Small Molecule Ras Inhibitors in Animal Models of Rheumatoid Arthritis

    Science.gov (United States)

    2017-10-01

    using the High Capacity cDNA Reverse Transcription Kit (Applied Biosystems, Thermo Fisher Scientific, Inc.), according to the manufacturer’s...7900 SDS Instrument (Applied Biosystems), as recommended by the manufacturers, in reactions containing 50–100 ng cDNA . All reactions were done in

  2. In Silico Detection and Typing of Plasmids using PlasmidFinder and Plasmid Multilocus Sequence Typing

    DEFF Research Database (Denmark)

    Carattoli, Alessandra; Zankari, Ea; García-Fernández, Aurora

    2014-01-01

    In the work presented here, we designed and developed two easy-to-use Web tools for in silico detection and characterization of whole-genome sequence (WGS) and whole-plasmid sequence data from members of the family Enterobacteriaceae. These tools will facilitate bacterial typing based on draft...... genomes of multidrug-resistant Enterobacteriaceae species by the rapid detection of known plasmid types. Replicon sequences from 559 fully sequenced plasmids associated with the family Enterobacteriaceae in the NCBI nucleotide database were collected to build a consensus database for integration...... sequences identified in the 559 fully sequenced plasmids. For plasmid multilocus sequence typing (pMLST) analysis, a database that is updated weekly was generated from www.pubmlst.org and integrated into a Web tool called pMLST. Both databases were evaluated using draft genomes from a collection...

  3. Database and Expert Systems Applications

    DEFF Research Database (Denmark)

    Viborg Andersen, Kim; Debenham, John; Wagner, Roland

    schemata, query evaluation, semantic processing, information retrieval, temporal and spatial databases, querying XML, organisational aspects of databases, natural language processing, ontologies, Web data extraction, semantic Web, data stream management, data extraction, distributed database systems......This book constitutes the refereed proceedings of the 16th International Conference on Database and Expert Systems Applications, DEXA 2005, held in Copenhagen, Denmark, in August 2005.The 92 revised full papers presented together with 2 invited papers were carefully reviewed and selected from 390...... submissions. The papers are organized in topical sections on workflow automation, database queries, data classification and recommendation systems, information retrieval in multimedia databases, Web applications, implementational aspects of databases, multimedia databases, XML processing, security, XML...

  4. GenBank

    OpenAIRE

    Benson, Dennis A.; Cavanaugh, Mark; Clark, Karen; Karsch-Mizrachi, Ilene; Lipman, David J.; Ostell, James; Sayers, Eric W.

    2012-01-01

    GenBank? (http://www.ncbi.nlm.nih.gov) is a comprehensive database that contains publicly available nucleotide sequences for almost 260 000 formally described species. These sequences are obtained primarily through submissions from individual laboratories and batch submissions from large-scale sequencing projects, including whole-genome shotgun (WGS) and environmental sampling projects. Most submissions are made using the web-based BankIt or standalone Sequin programs, and GenBank staff assig...

  5. National Database of Geriatrics

    DEFF Research Database (Denmark)

    Kannegaard, Pia Nimann; Vinding, Kirsten L; Hare-Bruun, Helle

    2016-01-01

    AIM OF DATABASE: The aim of the National Database of Geriatrics is to monitor the quality of interdisciplinary diagnostics and treatment of patients admitted to a geriatric hospital unit. STUDY POPULATION: The database population consists of patients who were admitted to a geriatric hospital unit....... Geriatric patients cannot be defined by specific diagnoses. A geriatric patient is typically a frail multimorbid elderly patient with decreasing functional ability and social challenges. The database includes 14-15,000 admissions per year, and the database completeness has been stable at 90% during the past......, percentage of discharges with a rehabilitation plan, and the part of cases where an interdisciplinary conference has taken place. Data are recorded by doctors, nurses, and therapists in a database and linked to the Danish National Patient Register. DESCRIPTIVE DATA: Descriptive patient-related data include...

  6. A new relational database structure and online interface for the HITRAN database

    International Nuclear Information System (INIS)

    Hill, Christian; Gordon, Iouli E.; Rothman, Laurence S.; Tennyson, Jonathan

    2013-01-01

    A new format for the HITRAN database is proposed. By storing the line-transition data in a number of linked tables described by a relational database schema, it is possible to overcome the limitations of the existing format, which have become increasingly apparent over the last few years as new and more varied data are being used by radiative-transfer models. Although the database in the new format can be searched using the well-established Structured Query Language (SQL), a web service, HITRANonline, has been deployed to allow users to make most common queries of the database using a graphical user interface in a web page. The advantages of the relational form of the database to ensuring data integrity and consistency are explored, and the compatibility of the online interface with the emerging standards of the Virtual Atomic and Molecular Data Centre (VAMDC) project is discussed. In particular, the ability to access HITRAN data using a standard query language from other websites, command line tools and from within computer programs is described. -- Highlights: • A new, interactive version of the HITRAN database is presented. • The data is stored in a structured fashion in a relational database. • The new HITRANonline interface offers increased functionality and easier error correction

  7. Update History of This Database - fRNAdb | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available switchLanguage; BLAST Search Image Search Home About Archive Update History Data ...List Contact us fRNAdb Update History of This Database Date Update contents 2016/03/29 fRNAdb English archiv...on Download License Update History of This Database Site Policy | Contact Us Update History of This Database - fRNAdb | LSDB Archive ... ...e site is opened. 2006/12 fRNAdb ( http://www.ncrna.org/ ) is opened. About This Database Database Descripti

  8. Multilevel security for relational databases

    CERN Document Server

    Faragallah, Osama S; El-Samie, Fathi E Abd

    2014-01-01

    Concepts of Database Security Database Concepts Relational Database Security Concepts Access Control in Relational Databases      Discretionary Access Control      Mandatory Access Control      Role-Based Access Control Work Objectives Book Organization Basic Concept of Multilevel Database Security IntroductionMultilevel Database Relations Polyinstantiation      Invisible Polyinstantiation      Visible Polyinstantiation      Types of Polyinstantiation      Architectural Consideration

  9. A Case for Database Filesystems

    Energy Technology Data Exchange (ETDEWEB)

    Adams, P A; Hax, J C

    2009-05-13

    Data intensive science is offering new challenges and opportunities for Information Technology and traditional relational databases in particular. Database filesystems offer the potential to store Level Zero data and analyze Level 1 and Level 3 data within the same database system [2]. Scientific data is typically composed of both unstructured files and scalar data. Oracle SecureFiles is a new database filesystem feature in Oracle Database 11g that is specifically engineered to deliver high performance and scalability for storing unstructured or file data inside the Oracle database. SecureFiles presents the best of both the filesystem and the database worlds for unstructured content. Data stored inside SecureFiles can be queried or written at performance levels comparable to that of traditional filesystems while retaining the advantages of the Oracle database.

  10. Update History of This Database - TogoTV | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available switchLanguage; BLAST Search Image Search Home About Archive Update History Data ...List Contact us TogoTV Update History of This Database Date Update contents 2017/05/12 TogoTV English archiv...ription Download License Update History of This Database Site Policy | Contact Us Update History of This Database - TogoTV | LSDB Archive ... ...e site is opened. 2007/07/20 TogoTV ( http://togotv.dbcls.jp/ ) is opened. About This Database Database Desc

  11. Update History of This Database - ConfC | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available switchLanguage; BLAST Search Image Search Home About Archive Update History Data ...List Contact us ConfC Update History of This Database Date Update contents 2016/09/20 ConfC English archive ...tion Download License Update History of This Database Site Policy | Contact Us Update History of This Database - ConfC | LSDB Archive ... ...site is opened. 2005/05/01 ConfC (http://mbs.cbrc.jp/ConfC/) is opened. About This Database Database Descrip

  12. Developments in diffraction databases

    International Nuclear Information System (INIS)

    Jenkins, R.

    1999-01-01

    Full text: There are a number of databases available to the diffraction community. Two of the more important of these are the Powder Diffraction File (PDF) maintained by the International Centre for Diffraction Data (ICDD), and the Inorganic Crystal Structure Database (ICSD) maintained by Fachsinformationzentrum (FIZ, Karlsruhe). In application, the PDF has been used as an indispensable tool in phase identification and identification of unknowns. The ICSD database has extensive and explicit reference to the structures of compounds: atomic coordinates, space group and even thermal vibration parameters. A similar database, but for organic compounds, is maintained by the Cambridge Crystallographic Data Centre. These databases are often used as independent sources of information. However, little thought has been given on how to exploit the combined properties of structural database tools. A recently completed agreement between ICDD and FIZ, plus ICDD and Cambridge, provides a first step in complementary use of the PDF and the ICSD databases. The focus of this paper (as indicated below) is to examine ways of exploiting the combined properties of both databases. In 1996, there were approximately 76,000 entries in the PDF and approximately 43,000 entries in the ICSD database. The ICSD database has now been used to calculate entries in the PDF. Thus, to derive d-spacing and peak intensity data requires the synthesis of full diffraction patterns, i.e., we use the structural data in the ICSD database and then add instrumental resolution information. The combined data from PDF and ICSD can be effectively used in many ways. For example, we can calculate PDF data for an ideally random crystal distribution and also in the absence of preferred orientation. Again, we can use systematic studies of intermediate members in solid solutions series to help produce reliable quantitative phase analyses. In some cases, we can study how solid solution properties vary with composition and

  13. Aviation Safety Issues Database

    Science.gov (United States)

    Morello, Samuel A.; Ricks, Wendell R.

    2009-01-01

    The aviation safety issues database was instrumental in the refinement and substantiation of the National Aviation Safety Strategic Plan (NASSP). The issues database is a comprehensive set of issues from an extremely broad base of aviation functions, personnel, and vehicle categories, both nationally and internationally. Several aviation safety stakeholders such as the Commercial Aviation Safety Team (CAST) have already used the database. This broader interest was the genesis to making the database publically accessible and writing this report.

  14. BDVC (Bimodal Database of Violent Content): A database of violent audio and video

    Science.gov (United States)

    Rivera Martínez, Jose Luis; Mijes Cruz, Mario Humberto; Rodríguez Vázqu, Manuel Antonio; Rodríguez Espejo, Luis; Montoya Obeso, Abraham; García Vázquez, Mireya Saraí; Ramírez Acosta, Alejandro Álvaro

    2017-09-01

    Nowadays there is a trend towards the use of unimodal databases for multimedia content description, organization and retrieval applications of a single type of content like text, voice and images, instead bimodal databases allow to associate semantically two different types of content like audio-video, image-text, among others. The generation of a bimodal database of audio-video implies the creation of a connection between the multimedia content through the semantic relation that associates the actions of both types of information. This paper describes in detail the used characteristics and methodology for the creation of the bimodal database of violent content; the semantic relationship is stablished by the proposed concepts that describe the audiovisual information. The use of bimodal databases in applications related to the audiovisual content processing allows an increase in the semantic performance only and only if these applications process both type of content. This bimodal database counts with 580 audiovisual annotated segments, with a duration of 28 minutes, divided in 41 classes. Bimodal databases are a tool in the generation of applications for the semantic web.

  15. Experiment Databases

    Science.gov (United States)

    Vanschoren, Joaquin; Blockeel, Hendrik

    Next to running machine learning algorithms based on inductive queries, much can be learned by immediately querying the combined results of many prior studies. Indeed, all around the globe, thousands of machine learning experiments are being executed on a daily basis, generating a constant stream of empirical information on machine learning techniques. While the information contained in these experiments might have many uses beyond their original intent, results are typically described very concisely in papers and discarded afterwards. If we properly store and organize these results in central databases, they can be immediately reused for further analysis, thus boosting future research. In this chapter, we propose the use of experiment databases: databases designed to collect all the necessary details of these experiments, and to intelligently organize them in online repositories to enable fast and thorough analysis of a myriad of collected results. They constitute an additional, queriable source of empirical meta-data based on principled descriptions of algorithm executions, without reimplementing the algorithms in an inductive database. As such, they engender a very dynamic, collaborative approach to experimentation, in which experiments can be freely shared, linked together, and immediately reused by researchers all over the world. They can be set up for personal use, to share results within a lab or to create open, community-wide repositories. Here, we provide a high-level overview of their design, and use an existing experiment database to answer various interesting research questions about machine learning algorithms and to verify a number of recent studies.

  16. An XCT image database system

    International Nuclear Information System (INIS)

    Komori, Masaru; Minato, Kotaro; Koide, Harutoshi; Hirakawa, Akina; Nakano, Yoshihisa; Itoh, Harumi; Torizuka, Kanji; Yamasaki, Tetsuo; Kuwahara, Michiyoshi.

    1984-01-01

    In this paper, an expansion of X-ray CT (XCT) examination history database to XCT image database is discussed. The XCT examination history database has been constructed and used for daily examination and investigation in our hospital. This database consists of alpha-numeric information (locations, diagnosis and so on) of more than 15,000 cases, and for some of them, we add tree structured image data which has a flexibility for various types of image data. This database system is written by MUMPS database manipulation language. (author)

  17. The Danish fetal medicine database

    DEFF Research Database (Denmark)

    Ekelund, Charlotte Kvist; Kopp, Tine Iskov; Tabor, Ann

    2016-01-01

    trimester ultrasound scan performed at all public hospitals in Denmark are registered in the database. Main variables/descriptive data: Data on maternal characteristics, ultrasonic, and biochemical variables are continuously sent from the fetal medicine units’Astraia databases to the central database via...... analyses are sent to the database. Conclusion: It has been possible to establish a fetal medicine database, which monitors first-trimester screening for chromosomal abnormalities and second-trimester screening for major fetal malformations with the input from already collected data. The database...

  18. National database

    DEFF Research Database (Denmark)

    Kristensen, Helen Grundtvig; Stjernø, Henrik

    1995-01-01

    Artikel om national database for sygeplejeforskning oprettet på Dansk Institut for Sundheds- og Sygeplejeforskning. Det er målet med databasen at samle viden om forsknings- og udviklingsaktiviteter inden for sygeplejen.......Artikel om national database for sygeplejeforskning oprettet på Dansk Institut for Sundheds- og Sygeplejeforskning. Det er målet med databasen at samle viden om forsknings- og udviklingsaktiviteter inden for sygeplejen....

  19. The CAPEC Database

    DEFF Research Database (Denmark)

    Nielsen, Thomas Lund; Abildskov, Jens; Harper, Peter Mathias

    2001-01-01

    in the compound. This classification makes the CAPEC database a very useful tool, for example, in the development of new property models, since properties of chemically similar compounds are easily obtained. A program with efficient search and retrieval functions of properties has been developed.......The Computer-Aided Process Engineering Center (CAPEC) database of measured data was established with the aim to promote greater data exchange in the chemical engineering community. The target properties are pure component properties, mixture properties, and special drug solubility data....... The database divides pure component properties into primary, secondary, and functional properties. Mixture properties are categorized in terms of the number of components in the mixture and the number of phases present. The compounds in the database have been classified on the basis of the functional groups...

  20. Update History of This Database - AcEST | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available switchLanguage; BLAST Search Image Search Home About Archive Update History Data ...List Contact us AcEST Update History of This Database Date Update contents 2013/01/10 Errors found on AcEST ...s Database Database Description Download License Update History of This Data...base Site Policy | Contact Us Update History of This Database - AcEST | LSDB Archive ... ...Conting data have been correceted. For details, please refer to the following page. Data correction 2010/03/29 AcEST English archi

  1. The Danish Testicular Cancer database.

    Science.gov (United States)

    Daugaard, Gedske; Kier, Maria Gry Gundgaard; Bandak, Mikkel; Mortensen, Mette Saksø; Larsson, Heidi; Søgaard, Mette; Toft, Birgitte Groenkaer; Engvad, Birte; Agerbæk, Mads; Holm, Niels Vilstrup; Lauritsen, Jakob

    2016-01-01

    The nationwide Danish Testicular Cancer database consists of a retrospective research database (DaTeCa database) and a prospective clinical database (Danish Multidisciplinary Cancer Group [DMCG] DaTeCa database). The aim is to improve the quality of care for patients with testicular cancer (TC) in Denmark, that is, by identifying risk factors for relapse, toxicity related to treatment, and focusing on late effects. All Danish male patients with a histologically verified germ cell cancer diagnosis in the Danish Pathology Registry are included in the DaTeCa databases. Data collection has been performed from 1984 to 2007 and from 2013 onward, respectively. The retrospective DaTeCa database contains detailed information with more than 300 variables related to histology, stage, treatment, relapses, pathology, tumor markers, kidney function, lung function, etc. A questionnaire related to late effects has been conducted, which includes questions regarding social relationships, life situation, general health status, family background, diseases, symptoms, use of medication, marital status, psychosocial issues, fertility, and sexuality. TC survivors alive on October 2014 were invited to fill in this questionnaire including 160 validated questions. Collection of questionnaires is still ongoing. A biobank including blood/sputum samples for future genetic analyses has been established. Both samples related to DaTeCa and DMCG DaTeCa database are included. The prospective DMCG DaTeCa database includes variables regarding histology, stage, prognostic group, and treatment. The DMCG DaTeCa database has existed since 2013 and is a young clinical database. It is necessary to extend the data collection in the prospective database in order to answer quality-related questions. Data from the retrospective database will be added to the prospective data. This will result in a large and very comprehensive database for future studies on TC patients.

  2. Update History of This Database - D-HaploDB | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available List Contact us D-HaploDB Update History of This Database Date Update contents 2016/12/13 Description of the.../orca.gen.kyushu-u.ac.jp/) is released. About This Database Database Description Download License Update History of This Database... Site Policy | Contact Us Update History of This Database - D-HaploDB | LSDB Archive ...

  3. Scopus database: a review.

    Science.gov (United States)

    Burnham, Judy F

    2006-03-08

    The Scopus database provides access to STM journal articles and the references included in those articles, allowing the searcher to search both forward and backward in time. The database can be used for collection development as well as for research. This review provides information on the key points of the database and compares it to Web of Science. Neither database is inclusive, but complements each other. If a library can only afford one, choice must be based in institutional needs.

  4. Database principles programming performance

    CERN Document Server

    O'Neil, Patrick

    2014-01-01

    Database: Principles Programming Performance provides an introduction to the fundamental principles of database systems. This book focuses on database programming and the relationships between principles, programming, and performance.Organized into 10 chapters, this book begins with an overview of database design principles and presents a comprehensive introduction to the concepts used by a DBA. This text then provides grounding in many abstract concepts of the relational model. Other chapters introduce SQL, describing its capabilities and covering the statements and functions of the programmi

  5. Network and Database Security: Regulatory Compliance, Network, and Database Security - A Unified Process and Goal

    Directory of Open Access Journals (Sweden)

    Errol A. Blake

    2007-12-01

    Full Text Available Database security has evolved; data security professionals have developed numerous techniques and approaches to assure data confidentiality, integrity, and availability. This paper will show that the Traditional Database Security, which has focused primarily on creating user accounts and managing user privileges to database objects are not enough to protect data confidentiality, integrity, and availability. This paper is a compilation of different journals, articles and classroom discussions will focus on unifying the process of securing data or information whether it is in use, in storage or being transmitted. Promoting a change in Database Curriculum Development trends may also play a role in helping secure databases. This paper will take the approach that if one make a conscientious effort to unifying the Database Security process, which includes Database Management System (DBMS selection process, following regulatory compliances, analyzing and learning from the mistakes of others, Implementing Networking Security Technologies, and Securing the Database, may prevent database breach.

  6. Hazard Analysis Database Report

    CERN Document Server

    Grams, W H

    2000-01-01

    The Hazard Analysis Database was developed in conjunction with the hazard analysis activities conducted in accordance with DOE-STD-3009-94, Preparation Guide for U S . Department of Energy Nonreactor Nuclear Facility Safety Analysis Reports, for HNF-SD-WM-SAR-067, Tank Farms Final Safety Analysis Report (FSAR). The FSAR is part of the approved Authorization Basis (AB) for the River Protection Project (RPP). This document describes, identifies, and defines the contents and structure of the Tank Farms FSAR Hazard Analysis Database and documents the configuration control changes made to the database. The Hazard Analysis Database contains the collection of information generated during the initial hazard evaluations and the subsequent hazard and accident analysis activities. The Hazard Analysis Database supports the preparation of Chapters 3 ,4 , and 5 of the Tank Farms FSAR and the Unreviewed Safety Question (USQ) process and consists of two major, interrelated data sets: (1) Hazard Analysis Database: Data from t...

  7. Preparing and Analyzing Expressed Sequence Tags (ESTs Library for the Mammary Tissue of Local Turkish Kivircik Sheep

    Directory of Open Access Journals (Sweden)

    Nehir Ozdemir Ozgenturk

    2017-01-01

    Full Text Available Kivircik sheep is an important local Turkish sheep according to its meat quality and milk productivity. The aim of this study was to analyze gene expression profiles of both prenatal and postnatal stages for the Kivircik sheep. Therefore, two different cDNA libraries, which were taken from the same Kivircik sheep mammary gland tissue at prenatal and postnatal stages, were constructed. Total 3072 colonies which were randomly selected from the two libraries were sequenced for developing a sheep ESTs collection. We used Phred/Phrap computer programs for analysis of the raw EST and readable EST sequences were assembled with the CAP3 software. Putative functions of all unique sequences and statistical analysis were determined by Geneious software. Total 422 ESTs have over 80% similarity to known sequences of other organisms in NCBI classified by Panther database for the Gene Ontology (GO category. By comparing gene expression profiles, we observed some putative genes that may be relative to reproductive performance or play important roles in milk synthesis and secretion. A total of 2414 ESTs have been deposited to the NCBI GenBank database (GW996847–GW999260. EST data in this study have provided a new source of information to functional genome studies of sheep.

  8. De-MetaST-BLAST: a tool for the validation of degenerate primer sets and data mining of publicly available metagenomes.

    Directory of Open Access Journals (Sweden)

    Christopher A Gulvik

    Full Text Available Development and use of primer sets to amplify nucleic acid sequences of interest is fundamental to studies spanning many life science disciplines. As such, the validation of primer sets is essential. Several computer programs have been created to aid in the initial selection of primer sequences that may or may not require multiple nucleotide combinations (i.e., degeneracies. Conversely, validation of primer specificity has remained largely unchanged for several decades, and there are currently few available programs that allows for an evaluation of primers containing degenerate nucleotide bases. To alleviate this gap, we developed the program De-MetaST that performs an in silico amplification using user defined nucleotide sequence dataset(s and primer sequences that may contain degenerate bases. The program returns an output file that contains the in silico amplicons. When De-MetaST is paired with NCBI's BLAST (De-MetaST-BLAST, the program also returns the top 10 nr NCBI database hits for each recovered in silico amplicon. While the original motivation for development of this search tool was degenerate primer validation using the wealth of nucleotide sequences available in environmental metagenome and metatranscriptome databases, this search tool has potential utility in many data mining applications.

  9. The testis and ovary transcriptomes of the rock bream (Oplegnathus fasciatus: A bony fish with a unique neo Y chromosome

    Directory of Open Access Journals (Sweden)

    Dongdong Xu

    2016-03-01

    Full Text Available The rock bream (Oplegnathus fasciatus is considerably one of the most economically important marine fish in East Asia and has a unique neo-Y chromosome system that is a good model to study the sex determination and differentiation in fish. In the present study, we used Illumina sequencing technology (HiSeq2000 to sequence, assemble and annotate the transcriptome of the testis and ovary tissues of rock bream. A total of 40,004,378 (NCBI SRA database SRX1406649 and 53,108,992 (NCBI SRA database SRX1406648 high quality reads were obtained from testis and ovary RNA sequencing, respectively, and 60,421 contigs (with average length of 1301 bp were obtained after de novo assembling with Trinity software. Digital gene expression analysis reveals 14,036 contigs that show gender-enriched expressional profile with either testis-enriched (237 contigs or ovary-enriched (581 contigs with RPKM >100. There are 237 male- and 582 female-abundant expressed genes that show sex dimorphic expression. We hope that the gonad transcriptome and those gender-enriched transcripts of rock bream can provide some insight into the understanding of genome-wide transcriptome profile of teleost gonad tissue and give useful information in fish gonad development. Keywords: Gonad transcriptome, Testis, Ovary, Rock bream

  10. Database for propagation models

    Science.gov (United States)

    Kantak, Anil V.

    1991-07-01

    A propagation researcher or a systems engineer who intends to use the results of a propagation experiment is generally faced with various database tasks such as the selection of the computer software, the hardware, and the writing of the programs to pass the data through the models of interest. This task is repeated every time a new experiment is conducted or the same experiment is carried out at a different location generating different data. Thus the users of this data have to spend a considerable portion of their time learning how to implement the computer hardware and the software towards the desired end. This situation may be facilitated considerably if an easily accessible propagation database is created that has all the accepted (standardized) propagation phenomena models approved by the propagation research community. Also, the handling of data will become easier for the user. Such a database construction can only stimulate the growth of the propagation research it if is available to all the researchers, so that the results of the experiment conducted by one researcher can be examined independently by another, without different hardware and software being used. The database may be made flexible so that the researchers need not be confined only to the contents of the database. Another way in which the database may help the researchers is by the fact that they will not have to document the software and hardware tools used in their research since the propagation research community will know the database already. The following sections show a possible database construction, as well as properties of the database for the propagation research.

  11. Update History of This Database - TP Atlas | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available switchLanguage; BLAST Search Image Search Home About Archive Update History Data ...List Contact us TP Atlas Update History of This Database Date Update contents 2013/12/16 The email address i...s ( http://www.tanpaku.org/tpatlas/ ) is opened. About This Database Database Description Download License Update History of Thi...s Database Site Policy | Contact Us Update History of This Database - TP Atlas | LSDB Archive ... ...n the contact information is corrected. 2013/11/19 TP Atlas English archive site is opened. 2008/4/1 TP Atla

  12. Update History of This Database - KEGG MEDICUS | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available glish archive site is opened. 2010/10/01 KEGG MEDICUS ( http://www.kegg.jp/kegg/medicus/ ) is opened. About ...[ Credits ] English ]; } else if ( url.search(//en//) != -1 ) { url = url.replace(/...switchLanguage; BLAST Search Image Search Home About Archive Update History Data List Contact us KEGG MEDI...CUS Update History of This Database Date Update contents 2014/05/09 KEGG MEDICUS En...This Database Database Description Download License Update History of This Database Site Policy | Contact Us Update History of This Database - KEGG MEDICUS | LSDB Archive ...

  13. Coordinating Mobile Databases: A System Demonstration

    OpenAIRE

    Zaihrayeu, Ilya; Giunchiglia, Fausto

    2004-01-01

    In this paper we present the Peer Database Management System (PDBMS). This system runs on top of the standard database management system, and it allows it to connect its database with other (peer) databases on the network. A particularity of our solution is that PDBMS allows for conventional database technology to be effectively operational in mobile settings. We think of database mobility as a database network, where databases appear and disappear spontaneously and their network access point...

  14. Danish Urogynaecological Database

    DEFF Research Database (Denmark)

    Hansen, Ulla Darling; Gradel, Kim Oren; Larsen, Michael Due

    2016-01-01

    , complications if relevant, implants used if relevant, 3-6-month postoperative recording of symptoms, if any. A set of clinical quality indicators is being maintained by the steering committee for the database and is published in an annual report which also contains extensive descriptive statistics. The database......The Danish Urogynaecological Database is established in order to ensure high quality of treatment for patients undergoing urogynecological surgery. The database contains details of all women in Denmark undergoing incontinence surgery or pelvic organ prolapse surgery amounting to ~5,200 procedures...... has a completeness of over 90% of all urogynecological surgeries performed in Denmark. Some of the main variables have been validated using medical records as gold standard. The positive predictive value was above 90%. The data are used as a quality monitoring tool by the hospitals and in a number...

  15. LandIT Database

    DEFF Research Database (Denmark)

    Iftikhar, Nadeem; Pedersen, Torben Bach

    2010-01-01

    and reporting purposes. This paper presents the LandIT database; which is result of the LandIT project, which refers to an industrial collaboration project that developed technologies for communication and data integration between farming devices and systems. The LandIT database in principal is based...... on the ISOBUS standard; however the standard is extended with additional requirements, such as gradual data aggregation and flexible exchange of farming data. This paper describes the conceptual and logical schemas of the proposed database based on a real-life farming case study....

  16. Network-based Database Course

    DEFF Research Database (Denmark)

    Nielsen, J.N.; Knudsen, Morten; Nielsen, Jens Frederik Dalsgaard

    A course in database design and implementation has been de- signed, utilizing existing network facilities. The course is an elementary course for students of computer engineering. Its purpose is to give the students a theoretical database knowledge as well as practical experience with design...... and implementation. A tutorial relational database and the students self-designed databases are implemented on the UNIX system of Aalborg University, thus giving the teacher the possibility of live demonstrations in the lecture room, and the students the possibility of interactive learning in their working rooms...

  17. Migration Between NoSQL Databases

    OpenAIRE

    Opačak, Damir

    2013-01-01

    The thesis discusses the differences and, consequently, potential problems that may arise when migrating between different types of NoSQL databases. The first chapters introduce the reader to the issues of relational databases and present the beginnings of NoSQL databases. The following chapters present different types of NoSQL databases and some of their representatives with the aim to show specific features of NoSQL databases and the fact that each of them was developed to solve specifi...

  18. Update History of This Database - Q-TARO | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available switchLanguage; BLAST Search Image Search Home About Archive Update History Data ...List Contact us Q-TARO Update History of This Database Date Update contents 2014/10/20 The URL of the portal...ption Download License Update History of This Database Site Policy | Contact Us Update History of This Database - Q-TARO | LSDB Archive ... ... site is changed. 2013/12/17 The URL of the portal site is changed. 2013/12/13 Q-TARO English archive site i...s opened. 2009/11/15 Q-TARO ( http://qtaro.abr.affrc.go.jp/ ) is opened. About This Database Database Descri

  19. Comparison of the Frontier Distributed Database Caching System with NoSQL Databases

    CERN Document Server

    Dykstra, David

    2012-01-01

    One of the main attractions of non-relational "NoSQL" databases is their ability to scale to large numbers of readers, including readers spread over a wide area. The Frontier distributed database caching system, used in production by the Large Hadron Collider CMS and ATLAS detector projects for Conditions data, is based on traditional SQL databases but also has high scalability and wide-area distributability for an important subset of applications. This paper compares the major characteristics of the two different approaches and identifies the criteria for choosing which approach to prefer over the other. It also compares in some detail the NoSQL databases used by CMS and ATLAS: MongoDB, CouchDB, HBase, and Cassandra.

  20. Detailed insight into hordeins expression in high protein cultivars as a first stage to improve feed quality

    DEFF Research Database (Denmark)

    Kaczmarczyk, Agnieszka Ewa; Aaslo, Per; Vincze, Éva

    2011-01-01

    development. All the known hordein coding sequences collected from commonly available databases (NCBI, HarvEST) were classified into groups and subgroups (B1, B3, C, D and Γ). Specific primers were designed with Primique and AlleleID softwares and checked with qRT-PCR first on the control cultivar Golden...... and analyzed using two chemometrics methods: PCA and PLS. Obtained models give an impression about correlations present in and among these two phenomena....

  1. Towards cloud-centric distributed database evaluation

    OpenAIRE

    Seybold, Daniel

    2016-01-01

    The area of cloud computing also pushed the evolvement of distributed databases, resulting in a variety of distributed database systems, which can be classified in relation databases, NoSQL and NewSQL database systems. In general all representatives of these database system classes claim to provide elasticity and "unlimited" horizontal scalability. As these characteristics comply with the cloud, distributed databases seem to be a perfect match for Database-as-a-Service systems (DBaaS).

  2. Towards Cloud-centric Distributed Database Evaluation

    OpenAIRE

    Seybold, Daniel

    2016-01-01

    The area of cloud computing also pushed the evolvement of distributed databases, resulting in a variety of distributed database systems, which can be classified in relation databases, NoSQL and NewSQL database systems. In general all representatives of these database system classes claim to provide elasticity and "unlimited" horizontal scalability. As these characteristics comply with the cloud, distributed databases seem to be a perfect match for Database-as-a-Service systems (DBaaS).

  3. REPLIKASI UNIDIRECTIONAL PADA HETEROGEN DATABASE

    OpenAIRE

    Hendro Nindito; Evaristus Didik Madyatmadja; Albert Verasius Dian Sano

    2013-01-01

    The use of diverse database technology in enterprise today can not be avoided. Thus, technology is needed to generate information in real time. The purpose of this research is to discuss a database replication technology that can be applied in heterogeneous database environments. In this study we use Windows-based MS SQL Server database to Linux-based Oracle database as the goal. The research method used is prototyping where development can be done quickly and testing of working models of the...

  4. The Danish Testicular Cancer database

    DEFF Research Database (Denmark)

    Daugaard, Gedske; Kier, Maria Gry Gundgaard; Bandak, Mikkel

    2016-01-01

    AIM: The nationwide Danish Testicular Cancer database consists of a retrospective research database (DaTeCa database) and a prospective clinical database (Danish Multidisciplinary Cancer Group [DMCG] DaTeCa database). The aim is to improve the quality of care for patients with testicular cancer (TC......) in Denmark, that is, by identifying risk factors for relapse, toxicity related to treatment, and focusing on late effects. STUDY POPULATION: All Danish male patients with a histologically verified germ cell cancer diagnosis in the Danish Pathology Registry are included in the DaTeCa databases. Data...... collection has been performed from 1984 to 2007 and from 2013 onward, respectively. MAIN VARIABLES AND DESCRIPTIVE DATA: The retrospective DaTeCa database contains detailed information with more than 300 variables related to histology, stage, treatment, relapses, pathology, tumor markers, kidney function...

  5. Replikasi Unidirectional pada Heterogen Database

    Directory of Open Access Journals (Sweden)

    Hendro Nindito

    2013-12-01

    Full Text Available The use of diverse database technology in enterprise today can not be avoided. Thus, technology is needed to generate information in real time. The purpose of this research is to discuss a database replication technology that can be applied in heterogeneous database environments. In this study we use Windows-based MS SQL Server database to Linux-based Oracle database as the goal. The research method used is prototyping where development can be done quickly and testing of working models of the interaction process is done through repeated. From this research it is obtained that the database replication technolgy using Oracle Golden Gate can be applied in heterogeneous environments in real time as well.

  6. Danish clinical databases: An overview

    DEFF Research Database (Denmark)

    Green, Anders

    2011-01-01

    Clinical databases contain data related to diagnostic procedures, treatments and outcomes. In 2001, a scheme was introduced for the approval, supervision and support to clinical databases in Denmark.......Clinical databases contain data related to diagnostic procedures, treatments and outcomes. In 2001, a scheme was introduced for the approval, supervision and support to clinical databases in Denmark....

  7. Dictionary as Database.

    Science.gov (United States)

    Painter, Derrick

    1996-01-01

    Discussion of dictionaries as databases focuses on the digitizing of The Oxford English dictionary (OED) and the use of Standard Generalized Mark-Up Language (SGML). Topics include the creation of a consortium to digitize the OED, document structure, relational databases, text forms, sequence, and discourse. (LRW)

  8. INIST: databases reorientation

    International Nuclear Information System (INIS)

    Bidet, J.C.

    1995-01-01

    INIST is a CNRS (Centre National de la Recherche Scientifique) laboratory devoted to the treatment of scientific and technical informations and to the management of these informations compiled in a database. Reorientation of the database content has been proposed in 1994 to increase the transfer of research towards enterprises and services, to develop more automatized accesses to the informations, and to create a quality assurance plan. The catalog of publications comprises 5800 periodical titles (1300 for fundamental research and 4500 for applied research). A science and technology multi-thematic database will be created in 1995 for the retrieval of applied and technical informations. ''Grey literature'' (reports, thesis, proceedings..) and human and social sciences data will be added to the base by the use of informations selected in the existing GRISELI and Francis databases. Strong modifications are also planned in the thematic cover of Earth sciences and will considerably reduce the geological information content. (J.S.). 1 tab

  9. The Danish Testicular Cancer database

    Directory of Open Access Journals (Sweden)

    Daugaard G

    2016-10-01

    Full Text Available Gedske Daugaard,1 Maria Gry Gundgaard Kier,1 Mikkel Bandak,1 Mette Saksø Mortensen,1 Heidi Larsson,2 Mette Søgaard,2 Birgitte Groenkaer Toft,3 Birte Engvad,4 Mads Agerbæk,5 Niels Vilstrup Holm,6 Jakob Lauritsen1 1Department of Oncology 5073, Copenhagen University Hospital, Rigshospitalet, Copenhagen, 2Department of Clinical Epidemiology, Aarhus University Hospital, Aarhus, 3Department of Pathology, Copenhagen University Hospital, Rigshospitalet, Copenhagen, 4Department of Pathology, Odense University Hospital, Odense, 5Department of Oncology, Aarhus University Hospital, Aarhus, 6Department of Oncology, Odense University Hospital, Odense, Denmark Aim: The nationwide Danish Testicular Cancer database consists of a retrospective research database (DaTeCa database and a prospective clinical database (Danish Multidisciplinary Cancer Group [DMCG] DaTeCa database. The aim is to improve the quality of care for patients with testicular cancer (TC in Denmark, that is, by identifying risk factors for relapse, toxicity related to treatment, and focusing on late effects. Study population: All Danish male patients with a histologically verified germ cell cancer diagnosis in the Danish Pathology Registry are included in the DaTeCa databases. Data collection has been performed from 1984 to 2007 and from 2013 onward, respectively. Main variables and descriptive data: The retrospective DaTeCa database contains detailed information with more than 300 variables related to histology, stage, treatment, relapses, pathology, tumor markers, kidney function, lung function, etc. A questionnaire related to late effects has been conducted, which includes questions regarding social relationships, life situation, general health status, family background, diseases, symptoms, use of medication, marital status, psychosocial issues, fertility, and sexuality. TC survivors alive on October 2014 were invited to fill in this questionnaire including 160 validated questions

  10. Comparison of the Frontier Distributed Database Caching System to NoSQL Databases

    Science.gov (United States)

    Dykstra, Dave

    2012-12-01

    One of the main attractions of non-relational “NoSQL” databases is their ability to scale to large numbers of readers, including readers spread over a wide area. The Frontier distributed database caching system, used in production by the Large Hadron Collider CMS and ATLAS detector projects for Conditions data, is based on traditional SQL databases but also adds high scalability and the ability to be distributed over a wide-area for an important subset of applications. This paper compares the major characteristics of the two different approaches and identifies the criteria for choosing which approach to prefer over the other. It also compares in some detail the NoSQL databases used by CMS and ATLAS: MongoDB, CouchDB, HBase, and Cassandra.

  11. Comparison of the Frontier Distributed Database Caching System to NoSQL Databases

    International Nuclear Information System (INIS)

    Dykstra, Dave

    2012-01-01

    One of the main attractions of non-relational “NoSQL” databases is their ability to scale to large numbers of readers, including readers spread over a wide area. The Frontier distributed database caching system, used in production by the Large Hadron Collider CMS and ATLAS detector projects for Conditions data, is based on traditional SQL databases but also adds high scalability and the ability to be distributed over a wide-area for an important subset of applications. This paper compares the major characteristics of the two different approaches and identifies the criteria for choosing which approach to prefer over the other. It also compares in some detail the NoSQL databases used by CMS and ATLAS: MongoDB, CouchDB, HBase, and Cassandra.

  12. Comparison of the Frontier Distributed Database Caching System to NoSQL Databases

    Energy Technology Data Exchange (ETDEWEB)

    Dykstra, Dave [Fermilab

    2012-07-20

    One of the main attractions of non-relational NoSQL databases is their ability to scale to large numbers of readers, including readers spread over a wide area. The Frontier distributed database caching system, used in production by the Large Hadron Collider CMS and ATLAS detector projects for Conditions data, is based on traditional SQL databases but also adds high scalability and the ability to be distributed over a wide-area for an important subset of applications. This paper compares the major characteristics of the two different approaches and identifies the criteria for choosing which approach to prefer over the other. It also compares in some detail the NoSQL databases used by CMS and ATLAS: MongoDB, CouchDB, HBase, and Cassandra.

  13. Development of database on the distribution coefficient. 2. Preparation of database

    Energy Technology Data Exchange (ETDEWEB)

    Takebe, Shinichi; Abe, Masayoshi [Japan Atomic Energy Research Inst., Tokai, Ibaraki (Japan). Tokai Research Establishment

    2001-03-01

    The distribution coefficient is very important parameter for environmental impact assessment on the disposal of radioactive waste arising from research institutes. 'Database on the Distribution Coefficient' was built up from the informations which were obtained by the literature survey in the country for these various items such as value , measuring method and measurement condition of distribution coefficient, in order to select the reasonable distribution coefficient value on the utilization of this value in the safety evaluation. This report was explained about the outline on preparation of this database and was summarized as a use guide book of database. (author)

  14. Development of database on the distribution coefficient. 2. Preparation of database

    Energy Technology Data Exchange (ETDEWEB)

    Takebe, Shinichi; Abe, Masayoshi [Japan Atomic Energy Research Inst., Tokai, Ibaraki (Japan). Tokai Research Establishment

    2001-03-01

    The distribution coefficient is very important parameter for environmental impact assessment on the disposal of radioactive waste arising from research institutes. 'Database on the Distribution Coefficient' was built up from the informations which were obtained by the literature survey in the country for these various items such as value , measuring method and measurement condition of distribution coefficient, in order to select the reasonable distribution coefficient value on the utilization of this value in the safety evaluation. This report was explained about the outline on preparation of this database and was summarized as a use guide book of database. (author)

  15. Balkan Vegetation Database

    NARCIS (Netherlands)

    Vassilev, Kiril; Pedashenko, Hristo; Alexandrova, Alexandra; Tashev, Alexandar; Ganeva, Anna; Gavrilova, Anna; Gradevska, Asya; Assenov, Assen; Vitkova, Antonina; Grigorov, Borislav; Gussev, Chavdar; Filipova, Eva; Aneva, Ina; Knollová, Ilona; Nikolov, Ivaylo; Georgiev, Georgi; Gogushev, Georgi; Tinchev, Georgi; Pachedjieva, Kalina; Koev, Koycho; Lyubenova, Mariyana; Dimitrov, Marius; Apostolova-Stoyanova, Nadezhda; Velev, Nikolay; Zhelev, Petar; Glogov, Plamen; Natcheva, Rayna; Tzonev, Rossen; Boch, Steffen; Hennekens, Stephan M.; Georgiev, Stoyan; Stoyanov, Stoyan; Karakiev, Todor; Kalníková, Veronika; Shivarov, Veselin; Russakova, Veska; Vulchev, Vladimir

    2016-01-01

    The Balkan Vegetation Database (BVD; GIVD ID: EU-00-019; http://www.givd.info/ID/EU-00- 019) is a regional database that consists of phytosociological relevés from different vegetation types from six countries on the Balkan Peninsula (Albania, Bosnia and Herzegovina, Bulgaria, Kosovo, Montenegro

  16. Proceedings of the Canadian Society for Bioengineering CSBE/SCGAB 2009 annual general meeting and technical conference

    International Nuclear Information System (INIS)

    2009-01-01

    This conference was attended by experts on current issues in engineering of an urban ecosystem, composting, biofuels and green energy. The meeting provided a forum to discuss advances in the application of engineering principles and practices dealing with biological systems for the production of food, bioproducts and energy. The discussions focused on engineering practices in agriculture, forestry, bioresources, biochemistry and biosystems. The 7 technical sessions of the conference were entitled: aquaculture; safety and training; bioprocessing; energy production and biofuels; environment and ecology; soil and water; and development of technologies. The conference feature 58 presentations, of which 9 have been catalogued separately for inclusion in this database. refs., tabs., figs

  17. Update History of This Database - GenLibi | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available switchLanguage; BLAST Search Image Search Home About Archive Update History Data ...List Contact us GenLibi Update History of This Database Date Update contents 2014/03/25 GenLibi English archi...base Description Download License Update History of This Database Site Policy | Contact Us Update History of This Database - GenLibi | LSDB Archive ... ...ve site is opened. 2007/03/01 GenLibi ( http://gene.biosciencedbc.jp/ ) is opened. About This Database Data

  18. Update History of This Database - dbQSNP | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available switchLanguage; BLAST Search Image Search Home About Archive Update History Data ...List Contact us dbQSNP Update History of This Database Date Update contents 2017/02/16 dbQSNP English archiv...e Description Download License Update History of This Database Site Policy | Contact Us Update History of This Database - dbQSNP | LSDB Archive ... ...e site is opened. 2002/10/23 dbQSNP (http://qsnp.gen.kyushu-u.ac.jp/) is opened. About This Database Databas

  19. A new relational database structure and online interface for the HITRAN database

    Science.gov (United States)

    Hill, Christian; Gordon, Iouli E.; Rothman, Laurence S.; Tennyson, Jonathan

    2013-11-01

    A new format for the HITRAN database is proposed. By storing the line-transition data in a number of linked tables described by a relational database schema, it is possible to overcome the limitations of the existing format, which have become increasingly apparent over the last few years as new and more varied data are being used by radiative-transfer models. Although the database in the new format can be searched using the well-established Structured Query Language (SQL), a web service, HITRANonline, has been deployed to allow users to make most common queries of the database using a graphical user interface in a web page. The advantages of the relational form of the database to ensuring data integrity and consistency are explored, and the compatibility of the online interface with the emerging standards of the Virtual Atomic and Molecular Data Centre (VAMDC) project is discussed. In particular, the ability to access HITRAN data using a standard query language from other websites, command line tools and from within computer programs is described.

  20. Linking the Taiwan Fish Database to the Global Database

    Directory of Open Access Journals (Sweden)

    Kwang-Tsao Shao

    2007-03-01

    Full Text Available Under the support of the National Digital Archive Program (NDAP, basic species information about most Taiwanese fishes, including their morphology, ecology, distribution, specimens with photos, and literatures have been compiled into the "Fish Database of Taiwan" (http://fishdb.sinica.edu.tw. We expect that the all Taiwanese fish species databank (RSD, with 2800+ species, and the digital "Fish Fauna of Taiwan" will be completed in 2007. Underwater ecological photos and video images for all 2,800+ fishes are quite difficult to achieve but will be collected continuously in the future. In the last year of NDAP, we have successfully integrated all fish specimen data deposited at 7 different institutes in Taiwan as well as their collection maps on the Google Map and Google Earth. Further, the database also provides the pronunciation of Latin scientific names and transliteration of Chinese common names by referring to the Romanization system for all Taiwanese fishes (2,902 species in 292 families so far. The Taiwanese fish species checklist with Chinese common/vernacular names and specimen data has been updated periodically and provided to the global FishBase as well as the Global Biodiversity Information Facility (GBIF through the national portal of the Taiwan Biodiversity Information Facility (TaiBIF. Thus, Taiwanese fish data can be queried and browsed on the WWW. For contributing to the "Barcode of Life" and "All Fishes" international projects, alcohol-preserved specimens of more than 1,800 species and cryobanking tissues of 800 species have been accumulated at RCBAS in the past two years. Through this close collaboration between local and global databases, "The Fish Database of Taiwan" now attracts more than 250,000 visitors and achieves 5 million hits per month. We believe that this local database is becoming an important resource for education, research, conservation, and sustainable use of fish in Taiwan.

  1. Tradeoffs in distributed databases

    OpenAIRE

    Juntunen, R. (Risto)

    2016-01-01

    Abstract In a distributed database data is spread throughout the network into separated nodes with different DBMS systems (Date, 2000). According to CAP-theorem three database properties — consistency, availability and partition tolerance cannot be achieved simultaneously in distributed database systems. Two of these properties can be achieved but not all three at the same time (Brewer, 2000). Since this theorem there has b...

  2. Automated Oracle database testing

    CERN Multimedia

    CERN. Geneva

    2014-01-01

    Ensuring database stability and steady performance in the modern world of agile computing is a major challenge. Various changes happening at any level of the computing infrastructure: OS parameters & packages, kernel versions, database parameters & patches, or even schema changes, all can potentially harm production services. This presentation shows how an automatic and regular testing of Oracle databases can be achieved in such agile environment.

  3. Database Systems - Present and Future

    Directory of Open Access Journals (Sweden)

    2009-01-01

    Full Text Available The database systems have nowadays an increasingly important role in the knowledge-based society, in which computers have penetrated all fields of activity and the Internet tends to develop worldwide. In the current informatics context, the development of the applications with databases is the work of the specialists. Using databases, reach a database from various applications, and also some of related concepts, have become accessible to all categories of IT users. This paper aims to summarize the curricular area regarding the fundamental database systems issues, which are necessary in order to train specialists in economic informatics higher education. The database systems integrate and interfere with several informatics technologies and therefore are more difficult to understand and use. Thus, students should know already a set of minimum, mandatory concepts and their practical implementation: computer systems, programming techniques, programming languages, data structures. The article also presents the actual trends in the evolution of the database systems, in the context of economic informatics.

  4. Database on wind characteristics. Contents of database bank

    DEFF Research Database (Denmark)

    Larsen, Gunner Chr.; Hansen, K.S.

    2001-01-01

    for the available data in the established database bank and part three is the Users Manual describing the various ways to access and analyse the data. The present report constitutes the second part of the Annex XVII reporting. Basically, the database bank contains three categories of data, i.e. i) high sampled wind...... field time series; ii) high sampled wind turbine structural response time series; andiii) wind resource data. The main emphasis, however, is on category i). The available data, within each of the three categories, are described in details. The description embraces site characteristics, terrain type...

  5. USAID Anticorruption Projects Database

    Data.gov (United States)

    US Agency for International Development — The Anticorruption Projects Database (Database) includes information about USAID projects with anticorruption interventions implemented worldwide between 2007 and...

  6. Database design using entity-relationship diagrams

    CERN Document Server

    Bagui, Sikha

    2011-01-01

    Data, Databases, and the Software Engineering ProcessDataBuilding a DatabaseWhat is the Software Engineering Process?Entity Relationship Diagrams and the Software Engineering Life Cycle          Phase 1: Get the Requirements for the Database          Phase 2: Specify the Database          Phase 3: Design the DatabaseData and Data ModelsFiles, Records, and Data ItemsMoving from 3 × 5 Cards to ComputersDatabase Models     The Hierarchical ModelThe Network ModelThe Relational ModelThe Relational Model and Functional DependenciesFundamental Relational DatabaseRelational Database and SetsFunctional

  7. Respiratory cancer database: An open access database of respiratory cancer gene and miRNA.

    Science.gov (United States)

    Choubey, Jyotsna; Choudhari, Jyoti Kant; Patel, Ashish; Verma, Mukesh Kumar

    2017-01-01

    Respiratory cancer database (RespCanDB) is a genomic and proteomic database of cancer of respiratory organ. It also includes the information of medicinal plants used for the treatment of various respiratory cancers with structure of its active constituents as well as pharmacological and chemical information of drug associated with various respiratory cancers. Data in RespCanDB has been manually collected from published research article and from other databases. Data has been integrated using MySQL an object-relational database management system. MySQL manages all data in the back-end and provides commands to retrieve and store the data into the database. The web interface of database has been built in ASP. RespCanDB is expected to contribute to the understanding of scientific community regarding respiratory cancer biology as well as developments of new way of diagnosing and treating respiratory cancer. Currently, the database consist the oncogenomic information of lung cancer, laryngeal cancer, and nasopharyngeal cancer. Data for other cancers, such as oral and tracheal cancers, will be added in the near future. The URL of RespCanDB is http://ridb.subdic-bioinformatics-nitrr.in/.

  8. ADANS database specification

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1997-01-16

    The purpose of the Air Mobility Command (AMC) Deployment Analysis System (ADANS) Database Specification (DS) is to describe the database organization and storage allocation and to provide the detailed data model of the physical design and information necessary for the construction of the parts of the database (e.g., tables, indexes, rules, defaults). The DS includes entity relationship diagrams, table and field definitions, reports on other database objects, and a description of the ADANS data dictionary. ADANS is the automated system used by Headquarters AMC and the Tanker Airlift Control Center (TACC) for airlift planning and scheduling of peacetime and contingency operations as well as for deliberate planning. ADANS also supports planning and scheduling of Air Refueling Events by the TACC and the unit-level tanker schedulers. ADANS receives input in the form of movement requirements and air refueling requests. It provides a suite of tools for planners to manipulate these requirements/requests against mobility assets and to develop, analyze, and distribute schedules. Analysis tools are provided for assessing the products of the scheduling subsystems, and editing capabilities support the refinement of schedules. A reporting capability provides formatted screen, print, and/or file outputs of various standard reports. An interface subsystem handles message traffic to and from external systems. The database is an integral part of the functionality summarized above.

  9. Construction of a medicinal leech transcriptome database and its application to the identification of leech homologs of neural and innate immune genes

    Directory of Open Access Journals (Sweden)

    Wincker Patrick

    2010-06-01

    Full Text Available Abstract Background The medicinal leech, Hirudo medicinalis, is an important model system for the study of nervous system structure, function, development, regeneration and repair. It is also a unique species in being presently approved for use in medical procedures, such as clearing of pooled blood following certain surgical procedures. It is a current, and potentially also future, source of medically useful molecular factors, such as anticoagulants and antibacterial peptides, which may have evolved as a result of its parasitizing large mammals, including humans. Despite the broad focus of research on this system, little has been done at the genomic or transcriptomic levels and there is a paucity of openly available sequence data. To begin to address this problem, we constructed whole embryo and adult central nervous system (CNS EST libraries and created a clustered sequence database of the Hirudo transcriptome that is available to the scientific community. Results A total of ~133,000 EST clones from two directionally-cloned cDNA libraries, one constructed from mRNA derived from whole embryos at several developmental stages and the other from adult CNS cords, were sequenced in one or both directions by three different groups: Genoscope (French National Sequencing Center, the University of Iowa Sequencing Facility and the DOE Joint Genome Institute. These were assembled using the phrap software package into 31,232 unique contigs and singletons, with an average length of 827 nt. The assembled transcripts were then translated in all six frames and compared to proteins in NCBI's non-redundant (NR and to the Gene Ontology (GO protein sequence databases, resulting in 15,565 matches to 11,236 proteins in NR and 13,935 matches to 8,073 proteins in GO. Searching the database for transcripts of genes homologous to those thought to be involved in the innate immune responses of vertebrates and other invertebrates yielded a set of nearly one hundred

  10. Construction of a medicinal leech transcriptome database and its application to the identification of leech homologs of neural and innate immune genes.

    Science.gov (United States)

    Macagno, Eduardo R; Gaasterland, Terry; Edsall, Lee; Bafna, Vineet; Soares, Marcelo B; Scheetz, Todd; Casavant, Thomas; Da Silva, Corinne; Wincker, Patrick; Tasiemski, Aurélie; Salzet, Michel

    2010-06-25

    The medicinal leech, Hirudo medicinalis, is an important model system for the study of nervous system structure, function, development, regeneration and repair. It is also a unique species in being presently approved for use in medical procedures, such as clearing of pooled blood following certain surgical procedures. It is a current, and potentially also future, source of medically useful molecular factors, such as anticoagulants and antibacterial peptides, which may have evolved as a result of its parasitizing large mammals, including humans. Despite the broad focus of research on this system, little has been done at the genomic or transcriptomic levels and there is a paucity of openly available sequence data. To begin to address this problem, we constructed whole embryo and adult central nervous system (CNS) EST libraries and created a clustered sequence database of the Hirudo transcriptome that is available to the scientific community. A total of approximately 133,000 EST clones from two directionally-cloned cDNA libraries, one constructed from mRNA derived from whole embryos at several developmental stages and the other from adult CNS cords, were sequenced in one or both directions by three different groups: Genoscope (French National Sequencing Center), the University of Iowa Sequencing Facility and the DOE Joint Genome Institute. These were assembled using the phrap software package into 31,232 unique contigs and singletons, with an average length of 827 nt. The assembled transcripts were then translated in all six frames and compared to proteins in NCBI's non-redundant (NR) and to the Gene Ontology (GO) protein sequence databases, resulting in 15,565 matches to 11,236 proteins in NR and 13,935 matches to 8,073 proteins in GO. Searching the database for transcripts of genes homologous to those thought to be involved in the innate immune responses of vertebrates and other invertebrates yielded a set of nearly one hundred evolutionarily conserved sequences

  11. De novo transcriptome assembly of two contrasting pumpkin cultivars

    Directory of Open Access Journals (Sweden)

    Aliki Xanthopoulou

    2016-03-01

    Full Text Available Cucurbita pepo (squash, pumpkin, gourd, a worldwide-cultivated vegetable of American origin, is extremely variable in fruit characteristics. However, the information associated with genes and genetic markers for pumpkin is very limited. In order to identify new genes and to develop genetic markers, we performed a transcriptome analysis (RNA-Seq of two contrasting pumpkin cultivars. Leaves and female flowers of cultivars, ‘Big Moose’ with large round fruits and ‘Munchkin’ with small round fruits, were harvested for total RNA extraction. We obtained a total of 6 GB (Big Moose; http://www.ncbi.nlm.nih.gov/Traces/sra/?run=SRR3056882 and 5 GB (Munchkin; http://www.ncbi.nlm.nih.gov/Traces/sra/?run=SRR3056883 sequence data (NCBI SRA database SRX1502732 and SRX1502735, respectively, which correspond to 18,055,786 and 14,824,292 150-base reads. After quality assessment, the clean sequences where 17,995,932 and 14,774,486 respectively. The numbers of total transcripts for ‘Big Moose’ and ‘Munchkin’ were 84,727 and 68,051, respectively. TransDecoder identified possible coding regions in assembled transcripts. This study provides transcriptome data for two contrasting pumpkin cultivars, which might be useful for genetic marker development and comparative transcriptome analyses. Keywords: RNA-Seq, Pumpkin, Contrasting cultivars, Cucurbita pepo

  12. Generation and analysis of a large-scale expressed sequence Tag database from a full-length enriched cDNA library of developing leaves of Gossypium hirsutum L.

    Directory of Open Access Journals (Sweden)

    Min Lin

    Full Text Available BACKGROUND: Cotton (Gossypium hirsutum L. is one of the world's most economically-important crops. However, its entire genome has not been sequenced, and limited resources are available in GenBank for understanding the molecular mechanisms underlying leaf development and senescence. METHODOLOGY/PRINCIPAL FINDINGS: In this study, 9,874 high-quality ESTs were generated from a normalized, full-length cDNA library derived from pooled RNA isolated from throughout leaf development during the plant blooming stage. After clustering and assembly of these ESTs, 5,191 unique sequences, representative 1,652 contigs and 3,539 singletons, were obtained. The average unique sequence length was 682 bp. Annotation of these unique sequences revealed that 84.4% showed significant homology to sequences in the NCBI non-redundant protein database, and 57.3% had significant hits to known proteins in the Swiss-Prot database. Comparative analysis indicated that our library added 2,400 ESTs and 991 unique sequences to those known for cotton. The unigenes were functionally characterized by gene ontology annotation. We identified 1,339 and 200 unigenes as potential leaf senescence-related genes and transcription factors, respectively. Moreover, nine genes related to leaf senescence and eleven MYB transcription factors were randomly selected for quantitative real-time PCR (qRT-PCR, which revealed that these genes were regulated differentially during senescence. The qRT-PCR for three GhYLSs revealed that these genes express express preferentially in senescent leaves. CONCLUSIONS/SIGNIFICANCE: These EST resources will provide valuable sequence information for gene expression profiling analyses and functional genomics studies to elucidate their roles, as well as for studying the mechanisms of leaf development and senescence in cotton and discovering candidate genes related to important agronomic traits of cotton. These data will also facilitate future whole-genome sequence

  13. The Hanford Site generic component failure-rate database compared with other generic failure-rate databases

    International Nuclear Information System (INIS)

    Reardon, M.F.; Zentner, M.D.

    1992-11-01

    The Risk Assessment Technology Group, Westinghouse Hanford Company (WHC), has compiled a component failure rate database to be used during risk and reliability analysis of nonreactor facilities. Because site-specific data for the Hanford Site are generally not kept or not compiled in a usable form, the database was assembled using information from a variety of other established sources. Generally, the most conservative failure rates were chosen from the databases reviewed. The Hanford Site database has since been used extensively in fault tree modeling of many Hanford Site facilities and systems. The purpose of this study was to evaluate the reasonableness of the data chosen for the Hanford Site database by comparing the values chosen with the values from the other databases

  14. Method and electronic database search engine for exposing the content of an electronic database

    NARCIS (Netherlands)

    Stappers, P.J.

    2000-01-01

    The invention relates to an electronic database search engine comprising an electronic memory device suitable for storing and releasing elements from the database, a display unit, a user interface for selecting and displaying at least one element from the database on the display unit, and control

  15. The LHCb configuration database

    CERN Document Server

    Abadie, L; Van Herwijnen, Eric; Jacobsson, R; Jost, B; Neufeld, N

    2005-01-01

    The aim of the LHCb configuration database is to store information about all the controllable devices of the detector. The experiment's control system (that uses PVSS ) will configure, start up and monitor the detector from the information in the configuration database. The database will contain devices with their properties, connectivity and hierarchy. The ability to store and rapidly retrieve huge amounts of data, and the navigability between devices are important requirements. We have collected use cases to ensure the completeness of the design. Using the entity relationship modelling technique we describe the use cases as classes with attributes and links. We designed the schema for the tables using relational diagrams. This methodology has been applied to the TFC (switches) and DAQ system. Other parts of the detector will follow later. The database has been implemented using Oracle to benefit from central CERN database support. The project also foresees the creation of tools to populate, maintain, and co...

  16. The CUTLASS database facilities

    International Nuclear Information System (INIS)

    Jervis, P.; Rutter, P.

    1988-09-01

    The enhancement of the CUTLASS database management system to provide improved facilities for data handling is seen as a prerequisite to its effective use for future power station data processing and control applications. This particularly applies to the larger projects such as AGR data processing system refurbishments, and the data processing systems required for the new Coal Fired Reference Design stations. In anticipation of the need for improved data handling facilities in CUTLASS, the CEGB established a User Sub-Group in the early 1980's to define the database facilities required by users. Following the endorsement of the resulting specification and a detailed design study, the database facilities have been implemented as an integral part of the CUTLASS system. This paper provides an introduction to the range of CUTLASS Database facilities, and emphasises the role of Database as the central facility around which future Kit 1 and (particularly) Kit 6 CUTLASS based data processing and control systems will be designed and implemented. (author)

  17. Kazusa Marker DataBase: a database for genomics, genetics, and molecular breeding in plants

    Science.gov (United States)

    Shirasawa, Kenta; Isobe, Sachiko; Tabata, Satoshi; Hirakawa, Hideki

    2014-01-01

    In order to provide useful genomic information for agronomical plants, we have established a database, the Kazusa Marker DataBase (http://marker.kazusa.or.jp). This database includes information on DNA markers, e.g., SSR and SNP markers, genetic linkage maps, and physical maps, that were developed at the Kazusa DNA Research Institute. Keyword searches for the markers, sequence data used for marker development, and experimental conditions are also available through this database. Currently, 10 plant species have been targeted: tomato (Solanum lycopersicum), pepper (Capsicum annuum), strawberry (Fragaria × ananassa), radish (Raphanus sativus), Lotus japonicus, soybean (Glycine max), peanut (Arachis hypogaea), red clover (Trifolium pratense), white clover (Trifolium repens), and eucalyptus (Eucalyptus camaldulensis). In addition, the number of plant species registered in this database will be increased as our research progresses. The Kazusa Marker DataBase will be a useful tool for both basic and applied sciences, such as genomics, genetics, and molecular breeding in crops. PMID:25320561

  18. HIV Structural Database

    Science.gov (United States)

    SRD 102 HIV Structural Database (Web, free access)   The HIV Protease Structural Database is an archive of experimentally determined 3-D structures of Human Immunodeficiency Virus 1 (HIV-1), Human Immunodeficiency Virus 2 (HIV-2) and Simian Immunodeficiency Virus (SIV) Proteases and their complexes with inhibitors or products of substrate cleavage.

  19. Towards Sensor Database Systems

    DEFF Research Database (Denmark)

    Bonnet, Philippe; Gehrke, Johannes; Seshadri, Praveen

    2001-01-01

    . These systems lack flexibility because data is extracted in a predefined way; also, they do not scale to a large number of devices because large volumes of raw data are transferred regardless of the queries that are submitted. In our new concept of sensor database system, queries dictate which data is extracted...... from the sensors. In this paper, we define the concept of sensor databases mixing stored data represented as relations and sensor data represented as time series. Each long-running query formulated over a sensor database defines a persistent view, which is maintained during a given time interval. We...... also describe the design and implementation of the COUGAR sensor database system....

  20. Hydrogen Leak Detection Sensor Database

    Science.gov (United States)

    Baker, Barton D.

    2010-01-01

    This slide presentation reviews the characteristics of the Hydrogen Sensor database. The database is the result of NASA's continuing interest in and improvement of its ability to detect and assess gas leaks in space applications. The database specifics and a snapshot of an entry in the database are reviewed. Attempts were made to determine the applicability of each of the 65 sensors for ground and/or vehicle use.

  1. RODOS database adapter

    International Nuclear Information System (INIS)

    Xie Gang

    1995-11-01

    Integrated data management is an essential aspect of many automatical information systems such as RODOS, a real-time on-line decision support system for nuclear emergency management. In particular, the application software must provide access management to different commercial database systems. This report presents the tools necessary for adapting embedded SQL-applications to both HP-ALLBASE/SQL and CA-Ingres/SQL databases. The design of the database adapter and the concept of RODOS embedded SQL syntax are discussed by considering some of the most important features of SQL-functions and the identification of significant differences between SQL-implementations. Finally fully part of the software developed and the administrator's and installation guides are described. (orig.) [de

  2. Education of indoor enviromental engineering technology

    Czech Academy of Sciences Publication Activity Database

    Kic, P.; Zajíček, Milan

    2011-01-01

    Roč. 9, Spec. 1 (2011), s. 83-90 ISSN 1406-894X. [Biosystems Engineering 2011. Tartu, 12.05.2011-13.05.2011] Institutional research plan: CEZ:AV0Z10750506 Keywords : Biosystems engineering * indoor environment * study * programs Subject RIV: AM - Education http://library.utia.cas.cz/separaty/2011/VS/zajicek-education of indoor enviromental engineering technology.pdf

  3. Supply Chain Initiatives Database

    Energy Technology Data Exchange (ETDEWEB)

    None

    2012-11-01

    The Supply Chain Initiatives Database (SCID) presents innovative approaches to engaging industrial suppliers in efforts to save energy, increase productivity and improve environmental performance. This comprehensive and freely-accessible database was developed by the Institute for Industrial Productivity (IIP). IIP acknowledges Ecofys for their valuable contributions. The database contains case studies searchable according to the types of activities buyers are undertaking to motivate suppliers, target sector, organization leading the initiative, and program or partnership linkages.

  4. The IRPVM-DB database

    International Nuclear Information System (INIS)

    Davies, L.M.; Gillemot, F.; Yanko, L.; Lyssakov, V.

    1997-01-01

    The IRPVM-DB (International Reactor Pressure Vessel Material Database) initiated by the IAEA IWG LMNPP is going to collect the available surveillance and research data world-wide on RPV material ageing. This paper presents the purpose of the database; it summarizes the type and the relationship of data included; it gives information about the data access and protection; and finally, it summarizes the state of art of the database. (author). 1 ref., 2 figs

  5. The IRPVM-DB database

    Energy Technology Data Exchange (ETDEWEB)

    Davies, L M [Davies Consultants, Oxford (United Kingdom); Gillemot, F [Atomic Energy Research Inst., Budapest (Hungary); Yanko, L [Minatom (Russian Federation); Lyssakov, V [International Atomic Energy Agency, Vienna (Austria)

    1997-09-01

    The IRPVM-DB (International Reactor Pressure Vessel Material Database) initiated by the IAEA IWG LMNPP is going to collect the available surveillance and research data world-wide on RPV material ageing. This paper presents the purpose of the database; it summarizes the type and the relationship of data included; it gives information about the data access and protection; and finally, it summarizes the state of art of the database. (author). 1 ref., 2 figs.

  6. Electron Effective-Attenuation-Length Database

    Science.gov (United States)

    SRD 82 NIST Electron Effective-Attenuation-Length Database (PC database, no charge)   This database provides values of electron effective attenuation lengths (EALs) in solid elements and compounds at selected electron energies between 50 eV and 2,000 eV. The database was designed mainly to provide EALs (to account for effects of elastic-eletron scattering) for applications in surface analysis by Auger-electron spectroscopy (AES) and X-ray photoelectron spectroscopy (XPS).

  7. DATABASE REPLICATION IN HETEROGENOUS PLATFORM

    OpenAIRE

    Hendro Nindito; Evaristus Didik Madyatmadja; Albert Verasius Dian Sano

    2014-01-01

    The application of diverse database technologies in enterprises today is increasingly a common practice. To provide high availability and survavibality of real-time information, a database replication technology that has capability to replicate databases under heterogenous platforms is required. The purpose of this research is to find the technology with such capability. In this research, the data source is stored in MSSQL database server running on Windows. The data will be replicated to MyS...

  8. Database security in the cloud

    OpenAIRE

    Sakhi, Imal

    2012-01-01

    The aim of the thesis is to get an overview of the database services available in cloud computing environment, investigate the security risks associated with it and propose the possible countermeasures to minimize the risks. The thesis also analyzes two cloud database service providers namely; Amazon RDS and Xeround. The reason behind choosing these two providers is because they are currently amongst the leading cloud database providers and both provide relational cloud databases which makes ...

  9. Clinical databases in physical therapy.

    NARCIS (Netherlands)

    Swinkels, I.C.S.; Ende, C.H.M. van den; Bakker, D. de; Wees, Ph.J van der; Hart, D.L.; Deutscher, D.; Bosch, W.J.H. van den; Dekker, J.

    2007-01-01

    Clinical databases in physical therapy provide increasing opportunities for research into physical therapy theory and practice. At present, information on the characteristics of existing databases is lacking. The purpose of this study was to identify clinical databases in which physical therapists

  10. NCBI-compliant genome submissions: tips and tricks to save time and money

    NARCIS (Netherlands)

    Pirovano, Walter; Boetzer, Marten; Derks, M.F.L.; Smit, S.

    2017-01-01

    Genome sequences nowadays play a central role in molecular biology and bioinformatics. These sequences are shared with the scientific community through sequence databases. The sequence repositories of the International Nucleotide Sequence Database Collaboration (INSDC, comprising GenBank, ENA and

  11. Nuclear technology databases and information network systems

    International Nuclear Information System (INIS)

    Iwata, Shuichi; Kikuchi, Yasuyuki; Minakuchi, Satoshi

    1993-01-01

    This paper describes the databases related to nuclear (science) technology, and information network. Following contents are collected in this paper: the database developed by JAERI, ENERGY NET, ATOM NET, NUCLEN nuclear information database, INIS, NUclear Code Information Service (NUCLIS), Social Application of Nuclear Technology Accumulation project (SANTA), Nuclear Information Database/Communication System (NICS), reactor materials database, radiation effects database, NucNet European nuclear information database, reactor dismantling database. (J.P.N.)

  12. Gene expression analysis of Solanum lycopersicum and Solanum habrochaites under drought conditions

    Directory of Open Access Journals (Sweden)

    Upama Mishra

    2016-09-01

    Full Text Available Drought is one of the limiting environmental factors that affect crop production worldwide. Understanding the molecular mechanism of drought stress is the key to developing drought tolerant crop. In this experiment we performed expression profiling of tomato plants under water deficit conditions using microarray technology. The data set we generated (available in the NCBI/GEO database under GSE22304 has been analyzed to identify genes that are involved in the regulation of tomato's responses to drought.

  13. Identification and Functional Characterization of a Tonoplast Dicarboxylate Transporter in Tomato (Solanum lycopersicum)

    OpenAIRE

    Liu, Ruiling; Li, Boqiang; Qin, Guozheng; Zhang, Zhanquan; Tian, Shiping

    2017-01-01

    Acidity plays an important role in flavor and overall organoleptic quality of fruit and is mainly due to the presence of organic acids. Understanding the molecular basis of organic acid metabolism is thus of primary importance for fruit quality improvement. Here, we cloned a putative tonoplast dicarboxylate transporter gene (SlTDT) from tomato, and submitted it to the NCBI database (GenBank accession number: KC733165). SlTDT protein contained 13 putative transmembrane domains in silico analys...

  14. Database Security: A Historical Perspective

    OpenAIRE

    Lesov, Paul

    2010-01-01

    The importance of security in database research has greatly increased over the years as most of critical functionality of the business and military enterprises became digitized. Database is an integral part of any information system and they often hold sensitive data. The security of the data depends on physical security, OS security and DBMS security. Database security can be compromised by obtaining sensitive data, changing data or degrading availability of the database. Over the last 30 ye...

  15. Diffusivity database (DDB) for major rocks. Database for the second progress report

    Energy Technology Data Exchange (ETDEWEB)

    Sato, Haruo

    1999-10-01

    A database for diffusivity for a data setting of effective diffusion coefficients in rock matrices in the second progress report, was developed. In this database, 3 kinds of diffusion coefficients: effective diffusion coefficient (De), apparent diffusion coefficient (Da) and free water diffusion coefficient (Do) were treated. The database, based on literatures published between 1980 and 1998, was developed considering the following points. (1) Since Japanese geological environment is focused in the second progress report, data for diffusion are collected focused on Japanese major rocks. (2) Although 22 elements are considered to be important in performance assessment for geological disposal, all elements and aquatic tracers are treated in this database development considering general purpose. (3) Since limestone, which belongs to sedimentary rock, can become one of the natural resources and is inappropriate as a host rock, it is omitted in this database development. Rock was categorized into 4 kinds of rocks; acid crystalline rock, alkaline crystalline rock, sedimentary rock (argillaceous/tuffaceous rock) and sedimentary rock (psammitic rock/sandy stone) from the viewpoint of geology and mass transport. In addition, rocks around neutrality among crystalline rock were categorized into the alkaline crystalline rock in this database. The database is composed of sub-databases for 4 kinds of rocks. Furthermore, the sub-databases for 4 kinds of the rocks are composed of databases to individual elements, in which totally, 24 items such as species, rock name, diffusion coefficients (De, Da, Do), obtained conditions (method, porewater, pH, Eh, temperature, atmosphere, etc.), etc. are input. As a result of literature survey, for De values for acid crystalline rock, totally, 207 data for 18 elements and one tracer (hydrocarbon) have been reported and all data were for granitic rocks such as granite, granodiorite and biotitic granite. For alkaline crystalline rock, totally, 32

  16. The magnet components database system

    International Nuclear Information System (INIS)

    Baggett, M.J.; Leedy, R.; Saltmarsh, C.; Tompkins, J.C.

    1990-01-01

    The philosophy, structure, and usage of MagCom, the SSC magnet components database, are described. The database has been implemented in Sybase (a powerful relational database management system) on a UNIX-based workstation at the Superconducting Super Collider Laboratory (SSCL); magnet project collaborators can access the database via network connections. The database was designed to contain the specifications and measured values of important properties for major materials, plus configuration information (specifying which individual items were used in each cable, coil, and magnet) and the test results on completed magnets. The data will facilitate the tracking and control of the production process as well as the correlation of magnet performance with the properties of its constituents. 3 refs., 9 figs

  17. The magnet components database system

    International Nuclear Information System (INIS)

    Baggett, M.J.; Leedy, R.; Saltmarsh, C.; Tompkins, J.C.

    1990-01-01

    The philosophy, structure, and usage MagCom, the SSC magnet components database, are described. The database has been implemented in Sybase (a powerful relational database management system) on a UNIX-based workstation at the Superconducting Super Collider Laboratory (SSCL); magnet project collaborators can access the database via network connections. The database was designed to contain the specifications and measured values of important properties for major materials, plus configuration information (specifying which individual items were used in each cable, coil, and magnet) and the test results on completed magnets. These data will facilitate the tracking and control of the production process as well as the correlation of magnet performance with the properties of its constituents. 3 refs., 10 figs

  18. SSC lattice database and graphical interface

    International Nuclear Information System (INIS)

    Trahern, C.G.; Zhou, J.

    1991-11-01

    When completed the Superconducting Super Collider will be the world's largest accelerator complex. In order to build this system on schedule, the use of database technologies will be essential. In this paper we discuss one of the database efforts underway at the SSC, the lattice database. The SSC lattice database provides a centralized source for the design of each major component of the accelerator complex. This includes the two collider rings, the High Energy Booster, Medium Energy Booster, Low Energy Booster, and the LINAC as well as transfer and test beam lines. These designs have been created using a menagerie of programs such as SYNCH, DIMAD, MAD, TRANSPORT, MAGIC, TRACE3D AND TEAPOT. However, once a design has been completed, it is entered into a uniform database schema in the database system. In this paper we discuss the reasons for creating the lattice database and its implementation via the commercial database system SYBASE. Each lattice in the lattice database is composed of a set of tables whose data structure can describe any of the SSC accelerator lattices. In order to allow the user community access to the databases, a programmatic interface known as dbsf (for database to several formats) has been written. Dbsf creates ascii input files appropriate to the above mentioned accelerator design programs. In addition it has a binary dataset output using the Self Describing Standard data discipline provided with the Integrated Scientific Tool Kit software tools. Finally we discuss the graphical interfaces to the lattice database. The primary interface, known as OZ, is a simulation environment as well as a database browser

  19. Tibetan Magmatism Database

    Science.gov (United States)

    Chapman, James B.; Kapp, Paul

    2017-11-01

    A database containing previously published geochronologic, geochemical, and isotopic data on Mesozoic to Quaternary igneous rocks in the Himalayan-Tibetan orogenic system are presented. The database is intended to serve as a repository for new and existing igneous rock data and is publicly accessible through a web-based platform that includes an interactive map and data table interface with search, filtering, and download options. To illustrate the utility of the database, the age, location, and ɛHft composition of magmatism from the central Gangdese batholith in the southern Lhasa terrane are compared. The data identify three high-flux events, which peak at 93, 50, and 15 Ma. They are characterized by inboard arc migration and a temporal and spatial shift to more evolved isotopic compositions.

  20. Implementasi Database Auditing dengan Memanfaatkan Sinkronisasi DBMS

    Directory of Open Access Journals (Sweden)

    Gede Anantaswarya Abhisena

    2017-08-01

    Full Text Available Database auditing dapat menjadi komponen penting dalam keamanan basis data dan kepatuhan terhadap peraturan pemerintah. Database Administrator perlu lebih waspada dalam teknik yang digunakan untuk melindungi data perusahaan, serta memantau dan memastikan bahwa perlindungan yang memadai terhadap data tersedia. Pada tingkat tinggi, database auditing merupakan fasilitas untuk melacak otoritas dan penggunaan sumber daya database. Ketika fungsi auditing diaktifkan, setiap operasi database yang diaudit menghasilkan jejak audit dari perubahan informasi yang dilakukan. Sinkronisasi database adalah bentuk dari replikasi, yang merupakan proses untuk memastikan setiap salinan data pada database berisi objek dan data yang serupa. Sinkronisasi database dapat dimanfaatkan dalam berbagai keperluan, salah satunya membangun auditing untuk mencatat setiap aktivitas yang terjadi pada database. Jejak audit dari operasi database yang dihasilkan, memungkinkan DBA (Database Administrator memelihara audit trails dari waktu ke waktu, untuk melakukan analisis tentang pola akses dan modifikasi terhadap data pada DBMS (Database Management System.

  1. Conceptual considerations for CBM databases

    Energy Technology Data Exchange (ETDEWEB)

    Akishina, E. P.; Aleksandrov, E. I.; Aleksandrov, I. N.; Filozova, I. A.; Ivanov, V. V.; Zrelov, P. V. [Lab. of Information Technologies, JINR, Dubna (Russian Federation); Friese, V.; Mueller, W. [GSI, Darmstadt (Germany)

    2014-07-01

    We consider a concept of databases for the Cm experiment. For this purpose, an analysis of the databases for large experiments at the LHC at CERN has been performed. Special features of various DBMS utilized in physical experiments, including relational and object-oriented DBMS as the most applicable ones for the tasks of these experiments, were analyzed. A set of databases for the CBM experiment, DBMS for their developments as well as use cases for the considered databases are suggested.

  2. Conceptual considerations for CBM databases

    International Nuclear Information System (INIS)

    Akishina, E.P.; Aleksandrov, E.I.; Aleksandrov, I.N.; Filozova, I.A.; Ivanov, V.V.; Zrelov, P.V.; Friese, V.; Mueller, W.

    2014-01-01

    We consider a concept of databases for the Cm experiment. For this purpose, an analysis of the databases for large experiments at the LHC at CERN has been performed. Special features of various DBMS utilized in physical experiments, including relational and object-oriented DBMS as the most applicable ones for the tasks of these experiments, were analyzed. A set of databases for the CBM experiment, DBMS for their developments as well as use cases for the considered databases are suggested.

  3. A New Database for Speaker Recognition

    DEFF Research Database (Denmark)

    Feng, Ling; Hansen, Lars Kai

    2005-01-01

    In this paper we discuss properties of speech databases used for speaker recognition research and evaluation, and we characterize some popular standard databases. The paper presents a new database called ELSDSR dedicated to speaker recognition applications. The main characteristics of this database...

  4. JICST Factual Database(2)

    Science.gov (United States)

    Araki, Keisuke

    The computer programme, which builds atom-bond connection tables from nomenclatures, is developed. Chemical substances with their nomenclature and varieties of trivial names or experimental code numbers are inputted. The chemical structures of the database are stereospecifically stored and are able to be searched and displayed according to stereochemistry. Source data are from laws and regulations of Japan, RTECS of US and so on. The database plays a central role within the integrated fact database service of JICST and makes interrelational retrieval possible.

  5. OECD/NEA thermochemical database

    Energy Technology Data Exchange (ETDEWEB)

    Byeon, Kee Hoh; Song, Dae Yong; Shin, Hyun Kyoo; Park, Seong Won; Ro, Seung Gy

    1998-03-01

    This state of the art report is to introduce the contents of the Chemical Data-Service, OECD/NEA, and the results of survey by OECD/NEA for the thermodynamic and kinetic database currently in use. It is also to summarize the results of Thermochemical Database Projects of OECD/NEA. This report will be a guide book for the researchers easily to get the validate thermodynamic and kinetic data of all substances from the available OECD/NEA database. (author). 75 refs.

  6. Native Health Research Database

    Science.gov (United States)

    ... Indian Health Board) Welcome to the Native Health Database. Please enter your search terms. Basic Search Advanced ... To learn more about searching the Native Health Database, click here. Tutorial Video The NHD has made ...

  7. E3 Staff Database

    Data.gov (United States)

    US Agency for International Development — E3 Staff database is maintained by E3 PDMS (Professional Development & Management Services) office. The database is Mysql. It is manually updated by E3 staff as...

  8. Clinical Databases for Chest Physicians.

    Science.gov (United States)

    Courtwright, Andrew M; Gabriel, Peter E

    2018-04-01

    A clinical database is a repository of patient medical and sociodemographic information focused on one or more specific health condition or exposure. Although clinical databases may be used for research purposes, their primary goal is to collect and track patient data for quality improvement, quality assurance, and/or actual clinical management. This article aims to provide an introduction and practical advice on the development of small-scale clinical databases for chest physicians and practice groups. Through example projects, we discuss the pros and cons of available technical platforms, including Microsoft Excel and Access, relational database management systems such as Oracle and PostgreSQL, and Research Electronic Data Capture. We consider approaches to deciding the base unit of data collection, creating consensus around variable definitions, and structuring routine clinical care to complement database aims. We conclude with an overview of regulatory and security considerations for clinical databases. Copyright © 2018 American College of Chest Physicians. Published by Elsevier Inc. All rights reserved.

  9. The Danish Smoking Cessation Database

    DEFF Research Database (Denmark)

    Rasmussen, Mette; Tønnesen, Hanne

    2016-01-01

    Background: The Danish Smoking Cessation Database (SCDB) was established in 2001 as the first national healthcare register within the field of health promotion. Aim of the database: The aim of the SCDB is to document and evaluate smoking cessation (SC) interventions to assess and improve their qu......‐free. The database is increasingly used in register-based research.......Background: The Danish Smoking Cessation Database (SCDB) was established in 2001 as the first national healthcare register within the field of health promotion. Aim of the database: The aim of the SCDB is to document and evaluate smoking cessation (SC) interventions to assess and improve...... their quality. The database was also designed to function as a basis for register-based research projects. Study population The population includes smokers in Denmark who have been receiving a face-to-face SC intervention offered by an SC clinic affiliated with the SCDB. SC clinics can be any organisation...

  10. OCA Oracle Database 11g database administration I : a real-world certification guide

    CERN Document Server

    Ries, Steve

    2013-01-01

    Developed as a practical book, ""Oracle Database 11g Administration I Certification Guide"" will show you all you need to know to effectively excel at being an Oracle DBA, for both examinations and the real world. This book is for anyone who needs the essential skills to become an Oracle DBA, pass the Oracle Database Administration I exam, and use those skills in the real world to manage secure, high performance, and highly available Oracle databases.

  11. Report on the database structuring project in fiscal 1996 related to the 'surveys on making databases for energy saving (2)'; 1996 nendo database kochiku jigyo hokokusho. Sho energy database system ka ni kansuru chosa 2

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1998-03-01

    With an objective to support promotion of energy conservation in such countries as Japan, China, Indonesia, the Philippines, Thailand, Malaysia, Taiwan and Korea, primary information on energy conservation in each country was collected, and the database was structured. This paper summarizes the achievements in fiscal 1996. Based on the survey result on the database project having been progressed to date, and on various data having been collected, this fiscal year has discussed structuring the database for distribution and proliferation of the database. In the discussion, requirements for the functions to be possessed by the database, items of data to be recorded in the database, and processing of the recorded data were put into order referring to propositions on the database circumstances. Demonstrations for the database of a proliferation version were performed in the Philippines, Indonesia and China. Three hundred CDs for distribution in each country were prepared. Adjustments and confirmation on operation of the supplied computers were carried out, and the operation explaining meetings were held in China and the Philippines. (NEDO)

  12. Danish Pancreatic Cancer Database

    DEFF Research Database (Denmark)

    Fristrup, Claus; Detlefsen, Sönke; Palnæs Hansen, Carsten

    2016-01-01

    : Death is monitored using data from the Danish Civil Registry. This registry monitors the survival status of the Danish population, and the registration is virtually complete. All data in the database are audited by all participating institutions, with respect to baseline characteristics, key indicators......AIM OF DATABASE: The Danish Pancreatic Cancer Database aims to prospectively register the epidemiology, diagnostic workup, diagnosis, treatment, and outcome of patients with pancreatic cancer in Denmark at an institutional and national level. STUDY POPULATION: Since May 1, 2011, all patients...... with microscopically verified ductal adenocarcinoma of the pancreas have been registered in the database. As of June 30, 2014, the total number of patients registered was 2,217. All data are cross-referenced with the Danish Pathology Registry and the Danish Patient Registry to ensure the completeness of registrations...

  13. Functionally Graded Materials Database

    Science.gov (United States)

    Kisara, Katsuto; Konno, Tomomi; Niino, Masayuki

    2008-02-01

    Functionally Graded Materials Database (hereinafter referred to as FGMs Database) was open to the society via Internet in October 2002, and since then it has been managed by the Japan Aerospace Exploration Agency (JAXA). As of October 2006, the database includes 1,703 research information entries with 2,429 researchers data, 509 institution data and so on. Reading materials such as "Applicability of FGMs Technology to Space Plane" and "FGMs Application to Space Solar Power System (SSPS)" were prepared in FY 2004 and 2005, respectively. The English version of "FGMs Application to Space Solar Power System (SSPS)" is now under preparation. This present paper explains the FGMs Database, describing the research information data, the sitemap and how to use it. From the access analysis, user access results and users' interests are discussed.

  14. [1012.5676] The Exoplanet Orbit Database

    Science.gov (United States)

    : The Exoplanet Orbit Database Authors: Jason T Wright, Onsi Fakhouri, Geoffrey W. Marcy, Eunkyu Han present a database of well determined orbital parameters of exoplanets. This database comprises parameters, and the method used for the planets discovery. This Exoplanet Orbit Database includes all planets

  15. Nuclear materials thermo-physical property database and property analysis using the database

    International Nuclear Information System (INIS)

    Jeong, Yeong Seok

    2002-02-01

    It is necessary that thermo-physical properties and understand of nuclear materials for evaluation and analysis to steady and accident states of commercial and research reactor. In this study, development of nuclear materials thermo-properties database and home page. In application of this database, it is analyzed of thermal conductivity, heat capacity, enthalpy, and linear thermal expansion of fuel and cladding material and compared thermo-properties model in nuclear fuel performance evaluation codes with experimental data in database. Results of compare thermo-property model of UO 2 fuel and cladding major performance evaluation code, both are similar

  16. Comparison of the Frontier Distributed Database Caching System with NoSQL Databases

    CERN Multimedia

    CERN. Geneva

    2012-01-01

    Non-relational "NoSQL" databases such as Cassandra and CouchDB are best known for their ability to scale to large numbers of clients spread over a wide area. The Frontier distributed database caching system, used in production by the Large Hadron Collider CMS and ATLAS detector projects, is based on traditional SQL databases but also has the same high scalability and wide-area distributability for an important subset of applications. This paper compares the architectures, behavior, performance, and maintainability of the two different approaches and identifies the criteria for choosing which approach to prefer over the other.

  17. NBIC: Search Ballast Report Database

    Science.gov (United States)

    Smithsonian Environmental Research Center Logo US Coast Guard Logo Submit BW Report | Search NBIC Database developed an online database that can be queried through our website. Data are accessible for all coastal Lakes, have been incorporated into the NBIC database as of August 2004. Information on data availability

  18. Cloud database development and management

    CERN Document Server

    Chao, Lee

    2013-01-01

    Nowadays, cloud computing is almost everywhere. However, one can hardly find a textbook that utilizes cloud computing for teaching database and application development. This cloud-based database development book teaches both the theory and practice with step-by-step instructions and examples. This book helps readers to set up a cloud computing environment for teaching and learning database systems. The book will cover adequate conceptual content for students and IT professionals to gain necessary knowledge and hands-on skills to set up cloud based database systems.

  19. 47 CFR 15.713 - TV bands database.

    Science.gov (United States)

    2010-10-01

    ... 47 Telecommunication 1 2010-10-01 2010-10-01 false TV bands database. 15.713 Section 15.713... TV bands database. (a) Purpose. The TV bands database serves the following functions: (1) To... databases. (b) Information in the TV bands database. (1) Facilities already recorded in Commission databases...

  20. Draft secure medical database standard.

    Science.gov (United States)

    Pangalos, George

    2002-01-01

    Medical database security is a particularly important issue for all Healthcare establishments. Medical information systems are intended to support a wide range of pertinent health issues today, for example: assure the quality of care, support effective management of the health services institutions, monitor and contain the cost of care, implement technology into care without violating social values, ensure the equity and availability of care, preserve humanity despite the proliferation of technology etc.. In this context, medical database security aims primarily to support: high availability, accuracy and consistency of the stored data, the medical professional secrecy and confidentiality, and the protection of the privacy of the patient. These properties, though of technical nature, basically require that the system is actually helpful for medical care and not harmful to patients. These later properties require in turn not only that fundamental ethical principles are not violated by employing database systems, but instead, are effectively enforced by technical means. This document reviews the existing and emerging work on the security of medical database systems. It presents in detail the related problems and requirements related to medical database security. It addresses the problems of medical database security policies, secure design methodologies and implementation techniques. It also describes the current legal framework and regulatory requirements for medical database security. The issue of medical database security guidelines is also examined in detailed. The current national and international efforts in the area are studied. It also gives an overview of the research work in the area. The document also presents in detail the most complete to our knowledge set of security guidelines for the development and operation of medical database systems.

  1. Databases of the marine metagenomics

    KAUST Repository

    Mineta, Katsuhiko

    2015-10-28

    The metagenomic data obtained from marine environments is significantly useful for understanding marine microbial communities. In comparison with the conventional amplicon-based approach of metagenomics, the recent shotgun sequencing-based approach has become a powerful tool that provides an efficient way of grasping a diversity of the entire microbial community at a sampling point in the sea. However, this approach accelerates accumulation of the metagenome data as well as increase of data complexity. Moreover, when metagenomic approach is used for monitoring a time change of marine environments at multiple locations of the seawater, accumulation of metagenomics data will become tremendous with an enormous speed. Because this kind of situation has started becoming of reality at many marine research institutions and stations all over the world, it looks obvious that the data management and analysis will be confronted by the so-called Big Data issues such as how the database can be constructed in an efficient way and how useful knowledge should be extracted from a vast amount of the data. In this review, we summarize the outline of all the major databases of marine metagenome that are currently publically available, noting that database exclusively on marine metagenome is none but the number of metagenome databases including marine metagenome data are six, unexpectedly still small. We also extend our explanation to the databases, as reference database we call, that will be useful for constructing a marine metagenome database as well as complementing important information with the database. Then, we would point out a number of challenges to be conquered in constructing the marine metagenome database.

  2. Directory of IAEA databases. 3. ed.

    International Nuclear Information System (INIS)

    1993-12-01

    This second edition of the Directory of IAEA Databases has been prepared within the Division of Scientific and Technical Information. Its main objective is to describe the computerized information sources available to staff members. This directory contains all databases produced at the IAEA, including databases stored on the mainframe, LAN's and PC's. All IAEA Division Directors have been requested to register the existence of their databases with NESI. For the second edition database owners were requested to review the existing entries for their databases and answer four additional questions. The four additional questions concerned the type of database (e.g. Bibliographic, Text, Statistical etc.), the category of database (e.g. Administrative, Nuclear Data etc.), the available documentation and the type of media used for distribution. In the individual entries on the following pages the answers to the first two questions (type and category) is always listed, but the answer to the second two questions (documentation and media) is only listed when information has been made available

  3. Database Replication Prototype

    OpenAIRE

    Vandewall, R.

    2000-01-01

    This report describes the design of a Replication Framework that facilitates the implementation and com-parison of database replication techniques. Furthermore, it discusses the implementation of a Database Replication Prototype and compares the performance measurements of two replication techniques based on the Atomic Broadcast communication primitive: pessimistic active replication and optimistic active replication. The main contributions of this report can be split into four parts....

  4. Deep Insight into the Ganoderma lucidum by Comprehensive Analysis of Its Transcriptome

    Science.gov (United States)

    Yu, Guo-Jun; Wang, Man; Huang, Jie; Yin, Ya-Lin; Chen, Yi-Jie; Jiang, Shuai; Jin, Yan-Xia; Lan, Xian-Qing; Wong, Barry Hon Cheung; Liang, Yi; Sun, Hui

    2012-01-01

    Background Ganoderma lucidum is a basidiomycete white rot fungus and is of medicinal importance in China, Japan and other countries in the Asiatic region. To date, much research has been performed in identifying the medicinal ingredients in Ganoderma lucidum. Despite its important therapeutic effects in disease, little is known about Ganoderma lucidum at the genomic level. In order to gain a molecular understanding of this fungus, we utilized Illumina high-throughput technology to sequence and analyze the transcriptome of Ganoderma lucidum. Methodology/Principal Findings We obtained 6,439,690 and 6,416,670 high-quality reads from the mycelium and fruiting body of Ganoderma lucidum, and these were assembled to form 18,892 and 27,408 unigenes, respectively. A similarity search was performed against the NCBI non-redundant nucleotide database and a customized database composed of five fungal genomes. 11,098 and 8, 775 unigenes were matched to the NCBI non-redundant nucleotide database and our customized database, respectively. All unigenes were subjected to annotation by Gene Ontology, Eukaryotic Orthologous Group terms and Kyoto Encyclopedia of Genes and Genomes. Differentially expressed genes from the Ganoderma lucidum mycelium and fruiting body stage were analyzed, resulting in the identification of 13 unigenes which are involved in the terpenoid backbone biosynthesis pathway. Quantitative real-time PCR was used to confirm the expression levels of these unigenes. Ganoderma lucidum was also studied for wood degrading activity and a total of 22 putative FOLymes (fungal oxidative lignin enzymes) and 120 CAZymes (carbohydrate-active enzymes) were predicted from our Ganoderma lucidum transcriptome. Conclusions Our study provides comprehensive gene expression information on Ganoderma lucidum at the transcriptional level, which will form the foundation for functional genomics studies in this fungus. The use of Illumina sequencing technology has made de novo transcriptome

  5. Molecule database framework: a framework for creating database applications with chemical structure search capability.

    Science.gov (United States)

    Kiener, Joos

    2013-12-11

    Research in organic chemistry generates samples of novel chemicals together with their properties and other related data. The involved scientists must be able to store this data and search it by chemical structure. There are commercial solutions for common needs like chemical registration systems or electronic lab notebooks. However for specific requirements of in-house databases and processes no such solutions exist. Another issue is that commercial solutions have the risk of vendor lock-in and may require an expensive license of a proprietary relational database management system. To speed up and simplify the development for applications that require chemical structure search capabilities, I have developed Molecule Database Framework. The framework abstracts the storing and searching of chemical structures into method calls. Therefore software developers do not require extensive knowledge about chemistry and the underlying database cartridge. This decreases application development time. Molecule Database Framework is written in Java and I created it by integrating existing free and open-source tools and frameworks. The core functionality includes:•Support for multi-component compounds (mixtures)•Import and export of SD-files•Optional security (authorization)For chemical structure searching Molecule Database Framework leverages the capabilities of the Bingo Cartridge for PostgreSQL and provides type-safe searching, caching, transactions and optional method level security. Molecule Database Framework supports multi-component chemical compounds (mixtures).Furthermore the design of entity classes and the reasoning behind it are explained. By means of a simple web application I describe how the framework could be used. I then benchmarked this example application to create some basic performance expectations for chemical structure searches and import and export of SD-files. By using a simple web application it was shown that Molecule Database Framework

  6. Database structure and file layout of Nuclear Power Plant Database. Database for design information on Light Water Reactors in Japan

    International Nuclear Information System (INIS)

    Yamamoto, Nobuo; Izumi, Fumio.

    1995-12-01

    The Nuclear Power Plant Database (PPD) has been developed at the Japan Atomic Energy Research Institute (JAERI) to provide plant design information on domestic Light Water Reactors (LWRs) to be used for nuclear safety research and so forth. This database can run on the main frame computer in the JAERI Tokai Establishment. The PPD contains the information on the plant design concepts, the numbers, capacities, materials, structures and types of equipment and components, etc, based on the safety analysis reports of the domestic LWRs. This report describes the details of the PPD focusing on the database structure and layout of data files so that the users can utilize it efficiently. (author)

  7. Cell Centred Database (CCDB)

    Data.gov (United States)

    U.S. Department of Health & Human Services — The Cell Centered Database (CCDB) is a web accessible database for high resolution 2D, 3D and 4D data from light and electron microscopy, including correlated imaging.

  8. The plant phenological online database (PPODB): an online database for long-term phenological data

    Science.gov (United States)

    Dierenbach, Jonas; Badeck, Franz-W.; Schaber, Jörg

    2013-09-01

    We present an online database that provides unrestricted and free access to over 16 million plant phenological observations from over 8,000 stations in Central Europe between the years 1880 and 2009. Unique features are (1) a flexible and unrestricted access to a full-fledged database, allowing for a wide range of individual queries and data retrieval, (2) historical data for Germany before 1951 ranging back to 1880, and (3) more than 480 curated long-term time series covering more than 100 years for individual phenological phases and plants combined over Natural Regions in Germany. Time series for single stations or Natural Regions can be accessed through a user-friendly graphical geo-referenced interface. The joint databases made available with the plant phenological database PPODB render accessible an important data source for further analyses of long-term changes in phenology. The database can be accessed via www.ppodb.de .

  9. NCBI-compliant genome submissions: tips and tricks to save time and money.

    Science.gov (United States)

    Pirovano, Walter; Boetzer, Marten; Derks, Martijn F L; Smit, Sandra

    2017-03-01

    Genome sequences nowadays play a central role in molecular biology and bioinformatics. These sequences are shared with the scientific community through sequence databases. The sequence repositories of the International Nucleotide Sequence Database Collaboration (INSDC, comprising GenBank, ENA and DDBJ) are the largest in the world. Preparing an annotated sequence in such a way that it will be accepted by the database is challenging because many validation criteria apply. In our opinion, it is an undesirable situation that researchers who want to submit their sequence need either a lot of experience or help from partners to get the job done. To save valuable time and money, we list a number of recommendations for people who want to submit an annotated genome to a sequence database, as well as for tool developers, who could help to ease the process. © The Author 2015. Published by Oxford University Press. For Permissions, please email: journals.permissions@oup.com.

  10. JDD, Inc. Database

    Science.gov (United States)

    Miller, David A., Jr.

    2004-01-01

    JDD Inc, is a maintenance and custodial contracting company whose mission is to provide their clients in the private and government sectors "quality construction, construction management and cleaning services in the most efficient and cost effective manners, (JDD, Inc. Mission Statement)." This company provides facilities support for Fort Riley in Fo,rt Riley, Kansas and the NASA John H. Glenn Research Center at Lewis Field here in Cleveland, Ohio. JDD, Inc. is owned and operated by James Vaughn, who started as painter at NASA Glenn and has been working here for the past seventeen years. This summer I worked under Devan Anderson, who is the safety manager for JDD Inc. in the Logistics and Technical Information Division at Glenn Research Center The LTID provides all transportation, secretarial, security needs and contract management of these various services for the center. As a safety manager, my mentor provides Occupational Health and Safety Occupation (OSHA) compliance to all JDD, Inc. employees and handles all other issues (Environmental Protection Agency issues, workers compensation, safety and health training) involving to job safety. My summer assignment was not as considered "groundbreaking research" like many other summer interns have done in the past, but it is just as important and beneficial to JDD, Inc. I initially created a database using a Microsoft Excel program to classify and categorize data pertaining to numerous safety training certification courses instructed by our safety manager during the course of the fiscal year. This early portion of the database consisted of only data (training field index, employees who were present at these training courses and who was absent) from the training certification courses. Once I completed this phase of the database, I decided to expand the database and add as many dimensions to it as possible. Throughout the last seven weeks, I have been compiling more data from day to day operations and been adding the

  11. The flux database concerted action

    International Nuclear Information System (INIS)

    Mitchell, N.G.; Donnelly, C.E.

    1999-01-01

    This paper summarizes the background to the UIR action on the development of a flux database for radionuclide transfer in soil-plant systems. The action is discussed in terms of the objectives, the deliverables and the progress achieved so far by the flux database working group. The paper describes the background to the current initiative and outlines specific features of the database and supporting documentation. Particular emphasis is placed on the proforma used for data entry, on the database help file and on the approach adopted to indicate data quality. Refs. 3 (author)

  12. NLTE4 Plasma Population Kinetics Database

    Science.gov (United States)

    SRD 159 NLTE4 Plasma Population Kinetics Database (Web database for purchase)   This database contains benchmark results for simulation of plasma population kinetics and emission spectra. The data were contributed by the participants of the 4th Non-LTE Code Comparison Workshop who have unrestricted access to the database. The only limitation for other users is in hidden labeling of the output results. Guest users can proceed to the database entry page without entering userid and password.

  13. Ocean Drilling Program: Janus Web Database

    Science.gov (United States)

    JANUS Database Send questions/comments about the online database Request data not available online Janus database Search the ODP/TAMU web site ODP's main web site Janus Data Model Data Migration Overview in Janus Data Types and Examples Leg 199, sunrise. Janus Web Database ODP and IODP data are stored in

  14. The Danish Cardiac Rehabilitation Database

    DEFF Research Database (Denmark)

    Zwisler, Ann-Dorthe; Rossau, Henriette Knold; Nakano, Anne

    2016-01-01

    hospitals annually, with 75% receiving one or more outpatient rehabilitation services by 2015. The database has not yet been running for a full year, which explains the use of approximations. CONCLUSION: The DHRD is an online, national quality improvement database on CR, aimed at patients with CHD......AIM OF DATABASE: The Danish Cardiac Rehabilitation Database (DHRD) aims to improve the quality of cardiac rehabilitation (CR) to the benefit of patients with coronary heart disease (CHD). STUDY POPULATION: Hospitalized patients with CHD with stenosis on coronary angiography treated...... with percutaneous coronary intervention, coronary artery bypass grafting, or medication alone. Reporting is mandatory for all hospitals in Denmark delivering CR. The database was initially implemented in 2013 and was fully running from August 14, 2015, thus comprising data at a patient level from the latter date...

  15. Directory of IAEA databases

    International Nuclear Information System (INIS)

    1991-11-01

    The first edition of the Directory of IAEA Databases is intended to describe the computerized information sources available to IAEA staff members. It contains a listing of all databases produced at the IAEA, together with information on their availability

  16. Database Description - RGP physicalmap | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available classification Plant databases - Rice Database classification Sequence Physical map Organism Taxonomy Name: ...inobe Journal: Nature Genetics (1994) 8: 365-372. External Links: Article title: Physical Mapping of Rice Ch...rnal: DNA Research (1997) 4(2): 133-140. External Links: Article title: Physical Mapping of Rice Chromosomes... T Sasaki Journal: Genome Research (1996) 6(10): 935-942. External Links: Article title: Physical mapping of

  17. Database Independent Migration of Objects into an Object-Relational Database

    CERN Document Server

    Ali, A; Munir, K; Waseem-Hassan, M; Willers, I

    2002-01-01

    CERN's (European Organization for Nuclear Research) WISDOM project [1] deals with the replication of data between homogeneous sources in a Wide Area Network (WAN) using the extensible Markup Language (XML). The last phase of the WISDOM (Wide-area, database Independent Serialization of Distributed Objects for data Migration) project [2], indicates the future directions for this work to be to incorporate heterogeneous sources as compared to homogeneous sources as described by [3]. This work will become essential for the CERN community once the need to transfer their legacy data to some other source, other then Objectivity [4], arises. Oracle 9i - an Object-Relational Database (including support for abstract data types, ADTs) appears to be a potential candidate for the physics event store in the CERN CMS experiment as suggested by [4] & [5]. Consequently this database has been selected for study. As a result of this work the HEP community will get a tool for migrating their data from Objectivity to Oracle9i.

  18. The Danish Urogynaecological Database

    DEFF Research Database (Denmark)

    Guldberg, Rikke; Brostrøm, Søren; Hansen, Jesper Kjær

    2013-01-01

    in the DugaBase from 1 January 2009 to 31 October 2010, using medical records as a reference. RESULTS: A total of 16,509 urogynaecological procedures were registered in the DugaBase by 31 December 2010. The database completeness has increased by calendar time, from 38.2 % in 2007 to 93.2 % in 2010 for public......INTRODUCTION AND HYPOTHESIS: The Danish Urogynaecological Database (DugaBase) is a nationwide clinical database established in 2006 to monitor, ensure and improve the quality of urogynaecological surgery. We aimed to describe its establishment and completeness and to validate selected variables....... This is the first study based on data from the DugaBase. METHODS: The database completeness was calculated as a comparison between urogynaecological procedures reported to the Danish National Patient Registry and to the DugaBase. Validity was assessed for selected variables from a random sample of 200 women...

  19. Moving Observer Support for Databases

    DEFF Research Database (Denmark)

    Bukauskas, Linas

    Interactive visual data explorations impose rigid requirements on database and visualization systems. Systems that visualize huge amounts of data tend to request large amounts of memory resources and heavily use the CPU to process and visualize data. Current systems employ a loosely coupled...... architecture to exchange data between database and visualization. Thus, the interaction of the visualizer and the database is kept to the minimum, which most often leads to superfluous data being passed from database to visualizer. This Ph.D. thesis presents a novel tight coupling of database and visualizer....... The thesis discusses the VR-tree, an extension of the R-tree that enables observer relative data extraction. To support incremental observer position relative data extraction the thesis proposes the Volatile Access Structure (VAST). VAST is a main memory structure that caches nodes of the VR-tree. VAST...

  20. Advances in knowledge discovery in databases

    CERN Document Server

    Adhikari, Animesh

    2015-01-01

    This book presents recent advances in Knowledge discovery in databases (KDD) with a focus on the areas of market basket database, time-stamped databases and multiple related databases. Various interesting and intelligent algorithms are reported on data mining tasks. A large number of association measures are presented, which play significant roles in decision support applications. This book presents, discusses and contrasts new developments in mining time-stamped data, time-based data analyses, the identification of temporal patterns, the mining of multiple related databases, as well as local patterns analysis.  

  1. Chromobacterium spp. harbour Ambler class A beta-lactamases showing high identity with KPC

    DEFF Research Database (Denmark)

    Gudeta, Dereje Dadi; Bortolaia, Valeria; Jayol, Aurelie

    2016-01-01

    Objectives: The origin of KPC is unknown. The aim of this study was to detect progenitors of KPC in silico and to functionally verify their beta-lactam hydrolysis activity. Methods: The sequence of KPC-2 was used to mine the NCBI protein sequence database. The best non-KPC hits were analysed by a......-lactamases with up to 76% aa identity to KPC from distinct Chromobacterium species is highly indicative of the role played by this genus in the evolution of KPC....

  2. Cancer: a profit-driven biosystem?

    Science.gov (United States)

    Deisboeck, Thomas S

    2008-08-01

    The argument is made that solid malignant tumors behave as profit-driven biological systems in that they expand their nutrient-uptaking surface to increase energetic revenue, at a comparably low metabolic cost. Within this conceptual framework, cancer cell migration is a critical mechanism as it maximizes systemic surface expansion while minimizing diffusion distance. Treating these tumor systems with adjuvant anti-proliferative regimen only should increase the energetic net gain of the viable cancer cells left behind, hence would facilitate tumor recurrence. Therapeutic attempts to better control tumor (re)growth should therefore aim primarily at containing its surface expansion, thus reducing its energetic revenue, or increasing its metabolic costs or better yet, both.

  3. Evolutionary Models for Simple Biosystems

    Science.gov (United States)

    Bagnoli, Franco

    The concept of evolutionary development of structures constituted a real revolution in biology: it was possible to understand how the very complex structures of life can arise in an out-of-equilibrium system. The investigation of such systems has shown that indeed, systems under a flux of energy or matter can self-organize into complex patterns, think for instance to Rayleigh-Bernard convection, Liesegang rings, patterns formed by granular systems under shear. Following this line, one could characterize life as a state of matter, characterized by the slow, continuous process that we call evolution. In this paper we try to identify the organizational level of life, that spans several orders of magnitude from the elementary constituents to whole ecosystems. Although similar structures can be found in other contexts like ideas (memes) in neural systems and self-replicating elements (computer viruses, worms, etc.) in computer systems, we shall concentrate on biological evolutionary structure, and try to put into evidence the role and the emergence of network structure in such systems.

  4. Human Performance Event Database

    International Nuclear Information System (INIS)

    Trager, E. A.

    1998-01-01

    The purpose of this paper is to describe several aspects of a Human Performance Event Database (HPED) that is being developed by the Nuclear Regulatory Commission. These include the background, the database structure and basis for the structure, the process for coding and entering event records, the results of preliminary analyses of information in the database, and plans for the future. In 1992, the Office for Analysis and Evaluation of Operational Data (AEOD) within the NRC decided to develop a database for information on human performance during operating events. The database was needed to help classify and categorize the information to help feedback operating experience information to licensees and others. An NRC interoffice working group prepared a list of human performance information that should be reported for events and the list was based on the Human Performance Investigation Process (HPIP) that had been developed by the NRC as an aid in investigating events. The structure of the HPED was based on that list. The HPED currently includes data on events described in augmented inspection team (AIT) and incident investigation team (IIT) reports from 1990 through 1996, AEOD human performance studies from 1990 through 1993, recent NRR special team inspections, and licensee event reports (LERs) that were prepared for the events. (author)

  5. Preserved Organic Matter in the Alpine Tethyan Ocean Continental Transition (Totalp unit, Eastern Swiss Alps)

    Science.gov (United States)

    Mateeva, T.; Wolff, G. A.; Kusznir, N.; Wheeler, J.; Manatschal, G.

    2015-12-01

    Observations at hydrothermal systems in modern ocean settings suggest that methane produced by serpentinization can support methanotrophic bio-systems. An important question is whether such bio-systems are localised or are more pervasive in their association with serpentinized mantle in the subsurface. This has implications for the global importance of the hidden sub-surface bio-systems, the fate of methane and the carbon cycle. The Totalp unit, a remnant of a former Ocean Continent Transition (OCT) exposed in Alps of Eastern Switzerland, has been chosen to investigate the presence or absence of methanotrophic biosystems within serpentinized exhumed mantle in the Alpine Tethyan margin. The Totalp unit is made of serpentinized mantle and ophicalcites overlain by Upper Jurassic to Lower Cretaceous post-rift sediments. The Totalp unit has undergone little Alpine deformation and only a low-grade metamorphic overprint (serpentinized peridotite, ophicalcite and post-rift sediments contain hydrocarbons in the form of n-alkanes in the range C20 - C40; isoprenoids, for example pristane and phytane are present in sediments. The organic biological marker distribution is consistent with the temperature history of the OCT (i.e.lower maximum temperature than 200°C). First results from Totalp show evidence for preservation of marine organic matter in the serpentinized mantle and overlying sediments, although there is no evidence that any organic matter is generated from methanotrophic bio-systems. Nevertheless, focussing on Tethyan hydrothermal systems and preserved hydrocarbons will be critical in understanding whether methanotrophic biomarkers can be preserved and if so whether the methane originated from serpentenization.

  6. Scanner calibration revisited

    Directory of Open Access Journals (Sweden)

    Pozhitkov Alexander E

    2010-07-01

    Full Text Available Abstract Background Calibration of a microarray scanner is critical for accurate interpretation of microarray results. Shi et al. (BMC Bioinformatics, 2005, 6, Art. No. S11 Suppl. 2. reported usage of a Full Moon BioSystems slide for calibration. Inspired by the Shi et al. work, we have calibrated microarray scanners in our previous research. We were puzzled however, that most of the signal intensities from a biological sample fell below the sensitivity threshold level determined by the calibration slide. This conundrum led us to re-investigate the quality of calibration provided by the Full Moon BioSystems slide as well as the accuracy of the analysis performed by Shi et al. Methods Signal intensities were recorded on three different microarray scanners at various photomultiplier gain levels using the same calibration slide from Full Moon BioSystems. Data analysis was conducted on raw signal intensities without normalization or transformation of any kind. Weighted least-squares method was used to fit the data. Results We found that initial analysis performed by Shi et al. did not take into account autofluorescence of the Full Moon BioSystems slide, which led to a grossly distorted microarray scanner response. Our analysis revealed that a power-law function, which is explicitly accounting for the slide autofluorescence, perfectly described a relationship between signal intensities and fluorophore quantities. Conclusions Microarray scanners respond in a much less distorted fashion than was reported by Shi et al. Full Moon BioSystems calibration slides are inadequate for performing calibration. We recommend against using these slides.

  7. Let's talk about it: dialogues with multimedia databases Database support for human activity

    NARCIS (Netherlands)

    de Vries, A.P.; van der Veer, Gerrit C.; Blanken, Henk

    We describe two scenarios of user tasks in which access to multimedia data plays a significant role. Because current multimedia databases cannot support these tasks, we introduce three new requirements on multimedia databases: multimedia objects should be active objects, querying is an interaction

  8. The AMMA database

    Science.gov (United States)

    Boichard, Jean-Luc; Brissebrat, Guillaume; Cloche, Sophie; Eymard, Laurence; Fleury, Laurence; Mastrorillo, Laurence; Moulaye, Oumarou; Ramage, Karim

    2010-05-01

    The AMMA project includes aircraft, ground-based and ocean measurements, an intensive use of satellite data and diverse modelling studies. Therefore, the AMMA database aims at storing a great amount and a large variety of data, and at providing the data as rapidly and safely as possible to the AMMA research community. In order to stimulate the exchange of information and collaboration between researchers from different disciplines or using different tools, the database provides a detailed description of the products and uses standardized formats. The AMMA database contains: - AMMA field campaigns datasets; - historical data in West Africa from 1850 (operational networks and previous scientific programs); - satellite products from past and future satellites, (re-)mapped on a regular latitude/longitude grid and stored in NetCDF format (CF Convention); - model outputs from atmosphere or ocean operational (re-)analysis and forecasts, and from research simulations. The outputs are processed as the satellite products are. Before accessing the data, any user has to sign the AMMA data and publication policy. This chart only covers the use of data in the framework of scientific objectives and categorically excludes the redistribution of data to third parties and the usage for commercial applications. Some collaboration between data producers and users, and the mention of the AMMA project in any publication is also required. The AMMA database and the associated on-line tools have been fully developed and are managed by two teams in France (IPSL Database Centre, Paris and OMP, Toulouse). Users can access data of both data centres using an unique web portal. This website is composed of different modules : - Registration: forms to register, read and sign the data use chart when an user visits for the first time - Data access interface: friendly tool allowing to build a data extraction request by selecting various criteria like location, time, parameters... The request can

  9. SmallSat Database

    Science.gov (United States)

    Petropulos, Dolores; Bittner, David; Murawski, Robert; Golden, Bert

    2015-01-01

    The SmallSat has an unrealized potential in both the private industry and in the federal government. Currently over 70 companies, 50 universities and 17 governmental agencies are involved in SmallSat research and development. In 1994, the U.S. Army Missile and Defense mapped the moon using smallSat imagery. Since then Smart Phones have introduced this imagery to the people of the world as diverse industries watched this trend. The deployment cost of smallSats is also greatly reduced compared to traditional satellites due to the fact that multiple units can be deployed in a single mission. Imaging payloads have become more sophisticated, smaller and lighter. In addition, the growth of small technology obtained from private industries has led to the more widespread use of smallSats. This includes greater revisit rates in imagery, significantly lower costs, the ability to update technology more frequently and the ability to decrease vulnerability of enemy attacks. The popularity of smallSats show a changing mentality in this fast paced world of tomorrow. What impact has this created on the NASA communication networks now and in future years? In this project, we are developing the SmallSat Relational Database which can support a simulation of smallSats within the NASA SCaN Compatability Environment for Networks and Integrated Communications (SCENIC) Modeling and Simulation Lab. The NASA Space Communications and Networks (SCaN) Program can use this modeling to project required network support needs in the next 10 to 15 years. The SmallSat Rational Database could model smallSats just as the other SCaN databases model the more traditional larger satellites, with a few exceptions. One being that the smallSat Database is designed to be built-to-order. The SmallSat database holds various hardware configurations that can be used to model a smallSat. It will require significant effort to develop as the research material can only be populated by hand to obtain the unique data

  10. World Database of Happiness

    NARCIS (Netherlands)

    R. Veenhoven (Ruut)

    1995-01-01

    textabstractABSTRACT The World Database of Happiness is an ongoing register of research on subjective appreciation of life. Its purpose is to make the wealth of scattered findings accessible, and to create a basis for further meta-analytic studies. The database involves four sections:
    1.

  11. "First generation" automated DNA sequencing technology.

    Science.gov (United States)

    Slatko, Barton E; Kieleczawa, Jan; Ju, Jingyue; Gardner, Andrew F; Hendrickson, Cynthia L; Ausubel, Frederick M

    2011-10-01

    Beginning in the 1980s, automation of DNA sequencing has greatly increased throughput, reduced costs, and enabled large projects to be completed more easily. The development of automation technology paralleled the development of other aspects of DNA sequencing: better enzymes and chemistry, separation and imaging technology, sequencing protocols, robotics, and computational advancements (including base-calling algorithms with quality scores, database developments, and sequence analysis programs). Despite the emergence of high-throughput sequencing platforms, automated Sanger sequencing technology remains useful for many applications. This unit provides background and a description of the "First-Generation" automated DNA sequencing technology. It also includes protocols for using the current Applied Biosystems (ABI) automated DNA sequencing machines. © 2011 by John Wiley & Sons, Inc.

  12. Radiation safety research information database

    International Nuclear Information System (INIS)

    Yukawa, Masae; Miyamoto, Kiriko; Takeda, Hiroshi; Kuroda, Noriko; Yamamoto, Kazuhiko

    2004-01-01

    National Institute of Radiological Sciences in Japan began to construct Radiation Safety Research Information Database' in 2001. The research information database is of great service to evaluate the effects of radiation on people by estimating exposure dose by determining radiation and radioactive matters in the environment. The above database (DB) consists of seven DB such as Nirs Air Borne Dust Survey DB, Nirs Environmental Tritium Survey DB, Nirs Environmental Carbon Survey DB, Environmental Radiation Levels, Abe, Metabolic Database for Assessment of Internal Dose, Graphs of Predicted Monitoring Data, and Nirs nuclear installation environment water tritium survey DB. Outline of DB and each DB are explained. (S.Y.)

  13. Core Data of Yeast Interacting Proteins Database (Original Version) - Yeast Interacting Proteins Database | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available y are in the reverse direction. *1 A comprehensive two-hybrid analysis to explore the yeast protein interact...s. 2000 Jan 1;28(1):73-6. *2 The yeast proteome database (YPD) and Caenorhabditis elegans proteome database (WormPD): comprehensive...000 Jan 1;28(1):73-6. *3 A comprehensive analysis of protein-protein interactions in Saccharomyces cerevisia

  14. WMC Database Evaluation. Case Study Report

    Energy Technology Data Exchange (ETDEWEB)

    Palounek, Andrea P. T [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)

    2015-10-29

    The WMC Database is ultimately envisioned to hold a collection of experimental data, design information, and information from computational models. This project was a first attempt at using the Database to access experimental data and extract information from it. This evaluation shows that the Database concept is sound and robust, and that the Database, once fully populated, should remain eminently usable for future researchers.

  15. Integrating Variances into an Analytical Database

    Science.gov (United States)

    Sanchez, Carlos

    2010-01-01

    For this project, I enrolled in numerous SATERN courses that taught the basics of database programming. These include: Basic Access 2007 Forms, Introduction to Database Systems, Overview of Database Design, and others. My main job was to create an analytical database that can handle many stored forms and make it easy to interpret and organize. Additionally, I helped improve an existing database and populate it with information. These databases were designed to be used with data from Safety Variances and DCR forms. The research consisted of analyzing the database and comparing the data to find out which entries were repeated the most. If an entry happened to be repeated several times in the database, that would mean that the rule or requirement targeted by that variance has been bypassed many times already and so the requirement may not really be needed, but rather should be changed to allow the variance's conditions permanently. This project did not only restrict itself to the design and development of the database system, but also worked on exporting the data from the database to a different format (e.g. Excel or Word) so it could be analyzed in a simpler fashion. Thanks to the change in format, the data was organized in a spreadsheet that made it possible to sort the data by categories or types and helped speed up searches. Once my work with the database was done, the records of variances could be arranged so that they were displayed in numerical order, or one could search for a specific document targeted by the variances and restrict the search to only include variances that modified a specific requirement. A great part that contributed to my learning was SATERN, NASA's resource for education. Thanks to the SATERN online courses I took over the summer, I was able to learn many new things about computers and databases and also go more in depth into topics I already knew about.

  16. ORACLE DATABASE SECURITY

    OpenAIRE

    Cristina-Maria Titrade

    2011-01-01

    This paper presents some security issues, namely security database system level, data level security, user-level security, user management, resource management and password management. Security is a constant concern in the design and database development. Usually, there are no concerns about the existence of security, but rather how large it should be. A typically DBMS has several levels of security, in addition to those offered by the operating system or network. Typically, a DBMS has user a...

  17. A novel approach: chemical relational databases, and the role of the ISSCAN database on assessing chemical carcinogenicity.

    Science.gov (United States)

    Benigni, Romualdo; Bossa, Cecilia; Richard, Ann M; Yang, Chihae

    2008-01-01

    Mutagenicity and carcinogenicity databases are crucial resources for toxicologists and regulators involved in chemicals risk assessment. Until recently, existing public toxicity databases have been constructed primarily as "look-up-tables" of existing data, and most often did not contain chemical structures. Concepts and technologies originated from the structure-activity relationships science have provided powerful tools to create new types of databases, where the effective linkage of chemical toxicity with chemical structure can facilitate and greatly enhance data gathering and hypothesis generation, by permitting: a) exploration across both chemical and biological domains; and b) structure-searchability through the data. This paper reviews the main public databases, together with the progress in the field of chemical relational databases, and presents the ISSCAN database on experimental chemical carcinogens.

  18. An Online Database Producer's Memoirs and Memories of an Online Pioneer and The Database Industry: Looking into the Future.

    Science.gov (United States)

    Kollegger, James G.; And Others

    1988-01-01

    In the first of three articles, the producer of Energyline, Energynet, and Tele/Scope recalls the development of the databases and database business strategies. The second describes the development of biomedical online databases, and the third discusses future developments, including full text databases, database producers as online host, and…

  19. Database in Artificial Intelligence.

    Science.gov (United States)

    Wilkinson, Julia

    1986-01-01

    Describes a specialist bibliographic database of literature in the field of artificial intelligence created by the Turing Institute (Glasgow, Scotland) using the BRS/Search information retrieval software. The subscription method for end-users--i.e., annual fee entitles user to unlimited access to database, document provision, and printed awareness…

  20. SAADA: Astronomical Databases Made Easier

    Science.gov (United States)

    Michel, L.; Nguyen, H. N.; Motch, C.

    2005-12-01

    Many astronomers wish to share datasets with their community but have not enough manpower to develop databases having the functionalities required for high-level scientific applications. The SAADA project aims at automatizing the creation and deployment process of such databases. A generic but scientifically relevant data model has been designed which allows one to build databases by providing only a limited number of product mapping rules. Databases created by SAADA rely on a relational database supporting JDBC and covered by a Java layer including a lot of generated code. Such databases can simultaneously host spectra, images, source lists and plots. Data are grouped in user defined collections whose content can be seen as one unique set per data type even if their formats differ. Datasets can be correlated one with each other using qualified links. These links help, for example, to handle the nature of a cross-identification (e.g., a distance or a likelihood) or to describe their scientific content (e.g., by associating a spectrum to a catalog entry). The SAADA query engine is based on a language well suited to the data model which can handle constraints on linked data, in addition to classical astronomical queries. These constraints can be applied on the linked objects (number, class and attributes) and/or on the link qualifier values. Databases created by SAADA are accessed through a rich WEB interface or a Java API. We are currently developing an inter-operability module implanting VO protocols.

  1. Database thinking development in Context of School Education

    OpenAIRE

    Panský, Mikoláš

    2011-01-01

    The term database thinking is understood as group of Competencies that enables working with Database System. Database thinking development is targeted educational incidence to student with the expected outcome ability working with Database system. Thesis is focused on problematic of purposes, content and methods of database thinking development. Experimental part proposes quantitative metrics for database thinking development. KEYWORDS: Education, Database, Database thinking, Structured Query...

  2. Brain Tumor Database, a free relational database for collection and analysis of brain tumor patient information.

    Science.gov (United States)

    Bergamino, Maurizio; Hamilton, David J; Castelletti, Lara; Barletta, Laura; Castellan, Lucio

    2015-03-01

    In this study, we describe the development and utilization of a relational database designed to manage the clinical and radiological data of patients with brain tumors. The Brain Tumor Database was implemented using MySQL v.5.0, while the graphical user interface was created using PHP and HTML, thus making it easily accessible through a web browser. This web-based approach allows for multiple institutions to potentially access the database. The BT Database can record brain tumor patient information (e.g. clinical features, anatomical attributes, and radiological characteristics) and be used for clinical and research purposes. Analytic tools to automatically generate statistics and different plots are provided. The BT Database is a free and powerful user-friendly tool with a wide range of possible clinical and research applications in neurology and neurosurgery. The BT Database graphical user interface source code and manual are freely available at http://tumorsdatabase.altervista.org. © The Author(s) 2013.

  3. CD-ROM for the PGAA-IAEA database

    International Nuclear Information System (INIS)

    Firestone, R.B.; Zerking, V.

    2007-01-01

    Both the database of prompt gamma rays from slow neutron capture for elemental analysis and the results of this CRP are available on the accompanying CD-ROM. The file index.html is the home page for the CD-ROM, and provides links to the following information: (a) The CRP - General information, papers and reports relevant to this CRP. (b) The PGAA-IAEA database viewer - An interactive program to display and search the PGAA database by isotope, energy or capture cross-section. (c) The Database of Prompt Gamma Rays from Slow Neutron Capture for Elemental Analysis - This report. (d) The PGAA database files - Adopted PGAA database and associated files in EXCEL, PDF and Text formats. The archival databases by Lone et al. and by Reedy and Frankle are also available. (e) The Evaluated Gamma-Ray Activation File (EGAF) - The adopted PGAA database in ENSDF format. Data can be viewed with the Isotope Explorer 2.2 ENSDF Viewer. (f) The PGAA database evaluation - ENSDF format versions of the adopted PGAA database, and the Budapest and ENSDF isotopic input files. Decay scheme balance and statistical analysis summaries are provided. (g) The Isotope Explorer 2.2 ENSDF viewer - Windows software for viewing the level scheme drawings and tables provided in ENSDF format. The complete ENSDF database is included, as of December 2002. The databases and viewers are discussed in greater detail in the following sections

  4. Electron Inelastic-Mean-Free-Path Database

    Science.gov (United States)

    SRD 71 NIST Electron Inelastic-Mean-Free-Path Database (PC database, no charge)   This database provides values of electron inelastic mean free paths (IMFPs) for use in quantitative surface analyses by AES and XPS.

  5. ECMDB: The E. coli Metabolome Database

    OpenAIRE

    Guo, An Chi; Jewison, Timothy; Wilson, Michael; Liu, Yifeng; Knox, Craig; Djoumbou, Yannick; Lo, Patrick; Mandal, Rupasri; Krishnamurthy, Ram; Wishart, David S.

    2012-01-01

    The Escherichia coli Metabolome Database (ECMDB, http://www.ecmdb.ca) is a comprehensively annotated metabolomic database containing detailed information about the metabolome of E. coli (K-12). Modelled closely on the Human and Yeast Metabolome Databases, the ECMDB contains >2600 metabolites with links to ?1500 different genes and proteins, including enzymes and transporters. The information in the ECMDB has been collected from dozens of textbooks, journal articles and electronic databases. E...

  6. The Xeno-glycomics database (XDB): a relational database of qualitative and quantitative pig glycome repertoire.

    Science.gov (United States)

    Park, Hae-Min; Park, Ju-Hyeong; Kim, Yoon-Woo; Kim, Kyoung-Jin; Jeong, Hee-Jin; Jang, Kyoung-Soon; Kim, Byung-Gee; Kim, Yun-Gon

    2013-11-15

    In recent years, the improvement of mass spectrometry-based glycomics techniques (i.e. highly sensitive, quantitative and high-throughput analytical tools) has enabled us to obtain a large dataset of glycans. Here we present a database named Xeno-glycomics database (XDB) that contains cell- or tissue-specific pig glycomes analyzed with mass spectrometry-based techniques, including a comprehensive pig glycan information on chemical structures, mass values, types and relative quantities. It was designed as a user-friendly web-based interface that allows users to query the database according to pig tissue/cell types or glycan masses. This database will contribute in providing qualitative and quantitative information on glycomes characterized from various pig cells/organs in xenotransplantation and might eventually provide new targets in the α1,3-galactosyltransferase gene-knock out pigs era. The database can be accessed on the web at http://bioinformatics.snu.ac.kr/xdb.

  7. The ATLAS TAGS database distribution and management - Operational challenges of a multi-terabyte distributed database

    International Nuclear Information System (INIS)

    Viegas, F; Nairz, A; Goossens, L; Malon, D; Cranshaw, J; Dimitrov, G; Nowak, M; Gamboa, C; Gallas, E; Wong, A; Vinek, E

    2010-01-01

    The TAG files store summary event quantities that allow a quick selection of interesting events. This data will be produced at a nominal rate of 200 Hz, and is uploaded into a relational database for access from websites and other tools. The estimated database volume is 6TB per year, making it the largest application running on the ATLAS relational databases, at CERN and at other voluntary sites. The sheer volume and high rate of production makes this application a challenge to data and resource management, in many aspects. This paper will focus on the operational challenges of this system. These include: uploading the data from files to the CERN's and remote sites' databases; distributing the TAG metadata that is essential to guide the user through event selection; controlling resource usage of the database, from the user query load to the strategy of cleaning and archiving of old TAG data.

  8. Prototype Food and Nutrient Database for Dietary Studies: Branded Food Products Database for Public Health Proof of Concept

    Science.gov (United States)

    The Prototype Food and Nutrient Database for Dietary Studies (Prototype FNDDS) Branded Food Products Database for Public Health is a proof of concept database. The database contains a small selection of food products which is being used to exhibit the approach for incorporation of the Branded Food ...

  9. Update History of This Database - FANTOM5 | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available CAGE TSS aggregation 」 「 CAGE peaks 」 2015/12/07 FANTOM5 archive site is opened. (Archive V1) 2014/03/27 FANTOM5 ( http://fantom...switchLanguage; BLAST Search Image Search Home About Archive Update History Data List Contact us FANTOM...5 Update History of This Database Date Update contents 2017/03/14 FANTOM5 English arch...escription Download License Update History of This Database Site Policy | Contact Us Update History of This Database - FANTOM5 | LSDB Archive ...

  10. Product Licenses Database Application

    CERN Document Server

    Tonkovikj, Petar

    2016-01-01

    The goal of this project is to organize and centralize the data about software tools available to CERN employees, as well as provide a system that would simplify the license management process by providing information about the available licenses and their expiry dates. The project development process is consisted of two steps: modeling the products (software tools), product licenses, legal agreements and other data related to these entities in a relational database and developing the front-end user interface so that the user can interact with the database. The result is an ASP.NET MVC web application with interactive views for displaying and managing the data in the underlying database.

  11. COMPARISON OF POPULAR BIOINFORMATICS DATABASES

    OpenAIRE

    Abdulganiyu Abdu Yusuf; Zahraddeen Sufyanu; Kabir Yusuf Mamman; Abubakar Umar Suleiman

    2016-01-01

    Bioinformatics is the application of computational tools to capture and interpret biological data. It has wide applications in drug development, crop improvement, agricultural biotechnology and forensic DNA analysis. There are various databases available to researchers in bioinformatics. These databases are customized for a specific need and are ranged in size, scope, and purpose. The main drawbacks of bioinformatics databases include redundant information, constant change, data spread over m...

  12. Atomic Spectra Database (ASD)

    Science.gov (United States)

    SRD 78 NIST Atomic Spectra Database (ASD) (Web, free access)   This database provides access and search capability for NIST critically evaluated data on atomic energy levels, wavelengths, and transition probabilities that are reasonably up-to-date. The NIST Atomic Spectroscopy Data Center has carried out these critical compilations.

  13. Network and Database Security: Regulatory Compliance, Network, and Database Security - A Unified Process and Goal

    OpenAIRE

    Errol A. Blake

    2007-01-01

    Database security has evolved; data security professionals have developed numerous techniques and approaches to assure data confidentiality, integrity, and availability. This paper will show that the Traditional Database Security, which has focused primarily on creating user accounts and managing user privileges to database objects are not enough to protect data confidentiality, integrity, and availability. This paper is a compilation of different journals, articles and classroom discussions ...

  14. De-identifying an EHR Database

    DEFF Research Database (Denmark)

    Lauesen, Søren; Pantazos, Kostas; Lippert, Søren

    2011-01-01

    -identified a Danish EHR database with 437,164 patients. The goal was to generate a version with real medical records, but related to artificial persons. We developed a de-identification algorithm that uses lists of named entities, simple language analysis, and special rules. Our algorithm consists of 3 steps: collect...... lists of identifiers from the database and external resources, define a replacement for each identifier, and replace identifiers in structured data and free text. Some patient records could not be safely de-identified, so the de-identified database has 323,122 patient records with an acceptable degree...... of anonymity, readability and correctness (F-measure of 95%). The algorithm has to be adjusted for each culture, language and database....

  15. Security Research on Engineering Database System

    Institute of Scientific and Technical Information of China (English)

    2002-01-01

    Engine engineering database system is an oriented C AD applied database management system that has the capability managing distributed data. The paper discusses the security issue of the engine engineering database management system (EDBMS). Through studying and analyzing the database security, to draw a series of securi ty rules, which reach B1, level security standard. Which includes discretionary access control (DAC), mandatory access control (MAC) and audit. The EDBMS implem ents functions of DAC, ...

  16. The Lung Image Database Consortium (LIDC) and Image Database Resource Initiative (IDRI): A Completed Reference Database of Lung Nodules on CT Scans

    International Nuclear Information System (INIS)

    2011-01-01

    Purpose: The development of computer-aided diagnostic (CAD) methods for lung nodule detection, classification, and quantitative assessment can be facilitated through a well-characterized repository of computed tomography (CT) scans. The Lung Image Database Consortium (LIDC) and Image Database Resource Initiative (IDRI) completed such a database, establishing a publicly available reference for the medical imaging research community. Initiated by the National Cancer Institute (NCI), further advanced by the Foundation for the National Institutes of Health (FNIH), and accompanied by the Food and Drug Administration (FDA) through active participation, this public-private partnership demonstrates the success of a consortium founded on a consensus-based process. Methods: Seven academic centers and eight medical imaging companies collaborated to identify, address, and resolve challenging organizational, technical, and clinical issues to provide a solid foundation for a robust database. The LIDC/IDRI Database contains 1018 cases, each of which includes images from a clinical thoracic CT scan and an associated XML file that records the results of a two-phase image annotation process performed by four experienced thoracic radiologists. In the initial blinded-read phase, each radiologist independently reviewed each CT scan and marked lesions belonging to one of three categories (''nodule≥3 mm,''''nodule<3 mm,'' and ''non-nodule≥3 mm''). In the subsequent unblinded-read phase, each radiologist independently reviewed their own marks along with the anonymized marks of the three other radiologists to render a final opinion. The goal of this process was to identify as completely as possible all lung nodules in each CT scan without requiring forced consensus. Results: The Database contains 7371 lesions marked ''nodule'' by at least one radiologist. 2669 of these lesions were marked ''nodule≥3 mm'' by at least one radiologist, of which 928 (34.7%) received such marks from all

  17. JT-60 database system, 2

    International Nuclear Information System (INIS)

    Itoh, Yasuhiro; Kurihara, Kenichi; Kimura, Toyoaki.

    1987-07-01

    The JT-60 central control system, ''ZENKEI'' collects the control and instrumentation data relevant to discharge and device status data for plant monitoring. The former of the engineering data amounts to about 3 Mbytes per shot of discharge. The ''ZENKEI'' control system which consists of seven minicomputers for on-line real-time control has little performance of handling such a large amount of data for physical and engineering analysis. In order to solve this problem, it was planned to establish the experimental database on the Front-end Processor (FEP) of general purpose large computer in JAERI Computer Center. The database management system (DBMS), therefore, has been developed for creating the database during the shot interval. The engineering data are shipped up from ''ZENKEI'' to FEP through the dedicated communication line after the shot. The hierarchical data model has been adopted in this database, which consists of the data files with tree structure of three keys of system, discharge type and shot number. The JT-60 DBMS provides the data handling packages of subroutines for interfacing the database with user's application programs. The subroutine packages for supporting graphic processing and the function of access control for security of the database are also prepared in this DBMS. (author)

  18. SIFTS: Structure Integration with Function, Taxonomy and Sequences resource

    Science.gov (United States)

    Velankar, Sameer; Dana, José M.; Jacobsen, Julius; van Ginkel, Glen; Gane, Paul J.; Luo, Jie; Oldfield, Thomas J.; O’Donovan, Claire; Martin, Maria-Jesus; Kleywegt, Gerard J.

    2013-01-01

    The Structure Integration with Function, Taxonomy and Sequences resource (SIFTS; http://pdbe.org/sifts) is a close collaboration between the Protein Data Bank in Europe (PDBe) and UniProt. The two teams have developed a semi-automated process for maintaining up-to-date cross-reference information to UniProt entries, for all protein chains in the PDB entries present in the UniProt database. This process is carried out for every weekly PDB release and the information is stored in the SIFTS database. The SIFTS process includes cross-references to other biological resources such as Pfam, SCOP, CATH, GO, InterPro and the NCBI taxonomy database. The information is exported in XML format, one file for each PDB entry, and is made available by FTP. Many bioinformatics resources use SIFTS data to obtain cross-references between the PDB and other biological databases so as to provide their users with up-to-date information. PMID:23203869

  19. Surgery Risk Assessment (SRA) Database

    Data.gov (United States)

    Department of Veterans Affairs — The Surgery Risk Assessment (SRA) database is part of the VA Surgical Quality Improvement Program (VASQIP). This database contains assessments of selected surgical...

  20. KALIMER design database development and operation manual

    International Nuclear Information System (INIS)

    Jeong, Kwan Seong; Hahn, Do Hee; Lee, Yong Bum; Chang, Won Pyo

    2000-12-01

    KALIMER Design Database is developed to utilize the integration management for Liquid Metal Reactor Design Technology Development using Web Applications. KALIMER Design database consists of Results Database, Inter-Office Communication (IOC), 3D CAD database, Team Cooperation System, and Reserved Documents. Results Database is a research results database for mid-term and long-term nuclear R and D. IOC is a linkage control system inter sub project to share and integrate the research results for KALIMER. 3D CAD Database is a schematic design overview for KALIMER. Team Cooperation System is to inform team member of research cooperation and meetings. Finally, KALIMER Reserved Documents is developed to manage collected data and several documents since project accomplishment

  1. Databases for INDUS-1 and INDUS-2

    International Nuclear Information System (INIS)

    Merh, Bhavna N.; Fatnani, Pravin

    2003-01-01

    The databases for Indus are relational databases designed to store various categories of data related to the accelerator. The data archiving and retrieving system in Indus is based on a client/sever model. A general purpose commercial database is used to store parameters and equipment data for the whole machine. The database manages configuration, on-line and historical databases. On line and off line applications distributed in several systems can store and retrieve the data from the database over the network. This paper describes the structure of databases for Indus-1 and Indus-2 and their integration within the software architecture. The data analysis, design, resulting data-schema and implementation issues are discussed. (author)

  2. KALIMER design database development and operation manual

    Energy Technology Data Exchange (ETDEWEB)

    Jeong, Kwan Seong; Hahn, Do Hee; Lee, Yong Bum; Chang, Won Pyo

    2000-12-01

    KALIMER Design Database is developed to utilize the integration management for Liquid Metal Reactor Design Technology Development using Web Applications. KALIMER Design database consists of Results Database, Inter-Office Communication (IOC), 3D CAD database, Team Cooperation System, and Reserved Documents. Results Database is a research results database for mid-term and long-term nuclear R and D. IOC is a linkage control system inter sub project to share and integrate the research results for KALIMER. 3D CAD Database is a schematic design overview for KALIMER. Team Cooperation System is to inform team member of research cooperation and meetings. Finally, KALIMER Reserved Documents is developed to manage collected data and several documents since project accomplishment.

  3. The ATLAS TAGS database distribution and management - Operational challenges of a multi-terabyte distributed database

    Energy Technology Data Exchange (ETDEWEB)

    Viegas, F; Nairz, A; Goossens, L [CERN, CH-1211 Geneve 23 (Switzerland); Malon, D; Cranshaw, J [Argonne National Laboratory, 9700 S. Cass Avenue, Argonne, IL 60439 (United States); Dimitrov, G [DESY, D-22603 Hamburg (Germany); Nowak, M; Gamboa, C [Brookhaven National Laboratory, PO Box 5000 Upton, NY 11973-5000 (United States); Gallas, E [University of Oxford, Denys Wilkinson Building, Keble Road, Oxford OX1 3RH (United Kingdom); Wong, A [Triumf, 4004 Wesbrook Mall, Vancouver, BC, V6T 2A3 (Canada); Vinek, E [University of Vienna, Dr.-Karl-Lueger-Ring 1, 1010 Vienna (Austria)

    2010-04-01

    The TAG files store summary event quantities that allow a quick selection of interesting events. This data will be produced at a nominal rate of 200 Hz, and is uploaded into a relational database for access from websites and other tools. The estimated database volume is 6TB per year, making it the largest application running on the ATLAS relational databases, at CERN and at other voluntary sites. The sheer volume and high rate of production makes this application a challenge to data and resource management, in many aspects. This paper will focus on the operational challenges of this system. These include: uploading the data from files to the CERN's and remote sites' databases; distributing the TAG metadata that is essential to guide the user through event selection; controlling resource usage of the database, from the user query load to the strategy of cleaning and archiving of old TAG data.

  4. An Integrated Molecular Database on Indian Insects.

    Science.gov (United States)

    Pratheepa, Maria; Venkatesan, Thiruvengadam; Gracy, Gandhi; Jalali, Sushil Kumar; Rangheswaran, Rajagopal; Antony, Jomin Cruz; Rai, Anil

    2018-01-01

    MOlecular Database on Indian Insects (MODII) is an online database linking several databases like Insect Pest Info, Insect Barcode Information System (IBIn), Insect Whole Genome sequence, Other Genomic Resources of National Bureau of Agricultural Insect Resources (NBAIR), Whole Genome sequencing of Honey bee viruses, Insecticide resistance gene database and Genomic tools. This database was developed with a holistic approach for collecting information about phenomic and genomic information of agriculturally important insects. This insect resource database is available online for free at http://cib.res.in. http://cib.res.in/.

  5. Physical database design using Oracle

    CERN Document Server

    Burleson, Donald K

    2004-01-01

    INTRODUCTION TO ORACLE PHYSICAL DESIGNPrefaceRelational Databases and Physical DesignSystems Analysis and Physical Database DesignIntroduction to Logical Database DesignEntity/Relation ModelingBridging between Logical and Physical ModelsPhysical Design Requirements Validation PHYSICAL ENTITY DESIGN FOR ORACLEData Relationships and Physical DesignMassive De-Normalization: STAR Schema DesignDesigning Class HierarchiesMaterialized Views and De-NormalizationReferential IntegrityConclusionORACLE HARDWARE DESIGNPlanning the Server EnvironmentDesigning the Network Infrastructure for OracleOracle Netw

  6. RDD Databases

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — This database was established to oversee documents issued in support of fishery research activities including experimental fishing permits (EFP), letters of...

  7. DEVELOPING MULTITHREADED DATABASE APPLICATION USING JAVA TOOLS AND ORACLE DATABASE MANAGEMENT SYSTEM IN INTRANET ENVIRONMENT

    OpenAIRE

    Raied Salman

    2015-01-01

    In many business organizations, database applications are designed and implemented using various DBMS and Programming Languages. These applications are used to maintain databases for the organizations. The organization departments can be located at different locations and can be connected by intranet environment. In such environment maintenance of database records become an assignment of complexity which needs to be resolved. In this paper an intranet application is designed an...

  8. Mobile Source Observation Database (MSOD)

    Data.gov (United States)

    U.S. Environmental Protection Agency — The Mobile Source Observation Database (MSOD) is a relational database being developed by the Assessment and Standards Division (ASD) of the US Environmental...

  9. Jelly Views : Extending Relational Database Systems Toward Deductive Database Systems

    Directory of Open Access Journals (Sweden)

    Igor Wojnicki

    2004-01-01

    Full Text Available This paper regards the Jelly View technology, which provides a new, practical methodology for knowledge decomposition, storage, and retrieval within Relational Database Management Systems (RDBMS. Intensional Knowledge clauses (rules are decomposed and stored in the RDBMS founding reusable components. The results of the rule-based processing are visible as regular views, accessible through SQL. From the end-user point of view the processing capability becomes unlimited (arbitrarily complex queries can be constructed using Intensional Knowledge, while the most external queries are expressed with standard SQL. The RDBMS functionality becomes extended toward that of the Deductive Databases

  10. Authority Control and Linked Bibliographic Databases.

    Science.gov (United States)

    Clack, Doris H.

    1988-01-01

    Explores issues related to bibliographic database authority control, including the nature of standards, quality control, library cooperation, centralized and decentralized databases and authority control systems, and economic considerations. The implications of authority control for linking large scale databases are discussed. (18 references)…

  11. Security aspects of database systems implementation

    OpenAIRE

    Pokorný, Tomáš

    2009-01-01

    The aim of this thesis is to provide a comprehensive overview of database systems security. Reader is introduced into the basis of information security and its development. Following chapter defines a concept of database system security using ISO/IEC 27000 Standard. The findings from this chapter form a complex list of requirements on database security. One chapter also deals with legal aspects of this domain. Second part of this thesis offers a comparison of four object-relational database s...

  12. Relational Databases and Biomedical Big Data.

    Science.gov (United States)

    de Silva, N H Nisansa D

    2017-01-01

    In various biomedical applications that collect, handle, and manipulate data, the amounts of data tend to build up and venture into the range identified as bigdata. In such occurrences, a design decision has to be taken as to what type of database would be used to handle this data. More often than not, the default and classical solution to this in the biomedical domain according to past research is relational databases. While this used to be the norm for a long while, it is evident that there is a trend to move away from relational databases in favor of other types and paradigms of databases. However, it still has paramount importance to understand the interrelation that exists between biomedical big data and relational databases. This chapter will review the pros and cons of using relational databases to store biomedical big data that previous researches have discussed and used.

  13. Development and application of nuclear power operation database

    International Nuclear Information System (INIS)

    Shao Juying; Fang Zhaoxia

    1996-01-01

    The article describes the development of the Nuclear Power Operation Database which include Domestic and Overseas Nuclear Event Scale Database, Overseas Nuclear Power Operation Abnormal Event Database, Overseas Nuclear Power Operation General Reliability Database and Qinshan Nuclear Power Operation Abnormal Event Database. The development includes data collection and analysis, database construction and code design, database management system selection. The application of the database to provide support to the safety analysis of the NPPs which have been in commercial operation is also introduced

  14. The CATH database

    Directory of Open Access Journals (Sweden)

    Knudsen Michael

    2010-02-01

    Full Text Available Abstract The CATH database provides hierarchical classification of protein domains based on their folding patterns. Domains are obtained from protein structures deposited in the Protein Data Bank and both domain identification and subsequent classification use manual as well as automated procedures. The accompanying website http://www.cathdb.info provides an easy-to-use entry to the classification, allowing for both browsing and downloading of data. Here, we give a brief review of the database, its corresponding website and some related tools.

  15. Linking genotypes database with locus-specific database and genotype-phenotype correlation in phenylketonuria.

    Science.gov (United States)

    Wettstein, Sarah; Underhaug, Jarl; Perez, Belen; Marsden, Brian D; Yue, Wyatt W; Martinez, Aurora; Blau, Nenad

    2015-03-01

    The wide range of metabolic phenotypes in phenylketonuria is due to a large number of variants causing variable impairment in phenylalanine hydroxylase function. A total of 834 phenylalanine hydroxylase gene variants from the locus-specific database PAHvdb and genotypes of 4181 phenylketonuria patients from the BIOPKU database were characterized using FoldX, SIFT Blink, Polyphen-2 and SNPs3D algorithms. Obtained data was correlated with residual enzyme activity, patients' phenotype and tetrahydrobiopterin responsiveness. A descriptive analysis of both databases was compiled and an interactive viewer in PAHvdb database was implemented for structure visualization of missense variants. We found a quantitative relationship between phenylalanine hydroxylase protein stability and enzyme activity (r(s) = 0.479), between protein stability and allelic phenotype (r(s) = -0.458), as well as between enzyme activity and allelic phenotype (r(s) = 0.799). Enzyme stability algorithms (FoldX and SNPs3D), allelic phenotype and enzyme activity were most powerful to predict patients' phenotype and tetrahydrobiopterin response. Phenotype prediction was most accurate in deleterious genotypes (≈ 100%), followed by homozygous (92.9%), hemizygous (94.8%), and compound heterozygous genotypes (77.9%), while tetrahydrobiopterin response was correctly predicted in 71.0% of all cases. To our knowledge this is the largest study using algorithms for the prediction of patients' phenotype and tetrahydrobiopterin responsiveness in phenylketonuria patients, using data from the locus-specific and genotypes database.

  16. Environmental DNA as a Tool for Inventory and Monitoring of Aquatic Vertebrates

    Science.gov (United States)

    2017-07-01

    11  Figure 5-1. The Applied Biosystems 7500 Fast Real-Time PCR System, where Most of the Samples...Chinook salmon fry were found in YTC’s perennial streams (Johnson, Hanson, and Alkali Creeks), as well as the intermittent Corral Creek, in the...Biosystems 7500 Fast Real-Time PCR System (Figure 5-1) for all samples collected 2012-2013. For 2014, an upgraded machine with the same technology was

  17. LHCb distributed conditions database

    International Nuclear Information System (INIS)

    Clemencic, M

    2008-01-01

    The LHCb Conditions Database project provides the necessary tools to handle non-event time-varying data. The main users of conditions are reconstruction and analysis processes, which are running on the Grid. To allow efficient access to the data, we need to use a synchronized replica of the content of the database located at the same site as the event data file, i.e. the LHCb Tier1. The replica to be accessed is selected from information stored on LFC (LCG File Catalog) and managed with the interface provided by the LCG developed library CORAL. The plan to limit the submission of jobs to those sites where the required conditions are available will also be presented. LHCb applications are using the Conditions Database framework on a production basis since March 2007. We have been able to collect statistics on the performance and effectiveness of both the LCG library COOL (the library providing conditions handling functionalities) and the distribution framework itself. Stress tests on the CNAF hosted replica of the Conditions Database have been performed and the results will be summarized here

  18. Database on wind characteristics

    Energy Technology Data Exchange (ETDEWEB)

    Hansen, K.S. [The Technical Univ. of Denmark (Denmark); Courtney, M.S. [Risoe National Lab., (Denmark)

    1999-08-01

    The organisations that participated in the project consists of five research organisations: MIUU (Sweden), ECN (The Netherlands), CRES (Greece), DTU (Denmark), Risoe (Denmark) and one wind turbine manufacturer: Vestas Wind System A/S (Denmark). The overall goal was to build a database consisting of a large number of wind speed time series and create tools for efficiently searching through the data to select interesting data. The project resulted in a database located at DTU, Denmark with online access through the Internet. The database contains more than 50.000 hours of measured wind speed measurements. A wide range of wind climates and terrain types are represented with significant amounts of time series. Data have been chosen selectively with a deliberate over-representation of high wind and complex terrain cases. This makes the database ideal for wind turbine design needs but completely unsuitable for resource studies. Diversity has also been an important aim and this is realised with data from a large range of terrain types; everything from offshore to mountain, from Norway to Greece. (EHS)

  19. Using Large Diabetes Databases for Research.

    Science.gov (United States)

    Wild, Sarah; Fischbacher, Colin; McKnight, John

    2016-09-01

    There are an increasing number of clinical, administrative and trial databases that can be used for research. These are particularly valuable if there are opportunities for linkage to other databases. This paper describes examples of the use of large diabetes databases for research. It reviews the advantages and disadvantages of using large diabetes databases for research and suggests solutions for some challenges. Large, high-quality databases offer potential sources of information for research at relatively low cost. Fundamental issues for using databases for research are the completeness of capture of cases within the population and time period of interest and accuracy of the diagnosis of diabetes and outcomes of interest. The extent to which people included in the database are representative should be considered if the database is not population based and there is the intention to extrapolate findings to the wider diabetes population. Information on key variables such as date of diagnosis or duration of diabetes may not be available at all, may be inaccurate or may contain a large amount of missing data. Information on key confounding factors is rarely available for the nondiabetic or general population limiting comparisons with the population of people with diabetes. However comparisons that allow for differences in distribution of important demographic factors may be feasible using data for the whole population or a matched cohort study design. In summary, diabetes databases can be used to address important research questions. Understanding the strengths and limitations of this approach is crucial to interpret the findings appropriately. © 2016 Diabetes Technology Society.

  20. [Validation of interaction databases in psychopharmacotherapy].

    Science.gov (United States)

    Hahn, M; Roll, S C

    2018-03-01

    Drug-drug interaction databases are an important tool to increase drug safety in polypharmacy. There are several drug interaction databases available but it is unclear which one shows the best results and therefore increases safety for the user of the databases and the patients. So far, there has been no validation of German drug interaction databases. Validation of German drug interaction databases regarding the number of hits, mechanisms of drug interaction, references, clinical advice, and severity of the interaction. A total of 36 drug interactions which were published in the last 3-5 years were checked in 5 different databases. Besides the number of hits, it was also documented if the mechanism was correct, clinical advice was given, primary literature was cited, and the severity level of the drug-drug interaction was given. All databases showed weaknesses regarding the hit rate of the tested drug interactions, with a maximum of 67.7% hits. The highest score in this validation was achieved by MediQ with 104 out of 180 points. PsiacOnline achieved 83 points, arznei-telegramm® 58, ifap index® 54 and the ABDA-database 49 points. Based on this validation MediQ seems to be the most suitable databank for the field of psychopharmacotherapy. The best results in this comparison were achieved by MediQ but this database also needs improvement with respect to the hit rate so that the users can rely on the results and therefore increase drug therapy safety.

  1. What is a Lexicographical Database? | Bergenholtz | Lexikos

    African Journals Online (AJOL)

    Fifty years ago, nolexicographer used a database in the work process. Today, almost all dictionary projects incorporate databases. In our opinion, the optimal lexicographical database should be planned in cooperation between a lexicographer and a database specialist in each specific lexicographical project.

  2. National Transportation Atlas Databases : 2012.

    Science.gov (United States)

    2012-01-01

    The National Transportation Atlas Databases 2012 (NTAD2012) is a set of nationwide geographic databases of transportation facilities, transportation networks, and associated infrastructure. These datasets include spatial information for transportatio...

  3. National Transportation Atlas Databases : 2011.

    Science.gov (United States)

    2011-01-01

    The National Transportation Atlas Databases 2011 (NTAD2011) is a set of nationwide geographic databases of transportation facilities, transportation networks, and associated infrastructure. These datasets include spatial information for transportatio...

  4. National Transportation Atlas Databases : 2009.

    Science.gov (United States)

    2009-01-01

    The National Transportation Atlas Databases 2009 (NTAD2009) is a set of nationwide geographic databases of transportation facilities, transportation networks, and associated infrastructure. These datasets include spatial information for transportatio...

  5. National Transportation Atlas Databases : 2010.

    Science.gov (United States)

    2010-01-01

    The National Transportation Atlas Databases 2010 (NTAD2010) is a set of nationwide geographic databases of transportation facilities, transportation networks, and associated infrastructure. These datasets include spatial information for transportatio...

  6. The USAID Environmental Compliance Database

    Data.gov (United States)

    US Agency for International Development — The Environmental Compliance Database is a record of environmental compliance submissions with their outcomes. Documents in the database can be found by visiting the...

  7. Directory of IAEA databases. 4. ed.

    International Nuclear Information System (INIS)

    1997-06-01

    This fourth edition of the Directory of IAEA Databases has been prepared within the Division of NESI. ITs main objective is to describe the computerized information sources available to the public. This directory contains all publicly available databases which are produced at the IAEA. This includes databases stored on the mainframe, LAN servers and user PCs. All IAEA Division Directors have been requested to register the existence of their databases with NESI. At the data of printing, some of the information in the directory will be already obsolete. For the most up-to-date information please see the IAEA's World Wide Web site at URL: http:/www.iaea.or.at/databases/dbdir/. Refs, figs, tabs

  8. Distributed Database Control and Allocation. Volume 3. Distributed Database System Designer’s Handbook.

    Science.gov (United States)

    1983-10-01

    Multiversion Data 2-18 2.7.1 Multiversion Timestamping 2-20 2.T.2 Multiversion Looking 2-20 2.8 Combining the Techniques 2-22 3. Database Recovery Algorithms...See rTHEM79, GIFF79] for details. 2.7 Multiversion Data Let us return to a database system model where each logical data item is stored at one DM...In a multiversion database each Write wifxl, produces a new copy (or version) of x, denoted xi. Thus, the value of z is a set of ver- sions. For each

  9. The PMDB Protein Model Database

    Science.gov (United States)

    Castrignanò, Tiziana; De Meo, Paolo D'Onorio; Cozzetto, Domenico; Talamo, Ivano Giuseppe; Tramontano, Anna

    2006-01-01

    The Protein Model Database (PMDB) is a public resource aimed at storing manually built 3D models of proteins. The database is designed to provide access to models published in the scientific literature, together with validating experimental data. It is a relational database and it currently contains >74 000 models for ∼240 proteins. The system is accessible at and allows predictors to submit models along with related supporting evidence and users to download them through a simple and intuitive interface. Users can navigate in the database and retrieve models referring to the same target protein or to different regions of the same protein. Each model is assigned a unique identifier that allows interested users to directly access the data. PMID:16381873

  10. The Danish Fetal Medicine Database

    DEFF Research Database (Denmark)

    Ekelund, Charlotte K; Petersen, Olav B; Jørgensen, Finn S

    2015-01-01

    OBJECTIVE: To describe the establishment and organization of the Danish Fetal Medicine Database and to report national results of first-trimester combined screening for trisomy 21 in the 5-year period 2008-2012. DESIGN: National register study using prospectively collected first-trimester screening...... data from the Danish Fetal Medicine Database. POPULATION: Pregnant women in Denmark undergoing first-trimester screening for trisomy 21. METHODS: Data on maternal characteristics, biochemical and ultrasonic markers are continuously sent electronically from local fetal medicine databases (Astraia Gmbh...... software) to a central national database. Data are linked to outcome data from the National Birth Register, the National Patient Register and the National Cytogenetic Register via the mother's unique personal registration number. First-trimester screening data from 2008 to 2012 were retrieved. MAIN OUTCOME...

  11. Databases and bookkeeping for HEP experiments

    International Nuclear Information System (INIS)

    Blobel, V.; Cnops, A.-M.; Fisher, S.M.

    1983-09-01

    The term database is explained as well as the requirements for data bases in High Energy physics (HEP). Also covered are the packages used in HEP, summary of user experience, database management systems, relational database management systems for HEP use and observations. (U.K.)

  12. Content And Multimedia Database Management Systems

    NARCIS (Netherlands)

    de Vries, A.P.

    1999-01-01

    A database management system is a general-purpose software system that facilitates the processes of defining, constructing, and manipulating databases for various applications. The main characteristic of the ‘database approach’ is that it increases the value of data by its emphasis on data

  13. Storing XML Documents in Databases

    OpenAIRE

    Schmidt, A.R.; Manegold, Stefan; Kersten, Martin; Rivero, L.C.; Doorn, J.H.; Ferraggine, V.E.

    2005-01-01

    textabstractThe authors introduce concepts for loading large amounts of XML documents into databases where the documents are stored and maintained. The goal is to make XML databases as unobtrusive in multi-tier systems as possible and at the same time provide as many services defined by the XML standards as possible. The ubiquity of XML has sparked great interest in deploying concepts known from Relational Database Management Systems such as declarative query languages, transactions, indexes ...

  14. PostgreSQL database performance optimization

    OpenAIRE

    Wang, Qiang

    2011-01-01

    The thesis was request by Marlevo software Oy for a general description of the PostgreSQL database and its performance optimization technics. Its purpose was to help new PostgreSQL users to quickly understand the system and to assist DBAs to improve the database performance. The thesis was divided into two parts. The first part described PostgreSQL database optimization technics in theory. In additional popular tools were also introduced. This part was based on PostgreSQL documentation, r...

  15. Column-Oriented Database Systems (Tutorial)

    OpenAIRE

    Abadi, D.; Boncz, Peter; Harizopoulos, S.

    2009-01-01

    textabstractColumn-oriented database systems (column-stores) have attracted a lot of attention in the past few years. Column-stores, in a nutshell, store each database table column separately, with attribute values belonging to the same column stored contiguously, compressed, and densely packed, as opposed to traditional database systems that store entire records (rows) one after the other. Reading a subset of a table’s columns becomes faster, at the potential expense of excessive disk-head s...

  16. Categorical database generalization in GIS

    NARCIS (Netherlands)

    Liu, Y.

    2002-01-01

    Key words: Categorical database, categorical database generalization, Formal data structure, constraints, transformation unit, classification hierarchy, aggregation hierarchy, semantic similarity, data model,

  17. Children's Culture Database (CCD)

    DEFF Research Database (Denmark)

    Wanting, Birgit

    a Dialogue inspired database with documentation, network (individual and institutional profiles) and current news , paper presented at the research seminar: Electronic access to fiction, Copenhagen, November 11-13, 1996......a Dialogue inspired database with documentation, network (individual and institutional profiles) and current news , paper presented at the research seminar: Electronic access to fiction, Copenhagen, November 11-13, 1996...

  18. ArrayExpress update--trends in database growth and links to data analysis tools.

    Science.gov (United States)

    Rustici, Gabriella; Kolesnikov, Nikolay; Brandizi, Marco; Burdett, Tony; Dylag, Miroslaw; Emam, Ibrahim; Farne, Anna; Hastings, Emma; Ison, Jon; Keays, Maria; Kurbatova, Natalja; Malone, James; Mani, Roby; Mupo, Annalisa; Pedro Pereira, Rui; Pilicheva, Ekaterina; Rung, Johan; Sharma, Anjan; Tang, Y Amy; Ternent, Tobias; Tikhonov, Andrew; Welter, Danielle; Williams, Eleanor; Brazma, Alvis; Parkinson, Helen; Sarkans, Ugis

    2013-01-01

    The ArrayExpress Archive of Functional Genomics Data (http://www.ebi.ac.uk/arrayexpress) is one of three international functional genomics public data repositories, alongside the Gene Expression Omnibus at NCBI and the DDBJ Omics Archive, supporting peer-reviewed publications. It accepts data generated by sequencing or array-based technologies and currently contains data from almost a million assays, from over 30 000 experiments. The proportion of sequencing-based submissions has grown significantly over the last 2 years and has reached, in 2012, 15% of all new data. All data are available from ArrayExpress in MAGE-TAB format, which allows robust linking to data analysis and visualization tools, including Bioconductor and GenomeSpace. Additionally, R objects, for microarray data, and binary alignment format files, for sequencing data, have been generated for a significant proportion of ArrayExpress data.

  19. International Nuclear Safety Center (INSC) database

    International Nuclear Information System (INIS)

    Sofu, T.; Ley, H.; Turski, R.B.

    1997-01-01

    As an integral part of DOE's International Nuclear Safety Center (INSC) at Argonne National Laboratory, the INSC Database has been established to provide an interactively accessible information resource for the world's nuclear facilities and to promote free and open exchange of nuclear safety information among nations. The INSC Database is a comprehensive resource database aimed at a scope and level of detail suitable for safety analysis and risk evaluation for the world's nuclear power plants and facilities. It also provides an electronic forum for international collaborative safety research for the Department of Energy and its international partners. The database is intended to provide plant design information, material properties, computational tools, and results of safety analysis. Initial emphasis in data gathering is given to Soviet-designed reactors in Russia, the former Soviet Union, and Eastern Europe. The implementation is performed under the Oracle database management system, and the World Wide Web is used to serve as the access path for remote users. An interface between the Oracle database and the Web server is established through a custom designed Web-Oracle gateway which is used mainly to perform queries on the stored data in the database tables

  20. Dealer Database

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — The dealer reporting databases contain the primary data reported by federally permitted seafood dealers in the northeast. Electronic reporting was implemented May 1,...

  1. XML databases and the semantic web

    CERN Document Server

    Thuraisingham, Bhavani

    2002-01-01

    Efficient access to data, sharing data, extracting information from data, and making use of the information have become urgent needs for today''s corporations. With so much data on the Web, managing it with conventional tools is becoming almost impossible. New tools and techniques are necessary to provide interoperability as well as warehousing between multiple data sources and systems, and to extract information from the databases. XML Databases and the Semantic Web focuses on critical and new Web technologies needed for organizations to carry out transactions on the Web, to understand how to use the Web effectively, and to exchange complex documents on the Web.This reference for database administrators, database designers, and Web designers working in tandem with database technologists covers three emerging technologies of significant impact for electronic business: Extensible Markup Language (XML), semi-structured databases, and the semantic Web. The first two parts of the book explore these emerging techn...

  2. Heterogeneous distributed databases: A case study

    Science.gov (United States)

    Stewart, Tracy R.; Mukkamala, Ravi

    1991-01-01

    Alternatives are reviewed for accessing distributed heterogeneous databases and a recommended solution is proposed. The current study is limited to the Automated Information Systems Center at the Naval Sea Combat Systems Engineering Station at Norfolk, VA. This center maintains two databases located on Digital Equipment Corporation's VAX computers running under the VMS operating system. The first data base, ICMS, resides on a VAX11/780 and has been implemented using VAX DBMS, a CODASYL based system. The second database, CSA, resides on a VAX 6460 and has been implemented using the ORACLE relational database management system (RDBMS). Both databases are used for configuration management within the U.S. Navy. Different customer bases are supported by each database. ICMS tracks U.S. Navy ships and major systems (anti-sub, sonar, etc.). Even though the major systems on ships and submarines have totally different functions, some of the equipment within the major systems are common to both ships and submarines.

  3. De novo transcriptome assembly of two different peach cultivars grown in Korea

    Directory of Open Access Journals (Sweden)

    Yeonhwa Jo

    2015-12-01

    Full Text Available Peach (Prunus persica is one of the most popular stone fruits worldwide. Next generation sequencing (NGS has facilitated genome and transcriptome analyses of several stone fruit trees. In this study, we conducted de novo transcriptome analyses of two peach cultivars grown in Korea. Leaves of two cultivars, referred to as Jangtaek and Mibaek, were harvested and used for library preparation. The two prepared libraries were paired-end sequenced by the HiSeq2000 system. We obtained 8.14 GB and 9.62 GB sequence data from Jangtaek and Mibaek (NCBI accession numbers: SRS1056585 and SRS1056587, respectively. The Trinity program was used to assemble two transcriptomes de novo, resulting in 110,477 (Jangtaek and 136,196 (Mibaek transcripts. TransDecoder identified possible coding regions in assembled transcripts. The identified proteins were subjected to BLASTP search against NCBI's non-redundant database for functional annotation. This study provides transcriptome data for two peach cultivars, which might be useful for genetic marker development and comparative transcriptome analyses.

  4. Brain transcriptomes of honey bees (Apis mellifera experimentally infected by two pathogens: Black queen cell virus and Nosema ceranae

    Directory of Open Access Journals (Sweden)

    Vincent Doublet

    2016-12-01

    Full Text Available Regulation of gene expression in the brain plays an important role in behavioral plasticity and decision making in response to external stimuli. However, both can be severely affected by environmental factors, such as parasites and pathogens. In honey bees, the emergence and re-emergence of pathogens and potential for pathogen co-infection and interaction have been suggested as major components that significantly impaired social behavior and survival. To understand how the honey bee is affected and responds to interacting pathogens, we co-infected workers with two prevalent pathogens of different nature, the positive single strand RNA virus Black queen cell virus (BQCV, and the Microsporidia Nosema ceranae, and explored gene expression changes in brains upon single infections and co-infections. Our data provide an important resource for research on honey bee diseases, and more generally on insect host-pathogen and pathogen-pathogen interactions. Raw and processed data are publicly available in the NCBI/GEO database: (http://www.ncbi.nlm.nih.gov/geo/ under accession number GSE81664.

  5. Mapping transcriptome profiles of in vitro iPSC-derived cardiac differentiation to in utero heart development

    Directory of Open Access Journals (Sweden)

    Xing Li

    2016-03-01

    Full Text Available The dataset includes microarray data (Affymetrix Mouse Genome 430 2.0 Array from WT and Nos3−/− mouse embryonic heart ventricular tissues at 14.5 days post coitum (E14.5, induced pluripotent stem cells (iPSCs derived from WT and Nos3−/− mouse tail tip fibroblasts, iPSC-differentiated cardiomyocytes at Day 11, and mouse embryonic stem cells (mESCs and differentiated cardiomyocytes as positive controls for mouse iPSC differentiation. Both in utero (using embryonic heart tissues and in vitro (using iPSCs and differentiated cells microarray datasets were deposited to the NCBI Gene Expression Omnibus (GEO database. The deposited data in GEO include raw microarray data, metadata for sample source information, experimental design, sample and data processing, and gene expression matrix. The data are available under GEO Access Number GSE69317 (GSE69315 for tissue sample microarray data, GSE69316 for iPSCs microarray data, http://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc= GSE69317. Keywords: Induced pluripotent stem cell, Cardiac development, Nos3 knockout, Disease modeling, Microarray analysis

  6. Genotyping-by-sequencing data of 272 crested wheatgrass (Agropyron cristatum genotypes

    Directory of Open Access Journals (Sweden)

    Pingchuan Li

    2017-12-01

    Full Text Available Crested wheatgrass [Agropyron cristatum L. (Gaertn.] is an important cool-season forage grass widely used for early spring grazing. However, the genomic resources for this non-model plant are still lacking. Our goal was to generate the first set of next generation sequencing data using the genotyping-by-sequencing technique. A total of 272 crested wheatgrass plants representing seven breeding lines, five cultivars and five geographically diverse accessions were sequenced with an Illumina MiSeq instrument. These sequence datasets were processed using different bioinformatics tools to generate contigs for diploid and tetraploid plants and SNPs for diploid plants. Together, these genomic resources form a fundamental basis for genomic studies of crested wheatgrass and other wheatgrass species. The raw reads were deposited into Sequence Read Archive (SRA database under NCBI accession SRP115373 (https://www.ncbi.nlm.nih.gov/sra?term=SRP115373 and the supplementary datasets are accessible in Figshare (10.6084/m9.figshare.5345092. Keywords: Crested wheatgrass, Genotyping-by-sequencing, Diploid, Tetraploid, Raw sequence data

  7. DREW-UCLA Breast Cancer Research and Training Program: Molecular/Cellular Pathogenesis Model

    Science.gov (United States)

    2007-03-01

    RHS1764-9209568) were designed corresponding to nucleotides 575 to 595 of the coding region (gccctggccgtgctagacaat) of Homo sapiens ERBB2 transcript...variant 1, mRNA sequence (NM_004448, NCBI database), and 2896 to 2917 of the coding region (gctgaactggtgtatgcagatt) of Homo sapiens ERBB2, transcript...responsible for alanine transport. Springer Apoptosis (2007) 12:593–612 599 * T ra n sp o rt V el o ci ty (n m o l/m g p ro te in /m in ) 0.0 0.5 1.0

  8. Abstract databases in nuclear medicine; New database for articles not indexed in PubMed

    International Nuclear Information System (INIS)

    Ugrinska, A.; Mustafa, B.

    2004-01-01

    Full text: Abstract databases available on Internet free of charge were searched for nuclear medicine contents. The only comprehensive database found was PubMed. Analysis of nuclear medicine journals included in PubMed was performed. PubMed contains 25 medical journals that contain the phrase 'nuclear medicine' in different languages in their title. Searching the Internet with the search engine 'Google' we have found four more peer-reviewed journals with the phrase 'nuclear medicine' in their title. In addition, we are fully aware that many articles related to nuclear medicine are published in national medical journals devoted to general medicine. For example in year 2000 colleagues from Institute of Pathophysiology and Nuclear Medicine, Skopje, Macedonia have published 10 articles out of which none could be found on PubMed. This suggested that a big amount of research work is not accessible for the people professionally involved in nuclear medicine. Therefore, we have created a database framework for abstracts that couldn't be found in PubMed. The database is organized in user-friendly manner. There are two main sections: 'post an abstract' and 'search for abstracts'. Authors of the articles are expected to submit their work in the section 'post an abstract'. During the submission process authors should fill the separate boxes with the Title in English, Title in original language, Country of origin, Journal name, Volume, Issue and Pages. Authors should choose up to five keywords from a drop-down menu. Authors are encouraged if the abstract is not published in English to translate it. The section 'search for abstract' is searchable according to Author, Keywords, and words and phrases incorporated in the English title. The abstract database currently resides on an MS Access back-end, with a front-end in ASP (Active Server Pages). In the future, we plan to migrate the database on a MS SQL Server, which should provide a faster and more reliable framework for hosting a

  9. The Danish Fetal Medicine Database

    Directory of Open Access Journals (Sweden)

    Ekelund CK

    2016-10-01

    Full Text Available Charlotte Kvist Ekelund,1 Tine Iskov Kopp,2 Ann Tabor,1 Olav Bjørn Petersen3 1Department of Obstetrics, Center of Fetal Medicine, Rigshospitalet, University of Copenhagen, Copenhagen, Denmark; 2Registry Support Centre (East – Epidemiology and Biostatistics, Research Centre for Prevention and Health, Glostrup, Denmark; 3Fetal Medicine Unit, Aarhus University Hospital, Aarhus Nord, Denmark Aim: The aim of this study is to set up a database in order to monitor the detection rates and false-positive rates of first-trimester screening for chromosomal abnormalities and prenatal detection rates of fetal malformations in Denmark. Study population: Pregnant women with a first or second trimester ultrasound scan performed at all public hospitals in Denmark are registered in the database. Main variables/descriptive data: Data on maternal characteristics, ultrasonic, and biochemical variables are continuously sent from the fetal medicine units' Astraia databases to the central database via web service. Information about outcome of pregnancy (miscarriage, termination, live birth, or stillbirth is received from the National Patient Register and National Birth Register and linked via the Danish unique personal registration number. Furthermore, results of all pre- and postnatal chromosome analyses are sent to the database. Conclusion: It has been possible to establish a fetal medicine database, which monitors first-trimester screening for chromosomal abnormalities and second-trimester screening for major fetal malformations with the input from already collected data. The database is valuable to assess the performance at a regional level and to compare Danish performance with international results at a national level. Keywords: prenatal screening, nuchal translucency, fetal malformations, chromosomal abnormalities

  10. Advanced Query Formulation in Deductive Databases.

    Science.gov (United States)

    Niemi, Timo; Jarvelin, Kalervo

    1992-01-01

    Discusses deductive databases and database management systems (DBMS) and introduces a framework for advanced query formulation for end users. Recursive processing is described, a sample extensional database is presented, query types are explained, and criteria for advanced query formulation from the end user's viewpoint are examined. (31…

  11. Online Petroleum Industry Bibliographic Databases: A Review.

    Science.gov (United States)

    Anderson, Margaret B.

    This paper discusses the present status of the bibliographic database industry, reviews the development of online databases of interest to the petroleum industry, and considers future developments in online searching and their effect on libraries and information centers. Three groups of databases are described: (1) databases developed by the…

  12. Enforcing Privacy in Cloud Databases

    OpenAIRE

    Moghadam, Somayeh Sobati; Darmont, Jérôme; Gavin, Gérald

    2017-01-01

    International audience; Outsourcing databases, i.e., resorting to Database-as-a-Service (DBaaS), is nowadays a popular choice due to the elasticity, availability, scalability and pay-as-you-go features of cloud computing. However, most data are sensitive to some extent, and data privacy remains one of the top concerns to DBaaS users, for obvious legal and competitive reasons.In this paper, we survey the mechanisms that aim at making databases secure in a cloud environment, and discuss current...

  13. Practical database programming with Java

    CERN Document Server

    Bai, Ying

    2011-01-01

    "This important resource offers a detailed description about the practical considerations and applications in database programming using Java NetBeans 6.8 with authentic examples and detailed explanations. This book provides readers with a clear picture as to how to handle the database programming issues in the Java NetBeans environment. The book is ideal for classroom and professional training material. It includes a wealth of supplemental material that is available for download including Powerpoint slides, solution manuals, and sample databases"--

  14. Evolution of the Configuration Database Design

    International Nuclear Information System (INIS)

    Salnikov, A.

    2006-01-01

    The BABAR experiment at SLAC successfully collects physics data since 1999. One of the major parts of its on-line system is the configuration database which provides other parts of the system with the configuration data necessary for data taking. Originally the configuration database was implemented in the Objectivity/DB ODBMS. Recently BABAR performed a successful migration of its event store from Objectivity/DB to ROOT and this prompted a complete phase-out of the Objectivity/DB in all other BABAR databases. It required the complete redesign of the configuration database to hide any implementation details and to support multiple storage technologies. In this paper we describe the process of the migration of the configuration database, its new design, implementation strategy and details

  15. The Sequenced Angiosperm Genomes and Genome Databases.

    Science.gov (United States)

    Chen, Fei; Dong, Wei; Zhang, Jiawei; Guo, Xinyue; Chen, Junhao; Wang, Zhengjia; Lin, Zhenguo; Tang, Haibao; Zhang, Liangsheng

    2018-01-01

    Angiosperms, the flowering plants, provide the essential resources for human life, such as food, energy, oxygen, and materials. They also promoted the evolution of human, animals, and the planet earth. Despite the numerous advances in genome reports or sequencing technologies, no review covers all the released angiosperm genomes and the genome databases for data sharing. Based on the rapid advances and innovations in the database reconstruction in the last few years, here we provide a comprehensive review for three major types of angiosperm genome databases, including databases for a single species, for a specific angiosperm clade, and for multiple angiosperm species. The scope, tools, and data of each type of databases and their features are concisely discussed. The genome databases for a single species or a clade of species are especially popular for specific group of researchers, while a timely-updated comprehensive database is more powerful for address of major scientific mysteries at the genome scale. Considering the low coverage of flowering plants in any available database, we propose construction of a comprehensive database to facilitate large-scale comparative studies of angiosperm genomes and to promote the collaborative studies of important questions in plant biology.

  16. The Danish Nonmelanoma Skin Cancer Dermatology Database

    DEFF Research Database (Denmark)

    Lamberg, Anna Lei; Sølvsten, Henrik; Lei, Ulrikke

    2016-01-01

    AIM OF DATABASE: The Danish Nonmelanoma Skin Cancer Dermatology Database was established in 2008. The aim of this database was to collect data on nonmelanoma skin cancer (NMSC) treatment and improve its treatment in Denmark. NMSC is the most common malignancy in the western countries and represents...... treatment. The database has revealed that overall, the quality of care of NMSC in Danish dermatological clinics is high, and the database provides the necessary data for continuous quality assurance....

  17. Development of the Nuclear Ship Database. 1. Outline of the Nuclear Ship Experimental Database

    Energy Technology Data Exchange (ETDEWEB)

    Kyouya, Masahiko; Ochiai, Masa-aki [Japan Atomic Energy Research Inst., Tokai, Ibaraki (Japan). Tokai Research Establishment; Hashidate, Kouji

    1995-03-01

    We obtained the experimental data on the effects of the ship motions and the change in load and caused by the ship operations, the waves, the winds etc., to the nuclear power plant behavior, through the Power-up Tests and Experimental Voyages of the Nuclear Ship MUTSU. Moreover, we accumulated the techniques, the knowledge and others on the Nuclear Ship development at the each stage of the N.S. MUTSU Research and Development program, such as the design stage, the construction stage, the operation stage and others. These data, techniques, knowledge and others are the assembly of the experimental data and the experiences through the design, the construction and the operation of the first nuclear ship in JAPAN. It is important to keep and pigeonhole these products of the N.S. MUTSU program in order to utilize them effectively in the research and development of the advanced marine reactor, since there is no construction plan of the nuclear ship for the present in JAPAN. We have been carrying out the development of the Nuclear Ship Database System since 1991 for the purpose of effective utilization of the N.S. MUTSU products in the design study of the advanced marine reactors. The part of the Nuclear Ship Database System on the experimental data, called Nuclear Ship Experimental Database, was already accomplished and utilized since 1993. This report describes the outline and the use of the Nuclear Ship Experimental Database.The remaining part of the database system on the documentary data, called Nuclear Ship Documentary Database, are now under development. (author).

  18. Development of the Nuclear Ship Database. 1. Outline of the Nuclear Ship Experimental Database

    International Nuclear Information System (INIS)

    Kyouya, Masahiko; Ochiai, Masa-aki; Hashidate, Kouji.

    1995-03-01

    We obtained the experimental data on the effects of the ship motions and the change in load and caused by the ship operations, the waves, the winds etc., to the nuclear power plant behavior, through the Power-up Tests and Experimental Voyages of the Nuclear Ship MUTSU. Moreover, we accumulated the techniques, the knowledge and others on the Nuclear Ship development at the each stage of the N.S. MUTSU Research and Development program, such as the design stage, the construction stage, the operation stage and others. These data, techniques, knowledge and others are the assembly of the experimental data and the experiences through the design, the construction and the operation of the first nuclear ship in JAPAN. It is important to keep and pigeonhole these products of the N.S. MUTSU program in order to utilize them effectively in the research and development of the advanced marine reactor, since there is no construction plan of the nuclear ship for the present in JAPAN. We have been carrying out the development of the Nuclear Ship Database System since 1991 for the purpose of effective utilization of the N.S. MUTSU products in the design study of the advanced marine reactors. The part of the Nuclear Ship Database System on the experimental data, called Nuclear Ship Experimental Database, was already accomplished and utilized since 1993. This report describes the outline and the use of the Nuclear Ship Experimental Database.The remaining part of the database system on the documentary data, called Nuclear Ship Documentary Database, are now under development. (author)

  19. The Danish Inguinal Hernia database

    DEFF Research Database (Denmark)

    Friis-Andersen, Hans; Bisgaard, Thue

    2016-01-01

    AIM OF DATABASE: To monitor and improve nation-wide surgical outcome after groin hernia repair based on scientific evidence-based surgical strategies for the national and international surgical community. STUDY POPULATION: Patients ≥18 years operated for groin hernia. MAIN VARIABLES: Type and size...... access to their own data stratified on individual surgeons. Registrations are based on a closed, protected Internet system requiring personal codes also identifying the operating institution. A national steering committee consisting of 13 voluntary and dedicated surgeons, 11 of whom are unpaid, handles...... the medical management of the database. RESULTS: The Danish Inguinal Hernia Database comprises intraoperative data from >130,000 repairs (May 2015). A total of 49 peer-reviewed national and international publications have been published from the database (June 2015). CONCLUSION: The Danish Inguinal Hernia...

  20. Danish Colorectal Cancer Group Database

    DEFF Research Database (Denmark)

    Ingeholm, Peter; Gögenur, Ismail; Iversen, Lene H

    2016-01-01

    AIM OF DATABASE: The aim of the database, which has existed for registration of all patients with colorectal cancer in Denmark since 2001, is to improve the prognosis for this patient group. STUDY POPULATION: All Danish patients with newly diagnosed colorectal cancer who are either diagnosed......, and other pathological risk factors. DESCRIPTIVE DATA: The database has had >95% completeness in including patients with colorectal adenocarcinoma with >54,000 patients registered so far with approximately one-third rectal cancers and two-third colon cancers and an overrepresentation of men among rectal...... diagnosis, surgical interventions, and short-term outcomes. The database does not have high-resolution oncological data and does not register recurrences after primary surgery. The Danish Colorectal Cancer Group provides high-quality data and has been documenting an increase in short- and long...