Sample records for chloroform
from WorldWideScience.org

Sample records 1 - 20 shown. Select sample records:



1

Imobilização de TiO2 em concreto: fotodegradação de clorofórmio e fenol/ TiO2 immobilization onto concrete: chloroform and phenol photodegradation

Santos, Valquíria Claret dos; Kondo, Márcia Matiko
2006-04-01

Resumo em inglês TiO2 immobilization on concrete was studied using mixtures with cement, varnish and resin. The UV radiation sources were a germicide UV lamp and solar light. Aqueous solutions of chloroform (CHCl3) and of phenol were prepared and recirculated over the TiO2 immobilized surfaces. The immobilized TiO2 surfaces showed better photocatalytic efficiency for phenol degradation compared to the control. For CHCl3, the presence or absence of the catalyst did not cause any significan (mais) t difference to its degradation efficiency. The micrographic results showed a more homogeneous surface for TiO2 immobilized in resin and varnish.

Scientific Electronic Library Online (Portuguese)

2

Termodinâmica estatística de líquidos com o método de Monte Carlo. II. O líquido clorofórmio/ Statistical thermodynamics of liquids using the Monte Carlo method. II. Liquid chloroform

Barlette, Vania Elisabeth; Freitas, Luiz Carlos Gomide
1999-07-01

Resumo em inglês Thermodynamic properties and radial distribution functions for liquid chloroform were calculated using the Monte Carlo method implemented with Metropolis algorithm in the NpT ensemble at 298 K and 1 atm. A five site model was developed to represent the chloroform molecules. A force field composed by Lennard-Jones and Coulomb potential functions was used to calculate the intermolecular energy. The partial charges needed to represent the Coulombic interactions were obtained (mais) from quantum chemical ab initio calculations. The Lennard-Jones parameters were adjusted to reproduce experimental values for density and enthalpy of vaporization for pure liquid. All thermodynamic results are in excelent agreement with experimental data. The correlation functions calculated are in good accordance with theoretical results avaliable in the literature. The free energy for solvating one chloroform molecule into its own liquid at 298 K and 1 atm was computed as an additional test of the potential model. The result obtained compares well with the experimental value. The medium effects on cis/trans convertion of a hypotetical solute in water TIP4P and chloroform solvents were also accomplished. The results obtained from this investigation are in agreement with estimates of the continuous theory of solvation.

Scientific Electronic Library Online (Portuguese)

3

Contribuição ao estudo fitoquímico de Dorstenia multiformis Miquel (Moraceae) com abordagem em atividade antioxidante/ Contribution to the phytochemical study of Dorstenia multiformis Miquel (Moraceae) with approach in antioxidant activity

Balestrin, Luciana; Dias, Josiane F. Gaspari; Miguel, Obdúlio Gomes; Dall'Stella, Daniela S. G.; Miguel, Marilis Dallarmi
2008-06-01

Resumo em português Conhecida como carapiá, a espécie Dorstenia multiformis Miquel, Moraceae, é largamente empregada na medicina popular contra doenças de pele. Neste trabalho determinou-se a atividade antioxidante de substâncias isoladas, do extrato etanólico, e frações hexano, clorofórmio e acetato de etila. Todas as amostras testadas apresentaram atividade antioxidante, sendo que a fração clorofórmio foi a que apresentou maior atividade antioxidante. Resumo em inglês The species Dorstenia multiformis Miquel, Moraceae, known as "carapiá", is largely employed in folk medicine against skin diseases. In this paper the antioxidant activity of isolated substances, from the ethanol extract, and hexane, chloroform and ethyl acetate fractions has been determined. All of the tested samples showed antioxidant activity, and the chloroform fraction was the one that presented the largest antioxidant activity.

Scientific Electronic Library Online (Portuguese)

4

Biciclogermacreno, resveratrol e atividade antifúngica em extratos de folhas de Cissus verticillata (L.) Nicolson & Jarvis (Vitaceae)/ Bicyclogermacrene, resveratrol and fungitoxic activity on leaves extracts of Cissus verticillata L. Nicolson & Jarvis (Vitaceae)

Silva, Luciana da; Oniki, Glaucia H.; Agripino, Débora G.; Moreno, Paulo R. H.; Young, Maria Claudia M.; Mayworm, Marco Aurélio S.; Ladeira, Angela M.
2007-09-01

Resumo em português Cissus verticillata L. (Vitaceae) tem sido empregada popularmente como anti-diabética. Nessa espécie foi também detectada atividade fungitóxica. O objetivo do presente trabalho foi realizar a identificação dos compostos fungitóxicos em extratos de folhas. O extrato etanólico foi submetido a fracionamento com solventes de diferentes polaridades (hexano, clorofórmio, acetato de etila e butanol) e seu efeito antifúngico foi analisado frente a Cladosporium sphaerosp (mais) ermum. Os extratos em clorofórmio e acetato de etila mostraram atividade, e foram fracionados por cromatografia em coluna e cromatografia preparativa em placas de sílica, respectivamente. Três terpenóides foram isolados do extrato em clorofórmio; um deles foi identificado, por análise em CG-EM, como um sesquiterpeno, o biciclogermacreno. O composto ativo do extrato em acetato de etila foi identificado, por análises em CLAE, como o estilbeno resveratrol. Resumo em inglês Cissus verticillata L. (Vitaceae) is popularly employed as hypoglicemic and it shows fungitoxic activity. This work aims at identification of fungitoxic compounds on extracts of leaves. The ethanol extract was partitioned using solvents of different polarities (hexane, chloroform, ethyl acetate and butanol) and its fungitoxic activity was analysed upon Cladosporium sphaerospermum. The chloroform and ethyl acetate extracts showed activity and they were fractionated by colu (mais) mn chromatography and preparative TLC, respectively. Three terpenoids were isolated from the chloroform extract, one of them identified by GLC-MS analysis as sesquiterpene bicyclogermacrene. The active compound of the ethyl acetate extract was identified by HPLC analyses as stilbene resveratrol.

Scientific Electronic Library Online (Portuguese)

5

Metodologia de extração e determinaçao do teor de extrativos em madeiras de eucalipto/ Methodology of extration and determination of extractive contents in eucalypt woods

Silvério, Flaviano Oliveira; Barbosa, Luiz Cláudio de Almeida; Gomide, José Lívio; Reis, Fernando Pinheiro; Piló-Veloso, Dorila
2006-12-01

Resumo em português Neste trabalho foi avaliado o teor de extrativos em madeiras de eucalipto, por meio de extrações com acetona, mistura de tolueno:etanol (2:1), clorofórmio e diclorometano. As maiores porcentagens de extrativos totais foram obtidas ao utilizar acetona como solvente. Os extratos obtidos em acetona e tolueno:etanol foram ressuspendidos em diclorometano, para avaliação do teor de extrativos lipofílicos. As porcentagens desses extrativos foram semelhantes às obtidas com (mais) diclorometano ou clorofórmio, em extrações diretas. Os extratos foram analisados por espectroscopia no infravermelho, para identificação dos principais grupos funcionais dos constituintes extraídos. Resumo em inglês The extractives content in eucalypt woods were evaluated using direct extractions with acetone, mixture of toluene:ethanol (2:1), chloroform and dichloromethane. The largest percentages of extractives were obtained using acetone as solvent. The extracts obtained in acetone and toluene:ethanol were dissolved in dichloromethane to establish the percentage of lipophilic extractives. The percentages of these extractives were similar to those obtained with dichloromethane or c (mais) hloroform by direct extractions. The extracts were analyzed by infrared spectroscopy to identify the main functional groups.

Scientific Electronic Library Online (Portuguese)

6

Extração e teores de 2-tridecanona e 2-undecanona em genótípos de tomateiro/ Extraction and contents of 2-tridecanone and 2-undecanone in tomato genotypes

Giustolin, Teresinha A.; Vendramim, José D.; Baptista, Gilberto C. de
1997-04-01

Resumo em português Desenvolveu-se metodologia de extração dos compostos 2-tridecanona (2-T) e 2-undecanona (2-U), em tomateiro (Lycopersicon spp utilizando-se folhas de uma cultivar comercial fortificada com os referidos aleloquímicos, sendo os extratos analisados por cromatografia gasosa. Para a extração, testaram-se: clorofórmio; clorofórmio mais extrator de Butt; e extrator de Butt. Os três métodos propiciaram recuperação dos compostos acima de 80%, tendo sido selecionado o pr (mais) imeiro por ser mais prático e utilizar menor volume de solvente. Os genótipos submetidos à extração foram: Lycopersicon hirsutum f. glabratum (PI 134417), L. esculentum ('Santa Cruz Kada AG-373') e 22 híbridos F1l(RC1) [(PI 134417 L. esculentum) x PI 134417]. Dentre os híbridos analisados, em apenas seis foram detectados o 2-T e o 2-U e em outros quatro híbridos apenas o 2-T. No híbrido com maior concentração de aleloquímicos foram encontrados 351 ppm de 2-T e 62 ppm de 2-U. Em L. esculentum, os aleloquímicos não foram detectados, enquanto que na PI 134417, as concentrações de 2-T e 2-U foram, respectivamente, 1902 e 473 ppm. Resumo em inglês A methodology for extraction of 2-tridecanone (2-T) and 2-undecanone (2-U) from tomato plants {Lycopersicon spp.) was developed using leaves of a commercial cultivar previously fortified with these allelochemicals. Extracts were analyzed in a gas chromatograph, using the following methods: chloroform; chloroform plus Butt extractor; and Butt extractor. The three methods recovered more than 80% of the allelochemicals. However, the first method was more pratical, using less (mais) volume of solvent. The genotypes Lycopersicon hirsutum f. glabratum (PI 134417), L. esculentum ('Santa Cruz Kada AG-373'), and 22 hybrids F1 (RC1) [(PI 134417 x L. esculentum} x PI 134417) were analyzed for the amounts of these allelochemicals. Among the hybrids, six presented both 2-T and 2-U, and four presented only 2-T. The highest concentration of allelochemicals was 351 ppm of 2-T, and 62 ppm of 2-U. The allelochemicals were not detected in L. esculentum. The concentrations of 2-T and 2-U in PI 134417 were 1902 and 473 ppm, respectively.

Scientific Electronic Library Online (Portuguese)

7

Método espectroscópico para determinação de cumarina em xarope de Mikania glomerata Sprengel/ Ultraviolet spectroscopy method for coumarin quantification in Mikania glomerata Sprengel syrup

Silva, Cleinils R. da; Gomes, Víctor S.; Kulkamp, Irene C.; Kanis, Luiz A.
2008-12-01

Resumo em português Este trabalho teve como objetivo desenvolver uma metodologia analítica por espectroscopia UV, para doseamento de cumarina em xaropes de Mikania glomerata. A técnica foi baseada na extração da cumarina utilizando solventes como o clorofórmio e hexano. Após a seleção do solvente, o comprimento de onda foi definido através da sobreposição dos espectros da cumarina, metil parabeno, diluição do xarope e solução extrativa do xarope. Foram preparadas curvas analí (mais) ticas de cinco soluções de cumarina com concentração variando de 0,002 a 0,03 mg/mL. Para análise da exatidão do método, foram preparados três lotes de xarope de Mikania glomerata Sprengel e o teor de cumarina determinado pela técnica espectrofotométrica foi comparado a técnica por cromatografia líquida de alta eficiência. O solvente selecionado para extração foi o clorofórmio, o comprimento de onda 320 nm. A curva analítica apresentou R² de 0,99978, demonstrando linearidade. A comparação estatística do doseamento da cumarina pela técnica espectrofotométrica estudada com a técnica cromatográfica desenvolvida por Celeghini et al. (2001) demonstrou não existir diferenças significativas, indicativo de exatidão da técnica. Resumo em inglês A spectrophotometric procedure for coumarin determination in Mikania glomerata Sprengel (guaco) syrup is described in this work. Due to the high number of constituents in guaco syrups, the coumarin was extracted with apolar extractors (chloroform and hexane), in which chloroform was selected, because of its higher capacity of extraction. After the solvent choice, the wavelength at 320 nm, region where there is the lower interference of syrup constituents, was selected. Th (mais) e calibration curve showed linearity, R² of 0.99978. The spectrophotometric assay of coumarin in three samples of Mikania glomerata Sprengel syrup showed accuracy compared with the HPLC method. The results presented suggest that the spectrophotometric method may be useful for the quantitative analysis of coumarin in Mikania glomerata Sprengel syrup.

Scientific Electronic Library Online (Portuguese)

8

MÉTODOS DE EXTRAÇÃO DE DNA PARA A DETECÇÃO DE Salmonella EM OVOS DE GALINHAS, COM E SEM CASCA, ATRAVÉS DA REAÇÃO EM CADEIA PELA POLIMERASE/ DNA EXTRACTION METHODS FOR Salmonella DETECTION IN CHICKEN EGGS, INSHELL AND OUTSHELL, BY POLIMERASE CHAIN REACTION

Flôres, Maristela Lovato; Nascimento, Vladimir Pinheiro do; Kader, Ivonyr Irene Troglio Abdel; Santos, Luciana Ruschel dos; Pontes, Alexandre Pontes; Salle, Carlos Tadeu Pippi; Lopes, Rui Fernando Felix
2001-04-01

Resumo em português O diagnóstico microbiológico de Salmonella sp em amostras de alimentos é demorado, com cinco diferentes etapas, levando cerca de 120 horas até o resultado final. A utilização da técnica da Reação em Cadeia pela Polimerase (PCR) pode diminuir esse período, porém sofre influência de substâncias presentes na amostra que afetam a reação. O objetivo deste trabalho foi comparar dois métodos de extração de DNA, a extração por tratamento térmico e a pelo feno (mais) l-clorofórmio, em amostras de 100 ovos de galinhas domésticas artificialmente contaminados com uma cepa de Salmonella enterica sorovar typhimurium em fase estacionária. O material obtido com as extrações foi submetido à PCR, utilizando-se um par de iniciadores que amplificam um fragmento de 284pb do gene InvA de Salmonella sp. Comparando os métodos de extração, observou-se uma diferença na capacidade de detecção de 12% a favor do método do fenol-clorofórmio, quando a extração foi realizada a partir do ovo com casca. No momento em que a mesma metodologia foi usada apenas com a parte interna dos ovos, essa diferença subiu para 26% o que foi significativo (P Resumo em inglês The Salmonella sp detection in feed samples is time consuming, it has five stages and requires 120 hours for final results. The use of polimerase chain reaction technique can reduce this time considerably, however it can be affected by substances from the sample. This study had the objective of comparing two methods of DNA extraction, by heating process and by phenol-chloroform in samples of 100 chicken eggs experimentally infected with a sample of Salmonella enterica sor (mais) ovar typhimurium in stationary phase. After the two extraction methods a PCR was done using a pair of oligonucleotides that amplifies a fragment of 284pb in the InvA gene de Salmonella sp. Comparing the extraction methods it was noted a difference of 12% favorably to the phenol-chloroform method when the extraction was done from eggs with shell. The same method using just the egg internal part resulted in a difference of 26% with high significance (P

Scientific Electronic Library Online (Portuguese)

9

Biologia molecular aplicada às dermatoses tropicais/ Molecular biology in tropical dermatoses

Roselino, Ana Maria
2008-06-01

Resumo em português São apresentados conceitos básicos sobre célula, código genético e síntese protéica, e sobre algumas técnicas de biologia molecular, tais como PCR, PCR-RFLP, seqüenciamento de DNA, RT-PCR e immunoblotting. São fornecidos protocolos de extração de nucleotídeos e de proteínas, como salting out no sangue periférico e métodos do fenol-clorofórmio e do trizol em tecidos. Seguem-se exemplos comentados da aplicação de técnicas de biologia molecular para o dia (mais) gnóstico etiológico e pesquisa em dermatoses tropicais, com ênfase na leishmaniose tegumentar americana e hanseníase. Resumo em inglês Initially, basic concepts are presented concerning the cell, genetic code and protein synthesis, and some techniques of molecular biology, such as PCR, PCR-RFLP, DNA sequencing, RT-PCR and immunoblotting. Protocols of nucleotides and of proteins extraction are supplied, such as salting out in peripheral blood allied to phenol-chloroform and trizol methods in skin samples. To proceed, commented examples of application of those techniques of molecular biology for the etiolo (mais) gic diagnosis and for research in tropical dermatoses, with emphasis to American tegumentary leishmaniasis and leprosy are presented.

Scientific Electronic Library Online (Portuguese)

10

Determinação do íon ferro em preparações farmacêuticas através da cromatografia planar e espectrofotometria/ Determination of ferrous ion in pharmaceutical preparations through planar chromatography and spectrophotometry

MANCINI, Maria Aparecida Donnini; ZUANON NETTO, José; VALLADÃO, Dênia Mendes de Sousa
1997-01-01

Resumo em português Os autores estudaram o comportamento cromatográfico de preparações farmacêuticas comerciais contendo o íon Fe (II). Utilizando celulose microcristalina/Propanol: ácido clorídrico 4 N: ácido acético concentrado: ácido nítrico concentrado: clorofórmio (40: 5: 5: 10: 10), como sistema cromatográfico e alizarina como reagente de detecção, Fe (II), Mn (II), Mg (II), Cu (II), Zn (II) e Ca (II) foram separados e identificados pela Cromatografia Planar. O Fe (II) f (mais) oi determinado pela reação com a ortofenantrolina, resultando em solução adequada para quantificação colorimétrica. Resumo em inglês The authors have studied the chromatographic behavior of pharmaceutical preparations obtained from commercial sources containing the ferrous ion. Using microcrystalline cellulose , propanol: 4 N, H Cl, acetic acid, nitric acid, chloroform mixture (40: 5: 5: 10: 10) as chromatographic system and and Alyzarin as the detection reagent Fe (II), Mn (II), Mg(II), Zn (II) and Ca (II) were separated and identificated by Planar Chromatography. Fe (II) cation was determined by reaction with 1, 10-Phenanthroline, resulting in an appropriate solution for colorimetric quantitation.

Scientific Electronic Library Online (Portuguese)

11

Identificação de alcalóides xantínicos do guaraná (Paullinia cupana KBK) por cromatografia em camada delgada em amostras de urina/ Identification of xanthine alkaloids of guaraná in urine samples using thin-layer chromatography

Mousinho, Maurílio de Carvalho; Oliveira, Fernando de
1986-01-01

Resumo em português É proposto um esquema analítico, simples e sensível, para identificação de bases xânticas do guaraná em material biológico. Amostras de urina de consumidores de guaraná são submetidos à extração com clorofórmio em meio alcalino. Após evaporação dos extratos, os resíduos são transferidos para uma cromatoplaca de silicagel G (0,25 mm) e desenvolvidos em acetato de etilaciclohexano-metanol-hidróxido de amônio, 70:15:10:5 (11,5 cm) e, a seguir, acetato de (mais) etilaciclohexano-hidróxido de amônio, 50:40:0,1 (15,5 cm) na mesma direção. A revelação é feita com o reativo de DRAGENDORFF iodado. Resumo em inglês A simple and sensitive thin layer chromatographic analytical method is proposed for the identification of xanthic bases of guarana Paullinia cupana HBK in urine samples. The samples were obtained from the consumers of the stimulant drink and submitted to extraction with chloroform in alkaline medium. After evaporation of the extracts residues were transferred to silicagel G (0,25 mm) thin-layer plates and developed with ethylacetatecyclohexane-methanol, ammonium hydroxide (mais) 50:40:0,1 for 14,5 cm in the same dimension. The spots were revealed with Dragendorff-iodate chromogen agent.

Scientific Electronic Library Online (Portuguese)

12

Teor lipídico e perfil de ácidos graxos da carne de capivara (Hydrochaeris hydrochaeris)/ Lipid content and fatty-acids of capybara meat (Hydrochaeris hydrochaeris)

Jardim, Nilo Salgado; Bressan, Maria Cristina; Lemos, Ana Lucia da Silva Correia; Thomazini, Marcelo; Ferreira, Milena Wolff
2003-06-01

Resumo em português Objetivou-se com o presente trabalho avaliar o efeito dos fatores sexo e diferentes faixas de peso ao abate (30 a 40kg, 40 a 50kg e 50 a 60kg) no teor de lipídeos e perfil de ácidos graxos (AG) da carne de capivara (Hydrochaeris hydrochaeris). As amostras constituíram-se da porção cranial do músculo longissimus dorsi de 28 capivaras (16 machos e 12 fêmeas) provenientes de um mesmo zoocriadouro. As análises foram realizadas no Laboratório de Certificação da Qual (mais) idade de Carnes e Derivados do Instituto de Tecnologia de Alimentos-ITAL, em SP. Os lipídeos foram extraídos com clorofórmio/metanol (2:1), segundo Folch et al. (1957) e a composição de AG, por cromatografia gasosa (Bragagnolo, 1997). O músculo longissimus dorsi in natura de capivara apresentou média de 0,82% de lipídeos. Houve diferença (P Resumo em inglês This work aimed to evaluate the effect of the factors sex and different slaughter weight ranges (30-40kg, 40-50kg, 50-60kg) on the lipid content and fatty acids profiles of capybara meat. The samples were constituted of the cranial portion of the longissimus dorsi muscle of 28 capybaras (16 males and 12 females), from the same farm. The analyses were carried out at the Meats and Derived Quality Certification Laboratory of the Food Technology Institute - ITAL, in SP. The l (mais) ipids were extracted using chloroform/ methanol (2:1 (v/v) mixture), following the methodology of Folch et al. (1957), and the composition of fatty acids analysed by gas chromatography (Bragagnolo, 1997). The raw loin of capybara presented 0,82% of lipids. There was significant difference (P

Scientific Electronic Library Online (Portuguese)

13

Evaluation of paraffins biodegradation and biosurfactant production by Bacillus subtilis in the presence of crude oil/ Avaliação da biodegradação de parafinas e da produção de biosurfactante por Bacillus subtilis na presença de petróleo

Queiroga, Carmen Lucia; Nascimento, Lídia Regina; Serra, Gil Eduardo
2003-12-01

Resumo em português Os experimentos com Bacillus subtilis para avaliação da tensão superficial foram realizados com meio de cultivo contendo como nutrientes básicos 0,4% de ions nitrato e 4% de glicose, na presença de petróleo. A produção de surfactina foi observada pela redução da tensão superficial do meio de cultura fermentado. Surfactina foi isolada a partir do meio de cultura fermentado por B. subtilis, por precipitação ácida seguida de extração com clorofórmio-metanol. (mais) A avaliação da composição dos alcanos lineares (parafinas) foi realizada por cromatografia gasosa. Observamos uma significativa redução da tensão superficial do meio de cultura indicando que a produção de biosurfactante não foi inibida pela presença de parafina, e que as parafinas leves podem ter sido consumidas. Resumo em inglês Bacillus subtilis experiments for surface tension evaluation were accomplished with culture medium containing 0.4% nitrate ions and 4% glucose basic nutrient in the presence of crude oil. Surfactin production was observed by surface tension reduction of the culture broth. Surfactin was isolated from Bacillus subtilis fermented broth, by acid-precipitation followed by extraction with chloroform-methanol. Evaluation of the linear alkanes composition was performed by capilla (mais) ry gas chromatography. We observed a significant reduction of the surface tension of the fermented broth indicating that the biosurfactant production was not inhibited by the crude oil presence, and that the light paraffins might have been consumed.

Scientific Electronic Library Online (Portuguese)

14

Exposição humana a trialometanos presentes em água tratada/ Human exposure to trihalomethanes in drinking water

Tominaga, Maria Y; Midio, Antonio F
1999-08-01

Resumo em português Realizou-se uma revisão bibliográfica do período de 1974-1998, no MEDLINE, sobre compostos orgânicos halogenados derivados de hidrocarbonetos denominados de trialometanos. Muitos deles, reconhecidamente carcinogênicos para diferentes espécies animais, podem ser encontrados freqüentemente, inclusive entre nós, em águas tratadas e enviadas à população urbana. É o caso de compostos como o clorofórmio, bromodiclorometano, clorodibromometano e bromofórmio, resul (mais) tantes da halogenação de precursores, principalmente substâncias húmicas e fúlvicas presentes na água que será tratada (clorada). Assim, descreve-se sua formação, fontes de exposição humana bem como os aspectos toxicológicos de maior importância: disposição cinética e espectro dos efeitos tóxicos (carcinogênicos, mutagênicos e teratogênicos) decorrentes de exposições a longo prazo e baixas concentrações. Níveis seguros de exposição propostos são também fornecidos. Resumo em inglês Halogenated hydrocarbon compounds, some of them recognized as carcinogenic to different animal species can be found in drinking water. Chloroform, bromodichloromethane, dibromochloromethane and bromoform are the most important trihalomethanes found in potable water. They are produced in natural waters during chlorinated desinfection by the halogenation of precursors, specially humic and fulvic compounds. The review, in the MEDLINE covers the period from 1974 to 1998, pres (mais) ents the general aspects of the formation of trihalomethanes, sources of human exposure and their toxicological meaning for exposed organisms: toxicokinetic disposition and spectrum of toxic effects (carcinogenic, mutagenic and teratogenic).

Scientific Electronic Library Online (Portuguese)

15

Exposição humana a trialometanos presentes em água tratada/ Human exposure to trihalomethanes in drinking water

Tominaga, Maria Y; Midio, Antonio F
1999-08-01

Resumo em português Realizou-se uma revisão bibliográfica do período de 1974-1998, no MEDLINE, sobre compostos orgânicos halogenados derivados de hidrocarbonetos denominados de trialometanos. Muitos deles, reconhecidamente carcinogênicos para diferentes espécies animais, podem ser encontrados freqüentemente, inclusive entre nós, em águas tratadas e enviadas à população urbana. É o caso de compostos como o clorofórmio, bromodiclorometano, clorodibromometano e bromofórmio, resul (mais) tantes da halogenação de precursores, principalmente substâncias húmicas e fúlvicas presentes na água que será tratada (clorada). Assim, descreve-se sua formação, fontes de exposição humana bem como os aspectos toxicológicos de maior importância: disposição cinética e espectro dos efeitos tóxicos (carcinogênicos, mutagênicos e teratogênicos) decorrentes de exposições a longo prazo e baixas concentrações. Níveis seguros de exposição propostos são também fornecidos. Resumo em inglês Halogenated hydrocarbon compounds, some of them recognized as carcinogenic to different animal species can be found in drinking water. Chloroform, bromodichloromethane, dibromochloromethane and bromoform are the most important trihalomethanes found in potable water. They are produced in natural waters during chlorinated desinfection by the halogenation of precursors, specially humic and fulvic compounds. The review, in the MEDLINE covers the period from 1974 to 1998, pres (mais) ents the general aspects of the formation of trihalomethanes, sources of human exposure and their toxicological meaning for exposed organisms: toxicokinetic disposition and spectrum of toxic effects (carcinogenic, mutagenic and teratogenic).

Scientific Electronic Library Online (Portuguese)

16

Purificação e propriedades do vírus do mosaico do quenopódio/ Purification and properties of chenopodium mosaic virus

Silva, Darcy M.; Meneghini, Mário; Santos, Helena Lopes de Souza
1958-01-01

Resumo em português O vírus do mosaico do quenopódio foi purificado por meio de centrifugações alternadas de baixa e alta velocidade, complementadas pelo tratamento com clorofórmio e álcool amílico. Foram obtidas preparações altamente ativas, que apresentaram as reações características das proteínas e um espectro de absorção da luz ultravioleta igual ao das nucleoproteínas, e que não apresentavam o fenômeno de anisotropia de fluxo. O sedimento dessas preparações purificad (mais) as, obtido na ultracentrífuga, retomado em um pequeno volume de solução de sulfato de amônio 0,2 saturada e guardado a 4°C, produz um grande número de microcristais. As partículas que compõem as preparações examinadas ao microscópio são de aspecto e dimensões bastante uniformes; são "esféricas" e de cerca de 30 milimicros de diâmetro. O material purificado se assemelha ao vírus do mosaico "southern bean", quanto ao aspecto dos cristais, mas os testes de hospedeiros e sorológicos indicaram tratar-se de dois vírus perfeitamente distintos. Resumo em inglês The Chenopodium mosaic virus was purified by means of alternated low and high speed centrifugations combined with chloroform N-amyl alcohol treatment. Such preparations have a high activity, give positive tests for protein and its ultra-violet absorption spectrum is that of a nucleoprotein solution. They do not show the phenomenon of anisotropy of flow. When examined in the electron microscope they showed to be constituted of "spherical" particles of uniform size having a (mais) n approximate diameter of 30 mμ.. If a pellet of the purified virus is resuspended in a small volume of 0,2 saturated (NH4)2 SO4 solution and kept at 4°C for several hours, masses of roughly rhombic crystals are formed. As far as the size of particles and the form of crystals are concerned, the Chenopodium mosaic virus resembles the southern bean mosaic virus. They differ, however, in their host range and are not related serologically.

Scientific Electronic Library Online (Portuguese)

17

Extração de ecdisterona em raízes de ginseng brasileiro/ Extraction of ecdysterone from roots of Brazilian ginseng

Flores, Rejane; Nicoloso, Fernando Teixeira; Brondani, Daniela; Maldaner, Joseila; Cezarotto, Verciane; Giacomelli, Sandro Rogério
2009-07-01

Resumo em português Este estudo teve como objetivo otimizar a extração de ecdisterona em raízes de ginseng brasileiro. Primeiramente, para se avaliar a eficiência do solvente extrator, amostras de raízes dois acessos (BRA e JB-UFSM) de P. glomerata foram extraídas em Soxhlet com metanol e clorofórmio, separadamente, durante 4 horas. No segundo ensaio, com o intuito de se escolher o método extrator, a extração foi conduzida em Soxhlet e em ultrassom, utilizando metanol como solvente (mais) . Em P. tuberosa, as amostras foram extraídas com metanol, e a extração foi conduzida em Soxhlet e em banho ultrasônico. O conteúdo de ecdisterona foi determinado em Cromatógrafo Líquido de Alta Eficiência (CLAE). Em ambas as espécies, um maior conteúdo de ecdisterona foi detectado nas amostras extraídas com metanol e em Soxhlet. A metodologia proposta mostrou-se eficaz para a quantificação da ecdisterona a partir das raízes de P. glomerata e P. tuberosa, podendo ser aplicada no controle de qualidade de drogas vegetais e/ou fitoterápicos. Resumo em inglês This study aimed at optimizing the extraction method from ecdysterone of Brazilian ginseng. Root samples of two accessions (BRA and JB-UFSM) of P. glomerata were extracted in a Soxhlet with methanol or chloroform for 4h. In the second trial, the extration was conduced in a Soxhlet or ultrasonic using metanol as a solvent. In P. tuberosa, the roots samples were extracted with methanol in a Soxhlet or in ultrasonic. The ecdysterone content was determinated using high effici (mais) ency liquid chromatography methods. In both studied species, the highest ecdisterone content was detected from samples extracted in a Soxhlet and using methanol as a solvent. This extration method has been successfully applied for determination of ecdysterone content from roots of Brazilian ginseng, and could be useful for the quality control of drugs and pharmaceutical formulations.

Scientific Electronic Library Online (Portuguese)

18

Cor, betacaroteno e colesterol em gema de ovos obtidos de poedeiras que receberam diferentes dietas/ Color, beta-caroten and cholesterol in yolks of eggs by different diets of laying hens

Biscaro, Luciana Marino e; Canniatti-Brazaca, Solange Guidolin
2006-12-01

Resumo em português O ovo é um alimento considerado nutricionalmente completo, e contém quantidade significativa de nutrientes. Para os consumidores, a qualidade deste alimento está relacionada com o prazo de validade do produto e com as características sensoriais, como cor da gema e da casca. Poucos estudos foram efetuados no Brasil sobre a utilização de agentes pigmentantes e seus efeitos sobre a coloração das gemas e proporção e qualidade química dos componentes do ovo. Com bas (mais) e nisso, objetivou-se com este trabalho relacionar diferentes dietas com cor, quantidade de betacaroteno e teor colesterol das gemas dos ovos. Foram coletados ovos de poedeiras que receberam 4 diferentes tipos de ração. A cor foi medida em colorímetro Minolta, o beta-caroteno separado em coluna e medido em espectrofotômetro e o colesterol extraído com clorofórmio e quantificado por método colorimétrico. Os resultados mostraram que não há relação entre a cor e aumento do teor de betacaroteno das gemas dos ovos, mas a alimentação alterou a cor da gema. O teor de colesterol foi diferente (p Resumo em inglês Egg is a nutritional complete food, and content significant quantity of nutrients. For the consumers, the food quality is related with validity date of product and with sensorial characteristics, like yolk color and hull. Few studies were done in Brazil about utilization of colorfull agents and theirs effects in yolk color and chemical quality of egg compounds. The objective of this research was related different feeds with the color, beta-carotene and cholesterol amount (mais) of egg yolk. Eggs were caught of laying hens that received 4 feed types. The color measure was done by Minolta colorimeter, beta-carotene separated by column and spectrophotometer and cholesterol separated with chloroform and measured by colorimetric method. The results showed that there is not a relation between the color an increase of beta-carotene amount in the yolks, but feed altered the yolk color. Cholesterol amount was different (p

Scientific Electronic Library Online (Portuguese)

19

Estudo da produção de beta-galactosidase por fermentação de soro de queijo com Kluyveromyces marxianus/ Synthesis of beta-galactosidase by fermentation of cheese whey by Kluyveromyces marxianus

Santiago, Patrícia A.; Marquez, Líbia D. S.; Cardoso, Vicelma L.; Ribeiro, Eloízio J.
2004-12-01

Resumo em português A hidrólise enzimática da lactose por beta-galactosidase desempenha importante papel no processamento de produtos lácteos, como na obtenção de leite com baixo teor de lactose para consumo por indivíduos intolerantes à mesma e na prevenção da cristalização em produtos de laticínio. Neste trabalho, a enzima beta-galactosidase foi produzida pelo cultivo do microrganismo Kluyveromyces marxianus, em meio de cultura à base de soro de queijo em diferentes concentra� (mais) �ões iniciais de lactose e extrato de levedura, de acordo com um planejamento fatorial. As fermentações foram conduzidas em incubador rotativo a 150rpm, a 30°C e pH inicial 5,5. A concentração celular inicial foi de 10(7) células/mL. Para a extração da enzima beta-galactosidase, foi realizada autólise das células utilizando como solvente o clorofórmio em tampão fosfato. No meio de cultura enriquecido com (NH4)2SO4, KH2PO4 e MgSO4, nas concentrações iniciais de lactose e de extrato de levedura iguais a 50g/L e 12g/L, respectivamente, obteve-se uma atividade de 28,0UGl/mL e uma concentração celular máxima de 5,3g/L. Resumo em inglês The enzymatic hydrolysis of lactose by beta-galactosidase plays an important role in the processing of milky products such as the production of lactose-hydrolyzed milk for consumption by intolerant person to lactose and the prevention of the crystallization in dairy products. In this work, the influences of nutrient concentrations in the culture medium based on cheese whey were studied with the objective of producing beta-galactosidase from Kluyveromyces marxianus. The fe (mais) rmentations were carried out in a shaker at 30°C and initial pH 5.5 under agitation, starting with an initial cellular concentration of 10(7) cells/mL, varying the initial concentrations of lactose and yeast extract. For extraction of the enzyme of the cells it was used autolysis with chloroform in potassium phosphate buffer. In the medium with a initial lactose concentration of 50g/L, supplemented with salts, yeast extract 12g/L, the enzymatic activity and cellular concentration were 28 UGl/mL and 5.3g/L respectively.

Scientific Electronic Library Online (Portuguese)

20

Efeito de extratos de própolis verde sobre bactérias patogênicas isoladas do leite de vacas com mastite/ Effect of green propolis extracts on patogenic bacteria isolated from milk of cows with mastitis

PINTO, Marcelo Souza; FARIA, José Eurico de; MESSAGE, Dejair; CASSINI, Sérvio Túlio Alves; PEREIRA, Carmen Silva; GIOSO, Marilú Martins
2001-01-01

Resumo em português A sensibilidade, in vitro, de amostras de Staphylococcus aureus, Staphylococcus sp. coagulase negativos, Streptococcus agalactiae e bactérias do grupo dos coliformes, isoladas do leite de vacas com mastite, a diferentes extratos de própolis, na concentração de 100 mg/ml, foi avaliada pela técnica do antibiograma em discos de papel de filtro com sobrecamada de meio de cultura. Os resultados mostraram que o extrato etanólico de própolis comercial, os extratos etanól (mais) ico e, em menor proporção, o metanólico inibiram o crescimento das amostras de bactérias Gram-positivas, Staphylococcus aureus, Staphylococcus sp. coagulase negativos e Streptococcus agalactiae. Os extratos obtidos através da água, do acetato de etila e do clorofórmio não inibiram nenhuma amostra bacteriana, assim como os veículos etanol e metanol puros utilizados como controle. A bactéria Gram-negativa testada, do tipo coliforme, não apresentou sensibilidade a nenhum dos extratos. Verificaram-se diferenças significativas (p Resumo em inglês In vitro, the sensitivity to different propolis extracts, at a concentration of 100 mg/ml, of Staphylococcus aureus, Staphylococcus sp. coagulase negative, Streptococcus agalactiae and bacteria of the coliform group, isolated from the milk of cows with mastitis, was evaluated using the technique of an agar disk diffusion with a medium doublelayer. The results showed that the commercial propolis, the ethanolic extract, and, in a minor proportion, the methanolic extract inh (mais) ibited the growth of the Gram positive bacteria, Staphylococcus aureus, Staphylococcus sp. coagulase negative and Streptococcus agalactiae. The extracts obtained through water, etila acetate and chloroform did not inhibit any bacterial strains, nor did the pure ethanol and methanol vehicles that were utilized as controls. The Gram negative bacterium tested, from the coliform group, did not show sensitivity to any extract. Bacterial strains of the same species collected from different sources presented significant differences in sensitivity to the extracts (p

Scientific Electronic Library Online (Portuguese)

21

Novos polimorfismos no gene da obesidade em raças divergentes de suínos/ Polymorphisms in the leptin gene in divergent swine breeds

Soares, M.A.M.; Guimarães, S.E.F.; Euclydes, R.F.; Lopes, P.S.; Peixoto, J.O.; Guimarães, M.F.M.; Wenceslau, A.A.; Pires, A.V.; Benevenuto Júnior, A.A.
2006-06-01

Resumo em português Investigou-se a existência de polimorfismo no gene da leptina (gene da obesidade) entre varrões da raça nativa Piau (porco tipo banha) e matrizes mestiças de raças comerciais (Landrace/Large White e Landrace/Large White com Pietrain), selecionadas para peso e precocidade. Oito pares de primers foram desenhados a partir da seqüência disponível no GenBank (U66254), usada, neste trabalho, como seqüência de referência. Amostras de DNA foram extraídas de células s (mais) angüíneas brancas utilizando-se solução de fenol:clorofórmio, após tratamento com proteinase K. Os fragmentos gerados por amplificação da reação em cadeia da polimerase foram purificados e seqüenciados em seqüenciador automático. As seqüências de nucleotídeos, obtidas a partir do DNA das raças comerciais de suíno, apresentaram maior similaridade com a seqüência de referência, e as seqüências geradas a partir do DNA dos animais nativos divergiram de ambas em algumas posições. Dos 28 polimorfismos encontrados, oito foram observados em apenas uma das três seqüências geradas a partir do DNA das raças nativas. Doze estavam presentes em duas seqüências, e os oito polimorfismos restantes foram encontrados nos três animais nativos. Resumo em inglês Leptin gene (obese gene) polymorphism was investigated in Piau boars (a fat, native breed) and sows from commercial strains (Landrace/Large White and Landrace/Large White by Pietrain) chosen for rapid growth and early sexual maturity. Eight pairs of primers designed using the sequence available from GenBank (access nº U66254) were identified as the reference sequence in this project. DNA samples were extracted from white blood cells using phenol:chloroform solution, afte (mais) r treatment with proteinase K. Fragments generated by amplification of the Polymerase Chain Reaction were purified and sequenced in an automatic sequencer. Nucleotide sequences obtained from DNA of commercial swine breeds were similar to the reference sequence; whereas sequences generated from native breed DNA diverged from the reference sequence and from domestic breed DNA. Of the 28 polymorphisms found, eight were observed in only one of the three sequences generated from DNA of native breeds. Twelve polymorphisms were present in two sequences and the eight remaining polymorphisms were found in all three categories of DNA.

Scientific Electronic Library Online (Portuguese)

22

Atividade antimicrobiana de Struthanthus vulgaris (erva-de-passarinho)/ Antimicrobial activity of Struthantus vulgaris (erva-de-passarinho)

Vieira, O.M.C.; Santos, M.H.; Silva, G.A.; Siqueira, A.M.
2005-06-01

Resumo em português As plantas do gênero Struthanthus são conhecidas como ervas-de-passarinho e parasitam pomares no Brasil, principalmente os de laranjeiras e goiabeiras. Na medicina popular são usadas nas afecções das vias respiratórias. O extrato hidroetanólico a 70% de folhas frescas de Struthanthus vulgaris apresentou atividade antimicrobiana contra amostras bacterianas Gram positiva e Gram negativa. Este extrato não apresentou, nas condições testadas, atividade contra fungos. (mais) As amostras bacterianas mais sensíveis ao extrato foram Bacillus cereus (ATCC 11778), Micrococcus luteus (ATCC 9341), Staphylococcus aureus (ATCC 6538), S. epidermidis (ATCC 12228) e P. aeruginosa (ATCC 27853), usando o método de difusão em agar. As frações obtidas, pela partição líquido-líquido do extrato hidroetanólico a 70%, com solventes de polaridades crescentes (clorofórmio, acetato de etila, n-butanol e água), apresentaram diferentes atividades inibitórias. A fração que apresentou a maior atividade contra bactéria Gram positiva (B. cereus) e Gram negativa (P. aeruginosa) foi aquela obtida com n-butanol. Nessa fração foram detectados flavonóides, taninos condensados (proantocianidinas) e saponinas. Resumo em inglês Struthantus vulgaris (mistletoe) is one of the most common hemiparasite species in Brazil. It occurs as a parasite of orchards, mainly in orange and guava trees. Some authors mention Struthantus use in traditional medicine for respiratory diseases treatment. Fresh leaves concentrated hydroalcoholic extract showed antimicrobial activity against Gram positive and Gram negative bacterial samples. In tested conditions, these extracts did not show activity against fungi. The m (mais) ore susceptible bacterial samples to fresh leaves hydroalcoholic extract were Bacillus cereus (ATCC 11778), Micrococcus luteus (ATCC 9341), Staphylococcus aureus (ATCC 6538), S. epidermidis (ATCC 12228) and Pseudomonas aeruginosa (ATCC 27853). The method used for assessment of antimicrobial activity was agar diffusion. Fractions obtained from fresh leaves concentrated alcoholic extracts with increasing polarity solvents (chloroform, ethyl acetate, n-butanol and water) showed different inhibitory activities. n-Butanol fraction showed greater activity against Gram positive bacteria (B. cereus) and Gram negative bacteria (P. aeruginosa). In this fraction, flavonoids, condensed tannins (proanthocyanidins) and saponins, were found.

Scientific Electronic Library Online (Portuguese)

23

Extração de DNA de materiais de arquivo e fontes escassas para utilização em reação de polimerização em cadeia (PCR)/ Methods of DNA extraction from archived materials and rare sources for utilization in polymer chain reaction

Barea, Jaqueline A.; Pardini, Maria Inês M. C.; Gushiken, Tsieko
2004-12-01

Resumo em português Este trabalho visou a comparação de cinco métodos diferentes de extração de DNA de materiais de arquivo (tecidos incluídos em parafina, esfregaços de sangue periférico - corados e não corados com Leishman, lâminas com mielogramas, gotas de sangue em Guthrie Card) e de fontes escassas (células bucais, um e três bulbos capilares e 2 mL de urina), para que fossem avaliadas a facilidade de aplicação e a facilidade de amplificação deste DNA pela técnica da rea (mais) ção de polimerização em cadeia (PCR). Os métodos incluíram digestão por proteinase K, seguida ou não por purificação com fenol/clorofórmio; Chelex 100® (BioRad); Insta Gene® (BioRad) e fervura em água estéril. O DNA obtido foi testado para amplificação de três fragmentos gênicos: Brain-derived neutrophic factor (764 pb), Factor V Leiden (220 pb) e Abelson (106 pb). De acordo com o comprimento do fragmento gênico estudado, da fonte potencial de DNA e do método de extração utilizado, os resultados caracterizaram o melhor caminho para padronização de procedimentos técnicos a serem incluídos no manual de Procedimentos Operacionais Padrão do Laboratório de Biologia Molecular do Hemocentro - HC - Unesp - Botucatu. Resumo em inglês The present work aimed at comparing five different methods of DNA extraction of samples from archived materials (paraffin-embedded tissues, peripheral blood smears - stained or not with Leishman, aspired bone marrow smears and Guthrie card bloodspots) and from rare sources (oral cells, one and three capillary bulbs, 2 mL of urine), to evaluate the ease of application and the possibility of amplification of this DNA by the polymerization chain reaction (PCR) technique. The (mais) methods included proteinase K digestion - followed or not by phenol/chloroform purification, Chelex 100® (BioRad), InstaGene® (BioRad) and boiling in the sterile water. The DNA obtained was tested for amplification of three genic fragments: the brain-derived neutrophic factor gene (764 bp), the Factor V Leiden gene (220 bp) and the Abelson gene (106 bp). According to the gene fragment length studied, the DNA potential source and the extraction method used, the results characterized the best way to standardize technical procedures to be included in the Standard Operational Procedure Manual of the Molecular Biology Laboratory of the Blood Center in the Medicine School of Unesp, Botucatu, Brazil.

Scientific Electronic Library Online (Portuguese)

24

Estudo fitoquímico e alelopático do extrato de caule de sucupira-branca (Pterodon emarginatus)/ Phytochemistry and allelophatic study of Pterodon emarginatus stem extract

Hernández-Terrones, M.G.; Morais, S.A.L.; Ferreira, S.; Santos, D.Q.; Nascimento, E.A.; Chang, R.
2007-12-01

Resumo em português A alelopatia é um dos fenômenos pouco estudados no Cerrado. Trata-se de uma ocorrência natural, resultante da liberação de substâncias capazes de estimular ou inibir o desenvolvimento de outras plantas. Objetivou-se neste trabalho avaliar a ação alelopática de extratos da sucupira-branca (Pterodon emarginatus) sobre a germinação e o desenvolvimento da raiz e parte aérea do capim-colonião (Panicum maximum). Bioensaios de germinação realizados em placas de Pe (mais) tri comprovaram que o extrato metanólico do tronco dessa planta, a 150 ppm, inibiu 83% do desenvolvimento da raiz, 75% da parte aérea e 30% da germinação de sementes de capim-colonião. Em casa de vegetação, os resultados de inibição foram de 83% para a parte aérea, 80% para a raiz e 63% para a germinação, mas somente na concentração de 400 ppm. Frações do extrato metanólico bruto obtidas por cromatografia de coluna cromatográfica não reproduziram os resultados de inibição obtidos inicialmente. A fração mais ativa (diclorometano/clorofórmio) foi analisada por CG/EM. Ela é constituída fundamentalmente por substâncias alifáticas de cadeia longa: fitol (13,5%), ácido oléico (12,8%), linoleiladato de metila (10,9%) e ácido palmítico (6,9%). Foram detectados, também, os compostos 1,2,4-trimetil e isopropilbenzenos (12,2%) e as cetonas isoméricas isopropenilmetilcetona e 3-penten-2-ona (7,3%). Três compostos desconhecidos também se destacaram: um de baixa massa molar (98 Da, 13,5%) e dois de massa molar elevada (13,6%). Resumo em inglês Allelopathy is one of the natural phenomena little studied in the cerrado. It is the result of the release of substances capable of stimulating or inhibiting the growth of other plants. The objective of this work was to evaluate the allelophatic action of the white sucupira (Pterodon emarginatus) stem extract on the germination and development of colonião grass (Panicum maximum) under germination, root and aerial part development of colonião grass (Panicum maximum) root (mais) and aerial part. Germination assays carried out in Petri dishes confirmed that the methanolic (200 ppm) extract inhibited the growth of hypocotyl (75%), root (83%), and germination (30%) of colonião grass. The greenhouse results obtained were: hypocotyl 83%, root 80% and germination 63%, but at a concentration of 400 ppm. Methanolic extract fractions did not reproduce the results cited above. The most active fraction (dichloromethane/chloroform) was analyzed by GC/MS. It contains mainly long-chain aliphatic compounds such as phytol (13.5%), oleic acid (12.8%), methyl linolelaidate (10.9%) and palmitic acid (6.9%); 1,2,4-trimethyl- and isopropenylbenzene (12.2%); two isomeric ketones (isopropenyl methyl and 3-penten-2-one) (7.3%) were also detected. Three unknown compounds were also important: one with a low molecular weight (98 Da, 13.5%) and two of high molecular weight (13.6%).

Scientific Electronic Library Online (Portuguese)

25

Triagem da atividade antibacteriana in vitro do látex e extratos de Croton urucurana Baillon/ In vitro screening of antibacterial activity of the latex and extracts from Croton urucurana Baillon

Oliveira, Iris S.; Lima, Joaquim C. S.; Silva, Regilane M.; Martins, Domingos T. O.
2008-12-01

Resumo em português Avaliou-se a atividade antibacteriana dos látex e extratos de diferentes polaridades e farmacógenos de Croton urucurana em ensaios antimicrobianos. Os farmacógenos foram coletados em Barão de Melgaço-MT. Os extratos foram obtidos por maceração a frio em hexano, diclorometano, acetato de etila, etanol e clorofórmio, rotaevaporado e seco em estufa. No ensaio de difusão em disco, os látex mostraram potente ação contra todas as bactérias, com exceção da E. coli (mais) , não diferindo quanto à potência e espectro antibacterianos. Extratos em hexano, diclorometano e etanol das folhas mostraram atividade contra S. pyogenes, K. pneumoniae, P. aeruginosa, S. typhimurium, S. aureus e S. epidermidis nas maiores doses. Extratos da entrecasca foram ativos contra S. aureus, S. epidermidis, P. aeruginosa, E. faecalis, S. pyogenes, E. coli, K. pneumoniae e S. typhimurium. Os látex apresentaram espectro de ação e potência maiores que os extratos obtidos da entrecasca e folhas. Dos extratos obtidos da entrecasca, o clorofórmico foi o mais potente, seguido pelo etanólico, indicando a presença de diferentes princípios ativos. Na microdiluição em caldo, os látex e extratos foram ativos, porém com maior potência para os primeiros. Os resultados evidenciam atividade antibacteriana para C. urucurana, em diferentes partes da planta e por diferentes metabólitos secundários. Resumo em inglês We evaluated the antibacterial activity of the latex and extracts from different polarities and pharmacogens of Croton urucurana using antimicrobial assays. The pharmacogens were collected in Barão de Melgaço-MT. The extracts were obtained by cold maceration in hexane, dichloromethane, ethyl acetate, ethanol and chloroform. They were concentrated in rotatory evaporator and dried in stove. In the disk diffusion assay, the latex showed a potent action against all bacteria (mais) l strains, excepting E. coli, not differing in the potency and antibacterial spectrum. The hexane, dichloromethane and ethanol extracts of leaves showed activity against S. pyogenes, K. pneumoniae, P. aeruginosa, S. typhimurium, S. aureus and S. epidermidis in the major doses. Extracts obtained of stem bark were actives against S. aureus, S. epidermidis, P. aeruginosa, E. faecalis, S. pyogenes, E. coli, K. pneumoniae and S. typhimurium. The latex showed higher potency and broad-spectrum of action than extracts from stem bark and leaves. Among the stem bark extracts, the chloroform was the most potent one, followed by the ethanol extract. This result suggests the presence of different active principles. In the broth-microdilution, the latex and all extracts showed activity, even though, the latex presented more potency. Our results indicate that C. urucurana presents antibacterial activity, in different parts of the plant and by different secondary metabolites.

Scientific Electronic Library Online (Portuguese)

26

Padronização da metodologia do RT-PCR utilizado para identificação do mRNA da alfa-amilase em sementes de milho/ RT-PCR patterning for alpha-amylase messenger RNA identification in germinating maize seeds

Dantas, Bárbara França; Aragão, Carlos Alberto; Araújo-Junior, João Pessoa; Rodrigues, João Domingos; Cavariani, Cláudio; Nakagawa, João
2002-01-01

Resumo em português Durante a germinação das sementes, os carboidratos de reserva são degradados pela atividade de a-amilase. A identificação de mRNA é uma ferramenta fundamental para a definição da cinética de síntese de alfa-amilase. Objetivou-se padronizar a metodologia do RT-PCR para identificar o mRNA do gene de a-amilase em sementes de milho. Após três dias de germinação das cultivares Saracura-BRS 4154 e CATI-AL34, extraiu-se o RNA total pelo método do tiocianato de gua (mais) nidina-fenol-clorofórmio, com algumas modificações. A partir do RNA total extraído foi obtido cDNA com utilização de "random primers". A amplificação por PCR de uma porção do gene da alfa-amilase foi realizada com os "primers": "sense" - CGACATCGACCACCTCAAC; "antisense" - TTGACCAGCTCCTGCCTGTC; gelatina; DMSO e 1,25 unidades de Taq DNA polimerase por reação e completados com água tratada com DEPC. Os ciclos para a amplificação foram 94ºC durante 4 minutos, seguidos por 34 ciclos de 94ºC durante 1 minuto, 42ºC durante 1 minuto e 72ºC durante 1,5 minutos e, finalmente, 72ºC por 5 minutos. O produto do RT-PCR apresentou uma banda de 249 pares de base (pb) bem definida, para as duas cultivares estudadas, não ocorrendo bandas inespecíficas. A técnica do RT-PCR mostrou ser uma metodologia eficiente para a identificação da expressão de alfa-amilase durante a germinação das sementes e pode ser usado para estudo qualitativo e quantitativo da cinética de síntese dessa enzima em experimentos de germinação. Resumo em inglês During germination the seed reserve carbohydrates are degraded by alpha-amylase activity. The identification of mRNA is a very important tool for definition of alpha-amylase synthesis kinetics. This study aimed to adapt a PT-PCR methodology for a-identification of amylase mRNA in germinating maize seeds. After three days germination of Saracura BRS4154 and CATI AL34 maize cultivars, the total RNA was isolated by the guanidinium thiocyanate-phenol-chloroform extraction met (mais) hod, with some modifications. The cDNA was obtained from the total RNA, using random primers. The alpha-amylase gene PCR amplification was carried out with cDNA, primers (sense - CGACATCGACCACCTCAAC; antisense - TTGACCAGCTCCTGCCTGTC); gelatina; DMSO and 1,25 units of Taq DNA polimerase per reaction and complete with DEPC water. The amplification cycles were 94ºC/4 minutes, 34 cycles of 94ºC /1 minute, 42ºC/1 minute and 72ºC/1,5 minutes, and finally 72ºC/5 minutes. The RT-PCR product visualization in agarose gel eletcrophoresis indicated that this method presented well defined bands of 249 bp for the both the cultivars, without unspecific bands. The RT-PCR is an eficient method for alpha-amylase expression studies during germination and can be used as a tool for quantitative and qualitative research about alpha-amylase sinthesis kinetics.

Scientific Electronic Library Online (Portuguese)

27

Impacto do co-monômero hidroxivalerato na cinética de degradação térmica dos poli(3-hidroxialcanoatos)/ Impact of co-monomer hydroxyvalerate on thermal degradation kinetics of P3(HB-x% HV) copolymers

Souza, D.; Castillo, T.E.; Rodríguez, R.J.S.
2009-01-01

Resumo em português O objetivo deste trabalho foi avaliar o impacto que o conteúdo do co-monômero 3-hidroxivalerato exerce na cinética de degradação térmica de copolímeros P3(HB-x%HV). Filmes dos copolímeros, com diferentes conteúdos de co-monômero 3-hidroxivalerato, foram obtidos pela evaporação controlada de solvente, a partir de suas soluções em clorofórmio (1%m/m). Para o estudo termogramétrico (TGA), foram utilizados 10±0,3 mg de cada amostra, panelas de platina e (mais) atmosfera de He (100mL/min). O estudo cinético foi realizado em condições isotérmicas e não isotérmicas. Para as duas condições de análise, foi observado que os copoliésteres estudados apresentaram uma etapa de degradação definida em um curto intervalo de tempo. A análise da cinética do processo de degradação térmica, realizado segundo os métodos isoconversionais de Friedman e Ozawa-Wall-Flynn, indica que a energia de ativação envolvida no processo de degradação térmica é dependente da fração de conversão de massa. Tal dependência pode estar relacionada à ocorrência de clivagem de ligações covalentes com diferentes energias de ligação. Outro fator que pode contribuir para este comportamento é a diferença estrutural provocada pelos co-monômeros 3HB e 3HV. Os resultados obtidos indicam a necessidade de um controle na distribuição das unidades de 3HV, com vista a uma maior estabilidade térmica dos copolímeros. O aumento da estabilidade e, assim, da processabilidade destes copolímeros a partir do fundido, amplia as possibilidades de utilização destes poliésteres ambientalmente corretos. Resumo em inglês The aim of this work was to evaluate the impact that the content of the co-3-hydroxyvalerate monomer has on thermal degradation kinetics of P3(HB-x%HV) copolymers. Films of the copolymers with different contents of 3-hydroxyvalerate were obtained by controlled evaporation of solvent from chloroform solution (1% m/m). Thermogravimetry study was carried out in helium atmosphere, platinum pans and sample mass about 10 ± 0.3 mg. The thermal degradation kinetic study wa (mais) s made on isothermal conditions and non-isothermal conditions. For the two conditions of analysis, it was observed that the copolyester studied presented a defined stage of degradation in a short time interval. The analysis of thermal degradation kinetics carried out by the isoconversional methods of Friedman and Ozawa-Flynn-Wall showed that the activation energy for the process of thermal degradation is dependent on the fraction of mass conversion. Such dependence may be related to the occurrence of cleavage of covalent bonds with different bonding energies. Other characteristic could be the structural differences caused by co-monomers 3HB and 3HV. The results obtained indicate the need to control the distribution of 3HV units to improve the thermal stability of the polyesters. Improving the thermal stability, and thus the processability of these copolymers from melt, increases the possibilities of using these environmentally friendly polyesters.

Scientific Electronic Library Online (Portuguese)

28

RESÍDUOS DE FENITROTION EM FRUTOS E FOLHAS DE TOMATEIRO (Lycopersicon esculentum Mill) ESTAQUEADO

PIZANO, M.A.; DE BAPTISTA, G.C.
1998-05-01

Resumo em português Estudou-se o comportamento dos resíduos de fenitrotion em frutos e folhas de tomateiro estaqueado, através de cromatografia gasosa. O experimento de campo foi instalado quando as plantas tinham 90 dias após o transplante das mudas, e constou de quatro tratamentos: (1) uma aplicação de fenitrotion em dosagem simples, de 100 g i.a./100 litros de água, (2) uma aplicação em dosagem dobrada, de 200 g i.a./100 litros de água, (3) quatro aplicações espaçadas de sete (mais) dias, na dosagem simples e (4) testemunha. As amostras de fruto e folha foram colhidas um dia antes da aplicação (-1) e aos zero , 1, 2, 3, 5, 7 e 14 dias após. Basicamente, a metododogia para análises dos resíduos dos frutos e das folhas constou da extração com acetona e partição em clorofórmio; limpeza dos extratos em coluna de florisil (no caso de folhas) e eluição procedida com benzeno. As determinações quantitativas foram feitas por cromatografia gasosa, usando-se detector fotométrico de chama com filtro específico para fósforo. Os resíduos nas folhas foram sempre maiores do que os dos frutos (cerca de 80 vezes, em média) durante todo o período de colheita das amostras. Os valores de meia-vida de degradação de fenitrotion em frutos e folhas foram: 1,6 a 1,9 e 0,7 a 0,8 dia, respectivamente, mostrando uma diminuição mais rápida dos resíduos em folhas. As meias-vidas de persistência foram semelhantes para os dois substratos: 4,2 a 7,3 e 5,6 a 6,2 dias, respectivamente. Os resíduos encontrados nos frutos logo após a aplicação, foram menores que a tolerância oficial (0,5 ppm) para os tratamentos que utilizaram 100 g i.a./100 litros em uma ou quatro pulverizações espaçadas de sete dias. Uma única aplicação de 200 g i.a./100 litros resultou em resíduos menores que 0,5 ppm, desde um dia após a aplicação. Resumo em inglês The behavior of fenitrothion in fruits and leaves of staked tomato plants was studied with gas chromatography. The field experiment begun when plants had 90 days post-transplant and consisted of four treatments: (1) a single application of fenitrothion at 100 g a.i./100 liters of water; (2) a double dose application of 200 g a.i./100 liters of water; (3) four applications at 7 day intervals at the lower dosage; and (4) control. Fruit and leaf samples were collected one da (mais) y before application (-1) and at zero, 1, 2, 3, 5, 7 and 14 days post-application. Residual analysis of fruit and leave consisted of acetone extraction and partition with chloroform; extract cleaning in a florisil column and benzene elution (for leaves). Quantitative estimates were obtained in a gas chromatograph, using flame photometric detector, with a special phosphorus filter. Leaf residues were always higher than those in fruits (approximately 80 times), during all sampling intervals. Half-live degradation values of fenitrothion in fruits and leaves were: 1.6 to 1.9 and 0.7 to 0.8 days, respectively. Half-lives of persistence were similiar for both substrates: 4.2 to 7.3 and 5.6 to 6.2 days, respectively. Fruit residues immediately after application were below the official tolerance level (0.5 ppm) for treatments of 100 g a.i./100 liters in one or four weekly applications. A single application of 200 g a.i./100 liters resulted in residual levels lower than 0.5 ppm after one or more days post-application.

Scientific Electronic Library Online (Portuguese)

29

Estudo das folhas e caule de Hyptidendron canum(Pohl ex Benth.) Harley, Lamiaceae

Fiuza, Tatiana S.; Rezende, Maria H.; Sabóia-Morais, Simone M. T.; Tresvenzol, Leonice M. F.; Ferreira, Heleno D.; Paula, José R.
2010-05-01

Resumo em português Hyptidendron canum (Pohl ex Benth.) Harley, Lamiaceae, é utilizada popularmente como antimalárica, antiinflamatória, antiulcerativa, anti-hepatotóxica e anticancerígena. O objetivo deste trabalho foi realizar o estudo morfo-anatômico das folhas e caules e identificar as principais classes de metabólitos secundários presentes nas folhas de H. canum, dados ainda não descritos na literatura. As folhas e caules jovens coletados em Goiânia (GO) foram seccionados à m (mais) ão livre e preparados para análise microscópica. Foram realizadas reações de identificação de metabólitos secundários do material dessecado e pulverizado. Preparou-se o extrato etanólico bruto, que posteriormente foi fracionado por partição líquido-líquido com hexano, clorofórmio e acetato de etila. As frações foram submetidas à análise cromatográfica em camada delgada (CCD). As lâminas foliares apresentam epiderme adaxial constituída por células poligonais com parede reta. Na epiderme abaxial observam-se células com parede reta a ondulada e estômatos diacíticos e anisocíticos. Tricomas tectores e glandulares estão presente em ambas as faces da lâmina foliar. O pecíolo apresenta aspecto canaletado, epiderme adaxial e abaxial unisseriada. O caule, em secção transversal possui contorno em geral quadrangular, com presença de tricomas tectores e glandulares. As reações e a CCD das folhas evidenciaram a presença de flavonóides, saponinas, terpenos e lignanas. Este trabalho contribuiu para um maior conhecimento da morfo-anatomia e das classes químicas presentes em H. canum. Resumo em inglês Hyptidendron canum(Pohl ex Benth.) Harley, Lamiaceae, is popularly used as an antimalarial, anti-inflammatory, antiulcerative, antihepatotoxic and anticancer agent. The goal of this research was to perform the morphoanatomy study of H. canumleaves and stem and identify the main classes of secondary metabolites present in the of H. canumleaves. Such data have not been reported in the literature. The young leaves and stems were collected in Goiânia (GO), hand sectioned and (mais) prepared for microscope analysis. Reactions were performed for the identification of secondary metabolites of the dried and pulverized material. The crude ethanol extract was prepared and then fractioned by liquid-liquid partition with hexane, chloroform and ethyl acetate. Thin layer chromatography (TLC) analysis was performed on the fractions. The leaf blades presented adaxial epidermis constituted of polygonal cells with straight walls. On the abaxial epidermis cells with straight to wavy walls and diacytic and anisocytic stomates were noted. Non-glandular and glandular trichomes are present on both faces of the leaf blade. The petiole is grooved, and it presents single layered adaxial and abaxial epidermis. The cross section of the stem presents a generally quadrangular contour with the presence of non-glandular and glandular trichomes. The leaf reactions and TLC evidenced the presence of flavonoids, saponins, terpenes and lignanes. This works helps to increase knowledge of the morphoanatomy and the chemical classes present in H. canum.

Scientific Electronic Library Online (Portuguese)

30

Composição centesimal e colesterol da carne de jacaré-do-pantanal (Caiman yacare Daudin 1802) oriundo de zoocriadouro e habitat natural/ Proximate composition and cholesterol of the alligator-swampland meat (Caiman yacare Daudin 1802) originating from captivity and wild life

Vicente Neto, João; Bressan, Maria Cristina; Faria, Peter Bitencourt; Vieira, Josye Oliveira e; Santana, Merce Teodora Aguil; Kloster, Marcos
2006-08-01

Resumo em português Foram utilizados 12 animais, sendo 06 (peso médio de 5,93 kg) oriundos de zoocriadouro (Z) autorizado pelo Instituto Brasileiro do Meio Ambiente e dos Recursos Naturais Renováveis (IBAMA), Estado do Mato Grosso, Brasil, e 06 (peso médio de 6,78 kg) oriundos do habitat natural (H), provenientes do município de Cáceres MT. As amostras foram coletadas dos músculos ílio-ischio-caudalis e occipito-cervicalis medialis, cauda e dorso, respectivamente. Nesses músculos for (mais) am determinados: umidade, extrato etéreo, proteína e cinzas. A extração de lipídeos foi conduzida com uso de clorofórmio/metanol (2:1). O colesterol foi determinado por colorimetria em espectrofotômetro. O corte da cauda dos jacarés Z apresentou médias de 74,50; 24,20; 0,83; 0,91% e o corte dorso 76,20; 23,68; 0,49 e 0,99% para umidade, proteína, extrato etéreo e cinzas, respectivamente. Nos animais H, as médias foram 72,29; 21,83; 5,43 e 1,09% na cauda e 76,70; 21,93; 0,54 e 1,25% no dorso (umidade, proteína, extrato etéreo e cinzas, respectivamente). As médias de colesterol nos animais Z foram de 48,82 e de 53,73 mg/100 g na cauda e dorso, respectivamente. Nos animais H, as médias foram de 37,05 mg/100 g na cauda e 40,61 mg/100 g no dorso. Assim, os jacarés de Z apresentaram carne mais magra, do que os jacarés H. E quando comparados os cortes, a cauda apresentou mais proteína e extrato etéreo, enquanto o dorso apresentou mais umidade, cinzas e colesterol. Resumo em inglês They were used 12 animals, 06 (with average weight of 5.93 kg) originating from captivity, authorized by Instituto Brasileiro do Meio Ambiente e dos Recursos Naturais Renováveis (IBAMA), Mato Grosso state, Brazil, and 06 (with average weight of 6.78 kg) originating from natural habitat, every animals coming from municipal district of Cáceres, Mato Grosso state, Brazil. The samples were collected of the muscles ílio-ischio-caudalis and occipito-cervicalis medialis, tail (mais) and back, respectively. In those muscles they were determined: moisture, ethereal extract, protein and ashes. The lipids extraction was driven with chloroform/methanol (2:1). The cholesterol was determined by colorimeter in spectrophotometer. The cut tail of the alligators originating from captivity presented averages of 74.50; 24.20; 0.83; 0.91% and the cut back 76.20; 23.68; 0.49 and 0.99% for moisture, protein, ethereal extract and ashes, respectively. In the animals originating from natural habitat, the averages were 72.29; 21.83; 5.43 and 1.09% in the tail and 76.70; 21.93; 0.54 and 1.25% in the back (moisture, protein, ethereal extract and ashes, respectively). The cholesterol averages in the animals originating from captivity were of 48.82 and of 53.73 mg/100 g-1 in the tail and back, respectively. In the animals originating from natural habitat the averages were of 37.05 mg/100 g-1 in the tail and 40.61 mg/100 g in the back. Thus, the alligators originating from captivity presented thinner meat, than the alligators originating from natural habitat. When comparing the cuts, the tail presented higher protein and ethereal extract, while the neck presented higher moisture, ashes and cholesterol.

Scientific Electronic Library Online (Portuguese)

31

Análise da contaminação por Salmonella em ovos do tipo colonial através da reação em cadeia da polimerase/ Analysis of Salmonella in free-range eggs through polymerase chain reaction

Flôres, Maristela Lovato; Nascimento, Vladimir Pinheiro do; Kader, Ivonyr Irene Tróglio Abdel; Cardoso, Martha; Santos, Luciana Ruschel dos; Lopes, Rui Fernando Félix; Wald, Vera Beatriz; Barbosa, Taylor Marcelo Corrêa
2003-06-01

Resumo em português A identificação de poedeiras comerciais infectadas por salmonelas tem sido um dos pontos fortes da profilaxia e conseqüente redução de surtos de salmonelose em humanos associados ao consumo de ovos, sendo que a análise dos ovos pode ser mais um dos pontos de detecção da infecção, que, muitas vezes, cursa sem sinais clínicos. A Reação em Cadeia da Polimerase (PCR) parece ser uma estratégia útil para detecção de Salmonella, pois vários autores têm utiliza (mais) do a PCR para verificar a presença da bactéria em carnes, fezes, tecidos, sangue, leite e ovos, com diferentes metodologias de manipulação das amostras. Foram analisados 360 ovos, procedentes de dez propriedades rurais, produtoras de ovos tipo colonial, no distrito de Camobi, em Santa Maria - RS. Os ovos foram divididos em grupos de seis, totalizando sessenta amostras. O exame bacteriológico foi realizado conforme metodologia preconizada pelas normas técnicas e a metodologia de extração de DNA pelo fenol-clorofórmio. A PCR foi realizada para a amplificação de um fragmento de DNA de 284 pb. A análise dos resultados não demonstrou diferença significativa entre a PCR e o bacteriológico. Todas as amostras positivas ao bacteriológico foram positivas na PCR, sendo que essa última detectou duas amostras a mais, devido a sua alta sensibilidade e especificidade, especialmente quando é sabido que os ovos apresentam uma população microbiana mista que, muitas vezes, impede o isolamento adequado das salmonelas no bacteriológico pela competição com a flora bacteriana normalmente presente. Resumo em inglês The identification of salmonella infection in commercial poultry has been one of the strong points of prophylaxis and consequent reduction of salmonellosis outbreaks in humans associated to consumption of eggs, considering that the analysis of the eggs can be one more point of detection of infection, which for many times appear without clinical signs. The Polymerase Chain Reaction (PCR) seems to be a useful strategy for Salmonella detection, because various authors have u (mais) sed the PCR to verify the presence of bacteria in meat, feces, tissues, blood, milk and eggs, with different methods of manipulation of samples. We have analyzed 360 eggs from ten farms, producers of free range-eggs, in the district of Camobi, in Santa Maria - RS - Brasil. The eggs were grouped in pools of six, totaling sixty samples. The bacteriological exam was done in compliance with the method preconized by the technical rules and the method for extraction of DNA was by phenol-chloroform. The PCR was performed for the amplification of a 284 bp DNA fragment. The analysis of the results do not show significant difference between the PCR and the bacteriological exam. All positive samples in the bacteriological exam were also positive by PCR, however the PCR detected more two samples due to higher sensitivity and specificity, specially when it is known that the eggs show a mixed population of germs that many times difficult isolation of salmonellas in the bacteriological exam because of the competition with normal flora bacteria.

Scientific Electronic Library Online (Portuguese)

32

Influência da luminosidade e da camada de cera epicuticular de superfícies de folhas de soja na infecção de Phakopsora pachyrhizi/ Influence of light and leaf epicuticular wax layer on Phakopsora pachyrhizi infection in soybean

Furtado, Gleiber Q; Alves, Silvio A.M; Godoy, Cláudia V; Salatino, Maria L.F; Massola Júnior, Nelson S
2009-10-01

Resumo em português A ferrugem asiática, causada pelo fungo Phakopsora pachyrhizi, apresenta-se como um dos mais graves problemas fitossanitários da cultura da soja no Brasil, principalmente por não existirem, até o presente momento, cultivares com níveis de resistência satisfatórios. Objetivou-se estudar a influência da luminosidade e da camada de cera das superfícies foliares na infecção de folhas de soja por P. pachyrhizi. A superfície adaxial ou abaxial de folíolos do primei (mais) ro trifólio de plantas da cultivar BRS 154, estádio fenológico V2, foi inoculada com suspensão de 10(5) urediniósporos/mL-1. As plantas foram mantidas por 24 horas em câmara úmida e temperatura de 23ºC, sob luz ou escuro, em delineamento fatorial. Posteriormente, permaneceram 14 dias em fotoperíodo de 12 horas, sendo em seguida avaliada a densidade de lesões e a severidade da doença. Em um segundo experimento, avaliou-se in vitro , no escuro e na luz, a porcentagem de germinação de urediniósporos e de formação de apressórios. As camadas de cera adaxial e abaxial dos folíolos foram analisadas quantitativamente (extrações com clorofórmio) e estruturalmente (microscopia eletrônica de varredura). A densidade de lesões e a severidade foram maiores quando se inoculou a superfície adaxial de plantas incubadas no escuro, sem interação significativa entre os fatores. A germinação dos esporos no escuro (40,7%) foi significativamente superior à germinação na luz (28,5%). O mesmo ocorreu para a formação de apressórios, no escuro (24,7%) e na luz (12,8%). A quantidade e a estrutura das ceras epicuticulares não apresentaram diferenças entre as duas superfícies. Resumo em inglês Asian rust, caused by the fungus Phakopsora pachyrhizi, is one of the most serious phytosanitary problems of soybean in Brazil, especially because no cultivars with satisfactory resistance levels as yet exist. The objective of this study was to evaluate the influence of luminosity and of leaf epicuticular wax on the infection of soybean by P. pachyrhizi. The adaxial and abaxial leaflet surfaces of the first trifoliate leaf from cultivar BRS 154, phenological stage V2, wer (mais) e inoculated with a suspension of 10(5) uredospores/mL. The plants were kept for 24 hours in a humid chamber at temperature of 23ºC, in light or dark conditions, using a factorial design. Subsequently, the plants were maintained for 14 days under a 12-hour photoperiod. The disease severity and density were evaluated. For in vitro experiments, in light or dark conditions, the evaluation was done in terms of uredospore germination and appressorium formation. The wax content of adaxial and abaxial leaflets was analyzed quantitatively using chloroform extraction and ultrastructurally using scanning electron microscope. Higher density and severity were observed when the adaxial surface was inoculated, with later incubation of the plants in the dark, with no significant interaction between these factors. Spore germination in the dark (40.7%) was statistically different from spore germination in the light (28.5%). The same effect was observed with appressorium formation, in the dark (24.7%) and in the light (12.8%). The quantity and the ultrastructural aspects of epicuticular wax content did not show differences between the adaxial and abaxial surfaces; nor did they show any effect on infection by Phakopsora pachyrhizi in the soybean cultivar studied.

Scientific Electronic Library Online (Portuguese)

33

Transcrição reversa na determinação da expressão do mRNA para a enzima conversora de angiotensina testicular em animais tratados com zinco/ Assessment of the reverse transcriptase polymerase chain reaction technique in the determination of the mRNA expression for the testicular angiotensin-converting enzyme in zinc treated rats

Henriques, Gilberto Simeone; Silva, Adriana Gisele Hertzog da; Hirata, Rosário Dominguez Crespo; Hirata, Mario Hiroiuki; Cozzolino, Sílvia Maria Franciscato
2005-12-01

Resumo em português OBJETIVO: O objetivo deste trabalho foi otimizar as condições reacionais capazes de ocasionar variabilidade e de introduzir erros sistemáticos na reação em cadeia pela polimerase aplicada à análise da expressão gênica da isoforma testicular da enzima conversora de angiotensina. MÉTODOS: Avaliaram-se a concentração de cDNA, a concentração dos iniciadores, a temperatura de hibridização e o número de ciclos de desnaturação, hibridização e extensão. Para (mais) tanto, extraiu-se o RNA total por meio da reação com fenol-clorofórmio e isotiocianato de guanidina de amostras de testículos de ratos Wistar alimentados com uma ração contendo zinco. Em seguida, gerou-se o cDNA por transcrição reversa. Utilizando-se iniciadores específicos, amplificaram-se o gene de interesse (isoforma testicular da enzima conversora de angiotensina) e o gene controle Gliceraldeído-3-Fosfato-Desidrogenase. As amostras foram então aplicadas em gel de agarose e submetidas à eletroforese, coradas em brometo de etídio e visualizadas sob luz ultravioleta. RESULTADOS: Demonstrou-se que a melhor condição reacional para a reação em cadeia pela polimerase da isoforma testicular da enzima conversora de angiotensina e do Gliceraldeído-3-Fosfato-Desidrogenase foi: (1) concentração inicial de cDNA de 2µg, (2) concentração de iniciadores de 200nM, (3) temperatura de hibridização entre 57,5ºC e 60,1ºC e (4) 33 ciclos. CONCLUSÃO: Com essa otimização pôde-se minimizar as interferências sobre a técnica, contribuindo-se para a obtenção de dados comparativos a respeito da expressão gênica da enzima conversora de angiotensina testicular. Resumo em inglês OBJETIVE: The aim of the present work was to optimize the reaction conditions capable of generating variability and introducing systematic errors in the chain reaction of the polymerase used to analyze the gene expression for the testicular isoform of the angiotensin-converting enzyme. METHODS:The cDNA concentration, primer concentration, hybridization temperature and number of denaturation, hybridization and extension cycles were evaluated. For this purpose, samples of t (mais) estis from Wistar rats fed a zinc containing diet were used to extract total RNA using the phenol-chloroform-isothiocyanate reaction. Stable cDNA was then generated by the reverse transcription reaction. Using specific primers, the gene of interest (testicular isoform of the angiotensin-converting enzyme) and the housekeeping gene for the expression of Glyceraldehyde-3-Phosphate Dehydrogenase were amplified. The samples were then submitted to gel eletrophoresis in agarose gel, stained with ethide bromide and visualized in a UV chamber. RESULTS: The results showed that the best reaction conditions for the chain reaction by the testicular isoform polymerase of the angiotensin-converting enzyme and for Glyceraldehyde-3-Phosphate Dehydrogenase were: (1) initial cDNA concentration of 2 µg, (2) primer concentration of 200nM, (3) hybridization temperature between 57.5ºC and 60.1ºC and (4) 33 cycles. CONCLUSION: It was concluded that this optimization minimized interference of the technique, contributing to the production of true, comparative data for the testicular angiotensin- converting enzyme gene expression.

Scientific Electronic Library Online (Portuguese)

34

Controle pelo glyphosate e caracterização geral da superfície foliar de Commelina benghalensis, Ipomoea hederifolia, Richardia brasiliensis e Galinsoga parviflora/ Control with glyphosate and general leaf surface characterization of Commelina benghalensis, Ipomoea hederifolia, Richardia brasiliensis and Galinsoga parviflora

Monquero, P.A.; Cury, J.C.; Chistoffoleti, P.J.
2005-03-01

Resumo em português Este trabalho teve como objetivos caracterizar a superfície foliar das plantas daninhas Commelina benghalensis, Ipomoea hederifolia, Richardia brasiliensis e Galinsoga parviflora e determinar a porcentagem de controle dessas plantas pelo herbicida glyphosate. As ceras epicuticulares das plantas daninhas foram extraídas com clorofórmio e quantificadas (µg cm²). Partes centrais das folhas foram submetidas à microscopia eletrônica de varredura, para caracterizaç (mais) ão da superfície foliar. A fim de avaliar a suscetibilidade dessas plantas daninhas ao glyphosate, foi instalado experimento inteiramente casualizado composto por sete tratamentos (0, 360, 540, 720, 900, 1.440 e 2.160 g e.a. ha-1 de glyphosate) e quatro repetições em casa de vegetação, na Universidade de São Paulo, ESALQ/USP, PiracicabaSP, Brasil. A eficácia do herbicida foi avaliada aos 14, 21 e 28 dias após aplicação dos tratamentos. As plantas daninhas não diferiram muito com relação à quantidade de ceras epicuticulares. Em G. parviflora a superfície foliar apresenta tricomas tectores multicelulares e estômatos anomocíticos. I. hederifolia apresenta superfície foliar rugosa, tricomas tectores unicelulares e glandulares e estômatos paracíticos. Em C. benghalensis, a superfície foliar apresenta dois tipos de tricomas tectores, estômatos tetracíticos e ceras dispersas na superfície adaxial. A planta daninha R. brasiliensis apresenta estômatos paracíticos e tricomas unicelulares. As plantas daninhas C. benghalensis e R. brasiliensis são mais tolerantes ao glyphosate do que as outras espécies estudadas. Com base nos dados obtidos, pode-se concluir que as plantas daninhas apresentam características foliares diferentes, sendo C. benghalensis e R. brasiliensis as mais tolerantes ao glyphosate, mesmo quando se utiliza a maior dose herbicida. Resumo em inglês This work aimed to characterize the foliar surface of the weeds Commelina benghalensis, Ipomoea hederifolia, Richardia brasiliensis and Galinsoga parviflora and the percentage of control by the herbicide glyphosate. The epicuticular waxes were extracted by chloroform and quantified (µg cm-2). Central parts of the leaves of these weeds were submitted to electron microscopy to characterize the foliar surface. To evaluate the susceptibility of these weeds to glyphosate (mais) an experiment was arranged in a randomized complete design, 7 treatments (0, 360, 540, 720, 900, 1440 and 2160 g a.e. ha-1 of glyphosate) and four replications under greenhouse conditions at the University of São Paulo - ESALQ/USP - Piracicaba-SP, Brazil. Herbicide efficacy was assessed at 14, 21 and 28 days after treatment. In G. parviflora the foliar surface presents multicellular trichomes, and anomocytic stomata. In I. Hederifolia, the foliar surface is rough, with multicellular and glandular trichomes and paracytic stomata. In C. benghalensis, the foliar surface presents two types of trichomes and a lower number of tetracytic stomata. The presence of disperse wax was observed on the adaxial surface. R. brasiliensis presents great number of unicellular trichomes and paracytic stomata. The weeds C. benghalensis and R. brasiliensis were more tolerant to glyphosate than the other species studied. Based on the data obtained, it can be concluded that the weeds showed differences in the foliar characteristics, with C. benghalensis and R. brasiliensis being tolerant to the highest dose of glyphosate.

Scientific Electronic Library Online (Portuguese)

35

Triterpenos e alcalóide tipo cantinona dos galhos de Simaba polyphylla (Cavalcante) W.W. Thomas (Simaroubaceae)/ Triterpenes and a canthinone alkaloid from the stems of Simaba polyphylla (Cavalcante) W.W. Thomas (Simaroubaceae)

Saraiva, Rita de Cássia Guedes; Pinto, Angelo C.; Nunomura, Sergio Massayoshi; Pohlit, Adrian Martin
2006-04-01

Resumo em inglês Simaba polyphylla is a small tree found in the Amazon region, known by the common names "marupazinho" or "serve para tudo". It is used in traditional medicine for the treatment of fevers. This work describes the phytochemical study of the hexane extract and chloroform fraction obtained by partitioning the methanol extract of stems, which led to isolation and identification of the triterpenes niloticin, dyhidroniloticin, taraxerone and of the cytotoxic alkaloid 9-methoxy-canthin-6-one. These compounds are described for the first time in S. polyphylla.

Scientific Electronic Library Online (Portuguese)

36

Triterpenos da resina de Protium heptaphyllum March (B0urseraceae): caracterização em misturas binárias/ Triterpenes from the resin of Protium heptaphyllum March (Burseraceae): characterization in binary mixtures

Maia, Robinson Magalhães; Barbosa, Pedro Rocha; Cruz, Frederico Guaré; Roque, Nídia Franca; Fascio, Miguel
2000-10-01

Resumo em inglês Eight triterpenes, maniladiol, breine, ursa-9(11):12-dien-3beta-ol, oleana-9(11):12-dien-3beta-ol, 3alpha-hydroxy-tirucalla-8,24-dien-21-oic acid, 3alpha-hydroxy-tirucalla-7,24-dien-21-oic, alpha and beta amyrines were isolated as binary mixtures obtained from the chloroform extract of the oil-resin of Protium heptaphyllum March. The identification of the compounds was based mainly in 13C NMR data and mass spectra. The diene and the tetracyclic acid triterpenes were not reported before in the literature as constituents of the studied resin.

Scientific Electronic Library Online (Portuguese)

37

Tratamento de água subterrânea contaminada com compostos organoclorados usando ferro elementar e o reagente de Fenton/ Treatment of groundwater contaminated with chlorinated compounds using elemental iron and Fenton's reagent

Arruda, Tatiana Langbeck de; Jardim, Wilson F.
2007-01-01

Resumo em inglês The remediation of groundwater containing organochlorine compounds was evaluated using a reductive system with zero-valent iron, and the reductive process coupled with Fenton's reagent. The concentration of the individual target compounds reached up to 400 mg L-1 in the sample. Marked reductions in the chlorinated compounds were observed in the reductive process. The degradation followed pseudo-first-order kinetics in terms of the contaminant and was dependent on the samp (mais) le contact time with the solid reducing agent. An oxidative test with Fenton's reagent, followed by the reductive assay, showed that tetrachloroethylene was further reduced up to three times the initial concentration. The destruction of chloroform, however, demands an additional treatment.

Scientific Electronic Library Online (Portuguese)

38

Sobre o mechanismo de formação das hyperglobulias de origem toxica

Cruz, W. O.
1936-01-01

Resumo em português Tendo verificado uma acção hyperglobulinogena do tetrachloreto de carbono, thynol e essencia de chenopodio, quando administrados ao homem como vermifugos, procuramos averiguar qual o mechanismo destas hyperglobulias. Para isso tomamos duas substancias tambem hyperglobulinogenas (chloroformio e chloretona) e escolhemos o cão para animal de experiencia. Observamos que, com anesthesias prolongadas pelo chloroformio e pela chloretona, tal como naquellas substancias applica (mais) das ao homem como vermicidas, apparecem intensas hyperglobulias no sangue circulante. constatamos ainda uma rapidez extraordinaria no augmento de hematias (1 a 2 horas após o inicio da anesthesia), e a existencia de um nivel maximo para este augmento, que não é ultrapassado apezar de novas anesthesias prolongadas. Entretanto, em cães esplenectomisados este effeito das anesthesias prolongadas desapparece inteiramente em sua acção sobre o sangue. em todos os casos, tanto em homem como em cães (esplenectomisados ou não), ao par da hyperglobulia, notou-se sempre estados hypotensivos as vezes bastantes accentuados. Estes resultados nos levaram a concluir que no mechanismo das hyperglobulias de origem toxica, o factor principal está em uma contracção esplenica, (provocada provavelmente pela hypotensão observada), contracção está, que resulta em um lançamento na corrente circulatoria do sangue concentrado (lama esplenica) que normalmente se acha em reserva no baço. Resumo em inglês Having verified a hyperglobulinogenous action of carbon tetrachloride, thymol and chenopodium essence when administered to man as vermifuges, we endeavoured to verify which is the mechanism of such hyperglobuliae. For this purpose, we chose two substances (chloroform and chloretorn), also hyperglobulinogenous, and dogs were used as experimental animals. We observed that, after prolonged anesthesiae by chloroform and chloretone, in the circulating blood there appear intens (mais) ive hyperglobuliae, just as occurs in man after the use of the aforesaid substances when employed as vermicides. We verified, moreover, an extraordinarily quickness in the increase of red blood cells (1 to 2 hours after the beginning of the anesthesia), and the existence of a maximum rate for such increase which is not surpassed despite new prolonged anesthesiae. Yet, from their action on blood. In all cases, both of man and dogs (the latter whether splenectomized or not), along with hyperglobulia we always observed hypotensive states which, at times, were rather pronounced. We are led to infer from these results that, in the mechanism of hyperglobuliae through toxic origin, the principal factor lies in a spleen contraction, probably induced by the hypotension observed, a contraction, which brings forth a launching into the circulatory torrent of concentrated blood (splenic slime), normally kept in reserve by the spleen.

Scientific Electronic Library Online (Portuguese)

39

Saponinas triterpênicas de Tocoyena brasiliensis Mart. (Rubiaceae)/ Triterpenoid saponins from Tocoyena brasiliensis Mart. (Rubiaceae)

Hamerski, Lidilhone; Carbonezi, Carlos Alberto; Cavalheiro, Alberto José; Bolzani, Vanderlan da Silva; Young, Maria Cláudia Marx
2005-08-01

Resumo em inglês The present communication reports the isolation and identification of four triterpenoid saponins from the chloroform extract of the leaves of Tocoyena brasiliensis: 3-O-beta-D-quinovopyranosyl quinovic acid, 3-O-beta-D-quinovopyranosyl cincholic acid, 3-O-beta-D-glucopyranosyl quinovic acid and the 28-O-beta-D-glucopyranosyl ester derivative of quinovic acid as binary mixtures, respectively. From the ethanol extract a flavonoid identified as ramnazin-3-O-rutinoside was ob (mais) tained. The structures of these compounds were assigned by data analysis of 1D and 2D NMR spectrometry and comparison with data recorded in the literature for these compounds.

Scientific Electronic Library Online (Portuguese)

40

Proposição métodos analíticos para tinturas-mãe e misturas: avaliação estatística/ Proposition of analytical methods for tinctures and mixtures: statistical valuation

Biancalana, Gilberto Rubens; Nascimento, Marcos Cortez
1989-01-01

Resumo em português Com o objetiuo de propor métodos analíticos de tinturas-mãe e misturas utilizadas em preparações homeopáticas estudou-se a sua aplicabilidade a uma mistura em partes iguais de 10 (dez) tinturas-mãe, das seguintes plantas: Archangelica offcinalis L.; Drymis granatensis L.; Mentha piperita L.; Peumus boldus Molina; Cassia medica; Cassia augustifolia Bahl; Maytenus ilicifolia Martius; Artemisia absin­thium L. e Coriandrum sativum L. todas de usp terapêutico comprova (mais) do(6,7,8,9,10), e preparadas a partir de padões, em períodos distintos, durante cinco anos consecutivos. Os valores estatísticos calculados permitiram estabelecer os seguintes limites para os métodos propostos: a) Resíduo alcalino clorofórmico: entre 0,203 e 0,387%; b) Resíduo de ácido clorídrico adicionado ao extrato clorofórmico:entre 0,016 e 0,072%; c) Determinacdo de pll: entre 6,39 e 6,80; d) Determinação da acidez total: entre 0,048 a 0,112%. Resumo em inglês To propose a new analytical methodology applied to homeopathy, and its consequent statistical valuation, the autors studied its applicability to a mixture of ten tinctures in equal parts of the following plants: Archangelica officinalis L; Matricaria chamomile L; Drymis granatensis L; Mentha piperita L; Peumus boldus Molina; Cassia medica; Cassia augustifolia Vahl; Maytenus ilicifolia Martius; Artemisa absinthium L. and Coriandrum sativum L. all of them with therapeutic a (mais) ctivity proved (6,7,8,9,10) and prepared from standards, in distinct periods, during five consecutive years. The calculated statistical values permitted to establish the following limits form proposed methods: a) chloroform alkaline residue: form 0.203 to 0.387%; b) hydrochloride acid residue added to the chloroform extract: from 0.016 to 0.072%; c) pH: 6.39 to 6.80; d) Total acidity: from 0.048 to 0.112%.

Scientific Electronic Library Online (Portuguese)

41

Produção de metabólitos bioativos pelo líquen Cladonia substellata Vainio/ Production of bioactive metabolites from lichen Cladonia substellata Vainio

Ribeiro, Sheyla Mara; Pereira, Eugênia Cristina; Gusmão, Norma Buarque; Falcão, Emerson Peter; Silva, Nicácio Henrique da
2006-06-01

Resumo em português Objetivando comparar a atividade antimicrobiana de extratos brutos de Cladonia substellata, proveniente dos Estados de Minas Gerais e Pará, Brasil, utilizou-se o método de difusão em meio sólido. Extratos etéreo, clorofórmico e acetônico foram testados contra patógenos humanos e fitopatógenos na concentração de 1,0 mg/mL, 0,1 mg/mL e 0,01 mg/mL. Os extratos foram submetidos à cromatografia em camada delgada, e o princípio ativo atribuído através de biocroma (mais) tografia. Os resultados demonstraram que as sete espécies de fungos testadas foram resistentes aos extratos de C. substellata procedente do Pará, porém, quatro destas espécies mostraram-se sensíveis aos extratos etéreo e clorofórmico da amostra de Minas Gerais. Todos os extratos foram ativos contra as mesmas espécies de bactérias, entretanto os extratos da amostra procedente de Minas Gerais demonstraram melhor atividade. Das bactérias inibidas, Staphylococcus aureus mostrou-se a menos sensível, ao contrário das fitopatógenas que apresentaram grande sensibilidade. Os testes cromatográficos revelaram a presença de ácido úsnico em todos os extratos, porém, em maior quantidade na amostra do Pará. O biocromatograma revelou este ácido como princípio ativo da espécie, além de sua ação sinérgica com o ácido norestíctico, na amostra de Minas Gerais, justificando sua maior atividade. Resumo em inglês This work purposed to make a comparison between antimicrobial activity of crude extracts from Cladonia substellata, collected at Minas Gerais and Pará States, Brazil, using the diffusion solid medium methods. Ether, chloroform, and acetone extracts, at 1 mg/mL, 0.1 mg/mL, and 0.01 mg/mL, were tested against human pathogens and phytopathogens. The extracts were submitted to thin layer chromatography and their active principles attributed by biochromatography. The results (mais) demonstrated that the seven fungi species tested were no sensitive to extracts from C. substellata from Pará. On the other hand, four of these microorganisms were inhibited by C. substellata extracts from Minas Gerais. All extracts were active to the same bacteria species, but samples from Minas Gerais showed the highest activity. Among the inhibited bacteria Staphylococcus aureus was the less sensitive, with an opposite behavior to phytopathogen ones, that showed the highest sensitivity. Chromatographic assays revealed the presence of usnic acid in all extracts, thus in the most content in Pará samples. The biochromatograms reveals usnic acid as active principle of the species, and a synergic action to norstictic acid found in Minas Gerais samples, what justify its highest activity.

Scientific Electronic Library Online (Portuguese)

42

Potencial fitotóxico de extratos foliares de Aloe arborescens Miller (Asphodelaceae) produzidos em diferentes épocas do ano/ Analysis of the phytotoxic potential of Aloe arborescens Miller leaf extracts (Asphodelaceae) produced at different times of the year

Murakami, Cynthia; Cardoso, Fernando Leite; Mayworm, Marco Aurélio Sivero
2009-03-01

Resumo em português Este trabalho visou analisar o potencial fitotóxico de extratos foliares de Aloe arborescens Miller sobre a germinação e crescimento de plântulas de alface (Lactuca sativa L.). Amostras de folhas foram coletadas nas quatro estações climáticas e maceradas em etanol P.A. por 28 dias. Os extratos produzidos foram fracionados em extratos etanólico e clorofórmico e tiveram as concentrações reduzidas a 1%. Os bioensaios de ação fitotóxica foram desenvolvidos em tr (mais) iplicata, sob luz constante e temperatura ambiente. Apenas o extrato clorofórmico de primavera mostrou forte atividade fitotóxica sobre a germinação das sementes de alface (16,67%). Todos os extratos reduziram significativamente a primeira contagem, índice de velocidade germinação (IVG) e o crescimento do eixo hipocótiloradicular (EHR) das plântulas de alface, porém os extratos clorofórmicos mostraram maior atividade fitotóxica, gerando alterações morfológicas mais intensas sobre as plântulas de alface e apresentaram maiores teores de compostos fenólicos. Apesar de todos os extratos clorofórmicos inibirem fortemente o crescimento das folhas cotiledonares das plântulas de alface, não se observaram neste último efeito, variações em função dos períodos de coleta. Resumo em inglês This study aimed to analyze seasonal variation in the phytotoxic potential of Aloe arborescens Miller leaf extract on lettuce (Lactuca sativa L.) germination and growth. Leaf samples were collected in the four seasons and were macerated in ethanol P.A. for 28 days. The extracts were fractionated into solutions made with ethanol and chloroform, and concentrations were reduced to 1%. Phytotoxic activity bioassays were carried out in triplicate, under constant light and ambi (mais) ent temperature. Only the spring chloroform extract showed strong phytotoxic activity on lettuce seed germination (16.67%). All extracts significantly reduced the first count, germination velocity index (GVI) and growth of the hipocotyl-root axis (HRA) of the lettuce plants. However, the chloroform extracts showed greater phytotoxic activity, producing more intense morphology alterations on lettuce plants and showed greater content of phenolic compounds.

Scientific Electronic Library Online (Portuguese)

43

Perfil fitoquímico e ensaio microbiológico dos extratos da entrecasca de Maytenus rigida Mart. (Celastraceae)/ Phytochemistry and microbiological assay of the bark extracts of Maytenus rigida Mart. (Celastraceae)

Estevam, Charles S.; Cavalcanti, Amaro M.; Cambui, Érica Verena F.; Araújo Neto, Vítor; Leopoldo, Paulo T. G.; Fernandes, Roberta P. M.; Araujo, Brancilene S. de; Porfírio, Zenaldo; Sant'Ana, Antonio Euzébio G.
2009-03-01

Resumo em português Maytenus rigida Mart (Celastraceae), conhecida por "Bom-homem", "Bom-nome", "Cabelo-de-negro", "Casca-grossa" e "Pau-de-colher", é uma arvore de pequeno porte. A entrecasca do caule é empregada popularmente no Nordeste do Brasil no tratamento das dores em geral, infecções e inflamações. O presente trabalho avaliou tanto o perfil fitoquímico de M. rigida por meio de um roteiro analítico, quanto à atividade antibiótica dos extratos pelo método de Kirby-Bauer modi (mais) ficado. Os resultados demonstraram que os extratos etanólico, aquoso, clorofórmico, acetato de etila e hidroalcoólico de M. rigida apresentam atividade antibacteriana contra Escherichia coli, Pseudomonas aeruginosa e Staphylococcus aureus, enquanto que a fração hexânica não exibe qualquer atividade. Catequinas, quinonas, esteróides, triterpenos, saponinas, flavonóides e compostos fenólicos foram detectados na análise fitoquímica. Resumo em inglês Maynetus rigida Mart (Celastraceae), known as "Bom-homem", "Bom-nome", "Cabelo-de-negro", "Casca-grossa" and "Pau-de-colher", is a small tree. The stem bark is used by the population in the northeast of Brazil to treat aches, infections and inflammations in general. The present work evaluated both the phytochemistry of M. rigida Mart by an analytical routine, and the antimicrobial activity of the bark extracts by the Kirby-Bauer modified method. Our results showed the aqu (mais) eous, methanol, chloroform, ethyl acetate and hydroalcoolic extracts of M. rigida Mart has antimicrobial activity against Escherichia coli, Pseudomonas aeruginosa and Staphylococcus aureus, while the hexane extract does not have any activity. Catechins, quinones, steroids, triterpenes, saponins, flavonoids and phenolic compounds were detected by the phytochemical analysis.

Scientific Electronic Library Online (Portuguese)

44

Ocorrência de glicoalcalóides e esverdeamento em tubérculos de batata recém-colhidos e armazenados/ Occurrence of glycoalkaloids and greening in newly harvested and stored potato tubers

Spoladore, Dayse S.; Teixeira, João Paulo F.; Zullo, Marco Antônio T.; Teixeira, Paulo R. M.; Coelho, Sônia M. B. M.; Miranda Filho, Hilário S.
1983-01-01

Resumo em português Foram analisados 36 dos cultivares de batata (Solanum tuberosum L.) existentes no Instituto Agronômico, quanto ao teor de glicoalcalóides totais (TGA) na porção superficial dos tubérculos, e quanto à sua capacidade de esverdeamento, duas características importantes na comercialização do produto. As determinações foram feitas para tubérculos recém-colhidos, armazenados na ausência e na presença de luz, ambos por 25 dias. Os teores de TGA situaram-se na faixa (mais) de 3-24mg/100g de peso fresco. Tanto as condições de armazenamento quanto os cultivares influenciaram o teor de TGA e a capacidade de esverdeamento. Encontrou-se uma correlação linear significativa entre o teor de TGA e a capacidade de esverdeamento, independentemente de tratamentos e cultivares, negativa, porém, para tubérculos recém-colhidos. Os dados obtidos sugerem que ambos os fatores são influenciados por características genéticas peculiares a cada cultivar. Resumo em inglês Thirty-six cultivars of potatoes were studied with respect to the total glycoalkaloids (TGA) content and greening capacity of the tuber. The determinations were made in the superficial portion of both newly harvested and tubers stored in the presence or absence of light during 25 days. The TGA content ranged betwen 3-24mg/100g of fresh weight. Both the storage conditions and the cultivars influenced the TGA content and greening capacity. There was a negative correlation b (mais) etween TGA content and the 440nm absorbance of a chloroform extract for newly harvested tubers. This correlation, however, was positive for the stored tubers. The present data suggest that both the TGA content and the greening capacity of the tubers were influenced by genetic characteristícs of each cultivar.

Scientific Electronic Library Online (Portuguese)

45

Métodos de extração e qualidade da fração lipídica de matérias-primas de origem vegetal e animal/ Extraction methods and quality of the lipid fraction of vegetable and animal samples

Brum, Aelson Aloir Santana; Arruda, Lia Ferraz de; Regitano-d´Arce, Marisa Aparecida Bismara
2009-01-01

Resumo em inglês Methodologies of extraction of lipids from chicken breast and oats flakes were evaluated: Soxhlet, Folch et al., Bligh & Dyer and Hara & Radin. For chicken breast, the methods Soxhlet, Folch et al. and Bligh & Dyer presented the highest yields in total lipids. With oat flakes, the methods Soxhlet and Bligh & Dyer presented higher yields than the Hara & Radin and Folch et al. The Soxhlet method affected the quality of the lipid fraction in both samples. Extracted lipid com (mais) ponents were separated by thin layer chromatography, the chloroform-methanol based was more efficient to extract the neutral and polar lipids.

Scientific Electronic Library Online (Portuguese)

46

Inativação do vírus do mosaico comum do fumo pelo filtrado de culturas de Trichoderma sp

Forster, R.
1950-05-01

Resumo em inglês Trichoderma sp. grown in liquid medium produced a substance which has caused up to 90% reduction in the infection capacity of the tobacco mosaic virus, measured in number of local lesions on Nicotiana glutinosa half leaf inoculations. Under the present experiments the fungus has been grown in liquid medium and the filtrates used in inactivation tests on the virus. From the fact that the liquid filtrate showed inactivation power after only two days of culture it is conclud (mais) ed that the inactivation is of the nature of a secretion of the fungus into the liquid medium. The inactivation proceeded within 2 minutes after mixture of the culture extract with the virus, no better results were obtained if the mixtures allowed to stand for a longer period of time. If cultures were grown in the light in the laboratory the inactivation power decreased after the second day as was found by Weindling (8), for the effect on Rhizoctonia sp. If grown in the dark the inactivator continues to increase in concentrations for at least 22 days. In the dark no spores formation could be observed. Physiological activity associated with spores formation may be the reason for the loss of inactivator in day light grown cultures where spores start to be formed after the second day of growth. Extraction of the inactivator with chloroform was attempted according to Weindling's method. The inactivator could never be completely extracted since the treated filtrate kept showing inactivation on tobacco mosaic virus. This suggests that the inactivator for the virus may be a different from the one found by Weindling against Rhizoctonia sp. By ultracentrifugation at 35,000 r.p.m. no inactivator could be obtained from the filtrate. Using Takahashi's acetone method a whitish precipitate could be obtained which showed an inactivation of tobacco mosaic virus.

Scientific Electronic Library Online (Portuguese)

47

Feoforbídeo (etoxi-purpurina-18) isolado de Gossypium mustelinum (Malvaceae)/ Ethyl ester putpurin-18 from Gossypium mustelinum (Malvaceae)

Silva, Tania Maria Sarmento; Camara, Celso Amorim; Barbosa-Filho, José Maria; Giulietti, Ana Maria
2010-01-01

Resumo em inglês The phaeophorbide ethyl ester named Purpurin-18 and the flavonoids quercetin and kaempferol were obtained by chromatographic procedures from the chloroform fraction of aerial parts of Gossypium mustelinum. The structure of these compound was determined by NMR, IR and mass spectra data analysis. This is the first occurrence of this compound in Angiosperm.

Scientific Electronic Library Online (Portuguese)

48

Expressão gênica de caspases 3 e 8 em timo e baço de ratas recém-desmamadas e imunossuprimidas por glicocorticóide/ Genic expression of caspases 3 and 8 in thymus and spleen of glicocorticoid-immunossupressed weaned rats

Batista, J.J.; Martins, A.S.; Moro, L.; Vasconcelos, A.C.
2005-08-01

Resumo em português Determinou-se a expressão gênica das caspases 3 e 8 mediante transcrição reversa de mRNA total e reação em cadeia da polimerase (RT-PCR) para avaliar a apoptose em timo e baço de ratas imunossuprimidas por glicocorticóides. Utilizou-se dexametasona para indução da apoptose e atrofia linfóide. Quarenta e cinco fêmeas Wistar recém-desmamadas foram separadas em três grupos: as ratas de A (n=18) e B (n=18) foram tratadas com 250 e 500mg de glicocorticóide, via (mais) intramuscular, respectivamente, e as do C (n=9) não foram tratadas. Após 24, 48 e 72 horas, seis animais de cada grupo tratado e três do controle foram anestesiados, pesados e sacrificados. O baço e o timo foram coletados e pesados. Fragmentos dos órgãos foram fixados em formol tamponado a 10% e processados segundo técnica para inclusão em parafina. Os blocos foram seccionados em 5µm, e os cortes corados em hematoxilina e eosina. A análise histopatológica aliada ao peso dos órgãos nas diferentes doses e tempos demonstrou que a dexametasona induziu hipotrofia linfóide, que ocorreu com maior intensidade no tempo de 72 horas em animais do grupo B. Fragmentos de timo e de baço foram imediatamente congelados em nitrogênio líquido para extração de mRNA e DNA. Para a padronização da técnica de RT-PCR, utilizaram-se pool de amostras de mRNA dos animais-controle e pool de mRNA de animais tratados em cada tempo de experimento. A técnica de RT-PCR foi sensível o suficiente para a detecção dos mRNAs que codificam as caspases 3 e 8, e ambas participaram do processo de apoptose induzido por dexametasona. Resumo em inglês Expression of caspases 3 and 8 in spleen and thymus of immunosuppressed rats was analyzed by the reverse transcriptase-polymerase chain reaction (RT-PCR). Forty-five weaned female Wistar rats were divided into three groups: A (n=18) and B (n=18) rats were injected with 250µg and 500µg per rat, respectively; and C (n=9) rats were non-treated control animals. After 24, 48 and 72 hours, six animals from A and B groups and three controls were anaesthetized with chloroform, (mais) weighed and euthanized. Thymus and spleens were collected, weighed and a sample of each organ was fixed by immersion in 10% buffered formaline and embedded in paraffin. Thin sections (5µm) were stained with HE. Thymus and spleen samples were snap frozen in liquid nitrogen and stored at -80ºC for total RNA and DNA extraction. Apoptotic indices were calculated using sections stained with HE. Apoptotic indices and organs weights showed that hypotrophy happened mainly at 72h post treatment with 500µg/rat. RT-PCR was standardized using a pool of control animals and another from treated animals with A and B doses at each time period, respectively. Specific oligonucleotides for caspases 3 and 8 were drawn to obtain fragments of 271bp and 368bp, respectively. The results demonstrated that technique RT-PCR is sensitive enough to detect caspases 3 and 8 mRNAs and that caspase 3 and 8 participate in the apoptotic process induced by dexamethasone in weaned rats.

Scientific Electronic Library Online (Portuguese)

49

Estudo químico e biológico de Tephrosia toxicaria Pers./ Chemical and biological study of the Tephrosia toxicaria Pers.

Vasconcelos, Jackson Nunes e; Lima, Jefferson Queiroz; Lemos, Telma Leda Gomes de; Oliveira, Maria da Conceição Ferreira de; Almeida, Maria Mozarina Beserra; Andrade-Neto, Manoel; Mafezoli, Jair; Arriaga, Angela Martha Campos; Santiago, Gilvandete Maria Pinheiro; Braz-Filho, Raimundo
2009-01-01

Resumo em inglês The ethanol extracts from leaves, stems, pods and roots were assayed against the 3rd instar Aedes aegypti larvae and the highest activity was observed in the roots extracts (LC50 47.86 ppm). This extract was submitted to partition with hexane, chloroform, ethyl acetate and methanol. The respective fractions were bioassayed and the best larvicidal activities were identified in the hexane (LC50 23.99 ppm) and chloroform (LC50 13.80 ppm) fractions. Antioxidant activity (DDPH (mais) method) was observed in the ethanol extract (IC50 276 µg/mL) from roots of T. toxicaria. Fractions from this extract were also tested and the highest antioxidant activity (IC50 89 µg/mL) was found in the methanol fraction. The flavonoids iso-obovatin (1), obovatin (2), 6a,12a-dehydro-β-toxicarol (3), 6a,12a-dehydro-α-toxicarol (4) and α-toxicarol (5) were isolated and bioassayed against A. aegypti. The flavonoid 5 showed the best larvicidal activity (LC50 24.55 ppm). The antioxidant activity of 2 was investigated and showed IC50 3.370 µg/mL. The antioxidant and larvicidal activities of Tephrosia toxicaria are reported for the first time.

Scientific Electronic Library Online (Portuguese)

50

Estudo fitoquímico do decocto das folhas de Maytenus truncata Reissek e avaliação das atividades antinociceptiva, antiedematogênica e antiulcerogênica de extratos do decocto/ Phytochemical study of the decoct from the leaves of Maytenus Truncata Reissek and the evaluation of the antinociceptive, antiedematogenic and antiulcerogenic activities of the decoct extracts

Fonseca, Ana Paula Nascentes de Deus; Silva, Grácia Divina de Fátima; Carvalho, Juliana de Jesus; Salazar, Gloria Del Carmen Meléndez; Duarte, Lucienir Pains; Silva, Renata Pamplona; Jorge, Rodrigo Martinez; Tagliati, Carlos Alberto; Zani, Carlos Leomar; Alves, Tânia Maria de Almeida; Peres, Valdir; Vieira Filho, Sidney Augusto
2007-08-01

Resumo em inglês The present paper describes the phytochemical investigation and biological activities of the chloroform, ethyl acetate and methanol extracts of leaf decocts of M. truncata Reiss (Celastraceae). Our studies afforded two flavonoid glycosides, quercetin-3-O-rhamnopyranosyl-O-glucopyranosyl- O-rhamnopyranosyl-O-galactopyranoside (1) and kampferol-3-O-rhamnopyranosyl-O-glucopyranosyl- O-rhamnopyranosyl-O-galactopyranoside (2) from the methanolic extract and dulcitol (3) from t (mais) he ethyl acetate extract. Ethyl acetate and methanol extracts exhibited considerable antiulcerogenic and analgesic activities. The results of the phytochemical studies suggest that the healing activity of methanol extracts can be related to the presence of glycosyl flavonoids.

Scientific Electronic Library Online (Portuguese)

51

Estudo das propriedades e biodegradabilidade de blendas de poliéster/amido submetidas ao ataque microbiano/ Study of the properties and biodegradability of polyester/starch blends submitted to microbial attack

Vinhas, Glória M.; Almeida, Yêda M. B. de; Lima, Maria Alice Gomes de Andrade; Santos, Lívia Almeida
2007-01-01

Resumo em inglês This work deals with the biodegradation of blends of poly(beta-hydroxybutyrate)/starch and poly(beta-hydroxybutyrate-co-hydroxyvalerate)/starch. The blends were obtained by evaporation of the solvent in the mixture of the polymers in chloroform. Tests were carried out in presence of micro-organisms which acted as biodegradation agents. The blends were consumed as carbon substrate and the production of CO2 was evaluated in the process. In addition, the polyesters' mechanic (mais) al properties were reduced by the incorporation of starch in its structure. (¹H) NMR and infrared spectroscopy detected some characteristic polyester degradation groups in the polyesters' chemical structure, thus confirming the alteration suffered by it.

Scientific Electronic Library Online (Portuguese)

52

Determinação espectrofotométrica do arsênio em cabelo usando o método do dietilditiocarbamato de prata (SDDC) e trietanolamina/CHCl3 como solvente/ As spectrometric determination in hair samples using the silver diethyldithiocarbamate (SDDC) method and triethanolamine/CHCl3 as solvent

PEREIRA, Simone de Fátima Pinheiro; FERREIRA, Sérgio Luis Costa; COSTA, Antonio Celso Spínola; SARAIVA, Augusto César Fonseca; SILVA, Antonia Kelen Frota
2002-01-01

Resumo em português Pelo uso de técnicas mais baratas, como a do SDDC, é possível determinar níveis traços de arsênio em cabelo; entretanto esta técnica apresenta alguns inconvenientes como baixa estabilidade e o odor desagradável da piridina. A piridina foi substituída por trietanolamina/CHCl3 e as características analíticas do complexo foram estudadas. O complexo foi estável por 270 minutos, a faixa de aplicação da lei de Beer foi de 0,0 a 25,0 mig As, a repetibilidade foi de (mais) 0,028 mig As, o limite de detecção foi de 18,6 mig de As/L e a sensibilidade (épsilon)? de 1,12 10(4) L.mol-1.cm-1. O método foi aplicado à amostras de cabelo. A lavagem das amostras foi feita com extran e água desionizada e seca em estufa (40-60ºC). 0,1000 g de amostra foi submetida à 11 métodos de digestão. O melhor método foi o que usou uma solução 1:1 de HNO3 e H2SO4 concentrados em temperatura de 100-110ºC com evaporação até fumos de SO3. O tempo de abertura é um inconveniente neste tipo de digestão. Resumo em inglês The silver diethyldithiocarbamate (SDDC) method, has been employed for the determination of arsenic in different materials. The disagreeable odor of the pyridine, the lower stability and reproducibility of the complex are justifications for many works related to the alternatives of the method. The SDDC/pyridine system was substituted for system using triethanolamine 5% v/v in chloroform with many advantages. The method was used for arsenic determination in hair samples with good recovery. Many kinds of digestions was studied.

Scientific Electronic Library Online (Portuguese)

53

Determinação da massa molar por crioscopia: terc-butanol, um solvente extremamente adequado/ Molar mass determination by cryoscopy: tert-butyl alcohol, an extremely appropriate solvent

Santos, Anderson R. dos; Vidotti, Eliane C.; Silva, Expedito L.; Maionchi, Florângela; Hioka, Noboru
2002-09-01

Resumo em inglês We intend to divulge an easy experiment that permits the determination of molar masses of various compounds by cryoscopy. The major advantage of this is the use of the tert-butyl alcohol as a solvent, which requires simple apparatus and easy procedures. The melting point of this alcohol is around 25 ºC, which makes it easy to freeze and then melt the solutions. This solvent has a high cryoscopic constant and is miscible with both polar and non-polar compounds. The molar (mais) masses of acetone, water, chloroform, dichloro-methane, ethanol, hexane, carbon tetrachloride and toluene were determined. The results were good except for water. Even though there are reliable techniques of molar mass determination nowadays, this method is still frequently taught in undergraduate courses.

Scientific Electronic Library Online (Portuguese)

54

Constituição da alexina e mechanismo da hemolyse especifica/ Constitution of alexin and mechanism of specific haemolysis

Cruz, J. da Costa; Penna, H. de Azevedo
1932-08-01

Resumo em português Os autores observam que após a inactivação de sôro de cobaya a 54° durante 30 minutos permanecem no sôro as fracções thermolabeis em quantidade apreciavel; um tal sôro conservado na temperatura de 6°, por espaço de 18 horas, regenera parte da sua actividade alexica perdida. 2° Confirma-se a existencia de 4 componentes do complemento. 3° O chamado terceiro componente de Ritz e Coca é na verdade constituidos por dois elementos, pelos menos, differentes: um des (mais) tructivel pelo formol e outro destructivel pelo hydrosulphito de sodio. 4° A ammonia, o formol e o hydrosulpito de sodio são capazes de destruir os constituintes thermoresistentes da alexina do sôro inactivado a 56° 30 minutos, ao passo que as emulsões de levedos, de orgãos ou de gelose não o são. 5° As emulsões de levedo addicionadas a uma mistura em partes eguaes de sôro fresco de cobaya e de sôro aquecido a 56°, 30 m., são capazes de retirar não só o terceiro componente contido no sôro fresco da mistura, mas tambem o terceiro componente contido no sôro inactivado pelo calor. 6° Sem excluir a hypothese de uma floculação em que o sôro aquecido exerça o papel de um colloide protector, os autores admittem que a inactivação do complemento pelas emulsões de levedo ou pela gelose seja devida a substancias thermolabeis, do sôro, depois de adsorpção por essas emulsões, de substancias anti-tripticas. 7° Os diversos elementos que constituem a alexina são adsorvidos pelos globulos sensibilizados na seguinte ordem: Globulos-sensibilizadora-Fracção thermo-resistente sensivel á ammonia-Fracção thermolabil Globulina-Fracção thermolabil albumina-Fracção thermoresistente sensivel ao formol-Fracção thermoresistente sensivel ao hydrosulphito de sodio. 8° Na reacção de Bordet-Wassermann fortemente positiva é fixada sobretudo a fracção globulina thermolabil do complemento e não sómente o terceiro componente como seria licito esperar; a fracção thermolabil albumina permanece de regra livre e activa no liquido. 9° Os autores acham que se deve considerar como demonstrada a origem hepatica da alexina. Segundo experiencias procedidas em cães intoxicados pelo chloroformio não só baixa consideravelmente o titulo alexico global do sôro mas tambem os titulos, de todos os constituintes da alexina separadamente, soffrem, com a excepção da fracção thermolabil globulina, uma reducção muito accentuada. Resumo em inglês 1) The writers state that after the inactivation of fresh Guinea pig'serum at 54°C, for 30 minutes, this serum keeps the thermolable fractions in noticeable quantities. Such serum if mantained at 6°C. for 18 hours, reacquires part of the lost alexic activity. 2) The Ritz's, and Coca's 3rd component is formed at least by distinct elements, one sensible to tje action of formaline and the other to the action of sodium hydrosulphite. 4) Ammonia, formaline and sodium hydrosu (mais) lphite are able to destroy the thermostable components of the serum inactivated by heat (56°C., 30 minutes). The emulsions of yeast, organs and gelose are not able to do so. 5) The yeats emulsions added to a mixture o equal parts of G. p. fresh serum and serum inactivated by heat are capable to destroy the 3rd component present not only in the fresh serum as also in the inactivated one. 6) The writers do not exclude the hypothesis of a flocculation in which the inactivated serum exerts the rôle of a protector colloid, but they believe that the inactivation of the complement by yeast emulsions is due to the action of thermolable substances of fresh serum after the adsorption of antitriptic substances by said emulsions. 7) The different components which form the alexin adhere to the sensitized blood cells in the following order: Blood cells-sensitizer-Thermostable fraction sensible to ammonia -Thermolable globulin fraction - Thermolable albumin fraction - Thermostable fraction sensible to formaline and thermostable fraction sensible to sodium hydrosulphite. 8) In the Bordet-Wassermann's reaction, stark positive, is fixated especially the thermolable globulin fraction and not only the 3rd component as it could be supposed. The thermolable albumin fraction remains free and active in the fluid. 9) The writers think that the hepatic origin of the alexin must be accepted. According to experiments on dogs intoxicated by chloroform one observes not only the diminution of the alexic activity but also the decrease of all components of the alexin, with, perhaps, the exception of the thermolable globulin fraction.

Scientific Electronic Library Online (Portuguese)

55

Constituintes químicos, avaliação das atividades citotóxica e antioxidante de Mimosa paraibana Barneby (Mimosaceae)/ Chemical constituents, evaluation of the cytotoxic and antioxidant activities of Mimosa paraibana Barneby (Mimosaceae)

Nunes, Xirley P.; Mesquita, Rafael F.; Silva, Davi A.; Lira, Daysianne P.; Costa, Vicente C. O.; Silva, Marianna V. B.; Xavier, Aline L.; Diniz, Margareth F. F. M.; Agra, Maria de Fátima
2008-12-01

Resumo em português Mimosa paraibana Barneby foi submetida a um estudo fitoquímico para o isolamento de seus constituintes químicos, através de métodos cromatográficos usuais, e posterior identificação estrutural, utilizando-se métodos espectroscópicos de RMN ¹H e 13C uni e bidimensionais, além de comparações com modelos da literatura. Deste estudo pioneiro, foram isolados e identificados cinco constituintes da fase clorofórmica: uma mistura dos esteróides, β-sitosterol e (mais) estigmasterol, a 15¹-hidroxi-feofitina A, a 5,7-dihidroxiflavanona, o 3,4,5-trihidroxibenzoato de etila e o ácido p-cumárico. A atividade antioxidante das fases hexânica, clorofórmica e acetato de etila foi avaliada utilizando o radical estável DPPH (1,1-difenil-2-picril-hidrazil) e os resultados comparados com o padrão ácido ascórbico. A avaliação da citotoxicidade das fases foi realizada empregando-se o ensaio de letalidade contra Artemia salina. Dos extratos avaliados, somente o hexânico mostrou baixa toxicidade. Resumo em inglês The phytochemical study of Mimosa paraibana Barneby led to the isolation of its chemical constituents, through the usual chromatographic methods, and further structural identification, using ¹H and 13C NMR spectroscopic methods based on one and two-dimensional techniques, in addition to comparison with literature data. From this pioneering investigation with M. paraibana, five constituents were isolated and identified from the chloroform extract: a mixture of β-sito (mais) sterol and stigmasterol, 15¹-hydroxy-phaeophytin A, 5,7-dihydroxyflavanone, ethyl 3,4,5-trihydroxybenzoate and p-coumaric acid. The antioxidant activity of the hexane, chloroform and ethyl acetate extracts of M. paraibana were measured using the 1,1-diphenyl-2-picryl-hydrazyl (DPPH) free radical scavenging assay and the results compared with standard ascorbic acid. The toxicity activity of the extracts were performed using the bioassay of Artemia salina.

Scientific Electronic Library Online (Portuguese)

56

Constituintes químicos dos frutos de Copaifera langsdorffii Desf./ Chemical constituents of the fruits of Copaifera langsdorffii Desf.

Lima Neto, José de Sousa; Gramosa, Nilce Viana; Silveira, Edilberto Rocha
2008-01-01

Resumo em inglês Phytochemical investigation of the hexane extract of fruit shells of Copaifera langsdorffii Desf. (Caesalpinioideae) afforded ent-kaur-16-en-19-oic acid, polyalthic acid, nivenolide and the mixture of caryophyllene oxide and ent-kaur-16-en-19-oic acid. The chloroform extract of unripe seeds led to the isolation of coumarin and the GC/MS analysis of the extract allowed the identification of 81.8% of the fatty acid composition after hydrolysis followed by methylation. The m (mais) ain fatty acid identified was oleic acid (33.1%). The isolation of all secondary metabolites was accomplished by modern chromatographic methods and the structure determination was accomplished by spectrometric methods (IR, MS, NMR ¹H and 13C).

Scientific Electronic Library Online (Portuguese)

57

Constituintes químicos de Ipomoea subincana Meisn. (Convolvulaceae)/ Chemical constituents of Ipomoea subincana Meisn. (Convolvulaceae)

Meira, Marilena; David, Jorge M.; David, Juceni P.; Araújo, Sinara V.; Regis, Tatiara L.; Giulietti, Ana Maria; Queiróz, Luciano P. de
2008-01-01

Resumo em inglês The chloroform extract of aerial parts of Ipomoea subincana was submitted to different chromatographic procedures which afforded methyl caffeate, ethyl caffeate, methyl 3,4-dimethoxycinnamate, lupeol, alpha-amyrin, beta-amyrin, 3-beta-O-beta-D-glycopiranosyl-sitosterol, beta-sitosterol, stigmasterol, scopoletin, aromadendrane-4beta,10alpha-diol, n-docosyl-cis-p-coumarate and n-icosyl-trans-p-coumarate, vanilin, cinamic acid and vanillic acid. However, from the ethyl aceta (mais) te extract besides quercetin and 3-O-beta-D-glycopiranosyl-quercetin were isolated methyl 4-O-E-feruloyl-5-O-E-caffeoyl-quinate, methyl 3,5-di-O-E-caffeoyl-quinate and methyl 4-O-E-caffeoyl-quinate. The structures of the compounds were established on the basis of spectral data.

Scientific Electronic Library Online (Portuguese)

58

Constituintes químicos de Hyptidendron canum (Pohl ex Benth.) R. Harley (Lamiaceae)/ Chemical constituents of Hyptidendron canum (Pohl ex Benth.) R. Harley (Lamiaceae)

Lemes, Geralda de Fátima; Ferri, Pedro Henrique; Lopes, Márcia Nasser
2011-01-01

Resumo em inglês Chemical investigation of Hyptidendron canum stems resulted in the isolation of betulinic, ursolic and euscaphic acids. From the leaves were isolated 3β-O-β-galactopiranosilsitosterol, ursolic aldehyde, and mixtures of maslinic acid and 2α-hydroxyursolic acid, α and β-amyrin, uvaol and erythrodiol, sitosterol and stigmasterol, spathulenol and globulol. Hexane and chloroform leave fractions as well as ursolic and betulinic acids showed antifungal activities against the yeast form of Paracoccidioides brasiliensis.

Scientific Electronic Library Online (Portuguese)

59

Composição fenólica, atividade antibacteriana e antioxidante da própolis vermelha brasileira/ Phenolic composition, antibacterial and antioxidant activities of brazilian red propolis

Cabral, Ingridy Simone Ribeiro; Oldoni, Tatiane Luiza Cadorin; Prado, Adna; Bezerra, Rosângela Maria Neves; Alencar, Severino Matias de; Ikegaki, Masaharu; Rosalen, Pedro Luiz
2009-01-01

Resumo em inglês Propolis is a resinous hive product collected by honeybees from various plant sources. It has a complex chemical composition, constituted by various phenolic compounds. Extracts of increasing polarity (n-hexane, chloroform, and ethanol) were obtained from a sample of red propolis from the state of Alagoas. Assays were carried out for determination of contents of phenolics, along with antibacterial and antioxidant activities. The EEP, fractions and sub-fractions showed str (mais) ong biological activities and were related with phenolic the content compounds contents. The sub-fractions were more bioactive than the EEP and fractions, demonstrating that the antioxidant and antibacterial activities are not a result of synergistic effect between the various chemical compounds in propolis.

Scientific Electronic Library Online (Portuguese)

60

Caracterização química do "pitch" em indústria de celulose e papel de Eucalyptus/ Chemical characterization of pitch in Eucalyptus pulp and paper industry

Cruz, Mariluze P.; Barbosa, Luiz C. A.; Maltha, Célia R. A.; Gomide, José L.; Milanez, Augusto F.
2006-06-01

Resumo em inglês The chemical analysis of the acetone, chloroform, toluene and methanol extracts of a pitch sample was carried out by IR and GC-MS, leading to the identification of sixty nine compounds, including fatty acids, alcohols and hydrocarbons. Analysis of the acetone extractive of a eucalyptus wood used in Brazil for pulp production was also carried out, resulting in identification of fifty nine compounds, including mainly fatty acids, phenolic compounds, beta-sitosterol and othe (mais) r steroids. This analysis showed that pitch formation had a contribution from wood extractives and other sources of contamination. The results obtained and the methodology applied can be used by the pulp industry to develop new methods of pitch control.

Scientific Electronic Library Online (Portuguese)

61

Atividades antiúlcera e antioxidante Baccharis trimera (Less) DC (Asteraceae)/ Antiulcerogenic and antioxidant activities of Baccharis trimera (Less) DC (Asteraceae)

Dias, Larissa Funabashi de Toledo; Melo, Elisângela Severina de; Hernandes, Leandro Santoro; Bacchi, Elfriede M.
2009-03-01

Resumo em português A "carqueja", Baccharis trimera (Less) DC (Asteraceae), é uma espécie vegetal característica de regiões tropicais, muito utilizada na medicina popular como antiinflamatória, hipoglicemiante e em tratamento de problemas digestivos. A avaliação da atividade antiúlcera do extrato bruto liofilizado e do extrato liofilizado da "resina" (porção que durante a concentração dos extratos ficava depositada no fundo do recipiente com aspecto viscoso e pegajoso) foi realiz (mais) ada através de indução aguda por etanol acidificado. O extrato bruto liofilizado, na dose de 400 mg/ kg, reduziu a área de lesão em 90%, 200 mg/kg, 87%, 100 mg/kg, 66% e o fármaco controle (lansoprazol), 66%. O extrato liofilizado da "resina", administrado na dose de 400 mg/kg, reduziu a área de lesão em 82%, 200 mg/kg, 82%, 100 mg/kg, 53% e o fármaco controle (lansoprazol), 70%. A atividade antioxidante foi ensaiada com extrato bruto liofilizado, extrato liofilizado da "resina", pó da droga e frações clorofórmica, acetato de etila, etanol e etanol 50% através do método que reduz o radical 2,2'-difenil-1-picril-hidrazil (DPPH), permitindo após o equilíbrio da reação, calcular a quantidade de antioxidante gasta para reduzir 50% do DPPH, apresentando resultado evidente, comparado à vitamina E. Não foram verificados sinais de alteração aparente no ensaio de toxicidade na dose única de 5g/kg, em camundongos. Resumo em inglês Baccharis trimera (Less) DC (Asteraceae) is a medicinal Brazilian plant well-known by "carqueja". Natural from tropical regions, used as home-made medicine as anti-inflammatory, hypoglycemiant and for the treatment of digestive problems. The evaluation of the antiulcer activity of the extract and the "resin" (portion which during the extracts concentration was settled at the bottom of the recipient, showing a viscous and clammy aspect), was accomplished through the acute (mais) induction by acidified ethanol. The lyophilized extract, at a dose of 400 mg/kg, reduced the lesion area at 90%; 200 mg/kg, at 87%; 100 mg/kg, at 66%; and the control (lansoprazol) at 66%. The "resin" administered at the 400 mg/kg dose reduced the lesion area at 82%; 200 mg/kg, at 82%, 100 mg/kg, at 53% and the control (lansoprazol), at 70%. The antioxidant activity of the lyophilized extract, of the "resin" of the powdered drug, of the chloroform, ethyl acetate, ethanol and 50% ethanol fractions was tested following the method which reduces the 2,2-dipheny l-1 -picrylhydrazyl (DPPH) radical, permitting after the reaction balance, to calculate the amount of antioxidant spent to reduce 50% of the DPPH. The result was meaningful, when compared with the vitamin E result. The acute toxicity test performed in mice showed no apparent alteration.

Scientific Electronic Library Online (Portuguese)

62

Atividade antitumoral do Ageratum conyzoides L. (Asteraceae)/ Antitumoral activity of the Ageratum conyzoides L. (Asteraceae)

Momesso, Luciano da Silva; Moura, Rute Mendonça Xavier de; Constantino, Dulce Helena Jardim
2009-09-01

Resumo em português O Ageratum conyzoides, vegetal conhecido popularmente no Brasil é constituído por várias substâncias químicas, dentre elas os flavonóides, aos quais já foi atribuída a atividade antitumoral. Neste estudo foi avaliado o efeito das frações clorofórmica e metanólica do extrato AcOEt das folhas sobre o crescimento do tumor de Ehrlich. Foi constatado que o tratamento com as frações metanólicas, nas doses de 50 mg/kg de peso foi eficaz, inibindo o crescimento tum (mais) oral. A porcentagem de inibição para a fração metanólica estabilizada foi de 69,84% e de 68,25% para a fração metanólica não estabilizada. Estudos posteriores se fazem necessários para esclarecer quais os mecanismos envolvidos nesta inibição do crescimento tumoral. Resumo em inglês Ageratum conyzoides, a popular vegetal in Brazil, is composed by many chemical compounds, including flavonoids, and antitumoral activity has been attributed to it. In this assay the effect of chloroform and methanol fractions from EtOAc extract of the leaves on the growth of the Ehrlich tumor was evaluated. Under our experimental conditions we have observed that the treatment with methanol fractions, under the dosage of 50 mg/kg was efficient on inhibiting the tumoral gro (mais) wth. There was an inhibition percentage of 69.84% to the stabilized methanol fraction and 68.25% to the non-stabilized fraction. Further studies are necessary to clarify which mechanisms are involved in the inhibition of the tumoral growth.

Scientific Electronic Library Online (Portuguese)

63

Atividade antiproliferativa de Sloanea garckeana K. Schum./ Antiproliferative activity of Sloanea garckeana K. Schum.

Romero, Adriano Lopes; Fontana, Álvaro; Silva, Cleuza Conceição da; Souza, Maria Conceição de; Carvalho, João Ernesto de; Faria, Emiret O.; Kato, Lucilia; Oliveira, Cecília M. A. de
2008-01-01

Resumo em inglês The crude methanol extract and hexane, ethyl acetate, chloroform and methanol fractions from leaves of S. garckeana were examined in vitro for their antiproliferative activity on MCF-7, NCI-ADR, NCI-460, UACC-62, 786-0, OVCAR-03, PCO-3 and HT-29 human cancer cell lines. Among the assayed fractions, the ethyl acetate fraction showed to be cytotoxic against 786-0, UACC-62, OVCAR-03 and NCI-ADR cell lines with IC50 values of 12 µg/mL, 42 µg/mL, 53 µg/mL and 51 µg/mL, res (mais) pectively. Through fractionation and isolation procedures compound (1) was obtained from the EtOAc fraction and its structure was elucidated by spectral techniques.

Scientific Electronic Library Online (Portuguese)

64

Atividade antimicrobiana de Lippia alba (Mill.) N. E. Brown (Verbenaceae)/ Antimicrobial activity of Lippia alba (Mill.) N. E. Brown (Verbenaceae)

Aguiar, Jaciana S.; Costa, Maria C. C. D.; Nascimento, Silene C.; Sena, Kêsia X. F. R.
2008-09-01

Resumo em português Lippia alba (Mill.) N. E. Brown (Verbenaceae), amplamente distribuída em todo o território brasileiro, é conhecida popularmente como erva cidreira e utilizada na medicina popular como analgésica, febrífuga, antiinflamatória, antigripal e nas afecções hepáticas. Extratos brutos foram preparados a partir de plantas cultivadas, de modo padronizado, em horta medicinal do Laboratório de Fitoterapia da Empresa Pernambucana de Pesquisa Agropecuária (IPA) para a verifi (mais) cação da atividade antimicrobiana, in vitro, pelo método de difusão em disco de papel. A concentração inibitória mínima (CIM) foi determinada para os extratos que exibiram melhores atividades. Os resultados obtidos mostraram que os extratos clorofórmico, acetônico e etanólico da raiz foram ativos frente a Staphylococcus aureus, Micrococcus luteus, Bacillus subtilis, Mycobacterium smegmatis, Candida albicans e Monilia sitophila e os extratos hexânicos, etanólicos e metanólicos das folhas inibiram S. aureus, M. luteus, B. subtilis, M. smegmatis e M. sitophila. A menor concentração inibitória (CIM = 31,2 µg/mL), foi obtida para o extrato clorofórmico da raiz frente a B. subtilis e M. luteus. Resumo em inglês Lippia alba (Mill.) N. E. Brown (Verbenaceae), commonly known as "erva cidreira", is widely distributed throughout Brazil and is used in folk medicine as an analgesic, anti-inflammatory, cold remedy, as well as to reduce fevers and treat hepatic afflictions. Crude extracts of L. alba were prepared from plants cultivated in the medicinal garden of the Laboratório de Fitoterapia of the Empresa Pernambucana de Pesquisa Agropecuária (IPA), State of Pernambuco, Brazil, using (mais) standard techniques to test their in vitro antibacterial activity using the paper disk-diffusion method. The minimum inhibitory concentration (MIC) was determined for those extracts demonstrating the highest activity. The results demonstrated that the chloroform, acetone and ethanol extracts of root material were active against the growth of Staphylococcus aureus, Micrococcus luteus, Bacillus subtilis, Mycobacterium smegmatis, Candida albicans and Monilia sitophila, while the hexane, ethanol and methanol extracts of leaves inhibited the growth of S. aureus, M. luteus, B. subtilis, M. smegmatis and M. sitophila. The lowest inhibitory concentration (MIC = 31.2 µg/mL) was obtained with the chloroform root extract against B. subtilis and M. luteus.

Scientific Electronic Library Online (Portuguese)

65

Artefatos cumarínicos isolados de Polygala paniculata L. (Polygalaceae)/ Coumarinic artifacts isolated from Polygala paniculata L. (Polygalaceae)

Pizzolatti, M. G; Cristiano, R.; Monache, F. D.; Branco, A.
2002-01-01

Resumo em português A partir do fracionamento em coluna de gel de sílica do extrato clorofórmico de Polygala paniculata (Polygalaceae), foram isolados 7-metóxi-8-(1',2'-epóxi-3'-metil-3'-butenil)-cumarina (1) e dois artefatos cumarínicos (2a-2b), formados a partir da abertura do anel epóxido de 1 durante o processo de isolamento. O tratamento de 1 com EtOH/SiO2, sob agitação e à temperatura ambiente durante 24 horas, resultou na formação dos respectivos artefatos: 7-metóxi-8-(1'- (mais) hidróxi-2-etóxi-3'-metil-3'-butenil)-cumarina (2a) e 7-metóxi-8-(1'-etóxi-2-hidróxi-3'-metil-3'-butenil)-cumarina (2b). As estruturas químicas desses compostos foram determinadas através da análise de seus dados espectrais, incluindo RMN bidimensional. Resumo em inglês Fractionation of a chloroform extract of Polygala paniculata (Polygalaceae) on silica gel column chromatography yielded 7-methoxy-8-(1',2'-epoxy-3'-methyl-3'-butenyl)-coumarin (1) and two coumarinic artifacts (2a-2b). The reaction of 1 with EtOH/SiO2 at room temperature for 24 hours yielded 7-methoxy-8-(1'-hydroxy-2'-ethoxy-3'-methyl-3'-butenyl)-coumarin (2a) and 7-methoxy-8-(1'-ethoxy-2'-hydroxy-3'-methyl-3'-butenyl)-coumarin (2b). The structures have been determined by spectral data, including 2D NMR experiments.

Scientific Electronic Library Online (Portuguese)

66

Aplicação de cromatografia centrífuga de contra-corrente na purificação de ácido ursólico das folhas de Eugenia brasiliensis Lam./ Aplication of counter-current chromatography in the purification of ursolic acid from leavesof Eugenia brasiliensis Lam.

Frighetto, N.; Welendorf, R.M.; Silva, A.M.P.; Nakamura, M.J.; Siani, A.C.
2005-12-01

Resumo em português Os ácidos triterpênicos são metabólitos comuns na família Myrtaceae, especialmente no gênero Eugenia. O ácido ursólico foi descrito como um dos principais constituintes, nas folhas de Eugenia brasiliensis, coletada no Sudoeste do Brasil. Uma partição prévia, por solventes, do extrato etanólico ou do extrato clorofórmico de E. brasiliensis, seguida por uma purificação por cromatografia de contra-corrente de alta velocidade (CCCAV), conduziu ao isolamento do (mais) ácido ursólico com alto grau de pureza (> 97%). Esta substância, também foi isolada por cromatografia convencional de coluna aberta (rendimento de 0.22% a partir do extrato etanólico), e caracterizada por 13C-RMN, GC-EM e co-injeção com padrão comercial em CG-DIC, na forma do éster metílico. A técnica de CCCAV, usualmente usada para triterpenos glicosilados, foi aqui aplicada para a aglicona. As fases móvel e estacionária, no experimento de CCCAV, foram geradas pela mistura de n-hexano : acetato de etila : metanol : água, na proporção 10:5:2,5:1. A seleção do sistema de solventes (fases estacionária e móvel) foi determinada pela máxima distribuição eqüitativa do ácido ursólico em ambas as fases, medida por densitometria e monitorada por cromatografia em camada delgada, CCD, usando-se ácido ursólico comercial como referência. Resumo em inglês Triterpene acids are common metabolites in the Myrtaceae family, especially in the genus Eugenia. Ursolic acid was found in Eugenia brasiliensis collected in Southeastern Brazil. A previous solvent partition of the ethanol or chloroform extracts of the leavesof E. brasiliensis, followed by rapid high-speed counter-current chromatography (HSCCC) afforded ursolic acid in high purity (> 97%). This compound was also purified apart by conventional column chromatography (yield (mais) of 0.22% from the ethanolic extract) and characterized by 13C-NMR, GC-MS and co-injection of its methyl ester with standards in GC-FID. The HSCCC technique, usually applied to triterpene glycosides, was here applied successfully to an aglycone, to which examples are rarely described. The mobile and stationary phase for the HSCCC experiment were derived from the two-phase solvent system composed by n-hexane : ethyl acetate : methanol : water in the proportion of 10:5:2.5:1. The choice of the developing solvent system for optimum HSCCC separation was determined by TLC coupled to densitometric measurements of ursolic acid in both stationary and mobile phase, generated by the upper and lower layer of the system above. Commercial ursolic acid was used as standard.

Scientific Electronic Library Online (Portuguese)

67

Aplicação de SPME (Solid Phase Micro-Extraction) na análise de águas potáveis de três localidades do estado de São Paulo/ Application of SPME (Solid Phase Micro-Extraction) to the analysis of drinkable water from three locations in the state of São Paulo

Valente, Antonio Luiz Pires; Augusto, Fabio; Montero, Larisse; Rocha, Eduardo Carasek da; Pawliszyn, Janusz
1998-11-01

Resumo em inglês The technique of solid phase microextraction (SPME) was used for the extraction of halogenated contaminants of water samples from three cities of the State of São Paulo and the extracts were submitted to gas chromatographic analysis with electron capture detection (GC-ECD). In the samples of water collected at the city of São Paulo the detected level of trihalomethanes (THM) expressed as the sum of chloroform, dibromochloromethane and dichlorobromomethane, were higher t (mais) han the permissible limit established by the Brazilian regulation. In the samples collected at the two other cities the level of any of the three THM remained below the sensitivity of the ECD.

Scientific Electronic Library Online (Portuguese)

68

Análise sazonal do potencial antimicrobiano e teores de flavonoides e quinonas de extratos foliares de Aloe arborescens Mill., Xanthorrhoeaceae/ Seasonal analysis from the antimicrobial potency and flavonoid and quinone content from Aloe arborescens Mill., Xanthorrhoeaceae, leaf extracts

Cardoso, Fernando Leite; Murakami, Cynthia; Mayworm, Marco Aurélio Sivero; Marques, Lucas Miranda
2010-03-01

Resumo em português Este trabalho teve como objetivos avaliar o potencial antimicrobiano e os teores de flavonoides e quinonas de extratos foliares de Aloe arborescens Mill., Xanthorrhoeaceae, produzidos em diferentes épocas do ano. Extratos etanólicos e clorofórmicos foram preparados a partir de folhas, os bioensaios de atividade antimicrobiana foram desenvolvidos pelo método de macrodiluição em caldo, e dosagens de flavonoides e quinonas foram realizadas nos extratos. Todos os extrat (mais) os apresentaram ação inibitória sobre os microrganismos testados. O extrato clorofórmico de inverno apresentou a menor CIM (128 µg/mL) sobre B. subtilis. Os extratos clorofórmicos de inverno, primavera e verão apresentaram maior atividade antimicrobiana em relação ao extrato clorofórmico de outono. O extrato etanólico de inverno apresentou a menor CIM (256 µg/mL) e a menor CMM (512 µg/mL) sobre K. pneumoniae. Os extratos etanólicos de verão e outono mostraram baixa atividade antimicrobiana. Os teores de quinonas das folhas foram maiores nos períodos mais quentes de coleta (verão e outono), enquanto os teores de flavonoides foram semelhantes nos quatro períodos de coleta. Resumo em inglês This work has the objective of evaluate the antimicrobial potency and the content of flavonoids and quinones from the Aloe arborescens Mill., Xanthorrhoeaceae, leaf extracts produced in the four seasons of the year. Ethanol and chloroform extracts were prepared from the leaves, the bioassays from antimicrobial activity were developed by the macrodilution method in broth, and dosages of flavonoids and quinones were performed in the extracts. The winter chloroform extract s (mais) howed the lowest CIM (128 µg/mL) on B. subtilis. The ethanol extract showed the lowest CIM (256 µg/mL) and the lowest CMM (512 µg/mL) on K. pneumoniae. The summer and fall ethanol extracts showed low antimicrobial activity. The quinones extracts showed inhibitory activity on the tested microorganisms. The winter, spring and summer chloroform extracts showed higher antimicrobial activity compared to the fall chloroform one. The winter ethanol extract content from the leaves were higher in the hotter periods of collection (summer and fall) and the flavonoids content were similar in the four collection periods.

Scientific Electronic Library Online (Portuguese)