Sample records for gene amplification
from WorldWideScience.org

Sample records 1 - 20 shown. Select sample records:



1

Amplificação dos genes que codificam a endotelina-1 e seus receptores em valvas mitrais reumáticas/ Amplification of the genes that codify endothelin-1 and its receptors in rheumatic mitral valves/ Amplificación de los genes que codifican la endotelina-1 y sus receptores en válvulas mitrales reumáticas

Moura, Edmilson Bastos de; Gomes, Mariana Ribeiro; Corso, Ricardo Barros; Faber, Cristiano Nicolleti; Carneiro, Fabiana Pirani; Pacheco, Yolanda Galindo
2010-07-01

Resumo em português FUNDAMENTO: As cardiopatias são doenças de alta prevalência, sendo a cardite reumática uma doença de grande relevância em países em desenvolvimento. As alterações em câmaras cardíacas esquerdas se associam à disfunção endotelial, com aumento dos níveis de endotelina-1 (ET-1) e consequências sobre a circulação pulmonar, muitas vezes determinando a hipertensão pulmonar (HP). No entanto, a presença de ET-1 e seus receptores na própria valva mitral, promo (mais) vendo alterações vasculares pulmonares e aumentando a deformação valvar reumática, ainda é um assunto não abordado na literatura. OBJETIVO: Determinar, mediante técnicas moleculares, a expressão dos genes da endotelina e dos seus receptores em valvas mitrais reumáticas. MÉTODOS: 27 pacientes submetidos à troca valvar mitral tiveram seu tecido valvar analisado, a fim de determinar a presença de genes de ET-1 e seus receptores A e B. Foram feitas análises histológica e molecular das valvas (divididas em fragmentos M1, M2 e M3) e colhidos dados clínicos e epidemiológicos dos pacientes. Foram divididos em três grupos: valvopatia mitral, mitroaórtica e pacientes reoperados. RESULTADOS: O estudo mostrou a manifestação do gene da ET-1 em 40,7% dos espécimes e de seu receptor A em todas as amostras, com manifestação minoritária do gene do receptor B (22,2%). CONCLUSÃO: Todos os pacientes expressaram a presença do gene do receptor A. Não houve diferença estatística quanto à gravidade da doença, expressa em classe funcional, e aos subgrupos estudados (valvopatas mitrais, mitroaórticos e pacientes reoperados), ou quanto à expressão dos genes da ET-1 e seus receptores entre os subgrupos estudados (valvopatas mitrais, mitroaórticos e pacientes reoperados). Resumo em espanhol FUNDAMENTO: Las cardiopatías son enfermedades de alta prevalencia, siendo la carditis reumática una enfermedad de gran relevancia en países en desarrollo. Las alteraciones en cámaras cardíacas izquierdas se asocian a la disfunción endotelial, con aumento de los niveles de endotelina-1 (ET-1) y consecuencias sobre la circulación pulmonar, muchas veces determinando la hipertensión pulmonar (HP). Mientras que, la presencia de ET-1 y sus receptores en la propia válvu (mais) la mitral, promoviendo alteraciones vasculares pulmonares y aumentando la deformación valvar reumática, aún es un asunto no abordado en la literatura. OBJETIVO: Determinar, mediante técnicas moleculares, la expresión de los genes de la endotelina y de sus receptores en válvulas mitrales reumáticas. MÉTODOS: 27 pacientes sometidos a reemplazo valvular mitral tuvieron su tejido valvar analizado, a fin de determinar la presencia de genes de ET-1 y sus receptores A y B. Fueron hechos análisis histológico y molecular de las valvas (divididas en fragmentos M1, M2 y M3) y recogidos datos clínicos y epidemiológicos de los pacientes. Fueron divididos en tres grupos: valvopatía mitral, mitroaórtica y pacientes reoperados. RESULTADOS: El estudio mostró la manifestación del gen da ET-1 en 40,7% de los sujetos y de su receptor A en todas las muestras, con manifestación minoritaria del gen del receptor B (22,2%). CONCLUSIÓN: Todos los pacientes expresaron la presencia de gen del receptor A. No hubo diferencia estadística en cuanto a la gravedad de la enfermedad, expresada en clase funcional, y a los subgrupos estudiados (valvopatías mitrales, mitroaórticos y pacientes reoperados), o en cuanto a la expresión de los genes de la ET-1 y sus receptores entre los subgrupos estudiados (valvopatías mitrales, mitroaórticos y pacientes reoperados). Resumo em inglês BACKGROUND: Cardiopathies are high prevalence conditions. Among them, rheumatic carditis is of high relevance in developing countries. Left cardiac chamber changes are associated to endothelial dysfunction and ET-1 levels increase. Pulmonary circulation is then affected, and not seldom leading to pulmonary hypertension (PH). However, the presence of ET-1 and its receptors in the mitral valve itself - promoting pulmonary vascular changes, with increased rheumatic valvular (mais) deformation - has not been discussed in the literature. OBJECTIVE: To determine the expression of endothelin gene and its receptors in rheumatic mitral valves through techniques of molecular genetics. METHODS: Twenty-seven patients submitted to mitral valve replacement had their valvular tissue examined to determine the presence of ET-1 genes and their A and B receptors. Histological and molecular analysis of the valves was performed (divided into M1, M2 and M3 fragments), with patients' clinical and epidemiological data collected. Patients were divided into 3 groups (mitral valvopathy, mitroaortic valvopathy, and reoperation patients). RESULTS: The study showed endothelin-1 gene expression in 40.7% specimens and A receptor in all samples; receptor gene B had lower expression (22.2%). CONCLUSION: All patients showed A receptor gene expression. No statistically significant difference was observed in regard to condition severity, expressed according to functional class, and subgroups (mitral valvopathy, mitroaortic valvopathy, and reoperation patients).

Scientific Electronic Library Online (Portuguese)

2

Transformação genética de laranja 'Valência' com o gene cecropin MB39/ Genetic transformation of 'Valencia' sweet orange with the cecropin MB39 gene

Paoli, Luis Gustavo de; Camargo, Raquel Luciana Boscariol; Harakava, Ricardo; Mendes, Beatriz Madalena Januzzi; Mourão Filho, Francisco de Assis Alves
2007-11-01

Resumo em português O objetivo deste trabalho foi obter plantas transgênicas de laranja 'Valência' com o gene cecropin MB39 controlado pelo promotor do gene da fenilalanina-amônia-liase de citros, visando a expressão gênica específica nos vasos do xilema. A transformação genética foi realizada via Agrobacterium tumefaciens por meio do co-cultivo de segmentos de epicótilo. Onze plantas transgênicas foram identificadas por PCR, pela amplificação do fragmento esperado de 189 pb, as (mais) quais foram aclimatizadas em casa de vegetação. A integração do transgene foi confirmada em três plantas pela análise de transferência de Southern. Resumo em inglês The objective of this work was to produce 'Valencia' sweet orange transgenic plants with the cecropin MB39 gene controlled by a phenylalanine ammonia-lyase gene promoter from citrus in order to direct gene expression in xylem vessels. The genetic transformation was mediated by Agrobacterium tumefaciens with the co-culture of epicotyl segments. Eleven transgenic plants were selected by PCR with the amplification of a 189 bp fragment, which were acclimatized to greenhouse. The integration of the transgene was confirmed in three plants by Southern blot analysis.

Scientific Electronic Library Online (Portuguese)

3

Comparação entre dois métodos de detecção de DNA de papilomavírus humano em carcinoma epidermoide de lábio/ Comparison between two methods for human papilomavírus DNA detection in lip squamous cell carcinoma

Demathe, Adriana; Bernabé, Daniel Galera; Garcia, José Fernando; Nunes, Caris Maroni; Miyahara, Glauco Issamu
2010-04-01

Resumo em português Introdução: Recentemente o papilomavírus humano (HPV) tem sido associado à carcinogênese oral. A metodologia empregada na detecção do vírus é uma das maiores causas observadas da grande variabilidade nas taxas de detecção do HPV. Objetivo: Este estudo comparou a sensibilidade de detecção do DNA do HPV em casos de carcinoma epidermoide de lábio utilizando a amplificação do DNA viral por reação em cadeia da polimerase (PCR) ou nPCR. Material e método: For (mais) am utilizadas 33 amostras provenientes de casos de carcinoma epidermoide de lábio. Para as extrações do DNA utilizou-se o sistema QIAamp DNA Mini Kit. Como controle interno utilizou-se o gene da b-globina. Das 33 amostras iniciais, 30 foram positivas para o gene b-globina, sendo utilizadas para detectar o DNA viral. Comparou-se a amplificação do DNA viral pelos métodos da PCR com os oligonucleotídeos MY09/MY11 e nPCR, empregando-se os pares de oligonucleotídeos iniciadores MY09/MY11 e, na segunda etapa, o par GP5+/GP6+. O controle positivo para a presença do DNA do HPV utilizado foi a linhagem de células HeLa e, como controle negativo, a mistura de amplificação sem DNA. A análise dos produtos de PCR e nPCR para HPV foi realizada por eletroforese em gel de poliacrilamida a 8%. Resultados: Utilizando-se o método da PCR, a amplificação do DNA do HPV foi constatada em dois casos. Com a nPCR foi verificada presença de DNA viral em 13 das 30 amostras. Conclusão: Com a utilização da nPCR, a detecção do HPV nos casos estudados aumentou mais de seis vezes. Resumo em inglês Introduction: Human papillomavirus (HPV) has been currently associated with oral carcinogesis. The methodology applied in virus detection is one of the main reasons for the great variability observed in HPV detection. Objectives: This study compared HPV DNA detection efficiency in lip squamous cell carcinoma samples (SCC) using viral DNA amplification by PCR or nPCR. Methods: Thirty three samples of lip squamous cell carcinoma were selected. DNA extractions were performed (mais) with QIAamp DNA minikit. The internal control was b-globin gene. Thirty out of 33 initial samples were positive for b-globin gene, which were employed to detect viral DNA. The amplification of viral DNA was compared by PCR method through MY09/MY11 oligonucleotides and nPCR through MY09/MY11 oligonucleotides in the first stage and GP5+/GP6+ in the second stage. HeLa cells were used as positive control for HPV DNA presence and the amplification mixture without DNA as negative control. The analysis of PCR and nPCR products for HPV DNA was performed through gel electrophoresis in polyacrylamide at 8%. Results: HPV DNA amplification was verified in two cases by the use of PCR method. HPV DNA presence was verified in 13 out of 30 samples by the use of nPCR. Conclusion: HPV DNA detection of lip SCC increased sixfold in the studied cases with the employment of nPCR.

Scientific Electronic Library Online (Portuguese)

4

Eficiência de transformação genética de citrange 'carrizo' com duas construções gênicas/ Genetic transformation efficiency of 'carrizo' citrange with two gene constructions

Miyata, Luzia Yuriko; Mourão Filho, Francisco de Assis Alves; Scarpare Filho, João Alexio; Zambon, Flávia; Bassan, Meire Menezes; Mendes, Beatriz Madalena Januzzi; Harakava, Ricardo
2011-01-01

Resumo em português Transformação genética é considerada uma importante ferramenta auxiliar no melhoramento genético de plantas cítricas. Entretanto, a eficiência de transformação pode variar em função de diversos fatores, incluindo a própria construção gênica utilizada. Este trabalho buscou avaliar a eficiência de transformação genética de plantas de citrange 'Carrizo' [Poncirus trifoliata (L.) Raf. x Citrus sinensis (L.) Osbeck] com duas construções gênicas diferentes (mais) contendo o gene uidA (GUS) sob o controle dos promotores Arabidopsis thaliana phloem protein 2 (AtPhP2) e Arabidopsis thaliana sucrose transporter 2 (AtSuT2). Segmentos de epicótilo de plântulas germinadas in vitro foram utilizados como explantes. O gene nptII, que confere resistência ao antibiótico canamicina, foi utilizado nas construções gênicas como agente de seleção para regeneração de plantas transgênicas. O ensaio histoquímico com X-GLUC foi realizado em todas as brotações regeneradas para verificar a expressão do gene uidA. Dos 4.790 segmentos de epicótilo utilizados, registrou-se a regeneração de 366 brotações com reação positiva no ensaio histoquímico, as quais foram enxertadas em porta-enxertos cultivados in vitro. Cinco dessas brotações, de cada construção gênica, foram selecionadas para análise da PCR, com primers específicos para amplificação da sequência do gene uidA. A inserção do transgene foi confirmada por PCR em todas as brotações selecionadas. A eficiência de transformação e o número de brotos escapes, avaliada pelo teste histoquímico, variaram em função das construções gênicas utilizadas. Resumo em inglês Genetic transformation is considered an important tool to be applied in citrus genetic improvement. However, transformation efficiency may vary according to several factors, including the genetic construction utilized. This work aimed to evaluate the transformation efficiency of 'Carrizo' citrange [Poncirus trifoliata (L.) Raf. x Citrus sinensis (L.) Osbeck], containing two different gene constructions including the uidA (GUS) gene controlled by the promoters Arabidopsis (mais) thaliana phloem protein 2 (AtPhP2) and Arabidopsis thaliana sucrose transporter 2 (AtSuT2). Epicotil segments from in vitro germinated seedlings were used as explants. The nptII gene, which confers resistance to the antibiotic kanamycin, was used in the constructions as a selection agent to regenerate transgenic plants. X-GLUC histochemical analysis was performed in all regenerated shoots in order to verify the expression of the uidA gene. From the 4790 epicotyl segments utilized, 366 shoots had a positive reaction in the histochemical analysis, and were further grafted on in vitro grown rootstocks. Five out of these shoots, from each gene construction, were selected to perform PCR analysis, with specific primers for uidA gene sequence amplification. All selected plants evaluated by PCR confirmed gene integration. Transformation efficiency and number of non-transformed shoots, evaluated by histochemical analysis, varied among gene constructions utilized

Scientific Electronic Library Online (Portuguese)

5

Microdissecção e captura a laser na investigação do gene TP53 em tecidos incluídos em parafina/ Laser-capture microdissection for TP53 gene analysis in paraffin-embedded tissues

Ihlaseh, Shadia Muhammad; Oliveira, Maria Luiza Cotrim Sartor de; Silva, Glenda Nicioli da; Franchi, Carla Adriene da Silva; Camargo, João Lauro Viana de
2007-02-01

Resumo em português INTRODUÇÃO: Microdissecção e captura a laser (MCL) é uma técnica de desenvolvimento recente que permite a coleta de células individuais ou pequeno conjunto de células para análise molecular. Atualmente, no Brasil, há raros microscópios para MCL, de modo que a divulgação dos procedimentos inerentes a essa técnica é oportuna para destacar seu amplo potencial para diagnóstico e investigação. OBJETIVO: Este trabalho descreve a padronização dos procedimento (mais) s de MCL e de extração de DNA de material fixado em formalina e incluído em parafina. MATERIAL E MÉTODOS: Foram estudados o éxon 8 do gene TP53 e o gene da ciclofilina em amostras de tecido normal e de neoplasias de fígado e rim provenientes de modelo de carcinogênese química induzida em rato. A extração do DNA foi comprovada por reação em cadeia da polimerase (nested-PCR). RESULTADOS: Foram padronizados os procedimentos de preparo dos cortes histológicos, de microdissecção e captura a laser e de obtenção de seqüências gênicas pela reação de nested-PCR para tecidos incluídos em parafina. Obtivemos amplificação de 48,3% das amostras para o éxon 8 do gene TP53 e 51,7% para o gene da ciclofilina. Considerando pelo menos um dos dois segmentos gênicos, foram amplificadas 79,3% das amostras. DISCUSSÃO E CONCLUSÃO: A extração de DNA de tecidos fixados em formalina e incluídos em parafina e a técnica de nested-PCR foram adequadamente padronizadas para produtos gênicos de interesse, obtidos de material coletado por MCL. Esses procedimentos podem ser úteis para a obtenção de seqüências de DNA de arquivos para análise molecular. Resumo em inglês BACKGORUND: Laser-capture micro-dissection (LCM) is a recently developed procedure that provides single cells or specific cell groups for molecular analysis. Currently, there are few LCM systems in Brazil, in such a way that it is necessary to disseminate the technical procedures inherent to the methodology, and also to characterize its enormous potential for diagnosis and research. OBJECTIVE: This study describes the standardization of LCM and DNA extraction from formali (mais) n fixed and paraffin-embedded tissues. MATERIAL AND METHOD: The gene TP53 exon 8 and the cyclophilin gene were studied in normal and neoplastic liver and kidney samples from a chemical carcinogenesis model in rat. DNA extraction was confirmed by nested-PCR. RESULTS: Histological sections preparation for LCM and the nested-PCR procedures were standardized; 48.3% amplifications of the gene TP53 exon 8 and 51.7% of the cyclophilin gene samples were obtained. When at least one of the gene segments was considered, 79.3% samples presented amplification. DISCUSSION AND CONCLUSION: Procedures for DNA extraction from formalin fixed and paraffin-embedded tissues collected by LCM were standardized. They can be useful for DNA collection for molecular studies.

Scientific Electronic Library Online (Portuguese)

6

Análise de polimorfismos do gene da beta-lactoglobulina em vacas da raça Nelore e efeitos sobre o peso à desmama de suas progênies/ Polimorphism analisys of beta-lactoglobulin gene on Nellore cows and effects on weaning weight of the calves

Faria, F.J.C.; Guimarães, S.E.F.; Mourão, G.B.; Lima, R.M.G.; Pinheiro, L.E.L.
2000-06-01

Resumo em português Informações sobre peso à desmama de bezerros Nelore foram utilizadas após ajuste para idade padrão aos 205 dias, sexo, idade da mãe, touro e mês de desmama, para separar as reprodutrizes em dois grupos, segundo o peso de suas crias. As médias de peso dos bezerros ajustadas pelo método dos quadrados mínimos e erros-padrão (LSM± SE) foram para os grupos pesados (P) e leves (L) 163,21± 2,18kg e 134,44± 2,18kg, respectivamente, com 41 animais em cada grupo. Essa (mais) s reprodutrizes foram submetidas a coleta de sangue para estudo de polimorfismos do gene da beta-lactoglobulina, por meio da técnica de PCR-RFLP. A amplificação e a digestão de um fragmento do gene da beta-lactoglobulina entre o éxon II e III identificou os genótipos 1AA, 24AB e 56BB, com as freqüências de 0,16 e 0,84 para os alelos A e B, respectivamente. Os 24 animais com genótipo AB apresentaram LSM± SE de peso de seus produtos de 149,50± 4,17kg, e os 56 animais de genótipo BB tiveram média de 148,44± 2,73kg. O teste do qui-quadrado não apresentou significância (P>0,05), isto é, os grupos P e L não diferiram entre si quanto às freqüências alélicas apresentadas para esse gene. O genótipo das reprodutrizes não afetou o peso à desmama de suas crias, o que sugere haver outros fatores genéticos e não genéticos de maior magnitude que afetam o peso à desmama. Resumo em inglês Weaning weights from a Nelore herd were used after adjustment of means for 205 days of age, sex, age of dam, sire and weaning month, and resulted into two groups of cows that differed by the weaning weight of their calves. The least square means (LSM) and standard error (SE) were for heavy group 163.21± 2.18kg and for light group 134.44± 2.18kg, with 41 animals in each group. These animals were genotyped by DNA polymorphisms of beta -lactoglobulin gene, using PCR-RFLP. (mais) After amplification and digestion of a beta-lactoglobulin gene fragment between II and III exon, genotypes 1AA, 24AB and 56BB were identified, with 0.16 and 0.84 frequencies for A and B alleles, respectively. The 24AB and 56BB cows showed calves with LSM± SE of 149.50± 4.17kg and 148.44± 2.73kg respectively, for weaning weight. No difference (P>0.05) was found and the heavy and light groups were similar for the allelic frequencies for this gene. The dam’s genotype did not affect the weaning weight of the calves. This suggests of having other factors, genetic or non-genetic, with major magnitude that affect the weaning weight.

Scientific Electronic Library Online (Portuguese)

7

Isolamento do gene ALS e investigação do mecanismo de resistência a herbicidas em Sagittaria montevidensis/ Isolation of the ALS gene and investigation of the mechanism of herbicide resistance in Sagittaria montevidensis

Merotto Junior, Aldo; Kupas, Valmir; Nunes, Anderson Luis; Goulart, Ives Clayton Gomes dos Reis
2010-11-01

Resumo em português Diversos biótipos de sagitária (Sagittaria montevidensis Cham. & Schlecht) foram constatados como resistentes a herbicidas inibidores da enzima ALS no Brasil e em outros locais do mundo. Os objetivos deste trabalho foram isolar e sequenciar o gene ALS de sagitária de forma a identificar a ocorrência de mutações relacionadas ao mecanismo de resistência de insensibilidade do local da ação de herbicidas. O material vegetal consistiu de sementes de sagitária coletad (mais) as em lavouras de arroz irrigado localizadas na região Sul do Estado de Santa Catarina. Nove pares de sequências nucleotídicas iniciadoras foram desenhadas para a amplificação dos domínios C, A e D do gene ALS. As sequências nucleotídicas dos fragmentos amplificados com quatro pares de oligonucleotídeos inciadores resultaram em amplicons com 360 a 393 nucleotídeos. Essas sequências apresentaram homologia com o gene ALS padrão de Arabdopsis thaliana e arroz, possuindo apenas três mutações de ponto. Uma dessas alterações foi a mutação Pro197Phe, que é relacionada à ocorrência de resistência à herbicida em diversas espécies vegetais. As sequências obtidas evidenciaram que o gene ALS avaliado encontrava-se em heterozigose. Esses resultados sugerem a ocorrência de insensibilidade do local de ação como mecanismo de resistência a herbicidas inibidores de ALS em sagitária. A prevenção e o controle da resistência a herbicidas inibidores da ALS em sagitária devem ser fundamentados na rotação de herbicidas com diferentes mecanismos de ação. Resumo em inglês California arrowhead (Sagittaria montevidensis Cham. & Schlecht) is an aquatic weed often found in rice paddy fields. Several biotypes of California arrowhead resistant to ALS-inhibiting herbicides were found in Brazil and in several rice fields worldwide. The objective of this study was to sequence the ALS gene of California arrowhead and to identify the occurrence of mutations related to target site insensitivity as the mechanism of herbicide resistance. The plant mater (mais) ial consisted of seeds collected in rice paddy fields located in the state of Santa Catarina, Brazil. Nine pairs of primers were designed for the amplification of the domains C, A and D of the ALS gene. PCR reactions with four pairs of primers resulted in amplification of fragments with size close to expected, ranging from 360 to 393 nucleotides. These sequences showed high homology to the standard ALS gene Arabdopsis thaliana and rice having only three point mutations. One of these mutations was Pro197Phe that is related with herbicide resistance in several weeds. The sequences obtained indicated that the ALS gene evaluated was heterozygous. These results suggest the occurrence of insensitivity of the site of action as the mechanism of resistance to ALS-inhibitors herbicides in California arrowhead. The prevention and control of resistance to ALS-inhibitors in California arrowhead should be based on the rotation of herbicides with different mechanisms of action.

Scientific Electronic Library Online (Portuguese)

8

Padronização da técnica de extração de DNA de células de mucosa oral com NaCl: aplicação no estudo do gene PROP1/ Standardization of DNA extraction with NaCl from oral mucosa cells: application in PROP1 gene study

Abrão, Milena Garcia; Billerbeck, Ana Elisa C.; Nishi, Mirian Yumie; Marui, Suemi; Mendonça, Berenice B. de
2005-12-01

Resumo em português A extração de DNA de leucócitos periféricos é o meio de obtenção de DNA mais amplamente utilizado. Entretanto, a coleta de células a partir de swab oral, geralmente utilizada em medicina forense, é útil para obtenção de amostras de DNA de recém-nascidos, crianças e de pacientes que vivem em locais onde a coleta e o envio da amostra de sangue não é factível. Nosso objetivo foi padronizar a técnica de extração de DNA a partir de swab de células de mucos (mais) a oral utilizando NaCl, comparando-a com a extração pelo kit comercial. Para testar a qualidade do DNA, amplificamos os 3 éxons do gene PROP1 de 12 pacientes com hipopituitarismo hipofisário em DNA extraído simultaneamente de células da mucosa oral e de sangue periférico. A amplificação de fragmentos maiores foi testada em DNA de mucosa oral de indivíduos normais utilizando-se primers do éxon 10 do gene do FSHR (1000pb) e do gene CYP21A2 (1200pb). Ambos os métodos resultaram em DNA de boa qualidade, permitindo o estudo molecular. O método por NaCl mostrou-se mais rápido e barato, resultando em maior quantidade de DNA quando comparado ao kit comercial. Nos pacientes com hipopituitarismo, identificamos a mutação delAG301-302 em 6 pacientes, 4 em homozigose (33%) e 2 em heterozigose (16%), e a mutação G51A em heterozigose em uma paciente. Em conclusão, padronizamos a técnica de extração de DNA de células de swab oral com NaCl que, quando comparada à extração com kit comercial, apresentou menor custo e maior rapidez, indicando ser esta uma forma confiável de obtenção de DNA para estudos genéticos. Resumo em inglês DNA extraction of peripheral leukocytes is the most broadly used technique to obtain DNA. However, cell collection from an oral swab, frequently used in forensics, is useful to obtain DNA samples, mainly in newborns, children and patients who live far from the collection sites, where blood sample collection and sending is not feasible. Our objective was to standardize DNA extraction from an oral swab, using the NaCl method, comparing it with a commercial kit. To test DNA (mais) quality, we amplified the 3 exons of PROP1 gene of 12 patients with hypopituitarism in DNA obtained from oral cells and peripheral blood cells. Amplification of larger fragments was tested in oral DNA of normal subjects using primers of exon 10 of FSHR gene (1000bp) and of CYP21A2 gene (1200bp). Both methods yielded good quality DNA, allowing the amplification of 3 exons of PROP1 gene. The NaCl method showed to be faster and less expensive, resulting in a larger amount of DNA when compared to the commercial kit. We identified the delAG301-302 mutation in 6 patients, 4 in homozygous (33%) and 2 in heterozygous (16%) state and G51A mutation in heterozygous state in a single patient. In conclusion, we standardized the DNA extraction of oral cells with NaCl, which presented lower costs and faster results, when compared with the extraction by a commercial kit indicating that DNA from oral swabs are a reliable source for genetic studies.

Scientific Electronic Library Online (Portuguese)

9

Associação de bioensaios e caracterização molecular para seleção de novos isolados de Bacillus thuringiensis efetivos contra Spodoptera frugiperda (J.E. Smith) (Lepidoptera: Noctuidae)/ Association of bioassays and molecular characterization to select new Bacillus thuringiensis isolates effective against Spodoptera frugiperda (J. E. Smith) (Lepidoptera: Noctuidae)

Fatoretto, Júlio C.; Sena, Janete A.D.; Barreto, Marliton R.; Lemos, Manoel V.F.; Boiça Junior, Arlindo L.
2007-10-01

Resumo em português A lagarta de Spodoptera frugiperda (J. E. Smith) é uma das principais pragas do milho e para seu controle o Bacillus thuringiensis se destaca por sua atividade entomopatogênica. Este trabalho objetivou a caracterização molecular de isolados de B. thuringiensis quanto à presença do gene cry1 e a avaliação da sua eficiência no controle de lagartas de S. frugiperda. Nas análises da PCR, foi utilizado o Gral-cry1 para confirmação da presença do gene cry1 nos 115 (mais) isolados. Uma suspensão de 3 x 10(8) esporos/ml banhou a dieta utilizada para alimentação de 30 lagartas por isolado, com três repetições. A identificação do tipo de genes cry1 dos diferentes isolados foi realizada para cinco sub-classes de genes e análises de regressão linear foram realizadas para verificar possíveis associações entre a presença de um gene cry individual e altos níveis de toxicidade. Ttodos os DNAs amplificados com os iniciadores Gral-cry1 apresentaram produto de amplificação com tamanho esperado. Quanto aos níveis de eficiência inseticida contra a lagarta-do-cartucho, 41 isolados apresentaram 100% de mortalidade e 16 apresentaram índice entre 75% e 90%. O gene cry1Ab esteve presente em 80 isolados, cryB em 69 isolados, cry1Ac em todos os isolados, cryV e cry1E em 93 e 27 isolados, respectivamente. Os valores referentes ao efeito individual de cada gene na mortalidade de larvas foram significativos a 1% de probabilidade, para os genes cry1Ac e cry1E. Resumo em inglês The fall armyworm, Spodoptera frugiperda (J. E. Smith), is one of the main corn pests and Bacillus thuringiensis is important in its control because of its entomopathogenic property. The objective of this study was the molecular characterization of B. thuringiensis isolates for cry1 locus presence and the assessment of the efficiency of these isolates in controlling S. frugiperda caterpillars. Gral-cry1 was used in the PCR analyses to confirm the presence of the cry1 locu (mais) s in 15 isolates. A 3 x 10(8) spore/ml suspension bathed the diet used to feed 30 caterpillars per isolate, with three replications. The cry1 locus type genes of the different isolates were identified for five gene subclasses; linear regression analyses were carried out to ascertain possible associations between the presence of an individual cry1 locus gene and high levels of toxicity. All the DNAs amplified with Gral-cry1 presented an amplification product with the expected size. Regarding the levels of insecticide efficiency against the cob worm, 41 isolates presented 100% mortality and 16 presented an index between 70% and 90%. The cry1Ab gene was present in 80 isolates, cryb in 69 isolates, cry1Ac in all the isolates and cryv and cry1E in 93 and 27 isolates, respectively. The values regarding the individual effect of each gene on caterpillar mortality were significant at 1% probability for the cry1Ac and cry1E genes.

Scientific Electronic Library Online (Portuguese)

10

Relative expression of insulin like growth factor I (IGFI) and follicle stimulating hormone receptor (FSHR) in follicles and ovarian tissue from Bos primigenius indicus (Nelore)/ Expressão relativa de fator semelhante a insulina (IGFI) e receptor do homômonio folículo estimulante (FSHR) em folículos e tecido ovariano de Bos primigenius (Nelore)

Ferreira, Jorge Luís; Toniolli, Ricardo; Duarte, Ana Beatriz Graça; Campagnari, Francine; Boscaro, Ariadne Padovez; Pazini, Fabiane Siqueira; Garcia, José Fernando
2002-01-01

Resumo em português O aperfeiçoamento das técnicas que objetivam a exploração do potencial reprodutivo das fêmeas requer a compreensão mais ampla dos mecanismos de controle de desenvolvimento folicular. Uma alternativa de estudo nesta esfera, é a quantificação da expressão relativa de genes envolvidos nos processos de recrutamento, seleção e desenvolvimento folicular, pelo emprego da técnica de transcrição - reversa associado a reação em cadeia pela polimerase (RT - PCR). O (mais) presente trabalho objetivou quantificar a expressão relativa dos genes insulin-like growth factor I (IGF-I) e do receptor do hormônio folículo estimulante (FSHR), tendo como controle interno o gene da gliceraldeído 3-fosfato desidrogenase (GAPDH). Foram utilizados ovários bovinos de animais de matadouro em diferentes fases do ciclo estral. O RNA total dos folículos e tecido ovarianos foi purificado por TRIZOL. As reações de RT-PCR foram realizadas com o "kit" SuperScriptTM First-Strand. Os produtos de PCR foram analisados em gel de agarose e as bandas submetidas à análise densitométrica. Todos os genes foram amplificados observando-se a curva exponencial de amplificação, a validação do método foi realizada através de análise de regressão, sendo estabelecido o coeficiente de amplificação (E). A expressão relativa de mRNA para cada gene de interesse foi calculada pela fórmula estabelecida por Prelle et al.12. Em todos os tecidos analisados, todos os genes foram expressos, sobressaltando-se diferenças nos diferentes ciclos estudados. Com relação os dados referentes ao coeficiente de amplificação (E), observou-se tanto para gene controle (GAPDH), como para o gene IGF-I concordância nos valores encontrados para as diferentes classes analisadas. Quanto ao gene IGF-I, a interpretação dos achados para a expressão relativa de mRNA pode está relacionada ao caráter constitutivo dessa proteína ou devido os transcritos não serem dependentes dos níveis de FSH. Observou-se diferenças na expressão relativa de mRNA de FSHR entre as classes de tecidos analisados, o que pode ser explicado pela variação do número de receptores nas células da granulosa nas diferentes fases do ciclo estral. Pode-se perceber a partir desse estudo que a técnica de RT-PCR semi quantitativo é de grande importância biotecnológica, possibilitando auxílio na compreensão da dinâmica folicular. Entretanto esses estudos devem ser ampliados com outros genes para melhor compreensão das etapas fisiológicas envolvidas na foliculogênese. Resumo em inglês The improvement of techniques to maximize reproductive potential of females needs the whole comprehension of the controlling mechanisms of follicular development. An alternative for this purpose is the quantification of relative gene expression from those genes involved in recruitment, selection and follicular development, using reverse transcriptase - polymerase chain reaction (RT - PCR). The present study aimed to quantify relative gene expression from insulin-like grow (mais) th factor I (IGF-I) and follicle stimulating hormone receptor (FSHR) in cattle (Bos primigenius indicus), using as internal control the gliceraldheyde 3 phosphate dehydrogenase (GAPDH) gene. Ovaries in different estral cycle stages were obtained from slaughtered animals. Total RNA from follicles and ovarian tissue was purified and the RT-PCR conditions were standardized. PCR products were analyzed in ethydium bromide agarose gels and the bands submitted to densitometric analysis. Exponential amplification curves were constructed and the method's validation was performed using regression analysis to determine the amplification coefficient (E) for each of the three genes. Relative expression for each gene was calculated using the formula described by Prelle et al.12. In every sample there was gene expression detected for each gene showing differences related to cycle temperature. Amplification coefficient (E) was similar between control gene (GAPDH) and IGFI, independently of the class analyzed. IGFI linear amplification could be related to the constitutive characteristic of this protein since the transcripts are not dependents of FSH levels. It was observed difference in FSHR mRNA expression between the classes analyzed. It could be due to the variation of the receptor number in granulosa cells for each different phase of estral cycle. Semi-quantitative RT-PCR has a large application in biotechnology since it is useful to help us the better understanding of follicular dynamics. However these studies must be conducted using other genes in order to provide new clues for the physiology of folliculogenesis.

Scientific Electronic Library Online (Portuguese)

11

Freqüência da mutação 844ins68 do gene da cistationina beta-sintetase em pacientes com trombose venosa profunda/ Frequency of the 844ins68 mutation on the cystathionine beta-synthetase gene in deep venous thrombosis patients

Bonini-Domingos, Claudia R.; Zamaro, Paula J. A.; Mendiburu, Carlos F.; Sanches, Fábio E.; Cintra, Juliana R.; Godoy, José M. P. de; Mattos, Luiz C. de
2005-03-01

Resumo em português A hiper-homocisteinemia, resultante da deficiência na conversão da homocisteína em cistationina, constitui em fator de risco isolado para doenças vasculares. A mutação 844ins68 do gene da cistationina beta-sintetase é um fator adicional de risco para a trombose venosa profunda. O objetivo deste estudo foi avaliar a freqüência da mutação 844ins68 do gene da cistationina beta-sintetase em pacientes com trombose venosa profunda. Foram avaliados em estudo caso-cont (mais) role 95 pacientes com trombose venosa profunda, a presença da mutação 844ins68 no éxon 8 do gene da cistationina beta-sintetase. Como critério de inclusão foi adotada a presença de trombose venosa profunda confirmada pelo dúplex ou flebografia. O grupo controle constituiu-se de 95 doadores de sangue, sem história familiar prévia de trombose venosa, com sexo, grupo étnico e idades pareados aos do grupo de estudo. Foram coletados 5 mL de sangue venoso com o uso de anticoagulante EDTA de cada participante. O DNA foi extraído dos leucócitos pelo método DTAB e CTAB. A detecção da mutação do gene foi realizada por amplificação de um segmento gênico por PCR, com iniciadores que flanqueiam a região de inserção e com revelação em gel de agarose a 2%, corado com brometo de etídio, sob luz UV. O fragmento correspondente ao alelo normal contém 184 pares de base e o correspondente ao alelo mutante, 252 pares de base. O teste exato de Fisher foi utilizado na análise dos resultados. A condição heterozigota para a mutação foi encontrada em 14,73% dos pacientes e em 3,1% dos indivíduos do grupo controle (p = 0,009). A freqüência do alelo mutante mostrou diferença significativa (p = 0,01), sendo 0,074 para os pacientes versus 0,016 para o grupo controle. Não foram encontrados casos de homozigose. Resumo em inglês Hyperhomocysteinemia, resulting from a deficiency in the conversion of homocysteine to cystathionine, constitutes an independent risk factor for vascular diseases. The 844ins68 mutation of the cystathionine-beta-synthetase gene is an additional risk factor for deep venous thrombosis. The aim of this study was to evaluate the frequency of the 844ins68 mutation of the cystathionine-beta-synthetase gene in deep venous thrombosis. In a case control study, 95 patients with dee (mais) p venous thrombosis were evaluated in respect to the presence of the 844ins68 mutation on exon 8 of the cystathionine-beta-synthetase gene. The inclusion criterion included the presence of deep venous thrombosis confirmed by duplex or phlebography. A control group was formed consisting of 95 blood donors, without previous history of venous thrombosis with data such as gender, age and race similar to the study group. Five milliliters of venous blood were collected in EDTA anticoagulant from all the members of both groups. The DNA was extracted from the leukocytes by te DTAB and CTAB methods. Detection of the gene mutation was made by amplification by PCR, using primers for the insertion region and observed by 2% agarose gel electrophoresis using ethidium bromide stain. The fragment corresponding to the normal allele contains 184 base pairs and the mutant allele 252 base pairs. The Fisher exact test was utilized in the analysis of the results. Heterozygote individuals for the mutation were evidenced in 14.73% of the patients and in 3.1% of the control group (p-value = 0.009). The frequency of the mutant allele demonstrated a significant difference (0.074 for the patients versus 0.016 for the control group) (p-value = 0.01). No homozygotic individuals were found.

Scientific Electronic Library Online (Portuguese)

12

Extração de DNA de materiais de arquivo e fontes escassas para utilização em reação de polimerização em cadeia (PCR)/ Methods of DNA extraction from archived materials and rare sources for utilization in polymer chain reaction

Barea, Jaqueline A.; Pardini, Maria Inês M. C.; Gushiken, Tsieko
2004-12-01

Resumo em português Este trabalho visou a comparação de cinco métodos diferentes de extração de DNA de materiais de arquivo (tecidos incluídos em parafina, esfregaços de sangue periférico - corados e não corados com Leishman, lâminas com mielogramas, gotas de sangue em Guthrie Card) e de fontes escassas (células bucais, um e três bulbos capilares e 2 mL de urina), para que fossem avaliadas a facilidade de aplicação e a facilidade de amplificação deste DNA pela técnica da rea (mais) ção de polimerização em cadeia (PCR). Os métodos incluíram digestão por proteinase K, seguida ou não por purificação com fenol/clorofórmio; Chelex 100® (BioRad); Insta Gene® (BioRad) e fervura em água estéril. O DNA obtido foi testado para amplificação de três fragmentos gênicos: Brain-derived neutrophic factor (764 pb), Factor V Leiden (220 pb) e Abelson (106 pb). De acordo com o comprimento do fragmento gênico estudado, da fonte potencial de DNA e do método de extração utilizado, os resultados caracterizaram o melhor caminho para padronização de procedimentos técnicos a serem incluídos no manual de Procedimentos Operacionais Padrão do Laboratório de Biologia Molecular do Hemocentro - HC - Unesp - Botucatu. Resumo em inglês The present work aimed at comparing five different methods of DNA extraction of samples from archived materials (paraffin-embedded tissues, peripheral blood smears - stained or not with Leishman, aspired bone marrow smears and Guthrie card bloodspots) and from rare sources (oral cells, one and three capillary bulbs, 2 mL of urine), to evaluate the ease of application and the possibility of amplification of this DNA by the polymerization chain reaction (PCR) technique. The (mais) methods included proteinase K digestion - followed or not by phenol/chloroform purification, Chelex 100® (BioRad), InstaGene® (BioRad) and boiling in the sterile water. The DNA obtained was tested for amplification of three genic fragments: the brain-derived neutrophic factor gene (764 bp), the Factor V Leiden gene (220 bp) and the Abelson gene (106 bp). According to the gene fragment length studied, the DNA potential source and the extraction method used, the results characterized the best way to standardize technical procedures to be included in the Standard Operational Procedure Manual of the Molecular Biology Laboratory of the Blood Center in the Medicine School of Unesp, Botucatu, Brazil.

Scientific Electronic Library Online (Portuguese)

13

Sarcoide equino associado ao papilomavírus bovino BR-UEL-4/ Equine sarcoid associated with bovine papillomavirus BR-UEL-4

Anjos, Bruno Leite dos; Silva, Mariana Sá e; Diefenbach, Aline; Brito, Marilene de Farias; Seppa, Gilberto dos Santos; Brum, Mário Celso Sperotto
2010-06-01

Resumo em português Um equino, sem raça definida, macho com três anos de idade apresentou múltiplos nódulos na pele, em diversas regiões do corpo. As lesões localizavam-se predominantemente nos lábios, nas bochechas, na região submandibular e na região inguinal direita. Os tumores caracterizavam-se como sarcoides dos tipos misto, fibroblástico, verrucoso e oculto. Histologicamente apresentaram proliferação de fibroblastos dérmicos, muitas vezes ulcerado, com ou sem hiperplasia p (mais) seudoepiteliomatosa da epiderme e formação de pequenos grupos isolados de fibroblastos neoplásicos na derme superficial. Três amostras de tecido foram submetidas à extração de DNA e amplificação por PCR com oligonucleotídeos iniciadores genéricos direcionados para uma região interna do gene L1 dos papilomavírus. Os produtos resultantes da amplificação de duas amostras foram sequenciados e demonstraram identidade de 99% com o papilomavírus bovino (BPV) BR-UEL-4. Essa é a primeira descrição da infecção de equinos, bem como de sua associação com sarcoide pelo BPV BR-UEL-4, um suposto novo tipo de BPV identificado recentemente no Brasil a partir de papilomas cutâneos em bovinos. Resumo em inglês A 3-year-old, mixed breed, male horse showed multiple nodules in different areas of the skin. Lesions occurred predominantly on the lips, cheeks, and submandibular and right inguinal regions. The nodules were characterized as mixed, fibroblastic, verrucous and occult types of sarcoid. Histologically there was proliferation of dermal fibroblasts, with or without pseudoepitheliomatous hyperplasia of the epidermis (frequently ulcerated), and formation of small isolated group (mais) s of neoplastic fibroblasts in the superficial dermis. Three tissue samples were submitted to DNA extraction and PCR amplification with generic primers for the internal region of the papillomavirus L1 gene. The amplified products from two samples were sequenced and showed 99% identity with the bovine papillomavirus (BPV) BR-UEL-4. This is the first description of BPV BR-UEL-4 infecting a horse and causing sarcoid in this species. BPV BR-UEL-4 is a putative new BPV type recently identified in skin papillomas in a Brazilian cattle herd.

Scientific Electronic Library Online (Portuguese)

14

Novos polimorfismos no gene da obesidade em raças divergentes de suínos/ Polymorphisms in the leptin gene in divergent swine breeds

Soares, M.A.M.; Guimarães, S.E.F.; Euclydes, R.F.; Lopes, P.S.; Peixoto, J.O.; Guimarães, M.F.M.; Wenceslau, A.A.; Pires, A.V.; Benevenuto Júnior, A.A.
2006-06-01

Resumo em português Investigou-se a existência de polimorfismo no gene da leptina (gene da obesidade) entre varrões da raça nativa Piau (porco tipo banha) e matrizes mestiças de raças comerciais (Landrace/Large White e Landrace/Large White com Pietrain), selecionadas para peso e precocidade. Oito pares de primers foram desenhados a partir da seqüência disponível no GenBank (U66254), usada, neste trabalho, como seqüência de referência. Amostras de DNA foram extraídas de células s (mais) angüíneas brancas utilizando-se solução de fenol:clorofórmio, após tratamento com proteinase K. Os fragmentos gerados por amplificação da reação em cadeia da polimerase foram purificados e seqüenciados em seqüenciador automático. As seqüências de nucleotídeos, obtidas a partir do DNA das raças comerciais de suíno, apresentaram maior similaridade com a seqüência de referência, e as seqüências geradas a partir do DNA dos animais nativos divergiram de ambas em algumas posições. Dos 28 polimorfismos encontrados, oito foram observados em apenas uma das três seqüências geradas a partir do DNA das raças nativas. Doze estavam presentes em duas seqüências, e os oito polimorfismos restantes foram encontrados nos três animais nativos. Resumo em inglês Leptin gene (obese gene) polymorphism was investigated in Piau boars (a fat, native breed) and sows from commercial strains (Landrace/Large White and Landrace/Large White by Pietrain) chosen for rapid growth and early sexual maturity. Eight pairs of primers designed using the sequence available from GenBank (access nº U66254) were identified as the reference sequence in this project. DNA samples were extracted from white blood cells using phenol:chloroform solution, afte (mais) r treatment with proteinase K. Fragments generated by amplification of the Polymerase Chain Reaction were purified and sequenced in an automatic sequencer. Nucleotide sequences obtained from DNA of commercial swine breeds were similar to the reference sequence; whereas sequences generated from native breed DNA diverged from the reference sequence and from domestic breed DNA. Of the 28 polymorphisms found, eight were observed in only one of the three sequences generated from DNA of native breeds. Twelve polymorphisms were present in two sequences and the eight remaining polymorphisms were found in all three categories of DNA.

Scientific Electronic Library Online (Portuguese)

15

Freqüência de mutação no códon 12 do gene K-ras no carcinoma ductal invasivo de mama/ Frequency of mutations at codon 12 of the K--ras gene in invasive ductal breast cancer

Lima, Sônia Maria Rolim Rosa; Piato, Sebastião; Santos, Roberto Euzébio dos; Matheucci Junior, Euclides; Monte, Osmar
1999-04-01

Resumo em português Objetivo: pesquisar a freqüência de mutação pontual no códon 12 do gene K-ras, em espécimes cirúrgicos de pacientes portadoras de carcinoma ductal invasivo de mama. Material e Métodos: foram utilizados cortes de 50 espécimes cirúrgicos incluídos em blocos de parafina, de pacientes portadoras de carcinoma ductal invasivo de mama, com graus histológicos II e III. Os cortes destinados ao estudo foram desparafinizados e submetidos a extração do DNA, por meio do (mais) emprego da proteinase K. Para a amplificação do fragmento a ser analisado, utilizou-se a reação em cadeia da polimerase, seguida por clivagem com o emprego de enzima de restrição de comprimento variável (RFLP). A verificação da presença de mutação nas amostras foi feita com o emprego de eletroforese em gel de agarose, com marcador de peso molecular "Ladder 123" (GIBCO-BRL), e a documentação dos resultados, mediante fotografia, utilizando-se luz ultravioleta transmitida. Resultados: em cinco dos 50 carcinomas ductais invasivos de mama estudados (10%) constatou-se a presença de mutação no códon 12 do gene K-ras, sendo todas elas polimórficas para esse caráter. As afetadas pelos tumores, que apresentavam a referida mutação, encontravam-se na pós-menopausa. Em quatro dos cinco casos em que se constatou a mutação, o grau histológico dos tumores era II e no caso restante III. Resumo em inglês Purpose: the frequency of point mutation at codon 12 of the K¾ras gene was determined in paraffin blocks of surgical specimens from patients who had ductal invasive breast cancer. Material and Methods: Fifty surgical specimens blocked in paraffin from patients with ductal invasive breast cancer, with histological degree II and III, were used. The polymerase chain reaction (PCR) was used for amplification of DNA fragments studied. The material cle (mais) avage was obtained with restriction fragment length polymorphisms (RFLP). The electrophoresis in agarose gel, with Ladder 123 (GIBCO-BRL) marker, was employed to verify if some mutation had occurred. The results were shown using ultraviolet beam and recorded by photos. Results: mutations at codon 12 of K-ras gene were found in five samples (10%) and all of them were polymorphic for this caracter. The five patients whose tumors expressed mutation were in the postmenopausal period. Four patientes had tumors of histological degree II and one, III.

Scientific Electronic Library Online (Portuguese)

16

Associação dos polimorfismos dos genes TGF-beta1, CD14, IL-4, IL-4R e ADAM33 com a gravidade da asma em crianças e adolescentes/ Association of TGF-beta1, CD14, IL-4, IL-4R and ADAM33 gene polymorphisms with asthma severity in children and adolescents

Faria, Isabel C. J. de; Faria, Elisangela J. de; Toro, Adyléia A. D. C.; Ribeiro, José Dirceu; Bertuzzo, Carmen Silvia
2008-06-01

Resumo em português OBJETIVO: Verificar, em uma amostra de pacientes com asma atópica persistente leve, moderada e grave, a associação entre os polimorfismos dos genes fator de crescimento transformante-beta1 (TGF-beta1) (C-509T e T869C), CD14 (C-159T), IL-4 (C-590T), IL-4R (ILe50Val) e ADAM33 (S_2) com a gravidade da asma. MÉTODOS: Realizou-se um estudo clínico laboratorial prospectivo em pacientes com asma atópica persistente, comparados a um grupo controle no Hospital Universitário (mais) da Universidade Estadual de Campinas nos anos de 2006 e 2007. A análise do polimorfismo T869C do gene TGF-beta1 foi realizada pela técnica de reação em cadeia da polimerase (PCR) + sistema de amplificação refratária de mutação (ARMS). Os outros polimorfismos, C-509T do gene TGF-beta1, C-159T do gene CD14, C-590T da IL-4, ILe50Val da IL-4Ra e S2 do gene ADAM33, foram detectados por PCR e enzima de restrição. RESULTADOS: Foram incluídos 88 pacientes com asma atópica persistente (27 leves, 23 moderados e 38 graves) e 202 indivíduos saudáveis, doadores de sangue. Em relação ao polimorfismo T869C (TGF-beta1), observou-se uma associação entre o genótipo CC e os pacientes com asma grave. Nenhuma associação foi encontrada com os polimorfismos C-509T (TGF-beta1), C-590T (IL4) e S_2 (ADAM33). Quando se comparou a distribuição da freqüência genotípica do polimorfismo C-159T (CD14) na asma grave com o grupo controle, foi observado um resultado significativo com o genótipo TT. Houve associação significativa do genótipo Val/Val (IL-4R) com a asma leve. CONCLUSÃO: Nossos resultados indicam que os polimorfismos T869C (TGF-beta1), C-159T (CD14) e Val/Val (IL-4R) podem estar envolvidos na modulação da gravidade da asma. Resumo em inglês OBJECTIVE: To verify the association of transforming growth factor-beta1 (TGF-beta1) (C-509T and T869C), CD14 (C-159T), IL-4 (C-590T), IL-4R (ILe50Val) and ADAM33 (S_2) gene polymorphisms with asthma severity in a sample of patients with mild, moderate and severe persistent atopic asthma. METHODS: A clinical, laboratory, prospective study was performed in patients with persistent atopic asthma, compared to a control group at Hospital Universitário da Universidade Estadua (mais) l de Campinas between 2006 and 2007. Analysis of the TGF-beta1 T869C gene polymorphism was performed using the technique polymerase chain reaction (PCR) + amplification refractory mutation system (ARMS). TGF-beta1 C-509T, CD14 C-159T, IL-4 C-590T, IL-4Ra ILe50Val, and ADAM33 S2 gene polymorphisms were detected by PCR and restriction enzyme. RESULTS: This study included 88 patients with persistent atopic asthma (27 mild, 23 moderate and 38 severe) and 202 healthy blood donors. As to T869C polymorphism (TGF-beta1), there was an association between the CC genotype and patients with severe asthma. There was no association in polymorphisms C-509T (TGF-beta1), C-590T (IL-4) and S_2 (ADAM33). When distribution of C-159T polymorphism genotype frequency (CD14) in severe asthma was compared with the control group, there was a significant result with the TT genotype. There was significant association of the Val/Val genotype (IL-4R) with mild asthma. CONCLUSION: Our results indicate that T869C (TGF-beta1), C-159T (CD14) and Val/Val (IL-4R) polymorphisms might be involved in modulation of asthma severity.

Scientific Electronic Library Online (Portuguese)

17

Análise de polimorfismo do gene da somatotropina em vacas Nelore e seu efeito sobre o peso à desmama de suas progênies/ Polimorphism analisys of somatotropin gene on Nelore cows and effect on weaning weight of the calf

Faria, F.J.C.; Guimarães, S.E.F.; Lima, R.M.G.; Mourão, G.B.; Pinheiro, L.E.L.
1999-12-01

Resumo em português Informações sobre peso à desmama de um rebanho Nelore foram utilizadas após ajuste para idade padrão de 205 dias, sexo da cria, idade da mãe, touro e mês de desmama, para separar as reprodutrizes em dois grupos, cujos filhos diferiam nesse peso. As médias ajustadas pelo método dos quadrados mínimos foram para os grupos pesado (P) e leve (L) de 163,21± 2,18kg e 134,44± 2,18kg, respectivamente, com 41 animais em cada grupo. Essas reprodutrizes foram submetidas � (mais) � coleta de sangue para estudo de polimorfismos do gene da somatotropina bovina, pela técnica de PCR-RFLP (polymerase chain reaction-restriction fragment length polymorphism). A amplificação de uma região entre o éxon III e V do gene da somatotropina permitiu analisar dois sítios de restrição. Para o sítio do éxon V, todos os animais foram identificados como monomórficos (Leu-Leu). Quanto ao sítio do íntron 3, foi possível identificar os seguintes genótipos 21 (+/-) e 60 (-/-), com as freqüências de 0,13 e 0,87 para os alelos (+) e (-), respectivamente. O peso dos filhos dos animais com o genótipo +/- foi de 152,42± 4,41kg e os -/- 147,60± 2,61kg. Os grupos P e L não diferiram entre si quanto às freqüências alélicas apresentadas. O genótipo das reprodutrizes não afetou o peso à desmama de suas crias, existindo portanto outros efeitos genéticos e não genéticos de maior magnitude. Resumo em inglês Data from a Nelore herd were used after adjustment of the weaning weight for 205 days of age, sex, age of dam, sire and weaning month and resulted into two groups of cows according to the in weaning weight of their calves (heavy and light groups). The least square means (LSM) for weaning weights were 163.21± 2,18kg and 134,44± 2.18kg, for heavy (H) and light (L) groups, with 41 animals each one. These animals were genotyped for DNA polymorphisms of the bovine somatotrop (mais) in gene, using PCR-RFLP (polymerase chain reaction-restriction fragment length polymorphism). Amplification of a region between exons III and V of somatotropin gene allowed analysis of two restriction sites. All animals showed monomorphism for the V exon site, showing the (Leu-Leu) genotype. At intron 3 site, there were identified the 21+/- and 60 -/- genotypes, with 0.13 and 0.87 frequencies to (+) and (-) alleles, respectively. The calves from +/- counts was of 152.42± 4.41kg and of calves from -/- cows was 147.60± 2.61kg. Heavy and light groups were similar for the allelic frequencies. The dam’s genotype did not affect the weaning weight of the calves. This suggests the existence of another genetic or non-genetic factors with major magnitude.

Scientific Electronic Library Online (Portuguese)

18

Transformação genética da batata cultivar Achat via Agrobacterium tumefaciens/ Genetic transformation of potato cultivar Achat by Agrobacterium tumefaciens

Torres, Antonio Carlos; Ferreira, Adriana Teixeira; Romano, Eduardo; Cattony, Mônica Kangussú; Nascimento, Adriana Souza
2000-03-01

Resumo em português Explantes de segmentos nodais de batata (Solanum tuberosum L.) cultivar Achat provenientes da cultura in vitro foram transformados, via Agrobacterium tumefaciens, estirpe LBA4404, contendo o vetor binário pBI121 com os genes npt II e o gus-intron. A regeneração de potenciais transformantes foi feita em meio seletivo contendo 50 mg.L-1 de canamicina. Foram obtidas plantas expressando resistência à canamicina e atividade da b-glucuronidase. Pela análise molecular nas (mais) plantas gus+, via PCR, constatou-se a amplificação dos genes npt II. A hibridização por Southern blotting demonstrou a inserção de pelo menos uma cópia do gene introduzido. Resumo em inglês Nodal segment explants of potato (Solanum tuberosum L.) cv Achat were excised from in vitro growing plants, and transformed with Agrobacterium tumefaciens LBA4404 carrying the binary vector pBI121 with npt II and gus-intron genes. The regeneration of putative transformants was done in medium supplemented with 50 mg.L-1 of kanamycin. Putative transformants expressing kanamycin resistance and b-glucuronidase activity were identified. PCR analysis of these plants showed ampl (mais) ification of the npt II in gus+ plants. Southern blotting hybridization revealed the insertion of at least one copy of the npt II gene.

Scientific Electronic Library Online (Portuguese)

19

Padronização da metodologia do RT-PCR utilizado para identificação do mRNA da alfa-amilase em sementes de milho/ RT-PCR patterning for alpha-amylase messenger RNA identification in germinating maize seeds

Dantas, Bárbara França; Aragão, Carlos Alberto; Araújo-Junior, João Pessoa; Rodrigues, João Domingos; Cavariani, Cláudio; Nakagawa, João
2002-01-01

Resumo em português Durante a germinação das sementes, os carboidratos de reserva são degradados pela atividade de a-amilase. A identificação de mRNA é uma ferramenta fundamental para a definição da cinética de síntese de alfa-amilase. Objetivou-se padronizar a metodologia do RT-PCR para identificar o mRNA do gene de a-amilase em sementes de milho. Após três dias de germinação das cultivares Saracura-BRS 4154 e CATI-AL34, extraiu-se o RNA total pelo método do tiocianato de gua (mais) nidina-fenol-clorofórmio, com algumas modificações. A partir do RNA total extraído foi obtido cDNA com utilização de "random primers". A amplificação por PCR de uma porção do gene da alfa-amilase foi realizada com os "primers": "sense" - CGACATCGACCACCTCAAC; "antisense" - TTGACCAGCTCCTGCCTGTC; gelatina; DMSO e 1,25 unidades de Taq DNA polimerase por reação e completados com água tratada com DEPC. Os ciclos para a amplificação foram 94ºC durante 4 minutos, seguidos por 34 ciclos de 94ºC durante 1 minuto, 42ºC durante 1 minuto e 72ºC durante 1,5 minutos e, finalmente, 72ºC por 5 minutos. O produto do RT-PCR apresentou uma banda de 249 pares de base (pb) bem definida, para as duas cultivares estudadas, não ocorrendo bandas inespecíficas. A técnica do RT-PCR mostrou ser uma metodologia eficiente para a identificação da expressão de alfa-amilase durante a germinação das sementes e pode ser usado para estudo qualitativo e quantitativo da cinética de síntese dessa enzima em experimentos de germinação. Resumo em inglês During germination the seed reserve carbohydrates are degraded by alpha-amylase activity. The identification of mRNA is a very important tool for definition of alpha-amylase synthesis kinetics. This study aimed to adapt a PT-PCR methodology for a-identification of amylase mRNA in germinating maize seeds. After three days germination of Saracura BRS4154 and CATI AL34 maize cultivars, the total RNA was isolated by the guanidinium thiocyanate-phenol-chloroform extraction met (mais) hod, with some modifications. The cDNA was obtained from the total RNA, using random primers. The alpha-amylase gene PCR amplification was carried out with cDNA, primers (sense - CGACATCGACCACCTCAAC; antisense - TTGACCAGCTCCTGCCTGTC); gelatina; DMSO and 1,25 units of Taq DNA polimerase per reaction and complete with DEPC water. The amplification cycles were 94ºC/4 minutes, 34 cycles of 94ºC /1 minute, 42ºC/1 minute and 72ºC/1,5 minutes, and finally 72ºC/5 minutes. The RT-PCR product visualization in agarose gel eletcrophoresis indicated that this method presented well defined bands of 249 bp for the both the cultivars, without unspecific bands. The RT-PCR is an eficient method for alpha-amylase expression studies during germination and can be used as a tool for quantitative and qualitative research about alpha-amylase sinthesis kinetics.

Scientific Electronic Library Online (Portuguese)

20

Análise filogenética de papilomavírus bovino associado com lesões cutâneas em rebanhos do Estado do Paraná/ Phylogenetic analysis of bovine papillomavirus associated with skin warts in cattle herds from the state of Paraná

Claus, Marlise P.; Vivian, Daniel; Lunardi, Michele; Alfieri, Alice F.; Alfieri, Amauri A.
2007-07-01

Resumo em português A infecção pelo papilomavírus bovino (BPV) causa lesões hiperplásicas no epitélio cutâneo dos animais. De acordo com a localização e as características morfológicas das lesões, os seis tipos de BPV são classificados em dois sub-grupos. O objetivo desse trabalho foi identificar os tipos de BPV presentes em lesões cutâneas em bovinos de rebanhos do Estado do Paraná. Os primers degenerados FAP59 e FAP64 foram utilizados para a amplificação de um fragmento c (mais) om 478 pb do gene L1 do BPV bovino em nove amostras de papilomas cutâneos obtidos de seis animais provenientes de quatro rebanhos bovinos do Estado. Em todas as amostras foi possível a amplificação de um produto com a massa molecular esperada. Por meio da análise filogenética das seqüências dos amplicons foi possível identificar o BPV-2 em três amostras, o BPV-1 em uma e o BPV-6 em cinco amostras de papilomas. O BPV-6 foi encontrado tanto em papilomas localizados no teto quanto em outras partes do corpo. Em um dos animais, do qual foram colhidas mais de uma amostra, foi detectada infecção concomitante do BPV-1 com o BPV-2. As cinco amostras positivas para o BPV-6 apresentaram 100% de identidade de nucleotídeos com a amostra padrão disponível no GenBank. No entanto, foram identificadas diferenças entre as amostras do BPV-2 e BPV-1 e aquelas depositadas neste banco de dados. Esse estudo demonstrou a diversidade de tipos do BPV circulantes em rebanhos do Estado do Paraná. Resumo em inglês Bovine papillomavirus (BPV) infection causes hyperplastic lesions in the cutaneous epithelium of cattle. Six types of BPV were classified in two sub-groups, being correlated to the anatomical regions of the infection and morphologic characteristics of the lesions. The present study was carried out to identify the types of BPV present in skin warts of cattle from the state of Paraná, Brazil. The generic primers FAP59 and FAP64 were used for amplification of a 478 bp fragm (mais) ent of BPV L1 gene in nine cutaneous papilloma samples obtained from six animals in four herds. In all papillomas examined, a product with the expected molecular size was amplified. Phylogenetic analysis of the PCR products identified BPV-2 in three samples, BPV-1 in one, and BPV-6 in five papillomas. BPV-6 was detected in cutaneous papillomas of the teat and in other body parts as well. In one animal, from which more than one sample was collected, a concomitant infection by BPV-1 and BPV-2 was identified. The five positive BPV-6 samples showed a nucleotide identity of 100% with the sequence of the reference strain available in GenBank. However, differences among BPV-2 and BPV-1 Brazilian samples and the respective reference sequences deposited in GenBank were observed. Molecular comparison of the two BPV-2 strains identified showed the involvement of two viral variants. This study revealed the diversity of BPV types circulating in the state of Paraná.

Scientific Electronic Library Online (Portuguese)

21

Genotipicação de Clostridium perfringens isolados de frangos de corte através da PCR múltipla/ Genotyping Clostridium perfringens broiler chickens isolates by multiplex PCR products analyses

Gomes, Alexis de Matos; Lobato, Francisco Carlos Faria; Martins, Nelson Rodrigo da Silva; Assis, Ronnie Antunes de
2008-10-01

Resumo em português Clostridium perfringens (Cp) é uma bactéria aneróbica gram positiva que, além de provocar gangrena gasosa e enterotoxemia em humanos e animais, constitui-se na principal causa de enterite necrótica em aves de criações intensificadas. A identificação dos isolados foi realizada pela reação de lecitinase em ágar TSC-gema de ovo, colônias com dupla hemólise em ágar sangue desfibrinado de eqüino, coloração de Gram e provas bioquímicas. Das amostras analisada (mais) s, 171Cp foram isolados em jejuno e íleo de frangos de corte provenientes de um frigorífico da região de Pará de Minas-MG. Cp foi isolado em 62 (49,6%) de 125 amostras de conteúdo lumenal de jejunos e em 109 (87,2%) de igual número de íleos dos frangos de corte. Utilizando-se a técnica da PCR múltipla para genotipicacão das estirpes de Cp, de acordo com os genes para as toxinas principais e letais (cpa, cpb, etx e iA), da toxina cpb2 (cpb2) e enterotoxina (cpe), as estirpes de Cp isoladas foram classificadas em cinco tipos toxigênicos (A-E). Das 62 estirpes de Cp isoladas do jejuno, foram obtidos 42/62 (67,7%) tipo A, 1/62 (1,6%) tipo A com produto de amplificação para o gene da toxina beta2, 0/62 (0%) tipo B, 17/62 (27,4%) tipo C, 1/62 (1,6%) tipo D. Das 109 amostras de Cp isolados do íleo das aves foram obtidos 62/109 (56,9%) tipo A, 3/109 (2,7%) tipo A com produto de amplificação para o gene da toxina beta2, 1/62 (0,9%) tipo B, 38/109 (34,9%) tipo C, 1/109 (0,9%) tipo D. Cp A (60,8%) e Cp C (32,2%) foram os tipos toxigênicos predominantes em conteúdo intestinal de frango de corte. Cinco (2,9%) das 171 amostras de Cp isolados não foram tipificadas. Não foram detectados os genes codificadores das toxinas iota (iA) e enterotoxina (cpe) em nenhuma das 171 estirpes de Cp caracterizados. Resumo em inglês Clostridium perfringens (Cp) is an anaerobic gram-positive bacterium which causes gaseous gangrene and enterotoxaemias in humans and domestic animals, besides being the primary cause of necrotic enteritis in poultry. Cp isolates were preliminary identified according to the lecithinase test on agar TSC-egg yolk, colony with double haemolysis in desfibrinated horse blood agar, Gram staining and biochemical tests. Cp isolates (171) were obtained from the intestinal content o (mais) f broiler chickens sampled in a slaughterhouse in Pará de Minas city, MG, Brazil. Cp was isolated in 62/125 (49.6%) strains from jejunum content and in 109/125 (87.2%) of ileum. Cp strains were classified into five toxigenic types (A-E), using multiplex PCR assay for genotyping of the principal and lethal toxins in the detection of genes coding for toxins alfa, beta, epsilon e iota, nomely genes cpa, cpb, etx e iA genes, beta2 toxin (cpb2) and enterotoxin (cpe). From a total of 62 Cp jejunum isolates obtained 42/62 (67.7%) were type A, 1/62 (1.6%) type A with the amplification of products for beta2 toxin gene (A/B2), 0/62 (0%) type B, 17/62 (27.4%) type C and 1/62 (1.6%) type D. A total of 109 ileum Cp isolates were obtained being 62/109 (56.9%) type A, 3/109 (2.7%) type A/B2 toxin gene, 1/62 (0.9%) type B, 38/109 (34.9%) type C, 1/109 (0.9%) type D. Cp A (60.8%) and Cp C (32.2%) toxigenic types were the most prevalent types in the analyzed intestinal contents of broiler chickens Cp A 104/171 (60.8%) and 55/171 (32.2%) toxigenic types which were the most prevalent types analyzed into two partes of the intestinal content of broiler chickens. Five (2.9%) out of 171 Cp isolates were not typified. The iota toxin (iA) and enterotoxin gene (cpe) codifying genes were not identified.

Scientific Electronic Library Online (Portuguese)

22

Comparação de três protocolos de extração de DNA a partir de tecido fixado em formol e incluído em parafina/ Comparison of three DNA extraction protocols from formaldehyde-fixed and paraffin-embedded tissues

Fernandes, José Veríssimo; Meissner, Rosely de Vasconcellos; Fernandes, Thales Allyrio Araújo de Medeiros; Rocha, Luiz Reginaldo Menezes da; Cabral, Maulori Curie; Villa, Luisa Lina
2004-06-01

Resumo em português OBJETIVO: Padronizar um método alternativo para extração de DNA a partir de tecido fixado em formol e conservado em arquivos de blocos de parafina, visando à realização de estudos retrospectivos. MÉTODOS: Comparou-se a eficiência de protocolos de extração de DNA a partir de tecido parafinado, para análise por reação em cadeia de polimerase (PCR), tomando-se como parâmetro um protocolo baseado em um kit comercial. Foram feitas extrações do DNA de 60 espéci (mais) mes por três métodos: o protocolo A, baseado no kit GlassMAX; o B, utilizando-se o kit GFX TM; e o C, tendo como base o método de Banerjee et al.(2). A integridade e a suficiência do DNA presente na amostra foram avaliadas pela amplificação por PCR de um segmento de 110pb do gene da beta-globina humana, com visualização por meio de eletroforese em gel de poliacrilamida, corado pela prata. Resultados: Das 60 amostras analisadas, 45 apresentaram resultado positivo na PCR quando o DNA foi extraído por qualquer um dos três protocolos. Em seis amostras, a amplificação foi positiva apenas para o DNA extraído pelos protocolos A e C. Em três amostras, o resultado foi positivo apenas para o DNA extraído pelo protocolo A, e em duas, apenas para o DNA extraído pelo protocolo C. CONCLUSÕES: O protocolo C apresentou desempenho semelhante ao do protocolo A, com as vantagens de apresentar menor custo, dispensar o uso de kit comercial, além de não utilizar solventes orgânicos, revelando-se uma alternativa viável para a obtenção de DNA a partir de tecido fixado em formol e incluído em parafina. Resumo em inglês OBJECTIVE: To set up a method for DNA extraction from paraffin embedded cervical cancer specimens, previously formalin-fixed, aiming to accomplish retrospective analysis. METHODS: Sixty specimens were submitted to DNA extraction by three different methods. All of them involved digestion of the tissues by proteinase K, followed by DNA purification, based in three different approaches: protocol A used a DNA isolation kit, GlassMax (Gibco/BRL); protocol B was performed with (mais) the kit GFX TM Amersham Pharmacia Biotech; and protocol C was based on the method proposed by Banerjee et al.(2), with modifications. To evaluate the integrity and sufficiency of the DNA, the samples were submitted to a in vitro amplification of a segment of the human beta-globin gene, and the PCR products were analyzed by electrophoresis on 7% polyacrylamide gels, followed by silver staining. Results: Among 60 analyzed samples, 45 showed positive results when submitted to the three protocols. In six samples, PCR fragments were obtained with DNAs extracted through protocols A e C; in three samples, DNA extraction was achieved with protocol A only; and in two samples the DNA was successfully extracted only through protocol C. CONCLUSIONS: Protocols A and C generated similar results. Although protocol C is more labor-intensive and time consuming, it does not require a commercial kit and therefore has a lower cost. Furthermore, it does not require the use of organic solvents and may be considered a good alternative for DNA extraction from paraffin embedded tissues.

Scientific Electronic Library Online (Portuguese)

23

Avaliação da biodiversidade de rizóbios simbiontes do feijoeiro (Phaseolus vulgaris L.) em Santa Catarina/ Assessment of biodiversity in rhizobia symbionts of common bean (Phaseolus vulgaris L.) in Santa Catarina, Brazil

Stocco, Priscila; Santos, Julio César Pires do; Vargas, Vitor Paulo; Hungria, Mariangela
2008-06-01

Resumo em português Os solos brasileiros, em geral, apresentam uma população abundante de rizóbios capazes de nodular e fixar N2 em simbiose com o feijoeiro (Phaseolus vulgaris L.); contudo, a diversidade dessas bactérias ainda é pouco conhecida. Este estudo teve por objetivo conhecer a biodiversidade de microssimbiontes do feijoeiro em Santa Catarina e, para isso, foram obtidos 117 isolados de nódulos de plantas coletadas em campo, em 23 áreas do extremo oeste, do meio oeste e do pla (mais) nalto sul catarinense. Com base nos atributos morfofisiológicos, os isolados foram classificados em nove grupos. Pela análise dos perfis de DNA após a amplificação (PCR) com o "primer" BOX, que codifica regiões conservadas e repetidas do genoma, 107 perfis distintos foram agrupados em um nível final de similaridade de apenas 26,9 %. Os perfis obtidos pela amplificação do gene 16S ribossômico - referência na taxonomia atual de procariotos - seguida pela digestão com três enzimas de restrição (técnica de RFLP-PCR), resultaram em seis agrupamentos principais e cinco bactérias isoladas. As populações consistiram de 17,1 % de Rhizobium tropici, 35,9 % de R. etli, 32,5 % de R. leguminosarum, 1,7 % de R. giardinii e 12,8 % com perfis distintos das espécies descritas de rizóbios de feijoeiro. R. tropici predominou em solos ácidos do meio oeste e do planalto sul, R. leguminosarum não foi detectado no extremo oeste e R. etli ocorreu nas três regiões, essas duas últimas espécies em solos menos ácidos. Os resultados enfatizam a diversidade genética elevada de rizóbios, inter e intra-específica, nos solos catarinenses, inclusive com a indicação de novas espécies. Resumo em inglês Brazilian soils usually present a great number of populations of rhizobial bacteria capable of nodulating and fixing N2 in symbiosis with common bean (Phaseolus vulgaris L.), but the diversity of these bacteria is still poorly known. This study aimed to assess the biodiversity of micro-symbionts of common bean in the state of Santa Catarina in southern Brazil. One-hundred and seventeen isolates were obtained from field-grown plants in 23 areas of the far west, midwest and (mais) southern plateau of Santa Catarina. Based on morpho-physiological properties, the isolates were classified in nine groups. The DNA analysis by BOX-PCR, with the amplification of conserved and repetitive genome regions, detected 107 different profiles joined at a final similarity level of only 26.9 %, i.e., a high level of genetic diversity. The profiles obtained by the amplification of the 16S rRNA gene, followed by the digestion with three restriction enzymes (RFLP-PCR technique) defined six main groups and five isolated bacteria. The population consisted of 17.1 % Rhizobium tropici, 35.9 % R. etli, 32.5 % R. leguminosarum, 1.7 % R. giardinii and 12.8 % yet undocumented profiles of the common bean rhizobial species. R. tropici predominated in the acid soils of the midwest and southern plateau, R. leguminosarum was not detected in the far west and R. etli occurred in all three regions, while the last two species predominated in less acid soils. The results demonstrate the high inter- and intra-specific rhizobial diversity in the soils of Santa Catarina, besides indicating new species.

Scientific Electronic Library Online (Portuguese)

24

Pesquisa de Acinetobacter sp e Pseudomonas aeruginosa produtores de metalo-β-lactamase em hospital de emergência de Porto Alegre, Estado do Rio Grande do Sul, Brasil/ Investigation of metallo-β-lactamase-producing Acinetobacter sp and Pseudomonas aeruginosa at an emergency hospital in Porto Alegre, State of Rio Grande do Sul, Brazil

Laranjeira, Vani Dos Santos; Marchetti, Desiree Padilha; Steyer, Juçara Rodrigues; Corção, Gertrudes; Picoli, Simone Ulrich
2010-08-01

Resumo em português INTRODUÇÃO: O aparecimento de Pseudomonas aeruginosa e Acinetobacter sp produtores de metalo-β-lactamases (MBLs) é um desafio para os hospitais. MÉTODOS: Verificou-se a produção de MBL em cepas clínicas de Pseudomonas aeruginosa e Acinetobacter sp de um hospital de emergência de Porto Alegre pelo método de aproximação de disco e E-test MBL. Os genes bla foram pesquisados pela PCR. RESULTADOS: Duas cepas de Pseudomonas aeruginosa e oito Acinetobacter sp dem (mais) onstraram fenótipo de MBLs. A amplificação do gene blaSPM-1 confirmou a enzima em P. aeruginosa.. CONCLUSÕES: Deve-se ter cautela ao avaliar testes fenotípicos utilizados na detecção rotineira de metalo-enzima. Resumo em inglês INTRODUCTION: The appearance of metallo-β-lactamase (MBL)-producing Pseudomonas aeruginosa and Acinetobacter sp. is a challenge for hospitals. METHODS: The production of MBL in clinical isolates of Pseudomonas aeruginosa and Acinetobacter sp. From an emergency hospital in Porto Alegre was investigated using the disk approximation test and MBL E-test. The bla genes were determined using PCR. RESULTS: Two strains of Pseudomonas aeruginosa and eight of Acinetobacter sp (mais) were shown to be MBL phenotypes. Amplification of the blaSPM-1 gene confirmed the presence of the enzyme in P. aeruginosa. CONCLUSIONS: Caution is needed in evaluating phenotype tests used for routine detection of metallo-β-lactamases.

Scientific Electronic Library Online (Portuguese)

25

Incidência de mutação no códon 12 do protoncogene K-ras em carcinoma de próstata humana em uma amostra da população brasileira/ The incidence of mutation in codon 12 of the k-ras proto-oncogene in human prostate carcinoma with a Brazilian population sample

Gajardo, José Raul Cisternas; Tobias-Machado, Marcos; Simardi, Lucila Heloisa; Corrêa, Thiago Domingos; Wroclawski, Eric Roger
2004-06-01

Resumo em português Com o intuito de estudar a participação do gene ras ativado na tumorigênese humana, pesquisamos a freqüência de mutação pontual no códon 12 do gene K-ras em espécimes cirúrgicos de pacientes portadores de câncer de próstata. Foi utilizado um grupo controle de pacientes com hiperplasia prostática benigna (HPB). Os cortes destinados ao estudo foram submetidos a extração do DNA pelo método da proteinase K. A amplificação do fragmento isolado foi obtida pela (mais) reação em cadeia de polimerase seguida por clivagem, utilizando-se a enzima de restrição Mval. A eletroforese em gel de agarose permitiu a verificação da presença de mutações. Constatamos a presença de mutação no códon 12 do gene K-ras em dois dos 15 carcinomas de próstata estudados (13,3%), sendo que nenhuma em pacientes com HPB. A ocorrência de mutação de 13,3% na amostra da população brasileira analisada caracteriza uma incidência intermediária entre as populações japonesa e americana. É pouco provável que a mutação isolada do K-ras seja um evento significativo na carcinogênese prostática nesta população. Resumo em inglês Aiming to study the participation of activated ras gene on the human tumorogenesis, we have researched the frequency of a punctual mutation in codon 12 of the K-Ras oncogene in surgical specimens of patients with prostate cancer. We used control group of patients with benign prostatic hyperplasia. The pieces addressed to the study was submitted to the extraction of DNA by the proteina kinase method. The isolated fragment amplification was obtained using a polymerase chain (mais) reaction followed by clevage with Mval restriction enzime. The electrophoresis process allowed the verification of the mutation presence. We noticed the presence of mutation in codon 12 of the K-ras oncogene in two of 15 prostate carcinomas studied (13.3%). None of the patients with prostatic benign prostatic hyperplasia presented any mutation. The mutation incidence of 13.3% on brazilian population sample analysed demonstrated an intermediary incidence between American and Japanese population. It is unlikely that K-ras mutation isolated has a significant role on the prostatic carcinogenesis in this population.

Scientific Electronic Library Online (Portuguese)

26

Leucemia Mielóide Crônica: causas de falha do tratamento com mesilato de imatinibe/ Chronic Myeloid Leukemia: causes of treatment failure with imatinib

Pagnano, Katia B. B.
2008-04-01

Resumo em português O mesilato de imatinibe (MI) é atualmente o tratamento de escolha da Leucemoa Mielóide Crônica (LMC), mas, apesar dos excelentes resultados, não é capaz de erradicar completamente a doença, podendo ocorrer resistência ao tratamento. O mecanismo mais conhecido de resistência é o desenvolvimento de mutações do BCR-ABL, que impedem a ação ligação adequada do imatinibe à quinase, além de amplificação gênica e evolução clonal. No entanto, há uma série d (mais) e outros mecanismos envolvidos e ainda pouco estudados, como alterações na absorção, efluxo e influxo de droga para o interior das células. Devem-se também considerar outros fatores, como aderência ao tratamento e uso de medicamentos concomitantes que podem interferir com imatinibe, diminuindo sua ação. O entendimento desses mecanismos poderá contribuir no desenvolvimento de novas estratégias para o tratamento dos casos resistentes. Resumo em inglês Imatinib is currently the treatment of choice of CML, but despite of the excellent results, it is not able to completely eradicate the disease and resistance may occur. The most studied mechanism is the presence of ABL kinase mutations that interfere with imatinib binding and action, gene amplification and clonal evolution. However, there are other mechanisms involved and less studied such as drug absorption and influx and efflux of imatinib. Besides the true causes of re (mais) sistance, compliance is always a concern and also drug interaction should be checked. An understanding of these mechanisms will certainly contribute to develop new strategies for the treatment of resistant cases.

Scientific Electronic Library Online (Portuguese)

27

Avaliação de dois métodos de extração de DNA de material parafinado para amplificação em PCR/ Evaluation of two methods of DNA extraction from paraffin-embedded material for PCR amplification

Simonato, Luciana Estevam; Garcia, José Fernando; Nunes, Cáris Maroni; Miyahara, Glauco Issamu
2007-04-01

Resumo em português INTRODUÇÃO: Diversos métodos para extração de DNA a partir de tecidos biológicos inclusos em parafina encontram-se descritos na literatura, sendo o sucesso desse procedimento de grande importância para a realização de métodos moleculares de diagnóstico empregando a reação em cadeia da polimerase (PCR). OBJETIVO: Este estudo avaliou dois métodos de extração de DNA de material parafinado, visando à amplificação do DNA genômico pela técnica da PCR. MATER (mais) IAL E MÉTODO: Foram utilizadas 35 amostras de casos de carcinoma epidermóide de assoalho bucal diagnosticados e tratados no Centro de Oncologia Bucal da Universidade Estadual Paulista (Unesp). Os métodos de extração de DNA avaliados incluíram: 1. digestão com proteinase K seguida por purificação com Chelex 100® (BioRad); e 2. sistema QIAamp DNA minikit® (Qiagen). O DNA obtido foi quantificado por espectrofotometria e amplificado pela técnica da PCR, utilizando-se oligonucleotídeos iniciadores para betaglobina. RESULTADOS: A concentração de DNA obtido do material extraído com o primeiro método apresentou média de 120,62 ng/µl com razão entre as leituras das absorbâncias 260/280 variando de 0,8 a 1,41. Para as amostras extraídas com o segundo procedimento, o rendimento médio foi de 67,38 ng/µl, no entanto a razão 260/280 variou entre 1,11 e 2,53. O material foi submetido à PCR e, das 35 amostras extraídas com cada método, respectivamente, 29 e 30 apresentaram sinal positivo. CONCLUSÃO: Os dois métodos utilizados para obtenção de DNA de material parafinado apresentaram desempenho semelhante, revelando que ambos têm potencial para auxiliar na prática da biologia molecular diagnóstica, assim como no estudo diagnóstico retrospectivo em material parafinizado. Resumo em inglês BACKGROUND: There are several methods for DNA extraction from formalin-fixed paraffin-embedded tissues reported in the literature. High success rate on this procedure is important for the use of molecular diagnostic methods based on the polymerase chain reaction (PCR). OBJECTIVE: Two methods of DNA extraction from paraffin-embedded samples were tested aiming at PCR amplification of genomic DNA. MATERIAL AND METHOD: Thirty-five samples were obtained from patients with squa (mais) mous cell carcinoma of mouth floor treated at the Oral Oncology Center in Universidade Estadual Paulista. The DNA extraction methods included: 1. proteinase K digestion followed by Chelex 100® (BioRad) purification and 2. QIAamp DNA minikit® system (Qiagen). Purified DNA was quantified by spectrophometry and a beta-globin gene fragment was amplified using PCR. RESULTS: The DNA concentration from samples applied to the first method presented an average of 120.62 ng/µl and absorbance ratio 260/280 varying between 0.8 and 1.41. From the samples extracted using the second procedure, the mean DNA concentration was 67.38 ng/µl, with absorbance ratio varying between 1.11 and 2.53. DNA samples were submitted to PCR and from 35 samples extracted with both methods, respectively, 29 and 30 were successfully amplified for the beta-globin gene. CONCLUSION: Both methods used to obtain genomic DNA from formalin-fixed paraffin-embedded tissues presented similar performance, revealing their potential to be included in diagnosis of molecular biology, as well as in retrospective studies using archived paraffin-embedded samples.

Scientific Electronic Library Online (Portuguese)

28

Otimização da reação de polimerase em cadeia para detecção de Toxoplasma gondii em sangue venoso e placenta de gestantes/ Optimization of Toxoplasma gondii detection by PCR in pregnants blood and placenta

Spalding, Silvia Maria; Amendoeira, Maria Regina Reis; Coelho, Janice M.C.; Angel, Sergio O.
2002-01-01

Resumo em português A detecção de Toxoplasma gondii no sangue venoso e na placenta de gestantes pela reação de polimerase em cadeia pode facilitar o diagnóstico pré-natal da toxoplasmose congênita. Foram avaliadas gestantes IgM-reagentes e os seus filhos. Além das dosagens de IgG, IgM, IgA e reação de avidez de IgG (MEIA), foram realizadas a técnica de imunoperoxidase e a inoculação em camundongos. De cada amostra foi efetuada amplificação gênica com primers do gene B1 e novo (mais) s primers do gene TGR (chamados ABGTg7 C1 e N1). É preciso observar que o tratamento poderia ser responsável por uma diminuição da infecção. Desta forma, o diagnóstico negativo confirmaria a eficiência do tratamento preventivo na replicação parasitária no útero. A reação de polimerase em cadeia mostrou-se sensível e específica; evidenciou a presença de um a dez taquizoítas; pode ser utilizada com segurança e confiabilidade, além de tornar rápido o diagnóstico da toxoplasmose congênita, sendo, assim, ferramenta importante na avaliação pré-natal. Resumo em inglês The Toxoplasma gondii detection in venous blood and placenta of pregnants by polymerase chain reaction may facilitate the diagnosis of congenital toxoplasmosis. We evaluated pregnants with reagent immunoglobulin M (IgM) and their children. Beyond serological toxoplasma-specific immunoglobulins G (IgG), M (IgM), A (IgA) and IgG avidity (MEIA), we did immunoperoxidasis and mice inoculation. Genomic amplification with gene B1 primers and new TgR primers (called ABGTg7 C1 and (mais) N1) was conducted for each sample. It's necessary to observe that treatment probably is responsible for the infection decrease, that manner, negative results would confirm uteri therapeutic efficiency. PCR was sensitive and specific, it identified one to ten tachyzoites. Besides being a fast form of congenital toxoplasmosis diagnosis, it may be used safely and trustly, as an important tool for congenital evaluation.

Scientific Electronic Library Online (Portuguese)

29

Polimorfismo do gene dos receptores de progesterona e o aborto espontâneo de repetição/ Progesterone receptor gene polymorphism and recurrent spontaneous abortion

Traina, Évelyn; Daher, Silvia; Franchim, Camila Sommerauer; Fuziy, Juliana Aoki; Moron, Antônio Fernandes; Banzato, Priscilla Chamelete Andrade; Mattar, Rosiane
2010-05-01

Resumo em português OBJETIVO: investigar se polimorfismos dos genes que codificam o receptor de progesterona (PROGINS) estão relacionados à ocorrência de aborto espontâneo de repetição (AER). MÉTODOS: em estudo caso-controle, foram selecionados 85 pacientes com antecedente de pelo menos três abortos precoces sem etiologia definida (Grupo Caso) e 157 mulheres com história de pelo menos duas gestações de termo sem intercorrências e sem passado de abortamento (Grupo Controle). Reali (mais) zada coleta de 10 mL de sangue por punção venosa periférica e extração de DNA pela técnica DTAB/CTAB. As genotipagens foram feitas por reação em cadeia de polimerase (PCR), nas condições de ciclagem específica para o polimorfismo em estudo, seguida de amplificação em gel de agarose a 2%. A visualização das bandas foi feita sob luz ultravioleta e os géis foram fotografados. As diferenças genotípicas e alélicas entre os dois grupos para o polimorfismo PROGINS foram calculadas pelo teste de χ2, adotando-se como nível de significância valores de p Resumo em inglês PURPOSE: to assess a possible association between polymorphism of the progesterone receptor gene (PROGINS) and recurrent spontaneous abortion (RSA). METHODS: in this case-control study, 85 women with at least three previous spontaneous abortions without an identifiable cause (RSA Group) and 157 women with at least two previous term pregnancies without pathologies and no previous miscarriage (Control Group) were selected. An amount of 10 mL of peripheral blood was collecte (mais) d by venipuncture and genomic DNA was extracted by the DTAB/CTAB method, followed by the polymerase chain reaction (PCR) under specific conditions for this polymorphism and by amplification by 2% agarose gel electrophoresis. The bands were visualized with an ultraviolet light transilluminator and the gels were photographed. Differences in the PROGINS genotype and allele frequencies between groups were analyzed by the χ2 test, with the level of significance set at p

Scientific Electronic Library Online (Portuguese)

30

Diferenciação de micobactérias por PCR multiplex/ Differentiation of micobacteria by multiplex PCR

Poroca, Diogo da Rocha; Lima, Andrea Santos; Lima, Juliana Falcão de Araújo; Cruz, Heidi Lacerda Alves da; Montenegro, Rosana de Albuquerque; Melo, Fábio Lopes de; Schindler, Haiana Charifker; Montenegro, Lílian Maria Lapa
2009-12-01

Resumo em português O trabalho visou à otimização de um método baseado na reação em cadeia da polimerase multiplex - para diferenciação de micobactérias de interesse para a saúde pública. A PCR Multiplex baseou-se na amplificação simultânea do genehsp65, presente em todo gênero Mycobacterium, do gene dnaJ, presente apenas em Mycobacterium tuberculosis e Mycobacterium avium e da sequência de inserção IS6110 presente no complexo Mycobacterium tuberculosis, gerando amplicons d (mais) e 165pb, 365pb e 541pb, respectivamente. O limite de detecção foi de 1fg para o alvo hsp65, 100pg para o dnaJ e 0,1fg para o IS6110. A PCR multiplex detectou até 100pg de DNA de Mycobacterium tuberculosis. O sistema demonstrou ser específico e sensível na detecção de Mycobacterium tuberculosis, Mycobacterium bovis, Mycobacterium avium e Mycobacterium smegmatis. Os resultados obtidos utilizando cepas de referência demonstraram que a PCR multiplex pode ser uma ferramenta rápida, sensível e específica na diferenciação de micobactérias. Resumo em inglês This study aimed to optimize a method based on the polymerase chain reaction - multiplex PCR - for differentiation of mycobacteria species of interest for public health. The multiplex PCR was based on simultaneous amplification of the hsp65 gene, which is present in all species of the Mycobacterium genus, the dnaJ gene, which is present only in Mycobacterium tuberculosis and Mycobacterium avium and the IS6110 insertion sequence, which is present in the Mycobacterium tuber (mais) culosis complex, generating amplicons of 165 bp, 365 bp and 541 bp, respectively. The detection limit was 1 fg for the hsp65 target, 100 pg for dnaJ and 0.1 fg for IS6110. The multiplex PCR detected down to 100 pg of DNA of Mycobacterium tuberculosis. The system was shown to be specific and sensitive for detection of Mycobacterium tuberculosis, Mycobacterium bovis, Mycobacterium avium and Mycobacterium smegmatis. The results obtained using reference strains of mycobacteria showed that multiplex PCR may be a fast, sensitive and specific tool for differentiation of mycobacteria.

Scientific Electronic Library Online (Portuguese)

31

Novos conhecimentos sobre a flora bacteriana vaginal/ Vaginal bacterial flora: up to date

Linhares, Iara Moreno; Giraldo, Paulo Cesar; Baracat, Edmund Chada
2010-01-01

Resumo em português O objetivo desta revisão foi apresentar os novos conhecimentos sobre o ecossistema vaginal, enfatizando os métodos não cultiváveis de identificação microbiana (amplificação de genes), as várias espécies de Lactobacillus que podem compor a flora vaginal e a interação desta com os mecanismos locais de imunidade inata e adquirida, dependentes dos constituintes genéticos. Foram pesquisados no Medline (Pubmed) os artigos relacionados ao tema publicados entre 1997 (mais) e 2009, selecionando-se apenas os considerados relevantes. A utilização de técnicas não cultiváveis (técnicas de amplificação de genes) tem possibilitado o melhor conhecimento sobre a composição do ecossistema vaginal. Na maioria das mulheres no menacme predominam na vagina uma ou mais espécies de Lactobacillus: L. crispatus, . L. inners e L gasseri. Entretanto, em outras mulheres aparentemente saudáveis pode haver deficiência ou mesmo ausência de Lactobacillus, que são substituídos por outras bactérias produtoras de ácido lático: espécies de Atopobium, Megasphaera e/ou Leptotrichia. A infecção e/ou a proliferação de bactérias patogênicas na vagina são suprimidas pela produção de ácido lático, por produtos gerados pelas bactérias e pela atividade local das imunidades inata e adquirida. As células epiteliais vaginais produzem diversos componentes com atividade antimicrobiana. Tais células ainda possuem receptores de membrana ("Toll-like receptors") que reconhecem padrões moleculares associados aos patógenos. O reconhecimento leva à produção de citocinas proinflamatórias e à estimulação da imunidade antigenoespecífica. A produção de anticorpos IgG e IgA também pode ser iniciada na endocérvice e na vagina em resposta à infecção. Conclui-se que a composição da flora vaginal e os mecanismos de imunidade representam importantes mecanismos de defesa. Os critérios de "flora normal" e "flora anormal" devem ser revistos; os polimorfismos genéticos podem explicar variações na composições da flora. Ressalta-se a necessidade de que tais conhecimentos sejam incorporados à pratica clínica do ginecologista e obstetra para o aprimoramento do cuidado às pacientes. Resumo em inglês The aim of this review is to update knowledge about the vaginal ecosystem, non-cultivation methods for bacterial identification (gene amplification), the Lactobacillus species that comprise normal vaginal flora and influence of host genetics on bacterial interactions with local innate and acquired immune defenses. A Medline (Pubmed) search from 1997-2009 for relevant articles was performed and the most informative articles were selected. Non-culture techniques (gene ampli (mais) fication) allow a comprehensive analysis of the vaginal ecosystem's composition. In the majority of women in the reproductive age there is a predominance of one or more species of Lactobacillus: L. crispatus, L. inners and L gasseri. However, in other apparently healthy women there is a deficiency or complete absence of Lactobacilli. Instead, there is a substitution by other lactic acid-producing bacteria: Atobium, Megasphaera and/or Leptotrichia species. The infectivity and/or proliferation of pathogenic bacteria in the vagina is suppressed by lactic acid production, by products of endogenous bacteria and by activation of local innate and acquired immunity. Vaginal epithelial cells produce several compounds with anti-microbial activity. These cells have Toll-like receptors on their membrane that recognize molecular patterns associated with pathogens. Recognition leads to production of pro-inflammatory cytokines and stimulation of antigen-specific immunity. The production of IgG and IgA antibodies is also triggered in the endocervix and vagina in response to infection. Vaginal flora composition and the immune mechanisms constitute important defenses. Criteria of normal and abnormal flora have to be reviewed and genetic polymorphism can explain variations in flora composition. This new knowledge should be included in the clinical practice of gynecologists and obstetricians to improve patients care.

Scientific Electronic Library Online (Portuguese)

32

Avaliação de métodos de preservação de amostras de plantas de savanas neotropicais para a obtenção de DNA de alta qualidade para estudos moleculares/ Evaluation of methods of Neotropical Savanna plant samples preservation for yielding high quality DNA for molecular studies

Feres, Fabíola; Souza, Anete P. de; Amaral, Maria do Carmo E. do; Bittrich, Volker
2005-06-01

Resumo em português Foram comparadas metodologias para preservação de amostras de folhas de plantas de savanas neotropicais, visando a posterior obtenção de DNA de alta qualidade para estudos moleculares. Foram também testadas diferentes metodologias para extração de DNA das amostras investigadas. A qualidade do DNA extraído foi avaliada através de dois métodos: por digestão, utilizando-se três enzimas de restrição e através da amplificação do gene mitocondrial cox3 (subunid (mais) ade III da citocromo oxidase) por PCR. Os resultados revelaram que, para as plantas de savanas investigadas, a metodologia de preservação de amostras mais comumente empregada pelos botânicos (desidratação rápida usando sílica-gel) não é a mais eficiente. Os resultados obtidos demonstram a importância de testar diferentes métodos de preservação de amostras vegetais para estudos moleculares, para garantir a obtenção de DNA de alta qualidade. Para as plantas de savanas neotropicais, o método de preservação em sílica gel pode ser menos eficiente do que outros métodos igualmente simples de preservação de amostras. Resumo em inglês Methods for the preservation of leaf sample from plants occurring in neotropical savannas were compared, with the aim to get high quality DNA for molecular studies. Different methods for DNA isolation of the same samples were also compared. The DNA quality was evaluated by two empirical methods: digestion of the DNA with three restriction enzymes and by amplification of the mitochondrial cox3 gene by PCR. The results show that, for the savanna plants investigated, the mos (mais) t commonly employed method for plant sample preservation (quick dehydratation using silica gel) is not the most efficient. Our results demonstrate the importance of testing different methods of plant tissue preservation for molecular studies to guarantee high quality DNA. For plants from neotropical savannas, the silica gel method might be often less efficient than other equally simple methods of sample preservation.

Scientific Electronic Library Online (Portuguese)

33

Expressão imuno-histoquímica de c-erb-B2 e p53 em carcinomas gástricos/ Imunohistochemical expression of c-erb-B2 and p53 in gastric carcinomas

Begnami, Maria Dirlei F. S.; Campos, Antônio Hugo J. F. M.; Silva, Edaíse; Montagnini, André; Nascimento, Carlos F.; Nonogaki, Sueli; Soares, Fernando
2005-08-01

Resumo em português INTRODUÇÃO: Em nosso meio, os carcinomas gástricos ainda são neoplasias bastante freqüentes e responsáveis por altas taxas de mortalidade. Recentemente, têm-se demonstrado a expressão de p53 e a amplificação do gene c-erb-B2 nos carcinomas gástricos. A relevância e o significado biológico destas alterações ainda não foram totalmente estabelecidos. OBJETIVO: Estudar as expressões imuno-histoquímicas de p53 e c-erb-B2 em 482 casos de carcinomas gástricos. (mais) MATERIAL E MÉTODOS: Foram construídos três blocos de tissue microarray (TMA) utilizando-se duplicatas de 482 casos de carcinomas gástricos. Os cortes foram corados por hematoxilina e eosina (HE), tendo sido feita pesquisa para p53 e c-erb-B2. Foram considerados positivos para p53 os casos com marcação nuclear em mais de 10% das células tumorais. Para o c-erb-B2 foram considerados positivos os casos com marcação de membrana completa em mais de 10% das células tumorais. RESULTADOS: A expressão de p53 e c-erb-B2 foi observada em 30% e 12% dos casos, respectivamente. Em relação aos tipos histológicos observou-se correlação entre os carcinomas do tipo intestinal e a expressão de c-erb-B2 (p Resumo em inglês INTRODUCTION: Gastric cancer is one of the commonest cancers in our country being responsible for a high mortality rate. Recently, the expression of p53 and amplification of c-erb-B2 gene have been described in gastric carcinoma. The relevance and biological significance of these findings are not established yet. OBJECTIVE: The authors investigated p53, c-erb-B2 immunohistochemical expression in 482 cases of gastric carcinomas. MATERIAL AND METHODS: Tissue microarray (TMA (mais) ) blocks were designed using replicate samples of paraffin-embedded tissue from 482 gastric carcinomas. Sections were stained with HE, and antibodies to p53 and c-erb-B2. Cases were considered p53 positive if nuclear staining was detected in > 10% of the tumor cells. Cases were assessed c-erb-B2 positive if the entire circunference of the cell membrane was stained in > 10% of the tumor cells. RESULTS: Overall expression of p53 and c-erb-B2 was observed in 30% and 12% of gastric carcinomas cases, respectively. Relationship with intestinal type of gastric carcinomas and expression of c-erb-B2 was shown (p

Scientific Electronic Library Online (Portuguese)

34

Estudo comparativo de três diferentes procedimentos para extração de RNA a partir de amostras fixadas em formalina e embebidas em parafina/ Comparative study of three different procedures for RNA extraction from formalin-fixed paraffin-embedded samples

Ribeiro-Silva, Alfredo; Garcia, Sérgio Britto
2008-04-01

Resumo em português INTRODUÇÃO: O desenvolvimento de métodos de extração de RNA a partir de amostras fixadas em formalina e embebidas em parafina (FFEP) possibilitou estudos retrospectivos de biologia molecular. Objetivos: Comparar a quantidade e a qualidade do RNA extraído de amostras FFEP a partir de três kits disponíveis comercialmente. MATERIAL E MÉTODO: Utilizando-se três diferentes procedimentos, o RNA total foi extraído de 14 blocos de parafina contendo fragmentos de carcin (mais) omas mamários, todos arquivados há 10 anos. A quantidade do RNA foi expressa em pg/µl; e a qualidade, pelo número de integridade do RNA (NIR), utilizando-se o Bioanalyzer da Agilent com o Pico LabChip. O RNA de maior NIR extraído de cada uma das 14 amostras foi amplificado por reação em cadeia da polimerase com transcrição reversa (RT-PCR) utilizando-se o gene G6PD, com primers designados para gerar fragmentos de 67, 151 e 242 pares de bases (pb). RESULTADOS: A média e a mediana da quantidade do RNA extraído para os três protocolos foram, respectivamente, 42,91 e 31,31 pg/µl. A média e a mediana do NIR foram, respectivamente, 1,8 e 2. Em todas as amostras, o gene G6PD foi amplificado para fragmentos de RNA de 67 e 151 pb. DISCUSSÃO: Como houve grande variação individual na quantidade e na qualidade do RNA extraído para cada amostra, os dados do presente estudo indicam que, se não for possível extrair RNA de uma determinada amostra na primeira tentativa, uma segunda extração deve ser realizada antes de se descartar essa amostra para testes de biologia molecular. CONCLUSÕES: Nos três procedimentos utilizados foi possível extrair RNA de qualidade aceitável para amplificação por RT-PCR (com NIR > 1,4). Resumo em inglês BACKGROUND: The development of methods for RNA extraction from formalin-fixed paraffin-embedded (FFPE) samples has allowed retrospective studies of molecular biology. OBJECTIVES: To compare the quantity and quality of RNA extracted from FFPE samples using three commercially available kits. Material and methods: Using three different procedures, the total RNA was extracted from 14 paraffin blocks containing fragments of mammary carcinomas, which had been archived for 10 ye (mais) ars. The quantity of RNA was expressed in pg/µl; and the quality in RNA integrity number (RIN), by using the Agilent Bioanalyser with Pico LabChip. The RNA with higher RIN extracted from each of the 14 samples was amplified by reverse transcriptase-polymerase chain reaction (RT-PCR) using the G6PD gene with primers designed to create fragments with 67, 151 and 242 base pairs (bp). RESULTS: The mean and median of RNA quantity extracted for the three procedures were respectively 42.91 and 31.31 pg/µl. The mean and median of RIN were respectively 1.8 and 2. In all the samples, the G6PD gene was amplified for RNA fragments with 67 and 151 bp. DISCUSSION: Due to the significant individual variation in quantity and quality of the extracted RNA from each sample, the data from the present study show that, if it is not possible to extract RNA from a given sample in the first attempt, a second extraction should be performed before excluding this sample. CONCLUSION: It was possible to extract RNA with acceptable quality for amplification by RT-PCR (RIN > 1.4) in the three procedures used.

Scientific Electronic Library Online (Portuguese)

35

Optimização da detecção do polimorfismo Ala 677 - Val do gene que codifica a metilenotetrahidrofolato redutase (MTHFR)/ Optimization of Methylenetetrahydrofolate Reductase C677T polimorphism detection

Persuhn, Darlene Camati; Soares Melo, Sandra; Maccagnan, Carlos Leonardo; Besen, Pinheiro; Sansão, Fabiano; Mangrich, Iriane Eger
2006-03-01

Resumo em português A mutação (C677T) no gene que codifica a enzima metilenotetrahidrofolato redutase (MTHFR) tem sido associada a hiperhomocisteinemia e possivelmente ao risco elevado para doenças vasculares. O objetivo deste trabalho foi otimizar sua detecção por PCR para faciliar estudos populacionais. Foram testadas metodologias alternativas de purificação do DNA genômico humano e os resultados obtidos permitiram padronizar uma técnica com redução de reagentes para extração (mais) de DNA por precipitação com NaCl. Foram realizados experimentos variando a concentração dos componentes da reação de PCR que permitiram definir que reações contendo metade do volume inicial de deoxinucleotídeos e iniciadores (primers), assim como 0,5U de Taq DNA polimerase produzem essencialmente a mesma quantidade de amplificado que a reação anteriormente utilizada. Testou-se ainda, a redução do volume da reação de PCR com objetivo de utilizar o produto de amplificação diretamente para digestão com a enzima HinfI, evitando assim, etapas de pipetagem que acarretam em risco de contaminação. Obteve-se sucesso com 15 mL de volume final; que permitiu a utilização do sistema de PCR completo para digestão do produto amplificado. A importância deste estudo pode ser justificada pela significância que as doenças vasculares apresentam em termos populacionais e por este polimorfismo estar potencialmente relacionado com o risco de DAC (doença artério-coronariana) precoce. Resumo em inglês A common mutation C677T in methylenetetrahydrofolate reductase (MTHFR) gene, involved in the metabolism of homocysteine, has been suggested to play a role in increasing cardiovascular disease risk. In order to facilitate the obtainment of population data, the objective of this work was improve its PCR detection. Leucocytes DNA purification alternative protocols were tested and a new low cost method of NaCl precipitation was developed. The composition of PCR mixture was al (mais) so tested and it defined that the concentration of deoxynucleotides, primers and Taq DNA polimerase could be reduced in a half. The final volume of PCR mixture was reduced to 15 µL, enabling the utilization of the same tube to amplification and HinfI digestion processes, avoiding extra steps. The significance of cardiovascular disease in populational data and the possibility of involvement of this mutation as risk factor of precocious ACD (arterial cardiovascular disease) justify this work.

Scientific Electronic Library Online (Portuguese)

36

Um protocolo de "nested-PCR" para detecção do vírus da anemia das galinhas/ A nested-PCR protocol for detection of the chicken anemia virus

Simionatto, Simone; Lima-Rosa, Carlos André da Veiga; Rubin, Lauricio Librelotto; Canal, Cláudio Wageck
2005-06-01

Resumo em português Este trabalho descreve o estabelecimento de um pro!tocolo de "nested-PCR" para a detecção do vírus da anemia das galinhas (CAV, chicken anemia virus), agente causador da anemia infecciosa das galinhas. Para a extração de DNA a partir de amostras clínicas um método baseado no uso de tiocianato de guanidina mostrou-se mais sensível e prático, do que os demais avaliados. Para a PCR inicial foi selecionado um par de primers que amplifica uma região de 664 pares de b (mais) ases (pb) do gene VP1. Para a "nested-PCR" propriamente dita, foi selecionado um segundo par que amplifica uma região interna de 520 pb. A especificidade dos primers foi avaliada utilizando amostras de lotes controlados para CAV. Outras trinta amostras vírus e bactérias, causadoras de doenças em aves, não geraram produto de amplificação. A sensibilidade do teste foi determinada a partir de diluições seriadas de uma amostra vacinal de CAV. A "nested-PCR" mostrou ser mais sensível do que a PCR e foi capaz de detectar pelo menos 0,16 TCID50% da cepa vacinal. Além disso, detectou DNA viral em tecidos, soro e cama aviária de lotes com e sem sinais clínicos. Conclui-se que, como técnica para a detecção do CAV, o protocolo de "nested-PCR" aqui descrito, é mais sensível, rápido e menos trabalhoso do que o isolamento viral em cultivo celular. Resumo em inglês This paper reports a nested polymerase chain reaction (nested-PCR) protocol for detection of chicken anemia virus (CAV), the causal agent of infectious chicken anemia. For DNA extraction from clinical samples, a method based on guanidine thiocyanate was found more sensitive and practical than other extraction protocols tested. The pair of primers used in the initial PCR targeted a 664 bp fragment on the VP1 gene. The primers for the internal PCR targeted a fragment of 520 (mais) bp. The specificity of the primers was evaluated on samples of CAV controlled flocks. Thirty different viruses and bacteria isolated from chickens did not give rise to any amplification product in the assay. The sensitivity of the nested-PCR was determined on serial dilutions of a CAV vaccine. The nested-PCR was more sensitive than a one step PCR and was able to detect at least 0.16 TCID50 of the vaccine strain. In addition, the protocol employed here detected viral DNA from tissues, sera and litter from flocks with or without clinical signs of disease. It is concluded that the nested-PCR protocol described here is more sensitive, faster and less cumbersome than virus isolation in cell culture as a diagnostic technique for detection of CAV.

Scientific Electronic Library Online (Portuguese)

37

Caracterização molecular de acessos de Cratylia argentea e sua relação filogenética com outras leguminosas/ Molecular characterization of Cratylia argentea accessions and its phylogenetic relationship with other legumes

Galdino, Alexsandro Sobreira; Lima, João Paulo Matos Santos; Antunes, Renata de Souza Panarari; Prioli, José Alberto; Thiers, Paulo Roberto; Silva, Glocimar Pereira da; Grangeiro, Thalles Barbosa
2010-08-01

Resumo em português O objetivo deste trabalho foi realizar a caracterização molecular de 11 acessos de Cratylia argentea, com base no sequenciamento da região ITS (ITS1/5,8S/ITS2), bem como o estabelecimento de suas relações filogenéticas com outras leguminosas. As relações filogenéticas dessa espécie com outras 15 leguminosas foram estabelecidas com o uso de sequência do gene que codifica a subunidade 18S do rRNA (rDNA 18S). A amplificação do DNA da região ITS/5,8S dos 11 aces (mais) sos revelou uma única banda de aproximadamente 650 pb. Sequências ITS/5,8S foram obtidas de todos os acessos analisados e depois alinhadas com a região ITS/5,8S da leguminosa Galactia striata. O tamanho das sequências ITS/5,8S dos acessos de C. argentea variou de 565 a 615 pb. Os conteúdos médios de G + C nas regiões ITS1 e ITS2 variaram entre 46 e 47%. O alinhamento múltiplo das seqüências ITS/5,8S dos acessos de C. argentea com Galactia striata revelou a presença de deleções e inserções. Os acessos de C. argentea constituíram um único clado politômico. A análise filogenética de C. argentea demonstrou que essa espécie está incluída no clado das Diocleinae verdadeiras e que os gêneros Calopogonium e Pachyrhizus estão fora desse clado. Resumo em inglês The objective of this work was to molecularly characterize 11 Cratylia argentea accessions, based on the ITS (ITS1/5.8S/ITS2) region sequencing, as well to establish its phylogenetic relationship with other legume species. The phylogenetic relationship of this species with other 15 legume ones was established using a gene sequence that codes the subunit 18S of the rRNA (rDNA 18S). DNA amplification of the ITS/5.8S region of these 11 accessions revealed an amplicon with ar (mais) ound 650 bp. ITS/5.8S sequences were obtained from all accessions analysed, and then aligned with the region ITS/5.8S of Galactia striata legume. The size of ITS/5.8S region ranged from 565 to 615 bp. Average G + C contents in the ITS1 and ITS2 regions ranged between 46 and 47%. The multiple sequence alignment between the ITS sequences from C. argentea accessions and Galactia striata revealed the presence of deletions and insertions. C. argentea accessions formed a unique politomic clade. Cratylia argentea phylogenetic analysis demonstrated that this species is placed into the true Diocleinae Clade, and that Calopogonium and Pachyrhizus are not included in subtribe Diocleinae.

Scientific Electronic Library Online (Portuguese)

38

Detecção de Ornithobacterium rhinotracheale (ORT) por meio da reação em cadeia da polimerase (PCR)/ Polymerase chain reaction (PCR) detection of Ornthobacterium rhinotracheale (ORT)

Canal, Cláudio Wageck; Rocha, Silvio Luís da Silveira; Leão, Joice Aparecida; Fallavena, Luiz Cezar Bello; Oliveira, Silvia Dias de; Beltrão, Nilzane
2003-04-01

Resumo em português Ornithobacterium rhinotracheale (ORT) é uma bactéria Gram negativa recentemente descrita que se encontra associada às doenças do trato respiratório em criações de aves comerciais e silvestres em vários países do mundo. No Brasil, foram detectados anticorpos em um pequeno número de frangos de corte e suas matrizes dos Estados de São Paulo e Minas Gerais. Como a bactéria é fastidiosa, a Reação em Cadeia da Polimerase (PCR) torna-se útil para sua detecção e (mais) identificação. O presente trabalho visou verificar a ocorrência da ORT no Rio Grande do Sul pela detecção do DNA da bactéria. Foram coletadas 84 amostras de suabe de traquéia de aves pertencentes a 14 lotes de diferentes empresas avícolas. O DNA foi purificado e a PCR realizada com iniciadores específicos para o gene do RNA ribossomal 16S da ORT. Foram observados produtos de amplificação com 784 pares de bases em 10 das 84 amostras. As amostras positivas pertenciam a quatro lotes de três empresas estabelecidas em diferentes regiões do RS. Os resultados indicam que este patógeno respiratório de aves existe no Brasil e está presente em importantes regiões criatórias do RS. Outros estudos estão em andamento para determinar a prevalência e caracterização dos isolados obtidos. Resumo em inglês Ornithobacterium rhinotracheale (ORT) is a recently discovered Gram negative bacterium that has been associated with respiratory diseases in commercial poultry and wild birds from many countries. In Brazil, antibodies were detected in some broiler and breeder flocks from the States of São Paulo and Minas Gerais. Because the bacteria is difficult to grow, the Polymerase Chain Reaction (PCR) has been found to be suitable for identification and diagnostic purposes. The aim (mais) of the present work was to verify the occurrence of ORT in Rio Grande do Sul through the detection of the bacteria DNA. Tracheal swabs (84) were collected from 14 broiler flocks of distinct companies. DNA was purified and PCR performed with species specific primers from the ORT 16S ribosomal RNA gene. Amplification products with 784 base pairs were obtained from 10 out of the 84 samples. The positive samples were from four flocks of tree companies established in different regions of the state. The results indicate that this respiratory pathogen occurs in major broiler producing areas from the State of Rio Grande do Sul. Further studies are under way to determine the prevalence of this pathogen and to characterize the strains isolated.

Scientific Electronic Library Online (Portuguese)

39

Associação entre carcinoma espinocelular de cabeça e pescoço e polimorfismo no p53 (códon 72)/ P53 codon 72 polymorphism association with head and neck squamous cell carcinoma

Mojtahedi, Zahra; Hashemi, Seyed Basir; Khademi, Bijan; Karimi, Morteza; Haghshenas, Mohammad Reza; Fattahi, Mohammad Javad; Ghaderi, Abbas
2010-06-01

Resumo em português O gene supressor tumoral p53 abriga um polimorfismo funcional que codifica ou arginina (Arg) ou prolina (Pro) no códon 72 da proteína p53. Este polimorfismo tem sido considerado associado com o desenvolvimento e prognóstico do carcinoma espinocelular de cabeça e pescoço (CECP). OBJETIVO: Foram avaliados genótipo e freqüências alélicas do códon 72 do p53 em pacientes iranianos com CECP. TIPO DE ESTUDO: Estudo de Caso. MATERIAIS E MÉTODOS: Um total de 132 pacient (mais) es com CECP e 123 controles saudáveis foram genotipados. A fonte de DNA foi composta de células mononucleares do sangue periférico. A amplificação do DNA foi realizada através da reação em cadeia da polimerase específica para alelos. RESULTADOS: A distribuição dos alelos e genótipos não foi significativamente diferente entre os pacientes e controles. Além disso, nenhuma associação estatisticamente significativa foi encontrada entre o polimorfismo do códon 72 do p53 e localização, sexo ou idade no momento do diagnóstico. No entanto, o genótipo Pro/Pro estava significativamente aumentado em pacientes no estágio IV (30,8%) quando comparado ao estágio I-III da doença (11,1%) (p=0,03), e um número significativamente maior de doentes com o alelo Pro teve um aumento no risco de desenvolver doença no estágio IV (OR=2,2, IC= 95% =1.2-4.2, p=0,01). CONCLUSÃO: Os dados revelaram que o polimorfismo do p53 não afeta o risco de CECP em iranianos; porém, pode afetar a progressão para um estágio superior tumor. Resumo em inglês p53 tumoral suppressor gene harbors a functional polymorphism which codes either arginine (Arg) or proline (Pro) in the protein p53 of codon 72. Such polymorphism has been associated with the development or prognosis of head and neck squamous cell carcinoma (HNSCC). AIM: we assessed codon 72 p53 allelic frequencies and genotypes in HNSCC Iranian patients. STUDY DESIGN: Case Study. MATERIALS AND METHODS: a total of 132 HNSCC patients and 123 healthy controls were genotyped (mais) . DNA source was from mononuclear cells of the peripheral blood. DNA amplification was done by means of the allele-specific polymerase chain reaction. RESULTS: genotypes and allele distribution were not significantly different between patients and controls. Moreover, no statistically significant association was found between the 72 and p53 codon tumor location, gender or age at the time of diagnosis. However, the Pro/Pro genotype was significantly increase in stage IV patients (30.8%) when compared to stages I-III of the disease (11.1%) (p=0.03), and a significantly higher percentage of patients with the Pro allele had and a risk increase in stage IV disease (OR=2.2, 95% CI=1.2-4.2, p=0.01). CONCLUSION: data revealed that the p53 polymorphism do not impact the risk of HNSCC in Iranians, nonetheless, it can affect tumor progression to a higher tumor stage.

Scientific Electronic Library Online (Portuguese)

40

Fatores de risco ambientais para o câncer gástrico: a visão do toxicologista/ Environmental risk factors for gastric cancer: the toxicologist's standpoint

Gomes-Carneiro, Maria Regina; Ribeiro-Pinto, Luís Felipe; Paumgartten, Francisco José Roma
1997-01-01

Resumo em português A carcinogênese é um processo altamente complexo do qual participam fatores de risco herdados e fatores de risco ambientais, tais como a alimentação, o hábito de fumar, a ocupação, e a exposição a radiação e a agentes químicos. A toxicologia experimental identifica as substâncias químicas potencialmente carcinogênicas e torna possível medidas regulatórias que objetivam reduzir a exposição humana a elas. A carcinogênese pode ser vista como consistindo d (mais) e três seqüências distintas: a iniciação, a promoção e a progressão. A conversão neoplásica (iniciação) ocorre quando um evento genético (mutações, rearranjos cromossômicos, inserções ou deleções de genes e amplificação de genes) resulta em ativação de oncogenes e/ou em falta de expressão - ou inativação de produtos - de genes supressores de tumores. A promoção envolve a expansão clonal das células "iniciadas" e exige a proliferação celular. Estratégias efetivas para reduzir os riscos de câncer gástrico e os riscos de neoplasias de outras localizações devem incluir o controle de carcinógenos conhecidos, assim como a quimioprevenção, por meio de intervenções racionais no processo carcinogênico. Neste sentido, o desafio a ser enfrentado pelo toxicologista envolve o desenvolvimento de ensaios preditivos melhores e mais baratos e a elucidação dos mecanismos subjacentes à carcinogênese química. Resumo em inglês Carcinogenesis is a highly complex process involving both inherited risk factors and environmental ones such as diet, smoking, occupation, and exposure to radiation and chemical agents. Experimental toxicology identifies potentially carcinogenic chemicals and thus makes it possible to introduce regulatory measures aimed at reducing human exposure to them. Carcinogenesis can be viewed as consisting of three distinct sequences: initiation, promotion, and progression. Neopla (mais) stic conversion (initiation) occurs when a genetic event (e.g., point mutations, chromosomal rearrangements, insertion or deletion of genes, and gene amplification) results in oncogene activation and/or lack of expression - or inactivation of products - of tumor suppressor genes. Promotion involves clonal expansion of initiated cells and requires cell proliferation. Effective strategies for reducing risk of gastric cancer or neoplasias at other sites should include both control of known carcinogens and chemical prevention through rational interventions in the carcinogenic process. The toxicologist's challenge is thus to devise better and less expensive predictive assays and to elucidate the mechanisms underlying chemical carcinogenesis.

Scientific Electronic Library Online (Portuguese)

41

Fatores de risco ambientais para o câncer gástrico: a visão do toxicologista/ Environmental risk factors for gastric cancer: the toxicologist's standpoint

Gomes-Carneiro, Maria Regina; Ribeiro-Pinto, Luís Felipe; Paumgartten, Francisco José Roma
1997-01-01

Resumo em português A carcinogênese é um processo altamente complexo do qual participam fatores de risco herdados e fatores de risco ambientais, tais como a alimentação, o hábito de fumar, a ocupação, e a exposição a radiação e a agentes químicos. A toxicologia experimental identifica as substâncias químicas potencialmente carcinogênicas e torna possível medidas regulatórias que objetivam reduzir a exposição humana a elas. A carcinogênese pode ser vista como consistindo d (mais) e três seqüências distintas: a iniciação, a promoção e a progressão. A conversão neoplásica (iniciação) ocorre quando um evento genético (mutações, rearranjos cromossômicos, inserções ou deleções de genes e amplificação de genes) resulta em ativação de oncogenes e/ou em falta de expressão - ou inativação de produtos - de genes supressores de tumores. A promoção envolve a expansão clonal das células "iniciadas" e exige a proliferação celular. Estratégias efetivas para reduzir os riscos de câncer gástrico e os riscos de neoplasias de outras localizações devem incluir o controle de carcinógenos conhecidos, assim como a quimioprevenção, por meio de intervenções racionais no processo carcinogênico. Neste sentido, o desafio a ser enfrentado pelo toxicologista envolve o desenvolvimento de ensaios preditivos melhores e mais baratos e a elucidação dos mecanismos subjacentes à carcinogênese química. Resumo em inglês Carcinogenesis is a highly complex process involving both inherited risk factors and environmental ones such as diet, smoking, occupation, and exposure to radiation and chemical agents. Experimental toxicology identifies potentially carcinogenic chemicals and thus makes it possible to introduce regulatory measures aimed at reducing human exposure to them. Carcinogenesis can be viewed as consisting of three distinct sequences: initiation, promotion, and progression. Neopla (mais) stic conversion (initiation) occurs when a genetic event (e.g., point mutations, chromosomal rearrangements, insertion or deletion of genes, and gene amplification) results in oncogene activation and/or lack of expression - or inactivation of products - of tumor suppressor genes. Promotion involves clonal expansion of initiated cells and requires cell proliferation. Effective strategies for reducing risk of gastric cancer or neoplasias at other sites should include both control of known carcinogens and chemical prevention through rational interventions in the carcinogenic process. The toxicologist's challenge is thus to devise better and less expensive predictive assays and to elucidate the mechanisms underlying chemical carcinogenesis.

Scientific Electronic Library Online (Portuguese)

42

Ocorrência e variabilidade genética do Tomato severe rugose virus em tomateiro e pimentão no Estado de São Paulo/ Occurrence and genetic variability of Tomato severe rugose virus in pepper and tomato plants in São Paulo State

Rocha, Kelly Cristina Gonçales; Marubayashi, Julio Massaharu; Navas-Castillo, Jesús; Pavan, Marcelo Agenor; Krause-Sakate, Renate
2010-09-01

Resumo em português Um levantamento para avaliar a ocorrência de begomovírus nas culturas de pimentão e tomateiro no estado de São Paulo foi realizado entre janeiro/2007 e julho/2008. O DNA total de amostras de pimentão (710) e de tomateiro (103) foi extraído e a presença de begomovírus foi testada por PCR. Paralelamente, as mesmas amostras foram avaliadas por amplificação por círculo rolante (RCA) seguidas de PCR, e algumas amostras positivas analisadas por RCA-RFLP com a enzima (mais) de restrição HpaII, a fim de se conhecer a variabilidade genética dos isolados. Os resultados demonstraram que, para a técnica de PCR, 99 amostras de pimentão (13,94%) e 39 de tomateiro (37,86%) foram positivas para a presença de begomovírus, enquanto que por RCA-PCR, 333 (46,90%) de pimentão e 82 (79,61%) de tomateiro mostrando a maior sensibilidade desta técnica. Seqüências correspondentes à região 5' da capa protéica (CP) e um segmento de gene da região intergênica foram analisadas e indicaram apenas a presença da espécie Tomato severe rugose virus (ToSRV). Porém, seqüenciamento parcial de clones obtidos a partir de produto RCA de tomateiro permitiu a detecção de infecção mista de ToSRV e Tomato yellow vein streak virus (ToYVSV). Por RCA-RFLP quatro padrões de restrição foram observados para o ToSRV em pimentão, enquanto que em tomateiro observaram-se 18 padrões.Os resultados indicam maior diversidade genética dos begomovírus em tomateiro quando comparada com os de pimentão. Resumo em inglês From January/2007 to July/2008 a survey was carried out to evaluate the occurrence of begomoviruses in pepper and tomato crops from São Paulo State. Total DNA was extracted from 710 pepper and 103 tomato samples, and the presence of begomoviruses was tested by Polymerase chain reaction (PCR). The same samples were tested by Rolling Circle Amplification (RCA) followed by PCR, and some positive samples analyzed by RCA-RFLP and cleaved by the restriction enzyme HpaII to eva (mais) luate the genetic variability of these isolates. By PCR, 99 (13.94%) samples collected from pepper and 39 (37.86%) from tomato were positives for the presence of begomovirus, while by RCA-PCR 333 (46.90%) and 82 (79.61%) from pepper and tomato, respectively, indicating higher sensitivity of this technique. The 5' region of the coat protein (CP) gene and a segment of the intergenic region was analyzed indicating the presence of Tomato severe rugose virus (ToSRV) in pepper and tomato plants. However, the partial sequencing of clones from RCA products from a tomato sample indicated mixed infection of ToSRV with Tomato yellow vein streak virus (ToYVSV). By RCA-RFLP four restriction profiles were observed for ToSRV in pepper, while 18 profiles for begomovirus from tomato plants, indicating higher degree of genetic variability for begomovirus found in tomato plants compared to that in pepper plants.

Scientific Electronic Library Online (Portuguese)

43

Caracterização genética de rizóbios nativos dos tabuleiros costeiros eficientes em culturas do guandu e caupi/ Genetic characterization of indigenous rhizobia strains from the coastal tableland efficient for the pigeonpea and cowpea crops

Fernandes, Marcelo Ferreira; Fernandes, Roberta Pereira Miranda; Hungria, Mariangela
2003-08-01

Resumo em português O objetivo deste trabalho foi caracterizar geneticamente sete estirpes de rizóbios nativos dos tabuleiros costeiros de Sergipe com alta eficiência de fixação biológica do N2 em associação com guandu (Cajanus cajan) e caupi (Vigna unguiculata). A amplificação do DNA pela técnica de PCR (polymerase chain reaction) com o oligonucleotídeo específico BOX indicou um grau elevado de diversidade genética, uma vez que todas as estirpes apresentaram perfis únicos de D (mais) NA. A análise por BOX-PCR revelou, ainda, que essa metodologia é eficiente para diferenciar estirpes, mas não para a diferenciação de espécies de rizóbio. Pela técnica do RFLP (restriction fragment length polymorphism) da região do DNA que codifica o gene 16S rRNA e da região intergênica entre os genes 16S e 23S rRNA, com cinco enzimas de restrição, bem como pelo seqüenciamento parcial da região do 16S rRNA, foi possível classificar as estirpes nos gêneros Bradyrhizobium e Rhizobium. Houve coerência entre as análises envolvendo a região do 16S rRNA, mas o agrupamento com uma das estirpes diferiu pela análise do espaço intergênico. Os resultados obtidos com a estirpe R11 indicam variabilidade genética elevada em relação às espécies de rizóbios descritas, inclusive diferindo em diversas bases da região do 16S rRNA, e podem indicar uma nova espécie. Resumo em inglês The objective of this work was to characterize genetically seven indigenous rhizobial strains from the coastal tableland of Sergipe, Brazil, with high efficiency of biological nitrogen fixation with the pigeonpea (Cajanus cajan) and cowpea (Vigna unguiculata) crops. The DNA amplification with the PCR (polymerase chain reaction) technique and the specific primer BOX indicated a high level of genetic diversity, with all isolates showing unique profiles of DNA. The BOX-PCR a (mais) nalysis also indicated that this method is efficient to characterize strains but not to define rhizobial species. The RFLP (restriction fragment length polymorphism) analysis of the 16S rRNA region and of the intergenic region between the 16S and the 23S rRNA genes with five restriction enzymes, as well as the partial sequencing of the 16S rRNA region allowed the classification of the strains into the genera Bradyrhizobium and Rhizobium. There was an agreement between the results obtained by the analysis of the 16S rRNA region, but one strain differed when the intergenic space was considered. The results obtained with strain R11 showed a high level of genetic diversity when compared to the described rhizobial species, including differences in several bases of the 16S rRNA region, and might indicate a new species.

Scientific Electronic Library Online (Portuguese)

44

Estudo comparativo entre os métodos LSAB®+ e Herceptest® para a detecção de HER-2/neu em carcinoma de mama/ A comparative study between LSAB®+ and Herceptest® in the detection of HER-2/neu in breast carcinoma

Sales, Alexandre de Oliveira; Rodrigues, Sarah Jane de Paiva; Bacchi, Carlos E.
2004-08-01

Resumo em português INTRODUÇÃO: A hiperexpressão de human epidermal growth factor receptor (HER-2/neu) e a amplificação do seu gene são indicadores de formas mais agressivas do câncer de mama. A Food and Drug Administration (FDA) aprovou o teste denominado HercepTest® com a finalidade de selecionar pacientes com indicação para o uso de um anticorpo humanizado anti-HER-2/neu (trastuzumab), com efeito terapêutico comprovado. OBJETIVOS: O presente trabalho tem como objetivo comparar (mais) os resultados obtidos pelos métodos imuno-histoquímicos LSAB®+ com a utilização de anticorpo A0485 e HercepTest®. Material e métodos: Foram utilizados 50 casos de carcinoma de mama nos quais a pesquisa da hiperexpressão de HER-2 pelo método LSAB®+ já havia sido realizada. Foi repetida a pesquisa da hiperexpessão de HER-2/neu nos mesmos casos, utilizando-se o método do HercepTest®. RESULTADOS: 34 casos foram considerados negativos pelos dois métodos, com escore 0 pelo método HercepTest®. Destes, 12 obtiveram escore 1+ e 22 obtiveram escore 0 pelo método LSAB®+. Em oito casos, o escore foi 2+ pelos dois métodos. Escore 3+ foi encontrado também em oito casos pelos dois métodos. DISCUSSÃO: O método mais prático utilizado em laboratório de rotina diagnóstica para investigar a hiperexpressão de HER-2/neu é o estudo imuno-histoquímico. Em função de muitas variáveis, como tempo de fixação, tipo de fixador, duração da fixação, método de recuperação antigênica e tipo de anticorpo utilizado, pode haver divergência de resultados. CONCLUSÃO: O presente estudo concluiu que o método HercepTest®demonstrou resultados equivalentes aos resultados obtidos pelo método LSAB®+ em carcinoma de mama. Resumo em inglês INTRODUCTION: The overexpression of human epidermal growth factor receptor (HER-2/neu) protein and the amplification of its gene are indicators of more aggressive behavior in breast cancer. The Food and Drug Administration (FDA) has approved HercepTest® with the goal of selecting patients to be elegible for treatment with the humanized murine monoclonal antibody anti-HER-2/neu (trastuzumab). AIMS: The aim of the present study was to compare the results of HER-2/neu expre (mais) ssion using routine immunohistochemistry method LSAB®+ (Dakocytomation polyclonal antibody A0485) and HercepTest®. MATERIAL AND METHODS: 50 cases of breast carcinoma previously evaluated for HER-2/neu expression by routine immunohistochemistry using the LSAB+ method were included. These cases were also evaluated for HER-2/neu expression using HercepTest® for comparison. Results: 34 cases of breast carcinoma were negative for HER-2/neu expression by the two methods, with score 0 by HercepTest®. In 12 and 22 cases, respectively, score 1+ and 0 were observed by the LSAB®+ method. In eight cases, score 2+ was present by both methods. Score 3+ was found in eight cases also by both methods. DISCUSSION: The most common method used in routine clinical practice to determine HER-2/neu status is immunohistochemistry. Variability of HER-2/neu results can be caused by a number of variables including time of fixation, methods of epitope retrieval and type of primary antibodies used. CONCLUSION: The conclusion of the present study was that LSAB®+ and HercepTest® revealed equivalent results for HER-2/neu expression in breast carcinoma.

Scientific Electronic Library Online (Portuguese)

45

Uso de PCR e sequenciamento do rDNA 16S para identificação de bactérias do gênero Staphylococcus isoladas de mastite bovina/ Identification of Staphylococcus strains isolated from bovine mastitis by PCR and 16S rDNA sequencing

Lange, Carla C.; Brito, Maria A.V.P.; Brito, José R.F.; Arcuri, Edna F.; Souza, Guilherme N.; Machado, Marco A.; Domingues, Robert; Salimena, Alessandra P.S.
2011-01-01

Resumo em português O objetivo deste trabalho foi identificar espécies de Staphylococcus (n=100) isoladas de mastite em rebanhos bovinos do Estado de Minas Gerais. Para esta finalidade foram utilizadas reações de PCR empregando oligonucleotídeos iniciadores descritos anteriormente para amplificar genes específicos de S. aureus (femA), S. intermedius (rDNA 16S) e S. hyicus (rDNA 16S-23S) e o sequenciamento do rDNA 16S. De acordo com as reações de PCR, 83 isolados foram identificados co (mais) mo S. aureus, 13 isolados como S. intermedius, dois como S. hyicus e dois isolados não foram identificados. Foram submetidos ao sequenciamento do rDNA 16S seis isolados identificados como S. aureus e os 17 restantes. Os seis isolados identificados como S. aureus confirmaram essa identificação. Dos outros 17 isolados, 13 foram identificados como S. chromogenes e quatro como S. hyicus, com similaridade igual ou superior a 99%. Baseando-se nos resultados da reação de PCR do gene femA e do sequenciamento do rDNA 16S, foram identificados 83 S. aureus, 13 S. chromogenes e quatro S. hyicus. Neste estudo os oligonucleotídeos iniciadores empregados na reação de PCR para S. intermedius não foram específicos, pois amplificaram também S. chromogenes; e os empregados na reação de PCR para S. hyicus não foram sensíveis, pois falharam na identificação de dois isolados de S. hyicus. A identificação definitiva das duas últimas espécies somente foi possível pelo sequenciamento do rDNA 16S. Resumo em inglês The objective of this study was to identify the species of 100 isolates of Staphylococcus from mastitis in dairy cows from herds located in the state of Minas Gerais, Brazil. PCR reactions were carried out using specific primers described previously for S. aureus (femA gene), S. intermedius (16S rDNA) and S. hyicus (16S-23S rDNA spacer region). In addition, products of amplification of variable regions of the 16S rDNA gene of the strains were sequenced. According to the r (mais) esults of the PCR, 83 strains were identified as S. aureus, 13 as S. intermedius, two as S. hyicus and two isolates were not identified. The sequencing of 16S rDNA was applied to 23 strains identified by PCR amplifications: six S. aureus and the strains identified as S. intermedius (n=13), S. hyicus (n=2) or not identified (n=2). The sequencing of 16S rDNA confirmed the six strains as S. aureus. The others 17 strains were identified as S. chromogenes (13 isolates) and S. hyicus (four isolates). Each sample was related to a specie according to the smallest E-value and highest similarity (> 99%). The identification of S. hyicus and S. chromogenes was accomplished only by 16S rDNA sequencing.

Scientific Electronic Library Online (Portuguese)

46

Using polymerase chain reaction with primers based on the plcB-plcC intergenic region to detect Mycobacterium tuberculosis in clinical samples/ Deteção de Mycobacterium tuberculosis em amostras clínicas por reação em cadeia da polimerase utilizando primers baseados na região intergênica plcB-plcC

Pinto Júnior, Hermides; Bica, Claudia Giuliano; Palaci, Moisés; Dietze, Reynaldo; Basso, Luiz Augusto; Santos, Diógenes Santiago
2007-08-01

Resumo em português OBJETIVO: Desenvolver um sistema para o diagnóstico molecular da tuberculose por reação em cadeia da polimerase, do inglês polymerase chain reaction (PCR), pela construção de primers baseados na diferença da organização de uma região intergênica da fosfolipase (phospholipase) C (região plcB-plcC), que diferencia Mycobacterium tuberculosis das outras micobactérias. MÉTODOS: Um produto de PCR com o tamanho esperado (432 pb) foi obtido somente de M. tuberculosi (mais) s e M. africanum. Um total de 33 isolados micobacterianos e 273 amostras clínicas de pacientes com suspeita de tuberculose foram examinados. Estes foram submetidos ao estudo comparativo da técnica de PCR contra o cultivo. RESULTADOS: Os dados mostraram 93,8% de exatidão para PCR contra o cultivo (p Resumo em inglês OBJECTIVE: To develop a system for the molecular diagnosis of tuberculosis by polymerase chain reaction (PCR), constructing primers based on the difference in gene organization of the intergenic region of phospholipase C (plcB-plcC region), which differentiates Mycobacterium tuberculosis from other mycobacteria. METHODS: A PCR product of the expected size (432 bp) was obtained from M. tuberculosis and M. africanum only. A total of 33 mycobacterial isolates and 273 clinica (mais) l samples from patients suspected of having tuberculosis were examined. These were used in the comparative study of the PCR technique versus culture. RESULTS: For PCR versus culture, the data showed 93.8% accuracy (p

Scientific Electronic Library Online (Portuguese)

47

Seleção de clones de batata com resistência múltipla à pinta preta e aos vírus X e Y/ Selection of potato clones for multiple resistances to early blight, PVY and PVX

Neder, Diogo Gonçalves; Pinto, César Augusto Brasil Pereira; Melo, Dheyne Silva; Lepre, Andre Luiz; Peixouto, Leandro dos Santos
2010-08-01

Resumo em português O objetivo do presente trabalho foi selecionar clones de batata com elevado desempenho agronômico e resistência à pinta preta e aos vírus X e Y. Para tanto, foram realizados 57 cruzamentos entre clones portadores dos alelos Ry adg e Rx1, e a cultivar 'Chiquita', resistente à pinta preta (Alternaria solani). Na safra das águas de 2004, 57 famílias clonais foram avaliadas em campo e 331 clones selecionados considerando a aparência de tubérculos. Desse total de clon (mais) es, avaliados em mais dois experimentos no verão de 2005, 180 foram selecionados por meio do marcador SCAR RYSC3 como portadores do alelo Ry adg,. Também foram realizadas uma avaliação de desempenho agronômico na safra de inverno de 2006 e uma avaliação de resistência à pinta preta nas safras de verão de 2007 e 2008. Paralelamente, foi utilizado um marcador CAPS visando à seleção de clones portadores do gene Rx1. Dessa forma, combinando os resultados dos marcadores moleculares com os de campo, agrupados via índices de seleção, foi possível selecionar 20 clones de alto desempenho agronômico, resistentes à pinta preta e portadores do alelo Ry adg. Devido a problemas apresentados pelo marcador CAPS, apenas sete destes foram analisados e um identificado como portador do alelo Rx1. Resumo em inglês The purpose of this study was to select potato clones with high agronomic performance and resistant to early blight, Potato Virus Y (PVY) and Potato Virus X (PVX). Crossings were done among progenitors carrying the Ry adg and Rx1 alleles for resistance to PVY and PVX and the cultivar 'Chiquita', which presents high levels of resistance to early blight (Alternaria solani). In the rainy season of 2004, 57 clonal families were evaluated in the field and 331 clones were selec (mais) ted based on tuber appearance. These clones were field evaluated in two trials in the rainy season of 2005 and 180 clones were selected for Ry adg allele with the SCAR marker designed RYSC3. Another agronomic evaluation was done in the winter season of 2006 and early blight was evaluated in the rainy seasons of 2007 and 2008. Simultaneously a CAPS marker was used to select for the presence of Rx1 allele. Combining the results from these experiments we were able to select 20 clones presenting high agronomic performance, resistance to early blight and carrying the Ry adg allele. The use of CAPS marker has practical difficulties due to production of poor amplification products to be digested with the DdeI enzyme and should be changed for another marker which shows more efficiency.

Scientific Electronic Library Online (Portuguese)

48

Indexação biológica múltipla e RT-PCR para detecção de vírus latentes em macieiras/ Biological multiple indexing and RT-PCR detection of latent viruses in apple plants

Silva, Fabio N.; Nickel, Osmar; Fajardo, Thor V.M.; Bogo, Amauri
2008-04-01

Resumo em português O objetivo deste trabalho foi avaliar a viabilidade da indexação biológica múltipla de vírus latentes de macieiras em indicadoras lenhosas. O método consistiu na enxertia de cinco espécies de indicadoras e duas borbulhas da cultivar a ser indexada em um único porta-enxerto. Concluiu-se que a eficácia e a sensibilidade do método biológico múltiplo é adequada para a detecção confiável de Apple stem grooving virus (ASGV), Apple stem pitting virus (ASPV) e App (mais) le chlorotic leaf spot virus (ACLSV) em programas de limpeza clonal e certificação de matrizes de fruteiras. A RT-PCR confirmou o diagnóstico biológico de ASPV e ASGV. Entretanto, ACLSV diagnosticado pela indicadora LL-S5 não foi detectado por RT-PCR em três dos nove acessos analisados. O gene de proteína capsídica de ACLSV de um dos acessos estudados foi clonado e sequenciado; a região de pareamento dos iniciadores de PCR foi comparada com dados do Genbank como subsídio à interpretação da não amplificaçãode certos isolados de ACLSV. Resumo em inglês This study aimed to evaluate the suitability of a multiple biological indexing method of latent apple viruses. The method consisted of grafting five indicator species and two buds of the plant to be indexed on to one rootstock. Results showed that the sensitivity and efficacy of the MBI is adequate for reliable detection of Apple stem grooving virus, (ASGV), Apple stem pitting virus (ASPV) and Apple chlorotic leaf spot virus (ACLSV) of mother plant stock in certification (mais) programs. Sample analysis by RT-PCR confirmed the results of the diagnosis of ASPV and ASGV by multiple biological indexing. However, it did not detect ACLSV diagnosed by LL-S5 in three out of nine analyzed accessions. The coat protein gene of one of the accessions studied was cloned and sequenced. The annealing sites of primers used in unsuccessful amplification attempts were compared with data of the Genbank to explain the non-amplification of certain ACLSV isolates.

Scientific Electronic Library Online (Portuguese)

49

Expressão eficiente do gene reporter beta-glucuronidase nos tecidos vasculares de batata (Solanum tuberosum L.) utilizando de um promotor específico (BRA3) de Agrobacterium rhizogenes/ Efficient expression of beta-glucuronidase reporter gene in vascular tissue of potato (Solanum tuberosum L.) utilizing a specific promoter (BRA3) from Agrobacterium rhizogenes)

Torres, Antonio Carlos; Ferreira, Adriana T.; Widholzer, Carlos F. N.; Romano, Eduardo; Peters, José A.
2003-06-01

Resumo em português Promotores tecido-específico controlam a transcrição de genes em diferentes tecidos vegetais bem como em diferentes estádios de desenvolvimento da planta, levando à indução de distintos níveis de atividade transiente e/ou estável do gene. Tais promotores podem ser empregados para a expressão seletiva de genes de interesse. O promotor rol A de Agrobacterium rhizogenes, por exemplo, é floema-específico, sugerindo que possa ser empregado em estratégias de defesa (mais) de plantas que são infectadas por vírus com replicação restrita ao floema. A expressão do gene marcador da ß-glucuronidase (gus) dirigido pelo promotor rol A (pBRA3) foi observada em plantas transgênicas de batata (cvs. Macaca e Baronesa). Entrenós e secções de folhas foram submetidos ao cocultivo com A. tumefaciens. A atividade do gene gus avaliada em brotações resistentes à canamicina não se restringiu ao floema (alto nível de expressão do gene), mas também se manifestou no xilema dos caules. As expressões transiente e estável são, no entanto, tecido-específicas, localizadas sobretudo no sistema vascular de entrenós e ausente em raízes e folhas. As plantas gus positivas foram micropropagadas, plantadas em casa de vegetação e avaliadas por PCR, utilizando-se 'primers' específicos para o gene npt II. Nenhuma alteração fenotípica foi observada em plantas transgênicas, em relação às não transformadas. Resumo em inglês Tissue-especific promoters allow the modulation of gene transcription in different tissue types as well as in different stages of plant development, leading different levels of transient and stable activity of the gene product. These promoters have been employed for selective gene expression. The Agrobacterium rhizogenes rol A gene promoter (BRA3) controls phloem-specific expression indicating that this promoter might have an important role in plant defense strategies aga (mais) inst virus which replicated only in the phloem. The expression of ß-glucuronidase (gus) activity drived by BRA3 promoter was observed in transgenic potato plants (cvs Macaca and Baronesa). Entrenodes and leaf explants were infected and cocultivated with A. tumefaciens. The regeneration of putative transformants was in medium with 50 mg.L-1 of kanamycin. High frequency of transformants based upon kanamycin resistance and gus expression was obtained. All gus positive plants showed blue staining in vascular bundle (phloem and xylem). PCR analysis showed the amplification of npt II. No conspicuous phenotipic alteration was observed when comparing transgenic vs non-transgenic plants.

Scientific Electronic Library Online (Portuguese)

50

Efeito do genótipo halotano e de diferentes sistemas de produção no desempenho produtivo e na qualidade da carcaça suína/ Effect of the halothane genes and rearing systems on growth performance and pig carcass quality

Bridi, Ana Maria; Nicolaiewsky, Sergio; Rübensam, Jane Maria; Both, Maria do Carmo; Lobato, José Fernando Piva
2003-08-01

Resumo em português O objetivo deste trabalho foi verificar o efeito dos genótipos halotano homozigoto dominante e heterozigoto e de três sistemas de criação (confinado sobre piso de cimento, confinado sobre cama de maravalha e ao ar livre) no desempenho produtivo e na qualidade da carcaça e da carne suína. Foram utilizados 96 suínos machos castrados selecionados pelo exame de DNA genômico no sangue utilizando-se a técnica de reação em cadeia da polimerase (PCR) para amplificar a (mais) região do receptor rianodina. A região amplificada foi clivada pela técnica do polimorfismo do comprimento dos fragmentos de restrição (RFLP). Nas fases de crescimento e terminação, avaliaram-se ganho de peso, consumo de ração e conversão alimentar. Após o abate, as carcaças foram pesadas e tipificadas eletronicamente. Vinte e quatro horas após o abate, foram separados e pesados o pernil e o carrê e medida a área de olho de lombo. A presença do gene halotano não afetou o desempenho dos suínos, mas aumentou a porcentagem de carne magra e diminuiu a quantidade de gordura na carcaça. Suínos criados no sistema intensivo ao ar livre apresentaram menor ganho de peso e pior conversão alimentar. No sistema intensivo de criação confinado sobre cama, os suínos produziram carcaças com menor quantidade de carne magra e maior quantidade de gordura. Não houve efeito significativo da interação genótipo halotano e sistema de criação para as características avaliadas. Resumo em inglês The objective of this study was to evaluate the effect of the halothane genotypes (heterozygous and dominant homozygous) and intensive rearing systems (indoor, wood shavings bedding and outdoor) on growth performance, carcass and meat yield. Ninety six castrated male pigs were used for the trial. Identification of the halothane genotype was determined in blood samples using the DNA-test, based on the polymerase chain reaction (PCR) for amplification of the critical region (mais) of the ryanodine receptor and subsequent restriction of the amplified fragment by restriction fragment lengh polymorfism technique (RFLP). Growth and finishing performance were evaluated by weight gain, feed intake and feed efficiency. Carcass quality was evaluated by backfat and muscle depth, meat percentage through Hennessy Grading Probe and carcass weight. Twenty four hours after slaugther, ham and loin weight were recorded and the loin eye area was evaluated. The growth performance was similar for the two genotypes. The heterozygous pigs for the halothane gene had higher percentage of fat-free lean and less fat in the carcass. Outdoor reared pigs showed lower average daily gain and worst efficiency than pigs reared indoor. Carcasses of pigs reared under wood shavings bed had less fat-free lean and greater backfat thickeness. The interaction between halothane genotypes and rearing systems had no significant effect on any trait studied.

Scientific Electronic Library Online (Portuguese)

51

Efeito do genótipo halotano e de diferentes sistemas de produção na qualidade da carne suína/ Effect of the halothane genes and rearing systems on meat quality of pork

Bridi, Ana Maria; Rübensam, Jane Maria; Nicolaiewsky, Sergio; Lopes, Rui Fernando Felix; Lobato, José Fernando Piva
2003-12-01

Resumo em português Verificou-se o efeito dos genótipos halotano homozigoto dominante e heterozigoto e dos sistemas de criação confinado sobre piso de cimento, confinado sobre cama de maravalha e ao ar livre sobre a qualidade da carne suína. Foram utilizados 96 suínos machos castrados selecionados através do exame de DNA genômico, utilizando-se a técnica de reação em cadeia de polimerase (PCR) para amplificar a região do receptor rianodina. A região amplificada foi clivada pela t (mais) écnica polimorfismo do comprimento dos fragmentos de restrição (RFLP). Mediu-se o pH nos músculos Longissimus dorsi e Semimembranosus aos quarenta e cinco minutos e vinte e quatro horas após o abate. A capacidade de retenção de água foi avaliada em amostras do músculo Longissimus dorsi através das técnicas de perda de líquido por gotejamento, de cocção e de descongelamento. Escores para a cor e o grau de marmorização da carne foram atribuídos com auxílio de padrões fotográficos. A maciez da carne foi medida pela força de cisalhamento em equipamento Warner-Bratzler Shear. Suínos com gene halotano heterozigotos apresentaram valores inferiores de pH, menor capacidade de retenção de água e uma freqüência de carcaças com carne PSE três vezes maior. O sistema de criação não afetou os valores de pH inicial e final ou a capacidade de retenção de água da carne suína. A maior incidência de carne PSE foi observada nas carcaças dos suínos criados em sistema confinado sobre piso de concreto. Não houve efeito significativo da interação genótipo halotano e sistema de criação para as características avaliadas. Resumo em inglês The effect of halothane genotypes (heterozygous and dominant homozygous) and intensive rearing systems (indoor, wood shavings bedding and outdoor) on pork quality were determinated. Ninety six castrated male pigs were used for the trial. Identification of the halothane genotype was determined in blood samples using the DNA-test, based on the polymerase chain reaction (PCR) amplification of the critical region of the ryanodine receptor and subsequent restricion of the ampl (mais) ifield fragment by the restriction fragment lengh polymorfism (RFLP) technique. The pH at 45 minutes and 24 hours after slaughter was measured on the Longissimus dorsi and Semimembranosus muscles. At the laboratory, the Longissimus dorsi muscle was used for the evaluation of the color, marbling, drip loss, defrosting loss and cooking loss and shear force. The muscle of heterozygous pigs for the halothane gene had lower pH and higher drip loss and the incidence of the PSE condition in this genotype was three times higher. The rearing system did not affect the initial and ultimate pH or water holding capacity. Indoor reared pigs had greater frequency of PSE carcass. The interaction between halothane genotypes and rearing systems had no significant effect on any trait studied.

Scientific Electronic Library Online (Portuguese)

52

Diversidade de Phytophthora parasitica isolados de Citrus usando seqüências de nucleotídeos da região ITS-5.8S rDNA/ Genotypic diversity among P. parasitica isolates reveled by ITS-5.8S rDNA nucleotide sequences

Rosa, Daniel Dias; Machado, Marcos Antonio; Targon, Maria Luisa Penteado Natividade; Furtado, Edson Luiz
2006-06-01

Resumo em português Realizou-se estudo para caracterização e verificação da diversidade genética de Phytophthora parasitica, agente causador da gomose dos citros. Quatorze isolados de Phytophthora parasitica, provenientes do Estado de São Paulo, foram seqüenciados a partir das regiões internas transcritas (ITS1 e ITS2) do gene 5.8S. Obtiveram-se seqüências de 812 pb a 860 pb que foram comparadas com seqüências de outras espécies de Phytophthora spp depositadas no NCBI. Foram fei (mais) tos estudos filogenéticos, utilizando-se o método "neighbor-joining" com 1000 "bootstrap" e construído o dendrograma mais representativo. Obtiveram-se os resultados de 98,88% a 100% de similaridade genética entre os 14 isolados paulistas, e 99,5% a 98,8% entre estes e a seqüência de P. nicotianae (gi| 8927482) obtida do GenBank NCBI. Resumo em inglês Phytophthoraparasitica is been considered one of the most prevalent citrus soilborn pathogens in Brazil. Fourteen isolates were collected in different region of São Paulo state. Amplification of the ITS region using primers ITS1 and ITS2 produced DNA fragments of 812 to 860 bp, that were compared with other sequences obtained to Gene Bank (NCBI). Neighbor-joining analysis, with 1000 bootstrap revealed an average similarity of 99,3 to 100% between the isolates, and 98,1 t (mais) o 99,9% between S. Paulo state isolates and P. nicotianae (= Phytophthoraparasitica)obtained from the Gene Bank (gi|8927482). The ITS1 was more conserved than to the ITS2. This is a good tool for quick diagnosis of Phytophthora citrus diseases.

Scientific Electronic Library Online (Portuguese)

53

Diagnóstico e genotipagem do vírus da pseudoraiva por nested-PCR e análise de restrição enzimática/ Diagnosis and genotyping of pseudorabies virus by nested-PCR and restriction enzyme analysis

Fonseca Júnior, Antônio Augusto; Carmagos, Marcelo Fernandes; D'Ambros, Régia Maria Feltrin; Braga, Alexandre Carvalho; Ciacci-Zanella, Janice; Heinemann, Marcos Bryana; Leite, Rômulo Cerqueira; Reis, Jenner Karlisson Pimenta dos
2010-04-01

Resumo em português A pseudoraiva (PR) é uma enfermidade viral responsável por consideráveis perdas econômicas na indústria de suínos. O vírus da pseudoraiva (PrV) apresenta apenas um sorotipo, mas, por análise de restrição enzimática, foi classificado em quatro genótipos denominados I, II, III e IV. Os métodos usados para genotipagem dependem do isolamento do vírus, da purificação do DNA viral, da restrição enzimática do genoma completo e da visualização após eletrofor (mais) ese. O objetivo deste trabalho foi estabelecer um método mais rápido e sensível para detectar e genotipar o PrV por nested-PCR e análise de restrição enzimática. Vinte isolados do PrV das regiões Sul e Sudeste do Brasil e a estirpe padrão Shope foram replicadas em células PK-15 e submetidas à nested-PCR para o gene da glicoproteína E. Além desses vírus previamente isolados, foram avaliadas 75 amostras clínicas de cérebro de suíno em um total de 25 animais positivos para a PR no isolamento e na soroneutralização viral e 50 amostras negativas provenientes de animais negativos na soroneutralização viral e de granjas sem histórico de PR. Todas as amostras clínicas tiveram resultados compatíveis com o isolamento e a soroneutralização, e a totalidade das amostras positivas foi classificada como genótipo II. A sensibilidade analítica da nested-PCR foi de 10-1,3 TCID50 mL-1. A combinação da nested-PCR e da restrição enzimática foi capaz de detectar e genotipar o vírus com resultados em um a dois dias, sendo mais rápida que os métodos convencionais de restrição do genoma completo que podem demorar até sete dias. Resumo em inglês Pseudorabies is a disease caused by Suid herpesvirus 1 (PrV) and is responsible for considerable economic losses in the swine industry. The PrV has only one serotype, but based on RFLP (restriction fragment length polymorphism) the virus was divided into four genotypes named I, II, III, IV. The classical methods for PrV genotyping usually require virus isolation, DNA purification enzyme restriction analysis and a long electrophoresis. The aim of this research was to descr (mais) ibe a faster and more sensitive method to detect and genotype PrV based on nested-PCR and restriction enzyme analysis. Twenty PrV isolates from south and southeast regions of Brazil, and the standard strain Shope were grown in PK-15 cells and submitted to PCR for glycoprotein E gene amplification. Additionally were tested 75 clinical samples (swine brain), with 25 positives for virus isolation and seroneutralization, and 50 negatives from a flock free PR with negative results in seroneutralization test. There was 100% of agreement between results of nested-PCR and virus isolation and seroneutralization and all samples detected were classified as genotype II. The nested-PCR, combined with restriction enzyme analysis, was able to detect and genotype PrV in 1-2 days with a sensitivity of 10-1,3 TCID50 mL-1. It was faster than classical methods described in the literature that require at least 7 days to be completed.

Scientific Electronic Library Online (Portuguese)

54

Diagnóstico de infecção congênita e perinatal por citomegalovírus utilizando a reação em cadeia da polimerase/ Diagnosis of congenital and perinatal cytomegalovirus infection by using the polymerase chain reaction

Yamamoto, Aparecida Yulie; Aquino, Victor Hugo; Figueiredo, Luis Tadeu Moraes; Mussi-Pinhata, Marisa Marcia
1998-02-01

Resumo em português Aplicou-se uma reação em cadeia da polimerase (PCR) no diagnóstico de infecção congênita e perinatal por citomegalovirus, comparando-a com a técnica de isolamento viral em cultura celular. Foram processadas 305 amostras de urina de crianças de 0 a 6 meses, por ambas as técnicas. Utilizou-se na PCR os primers que amplificam parte do gene codificador do principal antígeno precoce imediato de CMV. Detectou-se virúria em 47 amostras por PCR e comparando os resultad (mais) os com aqueles obtidos pelo isolamento viral, observou-se copositividade de 89,6% e conegatividade de 98,5%. Estas amostras positivas tiveram o resultado confirmado por PCR utilizando outros primers que amplificam regiões dos genes codificadores das glicoproteínas B e H de CMV. O diagnóstico de infecção congênita e perinatal por CMV pela PCR mostrou sensibilidade comparável à do isolamento viral e o uso de vários primers conferiu alta especificidade ao teste. Resumo em inglês The practical application of a polymerase chain reaction (PCR) amplification for the diagnosis of congenital and perinatal cytomegalovirus (CMV) infections was evaluated. Three hundred five urine samples were tested by PCR and conventional virus isolation in cell culture. Viruria was detected in 47 urine samples by PCR using a primer pair which amplifies part of the major immediate-early (MIE) CMV genome. The PCR compared to virus isolation showed 89,6% sensitivity, 98,5% (mais) specificity and 91,5% positive predictive value. PCR with primer pairs amplifying parts of the glycoprotein B and glycoprotein H genes of CMV were used for confirmation of the positivity of the 47 urine samples. We concluded that this CMV PCR assay in urine has a suitable sensitivity for the diagnosis of congenital and perinatal infections and its specificity is highly increased by use of more than one pair of primers among the ones we used.

Scientific Electronic Library Online (Portuguese)

55

Analysis of EGFR Overexpression, EGFR gene amplification and the EGFRvIII Mutation in portuguese high-grade gliomas

Viana, Marta Pereira; Lopes, José M.; Little, Suzie; Milanezi, Fernanda; Basto, Diana; Pardal, Fernando; Jones, C.

DRIVER (Portuguese)