Sample records for dmso
from WorldWideScience.org

Sample records 1 - 20 shown. Select sample records:



1

Dimetilsulfóxido - DMSO no teste de sensibilidade microbiana in vitro em cepas de Rhodococcus equi isoladas de afecções pulmonares em potros/ In vitro effect of dimethyl sulfoxide - DMSO in antimicrobial susceptibility test of Rhodococcus equi isolated from pulmonary in foals

Ribeiro, Márcio Garcia; Carvalho Filho, Aldo Santana de; Listoni, Fernando José Paganini
2001-10-01

Resumo em português Comparou-se a sensibilidade microbiana in vitro de isolados de Rhodococcus equi pelo teste padrão de difusão com discos, com o modificado, pela adição de 5% de dimetilsulfóxido-DMSO. Observou-se aumento da sensibilidade do R. equi no teste com DMSO, frente a aminoglicosídeos (canamicina, amicacina, estreptomicina) e ao cloranfenicol, enquanto para a eritromicina e derivados ß-lactâmicos (penicilina G, cefalosporinas, amoxicilina, oxacilina), constatou-se redução da sensibilidade do agente. Resumo em inglês In vitro antimicrobial susceptibility of strains of Rhodococcus equi by standard diffusion disk test and a modified method, by the addition dimethyl sulphoxide (5%), was evaluated. Increase in sensitivity of R. equi using modified method was observed in aminoglycosides group (kanamycin, amikacin, streptomycin) and cloramphenicol, while erythromycin and ß-lactam derivates (penicillin G, cephalosporins, amoxicillin, oxacillin) showed a reduction in sensitivity to the agent.

Scientific Electronic Library Online (Portuguese)

3

Sucesso do resfriamento e congelamento de sêmen de pirapitinga Brycon nattereri/ Sucess of cooling and freezing of pirapitinga (Brycon nattereri) semen

Oliveira, A.V.; Viveiros, A.T.M.; Maria, A.N.; Freitas, R.T.F.; Izaú, Z.A.
2007-12-01

Resumo em português Avaliaram-se protocolos de resfriamento e de criopreservação do sêmen de pirapitinga (Brycon nattereri) utilizando-se sêmen diluído em NaCl 154mM, NaCl 200mM, Saad e BTS® e resfriado por sete dias. Cinco diluidores (glicose 277mM, NaCl 154mM, NaCl 200mM, Saad e BTS®) foram combinados com dois crioprotetores (DMSO - dimetilsulfóxido e metilglicol) e usados como meio de congelamento. O sêmen diluído em cada meio foi envasado (palhetas de 0,5ml) e congelado, e a mo (mais) tilidade espermática avaliada após o descongelamento (60°C, 8seg). O sêmen foi novamente congelado em palhetas com diferentes volumes (0,25 e 0,5ml) e descongelados em banho-maria em duas temperaturas (50° e 60°C). As maiores motilidades (48%) foram observadas no sêmen diluído em BTS® e resfriado por sete dias. Motilidade espermática acima de 68% foram observadas no sêmen congelado em NaCl 154mM-metilglicol, BTS®-metilglicol, NaCl 200mM-DMSO e Saad-DMSO. Não houve diferença entre os volumes de palheta nem entre as temperaturas de descongelamento quanto a motilidade espermática. Assim, o sêmen de pirapitinga mantém altas taxas de motilidade quando resfriado em BTS® por até sete dias ou congelado em NaCl 154mM-metilglicol, BTS®-metilglicol, NaCl 200mM-DMSO e Saad-DMSO. Resumo em inglês Cooling and freezing protocols of pirapitinga (Brycon nattereri) semen were evaluated using semen diluted in 154mM NaCl, 200mM NaCl, Saad or BTS™, and cooled for seven days. Sperm motility was daily evaluated. Five extenders (277mM glucose, 154mM NaCl, 200mM NaCl, Saad and BTS™) were combined with two cryoprotectants (DMSO - dimethyl sulphoxide and methylglycol) to produce 10 cryosolutions. Semen was diluted in each cryosolutions, aspirated into 0.5ml straws a (mais) nd frozen. Sperm motility was evaluated after thawing (60°C, 8 sec). Then, semen was frozen in straws with different volumes (0.25 and 0.5ml), and thawed under different water-bath temperatures (50° and 60°C). Higher sperm motility (48%) was observed when semen was cooled in BTS™ for seven days. Post-thawing sperm motility above 68% was observed when semen was frozen in 154mM NaCl-methylglycol, BTS™-methylglycol, 200mM NaCl-DMSO or Saad-DMSO. There was no difference on sperm motility when semen was frozen in 0.25 or 0.5ml straws and thawed in 50° or 60°C water-bath. Thus, pirapitinga semen can be successfully cooled in BTS™ for seven days or frozen in 154 mM NaCl-methylglycol, BTS™- methylglycol, 200mM NaCl-DMSO and Saad-DMSO.

Scientific Electronic Library Online (Portuguese)

4

Criopreservação do sêmen de curimba (Prochilodus lineatus) mediante adição de diferentes diluidores, ativadores e crioprotetores/ Cryopreservation of curimba (Prochilodus lineatus) semen after addition of different diluters, activators and cryoprotectants

Murgas, Luis David Solis; Miliorini, Aléssio Batista; Freitas, Rilke Tadeu Fonseca de; Pereira, Gilmara Junqueira Machado
2007-06-01

Resumo em português Amostras de sêmen de cinco espécimes de Prochilodus lineatus (Valencienes, 1847) foram utilizadas para avaliação dos efeitos tóxicos e crioprotetores de seis soluções à base de BTS (Beltsville Thawing Solution®) 4,5% enriquecidas com metanol e DMSO nas concentrações de 10% (A = BTS 4,5% + Metanol 10%; B = BTS 4,5% + DMSO 10%; C = BTS 4,5% + KCl 0,072% + metanol 10%; D = BTS 4,5% + KCl 0,072% + DMSO 10%; E = BTS 4,5% + KI 0,036% + metanol 10%; e F = BTS 4,5% + K (mais) I 0,036% + DMSO 10%). Foram avaliadas ainda três soluções ativadoras (água destilada, NaHCO3 60 mM e NaHCO3 119 mM), antes e após o congelamento. Estudaram-se a taxa e a duração da motilidade espermática. Não houve diferença significativa entre as soluções crioprotetoras utilizadas. O sêmen ativado por NaHCO3 60 e 119 mM apresentou as maiores taxas de motilidade espermática. A ativação por NaHCO3 119 mM possibilitou as maiores durações de motilidade no sêmen de P. lineatus. Resumo em inglês Semen samples of five specimens of Prochilodus lineatus (Valencienes, 1847) were used to test the toxic and cryoprotectants effects of six solutions based on BTS (Beltsville Thawing Solution®) 4.5%: A - BTS 4.5% + Methanol 10%; B - BTS 4.5% + DMSO 10%; C - BTS 4.5% + KCl 0.072% + Methanol 10%; D - BTS 4.5% + KCl 0.072% + DMSO 10%; E - BTS 4.5% + KI 0.036% + Methanol 10% and F - BTS 4.5% + KI 0.036% + DMSO 10%). The effect of other three activator solutions (Distillated W (mais) ater, NaHCO3 60 mM and NaHCO3 119 mM) on the rate and duration of sperm motility were also evaluated before and after freezing. No significant differences were observed among the cryoprotectant solutions. Sperm motility rates for P. lineatus were higher for semen activated by NaHCO3 60mM and NaHCO3 119mM, which propitiated the highest sperm motility duration.

Scientific Electronic Library Online (Portuguese)

5

Sensibilidade dos espermatozoides de dourado (Salminus brasiliensis) a diferentes soluções crioprotetoras/ Sensitivity of dourado (Salminus brasiliensis) spermatozoa to different cryoprotectant solutions

Viveiros, A.T.M.; Oliveira, A.V.; Maria, A.N.; Orfão, L.H.; Souza, J.C.
2009-08-01

Resumo em português Em três experimentos, avaliou-se a sensibilidade dos espermatozoides de dourado (Salminus brasiliensis) a diferentes soluções crioprotetoras. No experimento 1, o sêmen foi diluído, 1:10, em 12 soluções (quatro diluidores x três crioprotetores - dimetilsulfóxido (DMSO), metilglicol ou glicerol). Metade de cada amostra foi resfriada por uma hora e a outra, criopreservada. A motilidade espermática foi avaliada imediatamente após a diluição e após o resfriamento (mais) em todas as amostras e, após o descongelamento, apenas nas amostras criopreservadas em DMSO. No experimento 2, o sêmen foi diluído, 1:5, em cinco soluções contendo DMSO e resfriado, criopreservado e avaliado como no experimento 1. No experimento 3, o sêmen foi diluído, 1:5, em quatro soluções contendo DMSO e criopreservado e avaliado quanto à motilidade e à fertilidade. Quando o sêmen foi diluído 1:10, observou-se motilidade acima de 58% em todas as amostras resfriadas em DMSO e em NaCl-tris-metilglicol. Baixa motilidade foi observada nas amostras resfriadas nas outras combinações com metilglicol (5-32%) ou glicerol (0-8%) e naquelas criopreservadas (16-20%). Todas as amostras diluídas 1:5 apresentaram motilidade de 65-72% após o resfriamento e de 45-66% após o descongelamento (experimentos 2 e 3). As taxas de eclosão produzidas com sêmen criopreservado, entretanto, foram baixas (17-23%) em relação ao sêmen fresco (60%). Resumo em inglês The sensitivity of dourado (Salminus brasiliensis) spermatozoa to different cryoprotectant solutions was evaluated in three experiments. In experiment 1, semen was diluted, 1:10, in 12 solutions (four extenders x three cryoprotectants - dimethylsulphoxide (DMSO), methyglycol, or glycerol). Half of each sample was refrigerated for one hour while the other half was cryopreserved. Sperm motility was immediately assessed after dilution and after refrigeration in all samples, (mais) and after thawing in those cryopreserved in DMSO. In experiment 2, semen was diluted, 1:5, in five solutions containing DMSO, refrigerated, cryopreserved, and analyzed as in experiment 1. In experiment 3, semen was diluted, 1:5, in five solutions containing DMSO, cryopreserved and evaluated for motility and fertility. When semen was diluted 1:10, motility higher than 58% was observed in all samples refrigerated in DMSO and in NaCl-tris-methylglycol. Low motility was observed in samples refrigerated in the other combinations of methylglycol (5-32%) or glycerol (0-8%) and in those cryopreserved (16-20%). All samples diluted 1:5 yielded motility of 65-72% after refrigeration, and 45-66% after thawing (experiments 2 and 3). The hatching rates produced with cryopreserved semen, however, were lower (17-23%) compared to fresh semen (60%).

Scientific Electronic Library Online (Portuguese)

6

Efeitos do dimetilsulfóxido no estresse oxidativo e na regeneração hepática pós-hepatectomia em ratos/ Effects of dimethylsulfoxide on post-hepatectomy oxidative stress and liver regeneration in rats

Melo, José Ulisses de Souza; Vasconcelos, Paulo Roberto Leitão de; Santos, Jefferson Menezes Viana; Campos Júnior, Manoel Messias; Barreto, Marcus Vinicius Amaral; Kimura, Osamu de Sandes
2008-04-01

Resumo em português OBJETIVO: avaliar a influência do DMSO sobre o estresse oxidativo e a regeneração hepática pós-HP via um modelo experimental. MÉTODO: 36 ratos Wistar machos jovens foram aleatoriamente distribuídos em dois Grupos de 18 animais: parcialmente hepatectomizados com infusão diária de solução salina (controle) e parcialmente hepatectomizados com aporte diário intraperitoneal de DMSO, todos por duas semanas. Nos tempos 36h (T1), 168h (T2) e 336h (T3) pós-HP, glutati (mais) ona (GSH) foi medida no plasma e no tecido hepático, enquanto glicose e bilirrubina total foram aquilatados no sangue. A massa do fígado residual, nos mesmos tempos, foi o parâmetro utilizado para estimar a evolução da regeneração do fígado. RESULTADOS: DMSO baixou os níveis de GSH hepático e sangüíneo mas não interferiu na evolução da massa em regeneração. CONCLUSÃO: DMSO inibiu o estresse oxidativo pós-HP mas não mostrou alterações significantes na regeneração hepática em ratos. Resumo em inglês BACKGROUND: The purposes of this study were to evaluate dimethylsulfoxide (DMSO) influences on oxidative stress and rat liver regeneration after partial hepatectomy (PH). METHODS: 36 young male Wistar rats were randomly assigned to two groups of 18 animals each - experimental (G2) and control (G1) - and all of them were submitted to PH at the time T0. The G1 rats received daily for 14 days, by intraperitoneal (i.p.) route, NaCl 0.9% (saline) 0.1mL/kg and the G2 animals go (mais) t daily DMSO 3% 0.1mL/kg by the same route. In each group, at 36h(T1), 168h(T2) and 336h(T3) post-PH, a subgroup of 6 rats were chosen in a randomized way to complementary hepatectomy, when blood and the residual liver lobes were taken to measure reduced glutathione (GSH) (blood plasma and liver) and blood concentrations of glucose and total bilirubin. All surgical procedures were performed under inhaled ether anesthesia. RESULTS: DMSO inhibited the liver and the plasma GSH concentrations after 7 days but did not show any significant effect on liver regeneration phenomenona. CONCLUSION: DMSO administration leads to an inhibitory effect on oxidative stress but did not show any change on the liver regeneration evolution in rats after PH.

Scientific Electronic Library Online (Portuguese)

7

Criopreservação do sêmen testicular do teleósteo piau-açu Leporimus macrocephalus/ Testicular sperm cryopreservation of the teleost 'piau-açu' Leporinus macrocephalus

Ribeiro, R.I.M.A.; Godinho, H.P.
2003-02-01

Resumo em português Avaliaram-se metodologias de criopreservação para o sêmen do piau-açu Leporinus macrocephalus (Teleostei, Anostomidae). O volume de sêmen coletado diretamente dos testículos de seis peixes (446,7±165,1g de peso corporal) foi de 0,4±0,2 ml. Testou-se a toxicidade dos crioprotetores dimetilsulfóxido (DMSO), dimetilacetamida, propilenoglicol, etilenoglicol e metanol nas concentrações de 5%, 10% e 15%. DMSO, dimetilacetamida e propilenoglicol foram os menos tóxico (mais) s e, por isso, utilizados na criopreservação do sêmen. Para este teste, o sêmen foi diluído 1:8 (v:v) em soluções de cada crioprotetor(8,9%, concentração final) às quais adicionaram-se gema de ovo de galinha (8,9%, concentração final), glicose (5%) e água destilada (75%). A mistura foi então envasada em palhetas de 5ml de capacidade e imediatamente colocada em botijão de vapor de nitrogênio líquido. A taxa de motilidade espermática pós-descongelamento mais alta (40,8± 13,6 %) foi obtida com sêmen criopreservado em diluente contendo DMSO e ativado em solução de NaHCO3 119mM. A taxa de fertilização, correspondente a 84,3±9,4% do controle, foi obtida com ovócitos de piau-açu fertilizados com sêmen congelado em solução de DMSO (8%, concentração final). Resumo em inglês Methods for cryopreservation of 'piau-açu' Leporinus macrocephalus (Teleostei, Anostomidae) sperm were evaluated. Sperm collected directly from the testes of six fish (446.7±165.1g of body weight) yielded 0.4±0.2 ml. The toxicity of the cryoprotectants dimethyl sulphoxide (DMSO), dimethyl acetamide, propylene glycol, ethylene glycol and methanol, at concentrations of 5%, 10% and 15%, was tested. DMSO, dimethyl acetamide and propylene glycol were the least toxic and wer (mais) e used to freeze the sperm. Sperm was diluted 1:8 (v:v) in solutions made of 8.9% (final concentration) of one of those crioprotectants to which 8.9% (final concentration) of chicken yolk egg, 5% glucose and 75% distilled water were added. The mixture was then poured into 0.5-ml capacity straws and immediately deepened into a cryogenic shipper containing only liquid nitrogen vapor. The highest frozen/thawed sperm motility rate (40.8± 13.6 %) was obtained with sperm cryopreserved in the DMSO containing diluent and activated in 119 mM NaHCO3. Piau-açu eggs fertilized with sperm previously cryopreserved in solution containing 8% (final concentration) DMSO yielded a rate of fertilization of 84.3 ± 9.4% of the control.

Scientific Electronic Library Online (Portuguese)

8

A new experimental procedure to obtain titania powders as anatase phase by a sol-gel process

Farias, Robson Fernandes de
2002-11-01

Resumo em inglês Titania powders were synthesized by a sol-gel process using titanium tetrabutoxide as precursor. The syntheses were performed in water or in solutions of dimethylformamide (dmf) or dimethylsulfoxide (dmso). It is demonstrated, by X-ray diffraction patterns of the synthesized powders, that the samples obtained in dmf or dmso solutions are crystalline (anatase phase) with some minor amount of brookite phase, whereas the sample synthesized in water is amorphous. The anatase (mais) phase can be obtained independently of any previous or further treatment of the synthesized powder, such as hydrothermal or heat treatment, providing a new, simple, quick and inexpensive route to synthesize anatase powders. From the peak broadening of the anatase (101) diffraction, the crystallite sizes were calculated as 6 nm.

Scientific Electronic Library Online (Portuguese)

9

Avaliação espermática pós-descongelamento em tambaqui, Colossoma macropomum (Cuvier, 1818)/ Sperm evaluation of tambaqui, Colossoma macropomum (Cuvier, 1818), after thawing

Menezes, Jenner Tavares Bezerra; Queiroz, Luiz Jardim de; Doria, Carolina Rodrigues da Costa; Menezes Jr, Jaire Bezerra
2008-01-01

Resumo em português Este estudo testa procedimentos de congelamento do sêmen de tambaqui, Colossoma macropomum , e eficiência na fertilização de ovócitos. Sêmen de um reprodutor induzido hormonalmente foi amostrado e armazenado em tubos de ensaio. O material foi diluído em soluções crioprotetoras (dimetilacetamida [DMA], dimetilsulfóxido [DMSO], metanol, propilenoglicol e etilenoglicol) (proporção de 1:3; sêmen:diluente), e submetido a procedimentos de rotina de congelamento. A (mais) motilidade foi avaliada antes e depois deste procedimento. Testes de fertilização foram feitos com o sêmen criopreservado. A motilidade pré-congelamento foi de 80% e após o congelamento foi de 20-25% para propilenoglicol e etilenoglicol, 5-10% para DMSO e 5% para DMA e metanol. A fertilização foi de 76% e 88% para propilenoglicol e etilenoglicol, respectivamente. Resumo em inglês This work tests freezing procedures of tambaqui, Colossoma macropomum , and efficiency in egg fertilizing. Sperm of a hormonally induced reproducer was collected and stored in assay pipes. The material was diluted in cryoprotectant solutions (dimetilacetamida [DMA], dimetilsulfóxido [DMSO], metanol, propilenoglicol e etilenoglicol) (1:3 ratio: sperm:diluting), and subjected to routine freezing procedures. The motility was evaluated before and after this procedure. Fertil (mais) ization tests were made with cryopreserved sperm. The motility was evaluated before and after these tests. Fertilization tests were made with the cryopreserved semen. The pre-freezing motility was 80%, and after freezing, it was 20-25% for propilenoglicol and etilenoglicol, 5-10% for DMSO and 5% for DMA and methanol. The fertilization was 76% and 88% for propilenoglicol and etilenoglicol, respectively.

Scientific Electronic Library Online (Portuguese)

10

Cryptosporidium sp. em intestinos, bursa de Fabricius e traquéia de frangos (Gallus gallus sp)/ Cryptosporidium sp. in intestines, bursa of Fabricius and poultry trachea (Gallus gallus sp)

Jacobsen, Gislaine; Barcelos, Aléverson da Silva; Flôres, Maristela Lovato; Segabinazi, Stefanie Dickel; Lagaggio, Vera Regina Albuquerque
2006-04-01

Resumo em português Parasitas do gênero Cryptosporidium infectam várias espécies de animais, e a enfermidade resultante é a criptosporidiose, importante zoonose de distribuição mundial. Em aves, a infecção tem sido reportada em várias espécies. Este trabalho objetivou identificar a presença do parasita em 208 amostras de bursa de Fabricius, 208 amostras de intestino e 208 de traquéia, coletadas de frangos (Gallus gallus sp) de diferentes idades, abatidos em três propriedades rur (mais) ais do município de Santa Maria, RS. Foram feitas três impressões de cada amostra em lâminas para microscopia, coradas pelas técnicas de Ziehl Neelsen modificada com Dimetil Sulfóxido (DMSO), Ziehl Neelsen modificada por Henriksen e Pohlens (HP), Ziehl Neelsen (ZN) e Kinyoun (K), perfazendo 1872 impressões analisadas em microscopia óptica (1000 x). Neste total, nas diferentes colorações empregadas, oocistos do parasita Cryptosporidium sp. foram visualizados em 18 impressões de traquéia, 42 de bursa de Fabricius e 29 de intestino, resultando positivas, portanto, 89 impressões. Destas, 44 foram identificadas pela técnica de DMSO, 32 por HP, três por ZN e 10 por K. Pode-se concluir que os oocistos do parasita Cryptosporidium sp. foram visualizados com maior freqüência nas impressões de bursa de Fabricius, e que o método de coloração, dentre os utilizados, que proporcionou a maior visualização dos oocistos foi o DMSO. Resumo em inglês Parasites of the gennus Cryptosporidium infect several animal species.The disease resultant is the criptosporidiosis, an important zoonosis spreaded worldwide. In poultry, the infection has been reported in several species. This study goal was to identify the parasite presence in 208 bursa of Fabricius samples, 208 intestine and 208 of trachea, collected at chicks (Gallus gallus sp) of different ages, killed at three farms in Santa Maria city, Rio Grande do Sul State, Bra (mais) zil. Three printings of each sample were done,on glass slides colored through the Ziehl Neelsen technique modified with Dimetil Sulfóxido (DMSO), Ziehl Neelsen modifed by Henriksen and Pohlens (HP), Ziehl Neelsen (ZN) and Kinyoun (K), completing 1872 printings analyzed in optical microscopy (1000 x). At this final number, at the different colorations done, oocysts of the parasite Cryptosporidium sp. were viewed in 18 trachea printings, 42 of bursa de Fabricius and 29 of intestine, resulting positive, 89 printings. From these 89, 44 were identified through the technique DMSO, 32 through HP, three through ZN and 10 through K. Cryptosporidium sp. parasites oocysts were found with more frequency from printings of bursa the Fabricius. The coloration method, of those utilized, was the one which had the better visualization of the oocysts was the DMSO.

Scientific Electronic Library Online (Portuguese)

11

Ação do dimetil-sulfóxido na isquemia de retalhos randômicos de pele em ratos/ The role of subcutaneous methyl-sulfoxide in a morphological study of random skin flaps in rats

Almeida, Kleder Gomes de; Fagundes, Djalma José; Manna, Mônica Cecília Bochetti; Montero, Edna Frasson de Souza
2004-12-01

Resumo em português Objetivo: Avaliar a ação do dimetil-sulfóxido (DMSO) na necrose distal de retalhos randômicos isquêmicos em ratos. Métodos: Foram utilizados 30 ratos machos, linhagem Wistar, peso entre 220 e 363g e idade média de 3 meses. O retalho cutâneo dorsal (8x2cm) com pedículo cranial foi descolado, reposto em seu leito e suturado com poliamida 4.0. O grupo controle-CT (n=10) não recebeu nenhuma medicação, o grupo simulado-SM (n=10) recebeu o volume de 1mL de solução (mais) salina subcutânea, dividida em dez aplicações ao longo do retalho, o grupo experimento-EX (n=10) recebeu a injeção de 1ml de DMSO 5%. Após sete dias foram avaliadas as áreas de necrose distal e colhido material para o estudo histológico. Resultados: As medidas das áreas de necrose (CT=47,99, SM=58,78, EX=41,57) e as porcentagens das áreas de necrose (CT=29,98, SM=36,73, EX=23,99) mostraram-se menores no grupo Ex (p Resumo em inglês Purpose: To evaluate through the morphologic study (macro and microscopic) the effectiveness of DMSO in the genesis of the distal necrosis of random skin flaps in rats. Methods: 30 male rats were used, lineage Wistar, weight between 220 and 363g and 3 months medium age .The skin flap (8x2cm) with remained cranial vessels it was unstuck, restored at his bed and sutured with polyamide 4.0. The control-group CT (n=10) don’t received any medication, the simulated group -SM ( (mais) n=10) it received the volume of 1mL of subcutaneous saline solution, divided in ten applications along the skin flap, the experiment group (n=10) it received the injection of 1ml of DMSO5%. After seven days they were appraised the areas of distal necrosis and picked material for the histology study. Results: The measures of the necrosis areas (CT=47.99, SM=58.78, EX=41.57) and the percentages of the necrosis areas (CT=29.98, SM=36.73, EX =23.99) they were shown smaller in the EX group (p

Scientific Electronic Library Online (Portuguese)

12

Glândula submandibular de ratos com envelhecimento: observações ao microscópio eletrônico de varredura de alta resolução/ Submandibular gland of rats with ageing: observations with high resolution scanning electron microscopy

Watanabe, Ii-Sei; Guimarães, Juliana P.; Ogawa, Koichi; Iyomasa, Mamie M.; Miglino, Maria Angélica; Silva, Marcelo Cavenaghi P.; Semprini, Marisa; Sosthines, Márcia Consentino K.; Lopes, Marília O.; Lopes, Ruberval A.
2007-12-01

Resumo em português As características tridimensionais dos componentes intracelulares de células acinares e de ductos foram reveladas usando o método ósmio-DMSO-ósmio. As amostras foram maceradas em solução de tetróxido de ósmio diluído após a fratura na solução de dimetil sulfoxido. As lamelas do retículo endoplasmático granular são reveladas entremeadas por várias mitocôndrias. As lamelas do retículo endoplasmático granular são localizados ao redor dos núcleos na por� (mais) �ão basal e estas estruturas são observadas em imagens tridimensionais de microscopia eletrônica de alta resolução. Resumo em inglês The three-dimensional characteristics of the intracellular components of acinar and ductal cells were revealed using the osmium-DMSO-osmium method. The samples were macerated in diluted osmium after fractured in DMSO solution. The stacks of the rough endoplasmic reticulum are revealed intermingling by several mitochondria. The lamellae of the rough endoplasmic reticulum are located around the nuclei at basal portion and these structures are shown in three-dimensional HRSEM images.

Scientific Electronic Library Online (Portuguese)

13

Viabilidade e fertilização in vitro de oócitos bovinos após vitrificação/ Viability and in vitro fertilization of bovine oocytes after vitrification

Galbinski, Sérgio; Bos-Mikich, Adriana; Ferrari, Arnaldo Nicola
2003-09-01

Resumo em português OBJETIVOS: avaliar a técnica de criopreservação por vitrificação em DMSO 6 M para oócitos bovinos maturados in vitro e os efeitos do tempo de exposição às soluções de vitrificação (SV). MÉTODOS: estudo experimental tipo coorte. Ovários de bovinos foram obtidos em frigorífico e transportados ao laboratório. Os oócitos foram aspirados. A partir da SV contendo DMSO 6 M (SV 100%), foram preparadas soluções a 25 e 65%. Oócitos foram maturados in vitro por (mais) 18-22 horas. Para vitrificação, os oócitos foram colocados em SV 25%, por 5 minutos, transferidos à SV 65%, pipetados em SV 100% para palhetas e estocados em nitrogênio líquido. No primeiro grupo experimental, a exposição à SV 65% tomou até 60 segundos e no segundo grupo não ultrapassou 30 segundos. Para descongelamento, as palhetas foram expostas ao ar por 10 segundos, colocadas em banho-maria por 10 segundos e seu conteúdo expelido e mantido em solução de sacarose por 5 minutos. No terceiro grupo, os oócitos passaram por todas SV menos pelo nitrogênio líquido. Os oócitos recuperados foram inseminados. Para controle, oócitos frescos, maturados in vitro, foram inseminados. RESULTADOS: após vitrificação, foram recuperados 69,1 e 59,8% dos oócitos nos grupos de 30 segundos e 60 segundos, respectivamente, e 24 horas após inseminação pareceram morfologicamente normais 93 e 89,1% deles, respectivamente. No grupo de oócitos expostos às SV sem vitrificação, foram recuperados 75,6%, sendo 84,6% destes viáveis 24 horas após inseminação. Não ocorreu fertilização nos grupos experimentais. Entre os controles frescos, foram fertilizados 65,4% dos oócitos. CONCLUSÕES: a técnica de vitrificação utilizando DMSO 6 M não é aplicável para criopreservação de oócitos bovinos maturados in vitro. A redução do tempo de exposição às SV não superou o efeito deletério sobre a capacidade fertilizadora dos oócitos. Aprimoramentos da técnica são necessários para proteção da zona pelúcida e do oolema. Resumo em inglês PURPOSE: to verify vitrification techniques using 6 M DMSO to cryopreserve in vitro matured bovine oocytes, and to assess the effects of the time of exposure to vitrification solutions (VS). METHODS: dilutions of VS were prepared from the stock VS (VS 100%) consisting of 6 M DMSO to give 25 and 65% DMSO solutions. Bovine oocytes were in vitro matured for 18-22 h. Matured oocytes were placed first into 25% VS, at room temperature for 5 min, then transferred to 65% VS, befo (mais) re being pipetted into the 100% VS in plastic straws. Three experimental groups were formed: in the first group, time of pipetting through 65% VS and loading the straw took up to 60 s, in the second group it did not exceed 30 s. For thawing, straws were held in air for 10 s and then in a water bath for 10 s. The contents of each straw were expelled in sucrose solution and held for 5 min. In the third experimental group, oocytes went through all VS, but were not vitrified. All retrieved oocytes were inseminated. For control, fresh, in vitro matured oocytes were inseminated. RESULTS: after vitrification, 69.1 and 59.8% of the oocytes were retrieved from the 30 s and 60 s groups, respectively, and 93 and 89% of these oocytes appeared morphologically normal 24 h after insemination, respectively. In the group of oocytes exposed without vitrification, 75.6% were retrieved and 84.7% were morphologically viable, 24 h after insemination. No fertilization was observed in the experimental groups. Among controls, 65.4% were fertilized. CONCLUSIONS: the vitrification technique using 6 M DMSO is not a feasible approach to cryopreserve in vitro matured bovine oocytes. Decreasing the time of exposure to VS did not overcome deleterious effects of the procedure on the fertilizability of oocytes. Improvements in the technique are needed to protect the zona pellucida and oolemma.

Scientific Electronic Library Online (Portuguese)

14

Criopreservação do sêmen de tilápia-nilótica Oreochromis niloticus, var. Chitralada: crioprotetores, soluções ativadoras e refrigerador criogênico/ Cryopreservation of the semen of Nile tilapia Oreochromis niloticus, var. Chitralada: cryoprotectants, spermatozoa activating solutions and cryogenic refrigerator

Godinho, Hugo Pereira; Amorim, Vanessa Márcia da Cunha; Peixoto, Marco Túlio Diniz
2003-12-01

Resumo em português Realizaram-se experimentos relativos a crioprotetores, diluentes e soluções ativadoras pós-descongelamento com o sêmen de tilápia-nilótica Oreochromis niloticus, var. Chitralada. Utilizaram-se soluções crioprotetoras contendo DMSO ou metanol, em várias concentrações. O sêmen diluído na solução crioprotetora foi envazado em palhetas de 0,5 mL, congelado em botijão de vapor de nitrogênio líquido e, então, armazenado em nitrogênio líquido. A motilidade e (mais) spermática do sêmen descongelado foi avaliada em soluções ativadoras de NaHCO3 119mM, NaCl 25 mM e água destilada. As taxas de motilidade espermática pós-descongelamento obtidas com sêmen criopreservado com metanol (concentração final = 7,5-12 %) foram de 31-46% e quando o crioprotetor utilizado foi o DMSO (concentração final = 5-8%), de 20-35%. Em ambas as condições, o sêmen foi ativado com solução de NaHCO3 119mM. A diluição do sêmen em diferentes proporções (1:1 a 1:4; sêmen: diluente) não produziu diferenças significativas nas taxas de motilidade espermática pós-descongelamento. Resumo em inglês Experiments were conducted concerning cryoprotectants, extenders, and post thawing activating solutions for the semen of Nile tilapia Oreochromis niloticus, var. Chitralada. The extender solutions contained DMSO or methanol in various concentrations. The semen was previously diluted in the extender, drawn into 0.5 mL straws, frozen in the cryogenic shipper and then stored in liquid nitrogen. Motility of the thawed sperm was evaluated with NaHCO3 119mM, NaCl 25 mM and dist (mais) illed water. Motility rate of thawed sperm, cryopreserved with methanol (final concentration = 7.5-12%) and activated with NaHCO3 119mM, was 31-46%. When DMSO replaced methanol, the motility of frozen/thawed sperm activated, also with NaHCO3 119mM, was 20-35%. Semen:extender dilutions of 1:1 to 1:4 did not show significant effects on the post-thawing sperm motility rate.

Scientific Electronic Library Online (Portuguese)

15

Uso de microbiota cecal congelada com crioprotetores em pintos infectados experimentalmente com Salmonella enterica sorovar Enteritidis/ Use of frozen cecal microbiota with cryoprotectors in chicks experimentally infected with Salmonella enterica serotype Enteritidis

Andreatti Filho, R.L.; Lima, E.T.; Okamoto, A.S.; Sampaio, H.M.
2007-06-01

Resumo em português Pintos de corte com um dia de idade foram tratados com microbiota cecal cultivada em condição de aerobiose, nos tempos de congelamento de 90, 200, 290 e 360 dias, e associada aos crioprotetores sacarose, trealose, dimetilsulfóxido (DMSO) e glicerol. Posteriormente as aves foram desafiadas com Salmonella Enteritidis, visando determinar a eficácia dos tratamentos em relação à quantidade de bactérias viáveis da microbiota que foi maior aos 90 dias (10,58 Log10 UFC/m (mais) l), quando as aves foram tratadas com sacarose, e menor aos 290 dias, quando tratadas com glicerol (7,73 Log10 UFC/ml). No tempo zero, todas as aves apresentaram Salmonella (100%) quando tratadas com DMSO e glicerol, com colonização cecal de 4,9 e 5,2 Log10 UFC/g do conteúdo cecal, respectivamente; aos 360 dias nenhuma ave foi infectada, independente do tratamento. A microbiota cecal, independente de tratamento, sempre determinou menor quantidade de S. Enteritidis em qualquer um dos parâmetros pesquisados, quando comparada com a das aves não tratadas. O congelamento em nitrogênio líquido foi eficaz na manutenção da viabilidade da microbiota cecal até 360 dias. Resumo em inglês One-day-old broiler chicks were treated with cecal microbiota cultivated under aerobiose conditions, frozen during 90, 200, 290 and 360 days and associated with different cryoprotectors such as sucrose, trehalose, DMSO and glycerol. Subsequently, the birds were challenged with Salmonella Enteritidis in order to determine the efficacy of the different treatments in relation to the quantity of viable bacteria, which was higher at 90 days when treated with sucrose (10.58 log (mais) 10 CFU/ml) and lower at 290 days when treated with glycerol (7.73 log10 CFU/ml). The quantity of infected birds was 100% in 0 time, when the cecal colonization by S. Enteritidis was 4.9 and 5.2 log10 CFU/g of cecal content, respectively treated with DMSO and glycerol. No bird was infected at 360 days, irrespectively of the treatment. In all treatments, the cecal microbiota always determined a lesser quantity of S. Enteritidis for all the studied parameters compared to non-treated birds. Frozen in liquid nitrogen was effective in maintaining the viability of cecal microbiota during the experimental period of 360 days.

Scientific Electronic Library Online (Portuguese)

16

Espectros eletrônicos de alguns complexos de geometria octaédrica de Ni2+: uma introdução prática à teoria do campo cristalino no curso de graduação/ Electronic spectra of some Ni2+ octahedral complexes: a practical introduction to the crystal field theory in the undergraduate course

Gushikem, Yoshitaka
2005-02-01

Resumo em inglês The experiment introduces the undergraduate students to the crystal field theory. The electronic spectra of the octahedral complexes of [Ni(L)n]2+ (L = H2O, dmso, NH3 and en) obtained in the experiment are used to calculate 10Dq and B parameters. The experiment shows how the parameters can be calculated and correlated with the nature of the ligands and the field intensities produced.

Scientific Electronic Library Online (Portuguese)

17

Resíduos do beneficiamento do camarão cultivado: obtenção de pigmentos carotenóides/ Waste from the processing of farmed shrimp: a source of carotenoid pigments

Ogawa, Masayoshi; Maia, Everardo Lima; Fernandes, Ana Carolina; Nunes, Maria Lucia; Oliveira, Maria Elisabeth Barros de; Freitas, Simone Tupinambá
2007-06-01

Resumo em português A extração de pigmentos carotenóides constitui uma possível alternativa, de grande agregação de valor, para o aproveitamento da cabeça do camarão Litopenaeus vannamei. O objetivo do presente trabalho foi a identificação, a extração e a quantificação dos principais pigmentos desta matéria-prima, coletados a partir de uma planta de beneficiamento de camarão no Ceará - Brasil. Após cocção dos resíduos a 100 °C, na proporção 1:2 cabeça de camarão (mais) e água durante 15 minutos, obteve-se uma pasta de pigmentos brutos extraindo-se os carotenóides com acetona resfriada e, posteriormente, com hexano, obtendo a fase pigmento-hexano. Obteve-se também a fase DMSO, após o material ser particionado com dimetilsulfóxido, e uma fração acidificada. Estas frações sofreram evaporação e secagem, sendo os carotenóides identificados em coluna aberta, utilizando-se o parâmetro de eluição das frações, o espectro de absorção visível e o valor de Rf na camada delgada de sílica gel. Os espectros de absorção de cada fração foram obtidos a 350 a 550 nm e quantificados por cromatografia de camada delgada. Para o cálculo de carotenóides totais (37,62 µg.g-1 da pasta de pigmentos), utilizou-se o somatório das frações hexano, DMSO e acidificada, e coeficientes de extinção 2592, 2100 e 1690 referentes ao beta-caroteno, astaxantina e astaceno, respectivamente. A astaxantina foi o pigmento mais abundante (45,5%), seguido do beta-caroteno-5,6-epóxido (33,5%) e do astaceno (21,0%). Resumo em inglês The extraction of carotenoid pigments from shrimp heads left over from the processing of Litopenaeus vannamei has been shown to constitute an economically feasible alternative for aggregating value to shrimp processing waste. The objective of the present study was to extract, identify and quantify the main pigments found in shrimp heads collected at a shrimp processing plant in Ceará (Brazil). Samples were cooked for 15 minutes at 100 °C in water at a ratio of 1:2 un (mais) til producing a mush. Carotenoids were extracted using cooled acetone and then hexane (the hexane phase). Subsequently, the DMSO phase was produced along with an acid fraction by partitioning with dimethyl sulfoxide. Following evaporation and drying, the carotenoids were identified in an open column using the elution parameter of the fractions, the visible absorption spectrum and the Rf value of the thin layer of silica gel. The absorption spectra of each fraction were read at 350-550 nm and quantified by thin-layer chromatography. The calculation of total carotenoids (37.62 µg.g-1 of the pigment mush) used the sum of the hexane, DMSO and acid fractions as well as the extinction coefficients of beta-carotene, astaxantin and astacin (2592, 2100 and 1690, respectively). The most abundant pigment was astaxantin (45.5%), followed by beta-carotene-5,6-epoxide (33.5%) and astacin (21.0%).

Scientific Electronic Library Online (Portuguese)

18

Viabilidade de cepas de Malassezia pachydermatis mantidas em diferentes métodos de conservação/ Viability of Malassezia pachydermatis strains maintained in various storage mediums

Girão, Marília Dutra; Prado, Marilena Ribeiro do; Brilhante, Raimunda Sâmia Nogueira; Cordeiro, Rossana Aguiar; Monteiro, André Jalles; Sidrim, José Júlio Costa; Rocha, Marcos Fábio Gadelha
2004-06-01

Resumo em português A manutenção de culturas de Malassezia pachydermatis em micotecas é importante para estudos retrospectivos e prospectivos. O objetivo deste trabalho foi avaliar o comportamento de Malassezia pachydermatis frente a diferentes métodos de conservação de culturas. Para tanto, após o processo de identificação, essa levedura foi estocada, por seis e nove meses, em salina e salina com óleo mineral a 28°C, bem como, em ágar Dixon, ágar Dixon acrescido de glicerol e � (mais) �gar Dixon acrescido de dimetil-sulfóxido (DMSO) a -20°C. Os meios de Dixon e Dixon acrescido de glicerol foram os métodos mais adequados (p Resumo em inglês The maintenance of Malassezia pachydermatis in fungal collections is very important for retrospective and prospective studies. The aim of this study was to evaluate the behavior of Malassezia pachydermatis in different storage methods. After the identification process, M. pachydermatis strains were stored for six and nine months, in saline and saline plus mineral oil at 28°C, as well as in Dixon's agar, Dixon's agar plus glycerol and Dixon's agar plus dimethyl-sulfoxide (mais) (DMSO), at -20°C. Dixon's agar and Dixon's agar plus glycerol were the most adequate methods (p

Scientific Electronic Library Online (Portuguese)

19

Atividade predatória, crescimento radial e esporulação de fungos predadores de nematóides Monacrosporium spp, submetidos à criopreservação/ Predatory activity, radial growth and esporulation of nematode-trapping fungus Monacrosporium spp, submitted to cryopreservation

Campos, Artur Kanadani; Mota, Marcelo de Andrade; Araújo, Jackson Victor de; Cecon, Paulo Roberto
2004-04-01

Resumo em português Testes in vitro foram realizados para avaliar o efeito da criopreservação em nitrogênio líquido com e sem adição de crioprotetores (DMSO ou glicerol), na atividade predatória sobre larvas infectantes de Cooperia sp e Haemonchus sp, crescimento radial e produção de conídios de dois isolados de fungos predadores de nematóides (Monacrosporium sinense e Monacrosporium appendiculatum). A capacidade predatória dos fungos sobre larvas infectantes de Cooperia sp e Hae (mais) monchus sp dos fungos previamente submetidos aos diferentes métodos de preservação não foi afetada. O crescimento radial dos fungos criopreservados com glicerol 10% foi mais expressivo(p Resumo em inglês In vitro tests were performed to evaluate the effect of cryopreservation with or without addition of cryoprotectants (DMSO or glycerol) in the predatory activity on Cooperia sp and Haemonchus sp infective larvae, radial growth and conidial production of two isolates of nematode-trapping fungus (Monacrosporium sinense and M. appendiculatum). The predatory activity on Cooperia and Haemonchus sp infective larvae of the fungus submitted to the different preservations methods (mais) did not affected. The radial growth of the fungus cryopreserved with glycerol was higher (p

Scientific Electronic Library Online (Portuguese)

20

Avaliação da eficiência de caulinita intercalada com dimetilsulfóxido em adsorção com o Zn(II) em meio aquoso: cinética do processo de adsorção/ Evaluation of intercaled kaolinite efficiency with dimetilsulfoxide in adsorption with Zn(II) in aqueous medium: kinetics of the adsorption process

Guerra, D. L.; Sousa, J. A.; Airoldi, C.; Viana, R. R.
2008-09-01

Resumo em português Amostras de caulinita oriundas da região do Rio Capim, estado do Pará, Brasil, foram intercaladas com dimetilsulfóxido - DMSO. As amostras de caulinita naturais e intercaladas foram utilizadas em processo de adsorção com Zn(II) em meio aquoso em pH 5,0 e temperatura controlada de 298 ± 1K. As propriedades físico-químicas das amostras de caulinita foram otimizadas pelo processo de intercalação, como: área superficial de 14,74 para 91,72 m²g-1 (A1) e diâmetro d (mais) e poros de 2,79 para 10,72 nm (A1). A análise dos resultados experimentais de adsorção foi feita pelos modelos de Langmuir, Temkin e Freundlich. O modelo de Langmuir apresentou melhor aproximação com os dados experimentais de adsorção. Estes resultados foram bem representados pelo modelo cinético de segunda ordem de Lagergren, com a taxa constante K2 no intervalo de 4,76x10-3 a 11,81x10-3 g(mmol.min)-1 (A2). O processo de adsorção foi considerado rápido alcançando o equilíbrio em 180 min. Resumo em inglês The kaolinite clay samples from Capim River region, Pará state, Brazil, were intercalated with dimethylsulfoxide - DMSO. The natural and intercalated kaolinite were used in adsorption process with Zn(II) in aqueous medium at pH 5.0 and controlled temperature of 298 ± 1K. The physical-chemical properties of kaolinite samples were optimized for the intercalation process, such as: specific area of 14.74 to 91.72 m²g-1 (A1) and pore diameter of 2.79 to 10.72 nm (A1). The a (mais) dsorption experimental results were analyzed for Langmuir, Temkin and Freundlich models, the Langmuir model has been presented best approximation with experimental adsorption isotherms data. These results best fitted the second order kinetic of Lagergren model with rate constant K2, in the range of 4.76x10-3 to 11.81x10-3 g(mmol.min)-1 (A2). The adsorption process was very fast and equilibrium was approached within 180 min.

Scientific Electronic Library Online (Portuguese)

21

Ação de extrato e óleo de nim no controle de Rhipicephalus (Boophilus) microplus (Canestrini, 1887) (Acari: Ixodidae) em laboratório/ Action of extract and oil neem in the control of Rhipicephalus (Boophilus) microplus (Canestrini, 1887) (Acari: Ixodidae) in laboratory

Broglio-Micheletti, Sônia Maria Forti; Dias, Nivia da Silva; Valente, Ellen Carine Neves; Souza, Leilianne Alves de; Lopes, Diego Olympio Peixoto; Santos, Jakeline Maria dos
2010-03-01

Resumo em português Extratos vegetais orgânicos e óleos emulsionáveis de Azadirachta indica A. Juss (Meliaceae) (nim) foram estudados com o objetivo de avaliar seus efeitos no controle de fêmeas ingurgitadas de Rhipicephalus (Boophilus) microplus (Canestrini, 1887) em laboratório. Foram utilizados extratos orgânicos hexânicos e alcoólicos a 2% (peso/volume), em testes de imersão, durante 5 minutos, preparados com sementes, solubilizados em dimetilsulfóxido (DMSO) a 1%. O experiment (mais) o foi inteiramente casualizado, sendo constituído por 6 tratamentos e 5 repetições, cada uma delas representada por 5 carrapatos. O grupo controle consistiu de fêmeas sem tratamento. Com base nos resultados deste trabalho, pode-se indicar que os tratamentos extrato de semente (hexano) e óleo emulsionável I¹, em concentração a 2%, possuem significativo potencial adjuvante de controle do carrapato bovino, pois ocasionam a mortalidade nos primeiros dias após o tratamento e interferem na reprodução, mostrando ser uma alternativa aos carrapaticidas normalmente utilizados. Resumo em inglês Organic plant extracts and emulsified oil of Azadirachta indica A. Juss (Meliaceae) (neem) were studied to evaluate its effects in control of engorged females of Rhipicephalus (Boophilus) microplus (Canestrini, 1887) in the laboratory. Hexane and alcoholic organic extracts, 2% (weight/volume) were used in tests of immersion for 5 minutes, prepared with seeds, solubilized in dimethylsulfoxide (DMSO) to 1%. The experiment was entirely randomized, consisting of 6 treatments (mais) and 5 replicates, each represented by 5 ticks. Control groups consisted of untreated females. Based on the results of this work, we can indicate that the seed extract (hexanic fraction) and óleo emulsionável I1 concentration to 2% have significant adjuvant potential to control the cattle tick, because, cause the mortality in the first days after the treatment and interfere in the reproduction, showing to be an alternative to acaricides normally used.

Scientific Electronic Library Online (Portuguese)

22

Controle de esterilidade de produtos de células progenitoras hematopoéticas do sangue periférico/ Sterility control of hematopoietic progenitor cells from peripheral blood products

Almeida, Igor D.; Coitinho, Adriana S.; Juckowsky, Clarice A.; Schmalfuss, Tissiana; Balsan, Almeri M.; Röhsig, Liane M.
2010-02-01

Resumo em português A taxa de contaminação microbiana dos produtos de células progenitoras hematopoéticas do sangue periférico é baixa. Neste estudo pesquisou-se a prevalência de hemoculturas positivas em células progenitoras hematopoéticas do sangue periférico (CPHSP) no Serviço de Hemoterapia do Hospital de Clínicas de Porto Alegre. Do total de 618 coletas realizadas no período de 2000 a 2007, 26 (4,2%) apresentaram contaminação por bactérias. O Staphylococcus coagulase-neg (mais) ativo foi predominantemente isolado nas hemoculturas. A antibioticoterapia pré e pós-infusão foi estabelecida de acordo com o microorganismo e seu antibiograma, sendo que, em cinco das doze infusões contaminadas realizadas, não foram administrados antimicrobianos profilaticamente. Episódios febris foram observados em sete pacientes (58%), enquanto cinco (42%) não apresentaram febre. Das doze infusões contaminadas realizadas, seis (50%) apresentaram hemocultura pós-descongelamento positivas, enquanto as restantes (50%) foram negativas. Isto se deve às propriedades bactericidas do DMSO, de células fagocitose-ativas e de temperaturas muito baixas atingidas na criopreservação. Autores têm relatado sucesso neste procedimento após a infusão desses produtos contaminados com o mínimo de consequências clínicas. Resumo em inglês The rate of microbial contamination of hematopoietic progenitor cell products from peripheral blood is low. In this study, we investigated the prevalence of positive blood cultures of hematopoietic progenitor cells from peripheral blood in a hemotherapy service. Of a total of 618 samples taken during the period from 2000 to 2007, 26 (4.2%) were contaminated by bacteria. Staphylococcus coagulase-negative was the predominant bacterium isolated in blood cultures. Pre- and po (mais) st-infusion antibiotic therapy was established depending on the microorganism and antibiogram, whereas in five out of twelve contaminated infusions, no antibiotics were administered prophylactically. Febrile episodes were observed in seven patients (58%), while five (42%) did not suffer from fever. Of the twelve contaminated infusions performed, six (50%) of the samples had positive blood cultures after thawing, while the others (50%) were negative. This is due to the bactericidal properties of DMSO, phagocytosis-active cells and the extremely low temperatures during cryopreservation. Authors have reported success in the procedure after the infusion of contaminated products with minimal clinical consequences.

Scientific Electronic Library Online (Portuguese)

23

Padronização da metodologia do RT-PCR utilizado para identificação do mRNA da alfa-amilase em sementes de milho/ RT-PCR patterning for alpha-amylase messenger RNA identification in germinating maize seeds

Dantas, Bárbara França; Aragão, Carlos Alberto; Araújo-Junior, João Pessoa; Rodrigues, João Domingos; Cavariani, Cláudio; Nakagawa, João
2002-01-01

Resumo em português Durante a germinação das sementes, os carboidratos de reserva são degradados pela atividade de a-amilase. A identificação de mRNA é uma ferramenta fundamental para a definição da cinética de síntese de alfa-amilase. Objetivou-se padronizar a metodologia do RT-PCR para identificar o mRNA do gene de a-amilase em sementes de milho. Após três dias de germinação das cultivares Saracura-BRS 4154 e CATI-AL34, extraiu-se o RNA total pelo método do tiocianato de gua (mais) nidina-fenol-clorofórmio, com algumas modificações. A partir do RNA total extraído foi obtido cDNA com utilização de "random primers". A amplificação por PCR de uma porção do gene da alfa-amilase foi realizada com os "primers": "sense" - CGACATCGACCACCTCAAC; "antisense" - TTGACCAGCTCCTGCCTGTC; gelatina; DMSO e 1,25 unidades de Taq DNA polimerase por reação e completados com água tratada com DEPC. Os ciclos para a amplificação foram 94ºC durante 4 minutos, seguidos por 34 ciclos de 94ºC durante 1 minuto, 42ºC durante 1 minuto e 72ºC durante 1,5 minutos e, finalmente, 72ºC por 5 minutos. O produto do RT-PCR apresentou uma banda de 249 pares de base (pb) bem definida, para as duas cultivares estudadas, não ocorrendo bandas inespecíficas. A técnica do RT-PCR mostrou ser uma metodologia eficiente para a identificação da expressão de alfa-amilase durante a germinação das sementes e pode ser usado para estudo qualitativo e quantitativo da cinética de síntese dessa enzima em experimentos de germinação. Resumo em inglês During germination the seed reserve carbohydrates are degraded by alpha-amylase activity. The identification of mRNA is a very important tool for definition of alpha-amylase synthesis kinetics. This study aimed to adapt a PT-PCR methodology for a-identification of amylase mRNA in germinating maize seeds. After three days germination of Saracura BRS4154 and CATI AL34 maize cultivars, the total RNA was isolated by the guanidinium thiocyanate-phenol-chloroform extraction met (mais) hod, with some modifications. The cDNA was obtained from the total RNA, using random primers. The alpha-amylase gene PCR amplification was carried out with cDNA, primers (sense - CGACATCGACCACCTCAAC; antisense - TTGACCAGCTCCTGCCTGTC); gelatina; DMSO and 1,25 units of Taq DNA polimerase per reaction and complete with DEPC water. The amplification cycles were 94ºC/4 minutes, 34 cycles of 94ºC /1 minute, 42ºC/1 minute and 72ºC/1,5 minutes, and finally 72ºC/5 minutes. The RT-PCR product visualization in agarose gel eletcrophoresis indicated that this method presented well defined bands of 249 bp for the both the cultivars, without unspecific bands. The RT-PCR is an eficient method for alpha-amylase expression studies during germination and can be used as a tool for quantitative and qualitative research about alpha-amylase sinthesis kinetics.

Scientific Electronic Library Online (Portuguese)

24

Efeito do transporte no desenvolvimento de embriões bovinos cultivados in vitro a fresco ou reaquecidos após vitrificação/ Effect of transportation on development of fresh or vitrified-warmed bovine embryos

Ramos, Alessandra de Almeida; Polisseni, Juliana; Sá, Wanderlei Ferreira de; Ferreira, Ademir de Moraes; Camargo, Luis Sérgio de Almeida; Folhadella, Danielle da Silva; Nogueira, Luiz Altamiro Garcia
2006-12-01

Resumo em português Avaliou-se a viabilidade de embriões bovinos cultivados in vitro, a fresco ou reaquecidos após vitrificação, depois de transportados por 6 ou 12 horas. Oócitos obtidos de folículos de ovários coletados em matadouro foram maturados, fecundados e cultivados in vitro. Após sete dias de cultivo, blastocistos com grau de qualidade I e II (segundo o manual da IETS-1998) foram selecionados, envasados em OPS (open pulled straws) e vitrificados em nitrogênio líquido. O r (mais) eaquecimento foi realizado a 39ºC pela passagem em soluções de HM com concentrações decrescentes de sacarose (0,25M - 0,15M) por cinco minutos em cada solução. Foram avaliados três tratamentos - V0: embriões vitrificados, reaquecidos e cultivados in vitro (n=25); V6: embriões vitrificados, transportados por 6 horas (simulação em palhetas), reaquecidos e cultivados in vitro (n=29); e V12: embriões vitrificados, transportados por 12 horas, reaquecidos e cultivados in vitro - comparados, cada um, a um tratamento controle, com embriões a fresco-C0: embriões a fresco cultivados in vitro (n=26); C6: embriões a fresco cultivados in vitro após 6 horas de transporte (n=30); e C12: embriões a fresco cultivados in vitro após 12 horas de transporte (n=30). Os embriões foram co-cultivados com células da granulosa em microgotas de TCM 199 acrescido de SFB. Foram avaliadas as taxas de re-expansão e eclosão após 48 horas de cultivo. A análise foi realizada pelo teste do qui-quadrado. As taxas de re-expansão entre os grupos V0, V6 e V12 não diferiram, assim como as taxas de eclosão entre os embriões vitrificados e os controles. As taxas de eclosão, no entanto, diferiram entre os embriões submetidos à vitrificação e os controles. Embriões bovinos produzidos in vitro podem ser transportados a fresco ou vitrificados por períodos de até 12 horas, pois possibilitam taxas de eclosão satisfatórias. Resumo em inglês The aim of this study was to evaluate the viability of in vitro produced bovine embryos, fresh or warmed, after submitted to different periods of transportation (6h-12h). Oocytes obtained from ovaries collected from slaughterhouse were matured, fertilized and cultured in vitro. After seven days, grades I and II blastocysts (according to IETS manual) were selected and vitrified after exposition to PBS solution with 5% fetal calf serum (HM), added with 10% ethylene glycol ( (mais) EG) and 10% of dymetil sulfoxide (DMSO), for one minute, followed by HM solution with 20% EG and 20% DMSO, for 20 seconds. Embryos were loaded into open pulled straws (OPS) and plunged into liquid nitrogen. Warming was performed at 39ºC by embryo exposure to decreasing concentration of sucrose (0.25 and 0.15M), for five minutes in each step. The warmed embryos were distributed in three groups: V0: in vitro cultured after warmed; V6: embryos loaded into straws and kept for 6 hours at 35ºC, before in vitro culture; and V12: embryos loaded into straws and kept for 12 hours at 35ºC, before in vitro culture. Each group was evaluated by control groups of fresh embryos (C0, C6 and C12, respectively). The embryos were co-cultured with cumulus cells in TCM-199 micro droplets added with SFB. Re-expansion and hatching rates after 48 hours in culture were evaluated and results were compared by the Chi-square test. Re-expanded rates among groups V0, V6 and V12 as well as hatching rates among vitrified groups and among control groups did not differ. However, hatching rates were different between vitrified groups and their respective controls. The satisfactory rates of hatching suggest that it is possible to transport warmed and fresh in vitro produced embryos for periods up to 12 hours.

Scientific Electronic Library Online (Portuguese)