
Sample records for myxococcus xanthus biofilms

  1. DNA builds and strengthens the extracellular matrix in Myxococcus xanthus biofilms by interacting with exopolysaccharides.

    Directory of Open Access Journals (Sweden)

    Wei Hu

    Full Text Available One intriguing discovery in modern microbiology is the extensive presence of extracellular DNA (eDNA within biofilms of various bacterial species. Although several biological functions have been suggested for eDNA, including involvement in biofilm formation, the detailed mechanism of eDNA integration into biofilm architecture is still poorly understood. In the biofilms formed by Myxococcus xanthus, a Gram-negative soil bacterium with complex morphogenesis and social behaviors, DNA was found within both extracted and native extracellular matrices (ECM. Further examination revealed that these eDNA molecules formed well organized structures that were similar in appearance to the organization of exopolysaccharides (EPS in ECM. Biochemical and image analyses confirmed that eDNA bound to and colocalized with EPS within the ECM of starvation biofilms and fruiting bodies. In addition, ECM containing eDNA exhibited greater physical strength and biological stress resistance compared to DNase I treated ECM. Taken together, these findings demonstrate that DNA interacts with EPS and strengthens biofilm structures in M. xanthus.

  2. Phase separation like dynamics during Myxococcus xanthus fruiting body formation (United States)

    Liu, Guannan; Thutupalli, Shashi; Wigbers, Manon; Shaevitz, Joshua


    Collective motion exists in many living organisms as an advantageous strategy to help the entire group with predation, forage, and survival. However, the principles of self-organization underlying such collective motions remain unclear. During various developmental stages of the soil-dwelling bacterium, Myxococcus xanthus, different types of collective motions are observed. In particular, when starved, M. xanthus cells eventually aggregate together to form 3-dimensional structures (fruiting bodies), inside which cells sporulate in response to the stress. We study the fruiting body formation process as an out of equilibrium phase separation process. As local cell density increases, the dynamics of the aggregation M. xanthus cells switch from a spatio-temporally random process, resembling nucleation and growth, to an emergent pattern formation process similar to a spinodal decomposition. By employing high-resolution microscopy and a video analysis system, we are able to track the motion of single cells within motile collective groups, while separately tuning local cell density, cell velocity and reversal frequency, probing the multi-dimensional phase space of M. xanthus development.

  3. Cloning and expression of clt genes encoding milk-clotting proteases from Myxococcus xanthus 422. (United States)

    Poza, M; Prieto-Alcedo, M; Sieiro, C; Villa, T G


    The screening of a gene library of the milk-clotting strain Myxococcus xanthus 422 constructed in Escherichia coli allowed the description of eight positive clones containing 26 open reading frames. Only three of them (cltA, cltB, and cltC) encoded proteins that exhibited intracellular milk-clotting ability in E. coli, Saccharomyces cerevisiae, and Pichia pastoris expression systems.

  4. Identification and Localization of Myxococcus xanthus Porins and Lipoproteins (United States)

    Bhat, Swapna; Zhu, Xiang; Patel, Ricky P.; Orlando, Ron; Shimkets, Lawrence J.


    Myxococcus xanthus DK1622 contains inner (IM) and outer membranes (OM) separated by a peptidoglycan layer. Integral membrane, β-barrel proteins are found exclusively in the OM where they form pores allowing the passage of nutrients, waste products and signals. One porin, Oar, is required for intercellular communication of the C-signal. An oar mutant produces CsgA but is unable to ripple or stimulate csgA mutants to develop suggesting that it is the channel for C-signaling. Six prediction programs were evaluated for their ability to identify β-barrel proteins. No program was reliable unless the predicted proteins were first parsed using Signal P, Lipo P and TMHMM, after which TMBETA-SVM and TMBETADISC-RBF identified β-barrel proteins most accurately. 228 β-barrel proteins were predicted from among 7331 protein coding regions, representing 3.1% of total genes. Sucrose density gradients were used to separate vegetative cell IM and OM fractions, and LC-MS/MS of OM proteins identified 54 β-barrel proteins. Another class of membrane proteins, the lipoproteins, are anchored in the membrane via a lipid moiety at the N-terminus. 44 OM proteins identified by LC-MS/MS were predicted lipoproteins. Lipoproteins are distributed between the IM, OM and ECM according to an N-terminal sorting sequence that varies among species. Sequence analysis revealed conservation of alanine at the +7 position of mature ECM lipoproteins, lysine at the +2 position of IM lipoproteins, and no noticable conservation within the OM lipoproteins. Site directed mutagenesis and immuno transmission electron microscopy showed that alanine at the +7 position is essential for sorting of the lipoprotein FibA into the ECM. FibA appears at normal levels in the ECM even when a +2 lysine is added to the signal sequence. These results suggest that ECM proteins have a unique method of secretion. It is now possible to target lipoproteins to specific IM, OM and ECM locations by manipulating the amino acid

  5. Cell-density-dependent lysis and sporulation of Myxococcus xanthus in agarose microbeads.


    Rosenbluh, A; Nir, R; Sahar, E; Rosenberg, E


    Vegetative cells of Myxococcus xanthus were immobilized in 25-microns-diameter agarose microbeads and incubated in either growth medium or sporulation buffer. In growth medium, the cells multiplied, glided to the periphery, and then filled the beads. In sporulation buffer, up to 90% of the cells lysed and ca. 50% of the surviving cells formed resistant spores. A strong correlation between sporulation and cell lysis was observed; both phenomena were cell density dependent. Sporulation proficie...

  6. Transmission of a signal that synchronizes cell movements in swarms of Myxococcus xanthus


    Kaiser, Dale; Warrick, Hans


    Multicellular organisms, by necessity, form highly organized structures. The mechanisms required to construct these often dynamic structures are a challenge to understand. Myxococcus xanthus, a soil bacterium, builds two large structures: growing swarms and fruiting bodies. Because the cells are genetically identical, they rely on regulating protein activity and the levels of gene expression. Moreover, the long, flexible, rod-shaped cells modify each others’ behavior when they collide. By exa...

  7. Two-Component Signal Transduction Systems That Regulate the Temporal and Spatial Expression of Myxococcus xanthus Sporulation Genes. (United States)

    Sarwar, Zaara; Garza, Anthony G


    When starved for nutrients, Myxococcus xanthus produces a biofilm that contains a mat of rod-shaped cells, known as peripheral rods, and aerial structures called fruiting bodies, which house thousands of dormant and stress-resistant spherical spores. Because rod-shaped cells differentiate into spherical, stress-resistant spores and spore differentiation occurs only in nascent fruiting bodies, many genes and multiple levels of regulation are required. Over the past 2 decades, many regulators of the temporal and spatial expression of M. xanthus sporulation genes have been uncovered. Of these sporulation gene regulators, two-component signal transduction circuits, which typically contain a histidine kinase sensor protein and a transcriptional regulator known as response regulator, are among the best characterized. In this review, we discuss prototypical two-component systems (Nla6S/Nla6 and Nla28S/Nla28) that regulate an early, preaggregation phase of sporulation gene expression during fruiting body development. We also discuss orphan response regulators (ActB and FruA) that regulate a later phase of sporulation gene expression, which begins during the aggregation stage of fruiting body development. In addition, we summarize the research on a complex two-component system (Esp) that is important for the spatial regulation of sporulation. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

  8. Herbicidal and antioxidant responses of transgenic rice overexpressing Myxococcus xanthus protoporphyrinogen oxidase. (United States)

    Jung, Sunyo; Back, Kyoungwhan


    We analyzed the herbicidal and antioxidant defense responses of transgenic rice plants that overexpressed the Myxococcus xanthus protoporphyrinogen oxidase gene. Leaf squares of the wild-type incubated with oxyfluorfen were characterized by necrotic leaf lesions and increases in conductivity and malonyldialdehyde levels, whereas transgenic lines M4 and M7 did not show any change with up to 100 microM oxyfluorfen. The wild-type had decreased F(v)/F(m) and produced a high level of H(2)O(2) at 18 h after foliar application of oxyfluorfen, whereas transgenic lines M4 and M7 were unaffected. In response to oxyfluorfen, violaxanthin, beta-carotene, and chlorophylls (Chls) decreased in wild-type plants, whereas antheraxanthin and zeaxanthin increased. Only a slight decline in Chls was observed in transgenic lines at 48 h after oxyfluorfen treatment. Noticeable increases of cytosolic Cu/Zn-superoxide dismutase, peroxidase isozymes 1 and 2, and catalase were observed after at 48 h of oxyfluorfen treatment in the wild-type. Non-enzymatic antioxidants appeared to respond faster to oxyfluorfen-induced photodynamic stress than did enzymatic antioxidants. Protective responses for the detoxification of active oxygen species were induced to counteract photodynamic stress in oxyfluorfen-treated, wild-type plants. However, oxyfluorfen-treated, transgenic plants suffered less oxidative stress, confirming increased herbicidal resistance resulted from dual expression of M. xanthus Protox in chloroplasts and mitochondria.

  9. ParABS system in chromosome partitioning in the bacterium Myxococcus xanthus.

    Directory of Open Access Journals (Sweden)

    Antonio A Iniesta

    Full Text Available Chromosome segregation is an essential cellular function in eukaryotic and prokaryotic cells. The ParABS system is a fundamental player for a mitosis-like process in chromosome partitioning in many bacterial species. This work shows that the social bacterium Myxococcus xanthus also uses the ParABS system for chromosome segregation. Its large prokaryotic genome of 9.1 Mb contains 22 parS sequences near the origin of replication, and it is shown here that M. xanthus ParB binds preferentially to a consensus parS sequence in vitro. ParB and ParA are essential for cell viability in M. xanthus as in Caulobacter crescentus, but unlike in many other bacteria. Absence of ParB results in anucleate cells, chromosome segregation defects and loss of viability. Analysis of ParA subcellular localization shows that it clusters at the poles in all cells, and in some, in the DNA-free cell division plane between two chromosomal DNA masses. This ParA localization pattern depends on ParB but not on FtsZ. ParB inhibits the nonspecific interaction of ParA with DNA, and ParA colocalizes with chromosomal DNA only when ParB is depleted. The subcellular localization of ParB suggests a single ParB-parS complex localized at the edge of the nucleoid, next to a polar ParA cluster, with a second ParB-parS complex migrating after the replication of parS takes place to the opposite nucleoid edge, next to the other polar ParA cluster.

  10. Competitive Interactions Between Incompatible Mutants of the Social Bacterium Myxococcus xanthus DK1622

    Directory of Open Access Journals (Sweden)

    Ya Gong


    Full Text Available Due to the high similarity in their requirements for space and food, close bacterial relatives may be each other's strongest competitors. Close bacterial relatives often form visible boundaries to separate their swarming colonies, a phenomenon termed colony-merger incompatibility. While bacterial species are known to have many incompatible strains, it is largely unclear which traits lead to multiple incompatibilities and the interactions between multiple incompatible siblings. To investigate the competitive interactions of closely related incompatible strains, we mutated Myxococcus xanthus DK1622, a predatory bacterium with complex social behavior. From 3392 random transposon mutations, we obtained 11 self-identification (SI deficient mutants that formed unmerged colony boundaries with the ancestral strain. The mutations were at nine loci with unknown functions and formed nine independent SI mutants. Compared with their ancestral strain, most of the SI mutants showed reduced growth, swarming and development abilities, but some remained unchanged from their monocultures. When pairwise mixed with their ancestral strain for co-cultivation, these mutants exhibited improved, reduced or unchanged competitive abilities compared with the ancestral strain. The sporulation efficiencies were affected by the DK1622 partner, ranging from almost complete inhibition to 360% stimulation. The differences in competitive growth between the SI mutants and DK1622 were highly correlated with the differences in their sporulation efficiencies. However, the competitive efficiencies of the mutants in mixture were inconsistent with their growth or sporulation abilities in monocultures. We propose that the colony-merger incompatibility in M. xanthus is associated with multiple independent genetic loci, and the incompatible strains hold competitive interaction abilities, which probably determine the complex relationships between multiple incompatible M. xanthus strains and

  11. The phosphatomes of the multicellular myxobacteria Myxococcus xanthus and Sorangium cellulosum in comparison with other prokaryotic genomes.

    Directory of Open Access Journals (Sweden)

    Anke Treuner-Lange

    Full Text Available BACKGROUND: Analysis of the complete genomes from the multicellular myxobacteria Myxococcus xanthus and Sorangium cellulosum identified the highest number of eukaryotic-like protein kinases (ELKs compared to all other genomes analyzed. High numbers of protein phosphatases (PPs could therefore be anticipated, as reversible protein phosphorylation is a major regulation mechanism of fundamental biological processes. METHODOLOGY: Here we report an intensive analysis of the phosphatomes of M. xanthus and S. cellulosum in which we constructed phylogenetic trees to position these sequences relative to PPs from other prokaryotic organisms. PRINCIPAL FINDINGS: PREDOMINANT OBSERVATIONS WERE: (i M. xanthus and S. cellulosum possess predominantly Ser/Thr PPs; (ii S. cellulosum encodes the highest number of PP2c-type phosphatases so far reported for a prokaryotic organism; (iii in contrast to M. xanthus only S. cellulosum encodes high numbers of SpoIIE-like PPs; (iv there is a significant lack of synteny among M. xanthus and S. cellulosum, and (v the degree of co-organization between kinase and phosphatase genes is extremely low in these myxobacterial genomes. CONCLUSIONS: We conclude that there has been a greater expansion of ELKs than PPs in multicellular myxobacteria.

  12. Sibling Rivalry in Myxococcus xanthus Is Mediated by Kin Recognition and a Polyploid Prophage. (United States)

    Dey, Arup; Vassallo, Christopher N; Conklin, Austin C; Pathak, Darshankumar T; Troselj, Vera; Wall, Daniel


    Myxobacteria form complex social communities that elicit multicellular behaviors. One such behavior is kin recognition, in which cells identify siblings via their polymorphic TraA cell surface receptor, to transiently fuse outer membranes and exchange their contents. In addition, outer membrane exchange (OME) regulates behaviors, such as inhibition of wild-type Myxococcus xanthus (DK1622) from swarming. Here we monitored the fate of motile cells and surprisingly found they were killed by nonmotile siblings. The kill phenotype required OME (i.e., was TraA dependent). The genetic basis of killing was traced to ancestral strains used to construct DK1622. Specifically, the kill phenotype mapped to a large "polyploid prophage," Mx alpha. Sensitive strains contained a 200-kb deletion that removed two of three Mx alpha units. To explain these results, we suggest that Mx alpha expresses a toxin-antitoxin cassette that uses the OME machinery of M. xanthus to transfer a toxin that makes the population "addicted" to Mx alpha. Thus, siblings that lost Mx alpha units (no immunity) are killed by cells that harbor the element. To test this, an Mx alpha-harboring laboratory strain was engineered (by traA allele swap) to recognize a closely related species, Myxococcus fulvus. As a result, M. fulvus, which lacks Mx alpha, was killed. These TraA-mediated antagonisms provide an explanation for how kin recognition specificity might have evolved in myxobacteria. That is, recognition specificity is determined by polymorphisms in traA, which we hypothesize were selected for because OME with non-kin leads to lethal outcomes. The transition from single cell to multicellular life is considered a major evolutionary event. Myxobacteria have successfully made this transition. For example, in response to starvation, individual cells aggregate into multicellular fruiting bodies wherein cells differentiate into spores. To build fruits, cells need to recognize their siblings, and in part, this is

  13. Global transcriptome analysis of spore formation in Myxococcus xanthus reveals a locus necessary for cell differentiation

    Directory of Open Access Journals (Sweden)

    Treuner-Lange Anke


    Full Text Available Abstract Background Myxococcus xanthus is a Gram negative bacterium that can differentiate into metabolically quiescent, environmentally resistant spores. Little is known about the mechanisms involved in differentiation in part because sporulation is normally initiated at the culmination of a complex starvation-induced developmental program and only inside multicellular fruiting bodies. To obtain a broad overview of the sporulation process and to identify novel genes necessary for differentiation, we instead performed global transcriptome analysis of an artificial chemically-induced sporulation process in which addition of glycerol to vegetatively growing liquid cultures of M. xanthus leads to rapid and synchronized differentiation of nearly all cells into myxospore-like entities. Results Our analyses identified 1 486 genes whose expression was significantly regulated at least two-fold within four hours of chemical-induced differentiation. Most of the previously identified sporulation marker genes were significantly upregulated. In contrast, most genes that are required to build starvation-induced multicellular fruiting bodies, but which are not required for sporulation per se, were not significantly regulated in our analysis. Analysis of functional gene categories significantly over-represented in the regulated genes, suggested large rearrangements in core metabolic pathways, and in genes involved in protein synthesis and fate. We used the microarray data to identify a novel operon of eight genes that, when mutated, rendered cells unable to produce viable chemical- or starvation-induced spores. Importantly, these mutants displayed no defects in building fruiting bodies, suggesting these genes are necessary for the core sporulation process. Furthermore, during the starvation-induced developmental program, these genes were expressed in fruiting bodies but not in peripheral rods, a subpopulation of developing cells which do not sporulate

  14. The dev Operon Regulates the Timing of Sporulation during Myxococcus xanthus Development. (United States)

    Rajagopalan, Ramya; Kroos, Lee


    Myxococcus xanthus undergoes multicellular development when starved. Thousands of rod-shaped cells coordinate their movements and aggregate into mounds in which cells differentiate into spores. Mutations in the dev operon impair development. The dev operon encompasses a clustered regularly interspaced short palindromic repeat-associated (CRISPR-Cas) system. Null mutations in devI , a small gene at the beginning of the dev operon, suppress the developmental defects caused by null mutations in the downstream devR and devS genes but failed to suppress defects caused by a small in-frame deletion in devT We provide evidence that the original mutant has a second-site mutation. We show that devT null mutants exhibit developmental defects indistinguishable from devR and devS null mutants, and a null mutation in devI suppresses the defects of a devT null mutation. The similarity of DevTRS proteins to components of the CRISPR-associated complex for antiviral defense (Cascade), together with our molecular characterization of dev mutants, support a model in which DevTRS form a Cascade-like subcomplex that negatively autoregulates dev transcript accumulation and prevents DevI overproduction that would strongly inhibit sporulation. Our results also suggest that DevI transiently inhibits sporulation when regulated normally. The mechanism of transient inhibition may involve MrpC, a key transcription factor, whose translation appears to be weakly inhibited by DevI. Finally, our characterization of a devI devS mutant indicates that very little exo transcript is required for sporulation, which is surprising since Exo proteins help form the polysaccharide spore coat. IMPORTANCE CRISPR-Cas systems typically function as adaptive immune systems in bacteria. The dev CRISPR-Cas system of M. xanthus has been proposed to prevent bacteriophage infection during development, but how dev controls sporulation has been elusive. Recent evidence supported a model in which DevR and DevS prevent

  15. Colony Expansion of Socially Motile Myxococcus xanthus Cells Is Driven by Growth, Motility, and Exopolysaccharide Production.

    Directory of Open Access Journals (Sweden)

    Pintu Patra


    Full Text Available Myxococcus xanthus, a model organism for studies of multicellular behavior in bacteria, moves exclusively on solid surfaces using two distinct but coordinated motility mechanisms. One of these, social (S motility is powered by the extension and retraction of type IV pili and requires the presence of exopolysaccharides (EPS produced by neighboring cells. As a result, S motility requires close cell-to-cell proximity and isolated cells do not translocate. Previous studies measuring S motility by observing the colony expansion of cells deposited on agar have shown that the expansion rate increases with initial cell density, but the biophysical mechanisms involved remain largely unknown. To understand the dynamics of S motility-driven colony expansion, we developed a reaction-diffusion model describing the effects of cell density, EPS deposition and nutrient exposure on the expansion rate. Our results show that at steady state the population expands as a traveling wave with a speed determined by the interplay of cell motility and growth, a well-known characteristic of Fisher's equation. The model explains the density-dependence of the colony expansion by demonstrating the presence of a lag phase-a transient period of very slow expansion with a duration dependent on the initial cell density. We propose that at a low initial density, more time is required for the cells to accumulate enough EPS to activate S-motility resulting in a longer lag period. Furthermore, our model makes the novel prediction that following the lag phase the population expands at a constant rate independent of the cell density. These predictions were confirmed by S motility experiments capturing long-term expansion dynamics.

  16. Colony Expansion of Socially Motile Myxococcus xanthus Cells Is Driven by Growth, Motility, and Exopolysaccharide Production. (United States)

    Patra, Pintu; Kissoon, Kimberley; Cornejo, Isabel; Kaplan, Heidi B; Igoshin, Oleg A


    Myxococcus xanthus, a model organism for studies of multicellular behavior in bacteria, moves exclusively on solid surfaces using two distinct but coordinated motility mechanisms. One of these, social (S) motility is powered by the extension and retraction of type IV pili and requires the presence of exopolysaccharides (EPS) produced by neighboring cells. As a result, S motility requires close cell-to-cell proximity and isolated cells do not translocate. Previous studies measuring S motility by observing the colony expansion of cells deposited on agar have shown that the expansion rate increases with initial cell density, but the biophysical mechanisms involved remain largely unknown. To understand the dynamics of S motility-driven colony expansion, we developed a reaction-diffusion model describing the effects of cell density, EPS deposition and nutrient exposure on the expansion rate. Our results show that at steady state the population expands as a traveling wave with a speed determined by the interplay of cell motility and growth, a well-known characteristic of Fisher's equation. The model explains the density-dependence of the colony expansion by demonstrating the presence of a lag phase-a transient period of very slow expansion with a duration dependent on the initial cell density. We propose that at a low initial density, more time is required for the cells to accumulate enough EPS to activate S-motility resulting in a longer lag period. Furthermore, our model makes the novel prediction that following the lag phase the population expands at a constant rate independent of the cell density. These predictions were confirmed by S motility experiments capturing long-term expansion dynamics.

  17. The guanosine nucleotide (p)ppGpp initiates development and A-factor production in myxococcus xanthus. (United States)

    Harris, B Z; Kaiser, D; Singer, M


    Guanosine 3'-di-5'-(tri)di-phosphate nucleotides [(p)ppGpp], synthesized in response to amino acid limitation, induce early gene expression leading to multicellular fruiting body formation in Myxococcus xanthus. A mutant (DK527) that fails to accumulate (p)ppGpp in response to starvation was found to be blocked in development prior to aggregation. By use of a series of developmentally regulated Tn5lac transcriptional fusion reporters, the time of developmental arrest in DK527 was narrowed to within the few hours of development, the period of starvation recognition. The mutant is also defective in the production of A-factor, an early extracellular cell-density signal. The relA gene from Escherichia coli, which encodes a ribosome-dependent (p)ppGpp synthetase, rescues this mutant. We also demonstrate that inactivation of the M. xanthus relA homolog blocks development and the accumulation of (p)ppGpp. Moreover, the wild-type allele of Myxococcus relA rescues DK527. These observations support a model in which accumulation of (p)ppGpp, in response to starvation, initiates the program of fruiting body development, including the production of A-factor.

  18. Analysis of dofA, a fruA-Dependent Developmental Gene, and Its Homologue, dofB, in Myxococcus xanthus


    Horiuchi, Takayuki; Akiyama, Takuya; Inouye, Sumiko; Komano, Teruya


    The developmentally regulated gene dofA, identified from pulse-labeling experiments by two-dimensional gel electrophoresis, and its homologue, dofB, were cloned and characterized in Myxococcus xanthus. Deletion of dofA and dofB did not affect the vegetative growth and development of M. xanthus. dofA was specifically expressed during development, while dofB expression was observed during vegetative growth and development. The dofA-lacZ fusion was introduced into a fruA mutant and A, B, C, D, a...

  19. Identification of a mutant locus that bypasses the BsgA protease requirement for social development in Myxococcus xanthus. (United States)

    Cusick, John K; Hager, Elizabeth; Gill, Ronald E


    The BsgA protease is required for the earliest morphological changes observed in Myxococcus xanthus development. We hypothesize that the BsgA protease is required to cleave an inhibitor of the developmental program, and isolation of genetic bypass suppressors of a bsgA mutant was used to identify signaling components controlling development downstream of the BsgA protease. Strain M955 was created by transposon mutagenesis of a bsgA mutant followed by screening for strains that could develop despite the absence of the BsgA protease. Strain M955 was able to aggregate, form fruiting bodies, and partially restored the production of viable spores in comparison to the parental bsgA mutant. The bsgA Tn5Ω955 strain partially restored developmental expression to a subset of genes normally induced during development, and expressed one developmentally induced fusion at higher amounts during vegetative growth in comparison to wild-type cells. The transposon in strain M955 was localized to a Ribonuclease D homolog that appears to exist in an operon with a downstream aminopeptidase-encoding gene. The identification of a third distinct bypass suppressor of the BsgA protease suggests that the BsgA protease may regulate a potentially complex pathway during the initiation of the M. xanthus developmental program. © FEMS 2014. All rights reserved. For permissions, please e-mail:

  20. Allopatric integrations selectively change host transcriptomes, leading to varied expression efficiencies of exotic genes in Myxococcus xanthus. (United States)

    Zhu, Li-Ping; Yue, Xin-Jing; Han, Kui; Li, Zhi-Feng; Zheng, Lian-Shuai; Yi, Xiu-Nan; Wang, Hai-Long; Zhang, You-Ming; Li, Yue-Zhong


    Exotic genes, especially clustered multiple-genes for a complex pathway, are normally integrated into chromosome for heterologous expression. The influences of insertion sites on heterologous expression and allotropic expressions of exotic genes on host remain mostly unclear. We compared the integration and expression efficiencies of single and multiple exotic genes that were inserted into Myxococcus xanthus genome by transposition and attB-site-directed recombination. While the site-directed integration had a rather stable chloramphenicol acetyl transferase (CAT) activity, the transposition produced varied CAT enzyme activities. We attempted to integrate the 56-kb gene cluster for the biosynthesis of antitumor polyketides epothilones into M. xanthus genome by site-direction but failed, which was determined to be due to the insertion size limitation at the attB site. The transposition technique produced many recombinants with varied production capabilities of epothilones, which, however, were not paralleled to the transcriptional characteristics of the local sites where the genes were integrated. Comparative transcriptomics analysis demonstrated that the allopatric integrations caused selective changes of host transcriptomes, leading to varied expressions of epothilone genes in different mutants. With the increase of insertion fragment size, transposition is a more practicable integration method for the expression of exotic genes. Allopatric integrations selectively change host transcriptomes, which lead to varied expression efficiencies of exotic genes.

  1. Activation of a development-specific gene, dofA, by FruA, an essential transcription factor for development of Myxococcus xanthus. (United States)

    Ueki, Toshiyuki; Inouye, Sumiko


    FruA is an essential transcription factor for Myxococcus xanthus development. The expression of tps and dofA genes is fruA dependent. In this study, we show by gel shift and footprint assays with the C-terminal DNA-binding domain of FruA and by a lacZ fusion assay that FruA may directly activate dofA expression during development.

  2. Activation of a Development-Specific Gene, dofA, by FruA, an Essential Transcription Factor for Development of Myxococcus xanthus


    Ueki, Toshiyuki; Inouye, Sumiko


    FruA is an essential transcription factor for Myxococcus xanthus development. The expression of tps and dofA genes is fruA dependent. In this study, we show by gel shift and footprint assays with the C-terminal DNA-binding domain of FruA and by a lacZ fusion assay that FruA may directly activate dofA expression during development.

  3. Increasing on-target cleavage efficiency for CRISPR/Cas9-induced large fragment deletion in Myxococcus xanthus. (United States)

    Yang, Ying-Jie; Wang, Ye; Li, Zhi-Feng; Gong, Ya; Zhang, Peng; Hu, Wen-Chao; Sheng, Duo-Hong; Li, Yue-Zhong


    The CRISPR/Cas9 system is a powerful tool for genome editing, in which the sgRNA binds and guides the Cas9 protein for the sequence-specific cleavage. The protocol is employable in different organisms, but is often limited by cell damage due to the endonuclease activity of the introduced Cas9 and the potential off-target DNA cleavage from incorrect guide by the 20 nt spacer. In this study, after resolving some critical limits, we have established an efficient CRISPR/Cas9 system for the deletion of large genome fragments related to the biosynthesis of secondary metabolites in Myxococcus xanthus cells. We revealed that the high expression of a codon-optimized cas9 gene in M. xanthus was cytotoxic, and developed a temporally high expression strategy to reduce the cell damage from high expressions of Cas9. We optimized the deletion protocol by using the tRNA-sgRNA-tRNA chimeric structure to ensure correct sgRNA sequence. We found that, in addition to the position-dependent nucleotide preference, the free energy of a 20 nt spacer was a key factor for the deletion efficiency. By using the developed protocol, we achieved the CRISPR/Cas9-induced deletion of large biosynthetic gene clusters for secondary metabolites in M. xanthus DK1622 and its epothilone-producing mutant. The findings and the proposals described in this paper were suggested to be workable in other organisms, for example, other Gram negative bacteria with high GC content.

  4. Contact- and Protein Transfer-Dependent Stimulation of Assembly of the Gliding Motility Machinery in Myxococcus xanthus.

    Directory of Open Access Journals (Sweden)

    Beata Jakobczak


    Full Text Available Bacteria engage in contact-dependent activities to coordinate cellular activities that aid their survival. Cells of Myxococcus xanthus move over surfaces by means of type IV pili and gliding motility. Upon direct contact, cells physically exchange outer membrane (OM lipoproteins, and this transfer can rescue motility in mutants lacking lipoproteins required for motility. The mechanism of gliding motility and its stimulation by transferred OM lipoproteins remain poorly characterized. We investigated the function of CglC, GltB, GltA and GltC, all of which are required for gliding. We demonstrate that CglC is an OM lipoprotein, GltB and GltA are integral OM β-barrel proteins, and GltC is a soluble periplasmic protein. GltB and GltA are mutually stabilizing, and both are required to stabilize GltC, whereas CglC accumulate independently of GltB, GltA and GltC. Consistently, purified GltB, GltA and GltC proteins interact in all pair-wise combinations. Using active fluorescently-tagged fusion proteins, we demonstrate that GltB, GltA and GltC are integral components of the gliding motility complex. Incorporation of GltB and GltA into this complex depends on CglC and GltC as well as on the cytoplasmic AglZ protein and the inner membrane protein AglQ, both of which are components of the gliding motility complex. Conversely, incorporation of AglZ and AglQ into the gliding motility complex depends on CglC, GltB, GltA and GltC. Remarkably, physical transfer of the OM lipoprotein CglC to a ΔcglC recipient stimulates assembly of the gliding motility complex in the recipient likely by facilitating the OM integration of GltB and GltA. These data provide evidence that the gliding motility complex in M. xanthus includes OM proteins and suggest that this complex extends from the cytoplasm across the cell envelope to the OM. These data add assembly of gliding motility complexes in M. xanthus to the growing list of contact-dependent activities in bacteria.

  5. A versatile class of cell surface directional motors gives rise to gliding motility and sporulation in Myxococcus xanthus.

    Directory of Open Access Journals (Sweden)

    Morgane Wartel


    Full Text Available Eukaryotic cells utilize an arsenal of processive transport systems to deliver macromolecules to specific subcellular sites. In prokaryotes, such transport mechanisms have only been shown to mediate gliding motility, a form of microbial surface translocation. Here, we show that the motility function of the Myxococcus xanthus Agl-Glt machinery results from the recent specialization of a versatile class of bacterial transporters. Specifically, we demonstrate that the Agl motility motor is modular and dissociates from the rest of the gliding machinery (the Glt complex to bind the newly expressed Nfs complex, a close Glt paralogue, during sporulation. Following this association, the Agl system transports Nfs proteins directionally around the spore surface. Since the main spore coat polymer is secreted at discrete sites around the spore surface, its transport by Agl-Nfs ensures its distribution around the spore. Thus, the Agl-Glt/Nfs machineries may constitute a novel class of directional bacterial surface transporters that can be diversified to specific tasks depending on the cognate cargo and machinery-specific accessories.

  6. Physical mapping of a 330 X 10(3)-base-pair region of the Myxococcus xanthus chromosome that is preferentially labeled during spore germination

    International Nuclear Information System (INIS)

    Komano, T.; Inouye, S.; Inouye, M.


    Myxococcus xanthus was pulse-labeled with [ 3 H]thymidine immediately after germination of dimethyl sulfoxide-induced spores. The restriction enzyme digests of the total chromosomal DNA from the pulse- labeled cells were analyzed by one-dimensional as well as two- dimensional agarose gel electrophoresis. Four PstI fragments preferentially labeled at a very early stage of germination were cloned into the unique PstI site of pBR322. By using these clones as probes, a restriction enzyme map was established covering approximately 6% of the total M. xanthus genome (330 X 10(3) base pairs). The distribution of the specific activities of the restriction fragments pulse-labeled after germination suggests a bidirectional mode of DNA replication from a fixed origin

  7. Molecular Cloning and Characterization of Two Genes for the Biotin Carboxylase and Carboxyltransferase Subunits of Acetyl Coenzyme A Carboxylase in Myxococcus xanthus


    Kimura, Yoshio; Miyake, Rina; Tokumasu, Yushi; Sato, Masayuki


    We have cloned a DNA fragment from a genomic library of Myxococcus xanthus using an oligonucleotide probe representing conserved regions of biotin carboxylase subunits of acetyl coenzyme A (acetyl-CoA) carboxylases. The fragment contained two open reading frames (ORF1 and ORF2), designated the accB and accA genes, capable of encoding a 538-amino-acid protein of 58.1 kDa and a 573-amino-acid protein of 61.5 kDa, respectively. The protein (AccA) encoded by the accA gene was strikingly similar t...

  8. Coupling gene expression and multicellular morphogenesis during fruiting body formation in Myxococcus xanthus

    DEFF Research Database (Denmark)

    Søgaard-Andersen, L.; Overgaard, M.; Lobedanz, S.


    xanthus illustrates this coupling in the construction of a multicellular structure. Fruiting body formation involves two stages: aggregation of cells into mounds and the position-specific sporulation of cells that have accumulated inside mounds. Developmental gene expression propels these two processes...... morphogenesis. Accumulation of the C-signal is tightly regulated and involves transcriptional activation of the csgA gene and proteolysis of the full-length CsgA protein to produce the shorter cell surface-associated 17 kDa C-signal protein. The C-signal induces aggregation, sporulation and developmental gene...

  9. A genetic screen in Myxococcus xanthus identifies mutants that uncouple outer membrane exchange from a downstream cellular response. (United States)

    Dey, Arup; Wall, Daniel


    Upon physical contact with sibling cells, myxobacteria transiently fuse their outer membranes (OMs) and exchange OM proteins and lipids. From previous work, TraA and TraB were identified to be essential factors for OM exchange (OME) in donor and recipient cells. To define the genetic complexity of OME, we carried out a comprehensive forward genetic screen. The screen was based on the observation that Myxococcus xanthus nonmotile cells, by a Tra-dependent mechanism, block swarm expansion of motile cells when mixed. Thus, mutants defective in OME or a downstream responsive pathway were readily identified as escape flares from mixed inocula seeded on agar. This screen was surprisingly powerful, as we found >50 mutants defective in OME. Importantly, all of the mutations mapped to the traAB operon, suggesting that there may be few, if any, proteins besides TraA and TraB directly required for OME. We also found a second and phenotypically different class of mutants that exhibited wild-type OME but were defective in a responsive pathway. This pathway is postulated to control inner membrane homeostasis by covalently attaching amino acids to phospholipids. The identified proteins are homologous to the Staphylococcus aureus MprF protein, which is involved in membrane adaptation and antibiotic resistance. Interestingly, we also found that a small number of nonmotile cells were sufficient to block the swarming behavior of a large gliding-proficient population. This result suggests that an OME-derived signal could be amplified from a few nonmotile producers to act on many responder cells. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

  10. Analysis of dofA, a fruA-dependent developmental gene, and its homologue, dofB, in Myxococcus xanthus. (United States)

    Horiuchi, Takayuki; Akiyama, Takuya; Inouye, Sumiko; Komano, Teruya


    The developmentally regulated gene dofA, identified from pulse-labeling experiments by two-dimensional gel electrophoresis, and its homologue, dofB, were cloned and characterized in Myxococcus xanthus. Deletion of dofA and dofB did not affect the vegetative growth and development of M. xanthus. dofA was specifically expressed during development, while dofB expression was observed during vegetative growth and development. The dofA-lacZ fusion was introduced into a fruA mutant and A, B, C, D, and E extracellular signal mutants. The pattern of dofA expression in the C signal mutant was similar to that of the wild-type strain, while dofA expression was not detected in the fruA mutant. These results are consistent with those of the pulse-labeling experiments. dofA expression was reduced in A and E signal mutants, whereas dofA expression was delayed in B and D signal mutants. The patterns of expression of the dofA gene in the fruA mutant and the five signal mutants are strikingly similar to that of the tps gene, which encodes protein S, a major component of the outer surface of the myxospore; this result suggests that the dofA and tps genes are similarly regulated. The involvement of a highly GC-rich inverted repeat sequence (underlined), CGGCCCCCGATTCGTCGGGGGCCG, in developmentally regulated dofA expression is suggested.

  11. Role of fruA and csgA genes in gene expression during development of Myxococcus xanthus. Analysis by two-dimensional gel electrophoresis. (United States)

    Horiuchi, Takayuki; Taoka, Masato; Isobe, Toshiaki; Komano, Teruya; Inouye, Sumiko


    Two genes, fruA and csgA, encoding a putative transcription factor and C-factor, respectively, are essential for fruiting body formation of Myxococcus xanthus. To investigate the role of fruA and csgA genes in developmental gene expression, developing cells as well as vegetative cells of M. xanthus wild-type, fruA::Tc, and csgA731 strains were pulse-labeled with [(35)S]methionine, and the whole cell proteins were analyzed using two-dimensional immobilized pH gradient/SDS-PAGE. Differences in protein synthesis patterns among more than 700 protein spots were detected during development of the three strains. Fourteen proteins showing distinctly different expression patterns in mutant cells were analyzed in more detail. Five of the 14 proteins were identified as elongation factor Tu (EF-Tu), Dru, DofA, FruA, and protein S by immunoblot analysis and mass spectroscopy. A gene encoding DofA was cloned and sequenced. Although both fruA and csgA genes regulate early development of M. xanthus, they were found to differently regulate expression of several developmental genes. The production of six proteins, including DofA and protein S, was dependent on fruA, whereas the production of two proteins was dependent on csgA, and one protein was dependent on both fruA and csgA. To explain the present findings, a new model was presented in which different levels of FruA phosphorylation may distinctively regulate the expression of two groups of developmental genes.

  12. The Type IV Pilus Assembly ATPase PilB of Myxococcus xanthus Interacts with the Inner Membrane Platform Protein PilC and the Nucleotide-binding Protein PilM. (United States)

    Bischof, Lisa Franziska; Friedrich, Carmen; Harms, Andrea; Søgaard-Andersen, Lotte; van der Does, Chris


    Type IV pili (T4P) are ubiquitous bacterial cell surface structures, involved in processes such as twitching motility, biofilm formation, bacteriophage infection, surface attachment, virulence, and natural transformation. T4P are assembled by machinery that can be divided into the outer membrane pore complex, the alignment complex that connects components in the inner and outer membrane, and the motor complex in the inner membrane and cytoplasm. Here, we characterize the inner membrane platform protein PilC, the cytosolic assembly ATPase PilB of the motor complex, and the cytosolic nucleotide-binding protein PilM of the alignment complex of the T4P machinery ofMyxococcus xanthus PilC was purified as a dimer and reconstituted into liposomes. PilB was isolated as a monomer and bound ATP in a non-cooperative manner, but PilB fused to Hcp1 ofPseudomonas aeruginosaformed a hexamer and bound ATP in a cooperative manner. Hexameric but not monomeric PilB bound to PilC reconstituted in liposomes, and this binding stimulated PilB ATPase activity. PilM could only be purified when it was stabilized by a fusion with a peptide corresponding to the first 16 amino acids of PilN, supporting an interaction between PilM and PilN(1-16). PilM-N(1-16) was isolated as a monomer that bound but did not hydrolyze ATP. PilM interacted directly with PilB, but only with PilC in the presence of PilB, suggesting an indirect interaction. We propose that PilB interacts with PilC and with PilM, thus establishing the connection between the alignment and the motor complex. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  13. Profiling the outer membrane proteome during growth and development of the social bacterium Myxococcus xanthus by selective biotinylation and analyses of outer membrane vesicles. (United States)

    Kahnt, Jörg; Aguiluz, Kryssia; Koch, Jürgen; Treuner-Lange, Anke; Konovalova, Anna; Huntley, Stuart; Hoppert, Michael; Søgaard-Andersen, Lotte; Hedderich, Reiner


    Social behavior in the bacterium Myxococcus xanthus relies on contact-dependent activities involving cell-cell and cell-substratum interactions. To identify outer membrane proteins that have a role in these activities, we profiled the outer membrane proteome of growing and starving cells using two strategies. First, outer membrane proteins were enriched by biotinylation of intact cells using the reagent NHS (N-hydroxysuccinimide)-PEO(12) (polyethylene oxide)-biotin with subsequent membrane solubilization and affinity chromatography. Second, the proteome of outer membrane vesicles (OMV) was determined. Comparisons of detected proteins show that these methods have different detection profiles and together provide a comprehensive view of the outer membrane proteome. From 362 proteins identified, 274 (76%) were cell envelope proteins including 64 integral outer membrane proteins and 85 lipoproteins. The majority of these proteins were of unknown function. Among integral outer membrane proteins with homologues of known function, TonB-dependent transporters comprise the largest group. Our data suggest novel functions for these transporters. Among lipoproteins with homologues of known function, proteins with hydrolytic functions comprise the largest group. The luminal load of OMV was enriched for proteins with hydrolytic functions. Our data suggest that OMV have functions in predation and possibly in transfer of intercellular signaling molecules between cells.

  14. A response regulator interfaces between the Frz chemosensory system and the MglA/MglB GTPase/GAP module to regulate polarity in Myxococcus xanthus.

    Directory of Open Access Journals (Sweden)

    Daniela Keilberg


    Full Text Available How cells establish and dynamically change polarity are general questions in cell biology. Cells of the rod-shaped bacterium Myxococcus xanthus move on surfaces with defined leading and lagging cell poles. Occasionally, cells undergo reversals, which correspond to an inversion of the leading-lagging pole polarity axis. Reversals are induced by the Frz chemosensory system and depend on relocalization of motility proteins between the poles. The Ras-like GTPase MglA localizes to and defines the leading cell pole in the GTP-bound form. MglB, the cognate MglA GTPase activating protein, localizes to and defines the lagging pole. During reversals, MglA-GTP and MglB switch poles and, therefore, dynamically localized motility proteins switch poles. We identified the RomR response regulator, which localizes in a bipolar asymmetric pattern with a large cluster at the lagging pole, as important for motility and reversals. We show that RomR interacts directly with MglA and MglB in vitro. Furthermore, RomR, MglA, and MglB affect the localization of each other in all pair-wise directions, suggesting that RomR stimulates motility by promoting correct localization of MglA and MglB in MglA/RomR and MglB/RomR complexes at opposite poles. Moreover, localization analyses suggest that the two RomR complexes mutually exclude each other from their respective poles. We further show that RomR interfaces with FrzZ, the output response regulator of the Frz chemosensory system, to regulate reversals. Thus, RomR serves at the functional interface to connect a classic bacterial signalling module (Frz to a classic eukaryotic polarity module (MglA/MglB. This modular design is paralleled by the phylogenetic distribution of the proteins, suggesting an evolutionary scheme in which RomR was incorporated into the MglA/MglB module to regulate cell polarity followed by the addition of the Frz system to dynamically regulate cell polarity.

  15. Myxococcus xanthus DK1622 Coordinates Expressions of the Duplicate groEL and Single groES Genes for Synergistic Functions of GroELs and GroES

    Directory of Open Access Journals (Sweden)

    Yue-zhong Li


    Full Text Available Chaperonin GroEL (Cpn60 requires cofactor GroES (Cpn10 for protein refolding in bacteria that possess single groEL and groES genes in a bicistronic groESL operon. Among 4,861 completely-sequenced prokaryotic genomes, 884 possess duplicate groEL genes and 770 possess groEL genes with no neighboring groES. It is unclear whether stand-alone groEL requires groES in order to function and, if required, how duplicate groEL genes and unequal groES genes balance their expressions. In Myxococcus xanthus DK1622, we determined that, while duplicate groELs were alternatively deletable, the single groES that clusters with groEL1 was essential for cell survival. Either GroEL1 or GroEL2 required interactions with GroES for in vitro and in vivo functions. Deletion of groEL1 or groEL2 resulted in decreased expressions of both groEL and groES; and ectopic complementation of groEL recovered not only the groEL but also groES expressions. The addition of an extra groES gene upstream groEL2 to form a bicistronic operon had almost no influence on groES expression and the cell survival rate, whereas over-expression of groES using a self-replicating plasmid simultaneously increased the groEL expressions. The results indicated that M. xanthus DK1622 cells coordinate expressions of the duplicate groEL and single groES genes for synergistic functions of GroELs and GroES. We proposed a potential regulation mechanism for the expression coordination.

  16. Enhancer-binding proteins with a forkhead-associated domain and the sigma(54) regulon in Myxococcus xanthus fruiting body development

    DEFF Research Database (Denmark)

    Jelsbak, Lars; Givskov, Michael Christian; Kaiser, D.


    -binding proteins. Here we report the finding of an unusual group of 12 genes encoding sigma(54)-dependent enhancer-binding proteins containing a forkhead-associated (FHA) domain as their N-terminal sensory domain. FHA domains in other proteins recognize phosphothreonine residues. An insertion mutation in one...... donor cell. Because FHA domains respond to phosphothreonine-containing proteins, these results suggest a regulatory link to the abundant Ser/Thr protein kinases in M. xanthus....

  17. Heterologous Expression of the Oxytetracycline Biosynthetic Pathway in Myxococcus xanthus▿ (United States)

    Stevens, D. Cole; Henry, Michael R.; Murphy, Kimberly A.; Boddy, Christopher N.


    New natural products for drug discovery may be accessed by heterologous expression of bacterial biosynthetic pathways in metagenomic DNA libraries. However, a “universal” host is needed for this experiment. Herein, we show that Myxococcus xanthus is a potential “universal” host for heterologous expression of polyketide biosynthetic gene clusters. PMID:20208031

  18. Division of Labor in Biofilms: the Ecology of Cell Differentiation. (United States)

    van Gestel, Jordi; Vlamakis, Hera; Kolter, Roberto


    The dense aggregation of cells on a surface, as seen in biofilms, inevitably results in both environmental and cellular heterogeneity. For example, nutrient gradients can trigger cells to differentiate into various phenotypic states. Not only do cells adapt physiologically to the local environmental conditions, but they also differentiate into cell types that interact with each other. This allows for task differentiation and, hence, the division of labor. In this article, we focus on cell differentiation and the division of labor in three bacterial species: Myxococcus xanthus, Bacillus subtilis, and Pseudomonas aeruginosa. During biofilm formation each of these species differentiates into distinct cell types, in some cases leading to cooperative interactions. The division of labor and the cooperative interactions between cell types are assumed to yield an emergent ecological benefit. Yet in most cases the ecological benefits have yet to be elucidated. A notable exception is M. xanthus, in which cell differentiation within fruiting bodies facilitates the dispersal of spores. We argue that the ecological benefits of the division of labor might best be understood when we consider the dynamic nature of both biofilm formation and degradation.

  19. Growth responses of Escherichia coli and Myxococcus xanthus on ...

    African Journals Online (AJOL)

    Bacteria colonize surfaces responding to the physicochemical properties of substrates. A systematic study was carried out with growing single bacterial colonies on the surface of agar media to decipher the interaction between bacterial growth and substrate stiffness. We investigated the growth kinetics of wild-type ...

  20. Biofilms. (United States)

    López, Daniel; Vlamakis, Hera; Kolter, Roberto


    The ability to form biofilms is a universal attribute of bacteria. Biofilms are multicellular communities held together by a self-produced extracellular matrix. The mechanisms that different bacteria employ to form biofilms vary, frequently depending on environmental conditions and specific strain attributes. In this review, we emphasize four well-studied model systems to give an overview of how several organisms form biofilms: Escherichia coli, Pseudomonas aeruginosa, Bacillus subtilis, and Staphylococcus aureus. Using these bacteria as examples, we discuss the key features of biofilms as well as mechanisms by which extracellular signals trigger biofilm formation.

  1. Xanthusbase: adapting wikipedia principles to a model organism database


    Arshinoff, Bradley I.; Suen, Garret; Just, Eric M.; Merchant, Sohel M.; Kibbe, Warren A.; Chisholm, Rex L.; Welch, Roy D.


    xanthusBase () is the official model organism database (MOD) for the social bacterium Myxococcus xanthus. In many respects, M.xanthus represents the pioneer model organism (MO) for studying the genetic, biochemical, and mechanistic basis of prokaryotic multicellularity, a topic that has garnered considerable attention due to the significance of biofilms in both basic and applied microbiology research. To facilitate its utility, the design of xanthusBase incorporates open-source software, leve...

  2. Biofilms


    López, Daniel; Vlamakis, Hera; Kolter, Roberto


    The ability to form biofilms is a universal attribute of bacteria. Biofilms are multicellular communities held together by a self-produced extracellular matrix. The mechanisms that different bacteria employ to form biofilms vary, frequently depending on environmental conditions and specific strain attributes. In this review, we emphasize four well-studied model systems to give an overview of how several organisms form biofilms: Escherichia coli, Pseudomonas aeruginosa, Bacillus subtilis, and ...

  3. Myxococcus CsgA, Drosophila Sniffer, and human HSD10 are cardiolipin phospholipases. (United States)

    Boynton, Tye O'Hara; Shimkets, Lawrence Joseph


    Myxococcus xanthus development requires CsgA, a member of the short-chain alcohol dehydrogenase (SCAD) family of proteins. We show that CsgA and SocA, a protein that can replace CsgA function in vivo, oxidize the 2'-OH glycerol moiety on cardiolipin and phosphatidylglycerol to produce diacylglycerol (DAG), dihydroxyacetone, and orthophosphate. A lipid extract enriched in DAGs from wild-type cells initiates development and lipid body production in a csgA mutant to bypass the mutational block. This novel phospholipase C-like reaction is widespread. SCADs that prevent neurodegenerative disorders, such as Drosophila Sniffer and human HSD10, oxidize cardiolipin with similar kinetic parameters. HSD10 exhibits a strong preference for cardiolipin with oxidized fatty acids. This activity is inhibited in the presence of the amyloid β peptide. Three HSD10 variants associated with neurodegenerative disorders are inactive with cardiolipin. We suggest that HSD10 protects humans from reactive oxygen species by removing damaged cardiolipin before it induces apoptosis. © 2015 Boynton and Shimkets; Published by Cold Spring Harbor Laboratory Press.

  4. Efficient expression and characterization of a cold-active endo-1, 4-β-glucanase from Citrobacter farmeri by co-expression of Myxococcus xanthus protein S

    Directory of Open Access Journals (Sweden)

    Xi Bai


    Conclusions: The ProS-EglC is promising in application of various biotechnological processes because of its cold-active characterizations. This study also suggests a useful strategy for the expression of foreign proteins in E. coli using a ProS tag.

  5. Combating biofilms

    DEFF Research Database (Denmark)

    Yang, Liang; Liu, Yang; Wu, Hong


    Biofilms are complex microbial communities consisting of microcolonies embedded in a matrix of self-produced polymer substances. Biofilm cells show much greater resistance to environmental challenges including antimicrobial agents than their free-living counterparts. The biofilm mode of life...... is believed to significantly contribute to successful microbial survival in hostile environments. Conventional treatment, disinfection and cleaning strategies do not proficiently deal with biofilm-related problems, such as persistent infections and contamination of food production facilities. In this review......, strategies to control biofilms are discussed, including those of inhibition of microbial attachment, interference of biofilm structure development and differentiation, killing of biofilm cells and induction of biofilm dispersion....

  6. Biofilm Risks

    DEFF Research Database (Denmark)

    Wirtanen, Gun Linnea; Salo, Satu


    This chapter on biofilm risks deals with biofilm formation of pathogenic microbes, sampling and detection methods, biofilm removal, and prevention of biofilm formation. Several common pathogens produce sticky and/or slimy structures in which the cells are embedded, that is, biofilms, on various...... surfaces in food processing. Biofilms of common foodborne pathogens are reviewed. The issue of persistent and nonpersistent microbial contamination in food processing is also discussed. It has been shown that biofilms can be difficult to remove and can thus cause severe disinfection and cleaning problems...... in food factories. In the prevention of biofilm formation microbial control in process lines should both limit the number of microbes on surfaces and reduce microbial activity in the process. Thus the hygienic design of process equipment and process lines is important in improving the process hygiene...

  7. Salmonella biofilms

    NARCIS (Netherlands)

    Castelijn, G.A.A.


    Biofilm formation by Salmonellaspp. is a problem in the food industry, since biofilms may act as a persistent source of product contamination. Therefore the aim of this study was to obtain more insight in the processes involved and the factors contributing to Salmonellabiofilm

  8. Biofilm Infections

    DEFF Research Database (Denmark)

    Bjarnsholt, Thomas; Jensen, Peter Østrup; Moser, Claus Ernst

    A still increasing interest and emphasis on the sessile bacterial lifestyle biofilms has been seen since it was realized that the vast majority of the total microbial biomass exists as biofilms. Aggregation of bacteria was first described by Leeuwenhoek in 1677, but only recently recognized...... as being important in chronic infection. In 1993 the American Society for Microbiology (ASM) recognized that the biofilm mode of growth was relevant to microbiology. This book covers both the evidence for biofilms in many chronic bacterial infections as well as the problems facing these infections...... such as diagnostics, pathogenesis, treatment regimes and in vitro and in vivo models for studying biofilms. This is the first scientific book on biofilm infections, chapters written by the world leading scientist and clinicians. The intended audience of this book is scientists, teachers at university level as well...

  9. Biofilm Development

    DEFF Research Database (Denmark)

    Tolker-Nielsen, Tim


    During the past decade we have gained much knowledge about the molecular mechanisms that are involved in initiation and termination of biofilm formation. In many bacteria, these processes appear to occur in response to specific environmental cues and result in, respectively, induction or terminat......During the past decade we have gained much knowledge about the molecular mechanisms that are involved in initiation and termination of biofilm formation. In many bacteria, these processes appear to occur in response to specific environmental cues and result in, respectively, induction...... or termination of biofilm matrix production via the second messenger molecule c-di-GMP. In between initiation and termination of biofilm formation we have defined specific biofilm stages, but the currently available evidence suggests that these transitions are mainly governed by adaptive responses......, and not by specific genetic programs. It appears that biofilm formation can occur through multiple pathways and that the spatial structure of the biofilms is species dependent as well as dependent on environmental conditions. Bacterial subpopulations, e.g., motile and nonmotile subpopulations, can develop...

  10. NCBI nr-aa BLAST: CBRC-OCUN-01-1368 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-OCUN-01-1368 ref|YP_633021.1| adventurous gliding motility protein AgmX [Myxoc...occus xanthus DK 1622] gb|ABF87224.1| adventurous gliding motility protein AgmX [Myxococcus xanthus DK 1622] YP_633021.1 3e-05 27% ...

  11. Wound biofilms: lessons learned from oral biofilms


    Mancl, Kimberly A.; Kirsner, Robert S.; Ajdic, Dragana


    Biofilms play an important role in the development and pathogenesis of many chronic infections. Oral biofilms, more commonly known as dental plaque,are a primary cause of oral diseases including caries, gingivitis and periodontitis. Oral biofilms are commonly studied as model biofilm systems as they are easily accessible, thus biofilm research in oral diseases is advanced with details of biofilm formation and bacterial interactions being well-elucidated. In contrast, wound research has relati...

  12. Hydraulic resistance of biofilms

    KAUST Repository

    Dreszer, C.; Vrouwenvelder, Johannes S.; Paulitsch-Fuchs, Astrid H.; Zwijnenburg, Arie; Kruithof, Joop C.; Flemming, Hans Curt


    resistance is very low compared to the expected biofilm resistance and, thus, biofilm resistance can be determined accurately. Transmembrane pressure drop was monitored. As biofilm parameters, thickness, total cell number, TOC, and extracellular polymeric

  13. Biocontrol Activity of Myxococcus sp. KYC 1126 against Phytophthora Blight on Hot Pepper

    Directory of Open Access Journals (Sweden)

    Sung Chul Yun


    Full Text Available Bacteriolytic myxobacteria have been known to secrete various antifungal metabolites against several soilborne phytopathogens including Phytophthora. Among the three isolates of Myxococcus spp., KYC 1126 and KYC 1136 perfectly inhibited the mycelial growth of Phytophtora capsici in vitro. In order to show the biocontrol activity on Phytophthora blight of hot pepper, we tried to find the best way of application of myxobacterial isolate. Although KYC 1126 fruiting body was easily grown on the colony of Escherichia coli as a nutrient source, it did not control the disease when it was pre-applied in soil. Before the bioassay of a liquid culture filtrate of KYC 1126 was conducted, its antifungal activity was confirmed on the seedlings applying with the mixture of the pathogen`s zoospore suspension and KYC 1126 filtrate. On greenhouse experiments with five and four replications, the control value of KYC 1126 on phyllosphere and rhizosphere was 88% and 36%, respectively. Whereas, the control value of dimetnomorph+propineb on phyllosphere was 100% and that of propamorcarb on rhizosphere was 44%. There was a phytotoxicity of the myxobacterial filtrate when seedlings were washed and soaked for 24 hours. Gummy materials were covered with roots. And stem and petiole were constricted, then a whole seedling was eventually blighted.

  14. The in vivo biofilm

    DEFF Research Database (Denmark)

    Bjarnsholt, Thomas; Alhede, Maria; Alhede, Morten


    Bacteria can grow and proliferate either as single, independent cells or organized in aggregates commonly referred to as biofilms. When bacteria succeed in forming a biofilm within the human host, the infection often becomes very resistant to treatment and can develop into a chronic state. Biofilms...... have been studied for decades using various in vitro models, but it remains debatable whether such in vitro biofilms actually resemble in vivo biofilms in chronic infections. In vivo biofilms share several structural characteristics that differ from most in vitro biofilms. Additionally, the in vivo...... experimental time span and presence of host defenses differ from chronic infections and the chemical microenvironment of both in vivo and in vitro biofilms is seldom taken into account. In this review, we discuss why the current in vitro models of biofilms might be limited for describing infectious biofilms...

  15. Biophysics of biofilm infection. (United States)

    Stewart, Philip S


    This article examines a likely basis of the tenacity of biofilm infections that has received relatively little attention: the resistance of biofilms to mechanical clearance. One way that a biofilm infection persists is by withstanding the flow of fluid or other mechanical forces that work to wash or sweep microorganisms out of the body. The fundamental criterion for mechanical persistence is that the biofilm failure strength exceeds the external applied stress. Mechanical failure of the biofilm and release of planktonic microbial cells is also important in vivo because it can result in dissemination of infection. The fundamental criterion for detachment and dissemination is that the applied stress exceeds the biofilm failure strength. The apparent contradiction for a biofilm to both persist and disseminate is resolved by recognizing that biofilm material properties are inherently heterogeneous. There are also mechanical aspects to the ways that infectious biofilms evade leukocyte phagocytosis. The possibility of alternative therapies for treating biofilm infections that work by reducing biofilm cohesion could (1) allow prevailing hydrodynamic shear to remove biofilm, (2) increase the efficacy of designed interventions for removing biofilms, (3) enable phagocytic engulfment of softened biofilm aggregates, and (4) improve phagocyte mobility and access to biofilm. © 2013 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved.

  16. Biofilm Fixed Film Systems

    Directory of Open Access Journals (Sweden)

    Dipesh Das


    Full Text Available The work reviewed here was published between 2008 and 2010 and describes research that involved aerobic and anoxic biofilm treatment of water pollutants. Biofilm denitrification systems are covered when appropriate. References catalogued here are divided on the basis of fundamental research area or reactor types. Fundamental research into biofilms is presented in two sections, Biofilm Measurement and Characterization and Growth and Modeling. The reactor types covered are: trickling filters, rotating biological contactors, fluidized bed bioreactors, submerged bed biofilm reactors, biological granular activated carbon, membrane bioreactors, and immobilized cell reactors. Innovative reactors, not easily classified, are then presented, followed by a section on biofilms on sand, soil and sediment.

  17. Pseudomonas aeruginosa Biofilm Infections

    DEFF Research Database (Denmark)

    Rybtke, Morten; Hultqvist, Louise Dahl; Givskov, Michael


    Studies of biopsies from infectious sites, explanted tissue and medical devises have provided evidence that biofilms are the underlying cause of a variety of tissue-associated and implant-associated recalcitrant human infections. With a need for novel anti-biofilm treatment strategies, research...... in biofilm infection microbiology, biofilm formation mechanisms and biofilm-associated antimicrobial tolerance has become an important area in microbiology. Substantial knowledge about biofilm formation mechanisms, biofilm-associated antimicrobial tolerance and immune evasion mechanisms has been obtained...... through work with biofilms grown in in vitro experimental setups, and the relevance of this information in the context of chronic infections is being investigated by the use of animal models of infection. Because our current in vitro experimental setups and animal models have limitations, new advanced...

  18. The Biofilm Challenge

    DEFF Research Database (Denmark)

    Alhede, Maria; Alhede, Morten


    The concept of biofilms has emerged in the clinical setting during the last decade. Infections involving biofilms have been documented in all parts of the human body, and it is currently believed that the presence of biofilm-forming bacteria is equivalent to chronic infection. A quick Pubmed search...

  19. Pseudomonas aeruginosa biofilm infections

    DEFF Research Database (Denmark)

    Tolker-Nielsen, Tim


    Bacteria in natural, industrial and clinical settings predominantly live in biofilms, i.e., sessile structured microbial communities encased in self-produced extracellular matrix material. One of the most important characteristics of microbial biofilms is that the resident bacteria display...... a remarkable increased tolerance toward antimicrobial attack. Biofilms formed by opportunistic pathogenic bacteria are involved in devastating persistent medical device-associated infections, and chronic infections in individuals who are immune-compromised or otherwise impaired in the host defense. Because...... the use of conventional antimicrobial compounds in many cases cannot eradicate biofilms, there is an urgent need to develop alternative measures to combat biofilm infections. The present review is focussed on the important opportunistic pathogen and biofilm model organism Pseudomonas aeruginosa. Initially...

  20. Hydraulic resistance of biofilms

    KAUST Repository

    Dreszer, C.


    Biofilms may interfere with membrane performance in at least three ways: (i) increase of the transmembrane pressure drop, (ii) increase of feed channel (feed-concentrate) pressure drop, and (iii) increase of transmembrane passage. Given the relevance of biofouling, it is surprising how few data exist about the hydraulic resistance of biofilms that may affect the transmembrane pressure drop and membrane passage. In this study, biofilms were generated in a lab scale cross flow microfiltration system at two fluxes (20 and 100Lm-2h-1) and constant cross flow (0.1ms-1). As a nutrient source, acetate was added (1.0mgL-1 acetate C) besides a control without nutrient supply. A microfiltration (MF) membrane was chosen because the MF membrane resistance is very low compared to the expected biofilm resistance and, thus, biofilm resistance can be determined accurately. Transmembrane pressure drop was monitored. As biofilm parameters, thickness, total cell number, TOC, and extracellular polymeric substances (EPS) were determined, it was demonstrated that no internal membrane fouling occurred and that the fouling layer actually consisted of a grown biofilm and was not a filter cake of accumulated bacterial cells. At 20Lm-2h-1 flux with a nutrient dosage of 1mgL-1 acetate C, the resistance after 4 days reached a value of 6×1012m-1. At 100Lm-2h-1 flux under the same conditions, the resistance was 5×1013m-1. No correlation of biofilm resistance to biofilm thickness was found; Biofilms with similar thickness could have different resistance depending on the applied flux. The cell number in biofilms was between 4×107 and 5×108 cellscm-2. At this number, bacterial cells make up less than a half percent of the overall biofilm volume and therefore did not hamper the water flow through the biofilm significantly. A flux of 100Lm-2h-1 with nutrient supply caused higher cell numbers, more biomass, and higher biofilm resistance than a flux of 20Lm-2h-1. However, the biofilm thickness

  1. Meningococcal biofilm formation

    DEFF Research Database (Denmark)

    Lappann, M.; Haagensen, Janus Anders Juul; Claus, H.


    We show that in a standardized in vitro flow system unencapsulated variants of genetically diverse lineages of Neisseria meningitidis formed biofilms, that could be maintained for more than 96 h. Biofilm cells were resistant to penicillin, but not to rifampin or ciprofloxacin. For some strains......, microcolony formation within biofilms was observed. Microcolony formation in strain MC58 depended on a functional copy of the pilE gene encoding the pilus subunit pilin, and was associated with twitching of cells. Nevertheless, unpiliated pilE mutants formed biofilms showing that attachment and accumulation......X alleles was identified among genetically diverse meningococcal strains. PilX alleles differed in their propensity to support autoaggregation of cells in suspension, but not in their ability to support microcolony formation within biofilms in the continuous flow system....

  2. Biofilms in wounds

    DEFF Research Database (Denmark)

    Cooper, R A; Bjarnsholt, Thomas; Alhede, M


    Following confirmation of the presence of biofilms in chronic wounds, the term biofilm became a buzzword within the wound healing community. For more than a century pathogens have been successfully isolated and identified from wound specimens using techniques that were devised in the nineteenth...... extracellular polymeric substances (EPS). Cells within such aggregations (or biofilms) display varying physiological and metabolic properties that are distinct from those of planktonic cells, and which contribute to their persistence. There are many factors that influence healing in wounds and the discovery...... of biofilms in chronic wounds has provided new insight into the reasons why. Increased tolerance of biofilms to antimicrobial agents explains the limited efficacy of antimicrobial agents in chronic wounds and illustrates the need to develop new management strategies. This review aims to explain the nature...

  3. Studying bacterial multispecies biofilms

    DEFF Research Database (Denmark)

    Røder, Henriette Lyng; Sørensen, Søren Johannes; Burmølle, Mette


    The high prevalence and significance of multispecies biofilms have now been demonstrated in various bacterial habitats with medical, industrial, and ecological relevance. It is highly evident that several species of bacteria coexist and interact in biofilms, which highlights the need for evaluating...... the approaches used to study these complex communities. This review focuses on the establishment of multispecies biofilms in vitro, interspecies interactions in microhabitats, and how to select communities for evaluation. Studies have used different experimental approaches; here we evaluate the benefits...... and drawbacks of varying the degree of complexity. This review aims to facilitate multispecies biofilm research in order to expand the current limited knowledge on interspecies interactions. Recent technological advances have enabled total diversity analysis of highly complex and diverse microbial communities...

  4. Bacterial Polymertropism, the Response to Strain-Induced Alignment of Polymers (United States)

    Lemon, David J.

    In nature, bacteria often live in surface-associated communities known as biofilms. Biofilm-forming bacteria deposit a layer of polysaccharide on the surfaces they inhabit; hence, polysaccharide is their immediate environment on any surface. In this study, we examined how the physical characteristics of polysaccharide substrates influence the behavior of the biofilm-forming bacterium Myxococcus xanthus. M. xanthus colonies, and indeed those of the majority of biofilm-forming species tested, respond to the compression-induced deformation of polysaccharide substrates by preferentially spreading across the surface perpendicular to the axis of compression. This response is conserved across multiple distantly related phyla and is found in species with an array of distinct motility apparatuses.The birefringence and small angle X-ray scattering patterns of compressed polysaccharide substrates indicate that the directed surface movements of these bacteria consistently match the orientation of the long axes of aligned and tightly packed polysaccharide fibers in compressed substrates. Therefore, we refer to this behavior as polymertropism to denote that the directed movements are a response to the physical arrangement of the change in packing and alignment of the polymers in the substrate. In addition to altering the colony morphology we find the behavior of groups of cells, called flares, is also affected in several species resulting in increased flare speed, duration, and displacement on compressed gel substrates.We suggest that polymertropism, which requires a downward-facing motility apparatus in M. xanthus, may be responsible for the observed tendency of bacterial cells to follow trails of extruded and presumably aligned polysaccharides, which their neighbors secrete and deposit on the substrate as they move across it. Polymertropism may also play a role in the organization of bacteria in a biofilm, as the iterative process of polysaccharide trail deposition and

  5. Compaction and relaxation of biofilms

    KAUST Repository

    Valladares Linares, R.


    Operation of membrane systems for water treatment can be seriously hampered by biofouling. A better characterization of biofilms in membrane systems and their impact on membrane performance may help to develop effective biofouling control strategies. The objective of this study was to determine the occurrence, extent and timescale of biofilm compaction and relaxation (decompaction), caused by permeate flux variations. The impact of permeate flux changes on biofilm thickness, structure and stiffness was investigated in situ and non-destructively with optical coherence tomography using membrane fouling monitors operated at a constant crossflow velocity of 0.1 m s−1 with permeate production. The permeate flux was varied sequentially from 20 to 60 and back to 20 L m−2 h−1. The study showed that the average biofilm thickness on the membrane decreased after elevating the permeate flux from 20 to 60 L m−2 h−1 while the biofilm thickness increased again after restoring the original flux of 20 L m−2 h−1, indicating the occurrence of biofilm compaction and relaxation. Within a few seconds after the flux change, the biofilm thickness was changed and stabilized, biofilm compaction occurred faster than the relaxation after restoring the original permeate flux. The initial biofilm parameters were not fully reinstated: the biofilm thickness was reduced by 21%, biofilm stiffness had increased and the hydraulic biofilm resistance was elevated by 16%. Biofilm thickness was related to the hydraulic biofilm resistance. Membrane performance losses are related to the biofilm thickness, density and morphology, which are influenced by (variations in) hydraulic conditions. A (temporarily) permeate flux increase caused biofilm compaction, together with membrane performance losses. The impact of biofilms on membrane performance can be influenced (increased and reduced) by operational parameters. The article shows that a (temporary) pressure increase leads to more

  6. Interactions in multispecies biofilms

    DEFF Research Database (Denmark)

    Burmølle, Mette; Ren, Dawei; Bjarnsholt, Thomas


    The recent focus on complex bacterial communities has led to the recognition of interactions across species boundaries. This is particularly pronounced in multispecies biofilms, where synergistic interactions impact the bacterial distribution and overall biomass produced. Importantly, in a number...... of settings, the interactions in a multispecies biofilm affect its overall function, physiology, or surroundings, by resulting in enhanced resistance, virulence, or degradation of pollutants, which is of significant importance to human health and activities. The underlying mechanisms causing these synergistic...

  7. Bacteriophages and Biofilms

    Directory of Open Access Journals (Sweden)

    David R. Harper


    Full Text Available Biofilms are an extremely common adaptation, allowing bacteria to colonize hostile environments. They present unique problems for antibiotics and biocides, both due to the nature of the extracellular matrix and to the presence within the biofilm of metabolically inactive persister cells. Such chemicals can be highly effective against planktonic bacterial cells, while being essentially ineffective against biofilms. By contrast, bacteriophages seem to have a greater ability to target this common form of bacterial growth. The high numbers of bacteria present within biofilms actually facilitate the action of bacteriophages by allowing rapid and efficient infection of the host and consequent amplification of the bacteriophage. Bacteriophages also have a number of properties that make biofilms susceptible to their action. They are known to produce (or to be able to induce enzymes that degrade the extracellular matrix. They are also able to infect persister cells, remaining dormant within them, but re-activating when they become metabolically active. Some cultured biofilms also seem better able to support the replication of bacteriophages than comparable planktonic systems. It is perhaps unsurprising that bacteriophages, as the natural predators of bacteria, have the ability to target this common form of bacterial life.

  8. Optimized candidal biofilm microtiter assay

    NARCIS (Netherlands)

    Krom, Bastiaan P.; Cohen, Jesse B.; Feser, Gail E. McElhaney; Cihlar, Ronald L.

    Microtiter based candidal biofilm formation is commonly being used. Here we describe the analysis of factors influencing the development of candidal biofilms such as the coating with serum, growth medium and pH. The data reported here show that optimal candidal biofilm formation is obtained when

  9. Biofilm formation on abiotic surfaces

    DEFF Research Database (Denmark)

    Tang, Lone


    Bacteria can attach to any surface in contact with water and proliferate into complex communities enclosed in an adhesive matrix, these communities are called biofilms. The matrix makes the biofilm difficult to remove by physical means, and bacteria in biofilm can survive treatment with many...

  10. Alginate production affects Pseudomonas aeruginosa biofilm development and architecture, but is not essential for biofilm formation

    DEFF Research Database (Denmark)

    Stapper, A.P.; Narasimhan, G.; Oman, D.E.


    of their biofilm formation using confocal laser scanning microscopy. Biofilm Image Processing (BIP) and Community Statistics (COMSTAT) software programs were used to provide quantitative measurements of the two-dimensional biofilm images. All three strains formed distinguishable biofilm architectures, indicating...

  11. Dental biofilm infections

    DEFF Research Database (Denmark)

    Larsen, Tove; Fiehn, Nils-Erik


    and cause gingival inflammation and breakdown of supporting periodontal fibers and bone and ultimately tooth loss, i.e., gingivitis, chronic or aggressive periodontitis, and around dental implants, peri-implantitis. Furthermore, bacteria from the dental biofilm may spread to other parts of the body......-fermenting bacteria causing demineralization of teeth, dental caries, which may further lead to inflammation and necrosis in the pulp and periapical region, i.e., pulpitis and periapical periodontitis. In supra- and subgingival biofilms, predominantly gram-negative, anaerobic proteolytic bacteria will colonize...

  12. Pseudomonas aeruginosa Biofilms

    DEFF Research Database (Denmark)

    Alhede, Maria; Bjarnsholt, Thomas; Givskov, Michael


    biofilms, which protect the aggregated, biopolymer-embedded bacteria from the detrimental actions of antibiotic treatments and host immunity. A key component in the protection against innate immunity is rhamnolipid, which is a quorum sensing (QS)-regulated virulence factor. QS is a cell-to-cell signaling...... mechanism used to coordinate expression of virulence and protection of aggregated biofilm cells. Rhamnolipids are known for their ability to cause hemolysis and have been shown to cause lysis of several cellular components of the human immune system, for example, macrophages and polymorphonuclear leukocytes...

  13. Manipulatiaon of Biofilm Microbial Ecology

    Energy Technology Data Exchange (ETDEWEB)

    Burkhalter, R.; Macnaughton, S.J.; Palmer, R.J.; Smith, C.A.; Whitaker, K.W.; White, D.C.; Zinn, M.; kirkegaard, R.


    The Biofilm mode of growth provides such significant advantages to the members of the consortium that most organisms in important habitats are found in biofilms. The study of factors that allow manipulation of biofilm microbes in the biofilm growth state requires that reproducible biofilms by generated. The most effective monitoring of biofilm formation, succession and desquamation is with on-line monitoring of microbial biofilms with flowcell for direct observation. The biofilm growth state incorporates a second important factor, the heterogeneity in the distribution in time and space of the component members of the biofilm consortium. This heterogeneity is reflected not only in the cellular distribution but in the metabolic activity within a population of cells. Activity and cellular distribution can be mapped in four dimensions with confocal microscopy, and function can be ascertained by genetically manipulated reporter functions for specific genes or by vital stains. The methodology for understanding the microbial ecology of biofilms is now much more readily available and the capacity to manipulate biofilms is becoming an important feature of biotechnology.

  14. Bacterial biofilm and associated infections

    Directory of Open Access Journals (Sweden)

    Muhsin Jamal


    Full Text Available Microscopic entities, microorganisms that drastically affect human health need to be thoroughly investigated. A biofilm is an architectural colony of microorganisms, within a matrix of extracellular polymeric substance that they produce. Biofilm contains microbial cells adherent to one-another and to a static surface (living or non-living. Bacterial biofilms are usually pathogenic in nature and can cause nosocomial infections. The National Institutes of Health (NIH revealed that among all microbial and chronic infections, 65% and 80%, respectively, are associated with biofilm formation. The process of biofilm formation consists of many steps, starting with attachment to a living or non-living surface that will lead to formation of micro-colony, giving rise to three-dimensional structures and ending up, after maturation, with detachment. During formation of biofilm several species of bacteria communicate with one another, employing quorum sensing. In general, bacterial biofilms show resistance against human immune system, as well as against antibiotics. Health related concerns speak loud due to the biofilm potential to cause diseases, utilizing both device-related and non-device-related infections. In summary, the understanding of bacterial biofilm is important to manage and/or to eradicate biofilm-related diseases. The current review is, therefore, an effort to encompass the current concepts in biofilm formation and its implications in human health and disease.

  15. Manipulation of Biofilm Microbial Ecology

    Energy Technology Data Exchange (ETDEWEB)

    White, D.C.; Palmer, R.J., Jr.; Zinn, M.; Smith, C.A.; Burkhalter, R.; Macnaughton, S.J.; Whitaker, K.W.; Kirkegaard, R.D.


    The biofilm mode of growth provides such significant advantages to the members of the consortium that most organisms in important habitats are found in biofilms. The study of factors that allow manipulation of biofilm microbes in the biofilm growth state requires that reproducible biofilms be generated. The most effective monitoring of biofilm formation, succession and desaturation is with on-line monitoring of microbial biofilms with flowcell for direct observation. The biofilm growth state incorporates a second important factor, the heterogeneity in distribution in time and space of the component members of the biofilm consortium. This heterogeneity is reflected not only in the cellular distribution but in the metabolic activity within a population of cells. Activity and cellular distribution can be mapped in four dimensions with confocal microscopy, and function can be ascertained by genetically manipulated reporter functions for specific genes or by vital stains. The methodology for understanding the microbial ecology of biofilms is now much more readily available and the capacity to manipulate biofilms is becoming an important feature of biotechnology.

  16. Biofilm in endodontics: A review (United States)

    Jhajharia, Kapil; Parolia, Abhishek; Shetty, K Vikram; Mehta, Lata Kiran


    Endodontic disease is a biofilm-mediated infection, and primary aim in the management of endodontic disease is the elimination of bacterial biofilm from the root canal system. The most common endodontic infection is caused by the surface-associated growth of microorganisms. It is important to apply the biofilm concept to endodontic microbiology to understand the pathogenic potential of the root canal microbiota as well as to form the basis for new approaches for disinfection. It is foremost to understand how the biofilm formed by root canal bacteria resists endodontic treatment measures. Bacterial etiology has been confirmed for common oral diseases such as caries and periodontal and endodontic infections. Bacteria causing these diseases are organized in biofilm structures, which are complex microbial communities composed of a great variety of bacteria with different ecological requirements and pathogenic potential. The biofilm community not only gives bacteria effective protection against the host's defense system but also makes them more resistant to a variety of disinfecting agents used as oral hygiene products or in the treatment of infections. Successful treatment of these diseases depends on biofilm removal as well as effective killing of biofilm bacteria. So, the fundamental to maintain oral health and prevent dental caries, gingivitis, and periodontitis is to control the oral biofilms. From these aspects, the formation of biofilms carries particular clinical significance because not only host defense mechanisms but also therapeutic efforts including chemical and mechanical antimicrobial treatment measures have the most difficult task of dealing with organisms that are gathered in a biofilm. The aim of this article was to review the mechanisms of biofilms’ formation, their roles in pulpal and periapical pathosis, the different types of biofilms, the factors influencing biofilm formation, the mechanisms of their antimicrobial resistance, techniques to

  17. Biofilm roughness determines Cryptosporidium parvum retention in environmental biofilms. (United States)

    DiCesare, E A Wolyniak; Hargreaves, B R; Jellison, K L


    The genus Cryptosporidium is a group of waterborne protozoan parasites that have been implicated in significant outbreaks of gastrointestinal infections throughout the world. Biofilms trap these pathogens and can contaminate water supplies through subsequent release. Biofilm microbial assemblages were collected seasonally from three streams in eastern Pennsylvania and used to grow biofilms in laboratory microcosms. Daily oocyst counts in the influx and efflux flow allowed the calculation of daily oocyst retention in the biofilm. Following the removal of oocysts from the influx water, oocyst attachment to the biofilm declined to an equilibrium state within 5 days that was sustained for at least 25 days. Varying the oocyst loading rate for the system showed that biofilm retention could be saturated, suggesting that discrete binding sites determined the maximum number of oocysts retained. Oocyst retention varied seasonally but was consistent across all three sites; however, seasonal oocyst retention was not consistent across years at the same site. No correlation between oocyst attachment and any measured water quality parameter was found. However, oocyst retention was strongly correlated with biofilm surface roughness and roughness varied among seasons and across years. We hypothesize that biofilm roughness and oocyst retention are dependent on environmentally driven changes in the biofilm community rather than directly on water quality conditions. It is important to understand oocyst transport dynamics to reduce risks of human infection. Better understanding of factors controlling biofilm retention of oocysts should improve our understanding of oocyst transport at different scales.


    There is a paucity of information concerning any link between the microorganisms commonly found in biofilms of drinking water systems and their impacts on human health. For bacteria, culture-based techniques detect only a limited number of the total microorganisms associated wit...

  19. [Biofilms in otolaryngology]. (United States)

    Mena Viveros, Nicolás


    According to the National Institute of Health of the USA, «more than 60% of all microbial infections are caused by biofilms».'This can surprise us, but it is enough to consider that common infections like those of the genito-urinary tract, infections produced by catheters, middle ear infections in children, the formation of dental plaque and gingivitis are caused by biofilms, for this statement to seem more realistic. At present this is one of the subjects of great interest within medicine, particularly in otolaryngology. Bacteria have traditionally been considered to be in a free state without evident organization, partly perhaps by the ease of studying them in this form. Nevertheless, the reality is that, in nature, the great majority of these germs form complex colonies adhered to surfaces, colonies that have received the name of biofilms. These biofilms are more common than previously thought and almost all of the people have been in contact with them in the form of infections in the teeth or humid, slippery areas. New treatments that can eradicate them are currently being investigated. Copyright © 2012 Elsevier España, S.L. All rights reserved.

  20. New Technologies for Studying Biofilms (United States)



    Bacteria have traditionally been studied as single-cell organisms. In laboratory settings, aerobic bacteria are usually cultured in aerated flasks, where the cells are considered essentially homogenous. However, in many natural environments, bacteria and other microorganisms grow in mixed communities, often associated with surfaces. Biofilms are comprised of surface-associated microorganisms, their extracellular matrix material, and environmental chemicals that have adsorbed to the bacteria or their matrix material. While this definition of a biofilm is fairly simple, biofilms are complex and dynamic. Our understanding of the activities of individual biofilm cells and whole biofilm systems has developed rapidly, due in part to advances in molecular, analytical, and imaging tools and the miniaturization of tools designed to characterize biofilms at the enzyme level, cellular level, and systems level. PMID:26350329

  1. Silver against Pseudomonas aeruginosa biofilms

    DEFF Research Database (Denmark)

    Bjarnsholt, Thomas; Kirketerp-Møller, K.; Kristiansen, S.


    bacteria in both the planktonic and biofilm modes of growth. The action of silver on mature in vitro biofilms of Pseudomonas aeruginosa, a primary pathogen of chronic infected wounds, was investigated. The results show that silver is very effective against mature biofilms of P. aeruginosa......, but that the silver concentration is important. A concentration of 5-10 ig/mL silver sulfadiazine eradicated the biofilm whereas a lower concentration (1 ig/mL) had no effect. The bactericidal concentration of silver required to eradicate the bacterial biofilm was 10-100 times higher than that used to eradicate...... planktonic bacteria. These observations strongly indicate that the concentration of silver in currently available wound dressings is much too low for treatment of chronic biofilm wounds. It is suggested that clinicians and manufacturers of the said wound dressings consider whether they are treating wounds...

  2. Extracellular DNA Contributes to Dental Biofilm Stability

    DEFF Research Database (Denmark)

    Schlafer, Sebastian; Meyer, Rikke Louise; Dige, Irene


    dental biofilms. This study aimed to determine whether eDNA was part of the matrix in biofilms grown in situ in the absence of sucrose and whether treatment with DNase dispersed biofilms grown for 2.5, 5, 7.5, 16.5, or 24 h. Three hundred biofilms from 10 study participants were collected and treated...... the amount of biofilm in very early stages of growth (up to 7.5 h), but the treatment effect decreased with increasing biofilm age. This study proves the involvement of eDNA in dental biofilm formation and its importance for biofilm stability in the earliest stages. Further research is required to uncover...

  3. Biofilm and Dental Biomaterials

    Directory of Open Access Journals (Sweden)

    Marit Øilo


    Full Text Available All treatment involving the use of biomaterials in the body can affect the host in positive or negative ways. The microbiological environment in the oral cavity is affected by the composition and shape of the biomaterials used for oral restorations. This may impair the patients’ oral health and sometimes their general health as well. Many factors determine the composition of the microbiota and the formation of biofilm in relation to biomaterials such as, surface roughness, surface energy and chemical composition, This paper aims to give an overview of the scientific literature regarding the association between the chemical, mechanical and physical properties of dental biomaterials and oral biofilm formation, with emphasis on current research and future perspectives.

  4. Biofilms promote altruism. (United States)

    Kreft, Jan-Ulrich


    The origin of altruism is a fundamental problem in evolution, and the maintenance of biodiversity is a fundamental problem in ecology. These two problems combine with the fundamental microbiological question of whether it is always advantageous for a unicellular organism to grow as fast as possible. The common basis for these three themes is a trade-off between growth rate and growth yield, which in turn is based on irreversible thermodynamics. The trade-off creates an evolutionary alternative between two strategies: high growth yield at low growth rate versus high growth rate at low growth yield. High growth yield at low growth rate is a case of an altruistic strategy because it increases the fitness of the group by using resources economically at the cost of decreased fitness, or growth rate, of the individual. The group-beneficial behaviour is advantageous in the long term, whereas the high growth rate strategy is advantageous in the short term. Coexistence of species requires differences between their niches, and niche space is typically divided into four 'axes' (time, space, resources, predators). This neglects survival strategies based on cooperation, which extend the possibilities of coexistence, arguing for the inclusion of cooperation as the fifth 'axis'. Here, individual-based model simulations show that spatial structure, as in, for example, biofilms, is necessary for the origin and maintenance of this 'primitive' altruistic strategy and that the common belief that growth rate but not yield decides the outcome of competition is based on chemostat models and experiments. This evolutionary perspective on life in biofilms can explain long-known biofilm characteristics, such as the structural organization into microcolonies, the often-observed lack of mixing among microcolonies, and the shedding of single cells, as promoting the origin and maintenance of the altruistic strategy. Whereas biofilms enrich altruists, enrichment cultures, microbiology's paradigm

  5. [Bacterial biofilms and infection]. (United States)

    Lasa, I; Del Pozo, J L; Penadés, J R; Leiva, J


    In developed countries we tend to think of heart disease and the numerous forms of cancer as the main causes of mortality, but on a global scale infectious diseases come close, or may even be ahead: 14.9 million deaths in 2002 compared to cardiovascular diseases (16.9 million deaths) and cancer (7.1 million deaths) (WHO report 2004). The infectious agents responsible for human mortality have evolved as medical techniques and hygienic measures have changed. Modern-day acute infectious diseases caused by specialized bacterial pathogens such as diphtheria, tetanus, cholera, plague, which represented the main causes of death at the beginning of XX century, have been effectively controlled with antibiotics and vaccines. In their place, more than half of the infectious diseases that affect mildly immunocompromised patients involve bacterial species that are commensal with the human body; these can produce chronic infections, are resistant to antimicrobial agents and there is no effective vaccine against them. Examples of these infections are the otitis media, native valve endocarditis, chronic urinary infections, bacterial prostatitis, osteomyelitis and all the infections related to medical devices. Direct analysis of the surface of medical devices or of tissues that have been foci of chronic infections shows the presence of large numbers of bacteria surrounded by an exopolysaccharide matrix, which has been named the "biofilm". Inside the biofilm, bacteria grow protected from the action of the antibodies, phagocytic cells and antimicrobial treatments. In this article, we describe the role of bacterial biofilms in human persistent infections.

  6. Biofilm architecture in a novel pressurized biofilm reactor. (United States)

    Jiang, Wei; Xia, Siqing; Duan, Liang; Hermanowicz, Slawomir W


    A novel pure-oxygen pressurized biofilm reactor was operated at different organic loading, mechanical shear and hydrodynamic conditions to understand the relationships between biofilm architecture and its operation. The ultimate goal was to improve the performance of the biofilm reactor. The biofilm was labeled with seven stains and observed with confocal laser scanning microscopy. Unusual biofilm architecture of a ribbon embedded between two surfaces with very few points of attachment was observed. As organic loading increased, the biofilm morphology changed from a moderately rough layer into a locally smoother biomass with significant bulging protuberances, although the chemical oxygen demand (COD) removal efficiency remained unchanged at about 75%. At higher organic loadings, biofilms contained a larger fraction of active cells distributed uniformly within a proteinaceous matrix with decreasing polysaccharide content. Higher hydrodynamic shear in combination with high organic loading resulted in the collapse of biofilm structure and a substantial decrease in reactor performance (a COD removal of 16%). Moreover, the important role of proteins for the spatial distribution of active cells was demonstrated quantitatively.

  7. Staphylococcus aureus biofilms: recent developments in biofilm dispersal. (United States)

    Lister, Jessica L; Horswill, Alexander R


    Staphylococcus aureus is a major cause of nosocomial and community-acquired infections and represents a significant burden on the healthcare system. S. aureus attachment to medical implants and host tissue, and the establishment of a mature biofilm, play an important role in the persistence of chronic infections. The formation of a biofilm, and encasement of cells in a polymer-based matrix, decreases the susceptibility to antimicrobials and immune defenses, making these infections difficult to eradicate. During infection, dispersal of cells from the biofilm can result in spread to secondary sites and worsening of the infection. In this review, we discuss the current understanding of the pathways behind biofilm dispersal in S. aureus, with a focus on enzymatic and newly described broad-spectrum dispersal mechanisms. Additionally, we explore potential applications of dispersal in the treatment of biofilm-mediated infections.

  8. Antibiotic treatment of biofilm infections

    DEFF Research Database (Denmark)

    Ciofu, Oana; Rojo-Molinero, Estrella; Macià, María D.


    Bacterial biofilms are associated with a wide range of infections, from those related to exogenous devices, such as catheters or prosthetic joints, to chronic tissue infections such as those occurring in the lungs of cystic fibrosis patients. Biofilms are recalcitrant to antibiotic treatment due ...

  9. Experimental evolution in biofilm populations (United States)

    Steenackers, Hans P.; Parijs, Ilse; Foster, Kevin R.; Vanderleyden, Jozef


    Biofilms are a major form of microbial life in which cells form dense surface associated communities that can persist for many generations. The long-life of biofilm communities means that they can be strongly shaped by evolutionary processes. Here, we review the experimental study of evolution in biofilm communities. We first provide an overview of the different experimental models used to study biofilm evolution and their associated advantages and disadvantages. We then illustrate the vast amount of diversification observed during biofilm evolution, and we discuss (i) potential ecological and evolutionary processes behind the observed diversification, (ii) recent insights into the genetics of adaptive diversification, (iii) the striking degree of parallelism between evolution experiments and real-life biofilms and (iv) potential consequences of diversification. In the second part, we discuss the insights provided by evolution experiments in how biofilm growth and structure can promote cooperative phenotypes. Overall, our analysis points to an important role of biofilm diversification and cooperation in bacterial survival and productivity. Deeper understanding of both processes is of key importance to design improved antimicrobial strategies and diagnostic techniques. PMID:26895713

  10. Microalgal biofilms for wastewater treatment

    NARCIS (Netherlands)

    Boelee, N.C.


    The objective of this thesis was to explore the possibilities of using microalgal biofilms for the treatment of municipal wastewater, with a focus on the post-treatment of municipal wastewater effluent. The potential of microalgal biofilms for wastewater treatment was first investigated using a

  11. Microbial ecology of phototrophic biofilms

    NARCIS (Netherlands)

    Roeselers, G.


    Biofilms are layered structures of microbial cells and an extracellular matrix of polymeric substances, associated with surfaces and interfaces. Biofilms trap nutrients for growth of the enclosed microbial community and help prevent detachment of cells from surfaces in flowing systems. Phototrophic

  12. Bacterial Biofilms in Jones Tubes. (United States)

    Ahn, Eric S; Hauck, Matthew J; Kirk Harris, Jonathan; Robertson, Charles E; Dailey, Roger A

    To investigate the presence and microbiology of bacterial biofilms on Jones tubes (JTs) by direct visualization with scanning electron microscopy and polymerase chain reaction (PCR) of representative JTs, and to correlate these findings with inflammation and/or infection related to the JT. In this study, prospective case series were performed. JTs were recovered from consecutive patients presenting to clinic for routine cleaning or recurrent irritation/infection. Four tubes were processed for scanning electron microscopy alone to visualize evidence of biofilms. Two tubes underwent PCR alone for bacterial quantification. One tube was divided in half and sent for scanning electron microscopy and PCR. Symptoms related to the JTs were recorded at the time of recovery. Seven tubes were obtained. Five underwent SEM, and 3 out of 5 showed evidence of biofilms (60%). Two of the 3 biofilms demonstrated cocci and the third revealed rods. Three tubes underwent PCR. The predominant bacteria identified were Pseudomonadales (39%), Pseudomonas (16%), and Staphylococcus (14%). Three of the 7 patients (43%) reported irritation and discharge at presentation. Two symptomatic patients, whose tubes were imaged only, revealed biofilms. The third symptomatic patient's tube underwent PCR only, showing predominantly Staphylococcus (56%) and Haemophilus (36%) species. Two of the 4 asymptomatic patients also showed biofilms. All symptomatic patients improved rapidly after tube exchange and steroid antibiotic drops. Bacterial biofilms were variably present on JTs, and did not always correlate with patients' symptoms. Nevertheless, routine JT cleaning is recommended to treat and possibly prevent inflammation caused by biofilms.

  13. Interaction of Nanoparticles with Biofilms (United States)

    In this work we have studied the interaction and adsorption of engineered nanoparticles such as TiO2, ZnO, CeO2 , and carbon nanotubes with biofilms. Biofilm is an extracellular polymeric substance coating comprised of living material and it is an aggregation of bacteria, algae, ...

  14. Biofilm models of polymicrobial infection. (United States)

    Gabrilska, Rebecca A; Rumbaugh, Kendra P


    Interactions between microbes are complex and play an important role in the pathogenesis of infections. These interactions can range from fierce competition for nutrients and niches to highly evolved cooperative mechanisms between different species that support their mutual growth. An increasing appreciation for these interactions, and desire to uncover the mechanisms that govern them, has resulted in a shift from monomicrobial to polymicrobial biofilm studies in different disease models. Here we provide an overview of biofilm models used to study select polymicrobial infections and highlight the impact that the interactions between microbes within these biofilms have on disease progression. Notable recent advances in the development of polymicrobial biofilm-associated infection models and challenges facing the study of polymicrobial biofilms are addressed.

  15. Antibiotic resistance of bacterial biofilms

    DEFF Research Database (Denmark)

    Hoiby, N.; Bjarnsholt, T.; Givskov, M.


    A biofilm is a structured consortium of bacteria embedded in a self-produced polymer matrix consisting of polysaccharide, protein and DNA. Bacterial biofilms cause chronic infections because they show increased tolerance to antibiotics and disinfectant chemicals as well as resisting phagocytosis...... and other components of the body's defence system. The persistence of, for example, staphylococcal infections related to foreign bodies is due to biofilm formation. Likewise, chronic Pseudomonas aeruginosa lung infection in cystic fibrosis patients is caused by biofilm-growing mucoid strains....... Characteristically, gradients of nutrients and oxygen exist from the top to the bottom of biofilms and these gradients are associated with decreased bacterial metabolic activity and increased doubling times of the bacterial cells; it is these more or less dormant cells that are responsible for some of the tolerance...

  16. Antibiotic tolerance and microbial biofilms

    DEFF Research Database (Denmark)

    Folkesson, Anders

    Increased tolerance to antimicrobial agents is thought to be an important feature of microbes growing in biofilms. We study the dynamics of antibiotic action within hydrodynamic flow chamber biofilms of Escherichia coli and Pseudomonas aeruginosa using isogenic mutants and fluorescent gene...... expression reporters and we address the question of how biofilm organization affects antibiotic susceptibility. The dynamics of microbial killing is monitored by viable count determination, and confocal laser microscopy. Our work shows that the apparent increased antibiotic tolerance is due to the formation...... of antibiotic tolerant subpopulations within the biofilm. The formation of these subpopulations is highly variable and dependent on the antibiotic used, the biofilm structural organization and the induction of specific tolerance mechanisms....

  17. Impact of Hydrodynamics on Oral Biofilm Strength

    NARCIS (Netherlands)

    Paramonova, E.; Kalmykowa, O. J.; van der Mei, H. C.; Busscher, H. J.; Sharma, P. K.


    Mechanical removal of oral biofilms is ubiquitously accepted as the best way to prevent caries and periodontal diseases. Removal effectiveness strongly depends on biofilm strength. To investigate the influence of hydrodynamics on oral biofilm strength, we grew single- and multi-species biofilms of

  18. Confocal microscopy imaging of the biofilm matrix

    DEFF Research Database (Denmark)

    Schlafer, Sebastian; Meyer, Rikke L


    The extracellular matrix is an integral part of microbial biofilms and an important field of research. Confocal laser scanning microscopy is a valuable tool for the study of biofilms, and in particular of the biofilm matrix, as it allows real-time visualization of fully hydrated, living specimens...... the concentration of solutes and the diffusive properties of the biofilm matrix....

  19. Oral Biofilm Architecture on Natural Teeth

    NARCIS (Netherlands)

    Zijnge, Vincent; van Leeuwen, M. Barbara M.; Degener, John E.; Abbas, Frank; Thurnheer, Thomas; Gmuer, Rudolf; Harmsen, Hermie J. M.


    Periodontitis and caries are infectious diseases of the oral cavity in which oral biofilms play a causative role. Moreover, oral biofilms are widely studied as model systems for bacterial adhesion, biofilm development, and biofilm resistance to antibiotics, due to their widespread presence and

  20. Bacterial biofilms: prokaryotic adventures in multicellularity

    DEFF Research Database (Denmark)

    Webb, J.S.; Givskov, Michael Christian; Kjelleberg, S.


    The development of bacterial biofilms includes both the initial social behavior of undifferentiated cells, as well as cell death and differentiation in the mature biofilm, and displays several striking similarities with higher organisms. Recent advances in the field provide new insight...... into differentiation and cell death events in bacterial biofilm development and propose that biofilms have an unexpected level of multicellularity....

  1. Growing and analyzing biofilms in flow chambers

    DEFF Research Database (Denmark)

    Tolker-Nielsen, Tim; Sternberg, Claus


    This unit describes the setup of flow chamber systems for the study of microbial biofilms, and methods for the analysis of structural biofilm formation. Use of flow chambers allows direct microscopic investigation of biofilm formation. The biofilms in flow chambers develop under hydrodynamic......, and disassembly and cleaning of the system. In addition, embedding and fluorescent in situ hybridization of flow chamber-grown biofilms are addressed....

  2. Conductive properties of methanogenic biofilms. (United States)

    Li, Cheng; Lesnik, Keaton Larson; Liu, Hong


    Extracellular electron transfer between syntrophic partners needs to be efficiently maintained in methanogenic environments. Direct extracellular electron transfer via electrical current is an alternative to indirect hydrogen transfer but requires construction of conductive extracellular structures. Conductive mechanisms and relationship between conductivity and the community composition in mixed-species methanogenic biofilms are not well understood. The present study investigated conductive behaviors of methanogenic biofilms and examined the correlation between biofilm conductivity and community composition between different anaerobic biofilms enriched from the same inoculum. Highest conductivity observed in methanogenic biofilms was 71.8±4.0μS/cm. Peak-manner response of conductivity upon changes over a range of electrochemical potentials suggests that electron transfer in methanogenic biofilms occurs through redox driven super-exchange. The strong correlation observed between biofilm conductivity and Geobacter spp. in the metabolically diverse anaerobic communities suggests that the efficiency of DEET may provide pressure for microbial communities to select for species that can produce electrical conduits. Copyright © 2017 Elsevier B.V. All rights reserved.

  3. Biofilm models for the practitioner

    DEFF Research Database (Denmark)

    Morgenroth, Eberhard Friedrich; van Loosdrecht, M. C. M.; Wanner, O.


    Even though mathematical biofilm models are extensively used in biofilm research, there has been very little application of these models in the engineering practice so far. However, practitioners would be interested in models that can be used as tools to control plant operation under dynamic...... conditions or to help them handle complex interactions between particle removal, carbon oxidation, nitrification, denitrification and biological phosphorus removal. But even though there is a whole range of biofilm models available, it is difficult for the practitioner to select the appropriate modeling...

  4. Stratified growth in Pseudomonas aeruginosa biofilms

    DEFF Research Database (Denmark)

    Werner, E.; Roe, F.; Bugnicourt, A.


    In this study, stratified patterns of protein synthesis and growth were demonstrated in Pseudomonas aeruginosa biofilms. Spatial patterns of protein synthetic activity inside biofilms were characterized by the use of two green fluorescent protein (GFP) reporter gene constructs. One construct...... synthesis was restricted to a narrow band in the part of the biofilm adjacent to the source of oxygen. The zone of active GFP expression was approximately 60 Am wide in colony biofilms and 30 Am wide in flow cell biofilms. The region of the biofilm in which cells were capable of elongation was mapped...... by treating colony biofilms with carbenicillin, which blocks cell division, and then measuring individual cell lengths by transmission electron microscopy. Cell elongation was localized at the air interface of the biofilm. The heterogeneous anabolic patterns measured inside these biofilms were likely a result...

  5. Novel method for quantitative estimation of biofilms

    DEFF Research Database (Denmark)

    Syal, Kirtimaan


    Biofilm protects bacteria from stress and hostile environment. Crystal violet (CV) assay is the most popular method for biofilm determination adopted by different laboratories so far. However, biofilm layer formed at the liquid-air interphase known as pellicle is extremely sensitive to its washing...... and staining steps. Early phase biofilms are also prone to damage by the latter steps. In bacteria like mycobacteria, biofilm formation occurs largely at the liquid-air interphase which is susceptible to loss. In the proposed protocol, loss of such biofilm layer was prevented. In place of inverting...... and discarding the media which can lead to the loss of the aerobic biofilm layer in CV assay, media was removed from the formed biofilm with the help of a syringe and biofilm layer was allowed to dry. The staining and washing steps were avoided, and an organic solvent-tetrahydrofuran (THF) was deployed...

  6. Hydrodynamic dispersion within porous biofilms

    KAUST Repository

    Davit, Y.; Byrne, H.; Osborne, J.; Pitt-Francis, J.; Gavaghan, D.; Quintard, M.


    Many microorganisms live within surface-associated consortia, termed biofilms, that can form intricate porous structures interspersed with a network of fluid channels. In such systems, transport phenomena, including flow and advection, regulate

  7. Bacterial biofilms and antibiotic resistance

    Directory of Open Access Journals (Sweden)

    Liliana Caldas-Arias


    Full Text Available Biofilms give to bacteria micro-environmental benefits; confers protection against antimicrobials. Bacteria have antibiotic resistance by conventional and unusual mechanisms leading to delayed wound healing, to increase recurrent chronic infections and nosocomial contamination of medical devices. Objective: This narrative review aims to introduce the characteristics of Bacteria-biofilms, antimicrobial resistance mechanisms and potential alternatives for prevention and control of its formation. Methods: Search strategy was performed on records: PubMed / Medline, Lilacs, Redalyc; with suppliers such as EBSCO and thesaurus MeSH and DeCS. Conclusions: Knowledge and research performance of biofilm bacteria are relevant in the search of technology for detection and measuring sensitivity to antibiotics. The identification of Bacterial-biofilms needs no-traditional microbiological diagnosis.

  8. Exploiting social evolution in biofilms

    DEFF Research Database (Denmark)

    Boyle, Kerry E; Heilmann, Silja; van Ditmarsch, Dave


    Bacteria are highly social organisms that communicate via signaling molecules, move collectively over surfaces and make biofilm communities. Nonetheless, our main line of defense against pathogenic bacteria consists of antibiotics-drugs that target individual-level traits of bacterial cells...... and thus, regrettably, select for resistance against their own action. A possible solution lies in targeting the mechanisms by which bacteria interact with each other within biofilms. The emerging field of microbial social evolution combines molecular microbiology with evolutionary theory to dissect...... the molecular mechanisms and the evolutionary pressures underpinning bacterial sociality. This exciting new research can ultimately lead to new therapies against biofilm infections that exploit evolutionary cheating or the trade-off between biofilm formation and dispersal....

  9. Biofilms: Community Behavior by Bacteria

    Indian Academy of Sciences (India)

    IAS Admin

    United we stand, divided we fall. This is a ... controls biofilm development, swarming motility and the produc- ... thought that the absence of overt gut flora upsets the balance .... there are several risks of integration which makes this strategy.

  10. Compaction and relaxation of biofilms

    KAUST Repository

    Valladares Linares, R.; Wexler, A. D.; Bucs, Szilard; Dreszer, C.; Zwijnenburg, A.; Flemming, H. C.; Kruithof, J. C.; Vrouwenvelder, Johannes S.


    Operation of membrane systems for water treatment can be seriously hampered by biofouling. A better characterization of biofilms in membrane systems and their impact on membrane performance may help to develop effective biofouling control strategies

  11. Biofilm in endodontics: a review


    Zambrano de la Peña, Sonia; Salcedo-Moncada, Doris; Petkova- Gueorguieva, Marieta; Ventocilla Huasupoma, María


    It is demonstrated the efforts made endodontic microbiology and science to get to decipher the secrets of this unique structure although every day new questions arise. We need the treatments we use to combat biofilm achieve oxygenate the periapical ecosystem and basically scrape and loosen the tightly adhering bacteria Knowing the process of biofilm formation, microbial metabolism and strategies that they use to resist and remain hidden but active , we know why we observe refractory periapica...

  12. Critical review on biofilm methods

    DEFF Research Database (Denmark)

    Azeredo, Joana; F. Azevedo, Nuno; Briandet, Romain


    Biofilms are widespread in nature and constitute an important strategy implemented by microorganisms to survive in sometimes harsh environmental conditions. They can be beneficial or have a negative impact particularly when formed in industrial settings or on medical devices. As such, research in...... and limitations of several methods. Accordingly, this review aims at helping scientists in finding the most appropriate and up-to-date methods to study their biofilms....

  13. Plasticity of Candida albicans Biofilms (United States)

    Daniels, Karla J.


    SUMMARY Candida albicans, the most pervasive fungal pathogen that colonizes humans, forms biofilms that are architecturally complex. They consist of a basal yeast cell polylayer and an upper region of hyphae encapsulated in extracellular matrix. However, biofilms formed in vitro vary as a result of the different conditions employed in models, the methods used to assess biofilm formation, strain differences, and, in a most dramatic fashion, the configuration of the mating type locus (MTL). Therefore, integrating data from different studies can lead to problems of interpretation if such variability is not taken into account. Here we review the conditions and factors that cause biofilm variation, with the goal of engendering awareness that more attention must be paid to the strains employed, the methods used to assess biofilm development, every aspect of the model employed, and the configuration of the MTL locus. We end by posing a set of questions that may be asked in comparing the results of different studies and developing protocols for new ones. This review should engender the notion that not all biofilms are created equal. PMID:27250770

  14. Ciliates as engineers of phototrophic biofilms

    NARCIS (Netherlands)

    Weerman, Ellen J.; van der Geest, Harm G.; van der Meulen, Myra D.; Manders, Erik M. M.; van de Koppel, Johan; Herman, Peter M. J.; Admiraal, Wim

    1. Phototrophic biofilms consist of a matrix of phototrophs, non-photosynthetic bacteria and extracellular polymeric substances (EPS) which is spatially structured. Despite widespread exploitation of algae and bacteria within phototrophic biofilms, for example by protozoans, the 'engineering'

  15. Current understanding of multi-species biofilms

    DEFF Research Database (Denmark)

    Yang, Liang; Liu, Yang; Wu, Hong


    every year worldwide to deal with damage to equipment, contaminations of products, energy losses, and infections in human beings resulted from microbial biofilms. Microorganisms compete, cooperate, and communicate with each other in multi-species biofilms. Understanding the mechanisms of multi......Direct observation of a wide range of natural microorganisms has revealed the fact that the majority of microbes persist as surface-attached communities surrounded by matrix materials, called biofilms. Biofilms can be formed by a single bacterial strain. However, most natural biofilms are actually......-species biofilm formation will facilitate the development of methods for combating bacterial biofilms in clinical, environmental, industrial, and agricultural areas. The most recent advances in the understanding of multi-species biofilms are summarized and discussed in the review....

  16. Killing of Serratia marcescens biofilms with chloramphenicol. (United States)

    Ray, Christopher; Shenoy, Anukul T; Orihuela, Carlos J; González-Juarbe, Norberto


    Serratia marcescens is a Gram-negative bacterium with proven resistance to multiple antibiotics and causative of catheter-associated infections. Bacterial colonization of catheters mainly involves the formation of biofilm. The objectives of this study were to explore the susceptibility of S. marcescens biofilms to high doses of common antibiotics and non-antimicrobial agents. Biofilms formed by a clinical isolate of S. marcescens were treated with ceftriaxone, kanamycin, gentamicin, and chloramphenicol at doses corresponding to 10, 100 and 1000 times their planktonic minimum inhibitory concentration. In addition, biofilms were also treated with chemical compounds such as polysorbate-80 and ursolic acid. S. marcescens demonstrated susceptibility to ceftriaxone, kanamycin, gentamicin, and chloramphenicol in its planktonic form, however, only chloramphenicol reduced both biofilm biomass and biofilm viability. Polysorbate-80 and ursolic acid had minimal to no effect on either planktonic and biofilm grown S. marcescens. Our results suggest that supratherapeutic doses of chloramphenicol can be used effectively against established S. marcescens biofilms.

  17. Candida Biofilms: Development, Architecture, and Resistance (United States)



    Intravascular device–related infections are often associated with biofilms (microbial communities encased within a polysaccharide-rich extracellular matrix) formed by pathogens on the surfaces of these devices. Candida species are the most common fungi isolated from catheter-, denture-, and voice prosthesis–associated infections and also are commonly isolated from contact lens–related infections (e.g., fungal keratitis). These biofilms exhibit decreased susceptibility to most antimicrobial agents, which contributes to the persistence of infection. Recent technological advances have facilitated the development of novel approaches to investigate the formation of biofilms and identify specific markers for biofilms. These studies have provided extensive knowledge of the effect of different variables, including growth time, nutrients, and physiological conditions, on biofilm formation, morphology, and architecture. In this article, we will focus on fungal biofilms (mainly Candida biofilms) and provide an update on the development, architecture, and resistance mechanisms of biofilms. PMID:26350306

  18. Cleaning and Disinfection of Bacillus cereus Biofilm. (United States)

    Deal, Amanda; Klein, Dan; Lopolito, Paul; Schwarz, John Spencer


    Methodology has been evolving for the testing of disinfectants against bacterial single-species biofilms, as the difficulty of biofilm remediation continues to gain much-needed attention. Bacterial single-species biofilm contamination presents a real risk to good manufacturing practice-regulated industries. However, mixed-species biofilms and biofilms containing bacterial spores remain an even greater challenge for cleaning and disinfection. Among spore-forming microorganisms frequently encountered in pharmaceutical manufacturing areas, the spores of Bacillus cereus are often determined to be the hardest to disinfect and eradicate. One of the reasons for the low degree of susceptibility to disinfection is the ability of these spores to be encapsulated within an exopolysachharide biofilm matrix. In this series of experiments, we evaluated the disinfectant susceptibility of B. cereus biofilms relative to disassociated B. cereus spores and biofilm from a non-spore-forming species. Further, we assessed the impact that pre-cleaning has on increasing that susceptibility. Methodology has been evolving for the testing of disinfectants against bacterial single-species biofilms, as the difficulty of biofilm remediation continues to gain much-needed attention. Bacterial single-species biofilm contamination presents a real risk to good manufacturing practice-regulated industries. However, mixed-species biofilms and biofilms containing bacterial spores remain an even greater challenge for cleaning and disinfection. Among spore-forming microorganisms frequently encountered in pharmaceutical manufacturing areas, the spores of Bacillus cereus are often determined to be the hardest to disinfect and eradicate. One of the reasons for the low degree of susceptibility to disinfection is the ability of these spores to be encapsulated within an exopolysachharide biofilm matrix. In this series of experiments, we evaluated the disinfectant susceptibility of B. cereus biofilms relative to

  19. Maggot excretions inhibit biofilm formation on biomaterials. (United States)

    Cazander, Gwendolyn; van de Veerdonk, Mariëlle C; Vandenbroucke-Grauls, Christina M J E; Schreurs, Marco W J; Jukema, Gerrolt N


    Biofilm-associated infections in trauma surgery are difficult to treat with conventional therapies. Therefore, it is important to develop new treatment modalities. Maggots in captured bags, which are permeable for larval excretions/secretions, aid in healing severe, infected wounds, suspect for biofilm formation. Therefore we presumed maggot excretions/secretions would reduce biofilm formation. We studied biofilm formation of Staphylococcus aureus, Staphylococcus epidermidis, Klebsiella oxytoca, Enterococcus faecalis, and Enterobacter cloacae on polyethylene, titanium, and stainless steel. We compared the quantities of biofilm formation between the bacterial species on the various biomaterials and the quantity of biofilm formation after various incubation times. Maggot excretions/secretions were added to existing biofilms to examine their effect. Comb-like models of the biomaterials, made to fit in a 96-well microtiter plate, were incubated with bacterial suspension. The formed biofilms were stained in crystal violet, which was eluted in ethanol. The optical density (at 595 nm) of the eluate was determined to quantify biofilm formation. Maggot excretions/secretions were pipetted in different concentrations to (nonstained) 7-day-old biofilms, incubated 24 hours, and finally measured. The strongest biofilms were formed by S. aureus and S. epidermidis on polyethylene and the weakest on titanium. The highest quantity of biofilm formation was reached within 7 days for both bacteria. The presence of excretions/secretions reduced biofilm formation on all biomaterials. A maximum of 92% of biofilm reduction was measured. Our observations suggest maggot excretions/secretions decrease biofilm formation and could provide a new treatment for biofilm formation on infected biomaterials.

  20. Microbiële biofilms in tandheelkunde

    NARCIS (Netherlands)

    Krom, B.P.


    Aangehechte gemeenschappen van micro-organismen, ook wel biofilms genoemd, zijn altijd en overal aanwezig. Hoewel biofilms een slechte naam hebben, zijn ze meestal natuurlijk, gezond en zelfs gewenst. In de tandartspraktijk komen zowel gezonde (orale biofilms) als ongezonde (bijv. in de waterleiding

  1. Microbiële biofilms in tandheelkunde

    NARCIS (Netherlands)

    Krom, B.P.


    Aangehechte gemeenschappen van micro-organismen, ook wel biofilms genoemd, zijn altijd en overal aanwezig. Hoewel biofilms een slechte naam hebben, zijn ze meestal natuurlijk, gezond en zelfs gewenst. In de mondzorgpraktijk komen zowel gezonde (orale biofilms) als ongezonde (bijv. in de waterleiding

  2. Differential growth of wrinkled biofilms (United States)

    Espeso, D. R.; Carpio, A.; Einarsson, B.


    Biofilms are antibiotic-resistant bacterial aggregates that grow on moist surfaces and can trigger hospital-acquired infections. They provide a classical example in biology where the dynamics of cellular communities may be observed and studied. Gene expression regulates cell division and differentiation, which affect the biofilm architecture. Mechanical and chemical processes shape the resulting structure. We gain insight into the interplay between cellular and mechanical processes during biofilm development on air-agar interfaces by means of a hybrid model. Cellular behavior is governed by stochastic rules informed by a cascade of concentration fields for nutrients, waste, and autoinducers. Cellular differentiation and death alter the structure and the mechanical properties of the biofilm, which is deformed according to Föppl-Von Kármán equations informed by cellular processes and the interaction with the substratum. Stiffness gradients due to growth and swelling produce wrinkle branching. We are able to reproduce wrinkled structures often formed by biofilms on air-agar interfaces, as well as spatial distributions of differentiated cells commonly observed with B. subtilis.

  3. Medical biofilms--nanotechnology approaches. (United States)

    Neethirajan, Suresh; Clond, Morgan A; Vogt, Adam


    Biofilms are colonies of bacteria or fungi that adhere to a surface, protected by an extracellular polymer matrix composed of polysaccharides and extracellular DNA. They are highly complex and dynamic multicellular structures that resist traditional means of killing planktonic bacteria. Recent developments in nanotechnology provide novel approaches to preventing and dispersing biofilm infections, which are a leading cause of morbidity and mortality. Medical device infections are responsible for approximately 60% of hospital acquired infections. In the United States, the estimated cost of caring for healthcare-associated infections is approximately between $28 billion and $45 billion per year. In this review, we will discuss our current understanding of biofilm formation and degradation, its relevance to challenges in clinical practice, and new technological developments in nanotechnology that are designed to address these challenges.

  4. Synergistic Interactions in Multispecies Biofilms

    DEFF Research Database (Denmark)

    Ren, Dawei

    The coexistence of hugely diverse microbes in most environments highlights the intricate interactions in microbial communities, which are central to their properties, such as productivity, stability and the resilience to disturbance. Biofilm, in environmental habitats, is such a spatially...... multispecies biofilm models, oral microbial community, also known as “dental plaque” is thoroughly investigated as a focal point to describe the interspecies interactions [1]. However, owing to the lack of a reliable high throughput and quantitative approach for exploring the interplay between multiple...... bacterial species, the study to elucidate the impact of interaction networks on the multispecies biofilms in natural ecosystems, especially in soil, is still at an early stage. The diverse patterns of interactions within the mixed communities as well as the predatorprey relationship between protozoa...

  5. Growing and Analyzing Biofilms in Flow Chambers

    DEFF Research Database (Denmark)

    Tolker-Nielsen, Tim; Sternberg, Claus


    This unit describes the setup of flow chamber systems for the study of microbial biofilms, and methods for the analysis of structural biofilm formation. Use of flow chambers allows direct microscopic investigation of biofilm formation. The biofilms in flow chambers develop under hydrodynamic......, and disassembly and cleaning of the system. In addition, embedding and fluorescent in situ hybridization of flow chamber–grown biofilms are addressed. Curr. Protoc. Microbiol. 21:1B.2.1-1B.2.17. © 2011 by John Wiley & Sons, Inc....

  6. Pattern formation in Pseudomonas aeruginosa biofilms

    DEFF Research Database (Denmark)

    Parsek, Matthew R.; Tolker-Nielsen, Tim


    Bacteria are capable of forming elaborate multicellular communities called biofilms. Pattern formation in biofilms depends on cell proliferation and cellular migration in response to the available nutrients and other external cues, as well as on self-generated intercellular signal molecules...... and the production of an extracellular matrix that serves as a structural 'scaffolding' for the biofilm cells. Pattern formation in biofilms allows cells to position themselves favorably within nutrient gradients and enables buildup and maintenance of physiologically distinct subpopulations, which facilitates...... survival of one or more subpopulations upon environmental insult, and therefore plays an important role in the innate tolerance displayed by biofilms toward adverse conditions....

  7. Biofilm reactors for ethanol production

    Energy Technology Data Exchange (ETDEWEB)

    Vega, J L; Clausen, E C; Gaddy, J L


    Whole cell immobilization has been studied in the laboratory during the last few years as a method to improve the performance and economics of most fermentation processes. Among the various techniques available for cell immobilization, methods that provide generation of a biofilm offer reduced diffusional resistance, high productivities, and simple operation. This paper reviews some of the important aspects of biofilm reactors for ethanol production, including reactor start-up, steady state behavior, process stability, and mathematical modeling. Special emphasis is placed on covalently bonded Saccharomyces cerevisiae in packed bed reactors.

  8. A short history of microbial biofilms and biofilm infections

    DEFF Research Database (Denmark)

    Høiby, Niels


    The observation of aggregated microbes surrounded by a self-produced matrix adhering to surfaces or located in tissues or secretions is old since both Leeuwenhoek and Pasteur have described the phenomenon. In environmental and technical microbiology, biofilms, 80–90 years ago, were already shown ...

  9. Biofilm Induced Tolerance Towards Antimicrobial Peptides

    DEFF Research Database (Denmark)

    Folkesson, Anders; Haagensen, Janus Anders Juul; Zampaloni, Claudia


    Increased tolerance to antimicrobial agents is thought to be an important feature of microbes growing in biofilms. We address the question of how biofilm organization affects antibiotic susceptibility. We established Escherichia coli biofilms with differential structural organization due...... to the presence of IncF plasmids expressing altered forms of the transfer pili in two different biofilm model systems. The mature biofilms were subsequently treated with two antibiotics with different molecular targets, the peptide antibiotic colistin and the fluoroquinolone ciprofloxacin. The dynamics...... of microbial killing were monitored by viable count determination, and confocal laser microscopy. Strains forming structurally organized biofilms show an increased bacterial survival when challenged with colistin, compared to strains forming unstructured biofilms. The increased survival is due to genetically...

  10. Molecular Basis for Saccharomyces cerevisiae Biofilm Development

    DEFF Research Database (Denmark)

    Andersen, Kaj Scherz

    In this study, I sought to identify genes regulating the global molecular program for development of sessile multicellular communities, also known as biofilm, of the eukaryotic microorganism, Saccharomyces cerevisiae (yeast). Yeast biofilm has a clinical interest, as biofilms can cause chronic...... infections in humans. Biofilm is also interesting from an evolutionary standpoint, as an example of primitive multicellularity. By using a genome-wide screen of yeast deletion mutants, I show that 71 genes are essential for biofilm formation. Two-thirds of these genes are required for transcription of FLO11......, but only a small subset is previously described as regulators of FLO11. These results reveal that the regulation of biofilm formation and FLO11 is even more complex than what has previously been described. I find that the molecular program for biofilm formation shares many essential components with two...

  11. Cell death in Pseudomonas aeruginosa biofilm development

    DEFF Research Database (Denmark)

    Webb, J.S.; Thompson, L.S.; James, S.


    Bacteria growing in biofilms often develop multicellular, three-dimensional structures known as microcolonies. Complex differentiation within biofilms of Pseudomonas aeruginosa occurs, leading to the creation of voids inside microcolonies and to the dispersal of cells from within these voids....... However, key developmental processes regulating these events are poorly understood. A normal component of multicellular development is cell death. Here we report that a repeatable pattern of cell death and lysis occurs in biofilms of P. aeruginosa during the normal course of development. Cell death...... occurred with temporal and spatial organization within biofilms, inside microcolonies, when the biofilms were allowed to develop in continuous-culture flow cells. A subpopulation of viable cells was always observed in these regions. During the onset of biofilm killing and during biofilm development...

  12. Modelling the growth of a methanotrophic biofilm

    DEFF Research Database (Denmark)

    Arcangeli, J.-P.; Arvin, E.


    This article discusses the growth of methanotrophic biofilms. Several independent biofilm growths scenarios involving different inocula were examined. Biofilm growth, substrate removal and product formation were monitored throughout the experiments. Based on the oxygen consumption it was concluded...... that heterotrophs and nitrifiers co-existed with methanotrophs in the biofilm. Heterotrophic biomass grew on soluble polymers formed by the hydrolysis of dead biomass entrapped in the biofilm. Nitrifier populations developed because of the presence of ammonia in the mineral medium. Based on these experimental...... was performed on this model. It indicated that the most influential parameters were those related to the biofilm (i.e. density; solid-volume fraction; thickness). This suggests that in order to improve the model, further research regarding the biofilm structure and composition is needed....

  13. Biofilms of vaginal Lactobacillus in vitro test. (United States)

    Wei, Xiao-Yu; Zhang, Rui; Xiao, Bing-Bing; Liao, Qin-Ping


    This paper focuses on biofilms of Lactobacillus spp. - a type of normal flora isolated from healthy human vaginas of women of childbearing age; thereupon, it broadens the research scope of investigation of vaginal normal flora. The static slide culture method was adopted to foster biofilms, marked by specific fluorescence staining. Laser scanning confocal and scanning electron microscopy were used to observe the microstructure of the biofilms. Photographs taken from the microstructure were analysed to calculate the density of the biofilms. The body of Lactobacillus spp., though red, turned yellow when interacting with the green extracellular polysaccharides. The structure of the biofilm and aquaporin within the biofilm were imaged. Lactobacillus density increases over time. This study provides convincing evidence that Lactobacillus can form biofilms and grow over time in vitro. This finding establishes an important and necessary condition for selecting proper strains for the pharmaceutics of vaginal ecology.

  14. The clinical impact of bacterial biofilms

    DEFF Research Database (Denmark)

    Høiby, Niels; Ciofu, Oana; Johansen, Helle Krogh


    Bacteria survive in nature by forming biofilms on surfaces and probably most, if not all, bacteria (and fungi) are capable of forming biofilms. A biofilm is a structured consortium of bacteria embedded in a self-produced polymer matrix consisting of polysaccharide, protein and extracellular DNA....... Bacterial biofilms are resistant to antibiotics, disinfectant chemicals and to phagocytosis and other components of the innate and adaptive inflammatory defense system of the body. It is known, for example, that persistence of staphylococcal infections related to foreign bodies is due to biofilm formation....... Likewise, chronic Pseudomonas aeruginosa lung infections in cystic fibrosis patients are caused by biofilm growing mucoid strains. Gradients of nutrients and oxygen exist from the top to the bottom of biofilms and the bacterial cells located in nutrient poor areas have decreased metabolic activity...

  15. Current and future trends for biofilm reactors for fermentation processes. (United States)

    Ercan, Duygu; Demirci, Ali


    Biofilms in the environment can both cause detrimental and beneficial effects. However, their use in bioreactors provides many advantages including lesser tendencies to develop membrane fouling and lower required capital costs, their higher biomass density and operation stability, contribution to resistance of microorganisms, etc. Biofilm formation occurs naturally by the attachment of microbial cells to the support without use of any chemicals agent in biofilm reactors. Biofilm reactors have been studied and commercially used for waste water treatment and bench and pilot-scale production of value-added products in the past decades. It is important to understand the fundamentals of biofilm formation, physical and chemical properties of a biofilm matrix to run the biofilm reactor at optimum conditions. This review includes the principles of biofilm formation; properties of a biofilm matrix and their roles in the biofilm formation; factors that improve the biofilm formation, such as support materials; advantages and disadvantages of biofilm reactors; and industrial applications of biofilm reactors.

  16. Candida biofilms: is adhesion sexy? (United States)

    Soll, David R


    The development of Candida albicans biofilms requires two types of adhesion molecule - the Als proteins and Hwp1. Mutational analyses have recently revealed that these molecules play complementary roles, and their characteristics suggest that they may have evolved from primitive mating agglutinins.

  17. Biofilm in drinking water networks

    International Nuclear Information System (INIS)

    Cristiani, Pietrangela


    Bacterial growth in drinking waters is today controlled adding small and non toxic quantities of sanitising products. An innovative electrochemical biofilm monitoring system, already successfully applied in industrial waters, could be confirmed as an effective diagnostic tool of water quality also for drinking distributions systems [it

  18. Hydrodynamic dispersion within porous biofilms

    KAUST Repository

    Davit, Y.


    Many microorganisms live within surface-associated consortia, termed biofilms, that can form intricate porous structures interspersed with a network of fluid channels. In such systems, transport phenomena, including flow and advection, regulate various aspects of cell behavior by controlling nutrient supply, evacuation of waste products, and permeation of antimicrobial agents. This study presents multiscale analysis of solute transport in these porous biofilms. We start our analysis with a channel-scale description of mass transport and use the method of volume averaging to derive a set of homogenized equations at the biofilm-scale in the case where the width of the channels is significantly smaller than the thickness of the biofilm. We show that solute transport may be described via two coupled partial differential equations or telegrapher\\'s equations for the averaged concentrations. These models are particularly relevant for chemicals, such as some antimicrobial agents, that penetrate cell clusters very slowly. In most cases, especially for nutrients, solute penetration is faster, and transport can be described via an advection-dispersion equation. In this simpler case, the effective diffusion is characterized by a second-order tensor whose components depend on (1) the topology of the channels\\' network; (2) the solute\\'s diffusion coefficients in the fluid and the cell clusters; (3) hydrodynamic dispersion effects; and (4) an additional dispersion term intrinsic to the two-phase configuration. Although solute transport in biofilms is commonly thought to be diffusion dominated, this analysis shows that hydrodynamic dispersion effects may significantly contribute to transport. © 2013 American Physical Society.

  19. Dynamic interactions of neutrophils and biofilms

    Directory of Open Access Journals (Sweden)

    Josefine Hirschfeld


    Full Text Available Background: The majority of microbial infections in humans are biofilm-associated and difficult to treat, as biofilms are highly resistant to antimicrobial agents and protect themselves from external threats in various ways. Biofilms are tenaciously attached to surfaces and impede the ability of host defense molecules and cells to penetrate them. On the other hand, some biofilms are beneficial for the host and contain protective microorganisms. Microbes in biofilms express pathogen-associated molecular patterns and epitopes that can be recognized by innate immune cells and opsonins, leading to activation of neutrophils and other leukocytes. Neutrophils are part of the first line of defense and have multiple antimicrobial strategies allowing them to attack pathogenic biofilms. Objective/design: In this paper, interaction modes of neutrophils with biofilms are reviewed. Antimicrobial strategies of neutrophils and the counteractions of the biofilm communities, with special attention to oral biofilms, are presented. Moreover, possible adverse effects of neutrophil activity and their biofilm-promoting side effects are discussed. Results/conclusion: Biofilms are partially, but not entirely, protected against neutrophil assault, which include the processes of phagocytosis, degranulation, and formation of neutrophil extracellular traps. However, virulence factors of microorganisms, microbial composition, and properties of the extracellular matrix determine whether a biofilm and subsequent microbial spread can be controlled by neutrophils and other host defense factors. Besides, neutrophils may inadvertently contribute to the physical and ecological stability of biofilms by promoting selection of more resistant strains. Moreover, neutrophil enzymes can degrade collagen and other proteins and, as a result, cause harm to the host tissues. These parameters could be crucial factors in the onset of periodontal inflammation and the subsequent tissue breakdown.

  20. Mycobacterium biofilms: factors involved in development, dispersal, and therapeutic strategies against biofilm-relevant pathogens. (United States)

    Xiang, Xiaohong; Deng, Wanyan; Liu, Minqiang; Xie, Jianping


    Many bacteria can develop biofilm (BF), a multicellular structure largely combining bacteria and their extracellular polymeric substances (EPS). The formation of biofilm results in an alternative existence in which microbes ensure their survival in adverse environments. Biofilm-relevant infections are more persistent, resistant to most antibiotics, and more recalcitrant to host immunity. Mycobacterium tuberculosis, the causative agent of tuberculosis, can develop biofilm, though whether M. tuberculosis can form biofilm within tuberculosis patients has yet to be determined. Here, we summarize the factors involved in the development and dispersal of mycobacterial biofilms, as well as underlying regulatory factors and inhibitors against biofilm to deepen our understanding of their development and to elucidate potential novel modes of action for future antibiotics. Key factors in biofilm formation identified as drug targets represent a novel and promising avenue for developing better antibiotics.

  1. Pseudomonas aeruginosa Biofilm, a Programmed Bacterial Life for Fitness. (United States)

    Lee, Keehoon; Yoon, Sang Sun


    A biofilm is a community of microbes that typically inhabit on surfaces and are encased in an extracellular matrix. Biofilms display very dissimilar characteristics to their planktonic counterparts. Biofilms are ubiquitous in the environment and influence our lives tremendously in both positive and negative ways. Pseudomonas aeruginosa is a bacterium known to produce robust biofilms. P. aeruginosa biofilms cause severe problems in immunocompromised patients, including those with cystic fibrosis or wound infection. Moreover, the unique biofilm properties further complicate the eradication of the biofilm infection, leading to the development of chronic infections. In this review, we discuss the history of biofilm research and general characteristics of bacterial biofilms. Then, distinct features pertaining to each stage of P. aeruginosa biofilm development are highlighted. Furthermore, infections caused by biofilms on their own or in association with other bacterial species ( i.e. , multispecies biofilms) are discussed in detail.

  2. Novel metabolic activity indicator in Streptococcus mutans biofilms

    NARCIS (Netherlands)

    Deng, D.M.; Hoogenkamp, M.A.; ten Cate, J.M.; Crielaard, W.


    Antimicrobial resistance of micro-organisms in biofilms requires novel strategies to evaluate the efficacy of caries preventive agents in actual biofilms. Hence we investigated fluorescence intensity (FI) in Streptococcus mutans biofilms constitutively expressing green fluorescent protein (GFP).

  3. GenBank blastx search result: AK287540 [KOME

    Lifescience Database Archive (English)

    Full Text Available AK287540 J065011K01 AF013216.1 AF013216 Myxococcus xanthus Dog (dog), isocitrate lyase (icl), Mls (mls), Ufo... (ufo), fumarate hydratase (fhy), and proteosome major subunit (clpP) genes, complete cds; and acyl-CoA oxidase (aco) gene, partial cds. BCT 0.0 0 ...

  4. GenBank blastn search result: AK241214 [KOME

    Lifescience Database Archive (English)

    Full Text Available AK241214 J065122P06 AF013216.1 AF013216 Myxococcus xanthus Dog (dog), isocitrate lyase (icl), Mls (mls), Ufo... (ufo), fumarate hydratase (fhy), and proteosome major subunit (clpP) genes, complete cds; and acyl-CoA oxidase (aco) gene, partial cds. BCT 8e-18 1 -1 ...

  5. GenBank blastx search result: AK243510 [KOME

    Lifescience Database Archive (English)

    Full Text Available AK243510 J100075B22 AF013216.1 AF013216 Myxococcus xanthus Dog (dog), isocitrate lyase (icl), Mls (mls), Ufo... (ufo), fumarate hydratase (fhy), and proteosome major subunit (clpP) genes, complete cds; and acyl-CoA oxidase (aco) gene, partial cds. BCT 2e-87 1 ...

  6. GenBank blastx search result: AK243527 [KOME

    Lifescience Database Archive (English)

    Full Text Available AK243527 J100075P16 AF013216.1 AF013216 Myxococcus xanthus Dog (dog), isocitrate lyase (icl), Mls (mls), Ufo... (ufo), fumarate hydratase (fhy), and proteosome major subunit (clpP) genes, complete cds; and acyl-CoA oxidase (aco) gene, partial cds. BCT 1e-143 1 ...

  7. GenBank blastx search result: AK241214 [KOME

    Lifescience Database Archive (English)

    Full Text Available AK241214 J065122P06 AF013216.1 AF013216 Myxococcus xanthus Dog (dog), isocitrate lyase (icl), Mls (mls), Ufo... (ufo), fumarate hydratase (fhy), and proteosome major subunit (clpP) genes, complete cds; and acyl-CoA oxidase (aco) gene, partial cds. BCT 1e-151 1 ...

  8. Staphylococcus aureus biofilm removal by targeting biofilm-associated extracellular proteins

    Directory of Open Access Journals (Sweden)

    Sudhir K Shukla


    Methods: Biofilm assay was done in 96-well microtitre plate to evaluate the effect of proteinase K on biofilms of bovine mastitis S. Aureus isolates. Extracellular polymeric substances were extracted and evaluated for their composition (protein, polysaccharides and extracellular DNA, before and after the proteinase K treatment. Results: Biofilm assay showed that 2 μg/ml proteinase K significantly inhibited biofilm development in bap-positive S. aureus V329 as well as other S. aureus isolates (SA7, SA10, SA33, SA352, but not in bap-mutant M556 and SA392 (a weak biofilm-producing strain. Proteinase K treatment on S. aureus planktonic cells showed that there was no inhibition of planktonic growth up to 32 μg/ml of proteinase K. Proteinase K treatment on 24 h old preformed biofilms showed an enhanced dispersion of bap-positive V329 and SA7, SA10, SA33 and SA352 biofilms; however, proteinase K did not affect the bap-mutant S. aureus M556 and SA392 biofilms. Biofilm compositions study before and after proteinase K treatment indicated that Bap might also be involved in eDNA retention in the biofilm matrix that aids in biofilm stability. When proteinase K was used in combination with antibiotics, a synergistic effect in antibiotic efficacy was observed against all biofilm-forming S. aureus isolates. Interpretation & conclusions: Proteinase K inhibited biofilms growth in S. aureus bovine mastitis isolates but did not affect their planktonic growth. An enhanced dispersion of preformed S. aureus biofilms was observed on proteinase K treatment. Proteinase K treatment with antibiotics showed a synergistic effect against S. aureus biofilms. The study suggests that dispersing S. aureus by protease can be of use while devising strategies againstS. aureus biofilms.

  9. Fremmedlegemeinfektioner--nyt om biofilm og quorum sensing

    DEFF Research Database (Denmark)

    Høiby, Niels; Johansen, Helle Krogh; Ciofu, Oana


    Biofilms are structured consortia of bacteria embedded in self-produced polymer matrix. Biofilms are resistant to antibiotics, disinfectives and phagocytosis. The persistence of foreign body infections is due to biofilms. Chronic P. aeruginosa lung infection in cystic fibrosis patients is a biofilm....... Bacteria in biofilms communicate by means of quorum sensing which activates genes for virulence factors. Biofilms can be prevented by antibiotic prophylaxis or early therapy or by quorum sensing inhibitors which make them susceptible to antibiotics and phagocytosis....

  10. Silver-Palladium Surfaces Inhibit Biofilm Formation

    DEFF Research Database (Denmark)

    Chiang, Wen-Chi; Schroll, Casper; Hilbert, Lisbeth Rischel


    Undesired biofilm formation is a major concern in many areas. In the present study, we investigated biofilm-inhibiting properties of a silver-palladium surface that kills bacteria by generating microelectric fields and electrochemical redox processes. For evaluation of the biofilm inhibition...... efficacy and study of the biofilm inhibition mechanism, the silver-sensitive Escherichia coli J53 and the silver-resistant E. coli J53[pMG101] strains were used as model organisms, and batch and flow chamber setups were used as model systems. In the case of the silver-sensitive strain, the silver......-palladium surfaces killed the bacteria and prevented biofilm formation under conditions of low or high bacterial load. In the case of the silver-resistant strain, the silver-palladium surfaces killed surface-associated bacteria and prevented biofilm formation under conditions of low bacterial load, whereas under...

  11. Mucosal biofilm detection in chronic otitis media

    DEFF Research Database (Denmark)

    Wessman, Marcus; Bjarnsholt, Thomas; Eickhardt-Sørensen, Steffen Robert


    The objectives of this study were to examine middle ear biopsies from Greenlandic patients with chronic otitis media (COM) for the presence of mucosal biofilms and the bacteria within the biofilms. Thirty-five middle ear biopsies were obtained from 32 Greenlandic COM patients admitted to ear...... of the patients served as controls. PNA-FISH showed morphological signs of biofilms in 15 out of 35 (43 %) middle ear biopsies. In the control skin biopsies, there were signs of biofilms in eight out of 23 biopsies (30 %), probably representing skin flora. PCR and 16s sequencing detected bacteria in seven out...... of 20 (35 %) usable middle ear biopsies, and in two out of ten (20 %) usable control samples. There was no association between biofilm findings and PCR and 16s sequencing. Staphylococci were the most common bacteria in bacterial culture. We found evidence of bacterial biofilms in 43 % of middle ear...

  12. Microbial biofilms: biosurfactants as antibiofilm agents. (United States)

    Banat, Ibrahim M; De Rienzo, Mayri A Díaz; Quinn, Gerry A


    Current microbial inhibition strategies based on planktonic bacterial physiology have been known to have limited efficacy on the growth of biofilm communities. This problem can be exacerbated by the emergence of increasingly resistant clinical strains. All aspects of biofilm measurement, monitoring, dispersal, control, and inhibition are becoming issues of increasing importance. Biosurfactants have merited renewed interest in both clinical and hygienic sectors due to their potential to disperse microbial biofilms in addition to many other advantages. The dispersal properties of biosurfactants have been shown to rival those of conventional inhibitory agents against bacterial and yeast biofilms. This makes them suitable candidates for use in new generations of microbial dispersal agents and for use as adjuvants for existing microbial suppression or eradication strategies. In this review, we explore aspects of biofilm characteristics and examine the contribution of biologically derived surface-active agents (biosurfactants) to the disruption or inhibition of microbial biofilms.

  13. Biofilm inhibitors that target amyloid proteins. (United States)

    Romero, Diego; Sanabria-Valentín, Edgardo; Vlamakis, Hera; Kolter, Roberto


    Bacteria establish stable communities, known as biofilms, that are resistant to antimicrobials. Biofilm robustness is due to the presence of an extracellular matrix, which for several species-among them Bacillus subtilis-includes amyloid-like protein fibers. In this work, we show that B. subtilis biofilms can be a simple and reliable tool for screening of molecules with antiamyloid activity. We identified two molecules, AA-861 and parthenolide, which efficiently inhibited biofilms by preventing the formation of amyloid-like fibers. Parthenolide also disrupted pre-established biofilms. These molecules also impeded the formation of biofilms of other bacterial species that secrete amyloid proteins, such as Bacillus cereus and Escherichia coli. Furthermore, the identified molecules decreased the conversion of the yeast protein New1 to the prion state in a heterologous host, indicating the broad range of activity of the molecules. Copyright © 2013 Elsevier Ltd. All rights reserved.

  14. [Biofilms and their significance in medical microbiology]. (United States)

    Cernohorská, L; Votava, M


    Microorganisms are able to adhere to various surfaces and to form there a three-dimensional structure known as biofilm. In biofilms, microbial cells show characteristics and behaviours different from those of plankton cells. Intercellular signalizations of the quorum-sensing type regulate interaction between members of the biofilm. Bacteria embedded in the biofilm can escape and form well known planktonic forms, that are obviously only a part of the bacterial life cycle. Bacteria adhere also to medically important surfaces such as catheters, either urinary or intravenous ones, artificial heart valves, orthopedic implants and so on and contribute to device-related infections like cystitis, catheter-related sepsis, endocarditis etc. Once a biofilm has been established on a surface, the bacteria harboured inside are less exposed to the host's immune response and less susceptible to antibiotics. As an important cause of nosocomial infections the biofilm must remain in the centre of the microbiologist's attention.

  15. Material modeling of biofilm mechanical properties. (United States)

    Laspidou, C S; Spyrou, L A; Aravas, N; Rittmann, B E


    A biofilm material model and a procedure for numerical integration are developed in this article. They enable calculation of a composite Young's modulus that varies in the biofilm and evolves with deformation. The biofilm-material model makes it possible to introduce a modeling example, produced by the Unified Multi-Component Cellular Automaton model, into the general-purpose finite-element code ABAQUS. Compressive, tensile, and shear loads are imposed, and the way the biofilm mechanical properties evolve is assessed. Results show that the local values of Young's modulus increase under compressive loading, since compression results in the voids "closing," thus making the material stiffer. For the opposite reason, biofilm stiffness decreases when tensile loads are imposed. Furthermore, the biofilm is more compliant in shear than in compression or tension due to the how the elastic shear modulus relates to Young's modulus. Copyright © 2014 Elsevier Inc. All rights reserved.

  16. Artificial biofilms establish the role of matrix interactions in staphylococcal biofilm assembly and disassembly (United States)

    Stewart, Elizabeth J.; Ganesan, Mahesh; Younger, John G.; Solomon, Michael J.


    We demonstrate that the microstructural and mechanical properties of bacterial biofilms can be created through colloidal self-assembly of cells and polymers, and thereby link the complex material properties of biofilms to well understood colloidal and polymeric behaviors. This finding is applied to soften and disassemble staphylococcal biofilms through pH changes. Bacterial biofilms are viscoelastic, structured communities of cells encapsulated in an extracellular polymeric substance (EPS) comprised of polysaccharides, proteins, and DNA. Although the identity and abundance of EPS macromolecules are known, how these matrix materials interact with themselves and bacterial cells to generate biofilm morphology and mechanics is not understood. Here, we find that the colloidal self-assembly of Staphylococcus epidermidis RP62A cells and polysaccharides into viscoelastic biofilms is driven by thermodynamic phase instability of EPS. pH conditions that induce phase instability of chitosan produce artificial S. epidermidis biofilms whose mechanics match natural S. epidermidis biofilms. Furthermore, pH-induced solubilization of the matrix triggers disassembly in both artificial and natural S. epidermidis biofilms. This pH-induced disassembly occurs in biofilms formed by five additional staphylococcal strains, including three clinical isolates. Our findings suggest that colloidal self-assembly of cells and matrix polymers produces biofilm viscoelasticity and that biofilm control strategies can exploit this mechanism. PMID:26272750

  17. Shape of the growing front of biofilms (United States)

    Wang, Xin; Stone, Howard A.; Golestanian, Ramin


    The spatial organization of bacteria in dense biofilms is key to their collective behaviour, and understanding it will be important for medical and technological applications. Here we study the morphology of a compact biofilm that undergoes unidirectional growth, and determine the condition for the stability of the growing interface as a function of the nutrient concentration and mechanical tension. Our study suggests that transient behaviour may play an important role in shaping the structure of a biofilm.

  18. Strategies for combating bacterial biofilm infections

    DEFF Research Database (Denmark)

    Wu, Hong; Moser, Claus Ernst; Wang, Heng-Zhuang


    Formation of biofilm is a survival strategy for bacteria and fungi to adapt to their living environment, especially in the hostile environment. Under the protection of biofilm, microbial cells in biofilm become tolerant and resistant to antibiotics and the immune responses, which increases the di.......International Journal of Oral Science advance online publication, 12 December 2014; doi:10.1038/ijos.2014.65....

  19. Effect of Lactoferrin on Oral Biofilm Formation (United States)


    effect of Lf on the early stages of single-species and multi- species oral biofilm development. Streptococcus gordonii (Sg), Streptococcus mutans ...and biofilm development by Pseudomonas aeruginosa and Streptococcus mutans have been demonstrated, limited studies have been conducted on its effect...the effect of Lf on the early stages of single- species and multi-species oral biofilm development. Streptococcus gordonii, Streptococcus mutans

  20. Red and Green Fluorescence from Oral Biofilms. (United States)

    Volgenant, Catherine M C; Hoogenkamp, Michel A; Krom, Bastiaan P; Janus, Marleen M; Ten Cate, Jacob M; de Soet, Johannes J; Crielaard, Wim; van der Veen, Monique H


    Red and green autofluorescence have been observed from dental plaque after excitation by blue light. It has been suggested that this red fluorescence is related to caries and the cariogenic potential of dental plaque. Recently, it was suggested that red fluorescence may be related to gingivitis. Little is known about green fluorescence from biofilms. Therefore, we assessed the dynamics of red and green fluorescence in real-time during biofilm formation. In addition, the fluorescence patterns of biofilm formed from saliva of eight different donors are described under simulated gingivitis and caries conditions. Biofilm formation was analysed for 12 hours under flow conditions in a microfluidic BioFlux flow system with high performance microscopy using a camera to allow live cell imaging. For fluorescence images dedicated excitation and emission filters were used. Both green and red fluorescence were linearly related with the total biomass of the biofilms. All biofilms displayed to some extent green and red fluorescence, with higher red and green fluorescence intensities from biofilms grown in the presence of serum (gingivitis simulation) as compared to the sucrose grown biofilms (cariogenic simulation). Remarkably, cocci with long chain lengths, presumably streptococci, were observed in the biofilms. Green and red fluorescence were not found homogeneously distributed within the biofilms: highly fluorescent spots (both green and red) were visible throughout the biomass. An increase in red fluorescence from the in vitro biofilms appeared to be related to the clinical inflammatory response of the respective saliva donors, which was previously assessed during an in vivo period of performing no-oral hygiene. The BioFlux model proved to be a reliable model to assess biofilm fluorescence. With this model, a prediction can be made whether a patient will be prone to the development of gingivitis or caries.

  1. Antibiotic tolerance and resistance in biofilms

    DEFF Research Database (Denmark)

    Ciofu, Oana; Tolker-Nielsen, Tim


    One of the most important features of microbial biofilms is their tolerance to antimicrobial agents and components of the host immune system. The difficulty of treating biofilm infections with antibiotics is a major clinical problem. Although antibiotics may decrease the number of bacteria...... in biofilms, they will not completely eradicate the bacteria in vivo which may have important clinical consequences in form of relapses of the infection....

  2. Red and Green Fluorescence from Oral Biofilms.

    Directory of Open Access Journals (Sweden)

    Catherine M C Volgenant

    Full Text Available Red and green autofluorescence have been observed from dental plaque after excitation by blue light. It has been suggested that this red fluorescence is related to caries and the cariogenic potential of dental plaque. Recently, it was suggested that red fluorescence may be related to gingivitis. Little is known about green fluorescence from biofilms. Therefore, we assessed the dynamics of red and green fluorescence in real-time during biofilm formation. In addition, the fluorescence patterns of biofilm formed from saliva of eight different donors are described under simulated gingivitis and caries conditions. Biofilm formation was analysed for 12 hours under flow conditions in a microfluidic BioFlux flow system with high performance microscopy using a camera to allow live cell imaging. For fluorescence images dedicated excitation and emission filters were used. Both green and red fluorescence were linearly related with the total biomass of the biofilms. All biofilms displayed to some extent green and red fluorescence, with higher red and green fluorescence intensities from biofilms grown in the presence of serum (gingivitis simulation as compared to the sucrose grown biofilms (cariogenic simulation. Remarkably, cocci with long chain lengths, presumably streptococci, were observed in the biofilms. Green and red fluorescence were not found homogeneously distributed within the biofilms: highly fluorescent spots (both green and red were visible throughout the biomass. An increase in red fluorescence from the in vitro biofilms appeared to be related to the clinical inflammatory response of the respective saliva donors, which was previously assessed during an in vivo period of performing no-oral hygiene. The BioFlux model proved to be a reliable model to assess biofilm fluorescence. With this model, a prediction can be made whether a patient will be prone to the development of gingivitis or caries.

  3. AFM Structural Characterization of Drinking Water Biofilm ... (United States)

    Due to the complexity of mixed culture drinking water biofilm, direct visual observation under in situ conditions has been challenging. In this study, atomic force microscopy (AFM) revealed the three dimensional morphology and arrangement of drinking water relevant biofilm in air and aqueous solution. Operating parameters were optimized to improve imaging of structural details for a mature biofilm in liquid. By using a soft cantilever (0.03 N/m) and slow scan rate (0.5 Hz), biofilm and individual bacterial cell’s structural topography were resolved and continuously imaged in liquid without loss of spatial resolution or sample damage. The developed methodology will allow future in situ investigations to temporally monitor mixed culture drinking water biofilm structural changes during disinfection treatments. Due to the complexity of mixed culture drinking water biofilm, direct visual observation under in situ conditions has been challenging. In this study, atomic force microscopy (AFM) revealed the three dimensional morphology and arrangement of drinking water relevant biofilm in air and aqueous solution. Operating parameters were optimized to improve imaging of structural details for a mature biofilm in liquid. By using a soft cantilever (0.03 N/m) and slow scan rate (0.5 Hz), biofilm and individual bacterial cell’s structural topography were resolved and continuously imaged in liquid without loss of spatial resolution or sample damage. The developed methodo

  4. Biofilm responses to marine fish farm wastes

    International Nuclear Information System (INIS)

    Sanz-Lazaro, Carlos; Navarrete-Mier, Francisco; Marin, Arnaldo


    The changes in the biofilm community due to organic matter enrichment, eutrophication and metal contamination derived from fish farming were studied. The biofilm biomass, polysaccharide content, trophic niche and element accumulation were quantified along an environmental gradient of fish farm wastes in two seasons. Biofilm structure and trophic diversity was influenced by seasonality as well as by the fish farm waste load. Fish farming enhanced the accumulation of organic carbon, nutrients, selenium and metals by the biofilm community. The accumulation pattern of these elements was similar regardless of the structure and trophic niche of the community. This suggests that the biofilm communities can be considered a reliable tool for assessing dissolved aquaculture wastes. Due to the ubiquity of biofilms and its wide range of consumers, its role as a sink of dissolved wastes may have important implications for the transfer of aquaculture wastes to higher trophic levels in coastal systems. - Research highlights: → Biofilms can act as a trophic pathway of fish farm dissolved wastes. → Biofilms are reliable tools for monitoring fish farm dissolved wastes. → The influence of the fish farm dissolved wastes can be detected 120-350 m from farm. - Under the influence of fish farming biofilm accumulates organic carbon, nutrients, selenium and metals, regardless of the structure and trophic niche of the community.

  5. Focus on the physics of biofilms

    International Nuclear Information System (INIS)

    Lecuyer, Sigolene; Stocker, Roman; Rusconi, Roberto


    Bacteria are the smallest and most abundant form of life. They have traditionally been considered as primarily planktonic organisms, swimming or floating in a liquid medium, and this view has shaped many of the approaches to microbial processes, including for example the design of most antibiotics. However, over the last few decades it has become clear that many bacteria often adopt a sessile, surface-associated lifestyle, forming complex multicellular communities called biofilms. Bacterial biofilms are found in a vast range of environments and have major consequences on human health and industrial processes, from biofouling of surfaces to the spread of diseases. Although the study of biofilms has been biologists’ territory for a long time, a multitude of phenomena in the formation and development of biofilms hinges on physical processes. We are pleased to present a collection of research papers that discuss some of the latest developments in many of the areas to which physicists can contribute a deeper understanding of biofilms, both experimentally and theoretically. The topics covered range from the influence of physical environmental parameters on cell attachment and subsequent biofilm growth, to the use of local probes and imaging techniques to investigate biofilm structure, to the development of biofilms in complex environments and the modeling of colony morphogenesis. The results presented contribute to addressing some of the major challenges in microbiology today, including the prevention of surface contamination, the optimization of biofilm disruption methods and the effectiveness of antibiotic treatments. (editorial)

  6. Electroactive biofilms of sulphate reducing bacteria

    International Nuclear Information System (INIS)

    Cordas, Cristina M.; Guerra, L. Tiago; Xavier, Catarina; Moura, Jose J.G.


    Biofilms formed from a pure strain of Desulfovibrio desulfuricans 27774 on stainless steel and graphite polarised surfaces were studied. The polarisation conditions applied were -0.4 V vs. SCE for different times. A cathodic current related with the biofilms growth was observed with a maximum intensity of -270 mA m -2 that remained stable for several days using graphite electrodes. These sulphate reducing bacteria biofilms present electrocatalytic activity towards hydrogen and oxygen reduction reactions. Electrode polarisation has a selective effect on the catalytic activity. The biofilms were also observed by scanning electronic microscopy revealing the formation of homogeneous films on the surfaces

  7. Aspartate inhibits Staphylococcus aureus biofilm formation. (United States)

    Yang, Hang; Wang, Mengyue; Yu, Junping; Wei, Hongping


    Biofilm formation renders Staphylococcus aureus highly resistant to conventional antibiotics and host defenses. Four D-amino acids (D-Leu, D-Met, D-Trp and D-Tyr) have been reported to be able to inhibit biofilm formation and disassemble established S. aureus biofilms. We report here for the first time that both D- and L-isoforms of aspartate (Asp) inhibited S. aureus biofilm formation on tissue culture plates. Similar biofilm inhibition effects were also observed against other staphylococcal strains, including S. saprophyticus, S. equorum, S. chromogenes and S. haemolyticus. It was found that Asp at high concentrations (>10 mM) inhibited the growth of planktonic N315 cells, but at subinhibitory concentrations decreased the cellular metabolic activity without influencing cell growth. The decreased cellular metabolic activity might be the reason for the production of less protein and DNA in the matrix of the biofilms formed in the presence of Asp. However, varied inhibition efficacies of Asp were observed for biofilms formed by clinical staphylococcal isolates. There might be mechanisms other than decreasing the metabolic activity, e.g. the biofilm phenotypes, affecting biofilm formation in the presence of Asp. © FEMS 2015. All rights reserved. For permissions, please e-mail:

  8. Mechanisms of Candida biofilm drug resistance (United States)

    Taff, Heather T; Mitchell, Kaitlin F; Edward, Jessica A; Andes, David R


    Candida commonly adheres to implanted medical devices, growing as a resilient biofilm capable of withstanding extraordinarily high antifungal concentrations. As currently available antifungals have minimal activity against biofilms, new drugs to treat these recalcitrant infections are urgently needed. Recent investigations have begun to shed light on the mechanisms behind the profound resistance associated with the biofilm mode of growth. This resistance appears to be multifactorial, involving both mechanisms similar to conventional, planktonic antifungal resistance, such as increased efflux pump activity, as well as mechanisms specific to the biofilm lifestyle. A unique biofilm property is the production of an extracellular matrix. Two components of this material, β-glucan and extracellular DNA, promote biofilm resistance to multiple antifungals. Biofilm formation also engages several stress response pathways that impair the activity of azole drugs. Resistance within a biofilm is often heterogeneous, with the development of a subpopulation of resistant persister cells. In this article we review the molecular mechanisms underlying Candida biofilm antifungal resistance and their relative contributions during various growth phases. PMID:24059922

  9. Candida Biofilms: Threats, Challenges, and Promising Strategies (United States)

    Cavalheiro, Mafalda; Teixeira, Miguel Cacho


    Candida species are fungal pathogens known for their ability to cause superficial and systemic infections in the human host. These pathogens are able to persist inside the host due to the development of pathogenicity and multidrug resistance traits, often leading to the failure of therapeutic strategies. One specific feature of Candida species pathogenicity is their ability to form biofilms, which protects them from external factors such as host immune system defenses and antifungal drugs. This review focuses on the current threats and challenges when dealing with biofilms formed by Candida albicans, Candida glabrata, Candida tropicalis, and Candida parapsilosis, highlighting the differences between the four species. Biofilm characteristics depend on the ability of each species to produce extracellular polymeric substances (EPS) and display dimorphic growth, but also on the biofilm substratum, carbon source availability and other factors. Additionally, the transcriptional control over processes like adhesion, biofilm formation, filamentation, and EPS production displays great complexity and diversity within pathogenic yeasts of the Candida genus. These differences not only have implications in the persistence of colonization and infections but also on antifungal resistance typically found in Candida biofilm cells, potentiated by EPS, that functions as a barrier to drug diffusion, and by the overexpression of drug resistance transporters. The ability to interact with different species in in vivo Candida biofilms is also a key factor to consider when dealing with this problem. Despite many challenges, the most promising strategies that are currently available or under development to limit biofilm formation or to eradicate mature biofilms are discussed. PMID:29487851

  10. Biofilm responses to marine fish farm wastes

    Energy Technology Data Exchange (ETDEWEB)

    Sanz-Lazaro, Carlos, E-mail: [Departamento de Ecologia e Hidrologia, Facultad de Biologia, Universidad de Murcia, 30100 Murcia (Spain); Navarrete-Mier, Francisco; Marin, Arnaldo [Departamento de Ecologia e Hidrologia, Facultad de Biologia, Universidad de Murcia, 30100 Murcia (Spain)


    The changes in the biofilm community due to organic matter enrichment, eutrophication and metal contamination derived from fish farming were studied. The biofilm biomass, polysaccharide content, trophic niche and element accumulation were quantified along an environmental gradient of fish farm wastes in two seasons. Biofilm structure and trophic diversity was influenced by seasonality as well as by the fish farm waste load. Fish farming enhanced the accumulation of organic carbon, nutrients, selenium and metals by the biofilm community. The accumulation pattern of these elements was similar regardless of the structure and trophic niche of the community. This suggests that the biofilm communities can be considered a reliable tool for assessing dissolved aquaculture wastes. Due to the ubiquity of biofilms and its wide range of consumers, its role as a sink of dissolved wastes may have important implications for the transfer of aquaculture wastes to higher trophic levels in coastal systems. - Research highlights: > Biofilms can act as a trophic pathway of fish farm dissolved wastes. > Biofilms are reliable tools for monitoring fish farm dissolved wastes. > The influence of the fish farm dissolved wastes can be detected 120-350 m from farm. - Under the influence of fish farming biofilm accumulates organic carbon, nutrients, selenium and metals, regardless of the structure and trophic niche of the community.

  11. Electroactive biofilms of sulphate reducing bacteria

    Energy Technology Data Exchange (ETDEWEB)

    Cordas, Cristina M.; Guerra, L. Tiago; Xavier, Catarina [Requimte-CQFB, Departamento de Quimica, Faculdade de Ciencias e Tecnologia, Universidade Nova de Lisboa, 2829-516 Caparica (Portugal); Moura, Jose J.G. [Requimte-CQFB, Departamento de Quimica, Faculdade de Ciencias e Tecnologia, Universidade Nova de Lisboa, 2829-516 Caparica (Portugal)], E-mail:


    Biofilms formed from a pure strain of Desulfovibrio desulfuricans 27774 on stainless steel and graphite polarised surfaces were studied. The polarisation conditions applied were -0.4 V vs. SCE for different times. A cathodic current related with the biofilms growth was observed with a maximum intensity of -270 mA m{sup -2} that remained stable for several days using graphite electrodes. These sulphate reducing bacteria biofilms present electrocatalytic activity towards hydrogen and oxygen reduction reactions. Electrode polarisation has a selective effect on the catalytic activity. The biofilms were also observed by scanning electronic microscopy revealing the formation of homogeneous films on the surfaces.

  12. Candida Biofilms: Threats, Challenges, and Promising Strategies. (United States)

    Cavalheiro, Mafalda; Teixeira, Miguel Cacho


    Candida species are fungal pathogens known for their ability to cause superficial and systemic infections in the human host. These pathogens are able to persist inside the host due to the development of pathogenicity and multidrug resistance traits, often leading to the failure of therapeutic strategies. One specific feature of Candida species pathogenicity is their ability to form biofilms, which protects them from external factors such as host immune system defenses and antifungal drugs. This review focuses on the current threats and challenges when dealing with biofilms formed by Candida albicans, Candida glabrata, Candida tropicalis , and Candida parapsilosis , highlighting the differences between the four species. Biofilm characteristics depend on the ability of each species to produce extracellular polymeric substances (EPS) and display dimorphic growth, but also on the biofilm substratum, carbon source availability and other factors. Additionally, the transcriptional control over processes like adhesion, biofilm formation, filamentation, and EPS production displays great complexity and diversity within pathogenic yeasts of the Candida genus. These differences not only have implications in the persistence of colonization and infections but also on antifungal resistance typically found in Candida biofilm cells, potentiated by EPS, that functions as a barrier to drug diffusion, and by the overexpression of drug resistance transporters. The ability to interact with different species in in vivo Candida biofilms is also a key factor to consider when dealing with this problem. Despite many challenges, the most promising strategies that are currently available or under development to limit biofilm formation or to eradicate mature biofilms are discussed.

  13. Targeting quorum sensing in Pseudomonas aeruginosa biofilms

    DEFF Research Database (Denmark)

    Jakobsen, Tim Holm; Bjarnsholt, Thomas; Jensen, Peter Østrup


    Bacterial resistance to conventional antibiotics combined with an increasing acknowledgement of the role of biofilms in chronic infections has led to a growing interest in new antimicrobial strategies that target the biofilm mode of growth. In the aggregated biofilm mode, cell-to-cell communication...... alternative antibacterial strategies. Here, we review state of the art research of quorum sensing inhibitors against the opportunistic human pathogen Pseudomonas aeruginosa, which is found in a number of biofilm-associated infections and identified as the predominant organism infecting the lungs of cystic...

  14. Microbial pathogenesis and biofilm development

    DEFF Research Database (Denmark)

    Reisner, A.; Høiby, N.; Tolker-Nielsen, Tim


    been termed 'maturation', which is thought to be mediated by a differentiation process. Maturation into late stages of biofilm development resulting in stable and robust structures may require the formation of a matrix of extracellular polymeric substances (EPS), which are most often assumed to consist...... a highly significant role in connection with chronic infections [1]. Bacterial growth on surfaces depends on several factors [2]. In nature, surfaces are probably often conditioned with a thin film of organic molecules, which may serve as attractants for bacterial chemotactic systems and which subsequently...... permit bacterial growth to occur. In laboratory model systems the growth of the surface-associated bacteria is supported by the nutrient supply in the moving or standing liquid. A benchmark of biofilm formation by several organisms in vitro is the development of three-dimensional structures that have...

  15. Molecular methods for biofilms

    KAUST Repository

    Ferrera, Isabel; Balagué , Vanessa; Voolstra, Christian R.; Aranda, Manuel; Bayer, Till; Abed, Raeid M.M.; Dobretsov, Sergey; Owens, Sarah M.; Wilkening, Jared; Fessler, Jennifer L.; Gilbert, Jack A.


    at the same time and to compare bacterial communities among different samples or in a single sample after certain treatments. DGGE, T-RFLP and ARISA share similar steps but require different materials and equipment. The three methods involve (i) sampling of the biofilms; (ii) DNA extraction and quantification; and (iii) PCR using specific primers. Metagenomics: This chapter focuses classical and next-generation metagenomics methods. These are limited to bacterial artificial chromosome (BAC) and Fosmid libraries and Sanger and next-generation 454 sequencing, as these methods are currently the most frequently used in research. The chapter discusses the special handling of deoxyribonucleic acid (DNA) needed to construct BAC and Fosmid libraries from marine water samples. It also briefly addresses the related topics of library archiving, databasing, and screening. The chapter provides a high-level overview of the special handling methods required to prepare DNA for BAC library construction. No special handling is needed for Fosmid library construction.

  16. Molecular methods for biofilms

    KAUST Repository

    Ferrera, Isabel


    at the same time and to compare bacterial communities among different samples or in a single sample after certain treatments. DGGE, T-RFLP and ARISA share similar steps but require different materials and equipment. The three methods involve (i) sampling of the biofilms; (ii) DNA extraction and quantification; and (iii) PCR using specific primers. Metagenomics: This chapter focuses classical and next-generation metagenomics methods. These are limited to bacterial artificial chromosome (BAC) and Fosmid libraries and Sanger and next-generation 454 sequencing, as these methods are currently the most frequently used in research. The chapter discusses the special handling of deoxyribonucleic acid (DNA) needed to construct BAC and Fosmid libraries from marine water samples. It also briefly addresses the related topics of library archiving, databasing, and screening. The chapter provides a high-level overview of the special handling methods required to prepare DNA for BAC library construction. No special handling is needed for Fosmid library construction.

  17. Reliability of Haemophilus influenzae biofilm measurement via static method, and determinants of in vitro biofilm production. (United States)

    Obaid, Najla A; Tristram, Stephen; Narkowicz, Christian K; Jacobson, Glenn A


    Information is lacking regarding the precision of microtitre plate (MTP) assays used to measure biofilm. This study investigated the precision of an MTP assay to measure biofilm production by nontypeable Haemophilus influenzae (NTHi) and the effects of frozen storage and inoculation technique on biofilm production. The density of bacterial final growth was determined by absorbance after 18-20 h incubation, and biofilm production was then measured by absorbance after crystal violet staining. Biofilm formation was categorised as high and low for each strain. For the high biofilm producing strains of NTHi, interday reproducibility of NTHi biofilm formation measured using the MTP assay was excellent and met the acceptance criteria, but higher variability was observed in low biofilm producers. Method of inoculum preparation was a determinant of biofilm formation with inoculum prepared directly from solid media showing increased biofilm production for at least one of the high producing strains. In general, storage of NTHi cultures at -80 °C for up to 48 weeks did not have any major effect on their ability to produce biofilm.

  18. Physics of biofilms: the initial stages of biofilm formation and dynamics

    International Nuclear Information System (INIS)

    Lambert, Guillaume; Bergman, Andrew; Zhang, Qiucen; Bortz, David; Austin, Robert


    One of the physiological responses of bacteria to external stress is to assemble into a biofilm. The formation of a biofilm greatly increases a bacterial population's resistance to a hostile environment by shielding cells, for example, from antibiotics. In this paper, we describe the conditions necessary for the emergence of biofilms in natural environments and relate them to the emergence of biofilm formation inside microfluidic devices. We show that competing species of Escherichia coli bacteria form biofilms to spatially segregate themselves in response to starvation stress, and use in situ methods to characterize the physical properties of the biofilms. Finally, we develop a microfluidic platform to study the inter-species interactions and show how biofilm-mediated genetic interactions can improve a species’ resistance to external stress. (paper)

  19. Biofilms in chronic infections - a matter of opportunity - monospecies biofilms in multispecies infections

    DEFF Research Database (Denmark)

    Burmølle, Mette; Thomsen, Trine Rolighed; Fazli, Mustafa


    It has become evident that aggregation or biofilm formation is an important survival mechanism for bacteria in almost any environment. In this review, we summarize recent visualizations of bacterial aggregates in several chronic infections (chronic otitis media, cystic fibrosis, infection due...... to permanent tissue fillers and chronic wounds) both as to distribution (such as where in the wound bed) and organization (monospecies or multispecies microcolonies). We correlate these biofilm observations to observations of commensal biofilms (dental and intestine) and biofilms in natural ecosystems (soil......). The observations of the chronic biofilm infections point toward a trend of low bacterial diversity and sovereign monospecies biofilm aggregates even though the infection in which they reside are multispecies. In contrast to this, commensal and natural biofilm aggregates contain multiple species that are believed...

  20. Biofilm formation and determination of minimum biofilm eradication concentration of antibiotics in Mycoplasma hyopneumoniae. (United States)

    Tassew, Dereje Damte; Mechesso, Abraham Fikru; Park, Na-Hye; Song, Ju-Beom; Shur, Joo-Woon; Park, Seung-Chun


    The study was aimed to investigate biofilm forming ability of Mycoplasma hyopneumoniae and to determine the minimum biofilm eradication concentrations of antibiotics. Biofilm forming ability of six strains of M. hyopneumoniae was examined using crystal violet staining on coverslips. The results demonstrated an apparent line of biofilm growth in 3 of the strains isolated from swine with confirmed cases of enzootic pneumonia. BacLight bacterial viability assay revealed that the majority of the cells were viable after 336 hr of incubation. Moreover, M. hyopneumoniae persists in the biofilm after being exposed to 10 fold higher concentration of antibiotics than the minimum inhibitory concentrations in planktonic cells. To the best of our knowledge, this is the first report of biofilm formation in M. hyopneumoniae. However, comprehensive studies on the mechanisms of biofilm formation are needed to combat swine enzootic pneumonia caused by resistant M. hyopneumoniae.

  1. Enzymatic removal and disinfection of bacterial biofilms

    DEFF Research Database (Denmark)

    Johansen, Charlotte; Falholt, Per; Gram, Lone


    -coated hydroxyapatite. The activity of enzymes against bacterial cells in biofilm was measured by fluorescence microscopy and an indirect conductance test in which evolution of carbon dioxide was measured. Glucose oxidase combined with lactoperoxidase was bactericidal against biofilm bacteria but did not remove...

  2. Biofilm ved kronisk rhinosinuitis og cystisk fibrose

    DEFF Research Database (Denmark)

    Fisker, Jacob; Buchwald, Christian von; Johansen, Helle Krogh


    Microbial biofilms are known to cause persistent foreign-body infections and have recently been acknowledged as involved in more than 65% of all human infections. Microbial biofilms have been detected in chronic rhinosinusitis, and chronic rhinosinusitis is mandatory in patients with cystic...

  3. Ciliates as engineers of phototrophic biofilms.

    NARCIS (Netherlands)

    Weerman, E.J.; van der Geest, H.G.; van der Meulen, M.D; Manders, E.M.M.; van de Koppel, J.; Herman, P.M.J.; Admiraal, W.


    1. Phototrophic biofilms consist of a matrix of phototrophs, non-photosynthetic bacteria and extracellular polymeric substances (EPS) which is spatially structured. Despite widespread exploitation of algae and bacteria within phototrophic biofilms, for example by protozoans, the ‘engineering’

  4. Ciliates as engineers of phototrophic biofilms.

    NARCIS (Netherlands)

    Weerman, E.J.; Geest, H.G.; Meulen, M.D.; Manders, E.M.M.; Van de Koppel, J.; Herman, P.M.J.; Admiraal, W.


    1.Phototrophic biofilms consist of a matrix of phototrophs, non-photosynthetic bacteria and extracellular polymeric substances (EPS) which is spatially structured. Despite widespread exploitation of algae and bacteria within phototrophic biofilms, for example by protozoans, the ‘engineering’ effects

  5. A spray based method for biofilm removal

    NARCIS (Netherlands)

    Cense, A.W.


    Biofilm growth on human teeth is the cause of oral diseases such as caries (tooth decay), gingivitis (inflammation of the gums) and periodontitis (inflammation of the tooth bone). In this thesis, a water based cleaning method is designed for removal of oral biofilms, or dental plaque. The first part

  6. Pseudomonas biofilm matrix composition and niche biology (United States)

    Mann, Ethan E.; Wozniak, Daniel J.


    Biofilms are a predominant form of growth for bacteria in the environment and in the clinic. Critical for biofilm development are adherence, proliferation, and dispersion phases. Each of these stages includes reinforcement by, or modulation of, the extracellular matrix. Pseudomonas aeruginosa has been a model organism for the study of biofilm formation. Additionally, other Pseudomonas species utilize biofilm formation during plant colonization and environmental persistence. Pseudomonads produce several biofilm matrix molecules, including polysaccharides, nucleic acids, and proteins. Accessory matrix components shown to aid biofilm formation and adaptability under varying conditions are also produced by pseudomonads. Adaptation facilitated by biofilm formation allows for selection of genetic variants with unique and distinguishable colony morphology. Examples include rugose small-colony variants and wrinkly spreaders (WS), which over produce Psl/Pel or cellulose, respectively, and mucoid bacteria that over produce alginate. The well-documented emergence of these variants suggests that pseudomonads take advantage of matrix-building subpopulations conferring specific benefits for the entire population. This review will focus on various polysaccharides as well as additional Pseudomonas biofilm matrix components. Discussions will center on structure–function relationships, regulation, and the role of individual matrix molecules in niche biology. PMID:22212072

  7. Spaceflight promotes biofilm formation by Pseudomonas aeruginosa.

    Directory of Open Access Journals (Sweden)

    Wooseong Kim

    Full Text Available Understanding the effects of spaceflight on microbial communities is crucial for the success of long-term, manned space missions. Surface-associated bacterial communities, known as biofilms, were abundant on the Mir space station and continue to be a challenge on the International Space Station. The health and safety hazards linked to the development of biofilms are of particular concern due to the suppression of immune function observed during spaceflight. While planktonic cultures of microbes have indicated that spaceflight can lead to increases in growth and virulence, the effects of spaceflight on biofilm development and physiology remain unclear. To address this issue, Pseudomonas aeruginosa was cultured during two Space Shuttle Atlantis missions: STS-132 and STS-135, and the biofilms formed during spaceflight were characterized. Spaceflight was observed to increase the number of viable cells, biofilm biomass, and thickness relative to normal gravity controls. Moreover, the biofilms formed during spaceflight exhibited a column-and-canopy structure that has not been observed on Earth. The increase in the amount of biofilms and the formation of the novel architecture during spaceflight were observed to be independent of carbon source and phosphate concentrations in the media. However, flagella-driven motility was shown to be essential for the formation of this biofilm architecture during spaceflight. These findings represent the first evidence that spaceflight affects community-level behaviors of bacteria and highlight the importance of understanding how both harmful and beneficial human-microbe interactions may be altered during spaceflight.

  8. Biofilm Surface Density Determines Biocide Effectiveness

    Directory of Open Access Journals (Sweden)

    Sara Bas


    Full Text Available High resistance of biofilms for chemical challenges is a serious industrial and medical problem. In this work a gradient of surface covered with biofilm has been produced and correlated to the effectiveness of different commercially available oxidative biocides. The results for thin Escherichia coli biofilms grown in rich media supplemented with glucose or lactose on glass or poly methyl methacrylate surfaces indicate that the effectiveness of hydrogen peroxide or chlorine dioxide and quaternary ammonium compounds is inversely proportional to the fraction of the surface covered with the biofilm. In areas where biofilm covered more than 90% of the available surface the biocide treatment was inefficient after 60 min of incubation. The combined effect of oxidant and surfactant increased the effectiveness of the biocide. On the other hand, the increased biofilm viscoelasticity reduced biocide effectiveness. The results emphasize differential biocide effectiveness depending on the fraction of the attached bacterial cells. The results suggest that biofilm biocide resistance is an acquired property that increases with biofilm maturation. The more dense sessile structures present lower log reductions compared to less dense ones.

  9. Visco-elastic properties of biofilms

    NARCIS (Netherlands)

    Peterson, Brandon Wade


    Microbiële biofilms aanpakken door ze te laten resoneren Naar schatting tachtig procent van alle bacteriële infecties die door dokters behandeld worden, wordt veroorzaakt door biofilms, dunne laagjes micro-organismen. Brandon Peterson stelt in preklinisch onderzoek de hypothese op dat de hechting

  10. Biofilms and their modifications by laser irradiation

    International Nuclear Information System (INIS)

    Richter, Asta; Gonpot, Preethee; Smith, Roger


    Biofilms are grown on different materials with various surface morphology and are investigated by light and scanning force microscopy. The growth patterns, coverage and adherence of the biofilm are shown to depend on the type of the substrate and its roughness as well as on the type of micro-organisms. Here we present investigations of Eschericia coli bacterial biofilms grown on the polymer material polyetheretherketone and also on titanium films on glass substrates. A Monte Carlo simulation of the growth process is developed which takes into account the aspect ratio of the micro-organisms and the diffusion of nutrient over the surface to feed them. A pulsed nitrogen laser has been applied to the samples and the interaction of the laser beam with the biofilm and the underlying substrate has been studied. Because of the inhomogeneity of the biofilms the ablated areas are different. With increasing number of laser pulses more biofilm material is removed but there appears also damage of the substrate. The threshold energy fluence for the biofilm ablation is estimated and depends on the sticking power of the bacteria. Ablation rates for the removal of the biofilms are also obtained


    Virtually anywhere a surface comes into contact with the water in a distribution system, one can find biofilms. Biofilms are formed in distribution system pipelines when microbial cells attach to pipe surfaces and multiply to form a film or slime layer on the pipe. Probably withi...

  12. The immune system vs. Pseudomonas aeruginosa biofilms

    DEFF Research Database (Denmark)

    Jensen, Peter Østrup; Givskov, Michael; Bjarnsholt, Thomas


    Ilya Metchnikoff and Paul Ehrlich were awarded the Nobel price in 1908. Since then, numerous studies have unraveled a multitude of mechanistically different immune responses to intruding microorganisms. However, in the vast majority of these studies, the underlying infectious agents have appeared...... in the planktonic state. Accordingly, much less is known about the immune responses to the presence of biofilm-based infections (which is probably also due to the relatively short period of time in which the immune response to biofilms has been studied). Nevertheless, more recent in vivo and in vitro studies have...... revealed both innate as well as adaptive immune responses to biofilms. On the other hand, measures launched by biofilm bacteria to achieve protection against the various immune responses have also been demonstrated. Whether particular immune responses to biofilm infections exist remains to be firmly...

  13. The ecology and biogeochemistry of stream biofilms. (United States)

    Battin, Tom J; Besemer, Katharina; Bengtsson, Mia M; Romani, Anna M; Packmann, Aaron I


    Streams and rivers form dense networks, shape the Earth's surface and, in their sediments, provide an immensely large surface area for microbial growth. Biofilms dominate microbial life in streams and rivers, drive crucial ecosystem processes and contribute substantially to global biogeochemical fluxes. In turn, water flow and related deliveries of nutrients and organic matter to biofilms constitute major constraints on microbial life. In this Review, we describe the ecology and biogeochemistry of stream biofilms and highlight the influence of physical and ecological processes on their structure and function. Recent advances in the study of biofilm ecology may pave the way towards a mechanistic understanding of the effects of climate and environmental change on stream biofilms and the biogeochemistry of stream ecosystems.

  14. Synergistic effects in mixed Escherichia coli biofilms

    DEFF Research Database (Denmark)

    Reisner, A.; Holler, B.M.; Molin, Søren


    Bacterial biofilms, often composed of multiple species and genetically distinct strains, develop under complex influences of cell-cell interactions. Although detailed knowledge about the mechanisms underlying formation of single-species laboratory biofilms has emerged, little is known about...... the pathways governing development of more complex heterogeneous communities. In this study, we established a laboratory model where biofilm-stimulating effects due to interactions between genetically diverse strains of Escherichia coli were monitored. Synergistic induction of biofilm formation resulting from...... the cocultivation of 403 undomesticated E. coli strains with a characterized E. coli K-12 strain was detected at a significant frequency. The survey suggests that different mechanisms underlie the observed stimulation, yet synergistic development of biofilm within the subset of E. coli isolates (n = 56) exhibiting...

  15. Pseudomonas aeruginosa biofilms in cystic fibrosis

    DEFF Research Database (Denmark)

    Høiby, Niels; Ciofu, Oana; Bjarnsholt, Thomas


    The persistence of chronic Pseudomonas aeruginosa lung infections in cystic fibrosis (CF) patients is due to biofilm-growing mucoid (alginate-producing) strains. A biofilm is a structured consortium of bacteria, embedded in a self-produced polymer matrix consisting of polysaccharide, protein...... and DNA. In CF lungs, the polysaccharide alginate is the major part of the P. aeruginosa biofilm matrix. Bacterial biofilms cause chronic infections because they show increased tolerance to antibiotics and resist phagocytosis, as well as other components of the innate and the adaptive immune system....... As a consequence, a pronounced antibody response develops, leading to immune complex-mediated chronic inflammation, dominated by polymorphonuclear leukocytes. The chronic inflammation is the major cause of the lung tissue damage in CF. Biofilm growth in CF lungs is associated with an increased frequency...

  16. Biofilms On Orbit and On Earth: Current Methods, Future Needs (United States)

    Vega, Leticia


    Biofilms have played a significant role on the effectiveness of life support hardware on the Space Shuttle and International Space Station (ISS). This presentation will discuss how biofilms impact flight hardware, how on orbit biofilms are analyzed from an engineering and research perspective, and future needs to analyze and utilize biofilms for long duration, deep space missions.

  17. Discovering Biofilms: Inquiry-Based Activities for the Classroom (United States)

    Redelman, Carly V.; Marrs, Kathleen; Anderson, Gregory G.


    In nature, bacteria exist in and adapt to different environments by forming microbial communities called "biofilms." We propose simple, inquiry-based laboratory exercises utilizing a biofilm formation assay, which allows controlled biofilm growth. Students will be able to qualitatively assess biofilm growth via staining. Recently, we developed a…

  18. In vitro phenotypic differentiation towards commensal and pathogenic oral biofilms

    NARCIS (Netherlands)

    Janus, M.M.; Keijser, B.J.F.; Bikker, F.J.; Exterkate, R.A.M.; Crielaard, W.; Krom, B.P.


    Commensal oral biofilms, defined by the absence of pathology-related phenotypes, are ubiquitously present. In contrast to pathological biofilms commensal biofilms are rarely studied. Here, the effect of the initial inoculum and subsequent growth conditions on in vitro oral biofilms was studied.

  19. Efficacy of NVC-422 against Staphylococcus aureus biofilms in a sheep biofilm model of sinusitis. (United States)

    Singhal, Deepti; Jekle, Andreas; Debabov, Dmitri; Wang, Lu; Khosrovi, Bez; Anderson, Mark; Foreman, Andrew; Wormald, Peter-John


    Bacterial biofilms are a major obstacle in management of recalcitrant chronic rhinosinusitis. NVC-422 is a potent, fast-acting, broad-spectrum, nonantibiotic, antimicrobial with a new mechanism of action effective against biofilm bacteria in in vitro conditions. The aim of this study was to investigate the safety and efficacy of NVC-422 as local antibiofilm treatment in a sheep model of rhinosinusitis. After accessing and occluding frontal sinus ostia in 24 merino sheep via staged endoscopic procedures, S. aureus clinical isolate was instilled in frontal sinuses. Following biofilm formation, ostial obstruction was removed and sinuses irrigated with 0.1% and 0.5% NVC-422 in 5 mM acetate isotonic saline at pH 4.0. Sheep were monitored for adverse effects and euthanized 24 hours after treatment. Frontal sinuses were assessed for infection and changes in mucosa after the treatment. S. aureus biofilms were identified with Baclight-confocal scanning microscopy protocol and the biofilm biomass assayed by applying the COMSTAT2 program to recorded image stacks. After 2 irrigations with 0.1% NVC-422, S. aureus biofilm biomass was reduced when compared to control sinuses (p = 0.0001), though this effect was variable in samples. NVC-422 0.5% solution irrigations reduced biofilm even more significantly and consistently over all samples (p biofilm biomass (p biofilms, with dose-dependent efficacy in this animal model of biofilm-associated sinusitis. Copyright © 2012 American Rhinologic Society-American Academy of Otolaryngic Allergy, LLC.

  20. Antibiotic resistance in Pseudomonas aeruginosa biofilms: towards the development of novel anti-biofilm therapies. (United States)

    Taylor, Patrick K; Yeung, Amy T Y; Hancock, Robert E W


    The growth of bacteria as structured aggregates termed biofilms leads to their protection from harsh environmental conditions such as physical and chemical stresses, shearing forces, and limited nutrient availability. Because of this highly adapted ability to survive adverse environmental conditions, bacterial biofilms are recalcitrant to antibiotic therapies and immune clearance. This is particularly problematic in hospital settings where biofilms are a frequent cause of chronic and device-related infections and constitute a significant burden on the health-care system. The major therapeutic strategy against infections is the use of antibiotics, which, due to adaptive resistance, are often insufficient to clear biofilm infections. Thus, novel biofilm-specific therapies are required. Specific features of biofilm development, such as surface adherence, extracellular matrix formation, quorum sensing, and highly regulated biofilm maturation and dispersal are currently being studied as targets to be exploited in the development of novel biofilm-specific treatments. Using Pseudomonas aeruginosa for illustrative purposes, this review highlights the antibiotic resistance mechanisms of biofilms, and discusses current research into novel biofilm-specific therapies. Copyright © 2014 Elsevier B.V. All rights reserved.

  1. Metal concentrations in stream biofilm and sediments and their potential to explain biofilm microbial community structure

    International Nuclear Information System (INIS)

    Ancion, Pierre-Yves; Lear, Gavin; Dopheide, Andrew; Lewis, Gillian D.


    Concentrations of metals associated with sediments have traditionally been analysed to assess the extent of heavy metal contamination in freshwater environments. Stream biofilms present an alternative medium for this assessment which may be more relevant to the risk incurred by stream ecosystems as they are intensively grazed by aquatic organisms at a higher trophic level. Therefore, we investigated zinc, copper and lead concentrations in biofilms and sediments of 23 stream sites variously impacted by urbanisation. Simultaneously, biofilm bacterial and ciliate protozoan community structure was analysed by Automated Ribosomal Intergenic Spacer Analysis and Terminal Restriction Fragment Length Polymorphism, respectively. Statistical analysis revealed that biofilm associated metals explained a greater proportion of the variations observed in bacterial and ciliate communities than did sediment associated-metals. This study suggests that the analysis of metal concentrations in biofilms provide a good assessment of detrimental effects of metal contaminants on aquatic biota. - Highlights: ► Zn, Cu and Pb concentrations in biofilm and sediments from 23 streams were assessed. ► Bacteria and ciliate protozoa were simultaneously used as biological indicators. ► Zn and Cu were generally enriched in biofilm compared to sediments. ► Metals in biofilm provide a useful assessment of freshwater ecosystem contamination. ► Results highlight the likely ecological importance of biofilm associated metals. - Metal concentrations in stream biofilms provide a good assessment of the effects of trace metal contaminants on freshwater ecosystems.

  2. Biofilm development in fixed bed biofilm reactors: experiments and simple models for engineering design purposes. (United States)

    Szilágyi, N; Kovács, R; Kenyeres, I; Csikor, Zs


    Biofilm development in a fixed bed biofilm reactor system performing municipal wastewater treatment was monitored aiming at accumulating colonization and maximum biofilm mass data usable in engineering practice for process design purposes. Initially a 6 month experimental period was selected for investigations where the biofilm formation and the performance of the reactors were monitored. The results were analyzed by two methods: for simple, steady-state process design purposes the maximum biofilm mass on carriers versus influent load and a time constant of the biofilm growth were determined, whereas for design approaches using dynamic models a simple biofilm mass prediction model including attachment and detachment mechanisms was selected and fitted to the experimental data. According to a detailed statistical analysis, the collected data have not allowed us to determine both the time constant of biofilm growth and the maximum biofilm mass on carriers at the same time. The observed maximum biofilm mass could be determined with a reasonable error and ranged between 438 gTS/m(2) carrier surface and 843 gTS/m(2), depending on influent load, and hydrodynamic conditions. The parallel analysis of the attachment-detachment model showed that the experimental data set allowed us to determine the attachment rate coefficient which was in the range of 0.05-0.4 m d(-1) depending on influent load and hydrodynamic conditions.

  3. Inactivation of Efflux Pumps Abolishes Bacterial Biofilm Formation

    DEFF Research Database (Denmark)

    Kvist, Malin; Hancock, Viktoria; Klemm, Per


    Bacterial biofilms cause numerous problems in health care and industry; notably, biofilms are associated with a large number of infections. Biofilm-dwelling bacteria are particularly resistant to antibiotics, making it hard to eradicate biofilm-associated infections. Bacteria rely on efflux pumps...... to get rid of toxic substances. We discovered that efflux pumps are highly active in bacterial biofilms, thus making efflux pumps attractive targets for antibiofilm measures. A number of efflux pump inhibitors (EPIs) are known. EPIs were shown to reduce biofilm formation, and in combination they could...... abolish biofilm formation completely. Also, EPIs were able to block the antibiotic tolerance of biofilms. The results of this feasibility study might pave the way for new treatments for biofilm-related infections and may be exploited for prevention of biofilms in general....

  4. Fractal analysis of Xylella fastidiosa biofilm formation (United States)

    Moreau, A. L. D.; Lorite, G. S.; Rodrigues, C. M.; Souza, A. A.; Cotta, M. A.


    We have investigated the growth process of Xylella fastidiosa biofilms inoculated on a glass. The size and the distance between biofilms were analyzed by optical images; a fractal analysis was carried out using scaling concepts and atomic force microscopy images. We observed that different biofilms show similar fractal characteristics, although morphological variations can be identified for different biofilm stages. Two types of structural patterns are suggested from the observed fractal dimensions Df. In the initial and final stages of biofilm formation, Df is 2.73±0.06 and 2.68±0.06, respectively, while in the maturation stage, Df=2.57±0.08. These values suggest that the biofilm growth can be understood as an Eden model in the former case, while diffusion-limited aggregation (DLA) seems to dominate the maturation stage. Changes in the correlation length parallel to the surface were also observed; these results were correlated with the biofilm matrix formation, which can hinder nutrient diffusion and thus create conditions to drive DLA growth.

  5. Biological synthesis of nanoparticles in biofilms. (United States)

    Tanzil, Abid H; Sultana, Sujala T; Saunders, Steven R; Shi, Liang; Marsili, Enrico; Beyenal, Haluk


    The biological synthesis of nanoparticles (NPs) by bacteria and biofilms via extracellular redox reactions has received attention because of the minimization of harmful chemicals, low cost, and ease of culturing and downstream processing. Bioreduction mechanisms vary across bacteria and growth conditions, which leads to various sizes and shapes of biosynthesized NPs. NP synthesis in biofilms offers additional advantages, such as higher biomass concentrations and larger surface areas, which can lead to more efficient and scalable biosynthesis. Although biofilms have been used to produce NPs, the mechanistic details of NP formation are not well understood. In this review, we identify three critical areas of research and development needed to advance our understanding of NP production by biofilms: 1) synthesis, 2) mechanism and 3) stabilization. Advancement in these areas could result in the biosynthesis of NPs that are suitable for practical applications, especially in drug delivery and biocatalysis. Specifically, the current status of methods and mechanisms of nanoparticle synthesis and surface stabilization using planktonic bacteria and biofilms is discussed. We conclude that the use of biofilms to synthesize and stabilize NPs is underappreciated and could provide a new direction in biofilm-based NP production. Copyright © 2016 Elsevier Inc. All rights reserved.

  6. Characterization of Mechanical Properties of Microbial Biofilms (United States)

    Callison, Elizabeth; Gose, James; Perlin, Marc; Ceccio, Steven


    The physical properties of microbial biofilms grown subject to shear flows determine the form and mechanical characteristics of the biofilm structure, and consequently, the turbulent interactions over and through the biofilm. These biofilms - sometimes referred to as slime - are comprised of microbial cells and extracellular polymeric substance (EPS) matrices that surround the multicellular communities. Some of the EPSs take the form of streamers that tend to oscillate in flows, causing increased turbulent mixing and drag. As the presence of EPS governs the compliance and overall stability of the filamentous streamers, investigation of the mechanical properties of biofilms may also inform efforts to understand hydrodynamic performance of fouled systems. In this study, a mixture of four diatom genera was grown under turbulent shear flow on test panels. The mechanical properties and hydrodynamic performance of the biofilm were investigated using rheology and turbulent flow studies in the Skin-Friction Flow Facility at the University of Michigan. The diatoms in the mixture of algae were identified, and the elastic and viscous moduli were determined from small-amplitude oscillations, while a creep test was used to evaluate the biofilm compliance.

  7. Crenarchaeal biofilm formation under extreme conditions.

    Directory of Open Access Journals (Sweden)

    Andrea Koerdt

    Full Text Available BACKGROUND: Biofilm formation has been studied in much detail for a variety of bacterial species, as it plays a major role in the pathogenicity of bacteria. However, only limited information is available for the development of archaeal communities that are frequently found in many natural environments. METHODOLOGY: We have analyzed biofilm formation in three closely related hyperthermophilic crenarchaeotes: Sulfolobus acidocaldarius, S. solfataricus and S. tokodaii. We established a microtitre plate assay adapted to high temperatures to determine how pH and temperature influence biofilm formation in these organisms. Biofilm analysis by confocal laser scanning microscopy demonstrated that the three strains form very different communities ranging from simple carpet-like structures in S. solfataricus to high density tower-like structures in S. acidocaldarius in static systems. Lectin staining indicated that all three strains produced extracellular polysaccharides containing glucose, galactose, mannose and N-acetylglucosamine once biofilm formation was initiated. While flagella mutants had no phenotype in two days old static biofilms of S. solfataricus, a UV-induced pili deletion mutant showed decreased attachment of cells. CONCLUSION: The study gives first insights into formation and development of crenarchaeal biofilms in extreme environments.

  8. Biofilms in Infections of the Eye

    Directory of Open Access Journals (Sweden)

    Paulo J. M. Bispo


    Full Text Available The ability to form biofilms in a variety of environments is a common trait of bacteria, and may represent one of the earliest defenses against predation. Biofilms are multicellular communities usually held together by a polymeric matrix, ranging from capsular material to cell lysate. In a structure that imposes diffusion limits, environmental microgradients arise to which individual bacteria adapt their physiologies, resulting in the gamut of physiological diversity. Additionally, the proximity of cells within the biofilm creates the opportunity for coordinated behaviors through cell–cell communication using diffusible signals, the most well documented being quorum sensing. Biofilms form on abiotic or biotic surfaces, and because of that are associated with a large proportion of human infections. Biofilm formation imposes a limitation on the uses and design of ocular devices, such as intraocular lenses, posterior contact lenses, scleral buckles, conjunctival plugs, lacrimal intubation devices and orbital implants. In the absence of abiotic materials, biofilms have been observed on the capsule, and in the corneal stroma. As the evidence for the involvement of microbial biofilms in many ocular infections has become compelling, developing new strategies to prevent their formation or to eradicate them at the site of infection, has become a priority.

  9. Treatment of Oral Multispecies Biofilms by an Anti-Biofilm Peptide.

    Directory of Open Access Journals (Sweden)

    Zhejun Wang

    Full Text Available Human oral biofilms are multispecies microbial communities that exhibit high resistance to antimicrobial agents. Dental plaque gives rise to highly prevalent and costly biofilm-related oral infections, which lead to caries or other types of oral infections. We investigated the ability of the recently identified anti-biofilm peptide 1018 to induce killing of bacterial cells present within oral multispecies biofilms. At 10 μg/ml (6.5 μM, peptide 1018 was able to significantly (p50% of the biofilm being killed and >35% being dispersed in only 3 minutes. Peptide 1018 may potentially be used by itself or in combination with CHX as a non-toxic and effective anti-biofilm agent for plaque disinfection in clinical dentistry.

  10. Implications of Biofilm Formation on Urological Devices (United States)

    Cadieux, Peter A.; Wignall, Geoffrey R.; Carriveau, Rupp; Denstedt, John D.


    Despite millions of dollars and several decades of research targeted at their prevention and eradication, biofilm-associated infections remain the major cause of urological device failure. Numerous strategies have been aimed at improving device design, biomaterial composition, surface properties and drug delivery, but have been largely circumvented by microbes and their plethora of attachment, host evasion, antimicrobial resistance, and dissemination strategies. This is not entirely surprising since natural biofilm formation has been going on for millions of years and remains a major part of microorganism survival and evolution. Thus, the fact that biofilms develop on and in the biomaterials and tissues of humans is really an extension of this natural tendency and greatly explains why they are so difficult for us to combat. Firstly, biofilm structure and composition inherently provide a protective environment for microorganisms, shielding them from the shear stress of urine flow, immune cell attack and some antimicrobials. Secondly, many biofilm organisms enter a metabolically dormant state that renders them tolerant to those antibiotics and host factors able to penetrate the biofilm matrix. Lastly, the majority of organisms that cause biofilm-associated urinary tract infections originate from our own oral cavity, skin, gastrointestinal and urogenital tracts and therefore have already adapted to many of our host defenses. Ultimately, while biofilms continue to hold an advantage with respect to recurrent infections and biomaterial usage within the urinary tract, significant progress has been made in understanding these dynamic microbial communities and novel approaches offer promise for their prevention and eradication. These include novel device designs, antimicrobials, anti-adhesive coatings, biodegradable polymers and biofilm-disrupting compounds and therapies.

  11. Candida Biofilms: Threats, Challenges, and Promising Strategies

    Directory of Open Access Journals (Sweden)

    Mafalda Cavalheiro


    Full Text Available Candida species are fungal pathogens known for their ability to cause superficial and systemic infections in the human host. These pathogens are able to persist inside the host due to the development of pathogenicity and multidrug resistance traits, often leading to the failure of therapeutic strategies. One specific feature of Candida species pathogenicity is their ability to form biofilms, which protects them from external factors such as host immune system defenses and antifungal drugs. This review focuses on the current threats and challenges when dealing with biofilms formed by Candida albicans, Candida glabrata, Candida tropicalis, and Candida parapsilosis, highlighting the differences between the four species. Biofilm characteristics depend on the ability of each species to produce extracellular polymeric substances (EPS and display dimorphic growth, but also on the biofilm substratum, carbon source availability and other factors. Additionally, the transcriptional control over processes like adhesion, biofilm formation, filamentation, and EPS production displays great complexity and diversity within pathogenic yeasts of the Candida genus. These differences not only have implications in the persistence of colonization and infections but also on antifungal resistance typically found in Candida biofilm cells, potentiated by EPS, that functions as a barrier to drug diffusion, and by the overexpression of drug resistance transporters. The ability to interact with different species in in vivo Candida biofilms is also a key factor to consider when dealing with this problem. Despite many challenges, the most promising strategies that are currently available or under development to limit biofilm formation or to eradicate mature biofilms are discussed.

  12. Biofilm extracellular DNA enhances mixed species biofilms of Staphylococcus epidermidis and Candida albicans. (United States)

    Pammi, Mohan; Liang, Rong; Hicks, John; Mistretta, Toni-Ann; Versalovic, James


    Polymicrobial infections are responsible for significant mortality and morbidity in adults and children. Staphylococcus epidermidis and Candida albicans are the most frequent combination of organisms isolated from polymicrobial infections. Vascular indwelling catheters are sites for mixed species biofilm formation and pose a significant risk for polymicrobial infections. We hypothesized that enhancement of biofilms in a mixed species environment increases patient mortality and morbidity. Mixed species biofilms of S. epidermidis and C. albicans were evaluated in vitro and in a subcutaneous catheter infection model in vivo. Mixed species biofilms were enhanced compared to single species biofilms of either S. epidermidis or C. albicans. A mixed species environment increased catheter infection and increased dissemination of S. epidermidis in mice. Microarrays were used to explore differential gene expression of S. epidermidis in the mixed species biofilms. In mixed species biofilms, compared to single species S. epidermidis biofilms, 2.7% of S. epidermidis genes were upregulated and 6% were down regulated. Staphylococcal autolysis repressors lrgA and lrgB were down regulated 36-fold and 27-fold respectively. The role of biofilm extracellular DNA was investigated by quantitation and by evaluating the effects of DNAse in a concentration and time dependent manner. S. epidermidis specific eDNA was increased in mixed species biofilms and further confirmed by degradation with DNAse. Mixed-species biofilms are enhanced and associated with increased S. epidermidis-specific eDNA in vitro and greater systemic dissemination of S. epidermidis in vivo. Down regulation of the lrg operon, a repressor of autolysis, associated with increased eDNA suggests a possible role for bacterial autolysis in mixed species biofilms. Enhancement and systemic dissemination of S. epidermidis may explain adverse outcomes after clinical polymicrobial infections of S. epidermidis and C. albicans.

  13. Prevention of biofilm formation and removal of existing biofilms by extracellular DNases of Campylobacter jejuni. (United States)

    Brown, Helen L; Reuter, Mark; Hanman, Kate; Betts, Roy P; van Vliet, Arnoud H M


    The fastidious nature of the foodborne bacterial pathogen Campylobacter jejuni contrasts with its ability to survive in the food chain. The formation of biofilms, or the integration into existing biofilms by C. jejuni, is thought to contribute to food chain survival. As extracellular DNA (eDNA) has previously been proposed to play a role in C. jejuni biofilms, we have investigated the role of extracellular DNases (eDNases) produced by C. jejuni in biofilm formation. A search of 2791 C. jejuni genomes highlighted that almost half of C. jejuni genomes contains at least one eDNase gene, but only a minority of isolates contains two or three of these eDNase genes, such as C. jejuni strain RM1221 which contains the cje0256, cje0566 and cje1441 eDNase genes. Strain RM1221 did not form biofilms, whereas the eDNase-negative strains NCTC 11168 and 81116 did. Incubation of pre-formed biofilms of NCTC 11168 with live C. jejuni RM1221 or with spent medium from a RM1221 culture resulted in removal of the biofilm. Inactivation of the cje1441 eDNase gene in strain RM1221 restored biofilm formation, and made the mutant unable to degrade biofilms of strain NCTC 11168. Finally, C. jejuni strain RM1221 was able to degrade genomic DNA from C. jejuni NCTC 11168, 81116 and RM1221, whereas strain NCTC 11168 and the RM1221 cje1441 mutant were unable to do so. This was mirrored by an absence of eDNA in overnight cultures of C. jejuni RM1221. This suggests that the activity of eDNases in C. jejuni affects biofilm formation and is not conducive to a biofilm lifestyle. These eDNases do however have a potential role in controlling biofilm formation by C. jejuni strains in food chain relevant environments.

  14. A novel approach for harnessing biofilm communities in moving bed biofilm reactors for industrial wastewater treatment


    Joe A. Lemire; Marc A. Demeter; Iain George; Howard Ceri; Raymond J. Turner


    Moving bed biofilm reactors (MBBRs) are an effective biotechnology for treating industrial wastewater. Biomass retention on moving bed biofilm reactor (MBBR) carriers (biofilm support materials), allows for the ease-of-operation and high treatment capacity of MBBR systems. Optimization of MBBR systems has largely focused on aspects of carrier design, while little attention has been paid to enhancing strategies for harnessing microbial biomass. Previously, our research group demonstrated that ...

  15. The Calgary Biofilm Device: New Technology for Rapid Determination of Antibiotic Susceptibilities of Bacterial Biofilms


    Ceri, H.; Olson, M. E.; Stremick, C.; Read, R. R.; Morck, D.; Buret, A.


    Determination of the MIC, based on the activities of antibiotics against planktonic bacteria, is the standard assay for antibiotic susceptibility testing. Adherent bacterial populations (biofilms) present with an innate lack of antibiotic susceptibility not seen in the same bacteria grown as planktonic populations. The Calgary Biofilm Device (CBD) is described as a new technology for the rapid and reproducible assay of biofilm susceptibilities to antibiotics. The CBD produces 96 equivalent bi...

  16. Biofilm extracellular DNA enhances mixed species biofilms of Staphylococcus epidermidis and Candida albicans (United States)


    Background Polymicrobial infections are responsible for significant mortality and morbidity in adults and children. Staphylococcus epidermidis and Candida albicans are the most frequent combination of organisms isolated from polymicrobial infections. Vascular indwelling catheters are sites for mixed species biofilm formation and pose a significant risk for polymicrobial infections. We hypothesized that enhancement of biofilms in a mixed species environment increases patient mortality and morbidity. Results Mixed species biofilms of S. epidermidis and C. albicans were evaluated in vitro and in a subcutaneous catheter infection model in vivo. Mixed species biofilms were enhanced compared to single species biofilms of either S. epidermidis or C. albicans. A mixed species environment increased catheter infection and increased dissemination of S. epidermidis in mice. Microarrays were used to explore differential gene expression of S. epidermidis in the mixed species biofilms. In mixed species biofilms, compared to single species S. epidermidis biofilms, 2.7% of S. epidermidis genes were upregulated and 6% were down regulated. Staphylococcal autolysis repressors lrgA and lrgB were down regulated 36-fold and 27-fold respectively. The role of biofilm extracellular DNA was investigated by quantitation and by evaluating the effects of DNAse in a concentration and time dependent manner. S. epidermidis specific eDNA was increased in mixed species biofilms and further confirmed by degradation with DNAse. Conclusions Mixed-species biofilms are enhanced and associated with increased S. epidermidis-specific eDNA in vitro and greater systemic dissemination of S. epidermidis in vivo. Down regulation of the lrg operon, a repressor of autolysis, associated with increased eDNA suggests a possible role for bacterial autolysis in mixed species biofilms. Enhancement and systemic dissemination of S. epidermidis may explain adverse outcomes after clinical polymicrobial infections of S

  17. Anaerobic granular sludge and biofilm reactors

    DEFF Research Database (Denmark)

    Skiadas, Ioannis V.; Gavala, Hariklia N.; Schmidt, Jens Ejbye


    by the immobilization of the biomass, which forms static biofilms, particle-supported biofilms, or granules depending on the reactor's operational conditions. The advantages of the high-rate anaerobic digestion over the conventional aerobic wastewater treatment methods has created a clear trend for the change......-rate anaerobic treatment systems based on anaerobic granular sludge and biofilm are described in this chapter. Emphasis is given to a) the Up-flow Anaerobic Sludge Blanket (UASB) systems, b) the main characteristics of the anaerobic granular sludge, and c) the factors that control the granulation process...

  18. Biofilm formation in a hot water system

    DEFF Research Database (Denmark)

    Bagh, L.K.; Albrechtsen, Hans-Jørgen; Arvin, Erik


    The biofilm formation rate was measured in situ in a hot water system in an apartment building by specially designed sampling equipment, and the net growth of the suspended bacteria was measured by incubation of water samples with the indigeneous bacteria. The biofilm formation rate reached......, in the sludge, or in the water from the distribution system was negligible. This indicated that bacterial growth took place on the inner surfaces in the hot water system and biofilm formation and detachment of bacteria could account for most of the suspended bacteria actually measured in hot water. Therefore...

  19. Quorum sensing inhibitors disable bacterial biofilms

    DEFF Research Database (Denmark)

    Bjarnsholt, Thomas; Tolker-Nielsen, Tim; Givskov, Michael


    It is now evident that bacteria assume the biofilm mode of growth during chronic infections. The important hallmarks of biofilm infections are development of local inflammations, extreme tolerance to the action of conventional antimicrobial agents and an almost infinite capacity to evade the host...... defence systems in particular innate immunity. In the biofilm mode, bacteria use cell to cell communication termed quorum-sensing (QS) to coordinate expression of virulence, tolerance towards a number of antimicrobial agents and shielding against the host defence system. Chemical biology approaches may...

  20. Fungal Biofilms: In Vivo Models for Discovery of Anti-Biofilm Drugs. (United States)

    Nett, Jeniel E; Andes, David R


    During infection, fungi frequently transition to a biofilm lifestyle, proliferating as communities of surface-adherent aggregates of cells. Phenotypically, cells in a biofilm are distinct from free-floating cells. Their high tolerance of antifungals and ability to withstand host defenses are two characteristics that foster resilience. Biofilm infections are particularly difficult to eradicate, and most available antifungals have minimal activity. Therefore, the discovery of novel compounds and innovative strategies to treat fungal biofilms is of great interest. Although many fungi have been observed to form biofilms, the most well-studied is Candida albicans. Animal models have been developed to simulate common Candida device-associated infections, including those involving vascular catheters, dentures, urinary catheters, and subcutaneous implants. Models have also reproduced the most common mucosal biofilm infections: oropharyngeal and vaginal candidiasis. These models incorporate the anatomical site, immune components, and fluid dynamics of clinical niches and have been instrumental in the study of drug resistance and investigation of novel therapies. This chapter describes the significance of fungal biofilm infections, the animal models developed for biofilm study, and how these models have contributed to the development of new strategies for the eradication of fungal biofilm infections.


    Energy Technology Data Exchange (ETDEWEB)

    Leschine, Susan


    This project addressed four major areas of investigation: i) characterization of formation of Cellulomonas uda biofilms on cellulose; ii) characterization of Clostridium phytofermentans biofilm development; colonization of cellulose and its regulation; iii) characterization of Thermobifida fusca biofilm development; colonization of cellulose and its regulation; and iii) description of the architecture of mature C. uda, C. phytofermentans, and T. fusca biofilms. This research is aimed at advancing understanding of biofilm formation and other complex processes involved in the degradation of the abundant cellulosic biomass, and the biology of the microbes involved. Information obtained from these studies is invaluable in the development of practical applications, such as the single-step bioconversion of cellulose-containing residues to fuels and other bioproducts. Our results have clearly shown that cellulose-decomposing microbes rapidly colonize cellulose and form complex structures typical of biofilms. Furthermore, our observations suggest that, as cells multiply on nutritive surfaces during biofilms formation, dramatic cell morphological changes occur. We speculated that morphological changes, which involve a transition from rod-shaped cells to more rounded forms, might be more apparent in a filamentous microbe. In order to test this hypothesis, we included in our research a study of biofilm formation by T. fusca, a thermophilic cellulolytic actinomycete commonly found in compost. The cellulase system of T. fusca has been extensively detailed through the work of David Wilson and colleagues at Cornell, and also, genome sequence of a T. fusca strain has been determine by the DOE Joint Genome Institute. Thus, T. fusca is an excellent subject for studies of biofilm development and its potential impacts on cellulose degradation. We also completed a study of the chitinase system of C. uda. This work provided essential background information for understanding how C. uda

  2. Fate of Salmonella Typhimurium in laboratory-scale drinking water biofilms

    CSIR Research Space (South Africa)

    Schaefer, Lisa M


    Full Text Available biofilms in monoculture and the fate and persistence of Salmonella in a mixed aquatic biofilm was examined. In monoculture S. Typhimurium formed loosely structured biofilms. Salmonella colonized established multi-species drinking water biofilms within 24...

  3. The Interface between Fungal Biofilms and Innate Immunity

    Directory of Open Access Journals (Sweden)

    John F. Kernien


    Full Text Available Fungal biofilms are communities of adherent cells surrounded by an extracellular matrix. These biofilms are commonly found during infection caused by a variety of fungal pathogens. Clinically, biofilm infections can be extremely difficult to eradicate due to their resistance to antifungals and host defenses. Biofilm formation can protect fungal pathogens from many aspects of the innate immune system, including killing by neutrophils and monocytes. Altered immune recognition during this phase of growth is also evident by changes in the cytokine profiles of monocytes and macrophages exposed to biofilm. In this manuscript, we review the host response to fungal biofilms, focusing on how these structures are recognized by the innate immune system. Biofilms formed by Candida, Aspergillus, and Cryptococcus have received the most attention and are highlighted. We describe common themes involved in the resilience of fungal biofilms to host immunity and give examples of biofilm defenses that are pathogen-specific.

  4. Characterization of starvation-induced dispersion in Pseudomonas putida biofilms

    DEFF Research Database (Denmark)

    Gjermansen, Morten; Ragas, Paula Cornelia; Sternberg, Claus


    The biofilm lifestyle, where microbial cells are aggregated because of expression of cell-to-cell interconnecting compounds, is believed to be of paramount importance to microbes in the environment. Because microbes must be able to alternate between sessile and planktonic states, it is anticipated...... that they must be able to regulate their ability to form biofilm and to dissolve biofilm. We present an investigation of a biofilm dissolution process occurring in flow-chamber-grown Pseudomonas putida biofilms. Local starvation-induced biofilm dissolution appears to be an integrated part of P. putida biofilm...... development that causes characteristic structural rearrangements. Rapid global dissolution of entire P. putida biofilms was shown to occur in response to carbon starvation. Genetic analysis suggested that the adjacent P. putida genes PP0164 and PP0165 play a role in P. putida biofilm formation and dissolution...

  5. Susceptibility of Porphyromonas gingivalis in biofilms to amoxicillin, doxycycline and metronidazole

    DEFF Research Database (Denmark)

    Larsen, T.


    Biofilm, Porphyromonas gingivalis, susceptibility testing, amoxicillin, doxycycline, metronidazole......Biofilm, Porphyromonas gingivalis, susceptibility testing, amoxicillin, doxycycline, metronidazole...

  6. Biofilm Formation by a Metabolically Versatile Bacterium

    National Research Council Canada - National Science Library

    Harwood, Caroline S


    .... The goal of this project is to conduct basic studies that will facilitate the development of a process wherein Rhodopseudomonas cells grown on surfaces as biofilms, produce hydrogen with energy...

  7. New approaches to combat Porphyromonas gingivalis biofilms (United States)

    Gerits, Evelien; Verstraeten, Natalie; Michiels, Jan


    ABSTRACT In nature, bacteria predominantly reside in structured, surface-attached communities embedded in a self-produced, extracellular matrix. These so-called biofilms play an important role in the development and pathogenesis of many infections, as they are difficult to eradicate due to their resistance to antimicrobials and host defense mechanisms. This review focusses on the biofilm-forming periodontal bacterium Porphyromonas gingivalis. Current knowledge on the virulence mechanisms underlying P. gingivalis biofilm formation is presented. In addition, oral infectious diseases in which P. gingivalis plays a key role are described, and an overview of conventional and new therapies for combating P. gingivalis biofilms is given. More insight into this intriguing pathogen might direct the development of better strategies to combat oral infections. PMID:28473880

  8. Bursting the bubble on bacterial biofilms

    DEFF Research Database (Denmark)

    Crusz, Shanika A; Popat, Roman; Rybtke, Morten Theil


    The flow cell biofilm system is an important and widely used tool for the in vitro cultivation and evaluation of bacterial biofilms under hydrodynamic conditions of flow. This paper provides an introduction to the background and use of such systems, accompanied by a detailed guide to the assembly...... of the apparatus including the description of new modifications which enhance its performance. As such, this is an essential guide for the novice biofilm researcher as well as providing valuable trouble-shooting techniques for even the most experienced laboratories. The adoption of a common and reliable...... methodology amongst researchers would enable findings to be shared and replicated amongst the biofilm research community, with the overall aim of advancing understanding and management of these complex and widespread bacterial communities....

  9. Treatment of Oral Multispecies Biofilms by an Anti-Biofilm Peptide. (United States)

    Wang, Zhejun; de la Fuente-Núñez, Cesar; Shen, Ya; Haapasalo, Markus; Hancock, Robert E W


    Human oral biofilms are multispecies microbial communities that exhibit high resistance to antimicrobial agents. Dental plaque gives rise to highly prevalent and costly biofilm-related oral infections, which lead to caries or other types of oral infections. We investigated the ability of the recently identified anti-biofilm peptide 1018 to induce killing of bacterial cells present within oral multispecies biofilms. At 10 μg/ml (6.5 μM), peptide 1018 was able to significantly (pbiofilm formation over 3 days. The activity of the peptide on preformed biofilms was found to be concentration-dependent since more than 60% of the total plaque biofilm cell population was killed by 10 μg/ml of peptide 1018 in 3 days, while at 5 μg/ml 50% of cells were dead and at 1 μg/ml the peptide triggered cell death in around 30% of the total bacterial population, as revealed by confocal microscopy. The presence of saliva did not affect peptide activity, since no statistically significant difference was found in the ability of peptide 1018 to kill oral biofilms using either saliva coated and non-saliva coated hydroxyapatite surfaces. Scanning electron microscopy experiments indicated that peptide 1018 induced cell lysis in plaque biofilms. Furthermore, combined treatment using peptide 1018 and chlorhexidine (CHX) increased the anti-biofilm activity of each compound compared to when these were used alone, resulting in >50% of the biofilm being killed and >35% being dispersed in only 3 minutes. Peptide 1018 may potentially be used by itself or in combination with CHX as a non-toxic and effective anti-biofilm agent for plaque disinfection in clinical dentistry.

  10. Activated Sludge and Aerobic Biofilm Reactors


    Von Sperling, Marcos


    "Activated Sludge and Aerobic Biofilm Reactors is the fifth volume in the series Biological Wastewater Treatment. The first part of the book is devoted to the activated sludge process, covering the removal of organic matter, nitrogen and phosphorus.A detailed analysis of the biological reactor (aeration tank) and the final sedimentation tanks is provided. The second part of the book covers aerobic biofilm reactors, especially trickling filters, rotating biological contractors and submerged ae...

  11. Role of Multicellular Aggregates in Biofilm Formation

    Directory of Open Access Journals (Sweden)

    Kasper N. Kragh


    Full Text Available In traditional models of in vitro biofilm development, individual bacterial cells seed a surface, multiply, and mature into multicellular, three-dimensional structures. Much research has been devoted to elucidating the mechanisms governing the initial attachment of single cells to surfaces. However, in natural environments and during infection, bacterial cells tend to clump as multicellular aggregates, and biofilms can also slough off aggregates as a part of the dispersal process. This makes it likely that biofilms are often seeded by aggregates and single cells, yet how these aggregates impact biofilm initiation and development is not known. Here we use a combination of experimental and computational approaches to determine the relative fitness of single cells and preformed aggregates during early development of Pseudomonas aeruginosa biofilms. We find that the relative fitness of aggregates depends markedly on the density of surrounding single cells, i.e., the level of competition for growth resources. When competition between aggregates and single cells is low, an aggregate has a growth disadvantage because the aggregate interior has poor access to growth resources. However, if competition is high, aggregates exhibit higher fitness, because extending vertically above the surface gives cells at the top of aggregates better access to growth resources. Other advantages of seeding by aggregates, such as earlier switching to a biofilm-like phenotype and enhanced resilience toward antibiotics and immune response, may add to this ecological benefit. Our findings suggest that current models of biofilm formation should be reconsidered to incorporate the role of aggregates in biofilm initiation.

  12. Neutrophil extracellular trap formation in supragingival biofilms. (United States)

    Hirschfeld, Josefine; Dommisch, Henrik; Skora, Philipp; Horvath, Gabor; Latz, Eicke; Hoerauf, Achim; Waller, Tobias; Kawai, Toshihisa; Jepsen, Søren; Deschner, James; Bekeredjian-Ding, Isabelle


    Oral biofilms are the causative agents of the highly prevalent oral diseases periodontitis and caries. Additionally, the host immune response is thought to play a critical role in disease onset. Neutrophils are known to be a key host response factor to bacterial challenge on host surfaces. Release of neutrophil extracellular traps (NETs) as a novel antimicrobial defense strategy has gained increasing attention in the past years. Here, we investigated the influx of neutrophils into the dental plaque and the ability of oral bacteria to trigger intra-biofilm release of NETs and intracellular proteins. Supragingival biofilms and whole saliva were sampled from systemically healthy subjects participating in an experimental gingivitis study. Biofilms were analysed by immunofluorescence followed by confocal and fluorescence microscopy. Moreover, concentrations of cytokines and immune-associated proteins in biofilm suspensions and saliva were assessed by ELISA. Neutrophils obtained from blood were stimulated with twelve bacterial species isolated from cultured biofilms or with lipopolysaccharide to monitor NET formation. Neutrophils, NETs, neutrophil-associated proteins (myeloperoxidase, elastase-2, cathepsin G, cathelicidin LL-37), interleukin-8, interleukin-1β and tumor necrosis factor were detected within plaque samples and saliva. All tested bacterial species as well as the polymicrobial samples isolated from the plaque of each donor induced release of NETs and interleukin-8. The degree of NET formation varied among different subjects and did not correlate with plaque scores or clinical signs of local inflammation. Our findings indicate that neutrophils are attracted towards dental biofilms, in which they become incorporated and where they are stimulated by microbes to release NETs and immunostimulatory proteins. Thus, neutrophils and NETs may be involved in host biofilm control, although their specific role needs to be further elucidated. Moreover, inter

  13. Physicochemical characteristics and microbial community evolution of biofilms during the start-up period in a moving bed biofilm reactor. (United States)

    Zhu, Yan; Zhang, Yan; Ren, Hong-Qiang; Geng, Jin-Ju; Xu, Ke; Huang, Hui; Ding, Li-Li


    This study aimed to investigate biofilm properties evolution coupled with different ages during the start-up period in a moving bed biofilm reactor system. Physicochemical characteristics including adhesion force, extracellular polymeric substances (EPS), morphology as well as volatile solid and microbial community were studied. Results showed that the formation and development of biofilms exhibited four stages, including (I) initial attachment and young biofilm formation, (II) biofilms accumulation, (III) biofilm sloughing and updating, and (IV) biofilm maturation. During the whole start-up period, adhesion force was positively and significantly correlated with the contents of EPS, especially the content of polysaccharide. In addition, increased adhesion force and EPS were beneficial for biofilm retention. Gram-negative bacteria mainly including Sphaerotilus, Zoogloea and Haliscomenobacter were predominant in the initial stage. Actinobacteria was beneficial to resist sloughing. Furthermore, filamentous bacteria were dominant in maturation biofilm. Copyright © 2015 Elsevier Ltd. All rights reserved.

  14. Role of biofilm roughness and hydrodynamic conditions in Legionella pneumophila adhesion to and detachment from simulated drinking water biofilms. (United States)

    Shen, Yun; Monroy, Guillermo L; Derlon, Nicolas; Janjaroen, Dao; Huang, Conghui; Morgenroth, Eberhard; Boppart, Stephen A; Ashbolt, Nicholas J; Liu, Wen-Tso; Nguyen, Thanh H


    Biofilms in drinking water distribution systems (DWDS) could exacerbate the persistence and associated risks of pathogenic Legionella pneumophila (L. pneumophila), thus raising human health concerns. However, mechanisms controlling adhesion and subsequent detachment of L. pneumophila associated with biofilms remain unclear. We determined the connection between L. pneumophila adhesion and subsequent detachment with biofilm physical structure characterization using optical coherence tomography (OCT) imaging technique. Analysis of the OCT images of multispecies biofilms grown under low nutrient condition up to 34 weeks revealed the lack of biofilm deformation even when these biofilms were exposed to flow velocity of 0.7 m/s, typical flow for DWDS. L. pneumophila adhesion on these biofilm under low flow velocity (0.007 m/s) positively correlated with biofilm roughness due to enlarged biofilm surface area and local flow conditions created by roughness asperities. The preadhered L. pneumophila on selected rough and smooth biofilms were found to detach when these biofilms were subjected to higher flow velocity. At the flow velocity of 0.1 and 0.3 m/s, the ratio of detached cell from the smooth biofilm surface was from 1.3 to 1.4 times higher than that from the rough biofilm surface, presumably because of the low shear stress zones near roughness asperities. This study determined that physical structure and local hydrodynamics control L. pneumophila adhesion to and detachment from simulated drinking water biofilm, thus it is the first step toward reducing the risk of L. pneumophila exposure and subsequent infections.

  15. Fremmedlegemeinfektioner--nyt om biofilm og quorum sensing

    DEFF Research Database (Denmark)

    Høiby, Niels; Johansen, Helle Krogh; Ciofu, Oana


    Biofilms are structured consortia of bacteria embedded in self-produced polymer matrix. Biofilms are resistant to antibiotics, disinfectives and phagocytosis. The persistence of foreign body infections is due to biofilms. Chronic P. aeruginosa lung infection in cystic fibrosis patients is a biofilm....... Bacteria in biofilms communicate by means of quorum sensing which activates genes for virulence factors. Biofilms can be prevented by antibiotic prophylaxis or early therapy or by quorum sensing inhibitors which make them susceptible to antibiotics and phagocytosis. Udgivelsesdato: 2007-Nov-26...

  16. Nanoindentation of Pseudomonas aeruginosa bacterial biofilm using atomic force microscopy

    International Nuclear Information System (INIS)

    Baniasadi, Mahmoud; Xu, Zhe; Du, Yingjie; Lu, Hongbing; Minary-Jolandan, Majid; Gandee, Leah; Zimmern, Philippe


    Bacterial biofilms are a source of many chronic infections. Biofilms and their inherent resistance to antibiotics are attributable to a range of health issues including affecting prosthetic implants, hospital-acquired infections, and wound infection. Mechanical properties of biofilm, in particular, at micro- and nano-scales, are governed by microstructures and porosity of the biofilm, which in turn may contribute to their inherent antibiotic resistance. We utilize atomic force microscopy (AFM)-based nanoindentation and finite element simulation to investigate the nanoscale mechanical properties of Pseudomonas aeruginosa bacterial biofilm. This biofilm was derived from human samples and represents a medically relevant model. (paper)

  17. The Candida albicans Biofilm Matrix: Composition, Structure and Function. (United States)

    Pierce, Christopher G; Vila, Taissa; Romo, Jesus A; Montelongo-Jauregui, Daniel; Wall, Gina; Ramasubramanian, Anand; Lopez-Ribot, Jose L


    A majority of infections caused by Candida albicans -the most frequent fungal pathogen-are associated with biofilm formation. A salient feature of C. albicans biofilms is the presence of the biofilm matrix. This matrix is composed of exopolymeric materials secreted by sessile cells within the biofilm, in which all classes of macromolecules are represented, and provides protection against environmental challenges. In this review, we summarize the knowledge accumulated during the last two decades on the composition, structure, and function of the C. albicans biofilm matrix. Knowledge of the matrix components, its structure, and function will help pave the way to novel strategies to combat C. albicans biofilm infections.

  18. Biofilm formation of Francisella noatunensis subsp. orientalis (United States)

    Soto, Esteban; Halliday-Wimmonds, Iona; Francis , Stewart; Kearney, Michael T.; Hansen, John D.


    Francisella noatunensis subsp. orientalis (Fno) is an emergent fish pathogen in both marine and fresh water environments. The bacterium is suspected to persist in the environment even without the presence of a suitable fish host. In the present study, the influence of different abiotic factors such as salinity and temperature were used to study the biofilm formation of different isolates of Fno including intracellular growth loci C (iglC)and pathogenicity determinant protein A (pdpA) knockout strains. Finally, we compared the susceptibility of planktonic and biofilm to three disinfectants used in the aquaculture and ornamental fish industry, namely Virkon®, bleach and hydrogen peroxide. The data indicates that Fno is capable of producing biofilms within 24 h where both salinity as well as temperature plays a role in the growth and biofilm formation of Fno. Mutations in theiglC or pdpA, both known virulence factors, do not appear to affect the capacity of Fno to produce biofilms, and the minimum inhibitory concentration, and minimum biocidal concentration for the three disinfectants were lower than the minimum biofilm eradication concentration values. This information needs to be taken into account if trying to eradicate the pathogen from aquaculture facilities or aquariums.

  19. Linking nutrient enrichment, sediment erodibility and biofilms (United States)

    Conrad, B.; Mahon, R.; Sojka, S. L.


    Sediment movement in coastal lagoons affects nutrient flux and primary producer growth. Previous research has shown that sediment erodibility is affected by biofilm concentration and that growth of benthic organisms, which produce biofilm, is affected by nutrient enrichment. However, researchers have not examined possible links between nutrient addition and sediment erodibility. We manipulated nutrient levels in the water column of 16 microcosms filled with homogenized sediment from a shallow coastal lagoon and artificial seawater to determine the effects on biofilm growth, measured through chlorophyll a and colloidal carbohydrate concentrations. Erosion tests using a Gust microcosm were conducted to determine the relationship between sediment erodibility and biofilm concentration. Results show that carbohydrate levels decreased with increasing nutrient enrichment and were unrelated to chlorophyll concentrations and erodibility. The nutrient levels did not predictably affect the chlorophyll levels, with lower chlorophyll concentrations in the control and medium enrichment treatments than the low and high enrichment treatments. Controls on biofilm growth are still unclear and the assumed relationship between carbohydrates and erodibility may be invalid. Understanding how biofilms respond to nutrient enrichment and subsequent effects on sediment erodibility is essential for protecting and restoring shallow coastal systems.

  20. Recolonization of laser-ablated bacterial biofilm. (United States)

    Nandakumar, Kanavillil; Obika, Hideki; Utsumi, Akihiro; Toshihiko, Ooie; Yano, Tetsuo


    The recolonization of laser-ablated bacterial monoculture biofilm was studied in the laboratory by using a flow-cytometer system. The marine biofilm-forming bacterium Pseudoalteromonas carrageenovora was used to develop biofilms on titanium coupons. Upon exposure to a low-power pulsed irradiation from an Nd:YAG laser, the coupons with biofilm were significantly reduced both in terms of total viable count (TVC) and area cover. The energy density used for a pulse of 5 ns was 0.1 J/cm(2) and the durations of irradiation exposure were 5 and 10 min. When placed in a flow of dilute ZoBell marine broth medium (10%) the laser-destructed bacterial film in a flow-cytometer showed significant recovery over a period of time. The flow of medium was regulated at 3.2 ml/min. The increase in area cover and TVC, however, was significantly less than that observed for nonirradiated control (t-test, Precolonization compared to control was thought be due to the lethal and sublethal impacts of laser irradiation on bacteria. This observation thus provided data on the online recolonization speed of biofilm, which is important when considering pulsed laser irradiation as an ablating technique of biofilm formation and removal in natural systems. Copyright 2003 Wiley Periodicals, Inc.

  1. Ultraviolet-Absorption Spectroscopic Biofilm Monitor (United States)

    Micheels, Ronald H.


    An ultraviolet-absorption spectrometer system has been developed as a prototype instrument to be used in continuous, real-time monitoring to detect the growth of biofilms. Such monitoring is desirable because biofilms are often harmful. For example, biofilms in potable-water and hydroponic systems act as both sources of pathogenic bacteria that resist biocides and as a mechanism for deterioration (including corrosion) of pipes. Biofilms formed from several types of hazardous bacteria can thrive in both plant-growth solutions and low-nutrient media like distilled water. Biofilms can also form in condensate tanks in air-conditioning systems and in industrial heat exchangers. At present, bacteria in potable-water and plant-growth systems aboard the space shuttle (and previously on the Mir space station) are monitored by culture-plate counting, which entails an incubation period of 24 to 48 hours for each sample. At present, there are no commercially available instruments for continuous monitoring of biofilms in terrestrial or spaceborne settings.

  2. Biofilm formation in attached microalgal reactors. (United States)

    Shen, Y; Zhu, W; Chen, C; Nie, Y; Lin, X


    The objective of this study was to investigate the fundamental question of biofilm formation. First, a drum biofilm reactor was introduced. The drums were coated with three porous substrates (cotton rope, canvas, and spandex), respectively. The relationships among the substrate, extracellular polymeric substances (EPS), and adhesion ratio were analyzed. Second, a plate biofilm reactor (PBR) was applied by replacing the drum with multiple parallel vertical plates to increase the surface area. The plates were coated with porous substrates on each side, and the nutrients were delivered to the cells by diffusion. The influence of nitrogen source and concentration on compositions of EPS and biofilm formation was analyzed using PBR under sunlight. The results indicated that both substrate and nitrogen were critical on the EPS compositions and biofilm formation. Under the optimal condition (glycine with concentration of 1 g l(-1) and substrate of canvas), the maximum biofilm productivity of 54.46 g m(-2) d(-1) with adhesion ratio of 84.4 % was achieved.

  3. Candida/Candida biofilms. First description of dual-species Candida albicans/C. rugosa biofilm. (United States)

    Martins, Carlos Henrique Gomes; Pires, Regina Helena; Cunha, Aline Oliveira; Pereira, Cristiane Aparecida Martins; Singulani, Junya de Lacorte; Abrão, Fariza; Moraes, Thais de; Mendes-Giannini, Maria José Soares


    Denture liners have physical properties that favour plaque accumulation and colonization by Candida species, irritating oral tissues and causing denture stomatitis. To isolate and determine the incidence of oral Candida species in dental prostheses, oral swabs were collected from the dental prostheses of 66 patients. All the strains were screened for their ability to form biofilms; both monospecies and dual-species combinations were tested. Candida albicans (63 %) was the most frequently isolated microorganism; Candida tropicalis (14 %), Candida glabrata (13 %), Candida rugosa (5 %), Candida parapsilosis (3 %), and Candida krusei (2 %) were also detected. The XTT assay showed that C. albicans SC5314 possessed a biofilm-forming ability significantly higher (p biofilm was less than the total CFU of a monospecies C. albicans biofilm. In contrast to the profuse hyphae verified in monospecies C. albicans biofilms, micrographies showed that the C. albicans/non-albicans Candida biofilms consisted of sparse yeast forms and profuse budding yeast cells that generated a network. These results suggested that C. albicans and the tested Candida species could co-exist in biofilms displaying apparent antagonism. The study provide the first description of C. albicans/C. rugosa mixed biofilm. Copyright © 2016 The British Mycological Society. Published by Elsevier Ltd. All rights reserved.

  4. The Roles of Biofilm Conductivity and Donor Substrate Kinetics in a Mixed-Culture Biofilm Anod (United States)

    We experimentally assessed kinetics and thermodynamics of electron transfer (ET) from the donor substrate (acetate) to the anode for a mixed-culture biofilm anode. We interpreted the results with a modified biofilm-conduction model consisting of three ET steps: (1) intracellular...

  5. High Biofilm Conductivity Maintained Despite Anode Potential Changes in a Geobacter-Enriched Biofilm (United States)

    This study systematically assessed intracellular electron transfer (IET) and extracellular electron transfer (EET) kinetics with respect to anode potential (Eanode) in a mixed-culture biofilm anode enriched with Geobacter spp. High biofilm conductivity (0.96–1.24 mScm^-1) was mai...

  6. Microelectrodes as novel research tools for environmental biofilm studies

    International Nuclear Information System (INIS)

    Yu, T.; Lu, R.; Bishop, L.


    Biofilm processes are widely utilized in environmental engineering for biodegradation of contaminated waters, gases and soils. It is important to understand the structure and functions of biofilms. Microelectrodes are novel experimental tools for environmental biofilm studies. The authors reviewed the techniques of oxygen, sulfide, redox potential and pH microelectrode. These microelectrodes have tip diameters of 3 to 20 μm, resulting a high spatial resolution. They enable us directly measure the chemical conditions as results of microbial activities in biofilms. The authors also reported the laboratory and field studies of wastewater biofilms using microelectrode techniques. The results of these studies provided experimental evidence on the stratification of microbial processes and the associated redox potential change in wastewater biofilms: (1) The oxygen penetration depth was only a fraction of the biofilm thickness. This observation, first made under laboratory conditions, has been confirmed under field conditions. (2) The biofilms with both aerobic oxidation and sulfate reduction had a clearly stratified structure. This was evidenced by a sharp decrease of redox potential near the interface between the aerobic zone and the sulfate reduction zone within the biofilm. In this type of biofilms, aerobic oxidation took place only in a shallow layer near the biofilm surface and sulfate reduction occurred in the deeper anoxic zone. (3) The redox potential changed with the shift of primary microbial process in biofilms, indicating that it is possible to use redox potential to help illustrate the structure and functions of biofilms. (author)

  7. Porphyromonas gingivalis and Treponema denticola synergistic polymicrobial biofilm development.

    Directory of Open Access Journals (Sweden)

    Ying Zhu

    Full Text Available Chronic periodontitis has a polymicrobial biofilm aetiology and interactions between key bacterial species are strongly implicated as contributing to disease progression. Porphyromonas gingivalis, Treponema denticola and Tannerella forsythia have all been implicated as playing roles in disease progression. P. gingivalis cell-surface-located protease/adhesins, the gingipains, have been suggested to be involved in its interactions with several other bacterial species. The aims of this study were to determine polymicrobial biofilm formation by P. gingivalis, T. denticola and T. forsythia, as well as the role of P. gingivalis gingipains in biofilm formation by using a gingipain null triple mutant. To determine homotypic and polymicrobial biofilm formation a flow cell system was employed and the biofilms imaged and quantified by fluorescent in situ hybridization using DNA species-specific probes and confocal scanning laser microscopy imaging. Of the three species, only P. gingivalis and T. denticola formed mature, homotypic biofilms, and a strong synergy was observed between P. gingivalis and T. denticola in polymicrobial biofilm formation. This synergy was demonstrated by significant increases in biovolume, average biofilm thickness and maximum biofilm thickness of both species. In addition there was a morphological change of T. denticola in polymicrobial biofilms when compared with homotypic biofilms, suggesting reduced motility in homotypic biofilms. P. gingivalis gingipains were shown to play an essential role in synergistic polymicrobial biofilm formation with T. denticola.

  8. Susceptibility of Staphylococcus aureus biofilms to reactive discharge gases. (United States)

    Traba, Christian; Liang, Jun F


    Formation of bacterial biofilms at solid-liquid interfaces creates numerous problems in both industrial and biomedical sciences. In this study, the susceptibility of Staphylococcus aureus biofilms to discharge gas generated from plasma was tested. It was found that despite distinct chemical/physical properties, discharge gases from oxygen, nitrogen, and argon demonstrated very potent and almost the same anti-biofilm activity. The bacterial cells in S. aureus biofilms were killed (>99.9%) by discharge gas within minutes of exposure. Under optimal experimental conditions, no bacteria and biofilm re-growth from discharge gas treated biofilms was found. Further studies revealed that the anti-biofilm activity of the discharge gas occurred by two distinct mechanisms: (1) killing bacteria in biofilms by causing severe cell membrane damage, and (2) damaging the extracellular polymeric matrix in the architecture of the biofilm to release biofilm from the surface of the solid substratum. Information gathered from this study provides an insight into the anti-biofilm mechanisms of plasma and confirms the applications of discharge gas in the treatment of biofilms and biofilm related bacterial infections.

  9. DNase I and proteinase K impair Listeria monocytogenes biofilm formation and induce dispersal of pre-existing biofilms. (United States)

    Nguyen, Uyen T; Burrows, Lori L


    Current sanitation methods in the food industry are not always sufficient for prevention or dispersal of Listeria monocytogenes biofilms. Here, we determined if prevention of adherence or dispersal of existing biofilms could occur if biofilm matrix components were disrupted enzymatically. Addition of DNase during biofilm formation reduced attachment (biofilms with 100μg/ml of DNase for 24h induced incomplete biofilm dispersal, with biofilm remaining compared to control. In contrast, addition of proteinase K completely inhibited biofilm formation, and 72h biofilms-including those grown under stimulatory conditions-were completely dispersed with 100μg/ml proteinase K. Generally-regarded-as-safe proteases bromelain and papain were less effective dispersants than proteinase K. In a time course assay, complete dispersal of L. monocytogenes biofilms from both polystyrene and type 304H food-grade stainless steel occurred within 5min at proteinase K concentrations above 25μg/ml. These data confirm that both DNA and proteins are required for L. monocytogenes biofilm development and maintenance, and that these components of the biofilm matrix can be targeted for effective prevention and removal of biofilms. Copyright © 2014 Elsevier B.V. All rights reserved.

  10. Biofilms in churches built in grottoes

    International Nuclear Information System (INIS)

    Cennamo, Paola; Montuori, Naomi; Trojsi, Giorgio; Fatigati, Giancarlo; Moretti, Aldo


    We investigated microorganisms dwelling on rocks, walls and paintings in two votive chapels built in grottoes in the Region of Campania, Italy. One grotto was near the coast in an area with a Mediterranean climate, and the other grotto was inland on a mountain in an area with a cold continental climate. Color and distribution of biofilms in various areas of the grottoes were examined. Microbial components of biofilms were identified by light and electron microscopy and by molecular techniques (DNA analyses and Automatic rRNA Intergenic Spacer Analysis). Biofilms were also analyzed by X-ray diffraction to detect inorganic constituents deriving from rocks in the grottoes and walls of the churches and by X-ray fluorescence to detect the elements that made up the pigments of the mural paintings; optical cross sections were used to observe their relationships with substrata. Species of eubacteria, cyanobacteria and green algae were identified. Some of these species occurred in both grottoes, while others were exclusive to only one of the grottoes. The diversity of species, their common or exclusive occurrence in the grottoes, the relationships among microbial communities and the differences in color and distribution of biofilms were discussed on the basis of the different climatic factors affecting the two grottoes and the different inorganic components of substrata. - Highlights: • Biofilms concur to the degradation of cultural heritage. • Microorganisms cause esthetic and structural damage in votive churches. • Biofilm features vary on different substrata, as limestone, plaster and paintings. • Features of biofilms mainly depend on environmental conditions. • Molecular biology techniques are indispensable in the study of biodegradation.

  11. Biofilms in churches built in grottoes

    Energy Technology Data Exchange (ETDEWEB)

    Cennamo, Paola, E-mail: [Facoltà di Lettere, Università degli Studi Suor Orsola Benincasa di Napoli, Via Santa Caterina da Siena 37, 80135 Naples (Italy); Montuori, Naomi [Dipartimento di Biologia, Università degli Studi di Napoli Federico II, Via Foria 223, 80139 Naples (Italy); Trojsi, Giorgio; Fatigati, Giancarlo [Facoltà di Lettere, Università degli Studi Suor Orsola Benincasa di Napoli, Via Santa Caterina da Siena 37, 80135 Naples (Italy); Moretti, Aldo [Dipartimento di Biologia, Università degli Studi di Napoli Federico II, Via Foria 223, 80139 Naples (Italy)


    We investigated microorganisms dwelling on rocks, walls and paintings in two votive chapels built in grottoes in the Region of Campania, Italy. One grotto was near the coast in an area with a Mediterranean climate, and the other grotto was inland on a mountain in an area with a cold continental climate. Color and distribution of biofilms in various areas of the grottoes were examined. Microbial components of biofilms were identified by light and electron microscopy and by molecular techniques (DNA analyses and Automatic rRNA Intergenic Spacer Analysis). Biofilms were also analyzed by X-ray diffraction to detect inorganic constituents deriving from rocks in the grottoes and walls of the churches and by X-ray fluorescence to detect the elements that made up the pigments of the mural paintings; optical cross sections were used to observe their relationships with substrata. Species of eubacteria, cyanobacteria and green algae were identified. Some of these species occurred in both grottoes, while others were exclusive to only one of the grottoes. The diversity of species, their common or exclusive occurrence in the grottoes, the relationships among microbial communities and the differences in color and distribution of biofilms were discussed on the basis of the different climatic factors affecting the two grottoes and the different inorganic components of substrata. - Highlights: • Biofilms concur to the degradation of cultural heritage. • Microorganisms cause esthetic and structural damage in votive churches. • Biofilm features vary on different substrata, as limestone, plaster and paintings. • Features of biofilms mainly depend on environmental conditions. • Molecular biology techniques are indispensable in the study of biodegradation.

  12. Oh What a Tangled Biofilm Web Bacteria Weave (United States)

    ... Home Page Oh What a Tangled Biofilm Web Bacteria Weave By Elia Ben-Ari Posted May 1, ... a suitable surface, some water and nutrients, and bacteria will likely put down stakes and form biofilms. ...

  13. Quantification of diatoms in biofilms: Standardisation of methods

    Digital Repository Service at National Institute of Oceanography (India)

    Patil, J.S.; Anil, A.C.

    of the difficulty in sampling and enumeration. Scraping or brushing are the traditional methods used for removal of diatoms from biofilms developed on solid substrata. The method of removal is the most critical step in enumerating the biofilm diatom community...

  14. Effect of Carvacrol on Salmonella Saintpaul Biofilms on Stainless ...

    African Journals Online (AJOL)

    2025 ... carvacrol on S. saintpaul biofilms on stainless steel surface was evaluated on ... cultures S. saintpaul at 35 ºC were diluted 1:100 .... characteristics of biofilm formation that occur in .... aureus and Salmonella enterica serovar Typhmurium.

  15. Dental biofilm: ecological interactions in health and disease

    NARCIS (Netherlands)

    Marsh, P.D.; Zaura, E.

    Background: The oral microbiome is diverse and exists as multispecies microbial communities on oral surfaces in structurally and functionally organized biofilms. Aim: To describe the network of microbial interactions (both synergistic and antagonistic) occurring within these biofilms and assess

  16. Analysis of biofilm formation and associated gene detection in ...

    African Journals Online (AJOL)



    Jan 26, 2012 ... positive strains and biofilm-negative strains, which indicates that the role of agr in ... Key words: Bovine mastitis Staphylococcus, biofilm, silver staining, crystal ... the culture medium was discarded and 1 ml of sterile phosphate.

  17. Bacteriophage-antibiotic synergism to control planktonic and biofilm ...

    African Journals Online (AJOL)

    Amina Amal Mahmoud Nouraldin


    Jul 11, 2015 ... mote resistance to antimicrobial agents, and its occurrence during the infectious ... Biofilm is a structured community of bacterial cells adher- ent to an inert or ..... biofilms with bacteriophages and chlorine. Biotechnol Bioeng.

  18. Combined Reactor and Microelectrode Measurements in Laboratory Grown Biofilms

    DEFF Research Database (Denmark)

    Larsen, Tove; Harremoës, Poul


    A combined biofilm reactor-/microelectrode experimental set-up has been constructed, allowing for simultaneous reactor mass balances and measurements of concentration profiles within the biofilm. The system consists of an annular biofilm reactor equipped with an oxygen microelectrode. Experiments...... were carried out with aerobic glucose and starch degrading biofilms. The well described aerobic glucose degradation biofilm system was used to test the combined reactor set-up. Results predicted from known biofilm kinetics were obtained. In the starch degrading biofilm, basic assumptions were tested...... with the microelectrode measurements. It was established, that even with a high molecular weight, non-diffusible substrate, degradation took place in the depths of the biofilm. Intrinsic enzymatic hydrolysis was not limiting and the volumetric removal rate of oxygen was zero order....

  19. Metagenomic Analysis of Showerhead Biofilms from a Hospital in Ohio (United States)

    Background: The National Institute of Health estimated that 80% of human microbial infections are associated with biofilms. Although water supplies and hospital equipments are constantly treated with disinfectants, the presence of biofilms in these areas has been frequently obser...

  20. Mimicking disinfection and drying of biofilms in contaminated endoscopes

    NARCIS (Netherlands)

    Kovaleva, J.; Degener, J. E.; van der Mei, H. C.


    The effects of peracetic acid-based (PAA) disinfectant with, and without, additional drying on Candida albicans, Candida parapsilosis, Pseudomonas aeruginosa and Stenotrophomonas maltophilia, isolated from contaminated flexible endoscopes, in single-and dual-species biofilms were studied. Biofilms

  1. The Exopolysaccharide Matrix: A Virulence Determinant of Cariogenic Biofilm


    Koo, H.; Falsetta, M.L.; Klein, M.I.


    Many infectious diseases in humans are caused or exacerbated by biofilms. Dental caries is a prime example of a biofilm-dependent disease, resulting from interactions of microorganisms, host factors, and diet (sugars), which modulate the dynamic formation of biofilms on tooth surfaces. All biofilms have a microbial-derived extracellular matrix as an essential constituent. The exopolysaccharides formed through interactions between sucrose- (and starch-) and Streptococcus mutans-derived exoenzy...

  2. The Composition and Metabolic Phenotype of Neisseria gonorrhoeae Biofilms

    Directory of Open Access Journals (Sweden)

    Michael A Apicella


    Full Text Available N. gonorrhoeae has been shown to form biofilms during cervical infection. Thus, biofilm formation may play an important role in the infection of women. The ability of N. gonorrhoeae to form membrane blebs is crucial to biofilm formation. Blebs contain DNA and outer membrane structures, which have been shown to be major constituents of the biofilm matrix. The organism expresses a DNA thermonuclease that is involved in remodeling of the biofilm matrix. Comparison of the transcriptional profiles of gonococcal biofilms and planktonic runoff indicate that genes involved in anaerobic metabolism and oxidative stress tolerance are more highly expressed in biofilm. The expression of aniA, ccp, and norB, which encode nitrite reductase, cytochrome c peroxidase, and nitric oxide reductase respectively, is required for mature biofilm formation over glass and human cervical cells. In addition, anaerobic respiration occurs in the substratum of gonococcal biofilms and disruption of the norB gene required for anaerobic respiration, results in a severe biofilm attenuation phenotype. It has been demonstrated that accumulation of nitric oxide (NO contributes to the phenotype of a norB mutant and can retard biofilm formation. However, NO can also enhance biofilm formation, and this is largely dependent on the concentration and donation rate or steady state kinetics of NO. The majority of the genes involved in gonococcal oxidative stress tolerance are also required for normal biofilm formation, as mutations in the following genes result in attenuated biofilm formation over cervical cells and/or glass: oxyR, gor, prx, mntABC, trxB, and estD. Overall, biofilm formation appears to be an adaptation for coping with the environmental stresses present in the female genitourinary tract. Therefore, this review will discuss the studies, which describe the composition and metabolic phenotype of gonococcal biofilms.

  3. The Development of Nitroxide Based Coatings for Biofilm Remediation- 154020 (United States)


    combat biofilm formation and growth is to use small molecules that act through non-microbicidal mechanisms to inhibit and/or disperse biofilms ...of materials (such as titanium, stainless steel , aluminium etc.)? Experiment: Our approaches used to address each of the fundamental challenges are...surfaces for inhibition of biofilm growth in a static assay has shown that the surfaces have little effect on biofilm formation . This result is very

  4. Effect of curcumin on Helicobacter pylori biofilm formation ...

    African Journals Online (AJOL)

    Three-dimensional structure of biofilm was imaged by scanning electron microscopy. The effect of curcumin on H. pylori adherence to HEp-2 cells was also investigated. Subinhibitory concentrations of curcumin inhibited the biofilm in dose dependent manner. However, H.pylori could restore ability to form biofilm during ...

  5. Genetic Basis for Saccharomyces cerevisiae Biofilm in Liquid Medium

    DEFF Research Database (Denmark)

    Andersen, Kaj Scherz; Bojsen, Rasmus Kenneth; Gro Rejkjær Sørensen, Laura


    Biofilm-forming microorganisms switch between two forms: free-living planktonic and sessile multicellular. Sessile communities of yeast biofilms in liquid medium provide a primitive example of multicellularity and are clinically important because biofilms tend to have other growth characteristics...

  6. Influence of Streptococcus mutans on Enterococcus faecalis Biofilm Formation

    NARCIS (Netherlands)

    Deng, Dong Mei; Hoogenkamp, Michel A.; Exterkate, Rob A. M.; Jiang, Lei Meng; van der Sluis, Lucas W. M.; ten Cate, Jacob M.; Crielaard, Wim

    Introduction: An important virulence factor of Enterococcus faecalis is its ability to form biofilms. Most studies on biofilm formation have been carried out by using E. faecalis monocultures. Given the polymicrobial nature of root canal infections, it is important to understand biofilm formation of

  7. Microbial Activity Influences Electrical Conductivity of Biofilm Anode (United States)

    This study assessed the conductivity of a Geobacter-enriched biofilm anode along with biofilm activity in a microbial electrochemical cell (MxC) equipped with two gold anodes (25 mM acetate medium), as different proton gradients were built throughout the biofilm. There was no pH ...

  8. Biofilm Formation on Dental Restorative and Implant Materials

    NARCIS (Netherlands)

    Busscher, H. J.; Rinastiti, M.; Siswomihardjo, W.; van der Mei, H. C.

    Biomaterials for the restoration of oral function are prone to biofilm formation, affecting oral health. Oral bacteria adhere to hydrophobic and hydrophilic surfaces, but due to fluctuating shear, little biofilm accumulates on hydrophobic surfaces in vivo. More biofilm accumulates on rough than on

  9. Extracellular DNA as matrix component in microbial biofilms

    DEFF Research Database (Denmark)

    Chiang, Wen-Chi; Tolker-Nielsen, Tim


    Bacteria in nature primarily live in surface-associated communities commonly known as biofilms. Because bacteria in biofilms, in many cases, display tolerance to host immune systems, antibiotics, and biocides, they are often difficult or impossible to eradicate. Biofilm formation, therefore, leads...

  10. Oral cavity anaerobic pathogens in biofilm formation on voice prostheses

    NARCIS (Netherlands)

    Bertl, Kristina; Zijnge, Vincent; Zatorska, Beata; Leonhard, Matthias; Schneider-Stickler, Berit; Harmsen, Hermie J. M.

    BACKGROUND: A polymerase chain reaction (PCR)-based method has been used to identify oral anaerobic pathogens in biofilms on voice prostheses. The purpose of the present study was to determine the location of those pathogens inside the biofilms. METHODS: Biofilms of 15 voice prostheses were sampled

  11. Mycobacterial biofilms: a greasy way to hold it together. (United States)

    Zambrano, María Mercedes; Kolter, Roberto


    Microorganisms growing on surfaces can form biofilms under certain conditions. In this issue of Cell, Ojha et al. (2005) investigate biofilm formation in mycobacteria. They identify new cell-wall components that are required for the formation of architecturally complex mature biofilms in these bacteria and the surprising involvement of a chaperone protein in this process.

  12. Biofilm production and antibiotic susceptibility profile of Escherichia ...

    African Journals Online (AJOL)

    Of the 139 isolates tested, 58 (42%) were biofilm producers with 22 (16%) of these being strong biofilm producers. Antibiotic resistance was common but kanamycin, meropenem and lomefloxacin were the most active with 6.6, 5.8 and 4.3% resistance rates respectively. The rate of biofilm formation was higher among E. coli ...

  13. Impact of osteitis and biofilm formation and correlation between both ...

    African Journals Online (AJOL)

    Background: The pathogenesis of diffuse sinonasal polyposis is still not completely established, possible explanations are osteitis, aeroallergens, fungal sinusitis and biofilms. There are no reports in Egypt about osteitis and biofilms in those patients. Purpose: To study the incidence and impact of osteitis and biofilms in ...

  14. Dimensioning of aerated submerged fixed bed biofilm reactors ...

    African Journals Online (AJOL)

    The description of a biofilm mathematical model application for dimensioning an aerated fixed bed biofilm reactor (ASFBBR) for petrochemical wastewater polishing is presented. A simple one-dimensional model of biofilm, developed by P Harremöes, was chosen for this purpose. The model was calibrated and verified ...

  15. Epithelial cell detachment by Porphyromonas gingivalis biofilm and planktonic cultures

    NARCIS (Netherlands)

    Huang, L.; van Loveren, C.; Ling, J.; Wei, X.; Crielaard, W.; Deng, D.M.


    Porphyromonas gingivalis is present as a biofilm at the sites of periodontal infections. The detachment of gingival epithelial cells induced by P. gingivalis biofilms was examined using planktonic cultures as a comparison. Exponentially grown planktonic cultures or 40-h biofilms were co-incubated

  16. Specific plant induced biofilm formation in Methylobacterium species (United States)

    Rossetto, Priscilla B.; Dourado, Manuella N.; Quecine, Maria C.; Andreote, Fernando D.; Araújo, Welington L.; Azevedo, João L.; Pizzirani-Kleiner, Aline A.


    Two endophytic strains of Methylobacterium spp. were used to evaluate biofilm formation on sugarcane roots and on inert wooden sticks. Results show that biofilm formation is variable and that plant surface and possibly root exudates have a role in Methylobacterium spp. host recognition, biofilm formation and successful colonization as endophytes. PMID:24031703

  17. A cathelicidin-2-derived peptide effectively impairs Staphylococcus epidermidis biofilms

    NARCIS (Netherlands)

    Molhoek, E.M.; van Dijk, A.; Veldhuizen, E.J.A.; Haagsman, H.P.; Bikker, F.J.


    Staphylococcus epidermidis is a major cause of nosocomial infections owing to its ability to form biofilms on the surface of medical devices. Biofilms are surface-adhered bacterial communities. In mature biofilms these communities are encased in an extracellular matrix composed of bacterial

  18. Induction of beta-lactamase production in Pseudomonas aeruginosa biofilm

    DEFF Research Database (Denmark)

    Giwercman, B; Jensen, E T; Høiby, N


    Imipenem induced high levels of beta-lactamase production in Pseudomonas aeruginosa biofilms. Piperacillin also induced beta-lactamase production in these biofilms but to a lesser degree. The combination of beta-lactamase production with other protective properties of the biofilm mode of growth c...... could be a major reason for the persistence of this sessile bacterium in chronic infections....

  19. Biofilm Formation Characteristics of Pseudomonas lundensis Isolated from Meat. (United States)

    Liu, Yong-Ji; Xie, Jing; Zhao, Li-Jun; Qian, Yun-Fang; Zhao, Yong; Liu, Xiao


    Biofilms formations of spoilage and pathogenic bacteria on food or food contact surfaces have attracted increasing attention. These events may lead to a higher risk of food spoilage and foodborne disease transmission. While Pseudomonas lundensis is one of the most important bacteria that cause spoilage in chilled meat, its capability for biofilm formation has been seldom reported. Here, we investigated biofilm formation characteristics of P. lundensis mainly by using crystal violet staining, and confocal laser scanning microscopy (CLSM). The swarming and swimming motility, biofilm formation in different temperatures (30, 10, and 4 °C) and the protease activity of the target strain were also assessed. The results showed that P. lundensis showed a typical surface-associated motility and was quite capable of forming biofilms in different temperatures (30, 10, and 4 °C). The strain began to adhere to the contact surfaces and form biofilms early in the 4 to 6 h. The biofilms began to be formed in massive amounts after 12 h at 30 °C, and the extracellular polysaccharides increased as the biofilm structure developed. Compared with at 30 °C, more biofilms were formed at 4 and 10 °C even by a low bacterial density. The protease activity in the biofilm was significantly correlated with the biofilm formation. Moreover, the protease activity in biofilm was significantly higher than that of the corresponding planktonic cultures after cultured 12 h at 30 °C. © 2015 Institute of Food Technologists®

  20. Shaping the growth behaviour of biofilms initiated from bacterial aggregates

    DEFF Research Database (Denmark)

    Melaugh, Gavin; Hutchison, Jaime; Kragh, Kasper Nørskov


    Bacterial biofilms are usually assumed to originate from individual cells deposited on a surface. However, many biofilm-forming bacteria tend to aggregate in the planktonic phase so that it is possible that many natural and infectious biofilms originate wholly or partially from pre-formed cell ag...

  1. Diagnosis of biofilm infections in cystic fibrosis patients

    DEFF Research Database (Denmark)

    Høiby, Niels; Bjarnsholt, Thomas; Moser, Claus


    Chronic Pseudomonas aeruginosa biofilm lung infection in cystic fibrosis patients is the best described biofilm infection in medicine. The initial focus can be the paranasal sinuses and then follows repeated colonization and infection of the lungs by aspiration. The matrix of the biofilms is domi...... by other pathogens e.g., Stenotrophomonas, Burkholderia multivorans, Achromobacter xylosoxidans and Mycobacterium abscessus complex....

  2. En rejse ind i dental biofilm

    DEFF Research Database (Denmark)

    Schlafer, Sebastian

    Som klinkassistent og tandplejer arbejder man hver dag med bakteriel biofilm på tandoverfladerne – plak. Alle ved udmærket, at denne biofilm er ansvarlig for mundhulens hyppigste sygdomme, caries og parodontitis. Vi renser patienternes tænder for biofilm og opfordrer dem til at fjerne biofilmen...... mindst to gange om dagen, så grundigt de kan. Desuden bruges der en lang række antibakterielle tilsætningsstoffer i både tandpasta og mundskyllevæsker, hvis hovedformål er at dræbe bakterierne i dental biofilm. Men er biofilmen virkelig kun farlig? Nyere forskning har vist, at mennesket faktisk i høj...... grad er afhængig af de bakterier, der koloniserer kroppen. Hvorfor gælder dette tilsyneladende ikke for mundhulen? I løbet af præsentationen vil jeg tage tilhørerne med på en rejse ind i dental biofilm. Jeg vil belyse den komplekse bakterielle arkitektur, som kendetegner biofilmen, og vil analysere de...

  3. Monochloramine Cometabolism by Nitrifying Biofilm Relevant ... (United States)

    Recently, biological monochloramine removal (i.e., cometabolism) by a pure culture ammonia–oxidizing bacteria, Nitrosomonas europaea, and a nitrifying mixed–culture have been shown to increase monochloramine demand. Although important, these previous suspended culture batch kinetic experiments were not representative of drinking water distribution systems where bacteria grow predominantly as biofilm attached to pipe walls or sediments and physiological differences may exist between suspension and biofilm growth. Therefore, the current research was an important next step in extending the previous results to investigate monochloramine cometabolism by biofilm grown in annular reactors under drinking water relevant conditions. Estimated monochloramine cometabolism kinetics were similar to those of ammonia metabolism, and monochloramine cometabolism was a significant loss mechanism (25–40% of the observed monochloramine loss). These results demonstrated that monochloramine cometabolism occurred in drinking water relevant nitrifying biofilm; thus, cometabolism may be a significant contribution to monochloramine loss during nitrification episodes in distribution systems. Investigate whether or not nitrifying biofilm can biologically transform monochloramine under drinking water relevant conditions.

  4. Bacillus subtilis biofilm induction by plant polysaccharides. (United States)

    Beauregard, Pascale B; Chai, Yunrong; Vlamakis, Hera; Losick, Richard; Kolter, Roberto


    Bacillus subtilis is a plant-beneficial Gram-positive bacterium widely used as a biofertilizer. However, relatively little is known regarding the molecular processes underlying this bacterium's ability to colonize roots. In contrast, much is known about how this bacterium forms matrix-enclosed multicellular communities (biofilms) in vitro. Here, we show that, when B. subtilis colonizes Arabidopsis thaliana roots it forms biofilms that depend on the same matrix genes required in vitro. B. subtilis biofilm formation was triggered by certain plant polysaccharides. These polysaccharides served as a signal for biofilm formation transduced via the kinases controlling the phosphorylation state of the master regulator Spo0A. In addition, plant polysaccharides are used as a source of sugars for the synthesis of the matrix exopolysaccharide. The bacterium's response to plant polysaccharides was observed across several different strains of the species, some of which are known to have beneficial effects on plants. These observations provide evidence that biofilm genes are crucial for Arabidopsis root colonization by B. subtilis and provide insights into how matrix synthesis may be triggered by this plant.

  5. In situ rheology of yeast biofilms. (United States)

    Brugnoni, Lorena I; Tarifa, María C; Lozano, Jorge E; Genovese, Diego


    The aim of the present work was to investigate the in situ rheological behavior of yeast biofilms growing on stainless steel under static and turbulent flow. The species used (Rhodototula mucilaginosa, Candida krusei, Candida kefyr and Candida tropicalis) were isolated from a clarified apple juice industry. The flow conditions impacted biofilm composition over time, with a predominance of C. krusei under static and turbulent flow. Likewise, structural variations occurred, with a tighter appearance under dynamic flow. Under turbulent flow there was an increase of 112 μm in biofilm thickness at 11 weeks (p < 0.001) and cell morphology was governed by hyphal structures and rounded cells. Using the in situ growth method introduced here, yeast biofilms were determined to be viscoelastic materials with a predominantly solid-like behavior, and neither this nor the G'0 values were significantly affected by the flow conditions or the growth time, and at large deformations their weak structure collapsed beyond a critical strain of about 1.5-5%. The present work could represent a starting point for developing in situ measurements of yeast rheology and contribute to a thin body of knowledge about fungal biofilm formation.

  6. Modeling physiological resistance in bacterial biofilms. (United States)

    Cogan, N G; Cortez, Ricardo; Fauci, Lisa


    A mathematical model of the action of antimicrobial agents on bacterial biofilms is presented. The model includes the fluid dynamics in and around the biofilm, advective and diffusive transport of two chemical constituents and the mechanism of physiological resistance. Although the mathematical model applies in three dimensions, we present two-dimensional simulations for arbitrary biofilm domains and various dosing strategies. The model allows the prediction of the spatial evolution of bacterial population and chemical constituents as well as different dosing strategies based on the fluid motion. We find that the interaction between the nutrient and the antimicrobial agent can reproduce survival curves which are comparable to other model predictions as well as experimental results. The model predicts that exposing the biofilm to low concentration doses of antimicrobial agent for longer time is more effective than short time dosing with high antimicrobial agent concentration. The effects of flow reversal and the roughness of the fluid/biofilm are also investigated. We find that reversing the flow increases the effectiveness of dosing. In addition, we show that overall survival decreases with increasing surface roughness.

  7. Simvastatin inhibits Candida albicans biofilm in vitro. (United States)

    Liu, Geoffrey; Vellucci, Vincent F; Kyc, Stephanie; Hostetter, Margaret K


    By inhibiting the conversion of 3-hydroxy-3-methylglutaryl CoA (HMG-CoA) to mevalonate, statins impair cholesterol metabolism in humans. We reasoned that statins might similarly interfere with the biosynthesis of ergosterol, the major sterol of the yeast cell membrane. As assessed by spectrophotometric and microscopic analysis, significant inhibition of biofilm production was noted after 16-h incubation with 1, 2.5, and 5 muM simvastatin, concentrations that did not affect growth, adhesion, or hyphal formation by C. albicans in vitro. Higher concentrations (10, 20, and 25 muM simvastatin) inhibited biofilm by >90% but also impaired growth. Addition of exogenous ergosterol (90 muM) overcame the effects of 1 and 2.5 muM simvastatin, suggesting that at least one mechanism of inhibition is interference with ergosterol biosynthesis. Clinical isolates from blood, skin, and mucosal surfaces produced biofilms; biofilms from bloodstream isolates were similarly inhibited by simvastatin. In the absence of fungicidal activity, simvastatin's interruption of a critical step in an essential metabolic pathway, highly conserved from yeast to man, has unexpected effects on biofilm production by a eukaryotic pathogen.

  8. Electrochemical sensors for biofilm and biocorrosion

    Energy Technology Data Exchange (ETDEWEB)

    Tribollet, B. [UPR 15 du CNRS, Universite Paris 6, 4 Place Jussieu, 75252 Paris Cedex05 (France)


    The presence of biofilm modifies the electrochemical properties of the interface and the mass transport near the interface. Two biofilm effects are damageable: the reduction of heat and/or mass transfer and the biocorrosion or microbiologically influenced corrosion (MIC). Two kinds of electrochemical sensors were developed: the first kind for the biofilm detection and the second one to evaluate the MIC risk. The biofilm detection is obtained by considering either the potential modification of the interface or the mass transport modification. The mass transport modification is analysed by considering the limiting diffusion current measured on a gold electrode where the biofilm development occurs. The MIC risk is evaluated with a sensor composed of two concentric electrodes in the material under investigation (e.g. carbon steel): a small disk electrode in the centre and a large ring. In a first step, a pit is artificially initiated by applying a current through these electrodes. In a second step, the risk factors of MIC are investigated by analysing the free coupling current circulating between these two short-circuited electrodes. (Abstract Copyright [2003], Wiley Periodicals, Inc.)

  9. The Fluid Dynamics of Nascent Biofilms (United States)

    Farthing, Nicola; Snow, Ben; Wilson, Laurence; Bees, Martin


    Many anti-biofilm approaches target mature biofilms with biochemical or physio-chemical interventions. We investigate the mechanics of interventions at an early stage that aim to inhibit biofilm maturation, focusing on hydrodynamics as cells transition from planktonic to surface-attached. Surface-attached cells generate flow fields that are relatively long-range compared with cells that are freely-swimming. We look at the effect of these flows on the biofilm formation. In particular, we use digital inline holographic microscopy to determine the three-dimensional flow due to a surface-attached cell and the effect this flow has on both tracers and other cells in the fluid. We compare experimental data with two models of cells on boundaries. The first approach utilizes slender body theory and captures many of the features of the experimental field. The second model develops a simple description in terms of singularity solutions of Stokes' flow, which produces qualitatively similar dynamics to both the experiments and more complex model but with significant computational savings. The range of validity of multiple cell arrangements is investigated. These two descriptions can be used to investigate the efficacy of actives developed by Unilever on nascent biofilms.

  10. Biofilms on Hospital Shower Hoses: Characterization and ... (United States)

    Although the source of drinking water used in hospitals is commonly, biofilms on water pipelines are refuge to bacteria that survive different disinfection strategies. Drinking water (DW) biofilms are well known to harbor opportunistic pathogens, however, these biofilm communities remain poorly characterized by culture-independent approaches that circumvent the limitations of conventional monitoring efforts. Hence, the frequency of pathogens in DW biofilms and how biofilm members withstand high doses of disinfectants and/or chlorine residuals in the water supply remain speculative, but directly impact public health. The aim of this study was to characterize the composition of microbial communities growing on five hospital shower hoses using both culture-dependent and culture-independent techniques. Two different sequence-based methods were used to characterize the bacterial fractions: 16S rRNA gene sequencing of bacterial cultures and next generation sequencing of metagenomes. Based on the metagenomic data, we found that Mycobacterium-like species was the abundant bacterial taxa that overlapped among the five samples. We also recovered the draft genome of a novel Mycobacterium species, closely related to opportunistic pathogenic nontuberculous mycobacteria, M. rhodesiae and M. tusciae, in addition to other, less abundant species. In contrast, the cultured fraction was mostly affiliated to Proteobacteria, such as members of the Sphingomonas, Blastomonas and Porph

  11. Beneficial Oral Biofilms as Smart Bioactive Interfaces

    Directory of Open Access Journals (Sweden)

    Beatrice Gutt


    Full Text Available Periodontitis is a very common health problem caused by formation of pathogenic bacterial biofilm that triggers inflammation resulting in either reversible gingivitis or irreversible periodontal hard and soft tissue damages, leading to loss of teeth when left untreated. Commensal bacteria play an important role in oral health in many aspects. Mainly by colonizing oral tissues, they (i contribute to maturation of immune response, and (ii foreclose attachment of pathobiont and, therefore, prevent from infection. The main goal of the study was to investigate if blocking of receptors on a commensal biofilm can prevent or reduce the attachment of pathogenic strains. To do so, biofilm produced by commensal Streptococcus sanguinis was treated with whole cell lysate of pathobionts Fusobacterium nucleatum or Porphyromonas gingivalis, followed by incubation with respective strain(s. The study revealed significant reduction in pathobiont adhesion to lysate-treated commensal biofilm. Therefore, adhesion of pathobionts onto the lysate-blocked biofilm was hindered; however, not completely eliminated supporting the idea that such approach in the oral cavity would benefit the production of a well-balanced and healthy bioactive interface.

  12. Microbial Biofilms: Persisters, Tolerance and Dosing (United States)

    Cogan, N. G.


    Almost all moist surfaces are colonized by microbial biofilms. Biofilms are implicated in cross-contamination of food products, biofouling, medical implants and various human infections such as dental cavities, ulcerative colitis and chronic respiratory infections. Much of current research is focused on the recalcitrance of biofilms to typical antibiotic and antimicrobial treatments. Although the polymer component of biofilms impedes the penetration of antimicrobials through reaction-diffusion limitation, this does not explain the observed tolerance, it merely delays the action of the agent. Heterogeneities in growth-rate also slow the eradication of the bacteria since most antimicrobials are far less effective for non-growing, or slowly growing bacteria. This also does not fully describe biofilm tolerance, since heterogeneities arr primairly a result of nutrient consumption. In this investigation, we describe the formation of `persister' cells which neither grow nor die in the presence of antibiotics. We propose that the cells are of a different phenotype than typical bacterial cells and the expression of the phenotype is regulated by the growth rate and the antibiotic concentration. We describe several experiments which describe the dynamics of persister cells and which motivate a dosing protocol that calls for periodic dosing of the population. We then introduce a mathematical model, which describes the effect of such a dosing regiment and indicates that the relative dose/withdrawal times are important in determining the effectiveness of such a treatment. A reduced model is introduced and the similar behavior is demonstrated analytically.

  13. Patterned biofilm formation reveals a mechanism for structural heterogeneity in bacterial biofilms. (United States)

    Gu, Huan; Hou, Shuyu; Yongyat, Chanokpon; De Tore, Suzanne; Ren, Dacheng


    Bacterial biofilms are ubiquitous and are the major cause of chronic infections in humans and persistent biofouling in industry. Despite the significance of bacterial biofilms, the mechanism of biofilm formation and associated drug tolerance is still not fully understood. A major challenge in biofilm research is the intrinsic heterogeneity in the biofilm structure, which leads to temporal and spatial variation in cell density and gene expression. To understand and control such structural heterogeneity, surfaces with patterned functional alkanthiols were used in this study to obtain Escherichia coli cell clusters with systematically varied cluster size and distance between clusters. The results from quantitative imaging analysis revealed an interesting phenomenon in which multicellular connections can be formed between cell clusters depending on the size of interacting clusters and the distance between them. In addition, significant differences in patterned biofilm formation were observed between wild-type E. coli RP437 and some of its isogenic mutants, indicating that certain cellular and genetic factors are involved in interactions among cell clusters. In particular, autoinducer-2-mediated quorum sensing was found to be important. Collectively, these results provide missing information that links cell-to-cell signaling and interaction among cell clusters to the structural organization of bacterial biofilms.

  14. Establishing a laboratory model of dental unit waterlines bacterial biofilms using a CDC biofilm reactor. (United States)

    Yoon, Hye Young; Lee, Si Young


    In this study, a laboratory model to reproduce dental unit waterline (DUWL) biofilms was developed using a CDC biofilm reactor (CBR). Bacteria obtained from DUWLs were filtered and cultured in Reasoner's 2A (R2A) for 10 days, and were subsequently stored at -70°C. This stock was cultivated on R2A in batch mode. After culturing for five days, the bacteria were inoculated into the CBR. Biofilms were grown on polyurethane tubing for four days. Biofilm accumulation and thickness was 1.3 × 10 5  CFU cm -2 and 10-14 μm respectively, after four days. Bacteria in the biofilms included cocci and rods of short and medium lengths. In addition, 38 bacterial genera were detected in biofilms. In this study, the suitability and reproducibility of the CBR model for DUWL biofilm formation were demonstrated. The model provides a foundation for the development of bacterial control methods for DUWLs.

  15. Biofilm characteristics and evaluation of the sanitation procedures of thermophilic Aeribacillus pallidus E334 biofilms. (United States)

    Kilic, Tugba; Karaca, Basar; Ozel, Beste Piril; Ozcan, Birgul; Cokmus, Cumhur; Coleri Cihan, Arzu


    The ability of Aeribacillus pallidus E334 to produce pellicle and form a biofilm was studied. Optimal biofilm formation occurred at 60 °C, pH 7.5 and 1.5% NaCl. Extra polymeric substances (EPS) were composed of proteins and eDNA (21.4 kb). E334 formed biofilm on many surfaces, but mostly preferred polypropylene and glass. Using CLSM analysis, the network-like structure of the EPS was observed. The A. pallidus biofilm had a novel eDNA content. DNaseI susceptibility (86.8% removal) of eDNA revealed its importance in mature biofilms, but the purified eDNA was resistant to DNaseI, probably due to its extended folding outside the matrix. Among 15 cleaning agents, biofilms could be removed with alkaline protease and sodium dodecyl sulphate (SDS). The removal of cells from polypropylene and biomass on glass was achieved with combined SDS/alkaline protease treatment. Strong A. pallidus biofilms could cause risks for industrial processes and abiotic surfaces must be taken into consideration in terms of sanitation procedures.

  16. Recent advances in dental biofilm: impacts of microbial interactions on the biofilm ecology and pathogenesis

    Directory of Open Access Journals (Sweden)

    Yung-Hua Li


    Full Text Available The human oral cavity is a complex ecosystem harboring hundreds species of microbes that are largely living on the tooth surfaces as dental biofilms. Most microbes in dental biofilms promote oral health by stimulating the immune system or by preventing invasion of pathogens. Species diversity, high cell density and close proximity of cells are typical of life in dental biofilms, where microbes interact with each other and develop complex interactions that can be either competitive or cooperative. Competition between species is a well-recognized ecological force to drive microbial metabolism, species diversity and evolution. However, it was not until recently that microbial cooperative activities are also recognized to play important roles in microbial physiology and ecology. Importantly, these interactions profoundly affect the overall biomass, function, diversity and the pathogenesis in dental biofilms. It is now recognized that every human body contains a personalized oral microbiome that is essential to maintaining the oral health. Remarkably, the indigenous species in dental biofilms often maintain a relatively stable and harmless relationship with the host, despite regular exposure to environmental perturbations and the host defense factors. Such stability or homeostasis results from a dynamic balance of microbial-microbial and microbial-host interactions. Under certain circumstances, however, the homeostasis may breakdown, predisposing a site to diseases. In this review, we describe several examples of microbial interactions and their impacts on the homeostasis and pathogenesis of dental biofilms. We hope to encourage research on microbial interactions in the regulation of the homeostasis in biofilms.

  17. Quantification of biofilm in microtiter plates: overview of testing conditions and practical recommendations for assessment of biofilm production by staphylococci. (United States)

    Stepanović, Srdjan; Vuković, Dragana; Hola, Veronika; Di Bonaventura, Giovanni; Djukić, Slobodanka; Cirković, Ivana; Ruzicka, Filip


    The details of all steps involved in the quantification of biofilm formation in microtiter plates are described. The presented protocol incorporates information on assessment of biofilm production by staphylococci, gained both by direct experience as well as by analysis of methods for assaying biofilm production. The obtained results should simplify quantification of biofilm formation in microtiter plates, and make it more reliable and comparable among different laboratories.

  18. A novel approach for harnessing biofilm communities in moving bed biofilm reactors for industrial wastewater treatment

    Directory of Open Access Journals (Sweden)

    Joe A. Lemire


    Full Text Available Moving bed biofilm reactors (MBBRs are an effective biotechnology for treating industrial wastewater. Biomass retention on moving bed biofilm reactor (MBBR carriers (biofilm support materials, allows for the ease-of-operation and high treatment capacity of MBBR systems. Optimization of MBBR systems has largely focused on aspects of carrier design, while little attention has been paid to enhancing strategies for harnessing microbial biomass. Previously, our research group demonstrated that mixed-species biofilms can be harvested from an industrial wastewater inoculum [oil sands process water (OSPW] using the Calgary Biofilm Device (CBD. Moreover, the resultant biofilm communities had the capacity to degrade organic toxins (naphthenic acids—NAs that are found in OSPW. Therefore, we hypothesized that harnessing microbial communities from industrial wastewater, as biofilms, on MBBR carriers may be an effective method to bioremediate industrial wastewater.Here, we detail our methodology adapting the workflow employed for using the CBD, to generate inoculant carriers to seed an MBBR.In this study, OSPW-derived biofilm communities were successfully grown, and their efficacy evaluated, on commercially available MBBR carriers affixed within a modified CBD system. The resultant biofilms demonstrated the capacity to transfer biomass to recipient carriers within a scaled MBBR. Moreover, MBBR systems inoculated in this manner were fully active 2 days post-inoculation, and readily degraded a select population of NAs. Together, these findings suggest that harnessing microbial communities on carriers affixed within a modified CBD system may represent a facile and rapid method for obtaining functional inoculants for use in wastewater MBBR treatment systems.

  19. pH, redox potential and local biofilm potential microenvironments within Geobacter sulfurreducens biofilms and their roles in electron transfer. (United States)

    Babauta, Jerome T; Nguyen, Hung Duc; Harrington, Timothy D; Renslow, Ryan; Beyenal, Haluk


    The limitation of pH inside electrode-respiring biofilms is a well-known concept. However, little is known about how pH and redox potential are affected by increasing current inside biofilms respiring on electrodes. Quantifying the variations in pH and redox potential with increasing current is needed to determine how electron transfer is tied to proton transfer within the biofilm. In this research, we quantified pH and redox potential variations in electrode-respiring Geobacter sulfurreducens biofilms as a function of respiration rates, measured as current. We also characterized pH and redox potential at the counter electrode. We concluded that (1) pH continued to decrease in the biofilm through different growth phases, showing that the pH is not always a limiting factor in a biofilm and (2) decreasing pH and increasing redox potential at the biofilm electrode were associated only with the biofilm, demonstrating that G. sulfurreducens biofilms respire in a unique internal environment. Redox potential inside the biofilm was also compared to the local biofilm potential measured by a graphite microelectrode, where the tip of the microelectrode was allowed to acclimatize inside the biofilm. Copyright © 2012 Wiley Periodicals, Inc.

  20. Anti-Biofilm and Immunomodulatory Activities of Peptides That Inhibit Biofilms Formed by Pathogens Isolated from Cystic Fibrosis Patients

    Directory of Open Access Journals (Sweden)

    César de la Fuente-Núñez


    Full Text Available Cystic fibrosis (CF patients often acquire chronic respiratory tract infections due to Pseudomonas aeruginosa and Burkholderia cepacia complex (Bcc species. In the CF lung, these bacteria grow as multicellular aggregates termed biofilms. Biofilms demonstrate increased (adaptive resistance to conventional antibiotics, and there are currently no available biofilm-specific therapies. Using plastic adherent, hydroxyapatite and flow cell biofilm models coupled with confocal and scanning electron microscopy, it was demonstrated that an anti-biofilm peptide 1018 prevented biofilm formation, eradicated mature biofilms and killed biofilms formed by a wide range of P. aeruginosa and B. cenocepacia clinical isolates. New peptide derivatives were designed that, compared to their parent peptide 1018, showed similar or decreased anti-biofilm activity against P. aeruginosa biofilms, but increased activity against biofilms formed by the Gram-positive bacterium methicillin resistant Staphylococcus aureus. In addition, some of these new peptide derivatives retained the immunomodulatory activity of 1018 since they induced the production of the chemokine monocyte chemotactic protein-1 (MCP-1 and suppressed lipopolysaccharide-mediated tumor necrosis factor-α (TNF-α production by human peripheral blood mononuclear cells (PBMC and were non-toxic towards these cells. Peptide 1018 and its derivatives provide promising leads for the treatment of chronic biofilm infections and hyperinflammatory lung disease in CF patients.

  1. Fluoride in dental biofilm and saliva

    DEFF Research Database (Denmark)

    Larsen, Line Staun

    Dette ph.d.-projekt bidrager med ny viden om fordelingen af fluorid i dental biofilm og saliva. For at udforske koncentrationen af fluorid i naturlig (in vivo) biofilmvæske, biofilmsediment og i saliva, blev der udført to meget forskellige kliniske studier. Resultaterne fra tværsnitsstudiet (Studie...... I), hos en stor gruppe mennesker (n=42) der konsulterede en tandklinik for behandling, bekræfter tidligere viden, at der findes en naturlig biologisk variation i fluoridkoncentrationerne i biofilm fra forskellige intra-orale regioner samt mellem biofilmvæske, biofilmsediment og saliva...... fluoridkoncentrationer i underkæbefronten, intermediære koncentrationer i alle tre overkæberegioner og de laveste koncentrationer i underkæbemolarregionerne. Begge studier viser at biofilmsedimentet indeholder størstedelen af fluorid i biofilm. Set i et bredere perspektiv viser fundene at der er et omvendt forhold...

  2. Diagnosis and understanding of chronic biofilm infections

    DEFF Research Database (Denmark)

    Thomsen, Trine Rolighed


    Title: Diagnosis and understanding of chronic biofilm infections. Name: Trine Rolighed Thomsen Aalborg University and Danish Technological Institute, Denmark Recent evidence suggests that the microbial community, its spatial distribution and activity play an important role in the prolongation......, anaerobic or unculturable bacteria living in biofilms. Thus, diagnosis of chronic infections is challenged by lack of appropriate sampling strategies and by limitations in microbiological testing methods. The purpose of this study was to improve sampling and diagnosis of chronic infections, especially...... considering the biofilm issue. Systematic and optimized sampling of various specimen types was performed. Extended culture, optimized DNA extraction, quantitative PCR, cloning, next generation sequencing and PNA FISH were applied on different types of specimens for optimized diagnosis. For further...

  3. Actinomyces naeslundii in intial dental biofilm formation

    DEFF Research Database (Denmark)

    Dige, Irene; Raarup, Merete Krog; Nyengaard, Jens Randel


    Combined use of Confocal Laser Scanning Microscopy (CLSM) and Fluorescent in situ Hybridization (FISH) offers new opportunities for analysing the spatial relationships and temporal changes of specific members of microbial populations in intact dental biofilms. AIMS: The purpose of this study....... RESULTS: This study confirmed previous work that streptococci are the predominant colonizers of early dental biofilm along with A. naeslundii. There was a notable increase in the total number of bacteria, Streptococcus spp., and A. naeslundii over time with a tendency towards a slower growth rate for A......-layer dental biofilms up to 48 h definitively demonstrated that A. naeslundii preferentially occupied the inner layers. Some A. naeslundii microcolonies extended perpendicularly from the supporting surface surrounded by other bacteria forming chimneys of complex multilayered micro-colonies. CONCLUSIONS...

  4. Co-existence in multispecies biofilm communities

    DEFF Research Database (Denmark)

    Røder, Henriette Lyng

    of these emergent properties which are relevant to as diverse areas as clinical settings and natural systems. In this thesis, I have attempted to contribute to our knowledge on the multispecies interactions with a special focus on biofilm communities. I was especially interested in how co-existing species affect...... each other and in understanding the key mechanisms and interactions involved. In the introduction of this thesis the most important concepts of multi-species interactions and biofilm development are explained. After this the topic changes to the various ways of examining community interactions...... and production. The analysis was further extended in manuscript 3, in which the effect of social interac-tions on biofilm formation in multispecies co-cultures isolated from a diverse range of environments was examined. The question raised was whether the interspecific interactions of co-existing bacteria...

  5. Application of biofilm bioreactors in white biotechnology. (United States)

    Muffler, K; Lakatos, M; Schlegel, C; Strieth, D; Kuhne, S; Ulber, R


    The production of valuable compounds in industrial biotechnology is commonly done by cultivation of suspended cells or use of (immobilized) enzymes rather than using microorganisms in an immobilized state. Within the field of wastewater as well as odor treatment the application of immobilized cells is a proven technique. The cells are entrapped in a matrix of extracellular polymeric compounds produced by themselves. The surface-associated agglomerate of encapsulated cells is termed biofilm. In comparison to common immobilization techniques, toxic effects of compounds used for cell entrapment may be neglected. Although the economic impact of biofilm processes used for the production of valuable compounds is negligible, many prospective approaches were examined in the laboratory and on a pilot scale. This review gives an overview of biofilm reactors applied to the production of valuable compounds. Moreover, the characteristics of the utilized materials are discussed with respect to support of surface-attached microbial growth.

  6. Complement activation by Pseudomonas aeruginosa biofilms

    DEFF Research Database (Denmark)

    Jensen, E T; Kharazmi, A; Garred, P


    In chronic infections, such as the bronchopulmonary Pseudomonas aeruginosa infection in cystic fibrosis (CF) patients, bacteria persist despite an intact host immune defense and frequent antibiotic treatment. An important reason for the persistence of the bacteria is their capacity for the biofilm...... mode of growth. In this study we investigated the role of biofilms in activation of complement, a major contributor to the inflammatory process. Complement activation by P. aeruginosa was examined in a complement consumption assay, production of C3 and factor B conversion products assessed by crossed...... immuno-electrophoresis, C5a generation tested by a PMN chemotactic assay, and terminal complement complex formation measured by ELISA. Two of the four assays showed that P. aeruginosa grown in biofilm activated complement less than planktonic bacteria, and all assays showed that activation by intact...

  7. Investigate Nasal Colonize Staphylococcus Species Biofilm Produced

    Directory of Open Access Journals (Sweden)

    Cemil Demir


    Full Text Available Aim: 127 S.aureus and 65 CoNS strains were isolated from patients noses%u2019. To produce a biofilm ability was investigated using three different methods. Slime-positive and negative staphylococcies%u2019 resistance were evaluated against different antibiotics. Material and Method: Swap samples puted 7% blood agar. Staphylococcus aureus and coagulase-negative staphylococci (CoNS isolates biofilm produced ability were investigated using Congo Red Agar (CRA, microplates (MP and Standard Tube (ST methods. In addition to that, presence of antibiotic resistance of the staphylococcal isolates are determined agar disc diffusion method. Results: The rate of biofilm producing Staphylococcus spp strains was found to be 72.4%, 67.7%, and 62.9%, respectively with CRA, MP, and ST tests. There was no significant relationship among the tests (p>0.05. In addition, antibiotic resistance of Staphylococcus spp. against various antibiotics was also determined by the agar disk diffusion method. Resistance rates of biofilm positive (BP Staphylococcus spp for penicilin G, ampicilin, amocycilin/clavulanic acid, tetracyclin, eritromycin, gentamycin, and enrofloxacin 71.7%, 69.7%, 6.2%, 20.7%, 21.4%, 1.4%, and 0.7%, respectively. Resistance rates of biofilm negative (BN spp for 42.6%, 23.4%, 4.3%, 14.9%, 19.1%, 0.0%, 0.0% respectively. All Staphylococcus isolates were found to be susceptible to vancomycin and teicaplonin. Although BP strains antibiotic resistance rates were observed higher than BN strains. But resistance rates were not found statistically significant (p>0.05. Discussion: CRA is the reliablity and specifity method to determine Staphylococcus spp. biofilm produce ability.

  8. Confocal Raman microscopy for identification of bacterial species in biofilms (United States)

    Beier, Brooke D.; Quivey, Robert G.; Berger, Andrew J.


    Implemented through a confocal microscope, Raman spectroscopy has been used to distinguish between biofilm samples of two common oral bacteria species, Streptococcus sanguinis and mutans, which are associated with healthy and cariogenic plaque, respectively. Biofilms of these species are studied as a model of dental plaque. A prediction model has been calibrated and validated using pure biofilms. This model has been used to identify the species of transferred and dehydrated samples (much like a plaque scraping) as well as hydrated biofilms in situ. Preliminary results of confocal Raman mapping of species in an intact two-species biofilm will be shown.

  9. Sticking together: building a biofilm the Bacillus subtilis way. (United States)

    Vlamakis, Hera; Chai, Yunrong; Beauregard, Pascale; Losick, Richard; Kolter, Roberto


    Biofilms are ubiquitous communities of tightly associated bacteria encased in an extracellular matrix. Bacillus subtilis has long served as a robust model organism to examine the molecular mechanisms of biofilm formation, and a number of studies have revealed that this process is regulated by several integrated pathways. In this Review, we focus on the molecular mechanisms that control B. subtilis biofilm assembly, and then briefly summarize the current state of knowledge regarding biofilm disassembly. We also discuss recent progress that has expanded our understanding of B. subtilis biofilm formation on plant roots, which are a natural habitat for this soil bacterium.

  10. Alginate overproduction affects Pseudomonas aeruginosa biofilm structure and function

    DEFF Research Database (Denmark)

    Hentzer, Morten; Teitzel, G.M.; Balzer, G.J.


    -resistant communities of microorganisms organized in biofilms. Although biofilm formation and the conversion to mucoidy are both important aspects of CF pathogenesis, the relationship between them is at the present unclear. In this study, we report that the overproduction of alginate affects biofilm development...... on an abiotic surface. Biofilms formed by an alginate- overproducing strain exhibit a highly structured architecture and are significantly more resistant to the antibiotic tobramycin than a biofilm formed by an isogenic nonmucoid strain. These results suggest that an important consequence of the conversion...

  11. Biofilm disruption with rotating microrods enhances antimicrobial efficacy (United States)

    Mair, Lamar O.; Nacev, Aleksandar; Hilaman, Ryan; Stepanov, Pavel Y.; Chowdhury, Sagar; Jafari, Sahar; Hausfeld, Jeffrey; Karlsson, Amy J.; Shirtliff, Mark E.; Shapiro, Benjamin; Weinberg, Irving N.


    Biofilms are a common and persistent cause of numerous illnesses. Compared to planktonic microbes, biofilm residing cells often demonstrate significant resistance to antimicrobial agents. Thus, methods for dislodging cells from the biofilm may increase the antimicrobial susceptibility of such cells, and serve as a mechanical means of increasing antimicrobial efficacy. Using Aspergillus fumigatus as a model microbe, we magnetically rotate microrods in and around biofilm. We show that such rods can improve the efficacy of antimicrobial Amphotericin B treatments in vitro. This work represents a first step in using kinetic magnetic particle therapy for disrupting fungal biofilms.

  12. Microbial Biofilm as a Smart Material

    DEFF Research Database (Denmark)

    Garde, Christian; Welch, Martin; Ferkinghoff-Borg, Jesper


    Microbial biofilm colonies will in many cases form a smart material capable of responding to external threats dependent on their size and internal state. The microbial community accordingly switches between passive, protective, or attack modes of action. In order to decide which strategy to employ......, it is essential for the biofilm community to be able to sense its own size. The sensor designed to perform this task is termed a quorum sensor, since it only permits collective behaviour once a sufficiently large assembly of microbes have been established. The generic quorum sensor construct involves two genes...


    Directory of Open Access Journals (Sweden)

    Gupta Puja, Gupta Pratima, Mittal Garima, Agarwal RK, Goyal Rohit


    Full Text Available Background: Biofilm producing bacteria which are inherently resistant to antibiotics and disinfectants are widely associated with implant associated infections. Staphylococcus is the most commonly associated pathogens with bloodstream infection. Aims: The current study was conducted to detect biofilm production in Staphylococci isolated from blood culture specimens. Materials and Methods: 70 clinically significant staphylococcal isolates from blood culture were screened for biofilm production by Tissue culture plate (TCP method, Tube method (TM and Congo red agar (CRA method and their antibiotic susceptibility profile was studied. Results: 59 out of 70 staphylococcal isolates were positive by TCP, out of these 21.4% staphylococci were high biofilm producers, 62.8% staphylococci were moderate biofilm producers and 15.8% were non-biofilm producers. Maximum resistance was observed in biofilm producers to cotrimoxazole (74.5% and erythromycin (62.7% and none were resistant to vancomycin and linezolid. Out of total 59 biofilm producers, 20.3 % (12 were methicillin resistant and all these were S. aureus isolates. 19% (1 out of total 11 biofilm non-producers were methicillin resistant. Conclusion: Biofilm production was seen to be a major virulence factor in most of the staphylococcal isolates obtained from patients with signs and symptoms of septicaemia. S. aureus was found to be the major pathogen and timely detection of biofilm producing phenotype should be carried out using a simple and reproducible method, TCP which is both qualitative and quantitative.

  14. Anti-Candida albicans biofilm effect of novel heterocyclic compounds. (United States)

    Kagan, Sarah; Jabbour, Adel; Sionov, Edward; Alquntar, Abed A; Steinberg, Doron; Srebnik, Morris; Nir-Paz, Ran; Weiss, Aryeh; Polacheck, Itzhack


    The aims of this study were to develop new anti-biofilm drugs, examine their activity against Candida albicans biofilm and investigate their structure-activity relationship and mechanism of action. A series of thiazolidinedione and succinimide derivatives were synthesized and their ability to inhibit C. albicans biofilm formation and destroy pre-formed biofilm was tested. The biofilms' structure, metabolic activity and viability were determined by XTT assay and propidium iodide and SYTO 9 live/dead stains combined with confocal microscopic analysis. The effect of the most active compounds on cell morphology, sterol distribution and cell wall morphology and composition was then determined by specific fluorescent stains and transmission electron microscopy. Most of the compounds were active at sub-MICs. Elongation of the aliphatic side chain resulted in reduced anti-biofilm activity and the sulphur atom contributed to biofilm killing, indicating a structure-activity relationship. The compounds differed in their effects on biofilm viability, yeast-to-hyphal form transition, hyphal morphology, cell wall morphology and composition, and sterol distribution. The most effective anti-biofilm compounds were the thiazolidinedione S8H and the succinimide NA8. We developed novel anti-biofilm agents that both inhibited and destroyed C. albicans biofilm. With some further development, these agents might be suitable for therapeutic purposes.

  15. Ginger Extract Inhibits Biofilm Formation by Pseudomonas aeruginosa PA14 (United States)

    Kim, Han-Shin; Park, Hee-Deung


    Bacterial biofilm formation can cause serious problems in clinical and industrial settings, which drives the development or screening of biofilm inhibitors. Some biofilm inhibitors have been screened from natural products or modified from natural compounds. Ginger has been used as a medicinal herb to treat infectious diseases for thousands of years, which leads to the hypothesis that it may contain chemicals inhibiting biofilm formation. To test this hypothesis, we evaluated ginger’s ability to inhibit Pseudomonas aeruginosa PA14 biofilm formation. A static biofilm assay demonstrated that biofilm development was reduced by 39–56% when ginger extract was added to the culture. In addition, various phenotypes were altered after ginger addition of PA14. Ginger extract decreased production of extracellular polymeric substances. This finding was confirmed by chemical analysis and confocal laser scanning microscopy. Furthermore, ginger extract formed noticeably less rugose colonies on agar plates containing Congo red and facilitated swarming motility on soft agar plates. The inhibition of biofilm formation and the altered phenotypes appear to be linked to a reduced level of a second messenger, bis-(3′-5′)-cyclic dimeric guanosine monophosphate. Importantly, ginger extract inhibited biofilm formation in both Gram-positive and Gram-negative bacteria. Also, surface biofilm cells formed with ginger extract detached more easily with surfactant than did those without ginger extract. Taken together, these findings provide a foundation for the possible discovery of a broad spectrum biofilm inhibitor. PMID:24086697

  16. Biofilm disruption with rotating microrods enhances antimicrobial efficacy

    Energy Technology Data Exchange (ETDEWEB)

    Mair, Lamar O., E-mail: [Weinberg Medical Physics, Inc., North Bethesda, MD (United States); Nacev, Aleksandar; Hilaman, Ryan; Stepanov, Pavel Y.; Chowdhury, Sagar; Jafari, Sahar [Weinberg Medical Physics, Inc., North Bethesda, MD (United States); Hausfeld, Jeffrey [School of Medicine and Health Sciences, George Washington University, WA (United States); Karlsson, Amy J. [Department of Chemical and Biomolecular Engineering, University of Maryland, College Park, MD (United States); Shirtliff, Mark E. [School of Dentistry, University of Maryland, Baltimore, MD (United States); Shapiro, Benjamin [Fischell Department of Bioengineering, University of Maryland, College Park, MD (United States); Weinberg, Irving N. [Weinberg Medical Physics, Inc., North Bethesda, MD (United States)


    Biofilms are a common and persistent cause of numerous illnesses. Compared to planktonic microbes, biofilm residing cells often demonstrate significant resistance to antimicrobial agents. Thus, methods for dislodging cells from the biofilm may increase the antimicrobial susceptibility of such cells, and serve as a mechanical means of increasing antimicrobial efficacy. Using Aspergillus fumigatus as a model microbe, we magnetically rotate microrods in and around biofilm. We show that such rods can improve the efficacy of antimicrobial Amphotericin B treatments in vitro. This work represents a first step in using kinetic magnetic particle therapy for disrupting fungal biofilms. - Highlights: • Fungal biofilms have been implicated in a variety of medical ailments. • Magnetic microrods, grown via electroplating, were rotated in and around fungal biofilms. • Rotating microrods potentiate the effectiveness of antimicrobial drug. • Antimicrobial efficacy may be enhanced due to increased mixing.

  17. Enhancement of Biofilm Formation on Pyrite by Sulfobacillus thermosulfidooxidans

    Directory of Open Access Journals (Sweden)

    Qian Li


    Full Text Available Bioleaching is the mobilization of metal cations from insoluble ores by microorganisms. Biofilms can enhance this process. Since Sulfobacillus often appears in leaching heaps or reactors, this genus has aroused attention. In this study, biofilm formation and subsequent pyrite dissolution by the Gram-positive, moderately thermophilic acidophile Sulfobacillus thermosulfidooxidans were investigated. Five strategies, including adjusting initial pH, supplementing an extra energy source or ferric ions, as well as exchanging exhausted medium with fresh medium, were tested for enhancement of its biofilm formation. The results show that regularly exchanging exhausted medium leads to a continuous biofilm development on pyrite. By this way, multiply layered biofilms were observed on pyrite slices, while only monolayer biofilms were visible on pyrite grains. In addition, biofilms were proven to be responsible for pyrite leaching in the early stages.

  18. Bacteriophages as Weapons Against Bacterial Biofilms in the Food Industry. (United States)

    Gutiérrez, Diana; Rodríguez-Rubio, Lorena; Martínez, Beatriz; Rodríguez, Ana; García, Pilar


    Microbiological contamination in the food industry is often attributed to the presence of biofilms in processing plants. Bacterial biofilms are complex communities of bacteria attached to a surface and surrounded by an extracellular polymeric material. Their extreme resistance to cleaning and disinfecting processes is related to a unique organization, which implies a differential bacterial growth and gene expression inside the biofilm. The impact of biofilms on health, and the economic consequences, has promoted the development of different approaches to control or remove biofilm formation. Recently, successful results in phage therapy have boosted new research in bacteriophages and phage lytic proteins for biofilm eradication. In this regard, this review examines the environmental factors that determine biofilm development in food-processing equipment. In addition, future perspectives for the use of bacteriophage-derived tools as disinfectants are discussed.

  19. From biofilm ecology to reactors: a focused review

    DEFF Research Database (Denmark)

    Boltz, Joshua P.; Smets, Barth F.; Rittmann, Bruce E.


    the following three topics: (1) biofilm ecology, (2) biofilm reactor technology and design, and (3) biofilm modeling. In so doing, it addresses the processes occurring in the biofilm, and how these affect and are affected by the broader biofilm system. The symphonic application of a suite of biological methods...... on the performance of various systems, but they can also be used beneficially for the treatment of water (defined herein as potable water, municipal and industrial wastewater, fresh/brackish/salt water bodies, groundwater) as well as in water stream-based biological resource recovery systems. This review addresses...... polymeric substance matrix are somewhat known, but their exact composition and role in the microbial conversion kinetics and biochemical transformations are still to be resolved. Biofilm grown microorganisms may contribute to increased metabolism of micro-pollutants. Several types of biofilm reactors have...

  20. Unravelling the core microbiome of biofilms in cooling tower systems. (United States)

    Di Gregorio, L; Tandoi, V; Congestri, R; Rossetti, S; Di Pippo, F


    In this study, next generation sequencing and catalyzed reporter deposition fluorescence in situ hybridization, combined with confocal microscopy, were used to provide insights into the biodiversity and structure of biofilms collected from four full-scale European cooling systems. Water samples were also analyzed to evaluate the impact of suspended microbes on biofilm formation. A common core microbiome, containing members of the families Sphingomonadaceae, Comamonadaceae and Hyphomicrobiaceae, was found in all four biofilms, despite the water of each coming from different sources (river and groundwater). This suggests that selection of the pioneer community was influenced by abiotic factors (temperature, pH) and tolerances to biocides. Members of the Sphingomonadaceae were assumed to play a key role in initial biofilm formation. Subsequent biofilm development was driven primarily by light availability, since biofilms were dominated by phototrophs in the two studied 'open' systems. Their interactions with other microbial populations then shaped the structure of the mature biofilm communities analyzed.

  1. Biofilm disruption with rotating microrods enhances antimicrobial efficacy

    International Nuclear Information System (INIS)

    Mair, Lamar O.; Nacev, Aleksandar; Hilaman, Ryan; Stepanov, Pavel Y.; Chowdhury, Sagar; Jafari, Sahar; Hausfeld, Jeffrey; Karlsson, Amy J.; Shirtliff, Mark E.; Shapiro, Benjamin; Weinberg, Irving N.


    Biofilms are a common and persistent cause of numerous illnesses. Compared to planktonic microbes, biofilm residing cells often demonstrate significant resistance to antimicrobial agents. Thus, methods for dislodging cells from the biofilm may increase the antimicrobial susceptibility of such cells, and serve as a mechanical means of increasing antimicrobial efficacy. Using Aspergillus fumigatus as a model microbe, we magnetically rotate microrods in and around biofilm. We show that such rods can improve the efficacy of antimicrobial Amphotericin B treatments in vitro. This work represents a first step in using kinetic magnetic particle therapy for disrupting fungal biofilms. - Highlights: • Fungal biofilms have been implicated in a variety of medical ailments. • Magnetic microrods, grown via electroplating, were rotated in and around fungal biofilms. • Rotating microrods potentiate the effectiveness of antimicrobial drug. • Antimicrobial efficacy may be enhanced due to increased mixing.

  2. Ratiometric Imaging of Extracellular pH in Dental Biofilms

    DEFF Research Database (Denmark)

    Schlafer, Sebastian; Dige, Irene


    The pH in bacterial biofilms on teeth is of central importance for dental caries, a disease with a high worldwide prevalence. Nutrients and metabolites are not distributed evenly in dental biofilms. A complex interplay of sorption to and reaction with organic matter in the biofilm reduces...... the diffusion paths of solutes and creates steep gradients of reactive molecules, including organic acids, across the biofilm. Quantitative fluorescent microscopic methods, such as fluorescence life time imaging or pH ratiometry, can be employed to visualize pH in different microenvironments of dental biofilms...... allows monitoring both vertical and horizontal pH gradients in real-time without mechanically disturbing the biofilm. However, care must be taken to differentiate accurately between extra- and intracellular compartments of the biofilm. Here, the ratiometric dye, seminaphthorhodafluor-4F 5-(and-6...

  3. The increasing relevance of biofilms in common dermatological conditions. (United States)

    Kravvas, G; Veitch, D; Al-Niaimi, F


    Biofilms are diverse groups of microorganisms encased in a self-produced matrix that offers protection against unfavorable conditions and antibiotics. We performed a literature search using the MEDLINE electronic database. Only original articles published in English were considered for review. Biofilms have been implicated in the pathogenesis of acne, eczema, hidradenitis suppurativa, onychomycosis, miliaria, and impetigo. Adverse dermal-filler reactions are also linked to biofilms. Strict aseptic technique and prophylactic antibiotics are recommended in order to avoid such complications. Finally, biofilms are implicated in wounds, mainly chronic and diabetic, where they impede healing and cause recurrent infections. Several novel anti-biofilm agents and wound debridement have been shown to be beneficial. Biofilms are a significant cause of disease with wide implications in the field of dermatology. Several novel treatments have been found to be effective against biofilms, depending on the underlying microbes and type of disease.

  4. Extracellular DNA as matrix component in microbial biofilms

    DEFF Research Database (Denmark)

    Chiang, Wen-Chi; Tolker-Nielsen, Tim


    Bacteria in nature primarily live in surface-associated communities commonly known as biofilms. Because bacteria in biofilms, in many cases, display tolerance to host immune systems, antibiotics, and biocides, they are often difficult or impossible to eradicate. Biofilm formation, therefore, leads...... to various persistent infections in humans and animals, and to a variety of complications in industry, where solid–water interfaces occur. Knowledge about the molecular mechanisms involved in biofilm formation is necessary for creating strategies to control biofilms. Recent studies have shown...... that extracellular DNA is an important component of the extracellular matrix of microbial biofilms. The present chapter is focussed on extracellular DNA as matrix component in biofilms formed by Pseudomonas aeruginosa as an example from the Gram-negative bacteria, and Streptococcus and Staphylococcus as examples...

  5. An update on Pseudomonas aeruginosa biofilm formation, tolerance, and dispersal

    DEFF Research Database (Denmark)

    Harmsen, Morten; Yang, Liang; Pamp, Sünje Johanna


    We review the recent advances in the understanding of the Pseudomonas aeruginosa biofilm lifestyle from studies using in vitro laboratory setups such as flow chambers and microtiter trays. Recent work sheds light on the role of nutrients, motility, and quorum sensing in structure formation in P....... aeruginosa biofilms. The second messenger, c-di-GMP, is established as an important regulator of the synthesis of polysaccharide and protein components of the biofilm matrix. Extracellular DNA is shown to be an essential component of the biofilm matrix. It has become apparent that biofilm formation involves...... interactions between different subpopulations. The molecular mechanisms underlying the tolerance of biofilm bacteria to antimicrobial agents are beginning to be unraveled, and new knowledge has been obtained regarding the environmental cues and regulatory mechanisms involved in biofilm dispersal....

  6. Chemoinformatics-assisted development of new anti-biofilm compounds

    DEFF Research Database (Denmark)

    Dürig, Anna; Kouskoumvekaki, Irene; Vejborg, Rebecca Munk


    Bacterial biofilms are associated with a large number of infections. Biofilm-dwelling bacteria are particularly resistant to antibiotics, making it hard to eradicate biofilm-associated infections. Here, we use a novel cross-disciplinary approach combining microbiology and chemoinformatics...... to identify new and efficient anti-biofilm drugs. We found that ellagic acid (present in green tea) significantly inhibited biofilm formation of Streptococcus dysgalactiae. Based on ellagic acid, we performed in silico screening of the Chinese Natural Product Database to predict a 2nd-generation list...... of compounds with similar characteristics. One of these, esculetin, proved to be more efficient in preventing biofilm formation by Staphylococcus aureus. From esculetin a 3rd-generation list of compounds was predicted. One of them, fisetin, was even better to abolish biofilm formation than the two parent...

  7. Bacterial signaling ecology and potential applications during aquatic biofilm construction. (United States)

    Vega, Leticia M; Alvarez, Pedro J; McLean, Robert J C


    In their natural environment, bacteria and other microorganisms typically grow as surface-adherent biofilm communities. Cell signal processes, including quorum signaling, are now recognized as being intimately involved in the development and function of biofilms. In contrast to their planktonic (unattached) counterparts, bacteria within biofilms are notoriously resistant to many traditional antimicrobial agents and so represent a major challenge in industry and medicine. Although biofilms impact many human activities, they actually represent an ancient mode of bacterial growth as shown in the fossil record. Consequently, many aquatic organisms have evolved strategies involving signal manipulation to control or co-exist with biofilms. Here, we review the chemical ecology of biofilms and propose mechanisms whereby signal manipulation can be used to promote or control biofilms.

  8. Host Proteins Determine MRSA Biofilm Structure and Integrity

    DEFF Research Database (Denmark)

    Dreier, Cindy; Nielsen, Astrid; Jørgensen, Nis Pedersen

    Human extracellular matrix (hECM) proteins aids the initial attachment and initiation of an infection, by specific binding to bacterial cell surface proteins. However, the importance of hECM proteins in structure, integrity and antibiotic resilience of a biofilm is unknown. This study aims...... to determine how specific hECM proteins affect S. aureus USA300 JE2 biofilms. Biofilms were grown in the presence of synovial fluid from rheumatoid arteritis patients to mimic in vivo conditions, where bacteria incorporate hECM proteins into the biofilm matrix. Difference in biofilm structure, with and without...... addition of hECM to growth media, was visualized by confocal laser scanning microscopy. Two enzymatic degradation experiments were used to study biofilm matrix composition and importance of hECM proteins: enzymatic removal of specific hECM proteins from growth media, before biofilm formation, and enzymatic...

  9. Modelling of toluene biodegradation and biofilm growth in a fixed biofilm reactor

    DEFF Research Database (Denmark)

    Arcangeli, Jean-Pierre; Arvin, Erik


    The modelling of aerobic biodegradation of toluene and the associated biofilm growth in a fixed biofilm system is presented. The model includes four biomass fractions, three dissolved components, and seven processes. It is assumed that part of the active biomass is composed of filamentous bacteria...... which grow relatively fast and detach easily, leading to a biomass growth delayed with respect to substrate degradation. The non-filamentous bacteria inside the biofilm also degrade toluene but with a slower rate compared to the filamentous bacteria. Because the nonfilamentous bacteria do not detach......, they are primarily responsible for the biofilm growth. The active biomass decays into biodegradable and ``inert'' dead biomass which is hydrolyzed into soluble products at two different rates. These products are partly degradable by the biomass and constitute the endogenous respiration. The dynamic growth phase...

  10. A personal history of research on microbial biofilms and biofilm infections. (United States)

    Høiby, Niels


    The observation of aggregated microorganisms surrounded by a self-produced matrix adhering to surfaces or located in tissues or secretions is as old as microbiology, with both Leeuwenhoek and Pasteur describing the phenomenon. In environmental and technical microbiology, biofilms were already shown 80-90 years ago to be important for biofouling on submerged surfaces, e.g. ships. The concept of biofilm infections and their importance in medicine is, however, biofilm was introduced into medicine in 1985 by Costerton. In the following decades, it became obvious that biofilm infections are widespread in medicine, and their importance is now generally accepted. © 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved.

  11. Microbial biofilms in water-mixed metalworking fluids; Mikrobielle Biofilme in wassergemischten Kuehlschmierstoffen

    Energy Technology Data Exchange (ETDEWEB)

    Koch, Thomas [Wisura GmbH, Bremen (Germany)


    The microbial load of water-miscible metalworking fluids (MWF) as well as the hygienic aspects and the cost-related impact on the production process due to the activity of microbes is in the focus of many scientific investigations and documented in the related publications. The majority of this research work is focused on the microbiology of the water body, i.e. with the microbial life in the liquid coolant. The habitat biofilm, i.e. the three-dimensional growth of bacteria and fungi on surfaces of the coolant systems has been scarcely considered. Based on the scientific findings made in the recent years studying biofilms it can be concluded, that the relevant microbial processes for the depletion of the MWF and its recontamination takes predominantly places in biofilms. This paper gives an overview of the structure, the formation and the life in biofilms and represents their relevance in MWF systems. (orig.)

  12. Modelling of toluene biodegradation and biofilm growth in a fixed biofilm reactor

    DEFF Research Database (Denmark)

    Arcangeli, Jean-Pierre; Arvin, Erik


    The modelling of aerobic biodegradation of toluene and the associated biofilm growth in a fixed biofilm system is presented. The model includes four biomass fractions, three dissolved components, and seven processes. It is assumed that part of the active biomass is composed of filamentous bacteria......, they are primarily responsible for the biofilm growth. The active biomass decays into biodegradable and ``inert'' dead biomass which is hydrolyzed into soluble products at two different rates. These products are partly degradable by the biomass and constitute the endogenous respiration. The dynamic growth phase...... which grow relatively fast and detach easily, leading to a biomass growth delayed with respect to substrate degradation. The non-filamentous bacteria inside the biofilm also degrade toluene but with a slower rate compared to the filamentous bacteria. Because the nonfilamentous bacteria do not detach...

  13. Microsensor and transcriptomic signatures of oxygen depletion in biofilms associated with chronic wounds: Biofilms and oxygen

    Energy Technology Data Exchange (ETDEWEB)

    James, Garth A. [Center for Biofilm Engineering, Montana State University, Bozeman Montana; Ge Zhao, Alice [Division of Dermatology, Department of Medicine, University of Washington, Seattle Washington; Usui, Marcia [Division of Dermatology, Department of Medicine, University of Washington, Seattle Washington; Underwood, Robert A. [Division of Dermatology, Department of Medicine, University of Washington, Seattle Washington; Nguyen, Hung [The Gene and Linda Voiland School of Chemical Engineering and Bioengineering, Washington State University, Pullman Washington; Beyenal, Haluk [The Gene and Linda Voiland School of Chemical Engineering and Bioengineering, Washington State University, Pullman Washington; deLancey Pulcini, Elinor [Center for Biofilm Engineering, Montana State University, Bozeman Montana; Agostinho Hunt, Alessandra [Department of Microbiology and Molecular Genetics, 5180 Biomedical and Physical Sciences, Michigan State University, East Lansing Michigan; Bernstein, Hans C. [Pacific Northwest National Laboratory, Chemical and Biological Signature Science, Richland Washington; Fleckman, Philip [Division of Dermatology, Department of Medicine, University of Washington, Seattle Washington; Olerud, John [Division of Dermatology, Department of Medicine, University of Washington, Seattle Washington; Williamson, Kerry S. [Center for Biofilm Engineering, Montana State University, Bozeman Montana; Franklin, Michael J. [Center for Biofilm Engineering, Montana State University, Bozeman Montana; Stewart, Philip S. [Center for Biofilm Engineering, Montana State University, Bozeman Montana


    Polymicrobial biofilms have been implicated in delayed wound healing, although the mechanisms by which biofilms impair wound healing are poorly understood. Many species of bacteria produce exotoxins and exoenzymes that may inhibit healing. In addition, oxygen consumption by biofilms may impede wound healing. In this study, we used oxygen microsensors to measure oxygen transects through in vitro-cultured biofilms, biofilms formed in vivo in a diabetic (db/db) mouse model, and ex vivo human chronic wound specimens. The results show that oxygen levels within both euthanized and live mouse wounds had steep gradients that reached minima ranging from 19 to 61% oxygen partial pressure, compared to atmospheric oxygen levels. The oxygen gradients in the mouse wounds were similar to those observed for clinical isolates cultured in vitro and for human ex vivo scabs. No oxygen gradients were observed for heat-killed scabs, suggesting that active metabolism by the viable bacteria contributed to the reduced oxygen partial pressure of the wounds. To characterize the metabolic activities of the bacteria in the mouse wounds, we performed transcriptomics analyses of Pseudomonas aeruginosa biofilms associated with the db/db mice wounds using Affymetrix microarrays. The results demonstrated that the bacteria expressed genes for metabolic activities associated with cell growth. Interestingly, the transcriptome results indicated that the bacteria within the wounds also experienced oxygen-limitation stress. Among the bacterial genes that were expressed in vivo were genes associated with the Anr-mediated hypoxia-stress response. Other bacterial stress response genes highly expressed in vivo were genes associated with stationary-phase growth, osmotic stress, and RpoH-mediated heat shock stress. Overall, the results support the hypothesis that the metabolic activities of bacteria in biofilms act as oxygen sinks in chronic wounds and that the depletion of oxygen contributes to the

  14. Modeling of the Bacillus subtilis Bacterial Biofilm Growing on an Agar Substrate. (United States)

    Wang, Xiaoling; Wang, Guoqing; Hao, Mudong


    Bacterial biofilms are organized communities composed of millions of microorganisms that accumulate on almost any kinds of surfaces. In this paper, a biofilm growth model on an agar substrate is developed based on mass conservation principles, Fick's first law, and Monod's kinetic reaction, by considering nutrient diffusion between biofilm and agar substrate. Our results show biofilm growth evolution characteristics such as biofilm thickness, active biomass, and nutrient concentration in the agar substrate. We quantitatively obtain biofilm growth dependence on different parameters. We provide an alternative mathematical method to describe other kinds of biofilm growth such as multiple bacterial species biofilm and also biofilm growth on various complex substrates.

  15. Combined treatment of Pseudomonas aeruginosa biofilms with bacteriophages and chlorine. (United States)

    Zhang, Yanyan; Hu, Zhiqiang


    Bacterial biofilms are a growing concern in a broad range of areas. In this study, a mixture of RNA bacteriophages isolated from municipal wastewater was used to control and remove biofilms. At the concentrations of 400 and 4 × 10(7) PFU/mL, the phages inhibited Pseudomonas aeruginosa biofilm formation by 45 ± 15% and 73 ± 8%, respectively. At the concentrations of 6,000 and 6 × 10(7) PFU/mL, the phages removed 45 ± 9% and 75 ± 5% of pre-existing P. aeruginosa biofilms, respectively. Chlorine reduced biofilm growth by 86 ± 3% at the concentration of 210 mg/L, but it did not remove pre-existing biofilms. However, a combination of phages (3 × 10(7) PFU/mL) and chlorine at this concentration reduced biofilm growth by 94 ± 2% and removed 88 ± 6% of existing biofilms. In a continuous flow system with continued biofilm growth, a combination of phages (a one-time treatment at the concentration of 1.9 × 10(8) PFU/mL for 1 h first) with chlorine removed 97 ± 1% of biofilms after Day 5 while phage and chlorine treatment alone removed 89 ± 1% and 40 ± 5%, respectively. For existing biofilms, a combined use of a lower phage concentration (3.8 × 10(5) PFU/mL) and chlorination with a shorter time duration (12 h) followed by continuous water flushing removed 96 ± 1% of biofilms in less than 2 days. Laser scanning confocal microscopy supplemented with electron microscopy indicated that the combination treatment resulted in biofilms with lowest cell density and viability. These results suggest that the combination treatment of phages and chlorine is a promising method to control and remove bacterial biofilms from various surfaces. Copyright © 2012 Wiley Periodicals, Inc.

  16. Biofilms and Wounds: An Identification Algorithm and Potential Treatment Options (United States)

    Percival, Steven L.; Vuotto, Claudia; Donelli, Gianfranco; Lipsky, Benjamin A.


    Significance: The presence of a “pathogenic” or “highly virulent” biofilm is a fundamental risk factor that prevents a chronic wound from healing and increases the risk of the wound becoming clinically infected. There is presently no unequivocal gold standard method available for clinicians to confirm the presence of biofilms in a wound. Thus, to help support clinician practice, we devised an algorithm intended to demonstrate evidence of the presence of a biofilm in a wound to assist with wound management. Recent Advances: A variety of histological and microscopic methods applied to tissue biopsies are currently the most informative techniques available for demonstrating the presence of generic (not classified as pathogenic or commensal) biofilms and the effect they are having in promoting inflammation and downregulating cellular functions. Critical Issues: Even as we rely on microscopic techniques to visualize biofilms, they are entities which are patchy and dispersed rather than confluent, particularly on biotic surfaces. Consequently, detection of biofilms by microscopic techniques alone can lead to frequent false-negative results. Furthermore, visual identification using the naked eye of a pathogenic biofilm on a macroscopic level on the wound will not be possible, unlike with biofilms on abiotic surfaces. Future Direction: Lacking specific biomarkers to demonstrate microscopic, nonconfluent, virulent biofilms in wounds, the present focus on biofilm research should be placed on changing clinical practice. This is best done by utilizing an anti-biofilm toolbox approach, rather than speculating on unscientific approaches to identifying biofilms, with or without staining, in wounds with the naked eye. The approach to controlling biofilm should include initial wound cleansing, periodic debridement, followed by the application of appropriate antimicrobial wound dressings. This approach appears to be effective in removing pathogenic biofilms. PMID:26155381

  17. Natural antigenic differences in the functionally equivalent extracellular DNABII proteins of bacterial biofilms provide a means for targeted biofilm therapeutics (United States)

    Rocco, Christopher J.; Davey, Mary Ellen; Bakaletz, Lauren O.; Goodman, Steven D.


    SUMMARY Bacteria that persist in the oral cavity exist within complex biofilm communities. A hallmark of biofilms is the presence of an extracellular polymeric substance (EPS), which consists of polysaccharides, extracellular DNA (eDNA), and proteins, including the DNABII family of proteins. The removal of DNABII proteins from a biofilm results in the loss of structural integrity of the eDNA and the collapse of the biofilm structure. We examined the role of DNABII proteins in the biofilm structure of the periodontal pathogen Porphyromonas gingivalis and the oral commensal Streptococcus gordonii. Co-aggregation with oral streptococci is thought to facilitate the establishment of P. gingivalis within the biofilm community. We demonstrate that DNABII proteins are present in the EPS of both S. gordonii and P. gingivalis biofilms, and that these biofilms can be disrupted through the addition of antisera derived against their respective DNABII proteins. We provide evidence that both eDNA and DNABII proteins are limiting in S. gordonii but not in P. gingivalis biofilms. In addition, these proteins are capable of complementing one another functionally. We also found that while antisera derived against most DNABII proteins are capable of binding a wide variety of DNABII proteins, the P. gingivalis DNABII proteins are antigenically distinct. The presence of DNABII proteins in the EPS of these biofilms and the antigenic uniqueness of the P. gingivalis proteins provide an opportunity to develop therapies that are targeted to remove P. gingivalis and biofilms that contain P. gingivalis from the oral cavity. PMID:26988714

  18. Multiscale Investigation on Biofilm Distribution and Its Impact on Macroscopic Biogeochemical Reaction Rates: BIOFILM DISTRIBUTION AND RATE SCALING

    Energy Technology Data Exchange (ETDEWEB)

    Yan, Zhifeng [Institute of Surface-Earth System Science, Tianjin University, Tianjin China; Pacific Northwest National Laboratory, Richland WA USA; Liu, Chongxuan [Pacific Northwest National Laboratory, Richland WA USA; School of Environmental Science and Engineering, Southern University of Science and Technology, Shenzhen China; Liu, Yuanyuan [Pacific Northwest National Laboratory, Richland WA USA; School of Earth Science and Engineering, Nanjing University, Nanjing China; Bailey, Vanessa L. [Pacific Northwest National Laboratory, Richland WA USA


    Biofilms are critical locations for biogeochemical reactions in the subsurface environment. The occurrence and distribution of biofilms at microscale as well as their impacts on macroscopic biogeochemical reaction rates are still poorly understood. This paper investigated the formation and distributions of biofilms in heterogeneous sediments using multiscale models, and evaluated the effects of biofilm heterogeneity on local and macroscopic biogeochemical reaction rates. Sediment pore structures derived from X-ray computed tomography were used to simulate the microscale flow dynamics and biofilm distribution in the sediment column. The response of biofilm formation and distribution to the variations in hydraulic and chemical properties was first examined. One representative biofilm distribution was then utilized to evaluate its effects on macroscopic reaction rates using nitrate reduction as an example. The results revealed that microorganisms primarily grew on the surfaces of grains and aggregates near preferential flow paths where both electron donor and acceptor were readily accessible, leading to the heterogeneous distribution of biofilms in the sediments. The heterogeneous biofilm distribution decreased the macroscopic rate of biogeochemical reactions as compared with those in homogeneous cases. Operationally considering the heterogeneous biofilm distribution in macroscopic reactive transport models such as using dual porosity domain concept can significantly improve the prediction of biogeochemical reaction rates. Overall, this study provided important insights into the biofilm formation and distribution in soils and sediments as well as their impacts on the macroscopic manifestation of reaction rates.

  19. Enhanced Biofilm Formation and Increased Resistance to Antimicrobial Agents and Bacterial Invasion Are Caused by Synergistic Interactions in Multispecies Biofilms

    DEFF Research Database (Denmark)

    Burmølle, Mette; Webb, J.S.; Rao, D.


    from the surface of the marine alga Ulva australis, were screened for synergistic interactions within biofilms when present together in different combinations. Four isolates, Microbacterium phyllosphaerae, Shewanella japonica, Dokdonia donghaensis, and Acinetobacter lwoffii, were found to interact......Most biofilms in their natural environments are likely to consist of consortia of species that influence each other in synergistic and antagonistic manners. However, few reports specifically address interactions within multispecies biofilms. In this study, 17 epiphytic bacterial strains, isolated...... synergistically in biofilms formed in 96-well microtiter plates: biofilm biomass was observed to increase by >167% in biofilms formed by the four strains compared to biofilms composed of single strains. When exposed to the antibacterial agent hydrogen peroxide or tetracycline, the relative activity (exposed...

  20. Calcium-Phosphate-Osteopontin Particles Reduce Biofilm Formation and pH Drops in in situ-Grown Dental Biofilms

    DEFF Research Database (Denmark)

    Schlafer, Sebastian; Ibsen, Casper Jon Steenberg; Birkedal, Henrik


    This 2-period crossover study investigated the effect of calcium-phosphate-osteopontin particles on biofilm formation and pH in 48-h biofilms grown in situ. Bovine milk osteopontin is a highly phosphorylated glycoprotein that has been shown to interfere with bacterial adhesion to salivary......-coated surfaces. Calcium-phosphate-osteopontin particles have been shown to reduce biofilm formation and pH drops in a 5-species laboratory model of dental biofilm without affecting bacterial viability. Here, smooth surface biofilms from 10 individuals were treated ex vivo 6 times/day for 30 min with either...... calcium-phosphate-osteopontin particles or sterile saline. After growth, the amount of biofilm formed was determined by confocal microscopy, and pH drops upon exposure to glucose were monitored using confocal-microscopy-based pH ratiometry. A total of 160 biofilms were analysed. No adverse effects...

  1. Phototrophic biofilms and their potential applications

    NARCIS (Netherlands)

    Roeselers, G.; Van Loosdrecht, M.C.M.; Muyzer, G.


    Phototrophic biofilms occur on surfaces exposed to light in a range of terrestrial and aquatic environments. Oxygenic phototrophs like diatoms, green algae, and cyanobacteria are the major primary producers that generate energy and reduce carbon dioxide, providing the system with organic substrates

  2. Adenoid Reservoir for Pathogenic Biofilm Bacteria▿ (United States)

    Nistico, L.; Kreft, R.; Gieseke, A.; Coticchia, J. M.; Burrows, A.; Khampang, P.; Liu, Y.; Kerschner, J. E.; Post, J. C.; Lonergan, S.; Sampath, R.; Hu, F. Z.; Ehrlich, G. D.; Stoodley, P.; Hall-Stoodley, L.


    Biofilms of pathogenic bacteria are present on the middle ear mucosa of children with chronic otitis media (COM) and may contribute to the persistence of pathogens and the recalcitrance of COM to antibiotic treatment. Controlled studies indicate that adenoidectomy is effective in the treatment of COM, suggesting that the adenoids may act as a reservoir for COM pathogens. To investigate the bacterial community in the adenoid, samples were obtained from 35 children undergoing adenoidectomy for chronic OM or obstructive sleep apnea. We used a novel, culture-independent molecular diagnostic methodology, followed by confocal microscopy, to investigate the in situ distribution and organization of pathogens in the adenoids to determine whether pathogenic bacteria exhibited criteria characteristic of biofilms. The Ibis T5000 Universal Biosensor System was used to interrogate the extent of the microbial diversity within adenoid biopsy specimens. Using a suite of 16 broad-range bacterial primers, we demonstrated that adenoids from both diagnostic groups were colonized with polymicrobial biofilms. Haemophilus influenzae was present in more adenoids from the COM group (P = 0.005), but there was no significant difference between the two patient groups for Streptococcus pneumoniae or Staphylococcus aureus. Fluorescence in situ hybridization, lectin binding, and the use of antibodies specific for host epithelial cells demonstrated that pathogens were aggregated, surrounded by a carbohydrate matrix, and localized on and within the epithelial cell surface, which is consistent with criteria for bacterial biofilms. PMID:21307211

  3. Benzene degradation in a denitrifying biofilm reactor

    NARCIS (Netherlands)

    Waals, van der Marcelle J.; Atashgahi, Siavash; Rocha, da Ulisses Nunes; Zaan, van der Bas M.; Smidt, Hauke; Gerritse, Jan


    Benzene is an aromatic compound and harmful for the environment. Biodegradation of benzene can reduce the toxicological risk after accidental or controlled release of this chemical in the environment. In this study, we further characterized an anaerobic continuous biofilm culture grown for more

  4. Global gene expression in Escherichia coli biofilms

    DEFF Research Database (Denmark)

    Schembri, Mark; Kjærgaard, K.; Klemm, Per


    It is now apparent that microorganisms undergo significant changes during the transition from planktonic to biofilm growth. These changes result in phenotypic adaptations that allow the formation of highly organized and structured sessile communities, which possess enhanced resistance to antimicr......It is now apparent that microorganisms undergo significant changes during the transition from planktonic to biofilm growth. These changes result in phenotypic adaptations that allow the formation of highly organized and structured sessile communities, which possess enhanced resistance...... the transition to biofilm growth, and these included genes expressed under oxygen-limiting conditions, genes encoding (putative) transport proteins, putative oxidoreductases and genes associated with enhanced heavy metal resistance. Of particular interest was the observation that many of the genes altered...... in expression have no current defined function. These genes, as well as those induced by stresses relevant to biofilm growth such as oxygen and nutrient limitation, may be important factors that trigger enhanced resistance mechanisms of sessile communities to antibiotics and hydrodynamic shear forces....

  5. Measurements of drag and flow over biofilm (United States)

    Hartenberger, Joel; Gose, James W.; Perlin, Marc; Ceccio, Steven L.


    Microbial `slime' biofilms detrimentally affect the performance of every day systems from medical devices to large ocean-going vessels. In flow applications, the presence of biofilm typically results in a drag increase and may alter the turbulence in the adjacent boundary layer. Recent studies emphasize the severity of the drag penalty associated with soft biofouling and suggest potential mechanisms underlying the increase; yet, fundamental questions remain-such as the role played by compliance and the contribution of form drag to the overall resistance experienced by a fouled system. Experiments conducted on live biofilm and 3D printed rigid replicas in the Skin-Friction Flow Facility at the University of Michigan seek to examine these factors. The hydrodynamic performance of the biofilms grown on test panels was evaluated through pressure drop measurements as well as conventional and microscale PIV. High-resolution, 3D rigid replicas of select cases were generated via additive manufacturing using surface profiles obtained from a laser scanning system. Drag and flow measurements will be presented along with details of the growth process and the surface profile characterization method.

  6. Role of multicellular aggregates in biofilm formation

    DEFF Research Database (Denmark)

    Kragh, Kasper N.; Hutchison, Jaime B.; Melaugh, Gavin


    In traditional models of in vitro biofilm development, individual bacterial cells seed a surface, multiply, and mature into multicellular, three-dimensional structures. Much research has been devoted to elucidating the mechanisms governing the initial attachment of single cells to surfaces. Howev...

  7. Cellular chain formation in Escherichia coli biofilms

    DEFF Research Database (Denmark)

    Vejborg, Rebecca Munk; Klemm, Per


    ; type I fimbriae expression significantly reduced cellular chain formation, presumably by steric hindrance. Cellular chain formation did not appear to be specific to E coli K-12. Although many urinary tract infection (UTI) isolates were found to form rather homogeneous, flat biofilms, three isolates...

  8. Multi-depth valved microfluidics for biofilm segmentation

    International Nuclear Information System (INIS)

    Meyer, M T; Bentley, W E; Ghodssi, R; Subramanian, S; Kim, Y W; Ben-Yoav, H; Gnerlich, M; Gerasopoulos, K


    Bacterial biofilms present a societal challenge, as they occur in the majority of infections but are highly resistant to both immune mechanisms and traditional antibiotics. In the pursuit of better understanding biofilm biology for developing new treatments, there is a need for streamlined, controlled platforms for biofilm growth and evaluation. We leverage advantages of microfluidics to develop a system in which biofilms are formed and sectioned, allowing parallel assays on multiple sections of one biofilm. A microfluidic testbed with multiple depth profiles was developed to accommodate biofilm growth and sectioning by hydraulically actuated valves. In realization of the platform, a novel fabrication technique was developed for creating multi-depth microfluidic molds using sequentially patterned photoresist separated and passivated by conformal coatings using atomic layer deposition. Biofilm thickness variation within three separately tested devices was less than 13% of the average thickness in each device, while variation between devices was 23% of the average thickness. In a demonstration of parallel experiments performed on one biofilm within one device, integrated valves were used to trisect the uniform biofilms with one section maintained as a control, and two sections exposed to different concentrations of sodium dodecyl sulfate. The technology presented here for multi-depth microchannel fabrication can be used to create a host of microfluidic devices with diverse architectures. While this work focuses on one application of such a device in biofilm sectioning for parallel experimentation, the tailored architectures enabled by the fabrication technology can be used to create devices that provide new biological information. (paper)

  9. Kaffir lime leaves extract inhibits biofilm formation by Streptococcus mutans. (United States)

    Kooltheat, Nateelak; Kamuthachad, Ludthawun; Anthapanya, Methinee; Samakchan, Natthapon; Sranujit, Rungnapa Pankla; Potup, Pachuen; Ferrante, Antonio; Usuwanthim, Kanchana


    Although kaffir lime has been reported to exhibit antioxidant and antileukemic activity, little is known about the antimicrobial effect of kaffir lime extract. Because Streptococcus mutans has been known to cause biofilm formation, it has been considered the most important causative pathogen of dental caries. Thus, the effective control of its effects on the oral biofilm is the key to the prevention of dental caries. The aims of the present study were to investigate the effect of kaffir lime leaves extract on biofilm formation and its antibacterial activity on S. mutans. We examined the effect of kaffir lime leaves extract on growth and biofilm formation of S. mutans. For the investigation we used a kaffir lime extract with high phenolic content. The minimum inhibitory concentration of the extract was determined by broth microdilution assay. The inhibitory effect of the test substances on biofilm formation was also investigated by biofilm formation assay and qRT-PCR of biofilm formation-associated genes. Kaffir lime leaves extract inhibits the growth of S. mutans, corresponding to the activity of an antibiotic, ampicillin. Formation of biofilm by S. mutans was also inhibited by the extract. These results were confirmed by the down-regulation of genes associated with the biofilm formation. The findings highlight the ability of kaffir lime leaves extract to inhibit S. mutans activity, which may be beneficial in the prevention of biofilm formation on dental surface, reducing dental plaque and decreasing the chance of dental carries. Copyright © 2016 Elsevier Inc. All rights reserved.

  10. Biofilm Formation As a Response to Ecological Competition.

    Directory of Open Access Journals (Sweden)

    Nuno M Oliveira


    Full Text Available Bacteria form dense surface-associated communities known as biofilms that are central to their persistence and how they affect us. Biofilm formation is commonly viewed as a cooperative enterprise, where strains and species work together for a common goal. Here we explore an alternative model: biofilm formation is a response to ecological competition. We co-cultured a diverse collection of natural isolates of the opportunistic pathogen Pseudomonas aeruginosa and studied the effect on biofilm formation. We show that strain mixing reliably increases biofilm formation compared to unmixed conditions. Importantly, strain mixing leads to strong competition: one strain dominates and largely excludes the other from the biofilm. Furthermore, we show that pyocins, narrow-spectrum antibiotics made by other P. aeruginosa strains, can stimulate biofilm formation by increasing the attachment of cells. Side-by-side comparisons using microfluidic assays suggest that the increase in biofilm occurs due to a general response to cellular damage: a comparable biofilm response occurs for pyocins that disrupt membranes as for commercial antibiotics that damage DNA, inhibit protein synthesis or transcription. Our data show that bacteria increase biofilm formation in response to ecological competition that is detected by antibiotic stress. This is inconsistent with the idea that sub-lethal concentrations of antibiotics are cooperative signals that coordinate microbial communities, as is often concluded. Instead, our work is consistent with competition sensing where low-levels of antibiotics are used to detect and respond to the competing genotypes that produce them.

  11. Inhibitory effect of farnesol on biofilm formation by Candida tropicalis

    Directory of Open Access Journals (Sweden)

    E Zibafar


    Full Text Available ABSTRACT Background: Candidiasis associated with indwelling medical devices is especially problematic since they can act as substrates for biofilm growth which are highly resistant to antifungal drugs. Farnesol is a quorum-sensing molecule that inhibits filamentation and biofilm formation in Candida albicans. Since in recent years Candida tropicalis have been reported as an important and common non-albicans Candida species with high drug resistance pattern, the inhibitory effect of farnesol on biofilm formation by Candida tropicalis was evaluated. Methods: Five Candida tropicalis strains were treated with different concentration of farnesol (0, 30 and 300 µM after 0, 1 and 4 hrs of adherence and then they were maintained under biofilm formation condition in polystyrene, 96-well microtiter plates at 37°C for 48 hrs. Biofilm formation was measured by a semiquantitative colorimetric technique based on reduction assay of 2,3- bis  -2H-tetrazolium- 5- carboxanilide (XTT. Results: The results indicated that the initial adherence time had no effect on biofilm formation and low concentration of farnesol (30 µM could not inhibit biofilm formation. However the presence of non-adherent cells increased biofilm formation significantly and the high concentration of farnesol (300 µM could inhibit biofilm formation. Conclusion: Results of this study showed that the high concentration of farnesol could inhibit biofilm formation and may be used as an adjuvant in prevention and in therapeutic strategies with antifungal drugs.

  12. Antibiofilm Effect of DNase against Single and Mixed Species Biofilm (United States)

    Sharma, Komal


    Biofilms are aggregates of microorganisms that coexist in socially coordinated micro-niche in a self-produced polymeric matrix on pre-conditioned surfaces. The biofilm matrix reduces the efficacy of antibiofilm strategies. DNase degrades the extracellular DNA (e-DNA) present in the matrix, rendering the matrix weak and susceptible to antimicrobials. In the current study, the effect of DNase I was evaluated during biofilm formation (pre-treatment), on preformed biofilms (post-treatment) and both (dual treatment). The DNase I pre-treatment was optimized for P. aeruginosa PAO1 (model biofilm organism) at 10 µg/mL and post-treatment at 10 µg/mL with 15 min of contact duration. Inclusion of Mg2+ alongside DNase I post-treatment resulted in 90% reduction in biofilm within only 5 min of contact time (irrespective of age of biofilm). On extension of these findings, DNase I was found to be less effective against mixed species biofilm than individual biofilms. DNase I can be used as potent antibiofilm agent and with further optimization can be effectively used for biofilm prevention and reduction in situ. PMID:29562719

  13. Anti-Biofilm Compounds Derived from Marine Sponges

    Directory of Open Access Journals (Sweden)

    Christian Melander


    Full Text Available Bacterial biofilms are surface-attached communities of microorganisms that are protected by an extracellular matrix of biomolecules. In the biofilm state, bacteria are significantly more resistant to external assault, including attack by antibiotics. In their native environment, bacterial biofilms underpin costly biofouling that wreaks havoc on shipping, utilities, and offshore industry. Within a host environment, they are insensitive to antiseptics and basic host immune responses. It is estimated that up to 80% of all microbial infections are biofilm-based. Biofilm infections of indwelling medical devices are of particular concern, since once the device is colonized, infection is almost impossible to eliminate. Given the prominence of biofilms in infectious diseases, there is a notable effort towards developing small, synthetically available molecules that will modulate bacterial biofilm development and maintenance. Here, we highlight the development of small molecules that inhibit and/or disperse bacterial biofilms specifically through non-microbicidal mechanisms. Importantly, we discuss several sets of compounds derived from marine sponges that we are developing in our labs to address the persistent biofilm problem. We will discuss: discovery/synthesis of natural products and their analogues—including our marine sponge-derived compounds and initial adjuvant activity and toxicological screening of our novel anti-biofilm compounds.

  14. The in vitro effect of xylitol on chronic rhinosinusitis biofilms. (United States)

    Jain, R; Lee, T; Hardcastle, T; Biswas, K; Radcliff, F; Douglas, R


    Biofilms have been implicated in chronic rhinosinusitis (CRS) and may explain the limited efficacy of antibiotics. There is a need to find more effective, non-antibiotic based therapies for CRS. This study examines the effects of xylitol on CRS biofilms and planktonic bacteria. Crystal violet assay and spectrophotometry were used to quantify the effects of xylitol (5% and 10% solutions) against Staphylococcus epidermidis, Pseudomonas aeruginosa, and Staphylococcus aureus. The disruption of established biofilms, inhibition of biofilm formation and effects on planktonic bacteria growth were investigated and compared to saline and no treatment. Xylitol 5% and 10% significantly reduced biofilm biomass (S. epidermidis), inhibited biofilm formation (S. aureus and P. aeruginosa) and reduced growth of planktonic bacteria (S. epidermidis, S. aureus, and P. aeruginosa). Xylitol 5% inhibited formation of S. epidermidis biofilms more effectively than xylitol 10%. Xylitol 10% reduced S. epidermidis planktonic bacteria more effectively than xylitol 5%. Saline, xylitol 5% and 10% disrupted established biofilms of S. aureus when compared with no treatment. No solution was effective against established P. aeruginosa biofilm. Xylitol has variable activity against biofilms and planktonic bacteria in vitro and may have therapeutic efficacy in the management of CRS.

  15. Inhibition of Staphylococcus epidermidis Biofilm by Trimethylsilane Plasma Coating (United States)

    Ma, Yibao; Jones, John E.; Ritts, Andrew C.; Yu, Qingsong


    Biofilm formation on implantable medical devices is a major impediment to the treatment of nosocomial infections and promotes local progressive tissue destruction. Staphylococcus epidermidis infections are the leading cause of biofilm formation on indwelling devices. Bacteria in biofilms are highly resistant to antibiotic treatment, which in combination with the increasing prevalence of antibiotic resistance among human pathogens further complicates treatment of biofilm-related device infections. We have developed a novel plasma coating technology. Trimethylsilane (TMS) was used as a monomer to coat the surfaces of 316L stainless steel and grade 5 titanium alloy, which are widely used in implantable medical devices. The results of biofilm assays demonstrated that this TMS coating markedly decreased S. epidermidis biofilm formation by inhibiting the attachment of bacterial cells to the TMS-coated surfaces during the early phase of biofilm development. We also discovered that bacterial cells on the TMS-coated surfaces were more susceptible to antibiotic treatment than their counterparts in biofilms on uncoated surfaces. These findings suggested that TMS coating could result in a surface that is resistant to biofilm development and also in a bacterial community that is more sensitive to antibiotic therapy than typical biofilms. PMID:22964248

  16. Multi-depth valved microfluidics for biofilm segmentation (United States)

    Meyer, M. T.; Subramanian, S.; Kim, Y. W.; Ben-Yoav, H.; Gnerlich, M.; Gerasopoulos, K.; Bentley, W. E.; Ghodssi, R.


    Bacterial biofilms present a societal challenge, as they occur in the majority of infections but are highly resistant to both immune mechanisms and traditional antibiotics. In the pursuit of better understanding biofilm biology for developing new treatments, there is a need for streamlined, controlled platforms for biofilm growth and evaluation. We leverage advantages of microfluidics to develop a system in which biofilms are formed and sectioned, allowing parallel assays on multiple sections of one biofilm. A microfluidic testbed with multiple depth profiles was developed to accommodate biofilm growth and sectioning by hydraulically actuated valves. In realization of the platform, a novel fabrication technique was developed for creating multi-depth microfluidic molds using sequentially patterned photoresist separated and passivated by conformal coatings using atomic layer deposition. Biofilm thickness variation within three separately tested devices was less than 13% of the average thickness in each device, while variation between devices was 23% of the average thickness. In a demonstration of parallel experiments performed on one biofilm within one device, integrated valves were used to trisect the uniform biofilms with one section maintained as a control, and two sections exposed to different concentrations of sodium dodecyl sulfate. The technology presented here for multi-depth microchannel fabrication can be used to create a host of microfluidic devices with diverse architectures. While this work focuses on one application of such a device in biofilm sectioning for parallel experimentation, the tailored architectures enabled by the fabrication technology can be used to create devices that provide new biological information.

  17. Agriculturally important microbial biofilms: Present status and future prospects. (United States)

    Velmourougane, Kulandaivelu; Prasanna, Radha; Saxena, Anil Kumar


    Microbial biofilms are a fascinating subject, due to their significant roles in the environment, industry, and health. Advances in biochemical and molecular techniques have helped in enhancing our understanding of biofilm structure and development. In the past, research on biofilms primarily focussed on health and industrial sectors; however, lately, biofilms in agriculture are gaining attention due to their immense potential in crop production, protection, and improvement. Biofilms play an important role in colonization of surfaces - soil, roots, or shoots of plants and enable proliferation in the desired niche, besides enhancing soil fertility. Although reports are available on microbial biofilms in general; scanty information is published on biofilm formation by agriculturally important microorganisms (bacteria, fungi, bacterial-fungal) and their interactions in the ecosystem. Better understanding of agriculturally important bacterial-fungal communities and their interactions can have several implications on climate change, soil quality, plant nutrition, plant protection, bioremediation, etc. Understanding the factors and genes involved in biofilm formation will help to develop more effective strategies for sustainable and environment-friendly agriculture. The present review brings together fundamental aspects of biofilms, in relation to their formation, regulatory mechanisms, genes involved, and their application in different fields, with special emphasis on agriculturally important microbial biofilms. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  18. Dynamics of Mixed- Candida Species Biofilms in Response to Antifungals. (United States)

    Vipulanandan, G; Herrera, M; Wiederhold, N P; Li, X; Mintz, J; Wickes, B L; Kadosh, D


    Oral infections caused by Candida species, the most commonly isolated human fungal pathogen, are frequently associated with biofilms. Although Candida albicans is the predominant organism found in patients with oral thrush, a biofilm infection, there is an increasing incidence of oral colonization and infections caused by non- albicans Candida species, including C. glabrata, C. dubliniensis, and C. tropicalis, which are frequently more resistant to antifungal treatment. While single-species Candida biofilms have been well studied, considerably less is known about the dynamics of mixed- Candida species biofilms and how these dynamics are altered by antifungal treatment. To address these questions, we developed a quantitative polymerase chain reaction-based approach to determine the precise species composition of mixed- Candida species biofilms formed by clinical isolates and laboratory strains in the presence and absence of clinically relevant concentrations of 3 commonly used antifungals: fluconazole, caspofungin, and amphotericin B. In monospecies biofilms, fluconazole exposure favored growth of C. glabrata and C. tropicalis, while caspofungin generally favored significant growth of all species to a varying degree. Fluconazole was not effective against preformed mixed- Candida species biofilms while amphotericin B was potent. As a general trend, in mixed- Candida species biofilms, C. albicans lost dominance in the presence of antifungals. Interestingly, presence in mixed versus monospecies biofilms reduced susceptibility to amphotericin B for C. tropicalis and C. glabrata. Overall, our data suggest that antifungal treatment favors the growth of specific non- albicans Candida species in mixed- Candida species biofilms.

  19. Sexual Biofilm Formation in Candida tropicalis Opaque Cells (United States)

    Jones, Stephen K.; Hirakawa, Matthew P.; Bennett, Richard J.


    Summary Candida albicans and Candida tropicalis are opportunistic fungal pathogens that can transition between white and opaque phenotypic states. White and opaque cells differ both morphologically and in their responses to environmental signals. In C. albicans, opaque cells respond to sexual pheromones by undergoing conjugation, while white cells are induced by pheromones to form sexual biofilms. Here, we show that sexual biofilm formation also occurs in C. tropicalis but, unlike C. albicans, biofilms are formed exclusively by opaque cells. C. tropicalis biofilm formation was dependent on the pheromone receptors Ste2 and Ste3, confirming the role of pheromone signaling in sexual biofilm development. Structural analysis of C. tropicalis sexual biofilms revealed stratified communities consisting of a basal layer of yeast cells and an upper layer of filamentous cells, together with an extracellular matrix. Transcriptional profiling showed that genes involved in pheromone signaling and conjugation were upregulated in sexual biofilms. Furthermore, FGR23, which encodes an agglutinin-like protein, was found to enhance both mating and sexual biofilm formation. Together, these studies reveal that C. tropicalis opaque cells form sexual biofilms with a complex architecture, and suggest a conserved role for sexual agglutinins in mediating mating, cell cohesion and biofilm formation. PMID:24612417

  20. Bacteriophage Lysin CF-301, a Potent Antistaphylococcal Biofilm Agent. (United States)

    Schuch, Raymond; Khan, Babar K; Raz, Assaf; Rotolo, Jimmy A; Wittekind, Michael


    Biofilms pose a unique therapeutic challenge because of the antibiotic tolerance of constituent bacteria. Treatments for biofilm-based infections represent a major unmet medical need, requiring novel agents to eradicate mature biofilms. Our objective was to evaluate bacteriophage lysin CF-301 as a new agent to target Staphylococcus aureus biofilms. We used minimum biofilm-eradicating concentration (MBEC) assays on 95 S. aureus strains to obtain a 90% MBEC (MBEC 90 ) value of ≤0.25 μg/ml for CF-301. Mature biofilms of coagulase-negative staphylococci, Streptococcus pyogenes , and Streptococcus agalactiae were also sensitive to disruption, with MBEC 90 values ranging from 0.25 to 8 μg/ml. The potency of CF-301 was demonstrated against S. aureus biofilms formed on polystyrene, glass, surgical mesh, and catheters. In catheters, CF-301 removed all biofilm within 1 h and killed all released bacteria by 6 h. Mixed-species biofilms, formed by S. aureus and Staphylococcus epidermidis on several surfaces, were removed by CF-301, as were S. aureus biofilms either enriched for small-colony variants (SCVs) or grown in human synovial fluid. The antibacterial activity of CF-301 was further demonstrated against S. aureus persister cells in exponential-phase and stationary-phase populations. Finally, the antibiofilm activity of CF-301 was greatly improved in combinations with the cell wall hydrolase lysostaphin when tested against a range of S. aureus strains. In all, the data show that CF-301 is highly effective at disrupting biofilms and killing biofilm bacteria, and, as such, it may be an efficient new agent for treating staphylococcal infections with a biofilm component. Copyright © 2017 American Society for Microbiology.

  1. Spore formation and toxin production in Clostridium difficile biofilms.

    Directory of Open Access Journals (Sweden)

    Ekaterina G Semenyuk

    Full Text Available The ability to grow as a biofilm can facilitate survival of bacteria in the environment and promote infection. To better characterize biofilm formation in the pathogen Clostridium difficile, we established a colony biofilm culture method for this organism on a polycarbonate filter, and analyzed the matrix and the cells in biofilms from a variety of clinical isolates over several days of biofilm culture. We found that biofilms readily formed in all strains analyzed, and that spores were abundant within about 6 days. We also found that extracellular DNA (eDNA, polysaccharide and protein was readily detected in the matrix of all strains, including the major toxins A and/or B, in toxigenic strains. All the strains we analyzed formed spores. Apart from strains 630 and VPI10463, which sporulated in the biofilm at relatively low frequencies, the frequencies of biofilm sporulation varied between 46 and 65%, suggesting that variations in sporulation levels among strains is unlikely to be a major factor in variation in the severity of disease. Spores in biofilms also had reduced germination efficiency compared to spores obtained by a conventional sporulation protocol. Transmission electron microscopy revealed that in 3 day-old biofilms, the outermost structure of the spore is a lightly staining coat. However, after 6 days, material that resembles cell debris in the matrix surrounds the spore, and darkly staining granules are closely associated with the spores surface. In 14 day-old biofilms, relatively few spores are surrounded by the apparent cell debris, and the surface-associated granules are present at higher density at the coat surface. Finally, we showed that biofilm cells possess 100-fold greater resistance to the antibiotic metronidazole then do cells cultured in liquid media. Taken together, our data suggest that C. difficile cells and spores in biofilms have specialized properties that may facilitate infection.

  2. Bacteriophage Lysin CF-301, a Potent Antistaphylococcal Biofilm Agent

    KAUST Repository

    Schuch, Raymond


    Biofilms pose a unique therapeutic challenge because of the antibiotic tolerance of constituent bacteria. Treatments for biofilm-based infections represent a major unmet medical need, requiring novel agents to eradicate mature biofilms. Our objective was to evaluate bacteriophage lysin CF-301 as a new agent to target Staphylococcus aureus biofilms. We used minimum biofilm-eradicating concentration (MBEC) assays on 95 S. aureus strains to obtain a 90% MBEC (MBEC90) value of <= 0.25 mu g/ml for CF-301. Mature biofilms of coagulase-negative staphylococci, Streptococcus pyogenes, and Streptococcus agalactiae were also sensitive to disruption, with MBEC90 values ranging from 0.25 to 8 mu g/ml. The potency of CF-301 was demonstrated against S. aureus biofilms formed on polystyrene, glass, surgical mesh, and catheters. In catheters, CF-301 removed all biofilm within 1 h and killed all released bacteria by 6 h. Mixed-species biofilms, formed by S. aureus and Staphylococcus epidermidis on several surfaces, were removed by CF-301, as were S. aureus biofilms either enriched for small-colony variants (SCVs) or grown in human synovial fluid. The antibacterial activity of CF-301 was further demonstrated against S. aureus persister cells in exponential-phase and stationary-phase populations. Finally, the antibiofilm activity of CF-301 was greatly improved in combinations with the cell wall hydrolase lysostaphin when tested against a range of S. aureus strains. In all, the data show that CF-301 is highly effective at disrupting biofilms and killing biofilm bacteria, and, as such, it may be an efficient new agent for treating staphylococcal infections with a biofilm component.

  3. Bacteriophage Lysin CF-301, a Potent Antistaphylococcal Biofilm Agent

    KAUST Repository

    Schuch, Raymond; Khan, Babar Khalid; Raz, Assaf; Rotolo, Jimmy A.; Wittekind, Michael


    Biofilms pose a unique therapeutic challenge because of the antibiotic tolerance of constituent bacteria. Treatments for biofilm-based infections represent a major unmet medical need, requiring novel agents to eradicate mature biofilms. Our objective was to evaluate bacteriophage lysin CF-301 as a new agent to target Staphylococcus aureus biofilms. We used minimum biofilm-eradicating concentration (MBEC) assays on 95 S. aureus strains to obtain a 90% MBEC (MBEC90) value of <= 0.25 mu g/ml for CF-301. Mature biofilms of coagulase-negative staphylococci, Streptococcus pyogenes, and Streptococcus agalactiae were also sensitive to disruption, with MBEC90 values ranging from 0.25 to 8 mu g/ml. The potency of CF-301 was demonstrated against S. aureus biofilms formed on polystyrene, glass, surgical mesh, and catheters. In catheters, CF-301 removed all biofilm within 1 h and killed all released bacteria by 6 h. Mixed-species biofilms, formed by S. aureus and Staphylococcus epidermidis on several surfaces, were removed by CF-301, as were S. aureus biofilms either enriched for small-colony variants (SCVs) or grown in human synovial fluid. The antibacterial activity of CF-301 was further demonstrated against S. aureus persister cells in exponential-phase and stationary-phase populations. Finally, the antibiofilm activity of CF-301 was greatly improved in combinations with the cell wall hydrolase lysostaphin when tested against a range of S. aureus strains. In all, the data show that CF-301 is highly effective at disrupting biofilms and killing biofilm bacteria, and, as such, it may be an efficient new agent for treating staphylococcal infections with a biofilm component.

  4. In vitro characterization of biofilms formed by Kingella kingae. (United States)

    Kaplan, J B; Sampathkumar, V; Bendaoud, M; Giannakakis, A K; Lally, E T; Balashova, N V


    The Gram-negative bacterium Kingella kingae is part of the normal oropharyngeal mucosal flora of children biofilm formation has been coupled with pharyngeal colonization, osteoarticular infections, and infective endocarditis, no studies have investigated biofilm formation in K. kingae. In this study we measured biofilm formation by 79 K. kingae clinical isolates using a 96-well microtiter plate crystal violet binding assay. We found that 37 of 79 strains (47%) formed biofilms. All strains that formed biofilms produced corroding colonies on agar. Biofilm formation was inhibited by proteinase K and DNase I. DNase I also caused the detachment of pre-formed K. kingae biofilm colonies. A mutant strain carrying a deletion of the pilus gene cluster pilA1pilA2fimB did not produce corroding colonies on agar, autoaggregate in broth, or form biofilms. Biofilm forming strains have higher levels of pilA1 expression. The extracellular components of biofilms contained 490 μg cm -2 of protein, 0.68 μg cm -2 of DNA, and 0.4 μg cm -2 of total carbohydrates. We concluded that biofilm formation is common among K. kingae clinical isolates, and that biofilm formation is dependent on the production of proteinaceous pili and extracellular DNA. Biofilm development may have relevance to the colonization, transmission, and pathogenesis of this bacterium. Extracellular DNA production by K. kingae may facilitate horizontal gene transfer within the oral microbial community. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  5. Spore formation and toxin production in Clostridium difficile biofilms. (United States)

    Semenyuk, Ekaterina G; Laning, Michelle L; Foley, Jennifer; Johnston, Pehga F; Knight, Katherine L; Gerding, Dale N; Driks, Adam


    The ability to grow as a biofilm can facilitate survival of bacteria in the environment and promote infection. To better characterize biofilm formation in the pathogen Clostridium difficile, we established a colony biofilm culture method for this organism on a polycarbonate filter, and analyzed the matrix and the cells in biofilms from a variety of clinical isolates over several days of biofilm culture. We found that biofilms readily formed in all strains analyzed, and that spores were abundant within about 6 days. We also found that extracellular DNA (eDNA), polysaccharide and protein was readily detected in the matrix of all strains, including the major toxins A and/or B, in toxigenic strains. All the strains we analyzed formed spores. Apart from strains 630 and VPI10463, which sporulated in the biofilm at relatively low frequencies, the frequencies of biofilm sporulation varied between 46 and 65%, suggesting that variations in sporulation levels among strains is unlikely to be a major factor in variation in the severity of disease. Spores in biofilms also had reduced germination efficiency compared to spores obtained by a conventional sporulation protocol. Transmission electron microscopy revealed that in 3 day-old biofilms, the outermost structure of the spore is a lightly staining coat. However, after 6 days, material that resembles cell debris in the matrix surrounds the spore, and darkly staining granules are closely associated with the spores surface. In 14 day-old biofilms, relatively few spores are surrounded by the apparent cell debris, and the surface-associated granules are present at higher density at the coat surface. Finally, we showed that biofilm cells possess 100-fold greater resistance to the antibiotic metronidazole then do cells cultured in liquid media. Taken together, our data suggest that C. difficile cells and spores in biofilms have specialized properties that may facilitate infection.

  6. Rotating disk electrodes to assess river biofilm thickness and elasticity. (United States)

    Boulêtreau, Stéphanie; Charcosset, Jean-Yves; Gamby, Jean; Lyautey, Emilie; Mastrorillo, Sylvain; Azémar, Frédéric; Moulin, Frédéric; Tribollet, Bernard; Garabetian, Frédéric


    The present study examined the relevance of an electrochemical method based on a rotating disk electrode (RDE) to assess river biofilm thickness and elasticity. An in situ colonisation experiment in the River Garonne (France) in August 2009 sought to obtain natural river biofilms exhibiting differentiated architecture. A constricted pipe providing two contrasted flow conditions (about 0.1 and 0.45 m s(-1) in inflow and constricted sections respectively) and containing 24 RDE was immersed in the river for 21 days. Biofilm thickness and elasticity were quantified using an electrochemical assay on 7 and 21 days old RDE-grown biofilms (t(7) and t(21), respectively). Biofilm thickness was affected by colonisation length and flow conditions and ranged from 36 ± 15 μm (mean ± standard deviation, n = 6) in the fast flow section at t(7) to 340 ± 140 μm (n = 3) in the slow flow section at t(21). Comparing the electrochemical signal to stereomicroscopic estimates of biofilms thickness indicated that the method consistently allowed (i) to detect early biofilm colonisation in the river and (ii) to measure biofilm thickness of up to a few hundred μm. Biofilm elasticity, i.e. biofilm squeeze by hydrodynamic constraint, was significantly higher in the slow (1300 ± 480 μm rpm(1/2), n = 8) than in the fast flow sections (790 ± 350 μm rpm(1/2), n = 11). Diatom and bacterial density, and biofilm-covered RDE surface analyses (i) confirmed that microbial accrual resulted in biofilm formation on the RDE surface, and (ii) indicated that thickness and elasticity represent useful integrative parameters of biofilm architecture that could be measured on natural river assemblages using the proposed electrochemical method. Copyright © 2010 Elsevier Ltd. All rights reserved.

  7. Biofilms on Hospital Shower Hoses: Characterization and Implications for Nosocomial Infections (United States)

    Although the source of drinking water used in hospitals is commonly, biofilms on water pipelines are refuge to bacteria that survive different disinfection strategies. Drinking water (DW) biofilms are well known to harbor opportunistic pathogens, however, these biofilm communitie...

  8. Identification of anti-biofilm components in Withania somnifera and their effect on virulence of Streptococcus mutans biofilms. (United States)

    Pandit, S; Cai, J N; Song, K Y; Jeon, J G


    The aim of this study was to identify components of the Withania somnifera that could show anti-virulence activity against Streptococcus mutans biofilms. The anti-acidogenic activity of fractions separated from W. somnifera was compared, and then the most active anti-acidogenic fraction was chemically characterized using gas chromatography-mass spectroscopy. The effect of the identified components on the acidogenicity, aciduricity and extracellular polymeric substances (EPS) formation of S. mutans UA159 biofilms was evaluated. The change in accumulation and acidogenicity of S. mutans UA159 biofilms by periodic treatments (10 min per treatment) with the identified components was also investigated. Of the fractions, n-hexane fraction showed the strongest anti-acidogenic activity and was mainly composed of palmitic, linoleic and oleic acids. Of the identified components, linoleic and oleic acids strongly affected the acid production rate, F-ATPase activity and EPS formation of the biofilms. Periodic treatment with linoleic and oleic acids during biofilm formation also inhibited the biofilm accumulation and acid production rate of the biofilms without killing the biofilm bacteria. These results suggest that linoleic and oleic acids may be effective agents for restraining virulence of S. mutans biofilms. Linoleic and oleic acids may be promising agents for controlling virulence of cariogenic biofilms and subsequent dental caries formation. © 2015 The Society for Applied Microbiology.

  9. Experimental model of biofilm implant-related osteomyelitis to test combination biomaterials using biofilms as initial inocula. (United States)

    Williams, Dustin L; Haymond, Bryan S; Woodbury, Kassie L; Beck, J Peter; Moore, David E; Epperson, R Tyler; Bloebaum, Roy D


    Currently, the majority of animal models that are used to study biofilm-related infections use planktonic bacterial cells as initial inocula to produce positive signals of infection in biomaterials studies. However, the use of planktonic cells has potentially led to inconsistent results in infection outcomes. In this study, well-established biofilms of methicillin-resistant Staphylococcus aureus were grown and used as initial inocula in an animal model of a Type IIIB open fracture. The goal of the work was to establish, for the first time, a repeatable model of biofilm implant-related osteomyelitis, wherein biofilms were used as initial inocula to test combination biomaterials. Results showed that 100% of animals that were treated with biofilms developed osteomyelitis, whereas 0% of animals not treated with biofilm developed infection. The development of this experimental model may lead to an important shift in biofilm and biomaterials research by showing that when biofilms are used as initial inocula, they may provide additional insights into how biofilm-related infections in the clinic develop and how they can be treated with combination biomaterials to eradicate and/or prevent biofilm formation. Copyright © 2012 Wiley Periodicals, Inc.

  10. Calcium-Phosphate-Osteopontin Particles Reduce Biofilm Formation and pH Drops in in situ Grown Dental Biofilms. (United States)

    Schlafer, Sebastian; Ibsen, Casper J S; Birkedal, Henrik; Nyvad, Bente


    This 2-period crossover study investigated the effect of calcium-phosphate-osteopontin particles on biofilm formation and pH in 48-h biofilms grown in situ. Bovine milk osteopontin is a highly phosphorylated glycoprotein that has been shown to interfere with bacterial adhesion to salivary-coated surfaces. Calcium-phosphate-osteopontin particles have been shown to reduce biofilm formation and pH drops in a 5-species laboratory model of dental biofilm without affecting bacterial viability. Here, smooth surface biofilms from 10 individuals were treated ex vivo 6 times/day for 30 min with either calcium-phosphate-osteopontin particles or sterile saline. After growth, the amount of biofilm formed was determined by confocal microscopy, and pH drops upon exposure to glucose were monitored using confocal-microscopy-based pH ratiometry. A total of 160 biofilms were analysed. No adverse effects of repeated ex vivo treatment with calcium-phosphate-osteopontin particles were observed. Particle treatment resulted in a 32% lower amount of biofilm formed (p Biofilm pH was significantly higher upon particle treatment, both shortly after the addition of glucose and after 30 min of incubation with glucose (p biofilms as well as the remineralizing potential of the particles. © 2016 S. Karger AG, Basel.

  11. A Nonbactericidal Zinc-Complexing Ligand as a Biofilm Inhibitor: Structure-Guided Contrasting Effects on Staphylococcus aureus Biofilm. (United States)

    Kapoor, Vidushi; Rai, Rajanikant; Thiyagarajan, Durairaj; Mukherjee, Sandipan; Das, Gopal; Ramesh, Aiyagari


    Zinc-complexing ligands are prospective anti-biofilm agents because of the pivotal role of zinc in the formation of Staphylococcus aureus biofilm. Accordingly, the potential of a thiosemicarbazone (compound C1) and a benzothiazole-based ligand (compound C4) in the prevention of S. aureus biofilm formation was assessed. Compound C1 displayed a bimodal activity, hindering biofilm formation only at low concentrations and promoting biofilm growth at higher concentrations. In the case of C4, a dose-dependent inhibition of S. aureus biofilm growth was observed. Atomic force microscopy analysis suggested that at higher concentrations C1 formed globular aggregates, which perhaps formed a substratum that favored adhesion of cells and biofilm formation. In the case of C4, zinc supplementation experiments validated zinc complexation as a plausible mechanism of inhibition of S. aureus biofilm. Interestingly, C4 was nontoxic to cultured HeLa cells and thus has promise as a therapeutic anti-biofilm agent. The essential understanding of the structure-driven implications of zinc-complexing ligands acquired in this study might assist future screening regimes for identification of potent anti-biofilm agents. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  12. Strategies for combating bacterial biofilms: A focus on anti-biofilm agents and their mechanisms of action (United States)

    Roy, Ranita; Tiwari, Monalisa; Donelli, Gianfranco; Tiwari, Vishvanath


    ABSTRACT Biofilm refers to the complex, sessile communities of microbes found either attached to a surface or buried firmly in an extracellular matrix as aggregates. The biofilm matrix surrounding bacteria makes them tolerant to harsh conditions and resistant to antibacterial treatments. Moreover, the biofilms are responsible for causing a broad range of chronic diseases and due to the emergence of antibiotic resistance in bacteria it has really become difficult to treat them with efficacy. Furthermore, the antibiotics available till date are ineffective for treating these biofilm related infections due to their higher values of minimum inhibitory concentration (MIC) and minimum bactericidal concentration (MBC), which may result in in-vivo toxicity. Hence, it is critically important to design or screen anti-biofilm molecules that can effectively minimize and eradicate biofilm related infections. In the present article, we have highlighted the mechanism of biofilm formation with reference to different models and various methods used for biofilm detection. A major focus has been put on various anti-biofilm molecules discovered or tested till date which may include herbal active compounds, chelating agents, peptide antibiotics, lantibiotics and synthetic chemical compounds along with their structures, mechanism of action and their respective MICs, MBCs, minimum biofilm inhibitory concentrations (MBICs) as well as the half maximal inhibitory concentration (IC50) values available in the literature so far. Different mode of action of anti biofilm molecules addressed here are inhibition via interference in the quorum sensing pathways, adhesion mechanism, disruption of extracellular DNA, protein, lipopolysaccharides, exopolysaccharides and secondary messengers involved in various signaling pathways. From this study, we conclude that the molecules considered here might be used to treat biofilm-associated infections after significant structural modifications, thereby

  13. Drinking water biofilm cohesiveness changes under chlorination or hydrodynamic stress. (United States)

    Mathieu, L; Bertrand, I; Abe, Y; Angel, E; Block, J C; Skali-Lami, S; Francius, G


    Attempts at removal of drinking water biofilms rely on various preventive and curative strategies such as nutrient reduction in drinking water, disinfection or water flushing, which have demonstrated limited efficiency. The main reason for these failures is the cohesiveness of the biofilm driven by the physico-chemical properties of its exopolymeric matrix (EPS). Effective cleaning procedures should break up the matrix and/or change the elastic properties of bacterial biofilms. The aim of this study was to evaluate the change in the cohesive strength of two-month-old drinking water biofilms under increasing hydrodynamic shear stress τw (from ∼0.2 to ∼10 Pa) and shock chlorination (applied concentration at T0: 10 mg Cl2/L; 60 min contact time). Biofilm erosion (cell loss per unit surface area) and cohesiveness (changes in the detachment shear stress and cluster volumes measured by atomic force microscopy (AFM)) were studied. When rapidly increasing the hydrodynamic constraint, biofilm removal was found to be dependent on a dual process of erosion and coalescence of the biofilm clusters. Indeed, 56% of the biofilm cells were removed with, concomitantly, a decrease in the number of the 50-300 μm(3) clusters and an increase in the number of the smaller (i.e., 600 μm(3)) ones. Moreover, AFM evidenced the strengthening of the biofilm structure along with the doubling of the number of contact points, NC, per cluster volume unit following the hydrodynamic disturbance. This suggests that the compactness of the biofilm exopolymers increases with hydrodynamic stress. Shock chlorination removed cells (-75%) from the biofilm while reducing the volume of biofilm clusters. Oxidation stress resulted in a decrease in the cohesive strength profile of the remaining drinking water biofilms linked to a reduction in the number of contact points within the biofilm network structure in particular for the largest biofilm cluster volumes (>200 μm(3)). Changes in the cohesive


    Directory of Open Access Journals (Sweden)

    Pavol Bajzík


    Full Text Available The complete removal of biofilms on food  equipment surfaces  is essential to ensure food safety and quality. However, cells in biofilms exhibit greater resistance against the action of sanitizers and other antimicrobial agents compared to their free living counterparts, making them much more difficult to remove. They can be a significant source of post - processing contamination and could potentially harbor pathogens in food processing platns. The biotechnology sector is just beginning to tackle the problem of biofilms by developing antimicrobial agents with novel mechanisms of action. Some studies seek to prevent biofilm formation, others aim to develop antimicrobial agents to treat existing biofilms, and still others are trying to disrupt the polymeric ties that bind the biofilms together. doi:10.5219/17

  15. An electrochemical impedance model for integrated bacterial biofilms

    International Nuclear Information System (INIS)

    Ben-Yoav, Hadar; Freeman, Amihay; Sternheim, Marek; Shacham-Diamand, Yosi


    Bacterial cells attachment onto solid surfaces and the following growth into mature microbial biofilms may result in highly antibiotic resistant biofilms. Such biofilms may be incidentally formed on tissues or implanted devices, or intentionally formed by directed deposition of microbial sensors on whole-cell bio-chip surface. A new method for electrical characterization of the later on-chip microbial biofilm buildup is presented in this paper. Measurement of impedance vs. frequency in the range of 100 mHz to 400 kHz of Escherichia coli cells attachment to indium-tin-oxide-coated electrodes was carried out while using optical microscopy estimating the electrode area coverage. We show that impedance spectroscopy measurements can be interpreted by a simple electrical equivalent model characterizing both attachment and growth of the biofilm. The correlation of extracted equivalent electrical lumped components with the visual biofilm parameters and their dependence on the attachment and growth phases is confirmed.

  16. Microscopic monitoring of extracellular pH in dental biofilms

    DEFF Research Database (Denmark)

    Schlafer, Sebastian; Garcia, Javier; Greve, Matilde

    pH in dental biofilm is a key virulence factor for the development of caries lesions. The complex three-dimensional architecture of dental biofilms leads to steep gradients of nutrients and metabolites, including organic acids, across the biofilm. For decades, measuring pH in dental biofilm has...... been limited to monitoring bulk pH with electrodes. Although pH microelectrodes with a better spatial resolution have been developed, they do not permit to monitor horizontal pH gradients in real-time. Quantitative fluorescent microscopic techniques, such as fluorescence lifetime imaging or pH...... ratiometry, can be employed to map the pH landscape in dental biofilm with more detail. However, when pH sensitive fluorescent probes are used to visualize pH in biofilms, it is crucial to differentiate between extracellular and intracellular pH. Intracellular microbial pH and pH in the extracellular matrix...

  17. Development and maturation of Escherichia coli K-12 biofilms

    DEFF Research Database (Denmark)

    Reisner, A.; Haagensen, J.A.J.; Schembri, Mark


    The development and maturation of E. coli biofilms in flow-chambers was investigated. We found that the presence of transfer constitutive IncF plasmids induced biofilm development forming structures resembling those reported for Pseudomonas aeruginosa . The development occurred in a step...... occurred in conjugation pilus proficient plasmid-carrying strains. The final shapes of the expanding structures in the mature biofilm seem to be determined by the pilus configuration, as various mutants affected in the processing and activity of the transfer pili displayed differently structured biofilms....... We further provide evidence that flagella, type 1 fimbriae, curli and Ag43 are all dispensable for the observed biofilm maturation. In addition, our results indicate that cell-to-cell signalling mediated by autoinducer 2 (AI-2) is not required for differentiation of E. coli within a biofilm community...

  18. Effect of fluoride and chlorhexidine digluconate mouthrinses on plaque biofilms

    DEFF Research Database (Denmark)

    Rabe, Per; Twetman, Svante; Kinnby, Bertil


    OBJECTIVE: To develop a model in which to investigate the architecture of plaque biofilms formed on enamel surfaces in vivo and to compare the effects of anti-microbial agents of relevance for caries on biofilm vitality. Materials and Methodology : Enamel discs mounted on healing abutments...... in the pre-molar region were worn by three subjects for 7 days. Control discs were removed before subjects rinsed with 0.1% chlorhexidine digluconate (CHX) or 0.2% sodium fluoride (NaF) for 1 minute. Biofilms were stained with Baclight Live/Dead and z-stacks of images created using confocal scanning laser...... micoscopy. The levels of vital and dead/damaged bacteria in the biofilms, assessed as the proportion of green and red pixels respectively, were analysed using ImageTrak(®) software. Results : The subjects showed individual differences in biofilm architecture. The thickness of the biofilms varied from 28...

  19. Bacteriophage-Derived Peptidase CHAPK Eliminates and Prevents Staphylococcal Biofilms

    Directory of Open Access Journals (Sweden)

    Mark Fenton


    Full Text Available New antibacterial agents are urgently needed for the elimination of biofilm-forming bacteria that are highly resistant to traditional antimicrobial agents. Proliferation of such bacteria can lead to significant economic losses in the agri-food sector. This study demonstrates the potential of the bacteriophage-derived peptidase, CHAPK, as a biocidal agent for the rapid disruption of biofilm-forming staphylococci, commonly associated with bovine mastitis. Purified CHAPK applied to biofilms of Staphylococcus aureus DPC5246 completely eliminated the staphylococcal biofilms within 4 h. In addition, CHAPK was able to prevent biofilm formation by this strain. The CHAPK lysin also reduced S. aureus in a skin decolonization model. Our data demonstrates the potential of CHAPK as a biocidal agent for prevention and treatment of biofilm-associated staphylococcal infections or as a decontaminating agent in the food and healthcare sectors.

  20. Biofilm mediated decontamination of pollutants from the environment

    Directory of Open Access Journals (Sweden)

    Arindam Mitra


    Full Text Available In this review, we highlight beneficial use of microbial biofilms in remediation of environmental pollutants by bioremediation. Bioremediation is an environment friendly, cost effective, sustainable technology that utilizes microbes to decontaminate and degrade a wide variety of pollutants into less harmful products. Relative to free-floating planktonic cells, microbes existing in biofilm mode are advantageous for bioremediation because of greater tolerance to pollutants, environmental stress and ability to degrade varied harsh pollutants via diverse catabolic pathways. In biofilm mode, microbes are immobilized in a self-synthesized matrix which offers protection from stress, contaminants and predatory protozoa. Contaminants ranging from heavy metals, petroleum, explosives, pesticides have been remediated using microbial consortia of biofilms. In the industry, biofilm based bioremediation is used to decontaminate polluted soil and groundwater. Here we discuss conventional and newer strategies utilizing biofilms in environmental remediation.

  1. Marine and estuarine natural microbial biofilms: ecological and biogeochemical dimensions

    Directory of Open Access Journals (Sweden)

    O. Roger Anderson


    Full Text Available Marine and estuarine microbial biofilms are ubiquitously distributed worldwide and are increasingly of interest in basic and applied sciences because of their unique structural and functional features that make them remarkably different from the biota in the plankton. This is a review of some current scientific knowledge of naturally occurring microbial marine and estuarine biofilms including prokaryotic and microeukaryotic biota, but excluding research specifically on engineering and applied aspects of biofilms such as biofouling. Because the microbial communities including bacteria and protists are integral to the fundamental ecological and biogeochemical processes that support biofilm communities, particular attention is given to the structural and ecological aspects of microbial biofilm formation, succession, and maturation, as well as the dynamics of the interactions of the microbiota in biofilms. The intent is to highlight current state of scientific knowledge and possible avenues of future productive research, especially focusing on the ecological and biogeochemical dimensions.

  2. Characterization of Acinetobacter baumannii biofilm associated components (United States)

    Brossard, Kari A.

    Acinetobacter baumannii is a Gram-negative aerobic coccobaccillus that is a major cause of nosocomial infections worldwide. Infected individuals may develop pneumonia, urinary tract, wound, and other infections that are associated with the use of indwelling medical devices such as catheters and mechanical ventilation. Treatment is difficult because many A. baumannii isolates have developed multi-drug resistance and the bacterium can persist on abiotic surfaces. Persistence and resistance may be due to formation of biofilms, which leads to long-term colonization, evasion of the host immune system and resistance to treatment with antibiotics and disinfectants. While biofilms are complex multifaceted structures, two bacterial components that have been shown to be important in formation and stability are exopolysaccharides (EPS) and the biofilm-associated protein (Bap). An EPS, poly-beta-1,6-N-acetylglucosamine, PNAG, has been described for E. coli and S. epidermidis. PNAG acts as an intercellular adhesin. Production of this adhesin is dependent on the pga/icaABCD locus. We have identified a homologous locus in A. baumannii 307-0294 that is involved in production of an exopolysaccharide, recognized by an anti-PNAG antibody. We hypothesized that the A. baumannii pgaABCD locus plays a role in biofilm formation, and protection against host innate defenses and disinfectants suggesting that PNAG is a possible virulence factor for the organism. The first aim of this thesis will define the pgaABCD locus. We have previously identified Bap, a protein with similarity to those described for S. aureus and we have demonstrated that this protein is involved in maintaining the stability of biofilms on glass. We hypothesized that A. baumannii Bap plays a role in persistence and pathogenesis and is regulated by quorum sensing. In our second aim we will examine the role of Bap in attachment and biofilm formation on medically relevant surfaces and also determine if Bap is involved in

  3. Anaerobic bacteria grow within Candida albicans biofilms and induce biofilm formation in suspension cultures. (United States)

    Fox, Emily P; Cowley, Elise S; Nobile, Clarissa J; Hartooni, Nairi; Newman, Dianne K; Johnson, Alexander D


    The human microbiome contains diverse microorganisms, which share and compete for the same environmental niches. A major microbial growth form in the human body is the biofilm state, where tightly packed bacterial, archaeal, and fungal cells must cooperate and/or compete for resources in order to survive. We examined mixed biofilms composed of the major fungal species of the gut microbiome, Candida albicans, and each of five prevalent bacterial gastrointestinal inhabitants: Bacteroides fragilis, Clostridium perfringens, Escherichia coli, Klebsiella pneumoniae, and Enterococcus faecalis. We observed that biofilms formed by C. albicans provide a hypoxic microenvironment that supports the growth of two anaerobic bacteria, even when cultured in ambient oxic conditions that are normally toxic to the bacteria. We also found that coculture with bacteria in biofilms induces massive gene expression changes in C. albicans, including upregulation of WOR1, which encodes a transcription regulator that controls a phenotypic switch in C. albicans, from the "white" cell type to the "opaque" cell type. Finally, we observed that in suspension cultures, C. perfringens induces aggregation of C. albicans into "mini-biofilms," which allow C. perfringens cells to survive in a normally toxic environment. This work indicates that bacteria and C. albicans interactions modulate the local chemistry of their environment in multiple ways to create niches favorable to their growth and survival. Copyright © 2014 Elsevier Ltd. All rights reserved.

  4. Development of a high-throughput Candida albicans biofilm chip.

    Directory of Open Access Journals (Sweden)

    Anand Srinivasan


    Full Text Available We have developed a high-density microarray platform consisting of nano-biofilms of Candida albicans. A robotic microarrayer was used to print yeast cells of C. albicans encapsulated in a collagen matrix at a volume as low as 50 nL onto surface-modified microscope slides. Upon incubation, the cells grow into fully formed "nano-biofilms". The morphological and architectural complexity of these biofilms were evaluated by scanning electron and confocal scanning laser microscopy. The extent of biofilm formation was determined using a microarray scanner from changes in fluorescence intensities due to FUN 1 metabolic processing. This staining technique was also adapted for antifungal susceptibility testing, which demonstrated that, similar to regular biofilms, cells within the on-chip biofilms displayed elevated levels of resistance against antifungal agents (fluconazole and amphotericin B. Thus, results from structural analyses and antifungal susceptibility testing indicated that despite miniaturization, these biofilms display the typical phenotypic properties associated with the biofilm mode of growth. In its final format, the C. albicans biofilm chip (CaBChip is composed of 768 equivalent and spatially distinct nano-biofilms on a single slide; multiple chips can be printed and processed simultaneously. Compared to current methods for the formation of microbial biofilms, namely the 96-well microtiter plate model, this fungal biofilm chip has advantages in terms of miniaturization and automation, which combine to cut reagent use and analysis time, minimize labor intensive steps, and dramatically reduce assay costs. Such a chip should accelerate the antifungal drug discovery process by enabling rapid, convenient and inexpensive screening of hundreds-to-thousands of compounds simultaneously.

  5. Streptococcus pneumoniae biofilm formation and dispersion during colonization and disease (United States)

    Chao, Yashuan; Marks, Laura R.; Pettigrew, Melinda M.; Hakansson, Anders P.


    Streptococcus pneumoniae (the pneumococcus) is a common colonizer of the human nasopharynx. Despite a low rate of invasive disease, the high prevalence of colonization results in millions of infections and over one million deaths per year, mostly in individuals under the age of 5 and the elderly. Colonizing pneumococci form well-organized biofilm communities in the nasopharyngeal environment, but the specific role of biofilms and their interaction with the host during colonization and disease is not yet clear. Pneumococci in biofilms are highly resistant to antimicrobial agents and this phenotype can be recapitulated when pneumococci are grown on respiratory epithelial cells under conditions found in the nasopharyngeal environment. Pneumococcal biofilms display lower levels of virulence in vivo and provide an optimal environment for increased genetic exchange both in vitro and in vivo, with increased natural transformation seen during co-colonization with multiple strains. Biofilms have also been detected on mucosal surfaces during pneumonia and middle ear infection, although the role of these biofilms in the disease process is debated. Recent studies have shown that changes in the nasopharyngeal environment caused by concomitant virus infection, changes in the microflora, inflammation, or other host assaults trigger active release of pneumococci from biofilms. These dispersed bacteria have distinct phenotypic properties and transcriptional profiles different from both biofilm and broth-grown, planktonic bacteria, resulting in a significantly increased virulence in vivo. In this review we discuss the properties of pneumococcal biofilms, the role of biofilm formation during pneumococcal colonization, including their propensity for increased ability to exchange genetic material, as well as mechanisms involved in transition from asymptomatic biofilm colonization to dissemination and disease of otherwise sterile sites. Greater understanding of pneumococcal biofilm

  6. Conjugation of Inulin Improves Anti-Biofilm Activity of Chitosan


    Guiqiang Zhang; Jing Liu; Ruilian Li; Siming Jiao; Cui Feng; Zhuo A. Wang; Yuguang Du


    Bacteria biofilm helps bacteria prevent phagocytosis during infection and increase resistance to antibiotics. Staphylococcus aureus is a Gram-positive pathogenic bacterium and is tightly associated with biofilm-related infections, which have led to great threat to human health. Chitosan, the only cationic polysaccharide in nature, has been demonstrated to have antimicrobial and anti-biofilm activities, which, however, require a relative high dosage of chitosan. Moreover, poor water solubility...

  7. Biofilm Formation on Different Materials Used in Oral Rehabilitation


    Souza, Júlio C. M.; Mota, Raquel R. C.; Sordi, Mariane B.; Passoni, Bernardo B.; Benfatti, Cesar A. M.; Magini, Ricardo S.


    Abstract The aim of this study was to evaluate the density and the morphological aspects of biofilms adhered to different materials applied in oral rehabilitation supported by dental implants. Sixty samples were divided into four groups: feldspar-based porcelain, CoCr alloy, commercially pure titanium grade IV and yttria-stabilized zirconia. Human saliva was diluted into BHI supplemented with sucrose to grow biofilms for 24 or 48 h. After this period, biofilm was removed by 1% protease treatm...

  8. Intrinsic and Extrinsic Aspects on Campylobacter jejuni Biofilms

    Directory of Open Access Journals (Sweden)

    Roberta T. Melo


    Full Text Available Biofilm represents a way of life that allows greater survival of microorganisms in hostile habitats. Campylobacter jejuni is able to form biofilms in vitro and on surfaces at several points in the poultry production chain. Genetic determinants related to their formation are expressed differently between strains and external conditions are decisive in this respect. Our approach combines phylogenetic analysis and the presence of seven specific genes linked to biofilm formation in association with traditional microbiology techniques, using Mueller Hinton and chicken juice as substrates in order to quantify, classify, determine the composition and morphology of the biomass of simple and mixed biofilms of 30 C. jejuni strains. It also evaluates the inhibition of its formation by biocides commonly used in industry and also by zinc oxide nanoparticles. Genetic analysis showed high heterogeneity with the identification of 23 pulsotypes. Despite the diversity, the presence of flaA, cadF, luxS, dnaJ, htrA, cbrA, and sodB genes in all strains shows the high potential for biofilm formation. This ability was only expressed in chicken juice, where they presented phenotype of a strong biofilm producer, with a mean count of 7.37 log CFU/mL and an ultrastructure characteristic of mature biofilm. The composition of simple and mixed biofilms was predominantly composed by proteins. The exceptions were found in mixed biofilms with Pseudomonas aeruginosa, which includes a carbohydrate-rich matrix, lower ability to sessile form in chicken juice and compact architecture of the biofilm, this aspects are intrinsic to this species. Hypochlorite, chlorhexidine, and peracetic acid were more effective in controlling viable cells of C. jejuni in biofilm, but the existence of tolerant strains indicates exposure to sublethal concentrations and development of adaptation mechanisms. This study shows that in chicken juice C. jejuni presents greater potential in producing mature

  9. Biocorrosion: towards understanding interactions between biofilms and metals. (United States)

    Beech, Iwona B; Sunner, Jan


    The term microbially influenced corrosion, or biocorrosion, refers to the accelerated deterioration of metals owing to the presence of biofilms on their surfaces. The detailed mechanisms of biocorrosion are still poorly understood. Recent investigations into biocorrosion have focused on the influence of biomineralization processes taking place on metallic surfaces and the impact of extracellular enzymes, active within the biofilm matrix, on electrochemical reactions at the biofilm-metal interface.

  10. Paired methods to measure biofilm killing and removal: a case study with Penicillin G treatment of Staphylococcus aureus biofilm. (United States)

    Ausbacher, D; Lorenz, L; Pitts, B; Stewart, P S; Goeres, D M


    Biofilms are microbial aggregates that show high tolerance to antibiotic treatments in vitro and in vivo. Killing and removal are both important in biofilm control, therefore methods that measure these two mechanisms were evaluated in a parallel experimental design. Kill was measured using the single tube method (ASTM method E2871) and removal was determined by video microscopy and image analysis using a new treatment flow cell. The advantage of the parallel test design is that both methods used biofilm covered coupons harvested from a CDC biofilm reactor, a well-established and standardized biofilm growth method. The control Staphylococcus aureus biofilms treated with growth medium increased by 0·6 logs during a 3-h contact time. Efficacy testing showed biofilms exposed to 400 μmol l -1 penicillin G decreased by only 0·3 logs. Interestingly, time-lapse confocal scanning laser microscopy revealed that penicillin G treatment dispersed the biofilm despite being an ineffective killing agent. In addition, no biofilm removal was detected when assays were performed in 96-well plates. These results illustrate that biofilm behaviour and impact of treatments can vary substantially when assayed by different methods. Measuring both killing and removal with well-characterized methods will be crucial for the discovery of new anti-biofilm strategies. Biofilms are tolerant to antimicrobial treatments and can lead to persistent infections. Finding new anti-biofilm strategies and understanding their mode-of-action is therefore of high importance. Historically, antimicrobial testing has focused on measuring the decrease in viability. While kill data are undeniably important, measuring biofilm disruption provides equally useful information. Starting with biofilm grown in the same reactor, we paired assessment of biofilm removal using a new treatment-flow-cell and real-time microscopy with kill data collected using the single tube method (ASTM E2871). Pairing these two methods

  11. A generalization of Hamilton’s rule for the evolution of microbial cooperation


    smith, jeff; Van Dyken, J. David; Zee, Peter


    Hamilton’s rule states that cooperation will evolve if the fitness cost to actors is less than the benefit to recipients multiplied by their genetic relatedness. This rule makes many simplifying assumptions, however, and does not accurately describe social evolution in organisms like microbes where selection is both strong and nonadditive. We derived a generalization of Hamilton’s rule and measured its parameters in Myxococcus xanthus bacteria. Nonadditivity made cooperative sporulation surpr...

  12. Dicty_cDB: Contig-U15795-1 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available ... 60 2e-07 EF527414_1( EF527414 |pid:none) Aspergillus tubingensis strain V-0.....yces hygroscopicus strain... 59 5e-07 EF527413_1( EF527413 |pid:none) Aspergillus aff. tubingensis V-04-... ...00113_4409( CP000113 |pid:none) Myxococcus xanthus DK 1622, com... 59 7e-07 EF527412_1( EF527412 |pid:none) Aspergillus aff. tubing

  13. Nitritation performance and biofilm development of co- and counter-diffusion biofilm reactors: Modeling and experimental comparison

    DEFF Research Database (Denmark)

    Wang, Rongchang; Terada, Akihiko; Lackner, Susanne


    A comparative study was conducted on the start-up performance and biofilm development in two different biofilm reactors with aim of obtaining partial nitritation. The reactors were both operated under oxygen limited conditions, but differed in geometry. While substrates (O-2, NH3) co......-diffused in one geometry, they counter-diffused in the other. Mathematical simulations of these two geometries were implemented in two 1-D multispecies biofilm models using the AQUASIM software. Sensitivity analysis results showed that the oxygen mass transfer coefficient (K-i) and maximum specific growth rate...... results showed that the counter-diffusion biofilms developed faster and attained a larger maximum biofilm thickness than the co-diffusion biofilms. Under oxygen limited condition (DO

  14. Quantification of biofilm structures by the novel computer program COMSTAT. (United States)

    Heydorn, A; Nielsen, A T; Hentzer, M; Sternberg, C; Givskov, M; Ersbøll, B K; Molin, S


    The structural organization of four microbial communities was analysed by a novel computer program, COMSTAT, which comprises ten features for quantifying three-dimensional biofilm image stacks. Monospecies biofilms of each of the four bacteria, Pseudomonas: putida, P. aureofaciens, P. fluorescens and P. aeruginosa, tagged with the green fluorescent protein (GFP) were grown in flow chambers with a defined minimal medium as substrate. Analysis by the COMSTAT program of four variables describing biofilm structure - mean thickness, roughness, substratum coverage and surface to volume ratio - showed that the four Pseudomonas: strains represent different modes of biofilm growth. P. putida had a unique developmental pattern starting with single cells on the substratum growing into micro-colonies, which were eventually succeeded by long filaments and elongated cell clusters. P. aeruginosa colonized the entire substratum, and formed flat, uniform biofilms. P. aureofaciens resembled P. aeruginosa, but had a stronger tendency to form micro-colonies. Finally, the biofilm structures of P. fluorescens had a phenotype intermediate between those of P. putida and P. aureofaciens. Analysis of biofilms of P. aureofaciens growing on 0.03 mM, 0.1 mM or 0.5 mM citrate minimal media showed that mean biofilm thickness increased with increasing citrate concentration. Moreover, biofilm roughness increased with lower citrate concentrations, whereas surface to volume ratio increased with higher citrate concentrations.

  15. Fluorescence lifetime imaging of oxygen in dental biofilm (United States)

    Gerritsen, Hans C.; de Grauw, Cees J.


    Dental biofilm consists of micro-colonies of bacteria embedded in a matrix of polysaccharides and salivary proteins. pH and oxygen concentration are of great importance in dental biofilm. Both can be measured using fluorescence techniques. The imaging of dental biofilm is complicated by the thickness of the biofilms that can be up to several hundred micrometers thick. Here, we employed a combination of two-photon excitation microscopy with fluorescence lifetime imaging to quantify the oxygen concentration in dental biofilm. Collisional quenching of fluorescent probes by molecular oxygen leads to a reduction of the fluorescence lifetime of the probe. We employed this mechanism to measure the oxygen concentration distribution in dental biofilm by means of fluorescence lifetime imaging. Here, TRIS Ruthenium chloride hydrate was used as an oxygen probe. A calibration procedure on buffers was use to measure the lifetime response of this Ruthenium probe. The results are in agreement with the Stern-Volmer equation. A linear relation was found between the ratio of the unquenched and the quenched lifetime and the oxygen concentration. The biofilm fluorescence lifetime imaging results show a strong oxygen gradient at the buffer - biofilm interface and the average oxygen concentration in the biofilm amounted to 50 μM.

  16. Spatial transcriptomes within the Pseudomonas aeruginosa biofilm architecture. (United States)

    Heacock-Kang, Yun; Sun, Zhenxin; Zarzycki-Siek, Jan; McMillan, Ian A; Norris, Michael H; Bluhm, Andrew P; Cabanas, Darlene; Fogen, Dawson; Vo, Hung; Donachie, Stuart P; Borlee, Bradley R; Sibley, Christopher D; Lewenza, Shawn; Schurr, Michael J; Schweizer, Herbert P; Hoang, Tung T


    Bacterial cooperative associations and dynamics in biofilm microenvironments are of special interest in recent years. Knowledge of localized gene-expression and corresponding bacterial behaviors within the biofilm architecture at a global scale has been limited, due to a lack of robust technology to study limited number of cells in stratified layers of biofilms. With our recent pioneering developments in single bacterial cell transcriptomic analysis technology, we generated herein an unprecedented spatial transcriptome map of the mature in vitro Pseudomonas aeruginosa biofilm model, revealing contemporaneous yet altered bacterial behaviors at different layers within the biofilm architecture (i.e., surface, middle and interior of the biofilm). Many genes encoding unknown functions were highly expressed at the biofilm-solid interphase, exposing a critical gap in the knowledge of their activities that may be unique to this interior niche. Several genes of unknown functions are critical for biofilm formation. The in vivo importance of these unknown proteins was validated in invertebrate (fruit fly) and vertebrate (mouse) models. We envisage the future value of this report to the community, in aiding the further pathophysiological understanding of P. aeruginosa biofilms. Our approach will open doors to the study of bacterial functional genomics of different species in numerous settings. © 2017 The Authors. Molecular Microbiology Published by John Wiley & Sons Ltd.

  17. Sticking together: building a biofilm the Bacillus subtilis way (United States)

    Vlamakis, Hera; Chai, Yunrong; Beauregard, Pascale; Losick, Richard; Kolter, Roberto


    Preface Biofilms are ubiquitous communities of tightly associated bacteria encased in an extracellular matrix. Bacillus subtilis has long-served as a robust model organism to examine the molecular mechanisms of biofilm formation and a number of studies have revealed that this process is subject to a number of integrated regulatory pathways. In this Review, we focus on the molecular mechanisms controlling biofilm assembly and briefly summarize the current state of knowledge regarding their disassembly. We also discuss recent progress that has expanded our understanding of biofilm formation on plant roots, which are a natural habitat for this soil bacterium. PMID:23353768

  18. Evolution of exploitative interactions during diversification in Bacillus subtilis biofilms

    DEFF Research Database (Denmark)

    Dragoš, Anna; Lakshmanan, Nivedha; Martin, Marivic


    variants. These variants can settle in alternative biofilm niches and develop new types of interactions that greatly influence population productivity. Here, we explore the evolutionary diversification of pellicle biofilms of the Gram positive, spore-forming bacterium Bacillus subtilis. We discover that......-similarly to other species-B. subtilis diversifies into distinct colony variants. These variants dramatically differ in biofilm formation abilities and expression of biofilm-related genes. In addition, using a quantitative approach, we reveal striking differences in surface complexity and hydrophobicity...

  19. Conjugation of Inulin Improves Anti-Biofilm Activity of Chitosan. (United States)

    Zhang, Guiqiang; Liu, Jing; Li, Ruilian; Jiao, Siming; Feng, Cui; Wang, Zhuo A; Du, Yuguang


    Bacteria biofilm helps bacteria prevent phagocytosis during infection and increase resistance to antibiotics. Staphylococcus aureus is a Gram-positive pathogenic bacterium and is tightly associated with biofilm-related infections, which have led to great threat to human health. Chitosan, the only cationic polysaccharide in nature, has been demonstrated to have antimicrobial and anti-biofilm activities, which, however, require a relative high dosage of chitosan. Moreover, poor water solubility further restricts its applications on anti-infection therapy. Inulins are a group of polysaccharides produced by many types of plants, and are widely used in processed foods. Compared to chitosan, inulin is very soluble in water and possesses a mild antibacterial activity against certain pathogenic bacteria. In order to develop an effective strategy to treat biofilm-related infections, we introduce a method by covalent conjugation of inulin to chitosan. The physicochemical characterization of the inulin⁻chitosan conjugate was assayed, and the anti-biofilm activity was evaluated against S. aureus biofilm. The results indicated that, as compared to chitosan, this novel polysaccharide⁻polysaccharide conjugate significantly enhanced activities against S. aureus either in a biofilm or planktonic state. Of note, the conjugate also showed a broad spectrum anti-biofilm activity on different bacteria strains and low cellular toxicity to mammalian cells. These results suggested that chitosan conjugation of inulin was a viable strategy for treatment against biofilm-related infections. This finding may further spread the application of natural polysaccharides on treatments of infectious disease.

  20. Role of bacterial efflux pumps in biofilm formation. (United States)

    Alav, Ilyas; Sutton, J Mark; Rahman, Khondaker Miraz


    Efflux pumps are widely implicated in antibiotic resistance because they can extrude the majority of clinically relevant antibiotics from within cells to the extracellular environment. However, there is increasing evidence from many studies to suggest that the pumps also play a role in biofilm formation. These studies have involved investigating the effects of efflux pump gene mutagenesis and efflux pump inhibitors on biofilm formation, and measuring the levels of efflux pump gene expression in biofilms. In particular, several key pathogenic species associated with increasing multidrug resistance, such as Acinetobacter baumannii, Escherichia coli, Pseudomonas aeruginosa and Staphylococcus aureus, have been investigated, whilst other studies have focused on Salmonella enterica serovar Typhimurium as a model organism and problematic pathogen. Studies have shown that efflux pumps, including AcrAB-TolC of E. coli, MexAB-OprM of P. aeruginosa, AdeFGH of A. baumannii and AcrD of S. enterica, play important roles in biofilm formation. The substrates for such pumps, and whether changes in their efflux activity affect biofilm formation directly or indirectly, remain to be determined. By understanding the roles that efflux pumps play in biofilm formation, novel therapeutic strategies can be developed to inhibit their function, to help disrupt biofilms and improve the treatment of infections. This review will discuss and evaluate the evidence for the roles of efflux pumps in biofilm formation and the potential approaches to overcome the increasing problem of biofilm-based infections.

  1. Enhanced Uranium Immobilization and Reduction by Geobacter sulfurreducens Biofilms (United States)

    Cologgi, Dena L.; Speers, Allison M.; Bullard, Blair A.; Kelly, Shelly D.


    Biofilms formed by dissimilatory metal reducers are of interest to develop permeable biobarriers for the immobilization of soluble contaminants such as uranium. Here we show that biofilms of the model uranium-reducing bacterium Geobacter sulfurreducens immobilized substantially more U(VI) than planktonic cells and did so for longer periods of time, reductively precipitating it to a mononuclear U(IV) phase involving carbon ligands. The biofilms also tolerated high and otherwise toxic concentrations (up to 5 mM) of uranium, consistent with a respiratory strategy that also protected the cells from uranium toxicity. The enhanced ability of the biofilms to immobilize uranium correlated only partially with the biofilm biomass and thickness and depended greatly on the area of the biofilm exposed to the soluble contaminant. In contrast, uranium reduction depended on the expression of Geobacter conductive pili and, to a lesser extent, on the presence of the c cytochrome OmcZ in the biofilm matrix. The results support a model in which the electroactive biofilm matrix immobilizes and reduces the uranium in the top stratum. This mechanism prevents the permeation and mineralization of uranium in the cell envelope, thereby preserving essential cellular functions and enhancing the catalytic capacity of Geobacter cells to reduce uranium. Hence, the biofilms provide cells with a physically and chemically protected environment for the sustained immobilization and reduction of uranium that is of interest for the development of improved strategies for the in situ bioremediation of environments impacted by uranium contamination. PMID:25128347

  2. An optical microfluidic platform for spatiotemporal biofilm treatment monitoring

    International Nuclear Information System (INIS)

    Kim, Young Wook; Mosteller, Matthew P; Subramanian, Sowmya; Meyer, Mariana T; Ghodssi, Reza; Bentley, William E


    Bacterial biofilms constitute in excess of 65% of clinical microbial infections, with the antibiotic treatment of biofilm infections posing a unique challenge due to their high antibiotic tolerance. Recent studies performed in our group have demonstrated that a bioelectric effect featuring low-intensity electric signals combined with antibiotics can significantly improve the efficacy of biofilm treatment. In this work, we demonstrate the bioelectric effect using sub-micron thick planar electrodes in a microfluidic device. This is critical in efforts to develop microsystems for clinical biofilm infection management, including both in vivo and in vitro applications. Adaptation of the method to the microscale, for example, can enable the development of localized biofilm infection treatment using microfabricated medical devices, while augmenting existing capabilities to perform biofilm management beyond the clinical realm. Furthermore, due to scale-down of the system, the voltage requirement for inducing the electric field is reduced further below the media electrolysis threshold. Enhanced biofilm treatment using the bioelectric effect in the developed microfluidic device elicited a 56% greater reduction in viable cell density and 26% further decrease in biomass growth compared to traditional antibiotic therapy. This biofilm treatment efficacy, demonstrated in a micro-scale device and utilizing biocompatible voltage ranges, encourages the use of this method for future clinical biofilm treatment applications. (paper)

  3. Effects of Miramistin and Phosprenil on Microbial Biofilms. (United States)

    Danilova, T A; Danilina, G A; Adzhieva, A A; Minko, A G; Nikolaeva, T N; Zhukhovitskii, V G; Pronin, A V


    Effects of Miramistin and Phosprenil on biofilms of S. pyogenes, S. aureus, E. coli, L. acidophilus, and L. plantarum were studied. Significant differences in the effects of these substances on mature biofilms of microorganisms and the process of their formation were observed. Miramistin had significant inhibiting effects on the forming of biofilms and on the formed biofilms of all studied microorganisms. Treatment with Miramistin inhibited biofilm formation by 2-3 times compared to the control. This effect was found already after using of Miramistin in the low doses (3.12 μg/ml). Inhibition of the growth of a formed biofilm was observed only after treatment with Miramistin in the high doses (25-50 μg/ml). Phosprenil in the high doses (15-30 mg/ml) inhibited the forming of biofilms, especially the biofilms of S. pyogenes and L. plantarum (by 3-4.5 times). Treatment of formed biofilms with the agent in doses of 6.0 and 0.6 mg/ml was associated with pronounced stimulation of its growth in S. pyogenes, S. aureus, and L. acidophilus.

  4. Analysis of the biofilm proteome of Xylella fastidiosa

    Directory of Open Access Journals (Sweden)

    Labate Carlos A


    Full Text Available Abstract Background Xylella fastidiosa is limited to the xylem of the plant host and the foregut of insect vectors (sharpshooters. The mechanism of pathogenicity of this bacterium differs from other plant pathogens, since it does not present typical genes that confer specific interactions between plant and pathogens (avr and/or hrp. The bacterium is injected directly into the xylem vessels where it adheres and colonizes. The whole process leads to the formation of biofilms, which are considered the main mechanism of pathogenicity. Cells in biofilms are metabolically and phenotypically different from their planktonic condition. The mature biofilm stage (phase of higher cell density presents high virulence and resistance to toxic substances such as antibiotics and detergents. Here we performed proteomic analysis of proteins expressed exclusively in the mature biofilm of X. fastidiosa strain 9a5c, in comparison to planktonic growth condition. Results We found a total of 456 proteins expressed in the biofilm condition, which correspond to approximately 10% of total protein in the genome. The biofilm showed 37% (or 144 proteins different protein than we found in the planktonic growth condition. The large difference in protein pattern in the biofilm condition may be responsible for the physiological changes of the cells in the biofilm of X. fastidiosa. Mass spectrometry was used to identify these proteins, while real-time quantitative polymerase chain reaction monitored expression of genes encoding them. Most of proteins expressed in the mature biofilm growth were associated with metabolism, adhesion, pathogenicity and stress conditions. Even though the biofilm cells in this work were not submitted to any stress condition, some stress related proteins were expressed only in the biofilm condition, suggesting that the biofilm cells would constitutively express proteins in different adverse environments. Conclusions We observed overexpression of proteins

  5. Electro-active bio-films: formation, characterization and mechanisms

    International Nuclear Information System (INIS)

    Parot, Sandrine


    Some bacteria, which are able to exchange electrons with a conductive material without mediator form on conductive surfaces electro-active bio-films. This bacterial property has been recently discovered (2001). Objectives of this work are to develop electro-active bio-films in various natural environments from indigenous flora, then through complementary electrochemical techniques (chrono-amperometry and cyclic voltammetry), to evaluate electro-activity of isolates coming from so-formed bio-films and to characterize mechanisms of electron transfer between bacteria and materials. First, electro-active bio-films have been developed under chrono-amperometry in garden compost and in water coming from Guyana mangrove. These bio-films were respectively able to use an electrode as electron acceptor (oxidation) or as electron donor (reduction). In compost, results obtained in chrono-amperometry and cyclic voltammetry suggest a two-step electron transfer: slow substrate consumption, then rapid electron transfer between bacteria and the electrode. Thereafter, the ability to reduce oxygen was demonstrated with cyclic voltammetry for facultative aerobic isolates from compost bio-films (Enterobacter spp. and Pseudomonas spp.) and for aerobic isolates obtained from marine electro-active bio-films (Roseobacter spp. in majority). Finally, bio-films inducing current increase in chrono-amperometry were developed in bioreactor with synthetic medium from a pure culture of isolates. Hence, for the first time, electro-activity of several anaerobic strains of Geobacter bremensis isolated from compost bio-films was highlighted. (author) [fr

  6. Role of bacterial biofilm in development of middle ear effusion. (United States)

    Tawfik, Sedeek Abd El-Salam; Ibrahim, Ahmed Aly; Talaat, Iman Mamdoh; El-Alkamy, Soliman Samy Abd El-Raouf; Youssef, Ahmed


    Biofilms have been implicated in the development of several chronic upper respiratory tract infections. Role of bacterial biofilms has been well studied in the pathogenesis of chronic rhinosinusitis. However, its impact on development of middle ear effusion is still a matter of debate. To study the extent of surface adenoid biofilm and evaluate its role in the pathogenesis of chronic otitis media with effusion in children. The study was carried out on 40 children in Alexandria Main University Hospital between 1 and 16 years of age without sex predilection, who were divided into two groups. The first group (20 children) had otitis media with effusion associated with adenoid hypertrophy, whereas the second group (20 children) had adenoid hypertrophy without middle ear effusion. Adenoidectomy with ventilation tube insertion was done for group 1 cases, whereas, only Adenoidectomy was done for group 2 cases. The samples were processed for the detection of biofilms by scanning electron microscopy. The biofilm formation was graded according to extension. Biofilm formation was detected on all samples for group 1. Adenoids removed from patients with otitis media with effusion had higher-grade biofilm formation than the other group (P 0.0001). No correlation was found between adenoid size and biofilm formation. In pediatric population, adenoid surface biofilm formation may be involved in the pathogenesis otitis media with effusion.

  7. Biofilm on artificial pacemaker: fiction or reality? (United States)

    Santos, Ana Paula Azevedo; Watanabe, Evandro; Andrade, Denise de


    Cardiac pacing through cardiac pacemaker is one of the most promising alternatives in the treatment of arrhythmias, but it can cause reactions natural or complex reactions, either early or late. This study aimed to describe the scientific evidence on the risk of infection and biofilm formation associated with cardiac pacemaker. This is a study of integrative literature review. It included 14 publications classified into three thematic categories: diagnosis (microbiological and/or clinical), complications and therapy of infections. Staphylococcus epidermidis and Staphylococcus aureus were the microorganisms most frequently isolated. It was not possible to determine the incidence of infection associated with pacemakers, since the studies were generally of prevalence. In terms of therapy, the complete removal of pacemakers stood out, especially in cases of suspected biofilm. Still controversial is the use of systemic antibiotic prophylaxis in reducing the incidence of infection associated with implantation of a pacemaker.

  8. Lethal photosensitization of biofilm-grown bacteria (United States)

    Wilson, Michael


    Antibacterial agents are increasingly being used for the prophylaxis and treatment of oral diseases. As these agents can be rendered ineffective by resistance development in the target organisms there is a need to develop alternative antimicrobial approaches. Light-activated antimicrobial agents release singlet oxygen and free radicals which can kill adjacent bacteria and a wide range of cariogenic and periodontopathogenic bacteria has been shown to be susceptible to such agents. In the oral cavity these organisms are present as biofilms (dental plaques) which are less susceptible to traditional antimicrobial agents than bacterial suspensions. The results of these studies have shown that biofilm-grown oral bacteria are also susceptible to lethal photosensitization although the light energy doses required are grater than those needed to kill the organisms when they are grown as aqueous suspensions.

  9. Pseudomonas biofilms: possibilities of their control

    Czech Academy of Sciences Publication Activity Database

    Masák, J.; Čejková, A.; Schreiberová, O.; Řezanka, Tomáš


    Roč. 89, č. 2 (2014), s. 1-14 ISSN 0168-6496 R&D Projects: GA ČR GA14-23597S; GA ČR GA14-00227S Grant - others:Ministry of Industry and Trade(CZ) FR-TI1/456; Ministry of Education, Youth and Sports(CZ) LF11016 Institutional support: RVO:61388971 Keywords : biofilm * pseudomonas * review Subject RIV: EE - Microbiology, Virology Impact factor: 3.568, year: 2014

  10. Microbial interactions in drinking water biofilms


    Simões, Lúcia C.; Simões, M.; Vieira, M. J.


    Drinking water distribution networks may be viewed as a large reactor where a number of chemical and microbiological processes are taking place. Control of microbial growth in drinking water distribution systems (DWDS) often achieved through the addition of disinfectants, is essential to limit the spread of waterborne pathogens. However, microorganisms can resist disinfection through protection within biofilms and resistant host cells. Recent studies into the microbial ecology ...

  11. Exopolysaccharides regulate calcium flow in cariogenic biofilms (United States)

    Varenganayil, Muth M.; Decho, Alan W.


    Caries-associated biofilms induce loss of calcium from tooth surfaces in the presence of dietary carbohydrates. Exopolysaccharides (EPS) provide a matrix scaffold and an abundance of primary binding sites within biofilms. The role of EPS in binding calcium in cariogenic biofilms is only partially understood. Thus, the aim of the present study is to investigate the relationship between the calcium dissolution rates and calcium tolerance of caries-associated bacteria and yeast as well as to examine the properties of EPS to quantify its binding affinity for dissolved calcium. Calcium dissolution was measured by dissolution zones on Pikovskaya’s agar. Calcium tolerance was assessed by isothermal microcalorimetry (IMC) by adding CaCl2 to the bacterial cultures. Acid-base titration and Fourier transform infrared (FTIR) spectroscopy were used to identify possible functional groups responsible for calcium binding, which was assessed by isothermal titration calorimetry (ITC). Lactobacillus spp. and mutans streptococci demonstrated calcium dissolution in the presence of different carbohydrates. All strains that demonstrated high dissolution rates also revealed higher rates of calcium tolerance by IMC. In addition, acidic functional groups were predominantly identified as possible binding sites for calcium ions by acid-base titration and FTIR. Finally, ITC revealed EPS to have a higher binding affinity for calcium compared, for example, to lactic acid. In conclusion, this study illustrates the role of EPS in terms of the calcium tolerance of cariogenic microbiota by determining the ability of EPS to control free calcium concentrations within the biofilms as a self-regulating mode of action in the pathogenesis of dental caries. PMID:29023506

  12. Candida parapsilosis Biofilm Identification by Raman Spectroscopy

    Czech Academy of Sciences Publication Activity Database

    Samek, Ota; Mlynariková, K.; Bernatová, Silvie; Ježek, Jan; Krzyžánek, Vladislav; Šiler, Martin; Zemánek, Pavel; Růžička, F.; Holá, Miroslava; Mahelová, M.


    Roč. 15, č. 12 (2014), s. 23924-23935 E-ISSN 1422-0067 R&D Projects: GA MŠk(CZ) LO1212; GA MŠk ED0017/01/01; GA ČR GAP205/11/1687 Institutional support: RVO:68081731 Keywords : Raman spectroscopy * Candida parapsilosis * biofilm Subject RIV: BH - Optics, Masers, Lasers Impact factor: 2.862, year: 2014

  13. Exopolysaccharides regulate calcium flow in cariogenic biofilms.

    Directory of Open Access Journals (Sweden)

    Monika Astasov-Frauenhoffer

    Full Text Available Caries-associated biofilms induce loss of calcium from tooth surfaces in the presence of dietary carbohydrates. Exopolysaccharides (EPS provide a matrix scaffold and an abundance of primary binding sites within biofilms. The role of EPS in binding calcium in cariogenic biofilms is only partially understood. Thus, the aim of the present study is to investigate the relationship between the calcium dissolution rates and calcium tolerance of caries-associated bacteria and yeast as well as to examine the properties of EPS to quantify its binding affinity for dissolved calcium. Calcium dissolution was measured by dissolution zones on Pikovskaya's agar. Calcium tolerance was assessed by isothermal microcalorimetry (IMC by adding CaCl2 to the bacterial cultures. Acid-base titration and Fourier transform infrared (FTIR spectroscopy were used to identify possible functional groups responsible for calcium binding, which was assessed by isothermal titration calorimetry (ITC. Lactobacillus spp. and mutans streptococci demonstrated calcium dissolution in the presence of different carbohydrates. All strains that demonstrated high dissolution rates also revealed higher rates of calcium tolerance by IMC. In addition, acidic functional groups were predominantly identified as possible binding sites for calcium ions by acid-base titration and FTIR. Finally, ITC revealed EPS to have a higher binding affinity for calcium compared, for example, to lactic acid. In conclusion, this study illustrates the role of EPS in terms of the calcium tolerance of cariogenic microbiota by determining the ability of EPS to control free calcium concentrations within the biofilms as a self-regulating mode of action in the pathogenesis of dental caries.

  14. Evaluation of combinations of putative anti-biofilm agents and antibiotics to eradicate biofilms of Staphylococcus aureus and Pseudomonas aeruginosa. (United States)

    Belfield, Katherine; Bayston, Roger; Hajduk, Nadzieja; Levell, Georgia; Birchall, John P; Daniel, Matija


    To evaluate potential anti-biofilm agents for their ability to enhance the activity of antibiotics for local treatment of localized biofilm infections. Staphylococcus aureus and Pseudomonas aeruginosa in vitro biofilm models were developed. The putative antibiotic enhancers N-acetylcysteine, acetylsalicylic acid, sodium salicylate, recombinant human deoxyribonuclease I, dispersin B, hydrogen peroxide and Johnson's Baby Shampoo (JBS) were tested for their anti-biofilm activity alone and their ability to enhance the activity of antibiotics for 7 or 14 days, against 5 day old biofilms. The antibiotic enhancers were paired with rifampicin and clindamycin against S. aureus and gentamicin and ciprofloxacin against P. aeruginosa. Isolates from biofilms that were not eradicated were tested for antibiotic resistance. Antibiotic levels 10× MIC and 100× MIC significantly reduced biofilm, but did not consistently eradicate it. Antibiotics at 100× MIC with 10% JBS for 14 days was the only treatment to eradicate both staphylococcal and pseudomonal biofilms. Recombinant human deoxyribonuclease I significantly reduced staphylococcal biofilm. Emergence of resistance of surviving isolates was minimal and was often associated with the small colony variant phenotype. JBS enhanced the activity of antibiotics and several other promising anti-biofilm agents were identified. Antibiotics with 10% JBS eradicated biofilms produced by both organisms. Such combinations might be useful in local treatment of localized biofilm infections. © The Author 2017. Published by Oxford University Press on behalf of the British Society for Antimicrobial Chemotherapy. All rights reserved. For Permissions, please email:

  15. Biofilm Formation by Mycobacterium bovis: Influence of Surface Kind and Temperatures of Sanitizer Treatments on Biofilm Control

    Directory of Open Access Journals (Sweden)

    Victoria O. Adetunji


    Full Text Available Mycobacterium bovis causes classic bovine tuberculosis, a zoonosis which is still a concern in Africa. Biofilm forming ability of two Mycobacterium bovis strains was assessed on coupons of cement, ceramic, or stainless steel in three different microbiological media at 37°C with agitation for 2, 3, or 4 weeks to determine the medium that promotes biofilm. Biofilm mass accumulated on coupons was treated with 2 sanitizers (sanitizer A (5.5 mg L−1 active iodine and sanitizer B (170.6 g1 alkyl dimethylbenzyl ammonium chloride, 78 g−1 didecyldimethyl ammonium chloride, 107.25 g L−1 glutaraldehyde, 146.25 g L−1 isopropanol, and 20 g L−1 pine oil at 28 and 45°C and in hot water at 85°C for 5 min. Residual biofilms on treated coupons were quantified using crystal violet binding assay. The two strains had a similar ability to form biofilms on the three surfaces. More biofilms were developed in media containing 5% liver extract. Biofilm mass increased as incubation time increased till the 3rd week. More biofilms were formed on cement than on ceramic and stainless steel surfaces. Treatment with hot water at 85°C reduced biofilm mass, however, sanitizing treatments at 45°C removed more biofilms than at 28°C. However, neither treatment completely eliminated the biofilms. The choice of processing surface and temperatures used for sanitizing treatments had an impact on biofilm formation and its removal from solid surfaces.

  16. Bistability and Biofilm Formation in Bacillus subtilis (United States)

    Chai, Yunrong; Chu, Frances; Kolter, Roberto; Losick, Richard


    Summary Biofilms of Bacillus subtilis consist of long chains of cells that are held together in bundles by an extracellular matrix of exopolysaccharide and the protein TasA. The exopolysaccharide is produced by enzymes encoded by the epsA-O operon and the gene encoding TasA is located in the yqxM-sipW-tasA operon. Both operons are under the control of the repressor SinR. Derepression is mediated by the antirepressor SinI, which binds to SinR with a 1:1 stoichiometry. Paradoxically, in medium promoting derepression of the matrix operons, the overall concentration of SinR in the culture greatly exceeded that of SinI. We show that under biofilm-promoting conditions sinI, which is under the control of the response regulator Spo0A, was expressed only in a small subpopulation of cells, whereas sinR was expressed in almost all cells. Activation of Spo0A is known to be subject to a bistable switch, and we infer that SinI reaches levels sufficient to trigger matrix production only in the subpopulation of cells in which Spo0A is active. Additionally, evidence suggests that sinI is expressed at intermediate, but not low or high, levels of Spo0A activity, which may explain why certain nutritional conditions are more effective in promoting biofilm formation than others. PMID:18047568

  17. Biofilm and dental implant: The microbial link

    Directory of Open Access Journals (Sweden)

    Sangeeta Dhir


    Full Text Available Mouth provides a congenial environment for the growth of the microorganisms as compared to any other part of the human body by exhibiting an ideal nonshedding surface. Dental plaque happens to be a diverse community of the microorganisms found on the tooth surface. Periodontal disease and the peri-implant disease are specific infections that are originating from these resident microbial species when the balance between the host and the microbial pathogenicity gets disrupted. This review discusses the biofilms in relation to the peri-implant region, factors affecting its presence, and the associated treatment to manage this complex microbial colony. Search Methodology: Electronic search of the medline was done with the search words: Implants and biofilms/dental biofilm formation/microbiology at implant abutment interface/surface free energy/roughness and implant, periimplantitis/local drug delivery and dental implant. Hand search across the journals - clinical oral implant research, implant dentistry, journal of dental research, international journal of oral implantology, journal of prosthetic dentistry, perioodntology 2000, journal of periodontology were performed. The articles included in the review comprised of in vivo studies, in vivo (animal and human studies, abstracts, review articles.

  18. Emergent pattern formation in an interstitial biofilm (United States)

    Zachreson, Cameron; Wolff, Christian; Whitchurch, Cynthia B.; Toth, Milos


    Collective behavior of bacterial colonies plays critical roles in adaptability, survivability, biofilm expansion and infection. We employ an individual-based model of an interstitial biofilm to study emergent pattern formation based on the assumptions that rod-shaped bacteria furrow through a viscous environment and excrete extracellular polymeric substances which bias their rate of motion. Because the bacteria furrow through their environment, the substratum stiffness is a key control parameter behind the formation of distinct morphological patterns. By systematically varying this property (which we quantify with a stiffness coefficient γ ), we show that subtle changes in the substratum stiffness can give rise to a stable state characterized by a high degree of local order and long-range pattern formation. The ordered state exhibits characteristics typically associated with bacterial fitness advantages, even though it is induced by changes in environmental conditions rather than changes in biological parameters. Our findings are applicable to a broad range of biofilms and provide insights into the relationship between bacterial movement and their environment, and basic mechanisms behind self-organization of biophysical systems.

  19. Bacterial Extracellular Polysaccharides Involved in Biofilm Formation

    Directory of Open Access Journals (Sweden)

    Elena P. Ivanova


    Full Text Available Extracellular polymeric substances (EPS produced by microorganisms are a complex mixture of biopolymers primarily consisting of polysaccharides, as well as proteins, nucleic acids, lipids and humic substances. EPS make up the intercellular space of microbial aggregates and form the structure and architecture of the biofilm matrix. The key functions of EPS comprise the mediation of the initial attachment of cells to different substrata and protection against environmental stress and dehydration. The aim of this review is to present a summary of the current status of the research into the role of EPS in bacterial attachment followed by biofilm formation. The latter has a profound impact on an array of biomedical, biotechnology and industrial fields including pharmaceutical and surgical applications, food engineering, bioremediation and biohydrometallurgy. The diverse structural variations of EPS produced by bacteria of different taxonomic lineages, together with examples of biotechnological applications, are discussed. Finally, a range of novel techniques that can be used in studies involving biofilm-specific polysaccharides is discussed.

  20. Enabling systematic, harmonised and large-scale biofilms data computation: the Biofilms Experiment Workbench. (United States)

    Pérez-Rodríguez, Gael; Glez-Peña, Daniel; Azevedo, Nuno F; Pereira, Maria Olívia; Fdez-Riverola, Florentino; Lourenço, Anália


    Biofilms are receiving increasing attention from the biomedical community. Biofilm-like growth within human body is considered one of the key microbial strategies to augment resistance and persistence during infectious processes. The Biofilms Experiment Workbench is a novel software workbench for the operation and analysis of biofilms experimental data. The goal is to promote the interchange and comparison of data among laboratories, providing systematic, harmonised and large-scale data computation. The workbench was developed with AIBench, an open-source Java desktop application framework for scientific software development in the domain of translational biomedicine. Implementation favours free and open-source third-parties, such as the R statistical package, and reaches for the Web services of the BiofOmics database to enable public experiment deposition. First, we summarise the novel, free, open, XML-based interchange format for encoding biofilms experimental data. Then, we describe the execution of common scenarios of operation with the new workbench, such as the creation of new experiments, the importation of data from Excel spreadsheets, the computation of analytical results, the on-demand and highly customised construction of Web publishable reports, and the comparison of results between laboratories. A considerable and varied amount of biofilms data is being generated, and there is a critical need to develop bioinformatics tools that expedite the interchange and comparison of microbiological and clinical results among laboratories. We propose a simple, open-source software infrastructure which is effective, extensible and easy to understand. The workbench is freely available for non-commercial use at under LGPL license. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  1. Calcium transcriptionally regulates the biofilm machinery of Xylella fastidiosa to promote continued biofilm development in batch cultures. (United States)

    Parker, Jennifer K; Chen, Hongyu; McCarty, Sara E; Liu, Lawrence Y; De La Fuente, Leonardo


    The functions of calcium (Ca) in bacteria are less characterized than in eukaryotes, where its role has been studied extensively. The plant-pathogenic bacterium Xylella fastidiosa has several virulence features that are enhanced by increased Ca concentrations, including biofilm formation. However, the specific mechanisms driving modulation of this feature are unclear. Characterization of biofilm formation over time showed that 4 mM Ca supplementation produced denser biofilms that were still developing at 96 h, while biofilm in non-supplemented media had reached the dispersal stage by 72 h. To identify changes in global gene expression in X. fastidiosa grown in supplemental Ca, RNA-Seq of batch culture biofilm cells was conducted at three 24-h time intervals. Results indicate that a variety of genes are differentially expressed in response to Ca, including genes related to attachment, motility, exopolysaccharide synthesis, biofilm formation, peptidoglycan synthesis, regulatory functions, iron homeostasis, and phages. Collectively, results demonstrate that Ca supplementation induces a transcriptional response that promotes continued biofilm development, while biofilm cells in nonsupplemented media are driven towards dispersion of cells from the biofilm structure. These results have important implications for disease progression in planta, where xylem sap is the source of Ca and other nutrients for X. fastidiosa. © 2016 Society for Applied Microbiology and John Wiley & Sons Ltd.

  2. Roles of ionic strength and biofilm roughness on adhesion kinetics of Escherichia coli onto groundwater biofilm grown on PVC surfaces (United States)

    Janjaroen, Dao; Ling, Fangqiong; Monroy, Guillermo; Derlon, Nicolas; Mogenroth, Eberhard; Boppart, Stephen A.; Liu, Wen-Tso; Nguyen, Thanh H.


    Mechanisms of Escherichia coli attachment on biofilms grown on PVC coupons were investigated. Biofilms were grown in CDC reactors using groundwater as feed solution over a period up to 27 weeks. Biofilm physical structure was characterized at the micro- and meso-scales using Scanning Electron Microscopy (SEM) and Optical Coherence Tomography (OCT), respectively. Microbial community diversity was analyzed with Terminal Restricted Fragment Length Polymorphism (T-RFLP). Both physical structure and microbial community diversity of the biofilms were shown to be changing from 2 weeks to 14 weeks, and became relatively stable after 16 weeks. A parallel plate flow chamber coupled with an inverted fluorescent microscope was also used to monitor the attachment of fluorescent microspheres and E. coli on clean PVC surfaces and biofilms grown on PVC surfaces for different ages. Two mechanisms of E. coli attachment were identified. The adhesion rate coefficients (kd) of E. coli on nascent PVC surfaces and 2-week biofilms increased with ionic strength. However, after biofilms grew for 8 weeks, the adhesion was found to be independent of solution chemistry. Instead, a positive correlation between kd and biofilm roughness as determined by OCT was obtained, indicating that the physical structure of biofilms could play an important role in facilitating the adhesion of E. coli cells. PMID:23497979

  3. Evaluation of intraspecies interactions in biofilm formation by Methylobacterium species isolated from pink-pigmented household biofilms. (United States)

    Xu, Fang-Fang; Morohoshi, Tomohiro; Wang, Wen-Zhao; Yamaguchi, Yuka; Liang, Yan; Ikeda, Tsukasa


    Concern regarding household biofilms has grown due to their widespread existence and potential to threaten human health by serving as pathogen reservoirs. Previous studies identified Methylobacterium as one of the dominant genera found in household biofilms. In the present study, we examined the mechanisms underlying biofilm formation by using the bacterial consortium found in household pink slime. A clone library analysis revealed that Methylobacterium was the predominant genus in household pink slime. In addition, 16 out of 21 pink-pigmented bacterial isolates were assigned to the genus Methylobacterium. Although all of the Methylobacterium isolates formed low-level biofilms, the amount of the biofilms formed by Methylobacterium sp. P-1M and P-18S was significantly increased by co-culturing with other Methylobacterium strains that belonged to a specific phylogenetic group. The single-species biofilm was easily washed from the glass surface, whereas the dual-species biofilm strongly adhered after washing. A confocal laser scanning microscopy analysis showed that the dual-species biofilms were significantly thicker and tighter than the single-species biofilms.

  4. Treatment of Oral Biofilms by a D-Enantiomeric Peptide. (United States)

    Zhang, Tian; Wang, Zhejun; Hancock, Robert E W; de la Fuente-Núñez, César; Haapasalo, Markus


    Almost all dental diseases are caused by biofilms that consist of multispecies communities. DJK-5, which is a short D-enantiomeric, protease-resistant peptide with broad-spectrum anti-biofilm activity, was tested for its effect on oral multispecies biofilms. Peptide DJK-5 at 10 μg/mL effectively prevented the growth of these microbes in culture media in a time-dependent manner. In addition to the prevention of growth, peptide DJK-5 completely killed both Streptococcus mutans and Enterococcus faecalis suspended from biofilms after 30 minutes of incubation in liquid culture media. DJK-5 also led to the effective killing of microbes in plaque biofilm. The proportion of bacterial cells killed by 10 μg/mL of DJK-5 was similar after 1 and 3 days, both exceeding 85%. DJK-5 was able to significantly prevent biofilm formation over 3 days (P = 0.000). After 72 hours of exposure, DJK-5 significantly reduced and almost completely prevented plaque biofilm production by more than 90% of biovolume compared to untreated controls (P = 0.000). The proportion of dead biofilm bacteria at the 10 μg/mL DJK-5 concentration was similar for 1- and 3-day-old biofilms, whereby >86% of the bacteria were killed. DJK-5 was also able to kill >79% and >85% of bacteria, respectively, after one-time and three brief treatments of 3-day-old biofilms. The combination of DJK-5 and chlorhexidine showed the best bacterial killing among all treatments, with ~83% and >88% of bacterial cells killed after 1 and 3 minutes, respectively. No significant difference was found in the percentage of biofilm killing amongst three donor plaque samples after DJK-5 treatment. In particular, DJK-5 showed strong performance in inhibiting biofilm development and eradicating pre-formed oral biofilms compared to L-enantiomeric peptide 1018. DJK-5 was very effective against oral biofilms when used alone or combined with chlorhexidine, and may be a promising agent for use in oral anti-biofilm strategies in the future.

  5. Evidence for biofilm acid neutralization by baking soda. (United States)

    Zero, Domenick T


    The generating of acids from the microbial metabolism of dietary sugars and the subsequent decrease in biofilm pH below the pH at which tooth mineral begins to demineralize (critical pH) are the key elements of the dental caries process. Caries preventive strategies that rapidly neutralize biofilm acids can prevent demineralization and favor remineralization and may help prevent the development of sugar-induced dysbiosis that shifts the biofilm toward increased cariogenic potential. Although the neutralizing ability of sodium bicarbonate (baking soda) has been known for many years, its anticaries potential as an additive to fluoride dentifrice has received only limited investigation. There is evidence that baking soda rapidly can reverse the biofilm pH decrease after a sugar challenge; however, the timing of when it is used in relation to a dietary sugar exposure is critical in that the sooner its used the greater the benefit in preventing a sustained biofilm pH decrease and subsequent demineralization. Furthermore, the effectiveness of baking soda in elevating biofilm pH appears to depend on concentration. Thus, the concentration of baking soda in marketed dentifrice products, which ranges from 10% to 65%, may affect their biofilm pH neutralizing performance. People with hyposalivation particularly may benefit from using fluoride dentifrice containing baking soda because of their diminished ability to clear dietary sugars and buffer biofilm acids. Although promising, there is the need for more evidence that strategies that modify the oral ecology, such as baking soda, can alter the cariogenic (acidogenic and aciduric) properties of biofilm microorganisms. The acid neutralization of dental biofilm by using fluoride dentifrice that contains baking soda has potential for helping counteract modern high-sugar diets by rapidly neutralizing biofilm-generated acid, especially in people with hyposalivation. Copyright © 2017 American Dental Association. Published by

  6. Incorporation of Listeria monocytogenes strains in raw milk biofilms. (United States)

    Weiler, Christiane; Ifland, Andrea; Naumann, Annette; Kleta, Sylvia; Noll, Matthias


    Biofilms develop successively on devices of milk production without sufficient cleaning and originate from the microbial community of raw milk. The established biofilm matrices enable incorporation of pathogens like Listeria monocytogenes, which can cause a continuous contamination of food processing plants. L. monocytogenes is frequently found in raw milk and non-pasteurized raw milk products and as part of a biofilm community in milk meters and bulk milk tanks. The aim of this study was to analyze whether different L. monocytogenes strains are interacting with the microbial community of raw milk in terms of biofilm formation in the same manner, and to identify at which stage of biofilm formation a selected L. monocytogenes strain settles best. Bacterial community structure and composition of biofilms were analyzed by a cloning and sequencing approach and terminal restriction fragment length polymorphism analysis (T-RFLP) based on the bacterial 16S rRNA gene. The chemical composition of biofilms was analyzed by Fourier transform infrared spectroscopy (FTIR), while settled L. monocytogenes cells were quantified by fluorescence in situ hybridization (FISH). Addition of individual L. monocytogenes strains to raw milk caused significant shifts in the biofilm biomass, in the chemical as well as in the bacterial community composition. Biofilm formation and attachment of L. monocytogenes cells were not serotype but strain specific. However, the added L. monocytogenes strains were not abundant since mainly members of the genera Citrobacter and Lactococcus dominated the bacterial biofilm community. Overall, added L. monocytogenes strains led to a highly competitive interaction with the raw milk community and triggered alterations in biofilm formation. Copyright © 2012 Elsevier B.V. All rights reserved.

  7. Transcriptomic and proteomic analyses of Desulfovibrio vulgaris biofilms: carbon and energy flow contribute to the distinct biofilm growth state. (United States)

    Clark, Melinda E; He, Zhili; Redding, Alyssa M; Joachimiak, Marcin P; Keasling, Jay D; Zhou, Jizhong Z; Arkin, Adam P; Mukhopadhyay, Aindrila; Fields, Matthew W


    Desulfovibrio vulgaris Hildenborough is a sulfate-reducing bacterium (SRB) that is intensively studied in the context of metal corrosion and heavy-metal bioremediation, and SRB populations are commonly observed in pipe and subsurface environments as surface-associated populations. In order to elucidate physiological changes associated with biofilm growth at both the transcript and protein level, transcriptomic and proteomic analyses were done on mature biofilm cells and compared to both batch and reactor planktonic populations. The biofilms were cultivated with lactate and sulfate in a continuously fed biofilm reactor, and compared to both batch and reactor planktonic populations. The functional genomic analysis demonstrated that biofilm cells were different compared to planktonic cells, and the majority of altered abundances for genes and proteins were annotated as hypothetical (unknown function), energy conservation, amino acid metabolism, and signal transduction. Genes and proteins that showed similar trends in detected levels were particularly involved in energy conservation such as increases in an annotated ech hydrogenase, formate dehydrogenase, pyruvate:ferredoxin oxidoreductase, and rnf oxidoreductase, and the biofilm cells had elevated formate dehydrogenase activity. Several other hydrogenases and formate dehydrogenases also showed an increased protein level, while decreased transcript and protein levels were observed for putative coo hydrogenase as well as a lactate permease and hyp hydrogenases for biofilm cells. Genes annotated for amino acid synthesis and nitrogen utilization were also predominant changers within the biofilm state. Ribosomal transcripts and proteins were notably decreased within the biofilm cells compared to exponential-phase cells but were not as low as levels observed in planktonic, stationary-phase cells. Several putative, extracellular proteins (DVU1012, 1545) were also detected in the extracellular fraction from biofilm cells

  8. Biofilm-forming activity of bacteria isolated from toilet bowl biofilms and the bactericidal activity of disinfectants against the isolates. (United States)

    Mori, Miho; Gomi, Mitsuhiro; Matsumune, Norihiko; Niizeki, Kazuma; Sakagami, Yoshikazu


    To evaluate the sanitary conditions of toilets, the bacterial counts of the toilet bowl biofilms in 5 Kansai area and 11 Kansai and Kanto area homes in Japan were measured in winter and summer seasons, respectively. Isolates (128 strains) were identified by analyzing 16S ribosomal RNA sequences. The number of colonies and bacterial species from biofilms sampled in winter tended to be higher and lower, respectively, than those in summer. Moreover, the composition of bacterial communities in summer and winter samples differed considerably. In summer samples, biofilms in Kansai and Kanto areas were dominated by Blastomonas sp. and Mycobacterium sp., respectively. Methylobacterium sp. was detected in all toilet bowl biofilms except for one sample. Methylobacterium sp. constituted the major presence in biofilms along with Brevundimonas sp., Sphingomonas sp., and/or Pseudomonas sp. The composition ratio of the sum of their genera was 88.0 from 42.9% of the total bacterial flora. The biofilm formation abilities of 128 isolates were investigated, and results suggested that Methylobacterium sp. and Sphingomonas sp. were involved in biofilm formation in toilet bowls. The biofilm formation of a mixed bacteria system that included bacteria with the highest biofilm-forming ability in a winter sample was greater than mixture without such bacteria. This result suggests that isolates possessing a high biofilm-forming activity are involved in the biofilm formation in the actual toilet bowl. A bactericidal test against 25 strains indicated that the bactericidal activities of didecyldimethylammonium chloride (DDAC) tended to be higher than those of polyhexamethylene biguanide (PHMB) and N-benzyl-N,N-dimethyldodecylammonium chloride (ADBAC). In particular, DDAC showed high bactericidal activity against approximately 90% of tested strains under the 5 h treatment.

  9. Casein Phosphopeptide-Amorphous Calcium Phosphate Reduces Streptococcus mutans Biofilm Development on Glass Ionomer Cement and Disrupts Established Biofilms. (United States)

    Dashper, Stuart G; Catmull, Deanne V; Liu, Sze-Wei; Myroforidis, Helen; Zalizniak, Ilya; Palamara, Joseph E A; Huq, N Laila; Reynolds, Eric C


    Glass ionomer cements (GIC) are dental restorative materials that are suitable for modification to help prevent dental plaque (biofilm) formation. The aim of this study was to determine the effects of incorporating casein phosphopeptide-amorphous calcium phosphate (CPP-ACP) into a GIC on the colonisation and establishment of Streptococcus mutans biofilms and the effects of aqueous CPP-ACP on established S mutans biofilms. S. mutans biofilms were either established in flow cells before a single ten min exposure to 1% w/v CPP-ACP treatment or cultured in static wells or flow cells with either GIC or GIC containing 3% w/w CPP-ACP as the substratum. The biofilms were then visualised using confocal laser scanning microscopy after BacLight LIVE/DEAD staining. A significant decrease in biovolume and average thickness of S. mutans biofilms was observed in both static and flow cell assays when 3% CPP-ACP was incorporated into the GIC substratum. A single ten min treatment with aqueous 1% CPP-ACP resulted in a 58% decrease in biofilm biomass and thickness of established S. mutans biofilms grown in a flow cell. The treatment also significantly altered the structure of these biofilms compared with controls. The incorporation of 3% CPP-ACP into GIC significantly reduced S. mutans biofilm development indicating another potential anticariogenic mechanism of this material. Additionally aqueous CPP-ACP disrupted established S. mutans biofilms. The use of CPP-ACP containing GIC combined with regular CPP-ACP treatment may lower S. mutans challenge.

  10. Casein Phosphopeptide-Amorphous Calcium Phosphate Reduces Streptococcus mutans Biofilm Development on Glass Ionomer Cement and Disrupts Established Biofilms.

    Directory of Open Access Journals (Sweden)

    Stuart G Dashper

    Full Text Available Glass ionomer cements (GIC are dental restorative materials that are suitable for modification to help prevent dental plaque (biofilm formation. The aim of this study was to determine the effects of incorporating casein phosphopeptide-amorphous calcium phosphate (CPP-ACP into a GIC on the colonisation and establishment of Streptococcus mutans biofilms and the effects of aqueous CPP-ACP on established S mutans biofilms. S. mutans biofilms were either established in flow cells before a single ten min exposure to 1% w/v CPP-ACP treatment or cultured in static wells or flow cells with either GIC or GIC containing 3% w/w CPP-ACP as the substratum. The biofilms were then visualised using confocal laser scanning microscopy after BacLight LIVE/DEAD staining. A significant decrease in biovolume and average thickness of S. mutans biofilms was observed in both static and flow cell assays when 3% CPP-ACP was incorporated into the GIC substratum. A single ten min treatment with aqueous 1% CPP-ACP resulted in a 58% decrease in biofilm biomass and thickness of established S. mutans biofilms grown in a flow cell. The treatment also significantly altered the structure of these biofilms compared with controls. The incorporation of 3% CPP-ACP into GIC significantly reduced S. mutans biofilm development indicating another potential anticariogenic mechanism of this material. Additionally aqueous CPP-ACP disrupted established S. mutans biofilms. The use of CPP-ACP containing GIC combined with regular CPP-ACP treatment may lower S. mutans challenge.

  11. The impact of manganese on biofilm development of Bacillus subtilis

    NARCIS (Netherlands)

    Mhatre, Eisha; Troszok, Agnieszka; Gallegos-Monterrosa, Ramses; Lindstädt, Stefanie; Hölscher, Theresa; Kuipers, Oscar P.; Kovács, Ákos T.


    Bacterial biofilms are dynamic and structurally complex communities, involving cell-to-cell interactions. In recent years, various environmental signals were identified that induce the complex biofilm development of the Gram-positive bacterium Bacillus subtilis. These signaling molecules are often

  12. Effects of lactoferricin B against keratitis-associated fungal biofilms. (United States)

    Sengupta, Jayangshu; Saha, Suman; Khetan, Archana; Sarkar, Sujoy K; Mandal, Santi M


    Biofilms are considered as the most important developmental characteristics in ocular infections. Biofilm eradication is a major challenge today to overcome the incidence of drug resistance. This report demonstrates the in vitro ability of biofilm formation on contact lens by three common keratitis-associated fungal pathogens, namely, Aspergillus fumigatus, Fusarium solani, and Candida albicans. Antifungal sensitivity testing performed for both planktonic cells and biofilm revealed the sessile phenotype to be resistant at MIC levels for the planktonic cells and also at higher concentrations. A prototype lens care solution was also found to be partially effective in eradication of the mature biofilm from contact lenses. Lactoferricin B (Lacf, 64 μg/ml), an antimicrobial peptide, exhibited almost no effect on the sessile phenotype. However, the combinatory effect of Lacf with antifungals against planktonic cells and biofilms of three fungal strains that were isolated from keratitis patients exhibited a reduction of antifungal dose more than eightfold. Furthermore, the effect of Lacf in lens care solution against biofilms in which those strains formed was eradicated successfully. These results suggest that lactoferricin B could be a promising candidate for clinical use in improving biofilm susceptibility to antifungals and also as an antibiofilm-antifungal additive in lens care solution.

  13. Bacterial biofilms investigated by atomic force microscopy and electrochemistry

    DEFF Research Database (Denmark)

    Hu, Yifan

    Bacterial biofilms are aggregates of microorganisms in which cells adhere to each other and adhere to a solid surface or an animal host cavity. Bacterial biofilms play important roles in human life, and cause serious harm for human society and huge economic losses. The complex composition of bact...

  14. Difference in initial dental biofilm accumulation between night and day. (United States)

    Dige, Irene; Schlafer, Sebastian; Nyvad, Bente


    The study of initial microbial colonization on dental surfaces is a field of intensive research because of the aetiological role of biofilms in oral diseases. Most previous studies of de novo accumulation and composition of dental biofilms in vivo do not differentiate between biofilms formed during day and night. This study hypothesized that there is a diurnal variation in the rate of accumulation of bacteria on solid surfaces in the oral cavity. In situ biofilm from healthy individuals was collected for 12 h during day and night, respectively, subjected to fluorescent in situ hybridization and visualized using confocal laser scanning microscopy. Analysis of the biofilms using stereological methods and digital image analysis revealed a consistent statistically significant difference between both the total number of bacteria and the biovolume in the two 12-h groups (p = 0.012), with the highest accumulation of bacteria during daytime (a factor of 8.8 and 6.1 higher, respectively). Hybridization with probes specific for streptococci and Actinomyces naeslundii indicated a higher proportion of streptococci in biofilms grown during daytime as compared to night-time. No differences could be observed for A. naeslundii. The degree of microbial coverage and the bacterial composition varied considerably between different individuals. The data provide firm evidence that initial biofilm formation decreases during the night, which may reflect differences in the availability of salivary nutrients. This finding is of significant importance when studying population dynamics during experimental dental biofilm formation.

  15. Bioactive Compounds Produced by Hypoxylon fragiforme against Staphylococcus aureus Biofilms

    Directory of Open Access Journals (Sweden)

    Kamila Tomoko Yuyama


    Full Text Available Treating infections organized in biofilms is a challenge due to the resistance of the pathogens against antibiotics and host immune cells. Many fungi grow in a wet environment, favorable for the growth of bacterial biofilms, and we speculated that fungi possess some strategies to control these bacterial biofilms. A fungus identified as Hypoxylon fragiforme, was collected in the Harz Mountains, Germany, and its mycelial culture was fermented in different culture media for 67 days to test its biological potential against bacterial biofilms. Sclerin, sclerin diacid and its 3-methyl monoester (methyl 1-(5-hydroxy-6-carboxylic-2,3,4-trimethylphenyl propionate are here described for the first time from this fungus. Sclerin and its diacid interfered with the biofilm formation of the pathogen Staphylococcus aureus, inhibiting 86% and 80% of the biofilm at 256 μg mL−1, respectively, but not killing the bacterium. Interestingly, the monomethylester of sclerin diacid was inactive. Although these compounds did not possess any activity against a pre-formed biofilm, they prevented its formation at subtoxic concentrations. Furthermore, sclerin and its diacid displayed a high specificity against Staphylococcus aureus, indicating a good strategy against pathogenic biofilms when combined with antibiotics.

  16. Development of the floating sulphur biofilm reactor for sulphide ...

    African Journals Online (AJOL)

    Development of the floating sulphur biofilm reactor for sulphide oxidation in biological water treatment systems. ... The effect of influent sulphide concentrations, flow rate and reactor dimensions on the sulphur biofilm formation were investigated for the optimisation of elemental sulphur recovery and sulphide removal ...

  17. Removal of Foodborne Pathogen Biofilms by Acidic Electrolyzed Water

    Directory of Open Access Journals (Sweden)

    Qiao Han


    Full Text Available Biofilms, which are complex microbial communities embedded in the protective extracellular polymeric substances (EPS, are difficult to remove in food production facilities. In this study, the use of acidic electrolyzed water (AEW to remove foodborne pathogen biofilms was evaluated. We used a green fluorescent protein-tagged Escherichia coli for monitoring the efficiency of AEW for removing biofilms, where under the optimal treatment conditions, the fluorescent signal of cells in the biofilm disappeared rapidly and the population of biofilm cells was reduced by more than 67%. Additionally, AEW triggered EPS disruption, as indicated by the deformation of the carbohydrate C-O-C bond and deformation of the aromatic rings in the amino acids tyrosine and phenylalanine. These deformations were identified by EPS chemical analysis and Raman spectroscopic analysis. Scanning electron microscopy (SEM images confirmed that the breakup and detachment of biofilm were enhanced after AEW treatment. Further, AEW also eradicated biofilms formed by both Gram-negative bacteria (Vibrio parahaemolyticus and Gram-positive bacteria (Listeria monocytogenes and was observed to inactivate the detached cells which are a potential source of secondary pollution. This study demonstrates that AEW could be a reliable foodborne pathogen biofilm disrupter and an eco-friendly alternative to sanitizers traditionally used in the food industry.

  18. Biofilms in Endodontics—Current Status and Future Directions (United States)

    Neelakantan, Prasanna; Romero, Monica; Vera, Jorge; Daood, Umer; Khan, Asad U.; Yan, Aixin; Cheung, Gary Shun Pan


    Microbiota are found in highly organized and complex entities, known as biofilms, the characteristics of which are fundamentally different from microbes in planktonic suspensions. Root canal infections are biofilm mediated. The complexity and variability of the root canal system, together with the multi-species nature of biofilms, make disinfection of this system extremely challenging. Microbial persistence appears to be the most important factor for failure of root canal treatment and this could further have an impact on pain and quality of life. Biofilm removal is accomplished by a chemo-mechanical process, using specific instruments and disinfecting chemicals in the form of irrigants and/or intracanal medicaments. Endodontic research has focused on the characterization of root canal biofilms and the clinical methods to disrupt the biofilms in addition to achieving microbial killing. In this narrative review, we discuss the role of microbial biofilms in endodontics and review the literature on the role of root canal disinfectants and disinfectant-activating methods on biofilm removal. PMID:28800075

  19. Biofilms in Endodontics-Current Status and Future Directions. (United States)

    Neelakantan, Prasanna; Romero, Monica; Vera, Jorge; Daood, Umer; Khan, Asad U; Yan, Aixin; Cheung, Gary Shun Pan


    Microbiota are found in highly organized and complex entities, known as biofilms, the characteristics of which are fundamentally different from microbes in planktonic suspensions. Root canal infections are biofilm mediated. The complexity and variability of the root canal system, together with the multi-species nature of biofilms, make disinfection of this system extremely challenging. Microbial persistence appears to be the most important factor for failure of root canal treatment and this could further have an impact on pain and quality of life. Biofilm removal is accomplished by a chemo-mechanical process, using specific instruments and disinfecting chemicals in the form of irrigants and/or intracanal medicaments. Endodontic research has focused on the characterization of root canal biofilms and the clinical methods to disrupt the biofilms in addition to achieving microbial killing. In this narrative review, we discuss the role of microbial biofilms in endodontics and review the literature on the role of root canal disinfectants and disinfectant-activating methods on biofilm removal.

  20. Antibiotic resistance and ndvB gene expression among biofilm ...

    African Journals Online (AJOL)

    A novel antibiotic resistant mechanism among biofilms is glucan-mediated sequestration in which ndvB gene encodes a glucosyltransferase involved in the formation of this glucans. We studied the biofilm formation and antibiotic susceptibility pattern of P. aeruginosa isolated from clinical samples, and measured the ...

  1. Lactobacillus plantarum lipoteichoic acid inhibits biofilm formation of Streptococcus mutans (United States)

    Ahn, Ki Bum; Baik, Jung Eun; Park, Ok-Jin; Yun, Cheol-Heui


    Dental caries is a biofilm-dependent oral disease and Streptococcus mutans is the known primary etiologic agent of dental caries that initiates biofilm formation on tooth surfaces. Although some Lactobacillus strains inhibit biofilm formation of oral pathogenic bacteria, the molecular mechanisms by which lactobacilli inhibit bacterial biofilm formation are not clearly understood. In this study, we demonstrated that Lactobacillus plantarum lipoteichoic acid (Lp.LTA) inhibited the biofilm formation of S. mutans on polystyrene plates, hydroxyapatite discs, and dentin slices without affecting the bacterial growth. Lp.LTA interferes with sucrose decomposition of S. mutans required for the production of exopolysaccharide, which is a main component of biofilm. Lp.LTA also attenuated the biding of fluorescein isothiocyanate-conjugated dextran to S. mutans, which is known to have a high affinity to exopolysaccharide on S. mutans. Dealanylated Lp.LTA did not inhibit biofilm formation of S. mutans implying that D-alanine moieties in the Lp.LTA structure were crucial for inhibition. Collectively, these results suggest that Lp.LTA attenuates S. mutans biofilm formation and could be used to develop effective anticaries agents. PMID:29420616

  2. Towards diagnostic guidelines for biofilm-associated infections

    DEFF Research Database (Denmark)

    Hall-Stoodley, Luanne; Stoodley, Paul; Kathju, Sandeep


    Biofilms associated with the human body, particularly in typically sterile locations, are difficult to diagnose and treat effectively because of their recalcitrance to conventional antibiotic therapy and host immune responses. The study of biofilms in medicine today requires a translational appro...

  3. The pulsed light inactivation of veterinary relevant microbial biofilms ...

    African Journals Online (AJOL)

    Results show that both Cryptosporidium and Giardia attach to biofilms in large numbers (100-1000 oo/cysts) in as little as 72 hours. Pulsed light successfully inactivated all test species (Listeria, Salmonella, Bacillus, Escherichia) in planktonic and biofilm form with an increase in inactivation for every increase in UV dose.

  4. Genetic Basis for Saccharomyces cerevisiae Biofilm in Liquid Medium

    DEFF Research Database (Denmark)

    Andersen, Kaj Scherz; Bojsen, Rasmus Kenneth; Gro Rejkjær Sørensen, Laura


    than free-living cells. We investigated the genetic basis for yeast, Saccharomyces cerevisiae, biofilm on solid surfaces in liquid medium by screening a comprehensive deletion mutant collection in the S1278b background and found 71 genes that were essential for biofilm development. Quantitative...

  5. Biofilm retention on surfaces with variable roughness and hydrophobicity

    DEFF Research Database (Denmark)

    Tang, Lone; Pillai, Saju; Revsbech, Niels Peter


    Biofilms on food processing equipment cause food spoilage and pose a hazard to consumers. The bacterial community on steel surfaces in a butcher’s shop was characterized, and bacteria representative of this community enriched from minced pork were used to study biofilm retention. Stainless steel...

  6. Biofilm formation enhances Helicobacter pylori survivability in vegetables. (United States)

    Ng, Chow Goon; Loke, Mun Fai; Goh, Khean Lee; Vadivelu, Jamuna; Ho, Bow


    To date, the exact route and mode of transmission of Helicobacter pylori remains elusive. The detection of H. pylori in food using molecular approaches has led us to postulate that the gastric pathogen may survive in the extragastric environment for an extended period. In this study, we show that H. pylori prolongs its survival by forming biofilm and micro-colonies on vegetables. The biofilm forming capability of H. pylori is both strain and vegetable dependent. H. pylori strains were classified into high and low biofilm formers based on their highest relative biofilm units (BU). High biofilm formers survived longer on vegetables compared to low biofilm formers. The bacteria survived better on cabbage compared to other vegetables tested. In addition, images captured on scanning electron and confocal laser scanning microscopes revealed that the bacteria were able to form biofilm and reside as micro-colonies on vegetable surfaces, strengthening the notion of possible survival of H. pylori on vegetables for an extended period of time. Taken together, the ability of H. pylori to form biofilm on vegetables (a common food source for human) potentially plays an important role in its survival, serving as a mode of transmission of H. pylori in the extragastric environment. Copyright © 2016 Elsevier Ltd. All rights reserved.

  7. Lactobacilli : Important in biofilm formation on voice prostheses

    NARCIS (Netherlands)

    Buijssen, Kevin J. D. A.; Harmsen, Hermie J. M.; van der Mei, Henny C.; Busscher, Henk J.; van der Laan, Bernard F. A. M.

    OBJECTIVE: We sought to identify bacterial strains responsible for biofilm formation on silicone rubber voice prostheses. STUDY DESIGN: We conducted an analysis of the bacterial population in biofilms on used silicone rubber voice prostheses by using new microbiological methods. METHODS: Two

  8. The Effect of Novel Heterocyclic Compounds on Cryptococcal Biofilm (United States)

    Korem, Maya; Kagan, Sarah


    Biofilm formation by microorganisms depends on their communication by quorum sensing, which is mediated by small diffusible signaling molecules that accumulate in the extracellular environment. During human infection, the pathogenic yeast Cryptococcus neoformans can form biofilm on medical devices, which protects the organism and increases its resistance to antifungal agents. The aim of this study was to test two novel heterocyclic compounds, S-8 (thiazolidinedione derivative, TZD) and NA-8 (succinimide derivative, SI), for their anti-biofilm activity against strains of Cryptococcus neoformans and Cryptococcus gattii. Biofilms were formed in a defined medium in 96-well polystyrene plates and 8-well micro-slides. The effect of sub-inhibitory concentrations of S-8 and NA-8 on biofilm formation was measured after 48 h by a metabolic reduction assay and by confocal laser microscopy analysis using fluorescent staining. The formation and development of cryptococcal biofilms was inhibited significantly by these compounds in concentrations below the minimum inhibitory concentration (MIC) values. These compounds may have a potential role in preventing fungal biofilm development on indwelling medical devices or even as a therapeutic measure after the establishment of biofilm. PMID:29371559

  9. Proteomics of drug resistance in Candida glabrata biofilms. (United States)

    Seneviratne, C Jayampath; Wang, Yu; Jin, Lijian; Abiko, Y; Samaranayake, Lakshman P


    Candida glabrata is a fungal pathogen that causes a variety of mucosal and systemic infections among compromised patient populations with higher mortality rates. Previous studies have shown that biofilm mode of the growth of the fungus is highly resistant to antifungal agents compared with the free-floating or planktonic mode of growth. Therefore, in the present study, we used 2-D DIGE to evaluate the differential proteomic profiles of C. glabrata under planktonic and biofilm modes of growth. Candida glabrata biofilms were developed on polystyrene surfaces and age-matched planktonic cultures were obtained in parallel. Initially, biofilm architecture, viability, and antifungal susceptibility were evaluated. Differentially expressed proteins more than 1.5-fold in DIGE analysis were subjected to MS/MS. The transcriptomic regulation of these biomarkers was evaluated by quantitative real-time PCR. Candida glabrata biofilms were highly resistant to the antifungals and biocides compared with the planktonic mode of growth. Candida glabrata biofilm proteome when compared with its planktonic proteome showed upregulation of stress response proteins, while glycolysis enzymes were downregulated. Similar trend could be observed at transcriptomic level. In conclusion, C. glabrata biofilms possess higher amount of stress response proteins, which may potentially contribute to the higher antifungal resistance seen in C. glabrata biofilms.


    Snyder, Richard A., Michael A. Lewis, Andreas Nocker and Joe E. Lepo. In press. Microbial Biofilms as Integrative Sensors of Environmental Quality. In: Estuarine Indicators Workshop Proceedings. CRC Press, Boca Raton, FL. 34 p. (ERL,GB 1198). Microbial biofilms are comple...

  11. Characterisation of Lactobacillus plantarum single and multi-strain biofilms

    NARCIS (Netherlands)

    Fernández Ramírez, Mónica D.


    Biofilms consist of microorganisms attached to a surface and embedded in a protective matrix of extracellular polymeric substances. Within a biofilm, micro-organisms are protected from harsh environmental conditions including those resulting from cleaning and disinfecting agents leading to food

  12. Interplay of Bacterial Interactions and Spatial Organisation in Multispecies Biofilms

    DEFF Research Database (Denmark)

    Liu, Wenzheng

    -tispecies biofilms, which provides theoretical and practical arguments for further ad-vancement of this field. Here, a reproducible four-species biofilm, composed of Stenotrophomonas rhizophila, Xan-thomonas retroflexus, Microbacterium oxydans and Paenibacillus amylolyticus, was established to study the effect...

  13. Formation of biofilm by strains of Listeria monocytogenes isolated ...

    African Journals Online (AJOL)

    Quantification of biofilm formation by 40 Listeria monocytogenes strains from wara soft cheese and its processing environment was assessed on glass vials surfaces. Attachement to glass surface was quantified using a crystal violet binding assay. All the 40 strains produced biofilms after 48 and 72 h incubation at 37oC.

  14. Contamination potential of drinking water distribution network biofilms. (United States)

    Wingender, J; Flemming, H C


    Drinking water distribution system biofilms were investigated for the presence of hygienically relevant microorganisms. Early biofilm formation was evaluated in biofilm reactors on stainless steel, copper, polyvinyl chloride (PVC) and polyethylene coupons exposed to unchlorinated drinking water. After 12 to 18 months, a plateau phase of biofilm development was reached. Surface colonization on the materials ranged between 4 x 10(6) and 3 x 10(7) cells/cm2, with heterotrophic plate count (HPC) bacteria between 9 x 10(3) and 7 x 10(5) colony-forming units (cfu)/cm2. Established biofilms were investigated in 18 pipe sections (2 to 99 years old) cut out from distribution pipelines. Materials included cast iron, galvanized steel, cement and PVC. Colonization ranged from 4 x 10(5) to 2 x 10(8) cells/cm2, HPC levels varied between 1 and 2 x 10(5) cfu/cm2. No correlation was found between extent of colonization and age of the pipes. Using cultural detection methods, coliform bacteria were rarely found, while Escherichia coli, Pseudomonas aeruginosa and Legionella spp. were not detected in the biofilms. In regular operation, distribution system biofilms do not seem to be common habitats for pathogens. However, nutrient-leaching materials like rubber-coated valves were observed with massive biofilms which harboured coliform bacteria contaminating drinking water.

  15. Effect of biocides on biofilms of some multidrug resistant clinical ...

    African Journals Online (AJOL)

    The ability of Escherichia coli and Klebsiella aerogenes to form biofilms was most affected. There was little inhibition of biofilm formation by the biocides on Staphylococcus aureus. This study has shown a relationship between biocide and multidrug resistance. Keywords: Biocides, Multi drug resistance, sodium hypochlorite, ...

  16. Insights into xanthomonas axonopodis pv. Citri biofilm through proteomics

    KAUST Repository

    Zimaro, Tamara


    Background: Xanthomonas axonopodis pv. Citri (X. a. pv. Citri) causes citrus canker that can result in defoliation and premature fruit drop with significant production losses worldwide. Biofilm formation is an important process in bacterial pathogens and several lines of evidence suggest that in X. a. pv. Citri this process is a requirement to achieve maximal virulence since it has a major role in host interactions. In this study, proteomics was used to gain further insights into the functions of biofilms. Results: In order to identify differentially expressed proteins, a comparative proteomic study using 2D difference gel electrophoresis was carried out on X. a. pv. Citri mature biofilm and planktonic cells. The biofilm proteome showed major variations in the composition of outer membrane proteins and receptor or transport proteins. Among them, several porins and TonB-dependent receptor were differentially regulated in the biofilm compared to the planktonic cells, indicating that these proteins may serve in maintaining specific membrane-associated functions including signaling and cellular homeostasis. In biofilms, UDP-glucose dehydrogenase with a major role in exopolysaccharide production and the non-fimbrial adhesin YapH involved in adherence were over-expressed, while a polynucleotide phosphorylase that was demonstrated to negatively control biofilm formation in E. coli was down-regulated. In addition, several proteins involved in protein synthesis, folding and stabilization were up-regulated in biofilms. Interestingly, some proteins related to energy production, such as ATP-synthase were down-regulated in biofilms. Moreover, a number of enzymes of the tricarboxylic acid cycle were differentially expressed. In addition, X. a. pv. Citri biofilms also showed down-regulation of several antioxidant enzymes. The respective gene expression patterns of several identified proteins in both X. a. pv. Citri mature biofilm and planktonic cells were evaluated by

  17. Improved Biofilm Antimicrobial Activity of Polyethylene Glycol Conjugated Tobramycin Compared to Tobramycin in Pseudomonas aeruginosa Biofilms. (United States)

    Du, Ju; Bandara, H M H N; Du, Ping; Huang, Hui; Hoang, Khang; Nguyen, Dang; Mogarala, Sri Vasudha; Smyth, Hugh D C


    The objective of this study was to develop a functionally enhanced antibiotic that would improve the therapeutic activity against bacterial biofilms. Tobramycin was chemically conjugated with polyethylene glycol (PEG) via site-specific conjugation to form PEGylated-tobramycin (Tob-PEG). The antibacterial efficacy of Tob-PEG, as compared to tobramycin, was assessed on the planktonic phase and biofilms phase of Pseudomonas aeruginosa. The minimum inhibitory concentration (MIC80) of Tob-PEG was higher (13.9 μmol/L) than that of tobramycin (1.4 μmol/L) in the planktonic phases. In contrast, the Tob-PEG was approximately 3.2-fold more effective in eliminating bacterial biofilms than tobramycin. Specifically, Tob-PEG had a MIC80 lower than those exhibited by tobramycin (27.8 μmol/L vs 89.8 μmol/L). Both confocal laser scanning microscopy and scanning electron microscopy further confirmed these data. Thus, modification of antimicrobials by PEGylation appears to be a promising approach for overcoming the bacterial resistance in the established biofilms of Pseudomonas aeruginosa.

  18. Biofilms for Babies: Introducing Microbes and Biofilms to Preschool-Aged Children

    Directory of Open Access Journals (Sweden)

    Jillian M. Couto


    Full Text Available Microbes are beneficial to life on our planet as they facilitate natural processes such as global nutrient cycling in our environment. This article details a 30-minute activity to introduce pre-school children ranging from 3 to 5 years of age to microbes and biofilms in the natural environment.

  19. Phosphorus removal using a microalgal biofilm in a new biofilm photobioreactor for tertiary wastewater treatment

    Czech Academy of Sciences Publication Activity Database

    Sukačová, Kateřina; Trtílek, M.; Rataj, Tomáš


    Roč. 75, mar (2015), s. 55-63 ISSN 0043-1354 R&D Projects: GA MŠk(CZ) ED1.1.00/02.0073 Institutional support: RVO:67179843 Keywords : microalgal biofilm * phosphorus removal * wastewater treatment Subject RIV: EH - Ecology, Behaviour Impact factor: 5.991, year: 2015

  20. Identification of biofilm-associated cluster (bac in Pseudomonas aeruginosa involved in biofilm formation and virulence.

    Directory of Open Access Journals (Sweden)

    Camille Macé

    Full Text Available Biofilms are prevalent in diseases caused by Pseudomonas aeruginosa, an opportunistic and nosocomial pathogen. By a proteomic approach, we previously identified a hypothetical protein of P. aeruginosa (coded by the gene pA3731 that was accumulated by biofilm cells. We report here that a Delta pA3731 mutant is highly biofilm-defective as compared with the wild-type strain. Using a mouse model of lung infection, we show that the mutation also induces a defect in bacterial growth during the acute phase of infection and an attenuation of the virulence. The pA3731 gene is found to control positively the ability to swarm and to produce extracellular rhamnolipids, and belongs to a cluster of 4 genes (pA3729-pA3732 not previously described in P. aeruginosa. Though the protein PA3731 has a predicted secondary structure similar to that of the Phage Shock Protein, some obvious differences are observed compared to already described psp systems, e.g., this unknown cluster is monocistronic and no homology is found between the other proteins constituting this locus and psp proteins. As E. coli PspA, the amount of the protein PA3731 is enlarged by an osmotic shock, however, not affected by a heat shock. We consequently named this locus bac for biofilm-associated cluster.

  1. Shell biofilm-associated nitrous oxide production in marine molluscs

    DEFF Research Database (Denmark)

    Heisterkamp, I.M.; Schramm, Andreas; Larsen, Lone Heimann


    Emission of the greenhouse gas nitrous oxide (N2O) from freshwater and terrestrial invertebrates has exclusively been ascribed to N2O production by ingested denitrifying bacteria in the anoxic gut of the animals. Our study of marine molluscs now shows that also microbial biofilms on shell surfaces...... are important sites of N2O production. The shell biofilms of Mytilus edulis, Littorina littorea and Hinia reticulata contributed 18-94% to the total animal-associated N2O emission. Nitrification and denitrification were equally important sources of N2O in shell biofilms as revealed by 15N-stable isotope...... mollusc species. Ammonium excretion by the animals was found to be sufficient to sustain N2O production in the shell biofilm. Apparently, the animals provide a nutrient-enriched microenvironment that stimulates growth and N2O production of the shell biofilm. This animal-induced stimulation...

  2. Functional bacterial amyloid increases Pseudomonas biofilm hydrophobicity and stiffness

    DEFF Research Database (Denmark)

    Zeng, Guanghong; Vad, Brian S; Dueholm, Morten S


    The success of Pseudomonas species as opportunistic pathogens derives in great part from their ability to form stable biofilms that offer protection against chemical and mechanical attack. The extracellular matrix of biofilms contains numerous biomolecules, and it has recently been discovered...... that in Pseudomonas one of the components includes β-sheet rich amyloid fibrils (functional amyloid) produced by the fap operon. However, the role of the functional amyloid within the biofilm has not yet been investigated in detail. Here we investigate how the fap-based amyloid produced by Pseudomonas affects biofilm...... hydrophobicity and mechanical properties. Using atomic force microscopy imaging and force spectroscopy, we show that the amyloid renders individual cells more resistant to drying and alters their interactions with hydrophobic probes. Importantly, amyloid makes Pseudomonas more hydrophobic and increases biofilm...

  3. Extracellular DNA Shields against Aminoglycosides in Pseudomonas aeruginosa Biofilms

    DEFF Research Database (Denmark)

    Chiang, Wen-Chi; Nilsson, Martin; Jensen, Peter Østrup


    Within recent years, it has been established that extracellular DNA is a key constituent of the matrix of microbial biofilms. In addition, it has recently been demonstrated that DNA binds positively charged antimicrobials such as aminoglycosides and antimicrobial peptides. In the present study, we...... provide evidence that extracellular DNA shields against aminoglycosides in Pseudomonas aeruginosa biofilms. We show that exogenously supplemented DNA integrates into P. aeruginosa biofilms and increases their tolerance toward aminoglycosides. We provide evidence that biofilms formed by a DNA release......-deficient P. aeruginosa quorum-sensing mutant are more susceptible to aminoglycoside treatment than wild-type biofilms but become rescued from the detrimental action of aminoglycosides upon supplementation with exogenous DNA. Furthermore, we demonstrate that exposure to lysed polymorphonuclear leukocytes...

  4. How deep can plasma penetrate into a biofilm? (United States)

    Xiong, Z.; Du, T.; Lu, X.; Cao, Y.; Pan, Y.


    It is well known that plasma can deactivate various types of microorganisms. However, one fundamental key question has never been addressed, namely, how deep can plasma penetrate into multilayer biofilms. In this letter, Porphyromonas gingivalis (PG) biofilms (10 days growth, which has about 30 layers of PG cells with a thickness of about 15 μm) are treated with a cold plasma plume. It is found that the plasma can penetrate the biofilms and effectively deactivate all the bacteria in the 15 μm thick biofilms. Moreover, it was found that most of the dead cells' structures in the biofilms are not damaged. From the optical emission spectra of the plasma, it can be concluded that it is O and OH, rather than O2-, N2+, or UV emission that play the major role in the deactivation processes.

  5. Mathematical Modeling of Biofilm Structures Using COMSTAT Data

    DEFF Research Database (Denmark)

    Verotta, Davide; Haagensen, Janus Anders Juul; Spormann, Alfred M.


    Mathematical modeling holds great potential for quantitatively describing biofilm growth in presence or absence of chemical agents used to limit or promote biofilm growth. In this paper, we describe a general mathematical/statistical framework that allows for the characterization of complex data...... in terms of few parameters and the capability to (i) compare different experiments and exposures to different agents, (ii) test different hypotheses regarding biofilm growth and interaction with different agents, and (iii) simulate arbitrary administrations of agents. The mathematical framework is divided...... to submodels characterizing biofilm, including new models characterizing live biofilm growth and dead cell accumulation; the interaction with agents inhibiting or stimulating growth; the kinetics of the agents. The statistical framework can take into account measurement and interexperiment variation. We...

  6. Mathematical Modeling of Biofilm Structures Using COMSTAT Data

    Directory of Open Access Journals (Sweden)

    Davide Verotta


    Full Text Available Mathematical modeling holds great potential for quantitatively describing biofilm growth in presence or absence of chemical agents used to limit or promote biofilm growth. In this paper, we describe a general mathematical/statistical framework that allows for the characterization of complex data in terms of few parameters and the capability to (i compare different experiments and exposures to different agents, (ii test different hypotheses regarding biofilm growth and interaction with different agents, and (iii simulate arbitrary administrations of agents. The mathematical framework is divided to submodels characterizing biofilm, including new models characterizing live biofilm growth and dead cell accumulation; the interaction with agents inhibiting or stimulating growth; the kinetics of the agents. The statistical framework can take into account measurement and interexperiment variation. We demonstrate the application of (some of the models using confocal microscopy data obtained using the computer program COMSTAT.

  7. Species-independent attraction to biofilms through electrical signaling (United States)

    Humphries, Jacqueline; Xiong, Liyang; Liu, Jintao; Prindle, Arthur; Yuan, Fang; Arjes, Heidi A.; Tsimring, Lev; Süel, Gürol M.


    Summary Bacteria residing within biofilm communities can coordinate their behavior through cell-to-cell signaling. However, it remains unclear if these signals can also influence the behavior of distant cells that are not part of the community. Using a microfluidic approach, we find that potassium ion channel-mediated electrical signaling generated by a Bacillus subtilis biofilm can attract distant cells. Integration of experiments and mathematical modeling indicates that extracellular potassium emitted from the biofilm alters the membrane potential of distant cells, thereby directing their motility. This electrically-mediated attraction appears to be a generic mechanism that enables cross-species interactions, as Pseudomonas aeruginosa cells also become attracted to the electrical signal released by the B. subtilis biofilm. Cells within a biofilm community can thus not only coordinate their own behavior, but also influence the behavior of diverse bacteria at a distance through long-range electrical signaling. PMID:28086091

  8. Nanoparticles for Control of Biofilms of Acinetobacter Species

    Directory of Open Access Journals (Sweden)

    Richa Singh


    Full Text Available Biofilms are the cause of 80% of microbial infections. Acinetobacter species have emerged as multi- and pan-drug-resistant bacteria and pose a great threat to human health. These act as nosocomial pathogens and form excellent biofilms, both on biotic and abiotic surfaces, leading to severe infections and diseases. Various methods have been developed for treatment and control of Acinetobacter biofilm including photodynamic therapy, radioimmunotherapy, prophylactic vaccines and antimicrobial peptides. Nanotechnology, in the present scenario, offers a promising alternative. Nanomaterials possess unique properties, and multiple bactericidal mechanisms render them more effective than conventional drugs. This review intends to provide an overview of Acinetobacter biofilm and the significant role of various nanoparticles as anti-biofouling agents, surface-coating materials and drug-delivery vehicles for biofilm control and treatment of Acinetobacter infections.

  9. Role of Extracellular DNA during Biofilm Formation by Listeria monocytogenes

    DEFF Research Database (Denmark)

    Harmsen, Morten; Lappann, Martin; Knøchel, S


    (eDNA) may be the only central component of the biofilm matrix and that it is necessary for both initial attachment and early biofilm formation for 41 L. monocytogenes strains that were tested. DNase I treatment resulted in dispersal of biofilms, not only in microtiter tray assays but also in flow......Listeria monocytogenes is a food-borne pathogen that is capable of living in harsh environments. It is believed to do this by forming biofilms, which are surface-associated multicellular structures encased in a self-produced matrix. In this paper we show that in L. monocytogenes extracellular DNA...... cell biofilm assays. However, it was also demonstrated that in a culture without eDNA, neither Listeria genomic DNA nor salmon sperm DNA by itself could restore the capacity to adhere. A search for additional necessary components revealed that peptidoglycan (PG), specifically N-acetylglucosamine (NAG...

  10. Blocking of bacterial biofilm formation by a fish protein coating

    DEFF Research Database (Denmark)

    Vejborg, Rebecca Munk; Klemm, Per


    Bacterial biofilm formation on inert surfaces is a significant health and economic problem in a wide range of environmental, industrial, and medical areas. Bacterial adhesion is generally a prerequisite for this colonization process and, thus, represents an attractive target for the development......, this proteinaceous coating is characterized with regards to its biofilm-reducing properties by using a range of urinary tract infectious isolates with various pathogenic and adhesive properties. The antiadhesive coating significantly reduced or delayed biofilm formation by all these isolates under every condition...... examined. The biofilm-reducing activity did, however, vary depending on the substratum physicochemical characteristics and the environmental conditions studied. These data illustrate the importance of protein conditioning layers with respect to bacterial biofilm formation and suggest that antiadhesive...

  11. Organic compounds inhibiting S. epidermidis adhesion and biofilm formation

    DEFF Research Database (Denmark)

    Qin, Zhiqiang; Zhang, Jingdong; Hu, Yifan


    The formation of biofilms on surfaces of indwelling medical devices is a serious medical problem. Staphylococcus epidermidis is a common pathogen found to colonize implanted devices and as a biofilm is more resistant to the host immune system as well as to antibiotic treatments. Combating S....... epidermidis infections by preventing or eradicating biofilm formation of the bacterium is therefore a medically important challenge. We report here a study of biofilm formation of S. epidermidis on solid surfaces using a combination of confocal laser scanning (CLSM) and atomic force microscopy (AFM) in both...... air and aqueous environments. We have investigated the inhibitory effects of surfaces treated with four organic compounds, two benzoate derivatives denoted as compound 59 and 75 and two carboxamicle derivatives denoted as compound 47 and 73, on S. epidermidis adhesion and biofilm formation. All four...

  12. Effects of ginseng on Pseudomonas aeruginosa motility and biofilm formation

    DEFF Research Database (Denmark)

    Wu, Hong; Lee, Baoleri; Yang, Liang


    protected animal models from developing chronic lung infection by P. aeruginosa. In the present study, the effects of ginseng on the formation of P. aeruginosa biofilms were further investigated in vitro and in vivo. Ginseng aqueous extract at concentrations of 0.5-2.0% did not inhibit the growth of P......Biofilm-associated chronic Pseudomonas aeruginosa lung infections in patients with cystic fibrosis are virtually impossible to eradicate with antibiotics because biofilm-growing bacteria are highly tolerant to antibiotics and host defense mechanisms. Previously, we found that ginseng treatments....... aeruginosa, but significantly prevented P. aeruginosa from forming biofilm. Exposure to 0.5% ginseng aqueous extract for 24 h destroyed most 7-day-old mature biofilms formed by both mucoid and nonmucoid P. aeruginosa strains. Ginseng treatment enhanced swimming and twitching motility, but reduced swarming...

  13. Biofilm Forming Lactobacillus: New Challenges for the Development of Probiotics

    Directory of Open Access Journals (Sweden)

    María José Salas-Jara


    Full Text Available Probiotics are live bacteria, generally administered in food, conferring beneficial effects to the host because they help to prevent or treat diseases, the majority of which are gastrointestinal. Numerous investigations have verified the beneficial effect of probiotic strains in biofilm form, including increased resistance to temperature, gastric pH and mechanical forces to that of their planktonic counterparts. In addition, the development of new encapsulation technologies, which have exploited the properties of biofilms in the creation of double coated capsules, has given origin to fourth generation probiotics. Up to now, reviews have focused on the detrimental effects of biofilms associated with pathogenic bacteria. Therefore, this work aims to amalgamate information describing the biofilms of Lactobacillus strains which are used as probiotics, particularly L. rhamnosus, L. plantarum, L. reuteri, and L. fermentum. Additionally, we have reviewed the development of probiotics using technology inspired by biofilms.

  14. Difference in initial dental biofilm accumulation between night and day

    DEFF Research Database (Denmark)

    Dige, Irene; Schlafer, Sebastian; Nyvad, Bente


    formed during day and night. We hypothesised that there is a diurnal variation in the rate of accumulation of bacteria on solid surfaces in the oral cavity. Material and methods. In situ biofilm from healthy individuals was collected for 12 h during day and night, respectively, subjected to fluorescent......Objective. The study of initial microbial colonization on dental surfaces is a field of intensive research because of the aetiological role of biofilms in oral diseases. Most previous studies of de novo accumulation and composition of dental biofilms in vivo do not differentiate between biofilms...... in situ hybridization, and visualized using confocal laser scanning microscopy. Results. Analysis of the biofilms using stereological methods and digital image analysis revealed a consistent statistically significant difference between both the total number of bacteria and the biovolume in the two 12-h...

  15. Involvement of NADH Oxidase in Biofilm Formation in Streptococcus sanguinis.

    Directory of Open Access Journals (Sweden)

    Xiuchun Ge

    Full Text Available Biofilms play important roles in microbial communities and are related to infectious diseases. Here, we report direct evidence that a bacterial nox gene encoding NADH oxidase is involved in biofilm formation. A dramatic reduction in biofilm formation was observed in a Streptococcus sanguinis nox mutant under anaerobic conditions without any decrease in growth. The membrane fluidity of the mutant bacterial cells was found to be decreased and the fatty acid composition altered, with increased palmitic acid and decreased stearic acid and vaccenic acid. Extracellular DNA of the mutant was reduced in abundance and bacterial competence was suppressed. Gene expression analysis in the mutant identified two genes with altered expression, gtfP and Idh, which were found to be related to biofilm formation through examination of their deletion mutants. NADH oxidase-related metabolic pathways were analyzed, further clarifying the function of this enzyme in biofilm formation.

  16. Cold Plasmas for Biofilm Control: Opportunities and Challenges. (United States)

    Gilmore, Brendan F; Flynn, Padrig B; O'Brien, Séamus; Hickok, Noreen; Freeman, Theresa; Bourke, Paula


    Bacterial biofilm infections account for a major proportion of chronic and medical device associated infections in humans, yet our ability to control them is compromised by their inherent tolerance to antimicrobial agents. Cold atmospheric plasma (CAP) represents a promising therapeutic option. CAP treatment of microbial biofilms represents the convergence of two complex phenomena: the production of a chemically diverse mixture of reactive species and intermediates, and their interaction with a heterogeneous 3D interface created by the biofilm extracellular polymeric matrix. Therefore, understanding these interactions and physiological responses to CAP exposure are central to effective management of infectious biofilms. We review the unique opportunities and challenges for translating CAP to the management of biofilms. Copyright © 2018. Published by Elsevier Ltd.

  17. Strategies for prevention and treatment of staphylococcal biofilms

    DEFF Research Database (Denmark)

    Meyer, Rikke Louise

    Biofilm formation by bacteria that colonize biomedical implants cause infections that cannot be eradicated by antibiotic therapy. Bacteria in biofilms are tolerant to every antibiotic known today, and this tolerance is partly due to their low metabolic activity, the occurrence of persister cells...... in biofilms. Innovative biomaterials may at best delay biofilm formation and an important question in this context is to understand how the material can contribute to more successful antibiotic treatment by not providing the cues that trigger the onset of antibiotic tolerance in the attached bacteria...... treatments that more effectively tackle biofilm infections. We have explored how the combination of antibiotic therapy with matrix-targeting enzymes can enhance the efficacy of antibiotics. The matrix composition is highly variable among different bacterial species, and this strategy will not produce a one...

  18. Computational approaches to standard-compliant biofilm data for reliable analysis and integration

    Directory of Open Access Journals (Sweden)

    Sousa Ana Margarida


    Full Text Available The study of microorganism consortia, also known as biofilms, is associated to a number of applications in biotechnology, ecotechnology and clinical domains. Nowadays, biofilm studies are heterogeneous and data-intensive, encompassing different levels of analysis. Computational modelling of biofilm studies has become thus a requirement to make sense of these vast and ever-expanding biofilm data volumes.

  19. Clinical Infectious Outcomes Associated with Biofilm-related Infections: a Retrospective Chart Review (United States)


    infectious outcomes. Methods: 221 clinical isolates collected from 2005 to 2012 and previously characterized for biofilm formation were studied. Clinical...chronic infection on multivariate analysis. Conclusions: Bacteria species, but not clinical characteristics, were associated with biofilm formation on...the implication of biofilms in a majority of human infections [2]. Biofilm formation also has been linked with poor wound healing [3], burn wound

  20. Fate of deposited cells in an aerobic binary bacterial biofilm

    International Nuclear Information System (INIS)

    Banks, M.K.


    A biofilm is a matrix of microbial cells and their extracellular products that is associated with a solid surface. Previous studies on biofilm development have employed only dissolved compounds as growth limiting substrates, without the influence of microbial species invading from the bulk liquid. The goal of this research project was to quantify the kinetics of processes governing suspended biomass turnover in biofilm systems, and the accompanying effects of suspended cell deposition on biofilm population dynamics. Experiments were conducted with two species of bacteria, Pseudomonas putida ATCC 11172 grown on glucose, and Hyphomicrobium ZV620 grown on methanol. Cryptic growth and particulate hydrolysis studies were evaluated, using combinations of these two bacteria, by measuring the uptake of radiolabelled cell lysis products, under batch conditions. Biofilms studies were performed to investigate bacterial deposition, continual biofilm removal by shear induced erosion, and biofilm ecology. Biofilms were developed in a flow cell reactor, under laminar flow conditions. Bacterial species were differentiated by radioactively labelling each species with their carbon substrate. A mathematical model was developed to predict the biofilm ecology of mixed cultures. The equations developed predict biofilm accumulation, as well as substrate and oxygen consumption. Results indicate that cryptic growth will occur for bacteria growing on their own species soluble lysis products and in some cases, bacteria growing on the soluble lysis products of other species. Particulate hydrolysis only occurred for Pseudomonas putida growing on Pseudomonas putida lysis products, but the lack of particulate hydrolysis occurring in the other studies may have been due to the short experimental period

  1. Effect of fluoride and chlorhexidine digluconate mouthrinses on plaque biofilms. (United States)

    Rabe, Per; Twetman, Svante; Kinnby, Bertil; Svensäter, Gunnel; Davies, Julia R


    To develop a model in which to investigate the architecture of plaque biofilms formed on enamel surfaces in vivo and to compare the effects of anti-microbial agents of relevance for caries on biofilm vitality. Materials and Methodology : Enamel discs mounted on healing abutments in the pre-molar region were worn by three subjects for 7 days. Control discs were removed before subjects rinsed with 0.1% chlorhexidine digluconate (CHX) or 0.2% sodium fluoride (NaF) for 1 minute. Biofilms were stained with Baclight Live/Dead and z-stacks of images created using confocal scanning laser micoscopy. The levels of vital and dead/damaged bacteria in the biofilms, assessed as the proportion of green and red pixels respectively, were analysed using ImageTrak(®) software. Results : The subjects showed individual differences in biofilm architecture. The thickness of the biofilms varied from 28-96µm although cell density was always the greatest in the middle layers. In control biofilms, the overall levels of vitality were high (71-98%) especially in the area closest to the enamel interface. Rinsing with either CHX or NaF caused a similar reduction in overall vitality. CHX exerted an effect throughout the biofilm, particularly on the surface of cell clusters whereas NaF caused cell damage/death mainly in the middle to lower biofilm layers. Conclusion : We describe a model that allows the formation of mature, undisturbed oral biofilms on human enamel surfaces in vivo and show that CHX and NaF have a similar effect on overall vitality but differ in their sites of action.

  2. Impact of early colonizers on in vitro subgingival biofilm formation.

    Directory of Open Access Journals (Sweden)

    Thomas W Ammann

    Full Text Available The aim of this study was to investigate the impact of early colonizing species on the structure and the composition of the bacterial community developing in a subgingival 10-species biofilm model system. The model included Streptococcus oralis, Streptococcus anginosus, Actinomycesoris, Fusobacterium nucleatum subsp. nucleatum, Veillonella dispar, Campylobacter rectus, Prevotella intermedia, Porphyromonas gingivalis, Tannerella forsythia, and Treponema denticola. Based on literature, we considered Streptococcus oralis, Streptococcus anginosus, and Actinomyces oris as early colonizers and examined their role in the biofilms by either a delayed addition to the consortium, or by not inoculating at all the biofilms with these species. We quantitatively evaluated the resulting biofilms by real-time quantitative PCR and further compared the structures using confocal laser scanning microscopy following fluorescence in situ hybridisation. The absence of the early colonizers did not hinder biofilm formation. The biofilms reached the same total counts and developed to normal thickness. However, quantitative shifts in the abundances of individual species were observed. In the absence of streptococci, the overall biofilm structure appeared looser and more dispersed. Moreover, besides a significant increase of P. intermedia and a decrease of P. gingivalis , P. intermedia appeared to form filamented long chains that resembled streptococci. A. oris, although growing to significantly higher abundance in absence of streptococci, did not have a visible impact on the biofilms. Hence, in the absence of the early colonizers, there is a pronounced effect on P. intermedia and P. gingivalis that may cause distinct shifts in the structure of the biofilm. Streptococci possibly facilitate the establishment of P. gingivalis into subgingival biofilms, while in their absence P. intermedia became more dominant and forms elongated chains.

  3. Surface proteins and the formation of biofilms by Staphylococcus aureus. (United States)

    Kim, Sung Joon; Chang, James; Rimal, Binayak; Yang, Hao; Schaefer, Jacob


    Staphylococcus aureus biofilms pose a serious clinical threat as reservoirs for persistent infections. Despite this clinical significance, the composition and mechanism of formation of S. aureus biofilms are unknown. To address these problems, we used solid-state NMR to examine S. aureus (SA113), a strong biofilm-forming strain. We labeled whole cells and cell walls of planktonic cells, young biofilms formed for 12-24h after stationary phase, and more mature biofilms formed for up to 60h after stationary phase. All samples were labeled either by (i) [ 15 N]glycine and l-[1- 13 C]threonine, or in separate experiments, by (ii) l-[2- 13 C, 15 N]leucine. We then measured 13 C- 15 N direct bonds by C{N} rotational-echo double resonance (REDOR). The increase in peptidoglycan stems that have bridges connected to a surface protein was determined directly by a cell-wall double difference (biofilm REDOR difference minus planktonic REDOR difference). This procedure eliminates errors arising from differences in 15 N isotopic enrichments and from the routing of 13 C label from threonine degradation to glycine. For both planktonic cells and the mature biofilm, 20% of pentaglycyl bridges are not cross-linked and are potential surface-protein attachment sites. None of these sites has a surface protein attached in the planktonic cells, but one-fourth have a surface protein attached in the mature biofilm. Moreover, the leucine-label shows that the concentration of β-strands in leucine-rich regions doubles in the mature biofilm. Thus, a primary event in establishing a S. aureus biofilm is extensive decoration of the cell surface with surface proteins that are linked covalently to the cell wall and promote cell-cell adhesion. Copyright © 2017 Elsevier B.V. All rights reserved.

  4. Assembly and development of the Pseudomonas aeruginosa biofilm matrix.

    Directory of Open Access Journals (Sweden)

    Luyan Ma


    Full Text Available Virtually all cells living in multicellular structures such as tissues and organs are encased in an extracellular matrix. One of the most important features of a biofilm is the extracellular polymeric substance that functions as a matrix, holding bacterial cells together. Yet very little is known about how the matrix forms or how matrix components encase bacteria during biofilm development. Pseudomonas aeruginosa forms environmentally and clinically relevant biofilms and is a paradigm organism for the study of biofilms. The extracellular polymeric substance of P. aeruginosa biofilms is an ill-defined mix of polysaccharides, nucleic acids, and proteins. Here, we directly visualize the product of the polysaccharide synthesis locus (Psl exopolysaccharide at different stages of biofilm development. During attachment, Psl is anchored on the cell surface in a helical pattern. This promotes cell-cell interactions and assembly of a matrix, which holds bacteria in the biofilm and on the surface. Chemical dissociation of Psl from the bacterial surface disrupted the Psl matrix as well as the biofilm structure. During biofilm maturation, Psl accumulates on the periphery of 3-D-structured microcolonies, resulting in a Psl matrix-free cavity in the microcolony center. At the dispersion stage, swimming cells appear in this matrix cavity. Dead cells and extracellular DNA (eDNA are also concentrated in the Psl matrix-free area. Deletion of genes that control cell death and autolysis affects the formation of the matrix cavity and microcolony dispersion. These data provide a mechanism for how P. aeruginosa builds a matrix and subsequently a cavity to free a portion of cells for seeding dispersal. Direct visualization reveals that Psl is a key scaffolding matrix component and opens up avenues for therapeutics of biofilm-related complications.

  5. Effect of antibacterial dental adhesive on multispecies biofilms formation. (United States)

    Zhang, K; Wang, S; Zhou, X; Xu, H H K; Weir, M D; Ge, Y; Li, M; Wang, S; Li, Y; Xu, X; Zheng, L; Cheng, L


    Antibacterial adhesives have favorable prospects to inhibit biofilms and secondary caries. The objectives of this study were to investigate the antibacterial effect of dental adhesives containing dimethylaminododecyl methacrylate (DMADDM) on different bacteria in controlled multispecies biofilms and its regulating effect on development of biofilm for the first time. Antibacterial material was synthesized, and Streptococcus mutans, Streptococcus gordonii, and Streptococcus sanguinis were chosen to form multispecies biofilms. Lactic acid assay and pH measurement were conducted to study the acid production of controlled multispecies biofilms. Anthrone method and exopolysaccharide (EPS):bacteria volume ratio measured by confocal laser scanning microscopy were performed to determine the EPS production of biofilms. The colony-forming unit counts, scanning electron microscope imaging, and dead:live volume ratio decided by confocal laser scanning microscopy were used to study the biomass change of controlled multispecies biofilms. The TaqMan real-time polymerase chain reaction and fluorescent in situ hybridization imaging were used to study the proportion change in multispecies biofilms of different groups. The results showed that DMADDM-containing adhesive groups slowed the pH drop and decreased the lactic acid production noticeably, especially lactic acid production in the 5% DMADDM group, which decreased 10- to 30-fold compared with control group (P biofilms compared with control group (P biofilm had a more healthy development tendency after the regulation of DMADDM. In conclusion, the adhesives containing DMADDM had remarkable antimicrobial properties to serve as "bioactive" adhesive materials and revealed its potential value for antibiofilm and anticaries clinical applications. © International & American Associations for Dental Research 2015.

  6. Application of two component biodegradable carriers in a particle-fixed biofilm airlift suspension reactor: development and structure of biofilms. (United States)

    Hille, Andrea; He, Mei; Ochmann, Clemens; Neu, Thomas R; Horn, Harald


    Two component biodegradable carriers for biofilm airlift suspension (BAS) reactors were investigated with respect to development of biofilm structure and oxygen transport inside the biofilm. The carriers were composed of PHB (polyhydroxybutyrate), which is easily degradable and PCL (caprolactone), which is less easily degradable by heterotrophic microorganisms. Cryosectioning combined with classical light microscopy and CLSM was used to identify the surface structure of the carrier material over a period of 250 days of biofilm cultivation in an airlift reactor. Pores of 50 to several hundred micrometers depth are formed due to the preferred degradation of PHB. Furthermore, microelectrode studies show the transport mechanism for different types of biofilm structures, which were generated under different substrate conditions. At high loading rates, the growth of a rather loosely structured biofilm with high penetration depths of oxygen was found. Strong changes of substrate concentration during fed-batch mode operation of the reactor enhance the growth of filamentous biofilms on the carriers. Mass transport in the outer regions of such biofilms was mainly driven by advection.

  7. Towards Biofilm Spectroscopy - A Novel Microfluidic Approach for Characterizing Biofilm Subpopulation by Microwave-Based Electrical Impedance Spectroscopy (United States)

    Richter, Christiane; Schneider, Stefan; Rapp, Bastian E.; Schmidt, Sönke; Schüßler, Martin; Jakoby, Rolf; Bruchmann, Julia; Bischer, Moritz; Schwartz, Thomas


    In this work three disciplines - microfluidics, microbiology and microwave engineering - are utilized to develop a system for analyzing subpopulations of biofilms and their reaction to antibiotic treatment. We present handling strategies to destabilize a biofilm inside a microfluidic system down to aggregate sizes ofbiofilm effects.

  8. Pseudomonas aeruginosa forms Biofilms in Acute InfectionIndependent of Cell-to-Cell Signaling

    Energy Technology Data Exchange (ETDEWEB)

    Schaber, J. Andy; Triffo, W.J.; Suh, Sang J.; Oliver, Jeffrey W.; Hastert, Mary C.; Griswold, John A.; Auer, Manfred; Hamood, Abdul N.; Rumbaugh, Kendra P.


    Biofilms are bacterial communities residing within a polysaccharide matrix that are associated with persistence and antibiotic resistance in chronic infections. We show that the opportunistic pathogen Pseudomonas aeruginosa forms biofilms within 8 hours of infection in thermally-injured mice, demonstrating that biofilms contribute to bacterial colonization in acute infections. P. aeruginosa biofilms were visualized within burned tissue surrounding blood vessels and adipose cells. Although quorum sensing (QS), a bacterial signaling mechanism, coordinates differentiation of biofilms in vitro, wild type and QS-deficient P. aeruginosa formed similar biofilms in vivo. Our findings demonstrate that P. aeruginosa forms biofilms on specific host tissues independent of QS.

  9. Biofilms and Oxidizing Biocides; Evaluation of Disinfection and Removal Effects by Using Established Microbial Systems. (United States)

    Tachikawa, Mariko


    The formation of bacterial biofilms and their disinfection and removal have been important subjects in the maintenance of water quality in areas such as public spas, swimming pools, food processing lines, industrial water systems, and in the hygienic control of medical devices, hospital procedures, etc. Presented here is an outline of biofilm formation, as well as studies on the disinfection and removal of biofilms by oxidizing biocides using established biofilms. These studies using established biofilms may increase the understanding of the variable response of biofilms to planktonic bacteria, and the unique aspects of oxidizing biocides in the disinfection and removal of biofilms.

  10. Residual structure of Streptococcus mutans biofilm following complete disinfection favors secondary bacterial adhesion and biofilm re-development.

    Directory of Open Access Journals (Sweden)

    Tatsuya Ohsumi

    Full Text Available Chemical disinfection of oral biofilms often leaves biofilm structures intact. This study aimed to examine whether the residual structure promotes secondary bacterial adhesion. Streptococcus mutans biofilms generated on resin-composite disks in a rotating disc reactor were disinfected completely with 70% isopropyl alcohol, and were again cultured in the same reactor after resupplying with the same bacterial solution. Specimens were subjected to fluorescence confocal laser scanning microscopy, viable cell counts and PCR-Invader assay in order to observe and quantify secondarily adhered cells. Fluorescence microscopic analysis, particularly after longitudinal cryosectioning, demonstrated stratified patterns of viable cells on the disinfected biofilm structure. Viable cell counts of test specimens were significantly higher than those of controls, and increased according to the amount of residual structure and culture period. Linear regression analysis exhibited a high correlation between viable and total cell counts. It was concluded that disinfected biofilm structures favored secondary bacterial adhesion.

  11. Distinct roles of extracellular polymeric substances in Pseudomonas aeruginosa biofilm development

    DEFF Research Database (Denmark)

    Yang, Liang; Hu, Yifan; Liu, Yang


    Bacteria form surface attached biofilm communities as one of the most important survival strategies in nature. Biofilms consist of water, bacterial cells and a wide range of self‐generated extracellular polymeric substances (EPS). Biofilm formation is a dynamic self‐assembly process and several d...... polysaccharide is more important than Pel polysaccharide in P. aeruginosa PAO1 biofilm formation and antibiotic resistance. Our study thus suggests that different EPS materials play distinct roles during bacterial biofilm formation.......Bacteria form surface attached biofilm communities as one of the most important survival strategies in nature. Biofilms consist of water, bacterial cells and a wide range of self‐generated extracellular polymeric substances (EPS). Biofilm formation is a dynamic self‐assembly process and several...... distinguishable stages are observed during bacterial biofilm development. Biofilm formation is shown to be coordinated by EPS production, cell migration, subpopulation differentiation and interactions. However, the ways these different factors affect each other and contribute to community structural...

  12. Capillary isoelectric focusing--useful tool for detection of the biofilm formation in Staphylococcus epidermidis. (United States)

    Ruzicka, Filip; Horka, Marie; Hola, Veronika; Votava, Miroslav


    The biofilm formation is an important factor of S. epidermidis virulence. Biofilm-positive strains might be clinically more important than biofilm-negative ones. Unlike biofilm-negative staphylococci, biofilm-positive staphylococci are surrounded with an extracellular polysaccharide substance. The presence of this substance on the surface can affect physico-chemical properties of the bacterial cell, including surface charge. 73 S. epidermidis strains were examined for the presence of ica operon, for the ability to form biofilm by Christensen test tube method and for the production of slime by Congo red agar method. Isoelectric points (pI) of these strains were determined by means of Capillary Isoelectric Focusing. The biofilm negative strains focused near pI value 2.3, while the pI values of the biofilm positive strains were near 2.6. Isoelectric point is a useful criterion for the differentiation between biofilm-positive and biofilm-negative S. epidermidis strains.

  13. Bioprinting Living Biofilms through Optogenetic Manipulation. (United States)

    Huang, Yajia; Xia, Aiguo; Yang, Guang; Jin, Fan


    In this paper, we present a new strategy for microprinting dense bacterial communities with a prescribed organization on a substrate. Unlike conventional bioprinting techniques that require bioinks, through optogenetic manipulation, we directly manipulated the behaviors of Pseudomonas aeruginosa to allow these living bacteria to autonomically form patterned biofilms following prescribed illumination. The results showed that through optogenetic manipulation, patterned bacterial communities with high spatial resolution (approximately 10 μm) could be constructed in 6 h. Thus, optogenetic manipulation greatly increases the range of available bioprinting techniques.

  14. Glutathione-Disrupted Biofilms of Clinical Pseudomonas aeruginosa Strains Exhibit an Enhanced Antibiotic Effect and a Novel Biofilm Transcriptome (United States)

    Das, Theerthankar; Ibugo, Amaye; Buckle, Edwina; Manefield, Mike; Manos, Jim


    Pseudomonas aeruginosa infections result in high morbidity and mortality rates for individuals with cystic fibrosis (CF), with premature death often occurring. These infections are complicated by the formation of biofilms in the sputum. Antibiotic therapy is stymied by antibiotic resistance of the biofilm matrix, making novel antibiofilm strategies highly desirable. Within P. aeruginosa biofilms, the redox factor pyocyanin enhances biofilm integrity by intercalating with extracellular DNA. The antioxidant glutathione (GSH) reacts with pyocyanin, disrupting intercalation. This study investigated GSH disruption by assaying the physiological effects of GSH and DNase I on biofilms of clinical CF isolates grown in CF artificial sputum medium (ASMDM+). Confocal scanning laser microscopy showed that 2 mM GSH, alone or combined with DNase I, significantly disrupted immature (24-h) biofilms of Australian epidemic strain (AES) isogens AES-1R and AES-1M. GSH alone greatly disrupted mature (72-h) AES-1R biofilms, resulting in significant differential expression of 587 genes, as indicated by RNA-sequencing (RNA-seq) analysis. Upregulated systems included cyclic diguanylate and pyoverdine biosynthesis, the type VI secretion system, nitrate metabolism, and translational machinery. Biofilm disruption with GSH revealed a cellular physiology distinct from those of mature and dispersed biofilms. RNA-seq results were validated by biochemical and quantitative PCR assays. Biofilms of a range of CF isolates disrupted with GSH and DNase I were significantly more susceptible to ciprofloxacin, and increased antibiotic effectiveness was achieved by increasing the GSH concentration. This study demonstrated that GSH, alone or with DNase I, represents an effective antibiofilm treatment when combined with appropriate antibiotics, pending in vivo studies. PMID:27161630

  15. Control of Listeria innocua Biofilms on Food Contact Surfaces with Slightly Acidic Electrolyzed Water and the Risk of Biofilm Cells Transfer to Duck Meat. (United States)

    Jeon, Hye Ri; Kwon, Mi Jin; Yoon, Ki Sun


    Biofilm formation on food contact surfaces is a potential hazard leading to cross-contamination during food processing. We investigated Listeria innocua biofilm formation on various food contact surfaces and compared the washing effect of slightly acidic electrolyzed water (SAEW) at 30, 50, 70, and 120 ppm with that of 200 ppm of sodium hypochlorite (NaClO) on biofilm cells. The risk of L. innocua biofilm transfer and growth on food at retail markets was also investigated. The viability of biofilms that formed on food contact surfaces and then transferred cells to duck meat was confirmed by fluorescence microscopy. L. innocua biofilm formation was greatest on rubber, followed by polypropylene, glass, and stainless steel. Regardless of sanitizer type, washing removed biofilms from polypropylene and stainless steel better than from rubber and glass. Among the various SAEW concentrations, washing with 70 ppm of SAEW for 5 min significantly reduced L. innocua biofilms on food contact surfaces during food processing. Efficiency of transfer of L. innocua biofilm cells was the highest on polypropylene and lowest on stainless steel. The transferred biofilm cells grew to the maximum population density, and the lag time of transferred biofilm cells was longer than that of planktonic cells. The biofilm cells that transferred to duck meat coexisted with live, injured, and dead cells, which indicates that effective washing is essential to remove biofilm on food contact surfaces during food processing to reduce the risk of foodborne disease outbreaks.

  16. Detection of biofilm production of Yersinia enterocolitica strains isolated from infected children and comparative antimicrobial susceptibility of biofilm versus planktonic forms. (United States)

    Ioannidis, A; Kyratsa, A; Ioannidou, V; Bersimis, S; Chatzipanagiotou, S


    The ability of Yersinia species to produce biofilms has not been hitherto systematically studied, although there is evidence, that Y. enterocolitica is able to form biofilms on inanimate surfaces. The present study aimed to detect the production of biofilms by 60 clinical strains of Y. enterocolitica and to compare the antimicrobial susceptibility of planktonic versus biofilm-forming bacteria. Y. enterocolitica strains were collected from stool and blood cultures collected from β-thalassaemic children, with gastroenteritis and/or septicemia. The isolated bacterial strains were grouped by biotyping and serotyping and the antimicrobial susceptibility of the planktonic forms was investigated by MIC determination. Biofilm formation was detected by the use of silicone disks and for the biofilm forming strains the minimum inhibitory concentration for bacterial regrowth (MICBR) of 11 clinically important antimicrobials was determined. The presence of the waaE, a gene reported to be related with biofilm formation was investigated in all the strains. All of 60 strains were positive for biofilm production by the use of silicone disks. The great majority of the biofilm forms were resistant to all the antimicrobials. In antimicrobial concentrations far higher than the CLSI breakpoints, bacterial regrowth from the biofilms was still possible. None of the strains bore the waaE gene. These results, indicate that biofilm formation by Y. enterocolitica might be an inherent feature. The presence of biofilms increased dramatically the MICBR in all antimicrobials. The way in which biofilms could contribute to Y. enterocolitica pathogenicity in humans is a matter needing further investigation.

  17. Biofilm-specific extracellular matrix proteins of non-typeable Haemophilus influenzae (United States)

    Wu, Siva; Baum, Marc M.; Kerwin, James; Guerrero-Given, Debbie; Webster, Simon; Schaudinn, Christoph; VanderVelde, David; Webster, Paul


    Non-typeable Haemophilus influenzae (NTHi), a human respiratory tract pathogen can form colony biofilms in vitro. Bacterial cells and the amorphous extracellular matrix (ECM) constituting the biofilm can be separated using sonication. The ECM from 24 hr and 96 hr NTHi biofilms contained polysaccharides and proteinaceous components as detected by NMR and FTIR spectroscopy. More conventional chemical assays on the biofilm ECM confirmed the presence of these components and also DNA. Proteomics revealed eighteen proteins present in biofilm ECM that were not detected in planktonic bacteria. One ECM protein was unique to 24 hr biofilms, two were found only in 96 hr biofilms, and fifteen were present in the ECM of both 24 hr and 96 hr NTHi biofilms. All proteins identified were either associated with bacterial membranes or were cytoplasmic proteins. Immunocytochemistry showed two of the identified proteins, a DNA-directed RNA polymerase and the outer membrane protein OMP P2, associated with bacteria and biofilm ECM. Identification of biofilm-specific proteins present in immature biofilms is an important step in understanding the in vitro process of NTHi biofilm formation. The presence of a cytoplasmic protein and a membrane protein in the biofilm ECM of immature NTHi biofilms suggests that bacterial cell lysis may be a feature of early biofilm formation. PMID:24942343

  18. Biofilms and mechanics: a review of experimental techniques and findings

    International Nuclear Information System (INIS)

    Gordon, Vernita D; Davis-Fields, Megan; Kovach, Kristin; Rodesney, Christopher A


    Biofilms are developmentally-dynamic communities of sessile microbes that adhere to each other and, often, to other structures in their environment. The cohesive mechanical forces binding microbes to each other confer mechanical and structural stability on the biofilm and give rise to biofilm viscoelasticity. The adhesive mechanical forces binding microbes to other structures in their environment can promote biofilm initiation and mechanosensing that leads to changes in biological activity. Thus, physical mechanics is intrinsic to characteristics that distinguish biofilms from free-swimming or free-floating microbes in liquid culture. However, very little is known about the specifics of what mechanical traits characterize different types of biofilms at different stages of development. Even less is known about how mechanical inputs impact microbial biology and how microbes can adjust their mechanical coupling to, and interaction with, their environment. These knowledge gaps arise, in part, from the challenges associated with experimental measurements of microbial and biofilm biomechanics. Here, we review extant experimental techniques and their most-salient findings to date. At the end of this review we indicate areas where significant advances in the state-of-the art are heading. (topical review)

  19. Diffuse urban pollution increases metal tolerance of natural heterotrophic biofilms

    International Nuclear Information System (INIS)

    Fechner, Lise C.; Gourlay-Francé, Catherine; Bourgeault, Adeline; Tusseau-Vuillemin, Marie-Hélène


    This study is a first attempt to investigate the impact of urban contamination on metal tolerance of heterotrophic river biofilms using a short-term test based on β-glucosidase activity. Tolerance levels to Cu, Cd, Zn, Ni and Pb were evaluated for biofilms collected at three sites along an urban gradient in the Seine river (France). Metallic pollution increased along the river, but concentrations remained low compared to environmental quality standards. Biofilm metal tolerance increased downstream from the urban area. Multivariate analysis confirmed the correlation between tolerance and contamination and between multi-metallic and physico-chemical gradients. Therefore, tolerance levels have to be interpreted in relation to the whole chemical and physical characteristics and not solely metal exposure. We conclude that community tolerance is a sensitive biological response to urban pressure and that mixtures of contaminants at levels lower than quality standards might have a significant impact on periphytic communities. - Highlights: ► A new short-term test based on β-glucosidase activity to assess biofilm metal tolerance. ► Cd, Cu, Ni, Pb and Zn tolerance of natural biofilms collected along an urban gradient. ► Metal tolerance levels increase upstream to downstream the river. ► Community tolerance increases at environmental quality standard exposure concentrations. ► Biofilm tolerance is a sensitive biological response to diffuse urban pollution. - Metal concentrations below environmental quality standards increase tolerance levels of natural, hetetrophic biofilms downstream from an urban area.

  20. Groundwater biofilm dynamics grown in situ along a nutrient gradient. (United States)

    Williamson, Wendy M; Close, Murray E; Leonard, Margaret M; Webber, Judith B; Lin, Susan


    This paper describes the in situ response of groundwater biofilms in an alluvial gravel aquifer system on the Canterbury Plains, New Zealand. Biofilms were developed on aquifer gravel, encased in fine mesh bags and suspended in protective columns in monitoring wells for at least 20 weeks. Four sites were selected in the same groundwater system where previous analyses indicated a gradient of increasing nitrate down the hydraulic gradient from Sites 1 to 4. Measurements during the current study classified the groundwater as oligotrophic. Biofilm responses to the nutrient gradients were assessed using bioassays, with biomass determined using protein and cellular and nucleic acid staining and biofilm activity using enzyme assays for lipid, carbohydrate, phosphate metabolism, and cell viability. In general, biofilm activity decreased as nitrate levels increased from Sites 1 to 4, with the opposite relationship for carbon and phosphorus concentrations. These results showed that the groundwater system supported biofilm growth and that the upper catchment supported efficient and productive biofilms (high ratio of activity per unit biomass). © 2012, Institute of Environmental Science & Research Ltd (ESR). Ground Water © 2012, National Ground Water Association.