Sample records for rna
from WorldWideScience.org

Sample records 1 - 20 shown. Select sample records:



1

Interferência por RNA: uma nova alternativa para terapia nas doenças reumáticas/ RNA interference: a new alternative for rheumatic diseases therapy

França, Natália Regine de; Mesquita Júnior, Danilo; Lima, Amanda Bandeira; Pucci, Fernando Vianna Cabral; Andrade, Luís Eduardo Coelho; Silva, Neusa Pereira
2010-12-01

Resumo em português A interferência por RNA (RNAi) é um mecanismo de silenciamento gênico pós-transcricional conservado durante a evolução. Esse mecanismo, recentemente descrito, é mediado por pequenos RNAs de fita dupla (dsRNAs) capazes de reconhecer especificamente uma sequência de mRNA-alvo e mediar sua clivagem ou repressão traducional. O emprego da RNAi como uma ferramenta de terapia gênica tem sido muito estudado, especialmente em infecções virais, câncer, desordens genét (mais) icas herdadas, doenças cardiovasculares e mesmo em doenças reumáticas. Aliados aos dados do genoma humano, os conhecimentos do silenciamento gênico mediado por RNAi podem permitir a determinação funcional de praticamente qualquer gene expresso em uma célula e sua implicação para o funcionamento e homeostase celular. Vários estudos terapêuticos in vitro e in vivo em modelos de doenças autoimunes vêm sendo realizados com resultados encorajadores. As vias de quebra de tolerância e inflamação são alvos potenciais para terapia com RNAi em doenças inflamatórias e autoimunes. Nesta revisão vamos recordar os princípios básicos da RNAi e discutir os aspectos que levaram ao desenvolvimento de propostas terapêuticas baseadas em RNAi, começando pelos estudos in vitro de desenvolvimento de ferramentas e identificação de alvos, chegando até os estudos pré-clínicos de disponibilização da droga in vivo, e testes em células humanas e modelos animais de doenças autoimunes. Por fim, vamos revisar os últimos avanços da experiência clínica da terapia com RNAi Resumo em inglês RNA interference (RNAi) is a post-transcriptional gene silencing mechanism preserved during evolution. This mechanism, recently described, is mediated by small double-stranded RNAs (dsRNAs) that can specifically recognize a target mRNA sequence and mediate its cleavage or translational repression. The use of RNAi as a tool for gene therapy has been extensively studied, especially in viral infections, cancer, inherited genetic disorders, cardiovascular and rheumatic diseas (mais) es. Together with data from human genome, the knowledge of gene silencing mediated by RNAi could allow a functional determination of virtually any cell expressed gene and its involvement in cellular functioning and homeostasis. Several in vitro and in vivo therapeutic studies with autoimmune disease animal models have been carried out with promising results. The pathways of tolerance breakage and inflammation are potential targets for RNAi therapy in inflammatory autoimmune diseases. This review will present the basic principles of RNAi and discuss several aspects of RNAi-based therapeutic approaches, from in vitro tool design and target identification to in vivo pre-clinical drug delivery, and tests of autoimmune diseases in human cells and animal models. Finally, this review will present some recent clinical experience with RNAi-based therapy

Scientific Electronic Library Online (Portuguese)

2

Silenciamento de genes com RNA interferência: um novo instrumento para investigação da fisiologia e fisiopatologia do córtex adrenal/ Gene silencing with RNA interference: a novel tool for the study of physiology and pathophysiology of adrenal cortex

Barbosa, Angela Silva; Lin, Chin Jia
2004-10-01

Resumo em português A inativação de genes por knock-out ou por bloqueio da tradução de seus transcritos (silenciamento) constitui uma estratégia extremamente poderosa tanto para atribuir função aos genes como para mapear a inter-relação dos diferentes componentes das vias regulatórias intracelulares. Um dos meios para se obter o silenciamento pós-transcricional consiste na ativação de um mecanismo mediado por RNAs fita-dupla (dsRNA) conhecido como RNA interferência (RNAi). O RN (mais) Ai se mostrou um instrumento extremamente versátil em pesquisa biomédica, podendo ser utilizado em experimentos de silenciamento pontual de genes ou ser adaptado para estudos em larga escala de genômica funcional, podendo, inclusive, ser utilizado como meio de terapia gênica. Neste trabalho, os autores discutem as vias intracelulares envolvidas no RNAi, bem como as principais estratégias e limitações técnicas para se obter o silenciamento em células de mamíferos. Fazem, também, uma revisão das principais aplicações do RNAi na terapêutica de doenças humanas e na investigação de fenômenos fisiológicos e fisiopatológicos do córtex adrenal. Resumo em inglês Loss-of-function approaches such as gene knock-out or gene silencing are extremely powerful strategies for assigning function to a gene and for mapping the interconnections of intracellular regulatory pathways. Post-transcriptional gene silencing can be obtained via activation of a double-stranded RNA (dsRNA) mediated mechanism termed RNA interference (RNAi). RNAi has revealed an extremely versatile tool in Biomedical research that can be used in both single silencing gen (mais) e experiments and in large-scale Functional Genomics studies and has been used as a tool for gene therapy. In the present paper the authors discuss the intracellular mechanisms underlying the RNAi phenomenon, as well the different strategies and their limitations for RNAi gene silencing in mammalian cells. The use of RNAi in the treatment of human diseases and in the investigation of both physiology and pathophysiology of adrenal cortex has also been reviewed.

Scientific Electronic Library Online (Portuguese)

3

Viróides e virusóides: relíquias do mundo de RNA/ Viroids and virusoids: relics of the RNA world

Eiras, Marcelo; Daròs, Jose Antonio; Flores, Ricardo; Kitajima, Elliot W.
2006-06-01

Resumo em português Até meados do século XX, os vírus eram considerados os representantes mais simples da escala biológica. A descoberta dos RNAs satélites e dos viróides por volta de 1970 foi surpreendente, pois comprovou-se a existência de uma nova classe de moléculas auto-replicativas ainda mais simples, denominada agentes sub-virais. Há indícios de que os viróides e virusóides (que formam uma classe de RNAs satélites), teriam feito parte do "Mundo de RNA" (que precedeu o mun (mais) do atual baseado no DNA e proteínas), podendo ser considerados fósseis moleculares dessa era antiga. A simplicidade desses agentes sub-virais e o fato de que a molécula de RNA deve interagir diretamente com fatores do hospedeiro para o desenvolvimento do seu ciclo infeccioso colocam esses patógenos como um modelo para o estudo de processos metabólicos celulares. Nos últimos anos, tem-se observado um volume grande de publicações visando elucidar aspectos da interação viróide/hospedeiro, como os mecanismos da patogênese, movimento dos viróides nas plantas hospedeiras, silenciamento gênico e atividades das ribozimas. Mudanças recentes ocorridas na taxonomia desses patógenos com a criação de famílias, gêneros e espécies, além da descoberta de novos viróides, também têm sido verificadas. A presente revisão visa atualizar o leitor quanto aos recentes avanços nas pesquisas com viróides, principalmente na taxonomia, filogenia e em vários aspectos moleculares da interação viróide/hospedeiro. Estão incluídas também algumas características dos virusóides e sua relação evolutiva com os viróides. Resumo em inglês By the middle of the last century, viruses were considered as the simplest biological entities. The discovery of satellite RNAs and viroids by 1970 was surprising because it revealed the existence of a novel class of self-replicating molecules even simpler, named subviral agents. There are evidences that viroids and virusoids (a class of satellite RNAs) were part of the so-called "RNA world" (that preceded our present world based on DNA and proteins) and for this reason t (mais) hey can be considered as molecular fossils of this ancient period. The simplicity of these subviral agents and the fact that the RNA molecule must interact directly with host factors for completing their infective cycle make these pathogens a model for the study of cellular processes. In the last years, a large number of publications have widened our knowledge of the viroid-host interactions, including pathogenesis mechanisms, movement through the host, gene silencing and ribozyme activity. Recent changes have been introduced in the taxonomy of these pathogens, with the creation of families, genera and species, and new viroids have also been found. The purpose of this review is to present the reader with these recent advances in viroid research, mainly on taxonomy, phylogeny and in molecular aspects of the viroid-host interaction. Some characteristics of virusoids and their evolutionary relationship with viroids are also included.

Scientific Electronic Library Online (Portuguese)

4

Análise molecular de segmento do RNA2 de comovirus isolados de soja no estado do Paraná/ Molecular analysis of RNA2 segment of comoviruses isolated from soybean in the State of Paraná

SOUTO, ELIEZER R.; ALMEIDA, ÁLVARO M. R.; BIANCHINI, ANÉSIO; SARTORI, FÁBIO; CALVO, ÉBERSON S.
2002-09-01

Resumo em português Nas áreas produtoras de feijão (Phaseolus vulgaris) do Estado do Paraná observa-se anualmente a ocorrência do vírus do mosaico em desenho do feijoeiro (Bean rugose mosaic virus, BRMV), principalmente em infecções mistas com o vírus do mosaico dourado do feijoeiro (Bean golden mosaic virus, BGMV), acarretando maior severidade de sintomas e causando perdas na produção. Recentemente constatou-se a presença do vírus do mosaico severo do caupi (Cowpea severe mosaic (mais) virus, CPSMV) associado a sintomas de queima do broto em plantações de soja (Glycine max) na região de Londrina, sendo este um fato novo no Estado. Neste trabalho, parte do RNA2 de dois comovirus isolados de soja no Paraná foram clonados e sequenciados, sendo 600 pares de bases (pb) do BRMV-PR e 594 pb do CPSMV-PR. Posteriormente, as seqüências correspondentes de aminoácidos foram comparadas com seis seqüências de vírus do gênero Comovirus depositadas no GenBank. Com base nestes dados observou-se que o segmento do RNA2 do isolado CPSMV-PR apresentou homologia de 85% com parte de uma seqüência já conhecida do RNA2 do CPSMV, enquanto que o segmento do RNA2 do isolado BRMV-PR apresentou homologia de 39% com o CPSMV, e de 44% com o Bean pod mottle virus (BPMV). Este trabalho apresenta pela primeira vez dados de sequenciamento parcial do BRMV, o que poderá contribuir para sua completa caracterização molecular e para o estabelecimento de estratégias para obtenção de plantas resistentes ao vírus. Resumo em inglês In bean (Phaseolus vulgaris) producing areas of Paraná State, Bean rugose mosaic virus (BRMV) has been found in mixed infections with Bean golden mosaic virus (BGMV) increasing the severity of symptoms and crop losses. The association of Cowpea severe mosaic virus (CPSMV) with bud blight symptoms in soybean (Glycine max) plants was recently observed in Paraná for the first time. In this work RT-PCR products of 600 bp of BRMV-PR RNA2 and 594 bp of CPSMV-PR RNA2 were clon (mais) ed and sequenced. The amino acid sequences coded by the RNA2 segment from these isolates were compared with sequences of the same RNA2 genomic region of six comovirus species from the GenBank. The CPSMV-PR showed 85% homology with the CPSMV RNA2 from the GenBank. Moreover, the BRMV-PR isolate showed 39 and 44% homology with CPSMV and Bean pod mottle virus (BPMV), respectively. This work shows, for the first time, partial sequencing data for BRMV. This data may be helpful for the complete molecular characterization of this virus and for establishing strategies to obtain virus resistant plants.

Scientific Electronic Library Online (Portuguese)

5

Efeito do estresse térmico agudo sobre os níveis da proteína e RNA mensageiro da Hsp70, em fígado e cérebro de pintos de corte de diferentes linhagens/ Effect of acute heat stress on hepatic and cerebral messenger RNA heat shock protein 70 and heat shock protein 70 level of broiler chicks from 2 to 5 days old of different strains

Dionello, Nelson José Laurino; Ferro, Jesus Aparecido; Macari, Marcos; Rutz, Fernando; Furlan, Luiz Roberto; Ferro, Maria Inês Tiraboschi
2001-10-01

Resumo em português Oitenta pintos de corte de duas linhagens, pescoço pelado (Na/na) e Hubbard-Pettersen, entre 2 e 5 dias de idade, foram expostos a estresse térmico agudo (36-37°C), durante cinco horas. Foram avaliados temperatura cloacal e peso corporal individuais ao início e final do período de estresse térmico agudo. Os pintos foram sacrificados ao final e amostras de fígado e cérebro foram coletadas e analisadas por Western Blotting e Northern Blotting, para quantificação d (mais) a proteína e RNA mensageiro da Hsp70, respectivamente. Os resultados apresentaram maiores níveis protéicos de Hsp70 no tecido cerebral do que no hepático. Antes do estresse térmico, não houve diferenças de linhagens para expressão e síntese de Hsp70, em ambos os tecidos. Após o estresse térmico, as aves estressadas apresentaram maiores níveis protéicos de Hsp70, quando o tecido analisado foi o fígado (para as pescoço pelado nas idades de 4 e 5 dias), e menores níveis, em relação às controles, quando o tecido analisado foi o cérebro (para as Pescoço pelado na idade de 2 dias). O tamanho do transcrito de RNA mensageiro de Hsp70 foi de 2,7 kb. Os resultados do presente experimento sugerem que, para o tecido cerebral, a indução de Hsp70 ocorreu em níveis transcripcional e traducional e para o tecido hepático foi detectada apenas alteração em nível traducional, para ambas as linhagens. Resumo em inglês Eighty broiler chicks, Naked neck (Na/na) and Hubbard-Pettersen strains, were exposed to acute heat stress (36-37°C), from 2 to 5 days of age, and body weight and cloacal temperature were measured in the beginning and at the end of the heat stress period (5 h). Birds were sacrificed at the end and liver and brain samples were collected and analyzed using Western Blotting and Northern Blotting to quantify Hsp70 levels and mRNA Hsp70 transcript, respectively. The brain tis (mais) sue had higher Hsp70 level than liver tissue. Before heat stress it was not observed difference in the Hsp70 expression between strains. After heat stress in the liver it was observed in increase in the Hsp70 level (naked neck birds at 4 and 5 days), and in the brain a reduced Hsp70 level was found when compared with the control birds (Naked neck birds at 2 days). The size of the mRNA Hsp70 transcript was 2.7 kb. The data of this experiment suggest that to the brain tissue heat stress affect Hsp70 at transcriptional and translational levels, and for hepatic tissue the effect is only at translational level, for different lines.

Scientific Electronic Library Online (Portuguese)

6

Estudo comparativo de três diferentes procedimentos para extração de RNA a partir de amostras fixadas em formalina e embebidas em parafina/ Comparative study of three different procedures for RNA extraction from formalin-fixed paraffin-embedded samples

Ribeiro-Silva, Alfredo; Garcia, Sérgio Britto
2008-04-01

Resumo em português INTRODUÇÃO: O desenvolvimento de métodos de extração de RNA a partir de amostras fixadas em formalina e embebidas em parafina (FFEP) possibilitou estudos retrospectivos de biologia molecular. Objetivos: Comparar a quantidade e a qualidade do RNA extraído de amostras FFEP a partir de três kits disponíveis comercialmente. MATERIAL E MÉTODO: Utilizando-se três diferentes procedimentos, o RNA total foi extraído de 14 blocos de parafina contendo fragmentos de carcin (mais) omas mamários, todos arquivados há 10 anos. A quantidade do RNA foi expressa em pg/µl; e a qualidade, pelo número de integridade do RNA (NIR), utilizando-se o Bioanalyzer da Agilent com o Pico LabChip. O RNA de maior NIR extraído de cada uma das 14 amostras foi amplificado por reação em cadeia da polimerase com transcrição reversa (RT-PCR) utilizando-se o gene G6PD, com primers designados para gerar fragmentos de 67, 151 e 242 pares de bases (pb). RESULTADOS: A média e a mediana da quantidade do RNA extraído para os três protocolos foram, respectivamente, 42,91 e 31,31 pg/µl. A média e a mediana do NIR foram, respectivamente, 1,8 e 2. Em todas as amostras, o gene G6PD foi amplificado para fragmentos de RNA de 67 e 151 pb. DISCUSSÃO: Como houve grande variação individual na quantidade e na qualidade do RNA extraído para cada amostra, os dados do presente estudo indicam que, se não for possível extrair RNA de uma determinada amostra na primeira tentativa, uma segunda extração deve ser realizada antes de se descartar essa amostra para testes de biologia molecular. CONCLUSÕES: Nos três procedimentos utilizados foi possível extrair RNA de qualidade aceitável para amplificação por RT-PCR (com NIR > 1,4). Resumo em inglês BACKGROUND: The development of methods for RNA extraction from formalin-fixed paraffin-embedded (FFPE) samples has allowed retrospective studies of molecular biology. OBJECTIVES: To compare the quantity and quality of RNA extracted from FFPE samples using three commercially available kits. Material and methods: Using three different procedures, the total RNA was extracted from 14 paraffin blocks containing fragments of mammary carcinomas, which had been archived for 10 ye (mais) ars. The quantity of RNA was expressed in pg/µl; and the quality in RNA integrity number (RIN), by using the Agilent Bioanalyser with Pico LabChip. The RNA with higher RIN extracted from each of the 14 samples was amplified by reverse transcriptase-polymerase chain reaction (RT-PCR) using the G6PD gene with primers designed to create fragments with 67, 151 and 242 base pairs (bp). RESULTS: The mean and median of RNA quantity extracted for the three procedures were respectively 42.91 and 31.31 pg/µl. The mean and median of RIN were respectively 1.8 and 2. In all the samples, the G6PD gene was amplified for RNA fragments with 67 and 151 bp. DISCUSSION: Due to the significant individual variation in quantity and quality of the extracted RNA from each sample, the data from the present study show that, if it is not possible to extract RNA from a given sample in the first attempt, a second extraction should be performed before excluding this sample. CONCLUSION: It was possible to extract RNA with acceptable quality for amplification by RT-PCR (RIN > 1.4) in the three procedures used.

Scientific Electronic Library Online (Portuguese)

7

Padronização da metodologia do RT-PCR utilizado para identificação do mRNA da alfa-amilase em sementes de milho/ RT-PCR patterning for alpha-amylase messenger RNA identification in germinating maize seeds

Dantas, Bárbara França; Aragão, Carlos Alberto; Araújo-Junior, João Pessoa; Rodrigues, João Domingos; Cavariani, Cláudio; Nakagawa, João
2002-01-01

Resumo em português Durante a germinação das sementes, os carboidratos de reserva são degradados pela atividade de a-amilase. A identificação de mRNA é uma ferramenta fundamental para a definição da cinética de síntese de alfa-amilase. Objetivou-se padronizar a metodologia do RT-PCR para identificar o mRNA do gene de a-amilase em sementes de milho. Após três dias de germinação das cultivares Saracura-BRS 4154 e CATI-AL34, extraiu-se o RNA total pelo método do tiocianato de gua (mais) nidina-fenol-clorofórmio, com algumas modificações. A partir do RNA total extraído foi obtido cDNA com utilização de "random primers". A amplificação por PCR de uma porção do gene da alfa-amilase foi realizada com os "primers": "sense" - CGACATCGACCACCTCAAC; "antisense" - TTGACCAGCTCCTGCCTGTC; gelatina; DMSO e 1,25 unidades de Taq DNA polimerase por reação e completados com água tratada com DEPC. Os ciclos para a amplificação foram 94ºC durante 4 minutos, seguidos por 34 ciclos de 94ºC durante 1 minuto, 42ºC durante 1 minuto e 72ºC durante 1,5 minutos e, finalmente, 72ºC por 5 minutos. O produto do RT-PCR apresentou uma banda de 249 pares de base (pb) bem definida, para as duas cultivares estudadas, não ocorrendo bandas inespecíficas. A técnica do RT-PCR mostrou ser uma metodologia eficiente para a identificação da expressão de alfa-amilase durante a germinação das sementes e pode ser usado para estudo qualitativo e quantitativo da cinética de síntese dessa enzima em experimentos de germinação. Resumo em inglês During germination the seed reserve carbohydrates are degraded by alpha-amylase activity. The identification of mRNA is a very important tool for definition of alpha-amylase synthesis kinetics. This study aimed to adapt a PT-PCR methodology for a-identification of amylase mRNA in germinating maize seeds. After three days germination of Saracura BRS4154 and CATI AL34 maize cultivars, the total RNA was isolated by the guanidinium thiocyanate-phenol-chloroform extraction met (mais) hod, with some modifications. The cDNA was obtained from the total RNA, using random primers. The alpha-amylase gene PCR amplification was carried out with cDNA, primers (sense - CGACATCGACCACCTCAAC; antisense - TTGACCAGCTCCTGCCTGTC); gelatina; DMSO and 1,25 units of Taq DNA polimerase per reaction and complete with DEPC water. The amplification cycles were 94ºC/4 minutes, 34 cycles of 94ºC /1 minute, 42ºC/1 minute and 72ºC/1,5 minutes, and finally 72ºC/5 minutes. The RT-PCR product visualization in agarose gel eletcrophoresis indicated that this method presented well defined bands of 249 bp for the both the cultivars, without unspecific bands. The RT-PCR is an eficient method for alpha-amylase expression studies during germination and can be used as a tool for quantitative and qualitative research about alpha-amylase sinthesis kinetics.

Scientific Electronic Library Online (Portuguese)

8

Proposta de um algoritmo genérico baseado em RNA para a proteção de distância de linhas de transmissão

Santos, R.C.; Senger, E.C.
2006-03-01

Resumo em português Neste artigo é apresentado um algoritmo baseado em Redes Neurais Artificiais (RNA) para a implementação de uma proteção de distância de linhas de transmissão. Tal algoritmo possui como principal contribuição a possibilidade de ser utilizado em qualquer linha de transmissão, independentemente da configuração ou do nível de tensão desta, dispensando um novo processo de treinamento da rede neural. Portanto, este algoritmo não necessita de nenhum ajuste na topo (mais) logia ou nos parâmetros da RNA (retreinamento), quando aplicado à diferentes sistemas elétricos. Esta característica diferencia a solução proposta, das demais baseadas em RNA, que são sempre projetadas para operarem numa única e exclusiva linha de transmissão (geometria de torre, condutores, comprimento e nível de tensão pré-determinados), inviabilizando sua implementação num relé comercial. Resumo em inglês This work presents an algorithm based on Artificial Neural Networks (ANN) for the implementation of a distance relay to be used in transmission lines. The main contribution of the proposed algorithm is the possibility to protect any transmission line (generic algorithm) independently of its voltage level or configuration, without a new ANN process training. Therefore, unlike previous works, this algorithm does not need any adjustment in the ANN architecture and its parame (mais) ters, when applied to different electric systems. This characteristic is the main differential of the solution presented here, when compared to other ANN based algorithms, always developed to operate in only one particular transmission line (tower geometry, cable, length and pre-determined voltage level), which makes them unfit to be implemented in a commercial relays.

Scientific Electronic Library Online (Portuguese)

9

A nova grande promessa da inovação em fármacos: RNA interferência saindo do laboratório para a clínica

Menck, Carlos Frederico Martins
2010-01-01

Resumo em português A descoberta de que nossas células dispõem de um mecanismo de silenciamento gênico empregando RNA interferência ainda é muito recente. Apesar disso, em menos de uma década a investigação científica já alcançou progresso, suficiente para muito brevemente nos apropriarmos desse conhecimento com fins terapêuticos. Duplexes de RNA são potenciais fármacos e há investimentos altos nessa nova abordagem. Aparentemente, a promessa de terapia gênica parece finalmente atingir sua maturidade com essas novas ferramentas. Resumo em inglês The discovery of gene silencing mechanisms in our own cells using RNA interference is very recent. However, in less than a decade, the scientific investigation have progressed enough to make us see that, very soon, we will use this knowledge for therapeutic purposes. RNA duplexes are potential pharmaceutical drugs and there are high investments in this new strategy. The promising gene therapy seems to finally reach maturity with these new tools.

Scientific Electronic Library Online (Portuguese)

10

Propriedades moleculares de um isolado brasileiro do Southern bean mosaic virus/ Molecular properties of a Brazilian isolate of Southern bean mosaic virus

MOREIRA, ANDREIA E.; GASPAR, JOSÉ O.
2002-06-01

Resumo em português Um isolado do Southern bean mosaic virus (SBMV), gênero Sobemovirus, encontrado em feijoeiro (Phaseolus vulgaris) no Estado de São Paulo, foi purificado e algumas de suas propriedades moleculares determinadas. As partículas virais apresentam diâmetro de 28-30 nm e proteína capsidial com massa molecular estimada em 30 kDa. Das partículas virais foi extraído RNA de vários tamanhos (4,2 Kb, 3,1 Kb, 2,65 Kb, 2,15 Kb, 1,64 Kb, 1,36 Kb e 1,0 Kb) sendo aquele de 4,2 Kb o (mais) RNA genômico e o de 1,0 Kb supostamente um subgenômico que codifica para a proteína capsidial. Ácidos ribonucleicos de mesmo tamanho foram também detectados in vivo, indicando estar associados à replicação viral. Na análise do RNA de fita dupla (dsRNA), somente duas espécies foram detectadas (4,2 Kpb e 1,0 Kpb) correspondendo às formas replicativas do RNA genômico e do subgenômico para proteína capsidial. Os resultados indicam que somente estes dois RNA são replicados por meio de formas replicativas (RFs), enquanto os demais devem ser formados talvez por iniciação interna da fita negativa do RNA genômico. O SBMV-B SP apresentou propriedades moleculares análogas àquelas do SBMV descrito na América do Norte. Resumo em inglês An isolateof the Southern bean mosaic virus (SBMV), genus Sobemovirus, found in the State of São Paulo, Brazil, was purified and some of its molecular properties determined. The virus particles are 28-30 nm in diameter and the coat protein has a molecular mass of 30 kDa. A heterogeneous population of RNAs (4.2 Kb, 3.1 Kb, 2.65 Kb, 2.15 Kb, 1.64 Kb, 1.36 Kb and 1.0 Kb) was extracted from virus particles, where those of 4.2 Kb and 1.0 Kb are, respectively, the genomic and (mais) the putative subgenomic RNA for coat protein. RNAs of the same size were also extracted from infected common bean (Phaseolus vulgaris) leaves, indicating that they must have some function in the virus replication cycle. Only two species of double-stranded RNAs (dsRNA) were extracted from infected tissues (4.2 Kbp and 1.0 Kbp), corresponding to the replicative forms of the genomic RNA and the subgenomic RNA for coat protein. These results indicate that only these two RNAs replicate by means of replicative forms (RF) while the others are probably synthesized by an internal initiation of the negative strand of the genomic RNA. The SBMV-B SP showed molecular properties analogous to the SBMV described in North America.

Scientific Electronic Library Online (Portuguese)

11

Carga viral vaginal de HIV em mulheres brasileiras infectadas pelo HIV/ HIV vaginal viral load in Brazilian HIV-infected women

Campos, Angela; Amaral, Eliana; Levi, José Eduardo; Portugal, Priscila; Villarroel, Marina; Bezerra, Karina C.; Silva, Marcos T. Nolasco da; Morais, Sirlei Siani
2008-02-01

Resumo em português OBJETIVO: Avaliar os fatores associados à presença de RNA-HIV na vagina. MÉTODOS: Estudo de corte transversal, em mulheres infectadas por HIV, excluindo-se aquelas com antecedente de histerectomia, as em uso de medicações vaginais nas últimas 48 horas, as que se referiram à relação sexual desprotegida há menos de 72 horas, as gestantes e aquelas com sangramento genital. Após consentimento, coletou-se amostra sanguínea para contagem de linfócitos T CD4 e carga (mais) viral plasmática de HIV, além de lavado vaginal com 10mL de solução salina, que foi centrifugado, aliquotado e armazenado em freezer -70°C para posterior quantificação de RNA-HIV livre. A mensuração de carga viral de RNA-HIV livre plasmática e vaginal foi realizada utilizando-se o kit HIV Monitor v1.5 Cobas Amplicor®, Roche. Pesquisou-se a presença de HPV de alto e baixo risco, clamídia e gonococo por Captura Híbrida II®, Digene, em amostra endocervical. Colheu-se amostra vaginal para bacterioscopia com coloração de Gram, utilizando-se os critérios de Nugent. RESULTADOS: Entre as 200 mulheres estudadas, 73,5% usavam terapia anti-retroviral (TARV) com drogas múltiplas. O RNA-HIV foi detectável no lavado vaginal de 18 delas (9%), mas em apenas uma daquelas que tinham carga viral plasmática indetectável (0,5%). A prevalência de HIV vaginal foi 24 vezes maior naquelas em que HIV plasmático era detectável. Carga viral plasmática de HIV, não usar TARV, CD4 reduzido e vaginose bacteriana aumentaram a prevalência de RNA-HIV vaginal, mas apenas a carga viral plasmática se manteve significativa na análise ajustada. CONCLUSÃO: A prevalência de RNA-HIV vaginal foi baixa (9%). A carga viral acima de 1.500 cópias/mL foi a única variável que permaneceu como fator de risco para RNA-HIV vaginal livre. Resumo em inglês OBJECTIVE: To evaluate factors associated to presence of free RNA-HIV in the vagina. METHODS: Cross-sectional study with HIV-infected women, excluding those who had undergone histerectomy, had used vaginal medication within the last 48 hours, had had unprotected sex less than 72 hours before, were pregnant, or had genital bleeding. After signing an informed consent, blood samples were obtained for T CD4 lymphocytes count and plasmatic viral load, in addition to cervico-va (mais) ginal lavage using 10mL of sterile normal saline, later centrifuged, aliquoted and stored at - 70°C to quantify free HIV-RNA. Plasmatic and vaginal viral load were measured using the kit HIV Monitor v1.5 Cobas Amplicor, Roche. Hybrid Capture test Digene was utilized for HPV (high and low risk), clamydia trachomatis and N. gonorrhoae detection from an endocervical sample. Vaginal swab for bacterioscopy by the Gram method, evaluated according to Nugent criteria was obtained. RESULTS: Among 200 women evaluated, 73.5% were using HAART. The RNA-HIV was detectable in the vaginal lavage of 18 (9%), but in only one of those who had undetectable plasma viral load (0.5%). The vaginal prevalence of HIV was 24 times higher among those with detectable plasmatic HIV. Plasma viral load > 1500 copies/mL, no HAART use, reduced CD4 and bacterial vaginosis had increased prevalence of vaginal HIV-RNA, but in the adjusted statistical analysis, only the former remained significant CONCLUSION: Prevalence of vaginal HIV-RNA was low (9%). Plasmatic viral load > 1500 copies/mL, was the only risk factor for free vaginal HIV-RNA.

Scientific Electronic Library Online (Portuguese)

12

Caracterização da região 5'-terminal de um isolado brasileiro do Southern bean mosaic virus

Espinha, Luciana M.; Gaspar, José O.; Ward, Richard J.; Ruller, Roberto; Camargo, Luis E. A.
2004-06-01

Resumo em português O presente trabalho caracteriza a região 5'-terminal de um isolado do Southern bean mosaic virus encontrado no Estado de São Paulo (SBMV-SP). O RNA foi extraído de partículas virais purificadas e submetido a RT-PCR usando oligonucleotídeos desenhados para amplificar cerca de 590 nt da região 5'-terminal do RNA viral. Foi obtido um fragmento de tamanho esperado que, após clonagem e seqüenciamento, mostrou a existência de uma região não codificadora com 92 nt e a (mais) primeira ORF, começando no primeiro AUG (posição 93) e terminando no códon UGA na posição 534. Na região não codificadora foi detectado um segmento parcialmente complementar ao RNA ribossomal 18S. A ORF1 codifica uma proteína de 147 aminoácidos com massa molecular estimada de 17080 Da. A extremidade 3' da ORF1 sobrepõe a extremidade 5' da ORF2 em 34 nucleotídeos. Os resultados obtidos indicam que a região 5'-terminal do RNA do SBMV-SP é similar ao isolado Arkansas (SBMV-ARK) descrito na América do Norte. Resumo em inglês We report the characterization of the 5'-terminal region of an isolate of Southern bean mosaic virus found in the São Paulo State, Brazil (SBMV-SP). The RNA was extracted from purified virus particles and subjected to RT-PCR using oligonucleotides designed to amplify about 590 nt of the 5'-terminal region of the viral RNA. A fragment with the expected size was obtained, which, after cloning and sequencing, showed the existence of a 5' non-coding region with 92 nt and the (mais) first ORF, starting at the first AUG (position 93) and ending at a UGA stop codon at position 534. A small site, partially complementary to the 3'-terminus of 18S ribossomal RNA was detected at the non-coding region. The ORF1 may encode a protein containing 147 amino acids with a deduced molecular weight of 17080 Da. The 3'-terminus of ORF1 overlaps the 5'-terminus of ORF2 in 34 nt. Our results indicate that the 5'-terminal region of SBMV-SP is similar to that of the Arkansas isolated (SBMV-ARK) described in the North America.

Scientific Electronic Library Online (Portuguese)

13

Relação entre diagnóstico citopatológico de neoplasia intra-epitelial cervical e índices de células CD4+ e de carga viral em pacientes HIV-soropositivas/ Association of cervical intraepithelial neoplasia with CD4 T cell counts and viral load in HIV-infected women

Coelho, Raquel Autran; Facundo; Nogueira, Aline Leite; Sakano, Célia Regina Souza Bezerra; Ribalta, Julisa Chamorro Lascasas; Baracat, Edmund Chada
2004-03-01

Resumo em português OBJETIVVO: relacionar a gravidade de lesão cervical diagnosticada por exame citopatológico à contagem de células CD4+ e à carga viral de RNA-HIV em pacientes HIV-soropositivas. MÉTODOS: foram avaliadas retrospectivamente, por meio de revisão de prontuários, 115 pacientes HIV-positivas atendidas em ambulatório de hospital universitário, no período de janeiro de 2002 até abril de 2003. Oitenta e três casos apresentaram diagnóstico de neoplasia intra-epitelial (mais) cervical (NIC) ao exame citopatológico, e trinta e dois, exames sem alterações. Todas as pacientes apresentavam contagem de células CD4+ e carga viral à época do exame. Os casos foram distribuídos quanto ao índice de células CD4+ em três grupos: CD4 acima de 500 cel/mm³, entre 200 e 500 cel/mm³ ou abaixo de 200 cel/mm³, e, em outros três grupos, quanto à carga viral de HIV: menor do que 10.000 cópias RNA-HIV/mL, entre 10.000 e 100.000 cópias RNA-HIV/mL ou maior do que 100.000 cópias RNA-HIV/mL. A verificação da hipótese de associação foi realizada por meio do teste exato de Fisher. RESULTADOS: das 83 pacientes com NIC citopatológico, 73% apresentaram contagem de células CD4+ abaixo de 500 células/mm³. Em qualquer das faixas de contagem de células CD4+, mais da metade das pacientes apresentavam NIC I citopatológico. Quanto à carga viral de HIV, 71,7% das pacientes com menor carga viral de HIV apresentaram NIC I, ao passo que 11,3% revelaram NIC III. Já no grupo com maior carga viral (100.000 cópias/mL), em 61,5% do total de pacientes o exame citopatológico foi compatível com NIC I, e 30,8% com NIC III. CONCLUSÃO: houve evidência de associação entre carga viral e NIC (p=0.013), não sendo observado o mesmo em relação à contagem de linfócitos CD4+. A presença de infecção secundária cervicovaginal foi considerada possível fator confundidor. Resumo em inglês PURPOSE: to correlate the type of cervical lesion diagnosed by Pap smear with CD4 cell counts and HIV-RNA viral load in HIV-positive patients. METHODS: one hundred and fifteen HIV patients were evaluated retrospectively in the present study, during the period from January 2002 to April 2003, at a university hospital. Eighty-three patients presented cervical intraepithelial neoplasia (CIN) in Pap smear, in comparison with thirty-two with no lesions. Patients were divided i (mais) nto three groups, according to CD4 counts: CD4 more than 500 cells/mm³, between 200 and 500 cells/mm³, and less than 200 cells/mm³, and other three groups, according to HIV viral load: less than 10,000 HIV-RNA copies/mL, between 10,000 and 100,000 HIV-RNA copies/mL, or more than 100,000 HIV-RNA copies/mL. Correlation was investigated by the Fisher test. RESULTS: of the eighty-three patients with CIN, 73% presented CD4 counts less than 500 cells/mm³. In all CD4 groups, more than 50% of the patients presented CIN. According to the viral load, 71.7% of the patients with less than 10,000 HIV-RNA copies/mL presented CIN I, compared with 11.3% that showed CIN III. In the group with higher viral load (>100.000 HIV-RNA copies/mL), 61.5% showed CIN I and 30.8% presented CIN III. CONCLUSION: association between viral load and CIN was established (p=0.013), which was not observed with CD4 cell counts and CIN. Concomitant cervicovaginal infection was considered a potential confounding factor.

Scientific Electronic Library Online (Portuguese)

14

Detecção do genótipo 4 do vírus da hepatite C em Salvador, BA/ Detection of genotype 4 of the hepatitis C virus in Salvador, BA

Zarife, Maria Alice Sant' Anna; Oliveira, Eline Carvalho Pimentel de; Romeu, Jane Maria Santos Leal; Reis, Mitermayer Galvão dos
2006-12-01

Resumo em português É descrito o primeiro caso de detecção do genótipo 4 do vírus da hepatite C (VHC) em Salvador, BA. Foram utilizados os testes de RT-PCR para detecção do VHC-RNA, e o LIPA para genotipagem. O genótipo 4 responde mal ao tratamento, sendo portanto importante a busca ativa dos contactantes. Resumo em inglês The first detected case of genotype 4 of the hepatitis C virus (HCV) in Salvador, Bahia, is described. RT-PCR tests were used to detect HCV-RNA, and LIPA was used for genotyping. Genotype 4 responds poorly to treatment, and it is therefore important to actively search for people who have been in contact with it.

Scientific Electronic Library Online (Portuguese)

15

Caracterização do gene da proteína capsidial do Grapevine virus A em videiras afetadas pela acanaladura do lenho de Kober no Estado de São Paulo/ Characterization of the coat protein gene of Grapevine virus A from Kober stem grooving-affected grapevines in the State of São Paulo, Brazil

Moreira, Andreia E.; Gaspar, José O.; Camargo, Luis E. A.; Kuniyuki, Hugo
2004-04-01

Resumo em português O presente trabalho caracteriza o gene codificador da proteína capsidial do isolado do Grapevine virus A (GVA) encontrado no Estado de São Paulo (GVA-SP). RNA total foi extraído de folhas e pecíolos de plantas de videira (Vitis spp.) da variedade 'Kober 5BB' e submetido a RT-PCR usando oligonucleotídeos desenhados para amplificar um fragmento entre as posições 6409 e 7175 do RNA do GVA ("GenBank", acesso X75433). Foi obtido um fragmento de tamanho esperado (767 nt) (mais) que inclui o gene da proteína capsidial, codificando 198 aminoácidos. A seqüência do GVA-SP apresentou similaridade de nucleotídeos e aminoácidos de, respectivamente, 86-92,3% e 94,5-98% com isolados do GVA da Europa, África e Japão (Acessos X75433, AF441234, AF007415, AB039841) e da região Sul do Brasil (Acesso AF494187), sendo, entretanto, mais similar aos isolados africano e italiano. Resumo em inglês We report the characterization of the coat protein gene of a Brazilian isolate of Grapevine virus A (GVA-SP). Total RNA was extracted from leaves and petioles of GVA infected plants of the grape (Vitis spp.) variety 'Kober 5BB' and subjected to RT-PCR using primers designed to amplify a fragment between positions 6409 and 7175 of the GVA RNA (GenBank Accession X75433). A fragment of the expected size (767 nt) was obtained which included the coat protein gene coding for 19 (mais) 8 amino acids. The GVA-SP sequence displayed nucleotide and amino acid similarity of, respectively, 86-92.3% and 94.5-98% with GVA isolates from Europe, Africa and Japan (Accessions X75433, AF441234, AF007415, AB039841) and Southern Brazil (Accession AF494187). The highest identity, however, was with the African and Italian isolates.

Scientific Electronic Library Online (Portuguese)

16

Estimativa de alturas geoidais para o estado de São Paulo baseada em redes neurais artificiais

Veronez, Maurício Roberto; Souza, Sérgio Florêncio de; Matsuoka, Marcelo Tomio; Reinhardt, Alessandro Ott
2009-12-01

Resumo em português A informação da altitude fornecida pelo sistema GNSS ( Global Navigation Satellite System ) é puramente geométrica, e na maioria dos trabalhos de engenharia a altitude deve estar referenciada ao geóide. Com um número suficiente de Referências de nível (Rn's) com coordenadas horizontais e verticais conhecidas, quase sempre, é possível ajustar-se, pelo Método dos Mínimos Quadrados, expressões matemáticas que permitem interpolar as alturas geoidais. O objetivo (mais) deste trabalho foi avaliar a eficiência das Redes Neurais Artificiais (RNAs) no processo de predição de alturas geoidais tendo como área de estudo o Estado de São Paulo. As informações utilizadas basearam-se em um conjunto de 157 Referências de nível (Rn's) distribuídas uniformemente em todo Estado. Para estas Rn's são conhecidas suas coordenadas horizontais (latitude e longitude) e verticais (altitudes geométrica e ortométrica e altura geoidal). Das 157 Rn's, 115 foram utilizadas para o treinamento da RNA e 42 no processo de simulação para avaliar a eficiência do modelo proposto. A eficiência baseou-se em determinar as discrepâncias (erro) entres as alturas geoidais conhecidas e as obtidas pelo modelo neural. Como contribuição da pesquisa comparou-se também os valores simulados com o Earth Gravitational Model 2008 (EGM2008) e também com o MAPGEO2004. Em termos de resultados a RNA proporcionou um erro absoluto médio de 0,19 m ± 0,14 m com uma forte correlação (R² = 0,9871) com os valores tomados como verdadeiros. Estatisticamente os testes realizados mostraram que não houve diferença entre as médias das alturas geoidais conhecidas e as fornecidas pelo modelo neural para um nível de significância de 5%. Comparando-se os resultados com o EGM2008 e MAPGEO2004 a RNA proporcionou uma redução no erro de 0,07 m e 0,44 m, respectivamente. Resumo em inglês The information of height provided by the GNSS (Global Navigation Satellite System) is purely geometrical, and in most engineering papers, the height must be referenced to the geoid. Provided we have a sufficient number of Bench Marks (BMs) with known horizontal and vertical coordinates, it is nearly always possible to adjust mathematical expressions that allow for the interpolation of geoidal heights. The aim of this paper is to evaluate the efficiency of Artificial Neur (mais) al Network (ANN) in the process of predicting geoidal heights, having the State of São Paulo as the area of study. The information used is based on a set of 157 BMs, evenly distributed all across the State. The horizontal coordinates (latitude and longitude) and the vertical coordinates (geometrical, orthometrical and geoidal heights) of these BMs are known. From the 157 BMs, 115 were used for the training of RNA and 42 in the process of simulation to assess the efficiency of the model proposed. Efficiency is based in determining the discrepancies (error) between known geoidal heights and those which were obtained by the neural model. As a contribution to this research, we have compared the values simulated with the Earth Gravitational Model 2008 (EGM2008) and with the MAPGEO2004 as well. In terms of results, the RNA produced a mean absolute error of 0.19 m ± 0.14 m and a strong correlation (R² = 0.9871) with the values taken as true. Statistically, the tests showed that there was no difference between known geoidal heights and those which were provided by the neural model for a level of significance of 5%. When we compare these results with the EGM2008 and MAPGEO2004, the RNA has an error reduction of 0.07 and 0.44 m, respectively.

Scientific Electronic Library Online (Portuguese)

17

Caracterização do gene da proteína capsidial de dois isolados, patologicamente distintos e sorologicamente semelhantes, do Grapevine virus B em videiras no Estado de São Paulo/ Characterization of the coat protein gene of two isolates, pathologically distinct and serologically similar, of Grapevine virus B in corky bark-affected grapevines in São Paulo State, Brazil

Moreira, Andreia E; Gaspar, José O; Camargo, Luís Eduardo A; Kuniyuk, Hugo
2004-02-01

Resumo em português No presente trabalho, descreve-se a caracterização do gene codificador da proteína capsidial de dois isolados sintomatologicamente distintos do Grapevine virus B (GVB). Para isto, RNA totais foram extraídos de folhas e pecíolos de videiras (Vitis spp.) infetadas, cultivares Rubi (GVB-C SP) e Itália (GVB-I SP) e utilizados para amplificar, por RT/PCR, um fragmento entre as posições 6425 e 7118 (694 nucleotídeos, nt) do RNA do GVB ("GenBank", acesso X75448). O frag (mais) mento obtido inclui o gene da proteína capsidial (594 nt) codificando 197 aminoácidos com massa molecular estimada em aproximadamente 21.600 Da. A seqüência do GVB-C SP apresentou maior similaridade de nucleotídeos e aminoácidos deduzidos com o isolado italiano (acesso X75448), enquanto que o GVB-I SP foi mais similar a um outro isolado brasileiro do GVB descrito no Rio Grande do Sul (GVB BR1, acesso AF438410). Os dois isolados paulistas do GVB podem ser diferenciados por digestão com a enzima de restrição EcoRI, uma vez que há um sítio interno no GVB-C SP que está ausente no isolado GVB-I SP. Resumo em inglês The present work describes the characterization of the coat protein gene of two isolates of Grapevine virus B (GVB), which can be differentiated by their biological behavior on some grape cultivars. The total RNA was extracted from leaves and petioles of infected grapevines (Vitis spp.) of the cultivars Rubi (GVB-C SP) and Italy (GVB-I SP) and used to amplify, by RT/PCR, a fragment between positions 6425 and 7118 (694 nucleotides, nt) of the genomic RNA (GenBank, access X (mais) 75448). The fragment comprises the coat protein gene (594 nt) coding for 197 amino acids with a predicted Mr of 21,600 Da. The sequence of GVB-C SP showed a greater similarity of nucleotides and deduced amino acids with the Italian isolate (access X74448), while the GVB-I SP was similar to a Brazilian isolate described in the State of Rio Grande do Sul , Brazil (GVB BR1, access AF438410). The isolates GVB-C SP and GVB-I SP can be differentiated by digestion with the enzyme EcoRI, since this restriction site is present on the GVB-C SP but absent on GVB-I SP.

Scientific Electronic Library Online (Portuguese)

18

Detecção do Grapevine virus A e Grapevine virus B por hibridização "dot-blot" com sondas moleculares não radioativas/ Detection of Grapevine virus A and Grapevine virus B by dot blot hybridization with non-radioactive molecular probes

Moreira, Andreia E; Gaspar, José O; Kuniyuki, Hugo
2005-10-01

Resumo em português O vírus A da videira (Grapevine virus A, GVA) e o vírus B da videira (Grapevirus virus B, GVB) estão associados à acanaladura do lenho de Kober ("Kober stem grooving") e ao fendilhamento cortical da videira ("grapevine corky bark"), respectivamente. Este trabalho descreve o uso de sondas moleculares de cDNA na detecção de isolados do GVA (GVA-SP) e do GVB (GVB-C-SP e GVB-I-SP) em videiras (Vitis spp.) e fumo (Nicotiana occidentalis). As sondas marcadas com digoxigen (mais) ina foram produzidas por RT-PCR utilizando oligonucleotídeos específicos para os genes da proteína capsidial. Os RNA totais foram extraídos de 45 plantas de diversas variedades de videira e de 13 plantas de fumo inoculadas mecanicamente com o GVB. Os RNA extraídos das plantas infetadas, indexadas biologicamente, hibridizaram com as sondas, não se verificando reação com plantas sadias. Para confirmar os resultados de hibridização, foram também feitos testes de RT-PCR. A utilização de hibridização "dot-blot" com sondas de cDNA mostrou-se eficaz na detecção dos vírus com especificidade e sensibilidade, ressaltando-se que, preferencialmente, folhas maduras e ramos dormentes devem ser utilizados nos testes diagnósticos para o GVB e GVA, respectivamente. Resumo em inglês Grapevine virus A (GVA) and Grapevine virus B (GVB) are involved in the Kober stem grooving and grapevine corky bark diseases, respectively. This work reports the molecular detection of isolates of GVA (GVA-SP) and GVB (GVB-C-SP and GVB-I-SP) in grapevines (Vitis spp.) and tobacco (Nicotiana occidentalis) by non-radioactive molecular probes. The digoxigenin-labeled probes were generated by RT-PCR using specific primers to the coat protein genes. Total RNA was extracted fr (mais) om 45 plants of several grapevine varieties and from 13 plants of tobacco mechanically inoculated with GVB. The RNA extracted from infected plants, considered infected by biological indexing, reacted to the cDNA probes while there was no hybridization with healthy plants. These results were also confirmed by RT-PCR experiments. The use of the cDNA probes hybridization was proved to be efficient in detecting both GVA and GVB with high specificity and sensitivity. However, mature leaves and dormant cuttings should be preferably used in diagnostic tests of GVB and GVA, respectively.

Scientific Electronic Library Online (Portuguese)

19

Detecção de allexivírus em primórdios foliares de alho via RT-PCR/ Detection of allexivírus on primordial garlic leaves using RT-PCR

Nascimento, Robson José do; Pio-Ribeiro, Gilvan; Santos, Roseane Cavalcanti dos; Melo Filho, Péricles de Albuquerque
2008-09-01

Resumo em português Nos procedimentos de detecção de allexivirus em bulbos de alho, tem-se como rotina o plantio de bulbilhos para obtenção de tecido foliar a ser analisado via testes sorológicos e/ou moleculares. A disponibilização das plantas em casa de vegetação implica em gastos com a manutenção e requer, em média, 30 dias. Em áreas isentas desses vírus, corre-se, ainda, o risco de sua introdução e disseminação. No presente trabalho buscou-se ajustar um protocolo para d (mais) etecção rápida de allexivírus em alho a partir de primórdios foliares. Bulbilhos de alho para consumo, oriundos do Rio Grande do Sul e importados da Argentina foram dissecados para obtenção de primórdios foliares e extração de RNA total a partir de 0,1 g de tecido. A seguir foram conduzidas reações de RT-PCR com um par de oligonucleotídeos, capaz de gerar um fragmento de aproximadamente 500 pb relativo à porção interna do gene da capa protéica de várias espécies do gênero Allexivirus. Uma banda com tamanho aproximado de 500 pb foi visualizada, em gel de agarose e, posteriormente, confirmada por Southern Blot e por seqüenciamento como sendo Garlic vírus C (GarV-C, AY170322.1). A obtenção de RNA total diretamente de primórdios foliares de bulbilhos e seu uso em análise de RT-PCR, constituem-se em uma metodologia econômica, rápida e segura para a detecção de allexivírus em bulbos de alho. Resumo em inglês Cloves crop is a routinely practice often used in procedures for detecting allexiviruses in garlic bulbs to obtainment foliar tissue to be analyzed by serological and/or molecular tests. The availability of the plants under greenhouse implies is expenses with the maintenance and requires abaut 30 days. In areas free of these viruses, there is also the risk of their introduction and dissemination. This study presents an adjustment of protocol aiming a fast detection of all (mais) exiviruses, using primordial leaves. Cloves of consumption-garlic, from Rio Grande do Sul, Brazil, and imported from Argentina were dissected for obtaining primordial leaves and total RNA extraction, using 0,1g of tissue of each sample. RT-PCR reactions were performed with a pair of primers able to amplify a 500 bp fragment, corresponding to the internal region of the coat protein gene from several species of Allexivirus genus. A band in the expected height (500 pb) was visualized in agarose gels and further confirmed using Southern Blot test and by sequencing as Garlic virus C (GarV-C, AY170322.1). Total RNA obtained from foliar primordia of cloves and its use in RT-PCR analysis is an economic, fast and secure methodology for allexivirus detection in garlic bulbs.

Scientific Electronic Library Online (Portuguese)

20

MicroRNAs e seu papel no desenvolvimento embrionário/ MicroRNAs and its role in embryonic development

Campos, Vinicius Farias; Urtiaga, Gabriel; Gonçalves, Breno; Deschamps, João Carlos; Collares, Tiago
2011-01-01

Resumo em português MicroRNAs (miRNAs) são pequenas moléculas de RNA com aproximadamente 22 nucleotídeos incapazes de codificar proteínas e que apresentam função na regulação pós-transcricional da expressão gênica. Vários estudos vêm demonstrando o importante papel dos miRNAs na regulação do desenvolvimento embrionário de diferentes espécies, desde o controle da expressão de RNAs mensageiros durante o desenvolvimento inicial embrionário até a determinação de linhagens c (mais) elulares durante a organogênese. Esta revisão irá abordar os principais miRNAs e seu papel na biologia reprodutiva, com ênfase no desenvolvimento embrionário de mamíferos. Resumo em inglês MicroRNAs (miRNAs) are small RNA molecules with around 22 nucleotides that are unable to encode proteins and play a key role on post-transcription regulation process. Several studies have demonstrated the relevant role of miRNAs on the regulation of embryonic development on different species, from the control of gene expression during the early embryo development to determination of cellular lineages over the organogenesis. This review will present the miRNAs and its role on reproductive biology focusing on the mammalian embryo development.

Scientific Electronic Library Online (Portuguese)

21

Infecção pelo vírus da hepatite c em pacientes em hemodiálise: prevalência e fatores de risco

Leão, José Rafael; Pace, Fabio Heleno de Lima; Chebli, Julio Maria Fonseca
2010-03-01

Resumo em português CONTEXTO: Doentes com doença renal crônica em tratamento hemodialítico apresentam risco aumentado de aquisição do vírus da hepatite C (VHC). Elevadas taxas de prevalência têm sido detectadas em unidades de diálise do mundo inteiro. Estudos recentes têm demonstrado que a infecção pelo VHC interfere de forma negativa na sobrevida dos pacientes em hemodiálise e naqueles submetidos ao transplante renal. OBJETIVOS: Determinar a prevalência e os fatores de risco d (mais) a infecção pelo VHC em pacientes submetidos a hemodiálise. MÉTODOS: Realizou-se estudo transversal entre janeiro e dezembro de 2007. Neste período, 236 pacientes em hemodiálise foram testados pelo ELISA de terceira geração. Os casos positivos foram submetidos a pesquisa qualitativa do HCV-RNA pelo método de PCR. Consideraram-se como portadores de infecção pelo VHC aqueles pacientes com anti-VHC e HCV-RNA positivos. Dosagens mensais de ALT e a média do valor de 12 meses foram obtidas em 195 pacientes. Do total de pacientes, 208 (88,1%) responderam ao questionário padronizado visando a identificação de fatores de risco associados à infecção pelo VHC. RESULTADOS: A prevalência de pacientes anti-VHC positivos encontrada entre os 236 testados foi de 14,8% (35/236); destes, a pesquisa do HCV-RNA foi positiva em 71,6% (25/35). Portanto, a prevalência da infecção crônica pelo VHC foi de 10,6% (25/236) dos pacientes. Pela análise bivariada, os principais fatores de risco associados à infecção pelo VHC foram o tempo de hemodiálise, o número de transfusões de sangue, a realização prévia de diálise peritonial e história de doença sexualmente transmissível. Contudo, após análise multivariada, somente o tempo de hemodiálise e história de doença sexualmente transmissível foram significativamente associados à infecção pelo VHC. Pacientes com mais de 10 anos de hemodiálise apresentaram risco de aquisição do VHC 73,9 (IC de 17,5 a 311,8) vezes maior quando comparados a pacientes com até 5 anos de tratamento. Indivíduos com doença sexualmente transmissível prévia apresentaram risco 4,8 (IC de 1,1 a 19,9) vezes superior de contaminação pelo VHC quando comparados àqueles sem doença sexualmente transmissível. O valor médio da ALT foi significantemente maior nos pacientes infectados pelo VHC (44,0 ± 13,5 U/L versus 33,5 ± 8,0 U/L, P Resumo em inglês CONTEXT: Chronic renal disease patients on hemodialysis are at increased risk of infection by hepatitis C virus (HCV). High prevalence rates have been reported from dialysis units worldwide. Recent studies have shown an inverse relation between HCV infection and life expectancy of patients on hemodialysis and those undergoing renal transplant. OBJECTIVES: Assess the prevalence of and risk factors for HCV infection in patients undergoing hemodialysis. METHODS: A cross-sect (mais) ional study was undertaken from January to December, 2007. During this period, 236 patients were tested for anti-HCV antibodies with third generation ELISA. Those who tested positive further underwent qualitative PCR testing for HCV-RNA. A subject was considered HCV-infected if both tests (anti-HCV and HCV-RNA) were positive. Monthly serum ALT and the mean for the 12-month period were obtained from 195 patients. Two hundred eight (88.1%) patients answered a standardized questionnaire aiming to identify risk factors for HCV infection. RESULTS: Of the 236 subjects studied, 14.8% (35/236) tested positive for anti-HCV antibodies. Of these, 71.6% (25/35) tested positive for HCV-RNA. Chronic HCV infection was thus prevalent in 10.6% (25/236). Bivariate analysis showed time on hemodialysis, number of blood transfusions, previous peritoneal dialysis and previous sexually transmitted diseases to be the main risk factors for HCV infection. Yet multivariate analysis showed that just time on hemodialysis and previous sexually transmitted diseases were significantly associated with HCV infection. Patients on hemodialysis for over 10 years were 73.9 (CI 17.5-311.8) times as likely to have acquired HCV, compared with those on hemodialysis for up to 5 years. Patients with previous sexually transmitted diseases had a 4.8 times higher risk of HCV infection compared with those without previous sexually transmitted diseases. Mean serum ALT was significantly higher in HCV-infected patients (44.0 ±13.5 U/L versus 33.5 ± 8.0 U/L, P

Scientific Electronic Library Online (Portuguese)

22

Detecção de rotavírus em um cão doméstico na cidade de Manaus-AM/ Rotavirus detection in a domestic dog in the City of Manaus-AM

Pimentel, Renah Boanerges de Queiroz; Costa, Cristóvão Alves da
2010-01-01

Resumo em português Os rotavírus do grupo A, são frequentemente associados com gastroenterites em mamíferos e aves. O objetivo deste trabalho foi detectar a presença de rotavírus em fezes de cães sintomáticos e assintomáticos para diarréia aguda. Foram coletadas 32 amostras de fezes de cães. Todas as amostras foram submetidas à extração do RNA viral seguida da Eletroforese em Gel de Poliacrilamida (EGPA), onde se identificou apenas 1 (um) caso de infecção por rotavírus, em am (mais) ostra assintomática. A análise do eletroferótipo mostrou um perfil 4:2:3:2 longo, e a homologia dos eletroferótipos de rotavírus humano e canino foi muito alta, sugerindo uma possível infecção interespécie. Resumo em inglês The group A rotaviruses are frequently associated with gastroenteritis in mammals and birds. The objective of this study was to detect the presence of rotavirus in feces of symptomatic and asymptomatic dogs for acute diarrhea. 32 samples of dog feces were collected. All the samples were submitted to viral RNA extraction followed by electrophoresis in poliacrylamide gels (PAGE), where only one case of rotavirus infection in one asymptomatic sample was found. The electropho (mais) retic analysis showed 4:2:3:2 long profile, and the homology between human and dog rotaviruses was very high. This suggests a possible interspecies infection.

Scientific Electronic Library Online (Portuguese)

23

Data Mining via Redes Neuronais Artificiais e Máquinas de Vectores de Suporte

Cruz, Armando; Cortez, Paulo
2009-12-01

Resumo em português Este artigo pretende esclarecer quais as vantagens de dois modelos não lineares de Data Mining: as Redes Neuronais Artificiais (RNA) e as Máquinas de Vectores de Suporte (MVS). Em particular, pretende-se medir o desempenho destas técnicas quando aplicadas a tarefas de classificação e regressão, comparando-as com outras técnicas (i.e. Árvores de Decisão/Regressão). Assim, fez-se uma análise de ferramentas de software que implementam os modelos referidos, tendo-s (mais) e escolhido duas aplicações de utilização livre (i.e. o ambiente R e o Weka) para conduzir as experiências efectuadas. Foram utilizados diversos problemas do mundo real, sendo que os resultados obtidos revelam que as MVS obtêm em geral melhores previsões, sendo seguidas pelas RNA. Resumo em inglês This paper pretends to infer about the advantages of two nonlinear Data Mining models: Artificial Neural Networks (ANN) and Support Vector Machines (SVM). In particular, the intention is to measure their performance when applied to classification and regression tasks, being compared with other techniques (i.e. Decision/Regression Trees). Thus, an analysis was performed over a wide range of software tools that implement the referred models. From this set, two open-source a (mais) pplications (i.e. R environment and Weka) where selected to conduct the experiments. Several real world problems where used as benchmarks. The results show that in general the SVM achieves better forecasts, followed by the ANN.

Scientific Electronic Library Online (Portuguese)

24

Dermatoses em indivíduos infectados pelo vírus HIV com diferentes graus de imunossupressão/ Dermatoses in HIV-infected patients with different degrees of immunosuppression

Cardoso, Fernando; Ramos, Heloísa; Lobo, Márcio
2002-12-01

Resumo em português FUNDAMENTOS: A contagem sangüínea de linfócitos T Helper CD4+ e o número de cópias de RNA viral são marcadores laboratoriais da progressão de imunodeficiência induzida pelo vírus HIV. OBJETIVOS: Relacionar os marcadores do grau de imunidade em infectados pelo HIV aos aspectos clínicos das dermatoses neles presentes. MÉTODOS: A amostra compreendeu 172 pacientes, submetidos a quantificações de linfócitos T CD4+ e CD8+, pela técnica de citometria de fluxo; qua (mais) ntificações de RNA viral pela técnica de amplificação de ácidos nucléicos (Nuclisens). Foram classificados em pacientes com e sem imunossupressão acentuada, a partir da classificação clínico-laboratorial da infecção pelo HIV do CDC/1992. RESULTADOS: O percentual médio da pele atingida pelas dermatoses foi 12,5% e a média do número de dermatoses por doente foi 2,08. As dermatoses neoplásicas e do grupo miscelânia predominaram nos indivíduos com valores de linfócitos T CD4+•200 células/mm³, enquanto valores de linfócitos T CD4+>200 células/mm³ em pacientes com infestações por artrópodes. CONCLUSÃO: O número de dermatoses por doente mostrou ser marcador da evolução de imunossupressão (p=0,003). A extensão percentual da pele atingida por dermatoses não se prestou a medir gravidade das dermatoses em infectados pelo HIV (p=0,6058). As contagens de linfócitos T CD4+ e CD8+ e da carga viral foram eficientes medidores do grau de imunossupressão dos infectados com dermatoses (p=0,003). Resumo em inglês BACKGROUND: The T-helper CD4+ lymphocyte blood count and number of viral RNA copies are laboratory markers tracing the progression of HIV-induced immunodeficiency. OBJECTIVES: Relate the markers indicating the varying degree of imunity in HIV-infected patients to the clinical aspects of the dermatoses present. METHODS: The sample consists of 172 patients, who were submitted to quantifications of T CD4+ and CD8 lymphocytes by the cytometric flow technique as well as quanti (mais) fications of viral RNA by the nucleic acid amplification technique (NucliSens). They were classified in patients with or without accentuated immunosuppression, based on the CDC-1992 clinic and laboratory classification of HIV infection. RESULTS: The average percentage of skin afflicted by dermatoses was 12.5% and the average number of dermatoses per patient was 2.08. Neoplasic dermatoses and dermatoses of the miscellaneous group predominated in individuals with CD4+ T •200 cells/mm³ lymphocyte values, whereas CD4+ T >200 cells/mm³ lymphocyte values predominated in patients infected by arthropods. CONCLUSION: The number of dermatoses per patient proved to be a marker for the course of immunosuppression (p=0,003). The percentage of skin extension affected by dermatoses did not lend itself to measuring the severity of dermatoses in HIV-infected patients (p=0,6058). The CD4+ T and CD8+ T and viral load lymphocyte count were efficient measurers of the degree of immunosuppression in dermatosis-infected patients (p=0.003).

Scientific Electronic Library Online (Portuguese)

25

Bidens mosaic virus: detecção via RT-PCR e identificação de Galinsoga parviflora como um novo hospedeiro natural do vírus/ Bidens mosaic virus: detection by RT-PCR and identification of Galinsoga parviflora as a new natural host of the virus

Sanches, Márcio Martinello; Spadotti, David Marques de Almeida; De Marchi, Bruno Rossito; Pavan, Marcelo Agenor; Krause-Sakate, Renate
2010-12-01

Resumo em português O Bidens mosaic virus (BiMV) é uma espécie tentativa do gênero Potyvirus, que infecta alface (Lactuca sativa). Na ausência de métodos eficientes para diagnose deste vírus, o objetivo do trabalho foi a síntese de oligonucleotídeos específicos e sua otimização em testes de RT-PCR em uma só etapa, partindo-se de extrações de RNA total. Os oligonucleotídeos 8851sens (5'AGG CAG TTC GCA CGG CAT AC 3´) e 9211ant (5´ CTT CAT CTG GAT GTG TGC TTC 3´) permitem a ef (mais) iciente detecção do vírus e possibilitaram a descoberta de uma nova hospedeira do vírus, a planta Galinsoga parviflora, comumente encontrada em canteiros de produção comercial de alface. Resumo em inglês Bidens mosaic virus (BiMV) is a tentative species of the genus Potyvirus and infects lettuce (Lactuca sativa). In the absence of efficient methods for the diagnosis of the virus, the objective of this work was to develop specifics primers for a one-step RT-PCR test using total RNA. The primer pairs 8851sens (5'AGG CAG TTC GCA CGG CAT AC 3´) and 9211ant (5´ CTT CAT CTG GAT GTG TGC TTC 3´) were considered very efficient for the detection of BiMV and the virus was found naturally infecting Galinsoga parviflora, a new host of BiMV, commonly found in commercial lettuce crops.

Scientific Electronic Library Online (Portuguese)

26

Rede neural artificial aplicada à previsão de vazão da Bacia Hidrográfica do Rio Piancó/ Artificial neural network applied to the forecast of streamflow in the Piancó River Basin

Sousa, Wanderson dos S.; Sousa, Francisco de A. S. de
2010-02-01

Resumo em português A previsão de vazão em um sistema hídrico não é apenas uma das técnicas utilizadas para minimizar o impacto das incertezas do clima sobre o gerenciamento dos recursos hídricos mas, também, um dos principais desafios relacionados ao conhecimento integrado da climatologia e da hidrologia de uma bacia hidrográfica. O objetivo deste trabalho foi modelar a relação não-linear entre chuva e vazão na bacia hidrográfica do rio Piancó, no semiárido paraibano, atrav� (mais) �s da técnica de Redes Neurais Artificiais (RNA). Aqui se avaliou a capacidade da RNA modelar o processo chuva-vazão em base mensal e se considerou, durante o seu treinamento, a influência da arquitetura da rede e da inicialização dos pesos. No final do treinamento foi escolhida a melhor arquitetura para modelar vazões médias mensais na bacia estudada, com base no desempenho do modelo. A arquitetura de RNA que produziu melhor resultado foi a RC315L, com valores para o coeficiente de determinação, de eficiência e erro padrão da estimativa de 92,0, 77,0% e 8,29, respectivamente. Resumo em inglês Streamflow forecasting in a water system is one of the techniques used to reduce the impact of the uncertainties of the climate on administration of the water resources. That technique can be considered as one of the principal challenges related to the integrated knowledge of the climatology and of the hydrology of the river basin. The aim of this work was to model the non-linear relationship between rainfall and streamflow in the Piancó River Basin, in the Paraíba semi (mais) arid, using the technique of Artificial Neural Networks (ANN). Here the ability of ANN was evaluated to model the rainfall-runoff process on a monthly basis. During training of the ANN, the network architecture and weights initialization influence were considered. At the end of the training the best architecture was chosen, to model the streamflow monthly mean in the studied basin, based upon the performance of the model. The ANN architecture that produced the better result was RC315L with values for the determination coefficient, efficiency coefficient and standard estimate error (SEE) equal to 92.0, 77.0% and 8.29 respectively.

Scientific Electronic Library Online (Portuguese)

27

Estresse oxidativo: relação entre geração de espécies reativas e defesa do organismo/ Oxidative stress: relations between the formation of reactive species and the organism's defense

Barreiros, André L. B. S.; David, Jorge M.; David, Juceni P.
2006-02-01

Resumo em inglês This work describes the mechanism of action of some reactive oxygen species (ROS) and reactive nitrogen species (RNS) in the oxidative stress of the human body, and their consequences on damage to DNA, RNA, proteins and lipids. It also illustrates the defense system of our organism against these ROS and RNS species. The action of nonenzymatic protection systems is reported, with emphasis on micromolecules like Q10 coenzyme, vitamin C, alpha-tocopherol, carotenoids and flavonoids. The importance of flavonoids is also emphasized, and their body protection mechanism is detailed.

Scientific Electronic Library Online (Portuguese)

28

Caracterização da região 3'-terminal do genoma de um isolado brasileiro do Southern bean mosaic virus/ Characterization of the 3'-terminal genome region of a Brazilian isolate of Southern bean mosaic virus

Espinha, Luciana M; Gaspar, José O; Moreira, Andreia E; Pereira, Ana Cecília B; Belintani, Priscila; Camargo, Luis E. A
2005-10-01

Resumo em português O presente trabalho caracteriza a região 3'-terminal do genoma de um isolado do Southern bean mosaic virus encontrado no Estado de São Paulo (SBMV-SP). O RNA foi extraído de partículas virais purificadas e submetido a RT-PCR usando oligonucleotídeos desenhados para amplificar 972 nt da região 3'-terminal do RNA viral. Foi obtido fragmento de tamanho esperado que inclui o gene da proteína capsidial e a região 3'-terminal não codificadora. O gene da proteína capsi (mais) dial (ORF4) contém 801 nucleotídeos, incluindo-se o códon de terminação UGA, com seqüência deduzida de 266 aminoácidos e massa molecular estimada de 28.800 Da. Sessenta e um aminoácidos terminais da ORF2 estão sobrepostos na ORF4. O "sinal de localização nuclear", encontrado dentro do "Domínio R" na região 5'-terminal da ORF4 de alguns sobemovírus, não foi identificado no SBMV-SP. Esse dado pode explicar a ausência de partículas virais do SBMV-SP no núcleo celular. A seqüência do SBMV-SP apresentou identidade de nucleotídeos e aminoácidos de, respectivamente, 91% e 93% com o isolado "Arkansas" (SBMV-ARK) descrito nos EUA. Os resultados obtidos indicam que o SBMV-SP e o SBMV-ARK são isolados muito proximamente relacionados. Resumo em inglês We report the characterization of the 3'-terminal genome region of an isolate of Southern bean mosaic virus found in the State of São Paulo, Brazil (SBMV-SP). The RNA was extracted from purified virus particles and subjected to RT-PCR using oligonucleotides designed to amplify 972 nt of the 3'-terminal region of the viral genome. The coat protein gene (ORF4) contains 801 nt, including the stop codon UGA, coding for 266 amino acids with a predicted molecular weight of 28, (mais) 800 Da. The 3'-terminus of ORF2 overlaps the 5'-terminus of ORF4 in 61 amino acids. The nuclear localization signal sequence, found in the "R domain" at the 5'-terminal of the ORF4 in some sobemoviruses, was not identified in SBMV-SP. This could explain the absence of SBMV-SP particles inside the cell nucleus. The SBMV-SP sequence showed identity of nucleotides and amino acids of, respectively, 91% and 93% with the "Arkansas" isolate (SBMV-ARK) described in the USA. The results obtained in the present work indicate that SBMV-SP and SBMV-ARK are closely related isolates of the same virus.

Scientific Electronic Library Online (Portuguese)

29

Tumorigênese Molecular Tiroideana: Implicações Para a Prática Médica/ Molecular Thyroid Tumorigenesis: Implications for The Clinical Practice

Maciel, Rui M.B.
2002-08-01

Resumo em português Esta revisão apresenta aspectos de utilidade prática da tumorigênese tiroideana. O mais importante é a possibilidade de se fazer o diagnóstico genético precoce dos indivíduos portadores de mutações do gene RET em famílias com carcinoma medular de tiróide e neoplasia endócrina múltipla tipo 2. Além disso, discutem-se dados relativos à patogênese molecular dos carcinomas diferenciados da tiróide, relacionados aos rearranjos entre RET e outros genes no caso (mais) do carcinoma papilífero (RET/PTC) e entre PAX-8 e PPARg1 no carcinoma folicular da tiróide. A seguir, analisam-se as mutações que causam ganho de função no receptor de TSH, causadoras dos nódulos autônomos. Finalmente, apresenta-se o emprego do RNA mensageiro da tiroglobulina no seguimento de pacientes com câncer de tiróide. Resumo em inglês In this review we present practical aspects of thyroid molecular tumorigenesis. The most important issue is the molecular diagnosis of affected patients with RET mutations in families with medullary thyroid carcinoma and multiple endocrine neoplasia type 2. In addition, we discuss the molecular pathologenesis of differentiated thyroid carcinoma, like the data on RET/PTC rearrangements in papillary carcinoma and PAX8-PPARg1 rearrangement in follicular carcinoma. Subsequent (mais) ly, we present gain of function mutations in thyroid nodules and finally we conclude discussing the use of messenger RNA of thyroglobulin in the follow-up of patients with differentiated thyroid cancer.

Scientific Electronic Library Online (Portuguese)

30

Mitomicina C e "Excimer laser"/ Mitomycin C and Excimer Laser

Wallau, Anelise Dutra; Leoratti, Maria Cristina Ventura; Campos, Mauro
2005-12-01

Resumo em português A mitomicina C é um antimetabólito que atua em nível celular bloqueando a replicação de DNA e RNA e inibindo a síntese protéica. Utilizada em diversas áreas da oftalmologia, recentemente vem sendo empregada como moduladora da resposta cicatricial corneana em cirurgias ópticas/refrativas por "excimer laser". A aplicação única de mitomicina C associada à cirurgia fotoablativa de superfície corneana tem se mostrado opção segura e eficiente para fins terapêut (mais) icos em olhos com opacidade corneana pré-existente e/ou profiláticos em olhos com alto risco de desenvolvimento de opacificação corneana pós-operatória. O uso da droga em cirurgia fotoablativa deve ser cauteloso até que seguimento de longo prazo avalie sua inocuidade tardia. O presente texto faz revisão dos principais estudos sobre modulação da resposta cicatricial corneana com uso de mitomicina C em cirurgias ópticas/refrativas de superfície. Resumo em inglês Mitomycin C is an antimetabolite agent that blocks DNA and RNA replication and protein synthesis. It has been used in several ophthalmologic areas, and recently as a modulator of corneal wound healing in excimer laser surgeries. A single application of mitomycin C during surface corneal photoablative surgery seems a safe and efficient therapeutic option for eyes with corneal opacity and/or as prophylaxis in eyes with high risk for corneal opacity development. The use of t (mais) his drug in photoablative surgery should be cautious until long-term safety results have been reported. The present text presents a review about corneal wound healing with the use of mitomycin C.

Scientific Electronic Library Online (Portuguese)

31

Resposta virológica sustentada em pacientes com co-infecção pelos genótipos 1 e 2 do vírus da hepatite C, com apenas nove semanas de terapêutica antiviral: relato de caso/ Sustained virological response in patients with coinfection by hepatitis C virus genotypes 1 and 2, after just nine weeks of antiviral therapy: case report

Araújo, Ana Ruth; Levi, José Eduardo; Almeida, Carlos Mauríco de; Lima, Tatiane Amábili de; Maia, Laura Patrícia Viana; Torres, Kátia Luz; Tarragô, Andréa Monteiro; Victória, Flamir; Victória, Marilu; Talhari, Sinésio; Malheiro, Adriana
2010-10-01

Resumo em português Relata-se um paciente do sexo masculino com 67 anos e sorologia positiva para o vírus da hepatite C (HCV). Exames moleculares revelaram a presença do RNA do HCV, com carga viral de 2.000 cópias/mL e genótipos 1 e 2. O tratamento foi com alfapeginterferon-2a, 180mcg/semana e ribavirina, 1.000mg/dia. Na quarta semana de tratamento, a carga viral para o HCV era indetectável. Na nona semana, o paciente apresentou hematêmese, piora do quadro de astenia, inapetência e co (mais) mprometimento do estado geral, quando o tratamento foi descontinuado. O PCR foi negativo após 6 meses e permaneceu assim após um ano. O paciente encontra-se assintomático. Resumo em inglês A report of a 67 year-old male patient with positive serology for HCV. PCR revealed the presence of HCV RNA, viral load of 2,000 copies/mL and genotypes 1 and 2. The pacient was treated with peginterferon alfa-2a at 180mcg/week and ribavirin at 1,000mg/day. In week four of treatment, HCV viral load was undetectable. In week nine, the patient developed hematemesis, worsening of asthenia, anorexia and impaired general condition, so the treatment was discontinued. The PCR was negative six months and one year after the cessation of treatment. The patient remains asymptomatic.

Scientific Electronic Library Online (Portuguese)

32

A Interleucina 1-beta mostra uma ação protetora na fase aguda do modelo de epilepsia induzido pela pilocarpina/ The il1β have a protective action in the acute phase of the pilocarpine-induced epilepsy model

Pascoal, VDB; Marchesini, RB; Matos, AHB; Conte, FF; Pereira, TC; Gilioli, R; Malheiros, JM; Polli, RS; Buzzá, HH; Tannús, A; Covolan, L; Cavalheiro, EA; Velloso, L; Cendes, F; Lopes-Cendes, I
2010-09-01

Resumo em português INTRODUÇÃO: Existem contradições na literatura quanto aos efeitos dos genes il1β e il1rn nas epilepsias. Nosso objetivo foi avaliar os efeitos do silenciamento desses dois genes na fase aguda do modelo de epilepsia induzido pela pilocarpina. MÉTODOS: Para alterar a expressão dos genes il1β e il1rn utilizamos a técnica de interferência por RNA. RESULTADOS: Obtivemos taxas de silenciamento significativas para os dois genes no sistema nervoso central. Obser (mais) vamos efeitos fenotípicos significativos, incluindo a alteração na taxa de mortalidade dos animais 5 dias após a indução do modelo. CONCLUSÕES: A il1β parece exercer um papel protetor na fase aguda do modelo de epilepsia induzido pela pilocarpina. Resumo em inglês INTRODUCTION: There is contradictory information regarding the of effects il1β and il1rn in epilepsy. We aimed to evaluate the effect of silencing both genes in the acute phase of the pilocarpine-induced epilepsy model. METHODS: We used RNA interference in order to achieve gene silencing. RESULTS: We obtained significant gene silencing in the central nervous system. In addition, we observed phenotypic effects including differences in mortality rates of animals 5 days (mais) after pilocarpine injections. CONCLUSION: Our results indicate that il1β seems to have a protective effect in the acute phase of the pilocarpine-induced epilepsy model.

Scientific Electronic Library Online (Portuguese)

33

Ocorrência generalizada do Lettuce mottle virus em três regiões produtoras de alface comercial do Estado de São Paulo/ Occurrence of Lettuce mottle virus on three lettuce producing areas from São Paulo State

Krause-Sakate, Renate; Firmino, Ana Carolina; Jadão, Adriana Salomão; Pavan, Marcelo A.; Silva, Norberto da; Hanai, Sérgio Minoru; Anbo, Roberto Hiroto; Nietzsche, Thomas
2008-02-01

Resumo em português Os sequivírus são vírus isométricos transmitidos por afídeos. Lettuce mottle virus (LeMoV), um provável sequivirus foi descrito no Brasil em 1982 e causa sintomas de mosaico semelhantes aos observados pelo Lettuce mosaic virus (LMV). Um levantamento para ocorrência do LeMoV nos campos de produção de alface de três diferentes regiões do Estado de São Paulo (Mogi das Cruzes, Campinas e Bauru) foi realizado durante 2002 a 2005. RNA total foi extraído e utilizado (mais) na detecção, em RT-PCR, com oligonucleotídeos específicos para o LeMoV. Do total de 1362 amostras, 137 (10,05%) foram positivas para o LeMoV. Infecção mista com o LMV foi verificada em 43 amostras (31,4%). Foi verificada a ocorrência do LeMoV nas três diferentes regiões analisadas, porém sua ocorrência foi baixa nas diferentes épocas do ano. Resumo em inglês Sequiviruses are isometric aphid-borne plant viruses. Lettuce mottle virus (LeMoV), a putative sequivirus was first described in Brazil on 1982 causing similar mosaic symptoms as Lettuce mosaic virus (LMV). A survey for the occurrence of LeMoV on open field conditions was carried out during 2002 to 2005 on Mogi das Cruzes, Campinas and Bauru in São Paulo state. Total RNA was extracted and used on RT-PCR with specific LeMoV primers. On 1362 samples tested, 137 (10,05%) we (mais) re positive for LeMoV. Mixed infections with LMV was observed on 43 samples (31,4%). The presence of LeMoV was observed in the three different regions, but with low incidence during the year.

Scientific Electronic Library Online (Portuguese)

34

Desenvolvimento e análise de uma rede neural artificial para estimativa da erosividade da chuva para o Estado de São Paulo/ Estimates of rainfall erosivity in São Paulo state by an artificial neural network

Moreira, Michel Castro; Cecílio, Roberto Avelino; Pinto, Francisco de Assis de Carvalho; Pruski, Fernando Falco
2006-12-01

Resumo em português O conhecimento do valor da erosividade da chuva (R) de determinada localidade é fundamental para a estimativa das perdas de solo feitas a partir da Equação Universal de Perdas de Solo, sendo, portanto, de grande importância no planejamento conservacionista. A fim de obter estimativas do valor de R para localidades onde este é desconhecido, desenvolveu-se uma rede neural artificial (RNA) e analisou-se a acurácia desta com o método de interpolação "Inverso de uma P (mais) otência da Distância" (ID). Comparando a RNA desenvolvida com o método de interpolação ID, verificou-se que a primeira apresentou menor erro relativo médio na estimativa de R e melhor índice de confiança, classificado como "Ótimo", podendo, portanto, ser utilizada no planejamento de uso, manejo e conservação do solo no Estado de São Paulo. Resumo em inglês Knowledge on rainfall erosivity (R) of particular sites is fundamental for soil loss estimation by the Universal Soil Loss Equation (USLE) and therefore highly important in conservation planning. In order to obtain the R value estimates for places where it is unknown, an artificial neural network (ANN) was developed for the state of São Paulo, and its accuracy compared with the Inverse Distance Weighted (IDW) interpolation method. The developed ANN presented a smaller me (mais) an relative error in the R estimation and a confidence index classified as "excellent", better than the IDW. ANN can therefore be used to estimate R values for soil use planning, management and conservation in São Paulo state.

Scientific Electronic Library Online (Portuguese)

35

cDNA-AFLP na identificação de genes relacionados a qualidade fisiológica/ cDNA-AFLP technique to genes identification interesting to physiological quality

Mertz, Liliane Marcia; Henning, Fernando Augusto; Zimmer, Paulo Dejalma
2009-01-01

Resumo em português Alguns trabalhos têm evidenciado a existência de genótipos de soja contrastantes para qualidade fisiológica de semente. Tais diferenças existem em virtude da presença de sementes com total ou parcial impermeabilidade do tegumento à água, o que as tornam menos susceptíveis aos danos mecânicos, as adversidades climáticas e a deterioração por umidade. A característica de tegumento semi-permeável pode ser incorporada às cultivares de alta produção por meio d (mais) os programas de melhoramento. No entanto, há necessidade de caracterizar os genes ou as regiões genômicas envolvidas com esta característica. Nesse contexto, ferramentas da biologia molecular, como a técnica de cDNA-AFLP, podem auxiliar a identificação de genes relacionados a qualidade fisiológica de sementes. O objetivo desse estudo foi verificar a eficácia da técnica de cDNA-AFLP, na obtenção de fragmentos de genes diferencialmente expressos entre tegumentos de sementes de soja com permeabilidade contrastante. Sementes provenientes dos genótipos CD-202 (tegumento amarelo, permeável e susceptível a deterioração) e TP (tegumento preto, semi-permeável e resistente a deterioração) foram cultivadas em casa-de-vegetação, sob condições homogêneas. Realizou-se a coleta das sementes em diferentes estágios de desenvolvimento (25, 30, 35, 40 e 55 dias após a antese). Procedeu-se à extração do RNA total utilizando-se três métodos, sendo o reagente Pure Link Plant RNA o mais eficiente. Para obtenção do cDNA dupla fita utilizou-se o kit Double Stranded cDNA Synthesis. A partir do cDNA obtido, aplicou-se a técnica de AFLP testando-se um total de 64 combinações de primers. Foram obtidos 47 fragmentos de cDNA diferencialmente expressos entre os tegumentos de sementes dos dois genótipos, os quais poderão ter suas funções reveladas pelo sequenciamento e análise in sílico. De acordo com os resultados obtidos, a técnica de cDNA-AFLP demonstra ser uma alternativa promissora para estudos que visem à identificação de genes relacionados a qualidade de sementes. Resumo em inglês Some studies have reported the existence of contrasting soybean genotypes for seed physiological quality. Differences such as presence of seeds with total or partial impermeability for water absorption through the seedcoat make them less susceptible to mechanical damage, adverse weather and deterioration. The semi-permeable seed coat trait can be used in soybean crop breeding programs to be incorporated in genotypes with high production. However, is necessary to character (mais) ize genes involved with the trait. Molecular biology tools, such as the cDNA-AFLP technique, can be used to identify genes involved in seed physiological quality. The objective of this study was to evaluate the efficacy of the cDNA-AFLP technique to obtain gene fragments differently expressed among soybean seedcoats with contrasting permeability. Seeds from two genotypes, CD-202 (susceptible to deterioration and permeable yellow coat) and TP (resistant to deterioration and semi-permeable black coat) were produced in greenhouse under homogeneous conditions. Seeds were harvested at different times (25, 30, 35, 40 e 55 days after anthesis). The total RNA was extracted using Pure Link Plant RNA reagent. The Double Stranded cDNA Synthesis Kit was used to obtain cDNA double strand. The AFLP technique was applied and 64 primer combinations were tested. This tool permitted the identification of 47 gene fragments differently expressed among coats from the two genotypes and was shown to be an efficient alternative to studies related to the identification of genes involved in seed quality.

Scientific Electronic Library Online (Portuguese)

36

Soroprevalência e genótipos do vírus da hepatite C em pacientes com lúpus eritematoso sistêmico (LES) em Goiânia, Brasil/ Hepatitis C virus seroprevalence and genotypes in patients with systemic lupus erythematosus (SLE) in Goiânia, Brazil

Barbosa, Vitalina de Souza; Silva, Nílzio Antônio da; Martins, Regina Maria Bringel
2005-08-01

Resumo em português A infecção pelo vírus da hepatite C (HCV) desperta grande interesse em reumatologia por apresentar várias manifestações extra-hepáticas. Diversos estudos mostram associação elevada da infecção pelo HCV com manifestações reumáticas como dores musculares, crioglobulinemia mista, síndrome reumatóide, síndrome de Sjögren, vasculite, glomerulonefrite, fenômeno de Raynaud, poliarterite nodosa, miopatia, auto-anticorpos e outras manifestações de doença difu (mais) sa do tecido conjuntivo. Em estudos anteriores realizados em nosso meio verificou-se a prevalência de 0,9% em gestantes, 1,4% em doadores de sangue, 1,8% em paciente com hanseníase e 2,0% em trabalhadores da área da saúde. OBJETIVO: determinar a prevalência da infecção pelo HCV em pacientes com lúpus eritematoso sistêmico (LES) atendidos no Serviço de Reumatologia do Hospital das Clínicas da Faculdade de Medicina da Universidade Federal de Goiás (HC-FM-UFG). MÉTODOS: foram entrevistados 175 pacientes com LES e amostras sangüíneas coletadas. Inicialmente, pesquisou-se a presença de anticorpos para o HCV (anti-HCV). As amostras anti-HCV positivas foram submetidas à detecção do RNA viral, pela reação em cadeia da polimerase (PCR) com primers complementares à região 5' não codificante do HCV. As amostras positivas foram genotipadas por line probe assay. RESULTADOS: a prevalência encontrada foi de 2,3% (4/175), e a identificação dos genótipos nas amostras RNA-HCV positivas revelou a presença do tipo 1 do HCV em três pacientes (75%) e do tipo 3 em um paciente (25%). Das quatro pacientes infectadas, três apresentaram evolução clínica favorável e uma evoluiu para óbito em razão de insuficiência renal por nefrite lúpica. CONCLUSÕES: a prevalência de HCV em pacientes com LES revelou-se um pouco maior que a encontrada anteriomente em gestantes, doadores de sangue e em hansenianos, comparável à encontrada em trabalhadores da saúde. Resumo em inglês The hepatitis C virus (HCV) infection is a source of concern in rheumatology because of its extrahepatic manifestations. Many studies have reported association between HCV infection and rheumatological manifestations such as: musculoskeletal pain, essential mixed cryoglobulinemia, rheumatoid arthritis, Sjögren's syndrome, vasculitis, glomerulonephritis, Raynaud's phenomenon, polyarteritis nodosa, myositis, autoantibody and other connective tissue diseases. In previous st (mais) udies developed in our region, prevalences of 0.9%, 1.4%, 1.8% and 2.0% were detected among pregnant women, blood donors, leprosy patients and health professionals, respectively. OBJECTIVE: to investigate the prevalence of hepatitis C virus infection among patients with systemic lupus erythematosus (SLE) in Goiânia, Brazil. METHODS: 175 patients were interviewed and had blood samples tested for HCV antibodies (anti-HCV) by a third generation enzyme linked immunosorbant assay (ELISA). RNA-HCV was detected by polymerase chain reaction (PCR) with primers complementary the 5' non-coding region of the HCV genoma, in all anti-HCV positive serum samples and genotyped by a line probe assay. RESULTS: an overall HCV infection prevalence of 2.3% (4/175) was found. Genotyping of RNA-HCV positive samples revealed HCV type 1 in 3 (75%) and type 3 in 1 (25%) patient. Clinical course was favorable in all HCV positive patients, except one, who died due to renal insuficiency related to lupus nephritis. CONCLUSIONS: anti-HCV prevalence among patients with SLE was slitghly higher than the prevanlence observed in pregnant women, healthy blood donors and leprosy patients, and similar to health professionals.

Scientific Electronic Library Online (Portuguese)

37

A história da disseminação dos microrganismos/ The history of the dissemination of microorganisms

Ujvari, Stefan Cunha
2008-12-01

Resumo em português O Homo sapiens nasceu portando agentes infecciosos que circulavam no animal ancestral comum ao homem e chimpanzé. Adquirimos outros microrganismos ainda no solo africano, época dos caçadores e coletores. Partimos da África, conquistamos o planeta e nos tornamos sedentários. Descobrimos a agricultura e a domesticação dos animais e, com isso, fomos invadidos por novos agentes infecciosos. Os microrganismos apanharam carona nas locomoções humanas. Estavam presentes (mais) nas migrações humanas originadas da África, nas campanhas militares da Antigüidade, nas viagens marítimas de descobrimentos, nas colonizações, no tráfico de escravos e outros. O avanço no estudo do DNA e RNA de microrganismos nos esclarece a origem e o dispersar de várias doenças infecciosas. Descobrimos, então, como estamos globalizando vírus, bactérias e parasitos desde nossa saída da África até os dias atuais. Resumo em inglês Homo sapiens was born with infectious agents that circulated in the common ancestral animal from which both the man and the chimpanzee evolved. We have acquired other microorganisms while still in African territory, in the time of the hunters and gatherers. We have left Africa, have conquered the planet and have become sedentary. We discovered agriculture and animal domestication and, thus, have been invaded by new infectious agents. The microorganisms came along with hum (mais) an locomotion. They were present in the human migrations from Africa, in the military campaigns of Antiquity, in the ocean voyages of discovery, in the colonizations, in the slave trade and so on. The advance in the studies of microorganisms DNA and RNA clarifies the origin and the spread of various infectious diseases. We can then find out how viruses, bacteria and parasites have been globalized since our departure from Africa until the present day.

Scientific Electronic Library Online (Portuguese)

38

Hepatite C aguda no profissional de saúde - revisão a propósito de um caso clínico/ Acute viral hepatitis C in the health care worker - review based on a clinical case

Valente, Cristina; Fernandes, Cláudia; Trindade, Luís
2010-11-01

Resumo em português O vírus da hepatite C (VHC) representa actualmente uma das causas mais importantes de hepatite crónica, cirrose e carcinoma hepatocelular. A hepatite C aguda sintomática manifesta-se em cerca de 10 a 15% dos indivíduos, podendo ocorrer uma resolução espontânea em quase metade dos casos; por outro lado a grande maioria das formas assintomáticas tende a evoluir para a cronicidade. A transmissão do VHC, seguindo-se a uma picada acidental, constitui uma importante pr (mais) eocupação para os Profissionais de Saúde. A monitorização destes profissionais constitui a melhor forma de avaliar a necessidade do tratamento da fase aguda, de forma a prevenir a evolução para formas crónicas. Todos aqueles que mantêm um RNA-VHC positivo à 12ª semana após o acidente são potenciais candidatos ao tratamento. Tem sido claramente demonstrado, em vários estudos, o benefício do tratamento da Hepatite C aguda, atingindo-se taxas de cura de 90 a 95%. Resumo em inglês Hepatitis C virus infection (HCV) is a major cause of chronic hepatitis, cirrhosis and hepatocellular carcinoma. Symptomatic acute hepatitis C occurs in only about 10 - 15% and in these individuals spontaneous clearance happens in almost half of the patients; on the other hand the majority of asymptomatic cases progress to chronicity. HCV transmission following a needle stick is an important threat to health care workers. Monitoring these professionals, is the best way to (mais) provide the rationale for treating them in the acute phase in order to prevent chronic evolution. Those patients who have detectable HCV-RNA at week 12 after exposure are potential candidates to treatment. Several studies have shown that treatment of acute HCV hepatitis is beneficial, achieving rates of success of 90 - 95%.

Scientific Electronic Library Online (Portuguese)

39

Uso de redes neurais artificiais para predição de índices zootécnicos nas fases de gestação e maternidade na suinocultura/ Use of artificial neural networks on the prediction of zootechnical indexes on gestation and farrowing stages of swines

Pandorfi, Héliton; Silva, Iran José Oliveira; Sarnighausen, Valéria Cristina Rodrigues; Vieira, Frederico Márcio Corrêa; Nascimento, Sheila Tavares; Guiselini, Cristiane
2011-03-01

Resumo em português Objetivou-se com este trabalho avaliar a precisão das redes neurais artificiais (RNA) na estimativa das redes neurais artificiais (RNA) na predição de índices zootécnicos, com base em variáveis térmicas e fisiológicas de porcas gestantes. A pesquisa foi realizada entre janeiro e abril de 2005 em uma propriedade de produção industrial de suínos, no setor de gestação, com 27 matrizes primíparas, alojadas em baias individuais e posteriormente na maternidade em (mais) baias de parição, onde foram quantificados os índices de produção dos leitões provenientes do estudo. Para tanto, foi implementada uma RNA backpropagation, com uma camada de entrada, uma oculta e uma camada de saída com funções de transferência tangente sigmoidal. A temperatura do ar e a frequência respiratória foram consideradas variáveis de entrada e o peso ao nascimento dos leitões e número de leitões mumificados, como variáveis de saída. A rede treinada apresentou ótimo poder de generalização, o que possibilitou a predição das variáveis-respostas. A caracterização do ambiente da gestação e maternidade foi adequada se comparada aos dados reais, com poucas tendências de sub ou superestimação de alguns valores. A utilização desse sistema especialista para a previsão dos índices zootécnicos é viável, pois o sistema tem bom desempenho para esta aplicação. Resumo em inglês The objective of this work was to evaluate the precision of Artificial Neural Networks (ANNs) to estimate zootechnical indexes, based on thermal and physiological variables of pregnant sows. This study was carried out from January to April 2005, in a swine industrial production farm in the gestation section with 27 primiparous gilts, allocated in individual pens and after on farrowing pens where it was quantified animal production indexes of piglets from the study. Theref (mais) ore, an ANN backpropagation was implemented, with one input layer, one hidden layer, and one output layer with tangent sigmoidal transference functions. Air temperature and respiratory frequency were considered as input variables and weight of piglet at birth and the number of mummified piglets as output variables. The trained ANN presented a great generalization power, which enabled the prediction of the answer-variables. Characterization of the environment of gestation and maternity was appropriated if compared to the real data, with few under or overestimated tendencies of some values. The use of this specialist system to predict zootechnical indexes is viable because the system shows a good performance for this use.

Scientific Electronic Library Online (Portuguese)

40

Hepatite A/ Hepatitis A

Pereira, Fausto E.L.; Gonçalves, Carlos S.
2003-06-01

Resumo em português A hepatite A é conhecida desde as antigas civilizações chinesa, grega e romana, mas o primeiro relato escrito se deu no século 18. O agente é um picornavírus, do genêro Hepatovírus e o RNA viral possui fita simples. Existem sete genótipos. Nas infecções naturais, os anticorpos das classes IgM e IgA são os mais precoces, aparecendo junto com as primeiras manifestações clínicas, mas podem surgir apenas no final da primeira semana de doença. A infecção pelo (mais) vírus da hepatite A resulta em infecção assintomática, infecção sintomática anictérica, ou em infecção sintomática ictérica. A forma fulminante da hepatite não é freqüente. O diagnóstico etiológico é feito pela pesquisa dos anticorpos anti-VHA da classe IgM, geralmente, pelo método de ELISA. Nenhum medicamento, exceto os sintomáticos, devem ser prescritos. A imunoprofilaxia passiva é feita pela injeção intramuscular de gamaglobulina anti-A e a imunoprofilaxia ativa através da vacinação. Resumo em inglês Hepatitis A infection is known since the ancient Chinese, Greek and Roman civilizations but the first documented report was published in the eighteenth century. The hepatovirus belongs to the Picornaviridae family, and carries a single strand RNA. There are 7 genotypes. Antibodies of the IgM and IgA classes, during natural infections, appear early in the serum, together with the first clinical manifestations of the disease, but they may also appear at the end of the first (mais) week of infection. There is a spectrum of clinical presentation: asymptomatic infection, symptomatic without jaundice and symptomatic jaundiced. A rare fatal form of hepatitis has been described. Diagnosis of the hepatitis A infection is confirmed by the finding of IgM anti-HAV antibodies, routinely performed using an ELISA test. Treatment is supportive. Intramuscular anti-A gamma globulin is used for passive immune prophylaxis, and there is an efficient vaccine for active immune prophylaxis.

Scientific Electronic Library Online (Portuguese)

41

O efeito da restrição calórica na longevidade/ Effect of caloric restriction on longevity

Genaro, Patrícia de Souza; Sarkis, Karin Sedó; Martini, Ligia Araújo
2009-07-01

Resumo em português A restrição calórica (RC) é uma das formas de intervenção nutricional mais amplamente discutida para se estender o tempo de vida em uma variedade de espécies, inclusive seres humanos. A RC parece reduzir a incidência de doenças relacionadas à idade. O mecanismo clássico que poderia explicar o efeito do consumo calórico no envelhecimento está relacionado à redução da gordura corporal e à sinalização da insulina, somada às espécies reativas de oxigênio (mais) produzidas durante a respiração que causam danos oxidativos ao DNA e ao RNA das células, promovendo o processo de envelhecimento e o aumento do risco de doenças. No entanto, o efeito da RC na longevidade em humanos ainda não está bem estabelecido e mais estudos são necessários para que os mecanismos celulares e moleculares responsáveis pelos efeitos terapêuticos da restrição calórica sejam elucidados. Além disso, é necessário diferenciar os efeitos benéficos da restrição calórica daqueles relacionados a hábitos alimentares saudáveis. Resumo em inglês Calorie restriction (CR) is the most evaluated nutritional intervention to increase lifespan in a variety of animal species, including human beings. CR has also been shown to delay the onset or reduce the incidence of many age-related diseases. The mechanism that could explain the effect of calorie intake on aging is related to the reduction of body fat and insulin signaling as well as reactive oxygen species produced during breathing. These phenomena cause oxidative dama (mais) ge to DNA and RNA promoting the process of aging and increasing the risk of illnesses. However, the effect of CR on longevity in human beings is not fully established and further studies are necessary in order to identify the molecular and cellular mechanisms for the therapeutic effect of RC. Moreover, it is necessary to set up the differences between the beneficial effects of caloric restriction from those related to dietary healthy habits.

Scientific Electronic Library Online (Portuguese)

42

Prevalência, fatores de risco e genótipos da hepatite C entre usuários de drogas/ Prevalence, risk factors and genotypes of hepatitis C virus infection among drug users, Central-Western Brazil/ Prevalencia, factores de riesgo y genotipos de la hepatitis C entre usuarios de drogas

Lopes, Carmen L R; Teles, Sheila A; Espírito-Santo, Márcia P; Lampe, Elisabete; Rodrigues, Fabiana P; Motta-Castro, Ana Rita C; Marinho, Thaís A; Reis, Nádia R; Silva, Ágabo M C; Martins, Regina M B
2009-08-01

Resumo em português OBJETIVO: Estimar a prevalência e fatores associados à infecção pelo vírus da hepatite C em usuários de drogas e identificar os genótipos e subtipos virais circulantes. MÉTODOS: Estudo realizado com 691 usuários de drogas de 26 centros de tratamento de uso de drogas filantrópicos, particulares e públicos de Goiânia (GO) e Campo Grande (MS), entre 2005 e 2006. Dados sociodemográficos e fatores de risco para infecção pelo HCV foram obtidos por meio de entrevi (mais) stas. Amostras sangüíneas foram testadas para a detecção de anticorpos para o HCV. As amostras positivas foram submetidas à detecção do RNA-HCV pela reação em cadeia da polimerase com iniciadores complementares às regiões 5' NC e NS5B do genoma viral e genotipadas pelo line probe assay (LiPA) e por seqüenciamento direto, seguido de análise filogenética. Prevalência e odds ratio foram calculados com intervalo de 95% de confiança. Os fatores de risco com p Resumo em espanhol OBJETIVO: Estimar la prevalencia y factores asociados a la infección por el virus de la hepatitis C en usuarios de drogas e identificar los genotipos y subtipos virales circulantes. MÉTODOS: Estudio realizado con 691 usuarios de drogas de 26 centros de tratamiento de uso de drogas filantrópicos, particulares y públicos de Goiania y Campo Grande (Centro-Oeste), entre 2005 y 2006. Datos sociodemográficos y factores de riesgo para infección por el HCV fueron obtenidos (mais) por medio de entrevistas. Muestras sanguíneas fueron evaluadas para la detección de anticuerpos para el HCV. Las muestras positivas fueron sometidas a la detección de RNA-HCV por la reacción en cadena de polimerasa con iniciadores complementarios a las regiones 5' NC y NS5B del genoma viral y genotipadas por el line probe assay (LiPA) y por secuenciación directa, seguido del análisis filogenético. Prevalencia y odds ratio fueron calculados con intervalo de 95% de confianza. Los factores de riesgo con p Resumo em inglês OBJECTIVE: To estimate prevalence of hepatitis C virus (HCV) infection and identify risk factors associated and circulating HCV genotypes and subtypes. METHODS: Study conducted including 691 drug users attending 26 charitable, private and public drug treatment centers in Goiânia and Campo Grande, central-western Brazil, between 2005 and 2006. Sociodemographic characteristics and risk factors for HCV infection were collected during interviews. Blood samples were tested fo (mais) r HCV antibodies (anti-HCV). Positive samples were submitted to HCV RNA detection by PCR with primers complementary to 5' NC and NS5B regions of viral genome and genotyped by line probe assay (LiPA) and direct nucleotide sequencing followed by phylogenetic analysis. The prevalence and odds ratio were calculated with 95% confidence intervals. Risk factors were first estimated in the univariate analysis (p

Scientific Electronic Library Online (Portuguese)

43

Prevalência, fatores de risco e genótipos da hepatite C entre usuários de drogas/ Prevalence, risk factors and genotypes of hepatitis C virus infection among drug users, Central-Western Brazil/ Prevalencia, factores de riesgo y genotipos de la hepatitis C entre usuarios de drogas

Lopes, Carmen L R; Teles, Sheila A; Espírito-Santo, Márcia P; Lampe, Elisabete; Rodrigues, Fabiana P; Motta-Castro, Ana Rita C; Marinho, Thaís A; Reis, Nádia R; Silva, Ágabo M C; Martins, Regina M B
2009-08-01

Resumo em português OBJETIVO: Estimar a prevalência e fatores associados à infecção pelo vírus da hepatite C em usuários de drogas e identificar os genótipos e subtipos virais circulantes. MÉTODOS: Estudo realizado com 691 usuários de drogas de 26 centros de tratamento de uso de drogas filantrópicos, particulares e públicos de Goiânia (GO) e Campo Grande (MS), entre 2005 e 2006. Dados sociodemográficos e fatores de risco para infecção pelo HCV foram obtidos por meio de entrevi (mais) stas. Amostras sangüíneas foram testadas para a detecção de anticorpos para o HCV. As amostras positivas foram submetidas à detecção do RNA-HCV pela reação em cadeia da polimerase com iniciadores complementares às regiões 5' NC e NS5B do genoma viral e genotipadas pelo line probe assay (LiPA) e por seqüenciamento direto, seguido de análise filogenética. Prevalência e odds ratio foram calculados com intervalo de 95% de confiança. Os fatores de risco com p Resumo em espanhol OBJETIVO: Estimar la prevalencia y factores asociados a la infección por el virus de la hepatitis C en usuarios de drogas e identificar los genotipos y subtipos virales circulantes. MÉTODOS: Estudio realizado con 691 usuarios de drogas de 26 centros de tratamiento de uso de drogas filantrópicos, particulares y públicos de Goiania y Campo Grande (Centro-Oeste), entre 2005 y 2006. Datos sociodemográficos y factores de riesgo para infección por el HCV fueron obtenidos (mais) por medio de entrevistas. Muestras sanguíneas fueron evaluadas para la detección de anticuerpos para el HCV. Las muestras positivas fueron sometidas a la detección de RNA-HCV por la reacción en cadena de polimerasa con iniciadores complementarios a las regiones 5' NC y NS5B del genoma viral y genotipadas por el line probe assay (LiPA) y por secuenciación directa, seguido del análisis filogenético. Prevalencia y odds ratio fueron calculados con intervalo de 95% de confianza. Los factores de riesgo con p Resumo em inglês OBJECTIVE: To estimate prevalence of hepatitis C virus (HCV) infection and identify risk factors associated and circulating HCV genotypes and subtypes. METHODS: Study conducted including 691 drug users attending 26 charitable, private and public drug treatment centers in Goiânia and Campo Grande, central-western Brazil, between 2005 and 2006. Sociodemographic characteristics and risk factors for HCV infection were collected during interviews. Blood samples were tested fo (mais) r HCV antibodies (anti-HCV). Positive samples were submitted to HCV RNA detection by PCR with primers complementary to 5' NC and NS5B regions of viral genome and genotyped by line probe assay (LiPA) and direct nucleotide sequencing followed by phylogenetic analysis. The prevalence and odds ratio were calculated with 95% confidence intervals. Risk factors were first estimated in the univariate analysis (p

Scientific Electronic Library Online (Portuguese)

44

Hepatite C/ Hepatitis C

Strauss, Edna
2001-02-01

Resumo em português Estima-se que cerca de 3% da população mundial esteja infectada pelo vírus da hepatite C. Todos os que receberam transfusão de sangue ou seus componentes e os usuários de drogas podem estar infectados. Procedimentos odontológicos, médicos, tatuagem ou acupuntura também constituem fatores de risco. A infecção se cronifica em até 85% dos indivíduos, com evolução assintomática durante anos ou décadas e apresentação clínica variada. Para o diagnóstico, a d (mais) eterminação do anti-VHC revela-se muito sensível e a confirmação se faz pela determinação do RNA-VHC no sangue; o estadiamento da doença e a avaliação da atividade inflamatória pela biópsia hepática. O tratamento objetiva deter a progressão da doença hepática através da inibição da replicação viral. Devido à baixa eficácia terapêutica aliada a importantes efeitos colaterais do interferon e da ribavirina, esses medicamentos encontram indicações e contra-indicações específicas. Vários fatores preditivos de resposta ao tratamento, principalmente a carga viral e o genótipo do VHC, mostram-se úteis na avaliação dos pacientes. Resumo em inglês It has been estimated that 3% of the world population is infected with the hepatitis C virus. Those who are blood product recipients or have been illicit drug users are at risk. Dental and medical procedures as well as tattooing and acupuncture are also risk factors. Chronic infection occurs in up to 85% of infected cases but they may remain without symptoms during years or even decades, and clinical presentation varies. Determination of anti-HCV in sera is a fairly sensi (mais) tive tool for the diagnosis, and confirmation requires the identification of HCV-RNA. Staging of the liver disease as well as definition of its present activity can be graded by liver biopsy. The aim of treatment is to stop the progression of the hepatic disease by inhibiting viral replication. Due to the low therapeutic efficacy combined with important side-effects, the administration of interferon and ribavirin have specific indications and contraindications. Predictive factors of therapeutic response, particularly viral load and genotypes of HCV, are useful in the evaluation of patients.

Scientific Electronic Library Online (Portuguese)

45

Hepatite E/ Hepatitis E

Paraná, Raymundo; Schinoni, Maria Isabel
2002-06-01

Resumo em português O vírus da hepatite E (VHE) é o segundo vírus de transmissão fecal-oral com hepatotropismo confirmado, após o vírus da hepatite A. As grandes epidemias de hepatite das décadas de 50 e 60 na Índia foram causadas pelo VHE. Observaram-se surtos da infecção na África Central, América Latina, Oriente Médio e Repúblicas independentes da ex-União Soviética. O quadro clínico da doença assemelha-se ao de outras hepatites virais. Não há casos descritos de hepati (mais) te E crônicas. Cerca de 20% das mulheres que adquirem a doença durante a gravidez desenvolvem formas graves, com insuficiência hepática fulminante. Confirma-se o diagnóstico quando se encontra no soro anticorpos (método de ELISA) das classes IgM (fase aguda) e/ou IgG (curados). O imunoblot e o PCR-RNA podem ser usados quando necessário. Não há tratamento específico. O uso de imunoglobulina hiperimune tem sido aconselhado por alguns autores. A prevenção se faz pelos cuidados higiênicos e dietéticos habituais. Não há vacina eficaz contra a doença. Resumo em inglês Hepatitis E virus (HEV) is the second most frequent hepatotropic virus transmitted via fecal-oral route, following closely behind hepatitis A virus. The great epidemics of hepatitis described during the 50s and 60s, in India, were caused by this virus. Epidemic bursts have also been described in Central Africa, Latin America, Middle East and in the independent Republics of the ex-Soviet Union. The clinical features of the disease do not differ from those reported for othe (mais) r viral hepatitides. There have been no cases of chronic hepatitis E reported. Around 20% of women infected during pregnancy develop a severe form of hepatitis which courses to liver failure. Diagnosis of hepatitis is confirmed when antibodies (using ELISA) of the IgM class (acute phase) and/or IgG (infected and cured) are found in the serum. Immunoblot and PCR-RNA may be used as necessary. There is no specific treatment for hepatitis E. Hyperimmune serum has been tried by some authors. Prevention is achieved by following the habitual hygienic and dietetic recommendations valid for diseases transmitted by contaminated water. There is no effective vaccine against the disease.

Scientific Electronic Library Online (Portuguese)

46

Fibromialgia e infecção crônica pelo vírus da hepatite C: ausência de associação em duas amostras/ Fibromyalgia and hepatitis C virus chronic infection: lack of association in two samples

Ribeiro, Luiz Severiano; Coelho, Austenir Maciel; Pádua, Ana Flávia Madureira de; Dias, Leandro Lamas; Azevedo, Daniela Castelo; Moura, Fabiana de Miranda; Mendes, Guilherme Santiago; Miranda, Helder Chaia Toledo; Proietti, Fernando Augusto
2007-04-01

Resumo em português OBJETIVO: avaliar a possível associação entre fibromialgia e infecção crônica pelo vírus da hepatite C (VHC). MÉTODOS: estudo transversal com 186 pacientes fibromiálgicas e 55 pacientes com diagnóstico de doenças difusas do tecido conjuntivo (DDTC) não-fibromiálgicas, e em 33 pacientes com infecção crônica pelo VHC e 34 controles sem doenças infecciosas relacionadas ao fígado, todas do sexo feminino e de idade igual ou superior a 18 anos. A fibromialgia (mais) foi diagnosticada segundo os critérios classificatórios do American College of Rheumatology (ACR) de 1990. Infecção crônica pelo VHC foi definida pela presença do RNA do vírus por meio da reação em cadeia da polimerase (PCR). As demais variáveis consideradas para as manifestações extra-hepáticas associadas à infecção crônica compreenderam: fadiga, parestesias, fenômeno de Raynaud, sintomas de boca e/ou olhos secos, depressão e presença de títulos detectáveis de anticorpos antitireoidianos. RESULTADOS: a infecção crônica pelo VHC foi detectada em três pacientes (1,6%) do grupo fibromiálgico e em nenhuma das pacientes com o diagnóstico de DDTC (p = 0,39). A dor musculoesquelética crônica disseminada foi mais prevalente no grupo de pacientes infectadas pelo VHC (45,5%) do que no grupo-controle (26,5%), mas não foi detectada associação entre fibromialgia e infecção crônica pelo VHC (OR = 1,39; IC 95% = 0,43-4,57). Dentre as manifestações extra-hepáticas, apenas os sintomas relativos a boca e/ou olhos secos apresentaram uma associação com a infecção crônica (OR = 6,40; IC 95% = 1,94-21,87). CONCLUSÃO: o estudo não detectou uma associação entre fibromialgia e infecção crônica pelo VHC. Resumo em inglês OBJECTIVE: to evaluate a possible association between fibromyalgia and hepatitis C virus (HCV) chronic infection. METHODS: cross-sectional study comprising 186 fibromyalgic women, 55 non-fibromyalgic controls with a diagnosis of diffuse connective tissue diseases (DCTD), 33 HCV chronically infected women and 34 selected from the gastroenterology outpatient clinic with no liver related infection disease, all aged 18 or older. Fibromyalgia was diagnosed according to the Ame (mais) rican College of Rheumatology (ACR) classification criteria. Chronic HCV infection was defined by detection of HCV-RNA using the polymerase chain reaction (PCR). Other extra-hepatic manifestations comprised: fatigue, paresthesia, Raynaud´s phenomenon, sicca symptoms, depression and detectable thyroid autoantibodies. RESULTS: HCV-RNA was detected in 3 of the 185 fibromyalgic women (1.6%) and in none of the 55 DCTD group (p = 0.39). Chronic widespread musculoskeletal pain was more prevalent in the infected group (45.5%) than in the non-infected (26.5%), but no association was found between fibromyalgia and HCV chronic infection (OR = 1.39; 95% CI = 0.43-4.57). With the regard to other variables, only sicca symptoms were found to be associated with chronic infection (OR = 6.40; 95% CI = 1.94-21.87). CONCLUSION: we found no association between fibromyalgia and chronic HCV infection.

Scientific Electronic Library Online (Portuguese)

47

Utilização de endoperóxidos de derivados de naftaleno como fontes químicas de oxigênio singlete em sistemas biológicos/ Naphthalene endoperoxides as chemical sources of singlet oxygen in biological systems

Martinez, Glaucia R.; Medeiros, Marisa H. G.; Di Mascio, Paolo
2000-10-01

Resumo em inglês Molecular oxygen, in the first excited state (singlet oxygen, ¹O2), has a substantial reactivity towards electron-rich organic molecules, such as biological targets, including unsaturated fatty acids, proteins, RNA and DNA. Considering the complexity of biological systems and the great variety of reactive species generated by photochemistry, efforts have been devoted to develop suitable ¹O2 generators based on the thermolysis of water soluble naphthalene endoperoxides. (mais) These compounds are chemically inert and have been employed as versatile sources of ¹O2. The synthesis is based on structural modifications in position 1,4 of dimethylnaphtalene, grafting hydrophilic substituents. The correspondent endoperoxide can be generated using photochemical method, or molybdate-catalyzed disproportionation of hydrogen peroxide.

Scientific Electronic Library Online (Portuguese)

48

Efeito do alumínio sobre a absorção, o acúmulo e o fracionamento do fósforo em sorgo/ Aluminum effect on uptake, accumulation and fractionation of phosphorus in sorghum

Pereira, Jamil Morais; Cambraia, José; Fonseca Júnior, Élcio Meira da; Ribeiro, Cleberson
2008-12-01

Resumo em português O trabalho teve como objetivo estudar o efeito do Al sobre a absorção, o acúmulo e o fracionamento do P em duas cultivares de sorgo. As plantas foram expostas a níveis tóxicos de Al durante dez dias e, então, colhidas e determinados o crescimento em tamanho e produção de massa seca, os teores de Al e de P total e as diversas formas de P nas duas partes das plantas. Avaliou-se, também, o efeito do Al sobre a absorção de P pelas raízes de plantas intactas. O Al (mais) reduziu o crescimento da raiz seminal e a produção de matéria seca de raízes e parte aérea nas duas cultivares, especialmente na sensível. Os teores de Al e de P total aumentaram nas raízes, mas não foram modificados na parte aérea nas duas cultivares. A absorção de P, entretanto, decresceu na presença de Al nas duas cultivares, principalmente na sensível. O Al, de modo geral, modificou as concentrações das várias formas de P solúvel (Pi e Porg) e insolúvel (P RNA e Presidual), exceto a da forma P LIP. Algumas dessas modificações parecem ser importantes e podem estar relacionadas com o mecanismo de tolerância ao Al em sorgo. Resumo em inglês The objective of this work was to evaluate Al effect on uptake, accumulation and fractionation of P in two sorghum cultivars. Plants were treated with toxic levels of Al during ten days and then they were harvested and growth, dry matter yield, Al and total P contents and concentrations of the various P forms in the two parts of the plants were determined. Aluminum effect on P uptake was also evaluated in intact plants. Aluminum reduced the growth of the seminal root and (mais) dry matter yield in roots and tops of both cultivars, especially in the sensitive one. Aluminum and P contents increased in roots but did not change in the top of both cultivars. Phosphate uptake by roots, however, decreased in the presence of Al in both cultivars, especially in the sensitive one. Aluminum, in general, changed concentrations of all soluble (Pi e Porg) and insoluble P forms (P RNA e Presidual), except of the P LIP form. Some of these modifications seem to be important and may be related to Al tolerance mechanism in sorghum.

Scientific Electronic Library Online (Portuguese)

49

Síndrome antifosfolípide primária e infecções por hepatites B e C/ Primary antiphospholipid syndrome and hepatitis B and C infections

Carvalho, Jozélio Freire de
2009-10-01

Resumo em português OBJETIVO: Avaliar a prevalência de sorologia positiva para hepatites B e C em pacientes com síndrome antifosfolípide (SAF) primária. PACIENTES E MÉTODOS: Estudo transversal de 47 pacientes com SAF primária (critérios de Sapporo). Foram avaliados os dados demográficos, clínicos, medicações e sorologias para hepatites B e C e PCR nos resultados positivos. RESULTADOS: A média de idade da população estudada foi de 38 ± 11 anos, sendo 80,8% do sexo feminino e 68 (mais) % da cor branca. A média de duração da doença foi de 67 ± 61 meses (variando de 1 - 240 meses). Os eventos arteriais foram vistos em 61,7% dos casos, os venosos em 51% e os obstétricos em 38,3%. Cinco (10,6%) pacientes com SAF primária apresentaram sorologia positiva para hepatite B ou C. Desses, três pacientes foram positivos para anti-HBs, com anti-HBc positivo em apenas um deles, e os outros dois foram positivos para hepatite C. A análise da PCR qualitativa não detectou RNA do vírus C em nenhum desses dois pacientes positivos. CONCLUSÃO: Uma pequena percentagem de pacientes com SAF primária apresenta sorologia positiva para hepatites B e C, sendo em todos os casos pós-vacinal ou cicatriz sorológica. Resumo em inglês OBJECTIVE: The objective of the present study was to evaluate the prevalence of hepatitis B and C serology in patients with primary antiphospholipid syndrome (APS). METHODS: This is a transversal study with 47 patients with primary APS (Sapporo's criteria). Demographic and clinical data, medications, and hepatitis B and C serologies, with PCR in positive cases, were evaluated. RESULTS: The study population had a mean age of 38±11 years, 80.8% were females, and 68% Caucas (mais) ian. The mean duration of the disease was 67 ± 61 months (ranging from 1 to 240 months). Arterial events were seen in 61.7% of the patients, venous events in 51%, and obstetric events in 38.3%. Five (10.6%) patients with primary APS had positive serologies for hepatitis B or C. Three of them were positive for anti-HBs, and only one was anti-HBc positive; the other two patients were positive for hepatitis C. Qualitative PCR did not detect hepatitis C viral RNA in neither of the positive patients. CONCLUSION: A small percentage of patients with primary APS had positive serology for hepatitis B and C, and all represented cases post-vaccine or serology scar.

Scientific Electronic Library Online (Portuguese)

50

Diagnóstico de resistência do Mycobacterium tuberculosis à rifampicina utilizando-se da reação em cadeia da polimerase/ Diagnostic of rifampicin-resistance of Mycobacterium tuberculosis by polymerase chain reaction

Carvalho, Wânia da Silva; Miranda, Silvana Spíndola de; Pesquero, Jorge Luiz; Gomes, Maria Aparecida
2007-03-01

Resumo em português A resistência do Mycobacterium tuberculosis aos tuberculostáticos tem surgido como grande ameaça à Saúde Pública. A resistência à rifampicina pode ser considerada como um marcador para a multi-resistência a fármacos e tem sido atribuída a mudanças estruturais da RNA polimerase, produto de expressão do gene rpoB. Os pacientes portadores dessas cepas têm baixa perspectiva frente ao tratamento. Os testes convencionais de sensibilidade aos fármacos realizados e (mais) m cultura do Mtb requerem várias semanas para o crescimento. Por este motivo, a Reação em Cadeia da Polimerase (PCR), método de baixo custo e que pode reduzir o tempo para o diagnóstico, representa alternativa viável e promissora. Neste artigo estão descritos os métodos mais comumente empregados na detecção de mutantes resistentes à rifampicina baseados na PCR, como análise de Polimorfismo Conformacional de Fita Simples (Single-Strand Conformation Polymorphism, SSCP), PCR Heteroduplex e INNO-LIPA. Recentemente, padronizou-se a técnica de PCR em baixa estringência, usando um único iniciador (Low Stringency Single Specific Primer, LSSP), que se mostrou um método rápido e sensível na detecção de mutações no gene rpoB. Resumo em inglês The resistance of Mycobacterium tuberculosis to tuberculostatic drugs has emerged as a major public health threat. The resistance to rifampicin which has been attributed to structural changes in RNA polymerase can be considered as a marker for multi-drug-resistance to tuberculosis (MDR-TB). Patients bearing rifampicin-resistant strains have poor diagnosis even with treatment. Conventional culture-based drug sensibility testing can require several weeks due to the growth. (mais) In this paper we describe the most common PCR-based methods for detection of mutations that lead to rifampicin resistance, such as Single-Strand Conformation Polymorphism (SSCP), PCR Heteroduplex and INNO-LIPA. Recently, by Low Stringency using a Single Specific Primer (LSSP) assay, it was standardized a protocol that showed to be rapid and sensitive for the detection of mutations in the rpoB gene.

Scientific Electronic Library Online (Portuguese)

51

Aumento da expressão do proto-oncogene ras no bócio multinodular: possível envolvimento na patogênese/ Proto-oncogene ras expression in multinodular goiter

Golbert, Lenara; Kolling, João Henrique; Leitão, Aline H.; Posser, Mirele; Lobato, Rafael; Maia, Ana Luiza
2003-12-01

Resumo em português A transformação neoplásica resulta de uma série de alterações genéticas, envolvendo ativação de proto-oncogenes e inativação de genes supressores tumorais. Ativação do proto-oncogene ras por mutações em ponto é a alteração genética mais freqüente em tumores espontâneos da tireóide. Avaliamos a expressão do gene ras no bócio nodular. Fragmentos de tecido tireoidiano normal e neoplásico foram coletados durante o ato cirúrgico, sendo que 79 paciente (mais) s tiveram diagnóstico histopatológico de bócio colóide e foram incluídos no estudo. O RNA total foi extraído pelo método de Trizol e o cDNA sintetizado através do Reverse Trancriptidase. Os genes H-ras e K-ras foram amplificados através de PCR com primers específicos. Do total da amostra, 62% apresentaram aumento da expressão de um dos genes ras estudados. Evidenciou-se aumento da expressão do H-ras em 9 dos 29 (31%) casos e do K-ras em 12 dos 32 (37,5%) tumores estudados. Os resultados demonstraram aumento da expressão do ras na doença nodular da tireóide e sugerem um papel importante desses genes na transformação neoplásica da tireóide. Resumo em inglês Neoplastic transformation results from a series of genetic alterations involving activation of protooncogenes and inactivation of tumor suppressor genes. Activation of ras protooncogenes by point mutation is the most frequent genetic alteration in spontaneous thyroid neoplasias. The goal of this study was to evaluate ras gene expression in the nodular goiter. Seventy-nine patients submitted to thyroidectomy and with a histological diagnosis of nodular goiter were included (mais) in the study. Tissues were obtained from both tumor and normal thyroid during surgery and frozen in liquid N2. Total RNA was isolated using TRIzol reagent and the cDNA was synthesized by reverse transcription. Twenty-one of the 34 (62%) nodules showed elevated expression of at least one of the ras genes studied. H-ras exhibited overexpression in 9 of 29 (31%) and K-ras in 12 of 32 (37.5%) tumor samples examined. Our results showed ras over expression in nodular disease, with different pattern of expression between H and K-ras genes, suggesting that control of these proto-oncogenes expression might play an important role on neoplastic transformation in thyroid cells.

Scientific Electronic Library Online (Portuguese)

52

A tristeza dos citros e suas implicações no melhoramento genético de porta-enxertos/ The citrus tristeza disease and its implications on rootstock improvement

Bordignon, Rita; Medina Filho, Herculano Penna; Muller, Gerd Walter; Siqueira, Walter José
2003-01-01

Resumo em português O Brasil é o maior produtor mundial de citros e, historicamente, a tristeza, a doença de maior importância econômica da cultura. Causada por um closterovirus (CTV) de RNA fita simples positiva, encontra-se disseminada por quase todas as regiões citrícolas do globo. Transmitida por enxertia e algumas espécies de pulgão, principalmente Toxoptera citricida, apresenta diversas estirpes, causando sintomas variados em Citrus e afins. Proteção cruzada de copas sensíve (mais) is através de estirpes fracas do vírus é uma eficiente técnica de controle desenvolvida no Brasil e utilizada em várias partes do mundo. Métodos de detecção e caracterização do vírus baseiam-se nos sintomas de variedades e clones específicos, mas, métodos sorológicos e moleculares são empregados também no monitoramento da expansão da doença. As plantas, não raro, são infectadas com mais de uma estirpe, que se podem recombinar geneticamente e são passíveis de transmissibilidade diferencial pelos vetores ou por diferentes borbulhas da mesma planta. A composição do complexo de estirpes presente na planta pode alterar-se após poda drástica, ou em resposta a condições ambientais. Tipos menores de RNA defectivos e subgenômicos ocorrem freqüentemente junto às partículas normais do CTV. Alguns defectivos estão associados aos sintomas de amarelecimento de plântulas. O controle da doença é feito pelo uso de variedades de copas e de porta-enxertos que interagem conforme a capacidade de multiplicar as partículas virais em suas células e de tolerar sua presença nos tecidos do floema. Essas características têm importantes implicações para o cultivo e melhoramento. A presente revisão discute também as reações de plantas enxertadas e de pé-franco, ressalta os problemas, conceitos básicos e as implicações relevantes para o melhoramento genético de porta-enxertos. Resumo em inglês Brazil is the world leading citrus producer and historically, tristeza is the most serious disease in economic importance. Tristeza is caused by a single strand RNA closterovirus, Citrus Tristeza Virus (CTV), is disseminated in almost all citrus regions of the world. It is transmitted by grafting and by several species of aphids mainly Toxoptera citricida. There are several virus strains, causing variable symptoms in the majority of species and related genera of Citrus. C (mais) ross-protection by mild virus strains is an efficient technique for protecting very sensitive scions in Brazil and elsewhere. Methods for detecting and characterizing virus strains are classically based on the reaction symptoms of specific varieties and clones. However, development of serological and molecular methods have allowed progress in the characterization and in monitoring the spread of the disease. Plants may be infected with more than one strain that can undergo genetic recombination, show differential transmissibility by the vector aphids, have composition of the strain complex altered by drastic pruning, temperature, and also segregate among budwoods, or by sub-culture in different clones. Smaller defective RNAs are often associated with normal CTV particles, some correlated with symptoms of seedling yellows. Efficient control is achieved by favorable combinations of scions and rootstocks. They react in predictable interactions dependent on both, the capability to multiply the viruses and to tolerate their presence in phloem tissues. These peculiarities have important implications on practical cultivation and on the genetic improvement of scions and rootstocks. This review discuss also the reaction of grafted and non-grafted plants, and highlights problems, basic concepts and relevant implications for citrus rootstock improvement.

Scientific Electronic Library Online (Portuguese)

53

Prevalência elevada de hepatite C no distrito de Botafogo, cidade de Bebedouro, interior do Estado de São Paulo, Brasil, 2007/ High prevalence of hepatitis C in the district of Botafogo, municipality of Bebedouro, São Paulo State, Brazil, 2007

Ferrão, Sabrina de Brito Ramalho Luz; Figueiredo, José Fernando de Castro; Yoshida, Clara Fumiko Tachibana; Passos, Afonso Dinis Costa
2009-02-01

Resumo em português O objetivo deste artigo foi estimar a prevalência de hepatite C nos moradores de Botafogo, distrito de Bebedouro, São Paulo, Brasil, e estudar possíveis fatores associados. Em cada domicílio foi sorteado um indivíduo com idade mínima de 18 anos, submetido a um questionário que levantava variáveis sócio-demográficas e fatores associados à infecção por hepatite C. Ao mesmo tempo, foi coletada uma amostra de sangue para realização de exames imunoenzimáticos. (mais) As amostras positivas ao anti-HCV foram submetidas à detecção do RNA viral. A prevalência de hepatite C encontrada foi 8,8% (IC95%: 5,8-11,7) e as variáveis preditoras independentes para o risco de infecção foram: sexo masculino, tempo de residência no local superior a trinta anos e uso de medicações parenterais com material não descartável, esterilizado com técnica de fervura. A prevalência elevada de infecção pela hepatite C nessa população relativamente isolada, de características rurais, parece ser resultado de exposições pregressas a injeções com material não adequadamente esterilizado, com algumas evidências apontando para a possibilidade de envolvimento de um antigo farmacêutico prático, que centralizava a aplicação desses produtos e era possivelmente um portador crônico da infecção. Resumo em inglês This article aimed to estimate the prevalence of hepatitis C in Botafogo, a district of Bebedouro, São Paulo State, Brazil, and investigate possible risk factors. One individual over 18 years of age was selected from each household to answer a questionnaire on socio-demographic variables and factors associated with hepatitis C. Blood samples were also drawn for immunoenzymatic tests. Positive HCV-antibody samples were submitted to viral RNA detection. HCV prevalence was (mais) 8.8% (95%CI: 5.8-11.7), and independent variables associated with risk of infection were: male gender, time of local residence > 30 years, and history of injected medication using non-disposable material, sterilized by boiling. The high prevalence of hepatitis C infection in this relatively isolated rural population appears to result from previous exposure to injections with inadequately sterilized material, with some evidence suggesting a specific elderly pharmacy employee who customarily applied such injections and may have been a chronic HCV carrier.

Scientific Electronic Library Online (Portuguese)

54

Prevalência elevada de hepatite C no distrito de Botafogo, cidade de Bebedouro, interior do Estado de São Paulo, Brasil, 2007/ High prevalence of hepatitis C in the district of Botafogo, municipality of Bebedouro, São Paulo State, Brazil, 2007

Ferrão, Sabrina de Brito Ramalho Luz; Figueiredo, José Fernando de Castro; Yoshida, Clara Fumiko Tachibana; Passos, Afonso Dinis Costa
2009-02-01

Resumo em português O objetivo deste artigo foi estimar a prevalência de hepatite C nos moradores de Botafogo, distrito de Bebedouro, São Paulo, Brasil, e estudar possíveis fatores associados. Em cada domicílio foi sorteado um indivíduo com idade mínima de 18 anos, submetido a um questionário que levantava variáveis sócio-demográficas e fatores associados à infecção por hepatite C. Ao mesmo tempo, foi coletada uma amostra de sangue para realização de exames imunoenzimáticos. (mais) As amostras positivas ao anti-HCV foram submetidas à detecção do RNA viral. A prevalência de hepatite C encontrada foi 8,8% (IC95%: 5,8-11,7) e as variáveis preditoras independentes para o risco de infecção foram: sexo masculino, tempo de residência no local superior a trinta anos e uso de medicações parenterais com material não descartável, esterilizado com técnica de fervura. A prevalência elevada de infecção pela hepatite C nessa população relativamente isolada, de características rurais, parece ser resultado de exposições pregressas a injeções com material não adequadamente esterilizado, com algumas evidências apontando para a possibilidade de envolvimento de um antigo farmacêutico prático, que centralizava a aplicação desses produtos e era possivelmente um portador crônico da infecção. Resumo em inglês This article aimed to estimate the prevalence of hepatitis C in Botafogo, a district of Bebedouro, São Paulo State, Brazil, and investigate possible risk factors. One individual over 18 years of age was selected from each household to answer a questionnaire on socio-demographic variables and factors associated with hepatitis C. Blood samples were also drawn for immunoenzymatic tests. Positive HCV-antibody samples were submitted to viral RNA detection. HCV prevalence was (mais) 8.8% (95%CI: 5.8-11.7), and independent variables associated with risk of infection were: male gender, time of local residence > 30 years, and history of injected medication using non-disposable material, sterilized by boiling. The high prevalence of hepatitis C infection in this relatively isolated rural population appears to result from previous exposure to injections with inadequately sterilized material, with some evidence suggesting a specific elderly pharmacy employee who customarily applied such injections and may have been a chronic HCV carrier.

Scientific Electronic Library Online (Portuguese)

55

Co-infecção por HIV/HCV em hospital universitário de Recife, Brasil/ HIV/HCV coinfection at an university hospital in Recife, Brazil/ Coinfección por HIV/HCV en hospital universitario de Recife, Brasil

Carvalho, Flávia Helena Pontes de; Coêlho, Maria Rosângela Cunha Duarte; Vilella, Tatiana de Aguiar Santos; Silva, Jéfferson Luis Almeida; Melo, Heloísa Ramos de Lacerda
2009-02-01

Resumo em português OBJETIVO: Estimar a prevalência do vírus da hepatite C (HCV) e fatores de risco associados com a co-infecção em pessoas soropositivas para HIV. MÉTODOS: Estudo do tipo transversal, descritivo e analítico, com 343 portadores do HIV atendidos em um hospital universitário de Recife (PE), no período de março a dezembro de 2003. Os pacientes foram submetidos a um questionário padronizado sobre os fatores de risco. Nas amostras de soro foram pesquisados o anti-HCV pel (mais) o ELISA, o HCV-RNA por meio da RT-PCR e a identificação dos genótipos foi realizada no equipamento ABI377 (PE Biosystems®). As análises estatísticas utilizadas foram a univariada, a multivariada e a regressão logística múltipla. RESULTADOS: A prevalência encontrada para o HCV foi de 4,1% (14/343) pelo ELISA e de 3,2 % (11/343) quando utilizada a RT-PCR. Os genótipos mais freqüentes foram 1b (45%), 3 (33%) e 1a (22%). A faixa etária com maior proporção de co-infectados foi a de 30 a 39 anos, com predomínio do sexo masculino (64,3%). Após regressão logística múltipla, apenas a variável transfusão sangüínea permaneceu como fator de risco para o HCV (OR=4,28; IC 95%: 1,44;12,73). CONCLUSÕES: A prevalência da co-infecção HIV/HCV foi baixa, a transfusão sangüínea foi um fator de risco e o genótipo 1b do HCV foi o mais freqüente. Resumo em espanhol OBJETIVO: Estimar la prevalencia de virus de hepatitis C (HCV) y factores de riesgo asociados con la coinfección en personas seropositivas para HIV. MÉTODOS: Estudio de tipo transversal, descriptivo y analítico, con 343 portadores de HIV atendidos en un hospital universitario de Recife (Noreste de Brasil), en el período de marzo a diciembre de 2003. Los pacientes fueron sometidos a un cuestionario estandarizado sobre los factores de riesgo. En las muestras de suero fu (mais) eron pesquisados el anti-HCV por ELISA, el HCV-RNA por medio de la RT-PCR y la identificación de los genotipos fue realizada en el equipo ABI377 (PE Biosystems®). Los análisis estadísticos utilizados fueron la univariada, la multivariada y la regresión logística múltiple. RESULTADOS: La prevalencia encontrada para el HCV fue de 4,1% (14/343) por ELISA y de 3,2% (11/343) por RT-PCR. Los genotipos mas frecuentes fueron 1b (45%), 3 (33%) y 1a (22%). El rango de edad con mayor proporción de coinfectados fue la de 30-39 años, con predominio del sexo masculino (64,3%). Posterior a la regresión logística múltiple, sólo la variable transfusión sanguínea permaneció como factor de riesgo para el HCV (OR=4,28; IC 95%: 1,44; 12,73). CONCLUSIONES: La prevalencia de la coinfección HIV/HCV fue baja, la transfusión sanguínea fue un factor de riesgo y el genotipo 1b de HCV fue el más frecuente. Resumo em inglês OBJECTIVE: To estimate the prevalence of hepatitis C virus (HCV) infection and risks factors associated with coinfection in HIV-positive individuals. METHODS: A cross-sectional descriptive study was conducted with 343 HIV patients attended at a university hospital in Recife, Northeastern Brazil, from March to December 2003. A standardized questionnaire about risk factors was administered. Serum samples were analyzed for anti-HCV antibodies using enzyme-linked immunosorben (mais) t assay (ELISA), HCV-RNA using reverse transcription-polymerase chain reaction (RT-PCR), and genotyping using the ABI 377 (PE Biosystems®). Univariate and multivariate analyses and multiple logistic regression were performed. RESULTS: HCV prevalence was 4.1% (14/343) using ELISA and 3.2% (11/343) using RT-PCR. The most common genotypes were 1b (45%), 3 (33%) and 1a (22%). Co-infection was higher among those aged 30 to 39 years, and predominantly in males (64.3 %). In the multiple logistic regression, the variable blood transfusion was the single remaining risk factor for HCV (OR=4.28; 95% CI 1.44;12.73). CONCLUSIONS: The prevalence of HIV/HCV coinfection was low. Blood transfusion was a risk factor and HCV genotype 1b was the most frequently found.

Scientific Electronic Library Online (Portuguese)

56

Co-infecção por HIV/HCV em hospital universitário de Recife, Brasil/ HIV/HCV coinfection at an university hospital in Recife, Brazil/ Coinfección por HIV/HCV en hospital universitario de Recife, Brasil

Carvalho, Flávia Helena Pontes de; Coêlho, Maria Rosângela Cunha Duarte; Vilella, Tatiana de Aguiar Santos; Silva, Jéfferson Luis Almeida; Melo, Heloísa Ramos de Lacerda
2009-02-01

Resumo em português OBJETIVO: Estimar a prevalência do vírus da hepatite C (HCV) e fatores de risco associados com a co-infecção em pessoas soropositivas para HIV. MÉTODOS: Estudo do tipo transversal, descritivo e analítico, com 343 portadores do HIV atendidos em um hospital universitário de Recife (PE), no período de março a dezembro de 2003. Os pacientes foram submetidos a um questionário padronizado sobre os fatores de risco. Nas amostras de soro foram pesquisados o anti-HCV pel (mais) o ELISA, o HCV-RNA por meio da RT-PCR e a identificação dos genótipos foi realizada no equipamento ABI377 (PE Biosystems®). As análises estatísticas utilizadas foram a univariada, a multivariada e a regressão logística múltipla. RESULTADOS: A prevalência encontrada para o HCV foi de 4,1% (14/343) pelo ELISA e de 3,2 % (11/343) quando utilizada a RT-PCR. Os genótipos mais freqüentes foram 1b (45%), 3 (33%) e 1a (22%). A faixa etária com maior proporção de co-infectados foi a de 30 a 39 anos, com predomínio do sexo masculino (64,3%). Após regressão logística múltipla, apenas a variável transfusão sangüínea permaneceu como fator de risco para o HCV (OR=4,28; IC 95%: 1,44;12,73). CONCLUSÕES: A prevalência da co-infecção HIV/HCV foi baixa, a transfusão sangüínea foi um fator de risco e o genótipo 1b do HCV foi o mais freqüente. Resumo em espanhol OBJETIVO: Estimar la prevalencia de virus de hepatitis C (HCV) y factores de riesgo asociados con la coinfección en personas seropositivas para HIV. MÉTODOS: Estudio de tipo transversal, descriptivo y analítico, con 343 portadores de HIV atendidos en un hospital universitario de Recife (Noreste de Brasil), en el período de marzo a diciembre de 2003. Los pacientes fueron sometidos a un cuestionario estandarizado sobre los factores de riesgo. En las muestras de suero fu (mais) eron pesquisados el anti-HCV por ELISA, el HCV-RNA por medio de la RT-PCR y la identificación de los genotipos fue realizada en el equipo ABI377 (PE Biosystems®). Los análisis estadísticos utilizados fueron la univariada, la multivariada y la regresión logística múltiple. RESULTADOS: La prevalencia encontrada para el HCV fue de 4,1% (14/343) por ELISA y de 3,2% (11/343) por RT-PCR. Los genotipos mas frecuentes fueron 1b (45%), 3 (33%) y 1a (22%). El rango de edad con mayor proporción de coinfectados fue la de 30-39 años, con predominio del sexo masculino (64,3%). Posterior a la regresión logística múltiple, sólo la variable transfusión sanguínea permaneció como factor de riesgo para el HCV (OR=4,28; IC 95%: 1,44; 12,73). CONCLUSIONES: La prevalencia de la coinfección HIV/HCV fue baja, la transfusión sanguínea fue un factor de riesgo y el genotipo 1b de HCV fue el más frecuente. Resumo em inglês OBJECTIVE: To estimate the prevalence of hepatitis C virus (HCV) infection and risks factors associated with coinfection in HIV-positive individuals. METHODS: A cross-sectional descriptive study was conducted with 343 HIV patients attended at a university hospital in Recife, Northeastern Brazil, from March to December 2003. A standardized questionnaire about risk factors was administered. Serum samples were analyzed for anti-HCV antibodies using enzyme-linked immunosorben (mais) t assay (ELISA), HCV-RNA using reverse transcription-polymerase chain reaction (RT-PCR), and genotyping using the ABI 377 (PE Biosystems®). Univariate and multivariate analyses and multiple logistic regression were performed. RESULTS: HCV prevalence was 4.1% (14/343) using ELISA and 3.2% (11/343) using RT-PCR. The most common genotypes were 1b (45%), 3 (33%) and 1a (22%). Co-infection was higher among those aged 30 to 39 years, and predominantly in males (64.3 %). In the multiple logistic regression, the variable blood transfusion was the single remaining risk factor for HCV (OR=4.28; 95% CI 1.44;12.73). CONCLUSIONS: The prevalence of HIV/HCV coinfection was low. Blood transfusion was a risk factor and HCV genotype 1b was the most frequently found.

Scientific Electronic Library Online (Portuguese)

57

Análise microscópica do miocárdio ventricular esquerdo em cães soropositivos para cinomose/ Microscopic analysis of the left ventricular myocardium in positive serum dogs to distemper disease

Rezende, Rodrigo S. de; Coelho, Humberto E.; Kamimura, Regis; Severino, Renato S.; Oliveira, Pedro C.L. de; Medeiros, Alessandra A.; Magalhães, Aline O.C.
2009-02-01

Resumo em português Classificado no gênero Morbillivirus da família Paramixoviridae, o vírus da cinomose possui RNA de fita simples de polaridade negativa, é causador de doença multissistêmica, altamente contagiosa e grave dos cães e carnívoros selvagens, e com elevado índice de mortalidade em animais não vacinados ou com falhas vacinais. Com o objetivo de avaliar as alterações histopatológicas no coração, particularmente na região do miocárdio ventricular esquerdo, de cães (mais) naturalmente infectados com o vírus da cinomose, foram estudados 35 animais, de ambos os sexos e com idades variadas. Das 35 amostras enviadas ao Laboratório de Medicina Veterinária Preventiva do Hospital Veterinário de Uberaba, 100% (35/35) mostrou-se soropositivas para a cinomose (técnica de imunoensaio em fase sólida) e tiveram no miocárdio ventricular esquerdo as seguintes alterações histopatológicas: miocardite, degeneração hialina, hiperemia e hemorragia, com 42,8% (15/35), 31,4% (11/35), 14,3% (5/35) e 11,4% (4/35), respectivamente. Tendo utilizado o teste Qui-Quadrado com nível de significância de 0,05, conclui-se que existe alta correlação (p=0,02) entre os animais infectados com o vírus da cinomose e as alterações histopatológicas observadas no miocárdio ventricular esquerdo. Resumo em inglês Classified pertaining to the genus Morbillivirus of the Paramyxoviridae family, the canine distemper virus is a RNA single-stranded virus with negative polarity and causes a multisystemic disease, serious and highly contagious for dogs and wild carnivores, with a high mortality rate in non-vaccinated animals or with vaccine fails. With the objective to evaluate heart histopathological alterations, particularly in the left ventricular myocardium, in dogs naturally infected (mais) with canine distemper virus, 35 dogs, males and females of different ages, were studied. All the 35 samples sent to the Veterinary Hospital of Uberaba were serum-positive for distemper (immunoassay technique in solid phase) and had in the left ventricular myocardium the following histopathologic alterations: myocarditis, hyalin degeneration, hyperemia and hemorrhage, in 42.8% (15/35), 31.4% (11/35), 14.3% (5/35) and 11.4% (4/35), respectively. Having carried out the Qui-Quadrado test with a significancy level of 0.05, it can be concluded that there is a high correlation (p=0.02) between the infected animals with canine distemper virus and histopathological alterations found in the left ventricular myocardium.

Scientific Electronic Library Online (Portuguese)

58

Desenvolvimento intestinal de bezerros recém-nascidos aleitados com colostro de vacas tratadas com rbST/ Intestinal development of new-born calves fed colostrum of cows treated with rbST

Bagaldo, Adriana Regina; Pauletti, Patricia; Delgado, Eduardo Francisquine; Lanna, Dante Pazzanese Duarte; Kindlein, Liris; Machado Neto, Raul
2007-08-01

Resumo em português Com o objetivo de avaliar o efeito de diferentes níveis de IGF-I sobre os indicadores de atividade celular hepática e intestinal em bezerros recém-nascidos, 42 vacas holandesas gestantes foram aleatoriamente distribuídas em dois grupos. O grupo rbST recebeu hormônio de crescimento (500 mg rbST) e o grupo controle recebeu injeção de vitamina E. As aplicações se iniciaram aos 35 dias pré-parto e foram repetidas a cada 14 dias até o parto. Os recém-nascidos foram (mais) distribuídos aleatoriamente nas seguintes idades de abate: após o nascimento e sem a ingestão de colostro; e 2 e 7 dias de vida com ingestão de colostro das respectivas mães. O delineamento experimental utilizado foi o inteiramente casualizado, em estrutura fatorial 2 x 3, correspondendo aos grupos das mães e às idades dos bezerros. Amostras do fígado, do jejuno e do íleo foram coletadas. Os bezerros do grupo rbST apresentaram, no jejuno, menores níveis de DNA e proteína aos 7 dias de vida, enquanto a concentração de proteína nesse grupo aumentou aos 2 dias de vida. Esse efeito também foi observado na relação proteína/RNA. No grupo controle, o aumento de proteína foi verificado no 7º dia. Os indicadores de atividade celular analisados sugerem que o IGF-I adicional no colostro de vacas tratadas com rbST teve participação na maturação celular intestinal dos bezerros, sendo determinante no comportamento da primeira geração de enterócitos. Resumo em inglês With the objective of evaluating different levels of IGF-I on the hepatical and intestinal indicators of cellular activity in newborn calves, 42 pregnant Holstein cows were randomly assigned to two groups: a) control: injection of vitamin E or b) rbST: injection of growth hormone (rbST). Injections started 35 days pre-partum and were repeated every 14 days until parturition. Newborn calves were randomly assigned to a 2 x 3 factorial arrangement of treatments (two mother g (mais) roups and three different ages). After slaughter, samples from liver, jejunum and ileum were collected. Calves from rbST group showed lower levels of DNA and protein in jejunum at seven days of age, while protein concentration increased at two days of age. Similar response was observed for the ratio of protein/RNA in jejunum. In the control group, the increase in protein concentration was observed in the seventh day of age. The indicators of cellular activity measured in this trial suggested that greater IGF-I concentration in colostrum of rbST treated cows promoted intestinal cellular maturation by affecting behavior of first generation enterocytes.

Scientific Electronic Library Online (Portuguese)

59

Perfil de citocinas da polipose nasossinusal na Fibrose Cística comparado com indivíduos sem doenças nasossinusais/ Cytokine profile in subjects with Cystic Fibrosis and nasal polyposis compared to patients with no nasal disorders

Nunes, Flávio Barbosa; Castro, Mirian Cabral Moreira de; Silva, Tacimara Moreira da; Araújo, Ricardo Nascimento; Becker, Helena Maria Gonçalves; Crosara, Paulo Fernando Tormin Borges; Guimarães, Roberto Eustáquio Santos
2010-02-01

Resumo em português Embora o perfil das citocinas na polipose nasossinusal seja bem documentado, pouco se sabe sobre estas proteínas quando associadas à Fibrose Cística. OBJETIVOS: Avaliar a expressão das citocinas IL¬4, IL¬5, IL¬6, IL¬8, GM¬C-SF e IFN--y analisada pela RT¬-PCR, nos pólipos de pacientes com Fibrose Cística. MATERIAL E MÉTODO: Estudo transversal, prospectivo, de 24 pacientes, 13 com Fibrose Cística e polipose nasossinusal (Grupo Fibrose Cística) e 11 com exame (mais) otorrinolaringológico normal (Grupo Controle). A média de idade foi de 21 anos (3¬-57), 12 eram do sexo masculino e 12 do sexo feminino. O perfil das citocinas foi pesquisado nos fragmentos de mucosa (Grupo Controle) ou pólipo nasal (Grupo Fibrose Cística) através da RT-¬PCR. Foram estudadas as transcrições para as citocinas IL¬4, IL¬5, IL¬6, IL¬8, IFN¬y e GM¬-CSF ajustadas pelo valor da β¬ actina. RESULTADOS: As interleucinas 5, 6, 8 e GM¬-CSF foram semelhantes nos dois grupos (p>0,05). Menores valores de IFNy¬ (p=0,03) e forte tendência de aumento de IL¬4 (p=0,06) foram observados no grupo Fibrose Cística. CONCLUSÃO: As células inflamatórias e estruturais podem produzir RNA mensageiro para IL¬4, bloqueando a produção de outras citocinas com IFN-y¬, sugerindo a participação destes mecanismos na formação dos pólipos da Fibrose Cística. Resumo em inglês Although the cytokine profile in nasal polyposis is well documented, little is known about cytokines associated to cystic fibrosis. AIM: Assess the expression of cytokines IL¬4, IL¬5, IL¬6, IL¬8, GM¬-CSF and IFN¬-y, analyzed through RT-PCR, in the polyps of patients with cystic fibrosis. MATERIALS AND METHODS: A cross-sectional, prospective study was carried out with 24 patients, 13 of whom had cystic fibrosis and nasal polyposis (Cystic Fibrosis Group) and 11 had n (mais) ormal otorhinolaryngological exams (Control Group). The average age was 21 years (3¬57); 12 participants were males and 12 were females. The cytokine profile was studied in mucosal fragments (Control Group) or nasal polyps (Cystic Fibrosis Group) through RT¬PCR. Transcriptions were studied for cytokines IL¬4, IL¬5, IL¬6, IL¬8, IFN¬y and GM¬CSF, adjusted for the β¬-actin value. RESULTS: Interleukins 5, 6, 8 and GM¬CSF were similar in both groups (p>0.05). There were lower values of IFN-y¬ (p=0.03) and a strong tendency toward an increase in IL¬4 (p=0.06) in the Cystic Fibrosis Group. CONCLUSION: Inflammatory and structural cells may produce messenger RNA for IL¬4, blocking the production of other cytokines such as IFN-y, suggesting the participation of this mechanism in the formation of polyps in cystic fibrosis.

Scientific Electronic Library Online (Portuguese)

60

Lesões histológicas no sistema nervoso central de cães com encefalite e diagnóstico molecular da infecção pelo vírus da cinomose canina/ Histopathological lesions in the central nervous system of dogs with encephalitis and molecular diagnosis of canine distemper virus infection

Gebara, C.M.S.; Wosiacki, S.R.; Negrão, F.J.; Alfieri, A.A.; Alfieri, A.F.
2004-04-01

Resumo em português Dez amostras de urina de cães que apresentavam sinais clínicos sistêmicos e neurológicos indicativos da infecção pelo vírus da cinomose canina (CDV) foram analisadas pela técnica da reação em cadeia pela polimerase precedida de transcrição reversa (RT-PCR) para a detecção do RNA do CDV. O exame histopatológico foi realizado em fragmentos de cérebro, cerebelo e bexiga. Como controle negativo foram colhidos fragmentos de órgãos e urina de quatro cães sem (mais) sinais clínicos de doença infecciosa e que morreram por outras causas. Todos os cães (9/10) positivos em RT-PCR apresentaram alterações histológicas no cérebro e cerebelo, características de encefalite aguda (5/9) ou crônica (4/9) compatíveis com as causadas pelo CDV. Um dos cães com alterações clínicas neurológicas semelhantes às observadas em cinomose foi negativo na RT-PCR e apresentou alterações histopatológicas inespecíficas. Nas amostras de bexiga não foram observadas lesões histológicas. Todas as amostras biológicas provenientes dos cães-controle foram negativas na RT-PCR (urina) e não apresentaram alterações histológicas (fragmentos de órgãos). O trabalho evidenciou a especificidade da RT-PCR no diagnóstico precoce e ante mortem na infecção pelo CDV. Resumo em inglês The reverse transcription-polymerase chain reaction (RT-PCR) was used to detect canine distemper virus (CDV) RNA in 10 urine samples from dogs that had died with clinical systemic and neurological signs indicative of CDV infection. Brain, cerebellum and urinary bladder fragments were collected for histopathological examination. For the negative control, urine and organ fragments were collected at necropsy from four dogs without clinical symptoms of infectious diseases tha (mais) t had died from other causes. The dogs positives in RT-PCR (9/10) presented histological lesions in the brain and cerebellum characteristic of acute (5/9) or chronic (4/9) encephalitis compatible with those caused by CDV. One of the dogs with neurological signs similar to those observed in canine distemper was negative in RT-PCR and presented non-specific histopathological alterations that could be associated to others nervous system diseases. Although the RT-PCR detected the CDV in urine of nine dogs with clinical signs of distemper, no histopathological alterations were observed in any of the urinary bladder samples. All the biological samples from the control dogs were negative in RT-PCR and did not present any histopathological alterations in organ. Besides describing the most characteristic histopathological lesion found in the central nervous system of dogs with acute and chronic encephalitis due to canine distemper, this study also showed the specificity of the RT-PCR technique in early and ante mortem diagnosis of CDV infections.

Scientific Electronic Library Online (Portuguese)

61

Avaliação molecular de norovírus em pacientes com gastroenterite aguda/ Molecular evaluation of norovírus in patients with acute gastroenteritis

Georgiadis, Sofia; Pilger, Diogo André; Pereira, Fabiana; Cantarelli, Vlademir Vicente
2010-06-01

Resumo em português INTRODUÇÃO: O norovírus foi recentemente identificado como o principal causador de surtos de gastroenterite aguda de origem não bacteriana em todo o mundo e está envolvido em episódios de origem alimentar. Neste estudo, foram avaliados pacientes com sintomas de gastroenterite aguda pelo período de um ano, a fim de se avaliar duas metodologias na identificação do NoV - a reação em cadeia por polimerase convencional e em tempo real -, incidência, sazonalidade e (mais) genótipo predominante. MÉTODOS: Após a extração do RNA, 50 amostras foram analisadas pela metodologia de PCR convencional e 365 amostras foram analisadas pela metodologia de PCR em tempo real. Todas as amostras que apresentaram resultado positivo pelas duas metodologias ou discordante foram sequenciadas, ao todo, 13 amostras foram sequenciadas. RESULTADOS: Das 50 amostras testadas pelas duas metodologias, 7 apresentaram resultado positivo pelo método convencional e 15 pelo método da PCR em tempo real. Do total de 365 amostras testadas pela metodologia de PCR, em tempo real, 48 foram positivas. Em relação às amostras sequenciadas, todas mostraram ser NoV do genogrupo II. Em relação à distribuição da incidência de amostras, positivas para NoV, ao longo do ano, pôde ser observada uma frequência de casos positivos maior na primavera, chegando a 29,7% em novembro. CONCLUSÕES: Observamos que o PCR em tempo real é o método mais sensível para a identificação do Nov, que a incidência do NoV é de 13,2% e o genogrupo II prevalece na população avaliada, sendo a primavera o período de maior taxa de infecção. Resumo em inglês INTRODUCTION: Norovírus was recently identified as the main cause of outbreaks of acute gastroenteritis of non-bacterial origin worldwide and it is involved in episodes of foodborne origin. In this study, patients with symptoms of acute gastroenteritis were evaluated over a one-year period, in order to evaluate two methods for identifying norovírus (real-time and conventional polymerase chain reaction), along with its incidence, seasonality and predominant genotype. MET (mais) HODS: After RNA extraction, 50 samples were analyzed using conventional PCR and 365 were analyzed using real-time PCR. All the samples that presented positive results using both methods or discordant results were sequenced. In all, 13 samples were sequenced. RESULTS: Out of the 50 samples tested using both methods, seven presented a positive result from the conventional method and 15 from real-time PCR. Out of the total of 365 samples tested using real-time PCR, 48 were positive. All of the sequenced samples were shown to present norovírus of genogroup II. Regarding the distribution of norovírus-positive sample incidence over the course of the year, higher frequency of positive cases was observed during the southern hemisphere spring, reaching 29.7% in November. CONCLUSIONS: We observed that real-time PCR was more sensitive for identifying norovírus. The incidence of norovírus was 13.2% and genogroup II predominated among the population evaluated, with the greatest infection rate in the southern hemisphere spring.

Scientific Electronic Library Online (Portuguese)

62

Eficiência microbiana e parâmetros ruminais em bovinos alimentados com dietas à base de volumosos tropicais/ Microbial efficiency and ruminal parameters in cattle fed diets based on tropical forage

Cabral, Luciano da Silva; Valadares Filho, Sebastião de Campos; Detmann, Edenio; Zervoudakis, Joanis Tilemahos; Souza, Alexandre Lima de; Veloso, Rafael Gonçalves
2008-05-01

Resumo em português Objetivou-se com este trabalho determinar o fluxo de compostos nitrogenados no abomaso, a degradação ruminal dos carboidratos totais e da matéria orgânica, a eficiência microbiana, a concentração de N-NH3 e o pH ruminal em bovinos alimentados com dietas à base de silagem de milho, silagem de capim-elefante ou feno de capim-tifton 85. Foram utilizados seis bovinos fistulados no rúmen e abomaso em um delineamento quadrado latino 3 × 3 duplo. Os fluxos de matéria (mais) seca da digesta e da matéria seca microbiana no abomaso foram determinados a partir da utilização de fibra em detergente neutro indigestível e das bases purinas como indicador microbiano, respectivamente. As concentrações de NH3 e o pH ruminal foram determinados antes e 2, 4 e 8 horas após a alimentação. As dietas à base de silagem de milho e de feno de capim-tifton 85 proporcionaram os maiores fluxos de compostos nitrogenados no abomaso. As bactérias isoladas do rúmen apresentaram em média 8,89% de N total e 18,40 para a relação N-RNA:N-total. A dieta à base de silagem de milho promoveu maior degradação ruminal da matéria orgânica (2,96 kg/dia) e dos carboidratos totais (3,07 kg/dia) e maior fluxo de massa microbiana para o abomaso (788,28 g/dia). As dietas à base de feno de capim-tifton 85 e de silagem de capim-elefante resultaram em maior eficiência microbiana, cujos valores foram 28,10 e 30,39 g de N microbiano/kg de carboidratos degradados no rúmen. As menores concentrações de NH3 e pH ruminal, considerando o tempo após a alimentação, ocorreram quando fornecida a dieta à base de silagem de milho, o que possivelmente afetou negativamente a eficiência microbiana. Resumo em inglês The objectives of the present work were to determine nitrogen compounds flow into the abomasum, total carbohydrate and organic matter ruminal degradation, microbial efficiency, N-NH3 concentration and ruminal pH in cattle fed with diets based on corn silage, elephant grass silage and Tifton-85 bermudagrass hay. Six ruminal and abomasal fistulated cattle were utilized in a double 3 × 3 latin square. Abomasal digesta dry matter of and microbial dry matter flows were determ (mais) ined by use of indigestible neutral detergent fiber and base purines as microbial marker, respectively. The N-NH3 concentration and ruminal pH were determined before and 2, 4 and 8 hours after feeding. The diets based on corn silage and Tifton-85 bermudagrass hay provided higher nitrogen compounds flow into abomasum. Isolated bacteria from rumen averaged 8.89% of total N and had an N-RNA:N-total ration of 18.40. The corn silage diet provided higher ruminal degradation of organic matter (2.96 kg/day) and of total carbohydrates (3.07 kg/day) and higher microbial matter flow to the abomasum (788.28 g/day). The Tifton-85 bermudagrass hay and elephant grass silage diets had the greatest microbial efficiencies, which values were 28.10 and 30.39 g of microbial N/kg of rumen degradable carbohydrates. The corn silage diet showed lower N-NH3 concentration and ruminal pH after feeding, possibly indicating reduction of microbial efficiency.

Scientific Electronic Library Online (Portuguese)

63

Viroides em citros/ Viroids in Citrus

Eiras, Marcelo; Silva, Simone Rodrigues; Stuchi, Eduardo Sanches; Targon, Maria Luisa Penteado Natividade; Carvalho, Sérgio Alves
2009-10-01

Resumo em português Os viroides são os menores fitopatógenos conhecidos. Constituídos por uma molécula de RNA de fita simples, circular, que não é encapsidada e não codifica proteínas, são capazes de se replicar de maneira autônoma nas células do hospedeiro. Os viroides de citros pertencem à família Pospiviroidae (cujos membros apresentam uma região central conservada, replicam-se no núcleo das células hospedeiras e não apresentam atividade ribozimática) com cinco espécies (mais) : Citrus exocortis viroid, CEVd (Pospiviroid), Hop stunt viroid, HSVd (Hostuviroid), Citrus bark cracking viroid, CBCVd (Cocadviroid) e Citrus bent leaf viroid, CBLVd e Citrus dwarfing viroid, CDVd (Apscaviroid). Além disso, Citrus viroid original source (CVd-OS) e mais recentemente, Citrus viroid V (CVd-V) foram propostas como espécies tentativas do gênero Apscaviroid. Os viroides de citros são transmitidos via enxertia e disseminados principalmente pela propagação de material contaminado. Sabe-se que os viroides de citros infectam praticamente todas as espécies do gênero Citrus e afins. Porém, há somente duas doenças importantes descritas em citros, induzidas por viroides: (i) a exocorte; (ii) e a xiloporose (ou cachexia). Apesar dos viroides induzirem sintomas severos, ou simplesmente afetarem o tamanho das árvores, muitas espécies de citros são assintomáticas, sendo o controle baseado em medidas preventivas, como utilização de gemas livres de viroides aliadas a métodos confiáveis de indexação. A proposta desta revisão é apresentar ao leitor os recentes avanços nas pesquisas com viroides de citros, principalmente na taxonomia, distribuição geográfica, métodos de detecção, limpeza e indexação, epidemiologia e controle, além do histórico e importância desses patógenos para a citricultura mundial. Resumo em inglês Viroids are the smallest known plant pathogens consisting of a non-encapsidated, circular, single-stranded RNA that replicate autonomously in their host plants. Viroids are classified into two families (Pospiviroidae and Avsunviroidae). All citrus viroids belong to the Pospiviroidae family (species that present a central conserved region, replicate in the nucleus of infected cells and lack of ribozyme activity) with five citrus viroid species: Citrus exocortis viroid, CEV (mais) d (Pospiviroid), Hop stunt viroid, HSVd (Hostuviroid), Citrus bark cracking viroid, CBCVd (Cocadviroid) and Citrus bent leaf viroid, CBLVd and Citrus dwarfing viroid, CDVd (Apscaviroid). In addition, Citrus viroid original source (CVd-OS) and, more recently, Citrus viroid V (CVd-V) have been proposed as tentative species of the genus Apscaviroid. Citrus viroids are graft-transmitted and their dissemination occurs mainly by propagation of contaminated material. It is known that they have a broad host range, infecting species of citrus and plants of citrus-related genera. Two important diseases in citrus are viroid-induced: (i) exocortis; (ii) and cachexia. Symptoms vary from severe to asymptomatic, and their control is based on preventive measures as availability of viroid-free budwood as a source of propagation material follow by adequate indexing procedures. The purpose of this review is to present the reader the recent advances on citrus viroid research, mainly on taxonomy, geographical distribution, methods of detection, indexing and cleaning, epidemiology and control.

Scientific Electronic Library Online (Portuguese)

64

Cinética digestiva e eficiência de síntese de proteína microbiana em novilhos alimentados com farelo de girassol e diferentes fontes energéticas/ Digestion kinetics and efficiency of microbial protein synthesis on beef steers fed sunflower meal and different energy sources

Mendes, Rosália; Ezequiel, Jane Maria Bertocco; Galati, Rosemary Laís; Nascimento, Virgílio Franco do; Queiroz, Mário Adriano Ávila; Pereira, Expedita Maria de Oliveira
2006-02-01

Resumo em português Objetivou-se avaliar o efeito da substituição parcial do milho pela casca de soja e pelo farelo de gérmen de milho sobre a produção e eficiência de síntese de proteína microbiana e sobre as taxas de diluição e passagem ruminal. Foram utilizados três novilhos de corte, mestiços, canulados no rúmen e no duodeno, distribuídos em dois delineamentos em quadrado latino 3 x 3. As dietas experimentais, à base de silagem de milho (60%), apresentavam como fonte de pr (mais) oteína farelo de girassol e, como fonte de energia, milho (MI) ou sua substituição parcial pela casca de soja (CS) ou pelo farelo de gérmen de milho (FGM). Para o isolamento da massa microbiana, foram coletadas amostras de conteúdo ruminal às 3, 6, 9 e 12 horas após a alimentação. Utilizaram-se RNA como marcador microbiano e dicromato de sódio e Co-EDTA como indicadores das taxas de passagem e de diluição, respectivamente. A composição dos microrganismos ruminais não foi influenciada pelas dietas experimentais ou pelos horários de coleta. Não houve diferenças significativas no fluxo de matéria orgânica, carboidratos totais, nitrogênio e nitrogênio microbiano para o duodeno e na eficiência de síntese de proteína microbiana. As taxas de diluição foram semelhantes entre as dietas, com média de 13,4%/h. A taxa de passagem da silagem de milho mordentada foi menor, com tendência de menor taxa de passagem também para o farelo de girassol na dieta MI. A casca de soja e o farelo de gérmen de milho podem substituir parcialmente o milho, proporcionando ambiente ruminal adequado ao desenvolvimento da flora microbiana e conseqüente produção de proteína microbiana ruminal em novilhos confinados. Resumo em inglês The objective of this trial was to evaluate the partial replacement of ground corn with soybean hulls or corn germ meal on ruminal microbial protein synthesis and efficiency and ruminal dilution and passage rates. Three crossbreed steers fitted with ruminal and duodenal cannulas were assigned to two 3 x 3 Latin squares. The experimental diets contained: corn silage (60%), sunflower meal and ground corn (GC diet) that was partially replaced with soybean hulls (SBH diet) or (mais) corn germ meal (CGM diet). Ruminal fluid was collected at 3, 6, 9, and 12 hours after feeding for isolation of ruminal microbes. RNA was used as the microbial marker while sodium dicromate and Co-EDTA were used as passage and dilution rate markers, respectively. Ruminal microbial composition was not affected by diets and time after feeding in the present trial. Moreover, duodenal flows of organic matter, total carbohydrates, nitrogen (N), and microbial N as well as microbial efficiency were all not significantly changed across diets. Fluid dilution rate also did not differ and averaged 13.4%/h among diets. Ruminal passage rate of mordant corn silage was lower and a trend for lower passage rate of sunflower meal on GC diet also was observed. Soybean hulls and corn germ meal can partially replace ground corn on diets for confined steers because they provided adequate ruminal environment for microbial growth and microbial protein synthesis.

Scientific Electronic Library Online (Portuguese)

65

A genética em transformação: crise e revisão do conceito de gene

Joaquim, Leyla Mariane; El-Hani, Charbel Niño
2010-03-01

Resumo em português O conceito de gene tem desempenhado um papel central na biologia desde sua introdução, no início do século xx. Contudo, ao longo do seu desenvolvimento histórico, o conceito tem sido objeto de controvérsia crescente, inicialmente na filosofia da biologia e, depois, na própria biologia. Desafios ao conceito de gene têm levado a uma dificuldade de preservar o chamado conceito molecular clássico, de acordo com o qual um gene é um segmento do DNA que codifica um pro (mais) duto funcional (polipeptídeo ou RNA). As últimas três décadas de estudos experimentais levaram a achados como genes interrompidos, emenda (splicing) alternativa, o chamado DNA-lixo, sequências TAR, pseudogenes, regulação pós-transcricional, rnai e rnasi, entre outros, os quais colocaram dificuldades inesperadas à compreensão usual do conceito de gene. Neste artigo, discutiremos os principais achados experimentais que desafiaram o conceito molecular clássico de gene. Daremos destaque, em particular, a avanços recentes, que tiveram lugar no Projeto Genoma Humano (PGH) e na Enciclopédia de Elementos de DNA (Encode). Atualmente, é clara a necessidade de uma análise e reformulação cuidadosa desse conceito central para o pensamento biológico. Muitos filósofos da biologia e biólogos, na tentativa de organizar a variedade de definições de gene, apresentaram visões interessantes a respeito desse conceito e de seu papel no conhecimento biológico, assim como propostas de revisão conceitual, que também abordaremos neste artigo. Concluímos que uma definição única de gene não é possível ou necessária. Ao contrário, o pluralismo de modelos e conceitos é provavelmente mais poderoso, desde que os domínios de cada conceito ou modelo sejam claramente definidos. Resumo em inglês The gene concept has played a central role in Biology since its introduction, in the beginnings of the twentieth century. However, throughout its historical development, this concept has been a matter of increasing controversy, initially in the philosophy of biology and, later, in biology itself. Challenges to the gene concept have resulted in the difficulty of preserving the so called classical molecular concept, according to which a gene is a stretch of DNA encoding a f (mais) unctional product (polypeptide or RNA). The last three decades of experimental studies led to findings such as interrupted genes, alternative splicing, so called junk DNA, TAR sequences, pseudogenes, postranscriptional regulation, RNAi and RNAsi, among others, that posed unexpected difficulties to the usual understanding of the gene concept. In this paper, we address the main experimental findings that challenge the classical molecular gene concept. We focus, in particular, on recent advances that took place in the Human Genome Project (hgp) and the Encyclopedia of DNA elements (Encode). It is now clear for that a careful analysis and reformulation of this central concept for biological thought is necessary. In an attempt to organize the variety of definitions given to genes, many philosophers and scientists presented interesting views about this concept and its role in biological thought, as well as proposals of conceptual revision, which we will also discuss in this paper. We conclude that a single, all-encompassing definition of gene is neither possible nor necessary. Rather, a pluralism of models and concepts is likely to be more powerful, provided that the domains of each concept or model be clearly defined.

Scientific Electronic Library Online (Portuguese)

66

Úlcera péptica gastroduodenal e infecção pelo Helicobacter pylori na criança e adolescente/ Gastroduodenal peptic ulcer and Helicobacter pylori infection in children and adolescents

Bittencourt, Paulo F. S.; Rocha, Gifone A.; Penna, Francisco J.; Queiroz, Dulciene M. M.
2006-10-01

Resumo em português OBJETIVO: Apresentar aspectos relevantes relativos à úlcera péptica gastroduodenal e à infecção pelo Helicobacter pylori na criança e adolescente. FONTES DOS DADOS : Livros técnicos e bases de dados MEDLINE e LILACS de 1966 a 2006. SÍNTESE DOS DADOS : A úlcera péptica na criança e adolescente pode ser primária, associada à infecção pelo H. pylori, ou secundária, na qual os mecanismos etiopatogênicos dependem da doença de base. A infecção é adquirida (mais) predominantemente na infância, com taxas de prevalência que variam de 56,8 a 83,1% nas crianças que vivem nas regiões mais pobres do Brasil e de aproximadamente 10% nas crianças abaixo de 10 anos de idade nos países desenvolvidos. A infecção pode ser diagnosticada por métodos invasivos, que investigam a presença da bactéria, ou de DNA, RNA ou produtos bacterianos em fragmentos de biópsia da mucosa gástrica obtida à endoscopia; também pode ser diagnosticada através de métodos não-invasivos, que compreendem a pesquisa de anticorpos anti-H. pylori em amostras de soro, urina ou saliva, a pesquisa de antígenos da bactéria nas fezes e o teste respiratório com uréia marcada com carbono-13. O método de escolha para o diagnóstico da úlcera péptica é a endoscopia digestiva alta, com a vantagem adicional de, durante o procedimento, permitir a obtenção de fragmentos de mucosa gástrica para o diagnóstico da infecção e estudo histopatológico. CONCLUSÕES: A infecção por H. pylori é a principal causa de úlcera péptica na infância. A erradicação da bactéria com antimicrobiano é acompanhada de cura da doença, sendo, portanto, indicada em todas as crianças H. pylori-positivas com úlcera péptica em atividade, recorrente, cicatrizada ou complicada. Resumo em inglês OBJECTIVE: To show important aspects of gastroduodenal peptic ulcer and of Helicobacter pylori infection in children and adolescents. SOURCES: Technical textbooks and MEDLINE and LILACS databases including publications between 1966 and 2006. SUMMARY OF THE FINDINGS : The etiology of peptic ulcer in children and adolescents may be primary, associated with H. pylori infection, or secondary, in which etiopathogenic mechanisms rely upon the underlying disease. The infection i (mais) s acquired predominantly in childhood, with prevalence rates between 56.8 and 83.1% in children who live in the poorest Brazilian regions, amounting to nearly 10% in children aged less than 10 years in industrialized countries. The infection can be diagnosed by invasive methods, which investigate the presence of the bacterium, or of DNA, RNA or bacterial products in biopsy fragments of the gastric mucosa obtained at endoscopic examination; it can also be diagnosed through noninvasive methods, which include the detection of anti-H. pylori antibodies in serum, urine or saliva samples, detection of bacterial antigens in stool samples, and the carbon 13-labeled urea breath test. However, upper gastrointestinal endoscopy is the method of choice for the diagnosis of peptic ulcer, as it allows collecting fragments from the gastric mucosa during the procedure for the diagnosis of infection and for histopathological analysis. CONCLUSIONS: H. pylori infection is the major cause of peptic ulcer among children. Eradication of the bacterium with antimicrobial therapy results in the cure of the disease, and is therefore indicated for all children with H. pylori infection with an active, recurrent, healed, or complicated peptic ulcer.

Scientific Electronic Library Online (Portuguese)

67

Transcrição reversa na determinação da expressão do mRNA para a enzima conversora de angiotensina testicular em animais tratados com zinco/ Assessment of the reverse transcriptase polymerase chain reaction technique in the determination of the mRNA expression for the testicular angiotensin-converting enzyme in zinc treated rats

Henriques, Gilberto Simeone; Silva, Adriana Gisele Hertzog da; Hirata, Rosário Dominguez Crespo; Hirata, Mario Hiroiuki; Cozzolino, Sílvia Maria Franciscato
2005-12-01

Resumo em português OBJETIVO: O objetivo deste trabalho foi otimizar as condições reacionais capazes de ocasionar variabilidade e de introduzir erros sistemáticos na reação em cadeia pela polimerase aplicada à análise da expressão gênica da isoforma testicular da enzima conversora de angiotensina. MÉTODOS: Avaliaram-se a concentração de cDNA, a concentração dos iniciadores, a temperatura de hibridização e o número de ciclos de desnaturação, hibridização e extensão. Para (mais) tanto, extraiu-se o RNA total por meio da reação com fenol-clorofórmio e isotiocianato de guanidina de amostras de testículos de ratos Wistar alimentados com uma ração contendo zinco. Em seguida, gerou-se o cDNA por transcrição reversa. Utilizando-se iniciadores específicos, amplificaram-se o gene de interesse (isoforma testicular da enzima conversora de angiotensina) e o gene controle Gliceraldeído-3-Fosfato-Desidrogenase. As amostras foram então aplicadas em gel de agarose e submetidas à eletroforese, coradas em brometo de etídio e visualizadas sob luz ultravioleta. RESULTADOS: Demonstrou-se que a melhor condição reacional para a reação em cadeia pela polimerase da isoforma testicular da enzima conversora de angiotensina e do Gliceraldeído-3-Fosfato-Desidrogenase foi: (1) concentração inicial de cDNA de 2µg, (2) concentração de iniciadores de 200nM, (3) temperatura de hibridização entre 57,5ºC e 60,1ºC e (4) 33 ciclos. CONCLUSÃO: Com essa otimização pôde-se minimizar as interferências sobre a técnica, contribuindo-se para a obtenção de dados comparativos a respeito da expressão gênica da enzima conversora de angiotensina testicular. Resumo em inglês OBJETIVE: The aim of the present work was to optimize the reaction conditions capable of generating variability and introducing systematic errors in the chain reaction of the polymerase used to analyze the gene expression for the testicular isoform of the angiotensin-converting enzyme. METHODS:The cDNA concentration, primer concentration, hybridization temperature and number of denaturation, hybridization and extension cycles were evaluated. For this purpose, samples of t (mais) estis from Wistar rats fed a zinc containing diet were used to extract total RNA using the phenol-chloroform-isothiocyanate reaction. Stable cDNA was then generated by the reverse transcription reaction. Using specific primers, the gene of interest (testicular isoform of the angiotensin-converting enzyme) and the housekeeping gene for the expression of Glyceraldehyde-3-Phosphate Dehydrogenase were amplified. The samples were then submitted to gel eletrophoresis in agarose gel, stained with ethide bromide and visualized in a UV chamber. RESULTS: The results showed that the best reaction conditions for the chain reaction by the testicular isoform polymerase of the angiotensin-converting enzyme and for Glyceraldehyde-3-Phosphate Dehydrogenase were: (1) initial cDNA concentration of 2 µg, (2) primer concentration of 200nM, (3) hybridization temperature between 57.5ºC and 60.1ºC and (4) 33 cycles. CONCLUSION: It was concluded that this optimization minimized interference of the technique, contributing to the production of true, comparative data for the testicular angiotensin- converting enzyme gene expression.

Scientific Electronic Library Online (Portuguese)

68

Diversidade e prevalência das mutações de resistência genotípica aos antirretrovirais entre crianças infectadas pelo HIV-1/ Diversity and prevalence of antiretroviral genotypic resistance mutations among HIV-1-infected children

Almeida, Flávia J.; Berezin, Eitan N.; Rodrigues, Rosângela; Sáfadi, Marco A. P.; Arnoni, Mariana V.; Oliveira, Cristina; Brígido, Luis F. M.
2009-04-01

Resumo em português OBJETIVO: Avaliar a genotipagem e subtipagem em crianças experimentadas e virgens de tratamento, assim como perfis de resistência a medicamentos através da genotipagem nessas crianças. MÉTODOS: Estudo retrospectivo de crianças HIV positivas virgens de tratamento e HIV positivas que não responderam ao tratamento pela terapia antirretroviral altamente ativa (HAART), acompanhadas na Santa Casa de São Paulo (SP). A genotipagem foi realizada com produtos purificados de (mais) reação em cadeia da polimerase (PCR) de RNA retrotranscrito, utilizando-se o kit comercial Viroseq HIV-1 Genotyping System 2.0 ou a técnica de nested PCR in-house. O sequenciamento foi realizado com equipamento automático (ABI 3100). As mutações de resistência antirretroviral (ARV) foram analisadas no Stanford HIV Drug Resistance Database e a subtipagem realizada no U.S. National Center for Biotechnology Information (NCBI), utilizando-se o programa de análises SimPlot, juntamente com a análise filogenética. RESULTADOS: Não foi detectada nenhuma mutação de resistência primária ARV nas 24 crianças virgens de tratamento, embora tenham ocorrido mutações que podem contribuir para a resistência aos inibidores da transcriptase reversa análogos de nucleosídeos (ITRN) (12,5%) e aos inibidores da protease (IP) (95,8%). Para as 23 crianças que não responderam à HAART, foram encontradas mutações de resistência ARV aos ITRN em 95,6% e aos inibidores da transcriptase reversa não-análogos de nucleosídeos (ITRNN) em 60,8%. Para os IP, foram observadas mutações de resistência ARV em 95,7%, 47,8% das quais apresentavam apenas polimorfismos. Nas análises de subtipagem, 78,3% das sequências agruparam-se no subtipo B do HIV-1, 4,3% no C, 13% no F e 4,4% em formas recombinantes. CONCLUSÕES: Nossos resultados mostram baixas taxas de resistência primária em crianças virgens de tratamento e altas taxas de resistência em crianças que não responderam ao tratamento ARV, o que é compatível com o uso ARV nesses pacientes. Resumo em inglês OBJECTIVE: To evaluate genotyping and subtyping in antiretroviral (ARV) naïve and experienced children, as well as drug resistance profiles through genotyping in these children. METHODS: This retrospective study assessed ARV-naïve HIV children and HIV children failing highly active antiretroviral treatment (HAART) followed up at Santa Casa de São Paulo. Genotyping was performed using purified polymerase chain reaction (PCR) products from retrotranscribed RNA using Kit (mais) Viroseq HIV-1 Genotyping System 2.0 or nested PCR in-house. Sequencing was performed using automatic equipment (ABI 3100). ARV resistance mutations were analyzed in the Stanford HIV Drug Resistance Database and subtyping was performed at the National Center for Biotechnology Information (NCBI), using SimPlot analysis, together with phylogenetic analysis. RESULTS: No primary ARV resistance mutation was detected in the 24 ARV-naïve children, although there were mutations that may contribute to resistance to nucleoside analogue reverse transcriptase inhibitors (NRTI) (12.5%) and to protease inhibitors (PI) (95.8%). For the 23 children failing HAART, we found ARV resistance mutations to NRTI in 95.6% and to non-nucleoside analogue reverse transcriptase inhibitors (NNRTI) in 60.8%. For PI, we found ARV resistance mutations in 95.7%, 47.8% of which had only polymorfisms. In the subtyping analyses, 78.3% of the sequences clustered in HIV-1 subtype B, 4.3% in C, 13% in F and 4.4% in recombinant forms. CONCLUSION: Our results show low rates of primary resistance in ARV-naïve children and high rates of resistance in children failing ARV treatment, which is compatible with ARV use in these patients.

Scientific Electronic Library Online (Portuguese)

69

Caracterização de um vírus baciliforme isolado de Solanum violaefolium transmitido pelos ácaros Brevipalpus phoenicis e Brevipalpus obovatus (Acari: Tenuipalpidae)/ Characterization of a bacilliform virus isolated from Solanum violaefolium transmitted by the tenuipalpid mites Brevipalpus phoenicis and Brevipalpus obovatus

Ferreira, Paulo de Tarso Oliveira; Locali-Fabris, Eliane Cristina; Freitas-Astúa, Juliana; Antonioli-Luizon, Renata; Gomes, Renata Takasugui; Machado, Marcos Antonio; Kitajima, Elliot Watanabe
2007-09-01

Resumo em português Solano-violeta (Solanum violaefolium) é uma planta ornamental rasteira usada para cobrir solos de áreas sombreadas. Um vírus que induz manchas anelares nas folhas desta planta, tentativamente designado Solanum violaefolium ringspot virus - SvRSV, transmitido pelo ácaro Brevipalpus phoenicis (Acari: Tenuipalpidae) foi encontrado em Piracicaba, SP. Trata-se de um vírus baciliforme que se assemelha a outros vírus do tipo citoplasmático transmitidos por Brevipalpus sp. (mais) Este trabalho teve como objetivo relatar propriedades biológicas e estabelecer uma caracterização molecular parcial do SvRSV. O vírus pode ser transmitido mecanicamente a várias outras espécies botânicas, causando lesões localizadas. Entre as espécies avaliadas, Datura stramonium mostrou-se a melhor hospedeira experimental. Observou-se também a manifestação de sintomas nestas plantas após infestação das mesmas por B. obovatus previamente alimentado em lesões de SvRSV, confirmando esta outra espécie de ácaro como vetor do vírus. Suas propriedades físicas in vitro foram: temperatura de inativação 40-45 ºC; ponto final de diluição 10-3-10-4; longevidade in vitro 12 dias. Em secções ultrafinas, as partículas do SvRSV mostraram-se levemente mais delgadas e mais longas que as de outros vírus do mesmo grupo. A partir do dsRNA do SvRSV foi construída uma biblioteca de cDNA e foram identificadas duas possíveis regiões codificadoras das proteínas de movimento e replicase viral. Baseado nestas regiões foram desenhados "primers" para amplificação do RNA do SvRSV por RT-PCR. Sondas baseadas nas seqüências obtidas hibridizaram com ss- e dsRNA de D. stramonium infectadas pelo vírus. Ensaios preliminares de RT-PCR e hibridização não resultaram em reação com o vírus da leprose dos citros, tipo citoplasmático (CiLV-C). Resumo em inglês Solanum violaefolium is an ornamental plant, with prostrate, trailing growth habit and is cultivated in shaded areas. A virus that causes ringspot symptoms on its leaves, tentatively named as Solanum violaefolium ringspot virus (SvRSV) and transmitted by Brevipalpus phoenicis (Acari: Tenuipalpidae) was found in Piracicaba city, São Paulo State. It is a bacilliform virus that resembles other cytoplasmic viruses transmitted by Brevipalpus sp. The objective of this work is (mais) to describe the biological properties and establish partial molecular characterization of the SvRSV. The SvRSV can be transmitted mechanically to several plant species causing local lesions. Among the tested species, Datura stramonium was proved to be the best experimental host. It was observed that S. violaefolium plants were infested by B. obovatus that also transmitted SvRSV in preliminary assays. Its in vitro physical properties were: thermal inactivation point: 40-45 ºC; dilution end point: 10-3-10-4 and in vitro longevity: 12 days. Ultrathin sections revealed that SvRSV particles are slightly thinner and longer than other cytoplasmic-type viruses transmitted by Brevipalpus sp. A cDNA library from dsRNA molecules extracted from SvRSV was constructed and two regions, which putatively code for the replicase and movement proteins were identified. Based on these sequences, primer pairs were designed for SvRSV´s RNA amplification by RT-PCR. Indeed, probes based on such sequences hybridized with ss- and dsRNA from infected D. stramonium plants. Preliminary molecular assays using primers and probes of SvRSV did not detect Citrus leprosis virus, cytoplasmic type (CiLV-C), another cytoplasmic type Brevipalpus-transmitted viruses.

Scientific Electronic Library Online (Portuguese)

70

Aspectos atuais sobre aminoácidos de cadeia ramificada e exercício físico/ Current aspects of branched chain amino acid and exercise

Rogero, Marcelo Macedo; Tirapegui, Julio
2008-12-01

Resumo em português Em humanos saudáveis, nove aminoácidos são considerados essenciais, uma vez que não podem ser sintetizados endogenamente e, portanto, devem ser ingeridos por meio da dieta. Dentre os aminoácidos essenciais, se incluem os três aminoácidos de cadeia ramificada, ou seja, leucina, valina e isoleucina. Esses aminoácidos participam da regulação do balanço protéico corporal além de serem fonte de nitrogênio para a síntese de alanina e glutamina. No tocante à regu (mais) lação da síntese protéica muscular, verifica-se que a leucina age estimulando a fase de iniciação da tradução do RNA-mensageiro em proteína, por mecanismos tanto dependentes quanto independentes de insulina. No que concerne ao exercício físico, supõe-se que esses aminoácidos estejam envolvidos na fadiga central, no balanço protéico muscular, na secreção de insulina, na modulação da imunocompetência, no aumento da performance de indivíduos que se exercitam em ambientes quentes e na diminuição do grau de lesão muscular. Nesse contexto, essa revisão aborda os aspectos atuais do metabolismo e da suplementação de aminoácidos de cadeia ramificada no exercício físico. Resumo em inglês In healthy humans, nine amino acids are considered to be essential once they cannot be endogenously synthesised and must therefore be ingested in the diet. Amongst the essential amino acids are the three branched chain amino acids, namely, leucine, valine and isoleucine. These amino acids participate in the regulation of protein balance in addition to being nitrogen sources for the synthesis of alanine and glutamine. As to the regulation of muscle protein synthesis, leuci (mais) ne acts in the stimulation of initiation of mRNA translation into protein, both through mechanisms that are dependent and independent of insulin. In the physiology of physical exercise, these branched amino acids play a role in central fatigue hypothesis, in muscle protein balance, in the secretion of insulin, in the modulation of the immune response, in performance enhancement of individuals who work out in hot environments, and in avoiding muscle lesion. This review approaches all aspects of the metabolism of and supplementation with branched chain amino acids in physical exercise.

Scientific Electronic Library Online (Portuguese)

71

Apoptose e expressão de VP2 e GAPDH na infecção precoce pelo vírus da doença infecciosa da bursa de Fabricius em pintos SPF/ Apoptosis and expression of VP2 and GADPH in an experimental infectious bursal disease in SPF chicks

Batista, J.J.; Martins, A.S.; Moro, L.; Resende, J.S.; Martins, N.R.S.; Vasconcelos, A.C.
2007-04-01

Resumo em português Vinte e nove pintos SPF de um dia foram inoculados com o vírus da doença infecciosa da bursa de Fabricius (VDIB) para avaliar a ocorrência precoce de apoptose e a expressão da proteína viral 2 (VP2) e da enzima gliceraldeído fosfato dehidrogenase (GAPDH). Os animais foram distribuídos em cinco grupos: 1-controle; e 2 a 5- com 24, 48, 72 e 96 horas pós-inoculação, respectivamente. Fragmentos da bursa de Fabricius foram colhidos para processamento histológico e e (mais) xtração de RNA. Lâminas coradas em HE e TUNEL (marcação in situ da fragmentação do genoma com transferase terminal de deoxinucleotídeo) foram utilizadas na morfometria do índice apoptótico. Amostras de mRNA foram testadas para a expressão dos genes VP2 e GAPDH utilizando-se transcrição reversa e RT-PCR. Utilizou-se um kit SYBR GREEN PCR, e a reação foi desenvolvida em ABI Prism 7000 SDS. Os índices apoptóticos cresceram progressivamente indicando uma relação na atrofia bursal causada pelo VDIB. Paralelamente, os resultados da PCR em tempo real demonstraram queda da carga viral nas células linfóides da bursa nos diferentes intervalos de tempo do experimento. Esses resultados sugerem um papel protetor da apoptose na diminuição da replicação viral. Resumo em inglês Twenty-nine SPF 1-day-old chicks were inoculated with infectious bursal disease virus (IBDV) to evaluate early apoptosis and the expression of viral protein 2 (VP2) and glyceraldehyde-3-phosphate dehydrogenease (GAPDH). Five groups were formed: G1-control -and G2 to G5, - 24, 48, 72 and 96 hours post inoculation, respectively. Half of each BF was fixed and processed by routine techniques. To quantify apoptosis, 5µm-thick sections were stained with HE and submitted to TUN (mais) EL (terminal transferase UDP nick end labeling) technique. mRNA was extracted from pooled samples of 3 animals/group and used for the expression of VP2 and GADPH genes using the reverse transcription and real-time polymerase chain reaction (RT-PCR). A SYBR GREEN PCR kit was used and the reaction was carried out in an ABI Prism 7000 SDS. Apoptotic indexes progressively increased indicating a role of IBDV in inducing hypotrophy of the BF. Also, it was showed that as long as apoptosis increased, viral protein expression decreased, which suggests that apoptosis plays a role as a defense mechanism against viral replication.

Scientific Electronic Library Online (Portuguese)

72

Linfonodo sentinela em melanoma de criança: relato de caso/ Sentinel lymph node in children with melanoma: case report

Oliveira Filho, Renato Santos de; Paiva, Geruza Rezende; Ferreira, Lydia M.; Alves, Marcos Chaves de Arruda; Santos, Ivan Dunshee A.O.; Enokihara, Milvia M.S.S.
2002-10-01

Resumo em português Objetivo: apresentar um caso de melanoma cutâneo na infância, submetido à biópsia de linfonodo sentinela. Descrição: criança de 12 anos de idade, portadora da síndrome do nevo displásico, desenvolveu melanoma em dorso. A biópsia excisional revelou melanoma (Breslow = 1,5 mm), sendo submetida a tratamento cirúrgico da lesão, com ampliação de margem de 2cm e biópsia de linfonodo sentinela. O exame anatomopatológico não mostrou doença residual. O exame do l (mais) infonodo sentinela não mostrou metástases ao exame histopatológico por hematoxilina eosina, nem à imunohistoquímica (S100 e HMB45). No entanto, a pesquisa de RNA mensageiro da tirosinase por RT-PCR se mostrou positiva. A paciente não mostrou sinais de metástase ou recidiva local nestes doze meses iniciais de seguimento. Comentários: o melanoma é raro em crianças, corresponde a menos de 1% dos tumores da infância. Inúmeros trabalhos mostram o aumento da incidência mundial do melanoma. Em cerca de 70%, se originam de nevos melanocíticos pré-existentes, e nos 30% restantes, eles surgem de novo. Dada a agressividade do melanoma, a sobrevida depende do diagnóstico precoce. A biópsia do linfonodo sentinela tem contribuído na decisão de se realizar ou não a linfadenectomia completa, e alguns autores já estão utilizando a mesma em crianças. Resumo em inglês Objective: to present a case of a child who was subjected to sentinel lymph node biopsy for cutaneous melanoma. Description: a 12 year-old child with Dysplastic Nevus Syndrome developed melanoma on the lumbar region. The excision biopsy revealed a melanoma with depth of 1.5 mm. The patient was submitted to amplification of the margins 2 cm in all directions and the sentinel node was also excised. The histopathological exam did not show residual disease. Sentinel on exam d (mais) id not show metastases either under hematoxylin-eosin stain or immunohistochemistry (S-100 and HMB45). Therefore, RT-PCR for tyrosinase mRNA was positive. The patient has been followed for twelve months without evidence of recurrence. Comments: childhood melanoma is rare, corresponding to less than 1% of malignant tumors in children. Data point to a worldwide increase in its incidence. Melanoma occurs in melanocytic lesions in 70% and in the remaining 30% it occurs de novo. Melanoma is very aggressive, so the survival depends on an early diagnosis. Sentinel lymph node biopsy has selected patients to complete lymphadenectomy. Some authors have been using this technique in childhood melanoma.

Scientific Electronic Library Online (Portuguese)

73

Expressão gênica de caspases 3 e 8 em timo e baço de ratas recém-desmamadas e imunossuprimidas por glicocorticóide/ Genic expression of caspases 3 and 8 in thymus and spleen of glicocorticoid-immunossupressed weaned rats

Batista, J.J.; Martins, A.S.; Moro, L.; Vasconcelos, A.C.
2005-08-01

Resumo em português Determinou-se a expressão gênica das caspases 3 e 8 mediante transcrição reversa de mRNA total e reação em cadeia da polimerase (RT-PCR) para avaliar a apoptose em timo e baço de ratas imunossuprimidas por glicocorticóides. Utilizou-se dexametasona para indução da apoptose e atrofia linfóide. Quarenta e cinco fêmeas Wistar recém-desmamadas foram separadas em três grupos: as ratas de A (n=18) e B (n=18) foram tratadas com 250 e 500mg de glicocorticóide, via (mais) intramuscular, respectivamente, e as do C (n=9) não foram tratadas. Após 24, 48 e 72 horas, seis animais de cada grupo tratado e três do controle foram anestesiados, pesados e sacrificados. O baço e o timo foram coletados e pesados. Fragmentos dos órgãos foram fixados em formol tamponado a 10% e processados segundo técnica para inclusão em parafina. Os blocos foram seccionados em 5µm, e os cortes corados em hematoxilina e eosina. A análise histopatológica aliada ao peso dos órgãos nas diferentes doses e tempos demonstrou que a dexametasona induziu hipotrofia linfóide, que ocorreu com maior intensidade no tempo de 72 horas em animais do grupo B. Fragmentos de timo e de baço foram imediatamente congelados em nitrogênio líquido para extração de mRNA e DNA. Para a padronização da técnica de RT-PCR, utilizaram-se pool de amostras de mRNA dos animais-controle e pool de mRNA de animais tratados em cada tempo de experimento. A técnica de RT-PCR foi sensível o suficiente para a detecção dos mRNAs que codificam as caspases 3 e 8, e ambas participaram do processo de apoptose induzido por dexametasona. Resumo em inglês Expression of caspases 3 and 8 in spleen and thymus of immunosuppressed rats was analyzed by the reverse transcriptase-polymerase chain reaction (RT-PCR). Forty-five weaned female Wistar rats were divided into three groups: A (n=18) and B (n=18) rats were injected with 250µg and 500µg per rat, respectively; and C (n=9) rats were non-treated control animals. After 24, 48 and 72 hours, six animals from A and B groups and three controls were anaesthetized with chloroform, (mais) weighed and euthanized. Thymus and spleens were collected, weighed and a sample of each organ was fixed by immersion in 10% buffered formaline and embedded in paraffin. Thin sections (5µm) were stained with HE. Thymus and spleen samples were snap frozen in liquid nitrogen and stored at -80ºC for total RNA and DNA extraction. Apoptotic indices were calculated using sections stained with HE. Apoptotic indices and organs weights showed that hypotrophy happened mainly at 72h post treatment with 500µg/rat. RT-PCR was standardized using a pool of control animals and another from treated animals with A and B doses at each time period, respectively. Specific oligonucleotides for caspases 3 and 8 were drawn to obtain fragments of 271bp and 368bp, respectively. The results demonstrated that technique RT-PCR is sensitive enough to detect caspases 3 and 8 mRNAs and that caspase 3 and 8 participate in the apoptotic process induced by dexamethasone in weaned rats.

Scientific Electronic Library Online (Portuguese)

74

Estudos de expressão gênica utilizando-se microarrays: delineamento, análise, e aplicações na pesquisa zootécnica/ Microarray gene expression studies: experimental design, statistical data analysis, and applications in livestock research

Rosa, Guilherme Jordão de Magalhães; Rocha, Leonardo Bernardes da; Furlan, Luiz Roberto
2007-07-01

Resumo em português A tecnologia de microarrays, ou microarranjos de DNA, possibilita a avaliação simultânea da expressão de milhares de genes em diferentes tecidos em determinado organismo, em diferentes estágios de desenvolvimento ou condições ambientais. Microarrays são bastante utilizados em experimentos de genômica funcional com diversas espécies animais e vegetais, e têm sido gradativamente incorporados em diferentes áreas da pesquisa zootécnica, como crescimento e metabol (mais) ismo, resposta imune a doenças, reprodução e resposta a fatores de estresse não-infecciosos (restrição alimentar, exposição a elementos tóxicos e outras condições ambientais desfavoráveis), bem como melhoramento genético animal. Tais experimentos, entretanto, são ainda consideravelmente caros, como consequência, geralmente são conduzidos com tamanhos amostrais relativamente pequenos. Por outro lado, a realização dos experimentos com microarrays, desde a coleta das amostras, até a obtenção das imagens para análise, envolve uma série de procedimentos laboratoriais de alta complexidade, que frequentemente introduzem variações adicionais aos resultados obtidos. Desta maneira, a condução de ensaios com microarrays requer cuidadoso delineamento experimental e análise estatística dos dados. Nesta apresentação são discutidos princípios básicos do planejamento de ensaios com microarrays, bem como as ferramentas estatísticas e computacionais mais comuns para a análise dos mesmos. São também discutidos alguns exemplos de aplicação de experimentos com microarrays em zootecnia e, numa última seção, são traçadas algumas considerações finais envolvendo os tópicos gerais abordados. Resumo em inglês Microarray technology allows monitoring thousands of genes simultaneously in a specific tissue of an organism, in different developmental stages or environmental conditions. Microarrays are very common in functional genomics experiments with both animals and plant species, and they have been increasingly used also in different areas of livestock research, such as growth and metabolism, reproduction, immune response to diseases and parasites, response to non-infectious str (mais) ess factors (such as dietary restriction, exposure to toxic elements and other unfavorable environmental conditions) as well as animal breeding. Such experiments, however, are still considerably expensive and time consuming and, consequently, they are performed with relatively small sample sizes. Nonetheless, microarray experiments are extremely complex, as they involve a number of laboratorial procedures such as sample collection, RNA extraction, reverse transcription and labeling, and the final hybridization. Hence, microarray assays require careful experimental planning and statistical data analysis. In this manuscript, basic principles of experimental design for microarray studies are reviewed, as well as the most common statistical and computational tools used for their analysis. In addition, some examples of application of microarray technology in animal science are discussed, and some concluding remarks are presented afterward.

Scientific Electronic Library Online (Portuguese)

75

MicroRNAs: nova classe de reguladores gênicos envolvidos na função endócrina e câncer/ MicroRNAs: novel class of gene regulators involved in endocrine function and cancer

Ricarte Filho, Júlio C.M.; Kimura, Edna Teruko
2006-12-01

Resumo em português MicroRNAs (miRNAs) representam uma nova classe de RNAs endógenos de ~22 nucleotídeos, que atuam como silenciadores pós-transcricionais, inibindo a tradução de RNAs mensageiros-alvo. Descobertos há pouco mais de uma década em Caenorhabditis elegans, os miRNAs são hoje reconhecidos como reguladores fundamentais da expressão gênica em plantas e animais. Até o momento, identificaram-se 462 genes de miRNA no genoma humano e estima-se que esse número supere 1000 miR (mais) NAs distintos. Análises bioinformáticas indicam que um único miRNA atue em diversos RNAs mensageiros, influenciando múltiplas vias de sinalização concomitantemente e apresentando enorme potencial regulatório. Apesar da biologia dos miRNAs ser ainda pouco entendida, essas moléculas já foram relacionadas a diversos processos biológicos. Além disso, a expressão anômala destes pequenos RNAs tem sido associada a diferentes patologias humanas, inclusive aquelas relacionadas ao sistema endócrino e câncer. Resumo em inglês MicroRNAs (miRNAs) represent a novel class of endogenous ~22-nucleotide RNAs that negatively regulate gene expression by inhibiting translation of target RNAs. Discovered just over a decade ago in Caenorhabditis elegans, miRNAs are now recognized as one of the major regulatory gene families in plants and animals. In the human genome, 462 miRNA genes have been discovered and the estimated number of miRNAs is as high as 1000. Bioinformatics analysis indicated that a unique (mais) miRNA acts on several mRNA, influencing multiple signaling pathways concomitantly, thus presenting enormous regulatory potential. Although the biology of miRNAs is not well understood, recent evidences have linked these molecules to diverse biological processes. Moreover, aberrant expression of miRNAs has been associated to human disease, including that related to the endocrine system and cancer.

Scientific Electronic Library Online (Portuguese)

76

Peptídeos bombesina-símiles: novos reguladores da secreção adeno-hipofisária

Ortiga-Carvalho, Tânia M.; Pazos-Moura, Carmen C.
2000-08-01

Resumo em português A neuromedina B (NB) e o peptídeo liberador de gastrina são peptídeos bombesina-símiles encontrados em mamíferos, inclusive em seres humanos. Ambos inibem a secreção hipofisária de tireotrofina (TSH); entretanto, somente a NB tem importância fisiológica demonstrada. A NB é produzida em abundância em tireotrofos e parece inibir a secreção de TSH por via autócrina, uma vez que o bloqueio do peptídeo endógeno causa aumento na liberação do TSH, tanto in viv (mais) o quanto in vitro. A NB é positivamente regulada pelos hormônios tireóideos (HT). Os HT aumentam o conteúdo de neuromedina B e do seu RNAm em adeno-hipófises de ratos hipotireóideos, poucas horas após sua administração, o que coincide com diminuição do TSH sérico. Isto nos levou a sugerir que a NB possa ser um intermediário protéico envolvido na inibição aguda da liberação de TSH induzida pelos HT. O TRH também altera rapidamente a expressão da NB. Quinze e 30 minutos após a administração do TRH em ratos normais já há diminuição do conteúdo hipofisário de NB e dos níveis do seu RNAm. No jejum e diabetes experimental, que se caracterizam por diminuição de HT séricos com níveis inadequadamente normais ou diminuídos de TSH, ocorre aumento do conteúdo de NB e de seu RNAm. O análogo de somatostatina, octreotide, também é capaz de aumentar o conteúdo de NB. Assim, a neuromedina B é um importante inibidor local da secreção de TSH, podendo ser uma via final comum de hormônios e neuro-hormônios que determinam variações na secreção de TSH. Resumo em inglês Neuromedin B (NB) and gastrin-releasing peptide (GRP) are mammalian bombesin-like peptides. Both peptides have inhibitory effects on thyrotropin (TSH) secretion, however NB is the one that proved to be physiologically relevant. The administration of NB reduces serum TSH of eu- and hypothyroid rats, while the antiserum against NB, that blocks the endogenous peptide, increases TSH secretion. NB is abundantly produced in thyrotrophs and acts locally as a autocrine factor to (mais) inhibit TSH release since isolated pituitaries increase the release of TSH in the presence of the specific antiserum. Thyroid hormones (TH) up-regulate pituitary NB peptide and mRNA content. This is a rapid effect: in hypothyroid rats it is seen within a few hours after a single injection of TH, and coincides with TSH suppression. These results suggest that NB could be an intermediary factor in the acute suppressive effect of TH on TSH secretion. TRH also rapidly changes NB expression. In normal rats, 15 to 30 minutes after TRH administration the pituitary NB peptide and mRNA content are already decreased. In experimental fasting and diabetes mellitus, which are characterized by inappropriately normal or decreased serum TSH, both the NB peptide and its mRNA pituitary content are increased. Octreotide, a somatostatin analog, also is able to increase pituitary neuromedin B content. Therefore, we propose that neuromedin B is a physiologically relevant local inhibitor of TSH secretion that may act as a final common pathway for hormones and neurohormones that modulate the rate of TSH secretion.

Scientific Electronic Library Online (Portuguese)

77

O desmame precoce afeta o ganho de peso e a composição corporal em camundongos adultos?/ Does early weaning influence weight gain and body composition in adult mice?

Rogero, Marcelo Macedo; Borges, Maria Carolina; Pires, Ivanir Santana de Oliveira; Tirapegui, Julio
2010-02-01

Resumo em português OBJETIVO: Avaliar o efeito do desmame precoce sobre o ganho de peso e a composição corporal de camundongos adultos jovens. MÉTODOS: Camundongos Swiss Webster, machos, foram desmamados precocemente (14º dia de vida) ou amamentados até o 21º dia de vida (grupo controle). Após o desmame, os animais foram alimentados com ração elaborada para roedores em crescimento até o 63º dia de vida, quando então foram sacrificados. RESULTADOS: O peso corporal dos animais do g (mais) rupo desmamado de forma precoce foi significantemente maior no 28º, 35º e no 63º dias de vida em relação ao grupo controle (p Resumo em inglês OBJECTIVE: The objective of this study was to assess the effect of early weaning on weight gain and body composition of young adult mice. METHODS: Swiss Webster male mice were weaned early, on the 14th day of life, or breastfed until the 21st day of life (control group). After weaning, the animals were fed a chow specifically made for growing rodents up to the 63rd day of life, when they were sacrificed. RESULTS: The body weight of the animals from the early-weaned group (mais) was significantly greater on the 28th, 35th, 63rd days of life compared to those from the control group (p

Scientific Electronic Library Online (Portuguese)

78

Mutação mitocondrial C1494T, deficiência auditiva e uso de antibióticos aminoglicosídeos/ C1494T mitochondrial dna mutation, hearing loss, and aminoglycosides antibiotics

Postal, Mariana; Palodeto, Bruna; Sartorato, Edi Lúcia; Oliveira, Camila Andréa de
2009-12-01

Resumo em português Tendo em vista a complexidade do mecanismo da audição, não é difícil compreender que a deficiência auditiva possa resultar de ampla variedade de anomalias geneticamente determinadas, bem como de diversos fatores ambientais. Mutações específicas no gene 12S rRNA em DNA mitocondrial são responsáveis por perda da audição não-sindrômica de herança materna, e pelo aumento da susceptibilidade ototóxica dos antibióticos aminoglicosídeos. OBJETIVO: Neste trabal (mais) ho, nós avaliamos a presença da mutação C1494T entre os indivíduos ouvintes e com deficiência auditiva que utilizaram aminoglicosídeos e os que não tiveram contato com o antibiótico. MATERIAL E MÉTODO: Foram estudados 20 pacientes com deficiência auditiva neurossensorial não-sindrômica sem histórico de sensibilização aos aminoglicosídeos e 40 recém-nascidos, prematuros e de alto-risco que utilizaram a droga ototóxica, dos quais 20 eram ouvintes e 20 com perda auditiva. As amostras foram analisadas por PCR-RFLP com a enzima de restrição Hph I. FORMA DE ESTUDO: Experimental. RESULTADOS: A mutação mitocondrial C1494T no gene 12S rRNA não foi detectada em nenhuma das amostras analisadas. CONCLUSÃO: Nossos dados sugerem que a deficiência auditiva dos indivíduos analisados não está relacionada com a ototoxicidade da mutação C1494T, demonstrando que esta mutação não é frequente em nossa população. Resumo em inglês In view of the complex mechanism of hearing, it is not difficult to understand that hearing impairment may result from a wide variety of genetically determined anomalies and various environmental factors. Specific mutations in the mitochondrial DNA 12S rRNA gene are responsible for maternally inherited non-syndromic hearing loss, and for increased susceptibility to the ototoxicity of aminoglycoside antibiotics. AIM: To asses the presence of C1494T mutation among individua (mais) ls with normal hearing and hearing impairment who used aminoglycosides and those who had not had contact with the antibiotic. MATERIAL AND METHOD: The study was composed of 20 patients with nonsyndromic sensorineural hearing loss without prior use of aminoglycosides and 40 premature and high-risk newborns who used ototoxic drugs, of whom 20 had good hearing and 20 had hearing loss. The samples were analyzed by PCR-RFLP with the restriction enzyme Hph I. STUDY DESIGN: Experimental. RESULTS: The mitochondrial 12S rRNA C1494T mutation was not detected in any of the samples analyzed. CONCLUSION: Our data suggest that the hearing loss of the individuals we analyzed was not related to the ototoxicity of mutation C1494T, showing that this mutation is not frequent in our population.

Scientific Electronic Library Online (Portuguese)

79

Identificação e avaliação de rizobactérias isoladas de raízes de milho/ Identification and evaluation of bacteria isolated from roots of maize

Pedrinho, Eliamar Aparecida Nascimbém; Galdiano Júnior, Renato Fernandes; Campanharo, João Carlos; Alves, Lúcia Maria Carareto; Lemos, Eliana Gertrudes de Macedo
2010-12-01

Resumo em português Estudos sobre a atividade microbiológica que ocorre na rizosfera de diversos vegetais levaram ao descobrimento de grupos de microrganismos importantes para o desenvolvimento vegetal. Dentre eles estão as rizobactérias que são capazes de colonizar as raízes, estimulando-a diretamente ou beneficiando o crescimento e o desenvolvimento de diversas plantas. Estas bactérias são chamadas Rizobactérias Promotoras de Crescimento em Plantas (RPCP). Este trabalho teve o obje (mais) tivo de isolar, identificar, testar a capacidade da solubilização de fosfato e a produção de ácido indol acético (AIA) de bactérias que habitam a rizosfera de plantas de milho. A análise parcial do gene 16S rRNA dos 58 isolados possibilitou a identificação dos gêneros, Bacillus, Burkholderia e Azospirillum, sendo os mais frequentes totalizando 68% dos isolados, seguidos de Sphingomonas, Pseudomonas, Herbaspirillum, Pantoea , Bosea. Desses, 27 apresentaram a capacidade de solubilização do fosfato e 18 foram positivos no teste colorimétrico para detecção de produção do AIA. A partir destes resultados, selecionou-se um organismo pertencente ao gênero Sphingomonas para ser testado em casa de vegetação como promotor de crescimento com as estirpes de Azospirillum brasilense (AbV5 e AbV6). As plantas foram avaliadas quanto à altura aos vinte e setenta dias após a germinação e a massa seca da parte aérea (MSPA)e parte radicular (MSPR) foi quantificada após setenta dias no encerramento do experimento. Os resultados das análises do isolado pertencente ao gênero Sphingomonas foram estatisticamente semelhantes às estirpes AbV5 e AbV6 na planta de milho indicando que este microrganismo possui potencial para ser utilizado como RPCP Resumo em inglês Researches about microbiological activity on many plants rizosphere led to the discovery of groups of important microrganisms for plants development. Among them there are the rizobacteria able to colonize the roots, stimulating directly or benefiting many plants. These bacteria are called Growth Promoting Rizobacteria or GPR. In view of this, the present study was performed, aiming to isolate, identify and test phosphate solubilization and acetic indol acid (AIA) producti (mais) on in bacteria that lives in maize roots. The partial analysis of the 16S rRNA gene of the 58 isolates enabled the identification of the genres Bacillus, Burkholderia and Azospirillum, and the most frequent totaling 86% of the isolates, followed by Sphingomonas, Pseudomonas, Herbaspirillum, Pantoea and Bosea. Out of the 58 isolates, 27 showed the capacity of phosphate solubilization and 18 were positive to the AIA production colorimetric detection test. From these results was chosen an organism belonging to the genre Sphingomonas to be tested at greenhouse as growth promoter with the strains Azospirillum brasiliense (AbV5 e AbV6). The plants were assessed twenty and seventy days after germination. Dry mass of shoot and root parts were quantified after seventy days at the end of the experiment. Statistical analysis indicated by the program Statistix v.9.0 showed that the isolates belonging to the genre Sphingomonas presented similar results as shown by strains AbV5 and AbV6 on maize plant. This microorganism may become a promising one to be used as a GPR

Scientific Electronic Library Online (Portuguese)

80

Identificação diferencial de Rhodococcus equi e Dietzia maris em bubalinos/ Differential identification of Rhodococcus equi and Dietzia maris in buffaloes

Viana, L.R.; Krewer, C.C.; Drescher, G.; Lazzari, A.; Botton, S.A.; Costa, M.M.; Loreto, E.L.S.; Vargas, A.C.
2009-08-01

Resumo em português Foram analisados 24 isolados bacterianos oriundos de leite e pele de búfalas (Bubalus bubalis), os quais foram previamente identificados como Rhodococcus equi com o auxílio de fenotipia concisa. Testes fenotípicos complementares e ferramentas moleculares foram utilizados com o objetivo de caracterizar esses isolados, bem como diferenciá-los de outros microrganismos intimamente relacionados. Observaram-se três fenótipos distintos, porém a identificação dos isolado (mais) s foi inconclusiva. Apenas um dos isolados foi comprovado como sendo R. equi com a realização da PCR espécie-específica, sequenciamento e análise dos fragmentos de DNA. Os demais isolados só foram identificados pelo sequenciamento de fragmento do gene que codifica a região 16S do rRNA universal de bactérias, indicando tratar-se de Dietzia maris. O perfil de susceptibilidade aos antimicrobianos revelou maior resistência dos isolados de D. maris para oxacilina (96%) e rifampicina (87%). O isolado de R. equi apresentou resistência à amicacina, oxacilina, penicilina, rifampicina e tetraciclina. Alerta-se para o risco da incorreta identificação dos isolados baseados em testes fenotípicos concisos e para a necessidade de utilização de testes complementares para diferenciação entre R. equi e D. maris. Resumo em inglês Twenty-four bacterial isolates from milk and skin of buffalo females (Bubalus bubalis), which previously had been identified as Rhodococcus equi by using a restricted number of phenotypical tests for bacterial characterization, were analyzed. The goal of this study was to perform the characterization of these isolates, as well as the differentiation of other microorganisms closely related by using additional phenotypical tests and molecular tools. Based on the phenotypica (mais) l results, three different biotypes were obtained. However, the identification of the isolates was inconclusive. Only one of the isolates was confirmed as R. equi by the PCR specifically for this species, as well DNA sequencing and DNA fragment analysis. All the other isolates only could be precisely identified after the DNA sequencing, and they were characterized as Dietzia maris. The sensitivity profile to antimicrobials demonstrated the highest resistance of D. maris to oxacillin and rifampin, 96% and 87%, respectively. R. equi isolate, presented resistance to amikacin, oxacillin, penicillin, rifampin, and tetracycline. Thus, it is important to alert for the risk of the incorrect identification of the bacterial isolates by using diagnostic analysis based on phenotypical tests in order to differentiate R. equi and D. maris, besides the necessity to use complementary tests for differentiation of these microorganisms.

Scientific Electronic Library Online (Portuguese)

81

Hibridização in situ com sonda não-radioativa para mRNA: princípios e aplicações em patologia/ In situ hybridization with non-radioactive riboprobes: principles and applications in pathology

Silva-Valenzuela, Maria das Graças da; Almeida, Fernanda Campos S.; Matizonkas-Antonio, Luciana Fasanella; Libório, Tatiana Nayara; Acquafreda, Thais; Cazal, Claudia; Ferraz, Alberto; Nunes, Fábio Daumas
2006-06-01

Resumo em português A técnica de hibridização in situ (ISH) tem sido usada para identificar mRNA (ou DNA) em amostras de tecido de material humano e animal. Embora uma série de protocolos para essa técnica seja utilizada, as descrições não são bem detalhadas. O objetivo deste trabalho é descrever a reação de hibridização in situ em tecido fresco e sua aplicação em patologia, tornando mais compreensível essa técnica tão importante, que possibilita observar a localização t (mais) ecidual e a expressão temporal e espacial dos transcritos de um determinado gene (mRNA). Resultados de reações com as ribossondas PITX1, SHH e WNT-5A, realizadas em amostras de tecido congelado, são apresentados. Resumo em inglês In situ hybridization (ISH) has been used to identify mRNA (or DNA) in fresh tissue samples of humans and animals. Several protocols describing this technique are available, although its description is not usually detailed enough. The present work describes in situ hybridization reaction on fresh tissue in a way to make understandable this important technique, which allows verifying the cellular localization, and the spatial and temporal expression, of gene transcripts (mRNA). Results with PITX1, TGIF, SHH and WNT-5A riboprobes, in fresh tissue samples, are presented.

Scientific Electronic Library Online (Portuguese)

83

Formação in vitro de túbulos capilares a partir de células de sangue de cordão umbilical humano com perspectivas para aplicação terapêutica/ In vitro formation of capillary tubules from human umbilical cord blood cells with perspectives for therapeutic application

Senegaglia, Alexandra Cristina; Brofman, Paulo Roberto Slud; Aita, Carlos Alberto Mayora; Dallagiovanna, Bruno; Rebelatto, Carmen Lúcia Kuniyoshi; Hansen, Paula; Barchiki, Fabiane; Krieger, Marco Aurélio
2008-12-01

Resumo em português OBJETIVO: As células progenitoras endoteliais (CPE), caracterizadas pelo marcador CD133+, contribuem para a neovascularização, e o aumento no número dessas células pode ser uma ferramenta terapêutica promissora. O sangue de cordão umbilical humano contém um número significante de CPE, sugerindo a possibilidade do uso destas células para a revascularização de tecidos isquêmicos. O objetivo desse trabalho foi analisar a funcionalidade das células CD133+ difere (mais) nciadas in vitro. MÉTODOS: As células diferenciadas foram caracterizadas por citometria de fluxo; a expressão do mRNA de VEGF foi avaliada por RT-PCR e a funcionalidade, por meio de ensaios de formação de túbulos capilares. RESULTADOS: As células diferenciadas perderam os marcadores de CPE, mantiveram em níveis baixos os marcadores das linhagens hematopoética e monocíticas e aumentaram a expressão dos marcadores de células endoteliais adultas. As células diferenciadas apresentaram transcritos no mRNA de VEGF e mostraram-se capazes de formar túbulos capilares in vitro. CONCLUSÃO: As células CD133+ diferenciadas in vitro em células endoteliais demonstraram serem funcionalmente ativas, abrindo perspectiva para seu uso futuro em aplicações terapêuticas. Resumo em inglês OBJECTIVE: Endothelial progenitor cells (EPC) caracterized by the CD133+ marker, contribute to the neovascularization. Increasing EPC number in vitro could be a promising therapeutic tool. Human umbilical cord blood maintains a significant number of EPC, suggesting the possibility to use these cells to induce the revascularization of ischemic tissues. The aim of this study was to analize the in vitro function of differentiated CD133+ cells. METHODS: Cells were characteriz (mais) ed by flow cytometry, VEGF mRNA expression was evaluated by the RT-PCR analysis and the functionally by essays of capillary tubes formation. RESULTS: Differentiated cells lost EPC markers, maintained low levels of markers for hematopoietic and monocytic cell lines and increased the expression of adult endothelial cell markers. Differentiated cells expressed VEGF mRNA and were capable to induce in vitro capillary tubules formation. CONCLUSION: CD133+ cells differentiated into endothelial cells in vitro are functionally active initiating the possibility of their use in future therapeutic applications.

Scientific Electronic Library Online (Portuguese)

84

Expressão dos protooncogenes c-fos, c-myc e c-jun em miométrio normal e mioma humanos/ Expression of the protooncogenes c-fos, c-myc and c-jun in human normal miometrium and leiomyoma

Ferrari, Ana Luiza; Robeiro, Maria Flávia Marques; Reche, Mateus; Brum, Ilma S.; Kohek, Maria Beatriz; Corleta, Helena von Eye; Capp, Edison
2006-10-01

Resumo em português OBJETIVO: Comparar a expressão gênica (mRNA) e protéica dos protooncogenes c-fos, c-myc e c-jun em miométrio normal e mioma humanos. MÉTODOS: Foi realizado um estudo do tipo caso-controle. O material foi coletado de 12 pacientes submetidas a histerectomia no Hospital de Clínicas de Porto Alegre. A expressão do mRNA específico para c-myc, c-fos, c-jun e beta-microglobulina foi avaliada pela técnica de RT-PCR, utilizando primers específicos para cada gene. A expre (mais) ssão protéica destes protooncogenes foi avaliada através de Western blot com anticorpos específicos. RESULTADOS: Não houve diferença significativa para expressão gênica desses protooncogenes entre miométrio normal e mioma (c-myc: 0,87 ± 0,08 vs 0,87 ± 0,08, p = 0,952; c-fos: 1,10 ± 0,17 vs 1,01 ± 0,11, p = 0,21; c-jun: 1,03 ± 0,12 vs 0,96 ± 0,09, p = 0,168, respectivamente). Não houve diferença significativa para expressão protéica desses protooncogenes entre miométrio normal e mioma (c-myc: 1,36 ± 0,48 vs 1,53 ± 0,29, p = 0,569; c-fos: 8,85 ± 5,5 vs 6,56 ± 4,22, p = 0,434; e c-jun: 6,47 ± 3,04 vs 5,42 ± 2,03, p = 0,266, respectivamente). CONCLUSÃO: A expressão gênica (transcrição) e a expressão protéica (tradução) dos protooncogenes c-myc, c-fos e c-jun em mioma e miométrio normal são semelhantes. Resumo em inglês Uterine myomas are common benign tumors of the female genital tract. The expression of growth factor signal transduction cascade components including the protooncogenes c-myc, c-fos, and c-jun seem to be involved in the development of myomas. PURPOSE: To compare the gene (mRNA) and protein expression of the protooncogenes c-fos, c-myc, and c-jun in human normal myometrium and leiomyoma. METHOD: A case-control study was performed. Samples were collected from 12 patients su (mais) bmitted to hysterectomy at the Hospital de Clínicas at Porto Alegre. The expression of the specific mRNA for c-myc, c-fos, c-jun, and beta-microglobulin was assessed through the RT-PCR technique, using specific primers to each gene. The protein expression of these protooncogenes was evaluated through the Western blot technique with specific antibodies. RESULTS: No statistically significant difference was observed in the gene expression for these protooncogenes between normal myometrium and leiomyoma (c-myc: 0,87 ± 0,08 vs 0,87 ± 0,08, p = 0,952; c-fos: 1,10 ± 0,17 vs 1,01 ± 0,11, p = 0,21; c-jun: 1,03 ± 0,12 vs 0,96 ± 0,09, p = 0,168, respectively). No statiscally significant difference was observed for the protein expression of these protooncogenes between normal myometrium and leiomyoma (c-myc: 1,36 ± 0,48 vs 1,53 ± 0,29, p = 0,569; c-fos: 8,85 ± 5,5 vs 6,56 ± 4,22, p = 0,434; e c-jun: 6,47 ± 3,04 vs 5,42 ± 2,03, p = 0,266, respectively). CONCLUSION: No difference was observed in the gene expression (transcription) nor in the protein expression (translation) of the protooncogenes c-myc, c-fos, and c-jun between leiomyoma and myometrium.

Scientific Electronic Library Online (Portuguese)

85

Expressão de TGFβ1 mRNA nas fases iniciais de expansão da sutura palatina mediana/ The expression of TGFβ1 mRNA in the early stage of the midpalatal suture cartilage expansion

Kobayashi, Emilia Teruko; Shibata, Yasuaki; Veltrini, Vanessa Cristina; Suguino, Rosely; Machado, Fabricio Monteiro de Castro; Provenzano, Maria Gisette Arias; Ferronato, Tatiane; Kato, Yuzo
2010-12-01

Resumo em português INTRODUÇÃO: a expansão da maxila induz a formação de novo osso na sutura palatina mediana por um processo de proliferação e diferenciação celular. A força de expansão pode estimular, nas células progenitoras, a produção de citocinas com atividade osteoindutiva, tais como o transforming growth factor β1(TGFβ1). OBJETIVOS: o principal objetivo deste estudo foi determinar a função dessa citocina nos estágios iniciais de expansão da sutura palatina (mais) mediana. MÉTODOS: um aparelho ortodôntico foi instalado entre os molares superiores direito e esquerdo de ratos com 4 semanas de idade. A força de expansão inicial foi de 50g. Os grupos controle e experimental foram sacrificados nos dias 0, 2 e 5. Cortes bucais de 6µm foram obtidos e sujeitos à técnica de hibridização in-situ. RESULTADOS: dois dias após a aplicação de força, as células osteocondroprogenitoras, distribuídas no lado interno do tecido cartilaginoso, exibiram altos níveis de transcrição de transforming growth factor β1. No dia 5, o nível de transcrição de TGFβ1 foi observado nos osteócitos e nas células osteoblásticas, na superfície do novo osso. A atividade osteoblástica foi confirmada por meio de um estudo imunohistoquímico utilizando-se Osteocalcina-Pro (OC-Pro). CONCLUSÕES: os dados sugerem que a expansão da sutura palatina induz a diferenciação de células osteocondroprogenitoras em osteoblastos, estimuladas pela produção de citocinas Resumo em inglês INTRODUCTION: The application of an orthodontic expansion force induces bone formation at the midpalatal suture because of cell proliferation and differentiation. Expansion forces may stimulate the production of osteoinductive cytokines, such as transforming growth factor β1 (TGFβ1), in the progenitor cells. OBJECTIVES: This study determined the role of TGFβ1 in the early stage of midpalatal suture cartilage expansion. METHODS: A rectangular orthodontic app (mais) liance was placed between the right and left upper molars of 4-week-old rats. The initial expansion force was 50 g. Animals in the control and experimental groups were sacrified on days 0, 2, and 5 and 6 µmm thick sections were prepared for an in situ hybridization technique. RESULTS: Two days after the application of force, prechondroblastic and undifferentiated mesenchymal cells distributed along the inner side of the cartilaginous tissue had high levels of TGFβ1 transcription. On day 5, the TGFβ1 transcription was found in osteocytes and osteoblastic cells on the surface of newly formed bone. Immunohistochemistry using Osteocalcin-Pro (OC-Pro) confirmed osteoblastic activity. Conclusions: Results suggest that the expansion of midpalatal suture cartilage induces differentiation of osteochondroprogenitor cells into osteoblasts after stimulation by cytokine production

Scientific Electronic Library Online (Portuguese)

86

Estudo de família brasileira portadora de deficiência auditiva sensorioneural não-sindrômica com herança mitocondrial/ Study of a Brazilian family presenting non-syndromic hearing loss with mitochondrial inheritance

Pupo, Altair Cadrobbi; Pirana, Sulene; Spinelli, Mauro; Lezirovitz, Karina; Mingroni Netto, Regina C.; Macedo, Lisandra S.
2008-10-01

Resumo em português O presente estudo teve como objetivo descrever os achados audiológicos e genéticos de nove membros de uma família brasileira que apresenta a mutação no DNA mitocondrial. Todos os nove membros realizaram estudo genético, avaliação foniátrica e audiológica (audiometria tonal e logoaudiometria). O estudo genético revelou a presença de mutação mitocondrial A1555G no gene 12S rRNA (MT-RNR-1) do DNA mitocondrial em todos os sujeitos. Oito sujeitos apresentaram def (mais) iciência auditiva e somente um apresentou limiares auditivos normais até o término da realização do estudo. Os resultados audiológicos apontaram para perdas auditivas bilaterais, com prevalência das simétricas, de configurações e graus variados (de moderado a profundo) e pós-linguais. Progressão da perda auditiva foi observada em dois irmãos afetados. Não foi possível afirmar a época do início da perda auditiva por falta de informação dos sujeitos, no entanto, observou-se manifestação da perda em crianças e adultos. As mutações no DNA mitocondrial representam uma causa importante de perda auditiva, sendo imprescindível a realização do diagnóstico etiopatológico, a fim de retardar o início ou evitar a progressão da surdez. Resumo em inglês We hereby report on the audiological and genetic findings in individuals from a Brazilian family, with the following mitochondrial mutation A1555G in the 12SrRNA gene (MT-RNR-1). Nine individuals underwent speech, audiologic (tonal audiometry and logoaudiometry) and genetic evaluations. Eight individuals among the A1555G carriers were affected by hearing impairment and one person had normal hearing thresholds till the end of the present study. The audiologic evaluation re (mais) sults indicated normal hearing thresholds all the way to bilateral profound hearing loss with post-lingual onset and variable configuration. Two affected siblings presented progressive hearing loss. It was impossible to precise the time of hearing loss onset; however, the impairment was present in both children and adults. The genetic study revealed the A1555G mitochondrial mutation in the 12SrRNA gene. Given the prevalence of mitochondrial mutations as a cause of hearing loss, it is fundamental to perform the etiopathologic diagnosis in order to postpone the onset or avoid hearing impairment progression. This kind of hearing impairment represents a challenge to the professionals since there are no physical traits that indicate genetic transmission.

Scientific Electronic Library Online (Portuguese)

87

Drogas anti-VIH: passado, presente e perspectivas futuras/ Drugs anti-HIV: past, present and future perspectives

Souza, Marcus Vinícius Nora de; Almeida, Mauro Vieira de
2003-05-01

Resumo em inglês Currently available anti-HIV drugs can be classified into three categories: nucleoside analogue reverse transcriptase inhibitors (NRTIs), non-nucleoside reverse transcriptase inhibitors (NNRTIs) and protease inhibitors (PIs). In addition to the reverse transcriptase (RT) and protease reaction, various other events in the HIV replicative cycle can be considered as potential targets for chemotherapeutic intervention: (1) viral adsorption, through binding to the viral envelo (mais) pe glycoprotein gp120; (2) viral entry, through blockage of the viral coreceptors CXCR4 and CCR5; (3) virus-cell fusion, through binding to the viral envelope glycoprotein gp 41; (4) viral assembly and disassembly through NCp7 zinc finger-targeted agents; (5) proviral DNA integration, through integrase inhibitors and (6) viral mRNA transcription, through inhibitors of the transcription (transactivation) process. Also, various new NRTIs, NNRTIs and PIs have been developed, possessing different improved characteristics.

Scientific Electronic Library Online (Portuguese)

88

Dois novos sistemas de diagnose precoce da meleira do mamoeiro/ Two new systems of early diagnosis of papaya sticky disease

Tavares, Eder T.; Tatagiba, Joseli S.; Ventura, José A.; Souza Jr., Manoel T.
2004-10-01

Resumo em português A diagnose da meleira do mamoeiro (Carica papaya)tem sido feita mediante observação de sintomas que aparecem principalmente nos frutos ou pela detecção de dsRNA de cerca de 12 kb, purificado a partir do látex em coluna de CF11, em gel de agarose ou poliacrilamida. Os sintomas nos frutos são tardios e permitem longa permanência de plantas infectadas no campo e o processo usado para detectar dsRNA é laborioso, não se prestando a detecção em larga escala. Visando (mais) disponibilizar protocolos de diagnose precoce da meleira que possam ser usados em larga escala, o presente trabalho apresenta dois métodos de detecção relativamente baratos, rápidos e que permitem o manuseio de dezenas de amostras por dia. Os dois métodos utilizam o látex extraído dos frutos, folhas ou caule de plantas, e se baseiam na extração e visualização de ácidos nucléicos. A presença do vírus é confirmada pela visualização do seu dsRNA em gel de agarose (1%) em 1X TBE. Com esta técnica temos conseguido resultados confiáveis a ponto de diagnosticar precocemente a meleira em plantas ainda jovens e em plantas assintomáticas. Resumo em inglês Papaya sticky disease was first reported affecting papaya (Carica papaya) in Brazil in the late 80s. Today this disease is found in the papaya production areas throughout Brazil, and in some of them it became the main limiting factor for the papaya industry. The primary disease symptom is an excessive exudation of highly fluid latex that becomes dark as result of oxidation and turns the fruit unmarketable. It is caused by a new virus that has an isometric particle (40-50 (mais) nm in diameter), and a unique 12 kb long dsRNA molecule. Since its diagnosis is done mainly by observation of the symptoms on the fruit, infected plants may be source of inoculum for several months before diagnosis. Another form of diagnosis is the detection of dsRNA from leaves and latex using CF11 columns. This is a laborious system not suited to large scale usage. The present work presents two cheap and fast diagnostic protocols. These protocols use latex obtained from fruits, leaves and stems, and are based on the extraction and visualization of nucleic acids. Presence of the virus is confirmed by the visualization of dsRNA on agarose (1%) gel in 1X TBE. Using these protocols it is possible to confirm the presence of the virus in young and assymptomatic plants.

Scientific Electronic Library Online (Portuguese)

89

Doença pulmonar intersticial relacionada a miosite e a síndrome antissintetase/ Myositis-related interstitial lung disease and antisynthetase syndrome

Solomon, Joshua; Swigris, Jeffrey J; Brown, Kevin K
2011-02-01

Resumo em português Em pacientes com miosite, é comum o comprometimento pulmonar, e a presença de anticorpos anti-aminoacil-RNAt sintetase (anti-ARS) é preditora da presença ou do desenvolvimento de doença pulmonar intersticial (DPI). Uma entidade clínica distinta - a síndrome antissintetase - é caracterizada pela presença de anticorpos anti-ARS, miosite, DPI, artrite, fenômeno de Raynaud e "mãos de mecânico". O mais comum anticorpo anti-ARS é o anti-Jo-1. Anticorpos anti-ARS ma (mais) is recentemente descritos podem conferir um fenótipo que é distinto daquele de pacientes com positividade para anti-Jo-1, sendo caracterizado por uma menor incidência de miosite e uma maior incidência de DPI. Nos pacientes com DPI relacionada à síndrome antissintetase, a resposta a medicações imunossupressoras é em geral favorável. Resumo em inglês In patients with myositis, the lung is commonly involved, and the presence of anti-aminoacyl-tRNA synthetase (anti-ARS) antibodies marks the presence or predicts the development of interstitial lung disease (ILD). A distinct clinical entity-antisynthetase syndrome-is characterized by the presence of anti-ARS antibodies, myositis, ILD, fever, arthritis, Raynaud's phenomenon, and mechanic's hands. The most common anti-ARS antibody is anti-Jo-1. More recently described anti- (mais) ARS antibodies might confer a phenotype that is distinct from that of anti-Jo-1-positive patients and is characterized by a lower incidence of myositis and a higher incidence of ILD. Among patients with antisynthetase syndrome-related ILD, the response to immunosuppressive medications is generally, but not universally, favorable.

Scientific Electronic Library Online (Portuguese)

90

Detecção e identificação molecular de vírus associados a videiras sintomáticas e assintomáticas/ Molecular detection and identification of virus associated with symptomatic and symptomless grapevines

Basso, Marcos Fernando; Fajardo, Thor Vinícius Martins; Eiras, Marcelo; Ayub, Ricardo Antônio; Nickel, Osmar
2010-11-01

Resumo em português A propagação vegetativa da videira favorece infecções virais múltiplas, com expressão diferencial de sintomas em função da combinação da cultivar ou espécie da hospedeira com a espécie viral. Os objetivos deste trabalho foram detectar e identificar as espécies virais presentes em duas espécies/cultivares de videira: uma sintomática e outra assintomática. DsRNA de ambas as amostras foi submetido à RT-PCR com 17 pares de oligonucleotídeos específicos para (mais) a detecção de Grapevine virus A (GVA), Grapevine virus B (GVB), Grapevine virus D (GVD), Grapevine fleck virus (GFkV), Grapevine fanleaf virus (GFLV), Arabis mosaic virus (ArMV), Grapevine chrome mosaic virus (GCMV), Rupestris stem pitting-associated virus (RSPaV), Grapevine leafroll-associated virus 1 a 4 (GLRaV-1 a -4), além de três pares de oligonucleotídeos degenerados. Pelo menos um fragmento amplificado, por par de oligonucleotídeos, foi clonado e sequenciado. Plantas sintomáticas e assintomáticas mostraram infecções múltiplas por RSPaV, GLRaV-2 e/ou GLRaV-3. As sequências de nucleotídeos obtidas para sete isolados de RSPaV, três de GLRaV-2 e dois de GLRaV-3 apresentaram identidades superiores a 90% com espécies homólogas e permitiram a definição das possíveis estirpes presentes nas amostras infectadas. Esses resultados evidenciam a necessidade da diagnose viral baseada em testes específicos para determinar a condição sanitária da videira. Resumo em inglês The vegetative propagation of grapevine facilitates multiple viral infections, with different symptoms which vary according to combinations of cultivar or host species with viral species. The aims of this research were to detect and identify the viral species infecting two grapevine species/cultivars: one symptomatic and one symptomless. DsRNA from both samples was assayed by RT-PCR using 17 pairs of specific primers for detection of the Grapevine virus A (GVA), Grapevine (mais) virus B (GVB), Grapevine virus D (GVD), Grapevine fleck virus (GFkV), Grapevine fanleaf virus (GFLV), Arabis mosaic virus (ArMV), Grapevine chrome mosaic virus (GCMV), Rupestris stem pitting-associated virus (RSPaV) and Grapevine leafroll-associated virus 1-4 (GLRaV-1 to -4), besides three degenerate primer pairs. For each primer pair at least one amplicon was cloned and sequenced. Symtomatic and symptomless plants were multiple infected by RSPaV, GLRaV-2 and/or GLRaV-3. The nucleotide sequences of seven isolates of RSPaV, three of GLRaV-2 and two of GLRaV-3 showed identities higher than 90% with the homologous viral species and allowed to identify possible viral strains in infected samples. These results highlight the necessity of viral diagnosis based on specific assays to determine grapevine sanitary status.

Scientific Electronic Library Online (Portuguese)

91

Detecção de Treponema denticola em casos de abscesso perirradicular agudo/ Detection of Treponema denticola in cases of acute periradicular abscesses

RÔÇAS, Isabela das Neves; SIQUEIRA Jr., José Freitas; FAVIERI, Amauri; SANTOS, Kátia Regina dos
2000-09-01

Resumo em português Nosso objetivo foi detectar Treponema denticola em casos de abscesso perirradicular agudo. O DNA extraído das amostras de pus foi examinado pelo método da "Polymerase Chain Reaction" direcionada para o gene do RNAr (fração 16S). A amplificação usando o "primer" da espécie Treponema denticola permitiu detectá-la em 5 dos 6 casos de abscessos examinados. Apenas uma banda de tamanho esperado foi observada para as amostras positivas para esta bactéria, o que foi conf (mais) irmado pela comparação com o DNA de referência do Treponema denticola (controle positivo). Até o momento, este é o primeiro relato da presença desta espiroqueta, considerada um importante patógeno periodontal em infecções endodônticas. Os resultados sugerem que Treponema denticola também pode ser um importante patógeno endodôntico. Resumo em inglês The purpose of this study was to report the detection of Treponema denticola in five out of six cases of acute periradicular abscesses. The 16S rRNA gene directed Polymerase Chain Reaction was the method utilized. This is probably the first report hitherto of the occurrence of this spirochete in acute periradicular abscesses.

Scientific Electronic Library Online (Portuguese)

92

Delineamento de experimentos em genética genômica/ Experimental design in genetical genomics

Rosa, Guilherme Jordão de Magalhães
2007-07-01

Resumo em português Genética genômica é um termo utilizado para representar o estudo de processos genéticos controladores de caracteres fenotípicos de herança complexa, a partir da análise conjunta de informação relativa a fenótipos, estruturas de parentesco, marcadores moleculares e expressão gênica. Estudos de genética genômica são utilizados, por exemplo, para a estimação da herdabilidade de níveis de transcrição, para o mapeamento de locos controladores da expressao g (mais) ênica (eQTL, do inglês expression Quantitative Trait Loci), e para o estudo de redes regulatórias. Genética genômica geralmente envolve experimentos com microarrays, os quais são ainda bastante caros e trabalhosos, limitando o tamanho amostral e conseqüentemente o poder estatístico de tais estudos. Desta maneira, é essencial que tais experimentos sejam otimizados do ponto de vista do delineamento, a partir de criteriosa escolha das amostras (indivíduos) a serem utilizadas, e do controle rigoroso dos vários fatores que podem afetar as variáveis-resposta de interesse. Outro ponto fundamental na condução de tais experimentos refere-se à marcação das amostras de mRNA com os fluoróforos e ao pareamento das mesmas em cada lâmina de microarray, os quais devem ser cuidadosamente planejados para que não haja confundimento entre estes efeitos e os fatores biológicos de interesse. Nesta apresentação serão discutidas algumas estratégias para o planejamento de estudos de genética genômica, incluindo a seleção de indivíduos objetivando-se a maximização da dissimilaridade genética ou do número de eventos de recombinação, bem como a condução eficiente dos ensaios com microarrays para diferentes objetivos experimentais. Resumo em inglês Genetical genomics experiments combine information on phenotypic traits, molecular markers and gene expression to study the genetic mechanisms governing variation in complex traits. Such studies can be used, for example, to estimate heritabilities of mRNA transcript abundances, to map expression quantitative trait loci (eQTL), and to infer regulatory gene networks. Microarray experiments, however, can be extremely costly and time consuming, which may limit sample sizes an (mais) d statistical power. Thus it is crucial to optimize experimental designs by carefully choosing the subjects to be assayed, and by cautiously controlling systematic factors affecting the system. Also, a rigorous strategy should be used for allocating mRNA samples across slides and dye labeling, so that effects of interest are not confounded with nuisance factors. In this presentation, we review some designs strategies for genetical genomics studies, including the selection of individuals for increased genetic dissimilarity and for a higher number of recombination events, as well as efficient microarray experiment layouts for various experimental goals.

Scientific Electronic Library Online (Portuguese)

93

Classificação taxonômica das estirpes de rizóbio recomendadas para as culturas da soja e do feijoeiro baseada no seqüenciamento do gene 16S rRNA/ Taxonomic classification of rhizobial strains recommended for soybean and common bean crops in Brazil based on the sequencing of the 16s rRNA gene

Chueire, L. M. O.; Bangel, E. V.; Mostasso, F. L.; Campo, R. J.; Pedrosa, F. O.; Hungria, M.
2003-10-01

Resumo em português As culturas da soja [Glycine max (L.) Merrill] e do feijoeiro (Phaseolus vulgaris L.) são de grande importância econômica e social para o Brasil e ambas podem ter seu requerimento de nitrogênio suprido pela simbiose com bactérias da ordem Rhizobiales. Para garantir a maximização do processo biológico, deve-se proceder à inoculação de estirpes de rizóbio eficientes e competitivas, recomendadas pela pesquisa. No Brasil, foram comercializados, na safra 2001/2002, (mais) 14 milhões de doses de inoculantes, dos quais 99 % para as culturas da soja e do feijoeiro. Neste trabalho, determinou-se a posição taxonômica das estirpes utilizadas em inoculantes comerciais para as duas culturas, pelo seqüenciamento da região do DNA que codifica o gene 16S rRNA, que é suficientemente variável, mas carrega as informações necessárias para permitir a análise filogenética de bactérias. O seqüenciamento permitiu definir que duas das estirpes recomendadas para a cultura da soja, SEMIA 587 e SEMIA 5019 (= 29 w), pertencem à espécie Bradyrhizobium elkanii e as duas outras, SEMIA 5079 (=CPAC 15) e SEMIA 5080 (= CPAC 7), à espécie B. japonicum. Determinou-se, ainda, que a estirpe SEMIA 4080 (=PRF 81), recomendada para o cultura do feijoeiro, pertence à espécie Rhizobium tropici. As seqüências obtidas foram depositadas no banco mundial de genes do National Center for Biotechnology Information. Resumo em inglês Soybean [Glycine max (L.) Merrill] and common bean (Phaseolus vulgaris L.) crops are of economical and social importance in Brazil; their requirement for nitrogen can be supplied by the symbiosis with bacteria belonging to the order Rhizobiales. However, to guarantee the maximization of the biological nitrogen fixation, seeds must be inoculated with efficient and competitive strains of rhizobia recommended by research. In 2001/2002, 14 million doses of inoculant were sold (mais) in Brazil, 99 % of these for soybean and common bean crops. In this study the taxonomic position of the strains used in commercial inoculants for both crops was evaluated by sequencing the DNA region that carries the information for the 16S rRNA gene. Although variable, it codes enough information to allow a phylogenetic analysis of the bacteria. Sequencing determined that two of the strains recommended for the soybean crop, SEMIA 587 and SEMIA 5019 (= 29 w), belong to the Bradyrhizobium elkanii, while the two other, SEMIA 5079 (=CPAC 15) and SEMIA 5080 (=CPAC 7), belong to the B. japonicum species. Strain SEMIA 4080 (=PRF 81), recommended for common bean crop, was identified as member of the species Rhizobium tropici. The sequences were included in the GenBank database of the National Center for Biotechnology Information.

Scientific Electronic Library Online (Portuguese)

94

Ceratoconjuntivite por Encephalitozoon hellem em periquitos agapornis (Agapornis spp.) no Brasil: relato de caso/ Keratoconjunctivitis by Encephalitozoon hellem in lovebirds (Agapornis spp.) in Brazil: case report

Nakamura, A.A.; Homem, C.G.; Garcia, S.D.; Meireles, M.V.
2010-08-01

Resumo em português Relata-se um caso de ceratoconjuntivite causada por Encephalitozoon hellem em agapornis (Agapornis spp.) adultos, provenientes de um criatório comercial. Cinco animais apresentaram sinais clínicos de ceratoconjuntivite, blefaroespasmo e blefaroedema bilateral, com presença de secreção seropurulenta. Amostras fecais foram colhidas e foi realizado exame coproparasitológico, com resultado negativo. Dois animais foram necropsiados, sendo detectados, em impressões de ra (mais) spado de conjuntiva ocular, esporos e outros estádios evolutivos de Microsporidium. A confirmação do diagnóstico foi feita pela reação em cadeia de polimerase e sequenciamento de fragmentos amplificados, com utilização de primers específicos para o gene da subunidade 18S do rRNA de E. hellem. A análise dos fragmentos amplificados demonstrou 100% de similaridade com outras sequências de E. hellem publicadas no GenBank. Este é primeiro relato de infecção por E. hellem em aves no Brasil. Resumo em inglês A clinical case of keratoconjunctivitis by Encephalitozoon hellem in adult lovebirds (Agapornis spp.) from a commercial flock is reported. Five animals presented clinical symptoms of keratoconjunctivitis, blepharospasm, and bilateral blepharoedema, with seropurulent secretion. Coproparasitological diagnosis was carried out in fecal samples, with negative results. Two animals were necropsied, with detection of spores and other developmental stages of Microsporidium in conj (mais) unctival smears. The confirmation of the diagnosis was accomplished by the polimerase chain reaction with specific primers for 18S subunit of the rRNA of E. hellem, followed by sequencing of amplified fragments, which revealed 100% of genetic similarity to E. hellem. This study is the first report of E. hellem infection in birds in Brazil.

Scientific Electronic Library Online (Portuguese)

95

Caracterização molecular de acessos de Cratylia argentea e sua relação filogenética com outras leguminosas/ Molecular characterization of Cratylia argentea accessions and its phylogenetic relationship with other legumes

Galdino, Alexsandro Sobreira; Lima, João Paulo Matos Santos; Antunes, Renata de Souza Panarari; Prioli, José Alberto; Thiers, Paulo Roberto; Silva, Glocimar Pereira da; Grangeiro, Thalles Barbosa
2010-08-01

Resumo em português O objetivo deste trabalho foi realizar a caracterização molecular de 11 acessos de Cratylia argentea, com base no sequenciamento da região ITS (ITS1/5,8S/ITS2), bem como o estabelecimento de suas relações filogenéticas com outras leguminosas. As relações filogenéticas dessa espécie com outras 15 leguminosas foram estabelecidas com o uso de sequência do gene que codifica a subunidade 18S do rRNA (rDNA 18S). A amplificação do DNA da região ITS/5,8S dos 11 aces (mais) sos revelou uma única banda de aproximadamente 650 pb. Sequências ITS/5,8S foram obtidas de todos os acessos analisados e depois alinhadas com a região ITS/5,8S da leguminosa Galactia striata. O tamanho das sequências ITS/5,8S dos acessos de C. argentea variou de 565 a 615 pb. Os conteúdos médios de G + C nas regiões ITS1 e ITS2 variaram entre 46 e 47%. O alinhamento múltiplo das seqüências ITS/5,8S dos acessos de C. argentea com Galactia striata revelou a presença de deleções e inserções. Os acessos de C. argentea constituíram um único clado politômico. A análise filogenética de C. argentea demonstrou que essa espécie está incluída no clado das Diocleinae verdadeiras e que os gêneros Calopogonium e Pachyrhizus estão fora desse clado. Resumo em inglês The objective of this work was to molecularly characterize 11 Cratylia argentea accessions, based on the ITS (ITS1/5.8S/ITS2) region sequencing, as well to establish its phylogenetic relationship with other legume species. The phylogenetic relationship of this species with other 15 legume ones was established using a gene sequence that codes the subunit 18S of the rRNA (rDNA 18S). DNA amplification of the ITS/5.8S region of these 11 accessions revealed an amplicon with ar (mais) ound 650 bp. ITS/5.8S sequences were obtained from all accessions analysed, and then aligned with the region ITS/5.8S of Galactia striata legume. The size of ITS/5.8S region ranged from 565 to 615 bp. Average G + C contents in the ITS1 and ITS2 regions ranged between 46 and 47%. The multiple sequence alignment between the ITS sequences from C. argentea accessions and Galactia striata revealed the presence of deletions and insertions. C. argentea accessions formed a unique politomic clade. Cratylia argentea phylogenetic analysis demonstrated that this species is placed into the true Diocleinae Clade, and that Calopogonium and Pachyrhizus are not included in subtribe Diocleinae.

Scientific Electronic Library Online (Portuguese)

96

Caracterização genética de rizóbios nativos dos tabuleiros costeiros eficientes em culturas do guandu e caupi/ Genetic characterization of indigenous rhizobia strains from the coastal tableland efficient for the pigeonpea and cowpea crops

Fernandes, Marcelo Ferreira; Fernandes, Roberta Pereira Miranda; Hungria, Mariangela
2003-08-01

Resumo em português O objetivo deste trabalho foi caracterizar geneticamente sete estirpes de rizóbios nativos dos tabuleiros costeiros de Sergipe com alta eficiência de fixação biológica do N2 em associação com guandu (Cajanus cajan) e caupi (Vigna unguiculata). A amplificação do DNA pela técnica de PCR (polymerase chain reaction) com o oligonucleotídeo específico BOX indicou um grau elevado de diversidade genética, uma vez que todas as estirpes apresentaram perfis únicos de D (mais) NA. A análise por BOX-PCR revelou, ainda, que essa metodologia é eficiente para diferenciar estirpes, mas não para a diferenciação de espécies de rizóbio. Pela técnica do RFLP (restriction fragment length polymorphism) da região do DNA que codifica o gene 16S rRNA e da região intergênica entre os genes 16S e 23S rRNA, com cinco enzimas de restrição, bem como pelo seqüenciamento parcial da região do 16S rRNA, foi possível classificar as estirpes nos gêneros Bradyrhizobium e Rhizobium. Houve coerência entre as análises envolvendo a região do 16S rRNA, mas o agrupamento com uma das estirpes diferiu pela análise do espaço intergênico. Os resultados obtidos com a estirpe R11 indicam variabilidade genética elevada em relação às espécies de rizóbios descritas, inclusive diferindo em diversas bases da região do 16S rRNA, e podem indicar uma nova espécie. Resumo em inglês The objective of this work was to characterize genetically seven indigenous rhizobial strains from the coastal tableland of Sergipe, Brazil, with high efficiency of biological nitrogen fixation with the pigeonpea (Cajanus cajan) and cowpea (Vigna unguiculata) crops. The DNA amplification with the PCR (polymerase chain reaction) technique and the specific primer BOX indicated a high level of genetic diversity, with all isolates showing unique profiles of DNA. The BOX-PCR a (mais) nalysis also indicated that this method is efficient to characterize strains but not to define rhizobial species. The RFLP (restriction fragment length polymorphism) analysis of the 16S rRNA region and of the intergenic region between the 16S and the 23S rRNA genes with five restriction enzymes, as well as the partial sequencing of the 16S rRNA region allowed the classification of the strains into the genera Bradyrhizobium and Rhizobium. There was an agreement between the results obtained by the analysis of the 16S rRNA region, but one strain differed when the intergenic space was considered. The results obtained with strain R11 showed a high level of genetic diversity when compared to the described rhizobial species, including differences in several bases of the 16S rRNA region, and might indicate a new species.

Scientific Electronic Library Online (Portuguese)

97

Caracterização de rizóbios indicados para produção de inoculantes por meio de sequenciamento parcial do 16S rRNA/ Characterization of rhizobia indicated for inoculant production using 16S rRNA partial sequencing

Toledo, Bethânia Figueiredo Barbosa de; Marcondes, Jackson; Lemos, Eliana Gertrudes de Macedo
2009-04-01

Resumo em português O objetivo deste trabalho foi confrontar as sequências parciais do gene 16S rRNA de estirpes padrão de rizóbios com as de estirpes recomendadas para a produção de inoculantes no Brasil, com vistas à verificação da confiabilidade do sequenciamento parcial desse gene para a identificação rápida de estirpes. Foram realizados sequenciamentos através de reação em cadeia da polimerase (PCR) com iniciadores relativos à região codificadora do gene 16S rRNA entre a (mais) s bactérias estudadas. Os resultados foram analisados pela consulta de similaridade de nucleotídeos aos do "Basic Local Alignment Search Tool" (Blastn) e por meio da interpretação de árvores filogenéticas geradas usando ferramentas de bioinformática. A classificação taxonômica das estirpes Semia recomendadas para inoculação de leguminosas com base em propriedades morfológicas e especificidade hospedeira não foi confirmada em todas as estirpes. A maioria das estirpes estudadas, consultadas no Blastn, é consistente com a classificação proposta pela construção de árvores filogenéticas das sequências destas estirpes, com base na similaridade pelo sequenciamento parcial do gene considerado. Resumo em inglês The aim of this work was to compare the partial sequences of 16S rRNA gene of rhizobia strain patterns already classified with strains recommended for the production of inoculants in Brazil, in order to verify the reliability of partial sequencing of the gene for the purpose of rapid identification of strains. Polymerase Chain Reaction (PCR) sequencing using primers on the coding region of the 16S rRNA gene among the bacteria studied was conducted. The results were analyz (mais) ed by consulting the nucleotides' similarity based on Basic Local Alignment Search Tool (Blastn) and by interpreting the phylogenetic trees generated by bioinformatic tools. The taxonomic classification of Semia strains recommended for legume inoculation based on morphological properties and host specificity was not confirmed in all strains. The similarity of the Blastn consultation by partial sequencing of the gene found in strains studied is consistent with the classification proposed by the construction of a phylogenetic tree of sequences of strains in most cases.

Scientific Electronic Library Online (Portuguese)

98

Biotecnologia animal

Coutinho, Luiz Lehmann; Rosário, Millor Fernandes do
2010-01-01

Resumo em português A biotecnologia animal tem fornecido novas ferramentas para os programas de melhoramento e, dessa forma, contribuído para melhorar a eficiência da produção dos produtos de origem animal. No entanto, os avanços têm sido mais lentos do que antecipados, especialmente em razão da dificuldade na identificação dos genes responsáveis pelas características fenotípicas de interesse zootécnico. Três estratégias principais têm sido utilizadas para identificar esses g (mais) enes - mapeamento de QTL, genes candidatos e sequenciamento de DNA e mRNA - e cada uma tem suas vantagens e limitações. O mapeamento de QTL permite determinar as regiões genômicas que contêm genes, mas o intervalo de confiança do QTL pode ser grande e conter muitos genes. A estratégia de genes candidatos é limitada por causa do conhecimento ainda restrito das funções de todos os genes. Os sequenciamentos de genomas e de sequências expressas podem auxiliar na identificação da posição de genes e de vias metabólicas associadas à característica de interesse. A integração dessas estratégias por meio do desenvolvimento de programas de bioinformática permitirá a identificação de novos genes de interesse zootécnico. Assim, os programas de melhoramento genético se beneficiarão pela inclusão da informação obtida diretamente do DNA na avaliação do mérito genético dos plantéis disponíveis. Resumo em inglês Animal biotechnology is providing new tools for animal breeding and genetics and thus contributing to advances in production efficiency and quality of animal products. However, the progress is slower than anticipated, mainly because of the difficulty involved in identifying genes that control phenotypic characteristics of importance to the animal industry. Three main strategies: QTL mapping, candidate genes and DNA and mRNA sequencing have been used to identify genes of e (mais) conomic interest to animal breeding and each has advantages and disadvantages. QTL mapping allows identification of the genomic region that contains the genes, but the confidence interval of the regions is usually large and may contain several genes. Candidate gene approach is limited to our restricted knowledge of the biological function of the genes. Sequencing of genomes and expressed sequences tags can provide identifying gene position and metabolic pathways associated with phenotypic trait. Integrating these strategies using bioinformatics software will allow identifying of novel genes for animal production. Then, animal breeding programs will include the information from DNA directly on evaluation of genetic value of livestock production.

Scientific Electronic Library Online (Portuguese)

99

Avaliação de populações de possíveis rizobactérias em solos sob espécies florestais/ Evaluation of possible rhizobacteria populations in soils under forest species

Pereira, Rodrigo Matheus; Silveira, Érico Leandro da; Carareto-Alves, Lúcia Maria; Lemos, Eliana Gertrudes de Macedo
2008-10-01

Resumo em português Embora estudos recentes relatem a utilização de RCPC (Rizobactérias Promotoras de Crescimento de Plantas) no Brasil, raríssimos trabalhos avaliam a presença natural dessas espécies bacterianas no solo. O objetivo deste trabalho foi avaliar a ocorrência de RPCP em duas amostras de solo sob diferentes tipos de manejo, através da construção e do seqüenciamento de bibliotecas de DNA metagenômico. Utilizaram-se oligonucleotídeos específicos para amplificação da (mais) região hipervariável do espaço intergênico dos genes ribossomais 16S-23S de DNA extraído de diferentes solos, sob Eucalyptus sp. e sob mata. Os fragmentos obtidos foram inseridos em vetor e clonados. As bibliotecas geraram 495 clones, que foram seqüenciados e identificados através de comparações realizadas pelo software Blast. O solo sob Eucalyptus sp. apresentou maior número de RPCP do que sob mata. Os filos Actinobacteria e Proteobacteria eram maiores no solo sob Eucalyptus sp., estando o filo Firmicutes ausente no solo sob mata. Somente oito espécies diferentes de RPCP foram detectadas: Bacillus subtilis, Bacillus megaterium, Bradyrhizobium japonicum, Bradyrhizobium elkanii, Bradyrhizobium sp., Frankia sp., Pseudomonas fluorescens e Pseudomonas gladioli. O trabalho forneceu valiosos dados sobre a presença de RPCP em solos com espécies florestais e sua possível utilização em reflorestamentos, assim como para o melhor conhecimento desses microrganismos nos solos do Brasil. Resumo em inglês Although new studies describe the use of PGPR (Plant Growth-Promoting Rhizobacteria) in Brazil, they rarely evaluate the natural existence of these bacterial species in the soil. The objective of this study was to evaluate PGPR in two samples under different use types, one with native forest and the other with eucalyptus, through construction and sequencing of a metagenomic DNA library. Using specific probes from the internally transcribed region of 16S-23S rRNA genes, fr (mais) agments of PCR products were inserted into the vector and cloned. The library generated 495 clones, which were sequenced and identified using Blast software. A greater number of PGPR was found in the soil under eucalyptus than under forest. Actinobacteria and Proteobacteria phyla were more abundant in Eucalyptus sp soil, and the phylum Firmicutes was not found in forest soil. Only eight different species were detected: Bacillus subtilis, Bacillus megaterium, Bradyrhizobium japonicum, Bradyrhizobium elkanii, Bradyrhizobium sp., Frankia sp., Pseudomonas fluorescens and Pseudomonas gladioli. This study provided valuable information about PGPR in soils under forest species and their possible used in reforestation, as well as for a more detailed understanding of these microorganisms in Brazilian soils.

Scientific Electronic Library Online (Portuguese)

100

Amplificação de mRNA de tireoglobulina no sangue de pacientes com carcinoma diferenciado da tireóide: qual o seu verdadeiro significado?/ Thyroglobulin mRNA amplification in peripheral blood of patients with differentiated thyroid carcinoma: what does it really mean?

Coelho, Sabrina Mendes; Vaisman, Mário; Carvalho, Denise Pires de
2006-06-01

Resumo em português Apesar do excelente prognóstico, aproximadamente 20-40% dos pacientes com carcinoma diferenciado da tireóide (CDT) evoluem com recidiva tumoral e o prognóstico está relacionado principalmente à detecção precoce da doença. Desta forma, o acompanhamento permanente dos pacientes com exames sensíveis é fundamental. A tireoglobulina (Tg) sérica já demonstrou importância como marcador de recidiva. Entretanto, sua dosagem apresenta ainda algumas dificuldades, como a (mais) interferência com anticorpo anti-Tg, e a sensibilidade dependente do nível de TSH. A amplificação de mRNA tumor-específico extraído a partir de células neoplásicas na corrente sangüínea apresentou resultados iniciais promissores. No entanto, após quase uma década de estudo da detecção do mRNA de Tg no sangue, ainda não foi estabelecida sua real contribuição no acompanhamento dos pacientes com CDT. Após análise crítica dos estudos publicados, verifica-se a enorme diversidade de protocolos empregados e resultados conflitantes. Desta forma, até o momento, a amplificação de mRNAs tireóide-específicos não é superior à dosagem de Tg sérica existente. A possibilidade de transcrição ilegítima e splicing alternativo são fatores que podem interferir com a especificidade do método. Resumo em inglês Despite the excellent prognosis, differentiated thyroid carcinoma (DTC) may recur in 20-40%, and prognosis is particularly related to early detection of recurrent disease. Therefore, long-term follow-up with sensitive tests is need. Serum thyroglobulin (Tg) has an established role as a tumor marker of relapse. However, there are technical limitations of Tg immunoassays, in special, the interference of anti-Tg antibodies and the method sensitivity is dependent on TSH stimu (mais) lation. Detection of circulating malignant cells by amplification of tumor-specific mRNA showed initial promising results. However, almost one decade of studies of Tg mRNA detection in peripheral blood, its real contribution for DTC follow-up had not yet been established. After a critical analysis of published data, it is clear that there are many protocol differences and conflicting results. Therefore, it seems that amplification of thyroid-specific mRNAs is not superior to sensitive Tg assays and illegitimate transcription and alternative splicing of Tg are factors that may influence mRNA test specificity.

Scientific Electronic Library Online (Portuguese)

101

A investigação genética na surdez hereditária não-sindrômica/ Genetic investigation of non-syndromic hereditary deafness

Pfeilsticker, Leopoldo N.; Stole, Guita; Sartorato, Edi Lucia; Delfino, Denise; Guerra, Andréa Trevas Maciel
2004-04-01

Resumo em português A investigação genética na surdez possibilita diagnósticos cada vez mais precisos. Mais de 100 genes estão potencialmente envolvidos na deficiência auditiva não-sindrômica, responsáveis por 70% de todas as causas genéticas de perda auditiva. Uma mutação específica (35delG) no gene GJB2 que codifica a proteína Conexina 26 é a mais encontrada na surdez hereditária não-sindrômica. OBJETIVO: Investigamos a presença das mutações 35delG/GJB2, A1555G/12SeRNA (mais) e A7445G/tRNASer (UCN) em pacientes sem diagnóstico etiológico conclusivo. FORMA DE ESTUDO: Estudo clínico com coorte transversal. MATERIAL E MÉTODO: Foram avaliados 75 pacientes atendidos na Disciplina de Otorrinolaringologia-Cabeça e Pescoço da UNICAMP entre julho e dezembro de 2000 que satisfizeram os critérios propostos. Encontramos seis mutações, das quais quatro 35delG/GJB2, uma A7445G/tRNASer (UCN) e uma W172X/GJB2, ainda não descrita na literatura. CONCLUSÃO: A pesquisa das mutações associadas à perda auditiva é de fácil realização, esclarece a etiologia de alguns pacientes e a sua descoberta possibilita o aconselhamento genético. Resumo em inglês The precise diagnosis of hearing loss can be clarified by genetic investigation. Non-syndromic hearing loss is responsible for 70% of all genetic causes of hearing loss. More than 100 genes are potentially involved in non-syndromic hearing loss. A specific mutation (35delG) on the GJB2 gene that codifies Conexin 26 protein is the most common finding in non-syndromic hereditary hearing loss. AIM: In this study the presence of mutations 35delG, A1555G/12SeRNA and A7445G/tRN (mais) ASer (UCN) where investigated for patients with hearing loss of unknown cause. STUDY DESIGN: Clinical study with transversal cohort. MATERIAL AND METHOD: 75 outpatients from the Department of Otolaryngology and Head and Neck Surgery of the University of Campinas-UNICAMP were evaluated from July to December of 2000. A total of six mutations were found, four 35delG/GJB2, one A7445G/tRNASer (UCN) and W172X/GJB2, a mutation not yet described in previous literature. CONCLUSION: The investigation of mutations associated with hearing loss can be carried out easily, elucidates the etiology and allows genetic counseling of the family.

Scientific Electronic Library Online (Portuguese)